Therapeutic nucleic acids from extracellular vesicles of TDO2-transduced fibroblasts and methods of use thereof

Specific RNA sequences from TDO2-transduced fibroblast extracellular vesicles address the limitations of current treatments by modulating immune responses and enhancing tissue healing in inflammatory conditions and tissue injury.

WO2026136759A2PCT designated stage Publication Date: 2026-06-25CEDARS SINAI MEDICAL CENT
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
CEDARS SINAI MEDICAL CENT
Filing Date
2025-12-18
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Current treatments for inflammatory conditions and tissue injury are inadequate in effectively modulating immune responses and promoting tissue healing.

Method used

Administration of therapeutically effective amounts of specific RNA sequences, such as miR-1246 and uREXl, derived from extracellular vesicles of TDO2-transduced fibroblasts, to target inflammatory pathways and promote immunomodulation and tissue repair.

Benefits of technology

The RNA sequences effectively reduce inflammation and improve tissue healing by modulating immune responses and promoting angiogenesis, reducing infarct size, and improving cardiac function in models of myocardial ischemia-reperfusion injury.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025060460_25062026_PF_FP_ABST
    Figure US2025060460_25062026_PF_FP_ABST
Patent Text Reader

Abstract

Several embodiments disclosed herein relate to methods and compositions for treatment of inflammation. In several embodiments, therapeutic nucleic acids enriched in extracellular vesicles from fibroblasts engineered to overexpress TDO2 are provided. In several embodiments, a therapeutically effective amount of the isolated nucleic acid is administered to treat an inflammatory condition. In several embodiments, the inflammation is secondary to tissue damage or an infection.
Need to check novelty before this filing date? Find Prior Art

Description

CSMC.026WO PATENTTHERAPEUTIC NUCLEIC ACIDS FROM EXTRACELLULAR VESICLES OFTDO2-TRANSDUCED FIBROBLASTS AND METHODS OF USE THEREOFREFERENCE TO PRIOR APPLICATION

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 737520, filed on December 20, 2024, which is hereby incorporated by reference herein in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED R&D

[0002] This invention was made with government support under Grant No. R01 HL142579, awarded to Dr. Ahmed Ibrahim by the National Institutes of Health. The Government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING

[0003] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled CSMC026WOSequenceListing.xml created on December 17,2025 which is 21,674 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.BACKGROUNDField

[0004] The present disclosure relates to therapeutic RNA, variants thereof, and treatment of inflammatory conditions, heart conditions, and / or tissue injury using same.SUMMARY

[0005] Provided herein is a method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence comprising GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1) or a sequence at least 80% identical thereto, wherein the isolated nucleic acid is RNA, wherein the isolated nucleic acid is at most 60 nucleobases in length. Also provided is a method of treating an inflammatorycondition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence comprising XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C, or A, or a sequence at least 90% identical thereto, wherein the isolated nucleic acid is RNA, wherein the isolated nucleic acid is at most 60 nucleobases in length, and wherein, when Xi is G, the nucleobase sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO:1, and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO:1.

[0006] Also provided is a method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence comprising AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3) or a sequence at least 80% identical thereto, wherein the isolated nucleic acid is RNA, wherein the isolated nucleic acid is at most 60 nucleobases in length.

[0007] Provided herein is method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence at least 80% identical to a reference sequence of a reference therapeutic nucleic acid comprised in a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2), wherein the isolated nucleic acid is RNA, and wherein the reference sequence is at least 18 nucleobases long. Also provided is a method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence at least 80% identical to a reference sequence of a reference therapeutic nucleic acid comprised in a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3- dioxygenase (TDO2), wherein the isolated nucleic acid is RNA, wherein the reference sequence is at least 18 nucleobases long, and wherein when the reference sequence comprises GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1) or a sequence at least 80% identical thereto, the reference sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO:1, and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO:1.

[0008] Further provided herein is a method of immunomodulation, comprising contacting an effective amount of an isolated nucleic acid with a population of macrophages, the nucleic acid comprising a nucleobase sequence at least 80% identical to a reference sequence of a reference therapeutic nucleic acid comprised in a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2), wherein the isolated nucleic acid is RNA, and wherein the reference sequence is at least 18 nucleobases long. Provided herein is a method of immunomodulation, comprising contacting an effective amount of an isolated nucleic acid with a population of macrophages, the nucleic acid comprising a nucleobase sequence at least 80% identical to a reference sequence of a reference therapeutic nucleic acid comprised in a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2), wherein the isolated nucleic acid is RNA, wherein the reference sequence is at least 18 nucleobases long, and wherein when the reference sequence comprises GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1) or a sequence at least 80% identical thereto, the reference sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO:1, and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO:1.

[0009] Also provided is a method of identifying a therapeutic agent, comprising: providing therapeutic extracellular vesicles (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2); identifying one or more candidate agents comprised in the therapeutic EV; providing EV from a second genetically modified fibroblast that is configured to overexpress TDO2 and GATA binding protein 4 (GATA4); and determining that the one or more candidate agents is enriched in the therapeutic EV compared to the EV from the second genetically modified fibroblast, whereby the one or more candidate agents is identified as a therapeutic agent.

[0010] Provided herein is an isolated nucleic acid comprising a nucleobase sequence comprising GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1), or a sequence at least 80% identical thereto, wherein the isolated nucleic acid is RNA, wherein the isolated nucleic acid is at most 60 nucleobases in length, and wherein the nucleic acid comprises at least one chemically modified residue, optionally wherein a residue of the nucleic acid in the nucleobase sequence comprises the at least one chemically modified residue. Also provided is an isolated nucleic acid comprising a nucleobase sequence comprisingXiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C, or A, or a sequence at least 90% identical thereto, wherein the isolated nucleic acid is RNA, wherein the isolated nucleic acid is at most 60 nucleobases in length, and wherein, when Xi is G. the nucleobase sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO: 1, and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO:1, and wherein the nucleic acid comprises at least one chemically modified residue in the nucleobase sequence.

[0011] Also provided is a therapeutic composition comprising: a therapeutically effective amount of the isolated nucleic acid of the present disclosure; and a pharmaceutically acceptable excipient.

[0012] A method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition an inhibitor of phospholamban (PLN), optionally wherein the inhibitor of PLN is an inhibitory RNA (e.g., siRNA or shRNA) that targets an RNA transcript (e.g., mRNA) encoding PLN, or wherein the inhibitor of PLN is uREXl or a functional derivative thereof, optionally wherein the inflammatory condition comprises: a cardiac inflammatory condition; a symptom or sequalae of a cardiac injury; and / or a symptom or sequalae of heart failure or myocardial infarction.BRIEF DESCRIPTION OF THE DRAWINGS

[0013] FIGs. 1A-1D show characterization of purified extracellular vesicles (EV) from TDO2-overexpressed and TDO2 / GATA4-overexpressed normal human dermal fibroblasts (nHDFs). FIG. 1A is a schematic diagram showing an extracellular vesicle (EV) purification workflow. FIG. IB is a collection of cryo-electron microscopy (Cryo-EM) images of TDO2-EV and TDO2 / GATA4-EV. FIG. 1C is a collection of images showing Western blot of EV markers. FIG. ID is a collection of a graph and a table showing nanoparticle tracking analysis (NTA) of TDO2-EV and TDO2 / GATA4-EV.

[0014] FIGs. 2A-2L show in vitro and in vivo evaluation of TDO2-EV and TDO2 / GATA4-EV. FIG. 2A is a collection of graphs showing the effect of TDO2-EV and TDO2 / GATA4-EV on expression of pro-inflammatory and anti-inflammatory genes in LPS- stimulated macrophages. FIG. 2B is a graph showing the effect of TDO2-EV and TDO2 / GATA4-EV on IL-6 protein expression levels in LPS-stimulated macrophages. FIG. 2C is a collection of immunofluorescence images of human dermal fibroblasts (HDF). Fluorescence intensity of a smooth muscle actin (a-SMA) staining (FIG. 2D) and collagen Istaining (FIG. 2E) were quantified. FIG. 2F is a collection of fluorescence images of an angiogenesis assay (Tube formation assay) in human coronary artery endothelial cells (HCAEC). Tube length was measured (FIG. 2G). FIG. 2H is a graph showing Ki67 immunofluorescence in HCAEC. FIG. 21 is a graph showing viability of human cardiac myocytes (HCM) under hypoxia condition. FIG. 2J is a schematic diagram of an experimental design for testing the effect of EV in a model of acute ischemia / reperfusion (ER). Cardiac troponin I (cTnl) levels was measured by ELISA (FIG. 2K) and infarct size was measured by TTC staining (FIG. 2L).

[0015] FIGs. 3A-3B show characterization of RNA profiles of TDO2-EV and TDO2 / GATA4-EV. FIG. 3A is a graph showing distribution of small-RNAs in EV. FIG. 3B is a heatmap showing differential miRNAs expression in EV.

[0016] FIGs. 4A-4G show evaluation of miR-1246 in the acute ER model. Different intravenous doses of miR-1246 were administered in the acute ER model, and infarct size (FIG. 4A) and cardiac troponin I (cTnl) (FIG. 4B) were measured. FIG. 4C is a graph showing infarct size in an acute ER model treated with miR-1246. FIG. 4D is a graph showing cTnl levels in an acute ER model treated with miR-1246. FIG. 4E is a schematic diagram of an experimental design for testing the effect of miR-1246 administered orally in a model of acute ischemia / reperfusion (ER). FIG. 4F is graph showing infarct size measured by TTC staining. FIG. 4G is a graph showing cTnl levels measured by ELISA.

[0017] FIGs. 5A-5F show evaluation of uREXl in the acute ER model. Different intravenous doses of uREXl were administered in the acute ER model, and infarct size (FIG. 5A) and cTnl (FIG. 5B) were measured. FIG. 5C is a graph showing infarct size in an acute ER model treated with uREXl. FIG. 5D is a graph showing cTnl levels in an acute ER model treated with uREXl. FIG. 5E is graph showing infarct size measured by TTC staining. FIG. 5F is a graph showing (cTnl) levels measured by ELISA.

[0018] FIG. A is a graph showing uREXl copy number in EV from TDO2- transduced fibroblasts. FIG. 6B shows the sequence of uREXl and scramble control.

[0019] FIGs. 7A-7D show characterization of fibroblasts transduced with TDO2 or TDO2 and GATA4. FIG. 7A is a collection of images showing transduced fibroblasts. FIG. 7B is a collection of graphs showing the expression of TDO2 and GATA4 mRNA in fibroblasts transduced with TDO2 or TDO2 and GATA4. FIG. 7C is a graphs showing expression ofGATA4 protein in fibroblasts transduced with TD02 or TD02 and GATA4. FIG. 7D is a collection of images showing a Western blot for expression of GATA4 in fibroblasts transduced with TD02 or TD02 and GATA4.

[0020] FIG. 8 is a collection of cryo-electron microscopy (cryo-EM) images of EV.

[0021] FIG. 9A is a collection of graphs showing CD63 concentration as a function of the concentration of EV from fibroblasts transduced with TDO2 or TDO2 and GATA4.

[0022] FIG. 9B is a graph showing protein concentration as a function of the concentration EV from fibroblasts transduced with TDO2 or TDO2 and GATA4.

[0023] FIG. 10A is a collection of graphs showing expression of CD 163 and CD206 in LPS- stimulated macrophages treated with EV.

[0024] FIG. 10B is a collection of graphs showing expression of fibrosis genes in TGF-beta stimulated-HDF cells treated with EV.

[0025] FIGs. 11A-11C show the effect of EV on rat bone marrow-derived macrophages (BMDM). FIG. 11 A is a graph showing optical density of LPS-induced BMDM cells treated with EV in culture. FIG. 1 IB is a graph showing the concentration of IL-6 in the supernatant of LPS-induced BMDM cells cultures treated with EV. FIG. 11C is a collection of graphs showing expression level of IL-6 after treatment with IL-6 of BMDM cells treated with or without LPS.

[0026] FIGs. 12A-12F show characterization of purified extracellular vesicles (EV) from TDO2-overexpressed and TDO2 / GATA4-overexpressed normal human dermal fibroblasts (nHDFs). FIG. 12A is a schematic diagram showing an extracellular vesicle (EV) purification workflow. FIG. 12B is a graph showing the average size of EVs. FIG. 12C is a graph showing that the show the effects TDO2 and TDO2 / GATA4 on the concentration of cardiac troponin I (cTnl) as measured by ELISA. FIG. 12D is a graph showing that the effects TDO2 and TDO2 / GATA4 on the infarct size as measured by TTC staining. FIG. 12E is a graph showing the proportion of mapped and unmapped reads. FIG. 12F is a graph showing the distribution of small-RNA between Large-EVs.

[0027] FIG. 13 is a collection of images of Western blots.

[0028] FIG. 14A shows a non-limiting example of a nucleic acid. FIG. 14B shows a non-limiting example of a nucleic acid.

[0029] FIG. 15A shows a non-limiting example of a human TDO2 amino acid sequence. FIG. 15B shows a non-limiting example of a human GATA4 amino acid sequence.

[0030] FIG. 16 is a block diagram showing a method of treating an inflammatory condition, according some non-limiting embodiments.

[0031] FIG. 17 is a block diagram showing a method of treating an inflammatory condition, according some non-limiting embodiments.

[0032] FIG. 18 is a block diagram showing a method of treating an inflammatory condition, according some non-limiting embodiments.

[0033] FIG. 19 shows dose-dependent effects of uREXl in in vivo rat model of acute myocardial injury.

[0034] FIG. 20 shows effects of uREXl in in vivo rat model of acute myocardial injury compared to Scramble and Vehicle.

[0035] FIGs. 21A-21E is a collection of graphs showing effects of uREXl on gene expression assessed by RT-qPCR. FIG. 21A shows effects of uREXl and Scramble on expression of proinflammatory genes in human macrophages with LPS. FIG. 21B shows effects of uREXl and Scramble on gene expression in human endothelial cells (human coronary artery endothelial cells (HCAECs)). FIGs. 21C-21E show effects of uREXl and Scramble on expression of profibrotic genes in human heart cardiac fibroblasts (HCFs).

[0036] FIG. 22A shows principal component analysis (PCA) of bulk RNA-seq in Vehicle and uREXl treated cells and validation analysis. PCA of HCFs separate uREXl- treated cells from control (PBS) cells indicating a global shift in transcriptional state (FIG. 22A). FIGs. 22B-22I are a collection of graphs validating and functionally testing candidate genes identified by bulk RNA-seq. FIG. 22B is a graph showing expression of PLN in HCF treated with uREXl. FIGs. 22C-22E show use of siRNA-mediated knockdown of PLN to determine contribution of candidate genes to the uREXl -dependent phenotype in HCFs. FIGs. 22F-22H are a collection of graphs showing representative differentially expressed genes identified by bulk RNA-seq and confirmed by RT-qPCR. FIG. 221 shows a graph showing PLN knockdown in human cardiac fibroblasts (HCFs) using three different siRNAs. siPLN-1 was used in subsequent experiments.

[0037] FIG. 23 shows a comparison of native uREXl with engineered uREXl sequences, according to some non-limiting embodiments. Bolded letters show location of Locked Nucleic Acid (LNA) modifications.

[0038] FIG. 24 shows a collection of graphs assessing the effects of engineered uREXl variants on target gene expression by RT-qPCR in human cardiac fibroblasts (HCFs).DETAILED DESCRIPTION

[0039] Extracellular vesicles (EVs) are nano-sized lipid-bilayer vesicles secreted by nearly all cell types and represent an evolutionarily conserved mechanism of cell-cell communication. EVs are laden with potent signaling molecules including lipids, proteins, and RNA. EV signaling plays a critical role in development, health, and disease. Emerging evidence also implicates EV secretion and signaling in the therapeutic effect of cell therapy. Therapeutic EV may modulate several pathways of tissue healing and repair, most notably, immunomodulation. Furthermore, studies have identified macrophages as major functional mediators of EV therapy. Macrophages are pivotal players in tissue injury and resolution. Recent mechanistic investigation further implicated Wnt-P-catenin signaling activation as necessary for the secretion of therapeutic EVs. A p-catenin-upregulated target gene includes tryptophan 2,3-dioxygenase (TDO2). TDO2 is an enzyme involved in the metabolism of tryptophan into various metabolites including kynurenine with well-described roles in immunomodulation. GATA4 is a zinc finger transcription factor that plays a vital role in the development of organs, including the heart. It regulates gene expression, promotes cardiac myocyte enlargement, and is involved in the morphogenesis of the atrial septum in the heart.

[0040] As shown herein, extracellular vesicles (EVs) from human dermal fibroblasts transduced with TDO2 contain therapeutic small RNAs (e.g., miR-1246 and uREXl). Synthetically produced miR-1246 and uREXl were found to be therapeutically active in a model of myocardial ischemia-reperfusion injury. Provided herein are methods of treating an inflammatory condition that includes administering a therapeutically effective amount of a therapeutic RNA (e.g., miR-1246 or uREXl) to a subject in need thereof. Also provided are methods of identifying a therapeutic agent, such as a therapeutic RNA, from EVs from TDO2- transduced fibroblasts.Terms

[0041] “Extracellular vesicle” or “EV” as used herein have their ordinary and customary meaning as understood by one of ordinary skill in the art, in view of the present disclosure. EVs include lipid bilayer structures generated by cells, and include exosomes, micro vesicles, epididimosomes, argosomes, exosome-like vesicles, microparticles, promininosomes, prostasomes, dexosomes, texosomes. dex, tex, archeosomes and oncosomes. Unless otherwise indicated herein, each of the foregoing terms shall also be understood to include engineered high-potency varieties of each type of membrane-bound vesicle.

[0042] As used herein “nucleic acid” and “oligonucleotide” have their customary and ordinary meaning as understood by one of ordinary skill in the art in view of the present disclosure. “Nucleic acid” and “oligonucleotide” refer to multiple nucleotides (e.g., molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), thymidine (T) or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G))), or analogues thereof. Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are nucleic acids in which the nucleotides are linked through a 3 ',5 '-phosphodiester bond to form a backbone of alternating phosphate groups and sugar moiety. RNA is composed of ribose sugar groups and DNA is composed of deoxyribose sugar groups. A nucleic acid includes polynucleosides (e.g., a polynucleotide minus the phosphate) and any other organic basecontaining polymer. Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymidine, inosine, 5 -methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6- diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties. Chemical modifications can be introduced at the site of the phosphodiester bond, sugar moiety, nucleobase, or combined sites thereof. Phosphorothioate (PS) oligonucleotides, are nucleic acids with a modified phosphate in which one of the non-bridging oxygens of the phosphate-ester group is changed to sulfur. This modification retains the negative charge of the backbone. They can have highly increased nuclease resistance relative to the natural nucleic acids. 2’-G-methylation is a modification on the ribose sugar of RNA in which a methyl group is added to the 2’ hydroxl group of the native RNA. In “locked” nucleic acids (LNAs) the 2'-oxygen is attached to the 4'-carbon of the ribose sugar via a methylene bridge that locks in an RNA-like C3’-endo conformation. Thesederivatives are also known as 2',4'-bridged nucleic acids (BNA). The methylene bridge fixes the furanose ring in the 3'-endo conformation that is highly advantageous for base pairing. LNA can form very stable duplexes with RNA and DNA according to the Watson-Crick rule with excellent selectivity. The incorporation of LNA monomers into DNA oligomer can increase the strength of hybridization. A nucleic acid can include any other suitable modifications. Thus, the term nucleic acid also encompasses nucleic acids with substitutions or modifications, such as in the bases and / or sugars. Nucleic acid includes nucleotide analogues and polymers thereof, including, but not limited to, a polynucleoside in which two nucleosides are linked by a non-phosphodiester bond, e.g., linked by a phosphorothioate bond. “RNA molecule” as used herein denotes a nucleic acid that includes ribose as the sugar component, and derivatives thereof, including a nucleic acid that has been modified at the site of the phosphodiester bond, sugar moiety, nucleobase, or combined sites thereof. As used herein, a “nucleobase sequence” denotes a sequence of nucleobases (e.g., cytosine (C), thymidine (T) I uracil (U). adenine (A) or guanine (G)) consecutively ordered along a backbone structure in a nucleic acid, e.g., along a sugar-phosphate backbone structure.

[0043] Nucleic acid molecules of the present disclosure may share a certain degree of sequence similarity or identity with the reference molecules (e.g., reference polypeptides or reference nucleic acid), for example, with art-described molecules (e.g., engineered or designed molecules or wild-type molecules). The term “identity” as known in the art, refers to a relationship between the sequences of two or more polypeptides or nucleic acids, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between them as determined by the number of matches between strings of two or more amino acid residues or nucleic acid residues. Identity measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (e.g.. “algorithms”). Identity of related peptides can be readily calculated by known methods. “% identity” as it applies to polypeptide or nucleic acid sequences is defined as the percentage of residues (amino acid residues or nucleic acid residues) in the candidate amino acid or nucleic acid sequence that are identical with the residues in the amino acid sequence or nucleic acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Any suitable methods and computer programs for the alignmentcan be used. It is understood that identity depends on a calculation of percent identity but may differ in value due to gaps and penalties introduced in the calculation. Generally, variants of a particular nucleic acid or polypeptide have at least 40%, 45%. 50%, 55%, 60%, 65%. 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to that particular reference nucleic acid or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art. Such tools for alignment include those of the BLAST suite (Stephen F. Altschul, et al (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”. Nucleic Acids Res. 25:3389-3402). Another popular local alignment technique is based on the Smith-Waterman algorithm (Smith, T. F. & Waterman, M. S. (1981) “Identification of common molecular subsequences.” J. Mol. Biol. 147:195-197.) A general global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, S. B. & Wunsch. C. D. (1970) “A general method applicable to the search for similarities in the amino acid sequences of two proteins.” J. Mol. Biol. 48:443-453.). More recently a Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed that purportedly produces global alignment of nucleobase and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm. Other tools are described herein, specifically in the definition of “identity” below.

[0044] The term “effective amount” as used herein refers to the amount of a composition or an agent needed to provide the desired effect, e.g., cellular response, therapeutic effect, etc. The term “therapeutically effective amount” refers to an amount of a composition or therapeutic agent that is sufficient to provide, e.g., a particular antiinflammatory effect when administered to a typical subject. A therapeutically effective amount as used herein, in various contexts, can include an amount sufficient to delay the development of a symptom of the disease, alter the course of a symptom disease (for example but not limited to, slowing the progression of a symptom of the disease), or reverse a symptom of the disease. The therapeutically effective amount may be administered in one or more doses of the therapeutic agent. The therapeutically effective amount may be administered in a single administration, or over a period of time in a plurality of doses.

[0045] “Treating” or “treatment” as used herein refers to altering one or more of the signs or symptoms of a condition, e.g., disease, described herein in a beneficial manner;improving or ameliorating other clinically accepted symptoms, e.g., by at least 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, or 200% or more; or inducing a desired response, by performing methods described herein. Efficacy of treatment can be assessed, for example, by measuring a marker, indicator, symptom, and / or the incidence of a condition treated according to the methods described herein or any other measurable parameter appropriate, e.g., circulating cTnl levels. Efficacy of treatment can also be measured by a failure of an individual to worsen as assessed by hospitalization, or need for medical interventions (e.g., progression of the disease is halted). Treatment includes any treatment of a disease in an individual or an animal (some non-limiting examples include a human or an animal) and includes: (1) inhibiting the disease, e.g., preventing a worsening of symptoms (e.g. pain or inflammation); or (2) relieving the severity of the disease, e.g., causing regression of symptoms. Treating includes, in some embodiments, healing or repairing a tissue or organ damaged or impaired by or as a consequence of a disease or other impact of a disease, e.g., inflammatory conditions. A therapeutically effective amount for the treatment of a disease means that amount which, when administered to a subject in need thereof, is sufficient to result in effective treatment as that term is defined herein, for that disease. Efficacy of an agent can be determined by assessing physical indicators of a condition or desired response, (e.g., cardiac function). One skilled in the art can monitor efficacy of administration and / or treatment by measuring any one of such parameters, or any combination of parameters.

[0046] “Administering” as used herein can include any suitable routes of administering a therapeutic agent or composition as disclosed herein. Suitable routes of administration include, without limitation, oral, parenteral, intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, cutaneous, injection or topical administration. Administration can be local or systemic.

[0047] “Subject,” as used herein refers to any vertebrate animal, including mammals and non-mammals. A subject can include primates, including humans, and nonprimate mammals, such as rodents, domestic animals or game animals. Non-primate mammals can include mouse, rat, hamster, rabbit, dog, cat, horse, cow, pig, sheep, goat, camel, deer, buffalo, bison, etc. Non-mammals can include bird (e.g., chicken, ostrich, emu, pigeon), reptile (e.g., snake, lizard, turtle), amphibian (e.g.. frog, salamander), etc. The terms, “individual,” “patient,” and “subject” are used interchangeably herein.NUCLEIC AND COMPOSITIONS THEREOF

[0048] Provided herein is an isolated nucleic acid that includes a nucleobase sequence of 5’-GUGGUCUAGUGGUUAGGAUUCGG-3’ (SEQ ID NO: 1) or a sequence at least 80% identical thereto, and uses thereof for treatment of an inflammatory condition, as described herein. In some embodiments, the isolated nucleic acid includes a nucleobase sequence at least 80%. 85%, 90%, 91%, 92%, 93%, 94%. 95%. 96%. 97%, 98%, 99%, or about 100% identical to 5’-GUGGUCUAGUGGUUAGGAUUCGG-3’ (SEQ ID NO: 1), or optionally it includes a nucleobase sequence that has sequence identity to SEQ ID NO:1 in a range defined by any two of the preceding values (e.g„ 80-100%, 85-97%, 90-98%, 93-99%, etc.). In some embodiments, the isolated nucleic acid includes the nucleobase sequence set forth in SEQ ID NO: 1 with up to 1, 2, 3, 4, or 5 substitutions thereto. In some embodiments, the nucleobase sequence consists of, or consists essentially of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1). In some embodiments, the isolated nucleic acid is or includes a RNA.

[0049] Also provided is an isolated nucleic acid comprising a nucleobase sequence comprising XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C, or A, or a sequence at least 80% identical thereto. In some embodiments, the isolated nucleic acid includes a nucleobase sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about 100% identical to 5’-XiUGGUCUAGUGGUUAGGAUUCGG-3’ (SEQ ID NO: 12), wherein Xi is G, C, or A, or optionally it includes a nucleobase sequence that has sequence identity to SEQ ID NO: 12 in a range defined by any two of the preceding values (e.g., 80-100%. 85-97%. 90-98%, 93-99%, etc.). In some embodiments, the isolated nucleic acid includes a nucleobase sequence at least 90% identical to 5’-XiUGGUCUAGUGGUUAGGAUUCGG-3’ (SEQ ID NO: 12), wherein Xi is G, C. or A. In some embodiments, the nucleic acid comprises at least one chemically modified residue in the nucleobase sequence. In some embodiments, the isolated nucleic acid is or includes a RNA.

[0050] In some embodiments, when Xi is G, the nucleobase sequence comprises (i) no residues or at most 5 residues 5’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1), and / or (ii) no residues or at most 3 residues 3’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1). In some embodiments, when Xi isG, the nucleobase sequence comprises (i) no residues or at most 4 residues 5’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1), and / or (ii) no residues or at most 3 residues 3’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1). In some embodiments, when Xi is G, the nucleobase sequence comprises (i) no residues or at most 3 residues 5’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1), and / or (ii) no residues or at most 3 residues 3’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1). In some embodiments, when Xi is G, the nucleobase sequence comprises (i) no residues or at most 2 residues 5’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1), and / or (ii) no residues or at most 3 residues 3’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1). In some embodiments, when Xi is G, the nucleobase sequence comprises (i) no residues or at most 1 residue 5’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1), and / or (ii) no residues or at most 3 residues 3’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1). In some embodiments, when Xi is G, the nucleobase sequence comprises (i) no residues 5’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1), and / or (ii) no residues or at most 3 residues 3’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1). In some embodiments, when Xi is G, the nucleobase sequence comprises no residues or at most 5 residues 5’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1). In some embodiments, when Xi is G, the nucleobase sequence comprises at most 5, 4, 3, 2, 1 or 0 residues 5’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1). In some embodiments, when Xi is G, the nucleobase sequence comprises no residues or at most 3 residues 3’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1). In some embodiments, when Xi is G, the nucleobase sequence comprises at most 3, 2, 1, or 0 residues 3’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1). In some embodiments, when Xi is G, the nucleobase sequence is at most 31 nucleobases long. In some embodiments, the nucleic acid includes at least one chemically modified residue in the nucleobase sequence.

[0051] In some embodiments, Xi is G, and the nucleobase sequence comprises (i) no residues or at most 5 residues 5’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1), and / or (ii) no residues or at most 2 residues 3’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1). In some embodiments, Xi is G, and the nucleobase sequence comprises (i) no residues or at most 5 residues 5’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1), and / or (ii) no residues or at most 1 residue 3’ of GUGGUCUAGUGGUUAGGAUUCGG(SEQ ID NO: 1). In some embodiments, Xi is G, and the nucleobase sequence comprises (i) no residues or at most 5 residues 5’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1), and / or (ii) no residues 3’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1).

[0052] In some embodiments, Xi in SEQ ID NO: 12 is C or A, or the nucleobase sequence includes GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 16). In some embodiments, Xi in SEQ ID NO: 12 is C or A, or the nucleobase sequence includes GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 16), and the nucleic acid includes at least one chemically modified residue (e.g., in the nucleobase sequence). In some embodiments, Xi in SEQ ID NO: 12 is C. In some embodiments, Xi in SEQ ID NO: 12 is C and the nucleic acid includes at least one chemically modified residue (e.g., in the nucleobase sequence). In some embodiments, Xi in SEQ ID NO: 12 is A. In some embodiments, Xi in SEQ ID NO: 12 is A, and the nucleic acid includes at least one chemically modified residue (e.g., in the nucleobase sequence). In some embodiments, the nucleobase sequence includes GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 16). In some embodiments, the nucleobase sequence includes GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 16), and the nucleic acid includes at least one chemically modified residue (e.g., in the nucleobase sequence).

[0053] In some embodiments, the nucleobase sequence is or includes any one of the constructs shown in FIG. 23. In some embodiments, the nucleobase sequence is or includes any one of the constructs shown in FIG. 23, other than UUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 16). In some embodiments, the nucleobase sequence is GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1). In some embodiments, the nucleobase sequence consists of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1). In some embodiments, the nucleobase sequence consists essentially of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1). In some embodiments, the nucleic acid is GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1). In some embodiments, the nucleic acid consists of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1). In some embodiments, the nucleic acid consists essentially of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1). In some embodiments, the nucleobase sequence is GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 13). hi some embodiments, the nucleobase sequence consists of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 13).In some embodiments, the nucleobase sequence consists essentially of CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 13). In some embodiments, the nucleic acid is CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 13). In some embodiments, the nucleic acid consists of CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 13). In some embodiments, the nucleic acid consists essentially of CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 13). In some embodiments, the nucleobase sequence is AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 14). In some embodiments, the nucleobase sequence consists of AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 14). In some embodiments, the nucleobase sequence consists essentially of AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 14). In some embodiments, the nucleic acid is AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 14). In some embodiments, the nucleic acid consists of AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 14). In some embodiments, the nucleic acid consists essentially of AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 14). In some embodiments, the nucleobase sequence is or includes UUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 15). In some embodiments, the nucleic acid is not or does not include UUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 15).

[0054] In any nucleic acid herein, in some embodiments, the nucleobase sequence does not include UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11). In some embodiments, the nucleobase sequence does not include UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 80% identical thereto. In some embodiments, the nucleobase sequence does not include UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 90% identical thereto. In some embodiments, the nucleobase sequence does not include UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 95% identical thereto. In some embodiments, the nucleobase sequence does not include UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical thereto. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 except the residue corresponding to position 1 of SEQ ID NO: 11 is not U. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 except the residue corresponding to position 2 of SEQ ID NO: 11 is not C. In some embodiments, the nucleobase sequence includes SEQ IDNO: 11 except the residue corresponding to position 3 of SEQ ID NO:11 is not C. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 except the residue corresponding to position 4 of SEQ ID NO: 11 is not C. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 except the residue corresponding to position 5 of SEQ ID NO: 11 is not U. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 except the residue corresponding to position 6 of SEQ ID NO: 11 is not G. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 except the residue corresponding to position 30 of SEQ ID NO: 11 is not C. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 except the residue corresponding to position 31 of SEQ ID NO: 11 is not G. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 except the residue corresponding to position 32 of SEQ ID NO: 11 is not G.

[0055] In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 with the proviso that the nucleobase sequence does not include the 6th, the 5th, the 4th, the 3rd, the 2nd, or the first residue at the 5’ end of SEQ ID NO: 11 and the 3 residues at the 3’ end of SEQ ID NO: 11. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 with the proviso that the nucleobase sequence does not include the 6th, the 5th, the 4th, the 3rd, the 2nd, or the first residue at the 5’ end of SEQ ID NO: 11 and the 2 residues at the 3’ end of SEQ ID NO: 11. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 with the proviso that the nucleobase sequence does not include the 6th, the 5th, the 4th, the 3rd, the 2nd, or the first residue at the 5’ end of SEQ ID NO: 11 and the first residue at the 3’ end of SEQ ID NO: 11.

[0056] In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 with the proviso that the nucleobase sequence does not include the 6 residues at the 5’ end of SEQ ID NO: 11 and the 3rd, the 2nd, or the first residues at the 3’ end of SEQ ID NO: 11. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 with the proviso that the nucleobase sequence does not include the 5 residues at the 5’ end of SEQ ID NO: 1 and the 3rd, the 2nd, or the first residues at the 3’ end of SEQ ID NO: 11. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 with the proviso that the nucleobase sequence does not include the 4 residues at the 5’ end of SEQ ID NO: 11 and the 3rd, the 2nd, or the first residues at the 3’ end of SEQ ID NO: 11. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 with the proviso that the nucleobase sequence does not include the 3residues at the 5’ end of SEQ ID NO: 11 and the 3rd, the 2nd, or the first residues at the 3’ end of SEQ ID NO: 11. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 with the proviso that the nucleobase sequence does not include the 2 residues at the 5’ end of SEQ ID NO: 11 and the 3rd, the 2nd, or the first residue at the 3’ end of SEQ ID NO: 11. In some embodiments, the nucleobase sequence includes SEQ ID NO: 11 with the proviso that the nucleobase sequence does not include the first residue at the 5’ end of SEQ ID NO: 11 and the 3rd, the 2nd, or the first residues at the 3’ end of SEQ ID NO: 11.

[0057] Provided herein is an isolated nucleic acid that includes a nucleobase sequence of 5’-AAUGGAUUUUUGGAGCAGG-3’ (SEQ ID NO: 3) or a sequence at least 80% identical thereto, and uses thereof for treatment of an inflammatory condition, as described herein. In some embodiments, the isolated nucleic acid includes a nucleobase sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about 100% identical to 5’-AAUGGAUUUUUGGAGCAGG-3’ (SEQ ID NO: 3), or optionally it includes a nucleobase sequence that has sequence identity to SEQ ID NO:3 in a range defined by any two of the preceding values (e.g., 80-100%, 85-97%, 90-98%, 93-99%, etc.). In some embodiments, the nucleobase sequence consists of, or consists essentially of AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3). In some embodiments, the isolated nucleic acid is or includes a RNA.

[0058] In some embodiments, the isolated nucleic acid is, is about or is at least 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, or 60 nucleobases in length, or optionally it includes a length that is in a range defined by any two of the preceding values (e.g., 18-60 nucleobases, 18-25 nucleobases, 19-25 nucleobases. 18-40 nucleobases, 23-30 nucleobases, etc.). In some embodiments, the isolated nucleic acid is 19-25 nucleobases in length. In some embodiments, the isolated nucleic acid is 23-30 nucleobases in length. In some embodiments, the isolated nucleic acid is 18-23 nucleobases in length. In some embodiments, the isolated nucleic acid is, is about or is at least 18 nucleobases in length. In some embodiments, the isolated nucleic acid is, is at least, or is about 23 nucleobases in length. In some embodiments, the isolated nucleic acid is at most 31 nucleobases in length.

[0059] In some embodiments, the isolated nucleic acid includes at least one chemically modified residue. As used herein, “chemically modified residue” denotes a nucleobase, sugar, phosphate, or any combination thereof (e.g., nucleoside, nucleotide) thathas been modified at a position along the nucleic acid to have a different chemical structure relative to a naturally occurring counterpart. In general, the chemical modification(s) is one that substantially preserves or enhances the therapeutic potency of the nucleic acid. Any suitable number of residues of the nucleic acid can be chemically modified. In some embodiments, the isolated nucleic acid includes 1, 2, 3, 4, 5, 6. 7, 8, 9, 10, or more chemically modified residues, or optionally it includes a number of chemically modified residues in a range defined by any two of the preceding values (e.g., 1-10, 2-8, 2-6, 4-6, 3-8, etc.). In some embodiments, the nucleic acid includes 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more chemically modified residues. In some embodiments, the nucleic acid includes 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-15, 1-20, 1-25, or 1-30 chemically modified residues. In some embodiments, the nucleic acid includes 1-10 chemically modified residues. In some embodiments, the nucleic acid includes 8 chemically modified residues. In some embodiments, the nucleic acid includes 6 chemically modified residues. In some embodiments, at least one residue of the nucleic acid in the nucleobase sequence comprises the at least one chemically modified residue. In some embodiments, the nucleic acid comprises the at least one chemically modified residue in the nucleobase sequence. In some embodiments, all of the at least one chemically modified residue is comprised in a residue of the nucleobase sequence. In some embodiments, the isolated nucleic acid includes one or more chemically modified residues (e.g.. 1, 2, 3, 4, 5, 6, 7, 8. 9, 10 or more, or optionally it includes a number of chemically modified residues in a range defined by any two of the preceding values (e.g., 1-10, 2-8, 2-6, 4-6, 3-8, etc.)) within SEQ ID NO: 1. In some embodiments, the isolated nucleic acid includes one or more chemically modified residues (e.g.. 1, 2, 3. 4, 5. 6, 7, 8, 9, 10 or more, or optionally it includes a number of chemically modified residues in a range defined by any two of the preceding values (e.g., 1-10, 2-8, 2-6, 4-6, 3-8. etc.)) within SEQ ID NO:3.

[0060] The nucleobase modification present at one residue of SEQ ID NO:1 may or may not be the same as the nucleobases modification present at another residue. In some embodiments, the nucleobase modifications present in SEQ ID NO:1 are all the same. Thenucleobase modification present at one residue of SEQ ID NO:3 may or may not be the same as the nucleobases modification present at another residue. In some embodiments, the nucleobase modifications present in SEQ ID NO:3 are all the same.

[0061] The chemically modified residues can be distributed along the isolated nucleic acid or the nucleobase sequence in any suitable manner. In some embodiments, the nucleic acid includes at least one chemically modified residue within the first half of the nucleic acid or the nucleobase sequence, e.g., the 5’ half of the nucleic acid or the nucleobase sequence. In some embodiments, the nucleic acid includes at least one chemically modified residue within the second half of the nucleic acid or the nucleobase sequence, e.g., the 3’ half of the nucleic acid or the nucleobase sequence. In some embodiments, the nucleic acid includes at least one chemically modified residue within the first half of the nucleic acid or the nucleobase sequence, e.g., the 5’ half of the nucleic acid or the nucleobase sequence, and at least one chemically modified residue within the second half of the nucleic acid or the nucleobase sequence, e.g., the 3’ half of the nucleic acid or the nucleobase sequence. In some embodiments, the nucleic acid includes one or more chemically modified residues within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides from the 5’ end of the nucleic acid or the nucleobase sequence. In some embodiments, the nucleic acid includes one or more chemically modified residues within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides from the 3’ end of the nucleic acid or the nucleobase sequence. In some embodiments, no two chemically modified residues are adjacent each other in the nucleic acid. In some embodiments, the nucleic acid includes 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically modified residues within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 5’ end of the nucleic acid or the nucleobase sequence. In some embodiments, the nucleic acid includes 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically modified residues within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 3’ end of the nucleic acid or the nucleobase sequence. In some embodiments, the nucleic acid includes the same number of chemically modified residues in the 5’ half and 3’half of the nucleic acid or the nucleobase sequence. In some embodiments, the nucleic acid includes a different number of chemically modified residues in the 5’ half and 3’half of the nucleic acid or the nucleobase sequence. In some embodiments, the nucleic acid includes a greater number of chemically modified residues in the 3’ half than in the 5 ’half of the nucleic acid or the nucleobase sequence. In some embodiments, the nucleic acid includes a greater number of chemically modified residues inthe 5’ half than in the 3 ’half of the nucleic acid or the nucleobase sequence. In some embodiments, the nucleic acid includes 3 chemically modified residues within 5 nucleotides from the 5’ end of the nucleic acid or the nucleobase sequence and / or 3 chemically modified residues within 5 nucleotides from the 3’ end of the nucleic acid or the nucleobase sequence. In some embodiments, at least one residue at positions 1-12 and / or 13-23 of the nucleobase sequence is the at least one chemically modified residue, optionally where the nucleic acid is 23 nucleobases long. In some embodiments, at least one residue at positions 1-13 and / or 14- 27 of the nucleobase sequence is the at least one chemically modified residue, optionally where the nucleic acid is 27 nucleobases long. In some embodiments, the nucleic acid includes the at least one chemically modified residue at one or more of positions 1, 3, 5, 19, 21, and 23 of the nucleobase sequence, optionally where the nucleic acid is 23 nucleobases long. In some embodiments, the nucleic acid includes the at least one chemically modified residue at one or more of positions 1, 3, 5, 23, 25, and 27 of the nucleobase sequence, optionally where the nucleic acid is 27 nucleobases long.

[0062] In some embodiments, the chemical modification is a backbone modification, e.g., modification of the sugar / phosphate backbone. In some embodiments, the chemical modification is a backbone sugar modification. In some embodiments, the chemically modified residue has a methylene bridge connecting the 2’-0 atom and the 4’-C atom of the nucleotide sugar ring to lock the conformation (Locked Nucleic Acid (LNA)). In some embodiments, the chemically modified residue includes a LNA. In some embodiments, the chemical modification includes the introduction of a phosphorothioate group as linker between nucleotides. Suitable backbone modifications of the chemically modified residues include, without limitation, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. In some embodiments, the chemical modification is a base modification.

[0063] In some embodiments, the chemically modified residue(s) increases in vitro and / or in vivo stability of the nucleic acid. In some embodiments, the chemically modified residue(s) increases therapeutic potency of the nucleic acid, e.g., for treating an inflammatory condition or cardiac injury.

[0064] The nucleic acids of the present disclosure can be prepared using any suitable option. Suitable options include, without limitation, chemical synthesis, enzymaticproduction and / or biological production. Tn some embodiments, the nucleic acids are prepared using chemical synthesis. Any suitable option for chemical synthesis of nucleic acids can be used. Suitable options include, without limitation, phosphodiester, phosphotriester, phosphoramidite, phosphite-triester, and solid phase synthesis approaches. In some embodiments, preparing the nucleic acids includes in vitro transcription. In some embodiments, the nucleic acids are prepared using recombinant DNA technology. In some embodiments, the nucleic acids are prepared by chemically modifying an unmodified nucleic acid having a nucleobase sequence of interest.

[0065] In some embodiments, the nucleobase sequence is selected from: (i) GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1); (ii) at least: CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:7); or AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:8), wherein the nucleic acid comprises the at least one chemically modified residue at positions 1, 3, 5, 19, 21 and 23 of the nucleobase sequence, and wherein the at least one chemically modified residue is a locked nucleic acid (LNA); or (iii) GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 10), wherein the nucleic acid comprises the at least one chemically modified residue at positions 1, 3, 5, 23, 25 and 27 of the nucleobase sequence, and wherein the at least one chemically modified residue is a locked nucleic acid (LNA). In some embodiments, the nucleobase sequence includes CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NOU), wherein residues 1, 3, 5, 19, 21, and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence is CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NOU), wherein residues 1, 3, 5, 19, 21, and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence consists of CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NOU), wherein residues 1, 3, 5, 19, 21, and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence consists essentially of CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NOU), wherein residues 1, 3, 5, 19, 21, and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleic acid is CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NOU), wherein residues 1, 3, 5, 19, 21, and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleic acid consists of CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NOU), wherein residues 1, 3, 5, 19, 21, and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleic acid consists essentially of CUGGUCUAGUGGUUAGGAUUCGG(SEQ TD N0:7), wherein residues 1 , 3, 5, 19, 21 , and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence includes AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:8), wherein residues 1, 3, 5. 19. 21. and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence is AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:8), wherein residues 1, 3, 5, 19, 21, and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence consists of AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:8), wherein residues 1, 3, 5, 19, 21, and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence consists essentially of AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:8), wherein residues 1, 3, 5, 19, 21, and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleic acid is AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:8), wherein residues 1, 3, 5, 19, 21, and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleic acid consists of AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:8), wherein residues 1, 3. 5, 19, 21, and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleic acid consists essentially of AUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:8), wherein residues 1, 3, 5, 19, 21, and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence includes GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 10), wherein residues 1, 3, 5, 23, 25, and 27 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence is GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 10), wherein residues 1, 3, 5, 23, 25, and 27 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence consists of GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 10), wherein residues 1, 3, 5, 23, 25, and 27 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence consists essentially of GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 10). wherein residues 1, 3. 5, 23, 25, and 27 of the nucleobase sequence is a LNA. In some embodiments, the nucleic acid is GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 10), wherein residues 1, 3, 5, 23, 25, and 27 of the nucleobase sequence is a LNA. In some embodiments, the nucleic acid consists of GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 10), wherein residues 1, 3, 5, 23, 25, and 27 of the nucleobase sequence is a LNA. In some embodiments, the nucleic acid consists essentially of GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQID NO: 10), wherein residues 1 , 3, 5, 23, 25, and 27 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence is or includes CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:9), wherein residues 1, 3, 5. 19. 21. and 23 of the nucleobase sequence is a LNA. In some embodiments, the nucleobase sequence is not or does not include CUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:9), wherein residues 1, 3. 5, 19, 21, and 23 of the nucleobase sequence is a LNA.

[0066] A nucleic acid (e.g., RNA molecule) of the present disclosure can be single stranded or double stranded (e.g., RNA / DNA hybrid). In some embodiments, the RNA molecule is single stranded. As used herein, “single stranded” denotes that the RNA is not hybridized to or annealed to another RNA molecule. In some embodiments, the single stranded RNA includes one or more portions that can hybridize or anneal to itself. In some embodiments, the single stranded RNA includes one or more portions that can form a stemloop structure by hybridizing or annealing to itself.

[0067] Also provided is a composition (e.g., therapeutic composition) that includes the isolated nucleic acid of the present disclosure. The therapeutic composition can include a therapeutically effective amount of any one of the isolated nucleic acids as described herein, and a pharmaceutically acceptable excipient. In some embodiments the therapeutic composition includes an isolated nucleic acid comprising a nucleobase sequence comprising GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1), or a sequence at least 80% identical thereto, wherein the isolated nucleic acid is RNA, wherein the isolated nucleic acid is at most 60 nucleobases in length, and wherein the nucleic acid comprises at least one chemically modified residue, as described herein. In some embodiments, a residue of the nucleic acid in the nucleobase sequence is or comprises the at least one chemically modified residue. In some embodiments, the composition is an exosome-free composition. In some embodiments, the method is an extracellular vesicle-free composition.

[0068] In some embodiments, compositions of the present disclosure, e.g., the isolated nucleic acid-containing compositions, include a pharmaceutically acceptable excipient, such as water or a buffer. Pharmaceutically acceptable excipients include, but not limited to, saline, aqueous buffer solutions, solvents and / or dispersion media. Some nonlimiting examples of materials which can serve as pharmaceutically-acceptable excipients include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch andpotato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or poly anhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances employed in pharmaceutical formulations.

[0069] In some embodiments, the composition includes a transfection reagent, e.g., to promote delivery of the nucleic acid to a target cellular target (in vitro or in vivo). Any suitable transfection reagent can be included in the composition. Suitable transfection reagents include, without limitation, a liposome, extracellular vesicle (EV), and a polyethylene glycol (PEG)-cationic lipid complex (PCLC). In some embodiments, the transfection reagent includes a lipid (e.g., a liposome-forming lipid), or a PEGylated lipid. In some embodiments, the lipid is a cationic lipid, as provided herein. In some embodiments, the transfection reagent includes DharmaFECT® or Lipofectamine®. In some embodiments, the nucleic acid of the present disclosure is formulated with the transfection reagent in the composition so as to promote cellular uptake and / or pharmacokinetics of the nucleic acid.

[0070] Liposomes are artificially-prepared vesicles which may primarily be composed of a lipid bilayer and may be used as a delivery vehicle for the administration of pharmaceutical formulations. Liposomes can be of different sizes such as, but not limited to, a multilamellar vesicle (MLV), which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, a small unilamellar vesicle (SUV), which may be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV), which may be between 50 and 500 nm in diameter. Liposome design may include, without limitation, opsonins or ligands in order to improve the attachmentof liposomes to target tissue / cells, or to activate events such as, but not limited to, endocytosis. Liposomes may contain a low or a high pH in order to improve the delivery of the cargo, e.g., a nucleic acid of the present disclosure.

[0071] In some embodiments, the composition includes, without limitation, liposomes such as those formed from l,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), l,2-dilinoleyloxy-3- dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]- dioxolane (DLin-KC2-DMA), and MC3 and liposomes such as, but not limited to, DOXIL® from Janssen Biotech, Inc. (Horsham, Pa.).

[0072] In some embodiments, the composition includes a cationic lipid. Any suitable cationic lipid may be used in the present compositions. Suitable cationic lipids include, without limitation, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA and amino alcohol lipids. In some embodiments, the composition includes a cationic lipid complex, e.g., a polyethylene glycol (PEG)-cationic lipid complex (PCLC). In some embodiments, the cationic lipid is PEGylated, e.g., 2 kDa PEG (“PEG2000”). Any suitable option can be used to PEGylate the cationic lipid. In some embodiments, PCLC is formed by exposing a mixture of PEG and the cationic lipid to one or more freeze / thaw cycles, e.g., 1, 2, 3, 4, 5 or more freeze / thaw cycles. In some embodiments, a freeze / thaw cycle includes freezing the mixture with liquid nitrogen (e.g., around -190 °C) for about 5 minutes, and thawing at about 60 °C for about 5 minutes. A nucleic acid of the present disclosure can be mixed with the PCLC to generate a complex of the nucleic acid and the PCLC.

[0073] In some embodiments, the composition includes extracellular vesicles (EV), e.g., exosomes. The extracellular vesicles (EV) can be those from any suitable source, e.g., EV derived from cardiosphere-derived cells (CDC), or from fibroblasts. Suitable EV, such as CDC-derived EV, are provided in, e.g., U.S. Application Publication Nos. 20080267921, 20160158291 and 20160160181; Smith et al., Circulation. 2007. 115:896-908; Aminzadeh, M. A. el al. Siem Cell Reports 10, 942-955 (2018); and Ibrahim et al., Stem Cell Reports. 2014 May 8;2(5):606-19, Ibrahim, A. G. et al. Nanomedicine 33, 102347 (2020), each of which is incorporated by reference in its entirety. In some embodiments, the EVs are those isolated from serum-free media conditioned by human CDCs in culture. In some embodiments, thecomposition includes EV and liposomes and / or PCLC as transfection reagents. Tn some embodiments, the composition is substantially free of CDC-derived EV.

[0074] EVs, e.g., exosomes, disclosed herein can vary in size, depending on the embodiment. Depending on the embodiment, the size of the EVs ranges in diameter from about 15 nm to about 95 nm in diameter, including about 15 nm to about 20 nm, about 20 nm to about 30 nm, about 30 nm to about 40 nm, about 40 nm to about 50 nm, about 50 nm to about 60 nm, about 60 nm to about 70 nm, about 70 nm to about 80 nm, about 80 nm to about 90 nm, about 90 nm to about 95 nm, and overlapping ranges thereof. In several embodiments, EVs are larger (e.g., those ranging from about 140 to about 210 nm, including about 140 nm to about 150 nm, about 150 nm to about 160 run, about 160 nm to about 170 nm, about 170 nm to about 180 nm, about 180 nm to about 190 nm, 190 nm to about 200 nm, about 200 nm to about 210 nm, and overlapping ranges thereof). In some embodiments, the EV diameter is in a range of about 15 nm to about 200 nm in diameter, including about 15 nm to about 20 nm, about 20 nm to about 30 nm, about 30 nm to about 40 nm, about 40 nm to about 50 nm, about 50 nm to about 60 nm, about 60 nm to about 70 nm, about 70 nm to about 80 nm, about 80 nm to about 90 nm, about 90 nm to about 100 nm, about 100 nm to about 110 nm, about 110 nm to about 120 nm, about 120 nm to about 130 nm, about 130 nm to about 140 nm, about 140 nm to about 150 nm, about 150 nm to about 160 nm, about 160 nm to about 170 nm, about 170 nm to about 180 nm, about 180 nm to about 190 nm, about 190 nm to about 200 nm, and overlapping ranges thereof. In some embodiments, the EVs that are generated from the original cellular body are 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 2,000, 5,000, or 10,000 times smaller in at least one dimension (e.g., diameter) than the original cellular body.

[0075] The composition containing the EV and nucleic acid of the present disclosure can be prepared using any suitable option. In some embodiments, loading the nucleic acid into the EV includes: formulating the nucleic acid with liposomes and / or PCLC, e.g., as provided above, to generate a nucleic acid-liposome mixture; combining the nucleic acid-liposome mixture with the EV; and enriching for EV associated with exosome markers to generate a population of EV enriched for the nucleic acid. Combining the nucleic acidliposome mixture with the EV can be done using any suitable option. In some embodiments, the nucleic acid-liposome mixture is combined with the EV at 37 °C with shaking for about 30 minutes or more. Enriching to generate a population of EV enriched for the nucleic acid canbe done using any suitable option. In some embodiments, enriching for EV associated with exosome markers includes immunoprecipitating EV associated with exosome markers using antibodies specific to an exosome marker. In some embodiments, the exosome marker is one or more of CD9, CD63 and CD81. In some embodiments, enriching for EV associated with exosome markers includes immunoprecipitating EV associated with all the exosome markers, CD9, CD63 and CD81. In some embodiments, the size distribution of the population of EV enriched for the nucleic acid is substantially unimodal. In some embodiments, at least 80%, 85%, 90%, 95%, 97%, 99% of the population has a diameter under a single peak in the size distribution. In some embodiments, the population of EV enriched for the nucleic acid has an average diameter of about 50-180 nm, e.g., 60-170 nm, 70-160 nm, 80-150 nm, 90-140 nm, 100-130 nm, or about 110-130 nm.

[0076] In some embodiments, the composition includes casein, e.g., a casein micelle. In some embodiments, the composition includes chitosan. In some embodiments, the composition includes casein and chitosan, e.g., a casein-chitosan micelle. In some embodiments, the composition includes a casein-chitosan complex. In some embodiments, the isolated nucleic acid in the composition is encapsulated in a casein-chitosan complex. In some embodiments, the composition includes one or more of phosphoproteins: alpha si casein, alpha s2 casein, beta casein, and kappa casein. In some embodiments, the composition includes two or more, three or more, or all four phosphoproteins: alpha si casein, alpha s2 casein, beta casein, and kappa casein. The phosphoproteins may be present in the composition at any suitable concentration (relative to each other, and relative to the total volume of the composition), and in some embodiments, is present in an amount suitable for forming casein micelles. In some embodiments, the casein phosphoproteins are collectively present in the composition at about 5-10 % (weight by volume). In some embodiments, the casein phosphoproteins are collectively present in the composition at about 8 % (weight by volume). In some embodiments, the casein phosphoproteins are collectively present in the composition at about 5 % (weight by volume). The casein phosphoproteins can be those from any suitable animal, e.g., mammal such as, but not limited to, human, non-human primate, cow, pig, horse, camel, goat, and sheep. In some embodiments, the casein phosphoproteins are bovine alpha si casein, alpha s2 casein, beta casein, and kappa casein. Suitable casein formulations with EV are provided in, e.g., Aminzadeh et al., J Extracell Vesicles. 2021 Jan;10(3):el2045, theentirety of which is incorporated herein by reference. Tn some embodiments, a composition, e.g., pharmaceutical composition, of the present disclosure formulated with casein, as provided herein, is suitable for oral administration to the subject. Without being bound by theory, the casein phosphoproteins in the composition are thought to increase the bioavailability of orally administered EV and / or liposomes and their cargo, e.g., the nucleic acid of the present disclosure.

[0077] In several embodiments, a composition for enhancing the oral bioavailability of a therapeutic nucleic acid of the present disclosure comprises at least two phosphoproteins selected from alpha si casein, alpha s2 casein, beta casein, and kappa casein, where the phosphoproteins are present in an amount between about 5% to about 10% (weight by volume) of the composition, in a physiologically compatible excipient. In several embodiments, the composition includes the alpha si casein in an amount between about 0% to about 50% (e.g., about 10% to about 45%, about 20% to about 40%. about 25% to about 40%, about including 30% to about 40%) (by weight), the alpha s2 casein in an amount between about 0% to about 20% (e.g., about 5% to about 15%, about 7% to about 12%, including about 8% to about 12%) (by weight), the beta casein in an amount between about 0% to about 50% (e.g., about 10% to about 45%, about 20% to about 40%, about 25% to about 40%, about including 30% to about 40%) (by weight), and the kappa casein in an amount between about 0% to about 20% (e.g., about 5% to about 18%, about 8% to about 18%, including about 10% to about 15%) (by weight) of the phosphoprotein mass in the composition. The present compositions can provide for enhanced oral bioavailability of therapeutic nucleic acids, such as uREXl.

[0078] In several embodiments, the formulations provided for herein are in the form of lipid-bound vesicles, e.g., micelles or liposomes, and can therefore include any suitable number of particles. In some embodiments, the amount of micelles (e.g., casein-chitosan coated micelles) is in a range of about 106to about 1010particles, e.g., about 2 x 106to about 1010particles, about 5 xlO6to about 1010particles, about 107to about 5 x 109particles, about 2 xlO7to about 5 x 109particles, about 5 xlO7to about 5 x 109particles, including about 1 xlO8to about 2 x 109particles. In some embodiments, the amount of micelles (e.g., casein-chitin coated micelles) in the population is about 106, about 2 x 106, about 5 x 106, about 107, about2 x 107, about 5 x 107, about 108, about 2 x 108, about 5 x 108, about 109, about 2 x 109, about 5 x 109, or about IO10particles, or an amount in between any two of the preceding values.

[0079] In several embodiments, the composition comprises casein-chitosan coated lipid micelles, where the casein phosphoproteins are present in the composition in suitable amounts (e.g., suitable total amount of phosphoprotein mass in the composition, suitable proportions of phosphoproteins relative to each other). In some embodiments, the composition includes two, three, or all four phosphoproteins selected from alpha si casein, alpha s2 casein, beta casein, and kappa casein. In some embodiments, the amount of a phosphoprotein in the composition depends on the amount of one or more other phosphoprotein present in the composition.

[0080] In some embodiments, alpha si casein is a phosphoprotein associated with the gene name CSN1S1. The alpha si casein can be a CSN1S1 phosphoprotein from any suitable mammal. In some embodiments, the alpha si casein is bovine (Gene ID: 282208), porcine (Gene ID: 445514), equine (Gene ID: 100033982), ovine (Gene ID: 443382), caprine (Gene ID: 100750242), cameline (Gene ID: 105090954), or human (Gene ID: 1446). In some embodiments, the alpha si casein is a non-human alpha si casein.

[0081] In some embodiments, the composition includes any suitable amount of alpha si casein. In some embodiments, the composition includes the alpha si casein in an amount, by weight, between about 0% to about 50%, e.g., between about 5% to about 50%, between about 10% to about 50%, between about 15% to about 45%, between about 20% to about 45%, including between about 25% to about 40%, of the phosphoprotein mass in the composition. In some embodiments, the composition includes the alpha si casein in an amount, by weight, of about 0%, 5%, 10%, 15%, 20%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or an amount within a range defined by any two of the preceding values.

[0082] In some embodiments, the alpha s2 casein is a phosphoprotein associated with the gene name CSN1S2. The alpha s2 casein can be a CSN1S2 phosphoprotein from any suitable mammal. In some embodiments, the alpha s2 casein is bovine (Gene ID: 282209), porcine (Gene ID: 445515), equine (Gene ID: 100327035), ovine (Gene ID: 443383), caprine (Gene ID: 100861229), or cameline (Gene ID: 105090951).

[0083] The composition can include any suitable amount of alpha s2 casein. In some embodiments, the composition includes the alpha s2 casein in an amount, by weight, between about 0% to about 20%. e.g., between about 2% to about 18%, between about 3% to about 18%, between about 4% to about 17%, between about 5% to about 16%, including between about 5% to about 15%, of the phosphoprotein mass in the composition. In some embodiments, the composition includes the alpha s2 casein in an amount, by weight, of about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 18%, 20%, or an amount within a range defined by any two of the preceding values.

[0084] In some embodiments, the beta casein is a phosphoprotein associated with the gene name CSN2. The beta casein can be a CSN2 phosphoprotein from any suitable mammal. In some embodiments, the beta casein is bovine (Gene ID: 281099). porcine (Gene ID: 404088), equine (Gene ID: 100033903), ovine (Gene ID: 443391), caprine (Gene ID: 100860784), cameline (Gene ID: 105080412), or human (Gene ID: 1447). In some embodiments, the beta casein is a non-human beta casein.

[0085] The composition can include any suitable amount of beta casein. In some embodiments, the composition includes the beta casein in an amount, by weight, between about 0% to about 50%, e.g., between about 5% to about 50%, between about 10% to about 50%, between about 15% to about 45%, between about 20% to about 45%, including between about 25% to about 40%, of the phosphoprotein mass in the composition. In some embodiments, the composition includes the beta casein in an amount, by weight, of about 0%, 5%, 10%, 15%, 20%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or an amount within a range defined by any two of the preceding values.

[0086] In some embodiments, the kappa casein is a phosphoprotein associated with the gene name CSN3. The beta casein can be a CSN3 phosphoprotein from any suitable mammal. In some embodiments, the kappa casein is bovine (Gene ID: 281728), porcine (Gene ID: 445511), equine (Gene ID: 100033983), ovine (Gene ID: 443394), caprine (Gene ID: 100861231), cameline (Gene IDs: 105080408 or 105090949), or human (Gene ID: 1448). In some embodiments, the kappa casein is a non-human kappa casein.

[0087] The composition can include any suitable amount of kappa casein. In some embodiments, the composition includes the kappa casein in an amount, by weight, between about 0% to about 20%, e.g., between about 2% to about 18%, between about 3% to about18%, between about 4% to about 17%, between about 5% to about 16%, including between about 5% to about 15%, of the phosphoprotein mass in the composition. In some embodiments, the composition includes the kappa casein in an amount, by weight, of about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 18%, 20%, or an amount within a range defined by any two of the preceding values.

[0088] Combinations of caseins from different species are used, in some embodiments. For example, in several embodiments, one or more human casein is used in combination with one or more bovine casein. Ratios of caseins are used in some embodiments, for example a 3: 1:3:1 ratio of alpha SI casei alpha s2 caseimbeta casei kappa casein. Different ratios may be used in some embodiments, for example 4: 1:4:1, 2: 1:2:1, or 1:1: 1:1. Ratios may also be used between any two given caseins in a composition, ranging from 1:1, 2:1, 3:1, 4:1, 5:1, 10:1, 1:5, 1:4, 1:3, 1:2, etc.

[0089] Any suitable total amount of the phosphoproteins may be present in the composition. In some embodiments, the phosphoproteins are present in an amount between 5% to about 10%, e.g., about 6% to about 10%, about 6% to about 9%, including about 6% to about 8%, (weight by volume) of the composition. In some embodiments, the phosphoproteins are present in an amount of about 5%, 6%, 7%, 8%, 9%, 10%, or an amount within a range defined by any two of the preceding values, (weight by volume) of the composition.

[0090] In some embodiments, one or more of the casein phosphoproteins are nonhuman casein phosphoproteins. In some embodiments, the exosomes and at least one of the casein phosphoproteins are from different species. In some embodiments, the exosomes are human exosomes. and one or more of the casein phosphoproteins are non-human casein phosphoproteins. In some embodiments, the exosomes are human exosomes, and one or more of the casein phosphoproteins are bovine (or ovine, porcine, caprine, cameline, or equine) casein phosphoproteins.

[0091] In some embodiments, the composition includes micellar structures formed by at least a portion of the casein phosphoproteins. In some embodiments, the casein micelles are substantially spherical. In some embodiments, a casein micelle in the composition has an average diameter (as measured per micelle) of about 40 nm, about 50 nm, about 60 nm, about 70 nm, about80 nm, about 90 nm, about 100 nm, about 110 nm, about 120 nm, about 130 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about450 nm, about 500 nm or more, or an average diameter within a range defined by any two of the preceding values. In some embodiments, a casein micelle in the composition has an average diameter (as measured per micelle) in a range from about 40 nm to about 500 nm, e.g., from about 40 nm to about 400 nm, from about 50 nm to about 300 nm, from about 60 nm to about 250 nm, from about 70 nm to about 250 nm, from about 80 nm to about 200 nm, including from about 90 nm to about 150 nm. The casein micelles of the present composition are generally not precipitated or in gel form.

[0092] In some embodiments, the composition includes one or more colloidal minerals (e.g., minerals in suspension). In several embodiments, a complex (e.g., two or more) minerals are used as a colloidal mineral complex. The colloidal mineral complex can include any suitable mineral compounds and / or their salts, hi some embodiments, the colloidal mineral complex includes, without limitation, one or more of calcium, magnesium, inorganic phosphate, citrate, sodium, potassium, and chloride, or their respective salts. In some embodiments, the colloidal mineral complex is present in an amount between about 2% and about 15%, e.g., about 2% to about 12%, about 5% to about 10%, about 5% to about 9%, including about 6% to about 9% (by weight) of the phosphoprotein mass in the composition. In some embodiments, the colloidal mineral complex is present in an amount of about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15% or an amount within a range defined by any two of the preceding percentages.

[0093] In some embodiments, the composition is in a parenteral dose form. In some embodiments, the parenteral dosage form is sterile or capable of being sterilized before administering to a patient. Examples of parenteral dosage forms include, but are not limited to, solutions ready for injection, dry products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, and emulsions. In addition, controlled-release parenteral dosage forms can be prepared for administration to a subject. Suitable excipients that can be used to provide parenteral dosage forms of the nucleic acid include, without limitation: sterile water; water for injection USP; saline solution; glucose solution; aqueous vehicles such as but not limited to, sodium chloride injection, Ringer's injection, dextrose Injection, dextrose and sodium chloride injection, and lactated Ringer's injection; water-miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene glycol, and propylene glycol; and non-aqueous vehicles such as, but not limitedto, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.METHODS

[0094] Provided herein are methods of treating a subject in need thereof using the RNA molecules of the present disclosure (also referred to herein as “treatment methods”). With reference to FIGs. 16 and 17, a method of treating an inflammatory condition is provided. The method 1600, 1700 can include administering 1610, 1710 to a subject in need of treating an inflammatory condition a therapeutically effective amount of any one of the isolated nucleic acids of the present disclosure. In some embodiments, the method 1600 includes administering 1610 to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence comprising GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1) or a sequence at least 80% identical thereto, where the isolated nucleic acid is RNA, and where the isolated nucleic acid is at most 60 nucleobases in length. In some embodiments, the method 1600 includes administering 1610 to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence comprising XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C, or A, or a sequence at least 80% identical thereto, where the isolated nucleic acid is RNA, and where the isolated nucleic acid is at most 60 nucleobases in length, and wherein, when Xi is G, the nucleobase sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO: 1, and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO:1. In some embodiments, the method 1700 includes administering 1710 to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence comprising AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3) or a sequence at least 80% identical thereto, wherein the isolated nucleic acid is RNA, where the isolated nucleic acid is at most 60 nucleobases in length. Administering the therapeutically effective amount of the isolated nucleic acid of the present disclosure can treat the inflammatory condition. In some embodiments, the method 1600, 1700 includes identifying 1620, 1720 the subject in need of treating the inflammatory condition.

[0095] The isolated nucleic acid administered to the subject can be any suitable nucleic acid, as described herein. In some embodiments, the nucleobase sequence is at least95% identical to GUGGUCUAGUGGUUAGGAUUCGG (SEQ TD NO:1). Tn some embodiments, the nucleobase sequence comprises GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1). In some embodiments, the isolated nucleic acid is 23-30 nucleobases in length. In some embodiments, the isolated nucleic acid is at most 31 nucleobases long. In some embodiments, the nucleobase sequence consists of, or consists essentially of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1). In some embodiments, the nucleobase sequence is at least 90% identical to XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C, or A, where when Xi is G. the nucleobase sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO:1, and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO: 1. In some embodiments, Xi is G. In some embodiments, Xi in SEQ ID NO: 12 is C or A, or wherein the nucleobase sequence comprises GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 16). In some embodiments, the nucleobase sequence consists essentially of XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C. or A. In some embodiments, the nucleobase sequence does not comprise UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 80% identical thereto. In some embodiments, the nucleobase sequence does not comprise UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11). In some embodiments, the nucleobase sequence does not comprise UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 80% identical thereto. In some embodiments, the nucleobase sequence does not comprise UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 95% identical thereto. In some embodiments, the nucleobase sequence does not comprise UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 96% identical thereto, hi some embodiments, the nucleobase sequence does not comprise UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11). or a sequence at least 97% identical thereto. In some embodiments, the nucleobase sequence does not comprise UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 98% identical thereto. In some embodiments, the nucleobase sequence does not comprise UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 99% identical thereto.

[0096] In some embodiments, the nucleobase sequence is at least 95% identical to AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3). In some embodiments, the nucleobase sequence comprises AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3). In some embodiments, the nucleobase sequence consists of, or consists essentially of AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3). hi some embodiments, the isolated nucleic acid is 19-25 nucleobases in length.

[0097] In some embodiments, the isolated nucleic acid comprises at least one chemically modified residue, optionally wherein a residue of the nucleic acid in the nucleobase sequence comprises the at least one chemically modified residue.

[0098] With reference to FIG. 18, a method of treating an inflammatory condition is provided. The method 1800 can include administering 1810 to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence at least 80% identical to a reference sequence of a reference therapeutic nucleic acid comprised in a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2), wherein the isolated nucleic acid is RNA, and wherein the reference sequence is at least 18 nucleobases long (e.g., 18-60 nucleobases long). In some embodiments, “overexpress” denotes an elevated level of expression of the noted protein and / or a nucleic acid encoding the noted protein relative to a reference level (e.g., level of expression in a control cell that is not genetically modified). In some embodiments, when the reference sequence comprises GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1) or a sequence at least 80% identical thereto, the reference sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO: 1 , and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO: 1. In some embodiments, the TDO2 protein has an amino acid sequence of SEQ ID NO:5 (as set forth in FIG. 15A), or a sequence at least 90%. 95%, 97%, 98%, 99% or more identical thereto. As described herein, EVs having a therapeutic effect (e.g., anti-inflammatory effect) when administered to a subject can be obtained from fibroblasts that have been transduced to overexpress TDO2. In some embodiments, the genetically modified fibroblast has an activated endogenous gene encoding TDO2. In some embodiments, the genetically modified fibroblast has been transduced with an exogenous activator specific to an endogenous gene encoding TDO2. In some embodiments, the genetically modified fibroblast expresses TDO2 from a transgene thatincludes a nucleotide sequence that encodes TD02 and is under control of a promoter that drives expression in the fibroblast. Administering the therapeutically effective amount of the isolated nucleic acid can treat the inflammatory condition.

[0099] In some embodiments, the isolated nucleic acid includes a nucleobase sequence at least 80%, 85%. 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about 100% identical to the reference sequence of the reference therapeutic nucleic acid comprised in the therapeutic extracellular vesicle (EV) from the genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2), or optionally it includes a nucleobase sequence that has sequence identity to the reference sequence in a range defined by any two of the preceding values (e.g., 80-100%, 85-97%, 90-98%, 93-99%, etc.). In some embodiments, the isolated nucleic acid is, is about or is at least 18, 19, 20, 12, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, or 60 nucleobases in length, or optionally it includes a length that is in a range defined by any two of the preceding values (e.g., 18-60 nucleobases, 18-25 nucleobases, 19-25 nucleobases, 18-40 nucleobases. 23-30 nucleobases, etc.). In some embodiments, the isolated nucleic acid is at most 60 nucleobases in length. In some embodiments, the isolated nucleic acid is 19-31 nucleobases in length. In some embodiments, the reference sequence does not compriseUCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 80% identical thereto.

[0100] In some embodiments, the reference therapeutic nucleic acid is enriched in the therapeutic EV compared to an EV from a fibroblast that is not configured to overexpress TDO2. In some embodiments, expression level of the reference therapeutic nucleic acid in the therapeutic EV is greater than the expression level in EV from a fibroblast that is not configured to overexpress TDO2 by, by about, or by at least 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 200, 500, or 1,000 fold or more, or optionally the expression level is higher by a fold amount in a range defined by any two of the preceding values (e.g., 1.5-1,000 fold, 2-200 fold, 3-10 fold, 4-200 fold, etc.). In some embodiments, expression level of the reference therapeutic nucleic acid in the therapeutic EV is greater than the expression level in EV from a fibroblast that is not configured to overexpress TDO2 by, by about, or by at least 3 fold. In some embodiments, expression level of the reference therapeutic nucleic acid in the therapeutic EV is greater thanthe expression level in EV from a fibroblast that is not configured to overexpress TD02 by, by about, or by at least 5 fold.

[0101] The therapeutic EVs can contain one or more nucleic acids, including RNA, that mediate the therapeutic effect(s) of the therapeutic EVs. In some embodiments, the reference therapeutic nucleic acid is a non-coding RNA. In some embodiments, the reference therapeutic nucleic acid is a miRNA, piRNA, rRNA, or tRNA, or a fragment thereof.

[0102] In some embodiments, the reference therapeutic nucleic acid is enriched in the therapeutic EV compared to an EV from a second genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2) and GATA binding protein 4 (GATA4). In some embodiments, GATA4 protein that is overexpressed in the fibroblast has an amino acid sequence of SEQ ID NO:6 (as set forth in FIG. 15B), or a sequence at least 90%, 95%, 97%, 98%, 99% or more identical thereto. As described herein, EV obtained from fibroblasts that have been transduced to overexpress TDO2 and GATA4 can have lower therapeutic effect compared to EV obtained from fibroblasts that have been transduced to overexpress TDO2 without GATA4. In some embodiments, the second genetically modified fibroblast has an activated endogenous gene encoding TDO2 and / or GATA4. In some embodiments, the second genetically modified fibroblast has been transduced with an exogenous activator specific to an endogenous gene encoding TDO2 and / or GATA4. In some embodiments, the second genetically modified fibroblast expresses GATA4 from a transgene that includes a nucleotide sequence that encodes GATA4 and is under control of a promoter that drives expression in the fibroblast.

[0103] In some embodiments, the reference therapeutic nucleic acid is enriched in the therapeutic EV compared to an EV from the second genetically modified fibroblast that is configured to overexpress TDO2 and GATA4. In some embodiments, expression level of the reference therapeutic nucleic acid in the therapeutic EV is greater than the expression level in EV from a fibroblast that is configured to overexpress TDO2 and GATA4 by, by about, or by at least 2, 3, 4, 5, 6, 7, 8, 9. 10. 20, 50, 100, 200, 500, 1,000, 2,000 or 5,000 fold or more, or optionally the expression level is higher by a fold amount in a range defined by any two of the preceding values (e.g., 2-5,000 fold, 3-500 fold, 4-20 fold, 10-200 fold, etc.). In some embodiments, expression level of the reference therapeutic nucleic acid in the therapeutic EV is greater than the expression level in EV from a fibroblast that is configured to overexpressTD02 and GATA4 by, by about, or by at least 5 fold. Tn some embodiments, expression level of the reference therapeutic nucleic acid in the therapeutic EV is greater than the expression level in EV from a fibroblast that is configured to overexpress TD02 and GATA4 by. by about, or by at least 7 fold.

[0104] Non-limiting examples of a reference therapeutic nucleic acid include uREXl (as provided in FIG. 6B) and / or miR-1246 (as provided in FIG. 14A). In some embodiments, the reference sequence of the reference therapeutic nucleic acid includes GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1). In some embodiments, the reference sequence of the reference therapeutic nucleic acid includes AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3).

[0105] Conditions that may be treated by the treatment methods include, without limitation, heart conditions and inflammatory conditions. In some embodiments, the conditions include, without limitation, myocardial infarction, cardiac disorders, myocardial alterations, inflammatory disease, cardiac inflammatory condition, or cardiac injury. In some embodiments, the conditions include myocardial infarction. In some embodiments, conditions treated by the treatment methods include, without limitation, conditions associated with inflammation (or inflammatory condition). In some embodiments, a subject treated by administering the isolated nucleic acid of the present disclosure, according to the treatment methods herein, are in need of treatment for conditions associated with inflammation (or inflammatory condition). The conditions associated with inflammation can include, without limitation, inflammation of the heart. In some embodiments, the conditions treated by the present treatment methods are a symptom and / or sequelae of a cardiac injury. In some embodiments, the method includes identifying a subject having or diagnosed with a heart condition or inflammatory condition, as described herein, and administering a therapeutically effective amount of the nucleic acids of the present disclosure to the subject.

[0106] In some embodiments, the heart condition includes myocardial infarction, heart failure, or a symptom or sequelae thereof (e.g., reduced heart function, cardiac tissue fibrosis, etc.). In some embodiments, the heart condition includes myocardial infarction. In some embodiments, heart function includes left ventricle function, which can be represented by any suitable option such as, without limitation, ejection fraction. In some embodiments, the method includes identifying a subject having or diagnosed with heart failure, or a symptomor sequelae thereof, as described herein, and administering a therapeutically effective amount of the isolated nucleic acid of the present disclosure to the subject. In some embodiments, the method includes identifying a subject who is at risk of, or has suffered myocardial infarction, or a symptom or sequelae thereof, as described herein, and administering a therapeutically effective amount of the isolated nucleic acid of the present disclosure to the subject. In some embodiments, the method includes identifying a subject who is at risk of, or has suffered myocardial infarction, or a symptom or sequelae thereof, as described herein, and administering a therapeutically effective amount of the isolated nucleic acid of the present disclosure to the subject. In some embodiments, the method includes identifying a subject who is at risk of, or has suffered cardiac injury, or a symptom or sequelae thereof, as described herein, and administering a therapeutically effective amount of the isolated nucleic acid of the present disclosure to the subject.

[0107] In some embodiments, a method of treating an inflammatory condition includes administering to a subject in need of treating a condition associated with inflammation a therapeutically effective amount of the isolated nucleic acid of the present disclosure (or a composition containing the same, as described herein), thereby treating the condition associated with inflammation (or inflammatory condition). In some embodiments, methods of the present disclosure include the use of the isolated nucleic acid, or a composition comprising same, to treat tissue damage caused by direct or indirect inflammation (e.g., inflammation secondary to tissue damage such as a myocardial infarction or infection, such as viral infection). In some embodiments, a treatment method of the present disclosure treats any one or more of a variety of inflammatory conditions. In some embodiments, the inflammatory condition is a chronic condition. In some embodiments, the inflammatory condition is one that is responsive to the anti-inflammatory effect of IL-10. In some embodiments, the inflammatory condition includes an autoimmune disease, graft-versus-host disease (GVHD) or an immune response to an organ transplant. In some embodiments, the inflammatory condition includes viral infection, sepsis, arthritis (rheumatoid arthritis, juvenile rheumatoid arthritis, psoriatic arthritis), multiple sclerosis, pemphigus, and type 1 diabetes (also referred to as insulin-dependent diabetes mellitus (IDDM)). In some embodiments, the inflammatory condition includes Behqet's disease, polymyositis / dermatomyositis, autoimmune cytopenias, autoimmune myocarditis, primary liver cirrhosis, Goodpasture's syndrome, autoimmunemeningitis, Sjogren's syndrome, systemic lupus erythematosus, Addison's disease, alopecia greata, ankylosing spondylitis, autoimmune hepatitis, autoimmune mumps, Crohn's disease, insulin-dependent diabetes mellitus, dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease, hemolytic anemia, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroma, spondyloarthropathy, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia and ulcerative colitis. In some embodiments, the inflammation is related to a bone marrow transplantation. In some embodiments, the inflammation is related to allograft rejection following tissue transplantation. In some embodiments, the autoimmune disease is a cardiac autoimmune disease, e.g., autoimmune myocarditis. In some embodiments, the autoimmune disease is scleroderma or systemic sclerosis. In some embodiments, the condition associated with inflammation (or inflammatory condition) comprises a symptom and / or sequelae of myocardial infarction, or heart failure. In some embodiments, the inflammatory condition comprises a cardiac inflammatory condition. In some embodiments, the condition associated with inflammation (or inflammatory condition) comprises inflammation and / or fibrosis of the heart. In some embodiments, the condition associated with inflammation (or inflammatory condition) a symptom and / or sequelae of myocardial infarction or heart failure (e.g., reduced heart function, cardiac tissue fibrosis, etc.). In some embodiments, the method includes identifying a subject having or diagnosed with inflammation of the heart, as described herein, and administering a therapeutically effective amount of the isolated nucleic acid of the present disclosure to the subject.

[0108] In some embodiments, the subject is a subject who has or has suffered heart failure. In some embodiments, the subject is a subject who has or has suffered myocardial infarction. In some embodiments, the subject is a subject who has or has suffered acute myocardial infarction. In some embodiments, the subject is at risk of having heart failure and / or myocardial infarction (e.g., myocardial infarction). In any method of treatment herein, in some embodiments, the subject is a mammalian subject. In any method of treatment herein, in some embodiments, the subject is a non-human primate subject. In any method of treatment herein, in some embodiments, the subject is a human subject.

[0109] In some embodiments, administering the therapeutically effective amount of the isolated nucleic acid to the subject ameliorates one or more symptoms of theinflammatory condition (e.g., reduced fibrosis, infarct size, reduced circulating level of inflammatory cytokines, reduced circulating level of a marker for cardiac injury, increased cardiac function, etc.), compared to a reference level (e.g.,. a suitable control level of the symptom for the inflammatory condition). In some embodiments, administering the therapeutically effective amount of the isolated nucleic acid to the subject ameliorates one or more symptoms of the inflammatory condition in a clinically meaningful manner.

[0110] In some embodiments, administering the therapeutically effective amount of the isolated nucleic acid to the subject reduces infarct size by, by about, or by at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 95% or more, or optionally it is reduced by a percentage in a range defined by any two of the preceding values (e.g., 10-95%, 15-50%, 20-60%, 30-45%, 40-75%, 50-90%, etc.), compared to a reference size (e.g., a suitable control infarct size, such as the infarct size in the subject before administering the isolated nucleic acid). In some embodiments, administering the therapeutically effective amount of the isolated nucleic acid to the subject reduces circulating level of a marker for cardiac injury (e.g., cTnl) by, by about, or by at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 95% or more, or optionally it is reduced by a percentage in a range defined by any two of the preceding values (e.g., 10-95%, 15-50%, 20-60%, 30-45%, 40-75%, 50-90%, etc.), compared to a reference level (e.g., a suitable control level, such as the level in the subject before administering the isolated nucleic acid).

[0111] In some embodiments, administering the therapeutically effective amount of the isolated nucleic acid to the subject prevents reduction in ejection fraction due to heart failure. In some embodiments, administering the therapeutically effective amount of the isolated nucleic acid to the subject prevents reduction in ejection fraction after myocardial infarction (e.g., myocardial infarction). In some embodiments, the subject’s ejection fraction does not substantively decrease due to heart failure or myocardial infarction after administering the therapeutically effective amount of the isolated nucleic acid to the subject. In some embodiments, the subject’s ejection fraction does not substantively decrease due to acute myocardial infarction after administering the therapeutically effective amount of the isolated nucleic acid to the subject. In some embodiments, the subject’s ejection fraction does not decrease, or decreases by. by about, or by at most 1, 2, 3, 4, 5%. or by a percentage in a range defined by any two of the preceding values (e.g., 0-5%, 0-3%, 1-4%, etc.) due to heart failureor myocardial infarction after administering the therapeutically effective amount of the isolated nucleic acid to the subject. In some embodiments, the subject’s ejection fraction does not decrease, or decreases by. by about, or by at most 1, 2, 3. 4, 5%. or by a percentage in a range defined by any two of the preceding values (e.g., 0-5%, 0-3%, 1-4%, etc.) due to acute myocardial infarction after administering the therapeutically effective amount of the isolated nucleic acid to the subject. In some embodiments, the subject’s ejection fraction increases after administering the therapeutically effective amount of the isolated nucleic acid to the subject, where the subject has suffered heart failure and / or myocardial infarction. In some embodiments, the subject’s ejection fraction increases after administering the therapeutically effective amount of the isolated nucleic acid to the subject, where the subject has suffered acute myocardial infarction. In some embodiments, administering the therapeutically effective amount of the isolated nucleic acid to the subject reduces myocardial fibrosis due to heart failure and / or myocardial infarction. In some embodiments, administering the therapeutically effective amount of the isolated nucleic acid to the subject reduces myocardial fibrosis due to acute myocardial infarction.

[0112] The isolated nucleic acid can be administered to the subject at any suitable therapeutically effective amount. In some embodiments, the therapeutically effective amount of the isolated nucleic acid includes, includes about, or includes at least 0.01 pg, 0.02 pg, 0.05 pg, 0.1 pg, 0.2 pg. 0.5 pg, 1 pg, 2 pg, 3 pg. 4 pg, 5 pg, 6 pg, 7 pg, 8 pg, 9 pg, 10 pg, 15 pg, 20 pg, 25 pg, 30 pg, 40 pg, 50 pg, 75 pg, 100 pg, 125 pg, 150 pg, 175 pg, 200 pg, 250 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg. 20 mg, 30 mg, 40 mg, 50 mg, 75 mg, 100 mg or more, or optionally, it includes an amount in a range defined by any two of the preceding values (e.g., 0.01 pg-0.1 pg, 0.1 pg-1 pg, 1 pg-10 pg, 10 pg-100 pg, 100 pg-1 mg, 1 mg-10 mg, 10 mg-100 mg). In some embodiments, the therapeutically effective amount is a weight-normalized amount. In some embodiments, the therapeutically effective amount of the isolated nucleic acid includes, includes about, or includes at least 0.001 pg / g, 0.002 pg / g, 0.005 pg / g. 0.01 pg / g, 0.02 pg / g, 0.05 pg / g, 0.1 pg / g, 0.15 pg / g, 0.2 pg / g, 0.5 pg / g, 1 pg / g, 2 pg / g, 3 pg / g, 4 pg / g, 5 pg / g, 6 pg / g, 7 pg / g, 8 pg / g, 9 pg / g, 10 pg / g, 15 pg / g, 20 pg / g, 25 pg / g, 30 pg / g, 35 pg / g, 40 pg / g, 45 pg / g, 50 pg / g. 60 pg / g, 70 pg / g, 80 pg / g, 90 pg / g. 100 pg / g of body weight, or more, or optionally, it includes an amount in a range defined by any two of the preceding values (e.g.,0.001 pg / g-0.01 pg / g, 0.01 pg / g-0.1 pg / g, 0.1 pg / g-1 pg / g, 1 pg / g-l O pg / g, 10 pg / g-100 pg / g). In some embodiments, the therapeutically effective amount of the isolated nucleic acid includes, includes about, or includes at least 0.001 mg / kg, 0.002 mg / kg, 0.005 mg / kg, 0.01 mg / kg, 0.02 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.15 mg / kg, 0.2 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg of body weight, or more, or optionally, it includes an amount in a range defined by any two of the preceding values (e.g., 0.001 mg / kg-0.01 mg / kg, 0.01 mg / kg-0.1 mg / kg, 0.1 mg / kg- 1 mg / kg, 1 mg / kg- 10 mg / kg, 10 mg / kg- 100 mg / kg).

[0113] In any method of the present disclosure, in some embodiments, the therapeutically effective amount of the isolated nucleic acid is sufficient on its own to bring about the desired outcome (e.g., without administering another therapeutic agent for the same condition or disease). In any method of the present disclosure, in some embodiments, the method includes administering a therapeutically effective amount of a composition that consists of, or consists essentially of the isolated nucleic acid and a pharmaceutically acceptable excipient.

[0114] The isolated nucleic acid or composition can be administered to the subject at any suitable dosing schedule. In some embodiments, the therapeutically effective amount of the isolated nucleic acid or the composition is administered to the subject no more frequently than three time a week, twice a week, once a week (QW), once every two weeks (Q2W), once every month (QM), once every two months (Q2M), once every three months (Q3M), once every four months (Q4M) or longer, or at a frequency in a range defined by any two of the preceding values (e.g., three times a week to once every four months (Q4M), twice a week to once every two months (Q2M), or twice a week to once a month (QM)). In some embodiments, the nucleic acid is administered to the subject 1. 2, 3, 4, 5, 6, 7, 8, 9. 10. 15. 20. 25. 30 or more times, or a number of times in a range defined by any two of the preceding values (e.g., 1-30 times, 2-20 times, 5-15 times, 1-20 times, etc.). In some embodiments, the isolated nucleic acid is administered to the subject at regular intervals. In some embodiments, the isolated nucleic acid is administered to the subject chronically.

[0115] The isolated nucleic acid or composition can be administered using any suitable route. Administration can be local or systemic. In some embodiments, administrationis parenteral. Suitable option for administration include, without limitation, intravenous, intramuscular, intracardial, subcutaneous, intra-arterial, intraperitoneal, or oral administration. In some embodiments, the isolated nucleic acid or composition is administered orally. In some embodiments, the isolated nucleic acid or composition is administered by oral gavage. In some embodiments, the isolated nucleic acid or composition is administered intravenously. In some embodiments, the isolated nucleic acid or composition is administered by infusion.

[0116] In any treatment method described herein, in some embodiments, the method is an exosome-free method. In some embodiments, the method is an extracellular vesicle-free method. As used herein, “exosome-free” and “extracellular vesicle-free” denotes that no substantive amount of exosome or extracellular vesicle is involved. In some embodiments, a method or composition that is exosome-free may involve a composition or use thereof that is substantially or essentially free of exosomes. In some embodiments, a method or composition that is exosome-free may involve a composition or use thereof that is free of exosomes. In some embodiments, a method or composition that is exosome-free may involve a composition or use thereof that is substantially or essentially free of extracellular vesicles. In some embodiments, a method or composition that is exosome-free may involve a composition or use thereof that is free of extracellular vesicles.

[0117] Also provided herein is a method of immunomodulation (“immunomodulation method”). The immunomodulation method can include contacting an effective amount of the isolated nucleic acid of the present disclosure (or a composition containing the same, as described herein), with a population of macrophages, e.g., human macrophages; population of fibroblasts, e.g. human cardiac fibroblasts. The nucleic acid can include a nucleobase sequence at least 80% identical to a reference sequence of a reference therapeutic nucleic acid comprised in a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2), wherein the isolated nucleic acid is RNA, and wherein the reference sequence is at least 18 nucleobases long, as described herein. In some embodiments, when the reference sequence comprises GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1) or a sequence at least 80% identical thereto, the reference sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO:1, and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO:1. In some embodiments, the isolated nucleic acid is at most 60 nucleobases in length (e.g., 18-60 nucleobases, 18-25 nucleobases, 23 nucleobases, 19 nucleobases, etc.). Tn some embodiments, the isolated nucleic acid is 19-31 nucleobases long.

[0118] In some embodiments, the reference therapeutic nucleic acid is a noncoding RNA. In some embodiments, the reference therapeutic nucleic acid is a miRNA, piRNA, rRNA, or tRNA, or a fragment thereof. In some embodiments, the reference therapeutic nucleic acid is a miRNA.

[0119] In some embodiments, the reference therapeutic nucleic acid is enriched in the therapeutic EV compared to an EV from a second genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2) and GATA binding protein 4 (GATA4). In some embodiments, expression level of the reference therapeutic nucleic acid in the therapeutic EV is greater than the expression level in EV from a fibroblast that is configured to overexpress TDO2 and GATA4 by, by about, or by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 200, 500, 1,000, 2,000 or 5,000 fold or more, or optionally the expression level is higher by a fold amount in a range defined by any two of the preceding values (e.g., 2-5,000 fold, 3- 500 fold, 4-20 fold, 10-200 fold, etc.). Non-limiting examples of a reference therapeutic nucleic acid include uREXl (as provided in FIG. 6B) and miR-1246 (as provided in FIG. 14A).

[0120] In some embodiments, the contacting comprises administering to a subject in need of treating an inflammatory condition an effective amount of the isolated nucleic acid or the composition. In some embodiments, contacting the effective amount of the isolated nucleic acid of the present disclosure with a population of macrophages (e.g., activated macrophages) changes expression of anti-inflammatory and / or inflammatory genes (e.g., IL- 10, IL-6. ILip and TGFP) by the macrophages, compared to a reference population of macrophages (e.g., a suitable control population of macrophages, such as a population of stimulated macrophages that have not been contacted with the isolated nucleic acid). In some embodiments, contacting the effective amount of the isolated nucleic acid of the present disclosure with a population of macrophages (e.g., activated macrophages) reduces expression of one or more inflammatory cytokines by the macrophages. In some embodiments, contacting the effective amount of the isolated nucleic acid of the present disclosure with a population of macrophages (e.g., stimulated macrophages) reduces expression of IL-6 and / or ILipby the macrophages, compared to a reference population of macrophages (e.g., a suitable control population of macrophages). In some embodiments, contacting the effective amount of theisolated nucleic acid of the present disclosure with a population of macrophages reduces expression of IL-6 and / or ILip by the macrophages by, by about, or by at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70. 75. 80% or more, or optionally it is reduced by a percentage in a range defined by any two of the preceding values (e.g., 10-80%, 15-50%, 20-60%, 30- 45%, etc.). In some embodiments, contacting the effective amount of the isolated nucleic acid of the present disclosure with a population of macrophages increases expression of IL10 and / or TGFp by the macrophages by, by about, or by at least 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7. 7.5, 8, 8.5, 9, 9.5, 10 fold, or optionally it is increased by a fold amount in a range defined by any two of the preceding values (e.g., 1.1-10 fold, 1.5-9 fold, 2-8 fold, 1.2-5 fold, etc.). In some embodiments, expression of IL-10, IL-6, ILip or TGFp is mRNA expression of IL-10. IL-6, ILip and TGFp. In some embodiments, expression of IL-10. IL-6, ILip or TGFp is protein expression of IL-10, IL-6, ILip and TGFp.

[0121] In some embodiments, contacting the effective amount of the isolated nucleic acid of the present disclosure with a population of fibroblasts reduces expression of smooth muscle actin (a-SMA) and / or collagen I in a population of fibroblasts (e.g., human dermal fibroblasts), compared to a reference population of fibroblasts (e.g., a suitable control population of fibroblasts, such as a population of fibroblasts that have not been contacted with the isolated nucleic acid). In some embodiments, contacting the effective amount of the isolated nucleic acid of the present disclosure with a population of fibroblasts reduces expression of a-SMA and / or collagen I in the population of fibroblasts by, by about, or by at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80% or more, or optionally it is reduced by a percentage in a range defined by any two of the preceding values (e.g., 10-80%, 15-50%, 20-60%, 30-45%, etc.), compared to a reference population of fibroblasts (e.g., a suitable control population of fibroblasts).. In some embodiments, expression of a-SMA and / or collagen I is mRNA expression of a-SMA and / or collagen I. In some embodiments, expression of a-SMA and / or collagen I is protein expression of a-SMA and / or collagen I.

[0122] In some embodiments, contacting the effective amount of the isolated nucleic acid of the present disclosure with a population of human coronary artery endothelial cells increases the length of the blood vessels in and / or the proliferation of the population of human coronary artery endothelial cells, compared to a reference population of cells (e.g., a suitable control population of human coronary artery endothelial cells, such as a population of-M-human coronary artery endothelial cells that have not been contacted with the isolated nucleic acid). In some embodiments, contacting the effective amount of the isolated nucleic acid of the present disclosure with a population of human coronary artery endothelial cells increases the length of the blood vessels in and / or the proliferation of the population of human coronary artery endothelial cells by, by about, or by at least 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.2, 2.5, 3, 3.5, 4, 4.5. 5, 5.5, 6, 6.5, 7. 7.5, 8, 8.5, 9, 9.5. 10 fold, or by a fold amount in a range defined by any two of the preceding values (e.g., 1.1-10 fold, 1.5-9 fold, 2-8 fold, 1.2-5 fold, etc.), compared to a reference population of cells (e.g., a suitable control population of human coronary artery endothelial cells).

[0123] In some embodiments, contacting the effective amount of the isolated nucleic acid of the present disclosure with a population of human cardiac myocytes increases the cell viability of the population of human cardiac myocytes when under hypoxic condition, compared to a reference population of human cardiac myocytes (e.g., a suitable control population of human cardiac myocytes, such as a population of human cardiac myocytes that have not been contacted with the isolated nucleic acid). In some embodiments, contacting the effective amount of the isolated nucleic acid of the present disclosure with a population of human cardiac myocytes increases the cell viability of the population of human cardiac myocytes when under hypoxic condition by, by about, or by at least 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5. 7, 7.5, 8. 8.5, 9, 9.5. 10 fold, or by a fold amount in a range defined by any two of the preceding values (e.g., 1.1-10 fold, 1.5-9 fold, 2-8 fold, 1.2-5 fold, etc.), compared to a reference population of human cardiac myocytes (e.g., a suitable control population of human cardiac myocytes).

[0124] In some embodiments, the contacting is done in vitro, e.g., in culture. In some embodiments, after contacting the macrophages in vitro, the method includes administering the isolated nucleic acid to a subject in need of treating a heart condition, fibrosis, or an inflammatory condition, as described herein.

[0125] In some embodiments, about 0.01 pg, 0.02 pg, 0.05 pg, 0.1 pg, 0.2 pg, 0.5 pg, 1 pg, 2 pg, 3 pg, 4 pg, 5 pg, 6 pg, 7 pg, 8 pg, 9 pg, 10 pg, 15 pg, 20 pg, 25 pg, 30 pg, 40 pg, 50 pg, 75 pg, 100 pg, 125 pg, 150 pg, 175 pg, 200 pg, 250 pg, 300 pg, 400 pg, 500 pg, 600 pg. 700 pg, 800 pg, 900 pg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 30 mg, 40 mg, 50 mg, 75 mg, 100 mg or more, or an amount in a range defined by any two of thepreceding values (e.g., 0.01 pg-0.1 pg, 0.1 pg-1 pg, 1 pg-10 pg, 10 pg-100 pg, 100 pg-1 mg, 1 mg-lOmg, lOmg-lOOmg) of the isolated nucleic acid is orally administered to the subject.

[0126] Also provided is a method of identifying a therapeutic agent. The method can include providing a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2) (e.g., the genetically modified fibroblasts as described herein). The method can also include identifying one or more candidate agents comprised in the EV. The method can further include providing an EV from a second genetically modified fibroblast that is configured to overexpress TDO2 and GATA binding protein 4 (GATA4). The method can include determining that the one or more candidate agents is enriched in the therapeutic EV compared to the EV from the second genetically modified fibroblast, whereby the one or more candidate agents is identified as a therapeutic agent.

[0127] In some embodiments, the therapeutic agent is a nucleic acid. In some embodiments, the therapeutic agent is RNA. In some embodiments, the method includes sequencing the one or more candidate agents. Any suitable option can be used to sequence the candidate agents. In some embodiments, the sequencing includes next-generation sequencing, or sequencing-by-synthesis.

[0128] In some embodiments, among EV from the genetically modified fibroblast that is configured to overexpress TDO2, those having a smaller average size tend to have a greater therapeutic effect. In some embodiments, the method includes providing the therapeutic EV by obtaining a first population of EV from a culture of the genetically modified fibroblast; and removing a second population of EV from the first population to obtain the therapeutic EV, wherein the second population of EV has a larger average size than the therapeutic EV. In some embodiments, the second population of EV has an average size of about 200 nm. Any suitable option can be used to determine the average size of the EV, such as, without limitation, by nanoparticle tracking analysis (NTA).

[0129] In some embodiments, the identified therapeutic agent is effective to provide one or more of: enhanced anti-inflammatory activity in a macrophage; treatment of an inflammatory condition in a subject in need thereof; treatment of cardiac injury in a subject in need thereof; and / or treatment of myocardial infarction, or a symptom or sequalae thereof, in a subject in need thereof.

[0130] The one or more candidate agents that is identified as a therapeutic agent may be enriched in the therapeutic EV compared to the EV from the second genetically modified fibroblast by any suitable fold amount. In some embodiments, expression level of the one or more candidate agents that is identified as a therapeutic agent in the therapeutic EV is greater than the expression level in EV from the second genetically modified fibroblast by, by about, or by at least 2. 3, 4. 5, 6. 7, 8, 9, 10, 20, 50, 100, 200, 500. 1,000. 2.000 or 5,000 fold or more, or optionally the expression level is higher by a fold amount in a range defined by any two of the preceding values (e.g., 2-5,000 fold, 3-500 fold, 4-20 fold, 10-200 fold, etc.).

[0131] The EV, e.g., exosomes, of the present disclosure can be derived from any suitable source, e.g., therapeutic cells, such as fibroblasts. In some embodiments, the EV are derived from engineered fibroblasts having enhanced therapeutic potential compared to, e.g., non-engineered fibroblasts. In some embodiments, the engineered fibroblasts are derived from normal human dermal fibroblasts (NHDF). In some embodiments, the fibroblasts are genetically modified to overexpress TDO2. In some embodiments, TDO2 expression is increased in the fibroblasts (or other cells) by introducing into the fibroblasts a nucleic acid configured to overexpress TDO2 in the fibroblasts, e.g., by containing a nucleotide sequence encoding an activating moiety configured to activate expression of an endogenous TDO2 gene, or by containing a nucleotide sequence encoding TDO2 protein whose expression is under a suitable promoter for expression in the fibroblasts. In some embodiments, the promoter is a constitutively active promoter. In some embodiments, the promoter is an inducible or conditionally active promoter. Any suitable option for genetically modifying a cell, e.g., fibroblast, can be used to prepare a therapeutic cell as provided herein. In some embodiments, genetically modifying the fibroblasts includes transducing the fibroblasts, e.g., via viral transduction, such as lentiviral transduction.

[0132] Depending on the embodiment, therapeutic cells, e.g., fibroblasts are derived from any suitable source. In some embodiments, the therapeutic nucleic acids are obtained from EV, e.g., exosomes, that are derived from cells obtained from a source that is allogeneic, autologous, xenogeneic, or syngeneic with respect to the tissue with which the therapeutic nucleic acids are contacted or the subject to which the therapeutic nucleic acids are administered.

[0133] Therapeutic EV, e.g., exosomes, in several embodiments, are isolated from cellular preparations by methods comprising one or more of filtration, centrifugation, antigenbased capture and the like. For example, in several embodiments, a population of cells grown in culture are collected and pooled. In several embodiments, monolayers of cells are used, in which case the cells are optionally treated in advance of pooling to improve cellular yield (e.g., dishes are scraped and / or enzymatically treated with an enzyme such as trypsin to liberate cells). In some embodiments, the cells are grown in serum-free medium, which was conditioned for 5-15 days, e.g., 15 days. In some embodiments, the therapeutic EV are collected from the conditioned medium using ultrafiltration and centrifugation. In several embodiments, cells grown in suspension are used.

[0134] In some embodiments, cells grown in culture under standard cell culture conditions are exposed to serum-free medium for 15 days, and conditioned media containing therapeutic EV, e.g., exosomes, are collected.

[0135] In some embodiments, therapeutic EV are subjected to one or more rounds of centrifugation (in several embodiments ultracentrifugation and / or density centrifugation is employed) in order to separate the EV fraction from the remainder of the cellular contents and debris from the population of cells. In some embodiments, centrifugation need not be performed to harvest EV. In several embodiments, pre-treatment of the cells is used to improve the efficiency of EV capture. For example, in several embodiments, agents that increase the rate of EV secretion from cells are used to improve the overall yield of EV. In some embodiments, augmentation of EV secretion is not performed. In some embodiments, size exclusion filtration is used in conjunction with, or in place of centrifugation, in order to collect a particular size (e.g., diameter) of EV. In several embodiments, filtration need not be used. In still additional embodiments, EV (or subpopulations of EV) are captured by selective identification of unique markers on or in the EV (e.g., transmembrane proteins). In such embodiments, the unique markers can be used to selectively enrich a particular EV population. In some embodiments, enrichment, selection, or filtration based on a particular marker or characteristic of EV is not performed. In some embodiments, EV are obtained by centrifuging the conditioned medium at about 3000 x g for 10 minutes, then sterile filtration using a 0.45 pm filter, then centrifugal ultrafiltration with a 100-kDa molecular weight cutoff filter. In some embodiments, the average size of the EV obtained using the above option is about 150nm (e.g., 140-170 nm). Tn some embodiments, EV are obtained by centrifuging the conditioned medium at about 300 x g for 10 minutes, then at about 1000 x g for 10 minutes to separate EV by size. In some embodiments, EV from TDO2 transduced cells and having smaller average diameter remain in the supernatant after the second centrifugation, and these show therapeutic effects, as described herein. In some embodiments. EV from TDO2 transduced cells and having larger diameter (e.g., about 200 nm average diameter) are in the pellet after the second centrifugation, and these show little or no therapeutic effect.

[0136] The therapeutic EV, e.g., exosomes. disclosed herein can vary in size, depending on the embodiment. Depending on the embodiment, the size of the EV ranges in diameter from about 15 nm to about 95 nm in diameter, including about 15 nm to about 20 nm, about 20 nm to about 30 nm, about 30 nm to about 40 nm, about 40 nm to about 50 nm, about 50 nm to about 60 nm, about 60 nm to about 70 nm, about 70 nm to about 80 nm, about 80 nm to about 90 nm, about 90 nm to about 95 nm, and overlapping ranges thereof. In several embodiments, EV are larger (e.g., those ranging from about 140 to about 210 nm, including about 140 nm to about 150 nm, about 150 nm to about 160 run, about 160 nm to about 170 nm, about 170 nm to about 180 nm, about 180 nm to about 190 nm, 190 nm to about 200 nm, about 200 nm to about 210 nm, and overlapping ranges thereof). In some embodiments, the EV that are generated from the original cellular body are 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 5000, or 10,000 times smaller in at least one dimension (e.g., diameter) than the original cellular body.

[0137] The therapeutic EV of the present disclosure may include a variety of biomolecules, such as nucleic acids and proteins, as payload. In some embodiments, the exosomes contain DNA, DNA fragments, DNA plasmids, mRNA, tRNA, snRNA, saRNA, miRNA, rRNA, regulating RNA, other non-coding and coding RNA, etc. In some embodiments, the exosomes contain non-coding RNAs (ncRNAs), such as, but not limited to, microRNAs (miRNAs). In some embodiments, the therapeutic EV of the present disclosure are preferentially enriched in tRNA and / or piRNA (piwi-interacting RNA), compared to EV of control cells (e.g., cells that have not been genetically engineered to overexpress TDO2).

[0138] Also provided herein is a method of treating an inflammatory condition, that includes administering to a subject in need of treating an inflammatory condition an inhibitor of phospholamban (PLN). Any suitable inhibitor of PLN can be used. In some embodiments,the inhibitor of PLN includes a construct that genetically inhibits expression of endogenous PLN in the subject. In some embodiments, the inhibitor of PLN is an inhibitory RNA (e.g., siRNA, shRNA, etc.) that targets an RNA transcript (e.g., mRNA) encoding PLN. In some embodiments, the inhibitor of PLN is CRISPR-Cas molecule configured to target and genetically modify the subject’s endogenous locus encoding PLN. In some embodiments, the inhibitor of PLN is CRISPR-Cas molecule configured to target and epigenetically modulate (e.g., inhibit) expression from the subject’s endogenous locus encoding PLN. In some embodiments, the inhibitor of PLN is uREXL or a derivative thereof (or functional derivative thereof) as described herein. In some embodiments, the subject is a human subject. In some embodiments, the PLN is human PLN (Gene ID 5350). In some embodiments, the inhibitor of PLN is administered to a target cell or tissue of interest. In some embodiments, the inhibitor of PLN is targeted to a target cell or tissue of interest. In some embodiments, the target cell is a macrophage. In some embodiments, the target cell is a muscle cell. In some embodiments, the target cell is a cardiac muscle cell. In some embodiments, the target tissue is the heart. In some embodiments, the inflammatory condition comprises: a cardiac inflammatory condition; a symptom or sequalae of a cardiac injury; and / or a symptom or sequalae of heart failure or myocardial infarction.Additional Embodiments

[0139] Further non-limiting embodiments of the present disclosure are provided by the following numbered embodiments.1. A method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence comprising GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1) or a sequence at least 80% identical thereto, wherein the isolated nucleic acid is RNA, wherein the isolated nucleic acid is at most 60 nucleobases in length. la. A method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence comprising XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C. or A, or a sequence at least 90% identical thereto, wherein the isolated nucleic acid is RNA, wherein theisolated nucleic acid is at most 60 nucleobases in length, and wherein, when Xi is G, the nucleobase sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO: 1, and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO:1, optionally Xi is G, optionally Xi is C or A, optionally the nucleobase sequence comprises GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 10).2. The method of embodiment 1, wherein the nucleobase sequence is at least 95% identical to GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1).3. The method of any one of the preceding embodiments, wherein the nucleobase sequence comprises GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1).4. The method of any one of the preceding embodiments, wherein the isolated nucleic acid is 23-30 nucleobases in length.5. The method of any one of the preceding embodiments, wherein the nucleobase sequence consists of, or consists essentially of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1).5a. The method of any one of the preceding embodiments, wherein the nucleobase sequence consists essentially of XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:12), wherein Xi is G, C, or A.5b. The method of any one of the preceding embodiments, wherein the nucleobase sequence does not comprise UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 80% identical thereto.6. A method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence comprising AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3) or a sequence at least 80% identical thereto, wherein the isolated nucleic acid is RNA, wherein the isolated nucleic acid is at most 60 nucleobases in length.7. The method of embodiment 6, wherein the nucleobase sequence is at least 95% identical to AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3).8. The method of embodiment 6 or 7, wherein the nucleobase sequence comprises AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3).9. The method of any one of embodiments 6-8, wherein the nucleobase sequence consists of, or consists essentially of AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3).10. The method of any one of embodiments 6-9, wherein the isolated nucleic acid is 19-25 nucleobases in length.11. The method of any one of the preceding embodiments, wherein the isolated nucleic acid comprises at least one chemically modified residue, optionally wherein a residue of the nucleic acid in the nucleobase sequence comprises the at least one chemically modified residue. l la. The method of embodiment 11, wherein at least one residue at positions 1-12 and / or 13-23 of the nucleobase sequence is the at least one chemically modified residue, or wherein at least one residue at positions 1-13 and / or 14-27 of the nucleobase sequence is the at least one chemically modified residue, optionally wherein the nucleic acid comprises the at least one chemically modified residue at: one or more of positions 1, 3, 5, 19, 21, and 23 of the nucleobase sequence, or one or more of positions 1, 3, 5, 23, 25, and 27 of the nucleobase sequence. l lb. The method of embodiment 11 or I la, wherein the at least one chemically modified residue is a locked nucleic acid (LNA).12. A method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence at least 80% identical to a reference sequence of a reference therapeutic nucleic acid comprised in a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2), wherein the isolated nucleic acid is RNA, and wherein the reference sequence is at least 18 nucleobases long.12a. A method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence at least 80% identical to a reference sequence of a reference therapeutic nucleic acid comprised in a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2), wherein the isolated nucleic acid is RNA, wherein the reference sequence is at least 18 nucleobases long, and wherein when the reference sequencecomprises GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1 ) or a sequence at least 80% identical thereto, the reference sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO: 1, and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO: 1, optionally wherein the isolated nucleic acid is 19-31 nucleobases in length, optionally wherein the reference sequence does not compriseUCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11). or a sequence at least 80% identical thereto.13. The method of embodiment 12 or 12a, wherein the reference therapeutic nucleic acid is enriched in the therapeutic EV compared to an EV from a fibroblast that is not configured to overexpress TDO2.14. The method of any one of embodiments 12-13, wherein the reference therapeutic nucleic acid is a non-coding RNA.15. The method of any one of embodiments 12-13, wherein the reference therapeutic nucleic acid is a miRNA, piRNA, rRNA, or tRNA, or a fragment thereof.16. The method of any one of embodiments 12-15, wherein the isolated nucleic acid is at most 60 nucleobases in length.17. The method of any one of embodiments 12-16, wherein the reference therapeutic nucleic acid is enriched in the therapeutic EV compared to an EV from a second genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2) and GATA binding protein 4 (GATA4).18. The method of any one of embodiments 12-17, wherein the reference sequence is or comprises GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1); or AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3).19. The method of any one of embodiments 12-18, wherein the isolated nucleic acid comprises, consists essentially of, or consists of the reference sequence of the reference therapeutic nucleic acid.20. The method of any one of embodiments 12-19, wherein the genetically modified fibroblast is a skin fibroblast, optionally wherein the skin fibroblast is a neonatal skin fibroblast.21. The method of any one of the preceding embodiments, wherein the inflammatory condition comprises a cardiac inflammatory condition.22. The method of any one of the preceding embodiments, wherein the inflammatory condition comprises a symptom or sequalae of a cardiac injury.23. The method of any one of the preceding embodiments, wherein the inflammatory condition comprises a symptom or sequalae of heart failure or myocardial infarction.24. The method of any one of the preceding embodiments, wherein the subject has or has suffered a myocardial infarction.25. The method of any one of the preceding embodiments, comprising orally administering the therapeutically effective amount of the nucleic acid to the subject.26. The method of any one of the preceding embodiments, comprising parenterally administering the therapeutically effective amount of the nucleic acid to the subject.27. The method of any one of the preceding embodiments, comprising intravenously, intramuscularly, or intracardially administering the therapeutically effective amount of the nucleic acid to the subject.28. The method of any one of the preceding embodiments, comprising identifying the subject in need of treating the inflammatory condition.29. A method of immunomodulation, comprising contacting an effective amount of an isolated nucleic acid with a population of macrophages, the nucleic acid comprising a nucleobase sequence at least 80% identical to a reference sequence of a reference therapeutic nucleic acid comprised in a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2), wherein the isolated nucleic acid is RNA, and wherein the reference sequence is at least 18 nucleobases long.29a. A method of immunomodulation, comprising contacting an effective amount of an isolated nucleic acid with a population of macrophages, the nucleic acid comprising a nucleobase sequence at least 80% identical to a reference sequence of a reference therapeutic nucleic acid comprised in a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2), wherein the isolated nucleic acid is RNA, and wherein the reference sequence is at least 18 nucleobases long, and wherein when the reference sequence comprises GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1) or a sequence at least 80% identicalthereto, the reference sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO:1, and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO:1.30. The method of embodiment 29 or 29a, wherein the contacting comprises administering to a subject in need of treating a treating an inflammatory condition an effective amount of the isolated nucleic acid, to thereby promote an anti-inflammatory activity of macrophages in the subject.31. The method of any one of embodiments 29-30, wherein the macrophage is a human macrophage.32. The method of any one of embodiments 29-31, wherein the reference therapeutic nucleic acid is a non-coding RNA.33. The method of any one of embodiments 29-31, wherein the reference therapeutic nucleic acid is a miRNA, piRNA, rRNA, or tRNA, or a fragment thereof.34. The method of any one of embodiments 29-33, wherein the isolated nucleic acid is at most 60 nucleobases in length.35. The method of any one of embodiments 29-34, wherein the reference therapeutic nucleic acid is enriched in the therapeutic EV compared to an EV from a second genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2) and GATA binding protein 4 (GATA4).36. The method of any one of embodiments 29-35, wherein the reference sequence is or comprises GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1); or AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3).37. The method of any one of embodiments 29-36. wherein the isolated nucleic acid comprises, consists essentially of, or consists of the reference sequence of the reference therapeutic nucleic acid.38. The method of any one of the preceding embodiments that is an exosome-free method, optionally wherein the method is an extracellular vesicle-free method.39. A method of identifying a therapeutic agent, comprising: providing therapeutic extracellular vesicles (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2); identifying one or more candidate agents comprised in the therapeutic EV;providing EV from a second genetically modified fibroblast that is configured to overexpress TD02 and GATA binding protein 4 (GATA4); and determining that the one or more candidate agents is enriched in the therapeutic EV compared to the EV from the second genetically modified fibroblast, whereby the one or more candidate agents is identified as a therapeutic agent.40. The method of embodiment 39, wherein the therapeutic agent is a nucleic acid, optionally wherein the therapeutic agent is RNA.41. The method of embodiment 40, comprising sequencing the one or more candidate agents.42. The method of any one of embodiments 39-41, wherein providing the therapeutic EV comprises: obtaining a first population of EV from a culture of the genetically modified fibroblast; and removing a second population of EV from the first population to obtain the therapeutic EV, wherein the second population of EV has a larger average size than the therapeutic EV, optionally wherein the second population of EV has an average size of about 200 nm as determined by nanoparticle tracking analysis (NT A).43. The method of any one of embodiments 39-42, wherein the identified therapeutic agent is effective to provide one or more of: enhanced anti-inflammatory activity in a macrophage; treatment of an inflammatory condition in a subject in need thereof; treatment of cardiac injury in a subject in need thereof; and / or treatment of myocardial infarction, or a symptom or sequalae thereof, in a subject in need thereof.44. An isolated nucleic acid comprising a nucleobase sequence comprising GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1), or a sequence at least 80% identical thereto, wherein the isolated nucleic acid is RNA, wherein the isolated nucleic acid is at most 60 nucleobases in length, and wherein the nucleic acid comprises at least one chemically modified residue, optionally wherein a residue of the nucleic acid in the nucleobase sequence comprises the at least one chemically modified residue.44a. An isolated nucleic acid comprising a nucleobase sequence comprising XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C, or A, or a sequence at least 90% identical thereto, wherein the isolated nucleic acid is RNA, wherein theisolated nucleic acid is at most 60 nucleobases in length, and wherein, when Xi is G, the nucleobase sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO: 1, and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO:1. and wherein the nucleic acid comprises at least one chemically modified residue in the nucleobase sequence, optionally Xi is G, optionally Xi is C or A, or wherein the nucleobase sequence comprises GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 10).45. The isolated nucleic acid of embodiment 44 or 44a, wherein the isolated nucleic acid is 23-30 nucleobases in length.46. The isolated nucleic acid of any one of embodiments 44-45, wherein the nucleobase sequence consists of, or consists essentially of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1).46a. The isolated nucleic acid of any one of embodiments 44-45, wherein the nucleobase sequence consists essentially of XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C, or A.46b. The isolated nucleic acid of any one of embodiments 44-46a, wherein at least one residue at positions 1-12 and / or 13-23 of the nucleobase sequence is the at least one chemically modified residue, or wherein at least one residue at positions 1-13 and / or 14-27 of the nucleobase sequence is the at least one chemically modified residue.46c. The isolated nucleic acid of any one of embodiments 44-46b, wherein the nucleic acid comprises the at least one chemically modified residue at: one or more of positions 1, 3, 5, 19, 21, and 23 of the nucleobase sequence, or one or more of positions 1, 3, 5, 23, 25, and 27 of the nucleobase sequence.46d. The isolated nucleic acid of any one of embodiments 44-46c, wherein the at least one chemically modified residue is a locked nucleic acid (LNA).46e. The isolated nucleic acid of any one of embodiments 44-46d. wherein the nucleobase sequence is selected from:(i) GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1);(ii) at least:GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:7); orAUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:8),wherein the nucleic acid comprises the at least one chemically modified residue at positions 1, 3, 5, 19, 21, and 23 of the nucleobase sequence, and wherein the at least one chemically modified residue is a locked nucleic acid (LNA); or(iii) GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 10), wherein the nucleic acid comprises the at least one chemically modified residue at positions 1, 3, 5, 23, 25 and 27 of the nucleobase sequence, and wherein the at least one chemically modified residue is a locked nucleic acid (LNA).47. A therapeutic composition comprising: a therapeutically effective amount of the isolated nucleic acid of any one of embodiments 44-46; and a pharmaceutically acceptable excipient.48. The therapeutic composition of embodiment 47 that is an exosome-free composition, optionally wherein the therapeutic composition is an extracellular vesicle-free composition.49. The therapeutic composition of embodiment 47 or 48, wherein the composition is suitable for oral administration of the isolated nucleic acid.50. The isolated nucleic acid of any one of embodiments 44-46e, for treatment of an inflammatory condition, optionally wherein the inflammatory condition comprises: a cardiac inflammatory condition; a symptom or sequalae of a cardiac injury; and / or a symptom or sequalae of heart failure or myocardial infarction.51. The isolated nucleic acid of any one of embodiments 44-46e, for the preparation of a medicament for treatment of an inflammatory condition, optionally wherein the inflammatory condition comprises: a cardiac inflammatory condition; a symptom or sequalae of a cardiac injury; and / or a symptom or sequalae of heart failure or myocardial infarction.

[0140] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are providedsolely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[0141] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein or nucleic acid structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[0142] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.

[0143] The technology described herein is further illustrated by the following examples, which in no way should be construed as being further limiting.EXAMPLESExample 1

[0144] The following procedures were used in Examples 2-7, unless indicated otherwise.

[0145] Neonatal Human Dermal Fibroblasts cells and reagents. Neonatal human dermal fibroblasts (nHDF) were sourced from ATCC (PCS-201-010). Cells were cultured in IMDM (GIBCO), 10% FBS (Hyclone), 2mM L-glutamine (GIBCO), and gentamicin (GIBCO) Cells were maintained at 37 °C 20% 02 / 5% CO2 in complete media with media exchanges every 3-4 days as needed. Cells were grown until near confluent and passaged using TrypLE (GIBCO).

[0146] Lentiviral transduction. nHDFs were plated in T25 flasks and transduced with GATA4 activation lentiviral particles and / or TDO2 activation lentiviral particles (Santa Cruz Biotech) at MOL20 in complete media. After 24 h of transduction, the virus was removed, and fresh complete media was added for cell recovery for a further 24 h. Cells were then subjected to selection by 5.0 pg / mL puromycin for approximately 3-4 days. Following selection complete media was replaced and cells were grown and passaged.

[0147] EV preparation and isolation. EVs were harvested from primary nHDFs at passage 5-7, from normal and transduced cells using a 15-day serum starvation method. Briefly, cells were grown to near confluence (-90%) at 20% 02 / 5% CO2 at 37°C. Cell bed was washed 2x with warmed PBS and then incubated in IMDM without serum supplementation for 15 days in the same environment. Conditioned media was collected, centrifuged at 3,000x g for 10 minutes to removed dead cells and debris, then filtered through a 0.45 pm PES filter to remove apoptotic bodies and protein aggregates, and frozen for later use at -80°C. EVs were purified using centrifugal ultrafiltration with a 100 kDa molecular weight cutoff filter (Sigma- Millipore). EV preparations, before and after concentration were analyzed by NTA using the Malvern Nanosight NS300 Instrument (Malvern Instruments) with the following acquisition parameters: camera levels of 15, detection level less than or equal to 5, number of videos taken = 5, and video length of 30 s.

[0148] EV isolation using size exclusion chromatography. EVs were collected and prepared as described above. After lOOkD ultrafiltration EVs were further purified using size exclusion chromatography columns (SBI). Briefly, 1.0 mL of concentrated EVs wereadded to each chromatographic column and incubated at room temp with rotation for 30-35 mins. EVs were eluted from the column by centrifugation at 500x g. EV size and concentration were analyzed by NTA as described above. Protein content of EV preparations was quantified using a BCA assay (Pierce).

[0149] Bone Marrow-Derived Macrophage Collection & Cell Culture Bone marrow-derived progenitor cells were collected from 3-month-old female Wistar Kyoto rats and differentiated into bone marrow-derived macrophages (BMDM) by culturing with 20ng / mL recombinant M-CSF (Life Technologies). Briefly, whole bone marrow cells were collected via aspiration with ice-cold PBS. Cells were filtered using a 70pm cell-strainer and centrifuged at 400x g for 10 min at 4°C to pellet. The cell pellet was resuspended in lOmL ACK buffer (GIBCO) for 30 sec. ACK was quenched with IMDM + 10% FBS and cells were centrifuged as described above. Cells were resuspended in complete media; IMDM +10% FBS + 20ng / mL M-CSF and counted. Cells were seeded into 6-well plates at 8.0xl04cells / well, or equivalent. Cells were incubated at 37°C with 20% O2 and 5% CO2. Fresh complete media was exchanged on day 3 and cells monitored for confluence. Test compounds were administered once BMDM cultures reached -75% confluence. Serum concentration was reduced to 1% during assays to facilitate EV uptake.

[0150] RNA isolation and RT-qPCR Total cell RNA was isolated using the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s protocol. Total EV RNA was isolated using the miRNeasy Advanced Serum Plasma Kit (Qiagen). Total cell RNA was quantified using nanodrop and diluted using diH2O. Total EV RNA was quantified by Qubit (Thermo Fisher Scientific). Cellular RNA Reverse Transcription was performed using the High-Capacity RNA-to-cDNA kit (Life Technologies) with Ipg RNA per reaction. PCR reactions were performed on the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) using TaqMan Fast Advanced Master Mix (Life Technologies. 4444556) and TaqMan primers. Each reaction was performed in triplicate. The gene expression assays used for this study are summarized in Table 1.Table 1

[0151] Cell lysate and protein assay. Cell lysates were collected for ELISA and western blot from 6-well plates. Cells were washed lx with ice-cold PBS. Cells were lysed inwell with 75pL lx lysis buffer with phospo / protease inhibitors (Thermo Fisher Scientific). The cell lysate was incubated on ice for 15 minutes, sonicated twice for 10 seconds each, and centrifuged at 15,000x g for 15 min at 4°C. The supernatant was collected and frozen for later use at -80°C. Protein lysates were quantified using a Pierce BCA Protein Assay kit (Thermo Fisher Scientific).

[0152] Antibodies used in this study are summarized in Supplementary Table 2.Table 2Example 2

[0153] This non-limiting example shows characterization of purified extracellular vesicles (EV) from TDO2-overexpressed and TDO2 / GATA4-overexpressed normal human dermal fibroblasts (nHDFs).

[0154] Normal human dermal fibroblasts (nHDFs) were transduced with TDO2 activating lentiviral particles, or TDO2 activating lentiviral particles and GATA4 activating lentiviral particles (FIG. 7A). Expression of TDO2 in TDO2 transduced cells, and of TDO2 and GATA4 in TDO2 / GATA4 transduced cells was confirmed (FIGs. 7B-7D).

[0155] FIGs. 7A-7D. Validation of the engineered cell culture model for EV production. (FIG. 7A) Phase contrast microscopy images of stable cells to confirm transduction efficiency. (FIG. 7B) These TDO2 and GATA4 expression at mRNA level of stable cells evaluated by RT-qPCR. (FIG. 7C). GATA4 protein levels was tested by EEISA (FIG. 7D) TDO2 was overexpressed by western blot.

[0156] EVs were harvested from nHDFs at passage 5-7, from normal and transduced cells using a 15 -day serum starvation method and the conditioned media was collected and the EVs were purified using centrifugal ultrafiltration with a 100 kDa molecular weight cutoff filter (Sigma- Millipore). After lOOkD ultrafiltration, EVs were further purified using size exclusion chromatography columns (SEC) (FIG. 1A).

[0157] FIGs. 1A-1D. Characterization of purified Extracellular Vesicles. (FIG. 1A) Schematic overview of the EV purification workflow. (FIG. IB) Cryo-electron microscopy (Cryo-EM) representative image of EVs, (a) WT-EV, (b) Vector-EV, (c) TDO2- EV, and (d) TDO2 / GATA4-EV, scale bar: 100 nm. (FIG. 1C) The protein expression of EV markers according to MISEV2018 such as CD63, CD9, TSG101, HSC70, Alix, GAPDH, and Calnexin of isolated EVs were determined by western blotting assay. (FIG. ID) The size distribution of EVs samples was determined using nanoparticle tracking analysis (NTA). Representative NTA size distribution profiles of isolated particles and their concentrations.

[0158] Cryo-electron microscopy (Cryo-EM) was used for direct visualization of the EVs (WT-EVs, Vector EVs, TDO2-EVs and TDO2 / GATA4-EVs) as shown in FIGs. IB and 8.

[0159] FIG. 8. Cryo-electron microscopy (Cryo-EM) images of WT-EVs, Vector- Evs, TDO2-EVS and TDO2 / GATA4-EVs.

[0160] Western plotting was performed for further characterization of the EVs. Blocking was performed using 5% non-fat milk in TBS+20% Teen, Ihr at RT. Primary antibody staining was done overnight at 4°C. Secondary HRP antibody staining was done for 90 min at RT then detected by SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific). The Western Blot demonstrated the presence of isolated EV using markers such as CD63, CD9, TSG101, HSC70, Alix, GAPDH, and Calnexin as shown in FIG.1C.

[0161] After the EVs were further purified using SEC, and the EV size distribution and concentration were analyzed by NTA (FIG. ID). Human CD63 concentration and total protein concentration of the purified EVs were measured (FIGs. 9A, 9B).

[0162] FIG. 9A-9B. Characterization of purified Extracellular Vesicles. (FIG. 9A) Linear correlation of CD63 concentration (pg / ml) measured by Human CD63 ELISA kit versus EV concentration (particles / ml) measured by NTA (n=3). (FIG. 9B) Dose dependence of Protein concentration (pg / ml) measured by BCA protein assay kit versus EV concentration (particles / ml) measured by NTA (n=3).

[0163] These results indicate that nHDFs were efficiency transduced with TDO2 or TDO2 / GATA4, and that EVs from TDO2 transduced cells and TDO2 / GATA4 transduced cells have EV size distribution, EV marker expression, and EV protein levels comparable to control cells.Example 3

[0164] This non-limiting example shows the effect of TDO2-EV in vitro (macrophages, fibroblasts, endothelial cells, and cardiomyocytes) and in vivo (ischemia / reperfusion 2 day rat model) characterization of purified extracellular vesicles (EV) from TDO2-overexpressed and TDO2 / GATA4-overexpressed normal human dermal fibroblasts (nHDFs).

[0165] EV from control, TDO2 induced or TDO2 / GATA4 induced fibroblasts were added to LPS-stimulated bone marrow macrophages. The effects of the TDO2-EVs and TDO2 / GATA4-EVs on expression of pro -inflammatory (IL- 10, IL-6) and anti-inflammatory (TGF-0, IL-10) genes in these LPS-stimulated macrophages were studied. FIG. 2A shows that both TDO2 and TDO2 / GATA4-EVs reduced the expression of IL-10 and IL-6IL-6 in the LPS- stimulated macrophages compared to control cells. Both TDO2 and TDO2 / GATA4-EVs increased the expression of TGF-0 in the LPS-stimulated macrophages. LPS-stimulated macrophages treated with EV from TDO2-induced and TDO2 / GATA4-induced fibroblasts showed reduced IL- 6 protein levels (FIG. 2B).

[0166] Expression of anti-inflammatory macrophage markers, CD163 and C206, were also assayed. No consistent change in expression of these markers was observed (FIG. 10A).

[0167] FIGs. 2A-2M. Evaluation of I / R rat model (m vivo) and human cardiac cells in vitro) in Extracellular Vesicles. (FIG. 2A) Pro-Inflammatory genes (ILl-beta, IL-6) or Anti- Inflammatory genes (TGF-beta, IL- 10) expression of LPS stimulated-macrophage treated with EVs (n=4). (FIG. 2B) IL-6 protein levels in supernatant of LPS stimulated macrophage treated with EVs was tested by ELISA. (FIG. 2C) Representative double immunofluorescence images of a-SMA and Collagen I in human dermal fibroblasts (HDF) co-treated with TGF-beta and EVs for 48h. The quantification of fluorescence intensity in a-SMA (FIG. 2D) and Collagen I (FIG. 2E) in each group (n=9). (FIG. 2F) Representative fluorescence image of in vitro angiogenesis assay (Tube formation assay) in HCAEC treated with each samples. (FIG. 2G) Total tube length of each images was measured by Image J angiogenesis. (FIG. 2H) Cell proliferation of HCAEC cells were performed using Ki67 immunofluorescence. Cell count (nuclei) were counterstained with Hoechst. The percentage of Ki67 positive cells was analyzed by Cytation5 software. (FIG. 21) Cardioprotection effect of sample treated HCM under hypoxia condition were assessed by cell viability (CCK-8). (FIG. 2J) Schematic timeline of the experiment procedures (Rat ER acute model). (FIG. 2K) Cardiac troponin I (cTNI) level as cardiac injured marker were measured by cTNI ELISA kit after 48h surgery. (FIG. 2L) Infarct size (%) were performed by TTC staining. (FIG. 2M) Representative TTC staining images of EVs treated rat PR model.

[0168] FIGs. 10A-10B. Evaluation of human macrophage cells and human dermal skin fibroblast (in vitro) in Extracellular Vesicles. (FIG. 10A) Anti-Inflammatory macrophage marker genes (CD163, CD206) expression of LPS-stimulated macrophage treated with EVs (n=4). (FIG. 10B) Expression of fibrosis genes (a-SMA, CollAl, Col3Al, and TNF) in TGF- beta stimulated-HDF cells treated with EVs (n=3).

[0169] The effect of treating rat macrophages in vitro with EV from control, TDO2 induced and TDO2 / GATA4 induced fibroblasts was determined. Rat BMDM were stimulated with LPS. Treatment with EV from TDO2 induced and TDO2 / GATA4 induced fibroblasts had not significant effect on cell viability (FIG. 11 A). IL-6 production by LPS-stimulated macrophages was reduced when the cells were treated with EV from TDO2 induced fibroblasts (FIG. 1 IB). EV from TDO2 / GATA4 induced fibroblasts was less effective at reducing IL-6 production than EV from TDO2 induced fibroblasts. The effect of EV from TDO2 inducedand TDO2 / GATA4 induced fibroblasts on TL-6 production in rat BMDM was more consistent in LPS -stimulated macrophages compared to non- stimulated macrophages (FIG. 11C).

[0170] FIGs. 11A-11C. The EV effect of rat BMDM cells in vitro. (FIG. 11A) Cell proliferation of LPS-induced BMDM cell were measured by a CCK-8 kit. (FIG. 11B) Proinflammatory cytokine (IL-6) levels of supernatant in EVs treated LPS BMDM cells for 24h. (FIG. 11C) Proinflammatory cytokine (IL-6) expression of EVs treated with or without LPS BMDM cells for 24h.

[0171] Human dermal fibroblasts (HDF) were treated with TGF-beta and extracellular vesicles (EV) from control, TDO2-induced, and TDO2 / GATA4-induced fibroblasts for 48 hours. Cells were then stained for smooth muscle actin (a-SMA) and collagen I. FIG. 2C shows the collection of immunofluorescence images of the treated and untreated HDFs with the a-SMA and collagen I antibodies. FIGs 2D and 2E quantified the expression of a-SMA and collagen I in the treated and untreated HDFs (see also FIG. 10B). The results showed that TDO2-EV reduced the expression of a-SMA and collagen I in the HDFs compared to control cells. In contrast, expression of a -SMA and collagen I was not significantly different from control when the cells were treated with TDO2 / GATA4-EV. A similar trend was observed for expression of Col3Al, but not for TNF (FIG. 10B).

[0172] Human coronary artery endothelial cells HCAECs were treated with extracellular vesicles (EV) from control, TDO2 induced and TDO2 / GATA4 induced fibroblasts to show the effects on the tube lengths formed by HCAECs (FIG. 2F). The tube lengths of the treated HCAECs were measured and quantified, and the results are shown in FIG. 2G. The percentage of the HCAECs undergoing proliferation was measured using the Ki67 immunofluorescence and quantified, as shown in FIG. 2H. The graphs show that EV from TDO2 induced fibroblasts promoted the formation of the blood vessels and cell proliferation compared, whereas EV from TDO2 / GATA4 induced fibroblasts did not.

[0173] HCMs were treated with extracellular vesicles (EV) from control, TDO2 induced and TDO2 / GATA4 induced fibroblasts, and placed under hypoxic condition, to show the effects on the cell viability. FIG. 21 shows the viability of the treated and control HCMs under hypoxic condition. The results show that a greater percentage of cells were viable under hypoxic condition when treated with EV from TDO2 induced fibroblasts, while HCMs treated with EV from TDO2 / GATA4 induced fibroblasts did not show increased cell viability .

[0174] Next, the in vivo effect of extracellular vesicles (EV) from control, TDO2 induced and TDO2 / GATA4 induced fibroblasts was tested in a 2 day acute ischemia / reperfusion (ER) model as shown in the schematic diagram in FIG. 2J. The concentration of cardiac troponin I (cTnl), as cardiac injury marker, in blood was measured by ELISA, and the results are shown in FIG. 2K. The infarct size was measured by TTC staining and quantified as shown in FIG. 2L. These results show that TDO2-EV treated animals had reduced cardiac troponin I release after ischemia / reperfusion injury, while reduction in cTnl in TDO2 / GATA4-EVtreated animals was less pronounced (FIG. 2K). Further, TDO2-EV treatment animals reduced scar size from ischemia / reperfusion injury compared to control, but TDO2 / GATA4-EV treatment did not (FIG. 2L).

[0175] These results demonstrate the in vitro and in vivo effect of TDO2-EV consistent with a therapeutic effect of TDO2-EV in ischemic cardiac injury, and abrogation of the therapeutic effect in TDO2 / GATA4-EV.Example 4

[0176] This non-limiting example shows characterization of RNA profiles of TDO2-EV and TDO2 / GATA4-EV, and in vivo evaluation of miR-1246. Annotation distribution of smalLRNAs between EVs.

[0177] To determine the RNA profiles of TDO2-EV and TDO2 / GATA4-EV, a purification workflow for large EV using serial centrifugation was developed (FIG. 12A). The purified L-EV had an average diameter of -200 nm (FIG. 12B).

[0178] FIGs. 12A-12F. Characterization of purified Extracellular Vesicles. (FIG. 12 A) Schematic overview of the large-EV (L-EV) purification workflow based in serial centrifugation forces. (FIG. 12B) The size distribution of EVs samples was determined using nanoparticle tracking analysis (NTA). (FIG. 12C) Cardiac troponin I (cTnl) level as cardiac injured marker were measured by cTnl ELISA kit after 48h surgery. (FIG. 12D) Infarct size (%) were performed by TTC staining. (FIG. 12E) The proportion of mapped and unmapped reads from L-EVs sample RNA profile. (FIG. 12F) Annotation distribution of small-RNAs between Large-EVs.

[0179] FIG. 3A shows distribution of small RNAs in TDO2-EV and TDO2 / GATA4-EV. FIG. 3B is a heatmap of the top 20 upregulated differential miRNAsexpression in EVs. The scale bar indicate fold change. miR-1246 showed upregulated expression in TD02-EV, but suppressed expression in TDO2 / GATA4-EV.

[0180] FIGs. 3A-3B. Analysis of the RNA profiles on Extracellular Vesicles. (FIG.3A) Annotation distribution of small-RNAs between EVs. (FIG. 3B) Heatmap of top 20 upregulated differential miRNAs expression in EVs.Example 5

[0181] This non-limiting example shows in vivo evaluation of miR-1246 doses in the acute I / R model.

[0182] In the acute I / R model, described above, different intravenous doses of miR- 1246 were administered to the subject after the ischemia and reperfusion to test different dosages of miR-1246 that would induce cardiac repair. The infarct size (FIG. 4 A) and circulating cardiac troponin I (cTnl) (FIG. 4B) were measured. FIGs. 4C and 4D are graphs that show the infarct size and cTnl levels in an acute ER model when treated with miR-1246 and miR mimic control. These graphs show that the miR-1246 effects are specific.

[0183] FIGs. 4A-4F. miR-1246 induced cardiac repair in vivo. Using the rat model of 1 / R described herein, different intravenous doses of miR-1246 were tested for therapeutic effect, as shown by infarct size (%; A) and circulating cardiac troponin I levels (B). miR-1246 effects were specific as a miR mimic control failed to reproduce these effects (C, D). miR- 1246 was also therapeutically active when given orally (FIGs. 4E-4G).

[0184] The effect of oral administration of miR-1246 was evaluated in the model of acute ischemia / reperfusion (I / R). The schematic diagram of the experimental design is shown in FIG. 4E. The effect of oral administration of miR-1246 on infarct size was measured using TTC staining (FIG. 4F), and circulating cTnl levels were also measured (FIG. 4G) measured by ELISA. miR-1246 was therapeutically active when given orally.Example 6

[0185] This non-limiting example shows in vivo evaluation of uREXl in the acute I / R model.

[0186] uREXl was identified as being enriched in TDO2-EVs (see Example 7). uREXl is a small RNA with previously unknown function and is encoded by an unmapped(un-indexed) region of the genome. Similar to miR-1246, uREXl was enriched in TD02-EV compared to TDO2 / GATA4-EV.

[0187] In the acute PR model, described above, different intravenous doses of uREXl were administered in the subject after the ischemia and reperfusion to assess different therapeutic dosages of uREXl that would induce cardiac repair. The infarct size (FIG. 5 A) and circulating cardiac troponin I (cTnl) (FIG. 5B) were also measured.

[0188] FIGs. 5A-5F. uREXl induced cardiac repair in vivo. Using the same rat model of PR as above, different therapeutic intravenous doses of uREXl were tested, as shown by infarct size (%; FIG. 5A) and circulating cardiac troponin I levels (FIG. 5B). uREXl effects are specific as a scramble control failed to reproduce these effects (FIGs. 5C, 5D). uREXl was also therapeutically active when given orally (FIGs. 5E, 5F).

[0189] In order to evaluate the effect of the sequence of uREXl, the model of acute ischemia / reperfusion (PR) experiment was performed, as described above. The infarct size (FIG. 5C) was measured using TTC staining, and cTnl levels (FIG. 5D) was measured using EEISA in the acute PR model when treated with uREXl and scrambled uREXl. These graphs show that the scrambled uREXl has almost no effect on the infarct size and cTnl level compared to control subjects, unlike uREXl which improved the cardiac repair significantly.

[0190] In order to evaluate the effect of oral administration of uREXl, the model of acute ischemia / reperfusion (PR) experiment was performed, as described above. The effects of oral administration of uREXl and scrambled uREXl indicating cardiac repair were measured as infarct size using TTC staining (FIG. 5E) and cTnl levels (FIG. 5F) measured by ELISA. These results show that uREXl was therapeutically active when given orally.Example 7

[0191] This non-limiting example shows in vitro evaluation of uREXl in the Normal human dermal fibroblast EVs.

[0192] The numbers of uREXl copies in wild-type EVs was compared to those in the TDO2-EVs. As shown in FIG 6A, TDO2-EVs was enriched for uREXl. FIG. 6B shows the sequence of uREXl (SEQ ID NO:1) and its scramble control (SEQ ID NO:2) used in Example 6.Example 8

[0193] This non-limiting example shows in vivo evaluation of uREXl in the acute ER model. This Example relates to Example 6.

[0194] In the acute ER model, described in Example 6, different intravenous doses of uREXl (2.5-200 ng / g) or control (0 ng / g) were administered to the subject after the ischemia and reperfusion to assess different therapeutic dosages of uREXl that would induce cardiac repair. Representative images of cardiac tissue sections showing infarct size in treated and vehicle- treated animals are shown (FIG. 19).

[0195] FIGs. 19, 5A, and 5B show uREXl dose-finding in a rat model of acute myocardial injury. Animals subjected to permanent ligation or ischemia-reperfusion received increasing doses of uREXl (2.5-200 ng / g) or control (0 ng / g), and infarct size, and circulating cardiac injury markers were quantified to identify an effective and well-tolerated dose range.

[0196] uREX also reduced infarct size compared to the scramble RNA and the control Representative images of cardiac tissue sections showing infarct size in uREXl - treated, scrambled-treated, and vehicle-treated animals are shown (FIG. 20). FIGs. 20, 5C, and 5D show uREXl attenuates adverse cardiac remodeling in acute myocardial injury model. Infarcted animals that received uREXl, scramble or control (PBS) were assessed by TTC staining and cardiac injury marker (cTNI).Example 9

[0197] This non-limiting example shows in vitro evaluation of the effect of uREXl in human macrophages, human endothelial cells, and human cardiac fibroblasts.

[0198] Human macrophages stimulated with LPS were treated with uREXl, Scramble, and control, and expression of proinflammatory genes (IL-6, IL-ip, TNF) was assessed by RT-qPCR (FIG. 21A).

[0199] Gene expression levels (VEGF, PDGFRa, VCAM1, eNOS) in human endothelial cells exposed to uREXl were analyzed by RT-qPCR (FIG. 21B).

[0200] The effect of uREXl on profibrotic gene expression was tested in human cardiac fibroblasts (HCFs) treated with TGFbeta. Compared to vehicle control and Scramble, uREXl suppressed profibrotic gene expression in TGFbeta-treated HCFs as assessed by RT- qPCR (FIGs. 21C-21E).

[0201] Further, principal component analysis (PCA) of bulk RNA-seq results was carried out. PCA separated TGFbeta and uREXl-treated human cardiac fibroblasts (HCFs) from vehicle (TGFbeta and PBS-treated) cells indicating a global shift in transcriptional state (FIG. 22A). Phospholamban (PLN) was identified as a candidate downstream target of uREXl.

[0202] Analysis of differentially expressed genes identified phospholamban (PLN) as a gene whose expression is suppressed in TGFbeta and uREXl-treated HCF. Reduction in PLN expression in uREXl-treated HCF was compared to vehicle (TGFbeta and PBS) and Scramble, and confirmed the bulk RNA-seq results (FIG. 22B). Control samples were HCF that were not treated with TGFbeta. Expression levels of representative differentially expressed genes identified by bulk RNA-seq were also confirmed by qPCR in samples treated with uREXl versus vehicle (FIG. 22F-22H) in TGFbeta-treated HCF. These results were consistent with bulk-RNA-seq results.

[0203] To further explore the role of PLN expression in regulating fibrotic genes, three independent siRNAs to PLN were tested to reduce PLN expression in TGFbeta-treated HCFs (FIG. 221). siPLN-1 was used in subsequent experiments. Selected differentially expressed genes were confirmed by RT-qPCR, and siRNA-mediated knockdown was used to determine their contribution to the uREXl -dependent phenotype in TGFbeta-treated HCFs (FIGs. 22C-22E).Example 10

[0204] This non-limiting example shows modified uREXl molecules and characterization of their ability to modulate target gene expression in HCFs.

[0205] uREXl variants were designed and engineered to include Locked Nucleic Acid (LNA) modifications, as indicated in FIG. 23 by the bolded residues.

[0206] Candidate modified uREXl molecules were generated and screened in TGFbeta-treated HCFs for their ability to modulate target gene expression (FIG. 24). Control samples were HCF that were not treated with TGFbeta. Vehicle samples were HCF treated with TGFbeta and vehicle.

Claims

WHAT TS CLAIMED TS:

1. A method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence comprising XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C. or A, or a sequence at least 90% identical thereto, wherein the isolated nucleic acid is RNA, wherein the isolated nucleic acid is at most 60 nucleobases in length, and wherein, when Xi is G, the nucleobase sequence comprises (i) no residues or at most 5 residues 5’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1), and / or (ii) no residues or at most 3 residues 3’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1).

2. The method of claim 1, wherein Xi is G.

3. The method of claim 1, wherein Xi is C or A, or wherein the nucleobase sequence comprises GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 16).

4. The method of claim 1, wherein the isolated nucleic acid is 23-30 nucleobases in length.

5. The method of claim 1, wherein the nucleobase sequence consists essentially of XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C, or A.

6. The method of claim 1, wherein the nucleobase sequence consists essentially of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1).

7. The method of claim 1, wherein the nucleobase sequence does not comprise UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 80% identical thereto.

8. A method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence comprising AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3) or a sequence at least 80% identical thereto, wherein the isolated nucleic acid is RNA, wherein the isolated nucleic acid is at most 60 nucleobases in length.

9. The method of claim 8, wherein the nucleobase sequence comprises AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3).

10. The method of claim 1 , wherein the isolated nucleic acid comprises at least one chemically modified residue in the nucleobase sequence.

11. The method of claim 10, wherein at least one residue at positions 1-12 and / or 13-23 of the nucleobase sequence is the at least one chemically modified residue, or wherein at least one residue at positions 1-13 and / or 14-27 of the nucleobase sequence is the at least one chemically modified residue.

12. The method of claim 11, wherein the nucleic acid comprises the at least one chemically modified residue at: one or more of positions 1, 3, 5, 19, 21, and 23 of the nucleobase sequence, or one or more of positions 1, 3, 5, 23, 25, and 27 of the nucleobase sequence.

13. The method of claim 10, wherein the at least one chemically modified residue is a locked nucleic acid (LNA).

14. A method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition a therapeutically effective amount of an isolated nucleic acid comprising a nucleobase sequence at least 80% identical to a reference sequence of a reference therapeutic nucleic acid comprised in a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2), wherein the isolated nucleic acid is RNA, wherein the reference sequence is at least 18 nucleobases long, and wherein when the reference sequence comprises GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1) or a sequence at least 80% identical thereto, the reference sequence comprises (i) no residues or at most 5 residues 5’ of SEQ ID NO:1, and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO:1.

15. The method of claim 14, wherein the isolated nucleic acid is 19-31 nucleobases in length.

16. The method of claim 14, wherein the reference sequence does not comprise UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 11), or a sequence at least 80% identical thereto.

17. The method of claim 14, wherein the reference therapeutic nucleic acid is enriched in the therapeutic EV compared to an EV from a fibroblast that is not configured to overexpress TDO2.

18. The method of claim 14, wherein the reference therapeutic nucleic acid is a noncoding RNA.

19. The method of claim 14, wherein the reference therapeutic nucleic acid is a miRNA, piRNA, rRNA, or tRNA, or a fragment thereof.

20. The method of claim 14, wherein the reference therapeutic nucleic acid is enriched in the therapeutic EV compared to an EV from a second genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2) and GATA binding protein 4 (GATA4).

21. The method of claim 14, wherein the reference therapeutic nucleic acid comprises a nucleobase sequence comprising: GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1); or AAUGGAUUUUUGGAGCAGG (SEQ ID NO:3).

22. The method of claim 14, wherein the genetically modified fibroblast is a skin fibroblast, optionally wherein the skin fibroblast is a neonatal skin fibroblast.

23. The method of claim 1, wherein the inflammatory condition comprises: a cardiac inflammatory condition; a symptom or sequalae of a cardiac injury; and / or a symptom or sequalae of heart failure or myocardial infarction.

24. The method of claim 1, wherein the subject has or has suffered a myocardial infarction.

25. The method of claim 1, comprising orally administering the therapeutically effective amount of the nucleic acid to the subject.

26. The method of claim 1, comprising parenterally administering the therapeutically effective amount of the nucleic acid to the subject.

27. The method of claim 1, that is an exosome-free method.

28. A method of immunomodulation, comprising contacting an effective amount of an isolated nucleic acid with a population of macrophages, the nucleic acid comprising a nucleobase sequence at least 80% identical to a reference sequence of a reference therapeutic nucleic acid comprised in a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2), wherein the isolated nucleic acid is RNA, wherein the reference sequence is at least 18 nucleobases long, and wherein when the reference sequence comprises GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1) or a sequence at least 80% identical thereto, the reference sequence comprises(i) no residues or at most 5 residues 5’ of SEQ ID NO:1 , and / or (ii) no residues or at most 3 residues 3’ of SEQ ID NO:1.

29. The method of claim 28, wherein the contacting comprises administering to a subject in need of treating a treating an inflammatory condition an effective amount of the isolated nucleic acid, to thereby promote an anti-inflammatory activity of macrophages in the subject.

30. The method of claim 28, wherein the macrophage is a human macrophage.

31. A method of identifying a therapeutic agent, comprising: providing a therapeutic extracellular vesicle (EV) from a genetically modified fibroblast that is configured to overexpress tryptophan 2,3-dioxygenase (TDO2); identifying one or more candidate agents comprised in the EV; providing an EV from a second genetically modified fibroblast that is configured to overexpress TDO2 and GATA binding protein 4 (GATA4); and determining that the one or more candidate agents is enriched in the therapeutic EV compared to the EV from the second genetically modified fibroblast, whereby the one or more candidate agents is identified as a therapeutic agent.

32. An isolated nucleic acid comprising a nucleobase sequence comprising XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C, or A, or a sequence at least 90% identical thereto, wherein the isolated nucleic acid is RNA, wherein the isolated nucleic acid is at most 60 nucleobases in length, and wherein, when Xi is G, the nucleobase sequence comprises (i) no residues or at most 5 residues 5’ GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1), and / or (ii) no residues or at most 3 residues 3’ of GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 1), and wherein the nucleic acid comprises at least one chemically modified residue in the nucleobase sequence.

33. The isolated nucleic acid of claim 32, wherein Xi is G.

34. The isolated nucleic acid of claim 32, wherein Xi is C or A, or wherein the nucleobase sequence comprises GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:16).

35. The isolated nucleic acid of claim 32, wherein the isolated nucleic acid is 23- 30 nucleobases in length.

36. The isolated nucleic acid of claim 32, wherein the nucleobase sequence consists essentially of XiUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 12), wherein Xi is G, C, or A.

37. The isolated nucleic acid of claim 32, wherein at least one residue at positions 1-12 and / or 13-23 of the nucleobase sequence is the at least one chemically modified residue, or wherein at least one residue at positions 1-13 and / or 14-27 of the nucleobase sequence is the at least one chemically modified residue.

38. The isolated nucleic acid of claim 37, wherein the nucleic acid comprises the at least one chemically modified residue at: one or more of positions 1, 3, 5, 19, 21, and 23 of the nucleobase sequence, or one or more of positions 1, 3, 5, 23, 25, and 27 of the nucleobase sequence.

39. The isolated nucleic acid of claim 32, wherein the at least one chemically modified residue is a locked nucleic acid (LNA).

40. The isolated nucleic acid of claim 32, wherein the nucleobase sequence is selected from:(i) GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:1);(ii) at least:GUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:7); orAUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO:8), wherein the nucleic acid comprises the at least one chemically modified residue at positions 1, 3, 5, 19, 21 and 23 of the nucleobase sequence, and wherein the at least one chemically modified residue is a locked nucleic acid (LNA); or(iii) GGCUGUGGUCUAGUGGUUAGGAUUCGG (SEQ ID NO: 10), wherein the nucleic acid comprises the at least one chemically modified residue at positions 1, 3, 5, 23, 25 and 27 of the nucleobase sequence, and wherein the at least one chemically modified residue is a locked nucleic acid (LNA).

41. The isolated nucleic acid of claim 32, for treatment of an inflammatory condition comprising: a cardiac inflammatory condition; a symptom or sequalae of a cardiac injury; and / or a symptom or sequalae of heart failure or myocardial infarction.

42. The isolated nucleic acid of claim 32, for the preparation of a medicament for treatment of an inflammatory condition comprising: a cardiac inflammatory condition; a symptom or sequalae of a cardiac injury; and / or a symptom or sequalae of heart failure or myocardial infarction.

43. A therapeutic composition comprising: a therapeutically effective amount of the isolated nucleic acid of claim 32; and a pharmaceutically acceptable excipient.

44. The therapeutic composition of claim 43, that is an exosome-free composition.

45. The therapeutic composition of claim 43, wherein the composition is suitable for oral administration of the isolated nucleic acid.

46. A method of treating an inflammatory condition, comprising administering to a subject in need of treating an inflammatory condition an inhibitor of phospholamban (PLN), optionally wherein the inhibitor of PLN is an inhibitory RNA (e.g., siRNA or shRNA) that targets an RNA transcript (e.g., mRNA) encoding PLN, or wherein the inhibitor of PLN is uREXl or a functional derivative thereof, optionally wherein the inflammatory condition comprises: a cardiac inflammatory condition; a symptom or sequalae of a cardiac injury; and / or a symptom or sequalae of heart failure or myocardial infarction.-SO-