Compositions and methods for modulating apoe

Abstract

Aspects of the disclosure relate to compositions and methods for modulating levels, transcription, splicing, and / or translation of one or more RNA transcripts (e.g., mRNA transcripts) in a cell or subject. The disclosure is based, in part, on isolated nucleic acids that bind to mRNA transcripts of genes involved in neurodegenerative diseases and disorders, for example an apolipoprotein E gene (APOE), which encodes a protein involved in lipid homeostasis and amyloid plaque formation in the CNS. In some embodiments, compositions of the disclosure are useful for treating neurodegenerative diseases or disorders, such as Alzheimer's disease (AD) or dementia with Lewy Bodies.

Description

[0001] COMPOSITIONS AND METHODS FOR MODULATING APOE

[0002] RELATED APPLICATIONS

[0003] The application claims the benefit under 35 U.S.C. 119(e) of U.S. Provisional Application number 63 / 508,831 filed on June 16, 2023, U.S. Provisional Application number 63 / 588,136 filed on October 5, 2023, and U.S. Provisional Application number 63 / 556,391 filed on February 21, 2024, each of which is herein incorporated by reference in its entirety.

[0004] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0005] The contents of the electronic sequence listing (L090770040WO00-SEQ-KZM.xml;

[0006] Size: 57,014 bytes; and Date of Creation: May 7, 2024) is herein incorporated by reference in its entirety.

[0007] BACKGROUND

[0008] Neurodegenerative disorders affect millions of people across the world each year. The accumulation of amyloid plaques and neurofibrillary tangles is associated with the development of neurodegenerative disease, such as Alzheimer’s and dementia with Lewy Bodies. Several mutations in a variety of proteins expressed in the brain appear important for the development of AD.

[0009] SUMMARY

[0010] Aspects of the disclosure relate to isolated nucleic acids that bind to mRNA transcripts of genes involved in certain diseases and disorders associated with amyloid plaque formation, for example a gene encoding apolipoprotein E (APOE). In some embodiments, compositions of the disclosure are useful for treating diseases or disorders associated with neurodegeneration (e.g., Alzheimer’s disease, dementia with Lewy Bodies, Parkinson’s disease and / or cognitive decline in Parkinson’s disease, vascular dementia, frontotemporal disorders associated with neurodegeneration, amyloid-related imaging abnormalities (ARIA), etc.). The disclosure is based, in part, on compositions and methods for modulating a level, transcription, splicing, and / or translation of one or more RNA transcripts (e.g., mRNA transcripts) in a cell or subject.

[0011] Accordingly, in some aspects, the disclosure provides an isolated nucleic acid that comprises a region of complementarity with a human APOE mRNA transcript, a nucleotide sequence that is at least 60% identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, 95-99%, or 100% identical) to any one of the nucleotide sequences set forth in SEQ ID NOs: 1-52, and upon binding to the mRNA transcript decreases a level, transcription, splicing, and / or translation of functional apolipoprotein E (ApoE) protein encoded by the mRNA transcript.

[0012] In some embodiments, the isolated nucleic acid comprises RNA. In some embodiments, the isolated nucleic acid is an antisense oligonucleotide (ASO).

[0013] In some embodiments, the isolated nucleic acid comprises or consists of between 10 and 40 nucleotides. In some embodiments, the isolated nucleic acid comprises or consists of between 18 and 25 nucleotides.

[0014] In some embodiments, the isolated nucleic acid comprises one or more chemical modifications. In some embodiments, the one or more chemical modifications comprise one or more nucleoside modifications and / or one or more sugar-phosphate backbone modifications. In some embodiments, the one or more nucleoside modifications comprises a 2'-O-methyl (2'- OMe) modification, a 2'-0-methoxyethyl (2'-O-MOE) modification, a 2'-fluoro modification, or a locked nucleic acid (LNA) modification. In some embodiments, the one or more sugarphosphate backbone modifications comprises a phosphorothioate backbone modification. In some embodiments, the isolated nucleic acid is fully chemically modified (e.g., contains a fully modified sugar-phosphate backbone, and all nucleotides of the isolated nucleic acid are chemically modified).

[0015] In some embodiments, the isolated nucleic acid comprises one or more deoxyribonucleotides. In some embodiments, the isolated nucleic acid is a gapmer.

[0016] In some embodiments, the region of complementarity is located in an untranslated region of the APOE mRNA transcript. In some embodiments, the untranslated region comprises a 5' UTR, intron, or 3' UTR of the APOE mRNA transcript.

[0017] In some embodiments, the region of complementarity is located in a protein coding region of the APOE mRNA transcript.

[0018] In some embodiments, the region of complementarity is located in an intron-exon boundary (e.g., the region of complementarity spans an intron exon boundary, such that the isolated nucleic acid hybridizes binds to both an intron and an exon at the same time) of the APOE mRNA transcript.

[0019] In some embodiments, the region of complementarity comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 continuous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOS: 53-57.

[0020] In some embodiments, the nucleotide sequence comprises the nucleic acid sequence set forth in any one of the nucleotide sequences set forth in Table 1. In some embodiments, the nucleotide sequence comprises the nucleic acid sequence set forth in any one of the nucleotide sequences set forth in Column A of Table 1. In some embodiments, the nucleotide sequence comprises one or more chemical modifications (e.g., a chemical modification pattern) set forth in Column C of Table 1. In some embodiments, the nucleotide sequence comprises a nucleic acid sequence set forth in any one of the nucleotide sequences set forth in Column A of Table 1 and one or more chemical modifications (e.g., a chemical modification pattern) set forth in Column C of Table 1. In some embodiments, the nucleic acid sequence from Column A and the one or more chemical modifications (e.g., a chemical modification pattern) in Column C are taken from the same row of Table 1.

[0021] In some aspects, the disclosure provides a method for decreasing a level, transcription, splicing, and / or translation of ApoE in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof.

[0022] In some aspects, the disclosure provides a method for reducing amyloid plaque formation in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof.

[0023] In some embodiments, the cell is a neuronal cell. In some embodiments, the neuronal cell is a presynaptic neuronal cell.

[0024] In some embodiments, the subject comprises one or more mutations in a gene that is associated with amyloid plaque formation. In some embodiments, the gene is APOE.

[0025] In some embodiments, the cell or subject is a human cell or subject.

[0026] In some embodiments, the subject has or is suspected of having neurodegenerative disease or disorder. In some embodiments the disease or disorder is Alzheimer’s disease. In some embodiments, the disease or disorder is dementia with Lewy Bodies.

[0027] In some embodiments, the administration is systemic administration. In some embodiments, the systemic administration comprises intravenous injection.

[0028] In some embodiments, the administration comprises direct administration to a target tissue of the subject. In some embodiments, the direct administration comprises direct injection to the central nervous system (CNS) of the subject. In some embodiments, the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject.

[0029] In some embodiments, the administration comprises placing the subject in a Trendelenburg position during the administration.

[0030] In some embodiments, the subject does not comprise a mutation in an APOE gene.

[0031] In some aspects, the disclosure provides a method for preventing or treating a neurodegenerative disease or disorder in a subject in need thereof, the method comprising administering to the subject an isolated nucleic acid as described herein.

[0032] In some embodiments, the subject is a human. In some embodiments, the neurodegenerative disease or disorder is Alzheimer’s disease. In some embodiments, the disease or disorder is dementia with Lewy Bodies. In some embodiments, the administration comprises direct administration to a target tissue of the subject. In some embodiments, the direct administration comprises direct injection to the central nervous system (CNS) of the subject. In some embodiments, the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject.

[0033] BRIEF DESCRIPTION OF DRAWINGS

[0034] FIG. 1 shows a schematic depicting modulation of RNA (e.g., mRNA, such as mature mRNA or pre-mRNA) levels, transcription, splicing, and / or translation by antisense oligonucleotides (ASOs). Composition “A” represents an ASO that binds to the 5’ untranslated region (5’ UTR) of an RNA. Composition “B” represents an ASO that binds to an intron of an RNA. Composition “C” represents an ASO that binds to a splice boundary (e.g., a splice junction) between an exon and intron of an RNA. Composition “D” represents an ASO that binds to an exon (e.g., protein coding region) of an RNA. Composition “E” represents a combination of an ASO binding to a 3' UTR of an RNA, alone or with a trans-regulator. Composition “F” represents a “gapmer” ASO that binds to an exon (e.g., protein coding region) of an RNA and mediates RNaseH decay. Composition “G” represents a “gapmer” ASO that binds to a 3' UTR of an RNA, alone or with a trans-regulator, and mediates RNaseH decay. In some embodiments, ASOs binding to an RNA result in translation of a truncated protein that has a dominant negative effect on the wild-type, full-length protein.

[0035] FIGs. 2A-2C shows representative in vitro data for ASOs targeting APOE RNA. FIG. 2A shows APOE mRNA levels in HepG2 cells at 48 hours after transfection with one of two different doses (5 nm or 20nm; light and dark shades, respectively) of APOE ASOs comprising either gapmer or skipper structures relative to mock- transfected controls (shown in black). Nontargeting ASOs or APOE siRNA were used as negative and positive controls, respectively. FIG. 2B shows coordinates of ASOs targeting APOE representing the change in APOE mRNA level elicited relative to mock control on a log2 scale upon transfection at 20nM and 5nM concentration on the X- and Y-axis as indicated. FIG. 2C shows APOE mRNA levels in HepG2 cells 48 hours after transfection for sixteen APOE ASOs pursued in multi-dose testing. For FIGs. 2A and 2C: bars indicate the mean expression in each condition; error bars indicate standard error; N=2 biological replicates.

[0036] FIGs. 3A-3C show representative in vitro data for dose-dependent knockdown of APOE RNA. FIG. 3A shows APOE mRNA levels in HepG2 cells at 48 hours after transfection with APOE ASOs (indicated in FIG. 2C) relative to mock-transfected control samples as a function of eight different doses and for non-targeting ASO negative control or APOE siRNA positive control, respectively. FIG. 3B shows data displayed in FIG. 3A indicating APOE mRNA expression patterns after transfection with the six ASOs shown. For FIGs. 3A-3B: skippers are shown in shaded bars labeled as “APOE ASOs” and indicated by the arrow labeled “Skipper”; gapmers are shown in all other shaded bars labeled as “APOE ASOs”; negative control shown in dark grey; and positive control shown in light grey. 0% knockdown and 50% knockdown are indicated by dashed lines (black and grey, respectively). FIG. 3C shows maximum inhibition (log2, Y-axis) plotted as a function of the observed EC50 (X-axis). The dot-plot indices the most potent ASOs. “SEQ ID NO: 5” comprises the nucleotide sequence of SEQ ID NO: 5, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 6 of Table 1. “SEQ ID NO: 11” comprises the nucleotide sequence of SEQ ID NO: 11, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 12 of Table 1. “SEQ ID NO: 16” comprises the nucleotide sequence of SEQ ID NO: 16, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 17 of Table 1. “SEQ ID NO: 22” comprises the nucleotide sequence of SEQ ID NO: 22, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 23 of Table 1. “SEQ ID NO: 29” comprises the nucleotide sequence of SEQ ID NO: 29, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 30 of Table 1. “SEQ ID NO: 50” comprises the nucleotide sequence of SEQ ID NO: 50, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 51 of Table 1.

[0037] FIGs. 4A-4B show representative data for in vivo reduction of APOE mRNA levels in mouse brain. FIG. 4A shows relative APOE mRNA levels in cortex tissues of mouse subjects two weeks after a single ICV injection of vehicle (artificial CSF) or APOE ASO 1 at a dose of lOOug or 200ug. FIG. 4B shows relative APOE mRNA levels in hippocampus tissues of mouse subjects two weeks after a single ICV injection of vehicle (artificial CSF) or APOE ASO 1 at a dose of lOOug or 200ug. “APOE ASO 1” comprises the nucleotide sequence of SEQ ID NO: 29, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 30 of Table 1. 0% knockdown and 50% knockdown are indicated by dashed lines (black and grey, respectively).

[0038] FIG. 5 shows a non-limiting example of an antisense oligonucleotide (ASO) design for targeting the 3' untranslated region (UTR) of an APOE mRNA transcript (e.g., one encoded by Ensembl ID NO: ENST00000252486).

[0039] FIGs. 6A-6J show representative immunostimulatory effects of APOE ASO on human peripheral blood mononuclear cells (huPBMCs) that were harvested from healthy donors. huPBMCs were either untreated (“mock” and “media”), treated with a cytokine / chemokine response control agent (XD-01024, XD00366 transfection, poly(l:c) transfection, CL097, R837, TL8-506, ODN2395 transfection, ODN2395 gymnotic, ODN2216 transfection, ODN2216 gymnotic, ODN2006 transfection, or ODN2006 gymnotic), or treated with ASO at a concentration of IpM, 3pM, or lOpM for 24 hours (indicated on x-axes). Cytokine / chemokine levels were then analyzed using the MSD-U-Plex platform (indicated by y-axes). “APOE ASO 1” comprises the nucleotide sequence of SEQ ID NO: 29, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 30 of Table 1. Plots show mean + / - standard error. Each dot represents an individual donor. N=4 donors (2 male and 2 female). FIG. 6A shows analyses of IFN-a2a levels. FIG. 6B shows analyses of IFN-b levels. FIG. 6C shows analyses of IL-1B levels. FIG. 6D shows analyses of IL-6 levels. FIG. 6E shows analyses of IL- 10 levels. FIG. 6F shows analyses of IP-10 levels. FIG. 6G shows analyses of MCP-1 levels. FIG. 6H shows analyses of MIP-la levels. FIG. 61 shows analyses of MIP-lb levels. FIG. 6J shows analyses of TNF-a levels.

[0040] FIG. 7 shows a non-limiting example of a study design wherein non-human primate subjects were administered a series of four intrathecal injections of either vehicle (artificial CSF) or ASO at a dose of 80 mg (20 mg + 20 mg + 20 mg + 20 mg). Each intrathecal injection was performed two weeks apart (days 0, 14, 28, and 42).

[0041] FIG. 8 shows ASO levels in dorsal root ganglion (DRG), hippocampus, lumbar spinal cord, motor cortex, prefrontal cortex, and temporal cortex samples obtained from injected non- human primate subjects and assessed by liquid chromatography-tandem mass spectrometry (LC- MS / MS). Non-human primate subjects received ASO at a dose of 80 mg (20 mg + 20 mg + 20 mg + 20 mg) by intrathecal injection as illustrated in FIG. 7. The indicated samples were obtained at two weeks post-final injection of ASO (day 56). Each dot represents a sample from obtained from a different non-human primate subject. N = 3 for each of the indicated groups of samples. Bars show mean + / - standard error of the mean. “APOE ASO 1” comprises the nucleotide sequence of SEQ ID NO: 29, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 30 of Table 1.

[0042] DETAILED DESCRIPTION

[0043] Aspects of the disclosure relate to compositions and methods for modulating a level, transcription, splicing, and / or translation of one or more RNA transcripts (e.g., mRNA transcripts) in a cell or subject. The disclosure is based, in part, on isolated nucleic acids that bind to mRNA transcripts of genes involved in amyloid plaque formation, for example a gene encoding apolipoprotein E (APOE). In some embodiments, compositions of the disclosure are useful for treating and / or preventing diseases or disorders associated with amyloid plaque formation. In some embodiments the disease or disorder is associated with neurodegeneration (e.g., Alzheimer’s disease, dementia with Lewy Bodies, Parkinson’s disease and / or cognitive decline in Parkinson’s disease, vascular dementia, frontotemporal disorders associated with neurodegeneration, amyloid-related imaging abnormalities (ARIA), etc.). In some embodiments, compositions of the disclosure are useful for reducing for amyloid plaques and neurofibrillary tangles in a subject in need thereof.

[0044] Lipid. Homeostasis and Amyloid Plaque Formation

[0045] Apolipoprotein E (APOE) is a lipid-binding protein involved in fat metabolism in mammals. APOE is found in variety of lipoprotein particles, such as chylomicrons, chylomicron remnants, very low-density lipoproteins (VLDLs), intermediate-density lipoproteins (IDLs), and some high-density lipoproteins (HDLs). These lipoprotein particles are found, for example, in plasma, interstitial fluid, and lymph where they are involved in the transport of lipids throughout the body. Without wishing to be bound by any particular theory, APOE interacts with lipids via its amphipathic structure. Additionally, APOE binds to a variety of cellular receptors which mediate the cellular uptake of lipoprotein particles, such as LDL receptor / LDLR, the LDL receptor-related proteins LRP1, LRP2, and LRP8, and the very low-density lipoprotein receptor / VLDLR. Accordingly, APOE is involved in the production, conversion, and clearance of lipoprotein particles at tissues / organs, such as liver, muscle, heart, and adipose tissues. Additionally, APOE has heparin-binding activity which enables binding to heparan- sulfate proteoglycans on cell surfaces. This property that supports the capture and the receptor-mediated uptake of lipoproteins comprising APOE by cells.

[0046] APOE is expressed in a variety of tissues and locations, such as the liver, adrenal gland, testis, ovary, skin, kidney, spleen, adipose tissues, and macrophages. However, APOE is also expressed in the brain by cells, such as astrocytes and glial cells in the cerebral cortex, and neurons in the frontal cortex and hippocampus.

[0047] APOE has been associated with a variety of diseases and disorders, such as cardiovascular disease, hematopoietic cancers, and neurodegenerative diseases. One specific example of a disease associated with APOE is Alzheimer’s disease (e.g., late-onset Alzheimer’s disease). Alzheimer’s is characterized by indicators, such as progressive dementia, loss of cognitive abilities, and deposition of fibrillar amyloid proteins as intraneuronal neurofibrillary tangles, extracellular amyloid plaques, and vascular amyloid deposits. APOE co-localizes with amyloid plaques comprising amyloid-P (AP). Moreover, APOE modulates amyloid plaque size and toxicity by promoting amyloidosis during the early stages of amyloid plaque formation and impairing clearance of plaques from the brain interstitial fluid. Accordingly, aspects of the disclosure relate to compositions for altering a level, transcription, splicing, and / or translation of genes associated with amyloid plaque formation.

[0048] A “gene associated with amyloid plaque formation” refers to a gene encoding a gene product (e.g., an mRNA, protein, etc.) that is genetically, biochemically, or functionally associated with amyloidogenic processing of amyloid precursor protein (APP) in a cell or subject. In some embodiments, a gene associated with amyloid plaque formation is APOE.

[0049] In some embodiments, a gene associated with amyloid plaque formation encodes an mRNA encoding an apolipoprotein E (APOE) protein. In humans, APOE is encoded by the APOE gene, located on chromosome 19 (e.g., encoded by Ensembl ID NO: ENST00000252486.9, Chromosome 19: 44,905,796-44,909,393 forward strand, location: 19ql3.32). The APOE gene, including untranslated regions (UTRs), comprises 3,598 nucleotides encoding 4 exons, and 3 introns. The human APOE gene may comprise singlenucleotide polymorphisms (SNPs) that result in variants, such as s2 (comprising Cl 12, C158) (a.k.a. APOE2 s3 (comprising Cl 12, R158) (a.k.a. APOE3). and s4 (comprising R112, R158) (a.k.a. APOE4). In some embodiments, APOE encodes a peptide set forth in NCBI Reference Sequence NP_000032.1, NP_001289617.1, NP_001289618.1, NP_001289619.1, or NP_001289620.1. In some embodiments, an APOE gene encodes an mRNA comprising the sequence set forth in NCBI Reference Sequence NM_014905.5, NM_001302688.2, NM_001302689.2, NM_001302690.2, or NM_001302691.2. In some embodiments, an mRNA is encoded by an APOE gene and comprises one of the sequences set forth below:

[0050] NM 000041,4

[0051] CTACTCAGCCCCAGC GGAGGT GAAGGAC GT C C T T C C C C AGGAGC C GAC T GGC C AAT C AC AGGC AGGAAGAT GAAGGT TCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGG AGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTAC CTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGC GC T GAT GGAC GAGAC CAT GAAGGAGT T GAAGGC C T AC AAAT C GGAAC T GGAGGAAC AAC T GAC CCCGGTGGC GGAGG AGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGC CGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTC CCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCG GGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTG CGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGC GC GGAT GGAGGAGAT GGGC AGC C GGAC C C GC GAC C GC C T GGAC GAGGT GAAGGAGC AGGT GGC GGAGGT GC GC GC C A AGC T GGAGGAGC AGGC C C AGC AGAT AC GCCTGCAGGCC GAGGC CTTCCAGGCCCGCCT C AAGAGC T GGT T C GAGC C C CTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCC TGTGCCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCCTCCTGCCTCCGC GCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCA AGTTTCACGCA ( SEQ ID NO : 53 )

[0052] NM 001302688.2

[0053] CTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGGTGAGAAGCGCAGTCGGGGGCACGGGGATGA GCTCAGGGGCCTC T AGAAAGAGC T GGGAC C C T GGGAAC CCCTGGCCTC C AGAC T GGC C AAT C AC AGGC AGGAAGAT G AAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGA GCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGG ATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTG AGGGCGCTGAT GGAC GAGAC CAT GAAGGAGT T GAAGGC C T AC AAAT C GGAAC T GGAGGAAC AAC T GAC CCCGGTGGC GGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGT GCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTC GCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCA GGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCC GCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTG CGCGCGCGGAT GGAGGAGAT GGGC AGC C GGAC C C GC GAC C GC C T GGAC GAGGT GAAGGAGC AGGT GGC GGAGGT GC G C GC C AAGC T GGAGGAGC AGGC C C AGC AGAT AC GC C T GC AGGC C GAGGC C T T C C AGGC C C GC C T C AAGAGC T GGT T C G AGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCC GCCCCTGTGCCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCCTCCTGCC TCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATT CACCAAGTTTCACGCA ( SEQ ID NO : 54 )

[0054] NM 001302689.2

[0055] AGAGAC GAC C C GAC C C GC T AGAAGAC T GGC C AAT C AC AGGC AGGAAGAT GAAGGT T CTGTGGGCTGCGTTGCTGGTC ACATTCCTGGCAGGATGCCAGGC C AAGGT GGAGC AAGC GGT GGAGAC AGAGC C GGAGC C C GAGC T GC GC C AGC AGAC CGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGT C T GAGC AGGT GCAGGAGGAGC TGCTCAGCTCCCAGGTCACC C AGGAAC T GAGGGC GC T GAT GGAC GAGAC CAT GAAG GAGT T GAAGGC C T AC AAAT C GGAAC T GGAGGAAC AAC T GAC CCCGGTGGC GGAGGAGAC GCGGGCACGGCTGTCCAA GGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCG AGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAG CGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCG CGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCC TGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGC C GGAC C C GC GAC C GC C T GGAC GAGGT GAAGGAGC AGGT GGC GGAGGT GC GC GC C AAGC T GGAGGAGC AGGC C C AGC A GATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCC AGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGA ACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCT GTCCCCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCACGCA ( SEQ ID NO : 55 )

[0056] NM 001302690.2

[0057] GGAT GGGGAGAT AAGAGAAGAC CAGGAGGGAGT T AAAT AGGGAAT GGGT T GGGGGC GGC T T GGT AAAT GT GC T GGGA T T AGGC T GT T GC AGAT AAT GC AAC AAGGC T T GGAAGGC T AAC C T GGGAC T GGC C AAT C AC AGGC AGGAAGAT GAAGG TTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCG GAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTA CCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGG C GC T GAT GGAC GAGAC CAT GAAGGAGT T GAAGGC C T AC AAAT C GGAAC T GGAGGAAC AAC T GAC CCCGGTGGC GGAG GAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGG CCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCT CCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCC GGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGT GCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCG C GC GGAT GGAGGAGAT GGGC AGC C GGAC C C GC GAC C GC C T GGAC GAGGT GAAGGAGC AGGT GGC GGAGGT GC GC GC C AAGC T GGAGGAGC AGGC C C AGC AGAT AC GCCTGCAGGCC GAGGC CTTCCAGGCCCGCCT C AAGAGC T GGT T C GAGC C CCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCC CTGTGCCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCCTCCTGCCTCCG CGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACC AAGTTTCACGCA ( SEQ ID NO : 56 )

[0058] NM_001302691.2

[0059] CTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGTTTCTCCTTCCCCAGACTGGCCAATCACAGG CAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGG T GGAGAC AGAGC C GGAGC C C GAGC T GC GC C AGC AGAC C GAGT GGC AGAGC GGCCAGCGCT GGGAAC TGGCACTGGGT CGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCAC C C AGGAAC T GAGGGC GC T GAT GGAC GAGAC CAT GAAGGAGT T GAAGGC C T AC AAAT C GGAAC T GGAGGAAC AAC T GA CCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATG GAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCG GGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGG CAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTG GAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGG C GAGC GGCTGCGCGCGCGGAT GGAGGAGAT GGGC AGC C GGAC C C GC GAC C GC C T GGAC GAGGT GAAGGAGC AGGT GG CGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAG AGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGG C AC C AGC GC C GC C C C T GT GC C C AGC GAC AAT C AC T GAAC GC C GAAGC C T GC AGC C AT GC GAC C C C AC GC C AC C C C GT GCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTT AATAAAGATTCACCAAGTTTCACGCA ( SEQ ID NO : 57 )

[0060] The skilled artisan recognizes that when referring to a gene sequence encoding an mRNA, the sequence of the mRNA is identical to the recited gene sequence, except that each instance of “T” is replaced with “U”.

[0061] Aspects of the disclosure relate to methods for inhibiting amyloid plaque formation in subjects having certain neurodegenerative diseases and disorders. In some embodiments, the subjects do not have any mutations in the APOE gene (e.g., the subjects have wild type APOE protein).

[0062] However, in some embodiments, an APOE gene (or an mRNA encoded by an APOE gene) comprises one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions relative to a wild type APOE gene (or mRNA encoded by a wild type APOE gene) and may be referred to as a “mutant” APOE gene or an APOE variant. The number of nucleotide substitutions in an APOE variant may vary. In some embodiments, an APOE variant comprises between 1 and 20, 5 and 10, 2 and 15, 10 and 30, or 20 and 100 nucleotide substitutions, nucleotide insertions, and / or nucleotide deletions relative to a wild type APOE gene (or mRNA encoded by a wild type APOE gene). In some embodiments, the one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions results in an amino acid substitution in the protein encoded by the APOE variant. In some embodiments, the one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions results in a nonsense mutation (e.g., insertion of a premature stop codon) in an mRNA encoded by the APOE variant.

[0063] In some embodiments, the one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions results in a frameshift mutation of the APOE variant relative to a wild type APOE gene. In some embodiments, a mutation or mutations present in an APOE variant result in the production of one or more splice variants of APOE mRNA. A “splice variant” may refer to a mRNA resulting from one or more mutations in a DNA sequence that occur at the boundary of an exon and an intron (splice site) of a gene. Splice site mutations generally disrupt RNA splicing and result in the loss of exons or the inclusion of introns and an altered protein-coding sequence (e.g., a “splice variant”).

[0064] Aspects of the disclosure relate to isolated nucleic acids, for example RNA processing modulators (e.g., ASOs) that bind to one or more target regions of an mRNA encoded by a gene associated with amyloid plaque formation. In some embodiments, the isolated nucleic acids bind to more or more splice variants of an APOE gene (e.g., a human APOE splice variant, such as APOE2, APOE3, APOE4, etc.). In some embodiments, an isolated nucleic acid described by the disclosure binds to a region of an APOE splice variant (e.g., mRNA encoded by an APOE variant) selected from an untranslated region (UTR). In some embodiments, the UTR is a 5' UTR. In some embodiments, the UTR is a 3' UTR. In some embodiments, an isolated nucleic acid described by this disclosure binds to a region of a polyadenylation sequence of an APOE splice variant. In some embodiments, an isolated nucleic acid described by this disclosure binds to a region that spans a boundary in the 3' UTR of an APOE splice variant where the 5' end of a polyadenylation sequence begins. In some embodiments, the UTR is an intron. In some embodiments, an isolated nucleic acid described by the disclosure binds to an intron-exon boundary of an APOE splice variant (e.g., mRNA encoded by an APOE variant). An intron-exon boundary refers to a contiguous nucleotide sequence that includes portions of an intron and exon that are adjacent to one another in the mRNA transcript. In some embodiments, an isolated nucleic acid (e.g., antisense oligonucleotide) binds to an mRNA expressed from a particular allele of APOE (e.g., binds to a target mRNA in an allele- specific manner).

[0065] Isolated nucleic acids

[0066] In some embodiments of the present disclosure, a nucleic acid is an isolated nucleic acid. In some cases, nucleic acids are alternatively referred to as oligonucleotides. In some embodiments, an isolated nucleic acid comprises DNA (e.g., deoxyribonucleotides). In some embodiments, an isolated nucleic acid comprises RNA (e.g., ribonucleotides), such as an isolated nucleic acid comprising a gapmer structure that comprises a region of deoxyribonucleotides which are flanked by regions of ribonucleotides. In some embodiments, an isolated nucleic acid comprises both DNA (e.g., deoxyribonucleotides) and RNA (e.g., ribonucleotides). An isolated nucleic acid may be single stranded or double stranded. In some embodiments, the isolated nucleic acid is an RNA oligonucleotide. In some embodiments, the isolated nucleic acid is a single stranded RNA oligonucleotide (which may also be referred to as a single stranded RNA polynucleotide).

[0067] As used herein, the term “isolated” means artificially produced. Artificial production of an isolated nucleic acid may be achieved, for example, through amplification in vitro through polymerase chain reaction (PCR), recombinant cloning, or chemical synthesis. Methods of synthesizing isolated nucleic acids, for example RNAs, are known in the art, for example as described by Soukchareun et al. Preparation and characterization of antisense oligonucleotide- peptide hybrids containing viral fusion peptides. Bioconjug Chem. 1995 Jan-Feb;6(l):43-53. doi: 10.1021 / bc00031a004. PMID: 7711103.

[0068] The length of an isolated nucleic acid may vary. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator described herein, such as an ASO described herein which may include, but is not limited to, a single stranded RNA) is 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or up to 120 nucleotides in length. In some embodiments, an isolated nucleic acid ranges from about 1 to 100, 2 to 30, 5 to 20, 10 to 40, or 20 to 80 nucleotides in length. In some embodiments, an isolated nucleic acid is between 10 and 50 nucleotides in length. In some embodiments, an isolated nucleic acid comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some embodiments, an isolated nucleic acid is more than 50 nucleotides in length (e.g., 60, 70, 80, 90, 100, etc., nucleotides in length). In some embodiments, an isolated nucleic acid is no greater than 200 nucleotides in length. In some embodiments, an isolated nucleic acid comprises a nucleotide sequence that encodes a full length, wild type APOE protein.

[0069] In some embodiments, an isolated nucleic acid of the disclosure (e.g., an RNA processing modulator described herein) comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-52 (provided in Column A of Table 1). In some embodiments, an isolated nucleic acid of the disclosure comprises an antisense oligonucleotide comprising at least 15 nucleotides (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleotides) of the any one of the sequences set forth in SEQ ID NOs: 1-52 (provided in column A of Table 1).

[0070] In some embodiments of the present invention, an isolated nucleic acid is modified (e.g., comprises one or more modifications, for example chemical modifications, such as those in Column C of Table 1). A modified nucleic acid may refer to an oligonucleotide that has been structurally altered in a non-natural manner (e.g., a manner that does not occur in nature). Nucleic acid modifications may be used to endow the nucleic acid with specific functional characteristics relative to unmodified nucleic acids. In some embodiments, modification of an isolated nucleic acid promotes binding of the isolated nucleic acid to a target molecule or increases stability of the isolated nucleic acid (e.g., makes the isolated nucleic acid resistant to enzymatic degradation).

[0071] In some embodiments, the one or more modifications is between 1 and 50 modifications, 2 and 20, 5 and 30, 10 and 40, or 15 and 50 modifications. In some embodiments, an isolated nucleic acid comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 modifications. In some embodiments, an isolated nucleic acid comprises more than 50 modifications (e.g., up to 60, 70, 80, 90, or 100, etc., modifications). In some embodiments, an isolated nucleic acid comprises chemical modifications on each nucleotide and each sugarphosphate backbone linkage. Such a modified isolated nucleic acid may be referred to as a “fully modified” isolated nucleic acid. In some embodiments, not all nucleotides of an isolated nucleic acid are modified.

[0072] A chemical modification may comprise a modification of a nucleobase or a nucleotide, and / or a modification of a sugar-phosphate backbone (e.g., modification of one or more sugarphosphate backbone linkages).

[0073] In some embodiments, an isolated nucleic acid of the disclosure (e.g., an RNA processing modulator described herein, such as an ASO described herein) comprises one or more chemical modification(s) listed in Column C of Table 1.

[0074] In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator described herein, such as an ASO described herein) comprises one or more modifications to a 5' carbon atom (e.g., a 5'-carbon atom of a sugar) and / or one or more modifications to a 5-carbon of a nucleobase. Examples of modifications include, but are not limited to, 5-(2-amino)propyl uridine, 5-bromo uridine, 5-propyne uridine, 5-propenyl uridine, 5-carboxymethylaminomethyl- 2-thiouracil, and 5-carboxymethylaminomethyl uracil. In other embodiments, the nucleic acid modification is targeted to the 6-carbon atom of a nucleobase. In some embodiments, an isolated nucleic acid comprises one or more modifications to a 6-carbon atom (e.g., a 6-carbon atom of a nucleobase) for example a 6-(2-amino)propyl uridine. In some embodiments, an isolated nucleic acid comprises one or more modifications to an 8-carbon atom (e.g., an 8-carbon atom of a nucleobase). Examples of 8 modifications include, but are not limited to, 8-bromo guanosine, 8- chloro guanosine, and 8-fluoroguanosine.

[0075] In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator described herein, such as an ASO described herein) comprises one or more modifications to a 2' carbon of the sugar group. Examples of modified sugar groups include but are not limited to D- ribose, 2'-O-alkyl (including 2'-O-methyl and 2'-O-ethyl), i.e., 2'-alkoxy, 2'-amino, 2'-S-alkyl, 2'- halo (including 2'-fluoro), 2'-2-O-methoxyethoxy, 2'-allyloxy (-OCH2CH=CH2), 2'-propargyl, 2'-propyl, ethynyl, ethenyl, propenyl, and cyano and the like. In some embodiments, a modified sugar moiety comprises a hexose and incorporated into an oligonucleotide as described (Augustyns, K., et al., Nucl. Acids. Res. 18:4711 (1992)). Other examples of 2' modifications include, but are not limited to, substitutions of the bound OH group with H, OR, R, F, Cl, Br, I, SH, SR, NH, NHR, NR, COOR, or OR, wherein R is a substituted or unsubstituted aliphatic group. Other 2' modifications are found in the art. The term “aliphatic,” as used herein, includes both saturated and unsaturated, straight chain (i.e., unbranched), branched, acyclic, cyclic, or polycyclic aliphatic hydrocarbons, which are optionally substituted with one or more functional groups. As will be appreciated by one of ordinary skill in the art, “aliphatic” is intended herein to include, but is not limited to, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, and cycloalkynyl moieties.

[0076] In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator described herein, such as an ASO described herein) modification comprises a sugar-phosphate backbone modification. One example of a phosphate group modifications is substitution of an oxygen atom with a sulfur atom. In other embodiments, the backbone of the nucleic acid is modified. Examples of backbone modifications include, but are not limited to, phosphorothioate, borano-phosphate, alkyl phosphonate nucleic acid, peptide nucleic acid, and morpholino. Morpholino backbones are described, for example by Corey and Abrams Genome Biol. 2001; 2(5): reviews 1015.1-reviews 1015.3.

[0077] Other examples of modified bases include N4,N4-ethanocytosine, 7-deazaxanthosine, 7- deazaguanosine, 8-oxo-N6-methyladenine, 4-acetylcytosine, dihydrouracil, inosine, N6- isopentenyl-adenine, 1 -methyladenine, 1 -methylpseudouracil, 1-methylguanine, 1- methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5- methylcytosine, N6 -methyladenine, 7-methylguanine, 2-methylthio-N6-isopentenyladenine, pseudouracil, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 2-thiocytosine, and 2,6- diaminopurine. Other examples of nucleic acid modifications are described for example by Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2): 117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45, Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. l l(2):77-85, Duffy. BMC Bio. 2020 Sep. 2(8): 112, and US Patent No. US5684143.

[0078] Additional modifications of isolated nucleic acids (e.g., ASOs) are described by Duffy et al. BMC Biology volume 18, Article number: 112 (2020), the entire contents of which are incorporated herein by reference.

[0079] In some embodiments, an isolated nucleic acid of the disclosure (e.g., an RNA processing modulator described herein, such as an ASO described herein) comprises a nucleic acid sequence from Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications) from Column C of Table 1, optionally where Columns A and C are from the same row of Table 1.

[0080] RNA processing modulators Aspects of the disclosure relate to compositions (e.g., isolated nucleic acids, agents, etc.) that modulate mRNAs encoded by genes associated with amyloid plaque formation. In some embodiments, the gene associated with amyloid plaque formation is APOE (e.g., a human APOE gene). In some embodiments, a composition comprises an RNA processing modulator. As used herein, an “RNA processing modulator” or “RPM” refers to an agent that binds to, and up- regulates, down-regulates, or otherwise change function or activity, of a target mRNA (e.g., an mRNA encoded by a gene associated with amyloid plaque formation, such as APOE, or a gene product such as a protein encoded by the mRNA) by affecting transcription, levels, splicing, and / or translation of the mRNA. An RNA processing modulator may be an isolated nucleic acid or ASO described herein. In some embodiments, an RNA processing modulator is an isolated nucleic acid that affects transcription, levels, splicing, and / or translation of a target mRNA (e.g., an mRNA encoded by an APOE gene). In some embodiments, an RNA processing modulator is an antisense oligonucleotide (ASO) that affects transcription, levels, splicing, and / or translation of a target mRNA (e.g., an mRNA encoded by an APOE gene). In some embodiments, an mRNA (e.g., a target mRNA) is a pre-mRNA (e.g., an RNA that has been transcribed from a gene, such as an APOE gene, but has not been processed to remove introns, for example by splicing). In some embodiments, an mRNA is a mature mRNA that has been processed (e.g., an mRNA transcribed from an APOE gene and that has undergone processing).

[0081] In some embodiments, an RNA processing modulator (e.g., an ASO, e.g., as described herein) upregulates transcription, levels, splicing, and / or translation of a target mRNA. Upregulation of transcription, levels, splicing, and / or translation may comprise binding to a regulatory region (e.g., an untranslated region, such as a 5' UTR or 3' UTR) of a target mRNA and reducing non-productive splicing or translation initiation from alternative start codons present in the target mRNA, for example through steric blocking of non-productive splice site(s) or alternative start codons (such as “upstream alternative start codons” located in the 5' UTR of the target mRNA), or causing a mRNA frameshift (e.g., a splice variant) resulting in translation of a protein variant from the target mRNA that lacks one or more inhibitory domains.

[0082] The amount of upregulation of transcription, levels, splicing, and / or translation mediated by an RNA processing modulator may vary. In some embodiments, an RNA processing modulator increases transcription, levels, splicing, and / or translation of a target mRNA transcript (e.g., increases relative to a cell or subject prior to the administration of the RPM, or increases relative to a control cell or subject) between 1-fold and 100-fold, 2-fold and 10-fold, 5- fold and 20-fold, 10-fold and 30-fold, 20-fold and 50-fold, or 25-fold and 100-fold, or any value therebetween. In some embodiments, an RNA processing modulator increases transcription, levels, splicing, and / or translation of a target mRNA transcript more than 100-fold, for example at least 200-fold, 400-fold, 500-fold, or 1000-fold. In some embodiments, an RNA processing modulator increases transcription, levels, splicing, and / or translation of a target mRNA transcript no more than 1000-fold. In some embodiments, upregulation of a level, transcription, splicing, and / or translation of a target mRNA is useful to increase expression of a desired (e.g., wild-type) allele encoding the target mRNA.

[0083] In some embodiments, an RNA processing modulator (e.g., an ASO, e.g., as described herein) downregulates transcription, levels, splicing, and / or translation of a target mRNA. Downregulation of transcription, levels, splicing, and / or translation may comprise binding to a regulatory region (e.g., an untranslated region, such as a 5' UTR or 3' UTR) of a target mRNA and blocking transcription the target mRNA, for example through steric blocking of a transcription initiation site, binding to an mRNA and subsequently initiating RNAse H-mediated degradation (e.g., in the context of a ‘gapmer’ RNA processing modulator), or causing an mRNA frameshift (e.g., a splice variant) resulting in translation of a protein variant from the target mRNA that is inactive, or has reduced function or activity (e.g., enzymatic activity, the ability to interact with other proteins to form protein complexes, etc.). In some embodiments, the resulting protein variant is a dominant negative protein variant. In some embodiments, downregulation of a level, transcription, splicing, and / or translation of a target mRNA is useful to increase expression of an undesirable (e.g., mutant, or disease-associated) allele encoding a target mRNA.

[0084] The amount of downregulation of transcription, levels, splicing, and / or translation mediated by an RNA processing modulator may vary. In some embodiments, an RNA processing modulator decreases transcription, levels, splicing, and / or translation of a target mRNA transcript between 1-fold and 100-fold, 2-fold and 10-fold, 5-fold and 20-fold, 10-fold and 30-fold, 20-fold and 50-fold, or 25-fold and 100-fold, or any value therebetween. In some embodiments, an RNA processing modulator decreases transcription, levels, splicing, and / or translation of a target mRNA transcript more than 100-fold, for example at least 200-fold, 400- fold, 500-fold, or 1000-fold. In some embodiments, an RNA processing modulator decreases transcription, levels, splicing, and / or translation of a target mRNA transcript no more than 1000- fold.

[0085] An RNA processing modulator (e.g., an ASO, e.g., as described herein) may alter the number and / or character of splice variants of a target mRNA. In some embodiments, an RNA processing modulator increases (relative to natural transcription or translation of a target mRNA) the number of different splice variants of an mRNA, or the ratio between different splice variants of an mRNA. In some embodiments, an RNA processing modulator decreases (relative to natural transcription or translation of a target mRNA) the number of different splice variants of an mRNA, or the ratio between different splice variants of an mRNA. In some embodiments, contacting a target mRNA with an RNA processing modulator results in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more splice variants of the target mRNA being transcribed and / or translated. In some embodiments, contacting a target mRNA with an RNA processing modulator results in a single splice variant of the target mRNA being transcribed and / or translated.

[0086] The binding location of an RNA processing modulator may vary. In some embodiments, an RNA processing modulator affects splicing of the target mRNA. For example, an RNA processing modulator may bind to the target mRNA at a splice junction (e.g., a location spanning an intron-exon boundary) and mediate skipping of one or more exons in the mRNA transcript. In some embodiments, skipping of one or more exons in the target mRNA results in production of a truncated protein variant of the protein encoded by the target mRNA. In another example, an RNA processing modulator may bind to the target mRNA at a splice junction and mediate alternative splicing in which an intron is translated, and a protein variant of the target gene is produced. In some embodiments, an RNA processing modulator binds a target mRNA at a location comprising a coding sequence (e.g., a protein coding sequence or an exon).

[0087] In some embodiments, an RNA processing modulator (e.g., an ASO, e.g., as described herein) comprises an agent selected from the group consisting of nucleic acid, peptide (including polypeptide), and small molecule. Examples of small molecule RNA processing inhibitors include but are not limited to translational readthrough-inducing drugs (TRIDs), such as certain aminoglycosides, non-aminoglycoside antibiotics (e.g., negamycin), ataluren (PTC124), and amlexanox. Examples of peptides include but are not limited to activator proteins (e.g., transcription factors), suppressor proteins (e.g., inducible cAMP early repressor (ICER), bZIP repressor, SP1 repressor, certain histone deacetylases, etc.), antibodies, etc. Examples of nucleic acids include but are not limited to suppressor tRNAs, dsRNA, siRNA, micro-RNA (miRNA), artificial miRNA (ami-RNA), aptamers, and antisense oligonucleotides. In some embodiments, an RNA processing modulator comprises an antisense oligonucleotide (ASO).

[0088] In some embodiments, an isolated nucleic acid described herein is an antisense nucleic acid, such as an antisense oligonucleotide (ASO). As used herein, the term, “antisense nucleic acid,” or “ASO” refers to a single stranded nucleic acid that has sequence complementarity to a target sequence and is specifically hybridizable, e.g., under stringent conditions, with a nucleic acid having the target sequence. An antisense nucleic acid is specifically hybridizable when binding of the antisense nucleic acid to the target nucleic acid is sufficient to produce complementary base pairing between the antisense nucleic acid and the target nucleic acid, and there is a sufficient degree of complementarity to reduce or avoid non-specific binding of the antisense nucleic acid to non-target nucleic acid under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed. In some embodiments, an ASO is chemically synthesized. An ASO may be a DNA polynucleotide, an RNA polynucleotide, or a DNA / RNA polynucleotide (e.g., an ASO comprising a gapmer structure that comprises a region of deoxyribonucleotides flanked by regions comprising ribonucleotides).

[0089] Complementary refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an antisense nucleic acid is capable of hydrogen bonding with a nucleotide at the corresponding position of a target nucleic acid (e.g., target RNA), then the antisense nucleic acid and target nucleic acid are considered to be complementary to each other at that position. The antisense nucleic acid and target nucleic acid are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other through their bases. Thus, “complementary” is a term that is used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the antisense nucleic acid and target nucleic acid. However, it should be appreciated that 100% complementarity is not required. For example, in some embodiments, an antisense nucleic acid (e.g., an oligonucleotide) may be at least 80% complementary to (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to) the consecutive nucleotides of a target nucleic acid (e.g., a target nucleic acid comprising an mRNA sequence encoded by any one of SEQ ID NOS: 53-57).

[0090] Sequence identity, including determination of sequence complementarity for nucleic acid sequences, may be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. In some embodiments, the percent identity between the two sequences is a function of the number of identical positions shared by the sequences (e.g., % homology=# of identical positions / total # of positionsxlOO), optionally penalizing the score for the number of gaps introduced and / or length of gaps introduced.

[0091] In some embodiments, an antisense oligonucleotide (e.g., an ASO described herein) has a length in a range of 5 to 40 nucleotides, 5 to 30 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, or 15 to 25 nucleotides. In some embodiments of the disclosure, an antisense oligonucleotide comprises a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides.

[0092] In some embodiments, an antisense nucleic acid (e.g., an ASO described herein) comprises a region of complementarity that is perfectly complementary to a portion of a target nucleic acid (e.g., 100% of the nucleotides of the ASO hybridize to the nucleotides of the target RNA, such as a target mRNA (e.g., an mRNA sequence encoded by any one of SEQ ID NOs: 53-57)). However, it should be appreciated that in some embodiments, an antisense nucleic acid comprises less than 100% sequence complementarity with a target nucleic acid (e.g., 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the nucleotides of the ASO hybridize to the nucleotides of the target RNA, such as a target mRNA (e.g., an mRNA sequence encoded by any one of SEQ ID NOs: 53-57)). In addition, to minimize the likelihood of off-target effects, an antisense nucleic acid may be designed to ensure that it does not have a sequence (e.g., of 5 or more consecutive nucleotides) that is complementary with an off-target nucleic acid (e.g., an mRNA that is not transcribed from an APOE gene).

[0093] In some embodiments, an antisense oligonucleotide (e.g., an ASO described herein) comprises a region of complementarity with an mRNA encoded by (e.g., transcribed from) an APOE gene. In some embodiments, an antisense nucleic acid oligonucleotide comprises a region of complementarity with an mRNA encoded by the sequence as set forth in any one of SEQ ID NOS: 53-57. In some embodiments, the region of complementarity of the antisense nucleic acid hybridizes with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of a target nucleic acid (e.g., an mRNA encoded by the sequence set forth in any one of SEQ ID NOS: 53-57). In some embodiments, an antisense oligonucleotide comprises a region of complementarity with a 5' UTR, 3' UTR, an intronic sequence, an exonic sequence, a splice donor sequence, a splice acceptor sequence or a lariat branch point encoded by a human APOE gene. In some embodiments, an antisense oligonucleotide comprises a region of complementarity with a 3' UTR encoded by a human APOE gene. In some embodiments, an antisense oligonucleotide comprises a region of complementarity with an exon encoded by a human APOE gene, such as exon 4. In some embodiments, an oligonucleotide binds to an mRNA expressed from a particular allele of APOE (e.g., binds to a target mRNA in an allelespecific manner).

[0094] In some embodiments, an antisense oligonucleotide (e.g., an ASO described herein) comprises a region of complementarity with an mRNA encoded by (e.g., transcribed from) an APOE gene. In some embodiments, an antisense oligonucleotide comprises a region of complementarity with a pre-mRNA sequence encoded by a human APOE gene, for example (e.g., Ensembl ID NO: ENST00000252486.9, Chromosome 19: 44,905,796-44,909,393 forward strand). In some embodiments, the region of complementarity of the antisense nucleic acid hybridizes with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of a target nucleic acid (e.g., a pre-mRNA encoded by Ensembl ID NO: ENST00000252486.9, Chromosome 19: 44,905,796-44,909,393 forward strand). In some embodiments, the antisense oligonucleotide comprises a region of complementarity with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of an intron encoded by Ensembl ID NO: ENST00000252486.9, Chromosome 19: 44,905,796- 44,909,393 forward strand. The skilled artisan recognizes that the reverse strand of such a nucleic acid encoding a pre-mRNA transcript or mRNA transcript may also be targeted.

[0095] In some embodiments, an antisense oligonucleotide (e.g., an ASO described herein) comprises a region of complementarity that is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 continuous nucleotides complementary with an mRNA encoded by the sequence as set forth in any one of SEQ ID NOS: 53-57. In some embodiments, an antisense oligonucleotide comprising a region of complementarity with an mRNA transcript encoded by any one of SEQ ID NOs: 53-57 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-52, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises a sequence of 10 or more contiguous nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, or more contiguous nucleotides) of any one of the sequences set forth in SEQ ID NOs: 1-52, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-52, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises a nucleotide sequence having one or more mismatches (e.g., one or more bases that is not complementary to the nucleotide at a given position of the target mRNA) relative to an mRNA transcript encoded by the sequence set forth in any one of SEQ ID NOS: 53-57. In some embodiments, an antisense oligonucleotide comprises a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches relative to an mRNA transcript encoded by the sequence set forth in any one of SEQ ID NOs: 53-57. In some embodiments, an antisense oligonucleotide comprising one or more mismatches relative to an mRNA transcript encoded by any one of SEQ ID NOs: 53-57 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a sequence of 10 or more contiguous nucleotides of any one of the sequences set forth in SEQ ID NOs: 1-52, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprising at least 60% sequence identity to a sequence of 10 or more contiguous nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, or more contiguous nucleotides) of any one of the sequences set forth in SEQ ID NOs: 1-52 differs at one or more nucleotide positions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide positions comprising a substitution, an insertion, or a deletion) relative to the sequence of 10 or more contiguous nucleotides of any one of the sequences set forth in SEQ ID NOs: 1-52, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprising one or more mismatches relative to an mRNA transcript encoded by any one of SEQ ID NOs: 53-57 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-52. In some embodiments, an antisense oligonucleotide comprising at least 60% sequence identity to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-52 differs at one or more nucleotide positions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide positions comprising a substitution, an insertion, or a deletion) relative to the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-52.

[0096] In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) are provided in a homogeneous preparation, e.g., in which at least 85%, at least 90%, at least 95%, or at least 99% of the RNA processing modulators (e.g., antisense oligonucleotides) are identical. In some embodiments, a homogeneous preparation is stereo-pure (e.g., diastereomeric). For example, in some embodiments, homogeneous preparations of antisense oligonucleotides are provided in which at least 85%, at least 90%, at least 95%, or at least 99% of the oligonucleotides in the preparation are 10 to 25 nucleotides in length and comprise a region of complementarity that is complementary with at least 6 contiguous nucleotides of an mRNA transcript encoded by an APOE gene (e.g., an APOE gene encoding an mRNA comprising the nucleic acid sequence set forth in any one of SEQ ID NOS: 53-57). In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) are provided in a heterogeneous preparation, e.g., comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different RNA processing modulators (e.g., antisense oligonucleotides each targeting a different sequence of an APOE mRNA transcript).

[0097] RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may be modified to achieve one or more desired properties, such as, for example, improved cellular uptake, improved stability, reduced immunogenicity, improved potency, improved target hybridization, susceptibility to RNAse cleavage, etc. In some embodiments, an antisense nucleic acid is modified such that when present in a cell that contains an APOE gene, it is capable of hybridizing with RNA transcribed from the APOE gene without inducing cleavage of the RNA by an RNase. In some embodiments, an antisense nucleic acid is modified such that when present in a cell that contains an APOE gene, it is capable of hybridizing with RNA transcribed from the APOE gene and inducing cleavage of the RNA by an RNase. RNA processing modulators (e.g., antisense oligonucleotides, e.g. a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-52, as recited in column A of Table 1) can be modified at a base moiety, sugar moiety and / or phosphate backbone. Accordingly, RNA processing modulators (e.g., antisense oligonucleotides) may have one or more modified nucleotides (e.g., a nucleotide analog) and / or one or more backbone modifications (e.g., a modified intemucleotide linkage). RNA processing modulators (e.g., antisense oligonucleotides) may have a combination of modified and unmodified nucleotides. RNA processing modulators (e.g., antisense oligonucleotides) may also have a combination of modified and unmodified intemucleotide linkages. RNA processing modulators (e.g., antisense oligonucleotides) may comprise one or more chemical modifications (or combinations of chemical modifications) from Column C of Table 1, e.g. in combination with any basic nucleotide sequence, e.g. from Column A of Table 1. In some embodiments, an RNA processing modulator comprises a nucleic acid sequence from Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications) from Column C of Table 1, optionally wherein Columns A and C are from the same row of Table 1. In some embodiments, an RNA processing modulator comprises a nucleic acid sequence from Column A of Table and one or more chemical modifications (or combinations of chemical modifications( from Column C of Table, wherein the nucleic acid sequence in Column A and the one or more chemical modifications in Column C are selected from the same row of Table 1.

[0098] In some embodiments, the one or more modifications is between 1 and 50 modifications, 2 and 20, 5 and 30, 10 and 40, or 15 and 50 modifications. In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 modifications. In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises more than 50 modifications (e.g., 60, 70, 80, 90, 100, etc., modifications). In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises no more than 100 modifications. In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises chemical modifications on each nucleotide and each sugar-phosphate backbone linkage. Such a modified RNA processing modulator (e.g., antisense oligonucleotide) may be referred to as a “fully modified” RNA processing modulator (e.g., antisense oligonucleotide). In some embodiments, a fully modified antisense oligonucleotide comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 1-52. In some embodiments, not all of the nucleotides of an antisense oligonucleotide are modified. RNA processing modulators (e.g., antisense oligonucleotides) may include ribonucleotides, deoxyribonucleotides, and combinations thereof (e.g., RNA processing modulators comprising a gapmer structure). Examples of modified nucleotides which can be used in antisense nucleic acids include, for example, 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1-methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5- oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxy acetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine.

[0099] In some embodiments, a modified nucleotide is a 2'-modified nucleotide. For example, the 2'-modified nucleotide may be a 2'-deoxy, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, 2'- amino and 2'-aminoalkoxy modified nucleotide. In some embodiments, the 2’ -modified nucleotide comprises a 2'-O-4'-C methylene bridge, such as a locked nucleic acid (LNA) nucleotide. In some embodiments of a 2' modified nucleotide the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. In such embodiments, the linkage may be a methylene ( — CH2 — )ngroup bridging the 2' oxygen atom and the 3' or 4' carbon atom wherein n is 1 or 2. In some embodiments, a linkage comprises a cEt modification (e.g., a -CH3 replacing a hydrogen in the methylene group of the bridge).

[0100] RNA processing modulators (e.g., antisense oligonucleotides) may include combinations of LNA nucleotides and unmodified nucleotides. Antisense nucleic acids may include combinations LNA and RNA nucleotides. Antisense nucleic acids may include combinations LNA and DNA nucleotides. A further preferred oligonucleotide modification includes Locked Nucleic Acids (LNAs) in which the 2 '-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety.

[0101] RNA processing modulators (e.g., antisense oligonucleotides) acids may also include nucleobase-modified nucleotides, e.g., nucleotides containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase. Bases may be modified to block the activity of adenosine deaminase, for example. Examples of modified nucleobases include, but are not limited to, uridine and / or cytidine modified at the 5-position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and / or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza- adenosine; O- and N-alkylated nucleotides, e.g., N6- methyl adenosine are suitable. It should be noted that the above modifications may be combined.

[0102] Within antisense nucleic acids e.g., antisense oligonucleotides) of the disclosure, as few as one and as many as all nucleotides can be modified. In some embodiments, a modified RNA processing modulator (e.g., antisense oligonucleotide) will contain as few modified nucleotides as are necessary to achieve a desired level of in vivo stability and / or bioaccessibility or other desired property.

[0103] Certain antisense oligonucleotides may include non-ionic DNA analogs, such as alkyland aryl-phosphonates (in which the charged non-bridging oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Nucleic acids which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation and may be used herein. In some embodiments, antisense nucleic acids may include at least one lipophilic substituted nucleotide analog and / or a pyrimidine-purine dinucleotide.

[0104] In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) may have one or two accessible 5' ends. It is possible to create modified oligonucleotides having two such 5' ends, for instance, by attaching two oligonucleotides through a 3 '-3' linkage to generate an oligonucleotide having one or two accessible 5' ends. The 3 '3 '-linkage may be a phosphodiester, phosphorothioate, or any other modified internucleoside bridge. Additionally, 3 '3 '-linked oligonucleotides where the linkage between the 3' terminal nucleosides is not a phosphodiester, phosphorothioate, or other modified bridge, can be prepared using an additional spacer, such as tri- or tetra-ethylenglycol phosphate moiety.

[0105] A phosphodiester internucleotide linkage of an RNA processing modulator (e.g., antisense oligonucleotide)can be replaced with a modified linkage. The modified linkage may be selected from, for example, phosphorothioate, phosphorodithioate, NRlR2-phosphoramidate, borano-phosphate, a-hydroxybenzyl phosphonate, phosphate-(Cl-C21) — O-alkyl ester, phosphate-[(C6-C12)aryl-(Cl-C21) — O-alkyl]ester, (Cl-C8)alkylphosphonate and / or (C6- C12)arylphosphonate bridges, and (C7-C12)-a-hydroxymethyl-aryl. In some embodiments, a triazole ring is used.

[0106] A phosphate backbone of the RNA processing modulators (e.g., antisense oligonucleotides) can be modified to generate peptide nucleic acid molecules. As used herein, the terms “peptide nucleic acids” or “PNAs” refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols, for example.

[0107] RNA processing modulators (e.g., antisense oligonucleotides) also be formulated as morpholino oligonucleotides. In such embodiments, the riboside moiety of each subunit of an oligonucleotide of the oligonucleotide reagent is converted to a morpholine moiety. Morpholinos may also be modified, e.g., as peptide conjugated morpholino, etc.

[0108] Aspects of the disclosure relate to RNA processing modulators (e.g., antisense oligonucleotides) comprising a “gapmer” structure. A “gapmer” refers to an antisense oligonucleotide comprising the following formula Xni-(Y)n2-(X)n3, where (X) is a ribonucleotide (e.g., an RNA base) and (Y) is a deoxyribonucleotide (e.g., DNA base), and where each of nl, n2, and n3 are an integer ranging from 1 to 50 (inclusive of all integers therebetween). In some embodiments, antisense oligonucleotides having a gapmer structure bind (e.g., hybridize) to a target mRNA (e.g., an mRNA encoded by an APOE gene) and induce ribonuclease Hl (RNAseHl)-mediated degradation of the target mRNA. Gapmer antisense oligonucleotides are known in the art, for example as described by Kasuya et al. Sci Rep. 2016; 6: 30377.

[0109] The number of DNA bases in a gapmer may vary. In some embodiments, a gapmer comprises between 1 and 10 DNA bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 DNA bases). In some embodiments, a gapmer comprises between 2 and 6 DNA bases (e.g., 2, 3, 4, 5, or 6 DNA bases). The DNA bases of a gapmer antisense oligonucleotide may be positioned toward to 5' end of the ASO (e.g., within 1, 2, 3, 4, 5, etc. nucleotides of the 5' terminal nucleotide of the ASO), toward the 3' end of the ASO (e.g., within 1, 2, 3, 4, 5, etc. nucleotides of the 3' terminal nucleotide of the ASO), or in the middle of the ASO (e.g., having an equal number of RNA bases flanking the DNA bases).

[0110] In other embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) can be linked to functional groups, such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane or the blood-brain barrier. For example, oligonucleotide reagents of the disclosure also may be modified with chemical moieties (e.g., cholesterol) that improve the in vivo pharmacological properties of the RNA processing modulator. In some embodiments, a functional group comprises a peptide, small molecule, sugar, lipid, nucleic acid, or combination of any of the foregoing.

[0111] Sequences and chemical modifications of representative RNA processing modulators (e.g., antisense oligonucleotides) targeting APOE (e.g., an mRNA encoded by an APOE gene, such as a pre-mRNA or mature mRNA) are shown in Columns A and C, respectively, of Table 1. Table 1: Representative RPMs targeting APOE

[0112] In some embodiments, an antisense oligonucleotide (e.g., an ASO described herein) comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 1-52, as recited in Column A of Table 1. In some embodiments, the antisense oligonucleotide comprises one or more of the chemical modifications described herein. In some embodiments, the antisense oligonucleotide comprises any one of the chemical modification patterns as recited in Column C of Table 1 corresponding to any one of the nucleotide sequences set forth in SEQ ID NOs: 1-52 as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 1-52, as recited in Column A of Table 1, and the corresponding chemical modification pattern of said SEQ ID NO as set forth in the same row in Column C of Table 1.

[0113] In some embodiments, an antisense oligonucleotide (e.g., an ASO as described herein) comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 8, 10, 21, 27, or 51. In some embodiments, the antisense oligonucleotide comprises one or more of the chemical modifications described herein. In some embodiments, the antisense comprises the chemical modification pattern as recited in Column C of Table 1 corresponding to any one of the nucleotide sequences set forth in SEQ ID NOs: 2-3, 5-6, 8-12, 18, 21, 23, 25, 27, 30-31, 34, 36, 40-42, 44, 48, and 51-52, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 8, 10, 21, 27, and 51, as recited in Column A of Table 1, and the corresponding chemical modification pattern of said SEQ ID NO as set forth in the same row of Column C of Table 1.

[0114] In some embodiments, an antisense oligonucleotide (e.g., an ASO as described herein) comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 13, 14, 15, 17, 20, 22, 24, 35, 37, 38, 39, and 46, as recited in Column A of Table 1. In some embodiments, the antisense oligonucleotide comprises one or more of the chemical modifications described herein. In some embodiments, the antisense oligonucleotide comprises the chemical modification pattern in Column C of Table 1 corresponding to any one of the nucleotide sequences set forth in SEQ ID NOs: 1-52, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 13, 14, 15, 17, 20, 22, 24, 35, 37, 38, 39, and 46, as recited in Column A of Table 1, and the corresponding chemical modification pattern of said SEQ ID NO as set forth in the same row of Column C of Table 1.

[0115] In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises at least 18 continuous nucleotides (e.g., comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 nucleotides) of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-52 (see Column A of Table 1). In some embodiments, an RNA processing modulator consists of 18 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “18mers” in Column C of the same row in Table 1. In some embodiments, an RNA processing modulator comprises 18 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “18mers” in Column C of the same row in Table 1 and comprises one additional nucleotide (either at the 5' end or 3' end) or two additional nucleotides (either both at the 5' end, both at the 3' end, or one at the 5' end and the other at the 3' end) which are complementary to a target sequence in an APOE mRNA that hybridizes to the 18 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1. In some embodiments, an RNA processing modulator consists of 19 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “20mers” in Column C of the same row in Table 1 and comprises one additional nucleotide either at the 5' end or 3' end which are complementary to a target sequence in an APOE mRNA that hybridizes to the 20 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1. In some embodiments, an RNA processing modulator comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “20mers” in Column C of the same row in Table 1. In some embodiments, an RNA processing modulator comprises 20 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “20mers” in Column C of the same row in Table 1 and comprises one or more additional nucleotides either at the 5' end, at the 3' end, or both the 5' end and the 3' end which are complementary to a target sequence in an APOE mRNA that hybridizes to the 20 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-52 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1) comprises one or more chemical modifications as set forth in any one of the rows in Column C of Table 1. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-52 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1) comprises a pattern of chemical modifications as set forth in any one of the rows in Column C of Table 1. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in any one of the nucleotide sequences set forth in SEQ ID NOs: 2-3, 5-6, 8-18, 20-25, 27 , 29-31, 34-42, 44, 46, 48, and 50-52. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 22. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 29. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 50. In some embodiments, an RNA processing modulator comprising the at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-52 reduces the levels of an APOE mRNA (e.g., a mature mRNA or a pre-mRNA) and / or an APOE protein by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an RNA processing modulator comprising the at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 5, 11, 16, 22, 29, and 50 reduces the levels of an APOE mRNA (e.g., a mature mRNA or a pre-mRNA) and / or an APOE protein by 50% or more (e.g., 50-60%, 60- 70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.

[0116] In some embodiments, an RNA processing modulator comprises or consists of 18 continuous nucleotides, comprises or consists of 19 continuous nucleotides, or comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-52 (see Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue. In some embodiments, an RNA processing modulator comprises or consists of 18 continuous nucleotides, comprises or consists of 19 continuous nucleotides, or comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-52 (see Column A of Table 1), wherein each position comprising a “T” residue is substituted for a “U” residue. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-52 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue and wherein the RNA processing modulator comprises one or more chemical modifications as set forth in any one of the rows in Column C of Table 1. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-52 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue and wherein the RNA processing modulator comprises a pattern of chemical modifications as set forth in any one of the rows in Column C of Table 1. In some embodiments, one or more positions in an RNA processing modulator comprising “U” residues comprises an uracil nitrogenous base or a chemically modified uracil nitrogenous base described herein and a deoxyribose sugar or a chemically modified deoxyribose sugar described herein. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 5, wherein one or more of positions in SEQ ID NO: 5 comprising a “T” residue (e.g., each position in SEQ ID NO: 5 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 11, wherein one or more of positions in SEQ ID NO: 11 comprising a “T” residue (e.g., each position in SEQ ID NO: 11 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 16, wherein one or more of positions in SEQ ID NO: 16 comprising a “T” residue (e.g., each position in SEQ ID NO: 16 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 22, wherein one or more of positions in SEQ ID NO: 22 comprising a “T” residue (e.g., each position in SEQ ID NO: 22 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 29, wherein one or more of positions in SEQ ID NO: 29 comprising a “T” residue (e.g., each position in SEQ ID NO: 29 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 50, wherein one or more of positions in SEQ ID NO: 50 comprising a “T” residue (e.g., each position in SEQ ID NO: 50 comprising a “T” residue) is substituted for a “U” residue.

[0117] In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises a skipper structure, wherein each nucleotide position comprises a ribose sugar which is linked to a nitrogenase base (e.g., a thymine (T), cytosine (C), guanine (G), adenine (A), or uracil (U)), the ribose sugars comprise a 2'-O-methoxyethyl (-OCH2CH2OCH3 (2' MOE)) modification, and each nucleotide position is linked by a phosphorothioate linkage or a phosphodiester linkage. In some embodiments, each nucleotide position is linked by a phosphorothioate linkage. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the skipper structure comprises or consists of 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-52 (see Column A of Table 1). In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the skipper structure comprises or consists of 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-52 (see Column A of Table 1), wherein one or more positions that comprise thymine (T) are replaced with uracil (U) in the nucleic acid sequence. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the skipper structure comprises or consists of 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 3, 5, 7, 11, 16, 22, 29, 31, 34, 43, or 48-50. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the skipper structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the skipper structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the skipper structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the skipper structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 22. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the skipper structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 29. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the skipper structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 50. In some embodiments, an RNA processing modulator comprising the skipper structure reduces the levels of an APOE mRNA (e.g., a mature mRNA or a pre-mRNA) and / or an APOE protein by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.

[0118] In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises a gapmer structure, wherein a region of 10 deoxyribonucleotides is flanked by regions each comprising 4 ribonucleotides (thereby totaling 8 ribonucleotides and 10 deoxyribonucleotides). In some embodiments, 1, 2, 3, or 4 ribonucleotides in each of the regions flanking the region of 10 deoxyribonucleotides comprise a 2'-O-methoxyethyl (- OCH2CH2OCH3 (2' MOE)) modification. In some embodiments, 1, 2, 3, or 4 ribose sugars comprised in each region flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage or a phosphodiester linkage. In some embodiments, 1-10 deoxyribose sugars (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deoxyribose sugars) comprised in the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, one or more ribose sugars (e.g., 1, 2, 3, or 4 ribose sugars) comprised in each of the regions flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, 16 out of the 18 positions are linked by phosphorothioate linkages. In some embodiments, 16 out of the 18 positions are linked by phosphorothioate linkages, wherein the second position is linked to the third position (relative to the 5' terminal end) by a phosphodiester linkage and the sixteenth position is linked to the seventeenth position (relative to the 5' terminal end) by a phosphodiester linkage. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-52 (see Column A of Table 1). In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 22. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 29. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 50. In some embodiments, an RNA processing modulator comprising the gapmer structure reduces the levels of an APOE mRNA (e.g., a mature mRNA or a pre-mRNA) and / or an APOE protein by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.

[0119] In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises a gapmer structure, wherein a region of 10 deoxyribonucleotides is flanked by regions each comprising 5 ribonucleotides (thereby totaling 10 ribonucleotides and 10 deoxyribonucleotides). In some embodiments, 1, 2, 3, 4, or 5 ribonucleotides in each of the regions flanking the region of 10 deoxyribonucleotides comprise a 2'-O-methoxyethyl (- OCH2CH2OCH3 (2' MOE)) modification. In some embodiments, 1, 2, 3, 4, or 5 ribose sugars comprised in each region flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage or a phosphodiester linkage. In some embodiments, 1-10 deoxyribose sugars (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deoxyribose sugars) comprised in the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, one or more ribose sugars (e.g., 1, 2, 3, 4, or 5 ribose sugars) comprised in each of the regions flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, 16 out of the 20 positions are linked by phosphorothioate linkages. In some embodiments, 16 out of the 20 positions are linked by phosphorothioate linkages, wherein the second position and third position (relative to the 5' terminal end), third position and fourth position (relative to the 5' terminal end), seventeenth position and eighteenth position (relative to the 5' terminal end), and eighteenth position and nineteenth position (relative to the 5' terminal end) are each linked by a phosphodiester linkage. In some embodiments, 18 out of the 20 positions are linked by phosphorothioate linkages. In some embodiments, 18 out of the 20 positions are linked by phosphorothioate linkages, wherein the second position and third position (relative to the 5' terminal end) are linked by a phosphodiester linkage and the seventeenth position and eighteenth position (relative to the 5' terminal end) are linked by a phosphodiester linkage. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-52 (see Column A of Table 1). In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 22. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 29. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 50. In some embodiments, an RNA processing modulator comprising the gapmer structure reduces the levels of an APOE mRNA (e.g., a mature mRNA or a pre-mRNA) and / or an APOE protein by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.

[0120] In some embodiments, an antisense oligonucleotide (e.g., an ASO described herein) comprises or consists of a region that is complementary with the 3' UTR of an APOE RNA (see, e.g., FIG. 5). In some embodiments, an antisense oligonucleotide comprises or consists of a region with complementarity to the 3' UTR that is found 1-4000 nucleotides downstream of the last exon of an APOE RNA. In some embodiments, an antisense oligonucleotide comprises or consists of a region with complementarity to the 3' UTR that is found 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600- 700, 700-800, 800-900, 900-1,000, 1,000-1,100, 1,100-1,200, 1,200-1,300, 1,300-1,400, 1,400- 1,500, 1,500-1,600, 1,600-1,700, 1,700-1,800, 1,800-1,900, 1,900-2,000, 2,000-2,100, 2,100- 2,200, 2,200-2,300, 2,300-2,400, 2,400-2,500, 2,500-2,600, 2,600-2,700, 2,700-2,800, 2,800- 2,900, 2,900-3,000, 3,000-3,100, 3,100-3,200, 3,200-3,300, 3,300-3,400, 3,400-3,500, 3,500- 3,600, 3,600-3,700, 3,700-3,800, or 3,900-4,000 nucleotides downstream of the last exon of an APOE RNA. In some embodiments, the region of complementarity comprises or consists of 1- 20 nucleotides in length. In some embodiments, the region of complementarity comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the antisense oligonucleotide comprises one or more of the chemical modifications described herein. In some embodiments, the antisense oligonucleotide comprises the chemical modification pattern in Column C of Table corresponding to any one of the nucleotide sequences set forth in SEQ ID NOs: 1-52, as recited in Column A of Table 1. In some embodiments, the antisense oligonucleotide comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9,

[0121] 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 3, 5, 7, 11, 16, 29, 31, 34, 43, and 48-50, as recited in Column A of Table 1. In some embodiments, the antisense oligonucleotide comprises or consists of 1-20 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 3, 5, 7, 11, 16, 29, 31, 34, 43, and 48-50 (see Column A of Table 1) and the chemical modification pattern corresponding to any one of SEQ ID NOs: 1-52 set forth in Column C of Table 1. In some embodiments, the antisense oligonucleotide comprises or consists of 1-20 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 3, 5, 7,

[0122] 11, 16, 29, 31, 34, 43, or 48-50 (see Column A of Table 1) and the corresponding chemical modification pattern of said SEQ ID NO as set forth in the same row in Column C of Table 1. In some embodiments, the antisense oligonucleotide comprises 18-20 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 3, 5, 7, 11, 16, 29, 31, 34, 43, or 48-50 (see Column A of Table 1) and the following modification pattern: Full PS; 2' MOE. In some embodiments, the antisense oligonucleotide comprises 18 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 3, 5, 7, 11, 16, 29, 31, 34, 43, or 48-50 (see Column A of Table 1) and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end. In some embodiments, the antisense oligonucleotide comprises 20 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 3, 5, 7, 11, 16, 29, 31, 34, 43, or 48-50 (see Column A of Table 1) and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end. In any of the foregoing embodiments: positions comprising “T” residues comprise a thymine (T) nitrogenous base bonded to the 1' carbon of either ribose or deoxyribose; isolated nucleic acids comprising a gapmer structure are indicated by structures denoted “(X)-(Y)-(X)”, wherein “(X)” refers to regions comprising an ‘X’ number of nucleotide positions having ribose and which flank a region referred to as “(Y)” comprising a ‘Y’ number of nucleotide positions having deoxyribose; isolated nucleic acids comprising a skipper structure are indicated by the lack of notation reciting “(X)-(Y)-(X)” and each nucleotide position comprises ribose; “Full PS” refers to each nucleotide position linked by an internucleotide linkage comprising a phosphorothioate modification unless otherwise indicated by nucleotide positions comprising a phosphodiester group (PO) at the 3' carbon of ribose; “2'MOE” refers to the 2' carbon of ribose bonded to an oxygen atom which is bonded to a methoxyethyl group; “#mer” refers to the number of nucleotide positions; and “PO” refers to nucleotide positions, wherein the 3' carbon of ribose comprises a phosphodiester bond which links the nucleotide position to an immediately adjacent nucleotide position in the 3' direction, wherein nucleotide positions comprising a PO group (e.g., a position referred to as 2nd or 3rd from a 5’ or 3' terminal end) at the 3' carbon of ribose is indicated by the location of the PO group which is referred to either as being “at” or “after”.

[0123] In some embodiments, an antisense oligonucleotide (e.g., an ASO described herein) comprises or consists of a region with complementarity to a polyadenylation sequence of an APOE RNA. In some embodiments, the region of complementarity comprises or consists of 1- 20 nucleotides in length. In some embodiments, the antisense oligonucleotide comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the antisense oligonucleotide comprises one or more of the chemical modifications described herein. In some embodiments, the antisense oligonucleotide comprising the region of complementarity comprises the chemical modification pattern in Column C of Table 1 corresponding to any one of the nucleotide sequences set forth in SEQ ID NOs: 1-52, as recited in Column A of Table 1. In some embodiments, the region of complementarity comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides set forth in the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 34, as recited in Column A of Table 1. In some embodiments, the antisense oligonucleotide comprises or consists of 1-20 contiguous nucleotides of the nucleotide sequences set forth in SEQ ID NO: 5 or SEQ ID NO: 34 (see Column A of Table 1) and the chemical modification pattern of any one of SEQ ID NOs: 1-52 set forth in Column C of Table 1. In some embodiments, the antisense oligonucleotide comprises or consists of 1-20 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: 5 or SEQ ID NO: 34 (see Column A of Table 1) and the corresponding chemical modification pattern of said SEQ ID NO as set forth in the same row in Column C of Table 1. In some embodiments, the antisense oligonucleotide comprises 18-20 contiguous nucleotides of the nucleotide sequences set forth in SEQ ID NO: 5 or SEQ ID NO: 34 (see Column A of Table 1) and the following modification pattern: Full PS; 2' MOE. In some embodiments, the antisense oligonucleotide comprises 18 contiguous nucleotides of the nucleotide sequences set forth in SEQ ID NO: 5 or SEQ ID NO: 34 (see Column A of Table 1) and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end. In some embodiments, the antisense oligonucleotide comprises 20 contiguous nucleotides of the nucleotide sequences set forth in SEQ ID NO: 5 or SEQ ID NO: 34 (see Column A of Table 1) and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end. In any of the foregoing embodiments: positions comprising “T” residues comprise a thymine (T) nitrogenous base bonded to the 1' carbon of either ribose or deoxyribose; isolated nucleic acids comprising a gapmer structure are indicated by structures denoted “(X)-(Y)-(X)”, wherein “(X)” refers to regions comprising an ‘X’ number of nucleotide positions having ribose and which flank a region referred to as “(Y)” comprising a ‘Y’ number of nucleotide positions having deoxyribose; isolated nucleic acids comprising a skipper structure are indicated by the lack of notation reciting “(X)-(Y)-(X)” and each nucleotide position comprises ribose; “Full PS” refers to each nucleotide position linked by an intemucleotide linkage comprising a phosphorothioate modification unless otherwise indicated by nucleotide positions comprising a phosphodiester group (PO) at the 3' carbon of ribose; “2M0E” refers to the 2' carbon of ribose bonded to an oxygen atom which is bonded to a methoxyethyl group; “#mer” refers to the number of nucleotide positions; and “PO” refers to nucleotide positions, wherein the 3' carbon of ribose comprises a phosphodiester bond which links the nucleotide position to an immediately adjacent nucleotide position in the 3' direction, wherein nucleotide positions comprising a PO group (e.g., a position referred to as 2nd or 3rd from a 5’ or 3' terminal end) at the 3' carbon of ribose is indicated by the location of the PO group which is referred to either as being “at” or “after”.

[0124] In some embodiments, an antisense oligonucleotide (e.g., an ASO described herein) comprises or consists of a region with complementarity to sequences that span the boundary in the 3' UTR of an APOE RNA where the polyadenylation sequence begins. In some embodiments, the region of complementarity comprises or consists of 1-20 nucleotides in length. In some embodiments, the region of complementarity comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the region of complementarity comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides found in the 3' UTR that are not in a polyadenylation sequence. In some embodiments, the region of complementarity comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides found in the polyadenylation sequence. In some embodiments, the antisense oligonucleotide comprises one or more of the chemical modifications described herein. In some embodiments, the antisense oligonucleotide comprises the chemical modification pattern set forth in Column C of Table 1 corresponding to any one of the nucleotide sequences set forth in SEQ ID NOs: 1-52, as recited in Column A of Table 1. In some embodiments, the region of complementarity comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 1-52 (see Column A of Table 1) and the corresponding chemical modification pattern of said SEQ ID NO as set forth in the same row in Column C of Table 1. In some embodiments, the antisense oligonucleotide comprises 18-20 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 3, 5, 7, 11, 16, 29, 31, 34, 43, or 48-50 (see Column A of Table 1) and the following modification pattern: Full PS; 2' MOE. In some embodiments, the antisense oligonucleotide comprises 18 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 3, 5, 7, 11, 16, 29, 31, 34, 43, or 48-50 (see Column A of Table 1) and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end. In some embodiments, the antisense oligonucleotide comprises 20 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs: 3, 5, 7, 11, 16, 29, 31, 34, 43, or 48-50 (see Column A of Table 1) and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end. In any of the foregoing embodiments: positions comprising “T” residues comprise a thymine (T) nitrogenous base bonded to the 1' carbon of either ribose or deoxyribose; isolated nucleic acids comprising a gapmer structure are indicated by structures denoted “(X)-(Y)-(X)”, wherein “(X)” refers to regions comprising an ‘X’ number of nucleotide positions having ribose and which flank a region referred to as “(Y)” comprising a ‘Y’ number of nucleotide positions having deoxyribose; isolated nucleic acids comprising a skipper structure are indicated by the lack of notation reciting “(X)-(Y)-(X)” and each nucleotide position comprises ribose; “Full PS” refers to each nucleotide position linked by an internucleotide linkage comprising a phosphorothioate modification unless otherwise indicated by nucleotide positions comprising a phosphodiester group (PO) at the 3' carbon of ribose; “2M0E” refers to the 2' carbon of ribose bonded to an oxygen atom which is bonded to a methoxyethyl group; “#mer” refers to the number of nucleotide positions; and “PO” refers to nucleotide positions, wherein the 3' carbon of ribose comprises a phosphodiester bond which links the nucleotide position to an immediately adjacent nucleotide position in the 3' direction, wherein nucleotide positions comprising a PO group (e.g., a position referred to as 2nd or 3rd from a 5’ or 3' terminal end) at the 3' carbon of ribose is indicated by the location of the PO group which is referred to either as being “at” or “after”.

[0125] In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 1 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 2 and the following modification pattern: Full PS; 2' MOE; 4- 10-4; PO after 2nd from 5' end; PO after 3rd position from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 3 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 4 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 5 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 6 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 7 and the following modification pattern: Full PS; 2' MOE;

[0126] 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 8 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 9 and the following modification pattern: Full PS; 2' MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 10 and the following modification pattern: Full PS; 2' MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 11 and the following modification pattern: Full PS; 2’ MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 12 and the following modification pattern: Full PS; 2' MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 13 and the following modification pattern: Full PS; 2' MOE; 5-10-5; PO after 2nd from 5' end; PO after 3rd position from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 14 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 15 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 16 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 17 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 18 and the following modification pattern: Full PS; 2' MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 19 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 20 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end;

[0127] 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 21 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 22 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 23 and the following modification pattern: Full PS; 2' MOE; 4-10-4; PO after 2nd from 5' end; PO after 3rd position from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 24 and the following modification pattern: Full PS; 2' MOE; 5-10-5; PO after 2nd from 5' end; PO after 3rd position from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 25 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 26 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 27 and the following modification pattern: Full PS; 2' MOE;

[0128] 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 28 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 29 and the following modification pattern: Full PS; 2' MOE; 5-10-5; PO after 2nd from 5' end; PO after 3rd position from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 30 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 31 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 32 and the following modification pattern: Full PS; 2' MOE;

[0129] 5-10-5; PO after 2nd from 5' end; PO after 3rd position from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 33 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 34 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd from 5' end; PO after 3rd position from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 35 and the following modification pattern: Full PS; 2' MOE; 5-10-5; PO after 2nd from 5' end; PO after 3rd position from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 36 and the following modification pattern: Full PS; 2' MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 37 and the following modification pattern: Full PS; 2' MOE; 5-10-5; PO after 2nd from 5' end; PO after 3rd position from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 38 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 39 and the following modification pattern: Full PS; 2' MOE; 5-10-5; PO after 2nd from 5' end; PO after 3rd position from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 40 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 41 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 42 and the following modification pattern: Full PS; 2' MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 43 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 44 and the following modification pattern: Full PS; 2' MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 45 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 46 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 47 and the following modification pattern: Full PS; 2’ MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 48 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 49 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 50 and the following modification pattern: Full PS; 2' MOE; 5-10-5, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 51 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 52 and the following modification pattern: Full PS; 2' MOE; 4-10-4, PO after 2nd base from 5' end; PO after 3rd base from 3' end; 18mer. In any of the foregoing embodiments: positions comprising “T” residues comprise a thymine (T) nitrogenous base bonded to the 1' carbon of either ribose or deoxyribose; isolated nucleic acids comprising a gapmer structure are indicated by structures denoted “(X)-(Y)-(X)”, wherein “(X)” refers to regions comprising an ‘X’ number of nucleotide positions having ribose and which flank a region referred to as “(Y)” comprising a ‘Y’ number of nucleotide positions having deoxyribose; isolated nucleic acids comprising a skipper structure are indicated by the lack of notation reciting “(X)-(Y)-(X)” and each nucleotide position comprises ribose; “Full PS” refers to each nucleotide position linked by an intemucleotide linkage comprising a phosphorothioate modification unless otherwise indicated by nucleotide positions comprising a phosphodiester group (PO) at the 3' carbon of ribose; “2'MOE” refers to the 2' carbon of ribose bonded to an oxygen atom which is bonded to a methoxyethyl group; “#mer” refers to the number of nucleotide positions; and “PO” refers to nucleotide positions, wherein the 3' carbon of ribose comprises a phosphodiester bond which links the nucleotide position to an immediately adjacent nucleotide position in the 3' direction, wherein nucleotide positions comprising a PO group (e.g., a position referred to as 2nd or 3rd from a 5’ or 3' terminal end) at the 3' carbon of ribose is indicated by the location of the PO group which is referred to either as being “at” or “after”.

[0130] Pharmaceutical Compositions

[0131] In some embodiments of the disclosure, RNA processing modulators (e.g., antisense oligonucleotides) are formulated into compositions for therapeutic purposes. In some embodiments, the compositions are designed to enhance the therapeutic effect of the RNA processing modulators, for example by increasing biocompatibility, targeting the RNA processing modulator to a site of interest in vivo, reducing clearance of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo, increasing the stability of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo, increasing uptake of an isolated nucleic acid (e.g., an antisense oligonucleotide) in target cells, or amplifying the intended effect of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo. Such effects may also be enhanced in vitro or ex vivo.

[0132] In some embodiments, the RNA processing modulator (e.g., antisense oligonucleotide) is provided in combination with a pharmaceutically acceptable carrier. A “pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it may perform its intended function. Additional ingredients that may be included in the pharmaceutical compositions used in the practice of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference.

[0133] Methods and Medical Uses

[0134] Aspects of the disclosure relate to methods of modulating transcription, translation, function, and / or activity of genes associated with amyloid plaque formation in a cell or subject. In some embodiments, the methods comprise administering a composition comprising one or more RNA processing modulators as described herein (e.g., 1, 2, 3, 4, 5, or more RNA processing modulators, for example 1, 2, 3, 4, 5, or more antisense oligonucleotides) to a cell or subject. In some embodiments, there is provided one or more RNA processing modulators as described herein (e.g., 1, 2, 3, 4, 5, or more RNA processing modulators, for example 1, 2, 3, 4, 5, or more antisense oligonucleotides), e.g. in a composition, for use as a medicament. In some embodiments, there is provided the use of one or more RNA processing modulators as described herein (e.g., 1, 2, 3, 4, 5, or more RNA processing modulators, for example 1, 2, 3, 4, 5, or more antisense oligonucleotides), e.g. in a composition, for use for the manufacture of a medicament for the treatment of a disease described herein. In some embodiments, administration of the compositions (e.g., RNA processing modulators) results in an alteration (e.g., a decrease) of APOE levels, an alteration (e.g., a decrease) in the levels of one or more markers of neurodegeneration in the cell or subject, and / or an alteration (e.g., a decrease) of levels of one or more biological products associated with amyloid plaque formation in the subject. The cell may be in vivo, ex vivo, or in vitro.

[0135] For example, in some embodiments, administration of an RNA processing modulator (e.g., an antisense oligonucleotide) targeting APOE mRNA results in inhibition of amyloid plaque formation in the cell or subject. In some embodiments, administration of an RNA processing modulator (e.g., an antisense oligonucleotide) targeting APOE mRNA results in a decrease in production of one or more amyloidogenic markers in the cell or subject. The disclosure is based, in part, on the recognition that contacting a cell or subject with an RNA processing modulator that decreases transcription, translation, function or activity of APOE protein results in a decrease of one or more amyloidogenic markers in the subject.

[0136] Neurodegenerative diseases, including Alzheimer’s disease, is characterized by indicators, such as progressive dementia and loss of cognitive abilities. Such changes may manifest in a subject as, for example, memory loss, forgetfulness, increased anxiety, dysphoric or euphoric mood, apathy, disinhibition, and / or agitation. Non-limiting examples of neurodegenerative disease include dementia with Lewy Bodies, Early-Onset Alzheimer’s Disease, Late-Onset Alzheimer’s Disease, Sporadic late-onset Alzheimer’s Disease, APOE4- positive Alzheimer’s Disease, Familial Alzheimer’s Disease, frontotemporal disorders associated with neurodegeneration, Parkinson’s disease and / or cognitive decline in Parkinson’s disease, vascular dementia, and amyloid-related imaging abnormalities (ARIA).

[0137] The molecular pathology of Alzheimer’s disease is associated with amyloidogenic changes in cells of the central nervous system (CNS). Such changes include, without limitation, abnormal endosomal trafficking, increased amyloid plaque levels, and / or increased intracellular fibrillary tangles comprising hyperphosphorylated tau proteins. The mechanism of amyloid plaque biogenesis involves dysregulated processing of amyloid precursor protein (APP). For example, P-secretase- and y-secretase-dependent release of APP from endosomes enables cleavage and subsequent processing of APP into a form which is capable of binding other APP molecules, thereby forming plaques inside of the cell. A number of proteins are associated with amyloidogenic processing of APP. For example, increased levels and / or activity of amyloid P- peptide species, such as Ap38, Ap40, and Ap42, are markers of amyloidogenesis. Additionally, various proteins involved in endosomal trafficking, such as SORL1, VPS26, and VPS35, are understood to generate soluble APPa which is non-amyloidogenic.

[0138] APOE mutations are associated with cellular mechanisms of neurodegeneration. For instance, APOE has been shown to be involved in deposition of fibrillar amyloid proteins as intraneuronal neurofibrillary tangles, extracellular amyloid plaques, and vascular amyloid deposits. APOE was also found to co-localize with amyloid plaques comprising Ap proteins. Moreover, APOE has been associated with modulating amyloid plaque size and toxicity by promoting amyloidosis during the early stages of Ap plaque formation and impairing clearance of plaques from the brain interstitial fluid.

[0139] Accordingly, in some aspects, the disclosure provides a method for decreasing one or more amyloidogenic markers in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-52 (provided in Column A of Table 1, optionally comprising one or more modifications in Column C of Table 1, and optionally wherein the sequence in Column A and the chemistry in Column C are provided in the same row of Table 1). In some embodiments, the isolated nucleic acid (e.g., antisense oligonucleotide) is administered as a monotherapy. In some embodiments, the isolated nucleic acid (e.g., antisense oligonucleotide) is administered as a component of a combination therapy with one or more additional therapeutic agents (e.g., one or more selective serotonin reuptake inhibitors (SSRIs), other antidepressants, or antipsychotics).

[0140] Generally, it is desirable to inhibit amyloid (or tau) plaque formation (e.g., by reducing APOE levels, transcription, splicing, and / or translation) in certain subjects (e.g., subjects having certain neurodegenerative diseases or disorders, for example Alzheimer’s disease or dementia with Lewy Bodies, Parkinson’s disease and / or cognitive decline in Parkinson’s disease, vascular dementia, frontotemporal disorders associated with neurodegeneration, amyloid-related imaging abnormalities (ARIA), etc.). However, it should be appreciated that, in some embodiments, the disclosure provides a method for increasing APOE function and / or activity in a cell or subject (e.g., by increasing APOE levels, transcription, splicing, and / or translation), the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises or consists of an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-52 (provided in Column A of Table 1, optionally comprising one or more modifications in Column C of Table 1, and optionally wherein the sequence in Column A and the chemistry in Column C are provided in the same row of Table 1).

[0141] In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator described herein, such as an ASO described herein) binds to an mRNA expressed from a particular allele of APOE (e.g., binds to a target mRNA in an allele- specific manner).

[0142] In some aspects, RNA processing modulators (e.g., antisense oligonucleotides) described by the disclosure are useful for treating a disease or disorder associated with amyloid plaque formation. Thus, in some aspects, provided herein are RNA processing modulators (e.g., antisense oligonucleotides) described by the disclosure for use in a method of treating and / or preventing a disease or disorder associated with amyloid plaque formation. A disease or disorder associated with amyloid plaque formation refers to a disease or disorder in which the subject (e.g., patient) is 1) characterized as having increased amyloid plaques and / or intracellular fibrillary tangles comprising hyperphosphorylated tau proteins, and / or 2) has one or more mutations in one or more genes associated with amyloid plaque formation, and / or 3) has one or more mutations in one or more genes that are involved in a pathway that degrades, synthesizes, and / or traffics APP. In some embodiments, the amyloid P-peptide species comprises Ap38, Ap40, and / or Ap42. In some embodiments, amyloid plaque formation comprises altered levels and / or activity of SORL1, VPS26, and / or VPS35. In some embodiments, the disease is Alzheimer’s disease or dementia with Lewy Bodies. Treatment and / or prevention may comprise decreasing a level, transcription, splicing, and / or translation of ApoE in a cell or subject, and / or reducing amyloid plaque formation.

[0143] In some embodiments, markers of amyloid plaque formation comprise altered levels and / or activity of APP and / or regulators of APP processing. In some embodiments, altered APP processing during amyloid plaque formation comprises increases in the levels and / or activity of amyloid P-peptide species. In some embodiments, the amyloid P-peptide species comprises Ap38, Ap40, and / or Ap42. In some embodiments, altered APP processing during amyloid plaque formation comprises altered levels and / or activity of SORL1, VPS26, and / or VPS35. In some embodiments, amyloid plaque formation and / or intracellular tangles comprising hyperphosphorylated tau proteins is revealed by assaying single photon emission computed tomography or positron emission tomography.

[0144] Methods of measuring protein levels and / or activity in a cell or subject are known in the art. In some embodiments, the level of Ap38, Ap40, Ap42, soluble APPa, and / or amyloid plaques produced by cells (e.g., cells in a subject) is determined by measuring the concentration of soluble APPa, and / or amyloid plaques in a sample (e.g., a biological sample obtained from the subject, for example a blood sample, serum sample, cerebrospinal fluid (CSF) sample, etc.).

[0145] Methods of measuring cholesterol levels in a subject are known in the art. In some embodiments, the cholesterol level in a subject is determined by measuring the concentration of cholesterol, or lipoprotein particles comprising cholesterol, in a sample (e.g., a biological sample obtained from the subject, for example a blood sample, serum sample, cerebrospinal fluid (CSF) sample, etc.).

[0146] In some embodiments, a subject has one or more mutations in an APOE gene. In some embodiments, a subject having one or more mutations in an APOE gene has (or is at risk of developing) a neurodegenerative disease or disorder. Methods of detecting mutations in a subject’s genes are known in the art and include, for example DNA sequencing, RNA sequencing, microarray analysis, etc.

[0147] In some embodiments, a subject having a disease or disorder associated with amyloid plaque formation comprises one or more mutations in one or more other genes that are involved in neurodegeneration. Examples of other genes involved in neurodegeneration include those encoding amyloid precursor protein (APP), SORL1, VPS26, VPS35, etc.

[0148] Accordingly, in some aspects, the disclosure provides a method for treating a disease or disorder associated with amyloid plaque formation, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. Also provided is an RNA processing modulator (e.g., antisense oligonucleotide) described by the disclosure for use in a method of treating a disease or disorder associated with amyloid plaque formation. The method may comprise administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising or consisting of the sequence set forth in any one of SEQ ID NOs: 1-52 (provided in Column A of Table 1, optionally comprising one or more modifications in Column C of Table 1, and optionally wherein the sequence in Column A and the chemistry in Column C are provided in the same row of Table 1). In some embodiments, the disease is Alzheimer’s disease or dementia with Lewy Bodies.

[0149] As used herein “treat” or “treating” refers to preventing or delaying disease onset, reducing or preventing the development of symptoms associated with a disease, reducing the severity of a disease, and / or preventing the worsening of symptoms associated with a disease. Accordingly, in some aspects, the disclosure provides a method for treating a subject having or suspected of having a disease caused by amyloid plaque formation. Treatment of a subject involves administration of a composition to the subject (e.g., an RNA processing modulator, such as an antisense oligonucleotide) as described herein. As used herein, the term “treating” refers to the application or administration of a composition (e.g., an RNA processing modulator, such as an antisense oligonucleotide as described herein) to a subject who has a disease or disorder associated with amyloid plaque formation, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disorder, the symptom of the disease, or the predisposition toward the disease.

[0150] Alleviating a disease associated with amyloid plaque formation includes preventing or delaying the development or progression of the disease, or reducing disease severity. Alleviating the disease does not necessarily require curative results. As used therein, "delaying" the development of a disease (such as a disease associated with amyloid plaque formation) means to deter, hinder, slow, retard, stabilize, and / or postpone progression of the disease. This delay can be of varying lengths of time, depending on the history of the disease and / or individuals being treated. A method that "delays" or alleviates the development of a disease, or delays the onset of the disease, is a method that reduces probability of developing one or more symptoms of the disease in a given time frame and / or reduces extent of the symptoms in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a number of subjects sufficient to give a statistically significant result.

[0151] "Development" or "progression" of a disease means initial manifestations and / or ensuing progression of the disease. Development of the disease can be detectable and assessed using standard clinical techniques as well known in the art. However, development also refers to progression that may be undetectable. For purpose of this disclosure, development or progression refers to the biological course of the symptoms. "Development" includes occurrence, recurrence, and onset. As used herein "onset" or "occurrence" of a disease associated with amyloid plaque formation.

[0152] A subject may be a human, a mouse, a rat, a pig, a dog, a cat, or a non-human primate. In some embodiments, a subject has or is suspected of having a disease or disorder associated with amyloid plaque formation. In some embodiments, a subject having a disease or disorder associated with amyloid plaque formation comprises at least one APOE allele having a mutation. In some embodiments, an APOE allele having a mutation (e.g., a mutation associated with amyloid plaque formation, such as an APOE loss-of-function mutation or other mutation that causes aberrant APOE function or activity including, for example, a mutation associated with Alzheimer’s disease or dementia with Lewy Bodies) comprises a frameshift mutation, a splice site mutation, a missense mutation, a truncation mutation or a nonsense mutation. A subject may have two APOE alleles having the same mutations (homozygous state) or two APOE alleles having different mutations (compound heterozygous state). The optimal course of administration or delivery of the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may vary depending upon the desired result and / or on the subject to be treated. As used herein “administration” refers to contacting cells with an RNA processing modulator and can be performed in vitro or in vivo. Compositions (e.g., pharmaceutical compositions) provided herein can be administered a number of routes including, but not limited to, by oral administration, intravenous administration (e.g., systemic intravenous injection / administration), administration to the brain and / or spinal cord, intracerebral injection, intraventricular injection, intracerebroventricular (ICV) injection, intracistemal injection, intraparenchymal injection, intrathecal injection, and any combination of the foregoing. In some embodiments, administration comprises administration to cerebral spinal fluid, and / or direct administration to an affected site (e.g., a target tissue, for example central nervous system (CNS) tissue, or peripheral nervous system (PNS) tissue).

[0153] In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract), and / or the condition of the subject (e.g., whether the subject is able to tolerate oral administration, injection, etc.). In some embodiments, administration (e.g., injection) of a compound or pharmaceutical composition is performed on a patient in a Trendelenburg position. In some embodiments, compositions are administered to a subject through only one administration route. In some embodiments, multiple administration routes may be exploited (e.g., serially, or simultaneously) for administration of the composition to a subject.

[0154] In some embodiments, it may be desirable to deliver the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure to the CNS of a subject. By “CNS” is meant all cells and tissue of the brain and spinal cord of a vertebrate. Thus, the term includes, but is not limited to, neuronal cells, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone, cartilage and the like. RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may be delivered directly to the CNS or brain by injection into, e.g., the ventricular region, as well as to the striatum (e.g., the caudate nucleus or putamen of the striatum), spinal cord and neuromuscular junction, or cerebellar lobule, with a needle, catheter or related device, using neurosurgical techniques known in the art, such as by stereotactic injection (see, e.g., Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000). In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intravenous injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intracerebral injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intracerebroventricular (ICV) injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intrathecal injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intrastriatal injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by intracranial injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by cistema magna injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by cerebral lateral ventricle injection. The skilled artisan will also recognize that the foregoing administration routes may be combined in a single subject (e.g., a subject may be administered RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure using a combination of two or more of the foregoing techniques).

[0155] In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA) is administered to a subject. In some embodiments, an effective amount of an RNA processing modulator (e.g., antisense oligonucleotide) is an amount sufficient to increase transcription, translation, function, and / or activity of a target mRNA (e.g., of a desired mutant, variant, and / or allele). In some embodiments, an effective amount of an RNA processing modulator (e.g., antisense oligonucleotide) is an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA (e.g., of an undesired mutant, variant, and / or allele). The effective amount will depend primarily on factors, such as the species, age, weight, health of the subject, and the tissue to be targeted, and may thus vary among animal and tissue. In some embodiments, an effective amount can be a combination of an effective dosage, frequency, and duration for administration.

[0156] In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1 ng-500 mg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1-1000 ng. In some embodiments, an effective amount of (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1-10, 10-50, 50-100, 100- 200, 200-300, 300-500, 500-750, or 750-1000 ng. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 0.1 pg-100.0 pg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) 0.1-1.0, 1.0-5.0, 5.0-20.0, 20.0-50.0, or 50.0-100.0 pg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1 pg-1000 pg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 100-250, 250-500, 500-750, or 750-1000 pg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 0.1-1.0, 1.0-20.0, 20.0-50.0, 50.0-200.0, or 200.0-500.0 mg.

[0157] During the course of treatment, administration of the composition may be altered or adjusted accordingly. For example, expression of the protein encoded by the nucleic acid targeted by the isolated nucleic acid of the pharmaceutical composition may be monitored to inform methods of use of the composition. Expression information may be obtained, for example, through measuring changes in the levels of the protein or RNA products of the target nucleic acid. Alternatively, sequencing analyses of the target nucleic acid may be employed to determine if expression changes include alterations in the structure or sequence of the protein or RNA product of the target nucleic acid sequence.

[0158] The amount of the composition will vary depending on a number of factors such as, but not limited to, clinical features (e.g., disease severity, rate of disease progression, physical characteristics, etc.) of a subject and the mode of administration. Accordingly, the composition may, in certain instances, be administered once or more than one to a single subject. In certain instances, the composition may be administered to the same subject through different modes or routes at different times during the treatment process.

[0159] EXAMPLES

[0160] Example 1: RNA Processing Modulators (RPMs) This example describes the use of RNA Processing Modulators (RPMs) for modulating translation of one or more mRNA transcripts in a cell or subject. RPMs function by binding to a target- specific mRNA sequence and altering (e.g., upregulating or down-regulating) translation of protein of the mRNA sequence.

[0161] In some embodiments, an RPM is an antisense oligonucleotide (ASO). Antisense oligonucleotides (ASOs) typically range from about 10 to 30 nucleotides in length, and may comprise a non-natural sugar-phosphate backbone (e.g., phosphorodiamidate morpholino backbone, phosphorothioate backbone, etc.) and / or one or more modified sugar moieties (e.g., 2'-O-methoxyethyl ribose (2'-0-M0E) modifications, etc.).

[0162] In some embodiments, an RPM (e.g., an ASO, e.g., as described herein) targets a structural element of an mRNA transcript, for example an untranslated region (UTR) to modulate the expression of the target (e.g., the target gene encoding the mRNA transcript) by increasing or decreasing transcription and / or translation of the protein encoded by the mRNA transcript (alternatively referred to as modulating expression in the up or the down direction. In another example, an RPM (e.g., an ASO, e.g., as described herein) may target a regulatory region (and thus interfere with protein binding, such as ribosomal protein binding) of a UTR region to modulate the expression of the target in the up or the down direction. Alternatively, an RPM (e.g., an ASO, e.g., as described herein) may target a splice site (e.g., a splice acceptor site or a splice donor site or one or more nucleotide positions thereof in a UTR region) to modulate the expression of the target in the up or the down direction (and thus generating novel protein variants). Additional examples of structural elements that can be targeted by RPMs (e.g., ASOs) include, but are not limited to, intronic regulatory sites, exonic regulatory sites, exon-intron boundaries, antisense binding sites of a target mRNA transcript, long-non-coding RNA (LncRNA) binding sites of a target gene, and a retained exon of a canonical mRNA.

[0163] Non-limiting examples of ASOs targeting various structural elements of an mRNA are show in FIG. 1. Composition “A” represents an ASO that binds to the 5' untranslated region (5' UTR) of an RNA. Composition “B” represents an ASO that binds to an intron of an RNA. Composition “C” represents an ASO that binds to a splice boundary (e.g., a splice junction) between an exon and intron of an RNA. Composition “D” represents an ASO that binds to an exon (e.g., protein coding region) of an RNA. Composition “E” represents a combination of an ASO binding to a 3' UTR of an RNA, alone or with a trans-regulator. Composition “F” represents a “gapmer” ASO that binds to an exon (e.g., a protein coding region) of an RNA and mediates RNaseH decay. Composition “G” represents a “gapmer” ASO that binds to a 3' UTR of an RNA, alone or with a trans-regulator, and mediates RNaseH decay. In some embodiments, ASOs binding to an RNA result in translation of a truncated protein that has a dominant negative effect on the wild-type, full-length protein.

[0164] Example 2: Lipid Homeostasis Regulators and Neurodegenerative Disease

[0165] This example describes diseases and disorders that area associated with amyloid plaque formation, particularly diseases and disorders associated with neurodegeneration. Neurodegenerative diseases, including Alzheimer’s disease, is characterized by indicators, such as progressive dementia and loss of cognitive abilities. Such changes may manifest in a subject as, for example, memory loss, forgetfulness, increased anxiety, dysphoric or euphoric mood, apathy, disinhibition, and / or agitation. Non-limiting examples of neurodegenerative disease include dementia with Lewy Bodies, Early-Onset Alzheimer’s Disease, Late-Onset Alzheimer’s Disease, Sporadic late-onset Alzheimer’s Disease, APOE4-positive Alzheimer’s Disease, Familial Alzheimer’s Disease, frontotemporal disorders associated with neurodegeneration, Parkinson’s disease and / or cognitive decline in Parkinson’s disease, vascular dementia, and amyloid-related imaging abnormalities (ARIA).

[0166] The molecular pathology of Alzheimer’s disease is associated with amyloidogenic changes in cells of the central nervous system (CNS). Such changes include, without limitation, abnormal endosomal trafficking, increased amyloid plaque levels, and / or increased intracellular fibrillary tangles comprising hyperphosphorylated tau proteins. The mechanism of amyloid plaque biogenesis involves dysregulated processing of amyloid precursor protein (APP). For example, P-secretase- and y-secretase-dependent release of APP from endosomes enables cleavage and subsequent processing of APP into a form which is capable of binding other APP molecules, thereby forming plaques inside of the cell. A number of proteins are associated with amyloidogenic processing of APP. For example, increased levels and / or activity of amyloid P- peptide species, such as Ap38, Ap40, and Ap42, are markers of amyloidogenesis. Additionally, various proteins involved in endosomal trafficking, such as SORE1, VPS26, and VPS35, are understood to generate soluble APPa which is non-amyloidogenic.

[0167] Accordingly, in some embodiments, markers of amyloid plaque formation comprise altered levels and / or activity of APP and / or regulators of APP processing. In some embodiments, altered APP processing during amyloid plaque formation comprises increases in the levels and / or activity of amyloid P-peptide species. In some embodiments, the amyloid P- peptide species comprises Ap38, Ap40, and / or Ap42. In some embodiments, altered APP processing during amyloid plaque formation comprises altered levels and / or activity of SORE1, VPS26, and / or VPS35. In some embodiments, amyloid plaque formation and / or intracellular tangles comprising hyperphosphorylated tan proteins is revealed by assaying single photon emission computed tomography or positron emission tomography.

[0168] APOE mutations are associated with cellular mechanisms of neurodegeneration. For instance, APOE has been shown to be involved in deposition of fibrillar amyloid proteins as intraneuronal neurofibrillary tangles, extracellular amyloid plaques, and vascular amyloid deposits. APOE was also found to co-localize with amyloid plaques comprising Ap proteins. Moreover, APOE has been associated with modulating amyloid plaque size and toxicity by promoting amyloidosis during the early stages of Ap plaque formation and impairing clearance of plaques from the brain interstitial fluid.

[0169] Example 3: ASOs targeting APOE

[0170] This example describes design of RPMs (e.g., ASOs) that target human APOE. In the context of diseases associated with neurodegeneration, it is desirable to decrease protein levels of apolipoprotein E (APOE) (e.g., by decreasing a level, transcription, splicing, and / or translation of APOE mRNA or by decreasing activity of APOE protein). In some embodiments, ASOs are designed to target regions of APOE mRNA that will result in decreased levels, transcription, splicing, and / or translation of APOE, decreased APOE mRNA levels, and / or decreased activity of APOE protein.

[0171] Embodiments of antisense oligonucleotides (ASOs) targeting APOE mRNA are described in Table 1. In some embodiments, the ASOs comprise one or more chemical modifications and / or comprise a non-natural sugar-phosphate backbone (e.g., a phosphorothioate backbone). In some embodiments, the ASO has a “gapmer” structure.

[0172] Example 4: In vitro screening of ASOs

[0173] Cell lines (e.g., HepG2 human hepatocarcinoma cells) were cultured and maintained using appropriate media (e.g., Dulbecco's Modified Eagle's Medium containing 10% fetal bovine serum). When appropriate, several approaches were used to generate in vitro models for assessment of apolipoprotein E (APOE) function. For instance, cell lines may be engineered to stably express APOE. When appropriate, cells were selected based on APOE expression.

[0174] A screen of ASOs targeting APOE RNA (Table 1) was performed in 96 well plate format, seeding about 20,000 cells per well and treating with the ASOs at different concentrations of 5 nM and 20 nM using the RNAiMAX Lipofectamine protocol. Each concentration was transfected in 2 independent wells for biological duplicates. Two different ASO chemistries were assayed for targeting of APOE RNA. A non-targeting ASO sequence with matched chemistry and length was used as a negative control, in addition to mock transfected wells treated with PBS or water. Cells were incubated at 37 °C in a cell culture incubator for 48 hours before isolating the total RNA for measurement of gene expression. Total RNA was isolated and evaluated using a TaqMan™ Fast Advanced Cells-to-CT™ kit (ThermoFisher A35378), as per the manufacturer’s instructions. The qPCR reaction was multiplexed with probes targeting APOE and the housekeeping gene hypoxanthine guanine phosphoribosyltransferase 1 (HPRTI) as an internal control. Cycle threshold (Ct) values generated for both APOE and HPRT1 were used in order to quantify APOE gene modulation.

[0175] APOE gene expression levels were analyzed using the Delta-Delta Ct method. For each sample, APOE gene expression levels, provided as cycle threshold (Ct) values, were normalized to the housekeeping gene HPRT1 (2-(AP0E Ct - HPRT1 Ct)). APOE expression relative to controls was then calculated for each sample based on the mean values of non-transfected control wells treated with water within each plate and shown as a percentage ((Sample / Control Mean) * 100). Resulting values for all treatment groups are shown in FIG. 2A.

[0176] Sixteen (16) ASOs resulted in a decrease in APOE RNA expression by more than 50% at the 5 nM dose. The effects of 16 of the most potent ASOs of either ASO chemistry at the 5 nM dose and the 20 nM dose are shown in FIGs. 2A-2B.

[0177] Sixteen (16) potent antisense ASOs of two different chemistries targeting APOE were selected from the two-concentration screen for further testing in multi-concentration response analysis and tested in an 8-dose response analysis.

[0178] Cells plated in 96-well plates were transfected using the RNAiMAX Lipofectamine protocol. Each ASO was transfected at 8 concentrations (40 nM, 20 nM, 10 nM, 5 nM, 2.5 nM, 1.25 nM, 0.625 nM, and 0.3125 nM), and each concentration was transfected in 3 independent wells for biological triplicates. Non-targeting ASOs were used as negative controls for the transfection as well as a mock transfected well. After a 48-hour incubation period, transfected cells were assayed for gene expression. mRNA levels were evaluated by quantitative reverse transcription polymerase chain reaction (RT-qPCR). Cells were assayed using TaqMan™ Fast Advanced Cells-to-CT™ kit (ThermoFisher A35378), as per vendor's protocol. The qPCR reaction was multiplexed with probes targeting APOE and the housekeeping HPRT1 gene as an internal control. Cycle threshold (Ct) values generated for both APOE and HPRT1 were used for analysis.

[0179] APOE gene expression levels were analyzed using the Delta-Delta Ct method. For each sample, APOE gene expression levels, provided as cycle threshold (Ct) values, were normalized to the housekeeping gene HPRT1 (2-(APOE Ct - HPRT1 Ct)). APOE expression relative to controls was then calculated for each sample based on the mean values of non-transfected control wells treated with water within each plate and shown as a percentage ((Sample / Control Mean) * 100). The 16 tested ASOs displayed concentration-dependent APOE mRNA knockdown (FIG. 3A). Among these, 6 ASOs showed EC50 values below 20 nM (FIGs. 3B- 3C), 1 ASO an EC50 below 5 nM in HepG2 cells (FIG. 3C, square in bottom left comer of the plot).

[0180] The effect of these ASOs on modulation of pathways associated with neurodegeneration may further be measured. Upon treatment of cells (e.g., cells comprising mutations in associated with Alzheimer’s disease, such, as APOE mutations) with ASOs, the levels of amyloid plaques are profiled by methods well known in the art (e.g., as described by Mavrogiorgou et al. Psychiatria Danubina Vol 23, No. 4: 334-339 (2011) and in Lamy et al. Neuropathology and Applied Neurobiology Vol. 15, Issue 6: 563-578 (1989). Briefly, silver staining is an established approach for visualizing amyloid plaques using stains including, but not limited to, Galiyas, Bielschowsky, or Campbell. Alternatively, immunological detection of amyloid plaques includes, but is not limited, to using antibodies against the amyloid plaque protein Ap4 or amyloids- specific Congo red stain. To further characterize ASO-dependent changes in APOE function, cytotoxicity is measured to understand the physiological impact of changes in APOE transcript levels. Cell viability is measured by generating survival curves through manually counting Trypan blue staining of cells following ASO treatment. Alternatively, propidium iodide staining of cells followed by flow cytometry analysis is used to measure cell death.

[0181] Example 5: In Vivo ASO Methods

[0182] A rodent model of Alzheimer’s disease (e.g., APPPS1-21 mice comprising overexpression of mutant APP and mutant PSEN1 genes and knock-in of human APOE allele) may be used. Animals are maintained in a consistent light and dark cycle and allowed to acclimate for at least five days prior to experiments. Regular feedings are executed at a consistent time, frequency, and amounts each day. ASOs targeting APOE are administered to the animals by infusion. When multiple ASO infusions are performed, administration of the ASO is done at the same time each day to minimize changes in metabolism due to circadian rhythm. ASO infusions are either directly provided to the affected area or into the cerebral spinal fluid (CSF). Animals may be placed in the Trendelenburg position during and after the infusion to aid in distribution of the ASOs into the tissue (e.g., CNS tissue) of the animals. ASOs are solubilized in an appropriate buffer and sterilized prior to infusions. Following infusions, animals are maintained for a predetermined period of time prior to analysis. In some instances, animals are fed a diet with radioactive lipids (e.g., cholesterol) to determine the extent of lipid homeostasis. To analyze the effect of ASO treatment, animals are anesthetized, and tissue is harvested. Harvested tissue samples are flash frozen in appropriate extraction buffers. Blood samples are isolated, when appropriate, and mixed with buffer for preservation purposes.

[0183] Harvested tissue samples are cryosectioned and used for immunohistochemistry analysis. Tissue samples are used for measuring soluble APPa and / or amyloid plaque levels.

[0184] Example 6: In Vivo Knockdown of APOE mRNA in Mouse Subjects

[0185] This example describes in vivo knockdown of APOE mRNA using ASOs described herein. Briefly, six- week old mice (B6(SJL)-Apoefm7^O£*4,Adl“77j) comprising knock-in of human APOE4, wherein exons 2, 3, and 4 of mouse Apoe are replaced with humans exons 2, 3, 4, and 3' UTR elements, were administered a single ICV injection of APOE ASO, and mRNA levels were quantified in the brain tissue (samples harvested from from Left Cortex 1 and Left Hippocampus) two-weeks post- ICV injection. Frozen tissues were lysed and homogenized in RLT buffer using beads (MP Biomedical) before RNA extraction using RNeasy Mini Kit (Qiagen) in a QIAcube station (Qiagen). RNA concentration was evaluated a nanodrop spectrometer (ThermoFisher), integrity using 2100 Bioanalyzer LabChip (Agilent). 500ng of RNA was reverse-transcribed using SuperScript IV VILO Master Mix ezDNase (Invitrogen). qPCR was performed with TaqMan Fast Advance Master Mix (Invitrogen) in a Quantstudio thermocycler (Applied Biosystems) with 2 independent Taqman (VIC) assays for APOE (TF Hs00171168_ml, TF Hs03037354_mH). PGK1, PPIA, and GAPDH levels were measured using a Taqman (FAM) assay (Mm00435617_ml, TF Mm99999915_gl, Thermofischer) for normalization using DeltaDeltaCt method.

[0186] FIGs. 4A-4B show representative data for in vivo reduction of APOE mRNA levels in mouse brain. FIG. 4A shows relative APOE mRNA levels in cortex tissues of mouse subjects two weeks after a single ICV injection of vehicle (artificial CSF) or APOE ASO 1 at a dose of 100 ug or 200 ug. FIG. 4B shows relative APOE mRNA levels in hippocampus tissues of mouse subjects two weeks after a single ICV injection of vehicle (artificial CSF) or APOE ASO 1 at a dose of 100 ug or 200 ug. “APOE ASO 1” comprises the nucleotide sequence of SEQ ID NO: 29, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 30 of Table 1. Values were averaged across 2 technical replicates and shown as a percentage of the vehicle-control group. Statistical analysis was performed using a linear model comparing treatment groups to the aCSF group and adjusting for RNA isolation batch (*:p<0.05, **:p<0.01, ***:p<0.001). 0% knockdown and 50% knockdown are indicated by dashed lines (black and grey, respectively). N = 3 and 2 for vehicle- and APOE ASOl-injected animals, respectively.

[0187] In the single ICV injection study, some animals exhibited minor acute in-life observations post administration of vehicle or APOE ASO 1, which were largely resolved in 1-2 hours. No major effects on life were observed in treated animals. Moreover, single ICV injection of APOE ASO 1 resulted in APOE mRNA knockdown by 25-40% in both the cortex and hippocampus (FIGs. 4A-4B).

[0188] Example 7: Immuno stimulatory Effects ofASOs In Vitro

[0189] This Example describes analyses of immunostimulatory effects of APOE ASOs in human peripheral blood mononuclear cells (huPBMCs).

[0190] All ASOs were prepared using in vivo quality grade material. huPBMCs were harvested from healthy donors and went either untreated, treated with a cytokine / chemokine response control agent, or treated with APOE ASO 1 (comprises the nucleotide sequence of SEQ ID NO: 29, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 30 of Table 1) at a concentration of IpM, 3pM, or lOpM for 24 hours.

[0191] Cytokine / chemokine response control agents included: XD-01024, a cholesterol- conjugated ApoB siRNA which has TLR7 / 8 agonist effects; CL097, a water-soluble derivative of imidazoquinoline compound R848 which is a TLR7 / 8 ligand; Imiquimod (R837), an immune response modifier having potent antiviral activity and also induces production of cytokines and activates TLR7; ODN2216 a 20mer oligo containing unmethylated CpG and has TLR9 agonist effects; ODN2006 having preference towards TLR9, one or more CpGs, class B; ODN2395 , TLR9, CpG with palindromic motif, class C; TL8-506, a benzoazepine compound which has TLR8 agonist effects; LMW poly(l:c) which has TLR3 agonist effects; and XD-00366, a 25mer double-stranded, unmodified, blunt-ended LacZ RNA duplex which has TLR7 / 8 agonist effects.

[0192] Following treatment of huPBMCs, the levels of IFN-a2a, IFN-b, IL- IB, IL-6, IL- 10, IP- 10, MCP-1, MIP-la, MIP-lb and TNF-a were measured using the MSD-U-Plex platform. Representative data from these analyses are shown in FIGs. 6A-6J. Negative control cells exhibited minimal increases or no detectable increase in chemokine / cytokine levels following treatment. Treatment with TLR agonist positive controls resulted in increased chemokine / cytokine levels as expected. When compared relative to cell samples treated under negative or positive control conditions, no immunogenic responses to APOE ASO detected (FIGs. 6A-6J).

[0193] Example 8: In Vivo ASO Administration to Non-Human Primates

[0194] This example describes in vivo administration of APOE ASOs to cynomolgus monkey (Macaca Jascicularis) subjects (also referred to as “non-human primate subjects”) and analyses of in vivo pharmacokinetics (ASO levels). Briefly, three male non-human primate subjects were administered a series of four intrathecal (“IT”) injections of either vehicle (artificial CSF) or ASO (“APOE ASO 1” comprises the nucleotide sequence of SEQ ID NO: 29, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 30 of Table 1) at a dose of 80 mg (20 mg+20 mg+20 mg+20 mg). For all non-human primate subjects, each round of IT injection was performed two weeks apart (days 0, 14, 28, and 42). Samples of cerebrospinal fluid as well as brain (frontal cortex, sensory cortex, and hippocampus), lumbar spinal cord, dorsal root ganglion, kidney, liver, spleen, heart, stomach, and gonads tissues were collected at two weeks following the last IT injection (FIG. 7). Liquid chromatography-tandem mass spectrometry (LC-MS / MS) analysis was used to measure ASO pharmacokinetics (ASO levels) in tissue samples obtained from injected non-human primates. ASO concentrations in tissue samples were quantified to determine ASO levels as a result of IT injection (FIG. 8).

[0195] EQUIVALENTS

[0196] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.

[0197] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0198] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document. The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”

[0199] The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

[0200] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0201] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and / or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0202] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0203] In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of’ and “consisting essentially of’ shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of’ and “consisting essentially of’ the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B”, the disclosure also contemplates the alternative embodiments “a composition consisting of A and B” and “a composition consisting essentially of A and B”.

Claims

CLAIMSWhat is claimed is:

1. An isolated nucleic acid that comprises a region of complementarity with a human APOE mRNA transcript, a nucleotide sequence that is at least 60% identical to any one of the nucleotide sequences set forth in any one of SEQ ID NOs: 1-52, and upon binding to the mRNA transcript decreases transcription, splicing, and / or translation of functional apolipoprotein E (APOE) protein encoded by the mRNA transcript.

2. The isolated nucleic acid of claim 1, wherein the isolated nucleic acid comprises RNA.

3. The isolated nucleic acid of claim 1 or 2, wherein the isolated nucleic acid is an antisense oligonucleotide.

4. The isolated nucleic acid of any one of claims 1 to 3, comprising or consisting of between 10 and 40 nucleotides.

5. The isolated nucleic acid of claim 4, wherein the isolated nucleic acid comprises or consists of between 18 and 25 nucleotides.

6. The isolated nucleic acid of any one of claims 1 to 5, wherein the isolated nucleic acid comprises one or more chemical modifications.

7. The isolated nucleic acid of claim 6, wherein the one or more chemical modifications comprise one or more nucleoside modifications and / or one or more sugar-phosphate backbone modifications.

8. The isolated nucleic acid of claim 7, wherein the one or more nucleoside modifications comprises a 2'-O-methyl (2'-0Me) modification, a 2'-O-methoxyethyl (2'-0-M0E) modification, a 2'-O-fluoro modification, or a locked nucleic acid (LNA) modification.

9. The isolated nucleic acid of claim 7 or 8, wherein the one or more sugar-phosphate backbone modifications comprises a phosphorothioate backbone modification.

10. The isolated nucleic acid of any one of claims 1 to 9, wherein the isolated nucleic acid is fully chemically modified.

11. The isolated nucleic acid of any one of claims 1 to 10, wherein the isolated nucleic acid comprises one or more deoxyribonucleotides, optionally wherein the isolated nucleic acid is a gapmer.

12. The isolated nucleic acid of any one of claims 1 to 11, wherein the region of complementarity is located in an untranslated region (UTR) of the APOE mRNA transcript.

13. The isolated nucleic acid of claim 12, wherein the untranslated region comprises a 5’ UTR, intron, or 3’ UTR of the APOE mRNA transcript.

14. The isolated nucleic acid of claim 12 or 13, wherein the untranslated region comprises a 3’ UTR of the APOE mRNA transcript.

15. The isolated nucleic acid of claim 12, wherein the region of complementarity is located in a sequence that spans the boundary in the 3’ UTR of the APOE mRNA transcript where the 5’ end of a poly adenylation sequence begins.

16. The isolated nucleic acid of claim 12, wherein the region of complementarity is located in a polyadenylation sequence of the APOE mRNA transcript.

17. The isolated nucleic acid of any one of claims 1 to 11, wherein the region of complementarity is located in a protein coding region of the APOE mRNA transcript.

18. The isolated nucleic acid of any one of claims 1 to 11, wherein the region of complementarity is located in an intron-exon boundary of the APOE mRNA transcript.

19. The isolated nucleic acid of any one of claims 1 to 18, wherein the region of complementarity comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 continuous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOS: 53-57.

20. The isolated nucleic acid of any one of claims 1 to 19, comprising the nucleotide sequence set forth in any one of the nucleotide sequences set forth in Table 1.

21. A composition comprising the isolated nucleic acid of any one of claims 1 to 20, and a pharmaceutically acceptable excipient.

22. A method for inhibiting amyloid plaque formation in a cell or subject, the method comprising administering the isolated nucleic acid of any one of claims 1 to 20 or the composition of claim 21 to a cell or a subject in need thereof.

23. The method of claim 22, wherein the cell is a neuronal cell.

24. The method of claim 22 or 23, wherein the subject comprises one or more mutations in a gene that is associated with a neurodegenerative disease or disorder, optionally wherein the gene is APOE.

25. The method of any one of claims 22 to 24, wherein the cell is a human cell, optionally wherein the cell is in a subject.

26. The method of any one of claims 22 to 25, wherein the subject is a human subject.

27. The method of any one of claims 22 to 26, wherein the subject has or is suspected of having a neurodegenerative disease or disorder.

28. The method of claim 27, wherein the disease or disorder is Alzheimer’s disease or dementia with Lewy Bodies.

29. The method of any one of claims 22 to 28, wherein the administration is systemic administration, optionally wherein the systemic administration comprises intravenous injection.

30. The method of any one of claims 22 to 28, wherein the administration comprises direct administration to a target tissue of the subject, optionally wherein the direct administration comprises direct injection to the central nervous system (CNS) or direct injection to the peripheral nervous system.

31. The method of claim 30, wherein the administration comprises placing the subject in a Trendelenburg position during the administration.

32. The method of any one of claims 22 to 31, wherein the subject is characterized as not having a mutation in APOE.

33. The method of any one of claims 22 to 31, wherein the subject comprises one or more mutations in a gene that is associated with amyloid plaque formation, optionally wherein the gene is APOE.

34. A method for preventing or treating a neurodegenerative disease or disorder in a subject in need thereof, the method comprising administering to the subject the isolated nucleic acid of any one of claims 1 to 20, or the composition of claim 21, to a subject in need thereof.

35. The method of claim 34, wherein the subject is a human.

36. The method of claim 34 or 35, wherein the disease or disorder is Alzheimer’s disease or dementia with Lewy Bodies.

37. The method of any one of claims 34 to 36, wherein the administration comprises direct administration to a target tissue of the subject, optionally wherein the direct administration comprises direct injection to the central nervous system (CNS), direct injection to the peripheral nervous system (PNS).

Images