Non-natural building blocks for enhanced translation and stability of mRNA

EP4746924A1Pending Publication Date: 2026-05-27ELEVEN THERAPEUTICS LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
ELEVEN THERAPEUTICS LTD
Filing Date
2024-07-16
Publication Date
2026-05-27

AI Technical Summary

Technical Problem

Conventional mRNA-based therapies face challenges due to the biochemical instability of mRNA, leading to short duration of effect and immunogenicity issues, primarily because of the limitations of natural cap structures and poly(A) tails.

Method used

The introduction of artificial mRNA constructs with chemically-stabilizing, non-natural elements at the 5' end (xCaps) and optionally at the 3' end, which replace the conventional cap and poly(A) tail, respectively, enhancing translation efficiency and stability.

Benefits of technology

This approach results in improved stability, translation efficiency, and prolonged duration of effect for mRNA therapies, reducing immunogenicity and enabling more scalable and efficient chemical synthesis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2024070162_23012025_PF_FP_ABST
    Figure EP2024070162_23012025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure relates to an artificial mRNA construct comprising: i. a polynucleotide M comprising at least one open reading frame encoding a polypeptide; and ii. a synthetic cap structure comprising at least one chemically-stabilizing element located at the 5'end of said polynucleotide M; and iii. optionally a synthetic 3' terminus comprising at least one chemically-stabilizing element located at the 3' end of said polynucleotide M, wherein said artificial mRNA construct is devoid of a canonical poly(A) tail and said synthetic 3' terminus replaces the canonical poly(A) tail; wherein said artificial mRNA construct is devoid of a canonical cap structure, said synthetic cap structure replaces the canonical cap and permits cap-independent translation of the at least one open reading frame. Said artificial mRNA construct exhibits enhanced chemical / enzymatical stability, enhanced translatability, and reduced immunogenicity.
Need to check novelty before this filing date? Find Prior Art

Description

NON-NATURAL BUILDING BLOCKS FOR ENHANCED TRANSLATION AND STABILITY OF MRNA PRIORITY CLAIM

[0001] The present application claims priority of US provisional application 63 / 527,114 dated 17thof July, 2023. FIELD OF THE INVENTION

[0002] The present invention addresses the challenges associated with conventional mRNA- based therapies by introducing an artificial mRNA construct comprising chemically-stabilizing, non-natural elements at the 5' end of the mRNA, termed xCap. xCaps eliminate the need for a natural cap structure. Surprisingly, by replacing the cap with these chemically-stabilizing elements that do not share any structural similarities to natural cap mRNA elements occurring in biological organisms or natural RNA ends (e.g. 5’-OH or 5’ end of one or more phosphate groups), a remarkable enhancement in RNA translation and stability is achieved. This surprising discovery paves the way for the design and development of mRNA therapies with extended efficacy and prolonged duration of effect.

[0003] The invention opens new possibilities in the field of mRNA-based treatments. By circumventing the limitations of conventional cap and optionally poly(A) elements, the disclosed technology offers improved stability, translation efficiency, scalable chemical synthesis, and immunogenicity control. These advancements enable significant enhancement of the clinical utility of therapeutic mRNAs and expand their scope of application across a wide range of conditions and diseases.

[0004] The addition of mRNA caps can be done either co-transcriptionally or post transcriptionally, by viral enzymes (for example vaccinia virus capping enzymes). Recently, cap structures were also added chemically, e.g., post phosphoramidite synthesis. In all cases, the addition of a cap has a limited efficiency, and therefore non-capped mRNA remains as a byproduct. These non-capped mRNAs are known activators of cellular immunogenicity, and may lead to translation termination as well as toxicity. Notably, the addition of an xCap may be done during chemical oligonucleotide synthesis, using standard phosphonamidite building blocks, and as such can reach completion. As the xCap structure is not recognized as foreign by cellular immunity, using xCap both simplifies the synthesis procedure (converting it to 1 step) and eliminates activation of cellular immunity BACKGROUND OF THE INVENTION

[0005] The field of gene therapy has been growing rapidly over the years, with mRNA-based therapies emerging as a promising approach for treating various diseases. RNA molecules can be designed to produce endogenous and foreign polypeptides and potentially compensatefor insufficient production levels of specific proteins. Encoding mRNAs to produce specific therapeutics polypeptides, and induce an immunological memory against infectious agents has been demonstrated on a large scale in recent years.

[0006] However, one shortcoming of this modality is the relatively short duration of the effect of mRNA due to its (bio)chemical instability and the existence of multiple RNA degrading enzymes inside cells, tissues, body fluids, and the environment more generally: RNA is much more unstable than DNA due to its chemical structure and RNA can be subject to autocatalysis as well as degradation by enzymes such as RNases, which are abundant in the environment due to their presence in sources such as sloughed-off skin cells and ubiquitous microorganisms.

[0007] The stability and translation efficiency of mRNAs is influenced by various factors. The structure of a canonical mRNA molecule can be divided into several parts including a 5′ cap, 3′ poly(A) tail, 5′ and 3′ untranslated regions (5′- and 3′-UTRs), and an open reading frame (ORF). A number of these components can be altered or modified to enhance the translatability and / or stability of mRNAs to make them suitable for therapeutic mRNA drugs.

[0008] In endogenous mRNAs, the 3’ UTR starts downstream of the open reading frame’s translation stop-codon and ends with a string of adenine RNA nucleotides termed poly-(A) tail. Poly(A) tails are pivotal for the translation of mRNAs and their lack thereof results in rapid mRNA degradation within the cell. The poly(A) tail also contributes to mRNA stability, and its length is positively correlated to translational efficiency (Wang, YS., et al., J Biomed Sci 30, 84 2023). The poly(A) tail can be incorporated in the plasmid template, added via PCR, or added post-transcriptionally by enzymatic polyadenylation, which generates variable lengths of poly(A) tails. In mammalian cells, the poly(A) length is about 250 nt, but it is gradually reduced during an organism’s lifetime. For mRNA drugs, it has been shown that a poly(A) tail length of approximately 100 nt is optimal to minimize decay (Schlake T, et al., RNA Biol. 2012 Nov; 9(11):1319-30. doi: 10.4161 / rna.22269. Epub 2012 Oct 12)

[0009] While a poly(A) tail is seen as a requirement of a functional mRNA, the relatively long sequence increases the overall length of the mRNA, which can impact various properties of potential mRNA drugs due to the higher molecular weight and steric properties impacting deliverability.

[0010] The open reading frame (ORF) of mRNAs spans the RNA sequence between a START and STOP codon and may encode a polypeptide. The lack of a STOP codon can result in faulty protein production, reduced mRNA translation, stability, or degradation of the entire mRNA by Non-stop decay (NSD).

[0011] The accepted minimal requirements of mRNAs such as presence of cap structure, a STOP codon within the ORF, or a poly(A) tail, for a functional mRNA limit the possible design options of scientists developing mRNA or mRNA-like molecules with preferable properties such as increased stability and enhanced translational efficiency.

[0012] Conventional mRNAs further comprise certain elements in the 5’ end, specifically - a cap structure. In human, the canonical cap structure is N7-methylguanosine bridged with a triphosphate to the 5’ end of the mRNA. This so-called cap0 serves as quality control for correct mRNA processing and contributes to stabilization of eukaryotic mRNA, splicing, nuclear export, initiation of translation and mRNA decay. However, a range of other nucleotide metabolites have been naturally observed on mRNA molecules including nicotinamide adenine dinucleotide (NAD). The canonical cap, and presumably other natural cap elements, confer stability, recruit proteins that are essential to promote translation, and reduce the activation of cellular immunity via various pattern recognition receptors.

[0013] However, the use of these natural cap elements in synthetic mRNA therapies has been associated with stability limitations. Natural mRNA decay mechanisms such as decapping enzymes (e.g., Dcp1 / Dcp2) and exonucleases (e.g., XRN-1) had evolved to degrade mRNA by removing the cap or digesting uncapped mRNA, therefore limiting the clinical potential of therapeutic mRNAs.

[0014] Additionally, synthetic mRNA capping has efficiency limitations, rendering a small, yet significant fraction of the mRNA uncapped and therefore immunogenic. These issues are corroborated in chemically synthesized mRNA – enzymatic capping typically requires mRNA with di- or triphosphate as a precursor, which are cumbersome to chemically synthesize and chemical capping can pose scalability challenges. Moreover, removing all uncapped mRNA requires additional resources and complicates the chemistry, manufacturing, and controls (CMC) profile of mRNA therapies.

[0015] Accordingly, there is an urgent need in the industry to overcome the minimal requirements of a functional mRNA as described above thereby providing a higher degree of freedom for mRNA design ultimately benefiting the development of, for instance, mRNA-based therapeutics. In particular, there is an increased need to enable complete chemical synthesis of therapeutic mRNAs without the use of in vitro transcription (IVT) or enzymatic capping. Also, the use of enzymatic approaches for the generation of the mRNA by IVT and especially the enzymatic capping procedure require excessive resources such as special enzymes, chemically- instable cap-precursors, and additional purification steps for removing impurities and uncapped products thus increasing not only the cost of the product but also limiting its purity and scalability. Moreover – double-stranded RNA, a known byproduct of IVT, is highly immunogenic.

[0016] To overcome these challenges, the present invention discloses non-natural chemically- stabilizing elements for use as at the 5’ and optionally 3’ terminus of mRNAs, that replace the conventional cap and poly(A) tail respectively, and which can be conveniently integrated using chemical synthesis approaches.SUMMARY OF THE INVENTION

[0017] One aspect of the present invention refers to an artificial mRNA construct comprising: i. a polynucleotide M comprising at least one open reading frame encoding a polypeptide; and ii. a synthetic cap structure comprising at least one chemically-stabilizing element located at the 5’end of said polynucleotide M; wherein said artificial mRNA construct is devoid of a canonical cap structure, said synthetic cap structure replaces the canonical cap and permits cap-independent translation of the at least one open reading frame.

[0018] In some embodiments, the artificial mRNA construct according to the invention further comprises iii. a synthetic 3’ terminus comprising at least one chemically-stabilizing element located at the 3’ end of said polynucleotide M, wherein said artificial mRNA construct is devoid of a canonical poly(A) tail and said synthetic 3’ terminus replaces the canonical poly(A) tail.

[0019] In some embodiments, said polynucleotide M further comprises a 5’UTR operably linked to the 5’ end of the open reading frame. In some embodiments, said polynucleotide M further comprises a 3’UTR operably linked to the 3’ end of the open reading frame.

[0020] In some embodiments, said polypeptide is a therapeutic polypeptide, a therapeutic peptide, an antibody, an enzyme, a vaccine antigen, a nucleic acid binding protein, or a diagnostic marker.

[0021] In some embodiments the synthetic cap structure of the artificial mRNA construct comprised 1 to 5, 1 to 10, 1 to 20, 1 to 30, 1 to 50 or 1 to 100, preferably 2 to 10 chemically- stabilizing elements. In some embodiments the synthetic 3’ terminus of the artificial mRNA construct comprises 1 to 5, 1 to 10, 1 to 20, 1 to 30, 1 to 50, 1-150 or 1 to 150, preferably 10 to 30 chemically-stabilizing elements.

[0022] In some embodiments, the chemically-stabilizing elements are independently selected from DNA nucleotides, non-natural nucleotides for example, L enantiomers and XNA, non- natural backbone modifications, modified nucleotides, modified nucleosides, modified backbone linkages, conjugates (preferably selected from GalNAc, Biotin, Puromycin, Cholesterol, or C16), non-RNA polymers, chemical spacers, doublers, treblers, branchers, sugars, lipids, peptides, vitamins, or any combination thereof. In some embodiments, the at least one chemically-stabilizing element independently comprises a fatty acid chain with 1 to 20 carbons. In some embodiments, the chemically-stabilizing elements are independently selected from phosphoramidite monomers. In some embodiments the 5’ end of the synthetic cap structure is linked by a phosphorothioate group.

[0023] In some embodiments, the chemically-stabilizing element at the 5’ end of the synthetic cap structure comprises a fatty acid chain, preferably Sp9.

[0024] A further aspect of the invention relates to a synthetic cap structure or the synthetic cap structure of artificial mRNA construct of the present invention comprising consisting or essentially consisting of a chemically-stabilizing element chain according to formula Q:formula Q, wherein P denotes a DNA polynucleotide of length 1 to 20 nt, m, n denote independently from each other an integer between 0 and 10, q denotes 0 or 1, L1 and L2 are phosphoramidite monomers independently selected from the group of SpC3, Sp9, SpC12, Sp18, Spermine, 1-Ethynyl-dSpacer, CholTEG, L-DNA, Bio-TEG linkers, Trebler, and GalNAc, L1 and L2 are different from each other, C is a phosphoramidite monomer selected from the group of puromycin, biotin-dT, 2’OC16-U, L-DNA, LNA, 2’Ome, 2’MOE, 2’F, and Morpholino.

[0025] In a preferred embodiment, the 5’ end of the polynucleotide M is linked to the 3’ end of the chemically-stabilizing element chain according to formula Q.

[0026] In some embodiments, the at least one chemically-stabilizing element of the chemically-stabilizing element chain according to formula Q is linked by a phosphorothioate linkage. In a preferred embodiment, all chemically-stabilizing elements of the chain according to formula Q are linked by a phosphorothioate linkage.

[0027] In some embodiments, q denotes 0 in formula Q, n is 1, and L2 a phosphoramidite monomer selected from the group of SpC3, Sp9, SpC12, and Sp18. In some embodiments, L1 is L-DNA, m is an integer between 1 to 5, and the 3’ terminal L1 element is linked to the 5’ terminus of the DNA polynucleotide P by a phosphorothioate linkage.

[0028] In some embodiments, the synthetic cap structure is selected from a chemically- stabilizing element chain according to formula C1-C6: ID Formula from 5’ to 3’ C1 [Sp9] G* C2 [Sp9] G* G* G* C3 [Sp9] [L-dA]*C4 [Sp9] [L-dA* L-dA* L-dA* L-dA]* C5 [Biotin] G* G* G* C6 [[3xGalNAc]* (Trebler)]* G*

[0029] A further aspect of the present invention relates to a synthetic 3’ terminus or the synthetic 3’ terminus of the artificial mRNA construct of the invention, wherein said synthetic 3’ terminus comprises, consists, or essentially consists of a chemically-stabilizing element chain according to formula W:formula W, wherein P denotes a polynucleotide P1 of length 4 to 100 nt, T denotes a DNA triplet, m, n denote independently from each other an integer between 0 and 10, p, q denotes independently from each 0 or 1, L1 and L2 are phosphoramidite monomers independently selected from the group of SpC3, Sp9, SpC12, Sp18, Spermine, 1-Ethynyl-dSpacer, CholTEG, L-DNA, Trebler, Bio-TEG linkers, and GalNAc, L1 and L2 are different from each other, C is a phosphoramidite monomer selected from the group of puromycin, biotin-dT, 2’OC16-U, L-DNA, LNA, 2’Ome, 2’MOE, 2’F, Morpholino.

[0030] In a preferred embodiment, the 3’ end of the polynucleotide M is linked to the 5’ end of the chemically-stabilizing element chain according to formula W.

[0031] In some embodiments, at least one chemically-stabilizing element of the chemically- stabilizing element chain according to formula W is linked by a phosphorothioate linkage. In a preferred embodiment, all chemically-stabilizing elements of the chain according to formula W are linked by a phosphorothioate linkage.

[0032] In some embodiments, the polynucleotide P1 denotes a DNA polynucleotide of length 4 to 50 nt, preferably of length 10 to 30 nt. In some embodiments, L1 and L2 are phosphoramidite monomers independently selected from the group of SpC3, Sp9, SpC12, Sp18.

[0033] In some embodiments, the synthetic 3’ terminus is selected from a chemically- stabilizing element chain according to formula T1-T13:ID Formula from 5’ to 3’ SEQ ID NOs T1 4xdA - T2 25xdASEQ ID NO 19T3 25xdA [3xL-dA]SEQ ID NO 20T4 25xdA [3xSp9]SEQ ID NO 19T5 AAAAAAAAAAA [Bio-dT] AAAAAAAAA [3xSp9] ACCSEQ ID NO 21T6 AAAAAAAAAAA [Bio-dT] AAAAAAAAA [3xSp9] ACC [Puro]SEQ ID NO 21T7 TGGGGATCATCCCTATAGTGAGTCGTATTAG [Bio-dT] [3xSp9] SEQ ID NO 22 ACC [Puro] T8 AAAAAAAAAAAAAAAAAAAA*C*G [3xSp9] [SpC3]SEQ ID NO 23T9 GCGAAAAAAAAAAA [Bio-dT] AAAAA AAAA*C*G [3xSp9]SEQ ID NO 24T10 GCGAAAAAAAAAAAAAAAAAAAAAAAAAA [3xSp9]SEQ ID NO 25T11 GCG [Bio-dT] AAAAAA AAAAAAAAAA AAAA*C*G [3xSp9]SEQ ID NO 26T12 GCGAAAAAAA AAAAAAAAAA AAA*C*G [3xSp9]SEQ ID NO 27T13 [20xdA]* dC* dG [3xSp9]* dCSEQ ID NO 28(SEQ ID NOs refer to underlined nucleotides of T1-T13)

[0034] A further aspect of the present invention relates to a method for the generation of the artificial mRNA construct of the invention comprising, consisting, or essentially consisting of the steps: i. providing a polynucleotide M and a synthetic cap structure, ii. linking said polynucleotide M to the synthetic cap structure, wherein the 5’ end of the polynucleotide M is linked to the synthetic cap structure, and iii. optionally linking the polynucleotide M to the synthetic 3’ terminus, wherein the 3’ end of the polynucleotide M is linked to the synthetic 3’ terminus.

[0035] A further aspect of the present invention relates to a therapeutic mRNA construct comprising or consisting of the artificial mRNA construct of the invention, wherein the polypeptide M encodes a therapeutic polypeptide, a therapeutic peptide, an antibody, an enzyme, a vaccine antigen, a nucleic acid binding protein, or a diagnostic marker.

[0036] A further aspect of the present invention relates to a pharmaceutical composition comprising the therapeutic mRNA construct of the invention. In some embodiments, said pharmaceutical composition further comprises one or more pharmaceutically acceptable diluents and / or excipients and / or one or more adjuvants.

[0037] A further aspect of the present invention relates to the artificial mRNA construct, the therapeutic mRNA construct, or the pharmaceutical composition according to the inventionfor use as a medicament. A further aspect of the present invention relates to the artificial mRNA construct, the therapeutic mRNA construct, or the pharmaceutical composition according to the invention for use as a vaccine.

[0038] A further aspect of the present invention relates to a kit or kit of parts comprising the artificial mRNA construct, the therapeutic mRNA construct, or the pharmaceutical composition according to the invention, or any combination thereof.

[0039] Further disclosed is a method for obtaining a peptide or protein, comprising, consisting, or essentially consisting of: i. providing an artificial mRNA construct according to the invention, and ii. translating said artificial mRNA construct.

[0040] A further aspect relates to the use of the artificial mRNA construct, the therapeutic mRNA construct, or the pharmaceutical composition according to the invention for obtaining a peptide or protein.

[0041] Further disclosed is the use of the artificial mRNA construct, the therapeutic mRNA construct, or the pharmaceutical composition according to the invention for transfecting a host cell.

[0042] A further aspect relates to the use of a synthetic cap structure and optionally synthetic 3’ terminus according to the invention for increasing stability and / or translational efficiency of a polynucleotide molecule, preferably of an mRNA molecule.

[0043] Further disclosed is an xRNA construct comprising: i. an open reading frame comprising an initiation codon and a nucleotide sequence encoding a polypeptide of interest; ii. at least one chemically-stabilizing xCap element located at the 5’end of said open reading frame, replacing the naturally occurring cap; and iii. optionally, at least one chemical stabilizing element located at the 3’ end of said open reading frame, replacing the poly(A) RNA tail; wherein the said chemically-stabilizing elements permit cap-independent translation of a polypeptide of interest

[0044] In some embodiments, the xRNA construct further comprises a 5’UTR region located at 5’ of the open reading frame. In some embodiments, the xRNA construct further comprises a 3’UTR region located at 3’ of the open reading frame. In some embodiments, the xRNA construct further comprises a 3’UTR region located at 3’ of the open reading frame, and a 5’UTR region located at 5’ of the open reading frame. In some embodiments, the chemical stabilizing elements of the xRNA construct are selected from DNA nucleotides, non-natural nucleotides (for example, L enantiomers and XNA), non-natural backbone modifications, modified nucleotides, modified nucleosides, modified backbone linkages, conjugates (for example GalNac, Biotin, Puromycin, Cholesterol, C16), non-RNA polymers, chemical spacers, doublers,treblers, branchers, sugars, lipids, peptides, vitamins and any combination thereof. In some embodiments, the number of chemical stabilizing elements of the xCap element located at the 5’end of said open reading frame is in the range of 1 to 5, 1 to 10, 1 to 20, 1 to 30, 1 to 50 or 1 to 100. In some embodiments, the number of chemical stabilizing elements located at the 3’end of said open reading frame is in the range of 1 to 5, 1 to 10, 1 to 20, 1 to 30, 1 to 50, 1- 150 or 0 to 150. In some embodiments, the polypeptide of interest encodes a therapeutic protein, a therapeutic peptide, an antibody, an enzyme, a vaccine antigen, a nucleic acid binding protein, or a diagnostic marker.

[0045] In some embodiments, the chemically-stabilizing element of the xCap element consists of a fatty acid chain connected to the 5’ end of the molecule. In some embodiments, the chemically-stabilizing element of the xCap element consists of a fatty acid chain with 1 to 20 carbons. In some embodiments, the chemically-stabilizing element of the xCap element consists of at least one phosphorothioate group between the 5’ nucleotide and the subsequent nucleotide. In some embodiments, the chemically-stabilizing element of the xCap element also includes a fatty acid chain on the 5’ end of the molecule, preferably C9.

[0046] Further disclosed is a method for producing the xRNA construct of the invention, comprising synthesizing the construct using chemical stabilizing elements and incorporating them into the corresponding positions of the open reading frame.

[0047] Further disclosed is a method for producing the xRNA construct of the invention, wherein different parts of the construct are synthesized chemically or enzymatically and are chemically or enzymatically ligated to each other.

[0048] Further disclosed is a pharmaceutical composition comprising the xRNA construct of the invention and a pharmaceutically acceptable carrier or excipient, wherein the composition is formulated for delivery to target cells or tissues.

[0049] Further disclosed is a method for inducing an immune response, comprising administering the xRNA construct of the invention as a vaccine, wherein the chemical stabilizing elements enhance the stability of the construct.

[0050] Further disclosed is a method for gene therapy, comprising delivering the xRNA construct of the invention to target cells, wherein the chemical stabilizing elements facilitate efficient delivery, stability, and expression of the construct.DEFINITIONS

[0051] For convenience, certain terms employed in the specification, examples, and appended claims are collected here.

[0052] The terms “polynucleotide” and “nucleic acid” are used herein interchangeably. They refer to a polymeric form of nucleotides of any length. Polynucleotides may have any three- dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, synthetic polynucleotides, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified, such as by conjugation with a labeling component. Polynucleotides depicted herein are in 5’ to 3’ direction unless otherwise stated.

[0053] If not stated otherwise, the term “nucleic acid” refers to any nucleic acid such as ribonucleic acid, deoxyribonucleic acid, xeno nucleic acid, single stranded or double stranded.

[0054] As used herein, the term “xeno nucleic acids” or “XNAs” are synthetic nucleic acid analogues that have a different phospho-sugar backbone or nucleobases than the natural nucleic acids DNA and RNA.

[0055] The term "RNA linker" according to the invention relates to a short RNA polynucleotide of length between 1 and 10 nt added between two nucleic acid sequences, such as between the polynucleotide M and the synthetic 3’ terminus according to the invention, to connect said two nucleic acid sequences. There is no limitation regarding the linker sequence.

[0056] The terms “codon” or “triplet” refers to a sequence of three nucleotides. A codon may encode an amino acid in a defined reading frame of a polynucleotide.

[0057] The term “operably linked” means with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and / or allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components.

[0058] The term “open reading frame” or “ORF” in the context of the invention may typically be a sequence of several nucleotide triplets which may be translated into a polypeptide or protein. An open reading frame preferably contains a start codon (initiation codon), i.e. a combination of three subsequent nucleotides coding usually for the amino acid methionine (ATG), at its 5'- end and a subsequent region which usually exhibits a length which is a multiple of 3 nucleotides. An ORF is preferably terminated by a stop-codon (e.g., TAA, TAG, TGA) unless stated otherwise. Typically, this is the only stop-codon of the open reading frame. Thus, an open reading frame in the context of the present invention is preferably a nucleotide sequence,consisting of a number of nucleotides that may be divided by three, which starts with a start codon (e.g. ATG) and which preferably terminates with a stop codon (e.g., TAA, TGA, or TAG). An ORF devoid of a STOP codon according to the invention relates to an ORF as described above wherein said ORF does not include any STOP-codon and said ORF is not terminated with a STOP-codon.

[0059] The term canonical or conventional “poly(A)”, or ”poly(A) tail”, is typically understood to be a RNA sequence of adenine nucleotides, e.g., of up to about 400 adenine nucleotides, e.g. from about 11 to about 400. A poly(A) sequence is typically located at the 3'end of an mRNA. In the context of the present invention, an artificial mRNA construct is devoid of a poly(A) sequence if said molecule does not comprise an RNA sequence of more than 10 uninterrupted adenine nucleotides downstream of its ORF.

[0060] The term ”5'-untranslated region” or ”5'UTR” refers to a nucleic acid sequence, which is typically part of an mRNA and is located between the 5’Cap and the open reading frame (ORF) of an mRNA. A 5'UTR of the mRNA is not translated into an amino acid sequence.

[0061] The term “TISU” (Translation Initiator ofmay refer to a specific sequence as known in the art within the 5' untranslated region (5'UTR) of an mRNA or constitutes the entire 5’UTR of an mRNA. TISU elements typically contain a consensus sequence that is recognized by the ribosome, facilitating efficient recruitment and binding of the ribosomal machinery to the mRNA, thereby promoting protein synthesis.

[0062] The term “3'-untranslated region” or “3'UTR” refers to a nucleic acid sequence, which is typically part of an mRNA and is located between the open reading frame (ORF) and the poly(A) sequence of an mRNA. A 3'UTR of the mRNA is not translated into an amino acid sequence.

[0063] The term “5’Cap” or “cap” refers to a small molecule at the 5’ end of the mRNA molecule that promotes canonical or non-canonical translation. In preferred embodiments the 5’Cap specifically binds one or more translation initiation factors. In a more preferred embodiment, the 5’Cap specifically binds to eukaryotic translation initiation factor 4E (eIF4E). Natural caps can be of several types, including Cap0, Cap1, and Cap2 structures.

[0064] The term´s “natural cap”, “canonical cap structure” or “conventional cap” refer to cap elements naturally occurring in various organisms, including nucleotide metabolites such as nicotinamide adenine dinucleotide, flavin adenine dinucleotide, Uridine diphosphate glucose, or naturally occurring ends to the mRNA such 5’-OH or 5’ with one or more phosphate groups.

[0065] A 5'Cap may typically be formed by a modified nucleotide, particularly by a derivative of a guanine nucleotide. Preferably, the 5'Cap is linked to the 5'-terminus via a 5'-5'- triphosphate linkage. A 5'Cap may be methylated, e.g. m7GpppN, wherein N is the terminal 5' nucleotide of the nucleic acid carrying the 5'Cap, typically the 5'-end of an RNA.

[0066] The term “xCap” or “synthetic cap structure” refers to one or more non-naturally occurring, chemically stabilizing elements located upstream of the opening reading frame of an mRNA or xRNA. Preferably, these one or more elements permit translation of a polypeptide from the mRNA despite the absence of a natural cap structure.

[0067] The term xRNA refers to a molecule that contains a polynucleotide chain that encodes a polypeptide and contains at least one non-natural chemically stabilizing element. Preferably, the term xRNA refers to an artificial mRNA construct according to the invention.

[0068] The term "chemically-stabilizing element" or “non-natural stabilization building blocks” or “non-natural chemical elements”, or “building blocks” refer to non-natural RNA elements that deviate from the natural or standard building blocks found in RNA molecules and / or naturally occurring cap structures. These chemically-stabilizing elements are designed to replace or modify the standard components of RNA in order to confer specific properties or functionalities to the RNA molecule. The chemically-stabilizing element may include chemically modified nucleotides, DNA nucleotides, nucleotide analogs, non-standard nucleobases, modified sugars, modified phosphates, chemical spacers, chemical branchers or treblers, conjugates, stereo isomers of natural / non-natural nucleotides, or any other modifications or substitutions that alter the structure or properties of RNA. These chemically-stabilizing elements can be incorporated into the RNA molecule during synthesis or through post- synthetic modifications, allowing for the creation of RNA molecules with enhanced stability, translational efficiency, or other desired characteristics.

[0069] In a preferred embodiment, said chemically-stabilizing elements are selected from phosphoramidite monomers. The term “phosphoramidite monomer” may refer to natural or synthetic nucleosides as defined by nomenclature commonly found in the field of polynucleotide chemical synthesis. Each phosphoramidite monomer is linked to the previous and / or subsequent element according to the polynucleotide synthesis nomenclature from 5’ to 3’ by e.g., phosphodiester bonds (unless otherwise stated or evident according to the nomenclature) as known in the arts. While all building blocks indicated in the present disclosure are known and well defined, the structures of a selected non-limiting set of phosphoramidite monomer useful according to the invention as well as the 5’ and 3’ linking orientation are summarized e.g., in table 1 and table 2 (phosphodiester bonds not shown). An example of phosphoramidite monomer structures incorporated into a polynucleotide or artificial mRNA construct according to the invention is shown in figure 18. A list of non-limiting precursor molecules useful for chemical synthesis according to phosphoramidite chemistry is summarized in table 3.

[0070] The term “chemically-stabilizing element is linked by a phosphorothioate linkage” means that the respective element is linked at its 3’ terminus to the downstream element or nucleotide by a phosphorothioate linkage as known in the art and commonly utilized in mRNA chemical synthesis using phosphoramidite chemistry.

[0071] The term “translational efficiency” relates to a biological property of mRNAs or mRNA- like molecules, wherein the efficiency of polypeptide synthesis through translation of the mRNA or mRNA-like molecule is quantified. In particular, the term "translation efficiency" relates to the amount of translation product provided by an mRNA or mRNA-like molecule within a particular period of time. It is well known in the art how to quantify the amount of translation product. For instance, quantities of reporter protein encoded by the respectivepolynucleotide, such as mRNA, may be determined, e.g., by ELISA assays or reporter assays such as luciferase assays depending on the reporter protein used.

[0072] The term “stability” of a compound refers to the chemical and / or enzymatic stability of compounds such as mRNAs in vitro and / or in vivo. For instance, the stability of an mRNA can relate to the stability during storage, within solution, within the human body, or within a cell, or within a certain organelle in the cell, such as the endosome. Preferably, the term "stability of a polynucleotide” relates to the "half-life" of a polynucleotide. "Half-life" relates to the period which is needed to eliminate half of the activity, amount, or number of molecules. In the context of the present invention, the half-life of a polynucleotide or a molecule is indicative for the stability of said molecule. It is well established in the art how to determine the half-life of a polynucleotide, for example, the quantities of polynucleotide present in cells at the sample time points may be determined by quantitative PCR methods.

[0073] Preferably, the term “increased stability of the synthetic polynucleotide molecule” means that the half-life, e.g. the period of time which is needed to eliminate half of the activity, amount, or number of molecules, of the synthetic polynucleotide molecule of the invention after application (e.g. transfection into cell line or injection into a subject), is increased compared to the half-life of a reference mRNA.

[0074] The terms “increased translational efficiency”, “polypeptide production duration”, “polypeptide expression”, or “total polypeptide production” mean that polypeptide production from the artificial mRNA construct of the invention is stabilized and / or prolonged compared to the polypeptide production from a reference nucleic acid such as a reference mRNA, e.g. comprising a comparable, preferably identical, polynucleotide M (i) but lacking said synthetic 3’ terminus (ii) of the invention, preferably in a mammalian expression system, such as an animal or cell culture system.

[0075] The term “biological activity” refers to a biological property such as pharmacological activity, efficacy or any other beneficial or adverse effects of a compound on living matter.

[0076] The term “delivery reagent” unless otherwise specified refers to any vehicle useful for the delivery of compounds to a tissue, cell or environment of choice. Non-limiting examples of delivery vehicles are nanoparticles, polymers, lipids, small molecules, aptamers, antibodies, and cell penetrating peptides, as well as any other vehicle known by the skilled person in the art.

[0077] The terms "polypeptide", "peptide", and "protein" relate to oligo- and polypeptides and refers to substances which comprise two or more, preferably 3 or more, preferably 4 or more, preferably 6 or more, preferably 8 or more, preferably 10 or more consecutive amino acids linked to one another via peptide bonds. The term "protein" refers to large peptides, preferably peptides having at least 151 amino acids, but the terms "(poly)peptide" and "protein" are used herein usually as synonyms. Polypeptides may further comprise according to the invention substances which contain not only amino acid components but also non-amino acid components such as sugars and phosphate structures, as well as substances containing bonds such as ester, thioether or disulfide bonds. According to the present invention, a nucleic acidsuch as RNA may encode a polypeptide or protein. Accordingly, a transcribable polynucleotide or a transcript thereof such as mRNAs may contain an open reading frame (ORF) encoding a polypeptide. Said polynucleotide may express the encoded polypeptide or protein. For example, said polynucleotide may be a nucleic acid encoding a therapeutical polypeptide.

[0078] The term "therapeutical polypeptide" relates to a polypeptide with a positive or advantageous effect on the condition or disease state of a subject when administered to the subject in a therapeutically effective amount. Preferably, a therapeutical polypeptide has curative or palliative properties and may be administered to ameliorate, relieve, alleviate, reverse, delay onset of or lessen the severity of one or more symptoms of a disease or disorder. A therapeutical polypeptide may have prophylactic properties and may be used to delay the onset of a disease or to lessen the severity of such disease or pathological condition. The term "therapeutical polypeptide" includes entire proteins or polypeptides, and can also refer to pharmaceutically active fragments thereof. It can also include pharmaceutically active analogs of a peptide or protein. The term "therapeutical polypeptide" includes polypeptides and proteins that are antigens, i.e., the polypeptide or protein elicits an immune response in a subject which may be therapeutic or partially or fully protective.

[0079] Examples of therapeutical polypeptides include, but are not limited to, cytokines and immune system proteins such as immunologically active compounds (e.g., interleukins , colony stimulating factor (CSF) , granulocyte colony stimulating factor (G-CSF) , granulocyte- macrophage colony stimulating factor (GM- CSF) , erythropoietin, tumor necrosis factor (TNF) , interferons, integrins, addressins, selectins, homing receptors, T cell receptors, immunoglobulins, soluble major histocompatibility complex antigens, immunologically active antigens such as bacterial, parasitic, or viral antigens, allergens, autoantigens , antibodies), hormones (insulin, thyroid hormone, catecholamines, gonadotrophins , trophic hormones, prolactin, oxytocin, dopamine, bovine somatotropin, leptins and the like), growth hormones (e.g., human grown hormone), growth factors (e.g., epidermal growth factor, nerve growth factor, insulin-like growth factor and the like), growth factor receptors, enzymes (tissue plasminogen activator, streptokinase, cholesterol biosynthetic or degradative, steroidogenic enzymes, kinases, phosphodiesterases, methylases, de-methylases , dehydrogenases, cellulases, proteases, lipases, phospholipases, aromatases, cytochromes, adenylate or guanylaste cyclases, neuramidases and the like), receptors (steroid hormone receptors, peptide receptors) , binding proteins (growth hormone or growth factor binding proteins and the like) , transcription and translation factors, tumor growth suppressing proteins (e.g., proteins which inhibit angiogenesis) , structural proteins (such as collagen, fibroin, fibrinogen, elastin, tubulin, actin, and myosin) , blood proteins (thrombin, serum albumin, Factor VII, Factor VIII, insulin, Factor IX, Factor X, tissue plasminogen activator, protein C, von Willebrand factor, antithrombin III, glucocerebrosidase , erythropoietin granulocyte colony stimulating factor (GCSF) or modified Factor VIII, anticoagulants and the like.

[0080] As used herein “therapeutically effective amount” refers to an amount of a composition that relieves (to some extent, as judged by a skilled medical practitioner) one or moresymptoms of the disease or condition in a mammal. Additionally, by “therapeutically effective amount” of a composition is meant an amount that returns to normal, either partially or completely, physiological or biochemical parameters associated with or causative of a disease or condition. A clinician skilled in the art can determine the therapeutically effective amount of a composition in order to treat or prevent a particular disease condition, or disorder when it is administered, such as intravenously, subcutaneously, intraperitoneally, orally, or through inhalation. The precise amount of the composition required to be therapeutically effective will depend upon numerous factors, e.g., such as the specific activity of the active agent, the delivery device employed, physical characteristics of the agent, purpose for the administration, in addition to many patient-specific considerations. But a determination of a therapeutically effective amount is within the skill of an ordinarily skilled clinician upon the appreciation of the disclosure set forth herein.

[0081] The terms “treating,” “treatment,” “therapy,” and “therapeutic treatment” as used herein refer to curative therapy, prophylactic therapy, or preventative therapy. An example of “preventative therapy” is the prevention or lessening the chance of a targeted disease (e.g., cancer or other proliferative disease) or related condition thereto. Those in need of treatment include those already with the disease or condition as well as those prone to have the disease or condition to be prevented. The terms “treating,” “treatment,” “therapy,” and “therapeutic treatment” as used herein also describe the management and care of a mammal for the purpose of combating a disease, or related condition, and includes the administration of a composition to alleviate the symptoms, side effects, or other complications of the disease, condition. Therapeutic treatment for cancer includes, but is not limited to, surgery, chemotherapy, radiation therapy, gene therapy, and immunotherapy.

[0082] The terms "comprising," "containing," "having," "include," and "including" used in this patent application, including the appended claims, should be interpreted as "including, but not limited to," unless otherwise explicitly stated. The terms "a," "an," "the," and similar referents used in the description of the invention, and specifically in the context of the appended claims, are to be understood as encompassing both the singular and the plural forms, unless otherwise specified. The use of any examples or exemplary language, such as "for example," "e.g.," "such as," is solely intended for illustrative purposes to demonstrate aspects or embodiments of the invention and should not be interpreted as limiting the scope of the invention, unless otherwise stated in the claims.

[0083] As used herein, the term "identity" when used in relation to nucleic acids or polypeptides, describes the degree of similarity between two or more nucleotide or polypeptide sequences. The percentage of "sequence identity" between two sequences can be determined by comparing two optimally aligned sequences over a comparison window, such that the portion of the sequence in the comparison window may comprise additions or deletions (gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acidresidue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. A sequence that is identical at every position in comparison to a reference sequence is said to be identical to the reference sequence and vice-versa. An alignment of two or more sequences may be performed using any suitable computer program. For example, a widely used and accepted computer program for performing sequence alignments is CLUSTALW vl .6 (Thompson, et al. (1994) Nucl. Acids Res., 22: 4673-4680).

[0084] Unless defined otherwise, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Particularly, unless otherwise stated, a term as used herein is given the definition as provided in the Oxford dictionary of biochemistry and molecular biology, Oxford University Press, 1997, revised 2000 and reprinted 2003, ISBN 0198506732.

[0085] While the following detailed description of the present disclosure is provided, it should be noted that the disclosure is not restricted to the specific methodologies, protocols, and reagents described herein, as they may vary. Furthermore, the terminology employed in this disclosure is solely intended to describe specific embodiments and should not be construed as limiting the scope of the present disclosure, which will be determined solely by the appended claims. Unless otherwise defined, all technical and scientific terms utilized in this disclosure hold their customary meanings as understood by a person skilled in the relevant field. DETAILED DESCRIPTION OF THE INVENTION

[0086] A first aspect of the present invention relates to an artificial mRNA construct comprising: i. a polynucleotide M comprising at least one open reading frame encoding a polypeptide; and ii. a synthetic cap structure comprising at least one chemically-stabilizing element located at the 5’end of said polynucleotide M, wherein said artificial mRNA construct is devoid of a canonical cap structure, and said synthetic cap structure replaces the canonical cap. Preferably, said synthetic cap structure permits cap- independent translation of the at least one open reading frame.

[0051] Surprisingly, it was found that the artificial mRNA construct according to the invention represents or provides an mRNA / mRNA-like molecule, which permits cap-independent translation of the at least one open reading frame. Said construct further shows comparable or increased chemical and / or enzymatic stability compared to conventional mRNA. Additionally, it was found that the artificial mRNA construct according to the invention increases the translational efficiency thereby allowing for prolonged and / or stabilized polypeptide production. Thus, the artificial mRNA construct as described herein provides a highly stable molecule with prolonged polypeptide production in vitro and in vivo compared to acanonical / conventional mRNA molecule encoding a comparable or the same open reading frame.

[0052] Surprisingly, it has been further found that replacing the canonical poly(A) tail of the artificial mRNA construct of the invention further increases the translatability and stability of the construct. In this context, the replacement of the canonical cap structure and simultaneous replacement of the canonical poly(A) tail resulted in a synergistical increase in stability and / or translatability of the artificial mRNA construct.

[0053] Accordingly, in some embodiments, the artificial mRNA construct according to the invention further comprises: iii. a synthetic 3’ terminus comprising at least one chemically-stabilizing element located at the 3’ end of said polynucleotide M, wherein said artificial mRNA construct is devoid of a canonical poly(A) tail and said synthetic 3’ terminus replaces the canonical poly(A) tail.

[0054] The combination of a synthetic cap structure as well as a synthetic 3’ terminus replacing canonical structures of a conventional mRNA according to the invention surprisingly provids chemical stability and permits translation the artificial mRNA constructs thus obtained. Accordingly, in a preferred embodiment, the artificial mRNA construct of the invention comprises said synthetic 3’ terminus.

[0055] Preferably, the polynucleotide M of the artificial mRNA construct is functionally linked to the synthetic cap structure and optionally synthetic 3’ terminus. This means that preferably the synthetic cap structure and optionally synthetic 3’ terminus is associated with the polypeptide M such that it may exert a function, such as a stabilizing function on the translation of a polypeptide encoded by the at least one ORF or a stabilizing function on the artificial mRNA construct. Preferably, the synthetic cap structure and the polynucleotide M are associated in 5' to 3' direction. Preferably, the polynucleotide M and the optional synthetic 3’ terminus are associated in 5' to 3' direction. Thus, the artificial mRNA construct may comprise in direction of 5’ to 3’ the synthetic cap structure, an optional RNA linker, the polynucleotide M, wherein the RNA linker may be present or absent. In a preferred embodiment, the artificial mRNA construct comprises in direction of 5’ to 3’ the synthetic cap structure, an optional RNA linker, the polynucleotide M, an optional RNA linker, and synthetic 3’ terminus, wherein the RNA linkers may be present or absent.

[0056] In some embodiments, the synthetic cap structure and optional synthetic 3’ terminus of the artificial mRNA construct according to the invention increases the translational efficiency, polypeptide production duration, polypeptide expression, total polypeptide production, or any combination thereof, of the artificial mRNA construct. In some embodiments, the synthetic cap structure and optional synthetic 3’ terminus of the artificial mRNA construct according to the invention increases the stability of the artificial mRNA construct. More preferably, the synthetic cap structure and optional synthetic 3’ terminus of the artificial mRNA construct according to the invention increases stability and / or translational efficiency.

[0057] In a preferred embodiment of the present invention, the synthetic cap structure and optional synthetic 3’ terminus of the artificial mRNA construct fulfills at least one function selected from the group of increasing the chemical and / or enzymatical stability and enhancing the translational efficiency of the artificial mRNA construct, preferably in a mammalian cell, such as but not limited to a human cell, compared to a nucleic acid, such as a canonical mRNA, comprising said at least one ORF of the polynucleotide M of the present invention. A canonical mRNA in this context may be, for instance, an mRNA naturally occurring comprising said at least one ORF of the polynucleotide M.

[0058] Said increase in stability, translational efficiency, polypeptide production duration, polypeptide expression, or total polypeptide production is preferably determined by comparison with a respective reference polynucleotide molecule (reference mRNA) lacking the synthetic cap structure and optional synthetic 3’ terminus of the invention, e.g. an mRNA comprising a conventional cap structure and a conventional poly(A) tail.

[0059] A reference mRNA / polynucleotide in this context means that the reference mRNA / polynucleotide comprises a comparable, preferably identical, polynucleotide M of the artificial mRNA construct but does not comprise the synthetic cap structure and optional synthetic 3’ terminus according to the invention.

[0060] Accordingly, polypeptide production from the artificial mRNA construct according to the present invention is observable for a longer time compared to what is observable, or would be observable, from a reference mRNA or canonical mRNA. In other words, the amount of polypeptide produced from the artificial mRNA construct of the invention measured over time is larger than the amount of polypeptide produced from a reference mRNA measured over the same time and under comparable conditions. For example, the amount of polypeptide production of the artificial mRNA construct of the invention measured in the initial phase of expression, such as 1h, 2h, 3h, 4h, 5h, or 6h, or during a prolonged time, such as 12h, 24h, 48h, 72h or longer post administration of the construct is larger than the amount measured under the same time and conditions for a reference mRNA.

[0061] The increase of stability and / or translational efficiency may be determined by any method suitable for this purpose known to skilled person. For example, reference mRNAs may be generated comprising a coding sequence for a reporter protein, such as luciferase, and a conventional cap structure and a canonical poly(A) sequence. Such mRNAs may be generated, for example, by in vitro transcription of respective vectors such as plasmid vectors, e.g. comprising a T7 promoter and a sequence encoding the respective mRNA sequences. The generated mRNA molecules may be transfected into cells by any transfection method suitable for transfecting mRNA, for example they may be electroporated into mammalian cells, such as A549 or HEK 293T cells, and samples may be analyzed at certain time points after transfection, for example, 6 hours, 24 hours, 48 hours, and 72 hours or longer post transfection.

[0062] Preferably, the at least one function exerted by the synthetic cap structure and optional synthetic 3’ terminus of the artificial mRNA construct according to the invention, such as increasing stability and / or enhancing translational efficiency of the polynucleotide M, is at least10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 80%, more preferably at least 90%, more preferably at least 100%, more preferably at least 200%, more preferably at least 300%, more preferably at least 400%, and even more preferably at least 500% increased, compared to a nucleic acid, such as a canonical mRNA, comprising said polynucleotide M of the present invention, as measured 6 hours, 24 hours, or preferably 48h post transfection.

[0063] POLYNUCLEOTIDE M

[0064] The polynucleotide M and the synthetic cap structure and optional synthetic 3’ terminus of the artificial mRNA construct according to the invention are heterologous, wherein heterologous in this context means that the polynucleotide M and the synthetic cap structure and optional synthetic 3’ terminus of the artificial mRNA construct according to the invention are not occurring naturally in this combination.

[0065] In some embodiments, the polynucleotide M is RNA. In some embodiments, the polynucleotide M comprises a combination of unmodified and modified RNA nucleotides, or only modified nucleotides. In some embodiments, the polynucleotide M comprises only naturally occurring RNA nucleotides.

[0066] The polynucleotide M according to the present invention may further comprise optional structures, commonly found in canonical mRNAs, including but not limited to a 5'UTR, and / or 3’UTR. Said optional structures are preferably operably linked to the at least one ORF of the polynucleotide M. For instance, the 5'UTR is preferably located 5' or upstream to the ORF and the optional 3’UTR 3’ or downstream to the ORF within the artificial mRNA construct according to the present invention. In some embodiments the structure of the artificial mRNA construct according to the invention is, from 5’ to 3’, synthetic cap structure - 5’UTR – ORF - 3’UTR – poly(A) tail. In some embodiments, the artificial mRNA construct according to the invention is, from 5’ to 3’, synthetic cap structure - 5’UTR – ORF - 3’UTR – synthetic 3’ terminus. In a preferred embodiment, the artificial mRNA construct according to the invention is, from 5’ to 3’, synthetic cap structure - 5’UTR – ORF – synthetic 3’ terminus

[0067] A 5’UTR according to the present invention may refer to a non-coding regulatory element linked to the at least one ORF of the polynucleotide M of the invention. 5’UTRs can be derived from the original 5’UTR associated with the ORF as seen in nature. However, in a preferred embodiment 5’UTRs according to the present invention are short naturally occurring or synthetic polynucleotide sequences. In some embodiment 5’UTRs have a length of about 10,000 monomers to about 1 monomer, more preferred a length of about 1,000 monomers to about 1 monomer, more preferred of about 100 monomers to about 5 monomers and most preferred of about 50 monomers to about 5 monomers.

[0068] In some embodiments, the polynucleotide M of the invention comprises a Kozak consensus sequence (Kozak sequence / element) and / or a Translation Initiator of Short 5′ UTR (TISU) element.

[0069] 3’UTRs useful according to the present invention are short naturally occurring or synthetic polynucleotide sequences. In some embodiment 3’UTRs have a length of about 10,000 monomers to about 1 monomer, more preferred a length of about 1,000 monomers to about 1 monomer, more preferred of about 100 monomers to about 5 monomers and most preferred of about 50 monomers to about 5 monomers.

[0070] The presence of a poly(A)-tail in canonical / conventional mRNA molecules is pivotal for stability and / or translational efficiency. Surprisingly, stability and / or translational efficiency of the artificial mRNA construct according to the invention is significantly improved even in said molecules that are devoid of a canonical poly(A)-tail compared to a reference mRNA molecule comprising a canonical poly(A)-tail and comprising the same at least one ORF of the polynucleotide M according to the invention. In fact, the replacement of the canonical cap and poly(A) tail by the synthetic cap structure and synthetic 3’ terminus respectively has a synergistical impact of translatability and / or stability of the construct.

[0071] The presence of a STOP codon at the 3’ end of an ORF comprising a conventional mRNA is indispensable for translational efficiency, wherein a lack of such codon regularly results, for instance, in non-stop decay and thus removal of the mRNA. Surprisingly, the lack of a STOP codon at the 3’ terminus of the at least one ORF of the artificial mRNA construct, wherein the conventional poly(A) tail is replaced with synthetic 3’ terminus according to the invention resulted in strong polypeptide production demonstrating that a STOP codon may be dispensable for polypeptide expression or even translation can be further promoted in its absence. Accordingly, in some embodiments the at least one ORF comprising the artificial mRNA construct of the invention is devoid of a STOP codon.

[0072] Surprisingly, the lack of a 3’UTR within the artificial mRNA construct, wherein the poly(A) tail is replaced with the synthetic 3’ terminus according to the invention resulted in strong protein expression demonstrating that a 3’UTR may be further dispensable for polypeptide expression. Accordingly, in some embodiments the artificial mRNA construct of the invention is devoid of a 3’UTR.

[0073] In a preferred embodiment, the at least one ORF comprising the polynucleotide M according to the invention encodes at least one therapeutic polypeptide, a therapeutic peptide, an antibody, an enzyme, a vaccine antigen, a nucleic acid binding protein, or a diagnostic marker. A therapeutical polypeptide according to the present invention relates to any polypeptide useful for the treatment of subjects in need thereof.

[0074] CHEMICALLY-STABILIZING ELEMENTS

[0075] The chemically-stabilizing elements according to the invention may vary in composition and structure. In various embodiments, the chemically-stabilizing elements can be selected from DNA nucleotides, non-natural nucleotides (such as L enantiomers and XNA), non-natural backbone modifications, modified nucleotides, modified nucleosides, modified backbone linkages, conjugates (e.g., GalNAc, Biotin, Puromycin, Cholesterol, C16), natural and non-natural polymers that are not RNA, chemical spacers, doublers, treblers, branchers, sugars, lipids, peptides, vitamins, and combinations thereof.

[0076] In some embodiments, the at least one chemically-stabilizing element independently comprises a fatty acid chain with 1 to 20 carbons.

[0077] In some embodiments, the chemically-stabilizing element of the artificial mRNA construct of the invention may comprise at least one phosphorothioate group between the 5' nucleotide and the subsequent nucleotide. Additionally, the chemically-stabilizing element may include a fatty acid chain on the 5' end of the molecule. Specific examples of said fatty acid chains include C9 fatty acid chains. Specific examples of chemically-stabilizing elements of the artificial mRNA construct include a fatty acid chain connected to the 5' end of the molecule. The length of the fatty acid chain can vary, with examples including fatty acid chains containing 1 to 20 carbons.

[0078] In some embodiments, the chemically-stabilizing element at the 5’ end of the synthetic cap structure comprises a fatty acid chain, preferably Sp9. In some embodiments, the 5’ end of the synthetic cap structure is linked by a phosphorothioate group.

[0079] In some embodiments more than one chemically-stabilizing element according to the invention may be functionally linked to a second, third etc., sometimes different element to form a continuous chain of elements. For instance, in some embodiments, the synthetic cap structure and synthetic 3’ terminus may independently refer to a chain of 5 consecutive chemically-stabilizing elements such as Sp9 phosphoramidite monomers functionally linked to each other as known in the art by e.g., phosphoramidite chemistry. Such chemically elements may be incorporated directly into a growing RNA sequence by synthetic chemistry in a way that the synthetic cap structure is linked to the 5’ end of the RNA, thus replacing the cap structure, and, optionally, the synthetic 3’ terminus is linked to the 3’ end of the RNA, thus replacing the conventional poly(A) tail.

[0080] The number of the at least one chemically-stabilizing elements of the synthetic cap structure located at the 5' end of the polynucleotide M of the invention can vary within a range. In some embodiments, the range may be from about 1 to about 100 elements, from about 1 to about 50 elements, from about 1 to about 41 elements, from about 1 to about 40 elements, from about 1 to about 30 elements, from about 1 to about 20 elements, from about 1 to about 19 elements, from about 1 to about 18 elements, from about 1 to about 17 elements, from about 1 to about 16 elements, from about 1 to about 15 elements, from about 1 to about 14 elements, from about 1 to about 13 elements, from about 1 to about 12 elements, from about 1 to about 11 elements, from about 1 to about 10 elements, from about 1 to about 9 elements, from about 1 to about 8 elements, from about 1 to about 7 elements, from about 1 to about 6 elements, from about 1 to about 5 elements, from about 1 to about 4 elements, from about 1 to about 3 elements. Preferably, from about 2 to about 5 elements, from about 2 to about 4 elements, from about 2 to about 3 elements.

[0081] In some embodiments, the synthetic cap structure comprises or consists of about 1 to about 100 elements, from about 1 to about 50 elements, from about 1 to about 41 chemically- stabilizing, from about 1 to about 40 elements, from about 1 to about 30 elements, from about 1 to about 20 elements, from about 1 to about 19 elements, from about 1 to about 18 elements, from about 1 to about 17 elements, from about 1 to about 16 elements, from about 1 to about 15 elements, from about 1 to about 14 elements, from about 1 to about 13 elements, from about 1 to about 12 elements, from about 1 to about 11 elements, from about 1 to about 10 elements, from about 1 to about 9 elements, from about 1 to about 8 elements, from about 1 to about 7 elements, from about 1 to about 6 elements, from about 1 to about 5 elements, from about 1 to about 4 elements, from about 1 to about 3 elements. Preferably, from about 2 to about 5 elements, from about 2 to about 4 elements, from about 2 to about 3 elements, preferably 1 to 5, 1 to 10, 1 to 20, 1 to 30, 1 to 50 or 1 to 100 chemically-stabilizing elements. Even more preferably, the synthetic cap structure comprises or consists of 2 to 10 chemically- stabilizing elements.

[0082] Similarly, the number of the at least one chemically-stabilizing elements of the synthetic 3’ terminus located at the 3' end of the polynucleotide M can also vary within a range. In some embodiments, the range may be from about 1 to about 200 elements, from about 1 to about 122 elements, from about 1 to about 100 elements, from about 1 to about 50 elements, from about 1 to about 40 elements, from about 1 to about 30 elements, from about 1 to about 20 elements, from about 1 to about 19 elements, from about 1 to about 18 elements, from about 1 to about 17 elements, from about 1 to about 16 elements, from about 1 to about 15 elements, from about 1 to about 14 elements, from about 1 to about 13 elements, from about 1 to about 12 elements, from about 1 to about 11 elements, from about 1 to about 10 elements, from about 1 to about 9 elements, from about 1 to about 8 elements, from about 1 to about 7 elements, from about 1 to about 6 elements, from about 1 to about 5 elements, from about 1 to about 4 elements, from about 1 to about 3 elements. In a preferred embodiment, the range is from 2 to 50, more preferably from 2 to 30, more preferably from 2 to 20, even more preferably 4 to 20 elements.

[0083] In some embodiments, the synthetic 3’ terminus comprised or consists 1 to 5, 1 to 10, 1 to 20, 1 to 30, 1 to 50, 1-150 or 1 to 150 chemically-stabilizing elements. Preferably, the synthetic 3’ terminus comprises or consists of 10 to 30 chemically-stabilizing elements.

[0084] A large number of monomers that can be useful as chemically-stabilizing elements according to the invention are known in the art. Many of these non-standard monomer units are utilized in chemical synthesis of polynucleotides using phosphoramidite chemistry and classified as spacers (e.g., "iSp", “Sp9”), and affinity tags (e.g., "[Bio-dT]"). Chemically-stabilizing elements in the description may be described by referring to (phosphoramidite) monomers using well-known polynucleotide synthesis nomenclature to indicate the non-standard monomer units. (See e.g., the web-site of Integrated DNA Technologies (IDT) at https: / / eu.idtdna.com / site / catalog / Modifications / GetAllMods, or GenLink at http: / / www.genelink.com / newsite / products / OligoModifications.asp for further details ofcommonly used oligonucleotide nomenclature.) For example, non-standard monomer units are enclosed in forward slashes (" / ") or in brackets (“[“ and “]”), and an asterisk "*" between units indicates a phosphorothioate linkage. Chemically-stabilizing elements using said nomenclature are linked to the previous element according to polynucleotide synthesis nomenclature from 5’ to 3’ by e.g., phosphodiester bonds (unless otherwise stated) as known in the arts and are herein referred to as phosphoramidite monomers. Accordingly, in some embodiments, the chemically-stabilizing elements are independently selected from phosphoramidite monomers.

[0085] In some embodiments, the synthetic cap structure and synthetic 3’ terminus according to the invention refers to a monomer chain comprising or consisting of at least one polynucleotide and optionally at least one building block L and / or at least one building block C, or any combination thereof, wherein L denotes a chemical linker and C denotes a monomer.

[0086] BUILDING BLOCK L

[0087] In some embodiments, the synthetic cap structure and / or the synthetic 3’ terminus comprises at least one building block L, wherein L denotes a chemical linker. In some embodiments, said building block L is selected from the group of non-RNA polymers, chemical spacers, doublers, sugars, lipids, peptides, aminonucleoside, vitamins, or any combination thereof. In a preferred embodiment, said at least one building block L is selected from the group of SpC3, Sp9, SpC12, Sp18, Spermine, 1-Ethynyl-dSpacer, CholTEG, L-DNA, preferably L- dA, Bio-TEG linkers, and GalNAc. In a preferred embodiment, said at least one building block L is a chemical spacer, more preferably a Sp9 spacer. In a preferred embodiment, building block L refers to a phosphoramidite monomer selected from the group of SpC3, Sp9, SpC12, Sp18, Spermine, 1-Ethynyl-dSpacer, CholTEG, L-DNA, preferably L-dA, Bio-TEG linkers, Trebler, and GalNAc.

[0088] The chemical linkers employed in the present invention may exhibit diverse structures, substituents, and substitution patterns. They can be modified with nitrogen, oxygen, and / or sulfur-containing groups, either pendant from or integral to the backbone of the protective group. Examples of such groups include polyethers, polyacids (such as polyacrylic acid and polylactic acid), polyols (e.g., glycerol), polyamines (e.g., spermine, spermidine), and molecules containing multiple nitrogen, oxygen, and / or sulfur moieties (e.g., 1,3-diamino-2-propanol, taurine). Relevant literature, such as Sandler et al.'s "Organic Functional Group Preparations, 2nd Ed., Academic Press, Inc., San Diego, 1983," provides further details. A broad selection of commercially available mono-, di-, and bis-functionalized poly(ethyleneglycol) molecules can be applied effectively in this aspect of the invention. Refer to sources like the 1997-1998 Catalog from Shearwater Polymers, Inc., Huntsville, Alabama, for specific examples. Moreover, individuals skilled in the field can employ various modification strategies readily within their synthetic repertoire. References like Harris' "Rev. Macromol. Chem. Phys., C25 (3): 325-373 (1985)" and Zalipsky et al.'s "Eur. Polym. J., 19 (12): 1177-1183 (1983)" offer valuable insights. Additionally, U.S. Patent No. 5,122,614 (issued on June 16, 1992, to Zalipsky) and U.S. PatentNo.5,650,234 (issued to Dolence et al. on July 22, 1997), along with their respective references, detail useful modification strategies.

[0089] BUILDING BLOCK C

[0090] In some embodiments, the synthetic cap structure and / or the synthetic 3’ terminus further comprises at least one building block C, wherein C denotes at least one monomer / small molecule conjugate. In a preferred embodiment, said at least one building block C is selected from the group consisting of Puromycin, biotin-dT, 2’OC16-U, Beta-L-DNA, LNA, 2’Ome, 2’MOE, 2’F, and Morpholino. In some embodiments, said at least one building block C is Puromycin. In a more preferred embodiment, said at least one building block C is Puromycin linked to between 1 and 10 nucleotides, more preferably to between 2 and 5 nucleotides, and most preferably to 3 nucleotides. In some embodiments said at least one building block C is Puromycin linked to a polynucleotide of any sequence, preferably of sequence, in 5’ to 3’ direction, ACC, wherein the 3’ end of the polynucleotide of sequence ACC is linked to a puromycin molecule (ACC-Puromycin).

[0091] In a preferred embodiment, building block C is a phosphoramidite monomer selected from the group of puromycin, biotin-dT, 2’OC16-U, Beta-L-DNA, LNA, 2’Ome, 2’MOE, 2’F, and Morpholino.

[0092] Surprisingly, the incorporation of various phosphoramidite monomer within the synthetic cap structure and the synthetic 3’ terminus according to the invention has a synergistic effect on stability of the artificial mRNA construct of the invention. The structural framework of the monomers / building blocks plays a pivotal role. Each monomer, carefully selected for its specific properties, contributes to the overall construction of the synthesized sequence. The chosen monomers may exhibit a characteristic phosphodiester linkage, a fundamental feature in the formation of nucleic acid chains. This linkage involves the condensation of the hydroxyl (-OH) group of one monomer with the 5' phosphate group of another, resulting in the creation of a robust covalent bond.

[0093] While all building blocks indicated are known and well defined, the structure of a selected non-limiting set of phosphoramidite monomer building blocks useful according to the invention is illustrated below.

[0094] Table 1 Building block L embodiments: Phosphoramidite monomers (phosphodiester bonds not shown) Building Formula block / Co de Spacer C3 [SpC3] Spacer 9 [Sp9]Spacer C12[SpC12]Spacer 18 [Sp18] Spermine [Spm] 5-Ethynyl- dU TIPS (5EdU) Cholester ol TEG [CholTEG] Biotin TEG [Bio-TEG] GalNAc [GalNAc]3' GalNaC trivalent (1+1+1) version 1 3' GalNaC trivalent (1+1+1) version 2 [[3xGalNA c]*(Trebler )]

[0095] Table 2: Building blocks C embodiments: Phosphoramidite monomersPuromycin Biotin-dT 2’OC16-U L-DNA LNA 2’Ome 2’MOE 2’FMorpholino Base= A / U / G / C / T / 5MeC / 5MeU / M6A / Ψ

[0096] SYNTHETIC CAP STRUCTURE

[0097] In some embodiments, the synthetic cap structure is a chemically-stabilizing element chain according to formula Q: formula Q, wherein P denotes a DNA polynucleotide of length 1 to 20 nt, m, n denote independently from each other an integer between 0 and 10, q denotes 0 or 1, L1 and L2 are phosphoramidite monomers independently selected from the group of SpC3, Sp9, SpC12, Sp18, Spermine, 1-Ethynyl-dSpacer, CholTEG, L-DNA, Bio-TEG linkers, Trebler, and GalNAc, L1 and L2 are different from each other, C is a phosphoramidite monomer selected from the group of puromycin, biotin-dT, 2’OC16-U, L-DNA, LNA, 2’Ome, 2’MOE, 2’F, and Morpholino, and wherein the 5’ end of the polynucleotide M is linked to the 3’ end of the chemically-stabilizing element chain according to formula Q.

[0098] In some embodiments, at least one chemically-stabilizing element of the chemically- stabilizing element chain according to formula Q is linked by a phosphorothioate linkage.

[0099] In some embodiments, q is 0, n is 1, and L2 is a phosphoramidite monomer selected from the group of SpC3, Sp9, SpC12, and Sp18.

[0100] In some embodiments, L1 is L-DNA, preferably L-dA, m is an integer between 1 to 5, and the 3’ terminal L1 element is linked to the 5’ terminus of the DNA polynucleotide P by a phosphorothioate linkage

[0101] In a preferred embodiment, the synthetic cap structure is selected from a chemically-stabilizing element chain according to formula C1-C6: ID Formula from 5’ to 3’C1 [Sp9] G* C2 [Sp9] G* G* G* C3 [Sp9] [L-dA]* C4 [Sp9] [L-dA* L-dA* L-dA* L-dA]* C5 [Biotin] G* G* G* C6 [[3xGalNAc]* (Trebler)]* G*

[0102] In some embodiments, the synthetic cap structure comprises or consists of a sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more sequence identity with a sequence selected from C1-C6, or any range or value derivable therein. In some embodiments, the synthetic cap structure comprises or consists of a sequence selected from C1-C6.

[0103] SYNTHETIC 3’ TERMINUS

[0104] In some embodiments, the synthetic 3’ terminus is a chemically-stabilizing element chain according to formula W:formula W, wherein P denotes a polynucleotide P1, preferably of length 4 to 100 nt, T denotes a DNA triplet, m, n denote independently from each other an integer between 0 and 10, p, q denotes independently from each 0 or 1, L1 and L2 are phosphoramidite monomers independently selected from the group of SpC3, Sp9, SpC12, Sp18, Spermine, 1-Ethynyl-dSpacer, CholTEG, L-DNA, Trebler, Bio-TEG linkers, and GalNAc, L1 and L2 are different from each other, C is a phosphoramidite monomer selected from the group of puromycin, biotin-dT, 2’OC16-U, L-DNA, LNA, 2’Ome, 2’MOE, 2’F, Morpholino, and wherein the 3’ end of the polynucleotide M is linked to the 5’ end of the chemically-stabilizing element chain according to formula W

[0105] In a preferred embodiment, the synthetic 3’ terminus according to the invention is devoid of non-modified natural RNA nucleotides.

[0106] In some embodiments, at least one chemically-stabilizing element of the chemically- stabilizing element chain according to formula W is linked by a phosphorothioate linkage.

[0107] In some embodiments, L1 and L2 are phosphoramidite monomers independently selected from the group of SpC3, Sp9, SpC12, Sp18.

[0108] POLYNUCLEOTIDE P1

[0109] In some embodiments the polynucleotide P1 of the synthetic 3’ terminus according to the invention is of length between about 4 nt and about 1000 nt, preferably between 4 nt and 500 nt, preferably between 4 nt and 400 nt, preferably between 4 nt and 300 nt, preferably between 4 nt and 200 nt, preferably between 4 nt and 100 nt, more preferably between about 4 nt and about 60 nt, more preferably between about 4 nt and about 50 nt, more preferably between about 4 nt and about 40 nt, more preferably between about 10 nt and about 40 nt, more preferably between about 20 nt and about 60 nt, and preferably between about 25 nt and about 35 nt.

[0110] In some embodiments the at least one polynucleotide P1 of the synthetic 3’ terminus according to the invention comprises at least one DNA nucleotide, modified RNA, DNA or XNA nucleotide, non-natural backbone modification, modified nucleotide, modified backbone linkage, or any combination thereof.

[0111] In some embodiments the at least one polynucleotide P1 of the invention comprises at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%, preferably at least 95%, or most preferably 100% modified and / or unmodified DNA nucleotides.

[0112] The selection of nucleobases determining the sequence of said polynucleotide P1 can significantly influence the properties of the artificial mRNA construct according to the invention. Surprisingly, it has been found that higher proportions of dA nucleotides within the polynucleotide P1 can further increase stability and efficiency. Accordingly, in some embodiments, said modified and / or unmodified DNA nucleotides are at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90% modified and / or unmodified dA nucleotides. In some embodiments, said modified and / or unmodified DNA nucleotides are 100% dA.

[0113] The incorporation of modified nucleotides into the at least one polynucleotide P1 may increase translational efficiency and stability even further. Accordingly, in some embodiments said modified DNA nucleotides are selected from the group of modifications to the ribose, modifications to the phosphate backbone, modifications to the nucleobases, or any combination thereof. In some embodiments, said modifications to the ribose are selected from the group of L-ribose, 2’-F, and 2’-O-methyl. In some embodiments said modifications to the phosphate backbone are selected from the group of phosphonothioate links, 3’- phosphonothiolate links, or 5’-phosphonothiolate links. In some embodiments said modifications to the nucleobases are selected from the group of N1-methyl-pseudo-uridine, pseudo-uridine, Biotin-dT, and 2,6-diaminopurine.

[0114] In some embodiments, the polynucleotide P1 comprises between about 1 to about 500, more preferably between 4 and 100, more preferably between 10 and 50, more preferably between 15 and 40, more preferably between 18 and 35, more preferably between 20 and 30, more preferably between 20 and 25, and even more preferably between 23 and 25 consecutive unmodified DNA nucleotides.

[0115] In some embodiment, said at least one polynucleotide P1 comprises, from 5’ to 3’, between 5 nt and 50 nt, preferably between 10 nt and 30 nt, more preferably between 20 nt and 25 nt, more preferably between 23 nt and 25 nt consecutive unmodified dA linked to at least one modified nucleotide linked to between 5 nt and 50 nt, preferably between 10 nt and 30 nt, more preferably between 20 nt and 25 nt, more preferably between 23 nt and 25 nt consecutive unmodified dA.

[0116] In some embodiments, the polynucleotide P1 denotes a DNA polynucleotide of length 4 to 50 nt, preferably of length 10 to 30 nt.

[0117] In a preferred embodiment, the at least one polynucleotide P1 comprises at least one Biotin-dT. In a more preferred embodiment, said at least one polynucleotide P1 comprises, from 5’ to 3’, between 5 nt and 20 nt consecutive dA linked to a Biotin-dT linked to between 5 nt and 20 nt consecutive dA.

[0118] In a preferred embodiment, the synthetic 3’ terminus is selected from a chemically- stabilizing element chain according to formula T1-T13: ID Formula from 5’ to 3’ SEQ ID NOs T1 4xdA - T2 25xdASEQ ID NO 19T3 25xdA [3xL-dA]SEQ ID NO 20T4 25xdA [3xSp9]SEQ ID NO 19T5 AAAAAAAAAAA [Bio-dT] AAAAAAAAA [3xSp9] ACCSEQ ID NO 21T6 AAAAAAAAAAA [Bio-dT] AAAAAAAAA [3xSp9] ACC [Puro]SEQ ID NO 21T7 TGGGGATCATCCCTATAGTGAGTCGTATTAG [Bio-dT] [3xSp9] SEQ ID NO 22 ACC [Puro] T8 AAAAAAAAAAAAAAAAAAAA*C*G [3xSp9] [SpC3]SEQ ID NO 23T9 GCGAAAAAAAAAAA [Bio-dT] AAAAA AAAA*C*G [3xSp9]SEQ ID NO 24T10 GCGAAAAAAAAAAAAAAAAAAAAAAAAAA [3xSp9]SEQ ID NO 25T11 GCG [Bio-dT] AAAAAA AAAAAAAAAA AAAA*C*G [3xSp9]SEQ ID NO 26T12 GCGAAAAAAA AAAAAAAAAA AAA*C*G [3xSp9]SEQ ID NO 27T13 [20xdA]* dC* dG [3xSp9]* dCSEQ ID NO 28(SEQ ID NOs refer to underlined nucleotides of T1-T13)

[0119] In some embodiments, the synthetic 3’ terminus comprises or consists of a sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more sequence identity with a sequence selected from T1-T13 or SEQ ID NO 19-30, or any range or value derivable therein. In some embodiments, the synthetic 3’ terminus comprises or consists of a sequence selected from T1-T13 or SEQ ID NO 19-29. INDUSTRIAL APPLICATION

[0120] A further aspect of the present invention relates to a method for the generation of the artificial mRNA construct of the present invention comprising or consisting of the following steps: (i) providing a synthetic cap structure and a polynucleotide M according to the invention, (ii) linking said synthetic cap structure to the 5’ end of the polynucleotide M, and (iii) optionally linking the 3’ end of the polynucleotide M to the synthetic 3’ terminus of the invention.

[0121] While conventional therapeutical mRNAs such as used in mRNA vaccines are produced by IVT in combination with various enzymatic steps such as polyadenylation and enzymatic capping, the relatively short artificial mRNA construct according to the invention may be assembled by chemical synthesis and / or using building blocks of preassembled molecules.

[0122] The artificial mRNA construct according to the invention may be obtained using known methods in the art. For instance, the polynucleotide M according to the invention may be fully or partially in vitro transcribed. However, preferably, the artificial mRNA construct is assembled by chemical synthesis of the polynucleotide M and synthetic cap structure and optional synthetic 3’ terminus of the invention. Alternatively, the 5’part including the Cap can be synthesized chemically and ligated to an IVT product. Surprisingly, the generation of the artificial mRNA construct of the present invention by chemical synthesis results in a reduced number of uncapped mRNA constructs compared to enzymatic generation of mRNAs as known in the art. Therefore, the ability to integrate the synthetic cap structure and optionally, the synthetic 3’ terminus according to the invention by chemical synthesis, such as by phosphoramidite chemistry utilizing commercially available phosphoramidite building blocks, results in a significantly reduced number, or completely eliminates, the generation of uncapped or incomplete mRNA constructs thus contributing to a consistent product preferred by the pharmaceutical industry and thus reduces undesired consequences of conventional mRNA constructs generated by e.g., IVT such as immunogenicity of the generated mixture of capped and uncapped constructs.

[0123] Modified natural, e.g., N1-methylpseudouridine, and artificial nucleotides can be incorporated into the polynucleotide M of the invention to further improve stability, enhance translation, and / or reduce immunogenicity of the artificial mRNA construct according to the invention. Surprisingly, the incorporation of at least one chemical modification in the polynucleotide M according to the invention has been shown to further increase the half-life of the artificial mRNA construct according to the invention.

[0124] In particular, the combination of multiple different chemical modifications has proven to increase stability further. The unspecific incorporation of chemical modifications into mRNA by IVT does not provide the necessary structural features critical to ensure stability. However, the fully or partially chemical synthesis of the artificial mRNA construct of the invention allows the incorporation of chemical modifications at precise nucleotide positions within the polynucleotide M sequence and, additionally, allows the incorporation of multiple different chemical modifications. Therefore, in one embodiment, the polynucleotide M according to the present invention comprises at least one chemically modified nucleotide. In a preferred embodiment, the polynucleotide M comprises modifications of the ribose 2’ hydroxyl on the RNA backbone selected from the list of 2'OMe nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, locked nucleic acid (LNA) nucleotides, and mixtures thereof.

[0125] In a preferred embodiment said at least one modified nucleotide is selected from the group of pseudo-uridine, N1-methyl-pseudo-uridine, phosphothioate links, 2’-OMe, 2’-H, 2’- F, or inverted nucleotides.

[0126] The at least one first and second chemically-stabilizing element according to the invention may be partially or entirely chemically synthesized. In a preferred embodiment the at least one first and second chemically-stabilizing element is obtainable or obtained entirely by chemical synthesis.

[0127] These synthesis approaches allow the introduction of chemically modified nucleotides and / or building blocks such as monomers, or building blocks L and C according to the invention at precisely selected positions of the at least one first and second chemically- stabilizing element using established and efficient synthesis methods, which enables industrial scalability, increases yield, and reduces costs.

[0128] Linking of the polynucleotide M and at least one first and second chemically- stabilizing element according to the invention may be achieved by chemically or enzymatically linking the 3’ end of the polynucleotide M to the 5’ end and 3’ end of the at least one first and second chemically-stabilizing element respectively by methods known in the art such as the use of ligases.

[0129] CHEMICAL SYNTHESIS OF CHEMICALLY-STABILIZING ELEMENTS

[0130] The chemical synthesis of the at least one first and second chemically-stabilizing element according to the invention may be performed using approaches known in the art. For instance, the linking of nucleotides comprising the polynucleotide M may be performed usingmethods that are well-known in the art for synthesis of ribonucleic (or deoxyribonucleic) oligonucleotides. Such synthesis is, among others, described in Beaucage and Iyer, Tetrahedron 1992; 48:2223-2311; Beaucage and Iyer, Tetrahedron 1993; 49: 6123-6194 and Caruthers, et. al., Methods Enzymol.1987; 154: 287-313; the synthesis of thioates is, among others, described in Eckstein, Annu. Rev. Biochem.1985; 54: 367-402, the synthesis of RNA molecules is described in Sproat, in Humana Press 2005 edited by Herdewijn P.; Kap. 2: 17-31 and respective downstream processes are, among others, described in Pingoud et. al., in IRL Press 1989 edited by Oliver R.W.A.; Kap.7: 183-208.

[0131] Other synthetic procedures are known in the art e.g. the procedures as described in Usman et al., 1987, J. Am. Chem. Soc., 109, 7845; Scaringe et al., 1990, NAR., 18, 5433; Wincott et al., 1995, NAR.23, 2677-2684; and Wincott et al., 1997, Methods Mol. Bio., 74, 59, and these procedures may make use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end. The modified (e.g. 2'-O- methylated) nucleotides, unmodified nucleotides, linkers (e.g. Sp9), and conjugates (e.g. Puromycin or GalNAc) are incorporated as desired. It is noted that a commercially available machines can be used for synthesis. Modified nucleotides and building blocks L and C described herein are well known in the art as moieties in polynucleotides. Accordingly, methods for sequential incorporation of said building blocks and modified nucleotides at the 5’ end, 3’ end or between selected nucleotides of a polynucleotide as indicated are well known. For instance, building blocks L such as SpC3, Sp9, SpC12, Sp18, Spermine can be introduced using commercially available building blocks Spacer Phosphoramidite C3 (CAS: 110894-23-0), Spacer Phosphoramidite 9 (CAS: 146668-73-7), Spacer C12 CE Phosphoramidite (CAS: 158665-27-1), Spacer Phosphoramidite 18 (CAS: 125607-09-2), Spermine Phosphoramidite (CAS: 1969276- 82-1) respectively.

[0132] A range of studies have explored the solid phase synthesis of oligonucleotides with phosphorothioate modifications. Morvan (Tet. Lett. 49. 7149-7152, 1990) successfully synthesized a phosphorothioate oligoribonucleotide on solid support, demonstrating its enhanced resistance to enzymatic degradation and its ability to bind to complementary RNA strands. This work was further expanded by Efimov (Nucleosides, Nucleotides, and Nucleic Acids, 26, 1087–1093, 2007), who developed a method for synthesizing natural and modified oligonucleotides, including those with phosphorothioate analogues, using the phosphotriester technique. Kostov (Molecules, 24(10), 1872, 2019) built on these findings by developing a robust solid-phase protocol for synthesizing chimeric oligonucleotides with various modifications, including phosphorothioate linkages. Lastly, Eldrup (Tet. Lett. 36, 6127-6130, 1990)) introduced new dithiophosphorylating reagents for solid phase synthesis, achieving good coupling efficiencies and producing phosphorodithioate oligodeoxythymidines free from phosphorothioate contaminations. These studies collectively demonstrate the feasibility and potential of solid phase synthesis for producing oligonucleotides with phosphorothioate modifications.

[0133] A diverse array of phosphoramidite precursor monomers is employed in the solid- phase synthesis of oligonucleotides, incorporating various 2’ protecting groups as recognized in the field. Each monomer may possess a phosphoramidite group protecting at 3’, while the 5'-hydroxyl is equipped with either DMTr, Lev, or Fmoc protecting groups.

[0134] In specific embodiments, the building blocks or chemically-stabilizing elements are incorporated into the artificial mRNA construct according to the invention by utilizing phosphoramidite precursor monomers such as compounds listed in table 3, encompassing formulas A to L.

[0135] Table 3 ID Name Formula A dT-CE Phosphoramidite (98796-51-1) BdA-CE Phosphoramidite(98796-53-3) CdC-CE Phosphoramidite(102212-98-6) DdG-CE Phosphoramidite(93183-15-4)E 5-FMOC-dT 3'CE PhosphoramiditeF 5'-FMOC-dG(n-ibu)3'CE PhosphoramiditeG 5’-FMOC-dC(n-Bz)3'CE PhosphoramiditeH 5’-FMOC-dA(n-Bz)3'CE PhosphoramiditeI 5’-Levulinyl-dT3'CE PhosphoramiditeJ 5’-Levulinyl-dG(n-ibu) 3'CE Phosphoramidite K5’-Levulinyl-dC(n-Bz)3'CE Phosphoramidite L5’-Levulinyl-dA(n-Bz)3'CE Phosphoramidite

[0136] THERAPEUTIC MRNA CONSTRUCT

[0137] A further aspect of the present invention relates to a therapeutic mRNA construct comprising or consisting of the artificial mRNA construct according to the invention, wherein said at least one ORF encodes at least one therapeutic polypeptide. Surprisingly, it was found that the artificial mRNA constructs of the present invention show low or no toxicity when used in vitro or in vivo. Additionally, surprisingly, the constructs of the invention show no immunogenicity or reduced immunogenicity of the host cell or organism as compared to a corresponding reference mRNA making them ideal candidates for therapeutic uses as e.g., disclosed herein.

[0138] Accordingly, in some embodiments, the artificial mRNA construct, or the therapeutic mRNA construct according to the invention show no immunogenicity or reduced immunogenicity of a host cell or organism as compared to a corresponding reference mRNA. The expression "having reduced immunogenicity as compared to a corresponding reference mRNA " is used in the present invention to mean that, when a construct according to the invention is administered to a host cell or organism, the immunogenicity of the construct ofthe invention is reduced as compared to a reference mRNA construct administered in the same or highly similar fashion. A decrease of the immunogenicity can be confirmed by several methods as commonly known in the art such as exemplarily stated in the description and examples described herein. For instance, a host cell line such as HepG2 cells or PBMCs may be transfected with a construct of the invention or a reference mRNA and expression levels of at least one interferon gene or an interferon-stimulated gene indicative of immunogenic activation as commonly known in the art measured such as Interferon beta (IFNB1) by e.g., qRT-PCT or immunoassays such as ELISA or western blot. The decrease or reduction of immunogenicity can be determined by comparing the value measure as described above for the construct of the invention and the reference mRNA as commonly known. When a decrease of the immunogenicity is determined by the above-described method, the immunogenicity of the constructs of the present invention is decreased by 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, preferably 99% or more, or 100% as measured in the initial phase of expression, such as 1h, 2h, 3h, 4h, 5h, or 6h, or during a prolonged time, such as 12h, 24h, 48h, 72h or longer post administration of the construct

[0139] In some embodiments said therapeutical polypeptide is selected from the group of cytokines and immune system proteins such as immunologically active compounds (e.g., interleukins , colony stimulating factor (CSF) , granulocyte colony stimulating factor (G-CSF) , granulocyte-macrophage colony stimulating factor (GM- CSF) , erythropoietin, tumor necrosis factor (TNF) , interferons, integrins, addressins, selectins, homing receptors, T cell receptors, immunoglobulins, soluble major histocompatibility complex antigens, immunologically active antigens such as bacterial, parasitic, or viral antigens, allergens, autoantigens , antibodies), hormones (insulin, thyroid hormone, catecholamines, gonadotrophines , trophic hormones, prolactin, oxytocin, dopamine, bovine somatotropin, leptins and the like), growth hormones (e.g., human grown hormone), growth factors (e.g., epidermal growth factor, nerve growth factor, insulin-like growth factor and the like), growth factor receptors, enzymes (tissue plasminogen activator, streptokinase, cholesterol biosynthetic or degradative, steroidogenic enzymes, kinases, phosphodiesterases, methylases, de-methylases , dehydrogenases, cellulases, proteases, lipases, phospholipases, aromatases, cytochromes, adenylate or guanylaste cyclases, neuramidases and the like), receptors (steroid hormone receptors, peptide receptors) , binding proteins (growth hormone or growth factor binding proteins and the like) , transcription and translation factors, tumor growth suppressing proteins (e.g., proteins which inhibit angiogenesis) , structural proteins (such as collagen, fibroin, fibrinogen, elastin, tubulin, actin, and myosin) , blood proteins (thrombin, serum albumin, Factor VII, Factor VIII, insulin, Factor IX, Factor X, tissue plasminogen activator, protein C, von Willebrand factor, antithrombin III, glucocerebrosidase, erythropoietin granulocyte colony stimulating factor (GCSF) or modified Factor VIII, anticoagulants and the like. In a preferred embodiment, said therapeutical polypeptide is selected from the group of GLP-1 and insulin.

[0140] Pharmaceutical compositions

[0141] A further aspect of the present invention relates to a pharmaceutical composition comprising or consisting of the therapeutic mRNA construct of the invention. In some embodiments said pharmaceutical composition comprises one or more pharmaceutically acceptable diluents and / or excipients and / or one or more adjuvants. Non limiting examples of excipients for a pharmaceutical composition include antioxidants, suspending agents, dispersing agents, preservatives, buffering agents, tonicity agents, and surfactants.

[0142] Delivery reagents

[0143] In some embodiments said pharmaceutical composition further comprises at least one delivery reagent. Delivery reagents useful for the protection and transport of therapeutic nucleic acid constructs in subjects in need thereof may comprise carriers known in the art such as, but not limited to, liposomes, lipoplexes, copolymers, such as PLGA, and lipid nanoparticles (LNPs).

[0144] Lipid-based delivery reagents have been increasingly recognized as one of the most promising delivery systems for RNA due to their biocompatibility and their ease of large-scale production. Cationic lipids have been widely studied as synthetic materials for delivery of RNA. After mixing, nucleic acids are condensed by cationic lipids to form lipid / nucleic acid complexes known as lipoplexes. These lipid complexes can protect genetic material from the action of nucleases and to deliver it into cells by interacting with the negatively charged cell membrane. Lipoplexes can be prepared by directly mixing positively charged lipids at physiological pH with negatively charged nucleic acids. In some embodiments, the at least one deliver reagent of the pharmaceutical composition according to the invention is one or more lipids selected from cationic lipids, ionizable lipids, anionic lipids, sterols, pegylated lipids, and any combination of the foregoing. In some embodiments, the pharmaceutical composition containing a translatable compound comprises a cationic lipid, a phospholipid, cholesterol, and a pegylated lipid. In certain embodiments, a pharmaceutical composition can be substantially free of liposomes.

[0145] In further embodiments, the at least one deliver reagent of the pharmaceutical composition according to the invention is a lipid nanoparticle (LNP). In some embodiments said LNP comprises at least one regent selected from the group of cationic or ionizable lipids, an aggregation reducing agent (such as polyethylene glycol (PEG) lipid or PEG-modified lipid), a non-cationic lipid (such as a neutral lipid), and a sterol.

[0146] Precise delivery of pharmaceutical compositions according to the invention is necessary to ensure delivery to host cells useful for the translation of the therapeutic polypeptide encoded. Deliver reagents according to the present invention and the salts, solvates and physiologically functional derivatives thereof, therefore, may include monoclonal antibodies, nucleic acids or nanoparticles as individual carriers to which the synthetic mRNA constructs are coupled or enclosed allowing the delivery of the pharmaceutical composition to desired host cells. The delivery reagent can guide the delivery of the synthetic mRNA construct by engaging with known biological structures of host cells such as cell-specific receptors and surface markers.

[0147] In addition, if desired or necessary, suitable binders, lubricants and disintegrants as well as dyes can likewise be incorporated into the mixture. Suitable binders include starch, gelatin, natural sugars, such as, for example, glucose or beta-lactose, sweeteners made from maize, natural and synthetic rubber, such as, for example, acacia, tragacanth or sodium alginate, carboxymethylcellulose, polyethylene glycol, waxes, and the like. The lubricants used in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like. The disintegrants include, without being restricted thereto, starch, methylcellulose, agar, bentonite, xanthan gum and the like. The tablets are formulated by, for example, preparing a powder mixture, granulating or dry- pressing the mixture, adding a lubricant and a disintegrant and pressing the entire mixture to give tablets. A powder mixture is prepared by mixing the compound comminuted in a suitable manner with a diluent or a base, as described above, and optionally with a binder, such as, for example, carboxymethylcellulose, an alginate, gelatin or polyvinylpyrrolidone, a dissolution retardant, such as, for example, paraffin, an absorption accelerator, such as, for example, a quaternary salt, and / or an absorbent, such as, for example, bentonite, kaolin or dicalcium phosphate. The powder mixture can be granulated by wetting it with a binder, such as, for example, syrup, starch paste, acacia mucilage or solutions of cellulose or polymer materials and pressing it through a sieve. As an alternative to granulation, the powder mixture can be run through a tableting machine, giving lumps of non-uniform shape, which are broken up to form granules. The granules can be lubricated by addition of stearic acid, a stearate salt, talc or mineral oil to prevent sticking to the tablet casting molds. The lubricated mixture is then pressed to give tablets. The compounds according to the invention can also be combined with a free-flowing inert excipient and then pressed directly to give tablets without carrying out the granulation or dry-pressing steps. A transparent or opaque protective layer consisting of a shellac sealing layer, a layer of sugar or polymer material and a gloss layer of wax may be present. Dyes can be added to these coatings to be able to differentiate between different dosage units.

[0148] Oral liquids, such as, for example, solution, syrups, and elixirs, can be prepared in the form of dosage units so that a given quantity comprises a pre- specified amount of the compound. Syrups can be prepared by dissolving the compound in an aqueous solution with a suitable flavor, while elixirs are prepared using a non-toxic alcoholic vehicle. Suspensions can be formulated by dispersion of the compound in a non-toxic vehicle. Solubilizers and emulsifiers, such as, for example, ethoxylated isostearyl alcohols and polyoxyethylene sorbitol ethers, preservatives, flavor additives, such as, for example, peppermint oil or natural sweeteners or saccharin, or other artificial sweeteners and the like, can likewise be added. The dosage unit formulations for oral administration can, if desired, be encapsulated in microcapsules. The formulation can also be prepared in such a way that the release is extended or retarded, such as, for example, by coating or embedding of particulate material in polymers, wax and the like.

[0149] All acid and base salts of the compounds described herein are intended to be included within the scope of this invention. A compound may exist in an unsolvated or solvated form,including hydrated forms. In general, the solvated forms, with pharmaceutically acceptable solvents such as water, ethanol, and the like, are equivalent to the unsolvated forms for the purposes of this disclosure. Compounds, salts, and solvates thereof, may exist in a tautomeric form, for example, as an amide or imino ether. All tautomeric forms are included in this invention.

[0150] ADMINISTRATION

[0151] Administering a therapeutically effective amount of the pharmaceutical composition according to the invention can be achieved by any means known in the art such as intravenously, subcutaneously, intraperitoneally, orally, or through inhalation.

[0152] A pharmaceutical composition according to the invention can be capable of local or systemic administration. In some aspects, a pharmaceutical composition can be capable of any modality of administration. In certain aspects, the administration can be by any route, including intravenous, subcutaneous, pulmonary, intramuscular, intraperitoneal, dermal, oral, inhalation or nasal administration.

[0153] In some embodiment according to the present invention, the pharmaceutical composition can be administered alone or in combination with an additional co-agent such as pharmaceutically active compounds or, useful in the treatment and / or prevention of diabetes mellitus and / or obesity.

[0154] In some embodiment the co-agent is administered in a prophylaxis-effective amount or a treatment-effective amount.

[0155] Pharmaceutical compositions can be adapted for administration via any desired suitable method, for example by oral (including buccal or sublingual), rectal, nasal, topical (including buccal, sublingual or transdermal), vaginal or parenteral (including subcutaneous, intramuscular, intravenous or intradermal) methods. Such formulations can be prepared using all processes known in the pharmaceutical art by, for example, combining the active ingredient with the excipient(s) or adjuvant(s).

[0156] In some embodiments, the administration according to the method of the present invention takes place oral, including buccal or sublingual, rectal, nasal, topical, including buccal, sublingual or transdermal, vaginal or parenteral, including subcutaneous, intramuscular, intravenous or intradermal.

[0157] Pharmaceutical compositions adapted for oral administration can be administered as separate units, such as, for example, capsules or tablets; powders or granules; solutions or suspensions in aqueous or non-aqueous liquids; edible foams or foam foods; or oil-in-water liquid emulsions or water-in-oil liquid emulsions.

[0158] Thus, for example, in the case of oral administration in the form of a tablet or capsule, the active-ingredient component can be combined with an oral, non-toxic and pharmaceutically acceptable inert excipient, such as, for example, ethanol, glycerol, water and the like. Powders are prepared by comminuting the compound to a suitable fine size andmixing it with a pharmaceutical excipient comminuted in a similar manner, such as, for example, an edible carbohydrate, such as, for example, starch or mannitol. A flavor, preservative, dispersant and dye may likewise be present.

[0159] Capsules are produced by preparing a powder mixture as described above and filling shaped gelatin shells therewith. Glidants and lubricants, such as, for example, highly disperse silicic acid, talc, magnesium stearate, calcium stearate or polyethylene glycol in solid form, can be added to the powder mixture before the filling operation. A disintegrant or solubilizer, such as, for example, agar-agar, calcium carbonate or sodium carbonate, may likewise be added in order to improve the availability of the medicament after the capsule has been taken.

[0160] Pharmaceutical compositions adapted for transdermal administration can be administered as independent plasters for extended, close contact with the epidermis of the recipient. Thus, for example, the active ingredient can be delivered from the plaster by iontophoresis, as described in general terms in Pharmaceutical Research, 3(6), 318 (1986). Pharmaceutical compounds adapted for topical administration can be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols or oils.

[0161] For the treatment of the eye or other external tissue, for example mouth and skin, the formulations are preferably applied as topical ointment or cream. In the case of formulation to give an ointment, the active ingredient can be employed either with a paraffinic or a water- miscible cream base. Alternatively, the active ingredient can be formulated to give a cream with an oil-in-water cream base or a water-in-oil base.

[0162] Pharmaceutical compositions adapted for topical application to the eye include eye drops, in which the active ingredient is dissolved or suspended in a suitable carrier, in particular an aqueous solvent.

[0163] Pharmaceutical compositions adapted for topical application in the mouth encompass lozenges, pastilles and mouthwashes.

[0164] Pharmaceutical compositions adapted for rectal administration can be administered in the form of suppositories or enemas.

[0165] Pharmaceutical compositions adapted for nasal administration in which the carrier substance is a solid comprise a coarse powder having a particle size, for example, in the range 20-500 microns, which is administered in the manner in which snuff is taken, i.e. by rapid inhalation via the nasal passages from a container containing the powder held close to the nose. Suitable formulations for administration as nasal spray or nose drops with a liquid as carrier substance encompass active-ingredient solutions in water or oil. Pharmaceutical formulations adapted for administration by inhalation encompass finely particulate dusts or mists, which can be generated by various types of pressurized dispensers with aerosols, nebulizers or insufflators.

[0166] Pharmaceutical compositions adapted for vaginal administration can be administered as pessaries, tampons, creams, gels, pastes, foams or spray formulations.

[0167] Pharmaceutical compositions adapted for parenteral administration include aqueous and non-aqueous sterile injection solutions comprising antioxidants, buffers, bacteriostatics and solutes, by means of which the formulation is rendered isotonic with the blood of the recipient to be treated; and aqueous and non-aqueous sterile suspensions, which may comprise suspension media and thickeners. The formulations can be administered in single- dose or multidose containers, for example sealed ampoules and vials, and stored in freeze- dried (lyophilized) state, so that only the addition of the sterile carrier liquid, for example water for injection purposes, immediately before use is necessary. Injection solutions and suspensions prepared in accordance with the recipe can be prepared from sterile powders, granules and tablets.

[0168] It goes without saying that, in addition to the above particularly mentioned constituents, the compositions may also comprise other agents usual in the art with respect to the particular type of formulation; thus, for example, formulations which are suitable for oral administration may comprise flavors.

[0169] MEDICAL USE

[0170] The artificial mRNA constructs, therapeutic mRNA constructs, and pharmaceutical compositions according to the present invention are ideal tools to produce therapeutic polypeptides within host cells able to exert biological functions in target cells, tissues, and environments and can be used alone or further modified to form pharmaceutical compositions useful for the treatment of diseases. Therefore, the present invention further relates to the artificial mRNA constructs, therapeutic mRNA constructs, and pharmaceutical compositions according to the present invention for use as a medicament.

[0171] The disclosure further provides a method to protect a subject from an indication selected from the group consisting of infectious disease, diabetes and obesity. Said method comprises: a) providing a pharmaceutical composition according to the invention and b) administering to a host cell of a subject said pharmaceutical composition, wherein administration of said composition protects the subject from an indication selected from the group consisting of infectious disease, diabetes and obesity.

[0172] In one embodiment said method protects a subject from Type II diabetes. In another embodiment said method protects a subject from Type I diabetes. In another embodiment said method protects a subject from gestational diabetes. In another embodiment said method protects a subject from maturity onset diabetes of the young (MODY). In another embodiment said method protects a subject from obesity. In another embodiment, the said method protects a subject from a monogenic form of obesity or diabetes (e.g., Type 2 diabetes). In another embodiment said method protects a subject from a polygenic form of obesity or diabetes (e.g., Type 2 diabetes).

[0173] As used herein, a subject is any animal that is susceptible disease. Subjects include humans and other mammals, such as cats, dogs, horses, other companion animals, other zoo animals, lab animals (e.g., mice, rats), and livestock.

[0174] A host cell according to the present invention refers to any cell capable of producing mRNA-encoded polypeptides and optionally secreting said polypeptide either to an epithelial surface or directly to the bloodstream.

[0175] In some embodiments, said host cell is selected from the list of exocrine cells and endocrine cells. In some embodiments said host cell is selected from the group of Brunner's gland cell in duodenum, Insulated goblet cell of respiratory and digestive tracts, Foveolar cell, Chief cell, Parietal cell, Pancreatic acinar cell, Paneth cell of small intestine, Type II pneumocyte of lung, Club cell of lung, Type I pneumocyte, Gall bladder epithelial cell, Centroacinar cell, Intercalated duct cell, Intestinal brush border cell, K cell, L cell, I cell, G cell, Enterochromaffin cell, Enterochromaffin-like cell, N cell, S cell, D cell, Mo cell, Thyroid gland cells, Thyroid epithelial cell, Parafollicular cell, Parathyroid gland cells, Parathyroid chief cell, Oxyphil cell, Pancreatic islets, Alpha cell, Beta cell, Delta cell, Epsilon cell, PP cell, Salivary gland mucous cell, Salivary gland serous cell, Von Ebner's gland cell in tongue, Mammary gland cell, Lacrimal gland cell, Ceruminous gland cell in ear, Eccrine sweat gland dark cell, Eccrine sweat gland clear cell, Apocrine sweat gland cell, Gland of Moll cell in eyelid, Sebaceous gland cell, Bowman's gland cell in nose, Hormone-secreting cells, Anterior / Intermediate pituitary cells, Corticotropes, Gonadotropes, Lactotropes, Melanotropes, Somatotropes, Thyrotropes, Magnocellular neurosecretory cells, Parvocellular neurosecretory cells, Chromaffin cells, Epithelial cells, Keratinocyte, Epidermal basal cell, Melanocyte, Trichocyte, Medullary hair shaft cell, Cortical hair shaft cell, Cuticular hair shaft cell, Huxley's layer hair root sheath cell, Henle's layer hair root sheath cell, Outer root sheath hair cell, Surface epithelial cell of cornea, tongue, mouth, nasal cavity, distal anal canal, distal urethra, and distal vagina, basal cell (stem cell) of cornea, tongue, mouth, nasal cavity, distal anal canal, distal urethra, and distal vagina, Intercalated duct cell, Striated duct cell, Lactiferous duct cell, Ameloblast, Oral cells, Odontoblast, Cementoblast,

[0176] Salivary glands are recognized as a useful depot organ in gene therapy, having several important features of other endocrine glands, such as high protein production and ability to secrete proteins into the bloodstream (see, for example, Voutetakis et al., 2005, J Endocrinol 185, 363-372). It has been previously reported that salivary glands are able to produce pharmacological levels of growth hormone and parathyroid hormone following transduction with recombinant viral vectors (see, for example, He et al., 1998, Gene Ther 5, 537-541; Adriaansen et al., 2011, Hum Gene Ther 22, 84-92). Therefore, in a preferred embodiment, the host cell according to the method of the invention is a salivary gland cell.

[0177] The invention encompasses the administration of therapeutic mRNA constructs according to the invention or of a pharmaceutical composition thereof, wherein said construct or the pharmaceutical composition thereof is administered to an individual prior to, simultaneously or sequentially with other therapeutic regimens or co-agents useful in the treatment of diabetes and / or obesity, in an effective amount. Compounds according to thepresent invention or the pharmaceutical formulations thereof that are administered simultaneously with said co-agents can be administered in the same or different composition(s) and by the same or different route(s) of administration.

[0178] DOSAGE

[0179] A therapeutically effective amount of therapeutic polynucleotide construct according to the present invention depends on several factors, including, for example, the age and weight of the subjects such as animals and humans, the precise condition that requires treatment, and its severity, the nature of the formulation and the method of administration, and is ultimately determined by the treating doctor or vet. However, a therapeutically effective dose of an active agent, e.g., a therapeutic polynucleotide construct or pharmaceutical composition according to the invention, in vivo can be a dose of about 0.001 to about 500 mg / kg body weight. For instance, the therapeutically effective dose may be about 0.001-0.01 mg / kg body weight, or 0.01-0.1 mg / kg, or 0.1-1 mg / kg, or 1-10 mg / kg, or 10-100 mg / kg. In some embodiments, a therapeutic polynucleotide construct or pharmaceutical composition according to the invention can be provided at a dose ranging from about 0.1 to about 10 mg / kg body weight, e.g., from about 0.5 to about 5 mg / kg, from about 1 to about 4.5 mg / kg, or from about 2 to about 4 mg / kg.

[0180] A therapeutically effective dose of an active agent, e.g., a therapeutic polynucleotide construct or pharmaceutical composition according to the invention, in vivo can be a dose of at least about 0.001 mg / kg body weight, or at least about 0.01 mg / kg, or at least about 0.1 mg / kg, or at least about 1 mg / kg, or at least about 2 mg / kg, or at least about 3 mg / kg, or at least about 4 mg / kg, or at least about 5 mg / kg, at least about 10 mg / kg, at least about 20 mg / kg, at least about 50 mg / kg, or more. In some embodiments, a synthetic mRNA construct or pharmaceutical composition according to the invention can be provided at a dose of about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 1.5 mg / kg, about 2 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 3.5 mg / kg, about 4 mg / kg, about 5 mg / kg, or about 6, 7, 8, 9, 10, 15, 20, 25, 50, 75, or 100 mg / kg.

[0181] FURTHER USES

[0182] Furthermore, the artificial mRNA constructs according to the invention can be transfected into cells to enhance protein expression. The expressed polypeptide exhibits improved stability and translatability compared to constructs having a conventional / natural 5'CAP and / or poly(A) tail. Accordingly, a further aspect of the invention relates to method for enhancing protein expression, comprising transfecting cells with the artificial mRNA construct of the invention, wherein the expressed polypeptide exhibits improved stability and translatability compared to constructs having a canonical 5’CAP. Further disclosed is the use of the artificial mRNA construct for the transfection of a host cell.

[0183] Additionally, the artificial mRNA constructs according to the invention can be administered as a vaccine to induce an immune response. The chemical stabilizing elements enhance the stability of the construct, thereby improving its efficacy as a vaccine. A furtheraspect of the invention, therefore, relates to a method for inducing an immune response, comprising administering the artificial mRNA construct of the invention as a vaccine, wherein the at least one ORF comprising the polynucleotide M encodes a vaccine antigen and the chemical stabilizing elements enhance the stability of the construct. Further disclosed is the use of the artificial mRNA construct of the invention as a vaccine.

[0184] Moreover, the artificial mRNA construct of the invention can be employed in gene therapy by delivering an encoding polynucleotide to target cells. The chemical stabilizing elements facilitate efficient delivery, stability, and expression of the construct for effective gene therapy treatment. Accordingly, a further aspect of the invention relates to a method for gene therapy, comprising delivering the artificial mRNA construct of the invention to target cells, wherein the chemical stabilizing elements facilitate efficient delivery, stability, and expression of the construct. Further disclosed is the use of the artificial mRNA construct for gene therapy.

[0185] KITS

[0186] The artificial mRNA constructs, the therapeutic mRNA constructs, and the pharmaceutical compositions and ingredients of said pharmaceutical compositions may also be manufactured and traded separately of each other. Thus, the invention relates further to a kit or kit of parts comprising the artificial mRNA construct, the therapeutic mRNA construct, and / or the pharmaceutical composition according to the invention. Preferably, such kit or kits of parts may, additionally, comprise instructions for use, cells for transfection, an adjuvant, a means for administration of the pharmaceutical composition, a pharmaceutically acceptable carrier and / or a pharmaceutically acceptable solution for dissolution or dilution of the artificial nucleic acid molecule, the vector, the cells, or the pharmaceutical composition.BRIEF DESCRIPTION OF THE FIGURES

[0187] Figure 1 shows in A from top to bottom: a schematic structure of the artificial mRNA construct of the invention, schematic structure of the artificial mRNA construct of the invention optionally comprising 5’UTR, schematic structure of the artificial mRNA construct of the invention optionally comprising 3’UTR, schematic structure of the artificial mRNA construct of the invention optionally comprising 5’UTR and 3’UTR. B shows an artificial mRNA construct according to the invention (xRNA) encoding HiBiT luciferase reporter, with stabilizing elements on both 5’ and 3’ UTRs and replacing the cap and the Poly(A) tail (Construct ID SEQ01: [Sp9]rG[ps]rGrGrGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrUrUr CrArArGrArArGrArUrUrArGrCdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdA[ps]dC[p s]dG[Sp9][Sp9][Sp9][C3], underlined SEQ ID NO 01, [C9] as shown in figure 1 B refers to Spacer 9: [Sp9]). C shows xRNA expression in A549 and HepG2 cells. Ctrl = HiBiT mRNA with Cap1 (Construct ID SEQ02: [m7GPPP][mG]rGrGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrUrU rCrArArGrArArGrArUrUrArGrCrUrArArArArArArArArArArArArArArArArArArArArArArCrG, underlined SEQ ID NO 02); xCap = HiBiT xRNA with xCap (Construct ID SEQ01).

[0188] Figure 2 shows HepG2 cell viability observed under a light microscope 6 hours (top panel) and 24 hours (bottom panel) post transfection with the mRNA ctrl (SEQ ID NO 02) or xCap (SEQ ID NO 01) described in example 1.

[0189] Figure 3 shows interferon activation in HepG2 cells, following transfection with mRNA-Cap1 (Construct ID SEQ02) and xRNA-xCap (Construct ID SEQ01, labelled as xCap in the figure) as described in example 1. p(I:C) denotes Polyinosinic:polycytidylic acid and serves as a positive control for interferon activation.

[0190] Figure 4 shows HiBiT luminescence measurements from A549 cells pre-transfected with Cap1-mRNA (SEQ02, labelled as IVT CAP1), xCap xRNA (SEQ01) and xCap mRNA (Construct ID SEQ03: [Sp9]rG[ps]rGrGrGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrUrUr CrArArGrArArGrArUrUrArGrCrUrArArArArArArArArArArArArArArArArArArArArArA, underlined SEQ ID NO 03). Constructs are described in Example 2.

[0191] Figure 5 shows schematic representation of the xCap versions tested. Original / xCap- xRNA v1 refers to Construct ID SEQ01 ([Sp9]rG[ps]rGrGrGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrUrUr CrArArGrArArGrArUrUrArGrCdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdA[ps]dC[p [Sp9][Sp9][C3], underlined). Shown in figure is [Sp9]rG[ps]rGrGrGrArGrArGrCrCrArCrC, underlined SEQ ID NO 29. extra PS: Construct ID SEQ04: [Sp9]rG[ps]rG[ps]rG[ps]rGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUr GrUrUrCrArArGrArArGrArUrUrArGrCrUrArAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdA[ps]dC[ps]dG[Sp9][Sp9][Sp9][C3], underlined SEQ ID NO 04. Shown in Figure is [Sp9]rG[ps]rG[ps]rG[ps]rGrArGrArGrCrCrArCrC, underlined SEQ ID NO 30. 1xL-DNA: Construct ID SEQ05: [Sp9][LdA][ps]rGrGrGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrUr UrCrArArGrArArGrArUrUrArGrCrUrArAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAd A[ps]dC[ps]dG[Sp9][Sp9][Sp9][ps]dC, underlined SEQ ID NO 05. Shown in Figure is [Sp9][LdA][ps]rGrGrGrArGrArGrCrCrArCrC, underlined SEQ ID NO 31. xCap-TISU: Construct ID SEQ06 [Sp9]rG[ps]rGrCrArArGrArUrGrGrCrGrGrCrArGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrUrUrCr ArArGrArArGrArUrUrArGrCrUrArAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdA[ps] dC[ps]dG[Sp9][Sp9][Sp9][ps]dC, underlined SEQ ID NO 06. Shown in Figure is [Sp9]rG[ps]rGrCrArArG. 3xL-DNA: Construct ID SEQ07 [Sp9][LdA][ps][LdA][ps][LdA][ps]rGrGrGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGr GrCrGrGrCrUrGrUrUrCrArArGrArArGrArUrUrArGrCdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAd AdAdAdAdA[ps]dC[ps]dG[Sp9][Sp9][Sp9][ps]dC, underlined SEQ ID NO 07. Shown in Figure is [Sp9][LdA][ps][LdA][ps][LdA][ps]rGrGrGrArGrArGrCrCrArCrC, underlined SEQ ID NO 32. 5’Biotin: Construct ID SEQ08 [5Bio]rG[ps]rG[ps]rG[ps]rGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUr GrUrUrCrArArGrArArGrArUrUrArGrCdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdA[ ps]dC[ps]dG[Sp9][Sp9][Sp9][ps]dC, underlined SEQ ID NO 08. Shown in Figure is [5Bio]rG[ps]rG[ps]rG[ps]rGrArGrArGrCrCrArCrC, underlined SEQ ID NO 33. 5’GalNAc: Construct ID SEQ09 [[3xGalNAc][ps](Trebler)][ps]rG[ps]rGrGrGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUr GrGrCrGrGrCrUrGrUrUrCrArArGrArArGrArUrUrArGrCdAdAdAdAdAdAdAdAdAdAdAdAdAdAd AdAdAdAdAdA[ps]dC[ps]dG[Sp9][Sp9][Sp9][C3], underlined SEQ ID NO 01. Shown in Figure is [[3xGalNAc][ps](Trebler)][ps]rG[ps]rGrGrGrArGrArGrCrCrArCrC, underlined SEQ ID NO 34. xCap m6A: Construct ID SEQ10 [Sp9]rG[ps]rGrGrG[m6A]rGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrU rUrCrArArGrArArGrArUrUrArGrCdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdA[ps]d C[ps]dG[Sp9][Sp9][Sp9][ps]dC, underlined SEQ ID NO 10. Shown in Figure is [Sp9]rG[ps]rGrGrG[m6A]rGrArGrCrCrArCrC, underlined SEQ ID NO 35.

[0192] Figure 6 shows alternative xCaps (Construct ID SEQ 01, 02, 04, 05, 06) transfected into A549 and measured for HiBiT luminescence 6 and 24 hours post transfection (all with stop codon).

[0193] Figure 7 shows cell viability observed under a light microscope for the alternative xCaps shown in Fig 6 (Construct ID SEQ 01, 02, 04, 05, 06).

[0194] Figure 8 shows additional xCaps, without a stop codon, tested in A549 cells, 6 hours post transfection Construct ID SEQ 02, 07, 08, 09, 10).

[0195] Figure 9 shows in vitro data for high expression of HiBit from: xCapV2: Construct ID SEQ11: [Sp9][LdA][ps][LdA][ps][LdA][ps]rGrCrArArGrArUrGrGrCrGrGrCrArGrUrGrArGrCrGrGrCrUrGrGr CrGrGrCrUrGrUrUrCrArArGrArArGrArUrUrArGrCrGrGrCrArGrCrArGrCrGrGrCrGrGrCdAdAdAdA dAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdA[ps]dC[ps]dG[ps][L-dA][L-dA][L-dA], underlined SEQ ID NO 11. xCapV1-TISU: Construct ID SEQ12 (xCapv1 in the figure): [Sp9]rG[ps]rGrCrArArGrArUrGrGrCrGrGrCrArGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrUrUrCr ArArGrArArGrArUrUrArGrCrGrGrCrArGrCrArGrCrGrGrCrGrGrCdAdAdAdAdAdAdAdAdAdAdAd AdAdAdAdAdAdAdAdA[ps]dC[ps]dG[Sp9][Sp9][Sp9][C3], underlined SEQ ID NO 12. mRNA-TISU: Construct ID SEQ13 (mRNA in the figure) [m7GPPP][mG]rCrArArGrArUrGrGrCrGrGrCrArGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrUrUrC rArArGrArArGrArUrUrArGrCrGrGrCrArGrCrArGrCrGrGrCrGrGrCrUrArArArArArArArArArArArArA rArArArArArArArArA, underlined SEQ ID NO 13. over 3 timepoints: 6, 24, and 48 hours post transfection into A549 cells.

[0196] Figure 10 shows in vitro data for high expression of Construct ID SEQ 11, 12, 13 over 3 timepoints: 6, 24, and 48 hours post transfection into HepG2 cells.

[0197] Figure 11 shows in vitro viability of A549 (panel A) and HepG2 (panel B) cells at 24 hours post transfection with the indicated RNA constructs (Construct ID SEQ 11, 12, 13). Viability was assessed using CellTitre Glow (Promega).

[0198] Figure 12 shows in vitro immunogenicity in A549 cells following transfection with Construct ID SEQ 11, 12, 13, assessed via qPCR measurements of the expression of interferon beta and interferon stimulated genes: IFIT2 and CXCL10 at 6 and 24 hours post transfection with the indicated RNA. CT values were normalized to 7SK housekeeping gene. Data is presented as fold change over Mock and in log scale.

[0199] Figure 13 shows in vitro immunogenicity in HepG2 cells following transfection with Construct ID SEQ 11, 12, 13, assessed via qPCR measurements of the expression of interferon beta and interferon stimulated genes: IFIT2 and CXCL10 at 6 hours post transfection with the indicated RNA. CT values were normalized to 7SK housekeeping gene. Data is presented as fold change over positive control: Poly I:C and in log scale.

[0200] Figure 14 shows in vivo durability of xCap RNA. Four independent in vivo studies testing HiBiT expression in the liver post-administration. C57BL / 6J mice (Charles River UK, aged 8-10 weeks) were injected with 10ug of CAP1-xRNA, CAP1-xRNA or PBS. At the indicated time, three animals were culled to measure HiBiT expression in the liver. HiBiT expression was determined by the Nano-Glo® HiBiT Lytic Detection System.IVT-pU120ntpolyA: Construct ID SEQ14: [m7GPPP][mG]rGrGrArGrArGrCrCrArCrCrA[m1psiU]rGrG[m1psiU]rGrArGrCrGrGrC[m1psiU]rGr GrCrGrGrC[m1psiU]rG[m1psiU][m1psiU]rCrArArGrArArGrA[m1psiU][m1psiU]rArGrCrGrGrCrAr GrCrArGrCrGrGrCrGrGrC[m1psiU]rArArArArArArArArArArArArArArArArArArArArArArArArArAr ArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArAr ArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArArAr ArArArArArArArArArArArArArA, underlined SEQ ID NO 14 CAP1-mRNA: Construct ID SEQ15: [m7GPPP][mG]rGrGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrUrU rCrArArGrArArGrArUrUrArGrCrUrArArArArArArArArArArArArArArArArArArArArArA, underlined SEQ ID NO 15 CAP-1 xRNA: Construct ID SEQ16: [m7GPPP][mG]rGrGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrUrU rCrArArGrArArGrArUrUrArGrCrUrArAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdA[ ps]dC[ps]dG[Sp9][Sp9][Sp9][ps]dC, underlined SEQ ID NO 16 xCap-xRNA: Construct ID SEQ01

[0201] Figure 15 shows In vivo durability of xCap xRNA (SEQ01) and CAP1-xRNA (SEQ16). RNA extracted from the livers of animals was used to directly detect HiBiT RNA levels using qRT-PCR. Figure 16 shows C57BL / 6J mice (Charles River UK, aged 8-10 weeks) were injected with 10ug of the indicated sequences.6 and 24 hours post administration, animals culled and HiBiT levels were detected using the Nano-Glo® HiBiT Lytic Detection System. xCapV1 jUTR (S8_142): Construct ID SEQ18 [Sp9]rG[ps]rGrGrGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrUrUr CrArArGrArArGrArUrUrArGrCrGrGrCrArGrCrArGrCrGrGrCrGrGrCdAdAdAdAdAdAdAdAdAdAd AdAdAdAdAdAdAdAdAdA[ps]dC[ps]dG[Sp9][Sp9][Sp9][C3], underlined SEQ ID NO 18, xCapV2 TISU (S8_144): Construct ID SEQ11, xCapV1-TISU (S8_143): Construct ID SEQ12, Cap1-jUTR (S8_139): Construct ID SEQ17 [m7GPPP][mG]rGrGrArGrArGrCrCrArCrCrArUrGrGrUrGrArGrCrGrGrCrUrGrGrCrGrGrCrUrGrUrU rCrArArGrArArGrArUrUrArGrCdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdAdA[ps]dC[ ps]dG[Sp9][Sp9][Sp9][C3], underlined SEQ ID NO 17.

[0202] Figure 17 liver from the animals above was analysed for the HiBiT RNA levels at 6- and 24-hours post-administration by qRT-PCR. The results indicate a significant improvement in the RNA half-life for Construct ID SEQ11, where the level of RNA is stable over time.

[0203] Figure 18 shows as an example the incorporation of a phosphoramidite monomer, here Sp9 (Spacer 9; code according to nomenclature: [Sp9]), into a polynucleotide or an artificial mRNA construct according to the invention. Top panel shows the incorporation of Sp9internally in a polynucleotide chain, wherein Sp9 is linked to the previous (upstream)s and subsequent (downstream) nucleotide or polynucleotide (5’oligo and oligo3’ respectively) according to nomenclature by phosphodiester bonds. Middle panel shows Sp9 at the 5’ end of the polynucleotide, bottom panel shows Sp9 at the 3’ end of a polynucleotide.EXAMPLES Example 1 xCap can mediate potent translation, with no observed toxicity or immunogenicity activation.

[0204] 50,000 A549 cells or HepG2 cells were seeded in 96 multiwell plates and transfected the next day with 50ng of the following constructs using Lipofectamine MessengerMAX (Invitrogen) according to the manufacturer’s recommendations: i. Mock: non transfected control ii. Ctrl (Construct ID SEQ02): denotes for Cap1 - Kozak sequence - HiBiT ORF - 20 rA. This is an mRNA encoding for the HiBiT subunit of luciferase and containing a 5’ Cap1 structure and a 20 nucleotides long Poly(A) RNA tail. iii. xCap (Construct ID SEQ01): denotes for xCap - Kozak sequence - HiBiT ORF - non canonical end. This is a construct encoding for the HiBiT subunit of luciferase and identical in sequence to the Ctrl construct but containing 5’ xCap and 3’ non-natural stabilization building blocks instead of cap and Poly(A) RNA elements.

[0203] Following incubation of 6 hours or 24 hours in 37 degrees Celsius, 5% CO2, the cells were lysed using Nano-Glo® HiBiT Lytic Detection System (Promega) according to the manufacturer’s recommendations, and the luminescence signal was measured using a Luminometer plate reader.

[0204] Additional samples transfected with the same constructs under the same conditions were used for testing interferon activation. In this instance, cells transfected with Polyinosinic : polycytidylic acid p(I:C) served as a positive control for interferon activation. For these samples, RNA was extracted using an RNA extraction kit (Zymo Research) according to the manufacturer recommendations. cDNA was synthesised using random hexamers primers and Superscript III (Thermo Fisher Scientific) according to the manufacturer recommendations. The expression level of Interferon beta (IFNB1) as well as two interferon-stimulated genes (IFIT2, CXCL10) was assessed using a TaqMan qPCR assay (Integrated DNA Technologies IDT) according to the manufacturer recommendations and was normalised to the level of the housekeeping gene 7SK.

[0205] The xCap construct demonstrated a signal stronger by nearly two orders of magnitude in comparison to the Cap1 mRNA in both time points and both cell types, demonstrating an overall stronger level of translation (Fig 1). The cells looked healthy and proliferating throughout the experiment with no observed toxicity under a light microscope (Fig 2). Cells transfected with the xCap construct showed no sign for Interferon activation, in contrast to cells transfected with the mRNA control - which did demonstrate Interferon activation (Fig 3).Example 2 xCap may require a non-canonical 3’end

[0206] 10,000 A549 cells were seeded in 96 multiwell plates and transfected the next day with 50ng of the following constructs using Lipofectamine MessengerMAX (Invitrogen) according to the manufacturer’s recommendations: i. Mock: non transfected control ii. IVT Cap1 (Construct ID SEQ02): denotes for: Cap1 - Kozak sequence - HiBiT ORF - 20 rA. This is an IVT mRNA encoding for the HiBiT subunit of luciferase and containing a 5’ Cap1 structure and a 20 nucleotides long Poly(A) RNA tail. iii. xCap xRNA (Construct ID SEQ01): denotes for: xCap - Kozak sequence - HiBiT ORF - non canonical end. This is a chemically synthesized construct encoding for the HiBiT subunit of luciferase and identical in sequence to the Ctrl construct but containing 5’ xCap and 3’ non-natural stabilization building blocks instead of cap and Poly(A) RNA elements. iv. xCap mRNA (Construct ID SEQ03): xCap - Kozak sequence - HiBiT ORF - 20 rA. This is a chemically synthesized construct encoding for the HiBiT subunit of luciferase and identical in sequence to the IVT Cap1 construct (including 20 nucleotides long Poly(A) RNA tail), but with an xCap instead of Cap1. The xCap is identical to the xCap in the xCap xRNA, i.e.: [Spacer9]-rG* where * denotes for phosphorothioate linkage.

[0207] Following incubation of 6 hours or 24 hours in 37 degrees Celsius, 5% CO2, the cells were lysed using Nano-Glo® HiBiT Lytic Detection System (Promega) according to the manufacturer’s recommendations, and the luminescence signal was measured using a Luminometer plate reader.

[0208] The results shown in Fig 4 indicate that while xCap supports strong translation for mRNA with a non-canonical 3’end (termed xRNA here), it cannot support strong translation for mRNA with a canonical poly(A) tail. Example 3 Alternative xCap designs I

[0209] 10,000 A549 cells were seeded in 96 multiwell plates and transfected the next day with 50ng of the following constructs using Lipofectamine MessengerMAX (Invitrogen) according to the manufacturer’s recommendations. Schemes of the constructs can be seen in Fig 5. i. Mock: non transfected control ii. IVT Cap1 (Construct ID SEQ02): denotes for: Cap1 - Kozak sequence - HiBiT ORF - 20 rA. This is an IVT mRNA encoding for the HiBiT subunit of luciferase and containing a 5’ Cap1 structure and a 20 nucleotides long Poly(A) RNA tail.iii. xCap V1 (Construct ID SEQ01): denotes for: [Spacer9]-rG* - Kozak sequence - HiBiT ORF - non canonical end. This is a chemically synthesised construct encoding for the HiBiT subunit of luciferase and identical in sequence to the Ctrl construct, but containing 5’ xCap and 3’ non-natural stabilization building blocks instead of cap and Poly(A) RNA elements. iv. xCap TISU (Construct ID SEQ06): [Spacer9]-rG* - TISU UTR - HiBiT ORF - non canonical end. This is a chemically synthesised construct encoding for the HiBiT subunit of luciferase and identical in sequence to the xCap V1 construct, but with a TISU 5’UTR instead of a Kozak sequence. v. xCap 1xL-DNA (Construct ID SEQ05): denotes for: [Spacer9]-LdA* - Kozak sequence - HiBiT ORF - non canonical end. This is a chemically synthesised construct encoding for the HiBiT subunit of luciferase and identical in sequence to the xCap V1 construct, but with an L-dA (left-helical conformation of deoxyadenosine) instead of rG after the 5’ Spacer9. vi. xCap extra PS (Construct ID SEQ04): denotes for: [Spacer9]-G*G*G* - Kozak sequence - HiBiT ORF - non canonical end. This is a chemically synthesised construct encoding for the HiBiT subunit of luciferase and identical in sequence to the xCap V1 construct, but with three phosphorothioate linkages instead of one.

[0210] Following incubation of 6 hours or 24 hours in 37 degrees Celsius, 5% CO2, the cells were lysed using Nano-Glo® HiBiT Lytic Detection System (Promega) according to the manufacturer’s recommendations, and the luminescence signal was measured using a Luminometer plate reader.

[0211] The results shown in Fig 6 indicate that all new xCap design can support translation for mRNA with a non-canonical 3’end (termed xRNA), and that TISU UTR is superior to having a Kozak sequence as a 5’ UTR. No cellular toxicity was observed under the light microscope for any of these xRNA designs (Fig 7). The only toxicity observed was following transfection with the mRNA IVT control. Example 4 Alternative xCap designs II

[0212] 10,000 A549 cells were seeded in 96 multiwell plates and transfected the next day with 25ng of the following constructs using Lipofectamine MessengerMAX (Invitrogen) according to the manufacturer’s recommendations. Schemes of the constructs can be seen in Fig 5. i. Mock: non transfected control ii. Cap1 mRNA (Construct ID SEQ02): denotes for: Cap1 - Kozak sequence - HiBiT ORF - 20 rA. This is an IVT mRNA encoding for the HiBiT subunit of luciferase and containing a 5’ Cap1 structure and a 20 nucleotides long Poly(A) RNA tail. iii. 5’GalNAc (Construct ID SEQ09), 5’Biotin (Construct ID SEQ08), 5’3xL-DNA and xCap m6A (Construct ID SEQ10): These are chemically synthesised constructs encoding for the HiBiTsubunit of luciferase (without a stop codon), but containing alternative xCap designs, as shown in fig.5.

[0213] Following incubation of 6 hours in 37 degrees Celsius, 5% CO2, the cells were lysed using Nano-Glo® HiBiT Lytic Detection System (Promega) according to the manufacturer’s recommendations, and the luminescence signal was measured using a Luminometer plate reader.

[0214] The results shown in Fig 6 indicate that all new xCap design can support translation for mRNA with a non-canonical 3’end (termed xRNA). No cellular toxicity was observed under the light microscope for any of these xRNA designs (Fig 7). The only toxicity observed was following transfection with the mRNA IVT control. Example 5 Characterisation of L-DNA design (XCapV2)

[0215] Expression of HiBiT over time:

[0216] HiBiT expression was tested by time course transfection assays in A549 (EXP-327 - 5000 cells / well) and HepG2 C3A (EXP-367 - 25,000 cells / well). For both cell lines, cells were seeded 1 day prior to transfection. Oligonucleotides were transfected via Lipofectamine MessengerMax (Invitrogen), according to manufacturer’s recommendations.

[0217] Note that downstream Serine-Glycine (S / G) linker increases oligo length by ~20% - therefore for these assays, transfection doses were calculated so that ~1pmol of RNA was transfected per well, to ensure as equal a number of molecules per well as possible.

[0218] Mock refers to non-transfected control, treated with Lipofectamine MessengerMax only.

[0219] Following incubation for designated timepoints of 6hr, 24hr and 48hr at 37°C, 5% CO2, the cells were lysed using Nano-Glo® HiBiT Lytic Detection System (Promega) according to the manufacturer’s recommendations, and the luminescence signal was measured using a Luminometer plate reader.

[0220] The data in Figures 9 (A549) and 10 (HepG2 C3A) shows distinct and consistent trends in both cell lines, which are summarized as follows: i. The new XCapV2 (s8-144) (with L-DNA elements) exponentially increases HiBiT expression. Considering the use of TISU as UTR, the direct comparator for this optimized xRNA is the XCapV1 TISU (s8-143) construct. ii. Both versions of XCap show superior HiBiT expression over Cap1. iii. TISU increases HiBiT expression over jUTR - in the figures presented this is most directly compared in the mRNA controls, however, if important - we can add here an example with xRNA (ELN EXP-300).Cell viability post-transfection

[0221] Cell viability was measured with Promega’s CellTitre Glo reagent as per the manufacturer’s instructions then read on a luminometer, in A549 and HepG2 C3A cells. CellTitre Glo measures ATP activity from viable cells. These assays were performed concurrently with the HiBiT expression assays, and the transfection method used was identical.

[0222] The data in Figures 11 A (A549) and B (HepG2 C3A) demonstrates that transfecting cells with xRNA has negligible impact on cell viability 24hr post-transfection.

[0223] Immunogenicity by qPCR

[0224] Immunogenicity was measured by quantitative polymerase chain reaction (qPCR) by detection of 3 immunostimulatory genes (ISG’s): CXCL10, IFN-β and IFIT2. The aim was to observe any immunogenicity following transfection of oligos into A549 (EXP-327, 6hr and 24hr) and HepG2 C3A (EXP-340, 6hr only) cell lines. Experiments were performed as follows: i. 48-well plates were seeded 1 day prior to transfection (A549 were seeded at 20,000 cells / well, and HepG2 C3A were seeded at 200,000 cells / well) ii. Transfection was performed to ensure doses between oligos with downstream S / G linker and those without were transfected at comparable molarity. Oligos were transfected using Lipofectamine MessengerMax (Invitrogen) according to the manufacturer’s instructions. iii. Poly I:C (High MW - Invitrogen) was used as a positive control for stimulation of the immune response pathways (notably IFN pathway). Dose was deliberately higher than the oligos to ensure a positive ISG response (A549 - 200ng / well, HepG2 C3A - 300ng / well). iv. Mock (non -transfected control treated with Lipofectamine MessengerMax solution) was used as a negative control. v. Transfected assay plates were incubated for the designated time points according to each experiment at 37°C / 5% CO2. vi. Following incubation, cellular RNA was extracted using Zymo RNA miniprep kit for RNA extraction from cells or tissues - procedure was performed according to manufacturer’s instructions. vii. Complementary DNA (c-DNA) templates for use in qPCR were generated by reverse transcription from extracted cellular RNA (A549 - 120ng / reaction, HepG2 C3A - 500ng / reaction). viii. qPCR was performed using TaqMan Fast protocol and read on QuantStudio. Each ISG was multiplexed independently with 7SK housekeeping gene and normalized to it.

[0225] The data in Figures 12 (A549) and 13 (HepG2 C3A) show that the xRNA designs are not immunogenic.Example 6 In vivo validation

[0226] To validate the activity and durability of xRNA in vivo, the RNA was encapsulated in MC3 lipid nanoparticles (LNPs) Lipidlaunch LNP-MC3 Exploration kit (Cayman chemicals) according to the manufacturer recommendations using the Ignite nanoparticle formulation system. These LNP2 are known to deliver nucleic acids to the liver. LNPs were qualified based on their size and PDI (<100nm and <0.15) and free RNA in the sample (<5%).

[0227] The encapsulated RNA was administered via intravenous injection (IV), to C57BL / 6J mice (Charles River UK, aged 8-10 weeks). A group comprised of three animals was culled at the indicated time points (6 – 240 hours post administration) to collect two parts of the left medial lobe of the liver (Fig 14, 15).

[0228] In order to test HiBiT function, livers were homogenized immediately after the collection of tissues. The fresh tissue was placed in lysis buffer and the tissue was homogenized using the ‘Precellys Evolution Touch Homogenizer + Cryolys Evolution’ (at 4ºC, 6000rpm for 30 seconds on to shake with 30 seconds rest period in between homogenization). Samples were mixed at equal volumes with the Nano-Glo® HiBiT Lytic Detection reagent and analyzed using the BMG ClarioStar plate reader. The results indicate that both the Cap1 xRNA and the xCap xRNA produce a highly stable signal over time, in comparison to a Cap1 mRNA control (Figure 14). In order to test the stability of the constructs, 20-40mg of tissue was immersed in 1200µl of lysis buffer and the tissue was disrupted using the Precellys Evolution device with dry ice on top to cool the samples to 4°C (600RPM, Cycle 5x30s, 30s pause). Samples were centrifuged and the supernatant was used for RNA extraction using the Quick-RNA™ Miniprep Kit, Zymo Research. cDNA was produced using Superscript 3 according to the manufacturer recommendation (Invitrogen) using HiBiT specific primer. qPCR was done using the Taqman fast advanced master mix (thermos fisher) using HiBiT-specific probes. Expression was normalized to the housekeeping gene Gapdh.

[0229] The results indicate that both Cap1 xRNA and xCap xRNA are detectable above background for up to at least 240 and 96 hours respectively (Fig 15)Example 7 In vivo validation of V2 design

[0230] To validate the activity and durability of xRNA. V2 in vivo, the RNA was encapsulated in MC3 lipid nanoparticles (LNPs) Lipidlaunch LNP-MC3 Exploration kit (Cayman chemicals) according to the manufacturer recommendations using the Ignite nanoparticle formulation system. These LNP2 are known to deliver nucleic acids to the liver. LNPs were qualified based on their size and PDI (<100nm and <0.15) and free RNA in the sample (<5%).

[0231] The encapsulated RNA was administered via intravenous injection (IV), to C57BL / 6J mice (Charles River UK, aged 8-10 weeks). A group of three animals was culled at the indicated time points (6 – 240 hours post administration) to collect two parts of the left medial lobe of the liver (Fig 16, 17).

[0232] In order to test HiBiT function, livers were homogenized immediately after the collection of tissues. The fresh tissue was placed in lysis buffer and the tissue was homogenized using the ‘Precellys Evolution Touch Homogenizer + Cryolys Evolution’ (at 4ºC, 6000rpm for 30 seconds on to shake with 30 seconds rest period in between homogenization). Samples were mixed at equal volumes with the Nano-Glo® HiBiT Lytic Detection reagent and analyzed using the BMG ClarioStar plate reader. The results indicate that the xCap xRNA V2 design has superior activity in comparison with the xCap xRNA V1 versions (Figure 16). In order to test the stability of the constructs, 20-40mg of tissue was immersed in 1200µl of lysis buffer and the tissue was disrupted using the Precellys Evolution device with dry ice on top to cool the samples to 4°C (600RPM, Cycle 5x30s, 30s pause). Samples were centrifuged and the supernatant was used for RNA extraction using the Quick-RNA™ Miniprep Kit, Zymo Research. cDNA was produced using Superscript 3 according to the manufacturer recommendation (Invitrogen) using HiBiT specific primer. qPCR was done using the Taqman fast advanced master mix (thermos fisher) using HiBiT-specific probes. Expression was normalized to the housekeeping gene Gapdh.

[0233] The results indicate that both V1 and V2 xCap xRNAs are highly stable in vivo, and the xCap xRNA V2 has superior stability (Fig 17).

Claims

WHAT CLAIMED IS 1. An artificial mRNA construct comprising: i. a polynucleotide M comprising at least one open reading frame encoding a polypeptide; and ii. a synthetic cap structure comprising at least one chemically-stabilizing element located at the 5’end of said polynucleotide M; wherein said artificial mRNA construct is devoid of a canonical cap structure, said synthetic cap structure replaces the canonical cap and permits cap-independent translation of the at least one open reading frame.

2. The artificial mRNA construct of claim 1 further comprising: iii. a synthetic 3’ terminus comprising at least one chemically-stabilizing element located at the 3’ end of said polynucleotide M, wherein said artificial mRNA construct is devoid of a canonical poly(A) tail and said synthetic 3’ terminus replaces the canonical poly(A) tail.

3. The artificial mRNA construct of claim 1 or 2, wherein said polynucleotide M further comprises a 5’UTR operably linked to the 5’ end of the open reading frame.

4. The artificial mRNA construct of claim 1 to 3, wherein said polynucleotide M further comprises a 3’UTR operably linked to the 3’ end of the open reading frame.

5. The artificial mRNA construct of claims 1 to 4, wherein said polypeptide is a therapeutic polypeptide, a therapeutic peptide, an antibody, an enzyme, a vaccine antigen, a nucleic acid binding protein, or a diagnostic marker.

6. The artificial mRNA construct of claims 1 to 5, wherein the synthetic cap structure comprised 1 to 5, 1 to 10, 1 to 20, 1 to 30, 1 to 50 or 1 to 100 chemically-stabilizing elements.

7. The artificial mRNA construct of claims 1 to 5, wherein the synthetic cap structure comprised 2 to 10 chemically-stabilizing elements.

8. The artificial mRNA construct of claims 2 to 7, wherein the synthetic 3’ terminus comprises 1 to 5, 1 to 10, 1 to 20, 1 to 30, 1 to 50, 1-150 or 1 to 150 chemically- stabilizing elements.

9. The artificial mRNA construct of claims 2 to 7, wherein the synthetic 3’ terminus comprises 10 to 30 chemically-stabilizing elements.

10. The artificial mRNA construct of claims 1 to 9, wherein the chemically-stabilizing elements are independently selected from DNA nucleotides, non-natural nucleotides for example, L enantiomers and XNA, non-natural backbone modifications, modified nucleotides, modified nucleosides, modified backbone linkages, conjugates (forexample GalNAc, Biotin, Puromycin, Cholesterol, C16), non-RNA polymers, chemical spacers, doublers, treblers, branchers, sugars, lipids, peptides, vitamins, or any combination thereof.

11. The artificial mRNA construct of claims 1 to 10, wherein the at least one chemically- stabilizing element independently comprises a fatty acid chain with 1 to 20 carbons.

12. The artificial mRNA construct of claim 1 to 11, wherein the chemically-stabilizing elements are independently selected from phosphoramidite monomers.

13. The artificial mRNA construct of claim 12, wherein the 5’ end of the synthetic cap structure is linked by a phosphorothioate group.

14. The artificial mRNA construct of claim 12, wherein the chemically-stabilizing element at the 5’ end of the synthetic cap structure comprises a fatty acid chain.

15. The artificial mRNA construct of claim 13, wherein the fatty acid chain is Sp9.

16. The artificial mRNA construct of claims 1 to 5, wherein the synthetic cap structure is a chemically-stabilizing element chain according to formula Q:formula Q, wherein P denotes a DNA polynucleotide of length 1 to 20 nt, m, n denote independently from each other an integer between 0 and 10, q denotes 0 or 1, L1 and L2 are phosphoramidite monomers independently selected from the group of SpC3, Sp9, SpC12, Sp18, Spermine, 1-Ethynyl-dSpacer, CholTEG, L-DNA, Bio-TEG linkers, Trebler, and GalNAc, L1 and L2 are different from each other, C is a phosphoramidite monomer selected from the group of puromycin, biotin- dT, 2’OC16-U, L-DNA, LNA, 2’Ome, 2’MOE, 2’F, and Morpholino, and wherein the 5’ end of the polynucleotide M is linked to the 3’ end of the chemically- stabilizing element chain according to formula Q.

17. The artificial mRNA construct of claim 16, wherein at least one chemically-stabilizing element of the chemically-stabilizing element chain according to formula Q is linked by a phosphorothioate linkage.

18. The artificial mRNA construct of claims 16 to 17, wherein q is 0, n is 1, and L2 a phosphoramidite monomer selected from the group of SpC3, Sp9, SpC12, and Sp18.

19. The artificial mRNA construct of claims 16 to 18, wherein L1 is L-DNA, m is an integer between 1 to 5, and the 3’ terminal L1 element is linked to the 5’ terminus of the DNA polynucleotide P by a phosphorothioate linkage.

20. The artificial mRNA construct of claims 1 to 5, wherein the synthetic cap structure is selected from a chemically-stabilizing element chain according to formula C1-C6: ID Formula from 5’ to 3’ C1 [Sp9] G* C2 [Sp9] G* G* G* C3 [Sp9] [L-dA]* C4 [Sp9] [L-dA* L-dA* L-dA* L-dA]* C5 [Biotin] G* G* G* C6 [[3xGalNAc]* (Trebler)]* G* 21. The artificial mRNA construct of claim 2 to 20, wherein the synthetic 3’ terminus is a chemically-stabilizing element chain according to formula W:formula W, wherein P denotes a polynucleotide P1 of length 4 to 100 nt, T denotes a DNA triplet, m, n denote independently from each other an integer between 0 and 10, p, q denotes independently from each 0 or 1, L1 and L2 are phosphoramidite monomers independently selected from the group of SpC3, Sp9, SpC12, Sp18, Spermine, 1-Ethynyl-dSpacer, CholTEG, L-DNA, Trebler, Bio- TEG linkers, and GalNAc, L1 and L2 are different from each other, C is a phosphoramidite monomer selected from the group of puromycin, biotin-dT, 2’OC16-U, L-DNA, LNA, 2’Ome, 2’MOE, 2’F, Morpholino, and wherein the 3’ end of the polynucleotide M is linked to the 5’ end of the chemically- stabilizing element chain according to formula W.

22. The artificial mRNA construct of claim 22, wherein at least one chemically-stabilizing element of the chemically-stabilizing element chain according to formula W is linked by a phosphorothioate linkage.

23. The artificial mRNA construct of claims 22 to 23, wherein the polynucleotide P1 denotes a DNA polynucleotide of length 4 to 50 nt, preferably of length 10 to 30 nt.

24. The artificial mRNA construct of claims 22 to 23, wherein L1 and L2 are phosphoramidite monomers independently selected from the group of SpC3, Sp9, SpC12, Sp18.

25. The artificial mRNA construct of claim 22, wherein the synthetic 3’ terminus is selected from a chemically-stabilizing element chain according to formula T1-T13: ID Formula from 5’ to 3’ SEQ ID NOs T1 4xdA - T2 25xdASEQ ID NO 19T3 25xdA [3xL-dA]SEQ ID NO 20T4 25xdA [3xSp9]SEQ ID NO 19T5 AAAAAAAAAAA [Bio-dT] AAAAAAAAA [3xSp9] ACCSEQ ID NO 21T6 AAAAAAAAAAA [Bio-dT] AAAAAAAAA [3xSp9] ACC [Puro]SEQ ID NO 21T7 TGGGGATCATCCCTATAGTGAGTCGTATTAG [Bio-dT] [3xSp9] SEQ ID NO 22 ACC [Puro] T8 AAAAAAAAAAAAAAAAAAAA*C*G [3xSp9] [SpC3]SEQ ID NO 23T9 GCGAAAAAAAAAAA [Bio-dT] AAAAA AAAA*C*G [3xSp9]SEQ ID NO 24T10 GCGAAAAAAAAAAAAAAAAAAAAAAAAAA [3xSp9]SEQ ID NO 25T11 GCG [Bio-dT] AAAAAA AAAAAAAAAA AAAA*C*G [3xSp9]SEQ ID NO 26T12 GCGAAAAAAA AAAAAAAAAA AAA*C*G [3xSp9]SEQ ID NO 27T13 [20xdA]* dC* dG [3xSp9]* dCSEQ ID NO 2826. A method for the generation of the artificial mRNA construct of any of claims 1 to 25 comprising or consisting of the steps: i. providing a polynucleotide M and a synthetic cap structure, ii. linking said polynucleotide M to the synthetic cap structure, wherein the 5’ end of the polynucleotide M is linked to the synthetic cap structure, and iii. optionally linking the polynucleotide M to the synthetic 3’ terminus, wherein the 3’ end of the polynucleotide M is linked to the synthetic 3’ terminus.

27. A therapeutic mRNA construct comprising or consisting of the artificial mRNA construct of claims 1 to 25, wherein the polypeptide M encodes a therapeutic polypeptide, a therapeutic peptide, an antibody, an enzyme, a vaccine antigen, a nucleic acid binding protein, or a diagnostic marker.

28. A pharmaceutical composition comprising the therapeutic mRNA construct of claim 28.

29. The pharmaceutical composition according to claim 28, further comprising one or more pharmaceutically acceptable diluents and / or excipients and / or one or more adjuvants.

30. The artificial mRNA construct according to any of claims 1 to 25, the therapeutic mRNA construct according to claim 27, or the pharmaceutical composition according to any of claims 28 to 29 for use as a medicament.

31. The artificial mRNA construct according to any of claims 1 to 25, the therapeutic mRNA construct according to claim 27, or the pharmaceutical composition according to any of claims 28 to 29 for use as a vaccine.

32. A kit or kit of parts comprising the artificial mRNA construct according to any of claims 1 to 25, the therapeutic mRNA construct according to claim 27, or the pharmaceutical composition according to any of claims 28 to 29.

33. A method for obtaining a peptide or protein, comprising i. providing an artificial mRNA construct according to any of claims 1 to 25, and ii. translating said artificial mRNA construct.

34. Use of the artificial mRNA construct of any of claims 1 to 25 for obtaining a peptide or protein.

35. Use of the artificial mRNA construct of any of claims 1 to 25 for transfecting a host cell.

36. Use of a synthetic cap structure and optionally synthetic 3’ terminus according to any of the proceeding claims for increasing stability and / or translational efficiency of a polynucleotide molecule, preferably of an mRNA molecule.