Modified vectors

EP4720100A1Pending Publication Date: 2026-04-08CENTEON LLC +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-05-24
Publication Date
2026-04-08

AI Technical Summary

Technical Problem

Lentiviral vectors used in gene therapy, such as those for treating Wiskott-Aldrich Syndrome, face challenges due to cryptic splice sites leading to alternative splicing, which can result in non-therapeutic transcripts and increased risk of leukemia, necessitating the development of vectors with improved safety profiles.

Method used

Modification of the HS4 insulator sequences within lentiviral vectors to inactivate cryptic splice acceptor sites SA4 and SA5, reducing alternative splicing and enhancing safety by altering the nucleotide sequences or orientations to prevent unwanted splicing events.

Benefits of technology

The modified vectors exhibit reduced alternative splicing, enhancing therapeutic efficacy and safety by minimizing the risk of adverse outcomes like leukemia, while maintaining effective transgene expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000014_0001
    Figure IMGF000014_0001
  • Figure IMGF000015_0001
    Figure IMGF000015_0001
  • Figure IMGF000016_0001
    Figure IMGF000016_0001
Patent Text Reader

Abstract

This disclosure relates generally to viral vectors useful for gene therapy applications. In particular the disclosure relates to lentiviral vectors, especially lentiviral vectors comprising modified insulator sequences.
Need to check novelty before this filing date? Find Prior Art

Description

TITLE OF THE INVENTIONMODIFIED VECTORSRELATED APPLICATIONS[00Ol]This application claims priority to United States Provisional Patent Application No. 63 / 469,040 entitled "Modified vectors" filed 25 May 2023, the contents of which are incorporated herein by reference in their entirety.FIELD OF THE INVENTION

[0002] This disclosure relates generally to viral vectors useful for gene therapy applications. In particular the disclosure relates to lentiviral vectors, especially lentiviral vectors comprising modified insulator sequences.BACKGROUND OF THE INVENTION

[0003] Viral-based vectors represent effective delivery vehicles for gene transfer. Such vectors may be used therapeutically to deliver genes to cells to provide either transient or permanent transgene expression, including adenoviruses (Ads), retroviruses (y-retroviruses and lentiviruses), poxviruses, adeno-associated viruses, baculoviruses, and herpes simplex viruses.

[0004] Lentiviruses are one genus of retroviruses capable of infecting dividing and non-dividing cells. Lentiviral particles encapsidate two sense-strand RNAs bound by nucleocapsid proteins, as well as reverse transcriptase, integrase and protease proteins. Lentiviral vectors have a number of features which make them amendable to transgene delivery for therapeutic purposes, including a large packaging capacity (up to about 10 kb) and the ability to integrate into a host cell genome providing long term transgene expression. As such lentiviral vectors at the forefront of development of gene delivery systems for a number of clinical gene therapy applications, and considerable attention has been given to the development of new generation lentiviral vectors, in part to improve efficiency of transgene expression and mitigate safety concerns.

[0005] Cryptic splice sites within lentiviral vectors can result in alternative splicing of transgene RNA, leading to the production of potentially non-therapeutic truncated transcripts and proteins, and alternative splicing of the lentiviral genomic RNA, leading to truncated virus RNA and potentially non- viable virus. Moreover, cryptic splice sites within lentiviral vectors can lead to alternative splicing of the transcripts from the gene into which the vector genome has integrated. Alternative splicing of transcripts of genes such as HMGA2, into which lentiviral vectors are known to integrate, can result in cells with clonal growth advantages and thus expansion of those cells expressing the alternatively spliced transcripts. This appears to be due, at least in part, to the absence in these truncated or fused transcripts of one or more of the let-7 binding sites that are present in full HMGA2 transcripts, and which are normally bound by the let-7 family of tumor suppressor microRNAs to negatively regulate expression, and to the fact that the truncated or fused transcripts are leading to the production of truncated HMGA2, which is functional.

[0006] For genetic diseases it is desirable to treat patients as early as possible to mitigate the effects of the disease and improve quality of life from an early stage, and therefore there is a need to reduce alternative splicing. While HMGA2 is not considered an oncogene, and clonal expansion resulting from overexpression of truncated or fused transcripts results is generally considered benign, the tolerance for even benign cell growth resulting from administration of a therapeutic lentiviral vector is low when the patients are pediatric patients, the target population for the treatment of numerous hereditary diseases such as Wiskott-Aldrich Syndrome.

[0007] Wiskott-Aldrich Syndrome (WAS) is a rare, X-linked primary immunodeficiency (PID) disorder characterized by recurrent infections, small platelets, microthrombocytopenia, eczema, and increased risk of autoimmune manifestations and tumors. Mutations in the Wiskott-Aldrich Syndrome protein (WASP) gene are responsible for Wiskott-Aldrich Syndrome. The gene that encodes the WAS protein is located in the short arm of X chromosome (XP11.22-11.23) and is about 9 kb, including 12 exons, and encoding 502 amino acids. To date, WASP mutations, including missense / nonsense, splicing, small deletions, small insertions, gross deletions, and gross insertions have been identified in patients with Wiskott-Aldrich Syndrome

[0008] Wiskott-Aldrich Syndrome protein is a hematopoietic system-specific intracellular signal transduction molecule, which is proline rich, and expressed only in hematopoietic cell lines. Wiskott- Aldrich Syndrome protein is believed to be an important regulator of the actin cytoskeleton found to be expressed in all leukocytes. It is believed to be involved in dynamic cytoskeletal changes, which are essential for multiple cellular functions such as adhesion, migration, phagocytosis, immune synapse formation, and receptor-mediated cellular activation processes (e.g. B and T cell antigen receptors). As a result, both innate and cellular adaptive immunity are believed to be affected in Wiskott-Aldrich Syndrome patients, rendering these patients highly susceptible to infections.

[0009] In general, WAS gene mutations that cause absent protein expression result in "classic Wiskott-Aldrich Syndrome." Reduced Wiskott-Aldrich Syndrome protein expression results in X- linked thrombocytopenia. Wiskott-Aldrich Syndrome protein activating gain-of-function mutations result in X-linked neutropenia. Depending on the mutations within the WAS gene product, there is wide variability of clinical manifestations and symptoms of the disease including thrombocytopenia, small platelets, eczema, immunodeficiency, hematologic abnormalities, and infectious manifestations. Autoimmune disease, including autoimmune hemolytic anemia, is also common and occurs in up to 40-70% of patients. There is also believed to be a significantly increased risk of lymphoreticular malignancy (10-20%), such as lymphoma, leukemia, and myelodysplasia.

[0010] Wiskott-Aldrich Syndrome was one of the first conditions ever to be successfully treated by allogeneic hematopoietic stem cell transplantation (HSCT) and gene therapy approaches for treatment of WAS continue to be reported. It is believed that a bone marrow transplant remains the only proven cure for this disease and the outcome is reasonably good for those patients with HLA- matched donors (only available for less than 20% of patients). Hematopoietic stem cell gene therapy (HSC-GT) offers a new, potentially curative, option for patients lacking a matched donor. Gene therapy offers several potential advantages over allogeneic HSCT. It is theoretically available to allpatients and is believed to decrease the risks of graft rejection, and possibly avoid the risks associated with Graft versus Host Disease (GvHD).

[0011] While clinical trials of HSC-GT using viral vectors, such as lentiviral vectors, for the treatment of WAS have indicated that this the approach can be therapeutically effective, patients in some clinical trials developed leukemia, potentially resulting from unwanted integration events (see e.g. Braun et al. (2014) Sci Transl Med. 6(227) :227ra33).

[0012] There is a need in the art for the development of lentiviral vectors with improved safety profiles for use in gene therapy applications of a variety of diseases including Wiskott-Aldrich Syndrome.SUMMARY OF THE INVENTION

[0013] The present disclosure is predicated, at least in part, on the identification of two cryptic splice acceptor sites within the HS4-650 insulator present in a therapeutic lentiviral vector encoding a Wiskott-Aldrich Syndrome protein. These cryptic splice acceptor sites are located in the reverse, complement sequence of the HS4-650 insulator (i.e. on the negative or reverse strand) and are designated herein as plice acceptor site 4 (SA4) and splice acceptor site 5 (SA5). SA4 is located at nucleotides 352-353 of SEQ ID NO:2 (i.e. splicing occurs between the nucleotide at position 352 and the nucleotide at position 353), where SEQ ID NO:2 is the reverse, complement sequence of the unmodified HS4-650 insulator set forth in SEQ ID NO: 1. SA5 is located at nucleotides 311-312 of SEQ ID NO:2 (i.e. splicing occurs between the nucleotide at position 311 and the nucleotide at position 312).

[0014] Accordingly, provided herein are nucleic acid constructs and vectors that contain a modified HS4 insulator in which SA4 and / or SA5 have been inactivated. The resulting constructs and vectors therefore can have associated with them a reduced risk of alternative splicing when introduced into a cell, such as a hematopoietic stem cell. The modified HS4 insulators can have a mutation relative to a "wild-type" or unmodified HS4-650 insulator that inactivates SA4 and / or SA5. Alternatively, the modified HS4 insulator may be oriented within the lentiviral vector, and / or relative to a transgene in the vector, such as a WAS gene, in such a manner so as to effectively inactivate SA4 and / or SA5 (i.e. SA4 and SA5 are not on the positive or forward strand of the viral RNA and / or the WAS transcript).

[0015] Thus, in one aspect of the invention there is provided a nucleic acid construct comprising a modified HS4 insulator, wherein the modified HS4 insulator comprises an inactivated splice acceptor site (SA4) relative to an unmodified HS4-650 insulator, wherein:SA4 is present in an unmodified HS4-650 insulator at nucleotide positions 352-353 with numbering relative to SEQ ID NO:2, wherein SEQ ID NO:2 is the reverse, complement sequence of the unmodified HS4-650 insulator set forth in SEQ ID NO: 1; and / orSA4 comprises the sequence ATCTCTCCAG^GCAAGCTCTT (SEQ ID NO: 49), where ^ represents the splice position.

[0016] In some embodiments, the modified HS4 insulator comprises, relative to an unmodified HS4- 650 insulator, a mutation that inactivates SA4. By way of example, the mutation may be a mutation of the A at position 351 (e.g. an A to T mutation) and / or a mutation of the G at position 352, with numbering relative to SEQ ID NO:2.

[0017] The modified HS4 insulator may be a modified HS4-650 insulator. In particular embodiments, the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs:3, 11, 19,27, 35 and 43.

[0018] In another aspect of the invention there is provided a nucleic acid construct comprising a modified HS4 insulator, wherein the modified HS4 insulator comprises an inactivated splice acceptor site (SA5) relative to an unmodified HS4-650 insulator, wherein:SA5 is present in an unmodified HS4-650 insulator at nucleotide positions 311-312 with numbering relative to SEQ ID NO:2, wherein SEQ ID NO:2 is the reverse, complement sequence of the unmodified HS4-650 insulator set forth in SEQ ID NO: 1; and / orSA5 comprises the sequence AATTCTCCAG^CTGCCTGTCC (SEQ ID NO: 50), where ^ represents the splice position.

[0019] In some embodiments, the modified HS4 insulator comprises, relative to an unmodified HS4- 650 insulator, a mutation that inactivates SA5. By way of example, the mutation may be a mutation of the A at position 310 (e.g. an A to T mutation) and / or a mutation of the G at position 311, with numbering relative to SEQ ID NO:2.

[0020] The modified HS4 insulator may be a modified HS4-650 insulator. In particular embodiments, the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs:4, 12, 20,28, 36 and 44.

[0021] In particular embodiments of the first and second aspects, the modified HS4 insulator further comprises one or more additional inactivated splice acceptor sites relative to an unmodified HS4-650 insulator. In exemplary embodiments, the one or more additional inactivated splice acceptor sites are selected from:(i) an inactivated splice acceptor site (SA1) present in an unmodified HS4-650 insulator at nucleotide positions 385-386 with numbering relative to SEQ ID NO:2, and / or comprising the sequence TTGCATCCAG^ACACCATCAA (SEQ ID NO:51) where ^ represents the splice position, optionally wherein SA1 is inactivated via an A to T mutation at position 384;(ii) an inactivated splice acceptor site (SA2) present in an unmodified HS4-650 insulator at nucleotide positions 446-447 with numbering relative to SEQ ID NO:2, and / or comprising the sequence ATCCCCCCAG^GTGTCTGCAG (SEQ ID NO: 52) where ^ represents the splice position, optionally wherein SA2 is inactivated via an A to T mutation at position 445; and / or(iii) an inactivated splice acceptor site (SA2) present in an unmodified HS4-650 insulator at nucleotide positions 456-457 with numbering relative to SEQ ID NO:2, and / or comprising the sequence GTGTCTGCAG^GCTCAAAGAG (SEQ ID NO: 53) where ^ represents the splice position, optionally wherein SA3 is inactivated via an A to T mutation at position 455.

[0022] In an exemplary embodiment of the present invention the modified HS4 insulator comprises inactivated splice acceptor sites SA4, SA2 and SA3. Accordingly, the modified HS4 insulator may comprise the sequence set forth in any one of SEQ ID NOs:5, 13, 21, 29, 37 and 45.

[0023] In an exemplary embodiment of the present invention the modified HS4 insulator comprises inactivated splice acceptor sites SA4, SA1, SA2 and SA3. Accordingly, the modified HS4 insulator may comprise the sequence set forth in any one of SEQ ID NOs:6, 14, 22, 30, 38 and 46.

[0024] In an exemplary embodiment of the present invention the modified HS4 insulator comprises inactivated splice acceptor sites SA4, SA5, SA1, SA2 and SA3. Accordingly, the modified HS4 insulator may comprise the sequence set forth in any one of SEQ ID NOs:7, 15, 23, 31, 39 and 47.

[0025] In an exemplary embodiment of the present invention the modified HS4 insulator comprises inactivated splice acceptor sites SA4, SA5, SA2 and SA3. Accordingly, the modified HS4 insulator may comprise the sequence set forth in any one of SEQ ID NOs:8, 16, 24, 32, 40 and 48.

[0026] Nucleic acid constructs of the present invention typically further comprise a first promoter operably linked to a first polynucleotide. Typically, the first promoter is operably linked to a first polynucleotide which comprises a heterologous transgene. The modified HS4 insulator may be located upstream or downstream of the first polynucleotide.

[0027] In some embodiments, the modified HS4 insulator is in the opposite orientation to the first polynucleotide. In one example, the first polynucleotide is in the forward orientation and the modified HS4 insulator is in the reverse orientation within the nucleic acid construct. In other embodiments, the modified HS4 insulator is in the same orientation as the first polynucleotide, thereby inactivating the relevant one or more splice acceptor sites. In one example, the first polynucleotide and the modified HS4 insulator are in the forward orientation within the nucleic acid construct.

[0028] In exemplary embodiments, the first polynucleotide encodes a Wiskott-Aldrich Syndrome protein. The Wiskott-Aldrich Syndrome protein may comprise an amino acid sequence set forth in SEQ ID NO:59 or a sequence having at least 95% sequence identity thereto. The first polynucleotide may comprise a sequence set forth in any one of SEQ ID NOs:60-62 or a sequence having at least 95% sequence identity thereto. In some examples, the first promoter is an MND promoter, e.g. one comprising the nucleic acid sequence set forth in SEQ ID NO:65 or a sequence having at least 90% sequence identity thereto.

[0029] Accordingly, also provided herein is a nucleic acid construct, comprising : a first promoter operably linked to a first polynucleotide encoding a Wiskott-Aldrich Syndrome protein; and a modified HS4 insulator, wherein the modified HS4 insulator comprises an inactivated splice acceptor site SA4 relative to an unmodified HS4-650 insulator.

[0030] Also provided herein is a nucleic acid construct, comprising : a first promoter operably linked to a first polynucleotide encoding a Wiskott-Aldrich Syndrome protein; and a modified HS4 insulator, wherein the modified HS4 insulator comprises an inactivated splice acceptor site SA5 relative to an unmodified HS4-650 insulator.

[0031] The nucleic acid constructs of the present invention may further comprise a Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE), optionally located between the first polynucleotide and the modified HS4 insulator, e.g. one comprising the nucleic acid sequence set forth in SEQ ID NO:63 or 64, or a sequence having at least 95% sequence identity thereto.

[0032] The nucleic acid constructs of the present invention may further comprise a second promoter operably linked to a second polynucleotide, optionally wherein the second polynucleotide encodes a nucleic acid that inhibits HPRT expression. In some examples, the nucleic acid that inhibits HPRT expression is a shRNA, e.g. one comprising a hairpin loop sequence set forth in of SEQ ID NO: 66 and / or comprising a nucleic acid sequence set forth in SEQ ID NO: 67 or 68, or a sequence comprising at least 95% sequence identity thereto. In some examples, the second promoter comprises a Pol III promoter or a Pol II promoter, e.g. one that comprises 7sk (e.g. one comprising a nucleic acid sequence set forth in any one of SEQ ID NOs:69-71 or a sequence having at least 95% sequence identity thereto). In some examples, the second promoter and the operably linked second polynucleotide are in the reverse orientation and upstream of the first promoter and the operably linked first polynucleotide.

[0033] The nucleic acid constructs of the present invention may further comprise a polyadenylation signal downstream of the first nucleic acid and the modified HS4 insulator. In an example, the polyadenylation signal comprises a B-globin poly(A) signal, optionally comprising the nucleic acid sequence set forth in SEQ ID NO:73 or a sequence having at least 95% sequence identity thereto.

[0034] A further aspect of the invention provides a vector comprising a nucleic acid construct of the present invention. In some examples, the vector may be a plasmid or a viral vector. The viral vector may be, for example, an adenoviral vector, and adeno-associated virus (AAV) vector or a retroviral vector. The retroviral vector may be a lentiviral vector. The viral vector may be a plasmid or a viral particle.

[0035] Also provided are host cells comprising a nucleic acid construct or vector of the present invention or transduced with a vector of the present invention. In some examples, the host cell is a hematopoietic stem cell (HSC), e.g. an allogeneic or autologous HSC.

[0036] Also provided are methods for treating a subject with Wiskott-Aldrich Syndrome, comprising administering to the subject a host cell of the invention. In particular embodiments, the methods comprise administering to the subject the host cell and then administering a purine analog (e.g. 6- thioguanine ("6TG"), 6-mercaptopurine ("6MP") or azathiopurine ("AZA")) to the subject to increase engraftment of the host cell. In further embodiments, the methods comprise pre-conditioning the subject with a purine analog prior to administering the host cell.

[0037] Also provided are uses of host cells of the invention for the preparation of a medicament for the treatment of Wiskott-Aldrich Syndrome.BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Embodiments of the disclosure are described herein, by way of non-limiting example only, with reference to the following drawings.

[0039] Figure 1 is an alignment of the reverse complement sequences of unmodified HS4-650 insulator and modified HS4-650 insulators, with splice acceptor sites (SA) boxed, as described herein. "650rev" = unmodified HS4-650 insulator (i.e. with unmodified splice sites); "650fwd" = HS4-650 insulator in a forward orientation relative to transgene (or a reverse orientation relative to control construct comprising original unmodified insulator); "3xSA" = A to T point mutations at splice sites SA1, SA2 and SA3 (SEQ ID NO:81); "5xSA" = A to T point mutations at splice sites SA4, SA5, SA1, SA2 and SA3 (SEQ ID NO:7); "4xSAalt" = A to T point mutations at splice sites SA4, SA5, SA2 and SA3 (SEQ ID NO:8); "4xSA" = A to T point mutations at splice sites SA4, SA1, SA2 and SA3 (SEQ ID NO:6); "3xSAalt" = A to T point mutations at splice sites SA4, SA2 and SA3 (SEQ ID NO:5).

[0040] Figure 2 is a schematic of control vector pBRNGTR47.

[0041] Figure 3 shows results from an HMGA2 fusion transcripts assay, including the percentage of exon3-LVV splice junctions (A) and the percentage of exon3-exon4 splice junctions (B) mapped from HMGA2 transcript assays in KG1 cells, "rev", "fwd", "3xSA" and "5xSA" are as described for Figure 1. "mock" refers to a control.

[0042] Figure 4 shows the ratio of LVV fusion transcripts to HMGA2 isoform 1 mapped from HMGA2 transcript assays in KG1 cells, "rev", "fwd", "3xSA" and "5xSA" are as described for Figure 1. "mock" refers to a control.

[0043] Figure 5. Results from global fusion transcript assay, in K561 cells with various exemplary WAS LVs, showing the effect of correction of canonical splice acceptor sites in various WAS LV vectors. A. "650Rev" a construct comprising unmodified HS4-650 insulator with unwanted splicing occurring at splice acceptor site at SA2; B "3xSA" a construct comprising a modified 3xSA HS4-650 insulator (as described in Fig. 1) with unwanted splicing occurring at splice acceptor site at newly identified SA4; C. "4xSA" a construct comprising a modified 4xSA HS4-650 insulator with unwanted splicing occurring at splice acceptor site at newly identified SA5; D. "5xSA" a construct comprising a modified 5xSA HS4-650 insulator (as described in Fig. 1) with no identified splicing or additional splice acceptor sites; E. "650fwd" a construct comprising an unmodified HS4-650 insulator oriented in the forward direction with no identified splice acceptor sites; F. "4xSAalt" a construct comprising a modified 4xSAalt HS4-650 insulator (as described in Fig. 1) with no identified splicing; G. "no insulator" a control construct comprising no HS4-650 insulator. H. Analysis of splice donor sites in "650fwd" construct with unwanted splicing at a single SD site. No splice donor sites were identified in exemplary insulator sequences (650rev, 3xSA, 4xSA, 4xSalt or 5xSA).

[0044] Figure 6 shows the results of a LIM domain only 2 (LMO2) activation assay. LMO2 gene expression levels (%; y-axis) in mScarlet+ cells normalized to PPIA with modified HS4-650 insulators 3xSA, 5xSA and 4xSAalt as described in Fig. 1, or unmodified HS4-650 insulator, relative to control construct comprising no insulator, "no insulator" refers to a control construct lacking an insulator. "Jurkat" refers to wild type Jurkat cells as a control. Mean values are provided. Dots represent individual samples.

[0045] Figure 7. A, Schematic of WASp expression in WAS Knockout (WAS KO) murine Lineage negative (Linneg) cells, results represented in Figs. 6 B-G. B and C, WAS transgene expression in liquid culture shown as MFI and % (y-axes, B and C, respectively) in murine LinnegWAS KO cellstransduced at a multiplicity of infection (MOI) of 1 and 10 (as indicated) with selected lentiviral vectors. Represents mean data from two independent experiments. D, dose dependent increase in vector copy integrations (VCN) in liquid culture for murine LinnegWAS KO cells at MOI of 1 and 10 (as indicated) with selected lentiviral vectors. Represents mean data from two independent experiments. E and F, WASp transgene expression in colony forming units (CFU) shown as MFI (E) and % (F) (y-axes) in murine LinnegWAS KO cells transduced at a multiplicity of infection (MOI) of 1 and 10 (as indicated) with selected lentiviral vectors. Represents mean data from two independent experiments. G, dose dependent increase in vector copy integrations (VCN) in colony forming units (CFU) for murine LinnegWAS KO cells transduced at MOI of 1 and 10 (as indicated) with selected lentiviral vectors. Represents mean data from two independent experiments. For B-G: "KO" refers to untransduced WAS KO cells and "WT" refers to wild-type cells as negative and positive controls respectively; "650Rev" refers to a construct comprising unmodified HS4-650 insulator with unmodified splice sites; "3xSA" and "5xSA" are as described for Figure 1.

[0046] Figure 8. A, Schematic of WASp expression in WAS Knockout U937 cells, results represented in Figs. 6 B, C and D. B and C, WAS transgene expression shown as MFI and % (y-axes, B and C, respectively) in U937 WAS KO cells transduced at a multiplicity of infection (MOI) of 0.5, 1 and 10 (as indicated) with selected lentiviral vectors. Represents mean data from two independent experiments. D, dose dependent increase in vector copy integrations (VCN) in U937 WAS KO cells transduced at MOI of 0.5, 1 and 10 (as indicated) with selected lentiviral vectors. Represents mean data from two independent experiments. For B, C and D: "KO" refers to untransduced WAS KO cells and "WT" refers to wild-type cells as negative and positive controls; "650Rev" refers to a construct comprising unmodified HS4-650 insulator with unmodified splice sites; "3xSA" and "5xSA" are as described for Figure 1.

[0047] Figure 9 is a schematic of the WAS LV in vivo toxicity study design.DETAILED DESCRIPTION OF THE INVENTION1. Definitions

[0048] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are described. For the purposes of the present invention, the following terms are defined below.

[0049] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0050] As used herein, "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or).

[0051] The terms "active agent" and "therapeutic agent" are used interchangeably herein and refer to agents that prevent, reduce or ameliorate at least one symptom of a disease or disorder.

[0052] The terms "administration concurrently" or "administering concurrently" or "coadministering" and the like refer to the administration of a single composition containing two or more agents, or the administration of each agent as separate compositions and / or delivered by separate routes either contemporaneously or simultaneously or sequentially within a short enough period of time that the effective result is equivalent to that obtained when all such agents are administered as a single composition. By "simultaneously" is meant that the agents are administered at substantially the same time, and desirably together in the same formulation. By "contemporaneously" it is meant that the agents are administered closely in time, e.g., one agent is administered within from about one minute to within about one day before or after another. Any contemporaneous time is useful. However, it will often be the case that when not administered simultaneously, the agents will be administered within about one minute to within about eight hours and suitably within less than about one to about four hours. When administered contemporaneously, the agents are suitably administered at the same site on the subject. The term "same site" includes the exact location, but can be within about 0.5 to about 15 centimeters, preferably from within about 0.5 to about 5 centimeters. The term "separately" as used herein means that the agents are administered at an interval, for example at an interval of about a day to several weeks or months. The agents may be administered in either order. The term "sequentially" as used herein means that the agents are administered in sequence, for example at an interval or intervals of minutes, hours, days or weeks. If appropriate the agents may be administered in a regular repeating cycle.

[0053] Throughout this specification, unless the context requires otherwise, the words "comprise", "comprises" and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. Thus, use of the term "comprising" and the like indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present. By "consisting of" is meant including, and limited to, whatever follows the phrase "consisting of". Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory, and that no other elements may be present. By "consisting essentially of" is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.

[0054] The term "construct" in the context of a nucleic acid construct refers to a genetic (nucleic acid) molecule including one or more polynucleotide sequences from one or more sources. Thus, constructs include recombinant or chimeric molecules in which two or more polynucleotide sequences of different origin are assembled into a single nucleic acid molecule. Nucleic acid constructs may include a construct that contains polynucleotide sequences, including regulatory and coding sequences that are not found together in nature ( / .e., at least one of the nucleotide sequences is heterologous with respect to at least one of its other nucleotide sequences). Representative nucleicacid constructs include any nucleic acid molecule such as a plasmid, cosmid, virus, autonomously replicating polynucleotide molecule, phage, or linear or circular single stranded or double stranded DNA or RNA nucleic acid molecule, derived from any source, capable of genomic integration or autonomous replication, comprising a nucleic acid molecule where one or more nucleic acid molecules have been operably linked. For the practice of the methods of the present disclosure, conventional compositions and methods for preparing and using constructs and host cells are well known to one skilled in the art, see for example, Molecular Cloning: A Laboratory Manual, 3rdedition Volumes 1, 2, and 3. J. F. Sambrook, D. W. Russell, and N. Irwin, Cold Spring Harbor Laboratory Press, 2000.

[0055] As used herein, "corresponding nucleotides", "corresponding amino acid residues" or "corresponding positions" refer to nucleotides, amino acids or positions that occur at aligned loci. The sequences of related or variant polynucleotides or polypeptides are aligned by any method known to those of skill in the art. Such methods typically maximize matches (e.g. identical nucleotides or amino acids at positions), and include methods such as using manual alignments and by using the numerous alignment programs available (for example, BLASTN, BLASTP, ClustlW, ClustlW2, EMBOSS, LALIGN, Kalign, etc) and others known to those of skill in the art. By aligning the sequences of polynucleotides, one skilled in the art can identify corresponding nucleotides. For example, by aligning the HS4-650 insulator set forth in SEQ ID NO:2 with other HS4-650 insulators (e.g. as shown in Figure 1), one of skill in the art can identify regions or nucleotides within the other insulator that correspond to various regions or nucleotides in the insulator set forth in SEQ ID NO:2. For example, the A at position 384 of SEQ ID NO:2 is the corresponding nucleotide of, or corresponds to, the A at position 375 of SEQ ID NO: 11. In another example, the SA1 site at nucleotides 385-386 of SEQ ID NO:2 corresponds to the SA1 site at nucleotides 375-376 of SEQ ID NO:20. Thus, when nucleotides or positions are referred to herein with respect to a particular sequence (e.g. an HS4 650 insulator sequence) it is understood that, where appropriate, the reference is also to the corresponding nucleotide or position in another sequence (e.g. another HS4 650 insulator sequence). For example, reference to SA1 in a HS4-650 insulator "at nucleotide positions 385-386, with numbering relative to SEQ ID NO: 2" refers to the SA1 at position 385-386 of the HS4-650 insulator set forth in SEQ ID NO:2 and SA1 in other HS4-650 insulators, where the SA1 is at positions corresponding to 385-386 of the HS4-650 insulator set forth in SEQ ID NO:2. In another example, reference to a HS4-650 insulator comprising a mutation of the A at position 384, with numbering relative to SEQ ID NO:2 encompasses not only the HS4-650 insulator set forth in SEQ ID NO:2 having a mutation of the A at position 384, but also other HS4-650 insulators having a mutation of the A at the position that corresponds to position 384 of SEQ ID NO:2.

[0056] By "effective amount", in the context of treating a disease or condition is meant the administration of an amount of an agent or composition to an individual in need of such treatment or prophylaxis, either in a single dose or as part of a series, that is effective for the prevention of incurring a symptom, holding in check such symptoms, and / or treating existing symptoms, of that condition. The effective amount will vary depending upon the age, health and physical condition of the individual to be treated and whether symptoms of disease are apparent, the taxonomic group of individual to be treated, the formulation of the composition, the assessment of the medical situation, and other relevant factors. Optimal dosing schedules can be calculated from measurements of drugaccumulation in the body of the subject. Optimum dosages may vary depending on the relative potency in an individual subject, and can generally be estimated based on EC50 values found to be effective in in vitro and in vivo animal models. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. It is expected that the amount will fall in a relatively broad range that can be determined through routine trials.

[0057] The terms "subject", "patient" and "individual" used interchangeably herein, refer to any subject, particularly a vertebrate subject, and even more particularly a mammalian subject, (e.g. human) with a MI.

[0058] As used herein, the term "expression cassette" refers to one or more genetic sequences within a vector which can express a RNA, and, in some embodiments, subsequently a protein. The expression cassette comprises at least one promoter and at least one gene of interest. In some embodiments, the expression cassette includes at least one promoter, at least one gene of interest, and at least one additional nucleic acid sequence encoding a molecule for expression (e.g. a transgene or RNAi). In some embodiments, the expression cassette is positionally and sequentially oriented within the vector such that the nucleic acid in the cassette can be transcribed into RNA, and when necessary, translated into a protein or a polypeptide, undergo appropriate post-translational modifications required for activity in the transformed cell (e.g. transduced stem cell), and be translocated to the appropriate compartment for biological activity by targeting to appropriate intracellular compartments or secretion into extracellular compartments. In some embodiments, the cassette has its 3' and 5' ends adapted for ready insertion into a vector, e.g., it has restriction endonuclease sites at each end.

[0059] As used herein, the term "host cell" refers to cells that is to be modified using the methods of the present disclosure. In some embodiments, the host cells are mammalian cells in which the lentiviral vector can be introduced. Suitable mammalian host cells include, but are not limited to, human cells, murine cells, non-human primate cells (e.g. rhesus monkey cells), human progenitor cells or stem cells, 293 cells, HeLa cells, D17 cells, MDCK cells, BHK cells, and Cf2Th cells. In certain embodiments, the host cell comprising an expression vector of the disclosure is a hematopoietic cell, such as hematopoietic progenitor / stem cell (e.g. CD34-positive hematopoietic progenitor / stem cell), a monocyte, a macrophage, a peripheral blood mononuclear cell, a CD4+ T lymphocyte, a CD8+ T lymphocyte, or a dendritic cell. The hematopoietic cells (e.g. CD4+ T lymphocytes, CD8+ T lymphocytes, and / or monocyte / macrophages) to be transduced with an expression vector of the disclosure can be allogeneic, autologous, or from a matched sibling. The hematopoietic cells are, in some embodiments, CD34-positive and can be isolated from the patient's bone marrow or peripheral blood. The isolated CD34-positive hematopoietic cells (and / or other hematopoietic cell described herein) is, in some embodiments, transduced with an expression vector as described herein.

[0060] As used herein, the term "hematopoietic stem cells" or "HSCs" refer to multipotent cells capable of differentiating into all the cell types of the hematopoietic system, including, but not limited to, granulocytes, monocytes, erythrocytes, megakaryocytes, lymphocytes, dendritic cells; and selfrenewal activity, i.e. the ability to divide and generate at least one daughter cell with the identical (e.g., self-renewing) characteristics of the parent cell.

[0061] As used herein, "HPRT" is an enzyme involved in purine metabolism encoded by the HPRT1 gene. HPRT1 is located on the X chromosome, and thus is present in single copy in males. HPRT1 encodes the transferase that catalyzes the conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate by transferring the 5-phosphorobosyl group from 5- phosphoribosyl 1-pyrophosphate to the purine. The enzyme functions primarily to salvage purines from degraded DNA for use in renewed purine synthesis.

[0062] As used herein, the term "lentivirus" refers to a genus of retroviruses that are capable of infecting dividing and non-dividing cells. Several examples of lentiviruses include HIV (human immunodeficiency virus: including HIV type 1, and HIV type 2), the etiologic agent of the human acquired immunodeficiency syndrome (AIDS); visna-maedi, which causes encephalitis (visna) or pneumonia (maedi) in sheep, the caprine arthritis-encephalitis virus, which causes immune deficiency, arthritis, and encephalopathy in goats; equine infectious anemia virus, which causes autoimmune hemolytic anemia, and encephalopathy in horses; feline immunodeficiency virus (FIV), which causes immune deficiency in cats; bovine immune deficiency virus (BIV), which causes lymphadenopathy, lymphocytosis, and possibly central nervous system infection in cattle; and simian immunodeficiency virus (SIV), which causes immune deficiency and encephalopathy in sub-human primates.

[0063] As used herein, the term "lentiviral vector" is used to denote any form of a nucleic acid derived from a lentivirus and used to transfer genetic material into a cell via transduction. The term encompasses lentiviral vector nucleic acids, such as DNA and RNA, encapsulated forms of these nucleic acids, and viral particles in which the viral vector nucleic acids have been packaged.

[0064] As used herein, the term "mutated" refers to a change in a sequence, such as a nucleotide or amino acid sequence, from a native, standard, or reference version of the respective sequence, i.e. the non-mutated sequence.

[0065] As used herein, the term "operably linked" refers to functional linkage between a nucleic acid expression control sequence (such as a promoter, signal sequence, enhancer or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence affects transcription and / or translation of the nucleic acid corresponding to the second sequence when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the expression control sequence.

[0066] As used herein, the term "promoter" refers to a recognition site of a polynucleotide (DNA or RNA) to which an RNA polymerase binds. An RNA polymerase initiates and transcribes polynucleotides operably linked to the promoter. In some embodiments, promoters operative in mammalian cells comprise an AT-rich region located approximately 25 to 30 bases upstream from the site where transcription is initiated and / or another sequence found about 70 to about 80 bases upstream from the start of transcription, e.g. a CNCAAT region where N may be any nucleotide.

[0067] As used herein, the terms "small hairpin RNA" or "shRNA" refer to RNA molecules comprising an antisense region, a loop portion and a sense region, wherein the sense region has complementary nucleotides that base pair with the antisense region to form a duplex stem. Following post- transcriptional processing, the small hairpin RNA is converted into a small interfering RNA by acleavage event mediated by the enzyme DICER, which is a member of the RNase III family. As used herein, the phrase "post-transcriptional processing" refers to mRNA processing that occurs after transcription and is mediated, for example, by the enzymes DICER and / or Drosha.

[0068] As used herein, the terms "transduce" or "transduction" refer to the delivery of a gene(s) using a viral or retroviral vector by means of infection rather than by transfection. For example, an anti-HPRT gene carried by a retroviral vector (a modified retrovirus used as a vector for introduction of nucleic acid into cells) can be transduced into a cell through infection and provirus integration. Thus, a "transduced gene" is a gene that has been introduced into the cell via lentiviral or vector infection and provirus integration. Viral vectors (e.g., "transducing vectors") transduce genes into "target cells" or host cells.

[0069] As used herein, the terms "treatment", "treating", and the like, refer to obtaining a desired pharmacologic and / or physiologic effect in a subject in need of treatment, that is, a subject who has a disease or disorder. By "treatment" is meant ameliorating or preventing one or more symptoms or effects (e.g. consequences) of a disease or disorder. Reference to "treatment", "treat" or "treating" does not necessarily mean to reverse or prevent any or all symptoms or effects of a disease or disorder. For example, the subject may ultimately suffer one or more symptoms or effects, but the number and / or severity of the symptoms or effects is reduced and / or the quality of life is improved compared to prior to treatment.

[0070] Each embodiment described herein is to be applied mutatis mutandis to each and every embodiment unless specifically stated otherwise.Table 1. Brief Description of the Sequences2. Nucleic acid constructs and vectors

[0071] The present disclosure provides nucleic acid constructs and vectors comprising said nucleic acid constructs that are useful for gene therapy applications. Nucleic acid constructs and vectors of the invention comprise a modified HS4 insulator. The nucleic acid constructs and vectors typicallyalso comprise a first promoter operably linked to a first polynucleotide, typically wherein the first polynucleotide comprises a transgene (i.e. encoding a protein or nucleic acid, such as a therapeutic protein or nucleic acid).

[0072] The modified HS4 insulator comprises an inactivation of one or more cryptic splice acceptor sites that are present in an unmodified HS4-650 insulator. Accordingly, the nucleic acid constructs and vectors of the present disclosure can be associated with reduced alternative splicing (e.g. of the transcript of the gene into which the nucleic acid construct or vector has integrated in the cell; of the construct or vector RNA; and / or the transcript of the transgene encoded by the construct or vector) when integrated into the genome of a cell compared to a construct or vector that contains an unmodified HS4-650 insulator as described herein. In some examples, the level of alternative splicing is reduced by at least or about 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%.

[0073] Nucleic acid constructs of the present disclosure may comprise or be present in a vector, such as a plasmid or viral vector. The viral vector may be, for example, an adenovirus vector, an AAV vector or a retroviral vector. In particular embodiments described herein, the retroviral vector is a lentiviral vector. Embodiments of the present disclosure are described below in the context of a lentiviral vector, however the person skilled in the art will recognise these as exemplary embodiments only and will appreciated that the scope of the present disclosure is not limited thereto.

[0074] For the purposes of embodiments of the present disclosure, a viral vector is a vector which comprises nucleic acid that includes at least one component part derivable from a virus, such as, for example, a lentivirus, an adenovirus or an AAV. That component part may be involved in the biological mechanisms by which the vector infects cells, expresses genes or is replicated. Thus, viral vectors include nucleic acid molecules such as plasmids, and virus particles.

[0075] The basic structure of retrovirus and lentivirus genomes share many common features such as a 5' LTR and a 3' LTR, between or within which are located a packaging signal to enable the genome to be packaged, a primer binding site, integration sites to enable integration into a host cell genome and gag, pol and env genes encoding the packaging components, which are polypeptides required for the assembly of viral particles. Lentiviruses have additional features, such as the rev and rev response element (RRE) sequences, which enable the efficient export of RNA transcripts of the integrated provirus from the nucleus to the cytoplasm of an infected target cell. In the provirus, the viral genes are flanked at both ends by regions called long terminal repeats (LTRs). The LTRs are responsible for proviral integration, and transcription. LTRs also serve as enhancer-promoter sequences and can control the expression of the viral genes. The LTRs themselves are identical sequences that can be divided into three elements, which are called "U3," "R" and "U5." U3 is derived from the sequence unique to the 3' end of the RNA, R is derived from a sequence repeated at both ends of the RNA, and U5 is derived from the sequence unique to the 5' end of the RNA. The sizes of the three elements can vary considerably among different viruses.

[0076] In one embodiment, at least part of one or more protein coding regions essential for replication may be removed from the vector, which makes the vector replication-defective. Portions of the viral genome may also be replaced by a nucleic acid in order to generate a vector comprising the nucleic acid which is capable of transducing a target non-dividing host cell and / or integrating itsgenome into a host genome. In one embodiment, the lentiviral vectors are non-integrating vectors as described in U.S. patent application Ser. No. 12 / 138,993 (herein incorporated by reference).

[0077] The lentiviral vector may have a genome that has been manipulated to remove the non- essential elements and to retain the essential elements in order to provide the required functionality to infect, transduce and deliver a nucleotide sequence of interest to a target host cell (See, e.g., U.S. Pat. No. 6,669,936, incorporated by reference). In some embodiments, the genome is limited to sufficient lentiviral genetic information to allow packaging of an RNA genome, in the presence of packaging components, into a viral particle capable of infecting a target cell. Infection of the target cell may include reverse transcription and integration into the target cell genome. In some embodiments, the vector is incapable of independent replication to produce infectious lentiviral particles within the final target cell. In some embodiments, the lentiviral vector lacks a functional gag-pol and / or env gene and / or other genes essential for replication.

[0078] In some examples, the lentiviral vector is a self-inactivating vector. Self-inactivating vectors may be constructed by deleting the transcriptional enhancers or the enhancers and promoter in the U3 region of the 3' LTR. After a round of vector reverse transcription and integration, these changes are copied into both the 5' and the 3' LTRs producing a transcriptionally inactive provirus (Yu et al., Proceedings Nat'l Acad. Sci. USA, 83:3194-98 (1986); Dougherty and Temin et al., Proceedings Nat'l Acad. Sci. USA, 84: 1197-01 (1987): Hawley, Proceedings Nat'l Acad. Sci. USA, 84:2406-10 (1987); Yee et al., Proceedings Nat'l Acad. Sci. USA, 91 :9564-68 (1994)). However, any promoter(s) internal to the LTRs in such vectors will still be transcriptionally active. This strategy has been employed to eliminate effects of the enhancers and promoters in the viral LTRs on transcription from internally placed genes. Such effects include increased transcription (Jolly et al., Nucleic Acids Research, 11 : 1855-72 (1983)) or suppression of transcription (Emerman & Temin, Cell, 39:449-67 (1984)). This strategy can also be used to eliminate downstream transcription from the 3' LTR into genomic DNA (Herman & Coffin, Science, 236:845-48 (1987)).

[0079] A plasmid vector used to produce the viral genome within a host cell / packaging cell will also include transcriptional regulatory control sequences operably linked to the lentiviral genome to direct transcription of the genome in a host cell / packaging cell. These regulatory sequences may be the natural sequences associated with the transcribed lentiviral sequence, i.e. the 5' U3 region, or they may be a heterologous or modified promoter such as another viral promoter, for example the CMV promoter or the 7tetO promoter / operator. Some lentiviral genomes require additional sequences for efficient virus production. For example, in the case of HIV-based lentiviral vectors, the rev and RRE sequences are preferably included; however the requirement for rev and RRE may be reduced or eliminated by codon optimization (See U.S. patent application Ser. No. 12 / 587,236, incorporated by reference). Alternative sequences which perform the same function, as the rev / RRE system are also known. For example, a functional analogue of the revIRRE system is found in the Mason Pfizer monkey virus. This is known as the constitutive transport element (CTE) and comprises an RRE-type sequence in the genome which is believed to interact with a factor in the infected cell. The cellular factor can be thought of as a rev analogue. Thus, CTE may be used as an alternative to the reviRRE system. Any other functional equivalents which are known or become available may be relevant tothe vectors of the present disclosure. For example, the Rex protein of HTLV-1 can functionally replace the Rev protein of HIV-1. It is also known that Rev and Rex have similar effects to IRE-BP.

[0080] In some embodiments, the expression vector comprises sequences from the 5' and 3' long terminal repeats (LTRs) of a lentivirus. In some embodiments, the vector comprises the R and U5 sequences from the 5' LTR of a lentivirus and an inactivated or self-inactivating 3' LTR from a lentivirus. In some embodiments, the LTR sequences are HIV LTR sequences.

[0081] In some embodiments, the lentiviral vectors contemplated herein may be integrative or non- integrating (also referred to as an integration defective lentivirus). As used herein, the term "integration defective lentivirus" or "IDLV" refers to a lentivirus having an integrase that lacks the capacity to integrate the viral genome into the genome of the host cells. In some applications, the use of by an integrating lentivirus vector may avoid potential insertional mutagenesis induced by an integrating lentivirus. Integration defective lentiviral vectors typically are generated by mutating the lentiviral integrase gene or by modifying the attachment sequences of the LTRs (see, e.g., Sarkis et al., Curr. Gene. Ther., 6: 430-437 (2008)). Lentiviral integrase is coded for by the HIV-1 Pol region and the region cannot be deleted as it encodes other critical activities including reverse transcription, nuclear import, and viral particle assembly. Mutations in pol that alter the integrase protein fall into one of two classes: those which selectively affect only integrase activity (Class I); or those that have pleiotropic effects (Class II). Mutations throughout the N and C terminals and the catalytic core region of the integrase protein generate Class II mutations that affect multiple functions including particle formation and reverse transcription. Class I mutations limit their affect to the catalytic activities, DNA binding, linear episome processing and multimerization of integrase. The most common Class I mutation sites are a triad of residues at the catalytic core of integrase, including D64, D116, and E152. Each mutation has been shown to efficiently inhibit integration with a frequency of integration up to four logs below that of normal integrating vectors while maintaining transgene expression of the NILV. Another alternative method for inhibiting integration is to introduce mutations in the integrase DNA attachment site (LTR att sites) within a 12 base-pair region of the U3 region or within an il base-pair region of the U5 region at the terminal ends of the 5' and 3' LTRs, respectively. These sequences include the conserved terminal CA dinucleotide which is exposed following integrase-mediated end-processing. Single or double mutations at the conserved CA / TG dinucleotide result in up to a three to four log reduction in integration frequency; however, it retains all other necessary functions for efficient viral transduction.2.1 Transaenes

[0082] Typically nucleic acid constructs and vectors of the present disclosure comprise a transgene. The transgene can be any gene that encodes a therapeutic expression product (e.g. protein or nucleic acid) that can correct a defect in a target cell (e.g. HSCs). Transgenes can include genomic sequences, cDNA sequences, and smaller engineered gene segments that express, or may be adapted to express, proteins, polypeptides, domains, fusion proteins, and mutants that maintain some or all of the therapeutic function of the full-length polypeptide encoded by the transgene. Those skilled in the art will appreciate that nucleic acid constructs and vectors of the disclosure comprising a modified HS4 insulator are applicable for use in a variety of gene therapy settings, and are notlimited by reference to the treatment of any specific disease or condition, nor to use for the delivery of any specific transgene.

[0083] In particular embodiments, the transgene encodes a Wiskott-Aldrich Syndrome (WAS) protein (WASP). Thus, in some embodiments, the nucleic acid constructs and vectors of the present disclosure comprise a first polynucleotide, wherein the first polynucleotide encodes a WASP. Exemplary WASP sequences include those comprising the amino acid sequence set forth in SEQ ID NO:59, an those having at least or about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 98%, or 99% sequence identity to the WASP set forth in SEQ ID NOs: 59. In some embodiments, the nucleic acid sequence encoding a WASP comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 98%, or 99% sequence identity to nucleic acid sequence set forth in any one of SEQ ID NOS:60- 62.2.2 HS4 insulators

[0084] The nucleic acid constructs and vectors of the present disclosure comprise a modified HS4 insulator that has one or more inactivated or disrupted splice acceptor sites relative to an unmodified HS4-650 insulator.

[0085] Insulator elements have two important activities: an "enhancer blocking activity" where the insulator prevents interaction between enhancers and promoters, and "barrier activity" whereby the insulator prevents transgene silencing by chromatin condensation. The barrier activity can effectively increase transgene expression, while the enhancer blocking activity can prevent enhancers in the vector acting on normally inactive oncogene promoters when integrated nearby.

[0086] The most well-characterized insulator with barrier and enhancer blocking functions is a 1.2 kb fragment which contains hypersensitive site 4 from the chicken [3-globin locus (cHS4). While this insulator is effective at increasing transgene expression and reducing unwanted promoter activity, it has been shown to reduce viral titres, thereby limiting large-scale virus production for clinical use. An alternative form, the 650 bp cHS4 insulator, which comprises a HS4-Core (250 bp) and a HS4- Ext (400 bp) and is referred to as HS4-650 (or c HS4-650) retains the barrier and enhancer blocking functions but does not impact viral production in the same manner as the 1.2 kb fragment (see e.g. Arumugam et al. 2009, PLoS ONE 4(9) :e6995; Wielgosz et al. 2015, Molecular Therapy -Methods & Clinical Development, 2, 14063).

[0087] As demonstrated herein, HS4 insulators can comprise cryptic splice acceptor sites. These splice acceptor sites were identified in the HS4-650 insulator set forth in SEQ ID NO: 1 when the insulator was present in a lentiviral vector in the reverse orientation, whereby the splice acceptor sites were in the positive strand of the vector. Thus, the splice acceptor sites were in the reverse complement sequence of SEQ ID NO: 1. This reverse complement sequence is set forth as SEQ ID NO:2. The splice acceptor sites include splice acceptor site SA4 and splice acceptor site SA5.

[0088] The HS4 insulator may also contain three other cryptic splice acceptor sites previously identified, denoted as SA1, SA2 and SA3 (as described in co-pending PCT / US2022 / 026409, the disclosure of which is incorporated herein). Table 2 shows the sequences and positions of these spliceacceptor sites in the HS4-650 insulator set forth in SEQ ID NO:2. Table 3 shows the sequences of the mutations made, as described hereinbelow, correcting each of these splice acceptor sites.Table 2. Splice sites in HS4-650 insulators

[0089] The lentiviral vectors of the present disclosure comprise a modified HS4 insulator in which one or both of splice acceptor sites SA4 and SA5 are inactivated. As described herein below, a modified HS4 insulator in which SA4 has been inactivated may also comprise one more additional inactivated splice acceptor sites selected from SA5, SA1, SA2 and SA3, and a modified HS4 insulator in which SA5 has been inactivated may also comprise one more additional inactivated splice acceptor sites selected from SA4, SA1, SA2 and SA3. Table 3 sets out exemplary inactivations as described herein for each of the splice acceptor sites SA4, SA5, SA1, SA2 and SA3.

[0090] The modified HS4 insulators described herein may be modified HS4-650 insulators (corresponding to the unmodified HS4-650 insulator of SEQ ID NO: 1, with a mutation in the SA4 and / or SA5 splice acceptor sites). Alternatively, the modified HS4 insulator may comprise a functional fragment of a HS4-650 insulator that comprises the SA4 and / or SA5 splice acceptor sites. The modified HS4 insulator may further contain the SA1, SA2 and / or SA3 splice acceptor sites. For example, the modified insulator may comprise a truncated HS4-650 insulator sequence comprising, for example, at least about 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, 400 bp, 450 bp, 500 bp, 550 bp or 600 bp of the HS4-650 insulator of SEQ ID NO: 1, including at least the SA4 splice acceptor site, at least the SA5 splice acceptor site or at least both the SA4 and SA5 splice acceptor sites. The modified HS4 insulator may be a hybrid or chimeric insulator comprising for example, at least about 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, 400 bp, 450 bp, 500 bp, 550 bp or 600 bp of the HS4-650 insulator of SEQ ID NO: 1, including at least the SA4 and / or SA5 splice acceptor sites, together with a sequence comprising at least a portion of a differentinsulator. The modified HS4 insulator may comprise, for example, at least about 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, 400 bp, 450 bp, 500 bp, 550 bp or 600 bp.Table 3. Inactivated splice sitesMutations shown in bold and underlined2.2.1 SA4

[0091] As shown in Table 2, SA4 is present at position 352-353 of SEQ ID NO:2 (i.e. splicing occurs between the G at position 352 and the A at position 353) and corresponding positions of other reverse complement HS4-650 insulator sequences, including those set forth in SEQ ID NOs: 10, 18, 26, 34 and 42. SA4 can also be defined as comprising the sequence ATCTCTCCAG^GCAAGCTCTT (SEQ ID NO:49), where ^ represents the splice position.

[0092] The nucleic acid constructs and vectors of the present disclosure comprise a modified HS4 insulator that, when present in the lentiviral vector, comprises an inactivated SA4 (relative to an unmodified HS4-650 insulator when present in the lentiviral vector). Thus, the modified HS4 insulators comprise a modification relative to an unmodified HS4-650 insulator, wherein the modification results in inactivation of SA4. Thus, a nucleic acid construct or vector comprising the modified HS4 insulator exhibits reduced splicing at position 352-353 when transduced into a cell compared to the splicing that occurs at position 352-353 in a nucleic acid construct or vector that comprises an unmodified HS4-650 insulator, with numbering relative to SEQ ID NO:2. In some examples, splicing is reduced by at least or about 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%. In some embodiments, the modification is or comprises a mutation in the sequence of the modified HS4 insulator relative to an unmodified HS4-650 insulator. In other examples, the modification is a change in the orientation of the modified HS4 insulator in the nucleic acid construct or vector relative to the orientation of an unmodified HS4-650 insulator when in the nucleic acid construct or vector. As would be appreciated, where the modification is a change in the orientation of the insulator, there may be no modification of the sequence of the modified HS4 insulator compared to an unmodified HS4-650 insulator.

[0093] Unmodified HS4-650 insulators include those that, when present in a nucleic acid construct or vector, comprise an active SA4, i.e. comprise a sequence and orientation within the nucleic acidconstruct or vector that can facilitate splicing at SA4. Exemplary unmodified HS4-650 insulators comprise a sequence set forth in SEQ ID NOs: l, 9, 17, 25, 33 and 41 (with reverse complement sequences set forth in SEQ ID NOs:2, 10, 18, 26, 34 and 42) and sequences having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided the SA4 site is still present, e.g. provided the reverse complement of the HS4-650 insulator comprises the sequence ATCTCTCCAGGCAAGCTCTT (SEQ ID NO:49)). In some examples, an unmodified HS4- 650 insulator is one in the reverse orientation in the nucleic acid construct or vector, such that SA4 is present on the positive strand. In further examples, an unmodified HS4-650 insulator is one in the reverse orientation compared to the transgene, such that SA4 is present on the positive strand of the transgene transcript.

[0094] In particular examples, the modified HS4 insulator contains a mutation (e.g. a nucleotide deletion, insertion or replacement) relative to an unmodified HS4-650 insulator, wherein the mutation inactivates SA4 that is present in the unmodified HS4-650 insulator (or reduces splicing at position 352-353 of the reverse complement sequence of the modified HS4 insulator compared to the splicing that occurs at position 352-353 of the reverse complement sequence of an unmodified HS4-650 insulator, with numbering relative to SEQ ID NO:2). The mutation can be any that inactivates or disrupts SA4. In some examples, the mutation is a deletion or substitution of any nucleotide in the SA4 sequence or a nucleotide insertion into the SA4 sequence (e.g. the sequence ATCTCTCCAGGCAAGCTCTT (SEQ ID NO:49)). In particular examples, the mutation is a mutation (e.g. deletion or substitution) of the A at position 351, the G at position 352, the G at position 353, and / or the C at position 354, with numbering relative to SEQ ID NO:2. For example, the modified HS4 insulator can comprise an A to T, A to C or A to G mutation at position 351, a G to C, G to A or G to T mutation at position 352, an G to C, G to A or G to T mutation at position 353, and / or a C to G, C to T or C to A mutation at position 354, with numbering relative to SEQ ID NO:2. In other examples, the mutation comprises an insertion of a nucleotide after position 351, 352 or 353. In some examples, the modified HS4 insulator comprises two or more of such mutations.

[0095] In one example, the modified HS4 insulator comprises an A to T mutation in the reverse complement sequence (i.e. in the complementary strand) at position 351, with numbering relative to SEQ ID NO:2. In particular embodiments, the reverse complement sequence of the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs:3, 11, 19, 27, 35 and 43, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided there is T position 351, with numbering relative to SEQ ID NO:2).

[0096] In some examples, the modified HS4 insulator described herein having a mutation that inactivates SA4 is in the opposite orientation to the transgene (i.e. in the opposite orientation to the first polynucleotide). In particular examples, the first polynucleotide is in the forward orientation and the modified HS4 insulator is in the reverse orientation within the nucleic acid construct or vector.

[0097] In a further example, the modified HS4 insulator is in the nucleic acid construct or vector in the opposition orientation to the orientation of an unmodified HS4-650 insulator when in the nucleic acid construct or vector, i.e. the orientation of the modified HS4 insulator inverted relative to an unmodified HS4-650 insulator, so as to inactivate SA4. In particular examples, the modified HS4insulator is in the forward orientation in the nucleic acid construct or vector. Thus, also provided are nucleic acid constructs and vectors comprising a first promoter operably linked to a first polynucleotide, wherein the first polynucleotide encodes a WASP, and a modified HS4 insulator, wherein the modified HS4 insulator is in the forward orientation in the nucleic acid construct or vector. In some examples, the first polynucleotide is also in the forward orientation in the nucleic acid construct or vector. In some examples, the HS4 insulator comprises a sequence set forth in any one of SEQ ID NOs: 1, 9, 17, 25, 33 and 41, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.2.2.2 SA5[0098JSA5 is present at position 311-312 of SEQ ID NO:2 (i.e. splicing occurs between the G at position 311 and the C at position 312) and corresponding positions of other reverse complement HS4-650 insulator sequences, including those set forth in SEQ ID NOs: 10, 18, 26, 34 and 42. SA5 can also be defined as comprising the sequence AATTCTCCAG^CTGCCTGTCC (SEQ ID NO:50), where represents the splice position.

[0099] The nucleic acid constructs and vectors of the present disclosure comprise a modified HS4 insulator that, when present in the nucleic acid construct or vector, comprises an inactivated SA5 (relative to an unmodified HS4-650 insulator when present in the nucleic acid construct or vector). Thus, the modified HS4 insulators, when present in the nucleic acid construct or vector, comprise a modification relative to an unmodified HS4-650 insulator, wherein the modification results in inactivation of SA5. Thus, a nucleic acid construct or vector comprising the modified HS4 insulator exhibits reduced splicing at position 311-312 when transduced into a cell compared to the splicing that occurs at position 311-312 with a nucleic acid construct or vector that comprises an unmodified HS4-650 insulator, with numbering relative to SEQ ID NO :2. In some examples, splicing is reduced by at least or about 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%. In some embodiments, the modification is or comprises a mutation in the sequence of the modified HS4 insulator relative to an unmodified HS4-650 insulator. In other examples, the modification is a change in the orientation of the modified HS4 insulator in the nucleic acid construct or vector relative to the orientation of an unmodified HS4-650 insulator when in the nucleic acid construct or vector. As would be appreciated, where the modification is a change in the orientation of the insulator, there may be no modification of the sequence of the modified HS4 insulator compared to an unmodified HS4-650 insulator.

[0100] Unmodified HS4-650 insulators include those that, when present in a nucleic acid construct or vector, comprise an active SA5, i.e. comprise a sequence and orientation within the nucleic acid construct or vector that can facilitate splicing at SA5. Exemplary unmodified HS4-650 insulators comprise a sequence set forth in SEQ ID NOs: l, 9, 17, 25, 33 and 41 (with reverse complement sequences set forth in SEQ ID NOs:2, 10, 18, 26, 34 and 42) and sequences having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided the SA5 site is still present, e.g. provided the reverse complement of the HS4-650 insulator comprises the sequence AATTCTCCAGCTGCCTGTCC (SEQ ID NO:50)). In some examples, an unmodified HS4-650 insulator is one in the reverse orientation in the nucleic acid construct or vector, such that SA5 is present on the positive strand. In further examples, an unmodified HS4-650insulator is one in the reverse orientation compared to the transgene, such that SA5 is present on the positive strand of the transgene transcript.

[0101] In particular examples, the modified HS4 insulator contains a mutation (e.g. a nucleotide deletion, insertion or replacement) relative to an unmodified HS4-650 insulator, wherein the mutation inactivates SA5 that is present in the unmodified HS4-650 insulator (or reduces splicing at position 311-312 of the reverse complement sequence of the modified HS4 insulator compared to the splicing that occurs at position 311-312 of the reverse complement sequence of an unmodified HS4-650 insulator, with numbering relative to SEQ ID NO:2). The mutation can be any that inactivates or disrupts SA5. In some examples, the mutation is a deletion or substitution of any nucleotide in the SA5 sequence or a nucleotide insertion into the SA5 sequence (e.g. the sequence AATTCTCCAGCTGCCTGTCC (SEQ ID NO:50)). In particular examples, the mutation is a mutation (e.g. deletion or substitution) of the A at position 310, the G at position 311, the C at position 312, and / or the T a position 313, with numbering relative to SEQ ID NO:2. For example, the modified HS4 insulator can comprise an A to T, A to C or A to G mutation at position 310, a G to C, G to A or G to T mutation at position 311, an C to G, C to T or C to A mutation at position 312, and / or a T to A, T to C or T to G mutation at position 313, with numbering relative to SEQ ID NO:2. In other examples, the mutation comprises an insertion of a nucleotide after position 310, 311 or 312. In some examples, the modified HS4 insulator comprises two or more of such mutations.

[0102] In one example, the modified HS4 insulator comprises an A to T mutation in the reverse complement sequence at position 310, with numbering relative to SEQ ID NO:2. In particular embodiments, the reverse complement sequence of the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs:4, 12, 20, 28, 36 and 44, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided there is T at position 310, with numbering relative to SEQ ID NO:2).

[0103] In some examples, the modified HS4 insulator described herein having a mutation that inactivates SA5 is in the opposite orientation to the transgene (i.e. in the opposite orientation to the first polynucleotide). In particular examples, the first polynucleotide is in the forward orientation and the modified HS4 insulator is in the reverse orientation within the lentiviral vector.

[0104] In a further example, the modified HS4 insulator is in the nucleic acid construct or vector in the opposition orientation to the orientation of an unmodified HS4-650 insulator when in the nucleic acid construct or vector, i.e. the orientation of the modified HS4 insulator inverted relative to an unmodified HS4-650 insulator, so as to inactivate SA5. In particular examples, the modified HS4 insulator is in the forward orientation in the nucleic acid construct or vector. Thus, also provided are nucleic acid constructs and vectors comprising a first promoter operably linked to a first polynucleotide, wherein the first polynucleotide encodes a WASP, and a modified HS4 insulator, wherein the HS4 insulator is in the forward orientation in the nucleic acid construct or vector. In some examples, the first polynucleotide is also in the forward orientation in the nucleic acid construct or vector. In some examples, the modified HS4 insulator comprises a sequence set forth in any one of SEQ ID NOs: l, 9, 17, 25, 33 and 41, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.2.2.3 SAI, SA2 and SAS

[0105] A modified HS4 insulator present in a nucleic acid construct or vector of the disclosure may also comprise an inactivated splice acceptor site SA1, SA2 and or SA3, such as a mutation that inactivates SA1, SA2 and / or SA3.

[0106] SA1 is present at position 385-386 of SEQ ID NO:2 (i.e. splicing occurs between the G at position 385 and the A at position 386) and corresponding positions of other reverse complement HS4-650 insulator sequences, including those set forth in SEQ ID NOs: ll, 20, 29, 38 and 47. SA1 can also be defined as comprising the sequence TTGCATCCAG^ACACCATCAA (SEQ ID NO:60), where ^ represents the splice position.

[0107] SA2 is present at position 446-447 of SEQ ID NO:2 (i.e. splicing occurs between the G at position 446 and the G at position 447) and corresponding positions of other reverse complement HS4-650 insulator sequences, including those set forth in SEQ ID NOs: ll, 20, 29, 38 and 47. SA2 can also be defined as comprising the sequence ATCCCCCCAG^GTGTCTGCAG (SEQ ID NO:61), where ^ represents the splice position.

[0108] SA3 is present at position 456-457 of SEQ ID NO:2 (i.e. splicing occurs between the G at position 456 and the G at position 457) and corresponding positions of other reverse complement HS4-650 insulator sequences, including those set forth in SEQ ID NOs: ll, 20, 29, 38 and 47. SA3 can also be defined as comprising the sequence GTGTCTGCAG^GCTCAAAGAG (SEQ ID NO:62), where ^ represents the splice position.

[0109] Nucleic acid constructs and vectors of the present disclosure may comprise a modified HS4 insulator that, when present in the nucleic acid construct or vector, comprises an inactivated SA1 (relative to an unmodified HS4-650 insulator when present in the lentiviral vector). Thus, the modified HS4 insulators, when present in the nucleic acid construct or vector, comprise a modification relative to an unmodified HS4-650 insulator, wherein the modification results in inactivation of SA1. Thus, a nucleic acid construct or vector comprising the modified HS4 insulator exhibits reduced splicing at position 385-386 when transduced into a cell compared to the splicing that occurs at position 385-386 in a nucleic acid construct or vector that comprises an unmodified HS4-650 insulator, with numbering relative to SEQ ID NO:2. In some examples, splicing is reduced by at least or about 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%. In some embodiments, the modification is or comprises a mutation in the sequence of the modified HS4 insulator relative to an unmodified HS4-650 insulator. In other examples, the modification is a change in the orientation of the modified HS4 insulator in the nucleic acid construct or vector relative to the orientation of an unmodified HS4- 650 insulator when in the nucleic acid construct or vector. As would be appreciated, where the modification is a change in the orientation of the insulator, there may be no modification of the sequence of the modified HS4 insulator compared to an unmodified HS4-650 insulator.

[0110] Unmodified HS4-650 insulators include those that, when present in a nucleic acid construct or vector, comprise an active SA1, i.e. comprise a sequence and orientation within the nucleic acid construct or vector that can facilitate splicing at SA1. Exemplary unmodified HS4-650 insulators comprise a sequence set forth in SEQ ID NOs: 1, 10, 19, 28, 37 and 46 (with reverse complement sequences set forth in SEQ ID NOs:2, 11, 20, 29, 38 and 47) and sequences having at least or about90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided SA1 site is still present, e.g. provided the reverse complement of the HS4-650 insulator comprises the sequence TTGCATCCAGACACCATCAA (SEQ ID NO:60)). In some examples, an unmodified HS4- 650 insulator is one in the reverse orientation in the nucleic acid construct or vector, such that SA1 is present on the positive strand. In further examples, an unmodified HS4-650 insulator is one in the reverse orientation compared to the transgene, such that SA1 is present on the positive strand of the transgene transcript.

[0111] In particular examples, the modified HS4 insulator contains a mutation (e.g. a nucleotide deletion, insertion or replacement) relative to an unmodified HS4-650 insulator, wherein the mutation inactivates SA1 that is present in the unmodified HS4-650 insulator (or reduces splicing at position 385-386 of the reverse complement sequence of the modified HS4 insulator compared to the splicing that occurs at position 385-386 of the reverse complement sequence of an unmodified HS4-650 insulator, with numbering relative to SEQ ID NO:2). The mutation can be any that inactivates or disrupts SA1. In some examples, the mutation is a deletion or substitution of any nucleotide in the SA1 sequence or a nucleotide insertion into the SA1 sequence (e.g. the sequence TTGCATCCAGACACCATCAA (SEQ ID NO:60)). In particular examples, the mutation is a mutation (e.g. deletion or substitution) of the A at position 384, the G at position 385, the A at position 386, and / or the C at position 387, with numbering relative to SEQ ID NO:2. For example, the modified HS4 insulator can comprise an A to T, A to C or A to G mutation at position 384, a G to C, G to A or G to T mutation at position 385, an A to T, A to C or A to G mutation at position 386, and / or a C to G, C to T or C to A mutation at position 387, with numbering relative to SEQ ID NO:2. In other examples, the mutation comprises an insertion of a nucleotide after position 384, 385 or 386. In some examples, the modified HS4 insulator comprises two or more of such mutations.

[0112] In one example, the modified HS4 insulator comprises an A to T mutation in the reverse complement sequence (i.e. in the complementary strand) at position 384, with numbering relative to SEQ ID NO:2. In particular embodiments, the reverse complement sequence of the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs:3, 12, 21, 30, 39 and 48 or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided there is T position 384, with numbering relative to SEQ ID NO:2).

[0113] In some examples, the modified HS4 insulator described herein having a mutation that inactivates SA1 is in the opposite orientation to the transgene (i.e. in the opposite orientation to the first nucleic acid sequence). In particular examples, the first nucleic acid is in the forward orientation and the modified HS4 insulator is in the reverse orientation within the nucleic acid construct or vector. In a further example, the modified HS4 insulator is in the nucleic acid construct or vector in the opposition orientation to an unmodified HS4-650 insulator when in the nucleic acid construct or vector, i.e. the orientation of the modified HS4 insulator inverted relative to an unmodified HS4-650 insulator, so as to inactivate SA1. In particular examples, the modified HS4 insulator is in the forward orientation in the nucleic acid construct or vector.

[0114] Nucleic acid constructs and vectors of the present disclosure may comprise a modified HS4 insulator that, when present in the nucleic acid construct or vector, comprises an inactivated SA2(relative to an unmodified HS4-650 insulator when present in the nucleic acid construct or vector). Thus, the modified HS4 insulators, when present in the nucleic acid construct or vector, comprise a modification relative to an unmodified HS4-650 insulator, wherein the modification results in inactivation of SA2. Thus, a nucleic acid construct or vector comprising the modified HS4 insulator exhibits reduced splicing at position 446-447 when transduced into a cell compared to the splicing that occurs at position 446-447 with a nucleic acid construct or vector that comprises an unmodified HS4-650 insulator, with numbering relative to SEQ ID NO:2. In some examples, splicing is reduced by at least or about 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%. In some embodiments, the modification is or comprises a mutation in the sequence of the modified HS4 insulator relative to an unmodified HS4-650 insulator. In other examples, the modification is a change in the orientation of the modified HS4 insulator in the nucleic acid construct or vector relative to the orientation of an unmodified HS4-650 insulator when in the nucleic acid construct or vector. As would be appreciated, where the modification is a change in the orientation of the insulator, there may be no modification of the sequence of the modified HS4 insulator compared to an unmodified HS4-650 insulator.

[0115] Unmodified HS4-650 insulators include those that, when present in a nucleic acid construct or vector, comprise an active SA2, i.e. comprise a sequence and orientation within the nucleic acid construct or vector that can facilitate splicing at SA2. Exemplary unmodified HS4-650 insulators comprise a sequence set forth in SEQ ID NOs: l, 10, 19, 28, 37 and 46 (with reverse complement sequences set forth in SEQ ID NOs:2, 11, 20, 29, 38 and 47) and sequences having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided the SA2 site is still present, e.g. provided the reverse complement of the HS4-650 insulator comprises the sequence ATCCCCCCAGGTGTCTGCAG (SEQ ID NO:61)). In some examples, an unmodified HS4 insulator is one in the reverse orientation in the nucleic acid construct or vector, such that SA2 is present on the positive strand. In further examples, an unmodified HS4-650 insulator is one in the reverse orientation compared to the transgene, such that SA2 is present on the positive strand of the transgene transcript.

[0116] In particular examples, the modified HS4 insulator contains a mutation (e.g. a nucleotide deletion, insertion or replacement) relative to an unmodified HS4-650 insulator, wherein the mutation inactivates SA2 that is present in the unmodified HS4-650 insulator (or reduces splicing at position 446-447 of the reverse complement sequence of the modified HS4 insulator compared to the splicing that occurs at position 446-447 of the reverse complement sequence of an unmodified HS4-650 insulator, with numbering relative to SEQ ID NO:2). The mutation can be any that inactivates or disrupts SA2. In some examples, the mutation is a deletion or substitution of any nucleotide in the SA2 sequence or a nucleotide insertion into the SA2 sequence (e.g. the sequence ATCCCCCCAGGTGTCTGCAG (SEQ ID NO:61)). In particular examples, the mutation is a mutation (e.g. deletion or substitution) of the A at position 445, the G at position 446, the G at position 447, and / or the T a position 448, with numbering relative to SEQ ID NO:2. For example, the modified HS4 insulator can comprise an A to T, A to C or A to G mutation at position 445, a G to C, G to A or G to T mutation at position 446, an G to C, G to T or G to A mutation at position 447, and / or a T to A, T to C or T to G mutation at position 448, with numbering relative to SEQ ID NO:2. In other examples,the mutation comprises an insertion of a nucleotide after position 445, 446 or 447. In some examples, the modified HS4 insulator comprises two or more of such mutations.

[0117] In one example, the modified HS4 insulator comprises an A to T mutation in the reverse complement sequence at position 445, with numbering relative to SEQ ID NO:2. In particular embodiments, the reverse complement sequence of the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID N0s:7, 16, 25, 34, 43 and 52 or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided there is T at position 445, with numbering relative to SEQ ID NO:2).

[0118] In some examples, the modified HS4 insulator described herein having a mutation that inactivates SA2 is in the opposite orientation to the transgene (i.e. in the opposite orientation to the first nucleic acid sequence). In particular examples, the first nucleic acid is in the forward orientation and the modified HS4 insulator is in the reverse orientation within the nucleic acid construct or vector. In a further example, the modified HS4 insulator is in the nucleic acid construct or vector in the opposition orientation to an unmodified HS4-650 insulator when in the nucleic acid construct or vector, i.e. the orientation of the modified HS4 insulator inverted relative to an unmodified HS4-650 insulator, so as to inactivate SA2. In particular examples, the modified HS4 insulator is in the forward orientation in the nucleic acid construct or vector.

[0119] Nucleic acid constructs and vectors of the present disclosure may comprise a modified HS4 insulator that, when present in the nucleic acid construct or vector, comprises an inactivated SA3 (relative to an unmodified HS4-650 insulator when present in the nucleic acid construct or vector). Thus, the modified HS4 insulators, when present in the nucleic acid construct or vector, comprise a modification relative to an unmodified HS4-650 insulator, wherein the modification results in inactivation of SA3. Thus, a nucleic acid construct or vector comprising the modified HS4 insulator exhibits reduced splicing at position 456-457 when transduced into a cell compared to the splicing that occurs at position 456-457 with a nucleic acid construct or vector that comprises an unmodified HS4-650 insulator, with numbering relative to SEQ ID NO:2. In some examples, splicing is reduced by at least or about 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%. In some embodiments, the modification is or comprises a mutation in the sequence of the modified HS4 insulator relative to an unmodified HS4-650 insulator. In other examples, the modification is a change in the orientation of the modified HS4 insulator in the vector relative to the orientation of an unmodified HS4-650 insulator when in the nucleic acid construct or vector. As would be appreciated, where the modification is a change in the orientation of the insulator, there may be no modification of the sequence of the modified HS4 insulator compared to an unmodified HS4-650 insulator.

[0120] Unmodified HS4-650 insulators include those that, when present in a nucleic acid construct or vector, comprise an active SA3, i.e. comprise a sequence and orientation within the nucleic acid construct or vector that can facilitate splicing at SA3. Exemplary unmodified HS4-650 insulators comprise a sequence set forth in SEQ ID NOs: l, 10, 19, 28, 37 and 46 (with reverse complement sequences set forth in SEQ ID NOs:2, 11, 20, 29, 38 and 47) and sequences having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided the SA3 site is still present, e.g. provided the reverse complement of the HS4-650 insulatorcomprises the sequence GTGTCTGCAGGCTCAAAGAG (SEQ ID NO:62)). In some examples, an unmodified HS4-650 insulator is one in the reverse orientation in the nucleic acid construct or vector, such that SA3 is present on the positive strand. In further examples, an unmodified HS4-650 insulator is one in the reverse orientation compared to the transgene, such that SA3 is present on the positive strand of the transgene transcript.

[0121] In particular examples, the modified HS4 insulator contains a mutation (e.g. a nucleotide deletion, insertion or replacement) relative to an unmodified HS4-650 insulator, wherein the mutation inactivates SA3 that is present in the unmodified HS4-650 insulator (or reduces splicing at position 456-457 of the reverse complement sequence of the modified HS4 insulator compared to the splicing that occurs at position 456-457 of the reverse complement sequence of an unmodified HS4-650 insulator, with numbering relative to SEQ ID NO:2). The mutation can be any that inactivates or disrupts SA3. In some examples, the mutation is a deletion or substitution of any nucleotide in the SA3 sequence or a nucleotide insertion into the SA3 sequence (e.g. the sequence GTGTCTGCAGGCTCAAAGAG (SEQ ID NO:62)). In particular examples, the mutation is a mutation (e.g. deletion or substitution) of the A at position 455, the G at position 446, the G at position 457, and / or the C a position 458, with numbering relative to SEQ ID NO:2. For example, the modified HS4 insulator can comprise an A to T, A to C or A to G mutation at position 455, a G to C, G to A or G to T mutation at position 456, an G to C, G to T or G to A mutation at position 447, and / or a C to A, C to G or C to T mutation at position 458, with numbering relative to SEQ ID NO:2. In other examples, the mutation comprises an insertion of a nucleotide after position 455, 456 or 457. In some examples, the modified HS4 insulator comprises two or more of such mutations.

[0122] In one example, the modified HS4 insulator comprises an A to T mutation in the reverse complement sequence at position 455, with numbering relative to SEQ ID NO:2. In particular embodiments, the reverse complement sequence of the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs: 9, 18, 27, 36, 45 and 54 or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided there is T at position 455, with numbering relative to SEQ ID NO:2).

[0123] In some examples, the modified HS4 insulator described herein having a mutation that inactivates SA3 is in the opposite orientation to the transgene (i.e. in the opposite orientation to the first nucleic acid sequence). In particular examples, the first nucleic acid is in the forward orientation and the modified HS4 insulator is in the reverse orientation within the nucleic acid construct or vector. In a further example, the modified HS4 insulator is in the nucleic acid construct or vector in the opposition orientation to an unmodified HS4-650 insulator when in the nucleic acid construct or vector, i.e. the orientation of the modified HS4 insulator inverted relative to an unmodified HS4-650 insulator, so as to inactivate SA3. In particular examples, the modified HS4 insulator is in the forward orientation in the nucleic acid construct or vector.2.2.4 Combination mutations

[0124] Modified HS4 insulators can comprise two or mutations that inactivate SA4 and one or more of SA5, SA1, SA2 and SA3, relative to an unmodified HS4-650 insulator, or that inactivate SA5 and one or more of SA4, SA1, SA2 and SA3, relative to an unmodified HS4-650 insulator. Any of themutations described above for inactivating SA4, SA5, SA1, SA2 and / or SA3 can be combined in a modified HS4 insulator.

[0125] In one example, the modified HS4 insulator comprises a mutation that inactivates SA4 and a mutation that inactivates SA2 and SA3. For example, the modified HS4 insulator can comprise an A to T mutation in the reverse complement sequence at position 351, with numbering relative to SEQ ID NO:2, an A to T mutation in the reverse complement sequence at position 445, with numbering relative to SEQ ID NO:2, and comprise an A to T mutation in the reverse complement sequence at position 455, with numbering relative to SEQ ID NO:2. In particular embodiments, the reverse complement sequence of the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID N0s:5, 13, 21, 29, 37 and 45, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided there is a T at position 351, a T at position 445 and a T at position 455, with numbering relative to SEQ ID NO:2).

[0126] In another example, the modified HS4 insulator comprises a mutation that inactivates SA4 and a mutation that inactivates SA1, SA2 and SA3. For example, the modified HS4 insulator can comprise an A to T mutation in the reverse complement sequence at position 351, with numbering relative to SEQ ID NO:2, an A to T mutation in the reverse complement sequence at position 384, with numbering relative to SEQ ID NO:2, an A to T mutation in the reverse complement sequence at position 445, with numbering relative to SEQ ID NO: 2, and an A to T mutation in the reverse complement sequence at position 455, with numbering relative to SEQ ID NO:2. In particular embodiments, the reverse complement sequence of the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID N0s:6, 14, 22, 30, 38 and 46, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided there is a T at position 351, a T at position 384, a T at position 445 and a T at position 455, with numbering relative to SEQ ID NO:2).

[0127] In another example, the modified HS4 insulator comprises a mutation that inactivates SA4, a mutation that inactivates SA5 and a mutation that inactivates SA1, SA2 and SA3. For example, the modified HS4 insulator can comprise an A to T mutation in the reverse complement sequence at position 351, with numbering relative to SEQ ID NO:2, an A to T mutation in the reverse complement sequence at position 310, with numbering relative to SEQ ID NO:2, an A to T mutation in the reverse complement sequence at position 384, with numbering relative to SEQ ID NO:2, an A to T mutation in the reverse complement sequence at position 445, with numbering relative to SEQ ID NO:2, and an A to T mutation in the reverse complement sequence at position 455, with numbering relative to SEQ ID NO:2. In particular embodiments, the reverse complement sequence of the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID N0s:7, 15, 23, 31, 39 and 47, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided there is a T at position 351, a T at position 310, a T at position 384, a T at position 445 and a T at position 455, with numbering relative to SEQ ID NO:2).

[0128] In another example, the modified HS4 insulator comprises a mutation that inactivates SA4, a mutation that inactivates SA5 and a mutation that inactivates SA2 and SA3. For example, the modified HS4 insulator can comprise an A to T mutation in the reverse complement sequence atposition 351, with numbering relative to SEQ ID NO:2, an A to T mutation in the reverse complement sequence at position 310, with numbering relative to SEQ ID NO:2, an A to T mutation in the reverse complement sequence at position 445, with numbering relative to SEQ ID NO:2, and an A to T mutation in the reverse complement sequence at position 455, with numbering relative to SEQ ID NO:2. In particular embodiments, the reverse complement sequence of the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs:8, 16, 24, 32, 30 and 48, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto (provided there is a T at position 351, a T at position 310, a T at position 445 and a T at position 455, with numbering relative to SEQ ID NO:2).2.3 Components to inhibit expression of the HPRT Gene

[0129] In some embodiments, the nucleic acid constructs and vectors of the present disclosure comprise a polynucleotide that encodes an agent that inhibits HPRT expression. Thus in some examples, the nucleic acid constructs and vectors comprise a second promoter operably linked to a second polynucleotide, wherein the second polynucleotide encodes a nucleic acid that inhibits HPRT expression. In some embodiments, the RNAi agent is an shRNA, a microRNA, or a hybrid thereof.2.3.1 RNAi

[0130] In some embodiments, the nucleic acid constructs and vectors comprise a second polynucleotide encoding an RNAi. RNA interference is an approach for post-transcriptional silencing of gene expression by triggering degradation of homologous transcripts through a complex multistep enzymatic process, e.g. a process involving sequence-specific double-stranded small interfering RNA (siRNA). A simplified model for the RNAi pathway is based on two steps, each involving a ribonuclease enzyme. In the first step, the trigger RNA (either dsRNA or miRNA primary transcript) is processed into a short, interfering RNA (siRNA) by the RNase II enzymes DICER and Drosha. In the second step, siRNAs are loaded into the effector complex RNA-induced silencing complex (RISC). The siRNA is unwound during RISC assembly and the single-stranded RNA hybridizes with mRNA target. It is believed that gene silencing is a result of nucleolytic degradation of the targeted mRNA by the RNase H enzyme Argonaute (Slicer). If the siRNA / mRNA duplex contains mismatches the mRNA is not cleaved. Rather, gene silencing is a result of translational inhibition.

[0131] In some embodiments, the RNAi agent is an inhibitory or silencing nucleic acid. As used herein, a "silencing nucleic acid" refers to any polynucleotide which is capable of interacting with a specific sequence to inhibit gene expression. Examples of silencing nucleic acids include RNA duplexes (e.g. siRNA, shRNA), locked nucleic acids ("LNAs"), antisense RNA, DNA polynucleotides which encode sense and / or antisense sequences of the siRNA or shRNA, DNAzymses, or ribozymes. The skilled artisan will appreciate that the inhibition of gene expression need not necessarily be gene expression from a specific enumerated sequence, and may be, for example, gene expression from a sequence controlled by that specific sequence.

[0132] Methods for constructing interfering RNAs are known in the art. For example, the interfering RNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self- complementary (i.e., each strand comprises nucleotide sequence that is complementary to nucleotidesequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure); the antisense strand comprises nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene) and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Alternatively, interfering RNA may be assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked by means of nucleic acid based or non-nucleic acid-based linker(s). The interfering RNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The interfering RNA can be a circular singlestranded polynucleotide having two or more loop structures and a stem comprising self- complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNA interference.

[0133] In some embodiments, the interfering RNA coding region encodes a self-complementary RNA molecule having a sense region, an antisense region and a loop region. When expressed, such an RNA molecule desirably forms a "hairpin" structure and is referred to herein as an "shRNA." In some embodiments, the loop region is generally between about 2 and about 10 nucleotides in length. In other embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and the antisense region are between about 15 and about 30 nucleotides in length. Following post-transcriptional processing, the small hairpin RNA is converted into a siRNA by a cleavage event mediated by the enzyme DICER, which is a member of the RNase III family. The siRNA is then capable of inhibiting the expression of a gene with which it shares homology. Further details are described by see Brummelkamp et al., Science 296:550-553, (2002); Lee et al, Nature Biotechnol., 20, 500-505, (2002); Miyagishi and Taira, Nature Biotechnol 20:497- 500, (2002); Paddison et al. Genes & Dev. 16:948-958, (2002); Paul, Nature Biotechnol, 20, 505- 508, (2002); Sui, Proc. Natl. Acad. Sd. USA, 99(6), 5515-5520, (2002); and Yu et al. Proc NatlAcadSci USA 99:6047-6052, (2002), the disclosures of which are hereby incorporated by reference herein in their entireties.2.3.2 shRNA

[0134] In some embodiments, the second polynucleotide encodes a shRNA that inhibits HPRT. In a particular embodiment, the shRNA is sh734, such as one comprising a sequence set forth in SEQ ID NO:66 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity thereto. In another embodiment, the sh734 comprises a multi-t termination sequence, which may be required for required for Pol III promoters such as 7SK. Thus, in some embodiments, the sh734 comprises the sequence set forth in SEQ ID NO:67 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,97% or 99% sequence identity thereto. In further embodiment, the sh734 comprises a single-t termination sequence, and thus comprises, for example, a sequence set forth in SEQ ID NO:68 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity thereto.2.3.3 MicroRNAs

[0135] MicroRNAs (miRs) are a group of non-coding RNAs which post-transcriptionally regulate the expression of their target genes. It is believed that these single stranded molecules form a miRNA-mediated silencing complex (miRISC) complex with other proteins which bind to the 3' untranslated region (UTR) of their target mRNAs so as to prevent their translation in the cytoplasm.

[0136] In some embodiments, shRNA sequences are embedded into micro-RNA secondary structures ("micro-RNA based shRNA"). In some embodiments, shRNA nucleic acid sequences targeting HPRT are embedded within micro-RNA secondary structures. In some embodiments, the micro-RNA based shRNAs target coding sequences within HPRT to achieve knockdown of HPRT expression, which is believed to be equivalent to the utilization of shRNA targeting HPRT without attendant pathway saturation and cellular toxicity or off-target effects. In some embodiments, the micro-RNA based shRNA is a de novo artificial microRNA shRNA. The production of such de novo micro-RNA based shRNAs are described by Fang, W. & Bartel, David P. The Menu of Features that Define Primary MicroRNAs and Enable De Novo Design of MicroRNA Genes. Molecular Cell 60, 131- 145, the disclosure of which is hereby incorporated by reference herein in its entirety.

[0137] Exemplary miRNAs are provided in International Patent Publication No. WO2020139796.2.3.4 Alternatives to RNAi

[0138] As an alternative to the incorporation of a RNAi, in some embodiments, the nucleic acid constructs and vectors may include a polynucleotide which encodes antisense oligonucleotides that bind sites in messenger RNA (mRNA). Antisense oligonucleotides of the present disclosure specifically hybridize with a nucleic acid encoding a protein and interfere with transcription or translation of the protein. In some embodiments, an antisense oligonucleotide targets DNA and interferes with its replication and / or transcription. In other embodiments, an antisense oligonucleotide specifically hybridizes with RNA, including pre-mRNA (i.e. precursor mRNA which is an immature single strand of mRNA), and mRNA. Such antisense oligonucleotides may affect, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity that may be engaged in or facilitated by the RNA. The overall effect of such interference is to modulate, decrease, or inhibit target protein expression.2.4 Other elements

[0139] Other elements that can be present in the nucleic acid constructs and vectors of the present disclosure include, for example, promoters, operators, termination signals, polyadenylation signals, etc. Those skilled in the art can readily identify suitable elements for the correct processing, transcription and / or translation of nucleic acid present in and encoded by the nucleic acid constructs and vectors.

[0140] In one example, the nucleic acid construct or vector comprises a Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE). In a particular embodiment, the WPRE is downstream of the first nucleic acid sequence and upstream of the modified HS4 insulator (i.e. is between the first nucleic acid sequence and the modified HS4 insulator. In some embodiments, the WPRE is a WPRE mut6 comprising a sequence set forth in SEQ ID NO:63 or a WPRE mut7 comprising a sequence set forth in SEQ ID NO:64, or comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity to the sequence set forth in SEQ ID NO :63 or 64.

[0141] In some examples, the promoter is a MND promoter, such as one comprising a sequence set forth in SEQ ID NO :65 a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity to the sequence set forth in SEQ ID NO:65. In one embodiment, the first promoter is a MND promoter and is operably linked to the first polynucleotide comprising the transgene.

[0142] In some examples, the promoter is a 7SK RNA promoter, such as one set forth in any one of SEQ ID NOs:69-71, or one comprising a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity to the sequences set forth in SEQ ID NO:69-71. In one embodiment, the second promoter is a 7SK RNA promoter and is operably linked to the second nucleic acid encoding a nucleic acid that inhibits HPRT expression.

[0143] In some examples, the nucleic acid construct or vector comprises a 7tetO promoter / operator, such as one comprising a sequence set forth in SEQ ID NO :72 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity to the sequence set forth in SEQ ID NO:72.

[0144] In further examples, the nucleic acid construct or vector comprises a β-globin poly(A) signal, such as one comprising a sequence set forth in SEQ ID NO:73 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity to the sequence set forth in SEQ ID NO :73.2.5 Production of vectors

[0145] The vectors of the present disclosure can be produced using any method, and such methods are well known to those skilled in the art. In some embodiments, a modified HS4 insulator, and optionally the first promoter operably linked to the first polynucleotide encoding a therapeutic protein such a Wiskott-Aldrich Syndrome protein (and optionally any other expression cassette or element described herein) is inserted into a vector, optionally a lentiviral vector, that is a plasmid, such as one selected from the group consisting of pTL20c, pTL20d, FG, pRRL, pCL20, pLKO.1 puro, pLKO.1, PLK0.3G, Tet-pLKO-puro, pSiCO, pLJM l-EGFP, FUGW, pLVTHM, pLVUT-tTR-KRAB, pLL3.7, pLB, pWPXL, pWPI, EF.CMV.RFP, pLenti CMV Puro DEST, pLenti-puro, pLOVE, pULTRA, pLJM l-EGFP, pLX301, pInducer20, pHIV-EGFP, Tet-pLKO-neo, pLV-mCherry, pCW57.1, pLionll, pSLIK-Hygro, and plnducerlO-mir-RUP-PheS. In other embodiments, the vector, optionally the lentiviral vector, into which the modified HS4 insulator, and optionally the first promoter and first polynucleotide, is inserted is selected from AnkT9W vector, a T9Ank2W vector, a TNS9 vector, a lentiglobin HPV569 vector, a lentiglobin BB305 vector, a BG-1 vector, a BGM-1 vector, a GLOBE vector, a G-GLOBEvector, a V5 vector, a V5m3 vector, a V5m3-400 vector, a G9 vector, and a BCL11A shmir vector. In a particular embodiment, the lentiviral expression vector is pTL20c.

[0146] For example, an expression cassette having the first promoter operably linked to the first polynucleotide, and a modified HS4 insulator, may be inserted into a pTL20c vector according to the methods described in United States Patent Publication No. 20180112233 and International Patent Publication No. WO2020139796.

[0147] Lentivirus particles or virions (or recombinant lentiviruses) can be produced using standard methods well known in the art. In one example, a stable producer cell line for generating virus is utilized, wherein the stable producer cell line is derived from one of a GPR, GPRG, GPRT, GPRGT, or GPRT-G packing cell line. In some embodiments, the stable producer cell line is derived from the GPRT-G cell line. In some embodiments, the stable producer cell line is generated by (a) synthesizing a vector by cloning nucleic acid sequences encoding an anti-HPRT shRNA and WASP into a recombinant plasmid (i.e. the synthesized vector may be any one of the vectors described herein that encode an anti-HPRT shRNA and WASP); (b) generating DNA fragments from the synthesized vector; (c) forming a concatemeric array from (i) the generated DNA fragments from the synthesized vector, and (ii) from DNA fragments derived from an antibiotic resistance cassette plasmid; (d) transfecting one of the packaging cell lines with the formed concatemeric array; and (e) isolating the stable producer cell line. Additional methods of forming a stable producer cell line are described in United States Patent Publication No. 20180112233.2.6 Exemplary vectors

[0148] Exemplary lentiviral vectors of the present disclosure include nucleic acid vectors (e.g. plasmids) and lentivirus virions (or virus particles) that comprise a 5'LTR (including a 7tetO promoter / operator, R and U5) downstream of which, from 5' to 3', is a central polypurine tract (cPPT), a REV response element (RRE), a 7sk-sh734 expression cassette comprising a 7sk promoter (e.g. one comprising a sequence set forth in any one of SEQ ID NOs:69-72 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity thereto) operably linked to nucleic acid encoding sh734 (e.g. one encoding a sh734 comprising a sequence set forth in any one of SEQ ID NOs:66-68 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity thereto), a WASP expression cassette comprising a MND promoter (e.g. one comprising the sequence set forth in SEQ ID NO: 65 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity thereto) operably linked to a transgene encoding WASP (such as a transgene comprising the sequence set forth in any one of SEQ ID NOs: 60-62 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity thereto), a WPRE (e.g. one comprising the sequence set forth in SEQ ID NO: 63 or 64 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity thereto), and a 3'LTR, which includes a HS4 insulator (such as an unmodified HS4 insulator set forth in any one of SEQ ID NOs: l, 9, 17, 25, 33 and 41 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity thereto, wherein the HS4 insulator is in the forward orientation, or a modified HS4 insulator in the reverse orientation and having an inactivated SA4and / or SA5 as described herein, U3, R and a β-globin poly(A) signal (e.g. one comprising the sequence set forth in SEQ ID NO: 73 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99% sequence identity thereto). In these vectors, typically the 7sk-sh734 expression cassette is in the reverse orientation and the WASP expression cassette is in the forward orientation.

[0149] In an example, the lentiviral vector comprises sequences set forth in SEQ ID NO:76, or sequences at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identical thereto, wherein the sequence comprises an inactivation of SA4, SA2 and SA3, i.e. comprises a T at position 351, a T at position 445 and a T at position 455, with numbering relative to SEQ ID NO:2. The WASP expression cassette is located from position 2396 to 4301 of SEQ ID NO:76, and the HS4-650 insulator resides between positions 5034-5698. The positions, within the sequence of SEQ ID NO:76, of the A to T point mutations within SA2, SA3 and SA4 are shown in Table 4.

[0150] In an example, the lentiviral vector comprises sequences set forth in SEQ ID NO:77, or sequences at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identical thereto, wherein the sequence comprises an inactivation of SA4, SA1, SA2 and SA3, i.e. comprises a T at position 351, a T at position 384, a T at position 445 and a T at position 455, with numbering relative to SEQ ID NO:2. The WASP expression cassette is located from position 2396 to 4301 of SEQ ID NO:77, and the HS4-650 insulator resides between positions 5034-5698. The positions, within the sequence of SEQ ID NO:77, of the A to T point mutations within SA1, SA2, SA3 and SA4 are shown in Table 4.

[0151] In an example, the lentiviral vector comprises sequences set forth in SEQ ID NO:78, or sequences at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identical thereto, wherein the sequence comprises an inactivation of SA4, SA5, SA1, SA2 and SA3, i.e. comprises a T at position 351, a T at position 310, a T at position 384, a T at position 445 and a T at position 455, with numbering relative to SEQ ID NO:2. The WASP expression cassette is located from position 2396 to 4301 of SEQ ID NO:78, and the HS4-650 insulator resides between positions 5034-5698. The positions, within the sequence of SEQ ID NO:78, of the A to T point mutations within SA1, SA2, SA3, SA4 and SA5 are shown in Table 4.

[0152] In an example, the lentiviral vector comprises sequences set forth in SEQ ID NO:79, or sequences at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identical thereto, wherein the sequence comprises an inactivation of SA4, SA5, SA2 and SA3, i.e. comprises a T at position 351, a T at position 310, a T at position 445 and a T at position 455, with numbering relative to SEQ ID NO:2. The WASP expression cassette is located from position 2396 to 4301 of SEQ ID NO:79, and the HS4-650 insulator resides between positions 5034-5698. The positions, within the sequence of SEQ ID NO:79, of the A to T point mutations within SA2, SA3, SA4 and SA5 are shown in Table 4.Table 4: Position of A->T point mutations in exemplary vectors3. Host cells

[0153] The present disclosure also provides a host cell comprising, transformed or transduced with a nucleic acid construct or vector of the present disclosure. A "host cell" or "target cell" means a cell that is to be transformed or transduced using the methods and nucleic acid constructs and vectors of the present disclosure. In some embodiments, the host cells are mammalian cells in which the nucleic acid construct or vector can be expressed. Suitable mammalian host cells include, but are not limited to, human cells, murine cells, non-human primate cells (e.g. rhesus monkey cells), human progenitor cells or stem cells, 293 cells, HeLa cells, D17 cells, MDCK cells, BHK cells, and Cf2Th cells. In certain embodiments, the host cell comprising a nucleic acid construct or vector of the disclosure is a hematopoietic cell, such as hematopoietic progenitor / stem cell (e.g. CD34-positive hematopoietic progenitor / stem cell), a monocyte, a macrophage, a peripheral blood mononuclear cell, a CD4+ T lymphocyte, a CD8+ T lymphocyte, or a dendritic cell.

[0154] The hematopoietic stem cells (e.g. CD4+ T lymphocytes, CD8+ T lymphocytes, and / or monocyte / macrophages) to be transduced with a vector of the disclosure can be allogeneic, autologous, or from a matched sibling. The HSCs are, in some embodiments, CD34-positive and can be isolated from the patient's bone marrow or peripheral blood. The isolated CD34-positive HSCs (and / or other hematopoietic cell described herein) is, in some embodiments, transduced with an vector as described herein.

[0155] In some embodiments, the host cells or transduced host cells are combined with a pharmaceutically acceptable carrier. In some embodiments, the host cells or transduced host cells are formulated with PLASMA-LYTE A (e.g. a sterile, nonpyrogenic isotonic solution for intravenous administration; where one liter of PLASMA-LYTE A has an ionic concentration of 140 mEq sodium, 5 mEq potassium, 3 mEq magnesium, 98 mEq chloride, 27 mEq acetate, and 23 mEq gluconate). In other embodiments, the host cells or transduced host cells are formulated in a solution of PLASMA- LYTE A, the solution comprising between about 8% and about 10% dimethyl sulfoxide (DMSO). In some embodiments, the less than about 2x107host cells / transduced host cells are present per mL of a formulation including PLASMA-LYTE A and DMSO.

[0156] In some embodiments, the host cells are rendered substantially HPRT deficient after transduction with a nucleic acid construct or vector according to the present disclosure. In some embodiments, the level of HPRT gene expression is reduced by at least 50%. In some embodiments, the level of HPRT gene expression is reduced by at least 55%. In some embodiments, the level of HPRT gene expression is reduced by at least 60%. In some embodiments, the level of HPRT gene expression is reduced by at least 65%. In some embodiments, the level of HPRT gene expression is reduced by at least 70%. In some embodiments, the level of HPRT gene expression is reduced by at least 75%. In some embodiments, the level of HPRT gene expression is reduced by at least 80%. In some embodiments, the level of HPRT gene expression is reduced by at least 85%. In some embodiments, the level of HPRT gene expression is reduced by at least 90%. In some embodiments, the level of HPRT gene expression is reduced by at least 95%. It is believed that cells having 20% or less residual HPRT gene expression are sensitive to a purine analog, such as 6TG, allowing for their selection with the purine analog.

[0157] In some embodiments, transduction of host cells may be increased by contacting the host cell, in vitro, ex vivo, or in vivo, with a nucleic acid construct or vector of the present disclosure and one or more compounds that increase transduction efficiency. For example, in some embodiments, the one or more compounds that increase transduction efficiency are compounds that stimulate the prostaglandin EP receptor signaling pathway, i.e. one or more compounds that increase the cell signaling activity downstream of a prostaglandin EP receptor in the cell contacted with the one or more compounds compared to the cell signaling activity downstream of the prostaglandin EP receptor in the absence of the one or more compounds. In some embodiments, the one or more compounds that increase transduction efficiency are a prostaglandin EP receptor ligand including, but not limited to, prostaglandin E2 (PGE2), or an analog or derivative thereof. In other embodiments, the one or more compounds that increase transduction efficiency include but are not limited to, RetroNectin (a 63 kD fragment of recombinant human fibronectin fragment, available from Takara); Lentiboost (a membrane-sealing poloxamer, available from Sirion Biotech), Protamine Sulphate, Cyclosporin H, and Rapamycin.4. Pharmaceutical compositions

[0158] The present disclosure also provides for compositions, including pharmaceutical compositions, comprising one or more vectors and / or non-viral delivery vehicles (e.g. nanocapsules) as disclosed herein. In some embodiments, pharmaceutical compositions comprise an effective amount of at least one of the vectors and / or non-viral delivery vehicles as described herein and a pharmaceutically acceptable carrier. For instance, in certain embodiments, the pharmaceutical composition comprises an effective amount of an vector and a pharmaceutically acceptable carrier. An effective amount can be readily determined by those skilled in the art based on factors such as body size, body weight, age, health, sex of the subject, ethnicity, and viral titers.

[0159] The phrases "pharmaceutically acceptable" or "pharmacologically acceptable" refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human. For example, an expression vector may be formulated with a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungalagents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans. Methods for the formulation of compounds with pharmaceutical carriers are known in the art and are described in, for example, in Remington's Pharmaceutical Science, (17th ed. Mack Publishing Company, Easton, Pa. 1985); and Goodman 81 Gillman's: The Pharmacological Basis of Therapeutics (11th Edition, McGraw-Hill Professional, 2005); the disclosures of each of which are hereby incorporated herein by reference in their entirety.

[0160] In some embodiments, the pharmaceutical compositions may comprise any of the vectors, nanocapsules, or compositions disclosed herein in any concentration that allows the silencing nucleic acid administered to achieve a concentration in the range of from about 0.1 mg / kg to about 1 mg / kg. In some embodiments, the pharmaceutical compositions may comprise the expression vector in an amount of from about 0.1% to about 99.9% by weight. Pharmaceutically acceptable carriers suitable for inclusion within any pharmaceutical composition include water, buffered water, saline solutions such as, for example, normal saline or balanced saline solutions such as Hank's or Earle's balanced solutions), glycine, hyaluronic acid etc. The pharmaceutical composition may be formulated for parenteral administration, such as intravenous, intramuscular or subcutaneous administration. Pharmaceutical compositions for parenteral administration may comprise pharmaceutically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and non-aqueous carriers, solvents, diluents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.), carboxymethylcellulose and mixtures thereof, vegetable oils (such as olive oil), injectable organic esters (e.g. ethyl oleate).

[0161] The pharmaceutical composition may be formulated for oral administration. Solid dosage forms for oral administration may include, for example, tablets, dragees, capsules, pills, and granules. In such solid dosage forms, the composition may comprise at least one pharmaceutically acceptable carrier such as sodium citrate and / or dicalcium phosphate and / or fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; binders such as carboxylmethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and acacia; humectants such as glycerol; disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, silicates, and sodium carbonate; wetting agents such as acetyl alcohol, glycerol monostearate; absorbants such as kaolin and bentonite clay; and / or lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof. Liquid dosage forms for oral administration may include, for example, pharmaceutically acceptable emulsions, solutions, suspensions, syrups and elixirs. Liquid dosages may include inert diluents such as water or other solvents, solubilizing agents and / or emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3- butylene glycol, dimethyl formamide, oils (such as, for example, cottonseed oil, corn oil, germ oil, castor oil, olive oil, sesame oil), glycerol, tetra hydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.

[0162] The pharmaceutical compositions may comprise penetration enhancers to enhance their delivery. Penetration enhancers may include fatty acids such as oleic acid, lauric acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, reclineate, monoolein, dilaurin, caprylic acid, arachidonic acid, glyceryl 1-monocaprate, mono and di-glycerides and physiologically acceptable salts thereof. The compositions may further include chelating agents such as, for example, ethylenediaminetetraacetic acid (EDTA), citric acid, salicylates (e.g. sodium salicylate, 5-methoxysalicylate, homovanilate).

[0163] The pharmaceutical compositions may comprise any of the vectors disclosed herein in an encapsulated form. For example, the vectors may be encapsulated within a nanocapsule, such as a nanocapsule comprising one or more biodegradable polymers such as polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides). In some embodiments, the vectors are encapsulated within polymeric nanocapsules. In other embodiments, the vectors are encapsulated within biodegradable and / or erodible polymeric nanocapsules. In some embodiments, the polymeric nanocapsules are comprised of two different positively charged monomers, at least one neutral monomer, and a crosslinker. In some embodiments, the nanocapsules further comprise at least one targeting moiety. In some embodiments, the nanocapsules comprise between 2 and between 6 targeting moieties. In some embodiments, the taretinc moieties are antibodies. In some embodiments, the targeting moieties target any one of the CD117, CD10, CD34, CD38, CD45, CD123, CD127, CD135, CD44, CD47, CD96, CD2, CD4, CD3, and CD9 markers. In some embodiments, the targeting moiety targets any one of a human mesenchymal stem cell CD marker, including the CD29, CD44, CD90, CD49a-f, CD51, CD73 (SH3), CD105 (SH2), CD106, CD166, and Stro-1 markers. In some embodiments, the targeting moiety targets any one of a human hematopoietic stem cell CD marker including CD34, CD38, CD45RA, CD90, and CD49.5. Methods of treatment

[0164] By way of example, a nucleic acid construct or vector described herein comprising a nucleic acid sequence encoding WASP may be administered so as to genetically correct Wiskott- Aldrich Syndrome or to alleviate the pathologies associated with Wiskott-Aldrich Syndrome. In some embodiments, a population of host cells transduced with a nucleic acid construct or vector is administered so as to correct Wiskott-Aldrich Syndrome or to alleviate the pathologies associated with Wiskott-Aldrich Syndrome. It is believed that this method is advantageous over currently available therapies, due to its availability to all patients, particularly those who do not have a matched sibling donor. It is further believed that this method also has the potential to be administered as a one-time treatment providing lifelong correction. It is also believed that the method is advantageously devoid of any immune side effects, and if side effects did arise, the side-effects could be mitigated by administering a dihydrofolate reductase inhibitor (e.g. MTX or MPA) as noted herein. It is further believed that an effective gene therapy approach will revolutionize the way Wiskott- Aldrich Syndrome is treated , ultimately improving patient outcome.

[0165] In some embodiments, treatment with the nucleic acid constructs, vectors or transduced host cells described herein genetically corrects or alleviates one or more of the pathologies associated with Wiskott-Aldrich Syndrome, such as those outlined below. In some embodiments, the pathologies which may be genetically corrected or alleviated by administering the expression vectorsor transduced host cells to a patient include, but are not limited to, microthrombocytopenia, eczema, autoimmune diseases, and recurrent infections. An eczema rash is common in patients with classic WAS. In infants, the eczema may occur on the face or scalp and can resemble "cradle cap." It can also have the appearance of a severe diaper rash, or be more generalized, involving the arms and legs. In older boys, eczema is often limited to the skin creases around the front of the elbows or behind the knees, behind the ears, or around the wrist. Since eczema is extremely itchy, patients often scratch themselves until they bleed, even while asleep. These areas where the skin barrier is broken can then serve as entry points for bacteria that can cause skin and blood stream infections.

[0166] It is believed that thrombocytopenia (a reduced number of platelets) is a common feature of patients with Wiskott-Aldrich Syndrome. In addition to being decreased in number, the platelets themselves are small and dysfunctional, less than half the size of normal platelets. As a result, patients with Wiskott-Aldrich Syndrome may bleed easily, even if they have not had an injury. In some embodiments, bleeding into the skin may cause pinhead sized bluish-red spots, called petechiae, or they may be larger and resemble bruises.

[0167] It is believed that the immunodeficiency associated with Wiskott-Aldrich Syndrome causes the function of both B- and T-lymphocytes to be significantly abnormal. As a result, infections are common in the classic form of Wiskott-Aldrich Syndrome and may involve all classes of microorganisms. In some embodiments, these infections may include upper and lower respiratory infections such as ear infections, sinus infections and pneumonia. More severe infections such as sepsis (bloodstream infection or "blood poisoning"), meningitis and severe viral infections are less frequent but can occur. Occasionally, patients with the classic form of Wiskott-Aldrich Syndrome may develop pneumonia caused by the fungus (pneumocystis jiroveci carinii). In some embodiments, the skin may become infected with bacteria such as Staphylococcus in areas where patients have scratched their eczema. In some embodiments, a viral skin infection called molluscum contagiosum is also commonly seen in Wiskott-Aldrich Syndrome. It is believed that vaccination to prevent infections is often not effective in Wiskott-Aldrich Syndrome since patients do not make normal protective antibody responses to vaccines.

[0168] In some embodiments, the recurrent infections include, but are not limited to, otitis media, skin abscess, pneumonia, enterocolitis, meningitis, sepsis, and urinary tract infection. In some embodiments, the recurrent infections are cutaneous infections. In some embodiments, the eczema experienced by patients diagnosed with Wiskott-Aldrich Syndrome is classified as treatmentresistant eczema.

[0169] By way of example, autoimmune diseases often experienced by those having Wiskott- Aldrich Syndrome include hemolytic anemia, vasculitis, arthritis, neutropenia, inflammatory bowel disease, and IgA nephropathy, Henoch-Schbnlein-like purpura, dermatomyositis, recurrent angioedema, and uveitis. In some embodiments, the recurrent infections may be caused by any of a bacterial, viral, or fungal infection. In some embodiments, treatment with the vectors or transduced host cells described herein genetically corrects or alleviates a plurality of the pathologies associated with Wiskott-Aldrich Syndrome, such as those outlined below.

[0170] As noted herein, in addition to the therapeutic gene, the nucleic acid constructs and vectors of the present disclosure may include an agent designed to inhibit or knockdown HPRT expression (e.g. a shRNA to HPRT), and hence provide for an in vivo chemoselection strategy that exploits the essential role that HPRT plays in metabolizing purine analogs, e.g. 6TG, into myelotoxic agents. Because HPRT-deficiency does not impair hematopoietic cell development or function, it can be removed from hematopoietic cells used for transplantation. Conditioning and chemoselection with a purine analog are discussed further herein.

[0171] In the context of the treatment of or alleviation of the pathologies associated with Wiskott-Aldrich Syndrome, the treatment of a subject includes: identifying a subject in need of treatment thereof; transducing HSCs (e.g. autologous HSCs, allogenic HSCs, sibling matched HSCs) with a lentiviral vector of the present disclosure; and transplanting or administering the transduced HSCs into the subject. In some embodiments, the subject in need of treatment thereof is one suffering from the pathologies associated with Wiskott-Aldrich Syndrome.

[0172] In some embodiments, the method further comprises a step of myeloablative conditioning prior to the administration of the transduced HSCs (e.g. using a purine analog, chemotherapy, radiation therapy, treatment with one or more internalizing immunotoxins or antibody-drug conjugates, or any combination thereof). In some embodiments, the method further comprises the step of pre-conditioning, or in vivo chemoselection, utilizing a purine analog (e.g. 6TG) following administration of the transduced HSCs. In some embodiments, the method further comprises the step of negative selection utilizing a dihydrofolate reductase inhibitor (e.g. MTX or MPA) should side effects arise (e.g. GvHD).5.1 Conditioning and Chemoselection with a Purine Analog

[0173] In some embodiments, the method of treatment comprises the additional steps of (i) conditioning prior to HSC transplantation; and / or (ii) in vivo chemoselection. One or both steps may utilize a purine analog. In some embodiments, the purine analog is selected from the group consisting of 6-thioguanine ("6TG"), 6-mercaptopurine ("6MP") or azathiopurine ("AZA"). It is believed that the engrafted Wiskott-Aldrich Syndrome protein-containing HSCs deficient in HPRT activity are highly resistant to the cytotoxic effects of the introduced purine analog. With a combined strategy of conditioning and chemoselection, efficient and high engraftment of HPRT-deficient, Wiskott-Aldrich Syndrome protein-containing HSCs with low overall toxicity can be achieved. It is believed that resultant expression of the Wiskott-Aldrich Syndrome protein, combined with the enhanced engraftment and chemoselection of gene-modified HSCs, can result in sufficient protein production to alleviate the pathologies associated with Wiskott-Aldrich Syndrome.

[0174] 6TG is a purine analog having both anticancer and immune-suppressive activities. Thioguanine competes with hypoxanthine and guanine for the enzyme hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) and is itself converted to 6-thioguanylic acid (TGMP). This nucleotide reaches high intracellular concentrations at therapeutic doses. TGMP interferes several points with the synthesis of guanine nucleotides. It inhibits de novo purine biosynthesis by pseudofeedback inhibition of glutamine-5-phosphoribosylpyrophosphateamidotransferase-the first enzyme unique to the de novo pathway for purine ribonucleotide. TGMP also inhibits the conversion of inosinicacid (IMP) to xanthylic acid (XMP) by competition for the enzyme IMP dehydrogenase. At one-time TGMP was felt to be a significant inhibitor of ATP : GMP phosphotransferase (guanylate kinase), but recent results have shown this not to be so. Thioguanylic acid is further converted to the di- and triphosphates, thioguanosine diphosphate (TGDP) and thioguanosine triphosphate (TGTP) (as well as their deoxyribosyl analogues) by the same enzymes which metabolize guanine nucleotides.

[0175] As those of skill in the art will appreciate, given the inclusion of an agent designed to inhbit HPRT expression, e.g. an RNAi agent to knockdown HPRT, in the vectors of the present disclosure, the resulting transduced HSCs are HPRT-deficient or substantially HPRT-deficient (e.g. such as those having 20% or less residual HPRT gene expression). As such, those HSCs that do express HPRT, i.e. HPRT wild-type cells, may be selectively depleted by administering one or more doses of 6TG. In some embodiments, 6TG may be administered for both myeloablative conditioning of HPRT-wild type recipients and for in vivo chemoselection process of donor cells. Hence, this strategy is believed to allow for the selection of gene-modified cells in vivo, i.e. for the selection of the Wiskott-Aldrich Syndrome protein-containing gene-modified cells in vivo.

[0176] In some embodiments, following the collection of HSCs from a donor, the HSCs are transduced with a vector according to the present disclosure. The resulting HSCs are HPRT-deficient and express the WAS gene. In parallel, a patient to receive the HSCs is first treated with a myeloablative conditioning step. Following conditioning, the transduced HSCs are transplanted or administered to the patient. The WAS gene containing HSCs may then be selected for in vivo using 6TG, as discussed herein.

[0177] Myeloablative conditioning may be achieved using high-dose conditioning radiation, chemotherapy, and / or treatment with a purine analog (e.g. 6TG). In some embodiments, the HSCs are administered between about 24 and about 96 hours following treatment with the conditioning regimen. In other embodiments, the patient is treated with the HSC graft between about 24 and about 72 hours following treatment with the conditioning regimen. In yet other embodiments, the patient is treated with the HSC graft between about 24 and about 48 hours following treatment with the conditioning regimen. In some embodiments, the HSC graft comprises between about 2 x 106 cells / kg to about 15 x 106 cells / kg (body weight of patient). In some embodiments, the HSC graft comprises a minimum of 2 x 106 cells / kg, with a target of greater than 6 x 106 cells / kg. In some embodiments, at least 10% of the cells administered are transduced with a lentiviral vector as described herein. In some embodiments, at least 20% of the cells administered are transduced with a lentiviral vector as described herein. In some embodiments, at least 30% of the cells administered are transduced with a lentiviral vector as described herein. In some embodiments, at least 40% of the cells administered are transduced with a lentiviral vector as described herein. In some embodiments, at least 50% of the cells administered are transduced with a lentiviral vector as described herein.

[0178] In some embodiments, transgene-containing HPRT-deficient HSCs are selected for in vivo using a low dose schedule of a purine analog, such as 6TG, which is believed to have minimal adverse effects on extra-hematopoietic tissues. In some embodiments, a dosage of the purine analog, such as 6TG, for in vivo chemoselection ranging from between about 0.2mg / kg / day to about0.6mg / kg / day is provided to a patient following introduction of the HSCs into the patient. In some embodiments, the dosage ranges from between about 0.3mg / kg / day to about lmg / kg / day. In some embodiments, the dosage is up to about 2mg / kg / day.

[0179] In some embodiments, the amount of 6TG administered per dose is based on a determination of a patient's HPRT enzyme activity. Those of ordinary skill in the art will appreciate that those presenting with higher levels of HPRT enzyme activity may be provided with doses having lower amounts of a purine analog, such as 6TG. The higher the level of HPRT the greater conversion of the purine analog, such as 6TG, to toxic metabolites. Therefore, the lower dose you would need to administer to achieve the same goal.

[0180] Measurement of TPMT genotypes and / or TPMT enzyme activity before instituting 6TG conditioning may identify individuals with low or absent TPMT enzyme activity. As such, in other embodiments, the amount of 6TG administered is based on thiopurine S-methyltransferase (TPMT) levels or TPMT genotype.

[0181] In some embodiments, the dosage of a purine analog, such as 6TG, for in vivo chemoselection is administered to the patient one to three times a week on a schedule with a cycle selected from the group consisting of: (i) weekly; (ii) every other week; (iii) one week of therapy followed by two, three or four weeks off; (iv) two weeks of therapy followed by one, two, three or four weeks off; (v) three weeks of therapy followed by one, two, three, four or five weeks off; (vi) four weeks of therapy followed by one, two, three, four or five weeks off; (vii) five weeks of therapy followed by one, two, three, four or five weeks off; and (viii) monthly.

[0182] In some embodiments, between about 3 and about 10 dosages of a purine analog, such as 6TG, are administered to the patient over an administration period ranging from 1 week to about 4 weeks. In some embodiments, 4 or 5 dosages of 6TG are administered to the patient over a 14- day period.5.2 Negative Selection with a Dihvdrofolate Reductase Inhibitor

[0183] In addition, HPRT-deficient cells can be negatively selected by using a dihydrofolate reductase inhibitor (e.g. MTX) to inhibit the enzyme dihydrofolate reductase (DHFR) in the purine de novo synthetic pathway. This has been developed as a safety procedure to eliminate gene-modified HSCs in case of unexpected adverse effects observed. As such, should any adverse side effects arise, a patient may be treated with a dihydrofolate reductase inhibitor (e.g. MTX or MPA). Adverse side effects include, for example, aberrant blood counts / clonal expansion indicating insertional mutagenesis in a particular clone of cells or cytokine storm.

[0184] It is believed that a dihydrofolate reductase inhibitor (e.g. MTX or MPA) competitively inhibits dihydrofolate reductase (DHFR), an enzyme that participates in tetrahydrofolate (THF) synthesis. DHFR catalyzes the conversion of dihydrofolate to active tetrahydrofolate. Folic acid is needed for the de novo synthesis of the nucleoside thymidine, required for DNA synthesis. Also, folate is essential for purine and pyrimidine base biosynthesis, so synthesis will be inhibited. The dihydrofolate reductase inhibitor (e.g. MTX or MPA) therefore inhibits the synthesis of DNA, RNA, thymidylates, and proteins. MTX or MPA blocks the de novo pathway by inhibiting DHFR. In HPRT- / - cell, there is no salvage or de novo pathway functional, leading to no purine synthesis, andtherefore the cells die. However, the HPRT wild type cells have a functional salvage pathway, their purine synthesis takes place and the cells survive.

[0185] Given the sensitivity of the modified HSCs produced according to the present disclosure, a dihydrofolate reductase inhibitor (e.g. MTX or MPA) may be used to selectively eliminate HPRT- deficient cells. In some embodiments, a dihydrofolate reductase inhibitor (e.g. MTX or MPA) is administered as a single dose. In some embodiments, multiple doses of the dihydrofolate reductase inhibitor are administered.

[0186] In some embodiments, an amount of MTX administered ranges from about 2 mg / m2 / infusion to about 100 mg / m2 / infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg / m2 / infusion to about 90 mg / m2 / infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg / m2 / infusion to about 80 mg / m2 / infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg / m2 / infusion to about 70 mg / m2 / infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg / m2 / infusion to about 60 mg / m2 / infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg / m2 / infusion to about 50 mg / m2 / infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg / m2 / infusion to about 40 mg / m2 / infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg / m2 / infusion to about 30 mg / m2 / infusion. In some embodiments, an amount of MTX administered ranges from about 20 mg / m2 / infusion to about 20 mg / m2 / infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg / m2 / infusion to about 10 mg / m2 / infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg / m2 / infusion to about 8 mg / m2 / infusion. In other embodiments, an amount of MTX administered ranges from about 2.5 mg / m2 / infusion to about 7.5 mg / m2 / infusion. In yet other embodiments, an amount of MTX administered is about 5 mg / m2 / infusion. In yet further embodiments, an amount of MTX administered is about 7.5 mg / m2 / infusion.

[0187] In some embodiments, between 2 and 6 infusions are made, and the infusions may each comprise the same dosage or different dosages (e.g. escalating dosages, decreasing dosages, etc.). In some embodiments, the administrations may be made on a weekly basis, or a bi-monthly basis.

[0188] In some embodiments, MPA is dosed in an amount of between about 500mg to about 1500mg per day. In some embodiments, the dose of MPA is administered in a single bolus. In some embodiments, the dose of MPA is divided into a plurality of individual doses totaling between about 500mg to about 1500mg per day.

[0189] In some embodiments, an analog or derivative of MTX or MPA may be substituted for MTX or MPA. Derivatives of MTX are described in United States Patent No. 5,958,928 and in PCT Publication No. WO / 2007 / 098089, the disclosures of which are hereby incorporated by reference herein in their entireties. In some embodiments, an alternative agent may be used in place of either MTX or MPA, including, but not limited to ribavarin (IMPDH inhibitor); VX-497 (IMPDH inhibitor) (see Jain J, VX-497: a novel, selective IMPDH inhibitor and immunosuppressive agent, J Pharm Sci. 2001 May;90(5) :625-37); lometrexol (DDATHF, LY249543) (GAR and / or AICAR inhibitor); thiopheneanalog (LY254155) (GAR and / or AICAR inhibitor), furan analog (LY222306) (GAR and / or AICAR inhibitor) (see Habeck et al., A Novel Class of Monoglutamated Antifolates Exhibits Tight-binding Inhibition of Human Glycinamide Ribonucleotide Formyltransferase and Potent Activity against Solid Tumors, Cancer Research 54, 1021-2026, Feb. 1994); DACTHF (GAR and / or AICAR inhibitor) (see Cheng et. al. Design, synthesis, and biological evaluation of 10-methanesulfonyl-DDACTHF, 10- methanesulfonyl-5-DACTHF, and 10-methylthio-DDACTHF as potent inhibitors of GAR Tfase and the de novo purine biosynthetic pathway; Bioorg Med Chem. 2005 May 16; 13(10) :3577-85); AG2034 (GAR and / or AICAR inhibitor) (see Boritzki et. al. AG2034: a novel inhibitor of glycinamide ribonucleotide formyltransferase, Invest New Drugs. 1996;14(3) :295-303); LY309887 (GAR and / or AICAR inhibitor) ((2S)-2-[[5-[2-[(6R)-2-amino-4-oxo-5,6,7,8-tetrahydro-lH-pyrido[2,3- d]pyrimidin-6-yl]ethyl]thiophene-2-carbonyl]amino]pentanedioic acid); alimta (LY231514) (GAR and / or AICAR inhibitor) (see Shih et. al. LY231514, a pyrrolo[2,3-d]pyrimidine-based antifolate that inhibits multiple folate-requiring enzymes, Cancer Res. 1997 Mar 15;57(6) : 1116-23); dmAMT (GAR and / or AICAR inhibitor), AG2009 (GAR and / or AICAR inhibitor); forodesine (Immucillin H, BCX-1777; trade names Mundesine and Fodosine) (inhibitor of purine nucleoside phosphorylase [PNP]) (see Kicska et. al., Immucillin H, a powerful transition-state analog inhibitor of purine nucleoside phosphorylase, selectively inhibits human T lymphocytes, PNAS April 10, 2001. 98 (8) 4593-4598); and immucillin-G (inhibitor of purine nucleoside phosphorylase [PNP]).6. Combination Therapy

[0190] In another aspect of the present disclosure is a combination therapy whereby antibacterial, antifungal, and / or antiviral active pharmaceutical ingredients (depending, of course, upon the particular infection presented) are administered prior to, during, or following the administration or transplantation of transduced HSCs (described above) into a patient in need of treatment thereof, e.g. to treat Wiskott-Aldrich Syndrome. In some embodiments, patients with Wiskott-Aldrich Syndrome and having severe thrombocytopenia may be treated with high dose intravenous immunoglobulin (2 gm / kg / day) and / or corticosteroids (2 mg / kg / day) prior to, during, or following the administration or transplantation of transduced HSCs (described above) into a patient in need of treatment thereof. Alternatively, an allogenic transplantation of stem cells from healthy donors may be administered before or after treatment with the expression vectors or transduced stem cells of the present disclosure

[0191] In order that the invention may be readily understood and put into practical effect, particular preferred embodiments will now be described by way of the following non-limiting examples.EXAMPLESEXAMPLE 1IDENTIFICATION OF CRYPTIC SPLICE SITES IN WAS LVV

[0192] A lentiviral vector containing l / IZAS cDNA was assessed for cryptic splice sites. This lentiviral vector is the plasmid pBRNGTR47_pTL20c_SK734rev_MND_WAS_650 (or pBRNGTR47) having a sequence set forth in SEQ ID NO:74. As can be seen from Figure 2, pBRNGTR47 contains a first expression cassette in the forward orientation containing WAS cDNA under the control of a MND promoter. Downstream of the WAS cDNA is a Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) followed by a HS4-650 insulator (in the reverse orientation) and β-globin polyA signal. A second expression cassette, which is upstream of the first expression construct and in the reverse orientation, includes nucleic acid encoding shRNA 734 under the control of a 7sk promoter. Lentiviral DNA (including the viral genes and LTR elements) are under the control of a 7tetO promoter / operator (see Figure 2). The positions and orientation of each of these elements within vector is provided in Table 5 below.Table 5

[0193] Using bioinformatic splice site prediction analysis (netgene2), three cryptic splice acceptor sites were previously identified, denoted as SA1, SA2 and SA3, as described in co-pending PCT / US2022 / 026409, the disclosure of which is incorporated herein by reference in its entirety. These three sites were considered prone to the induction of aberrant transcripts. Bioinformatic splice site prediction analysis (netgene2) of pBRNGTR47_pTL20c_SK734rev_MND_WAS_650 (or pBRNGTR47) did not predict the presence of any additional splice acceptor sites. Of note, as the HS4- 650 insulator is in the reverse orientation in PBRNGTR47, the splice acceptor sites are in the reverse complement sequence of the HS4-650 insulator.EXAMPLE 2GENERATION OF VECTORS WITH INACTIVATED SPLICE ACCEPTOR SITES

[0194] A series of modified vectors was generated to inactivate previously identified splice acceptor sites SA1, SA2 and / or SA3 (see PCT / US2022 / 026409, the disclosure of which is incorporated herein by reference in its entirety). The vectors contain a single nucleotide (A to T) mutation in the acceptor site(s). Following correction of three previously identified splice acceptor sites (SA1, SA2 and / or SA3), evaluation of the resultant modified vectors led to the subsequent identification of two additional, previously unrecognized splice acceptor sites, designated herein as SA4 and SA5 (see Table 2 hereinbefore). Methods and analyses leading to identification of SA4 and SA5 are outlined below (refer to Examples 3 and 4).

[0195] Table 6 summarizes the vectors produced. Some vectors lack the second expression cassette (i.e. the p7sk-shRNA 734 expression cassette). All vectors include WPRE downstream of the WAS cDNA, although the sequence varies, with the WPRE in pBRNGTR47 including 7 mutations (WPRE mut7) when compared to the wild-type sequence, and the newly-generated vectors utilizing a WPRE with 6 mutations (mut6) when compared to the wild-type sequence (also referred to in literature as WPRE mut6). All newly-generated vectors also include an additional 2 bp in the U3 sequence upstream of the insulator. This had been deleted in pBRNGTR47 but is reintroduced in PBRNGTR83, pBRNGTR234, pBRNGTR235, pBRNGTR319 and pBRNGTR318).Table 6EXAMPLE 3ASSESSMENT OF ABERRANT SPLICING WITH HMGA2 FUSION TRANSCRIPT ASSAY

[0196] An HDR-based gene editing assay was utilized to directly assess LV vector fusion transcripts within the HMG2A locus following integration within intron 3 of the HMGA2 gene. This approach was utilized as LV integration in this intron has led to the generation of LV vector fusion transcripts and clonal outgrowth in LV trials (De Ravin et al., 2016, Science Translational Medicine, Vol. 8, pp. 335ra57).

[0197] In brief, sgRNAs targeting multiple sites within HMGA2 intron 3 were designed that exhibited high efficiency cutting in cell lines (NHEJ rates 70-90%). A series of AAV homology directed repair (HDR) donors with 0.6 kb homology arms were designed and produced. Each donor contained homology arms flanking sequences derived from the LVV LTR containing insulator elements, including modified insulators. The AAV donors were designed to be used for co-delivery with sgRNA.

[0198] Following generation of recombinant AAV vector stocks, AAV donors and sgRNAs (delivered as RNPs) were introduced into a KG-1 cell line or into primary human CD34+ cells via nucleofection. In addition to the LTR / insulator donor constructs, a positive control AAV HDR donor was generated containing the same homology arms designed to introduce a MND.GFP. polyadenylation cassette. This control provides a rapid means to easily access targeted integration rates by flow cytometry. Using this control construct, HDR rates of ~40% were observed in KG-1 cells. Following co-delivery of RNPs and AAV LTR donors, HDR rates and fusion transcripts were measured in genomic DNA and RNA isolated from edited cells at >1 week post editing.EXAMPLE 4RNA-SEQ METHODS WITH ENRICHMENT FOR ASSESSMENT OF ABERRANT SPLICING

[0199] Sequencing of total RNA in a sample (RNA-Seq) is a useful next-generation sequencing technique for directly assessing signals of gene expression in a sample. However, RNA-Seq samples are often highly complex, and typically require deep sequencing to fully resolve the signal of relatively rare transcripts of interest. RNA-Seq hybridization capture kits may be used to enrich targets from acomplex sample prior to RNA-Seq. To this end, custom RNA baits were designed targeting HMGA2 to enrich for HMGA2 mRNA transcripts.

[0200] It is recognized that HMGA2 has at least five known transcript variants, each leading to expression of a different protein isoform. Common to all isoforms are exons 1, 2 and 3. An HMGA2 target enrichment kit was designed with baits targeting HMGA2 exons 1, 2 and 3. Baits for three housekeeping genes (B2M, PPIA, GAPDH) were designed as controls for normalization. The protocol described in PCT / US2022 / 026409 was used for enrichment of mRNAs containing HMGA2 exons from complex RNA Seq samples, enabling aberrant splice events to be assessed through the sequencing and quantification of the abundance of downstream HMGA2 exons compared with downstream lentiviral sequence.

[0201] As shown Table 7 and Figure 3, correction (inactivation) of the cryptic splice acceptors sites SA4 and SA5 in an exemplary vector in which sites SA1, SA2 and SA3 were also corrected (pBRNGTR319) resulted in a 65-fold reduction in overall HMGA2 fusion transcripts compared to a control vector comprising the unmodified insulator in KG-1 cells.Table 7: HMGA2 fusion transcripts % HMGA2 exon3-LV junctions vs % HMGA2 exon3-exon4 junctions

[0202] Additionally, when complete sequencing reads were mapped to the LVV sequences, as detailed in Figure 4 and Table 8, a similarly significant reduction in aberrant splicing and resultant fusion transcripts was observed. Note, complete sequencing reads were compared to a control vector and normalized to HK genes and editing rates.Table 8: HMGA2 fusion transcripts % HMGA2 exon3-LV junctions vs % HMGA2 exon3-exon4 junctions

[0203] Correction (inactivation) of the cryptic splice acceptors sites SA4 and SA5 in an exemplary vector in which sites SA1, SA2 and SA3 were also corrected (pBRNGTR319), resulted in a greater than 10-fold reduction in the percentage of unwanted transcripts (exon-LVV splice junctions) compared to a vector in which only SA1, SA2 and SA3 had been corrected (pBRNGTR119) and a nearly 20-fold reduction in unwanted transcripts compared to a control vector comprising the unmodified insulator in KG-1 cells (see Figure 3A). In samples with integrated constructs derived from the pBRNGTR319 vector, HMGA2 exon 3 to exon 4 (transcript variant 1) splicing levels were similar to those observed in untreated cells (Figure 3B).

[0204] Exemplary WAS LVs were also analysed using a global fusion transcript assay, comprising a similar enrichment and sequencing protocol.

[0205] A lentiviral target enrichment kit was designed with custom baits targeting the entire lentiviral sequence. The protocol described in PCT / US2022 / 026409 was used for enrichment and sequencing of mRNAs containing LV sequence from complex RNA Seq samples, enabling aberrant splice events to be assessed throughout the entire lentiviral sequence. Chimeric reads mapping to both the LV sequence and a sequence on a human autosome were extracted, followed by filtering out reads with junctions defined as canonical splice junctions (presence of the intronic GU and AG motifs), followed by mapping of the splice junctions between LV sequence and human genome onto the LVV provirus sequence (masking the first LTR). The mapped junction positions were divided into splice donors and splice acceptors, summed up and normalized to the library size. For better visualization, splice junction positions are shown only for the LTR region (Figure 5).

[0206] As shown in Figure 5A an LV construct comprising an unmodified HS4-650 insulator "650Rev" exhibited splicing at splice acceptor site at SA2 (arrow) in a global fusion transcript assay. Correction (inactivation) of the cryptic splice acceptors sites at SA1, SA2 and SA3 (as described in Example 1) in an exemplary vector "3xSA" (Figure 5B) reduced splicing activity at SA1, SA2 and SA3 when compared with the unmodified HS4-650 insulator (650Rev). Upon correction of SA1, SA2 and SA3 in the 3xSA exemplary vector, it was surprisingly observed that an additional splice acceptor site was activated (SA4) (as indicated by the arrow in Figure 5B). The correction (inactivation) of the cryptic splice acceptor site at SA4 in addition to SA1, SA2 and SA3 in exemplary LV construct "4xSA" (Figure 5C) reduced splice activity but surprisingly resulted in activation of an additional splice acceptor site (SA5) (as indicated by the arrow in Figure 5C). The correction (inactivation) of the cryptic splice acceptor sites at SA4 and SA5 in addition to SA1, SA2 and SA3, in exemplary LV construct "5xSA" (Figure 5D) resulted in a further reduction in splice activity with no further splice acceptor sites being identified. Another exemplary LV constructs comprising an HS4-650 insulator with corrected (inactivated) splice acceptor sites at SA2, SA3, SA4 and SA5 "4xSAalt" (Figure 5F) exhibited a reduction in splice activity with no further splice acceptor sites identified. Another exemplary LV construct comprising an unmodified HS4-650 insulator in a forward orientation ("650fwd") (Figure 5E) exhibited a reduction in splice activity compared to the reverse orientation ("650Rev"), but splice acceptor SA2 was detected in the other orientation. The global fusion transcripts assay also includes a control vector comprising no insulator (Figure 5G). Analysis of cryptic splice donor sites was also conducted using a global fusion transcripts assay. Analysis of splice donor sites in the "650fwd" construct identified a strong SD in the insulator (Figure 5H). No splicedonor sites were identified in the remaining exemplary insulator sequences (650rev, 3xSA, 4xSA, 4xSAalt or 5xSA).EXAMPLE 5ASSESSMENT OF INSULATOR ACTIVITY

[0207] A LIM domain only two (LMO2) activation assay was used to assess activity and verify the function of modified insulators. Similar assays have been described previously (see, e.g. Ryu et al., 2008, Blood, Vol. Ill, pp. 1866 and Goodman et al. 2018, Journal of Virology, Vol. 92 pp. e01639-17.

[0208] In brief, Jurkat cell lines having a targeted integration site within the promoter or the first intron of the LMO2 gene were used to assess vector constructs (Ryu et al., 2008; Zhou et al., 2010). Where a modified insulator sequence retains its insulator enhancer-blocking function, a LMO2 expression similar to that of the unmodified insulator sequence is observed, corresponding to a clear reduction in LMO2 expression compared to an uninsulated provirus. Where insulator function is reduced or disrupted by modification of the insulator sequence, a LMO2 expression higher than that of the unmodified insulator sequence is observed.

[0209] RT-qPCR was used as a measurement for LMO2 expression and thus enhancer blocking activity of exemplary insulators. LVV provirus constructs with an MND promoter driving an mScarlet- I reporter transgene and harboring different insulator sequences in the LTRs were used. As shown in Figure 6, exemplary constructs comprising modification (inactivation) of five splice acceptor sites SA4, SA5, SA1, SA2 and SA3 ("5xSA"; pBRNGTR319) and 4 splice acceptor sites SA4, SA5, SA2 and SA3 ("4xSAalt"; pBRNGTR318) retained effective insulator activity and prevented transactivation of adjacent loci, comparable to that observed for a construct comprising modifications (inactivation) of only three splice acceptor sites SA1, SA2 and SA3 ("3xSA"; pBRNGTR119) and the unmodified insulator.EXAMPLE 6TRANSDUCTION AND WASP EXPRESSION

[0210] WAS expression from exemplary lentiviral vector constructs were assessed in cells deficient for WASp expression, as described previously in PCT / US2022 / 026409, using U937 (human) cells (Figure 8A) and WAS KO murine Linnegcells (Figure 7A). Cells were transduced with lentiviral vectors harboring either an unmodified HS4 650 insulator, an insulator with splice acceptor sites SA4, SA5, SA1, SA2 and SA3 inactivated (pBRNGTR319) or an insulator with splice acceptor sites SA1, SA2 and SA3 inactivated (pBRNGTR119).

[0211] WAS protein expression was analyzed 7 days post transduction for WAS KO murine Linnegcells and at 21 days post transduction. The cells were transduced at a multiplicity of infection (MOI) of 1 and 10 (as indicated in Figure 7). Briefly, cells were harvested and permeablized to allowfor the staining of WAS protein intracellularly. WAS protein was stained with Alexa-Fluor 647 labelled WAS antibody (5A5, BD Biosciences, labelled in-house). Untransduced WAS KO cells and WT cells were used as negative and positive controls respectively. WAS expression in liquid culture was expressed as Median Fluorescent Intensity (MFI) and % WASp+ cells (Figure 7B and Figure 7C, respectively) in murine LinnegWAS KO cells. Figure 7D demonstrates a dose dependent increase in vector copy integrations (VCN) in liquid culture for murine LinnegWAS KO cells transduced at MOI of 1 and 10 (as indicated) with selected lentiviral vectors. In Figure 7E and Figure 7F, WASp transgene expression in colony forming units (CFU) is shown as MFI (E) and % (F) (y-axes) in murine LinnegWAS KO cells transduced at a multiplicity of infection (MOI) of 1 and 10 (as indicated) with selected lentiviral vectors.

[0212] WAS protein expression was analyzed 7 days post transduction for WAS KO U937 cells (Figure 8A). WAS transgene expression shown as MFI and % (y-axes, B and C, respectively) in U937 WAS KO cells transduced at a multiplicity of infection (MOI) of 0.5, 1 and 10 (as indicated) with selected lentiviral vectors. A dose dependent increase in vector copy integrations (VCN) was observed in U937 WAS KO cells transduced at MOI of 0.5, 1 and 10 (as indicated) with selected lentiviral vectors. Represents mean data from two independent experiments.

[0213] In U937 cells, for each insulator tested, WAS protein expression exceeded the WT control (Figure 8B). In Linnegcells, for each insulator tested WAS protein expression was comparable to the WT control (Figure 8B). This demonstrates that modification of the insulator to address aberrant splicing did not reduce or hinder transgene expression.EXAMPLE 7IN VIVO TOXICITY STUDY

[0214] A blinded study in a mouse model of human Wiskott-Aldrich Syndrome (mWAS mice, harbouring a knock-out of the WASP gene) was performed to assess the safety and preliminary efficacy of a representative WAS lentiviral vector ("WAS LV") comprising a modified HS4650 insulator with SA4, SA5, SA1, SA2 and SA3 inactivated. The study comprised three treatment groups : Linnegbone marrow cells transduced with a representative WAS LV ("WAS LV"); Linnegbone marrow cells (i.e. cells deficient in WAS expression; ""KO Mock", as a negative control); and wild-type cells (i.e. cells positive for WAS expression; "WT Mock", as a positive control). WAS LV were prepared using methods described in WO2016183260 entitled "Bio-Production of Lentiviral Vectors" and WO / 2023 / 187691 entitled "Methods of purifying an enveloped virus", the disclosures of which are incorporated herein by reference.

[0215] Briefly, and referring to Figure 9, CD34+ Linnegdonor HSCs were isolated, purified and transduced with WAS LV in the presence of Poloxamer F127 + Protamine Sulfate as transduction enhancer (Transductions conditions: cell density of 4 x 105cells / ml; 8.26 x 108transduction units / mL; and 4.5% v / v MOI: 9.3). Linnegbone marrow cells under mock conditions without LV, and wild-type cells under mock conditions without LV, were also prepared. mWAS mice were irradiated (2x) in preparation for transplantation of transduced donor HSCs. Cells were washed and resuspended in PBS.

[0216] A portion of the cells were also cultured for 6 days before flow cytometry and vector count assessment was performed. As expected, no LV was detected in either of the control groups, and an average of 2.08 VCN was detected in the WAS LV group. The percentage of WASp positive cells in each treatment group is shown in Table 9.Table 9 : WASp+ cells post-transduction

[0217] 2 x 105cells were transferred into mice, and the engrafted cells were assessed at two time points by flow cytometry analysis. At 10 weeks post transplantation, cells in the peripheral blood was assessed. At 16-18 weeks post transplantation, mice were euthanised and cells from the bone marrow and spleen were isolated. Flow cytometry was performed to assess engrafted levels by CD45.2+ staining (which identified donor cells, compared to CD45.1+ phenotype of host / recipient cells), and further to assess the percentage of donor (CD45.2+) B cells, T cells, neutrophils and monocytes that were WASp+.

[0218] The results indicated that animals were well engrafted (data not shown). As shown in Tables 10 and 11, group B had negligible levels of WASp+ cells. Group A exhibited very high percentages of WASp+ cells. Group C exhibited robust percentages of WASp+ cells but lower than Group A. These results indicated that there was a statistically significant functional defect in WAS KO cells. Data suggests this defect could be rescued in animals that received LV-WAS treated cells.

[0219] Importantly, all mice survived until the endpoint and there was no evidence of T cell lymphoma, leukaemia or any other adverse events. This indicated that the defective WASp expression could be rescued without causing adverse events, including adverse events associated with vector-induced aberrant splicing.Table 10 : WASp+ donor cells in the bone marrowTable 11 : WASp+ donor cells in the spleenSequences disclosed hereinUnmodified HS4-650 insulator (SEO ID NO : 1)Reverse complement (r-c) of unmodified HS4-650 insulator (SEO ID NO:2)Modified HS4-650 insulator (r-c) - A to T mutation at SA4 (mutation in bold and underlined) (SEO ID NO :3)Modified HS4-650 insulator (r-c) - A to T mutation at SA5 (mutation in bold and underlined) (SEO ID NO : 4)Modified HS4-650 insulator (r-c) - A to T mutation at SA2, SA3 and SA4 (mutation in bold and underlined) (SEO ID NO: 5)Modified HS4-650 insulator (r-c) - A to T mutation at SA1, SA2, SA3 and SA4 (mutation in bold and underlined) (SEO ID NO:6)Modified HS4-650 insulator (r-c) - A to T mutation at SA1, SA2, SA3, SA4 and SA5 (mutation in bold and underlined) (SEO ID NO :7)Modified HS4-650 insulator (r-c) - A to T mutation at SA2, SA3. SA4, SA5 (mutation in bold and underlined) (SEO ID NO:8)Unmodified HS4-650 insulator (Genbank Acc. No. JN0000O1) (SEO ID NO:9)Reverse complement (r-c) unmodified HS4-650 insulator (Genbank Acc. No. JN0000O1) (SEO ID NO: 10)Modified HS4-650 insulator (Genbank Acc. No. JN000001) (r-c) - A to T mutation at SA4 (mutation in bold and underlined) (SEO ID NO: 11)Modified HS4-650 insulator (Genbank Acc. No. JN0000O1) (r-c) - A to T mutation at SA5 (mutation in bold and underlined) (SEO ID NO: 12)Modified HS4-650 insulator (Genbank Acc. No. JN0000O1) (r-c) - A to T mutation at SA2, SA3 and SA4 (mutation in bold and underlined) (SEO ID NO : 13)Modified HS4-650 insulator (Genbank Acc. No. JN0000O1) (r-c) - A to T mutation at SA1, SA2, SA3 and SA4 (mutation in bold and underlined) (SEO ID NO: 14)Modified HS4-650 insulator (Genbank Acc. No. JN0000O1) (r-c) - A to T mutation at SA1, SA2,SA3, SA4 and SA5 (mutation in bold and underlined) (SEO ID NO: 15)Modified HS4-650 insulator (Genbank Acc. No. JN0000O1) (r-c) - A to T mutation at SA2, SA3. SA4 and SA5 (mutation in bold and underlined) (SEO ID NO: 16)Unmodified HS4-650 insulator (US2016003218) (SEO ID NO: 17)Reverse complement of unmodified HS4-650 insulator (US2016003218) (SEO ID NO: 18)Modified HS4-650 insulator (US2016003218) (r-c) - A to T mutation at SA4 (mutation in bold and underlined) (SEO ID NO: 19)Modified HS4-650 insulator (US2016003218) (r-c) - A to T mutation at SA5 (mutation in bold and underlined) (SEO ID NO:2Q)Modified HS4-650 insulator (US2016003218) (r-c) - A to T mutation at SA2, SA3 and SA4 (mutation in bold and underlined) (SEO ID NO:21)Modified HS4-650 insulator (US2016003218) (r-c) - A to T mutation at SA1, SA2, SA3 and SA4 (mutation in bold and underlined) (SEO ID NO:22)Modified HS4-650 insulator (US2016003218) (r-c) - A to T mutation at SA1, SA2, SA3, SA4 andSA5 (mutation in bold and underlined) (SEO ID NO :23)Modified HS4-650 insulator (US2016003218) (r-c) - A to T mutation at SA2, SA3. SA4 and SA5 (mutation in bold and underlined) (SEO ID NO:24)Unmodified HS4-650 insulator (Genbank Acc. No. MN044710.1) (SEO ID NO:25)Reverse complement of unmodified HS4-650 insulator (Genbank Acc. No. MN044710.1) (SEO ID NO:26)Modified HS4-650 insulator (Genbank Acc. No. MN044710.1) (r-c) - A to T mutation at SA4 (mutation in bold and underlined) (SEO ID NO:27)Modified HS4-650 insulator (Genbank Acc. No. MN044710.1) (r-c) - A to T mutation at SA5 (mutation in bold and underlined) (SEO ID NO:28)Modified HS4-650 insulator (Genbank Acc. No. MN044710.1) (r-c) - A to T mutation at SA2, SA3 and SA4 (mutation in bold and underlined) (SEO ID NO:29)Modified HS4-650 insulator (Genbank Acc. No. MN044710.1) (r-c) - A to T mutation at SA1, SA2, SA3 and SA4 (mutation in bold and underlined) (SEO ID NO:3Q)Modified HS4-650 insulator (Genbank Acc. No. MN044710.1) (r-c) - A to T mutation at SA1, SA2, SA3. SA4 and SA5 (mutation in bold and underlined) (SEO ID NO:31)Modified HS4-650 insulator (Genbank Acc. No. MN044710.1I (r-cl - A to T mutation at SA2, SA3.SA4 and SA5 (mutation in bold and underlined) (SEO ID NO:32IUnmodified HS4-650 insulator (Genbank Acc. No. MN044709I (SEO ID NO :33IReverse complement of unmodified HS4-650 insulator (Genbank Acc. No. MN044709) (SEO ID NO:34)Modified HS4-650 insulator (Genbank Acc. No. MN044709) (r-c) - A to T mutation at SA4 (mutation in bold and underlined) (SEO ID NO:35)Modified HS4-650 insulator (Genbank Acc. No. MN044709) (r-c) - A to T mutation at SA5 (mutation in bold and underlined) (SEO ID NO:36)Modified HS4-650 insulator (Genbank Acc. No. MN044709) (r-c) - A to T mutation at SA2, SA3 and SA4 (mutation in bold and underlined) (SEO ID NO :37)Modified HS4-650 insulator (Genbank Acc. No. MN044709) (r-c) - A to T mutation at SA1, SA2,SA3 and SA4 (mutation in bold and underlined) (SEO ID NO:38)Modified HS4-650 insulator (Genbank Acc. No. MN044709) (r-c) - A to T mutation at SA1, SA2,SA3, SA4 and SA5 (mutation in bold and underlined) (SEO ID NO:39)Modified HS4-650 insulator (Genbank Acc. No. MN044709) (r-c) - A to T mutation at SA2, SA3.SA4 and SA5 (mutation in bold and underlined) (SEO ID NO:4Q)Unmodified HS4-650 insulator (Genbank Acc. No. KF569217) (SEO ID NO:41)Reverse complement of unmodified HS4-650 insulator (Genbank Acc. No. KF569217) (SEO ID NO:42)Modified HS4-650 insulator (Genbank Acc. No. KF569217I (r-cl - A to T mutation at SA4 (mutation in bold and underlined! (SEO ID NO:43IModified HS4-650 insulator (Genbank Acc. No. KF569217) (r-c) - A to T mutation at SA5 (mutation in bold and underlined) (SEO ID NO:44)GModified HS4-650 insulator (Genbank Acc. No. KF569217) (r-c) - A to T mutation at SA2, SA3 and SA4 (mutation in bold and underlined) (SEO ID NO :45)Modified HS4-650 insulator (Genbank Acc. No. KF569217) (r-c) - A to T mutation at SA1, SA2, SA3 and SA4 (mutation in bold and underlined) (SEO ID NO:46)Modified HS4-650 insulator (Genbank Acc. No. KF569217) (r-c) - A to T mutation at SA1, SA2,SA3, SA4 and SA5 (mutation in bold and underlined) (SEO ID NO:47)Modified HS4-650 insulator (Genbank Acc. No. KF569217) (r-c) - A to T mutation at SA2, SA3. SA4 and SA5 (mutation in bold and underlined) (SEO ID NO:48)GSA4 sequence (SEO ID NO:49)SA5 sequence (SEO ID NQ:50)SA1 sequence (SEO ID NO:51)SA2 sequence (SEO ID NO:52)SA3 sequence (SEO ID NO:53)Inactivated SA4 sequence (SEO ID NO : 54)Inactivated SA5 sequence (SEO ID NO :55)Inactivated SA1 sequence (SEO ID NO : 56)Inactivated SA2 sequence (SEO ID NO : 57)Inactivated SA3 sequence (SEO ID NO : 58)WASP (SEO ID NO : 59)WASWT cDNA (wild-type ORF) (SEO ID NQ :60)WASWT cDNA (Genbank accession no. AB590224.1) (SEO ID NO:61)WASWT cDNA - codon optimized (SEO ID NO:62)WPRE mut6 (SEO ID NO :63)WPRE mut7 (SEO ID NO :64)MND promoter (SEO ID NO:65)Sh734 (SEO ID NO:66)sh734 with multi-t termination sequence (SEO ID NO:67)shRNA734 single t termination sequence (SEO ID NO:68)7SK RNA promoter (SEO ID NO:69)7SK RNA promoter (SEO ID NQ :70)7SK RNA promoter (SEO ID NO:71)7tet operator (SEO ID NO: 72)β-globin polv(A) signal (SEO ID NO:73)pBRNGTR47 pTL20c SK734rev MND WAS 650 (SEO ID N0 :74)pBRNGTR83 pTL20c MND WAS 650 (SEO ID NO:75)pBRNGTR234 pTL20c MND WAS 650 3xSA(234)mut (SEO ID NO:76)pBRNGTR235 pTL20c MND WAS 650 4xSA(1234)mut (SEO ID N0 :77)tpBRNGTR319 pTL20C MND WAS 650 5xSA(12345)mut (SEO ID N0 :78)pBRNGTR318 pTL20c MND WAS 650 4xSA(2345)mut (SEO ID NO :79)pBRNGTR119 pTL20c MND WAS 650 3xSA(123)mut (SEO ID NQ :80)Modified HS4-650 insulator (r-c) - A to T mutation at SA1, SA2 and SA3 (mutation in bold and underlined) (SEO ID NO:81)

[0220] The disclosure of every patent, patent application, and publication cited herein is hereby incorporated herein by reference in its entirety.

[0221] The citation of any reference herein should not be construed as an admission that such reference is available as "Prior Art" to the instant application.

[0222] Throughout the specification the aim has been to describe the preferred embodiments of the invention without limiting the invention to any one embodiment or specific collection of features. Those of skill in the art will therefore appreciate that, in light of the instant disclosure, various modifications and changes can be made in the particular embodiments exemplified without departing from the scope of the present invention. All such modifications and changes are intended to be included within the scope of the appended claims.

Claims

WHAT IS CLAIMED IS:

1. A nucleic acid construct comprising a modified HS4 insulator or a fragment thereof, wherein the modified HS4 insulator comprises an inactivated splice acceptor site (SA4) relative to an unmodified HS4-650 insulator, wherein:SA4 is present in an unmodified HS4-650 insulator at nucleotide positions 352-353 with numbering relative to SEQ ID NO:2, wherein SEQ ID NO:2 is the reverse, complement sequence of the unmodified HS4-650 insulator set forth in SEQ ID NO: 1; and / orSA4 comprises the sequence ATCTCTCCAG^GCAAGCTCTT (SEQ ID NO: 49), where ^ represents the splice position.

2. The nucleic acid construct of claim 1, wherein the modified HS4 insulator comprises, relative to an unmodified HS4-650 insulator, a mutation that inactivates SA4.

3. The nucleic acid construct of claim 2, wherein the mutation is an A to T mutation at position 351, with numbering relative to SEQ ID NO:2.

4. The nucleic acid construct of any one of claims 1 to 3, wherein the modified HS4 insulator is a HS4-650 insulator.

5. The nucleic acid construct of any one of claims 1 to 4, wherein the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs:3, 11, 19, 27, 35 and 43.

6. A nucleic acid construct comprising a modified HS4 insulator, wherein the modified HS4 insulator comprises an inactivated splice acceptor site (SA5) relative to an unmodified HS4- 650 insulator, wherein:SA5 is present in an unmodified HS4-650 insulator at nucleotide positions 311-312 with numbering relative to SEQ ID NO:2, wherein SEQ ID NO:2 is the reverse, complement sequence of the unmodified HS4-650 insulator set forth in SEQ ID NO: 1; and / orSA5 comprises the sequence AATTCTCCAG^CTGCCTGTCC (SEQ ID NO: 50), where ^ represents the splice position.

7. The nucleic acid construct of claim 6, wherein the modified HS4 insulator comprises, relative to an unmodified HS4-650 insulator, a mutation that inactivates SA5.

8. The nucleic acid construct of claim 7, wherein the mutation is an A to T mutation at position 310, with numbering relative to SEQ ID NO:2.

9. The nucleic acid construct of any one of claims 6 to 8, wherein the modified HS4 insulator is a HS4-650 insulator.

10. The nucleic acid construct of any one of claims 6 to 9, wherein the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs:4, 12, 20, 28, 36 and 44.

11. The nucleic acid construct of any one of claims 1 to 8, wherein the modified HS4 insulator further comprises one or more additional inactivated splice acceptor sites relative to an unmodified HS4-650 insulator.

12. The nucleic acid construct of claim 11, wherein the one or more additional inactivated splice acceptor sites are selected from:(i) an inactivated splice acceptor site (SA1) present in an unmodified HS4-650 insulator at nucleotide positions 385-386 with numbering relative to SEQ ID NO:2, and / or comprising the sequence TTGCATCCAG^ACACCATCAA (SEQ ID NO:51), optionally wherein SA1 is inactivated via an A to T mutation at position 384;(ii) an inactivated splice acceptor site (SA2) present in an unmodified HS4-650 insulator at nucleotide positions 446-447 with numbering relative to SEQ ID NO:2, and / or comprising the sequence ATCCCCCCAG^GTGTCTGCAG (SEQ ID NO:52), optionally wherein SA2 is inactivated via an A to T mutation at position 445; and / or(iii) an inactivated splice acceptor site (SA2) present in an unmodified HS4-650 insulator at nucleotide positions 456-457 with numbering relative to SEQ ID NO:2, and / or comprising the sequence GTGTCTGCAG^GCTCAAAGAG (SEQ ID NO:53), optionally wherein SA3 is inactivated via an A to T mutation at position 455, where ^ represents the splice position.

13. The nucleic acid construct of any one of claims 1 to 5 or 11, wherein the modified HS4 insulator comprises inactivated splice acceptor sites SA4, SA2 and SA3.

14. The nucleic acid construct of claim 13, wherein the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs:5, 13, 21, 29, 37 and 45.

15. The nucleic acid construct of any one of claims 1 to 5 or 11, wherein the modified HS4 insulator comprises inactivated splice acceptor sites SA4, SA1, SA2 and SA3.

16. The nucleic acid construct of claim 15, wherein the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs:6, 14, 22, 30, 38 and 46.

17. The nucleic acid construct of any one of claims 1 to 11, wherein the modified HS4 insulator comprises inactivated splice acceptor sites SA4, SA5, SA1, SA2 and SA3.

18. The nucleic acid construct of claim 17, wherein the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs:7, 15, 23, 31, 39 and 47.

19. The nucleic acid construct of any one of claims 1 to 11, wherein the modified HS4 insulator comprises inactivated splice acceptor sites SA4, SA5, SA2 and SA3.

20. The nucleic acid construct of claim 19, wherein the modified HS4 insulator comprises the sequence set forth in any one of SEQ ID NOs:8, 16, 24, 32, 40 and 48.

21. The nucleic acid construct of any one of claims 1 to 20, further comprising a first promoter operably linked to a first polynucleotide, optionally wherein the first polynucleotide comprises a heterologous transgene.

22. The nucleic acid construct of claim 21, wherein the first polynucleotide encodes a Wiskott-Aldrich Syndrome protein.

23. The nucleic acid construct of claim 22, wherein the Wiskott-Aldrich Syndrome protein comprises an amino acid sequence set forth in SEQ ID NO:59 or a sequence having at least 95% sequence identity thereto.

24. The nucleic acid construct of claim 22 or 23, wherein the first polynucleotide comprises a sequence set forth in any one of SEQ ID NOs:60-62 or a sequence having at least 95% sequence identity thereto.

25. The nucleic acid construct of any one of claims 21 to 24, wherein the modified HS4 insulator is in the opposite orientation to the first polynucleotide.

26. The nucleic acid construct of claim 25, wherein the first polynucleotide is in the forward orientation and the modified HS4 insulator is in the reverse orientation within the nucleic acid construct.T7. The nucleic acid construct of any one of claims 21 to 24, wherein the modified HS4 insulator is in the same orientation as the first polynucleotide.

28. The nucleic acid construct of claim 27, wherein the first polynucleotide and the modified HS4 insulator are in the forward orientation within the nucleic acid construct.

29. The nucleic acid construct of any one of claims 21 to 28, wherein the modified HS4 insulator is downstream of the first polynucleotide.

30. The nucleic acid construct of any one of claims 21 to 29, further comprising a Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) between the first polynucleotide and the modified HS4 insulator.

31. The nucleic acid construct of claim 30, wherein the WPRE comprises the nucleic acid sequence set forth in any one of SEQ ID NO:63 or 64, or a sequence having at least 95% sequence identity thereto.

32. The nucleic acid construct of any one of claims 21 to 31, wherein the first promoter is an MND promoter.

33. The nucleic acid construct of claim 32, wherein the MND promoter comprises the nucleic acid sequence set forth in SEQ ID NO:65 or a sequence having at least 95% sequence identity thereto.

34. The nucleic acid construct of any one of claims 21 to 33, further comprising a second promoter operably linked to a second polynucleotide.

35. The nucleic acid construct of claim 34, wherein the second polynucleotide encodes a nucleic acid that inhibits HPRT expression.

36. The nucleic acid construct of claim 35, wherein the nucleic acid that inhibits HPRT expression is a shRNA, optionally comprising a hairpin loop sequence set forth in of SEQ ID NO:66.

37. The nucleic acid construct of claim 36, wherein the shRNA comprises a nucleic acid sequence set forth in SEQ ID NO: 67 or 68, or a sequence comprising at least 95% sequence identity thereto.

38. The nucleic acid construct of any one of claims 34 to 37, wherein the second promoter comprises a Pol III promoter or a Pol II promoter.

39. The nucleic acid construct of claim 38, wherein the wherein the Pol III promoter comprises 7sk, optionally comprising a nucleic acid sequence set forth in any one of SEQ ID NOs:69-71 or a sequence having at least 95% sequence identity thereto.

40. The nucleic acid construct of any one of claims 34 to 39, wherein the second promoter and the operably linked second polynucleotide are in the reverse orientation and upstream of the first promoter and the operably linked first polynucleotide.

41. The nucleic acid construct of any one of claims 21 to 40, further comprising a polyadenylation signal downstream of the first polynucleotide and the modified HS4 insulator.

42. The nucleic acid construct of any one of claims 1 to 41, wherein the nucleic acid construct comprises a sequence set forth as nucleotides 2396-4301 of any one of SEQ ID NOs:76-79, ora sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

43. The nucleic acid construct of any one of claims 1 to 42, wherein the nucleic acid construct is present in a vector.

44. The nucleic acid construct of claim 43, wherein the vector is a plasmid or a viral vector.

45. The nucleic acid construct of claim 44, wherein the vector is a retroviral vector.

46. The nucleic acid construct of claim 45, wherein the vector is a lentiviral vector.

47. A vector comprising a nucleic acid construct of any one of claims 1 to 42.

48. The vector of claim 47, wherein the vector is a viral vector.

49. The vector of claim 48, wherein the vector is a retroviral vector.

50. The vector of claim 49, wherein the vector is a lentiviral vector.

51. The vector of any one of claims 47 to 50, comprising a sequence set forth as nucleotides2396-4301 of any one of SEQ ID NOs:76-79, or a sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

52. A host cell comprising a nucleic acid construct of any one of claims 1 to 46.

53. A host cell comprising, or transduced with, a vector of any one of claims 47 to 50.

54. The host cell of claim 52 or 53, wherein the host cell is a hematopoietic stem cell.

55. The host cell of any one of claims 52 to 54, wherein the host cell is HPRT-deficient.

56. A method of treating a subject with Wiskott-Aldrich Syndrome, comprising administering to the subject a host cell of any one of claims 52 to 55, wherein the first polynucleotide encodes a Wiskott-Aldrich Syndrome.

57. The method of claim 56, further comprising administering a purine analog to the subject to increase engraftment of the host cell.

58. The method of claim 57, wherein the purine analog is selected from the group consisting of 6-thioguanine ("6TG"), 6-mercaptopurine ("6MP") or azathiopurine ("AZA").

59. The method of any one of claims 56 to 58, further comprising pre-conditioning the subject with a purine analog prior to administering the host cell.

60. Use of the host cell of any one of claims 52 to 55 in the preparation of a medicament for the treatment of Wiskott-Aldrich Syndrome.