Riboswitch-regulated expression of chimeric antigen receptors

Abstract

The present disclosure relates to riboswitches and polynucleotide cassettes for regulating the expression of a chimeric antigen receptor (CAR) in response to a small molecule ligand, wherein the polynucleotide cassettes comprise the riboswitches and aptamers disclosed herein. Further provided are methods for producing a population of T cells, where the T cells comprise a CAR transgene comprising an expression construct for the inducible expression of the CAR in response to a small molecule inducer that binds to the riboswitch aptamer that is part of the expression construct. Also provided are methods for treating cancer by administering to a patient in need thereof (i) a population of T cells comprising the inducible CAR comprising the riboswitches described herein, and (ii) a small molecule inducer (aptamer ligand) disclosed herein.

Description

REGULATABLE EXPRESSION OF CHIMERIC ANTIGEN RECEPTORS REFERENCE TO A SEQUENCE LISTING

[0001] This application contains a Sequence Listing which has been submitted electronically in xml format and is hereby incorporated by reference in its entirety. Said xml copy, created on July 31, 2024, is named SeqList-162027-53576.xml and is 830,164 bytes in size. FIELD

[0002] The present disclosure relates to riboswitches and polynucleotide cassettes for regulating the expression of a chimeric antigen receptor (CAR) in response to a small molecule ligand, wherein the polynucleotide cassettes comprise riboswitches and / or aptamers disclosed herein. Further provided are methods for producing a population of T cells comprising an expression construct for the inducible expression of the CAR in response to a small molecule inducer that binds to the riboswitch aptamer. Also provided are methods for treating cancer by administering to a patient in need thereof (i) a population of T cells comprising the inducible CAR comprising the riboswitches disclosed herein, and (ii) a small molecule inducer (aptamer ligand) disclosed herein. BACKGROUND

[0003] Chimeric antigen receptor (CAR) T cells are genetically engineered T cells that have been modified to express a receptor for the recognition of, for example, a particular surface marker expressed on the surface of cancer cells. The CAR T cells obtain supra-physiological properties and act as “living drugs” presenting both immediate and steady effects due to expression of the CAR on the T cells surface. SUMMARY

[0004] In one aspect, the present disclosure provides a composition comprising a population of immune cells (e.g., a population of T cells) capable of expressing a chimeric antigen receptor (CAR) in response to the presence of a small molecule inducer (ligand), wherein the T cells in the population of T cells comprise a polynucleotide comprising: (i) a first sequence encoding the chimeric antigen receptor, and(ii) a second sequence comprising a polynucleotide cassette encoding (a) an alternatively spliced exon flanked by a 5ʹ intron and a 3ʹ intron; and (b) a riboswitch, wherein the riboswitch comprises an aptamer linked to an effector region comprising stem-forming sequence that comprises the 5ʹ splice site sequence of the 3ʹ intron and sequence complementary to the 5ʹ splice site sequence of the 3ʹ intron; wherein the second sequence is inserted into the first sequence.

[0005] In one aspect provided is population of T cells comprising a polynucleotide construct, the polynucleotide construct comprises a sequence encoding from 5′ to 3′: (a) a first intron; (b) an alternatively-spliced exon; and (c) a second intron comprising a riboswitch, wherein the riboswitch comprises an effector region and an aptamer, wherein the riboswitch comprises from 5′ to 3′: (i) a 5′ splice site sequence of the second intron; (ii) an aptamer sequence; and (iii) a sequence that is complementary to the 5′ splice site sequence of the second intron; wherein the 5′ splice site sequence of the second intron and the sequence that is complementary to the 5′ splice site sequence of the second intron are capable of forming a stem; wherein the alternatively-spliced exon comprises a stop codon that is in-frame with a CAR gene, comprising the polynucleotide construct, when the alternatively-spliced exon is spliced into the CAR gene mRNA.

[0006] In some embodiments, the T cells in the population of T cells have one or more of the following properties: (a) greater than about 30 %, greater than about 35 %, greater than about 40 %, greater than about 45 %; or greater than about 50 % of the T cells in the population of T cells have a naïve phenotype; (b) less than about 35 %; less than about 30 %; less than about 25 %; less than about 20 %; less than about 18 %; or less than about 16 % of the T cells in the population of T cells have a differentiated phenotype; (c) less than about 35 %; less than about 30 %; less than about 25 %; less than about 20 %; less than about 18 %; or less than about 16 % of the T cells in the population of T cells are CD45RA–, and / or CD62L–; (d) less than about 35 %; less than about 30 %; less than about 25 %; less than about 20 %; less than about 18 %; or less than about 16 % of the T cells in the population of T cells(e) enhanced cytotoxicity against cancer cells expressing the CAR antigen as compared to T cells that constitutively express the CAR; (f) reduced cytokine production when exposed to cancer cells expressing the CAR antigen as compared to T cells that constitutively express the CAR; (g) enhanced capacity for expansion in response to exposure to the CAR antigen as compared to T cells that constitutively express the CAR; and / or (h) reduced levels of T cell exhaustion following exposure to the CAR antigen as compared to T cells that constitutively express the CAR.

[0007] In some embodiments, the T cells in the population of T cells have one or more of the following properties: greater than about 30 %, greater than about 35 %, greater than about 40 %, greater than about 45 %; or greater than about 50 % of the T cells in the population of T cells are CD62L+CD45RA+, CCR7+, CD127+, or CD132+, or any combination thereof.

[0008] In some embodiments, the T cells in the population of T cells have one or more of the following properties: greater than about 30 %; greater than about 35 %; greater than about 40 %; greater than about 45 %; or greater than about 50 % of the T cells in the population of T cells are CD62L+and / or CD45RA+.

[0009] In some embodiments, the T cells in the population of T cells have one or more of the following properties: greater than about 30 %, greater than about 35 %, greater than about 40 %, greater than about 45 %; or greater than about 50 % of the T cells in the population of T cells are CD62L+.

[0010] In some embodiments, the T cells in the population of T cells have one or more of the following properties: less than about 35 %; less than about 30 %; less than about 25 %; less than about 20 %; less than about 18 %; or less than about 16 % of the T cells in the population of T cells have a differentiated phenotype effector memory or effector cell type.

[0011] In some embodiments, the exhausted T cells are CD39+, PD-1+, CTLA-4+, LAG-3+, TIM-3+, 2B4 / CD244 / SLAMF4+, CD160+, or TIGIT+, or any combination thereof.

[0012] In one embodiment, the exhausted T cells are CD39+.

[0013] In some embodiments, the reduced cytokine production is production of TNFα, IL- 2, IFNγ, or combinations thereof.

[0014] In embodiments, the population of T cells obtained from a subject and engineered to express a CAR gene in response to a small molecule inducer (due to incorporation of a gene regulation cassette disclosed herein into the CAR gene) has a phenotype that is similar to the phenotype of a T cell population obtained from the same patient that have not been engineeredembodiments, the above listed properties of the T cells in the population (comprising an inducible CAR as disclosed herein) are within about 5 %, about 10 %, about 15 %, about 20 %, or about 25 % of those properties in a T cell population derived from the same patient (that have not been engineered to comprise a CAR gene). The percentage of T cells expressing cell surface markers disclosed herein can be measured by known techniques, including staining for the marker using a marker specific antibody followed by fluorescence-activated cell sorting (FACS).

[0015] In some embodiments, the polynucleotide sequence comprising the first and the second sequence is present in the T cell receptor (TCR) alpha constant chain (TRAC) locus of the T cells.

[0016] Provided is a method for making a composition comprising the T cell population described herein, the method comprising: (a) obtaining a population of T cells; (b) introducing into the T cells in the population a polynucleotide comprising: (i) a first sequence encoding the chimeric antigen receptor, and (ii) a second sequence comprising a polynucleotide cassette encoding (a) an alternatively spliced exon flanked by a 5ʹ intron and a 3ʹ intron; and (b) a riboswitch, wherein the riboswitch comprises an aptamer linked to an effector region comprising stem-forming sequence that comprises the 5ʹ splice site sequence of the 3ʹ intron and sequence complementary to the 5ʹ splice site sequence of the 3ʹ intron; wherein the second sequence is inserted into the first sequence; and (c) expanding the T cells in culture.

[0017] In one embodiment, the aptamer binds a small molecule ligand (including the small molecule ligands disclosed herein).

[0018] In embodiments, the aptamer is or comprises an aptamer sequence disclosed herein.

[0019] In some embodiments, the 5ʹ splice site sequence of the 3ʹ intron comprises GTGAGT, GTAAGC, GTAAGT, GTGTGG, or GTANGT, wherein and N represents A, G, C, or T.

[0020] In some embodiments, the 5ʹ splice site sequence of the 3ʹ intron comprises GTAAGT, GTGAGT, or GTAATG.

[0021] In one embodiment, the 5ʹ splice site sequence of the 3ʹ intron comprises GTAATG.

[0022] In some embodiments, the alternatively-spliced exon (a) is derived from exon 2 of the human dihydrofolate reductase gene, human Wilms tumor 1 exon 5, mousecalcium / calmodulin-dependent protein kinase II delta exon 16, or SIRT1 exon 6; or (b) is synthetic.

[0023] In one embodiment, the alternatively-spliced exon is the modified exon 2 from human DHFR.

[0024] In some embodiments, the alternatively-spliced exon comprises SEQ ID NO: 590 or 591.

[0025] In some embodiments, the alternatively-spliced exon has been modified by one or more of the group consisting of altering the sequence of an exon splice enhancer, altering the sequence of exon splice silencer, adding an exon splice enhancer, and adding an exon splice silencer.

[0026] In one embodiment, the alternative exon contains a stop codon is in frame with the CAR gene. In embodiments, the alternative exon comprises, in addition to a stop codon, or as an alternative to a stop codon, another sequence that reduces or substantially prevents translation when the alternative exon is incorporated by splicing into the CAR gene mRNA including, e.g., a microRNA binding site, which leads to degradation of the mRNA.

[0027] In one embodiment, the 5ʹ intron comprises a stop codon in frame with the target gene.

[0028] In some embodiments, the 5ʹ and 3ʹ introns (a) are derived from an endogenous intron from the target gene, (b) are exogenous to the target gene, (c) are derived from intron 2 of the human β-globin gene.

[0029] In one embodiment, the 5ʹ and 3ʹ introns are each independently from about 50 to about 300 nucleotides in length.

[0030] In one embodiment, the 5ʹ and 3ʹ introns are each independently from about 125 to about 240 nucleotides in length.

[0031] In one embodiment, the stem-forming sequence is 6 to 13 base pairs in length.

[0032] In one embodiment, the stem-forming sequence is 7 to 12 base pairs in length.

[0033] In one embodiment, the stem-forming sequence is 8 to 11 base pairs in length. In one embodiment, the stem-forming sequence is 7 to 12 base pairs in length.

[0034] In one embodiment in a method provided herein, the step of expanding the T cells in culture occurs in absence of the small molecule ligand.

[0035] Provided is a method for treating cancer by administering to a subject in need thereof (i) a composition comprising a population of T cells as disclosed herein; and (ii) a composition comprising a small molecule ligand that binds the aptamer.

[0036] In one embodiment, the composition comprising a population of T cells and the small molecule ligand are administered concurrently.

[0037] In one embodiment, the composition comprising a population of T cells and the small molecule ligand are administered consecutively.

[0038] In one embodiment, the subject is a human.

[0039] In some embodiments, the aptamer comprises a sequence that is at least 90% identical to any one of SEQ ID NOs:1 or 7-588.

[0040] In some embodiments, the aptamer comprises a sequence that is at least 95% identical to any one of SEQ ID NOs:1 or 7-588.

[0041] In some embodiments, the aptamer comprises any one of SEQ ID NOs:1 or 7-588.

[0042] In some embodiments, the small molecule inducer is selected from a compound according to any one of Formulas I – XXII .

[0043] In some embodiments, the small molecule inducer is selected from any one of compounds 001-185 or any of the compounds in paragraph

[0307] . BRIEF DESCRIPTION OF THE FIGURES

[0044] Figures 1A and 1B: Figure 1A provides schematics of the gene regulation cassette containing a riboswitch in the context of intron-alternative exon-aptamer-intron (in this case in the context of the luciferase gene). Figure 1B provides schematics of the RiboCAR (the CAR coding sequence contains a gene regulation cassette disclosed herein) and ConstCAR (the CAR is constitutively expressed). Luci = luciferase. mtDHFR = modified dihydrofolate reductase exon 2 sequence.

[0045] Figures 2A and 2B: Figure 2A illustrates expression in HEK 293 cells of a CAR in which the CAR coding sequence contains a gene regulation cassette (“RiboCAR”) in response to small molecule inducer compound 004 compared to the constitutively expressed CAR (“ConstCAR”). See Figure 1B for construct configurations. Figure 2B illustrates expression in HEK 293 cells of a CAR in which the CAR coding sequence contains the gene regulation cassette (“RiboCAR”) in response to small molecule inducer compound 004 compared to background (HEK 293 cells without CAR expression construct). M.I.F. = mean fluorescence intensity.

[0046] Figures 3A and 3B: Figures 3A and 3B illustrate inducible expression of a CAR in HEK 293 cells from the CAR coding sequence containing the gene regulation cassettecompound 004. HEK 293 cells were transfected with indicated CAR constructs and treated with the small molecule inducer compound 004 at the listed concentrations. 48 hours after transfection, cells were stained with anti-FMC63 antibody and CAR expression was measured by flow cytometry. No CAR expression was detected from the RiboCAR-9 construct in the absence of inducer. CAR expression increased in the presence of increasing concentrations of inducer in a dose-dependent manner.

[0047] Figures 4A, 4B, 4C, 4D and 4E: Figures 4A and 4B illustrate expression of a CAR on the surface of Jurkat cells transfected with the RiboCAR-9 construct in response to multiple small molecule inducers disclosed herein. Figures 4C, 4D, and 4E illustrate expression of a CAR on the surface of Jurkat cells that have had either the RiboCAR-9 or ConstCAR expression cassette knocked into the TRAC locus. Treatment with compound 004 induced CAR expression on the cell surface of the stable Jurket cells in a dose dependent fashion (Figure 4C) while removal of small molecule inducer led to rapid decrease in CAR cell surface expression (Figures 4D and 4E), demonstrating the inducibility and reversibility of CAR expression regulated by the riboswitches disclosed herein via small molecule compounds disclosed herein.

[0048] Figures 5A and 5B: Expression of CAR on the surface of primary T cells in which either a RiboCAR (construct RiboCAR-9) or ConstCAR was knocked-in to the TRAC locus. In the absence of riboswitch inducer compound 004, CAR was not detectable on the cell surface of the RiboCAR-T cells. However, in the presence of compound 004, RiboCAR-T cells expressed CAR on the cell surface robustly (Figures 5A and 5B) and the level of CAR expression increased in response to increasing concentration of inducer (Figure 5B).

[0049] Figures 6A and 6B: Figure 6A shows that T cells with the RiboCAR expression cassette (construct RiboCAR-9) knocked-in to the TRAC locus and generated in the absence of inducer (i.e., CAR gene expression is OFF) had a high fraction of L-selectin+(CD62L+) cells (a marker of naïve and stem cell-like memory T cells)—approximately 52% of the population (without compound 004 treatment), which is essentially the same as the T cells that did not receive a CAR expression cassette (Mock T Cells). Even after treatment with compound 004, the RiboCAR T cells had a high fraction of CD62L+cells like the Mock T cells. Thus, the RiboCAR T cells comprise mainly naïve and stem cell-like memory T cells (naïve / Tscm cells). In addition, about 17 % of the RiboCAR T cell population were CD45RA–CD62L–cells comprising mainly effector memory T cells. In contrast, T cells engineered with ConstCAR were more differentiated, containing a significantly lower percentage of CD45A+CD62L+(approximately 47%) that were mainly more differentiated effector memory T cells. Figure 6B shows that the ConstCAR T cell population contained a higher fraction (48%) of T cells expressing CD39, which is a marker of exhausted T cells that inhibit T cell functionality. Only a small fraction (about 14 to 16 %) of RiboCAR-T cells or mock-T cells expressed CD39.

[0050] Figures 7A, 7B, 7C, and 7D: Figure 7A illustrates that in the absence of riboswitch inducer, RiboCAR-T cells (construct RiboCAR-9) exhibited no cytotoxic activity against target Raji-ffLuc cells, whereas in the presence of riboswitch inducer compound 004, RiboCAR-T cells elicited robust tumor cell lysis in a dose dependent manner. By contrast, ConstCAR-T cells exhibited cytotoxic activity irrespective of the presence of riboswitch inducer and were less active in target cell killing (approximately 20%) when compared with RiboCAR-T cells treated with riboswitch inducer compound 004. Figures 7B and 7C illustrate that RiboCAR-T cells produced cytokines IL-2 and INFγ when both tumor antigen and riboswitch inducer were present, with levels of cytokine release increasing in response to higher concentration of riboswitch inducer compound 004. Notably, the levels of IL-2 and IFNγ produced by RiboCAR-T cells treated with compound 004 were significantly lower than the cytokine levels released by ConstCAR-T cells. Figure 7D shows expansion of RiboCAR-T cells and ConstCAR-T cells in response to antigen challenge. Following three rounds of antigen challenges, RiboCAR-T cells expanded approximately 218-fold, whereas ConstCAR-T cells underwent exhaustion following the third round of antigen stimulation.

[0051] Figures 8A and 8B: RiboCAR-T cells outperformed ConstCAR-T cells in anti- tumor efficacy in vivo. NSG mice were inoculated with 1 x 106Raji-ffLuc cells by tail vein injection, and 4 days later were dosed orally with riboswitch small molecule inducer 4 hours before injection of 2 x 106CAR-T cells. As shown in Figure 8A, in such lymphoma mice, 7 days post CAR-T cell injection, mice injected with ConstCAR-T cells exhibited lower tumor growth compared with mice injected with control mock-T cells or injected with RiboCAR-T (construct RiboCAR-9) cells without riboswitch inducer treatment. However, in mice injected with the same number of RiboCAR-T cells but treated with small molecule inducer compound 004, the tumor burden was even lower than that in ConstCAR-T cells-injected mice. Further, a prolonged survival was observed in mice that received RiboCAR-T cells and were dosed with small molecule inducer (Figure 8B).

[0052] Figures 9A, 9B, 9C, 9D, 9E, and 9F: Riboswitch inducers remotely regulate the anti-tumor efficacy of RiboCAR-T cells in vivo in a dose-dependent fashion. Figures 9A shows the results from an experiment in which NOD / SCID / IL2Rγ− / −(NSG) mice were injected withwith either vehicle or 30 mg / kg or 100 mg / kg small molecule inducer.16 hrs hours post first inducer dosing, CAR+RiboCAR-T cells (construct RiboCAR-9) were infused intravenously into the Raji cell-bearing mice. Tumor progression or regression was monitored via bioluminescence imaging. Quantification of the bioluminescence is shown in Figures 9B, 9C, 9D, 9E, and 9F (each line represents results for one animal). Figure 9B shows the results for mice treated with mock T cells and ConstCAR T cells. Figures 9C and 9E show results for mice treated with RiboCAR-T cells and the indicated doses of small molecule inducer Comp. 004. Figures 9D and 9F shows the results for mice treated with RiboCAR-T cells and the indicated doses of small molecule inducer compound 111.

[0053] Figure 10: Treatment with RiboCAR-T cells and small molecule inducers results in prolonged survival of tumor-bearing mice (construct RiboCAR-9). Endpoints from longest to shortest: RiboCAR-T cells + 100 mg / kg compound 111; RiboCAR-T cells + 100 mg / kg compound 004; RiboCAR-T cells + 30 mg / kg compound 004; RiboCAR-T cells + 30 mg / kg compound 111; ConstCAR + 100 mg / kg compound 004; RiboCAR-T cells (no small molecule inducer).

[0054] Figure 11: RiboCAR constructs enable the inducible and reversible expression of an anti-HER2 CAR. CAR genes comprising a gene regulation cassette were generated as described in Example 7 and tested for the cell surface expression of the anti-HER2-CAR molecule in response to treatment with the indicated doses of the riboswitch small molecule inducer compound 004 (MXU-001) in HEK 293 cells. MXU-001 concentrations from left to right: 0 µM; 0.013 µM, 0.309 µM; 0.926 µM; 2.778 µM; 8.333 µM; 25 µM. “HER-CAR-A6” = HER-RiboCAR-A; “HER-CAR-B6” = HER-RiboCAR-B; etc. HER2-CAR = Cells that constitutively express a HER2 CAR (ConstCAR).

[0055] Figures 12A, 12B, 12C, 12D, 12E, and 12F: RiboCAR-T cells targeting HER2 are more cytotoxic to tumor cells than T cells constitutively expressing a HER2 CAR. Figure 12A shows HER2 CAR expression (construct HER2 CAR-D) on the cell surface of the primary T cells. Three days after CAR gene targeting, RiboCAR-T cells were treated for 20 hours with or without 25 µM compound 004 to induce CAR expression. HER2 expression shown on the x-axis. Figure 12B shows RiboCAR-T cells were activated more robustly by HER2 antigen on target Calu-3 cells in the presence of inducer compound 111 (also referred to as M310) as compared to ConstCAR-T cells. Figure 12C shows target cell viability for an experiment in which RiboCAR-T or ConstCAR-T cells, respectively, were co-cultured with HER2+Calu-3 cells at 2:1 ratio of effector to target cell (E:T ratio) in the absence or presence of differentlysis) for RiboCAR-T cells vs. ConstCAR-T cells. Figure 12 E shows results from an experiment similar to Figure 12C, but for different E:T ratios. Figure 12F shows a comparison of antigen-induced IFN-γ secretion by RiboCAR-T cells vs. ConstCAR-T cells.

[0056] Figures 13A and 13B show that small molecule inducers can remotely regulate the anti-tumor activity of RiboCAR-T cells targeting HER2+tumors in vivo. NSG mice were inoculated with 2.5 x 106Calu-3 cells subcutaneously and dosed orally and daily with 300 mg / kg of riboswitch small molecule inducer MXU-001 or M310, respectively. The first dose was administered 6 hours before injection of 2 x 106ConstCAR-T or RiboCAR-T cells (construct HER2 CAR-D), respectively. Figure 13A shows tumor volumes. Traces from top to bottom (by endpoint): mock T cells; RiboCAR no inducer; ConstCAR T cells; RiboCAR + 300 mg / kg MXU-001; RiboCAR + 300 mg / kg M310. Figure 13B shows tumor growth in %. Traces from top to bottom (by endpoint): mock T cells; RiboCAR no inducer; ConstCAR T cells; RiboCAR + 300 mg / kg MXU-001; RiboCAR + 300 mg / kg M310. DETAILED DESCRIPTION

[0057] Chimeric antigen receptor (CAR)-T cell therapy is a promising treatment for certain cancers. However, it is increasingly evident that the level and timing of CAR molecule expression is important for CAR-T cell activation, durability and anti-cancer activities. The present disclosure provides a system for the inducible expression of any CAR (referred to as “RiboCAR” herein) in response to the presence of a small molecule inducer. The disclosed systems allow for precise control of CAR expression. Unlike previously reported regulatable CAR platforms that utilize viral protease or chemical-induced protein dimerization, RiboCAR contains a synthetic mammalian ON riboswitch in the coding sequence of the CAR transgene, in which the aptamer portion of the riboswitch functions as a sensor for a specific small molecule inducer. The expression level of the CAR gene is dependent on the level of the small molecule inducer (aptamer ligand). CARs are undetectable in the absence of the small molecule, and a precise dose response in CAR levels is achieved with increasing dose of small molecule inducer, reaching levels higher than constitutively expressed CAR upon maximal small molecule inducer dose. Induced CAR expression diminishes following withdrawal of the small molecule inducer. Not only did exposure of T cells containing the RiboCAR expression cassette to small molecule inducer induce expression of the CAR molecule, but T cell activity was also controlled by the small molecule inducer. Additionally, T cells that were expanded incell activation, reduced markers of T cell exhaustion and greater cytotoxicity when compared with T cells expressing CAR constitutively. CAR levels can be regulated to the most effective levels and can be switched on and off according to the presence or absence of the small molecule inducers. With a bioavailable small molecule inducer, CAR-T activity can be precisely tuned and controlled in vivo. This precise control of CAR levels with its impact on CAR-T cell activity and durability provides a system for significantly improving the efficacy of CAR-T cell therapy in comparison to current CAR-T systems with constitutively active CAR expression. Provided herein are expression constructs and vectors comprising any of the sequences disclosed in Tables 2-6.

[0058] Chimeric Antigen Receptors

[0059] The aptamers and gene regulation cassettes disclosed herein can be used to regulate the expression of any target gene that can be expressed in a target cell, tissue or organism. The term “target gene” refers to a polynucleotide that is introduced into a cell and is capable of being transcribed into RNA and translated and / or expressed under appropriate conditions.

[0060] As disclosed herein, the aptamers and gene regulation cassettes disclosed herein are used to regulate the expression of a chimeric antigen receptor (CAR) in immune cells and more particularly, in T cells. CARs are simulated receptors containing an extracellular single-chain variable fragment (scFv), a transmembrane domain, as well as an intracellular region of immunoreceptor tyrosine-based activation motifs (ITAMs) in association with a co-stimulatory signal.

[0061] First-generation CAR T cells contained an intracellular domain from the TCR CD3 ζ-chain that induced T cell cytotoxicity effect against targeted cancer cells, but did not promote CAR T cell expansion in vivo following reinfusion of the engineered T cells. Second and third- generation CAR T cells contained additional co-stimulatory intracellular domains including CD28 or 4BB in second-generation CARs, and addition of a second costimulatory domain fused to CD3ζ in third-generation CARs. These additions augmented the potential of the CAR T cells to grow, expand, and persist in the patient’s body.

[0062] In some embodiments, the CAR T cells disclosed herein are engineered to express a CAR that recognizes a cancer antigen. Non-limiting examples of cancer antigens include CD19, CD20, CD30, CD33, CD38, CD133, BCMA, TEM8, EpCAM, ROR1, Folate Receptor, CD70, MAGE-1, MAGE-2, MAGE-3, MAGE A-10, MAGE-C2, MAGE-A12, CEA, tyrosinase, midkin, BAGE, CASP-8, β-catenin, CA-125, CDK-1, ESO-1, gp75, gp100 ,IL13Ralpha, IL13Ralpha2, AIM-2, AIM-3, NY-ESO-1, C9orf112, SART1, SART2, SART3, BRAP, RTN4, GLEA2, TNKS2, KIAA0376, ING4, HSPH1, C13orf24, RBPSUH, C6orf153, NKTR, NSEP1, U2AF1L, CYNL2, TPR GOLGA, BMI1, COX-2, EGFRvIII, EZH2, LICAM, Livin, Livinβ, MRP-3, Nestin, OLIG2, ART1, ART4, B-cycline, Gli1, Cav-1, Cathepsin B, CD74, E- Cadherin, EphA2 / Eck, Fra-1 / Fosl 1, GAGE-1, Ganglioside / GD2, GnT-V, β1, 6- Ν, Ki67, Ku70 / 80, PROX1, PSCA, SOX10, SOX11, Survivin, βhCG, WT1, mesothelin, melan-A, NY-BR-1, NY-CO-58, MN (gp250), telomerase, SSX-2, PRAME, PLK1, VEGF-A, VEGFR2, and Tie-2. In some embodiments, the CAR-T cells disclosed herein are engineered to express more than one antigen recognizing receptor to recognize one or more antigens.

[0063] In some embodiments, the CAR-T cells disclosed herein are further engineered to secrete therapeutic transgenes, including, but not limited to IL-2, IL-2 mutein, IL-15, CD40L, IL-33, and IL-12, or variants thereof.

[0064] In some embodiments, the CAR-T cells disclosed herein are engineered to express a protein that inhibits, blocks, or antagonizes the interaction of immunosuppressive polypeptides and / or their ligands. Immunosuppressive polypeptides suppress or decrease an immune response via their binding, and include CD47, PD-1, CTLA-4, and their corresponding ligands, including SIRPalpha, PD-L1, PD-L2, B7-1, B7-2, and TIGIT. Such polypeptides are present in the tumor microenvironment and inhibit immune responses to neoplastic cells.

[0065] In some embodiments, CAR-T cells disclosed herein are engineered to express a PD-1 variant (a PD-1 decoy) that is designed compete with endogenous PD-1. In some embodiments, the PD-1 decoy is lacking the cytoplasmic domain of PD-1. In some embodiments, the PD-1 transmembrane and intracellular signaling domains in the PD-1 decoy are replaced with a co-stimulating signaling domain of CD28 or a constitutively active IL-7 receptor, to convert possible inhibitory signal to improved T cell function.

[0066] Alternative Splicing Riboswitch

[0067] Riboswitches are regulatory segments of an RNA polynucleotide that regulate the stability of the RNA polynucleotide and / or regulate the production of a protein from the RNA polynucleotide in response to the presence or absence of aptamer-specific ligand molecules. In embodiments, the riboswitch comprises a sensor region (e.g., the aptamer region) and an effector region that together are responsible for sensing the presence of a ligand (e.g., a small molecule) and causing an effect that leads to increased or decreased expression of the target gene. The riboswitches described herein are recombinant, utilizing polynucleotides from two

[0068] Provided herein are methods for regulating the expression of a CAR by inserting into the CAR gene a polynucleotide cassette comprising sequence encoding an alternative splicing riboswitch described herein. The alternative splicing riboswitch comprises an alternatively-spliced exon, flanked by 5ʹ and 3ʹ introns, and a riboswitch comprising an aptamer (e.g., an aptamer disclosed herein). The aptamers described herein are encoded as part of a gene regulation cassette for the regulation of CAR expression by aptamer / ligand mediated alternative splicing of the resulting RNA (e.g., pre-mRNA). In this context, the gene regulation cassette comprises a riboswitch comprising a sensor region (e.g., the aptamers described herein) and an effector region that together are responsible for sensing the presence of a small molecule ligand and altering splicing to an alternative exon. Splicing refers to the process by which an intronic sequence is removed from the nascent pre-messenger RNA (pre-mRNA) and the exons are joined together to form the mRNA. Splice sites are junctions between exons and introns, and are defined by different consensus sequences at the 5′ and 3′ ends of the intron (i.e., the splice donor and splice acceptor sites, respectively). Splicing is carried out by a large multi-component structure called the spliceosome, which is a collection of small nuclear ribonucleoproteins (snRNPs) and a diverse array of auxiliary proteins. By recognizing various cis regulatory sequences, the spliceosome defines exon / intron boundaries, removes intronic sequences, and splices together the exons into a final message (e.g., the mRNA). In the case of alternative splicing, certain exons can be included or excluded to vary the final coding message thereby changing the resulting expressed protein.

[0069] In one embodiment, the regulation of target gene expression is achieved by using any of the DNA constructs disclosed in PCT Application No. PCT / US2016 / 016234 (WO2016 / 126747, Regulation of gene expression by aptamer-mediated modulation of alternative splicing), which is hereby incorporated by reference in its entirety. In embodiments of the present disclosure, the riboswitches and polynucleotide cassettes disclosed in PCT Application No. PCT / US2016 / 016234 (WO2016 / 126747) comprise an aptamer encoding sequence described herein in place of the aptamer sequence disclosed in PCT Application No. PCT / US2016 / 016234 (WO2016 / 126747).

[0070] In one embodiment, the polynucleotide cassette comprises (a) a riboswitch and (b) an alternatively-spliced exon, flanked by a 5′ intron and a 3′ intron, wherein the riboswitch comprises (i) an effector region comprising a stem forming sequence that includes the 5′ splice site sequence of the 3′ intron (and sequence complementary thereto), and (ii) an aptamer disclosed herein. In embodiments, the effector region is a stem forming region that forms theof the aptamers disclosed herein. In other words, the effector stem comprises a first sequence that is linked to the 5′ end of the aptamers disclosed herein and a second sequence that is linked to the 3′ end of the aptamers disclosed herein, wherein the first or second sequence includes the 5′ splice site sequence of the 3′ intron and the other includes sequence complementary to the 5′ splice site sequence of the 3′ intron. In embodiments, the effector region comprises the intronic 5′ splice site (“5′ ss”) sequence of the intron that is immediately 3′ of the alternative exon, as well as the sequence complimentary to the 5′ ss sequence of the 3′ intron.

[0071] In one embodiment, the polynucleotide construct comprises a sequence encoding from 5′ to 3′: (a) a first intron; (b) an alternatively-spliced exon; and (c) a second intron comprising a riboswitch, wherein the riboswitch comprises an effector region and an aptamer, wherein the riboswitch comprises from 5′ to 3′: (i) a 5′ splice site sequence of the second intron; (ii) an aptamer sequence; and (iii) a sequence that is complementary to the 5′ splice site sequence of the second intron; wherein the 5′ splice site sequence of the second intron and the sequence that is complementary to the 5′ splice site sequence of the second intron are capable of forming a stem; wherein the alternatively-spliced exon comprises a stop codon that is in-frame with a CAR gene, comprising the polynucleotide construct, when the alternatively-spliced exon is spliced into the CAR gene mRNA.

[0072] Depending on the CAR expression level desired, a person of ordinary skill in the art may modify the polynucleotide cassette that is inserted into the CAR coding sequence by varying the aptamer sequence, stem length, intron sequences, or exon sequences of the polynucleotide cassette. The modular nature of the expression cassette allows compatibility of the CAR expression construct with a variety of practical applications, including expression of CARs for research or for treatment. Importantly, by varying the different components of the expression system, the CAR expression constructs disclosed herein allow a person of ordinary skill in the art to fine-tune CAR expression to whatever level may be desired for a given application. For example, in some instances, the person or ordinary skill in the art might seek high levels of (absolute) CAR expression in presence of an aptamer ligand. Alternatively, the person skilled in the art may wish to employ a construct with significant CAR expression in absence of the aptamer ligand, but where expression can be further “boosted” for a desireddifference (i.e., a high dynamic range) between CAR expression levels in presence and absence of an aptamer ligand. In yet other instances, a very high CAR expression level in presence of an aptamer ligand might not be required, as long as there is minimal expression in absence of an aptamer ligand.

[0073] 5′ splice site sequences (i.e., the splice site sequence located at the 5′ end of an intron) are well known in the art. There is some variability among different 5′ splice site sequences, and this variability is also well understood in the art. For example, Shapiro and Senapathy (Shapiro MB, Senapathy P. RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res. 1987 Sep 11;15(17):7155-74 or Zhang MQ. Statistical features of human exons and their flanking regions. Hum Mol Genet.1998 May; 7(5):919-32, which is incorporated in its entirety herein) describe for a variety of eukaryotes which positions of the splice site sequence have some variability, and which positions are fixed. Likewise, Zhang (Zhang MQ. Statistical features of human exons and their flanking regions. Hum Mol Genet. 1998 May;7(5):919-32, which is incorporated in its entirety herein) also shows which positions of the splice site sequence may have some variability, and which positions are fixed. As such, a person skilled in the art can easily recognize a splice site sequence based on the known consensus sequence and based on its location relative to the exon / intron boundary. Exemplary splice site sequences include, but are not limited to: A G G || G T G A G T; A A A || G T A A G C; G C A || G T A A G T; G A G || G T G T G G; A / C A G || G T A / G A G T; N A G || G T A / G A G T; N A G || G T A A G T; A / C A / T G || G T A N G T; and N A G / A || G T A A G T (where || denotes the exon / intron boundary and N represents A, G, C, or T).

[0074] When the aptamer binds its ligand, the effector region forms a stem and thus prevents splicing to the splice donor site at the 3′ end of the alternative exon. Under certain conditions (for example, when the aptamer is not bound to its ligand), the effector region is in a context that provides access to the splice donor site at the 3′ end of the alternative exon, leading to inclusion of the alternative exon in the CAR gene mRNA. In some embodiments, the polynucleotide cassette is placed in the CAR gene to regulate expression of the CAR in response to a ligand. In one embodiment, the alternatively-spliced exon comprises a stop codon that is in-frame with the CAR gene when the alternatively-spliced exon is spliced into the CAR gene mRNA.

[0075] In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 598, wherein -X- represents an aptamer encoding sequence disclosed herein. Lower casedisclosed herein may contribute an additional bp pair to the stem). In one embodiment, the alternative exon (underlined in SEQ ID NO: 598, below) is replaced with another alternative exon sequence.

[0076] SEQ ID NO: 598

[0077] GTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTT AAGTTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACACATATTGACCAAATC AGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTT TGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATA CAATGTATCATGCCGAGTAACGCTGTTTCTCTAACTTGTAGGAATGAATTCAGAT ATTTCCAGAGAATGAAAAAAAAATCTTCAGTAGAAGgtaatgt-X- acattacGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCA ATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTC ATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGG GATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCAT ACCTCTTATCTTCCTCCCACAG. SEQ ID NO:598 corresponds to: (SEQ ID NO:1186)-X- (SEQ ID NO:1187).

[0078] In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 599, wherein -X- represents an aptamer encoding sequence disclosed herein. Lower case letters indicate paired stem sequence forming part of the effector stem. In one embodiment, the alternative exon (underlined in SEQ ID NO:599, below) is replaced with another alternative exon sequence.

[0079] SEQ ID NO: 599

[0080] GTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTT AAGTTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACACATATTGACCAAATC AGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTT TGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATA CAATGTATCATGCCGAGTAACGCTGTTTCTCTAACTTGTAGGAATGAATTCAGAT ATTTCCAGAGAATGAAAAAAAAATCTTCAGTAGAAGgtaatgtg-X- cacattacGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCA ATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTC ATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGG GATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCAT ACCTCTTATCTTCCTCCCACAG. SEQ ID NO:599 corresponds to: (SEQ ID NO:1188)-X-

[0081] The alternative exon is flanked by 5′ and 3′ intronic sequences. The 5′ and 3′ intronic sequences that can be used in the gene regulation cassettes disclosed herein can be any sequence that can be spliced out of the CAR gene creating either the CAR gene mRNA or the CAR gene mRNA comprising the alternative exon mRNA, depending upon the presence or absence of a ligand that binds the aptamer. The 5′ and 3′ intronic sequences each have the sequences necessary for splicing to occur, i.e., splice donor, splice acceptor and branch point sequences. In one embodiment, the 5′ and 3′ intronic sequences of the gene regulation cassette are derived from one or more naturally occurring introns or portions thereof. In one embodiment, the 5′ and 3′ intronic sequences are derived from a truncated human beta-globin intron 2 (IVS2Δ), from intron 2 of the human β-globin gene, from the SV40 mRNA intron (used in pCMV-LacZ vector from Clontech Laboratories, Inc.), from intron 6 of human triose phosphate isomerase (TPI) gene (Nott Ajit, et al. RNA.2003, 9:6070617), from an intron from human factor IX (Sumiko Kurachi, et al. J. Bio. Chem.1995, 270(10), 5276), from the target gene's own endogenous intron, or from any genomic fragment or synthetic introns (Yi Lai, et al. Hum Gene Ther.2006:17(10): 1036) that contain elements that are sufficient for regulated splicing (Thomas A. Cooper, Methods 2005 (37):331).

[0082] In one embodiment, the alternative exon and riboswitch are engineered to be in an endogenous intron of a target gene. That is, the intron (or a substantially similar intronic sequence) naturally occurs at that position of the target gene. In this case, the intronic sequence immediately upstream of the alternative exon is referred to as the 5′ intron or 5′ intronic sequence, and the intronic sequence immediately downstream of the alternative exon is referred to as the 3′ intron or 3′ intronic sequence. In this case, the endogenous intron is modified to contain a splice acceptor sequence and splice donor sequence flanking the 5′ and 3′ ends of the alternative exon. In one embodiment, the 5′ and / or 3′ introns are exogenous to the target gene.

[0083] The splice donor and splice acceptor sites in the alternative splicing gene regulation cassette can be modified to be strengthened or weakened. That is, the splice sites can be modified to be closer to the consensus for a splice donor or acceptor by standard cloning methods, site directed mutagenesis, and the like. Splice sites that are more similar to the splice consensus tend to promote splicing and are thus strengthened. Splice sites that are less similar to the splice consensus tend to hinder splicing and are thus weakened. The consensus for the splice donor of the most common class of introns (U2) is A / C A G∥G T A / G A G T (where ∥ denotes the exon / intron boundary). The consensus for the splice acceptor is C A G∥G (where ∥ denotes the exon / intron boundary). The frequency of particular nucleotides at the splice donorand acceptor sites are described in the art (see, e.g., Zhang, M. Q., Hum Mol Genet. 1988. 7(5):919-932). The strength of 5′ and 3′ splice sites can be adjusted to modulate splicing of the alternative exon.

[0084] Additional modifications to 5′ and 3′ introns present in the alternative splicing gene regulation cassette that can be made to modulate splicing include modifying, deleting, and / or adding intronic splicing enhancer elements, intronic splicing suppressor elements and or splice sites, and / or modifying the branch site sequence.

[0085] In one embodiment, the 5′ intron has been modified to contain a stop codon that will be in frame with the CAR gene. The 5′ and 3′ intronic sequences can also be modified to remove cryptic slice sites, which can be identified with publicly available software (see, e.g., Kapustin, Y. et al. Nucl. Acids Res.2011.1-8).

[0086] The lengths of the 5′ and 3′ intronic sequences can be adjusted in order to, for example, meet the size requirements for viral expression constructs. In one embodiment, the 5′ and / or 3′ intronic sequences are about 50 to about 300 nucleotides in length. In one embodiment, the 5′ and / or 3′ intronic sequences are about 125 to about 240 nucleotides in length.

[0087] The stem portion of the effector region should be of a sufficient length (and GC content) to substantially prevent alternative splicing of the alternative exon upon ligand binding the aptamer, while also allowing access to the splice site when the ligand is not present in sufficient quantities. In embodiments, the stem portion of the effector region comprises a stem sequence in addition to the 5′ splice site sequence of the 3′ intron and its complementary sequence of the 5′ splice site sequence. In embodiments, this additional stem sequence comprises a sequence from the aptamer stem. The length and sequence of the stem portion can be modified using known techniques in order to identify stems that allow acceptable background expression of the CAR gene when no ligand is present and acceptable expression levels of the CAR gene when the ligand is present.

[0088] In some embodiments, the effector region stem of the riboswitch is about 7 to about 20, about 7 to about 19, about 7 to about 18, about 7 to about 17, about 7 to about 16, about 7 to about 15, about 7 to about 14, about 7 to about 13, or about 7 to about 12 base pairs in length. In one embodiment, the effector region stem is 8 to 13 base pairs in length. In one embodiment, the effector region stem is 8 to 12 base pairs in length. In one embodiment, the effector region stem is 8 to 11 base pairs in length. In one embodiment, the stem has a length of about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base pairs. In addition to the length of the stem, the

[0089] In some embodiments, the 5′ splice site sequence of the second intron (i.e., the intron that is 3′ of the alternative exon) and the sequence that is complementary to the 5′ splice site sequence of the second intron may form a stem that may comprise additional stem forming sequence (together the (the effector region stem). In embodiments, this stem forming sequence is about 7 to about 20, about 7 to about 19, about 7 to about 18, about 7 to about 17, about 7 to about 16, about 7 to about 15, about 7 to about 14, about 7 to about 13, or about 7 to about 12 base pairs in length. In one embodiment, the region stem is 8 to 13 base pairs in length. In one embodiment, the stem is 8 to 12 base pairs in length. In one embodiment, the stem is 8 to 11 base pairs in length. In one embodiment, the stem has a length of about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base pairs. In addition to the length of the stem, the GC base pair content of the stem can be altered to modify the stability of the stem.

[0090] The alternative exon that is part of the alternative splicing gene regulation cassettes disclosed herein is any polynucleotide sequence capable of being transcribed to a pre-mRNA and alternatively spliced into the mRNA of the CAR gene. In one embodiment, the alternative exon contains at least one sequence that inhibits translation such that when the alternative exon is included in the CAR gene mRNA, expression of the CAR gene from that mRNA is prevented or reduced. In a preferred embodiment, the alternative exon contains a stop codon (TGA, TAA, TAG) that is in frame with the CAR gene when the alternative exon is included in the CAR gene mRNA by splicing. In embodiments, the alternative exon comprises, in addition to a stop codon, or as an alternative to a stop codon, another sequence that reduces or substantially prevents translation when the alternative exon is incorporated by splicing into the CAR gene mRNA including, e.g., a microRNA binding site, which leads to degradation of the mRNA. In one embodiment, the alternative exon comprises a miRNA binding sequence that results in degradation of the mRNA. In one embodiment, the alternative exon encodes a polypeptide sequence which reduces the stability of the protein containing this polypeptide sequence. In one embodiment, the alternative exon encodes a polypeptide sequence which directs the protein containing this polypeptide sequence for degradation.

[0091] The basal or background level of splicing of the alternative exon can be optimized by altering exon splice enhancer (ESE) sequences and exon splice suppressor (ESS) sequences and / or by introducing ESE or ESS sequences into the alternative exon. Such changes to the sequence of the alternative exon can be accomplished using methods known in the art, including, but not limited to site directed mutagenesis. Alternatively, oligonucleotides of a desired sequence (e.g., comprising all or part of the alternative exon) can be obtained fromESE sequences can be accomplished by methods known in the art, including, for example using ESEfinder 3.0 (Cartegni, L. et al. ESEfinder: a web resource to identify exonic splicing enhancers. Nucleic Acid Research, 2003, 31(13): 3568-3571) and / or other available resources.

[0092] In embodiments, the alternative exon is a naturally-occurring exon. In other embodiments, the alternative exon is derived from all or part of a known exon. In this context, “derived” refers to the alternative exon containing sequence that is substantially homologous to a naturally occurring exon, or a portion thereof, but may contain various mutations, such as mutations generated by altering exon splice enhancer (ESE) sequences and exon splice suppressor (ESS) sequences and / or by introducing ESE or ESS sequences into the alternative exon. “Homology” and “homologous” as used herein refer to the percent of identity between two polynucleotide sequences or between two polypeptide sequences. The correspondence between one sequence to another can be determined by techniques known in the art. For example, homology can be determined by a direct comparison of two polypeptide molecules by aligning their sequences and using readily available computer programs. Alternatively, homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded- specific nuclease(s), and size determination of the digested fragments. Two polynucleotide or two polypeptide sequences are “substantially homologous” to each other when, after optimally aligned with appropriate insertions or deletions, at least about 80%, at least about 85%, at least about 90%, and at least about 95% of the nucleotides or amino acids, respectively, match over a defined length of the molecules, as determined using the methods above.

[0093] In one embodiment, the alternatively-spliced exon is derived from exon 2 of the human dihydrofolate reductase gene (DHFR), mutant human Wilms tumor 1 exon 5, mouse calcium / calmodulin-dependent protein kinase II delta exon 16, or SIRT1 exon 6. In embodiments, the alternatively-spliced exon is, or comprises, the modified DHFR exon 2 of SEQ ID NO:590. (GAATGAATTCAGATATTTCCAGAGAATGAAAAAAAAATCTTCAGTAGAAG). In embodiments, the alternatively-spliced exon is, or comprises, the modified DHFR exon 2 of SEQ ID NO:591 (GAATGAATTCAGATATTTCCAGAGAATGAAAAAAAATCTTCAGTAGAAG). In some embodiments, the alternatively-spliced exon comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:590 or SEQ ID NO:591.

[0094] Aptamers

[0095] Aptamers are single-stranded nucleic acid molecules that non-covalently bind to specific ligands with high affinity and specificity by folding into three-dimensional structures. Aptamer ligands include ions, small molecules, proteins, viruses, and cells.

[0096] The term “aptamer” as used herein refers to an RNA polynucleotide (or DNA sequence encoding the RNA polynucleotide) that specifically binds to a class of ligands. The term "ligand" refers to a molecule that is specifically bound by an aptamer. Because the ligands induce target gene (i.e., CAR) expression from the gene regulation cassettes disclosed herein, the ligands are also referred to herein as inducers. Aptamers have binding regions that are capable of forming complexes with an intended target molecule (i.e., the ligand). An aptamer will typically be between about 15 and about 200 nucleotides in length. More commonly, an aptamer will be between about 30 and about 100 nucleotides in length, for example, 70 to 90 nucleotides in length. Aptamers typically comprise multiple paired (P) regions in which the aptamer forms a stem and unpaired regions where the aptamer forms a joining (J) region or a loop (L) region. The paired regions can be numbered sequentially starting at the 5ʹ end (P1) and numbering each stem sequentially (P2, P3, etc.). The loops (L1, L2, etc.) are numbered based on the adjacent paired region and the joining regions are numbered according to the paired regions that they link (e.g., J1-2 joins paired region P1 to paired region P2).

[0097] In embodiments, X1-X6are not simultaneously C, A, T, C, G, and A, respectively; X7-X12are not simultaneously A, T, T, G, C, and A, respectively; X13, X14, X15, X22, and X23are not simultaneously G, A, T, C, and G, respectively; and / or X16-X21, are not simultaneously A, T, C, A, T, and G, respectively. In embodiments, one or more of the above limitations applies to the aptamer when the 5′ and 3′ end of the aptamer sequence disclosed herein is not C and G, respectively.

[0098] In one aspect, the disclosure provides an aptamer that binds to a small molecule, wherein the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCAT CGACCCX7X8X9X10X11X12CCTX13X14X15CCGGX16X17X18X19X20X21CCGGX22X23C AGGGAG (SEQ ID NO:2); wherein: the first and the last nucleotide of the aptamer encoding sequence of SEQ ID NO:2 is any nucleotide or no nucleotide; X1is C or T; X2is any nucleotide;X4is G or T; X5is A, G, or T; X6is A or G; X7is A or T; X8is A, C, or T; X9is A, C, or T; X10is any nucleotide; X11is any nucleotide or no nucleotide; X12is A; X13is A, C, or G; X14is any nucleotide; X15is C, G, or T; X16is G or T; X17is A or T; X18is any nucleotide; X19is A or G; X20is A, G, T; X21is C, G, T; X22is T; and X23is A, G, or T.

[0099] In embodiments, the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCAT CGACCCX7X8X9X10X11X12CCTX13X14X15CCGGX16X17X18X19X20X21CCGGX22X23C AGGGAG (SEQ ID NO:2); wherein: the first and the last nucleotide of the aptamer encoding sequence of SEQ ID NO:2 is any nucleotide or no nucleotide; X1is C or T; X2is any nucleotide; X3is any nucleotide; X4is G or T; X5is A, G, or T; X6is A or G; X7is A;X9is A, C, or T; X10is any nucleotide; X11is any nucleotide or no nucleotide; X12is A; X13is A, C, or G; X14is any nucleotide; X15is C, G, or T; X16is G or T; X17is A or T; X18is any nucleotide; X19is A or G; X20is A, G, T; X21is C, G, T X22is T; and X23is A, G, or T.

[0100] In embodiments, the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCX7X8X9X10X11X12CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4), wherein: the first and the last nucleotide of the aptamer encoding sequence of SEQ ID NO:4 is any nucleotide or no nucleotide; X7is A, G, or T; X8is any nucleotide; X9is any nucleotide; X10is any nucleotide; X11is any nucleotide or no nucleotide; X12is A, C, or T.

[0101] In embodiments, X7-X12are not simultaneously A, T, T, G, C, and A, respectively.

[0102] In embodiments, the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCX7X8X9X10X11X12CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4), wherein: the first and the last nucleotide of the aptamer encoding sequence of SEQ ID NO:4 isX7is A or T; X8is A, C, or T; X9is A, C, or T; X10is any nucleotide; X11is any nucleotide or no nucleotide; and X12is A.

[0103] In embodiments, X7-X12are not simultaneously A, T, T, G, C, and A, respectively.

[0104] In embodiments, the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCX7X8X9X10X11X12CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4), wherein: the first and the last nucleotide of the aptamer encoding sequence of SEQ ID NO:4 is any nucleotide or no nucleotide; X7is A; X8is A, C, or T; X9is A, C, or T; X10is any nucleotide; X11is any nucleotide or no nucleotide; and X12is A.

[0105] In embodiments, X7-X12are not simultaneously A, T, T, G, C, and A, respectively.

[0106] In embodiments, the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCAT CGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3), wherein: the first and the last nucleotide of the aptamer encoding sequence of SEQ ID NO:3 is any nucleotide or no nucleotide; X1is C, G, or T; X2is any nucleotide; X3is any nucleotide; X4is any nucleotide; X5is any nucleotide; and X6is any nucleotide.

[0107] In embodiments, X1-X6are not simultaneously C, A, T, C, G, and A, respectively.CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCAT CGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3), wherein: the first and the last nucleotide of the aptamer encoding sequence of SEQ ID NO:3 is any nucleotide or no nucleotide; X1is C or T; X2is any nucleotide; X3is any nucleotide; X4is any nucleotide; X5is A, G, or T; and X6is any nucleotide.

[0109] In embodiments, X1-X6are not simultaneously C, A, T, C, G, and A, respectively.

[0110] In embodiments, the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCAT CGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3), wherein: the first and the last nucleotide of the aptamer encoding sequence of SEQ ID NO:3 is any nucleotide or no nucleotide; X1is C or T; X2is any nucleotide; X3is any nucleotide; X4is G or T; X5is A, G, or T; and X6is A or G.

[0111] In embodiments, the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCATTGCACCTX13X14X15CCGGATCATGCCGGX22X23CAGGGAG (SEQ ID NO:5), wherein: the first and the last nucleotide of the aptamer encoding sequence of SEQ ID NO:5 is any nucleotide or no nucleotide; X13, X14, X15, X22, and X23is any nucleotide.

[0112] In embodiments, X13, X14, X15, X22, and X23are not simultaneously G, A, T, C, and G, respectively.CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCATTGCACCTX13X14X15CCGGATCATGCCGGX22X23CAGGGAG (SEQ ID NO:5), wherein: the first and the last nucleotide of the aptamer encoding sequence of SEQ ID NO:5 is any nucleotide or no nucleotide; X13is A, C, or G; X14is any nucleotide; X15is C, G, or T; X22is T; and X23is A, G, or T.

[0114] In embodiments, the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCATTGCACCTGATCCGGX16X17X18X19X20X21CCGGCGCAGGGAG (SEQ ID NO:6), wherein: the first and the last nucleotide of the aptamer encoding sequence of SEQ ID NO:6 is any nucleotide or no nucleotide; X16is any nucleotide; X17is any nucleotide; X18is any nucleotide; X19is any nucleotide; X20is any nucleotide; and X21is C, G, T.

[0115] In embodiments, X16-X21, are not simultaneously A, T, C, A, T, and G, respectively.

[0116] In embodiments, the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCATTGCACCTGATCCGGX16X17X18X19X20X21CCGGCGCAGGGAG (SEQ ID NO:6), wherein: the first and the last nucleotide of the aptamer encoding sequence of SEQ ID NO:6 is any nucleotide or no nucleotide; X16is G or T; X17is A or T; X18is any nucleotide;X20is A, G, T; and X21is C, G, T.

[0117] In embodiments, the aptamer encoding sequence comprises a sequence that is at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 1 and 7-558. In embodiments, the aptamer encoding sequence comprises a sequence that is selected from the group consisting of SEQ ID NOs: 1 and 7-558.

[0118] In embodiments, the aptamer encoding sequence comprises a sequence that is at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-17, 89-96, 174-349, and 358-583. In embodiments, the aptamer encoding sequence comprises a sequence that is selected from the group consisting of SEQ ID NOs: 7- 17, 89-96, 174-349, and 358-583.

[0119] In embodiments, the aptamer encoding sequence comprises a sequence that is at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447. In embodiments, the aptamer encoding sequence comprises a sequence that is selected from the group consisting of SEQ ID NOs: 7- 11, 89-94, 174-349, and 358-447.

[0120] In embodiments, the aptamer encoding sequence comprises a sequence that is at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378. In embodiments, the aptamer encoding sequence comprises a sequence that is selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378.

[0121] In embodiments, provided herein aptamers encoding sequences that are derived from any aptamer encoding sequence disclosed herein, wherein the first and the last nucleotide of the aptamer encoding sequence is any nucleotide or no nucleotide. In embodiments, the first two and the last two nucleotides of an aptamer encoding sequencesequence that is 5ʹ and 3ʹ of the aptamer encoding sequence may be present and form part of the stem forming sequence of the riboswitch.

[0122] In one aspect, the disclosure provides the aptamer encoded by the aptamer encoding sequences disclosed herein.

[0123] The ordinarily-skilled artisan would understand that the aptamers described herein may be ribonucleic acid (RNA) molecules. In embodiments, the aptamers described herein are part of a longer RNA polynucleotide, including, for example, heterogeneous nuclear RNA (hnRNA) or messenger RNA (mRNA).

[0124] Small Molecule Inducers

[0125] An aptamer as disclosed herein binds to, or otherwise responds to the presence or addition of, a small molecule ligand, also referred to herein as a “small molecule inducer.” The small molecule inducer interacts with the aptamer to promote the induction of expression of a CAR, as described herein.

[0126] The inducers may be selected to provide high induction of the target gene(s) (i.e., CAR gene), and preferably have good selectivity (high selectivity towards the aptamer with low off-target binding). The compounds may additionally provide one or more of good physicochemical properties (e.g., solubility, physical and / or chemical stability), good pharmacokinetic properties (e.g., bioavailability, proper half-life and duration of action), and acceptable safety (low toxicity and / or low side effects, wide therapeutic window).

[0127] Small molecule inducers are disclosed in, for example, PCT application Nos. PCT / US2020 / 045022 (WO2021 / 026245, RNA-targeting ligands, compositions thereof, and methods of making and using the same), PCT / US2022 / 031736 (WO2022 / 256382, RNA- targeting ligands, compositions thereof, and methods of making and using the same), PCT / IB2022 / 000762 (WO2023 / 111686, Aptamers and small molecule ligands), and PCT / IB2024 / 000314 (Small molecule ligands and aptamers), each of which is incorporated herein by reference. The small molecule inducer may be a compound having the structure according to Formula I to XXII, including the small molecules in Table 1.

[0128] In embodiments, the small molecule has the structure according to Formula I:X1, X2, and X3are, in each instance, independently selected from CR1, CHR1, N, NH, O and S, wherein adjacent X1, X2, and X3are not simultaneously selected to be O or S; the dashed lines represent optional double bonds; Y1, Y2, and Y3are, in each instance, independently selected from CR2and N; n is 1 or 2, wherein when n is 1, only one of the dashed lines is a double bond; ,wherein k, p, q, r, and v are independently selected from integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, z is selected from integers 1, 2, 3, 4, and 5; c, d, e, f, g, h and i are independently selected from integers 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; j is selected from integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; M is selected from –NH-, -O-, -NHC(=O)-, -C(=O)NH-, -S-, and -C(=O)-; and A is selected fromwherein X4, X5, X6, and X7, are independently selected from CR3and N; X8is N or CH; Xbis selected from O, NH, and NCH3; wherein each of R1, R2, and R3are independently selected from -H, -Cl, -Br, -I, -F, -CF3, -CH2F, -CHF2, -OH, -CN, -NO2, -NH2, -NH(C1-C6alkyl), -N(C1-C6alkyl)2, -COOH, -COO(C1-C6alkyl), -CO(C1-C6alkyl), -O(C1-C6alkyl), -OCO(C1-C6alkyl), -NCO(C1-C6alkyl), -CONH(C1-C6 alkyl), and substituted or unsubstituted C1-C6 alkyl; additionally or alternatively, two R3on adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH; m is 1 or 2; each Rais independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Raattached to the same carbon atom form an oxo group, or two Raattached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; x is 0, 1, 2 or 3; each Rbis independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Rbattached to the same carbon atom form an oxo group; or two Rbattached to different carbon atoms form a 4 to 6 memberedcarbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; y is 0, 1, 2 or 3; and W is O or NR4, wherein R4is selected from selected from -H, -CO(C1-C6alkyl), substituted or unsubstituted C1-C6alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO(aryl), -CO(heteroaryl), and -CO(cycloalkyl); provided that at least two of X1, X2, X3, X4, X5, X6, and X7are N; or a pharmaceutically acceptable salt thereof.

[0129] In embodiments of the above formula, y is 0.

[0130] In embodiments, the small molecule has the structure according to Formula II:Formula (II) wherein X1, X2, and X3are, in each instance, independently selected from CR1, CHR1, N, NH, O and S, wherein adjacent X1, X2, and X3are not simultaneously selected to be O or S; the dashed lines represent optional double bonds; Y1, Y2, and Y3are, in each instance, independently selected from CR2and N; n is 1 or 2, wherein when n is 1, only one of the dashed lines is a double bond; L is selected from ,wherein k, p, q, r, and v are independently selected from integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, z is selected from integers 1, 2, 3, 4, and 5; and A is selected from, wherein X4, X5, X6, and X7, are independently selected from CR3and N; wherein each of R1, R2, and R3are independently selected from -H, -Cl, -Br, -I, -F, -CF3, -CH2F, -CHF2, -OH, -CN, -NO2, -NH2, -NH(C1-C6alkyl), -N(C1-C6alkyl)2, -COOH, -COO(C1-C6alkyl), -CO(C1-C6alkyl), -O(C1-C6alkyl), -OCO(C1-C6alkyl), -NCO(C1-C6alkyl), -CONH(C1-C6alkyl), and substituted or unsubstituted C1-C6alkyl; m is 1 or 2; and W is O or NR4, wherein R4is selected from selected from -H, -CO(C1-C6alkyl), substituted or unsubstituted C1-C6alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO(aryl), -CO(heteroaryl), and -CO(cycloalkyl); provided that at least two of X1, X2, X3, X4, X5, X6, and X7are N; or a pharmaceutically acceptable salt thereof.

[0131] In an embodiment of the above formula, at least one of X1, X2, or X3is N.

[0132] In an embodiment of the above formula, X1is N.

[0133] In an embodiment of the above formula, X2is N.

[0134] In an embodiment of the above formula, X3is N.

[0135] In an embodiment of the above formula, two of X1, X2, and X3are N.

[0136] In an embodiment of the above formula, X1and X3are N.

[0137] In an embodiment of the above formula, at least one of Y1, Y2, and Y3is N.

[0138] In an embodiment of the above formula, Y1 is N.

[0139] In an embodiment of the above formula, Y2is N.

[0140] In an embodiment of the above formula, Y3is N.

[0141] In an embodiment of the above formula, at least one of Y1, Y2, and Y3is CR2.

[0142] In an embodiment of the above formula, Y1is CR2.

[0143] In an embodiment of the above formula, Y2is CR2.

[0144] In an embodiment of the above formula, Y3is CR2.

[0145] In an embodiment of the above formula, n is 2.

[0146] In embodiments, the small molecule has the structure according to Formula III:, Formula (III) wherein X2aand X2bare independently selected from CR1and N; X1and X3are independently selected from CR1and N; L and A are as provided for Formula (II); and two of X1, X2a, X2b, and X3are N.

[0147] In embodiments, the small molecule has the structure according to formula (IV):Formula (IV) wherein L and A are as provided for Formula (II).

[0148] In any above embodiment of the compound, L may be selected from.

[0149] As in any above embodiment of a compound, L may be selected to be.

[0150] In any of the above embodiments, a compound wherein q and r are 0 or 1.

[0151] In any of the above embodiments, a compound wherein q is 1.

[0152] In any of the above embodiments, a compound wherein r is 1.

[0153] In any of the above embodiments, a compound wherein r is 0.

[0154] In any of the above embodiments, a compound wherein q and r are 1.

[0155] In any of the above embodiments, a compound wherein q is 1 and r is 0.

[0156] In any of the above embodiments, a compound wherein m is 1.

[0157] In any of the above embodiments, a compound wherein W is selected from NH, O, and N(C1-C6alkyl).

[0158] In any of the above embodiments, a compound wherein W is NH.

[0159] In any of the above embodiments, a compound wherein at least one of X4, X5, X6, and X7is N.

[0160] In any of the above embodiments, a compound wherein X4is N.

[0161] In any of the above embodiments, a compound wherein X5is N.

[0162] In any of the above embodiments, a compound wherein X6 is N.

[0163] In any of the above embodiments, a compound wherein X7is N.

[0164] In any of the above embodiments, a compound wherein X4and X6are N.

[0165] In any of the above embodiments, a compound wherein X5and X7are N.

[0166] In any of the above embodiments, a compound wherein X5or X6are N, and both X4and X7are independently CR2.

[0167] In any of the above embodiments, a compound wherein A is.

[0168] In any of the above embodiments, a compound with the structure of Formula V:

[0169] In any of the above embodiments, a compound wherein L is.

[0170] In any of the above embodiments, a compound wherein Y1, Y2, and Y3are, in each instance, independently selected from CR2and N, wherein R1is selected from -H, -Cl, -Br, -I, -F, -OH, and -NH2.

[0171] In any of the above embodiments, a compound wherein z is 2.

[0172] In any of the above embodiments, a compound wherein Y2is N.

[0173] In any of the above embodiments, a compound wherein Y2is CR2and R1is selected from -H, -F, -OH, and -NH2.

[0174] In any of the above embodiments, a compound wherein A is.

[0175] In embodiments, the small molecule has the structure according to formulas:.

[0176] In other embodiments, the small molecule has the structure according to formulas:.

[0177] In other embodiments, the small molecule has a structure of formula VI:Formula (VI) h iX1, X2, and X3are, in each instance, independently selected from CR1, CHR1, N, NH, O and S, wherein adjacent X1, X2, and X3are not simultaneously selected to be O or S; the dashed lines represent optional double bonds; Y1, Y2, and Y3are, in each instance, independently selected from CR2and N; n is 1 or 2, wherein when n is 1, only one of the dashed lines is a double bond; L1is selected fromwherein c, d, e, f, g, h and i are independently selected from integers 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; j is selected from integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; M is selected from –NH-, -O-, -NHC(=O)-, -C(=O)NH-, -S-, and -C(=O)-; and A is selected from, wherein X4, X5, X6, and X7, are independently selected from CR3and N; wherein each of R1, R2, and R3are independently selected from -H, -Cl, -Br, -I, -F, - CF3, -CH2F, -CHF2, -OH, -CN, -NO2, -NH2, -NH(C1-C6alkyl), -N(C1-C6alkyl)2, -COOH, - COO(C1-C6alkyl), -CO(C1-C6alkyl), -O(C1-C6alkyl), -OCO(C1-C6alkyl), -NCO(C1-C6alkyl), -CONH(C1-C6alkyl), and substituted or unsubstituted C1-C6alkyl; m is 1 or 2; andW is -O- or -N(R4)-, wherein R4is selected from -H, -CO(C1-C6alkyl), substituted or unsubstituted C1-C6alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO(aryl), -CO(heteroaryl), and - CO(cycloalkyl); provided that at least two of X1, X2, X3, X4, X5, X6, and X7are N; or a pharmaceutically acceptable salt thereof.

[0178] In an additional embodiment,wherein B isselected from –NH- and –NHC(=O)-; and y is an integer selected from 1, 2, 3, 4, and 5.

[0179] In the above embodiments, a compound wherein at least one of X1, X2, or X3is N.

[0180] In the above embodiments, a compound wherein X1is N.

[0181] In the above embodiments, a compound wherein X2is N.

[0182] In the above embodiments, a compound wherein X3is N.

[0183] In the above embodiments, a compound wherein, in each instance, two of X1, X2, and X3are N.

[0184] In the above embodiments, a compound wherein X1and X3are N.

[0185] In the above embodiments, a compound wherein at least one of Y1, Y2, and Y3is N.

[0186] In the above embodiments, a compound wherein Y1is N.

[0187] In the above embodiments, a compound wherein Y2is N.

[0188] In the above embodiments, a compound wherein Y3is N.

[0189] In the above embodiments, a compound wherein at least one of Y1, Y2, and Y3is CR2.

[0190] In the above embodiments, a compound wherein Y1is CR2.

[0191] In the above embodiments, a compound wherein Y2is CR2.

[0192] In the above embodiments, a compound wherein Y3is CR2.

[0193] In the above embodiments, a compound wherein n is 2.

[0194] As in any above embodiment, a compound having the structure of formula (VII):, Formula (VII) wherein X2aand X2bare independently selected from CR1and N; X1and X3are independently selected from CR1and N; L1and R1are as provided for Formula (I); and two of X1, X2a, X2b, and X3are N; or a pharmaceutically acceptable salt thereof.

[0195] In the above embodiments, a compound having the structure of formula (VIII):Formula (VIII) wherein L1is as provided for Formula (VI); or a pharmaceutically acceptable salt thereof.

[0196] In the above embodiments, a compound wherein c, d, e, f, g, h and i are independently selected from integers 1, 2, and 3.

[0197] In the above embodiments, a compound wherein L1is selected from.

[0198] In the above embodiments, a compound wherein c, d, e, and f are independently selected from integers 1, 2, and 3.

[0199] In the above embodiments, a compound wherein c, d, and e are 1.

[0200] In the above embodiments, a compound wherein L1is

[0201] In the above embodiments, a compound wherein e and f are independently selected from 1, 2, and 3.

[0202] In the above embodiments, a compound wherein e and f are 1 or 2.

[0203] In the above embodiments, a compound wherein e is 1.

[0204] In the above embodiments, a compound wherein f is 2.

[0205] In the above embodiments, a compound wherein e is 1 and f is 2.

[0206] In the above embodiments, a compound wherein L1is.

[0207] In the above embodiments, a compound wherein c is 1, 2, or 3.

[0208] In the above embodiments, a compound wherein c is 1.

[0209] In the above embodiments, a compound wherein c is 2

[0210] In the above embodiments, a compound wherein c is 3.

[0211] In the above embodiments, a compound wherein M is selected from –NH-, -O-, and –S-.

[0212] In the above embodiments, a compound wherein M is –NH-.

[0213] In the above embodiments, a compound wherein c is 1 and M is –NH-.

[0214] In the above embodiments, a compound wherein m is 1.

[0215] In the above embodiments, a compound wherein W is selected from -NH-, -O-, and -N(C1-C6alkyl)-.

[0216] In the above embodiments, a compound wherein W is -NH-.

[0217] In the above embodiments, a compound wherein at least one of X4, X5, X6, and X7is N.

[0218] In the above embodiments, a compound wherein X4is N.

[0219] In the above embodiments, a compound wherein X5is N.

[0220] In the above embodiments, a compound wherein X6is N.

[0221] In the above embodiments, a compound wherein X7is N.

[0222] In the above embodiments, a compound wherein X4and X6are N.

[0223] In the above embodiments, a compound wherein X5and X7are N.

[0224] In the above embodiments, a compound wherein X5or X6are N, and both X4and X7are independently CR2.

[0225] In the above embodiments a compound wherein A is.

[0226] In the above embodiments, a compound having the structure:a pharmaceutically acceptable salt thereof.

[0227] In other embodiments, the small molecule has a structure of formula (IX):Formula (IX) wherein X1, X2, and X3are, in each instance, independently selected from CR1, CHR1, N, NH, O and S, wherein adjacent X1, X2and X3are not simultaneously selected to be O or S; the dashed lines represent optional double bonds; Y1, Y2, and Y3are, in each instance, independently selected from CR2and N;R1and R2are independently selected from -H, -Cl, -Br, -I, -F, -CF3, -OH, -CN, -NO2, - NH2, -NH(C1-C6alkyl), -N(C1-C6alkyl)2, -COOH, -COO(C1-C6alkyl), -CO(C1-C6alkyl), - O(C1-C6alkyl), -OCO(C1-C6alkyl), -NCO(C1-C6alkyl), -CONH(C1-C6alkyl), and substituted or unsubstituted C1-C6alkyl; n is 1 or 2, wherein when n is 1, only one of the dashed lines is a double bond; y is an integer selected from 1, 2, 3, 4, and 5; and B is selected from –NH- and –NHC(=O)-; or a pharmaceutically acceptable salt thereof.

[0228] In the above embodiments, a compound wherein B is –NH-.

[0229] In the above embodiments, a compound wherein B is –NHC(=O)-.

[0230] In the above embodiments, a compound wherein y is an integer selected from 1, 2, and 3.

[0231] In the above embodiments, a compound wherein y is 1 or 3.

[0232] In the above embodiments, a compound wherein at least one of Y1, Y2, and Y3is N.

[0233] In the above embodiments, a compound wherein Y1is N.

[0234] In the above embodiments, a compound wherein Y2is N.

[0235] In the above embodiments, a compound wherein Y3is N.

[0236] In the above embodiments, a compound wherein at least one of Y1, Y2, and Y3is CR2.

[0237] In the above embodiments, a compound wherein Y1is CR2.

[0238] In the above embodiments, a compound wherein Y2is CR2.

[0239] In the above embodiments, a compound wherein Y3is CR2.

[0240] In the above embodiments, a compound wherein at least one of X1, X2, or X3is N.

[0241] In the above embodiments, a compound wherein, in each instance, two of X1, X2, and X3are N.

[0242] In the above embodiments, a compound wherein n is 2.

[0243] In the above embodiments, a compound with a structure of formula (X):Formula (X) X2aand X2bare independently selected from CR1and N;X1and X3are independently selected from CR1and N; wherein two of X1, X2a, X2b, and X3are N; and B, R1and y are as described in formula (VII); or a pharmaceutically acceptable salt thereof.

[0244] In the above embodiments, a compound having the structure of formula (XIa) or (XIb)wherein X2aand X2bare independently selected from CR1and N; X1and X3are independently selected from CR1and N; wherein two of X1, X2a, X2b, and X3are N; wherein y is an integer selected from 1, 2, and 3; and R1is as described in formula (IX); or a pharmaceutically acceptable salt thereof.

[0245] In the above embodiments, a compound wherein y is 1.

[0246] In the above embodiments, a compound wherein y is 3.

[0247] In the above embodiments, a compound having the structure of formula (XII):Formula (XII) wherein B and y are as described in formula (IX); or a pharmaceutically acceptable salt thereof.

[0248] In the above embodiments, a compound wherein B is -NH-.

[0249] In the above embodiments, a compound wherein B is –NHC(=O)-.

[0250] In the above embodiments, a compound wherein said compound has the structure:thereof

[0251] Compounds according to the above formulas and embodiments may be prepared, for example, according to the methods provided in PCT / US2020 / 45022 and from US provisional application serial number 63 / 195779, filed June 2, 2021, the disclosures of which are incorporated herein by reference in their entirety.

[0252] In other embodiments, the small molecule has a structure according to formula XIIIor a pharmaceutically acceptable salt thereof, wherein X4is selected from CH, CRdand N; X6is selected from CH, CRdand N; X7is selected from CH, CRdand N; wherein 0 or 1 of X4, X6or X7is N; A is selected from the group consisting of:Xais selected from N and CH; Xbis selected from O, NH, and NCH3;each Rais independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Raattached to the same carbon atom form an oxo group; or two Raattached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; each Rbis independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Rbattached to the same carbon atom form an oxo group; or two Rbattached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; m is 1 or 2; x is 0, 1, 2 or 3; y is 0, 1, 2 or 3; each Rcis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; each Rdis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6- membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH; and w is 0, 1 or 2.

[0253] For the compounds according to formula XIII, x may be selected to be 1, 2 or 3; x may be selected to be 1 or 2; or, x may be selected to be 1. Ramay be selected to be methyl, fluoro or chloro; or Ramay be selected to be methyl. Alternatively, x may be 0.

[0254] For the compounds according to formula XIII, y may be selected to be 0 or 1. Rbmay be selected from halo or methyl; or Rbmay be selected to be methyl.

[0255] For the compounds according to formula XIII, w may be selected from 0 or 1. Rcmay be selected from halo or methyl; or Rcmay be selected from F, Cl or methyl.

[0256] For the compounds according to formula XIII, each Rdmay be selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or Rdmay be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected

[0257] For the compounds according to formula XIII, Xamay be N.

[0258] For the compounds according to formula XIII, Xbmay be O. some embodiments of compounds of formula XIII, when A is selected to be, x is 1, 2 or 3; and / or two Rdon adjacent ring positions are taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.

[0260] In other embodiments, the small molecule has a structure according to formula XIVor a pharmaceutically acceptable salt thereof, wherein A is selected from the group consisting of:Xais selected from N and CH; each Rais independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Raattached to the same carbon atom form an oxo group; or two Raattached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; each Rbis independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Rbattached to the same carbon atom form an oxo group; or two Rbattached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH;m is 1 or 2; x is 0, 1, 2 or 3; y is 0, 1, 2 or 3; each Rcis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; each Rdis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH; w is 0, 1 or 2; and z is 0, 1 or 2.

[0261] For the compounds according to formula XIV, x may be selected to be 1, 2 or 3; x may be selected to be 1 or 2; or, x may be selected to be 1. Ramay be selected to be methyl, fluoro or chloro; or Ramay be selected to be methyl. Alternatively, x may be 0.

[0262] For the compounds according to formula XIV, y may be selected to be 0 or 1. Rbmay be selected from halo or methyl; or Rbmay be selected to be methyl.

[0263] For the compounds according to formula XIV, w may be selected from 0 or 1. Rcmay be selected from halo or methyl; or Rcmay be selected from F, Cl or methyl.

[0264] For the compounds according to formula XIV, z may be selected to be 1 or 2; or z may be selected to be 1. Each Rdmay be independently selected from halo, C1to C3alkyl, - OCH3, -CF3, -CH2F, and -CHF2; or Rdmay be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH. Alternatively, z may be 0.

[0265] For the compounds according to formula XIV, Xamay be N. some embodiments of compounds of formula XIV, when A is selected to bex is 1, 2 or 3; and / or two Rdon adjacent ring positions are taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.

[0267] In other embodiments, the small molecule has a structure according to formula XVor a pharmaceutically acceptable salt thereof, wherein A is selected from the group consisting of:each Rais independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Raattached to the same carbon atom form an oxo group; or two Raattached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; each Rbis independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Rbattached to the same carbon atom form an oxo group; or two Rbattached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; m is 1 or 2; x is 0, 1, 2 or 3; y is 0, 1, 2 or 3; each Rcis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; each Rdis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6- membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH; w is 0, 1 or 2; and z is 0, 1 or 2.

[0268] For the compounds according to formula XV, x may be selected to be 1, 2 or 3; x may be selected to be 1 or 2; or x may be selected to be 1. Ramay be selected to be methyl, fluoro or chloro; or Ramay be selected to be methyl. Alternatively, x may be 0.

[0269] For the compounds according to formula XV, y may be selected to be 0 or 1. Rbmay be selected from halo or methyl; or Rbmay be selected to be methyl.

[0270] For the compounds according to formula XV, w may be selected from 0 or 1. Rcmay be selected from halo or methyl; or Rcmay be selected from F, Cl or methyl.

[0271] For the compounds according to formula XV, z may be selected to be 1 or 2; or z may be selected to be 1. Each Rdmay be independently selected from halo, C1to C3alkyl, - OCH3, -CF3, -CH2F, and -CHF2; or Rdmay be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH. Alternatively, z may be 0. some embodiments of compounds of formula XV, when A is selected to be, x is 1, 2 or 3; and / or two Rdon adjacent ring positions are taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.

[0273] In other embodiments, the small molecule has a structure according to formula XVIor a pharmaceutically acceptable salt thereof, wherein X4is selected from CH, CRdand N; X6is selected from CH, CRdand N; X7is selected from CH, CRdand N; 46 7Xais selected from N and CH; each Rais independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Raattached to the same carbon atom form an oxo group; or two Raattached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; m is 1 or 2; x is 0, 1, 2 or 3; each Rcis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; each Rdis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6- membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH; and w is 0, 1 or 2.

[0274] For the compounds according to formula XVI, x may be selected to be 1, 2 or 3; x may be selected to be 1 or 2; or, x may be selected to be 1. Ramay be selected to be methyl, fluoro or chloro; or Ramay be selected to be methyl. Alternatively, x may be 0.

[0275] For the compounds according to formula XVI, w may be selected from 0 or 1. Rcmay be selected from halo or methyl; or Rcmay be selected from F, Cl or methyl.

[0276] For the compounds according to formula XVI, each Rdmay be selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or Rdmay be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.

[0277] For the compounds according to formula XVI, Xamay be N.

[0278] For the compounds according to formula XVI, Xbmay be O.

[0279] In some embodiments of compounds of formula XVI, x is 1, 2 or 3; and / or two Rdon adjacent ring positions are taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.

[0280] In other embodiments, the small molecule has a structure according to formula XVIIor a pharmaceutically acceptable salt thereof, wherein each Rais independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Raattached to the same carbon atom form an oxo group; or two Raattached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; each Rcis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; each Rdis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6- membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH; w is 0, 1 or 2; x is 0, 1, 2 or 3; and z is 0, 1 or 2.

[0281] For the compounds according to formula XVII, x may be selected to be 1, 2 or 3; x may be selected to be 1 or 2; or, x may be selected to be 1. Ramay be selected to be methyl, fluoro or chloro; or Ramay be selected to be methyl. Alternatively, x may be 0.

[0282] For the compounds according to formula XVII, w may be selected from 0 or 1. Rcmay be selected from halo or methyl; or Rcmay be selected from F, Cl or methyl.

[0283] For the compounds according to formula XVII, z may be selected to be 1 or 2; or z may be selected to be 1. Each Rdmay be independently selected from halo, C1to C3alkyl, - OCH3, -CF3, -CH2F, and -CHF2; or each Rdmay be independently selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.

[0284] In some embodiments of compounds of formula XVII, x is 1, 2 or 3; and / ortwo Rdon adjacent ring positions are taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.

[0285] In other embodiments, the small molecule has a structure according to formula XVIIIor a pharmaceutically acceptable salt thereof, wherein each Rais independently selected from methyl, halo, hydroxyl and amino; each Rcis independently selected from methyl, halo, hydroxyl and amino; each Rdis independently selected from methyl, halo, hydroxyl and amino; x is 0, 1, 2 or 3; w is 0, 1 or 2; and z is 0, 1 or 2.

[0286] For the compounds according to formula XVIII, x may be selected to be 1, 2 or 3; x may be selected to be 1 or 2; or, x may be selected to be 1. Ramay be selected to be methyl, fluoro or chloro; or Ramay be selected to be methyl. Alternatively, x may be 0.

[0287] For the compounds according to formula XVIII, w may be selected from 0 or 1. Rcmay be selected from halo or methyl; or Rcmay be selected from F, Cl or methyl.

[0288] For the compounds according to formula XVIII, z may be selected to be 0 or 1; or z may be selected to be 1.

[0289] In other embodiments, the small molecule has a structure according to formula XIX:or a pharmaceutically acceptable salt thereof, whereinRais selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively; each Rcis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; each Rdis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6- membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH; and w is 0, 1 or 2. z is 0, 1 or 2.

[0290] For the compounds according to formula XIX, Ramay be selected from methyl, halo, hydroxyl and amino; Ramay be selected to be methyl, fluoro or chloro; or Ramay be selected to be methyl.

[0291] For the compounds according to formula XIX, each Rcmay be independently selected from methyl, halo, hydroxyl and amino.

[0292] For the compounds according to formula XIX, each Rdmay be independently selected from methyl, halo, hydroxyl and amino.

[0293] In other embodiments, the small molecule has a structure according to formula XXX6is selected from CH, CRdand N; X7is selected from CH, CRdand N; wherein 0 or 1 of X4, X6or X7is N; Xbis selected from O, NH, and NCH3; each Rbis independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Rbattached to the same carbonatom form an oxo group; or two Rbattached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; m is 1 or 2; y is 0, 1, 2 or 3; each Rcis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; each Rdis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6- membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH; and w is 0, 1 or 2.

[0294] For the compounds according to formula XX, y may be selected to be 0 or 1. Rbmay be selected from halo or methyl; or Rbmay be selected to be methyl.

[0295] For the compounds according to formula XX, w may be selected from 0 or 1. Rcmay be selected from halo or methyl; or Rcmay be selected from F, Cl or methyl.

[0296] For the compounds according to formula XX, each Rdmay be selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or Rdmay be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.

[0297] For the compounds according to formula XX, Xbmay be O.

[0298] In other embodiments, the small molecule has a structure according to formula XXIor a pharmaceutically acceptable salt thereof, whereineach Rbis independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Rbattached to the same carbon atom form an oxo group; or two Rbattached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; each Rcis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; each Rdis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6- membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH; m is 1 or 2; w is 0, 1 or 2 y is 0, 1 or 2; and z is 0, 1 or 2.

[0299] For the compounds according to formula XXI, y may be selected to be 0 or 1. Rbmay be selected from halo or methyl; or Rbmay be selected to be methyl.

[0300] For the compounds according to formula XXI, w may be selected from 0 or 1. Rcmay be selected from halo or methyl; or Rcmay be selected from F, Cl or methyl.

[0301] For the compounds according to formula XXI, each Rdmay be selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or Rdmay be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.

[0302] In other embodiments, the small molecule has a structure according to formula XXIIor a pharmaceutically acceptable salt thereof, whereineach Rbis independently selected from C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl and amino; or additionally or alternatively, two Rbattached to the same carbon atom form an oxo group; or two Rbattached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; each Rcis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; each Rdis independently selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl and amino; alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6- membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH; m is 1 or 2; w is 0, 1 or 2; y is 0, 1 or 2; and z is 0, 1 or 2.

[0303] For the compounds according to formula XXII, y may be selected to be 0 or 1. Rbmay be selected from methyl, halo, hydroxyl and amino; or Rbmay be selected from halo or methyl; or Rbmay be selected to be methyl.

[0304] For the compounds according to formula XXII, w may be selected from 0 or 1. Rcmay be selected from methyl, halo, hydroxyl and amino; or Rcmay be selected from halo or methyl; or Rcmay be selected from F, Cl or methyl.

[0305] For the compounds according to formula XXII, each Rdmay be selected from halo, C1to C3alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or Rdmay be selected from methyl, halo, hydroxyl and amino; or Rdmay be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two Rdon adjacent ring positions may be taken together to form a 5- or 6- membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.

[0306] In other embodiments, the small molecule ligand has a structure according to the compounds in Table 1 (or a pharmaceutically acceptable salt thereof): Table 1. Small Molecule LigandsHN Cl HN N N 077 N N 084 N NHN HN N N 091 098

[0307] In embodiments, the aptamer disclosed herein binds to, or otherwise responds to the presence of one or more of the following compounds (or a pharmaceutically acceptable salt thereof):

[0308] The small molecule inducers may be prepared according to the methods disclosed in, for example, PCT Application Nos. PCT / US2020 / 045022 (WO2021 / 026245), PCT / US2022 / 031736 (WO2022 / 256382) and PCT / IB2022 / 000762 (WO2023 / 111686), each of which is incorporated herein by reference.

[0309] The term "alkyl" refers to the radical of saturated aliphatic groups, including straight-chain alkyl groups and branched-chain alkyl groups. In preferred embodiments, a straight chain or branched chain alkyl has 6 or fewer carbon atoms in its backbone (e.g., C1-C6for straight chain, C3-C6for branched chain). Alkyl groups include methyl, ethyl, propyl, isopropyl, n-butyl, iso-butyl, tert-butyl, pentyl, isopentyl, hexyl, and the like. The term “substituted alkyl” refers to an alkyl group which has from 1 to 4 substituents independently selected from halo, amino, amido, sulfonamido, OH, OCH3, nitro and CN.

[0310] The term "cycloalkyl" refers to saturated, carbocyclic groups having from 3 to 6 carbons in the ring. Cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl.

[0311] The term “bicyclyl” refers to saturated carbocyclic groups having two joined ring systems, which may be fused or bridged. Bicyclic groups include bicycle[2.1.1]hexane, bicycle[2.2.1]heptane, decalin, and the like. The term “tricyclyl” refers to saturated carbocyclic groups having three joined ring systems, which may be fused and / or bridged. Tricyclic groups include adamantane and the like.

[0312] Carbocyclic refers to ring system that comprise only carbon atoms as ring atoms (i.e., the ring system does not have a heteroatom as a ring atom). Carbocyclic ring systems may be unsaturated, but preferred carbocyclic rings are not aromatic.

[0313] The term “alkenyl” refers to unsaturated aliphatic groups, including straight-chain alkenyl groups and branched-chain alkenyl groups, having at least one carbon-carbon double bond. In preferred embodiments, the alkenyl group has two to six carbon atoms (e.g., C2-C6alkenyl).

[0314] As used herein, the term "halogen" or "halo" designates -F, -Cl, -Br or -I, and preferably -F, -Cl or -Br.

[0315] The terms "alkoxyl" or "alkoxy" as used herein refers to an alkyl group, as defined above, that is attached through an oxygen atom. Representative alkoxyl groups include methoxy, ethoxy, propyloxy, tert-butoxy and the like.

[0316] The terms "amine" and "amino" refer to both unsubstituted and substituted amines, e.g., a moiety that can be represented by the general formula:

[0317] wherein R and R' are each independently selected from H and C1-C3alkyl.

[0318] The terms "amido" refer to both unsubstituted and substituted amide substituents, e.g., a moiety that can be represented by the general formula:

[0319] wherein R and R' are each independently selected from H and C1-C3alkyl.

[0320] The terms “sulfonamide” or "sulfonamido" refer to both unsubstituted and substituted sulfonamide substituents, e.g., a moiety that can be represented by the general formula: O S N R OR'

[0321] wherein R and R' are each independently selected from H and C1-C3alkyl.

[0322] The term "aryl" as used herein includes 5- and 6-membered single-ring aromatic groups that may include from zero to four heteroatoms, for example, benzene, pyrene, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, triazole, pyrazole, pyridine, pyrazine, pyridazine and pyrimidine. Those aryl groups having heteroatoms in the ring structure may also be referred to as "aryl heterocycles" or "heteroaryl" groups. The term "aryl" also includes polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjoining rings (the rings are "fused rings") wherein at least one of the rings is aromatic. Accordingly, aryl includes 8- to 10-membered fused bicyclic aromatic groups that may include from zero to five heteroatoms, in which one or both rings are aromatic, for example napthylene, quinolone, isoquinoline, benzo[b]thiophene, tetrahydronapthelene, and the like. Each aryl group may be unsubstituted or may be substituted with 1 to 5 substituents selected from halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C1-C6alkyl, C2-C6alkenyl, C3-C7cycloalkyl, C6-C10bicyclyl, C1-C6haloalkyl, C1-C6perhaloalkyl, -O-(C1-C6alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 perhaloalkyl), aryl, -O-aryl, - (C1-C6alkyl)-aryl, -O-(C1-C6alkyl)-aryl, -S-(C1-C6alkyl), -S-(C3-C7cycloalkyl), -S-(C1-C6haloalkyl), -S-(C1-C6perhaloalkyl), -S-aryl, -S-(C1-C6alkyl)-aryl, heteroaryl and hetercyclyl.

[0323] The term “heterocycle” of “heterocyclyl” refer to non-aromatic heterocycles having from 1 to 3 ring heteroatoms. Preferred heterocycles are 5- and 6-membered heterocyclic groups having from 1 to 3 heteroatoms selected from the group consisting of O, N and S.

[0324] The term "heteroatom" as used herein means an atom of any element other than carbon or hydrogen. Preferred heteroatoms are nitrogen, oxygen, and sulfur.

[0325] As used herein, the definition of each expression, e.g. alkyl, R1, R2, etc., when it occurs more than once in any structure, is intended to be independent of its definition elsewhere in the same structure.

[0326] It will be understood that "substitution" or "substituted with" includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.

[0327] The aptamer ligands disclosed herein may exist in particular geometric or stereoisomeric forms well as mixtures thereof. Such geometric or stereoisomeric forms include, but not limited to, cis- and trans-isomers, R- and S-enantiomers, diastereomers, (D)-isomers, (L)-isomers, the racemic mixtures thereof, and other mixtures thereof. Additional asymmetric carbon atoms may be present in a substituent such as an alkyl group.

[0328] The compounds according to Formulas I to XXII may contain an acidic or basic functional group, and accordingly may be present in a salt form. Preferably, the salt form is a pharmaceutically acceptable salt. The term "pharmaceutically-acceptable salts" in this respect, refers to the relatively non-toxic, inorganic and organic acid and base addition salts of the compounds disclosed herein.

[0329] The compounds according to Formulas I to XXII may contain one or more basic functional group, such as amino or alkylamino, and are, thus, capable of forming pharmaceutically-acceptable salts with pharmaceutically-acceptable acids. These salts can be prepared in situ in the administration vehicle or the dosage form manufacturing process, or by separately reacting a purified compound disclosed herein in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed during subsequent purification. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts and the like (see, e.g., Berge et al. (1977) "Pharmaceutical Salts", J. Pharm. Sci.66:1-19).

[0330] The pharmaceutically acceptable salts of the subject compounds include the conventional nontoxic salts or quaternary ammonium salts of the compounds, e.g., from non- toxic organic or inorganic acids. For example, such conventional nontoxic salts include those derived from inorganic acids such as hydrochloride, hydrobromic, sulfuric, sulfamic, phosphoric, nitric, and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmitic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicyclic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isothionic, and the like.

[0331] In other cases, the compounds according to Formulas I to XXII may contain one or more acidic functional groups and, thus, are capable of forming pharmaceutically-acceptable salts with pharmaceutically-acceptable bases. These salts can likewise be prepared in situ in the administration vehicle or the dosage form manufacturing process, or by separately reacting the purified compound in its free acid form with a suitable base, such as the hydroxide, carbonate or bicarbonate of a pharmaceutically-acceptable metal cation, with ammonia, or with a pharmaceutically-acceptable organic primary, secondary or tertiary amine. Representative alkali or alkaline earth salts include the lithium, sodium, potassium, calcium, magnesium, and aluminum salts and the like. Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine and the like (see, e.g., Berge et al., supra).

[0332] In embodiments, the aptamers provided herein bind to, or otherwise respond to the presence of, one or more compounds of Formula I - XXII provided herein, and / or bind to, or otherwise respond to, a metabolite analog or derivative of a compound of Formula I - XXII.

[0333] The specificity of the binding of an aptamer to its ligand can be defined in terms of the comparative dissociation constants (Kd) of the aptamer for its ligand as compared to the dissociation constant of the aptamer for unrelated molecules. Thus, the ligand may be considered to be a molecule that binds to the aptamer with greater affinity than to unrelated material. Typically, the Kdfor the aptamer with respect to its ligand will be at least about 10- fold less than the Kdfor the aptamer with unrelated molecules. In other embodiments, the Kdwill be at least about 20-fold less, at least about 50-fold less, at least about 100-fold less, and at least about 200-fold less, at least about 500-fold less, at least about 1000-fold less, or at least about 10,000-fold less than the Kdfor the aptamer with unrelated molecules.

[0334] Methods of Making T cell Compositions

[0335] The T cells used for the RiboCAR T cell therapy can be obtained from a patient’s blood using an apheresis machine. The CAR transgene containing a gene regulation cassette described herein is introduced in the T cells by known methods. In preferred embodiments, the CAR transgene containing the gene regulation cassette disclosed herein is stably integrated into the genome of the T cells. In one embodiment the CAR transgene containing the gene regulation cassette is knocked into the TRAC locus, for example by methods disclosed herein. Once modified, the T cell numbers can be expanded in vitro before the modified T cells are returned to the patient, typically by infusion. Because levels of CAR expression is low or undetectable in the absence of inducer, expression of the CAR during the process of making the CAR-T cell is avoided, and tonic CAR signaling-induced T cell differentiation and T cell exhaustion can be prevented.

[0336] Provided herein is a method for making a T cell composition comprising: obtaining a population of T cells; introducing into the T cells in the population of T cells a polynucleotide comprising: (i) a first sequence encoding a chimeric antigen receptor, and (ii) a second sequence comprising a polynucleotide cassette encoding (a) an alternatively spliced exon flanked by a 5ʹ intron and a 3ʹ intron; and (b) a riboswitch, wherein the riboswitch comprises an aptamer linked to an effector region comprising stem-forming sequence that comprises the 5ʹ splice site sequence of the 3ʹ intron and sequence complementary to the 5ʹ splice site sequence of the 3ʹ intron, wherein the second sequence is inserted into the first sequence; and expanding the T cells in culture.

[0337] In embodiments, the T cells are expanded in absence of a small molecule ligand that binds to the aptamer. In embodiments, the T cells are expanded in presence of a small molecule ligand that binds to the aptamer.

[0338] Thus, the T cell population (comprising an inducible CAR expression cassette as described herein) have one or more; two or more; three or more; four or more; five or more; six or more of the following properties: greater than about 30 %, greater than about 35 %, greater than about 40 %, greater than about 45 %; or greater than about 50 % of the T cells in the population have a naïve phenotype and / or stem cell phenotype; greater than about 30 %, greater than about 35 %, greater than about 40 %, greater than about 45 %; or greater than about 50 % of the T cells in the population are CD62L+CD45RA+, CCR7+, CD127+, and / or CD132+;greater than about 30 %; greater than about 35 %; greater than about 40 %; greater than about 45 %; or greater than about 50 % of the T cells in the population are CD45RA+CD62L+; greater than about 30 %; greater than about 35 %; greater than about 40 %; greater than about 45 %; or greater than about 50 % of the T cells in the population are CD62L+; less than about 35 %; less than about 30 %; less than about 25 %; less than about 20 %; less than about 18 %; or less than about 16 % of the T cells in the population have a differentiated phenotype (e.g., effector memory T cells); less than about 35 %; less than about 30 %; less than about 25 %; less than about 20 %; less than about 18 %; or less than about 16 % of the T cells in the population are CD45RA–CD62L–CCR7-, CD127, and / or CD132-; less than about 35 %; less than about 30 %; less than about 25 %; less than about 20 %; less than about 18 %; or less than about 16 % of the T cells in the population are CD39+(and / or express other markers for T cell exhaustion); enhanced cytotoxicity against cancer cells expressing the CAR antigen compared to T cells that constitutively express the CAR; reduced cytokine (e.g., TNFα, IL-2 and / or IFNγ) production when exposed to cancer cells expressing the CAR antigen compared to T cells that constitutively express the CAR; enhanced capacity for expansion in response to exposure to the CAR antigen compared to T cells that constitutively express the CAR; and / or reduced levels of T cell exhaustion following exposure to the CAR antigen compared to T cells that constitutively express the CAR.

[0339] Naïve T cells are precursors for effector and memory T cell subsets. Phenotypically, naïve T cells usually express certain surface markers, including, but not limited to, CD45RA, CCR7, CD62L, CD127, and / or CD132. Naïve T cells usually lack expression of markers of previous activation, including, but not limited to, CD25, CD44, CD69, CD45RO, and / or HLA- DR. Generally speaking, naïve T cells exhibit a low metabolism and do not produce proinflammatory cytokines or mediate effector immune responses. In some embodiments, intracellular proteins such as FOXP1, ZEB2, and TBX21 are used as markers for naïve T cells.

[0340] Differentiated T cells include stem cell-like memory (TSCM), central memory (TCM), effector memory (TEM), and effector (TEFF) types listed in order of decreasing memory function and increasing effector function).

[0341] T cell exhaustion is a broad term used to describe T cell dysfunction resulting from chronic stimulation. Exhausted T cells present with a distinct phenotype, which may includeoverexpression of inhibitory markers such as PD-1, LAG-3 and TIM-3 as well as impairment in their ability to release pro-inflammatory cytokines (e.g., IFNγ and TNFα). Exhaustion often occurs in the tumor microenvironment, where T cells suffer a loss of their cytotoxic function and become ineffective in their ability to kill cancerous cells. See, e.g., Wherry EJ, Kurachi M. Molecular and cellular insights into T cell exhaustion, Nat Rev Immunol.2015 Aug;15(8):486- 99, which is incorporated herein in its entirety. Phenotypic markers can be used to distinguish effector T cells from exhausted T cells. These include markers that are highly expressed on effector CD8+T cells, including, but not limited to, CD44, LY6C and killer cell lectin-like receptor subfamily G member 1 (KLRG1), but that are expressed at low or intermediate levels on exhausted T cells. Alternatively, markers such as inhibitory receptors that are expressed at substantially higher levels by exhausted CD8+T cells can be used.

[0342] T cell markers can help identify and / or quantify different populations of T cells in a given sample. Methods for the identification of T cells subsets are known in the art. See, e.g., Mousset et al., Comprehensive Phenotyping of T Cells Using Flow Cytometry, Cytometry A. 2019 Jun;95(6):647-654; Golubovskaya et al, Different Subsets of T Cells, Memory, Effector Functions, and CAR-T Immunotherapy, Cancers (Basel).2016 Mar 15;8(3):36; Walsh et al., Classification of T-cell activation via autofluorescence lifetime imaging. Nat Biomed Eng. 2021 Jan;5(1):77-88, which are incorporated herein in their entireties.

[0343] Some T cell markers (for example, markers that are receptors) are located on the cell membrane. Other T cell markers (for example, cytokines) are secreted. Yet other T cell markers (for example, transcription factors), are located in the nucleus or the cytoplasm. If a T cell is “negative” for a given marker, e.g., CD19-, this usually means that the marker is expressed by the T cell either not all or in a relatively small amount, as compared to a reference cell. Similarly, if a T cell is “positive” for a given marker, e.g., CD19+, this usually means that the marker is expressed by the T cell at an amount that is significantly higher than expression of the marker by a reference cell. A reference cell can be another T cell belonging to a different T cell population or be another mammalian cell.

[0344] In embodiments, naïve T cells can be identified by CD62L+CD45RA+, CCR7+, CD127+, CD132+, CD25-, CD44-, CD69-, CD45RO-, and / or HLA-DR- or any combination thereof.

[0345] In embodiments, exhausted T cells can be identified by the presence of PD-1, CTLA- 4, LAG-3, CD39, TIM-3, 2B4 / CD244 / SLAMF4, CD160, TIGIT, or any combination thereof.

[0346] In embodiments, the population of T cells obtained from a subject and engineered to express a CAR gene in response to a small molecule inducer (due to incorporation of a generegulation cassette disclosed herein into the CAR gene) has a phenotype that is similar to the phenotype of the T cell population obtained from the same patient that have not been engineered to express a CAR (e.g., a control population of T cells obtained from the same patient). In embodiments, the above listed properties of the T cells in the population (comprising an inducible CAR expression cassette as described herein) are within about 5 %; about 10 %, about 15 %, about 20 % or about 25 % of those properties in a T cell population derived from the same patient (that have not been engineered to comprise a CAR gene). In other words, the RiboCAR T cells have the percent of cells in the population expressing markers for being naïve, stem cell-like, and / or exhausted that are highly similar to the T cells derived from the same patient that were not engineered to comprise a CAR gene.

[0347] The presence of certain T cell markers and / or the percent of T cells expressing one or more cell surface markers can be measured by techniques known to a person skilled in the art. For example, cells can be stained for the marker using a marker-specific antibody followed by fluorescence activated cell sorting (FACS). Other types of flow cytometry can be used. Alternatively, expression of certain markers can be assessed by measuring mRNA levels, for example, by using real-time PCR, Northern blotting, DNA microarrays, Serial Analysis of Gene Expression (SAGE), RNA sequencing, tiling arrays, or other methods known in the art. In some embodiments, marker expression is assessed by analyzing protein levels, for example, by Western blotting, immunoassays (including, but not limited to enzyme-linked immunosorbent assays (ELISA)), mass spectrometry, or other methods known in the art. A person skilled in the art may further analyze cytokines secreted by the T cells, for example, by any techniques disclosed herein, or enzyme-linked immunospot assays (ELISPOT), cytokine capture assays or intracellular cytokine staining.

[0348] Methods of Treatment and Pharmaceutical Compositions

[0349] In one aspect, provided is a method of treating cancer by administering immune cells (e.g., T cells) having a CAR transgene containing a gene regulation cassette described herein to a patient. However, due to the gene regulation cassette within the CAR gene sequence, the CAR is not expressed at significant levels, i.e., it is in the “off state” in the absence of the specific ligand that binds to the aptamer contained within in the regulatory cassette riboswitch. Only when the aptamer specific ligand is administered, is the CAR expression and T cell activity activated.

[0350] As used herein, the terms “subject” and “patient” are used interchangeably irrespective of whether the subject has undergone treatment in the past or is currentlyundergoing any form of treatment. As used herein, the terms “subject” and “subjects” may refer to any vertebrate, including, but not limited to, a mammal (e.g., cow, pig, camel, llama, horse, goat, rabbit, sheep, bovine, hamster, guinea pig, cat, dog, rat, and mouse, a non-human primate (for example, a monkey, including, but not limited to, a cynomolgus monkey, chimpanzee, etc.) and a human). The subject may be a human or a non-human. In some embodiments, the subject is a human.

[0351] The terms “treat,” “treated,” “treating,” or “treatment” as used herein refer to therapeutic treatment, wherein the object is to slow down (lessen) an undesired physiological condition, disorder or disease, or to obtain beneficial or desired clinical results. For the purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of the condition, disorder or disease; stabilization (i.e., not worsening) of the state of the condition, disorder or disease; delay in onset or slowing of the progression of the condition, disorder or disease; amelioration of the condition, disorder or disease state; and remission (whether partial or total), whether detectable or undetectable, or enhancement or improvement of the condition, disorder or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.

[0352] The compositions (including pharmaceutical compositions) disclosed herein may be administered in therapeutically effective amounts. An “effective amount” or “therapeutically effective amount” refers to an amount of the compound or agent that is capable of producing a medically desirable result in a treated subject. The treatment method can be performed in vivo or ex vivo, alone or in conjunction with other drugs or therapy. A therapeutically effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route.

[0353] The RiboCAR T cell therapy can be used to treat a variety of cancers depending on the antigen specificity of the CAR. In embodiments, RiboCAR T cell therapy can be used to treat hematological malignancies, including, for example leukemia, lymphoma and multiple myeloma.

[0354] The T cells used for the RiboCAR T cell therapy can be obtained from a patient’s blood using an apheresis machine. The CAR transgene containing a gene regulation cassette described herein is introduced in the T cells by known methods. In preferred embodiments, the CAR transgene containing the gene regulation cassette is stably integrated into the genome of the T cells. In one embodiment, the CAR transgene containing the gene regulation cassette isknocked into the TRAC locus, for example by methods disclosed herein. Once modified, the T cell numbers can be expanded in vitro before the modified T cells are returned to the patient, typically by infusion. Because levels of CAR expression are low or undetectable in the absence of inducer, expression of the CAR during the process of making the CAR-T cell is avoided, and tonic CAR signaling-induced T cell differentiation and exhaustion can be prevented.

[0355] In one embodiment, the T cells used in RiboCAR T cell therapy are derived from a healthy donor (allogeneic T cells). In one embodiment, the patient’s own T cells (autologous T cells) are used in RiboCAR T cell therapy.

[0356] The delivery of the immune cells containing the CAR gene comprising the regulatory cassette (RiboCAR T cells) described herein and the delivery of the small molecule inducer (ligand) generally may be at the same time or may be separated in time. The delivery of the inducer will control when the CAR is expressed, as well as the level of CAR expression. The inducer may be delivered by a number of routes including, but not limited to, intravitreal, intraocular, inhalation, subcutaneous, intramuscular, intradermal, intralesion, topical, intraperitoneal, intravenous (IV), intra-arterial, perivascular, intracerebral, intracerebroventricular, oral, sublingual, sublabial, buccal, nasal, intrathoracic, intracardiac, intrathecal, epidural, intraosseous, or intraarticular. In embodiments, the inducer molecule is delivered orally.

[0357] The timing of delivery of the inducer will depend on the requirement for activation of the CAR. The presence of a gene regulation cassette disclosed herein in the CAR transgene allows the expression of the CAR to be controlled temporally, in a manner determined by the temporal dosing of the ligand specific to the aptamer. The expression of the CAR transgene only on ligand administration and the ability to modulate the levels of expression by modulating dosage of the ligand (inducer), increases the safety of the CAR T cell therapy and increases CAR-T cell functionality as described herein by allowing the CAR expression to be off in the absence of the ligand (e.g., during production of the CAR-T cells containing the CAR gene comprising the regulatory cassette described herein). In addition, the safety is enhanced in the T cells having a regulatable CAR (RiboCAR), disclosed herein because these regulatable CAR T cells are more cytotoxic, but produce lower level of cytokines (compared to T cells constitutively expressing the CAR), indicating that T cell therapy using the regulatable CAR T cells described herein may reduce or avoid cytokine release syndrome (CRS, also referred to as cytokine storm), which is a common and severe side effect of standard CAR-T cell therapy where the CAR is constitutively expressed by the T cells.

[0358] In addition, the ability to reduce or even turn off CAR expression by reducing dosage or stopping administration, respectively, of the inducer can restore functionality of exhausted CAR-T cells in patients: With riboswitches disclosed herein controlling the CAR expression, the CAR-T cells can undergo intermittent “rest” simply by shutting off CAR expression. This intermittent rest can restore CAR-T cells if they start getting exhausted.

[0359] The small molecule inducers (ligands) described herein are generally combined with one or more pharmaceutically acceptable carriers to form pharmaceutical compositions suitable for administration to a patient. Pharmaceutically acceptable carriers include solvents, binders, diluents, disintegrants, lubricants, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, generally used in the pharmaceutical arts. Pharmaceutical compositions may be in the form of tablets, pills, capsules, troches, eye drops, and the like, and are formulated to be compatible with their intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, intranasal, subcutaneous, oral, inhalation, transdermal (topical), transmucosal, and ocular.

[0360] The pharmaceutical compositions comprising compounds of Formulas I – XXII, or Table 1, are administered to a patient in a dosing schedule such that an amount of the compound sufficient to desirably regulate the CAR expression is delivered to the patient. When the dosage form is a tablet, pill, or the like, preferably the pharmaceutical composition comprises from 0.1 mg to 10 g of the compound; from 0.5 mg to 5 g of the compound; from 1 mg to 1 g of the compound; from 2 mg to 750 mg of the compound; from 5 mg to 500 mg of the compound; from 10 mg to 250 mg of the compound; or from 150 mg to 300 mg of the compound.

[0361] The pharmaceutical compositions may be dosed once per day or multiple times per day (e.g., 2, 3, 4, 5, or more times per day). Alternatively, pharmaceutical compositions may be dosed less often than once per day, e.g., once every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days, or once a month or once every few months. In some embodiments, the pharmaceutical compositions may be administered to a patient only a small number of times, e.g., once, twice, three times, etc.

[0362] Provided herein is a method of treating a patient in need of T cell therapy by administering to the patient a population of T cells having inducible expression of a CAR transgene (due to the presence of a gene regulation cassette disclosed herein), the method further comprising administering to the patient a pharmaceutical composition comprising a ligand (inducer), which binds to an aptamer disclosed herein, and where the CAR gene containsa gene regulation cassette disclosed herein comprising the aptamer, thereby provideing the ability to regulate expression of the CAR in response to the ligand.

[0363] Articles of manufacture and kits

[0364] Also provided are kits or articles of manufacture for use in the methods described herein. In aspects, the kits comprise the compositions described herein (e.g., compositions for delivery of RiboCAR-T cells comprising the CAR containing the gene regulation cassette; and compositions for delivery of the small molecule inducer) in suitable packaging. Suitable packaging for compositions described herein are known in the art, and include, for example, vials (such as sealed vials), vessels, ampules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may further be sterilized and / or sealed. Kit may also contain reagents for generating the RiboCAR-T cells disclosed herein, including expression cassettes for inducible expression of the RiboCAR, disclosed herein.

[0365] Also provided are kits comprising the compositions described herein. These kits may further comprise instruction(s) on methods of using the composition, such as methods and uses described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for performing the administration of the compositions or performing any methods described herein. For example, in some embodiments, the kit comprises a regulatable RiboCAR expression cassette in a rAAV HDR donor vector (that can be knocked into the TRAC locus), and CRISPR / cas system for generation of RiboCAR-T cells, a pharmaceutically acceptable carrier suitable for injection, and one or more of: a buffer, a diluent, a filter, a needle, a syringe, and a package insert with instructions for performing the injections. In some embodiments, the kit is suitable for intraocular injection, intramuscular injection, intravenous injection and the like.

[0366] It is to be understood and expected that variations of the compositions of matter and methods herein disclosed can be made by one skilled in the art and it is intended that such modifications are to be included within the scope of the present disclosure. The following Examples further illustrate the invention, but should not be construed to limit the scope of the invention in any way.

[0367] All references cited herein are hereby incorporated by reference in their entirety. All nucleotide sequences provided herein are in a 5′ to 3′ orientation unless stated otherwise.EXAMPLES

[0368] Example 1. A riboswitch can regulate CAR cell surface expression in HEK 293 cells in response to small molecule ligand in dose dependent manner

[0369] Experimental Procedures

[0370] Generation of ConstCAR and RiboCAR Constructs: Gene fragments containing DNA sequences of human EF1α promoter, a 19BBz CAR followed by bone growth hormone polyA sequence (bGHpA) or the riboswitch cassette, were synthesized (IDT) and assembled using a Gibson Assembly kit (NEB) to generate pEF1α-ConstCAR without riboswitch cassette, or pEF1α-RiboCAR containing riboswitch cassette.

[0371] Transfection and Flow cytometry: 3.5 x 104human embryonic kidney (HEK) 293 cells were plated in a 96-well flat bottom plate the day before transfection. Plasmid DNA (500 ng) was added to a tube or a 96-well U-bottom plate. Separately, TransIT-293 reagent (Mirus; 1.4 µL) was added to 50 µL Optimum I media (Life Technologies) and allowed to sit for 5 minutes at room temperature (RT). Then, 50 µL of this diluted transfection reagent was added to the DNA, mixed, and incubated at RT for 20 min. Finally, 7 µL of this solution was added to a well of cells in the 96-well plate. Four hours after transfection, the medium containing transfection solution was replaced by fresh culture medium with compounds such as compound 004 as small molecule inducers at indicated concentrations. 24 hour or 48 hours post transfection, the transfected cells were trypsinized and stained with PE labeled monoclonal Anti-FMC63 antibody (Acrobiosystems) and were subjected to flow cytometric analysis using Guava easyCyte HT flow cytometer and Incyte software (EMD Millipore).

[0372] Results

[0373] The inventors previously developed the alternative splicing based, synthetic aptamer riboswitch system for regulating gene expression via small molecule ligands. This synthetic riboswitch system, as described, for example, in WO2016 / 126747 and WO2023 / 111686 (each incorporated herein by reference in its entirety), contains an intron-alternative exon-aptamer- Intron cassette in which ligand binding to the aptamer controls the accessibility of the 5ʹ splice site of the 3ʹ intron, therefore allowing for regulation of the expression of a target gene through modulating alternative splicing (Figure 1A). The riboswitches have been shown to be applicable to regulating the expression of various genes, such as reporter genes, the human Epo gene, human hormone genes as well as genes encoding therapeutic antibodies (WO2016 / 126747 and WO 2023 / 111686). Here, the riboswitch was applied to the expressioncassette of chimeric antigen receptor (CAR) to regulate the expression of CAR receptor molecule in human cells.

[0374] CAR molecules are chimeric receptors that generally contain an extracellular domain for recognizing antigens on target tumor cells, a transmembrane domain, and an intracellular costimulatory and signaling domain for activating immune cells. As proof-of- concept, the well-characterized 19BBz CAR molecule was chosen for Examples 1-6. 19BBz CAR is a second-generation anti-CD19 CAR that contains an FMC63 single-chain variable fragment (scFv), an intracellular 4-1BB co-stimulatory, and CD3ζ signaling domains linked by a CD8α hinge and transmembrane domains sequences (Figure 1B). This CAR molecule has been delivered in a lentiviral vector to human T lymphocytes to produce the FDA-approved CAR-T cell product Tisagenlecleucel (Kymriah).

[0375] The gene regulation cassette containing a riboswitch containing the aptamer N5- 12G6 (WO2023 / 111686) was inserted at 8 positions in the coding sequence of the CAR, position between nucleotide 148 and 149 (RiboCAR-1), between nucleotide 389 and 390 (RiboCAR-2), between nucleotide 571 and 572 (RiboCAR-3), between nucleotide 655 and 656 (RiboCAR-4), between nucleotide 1087 and 1088 (RiboCAR-5), between nucleotide 1220 and 1221 (RiboCAR-6), between nucleotide 1293 and 1294 (RiboCAR-7), or position between nucleotide 1348 and 1349 (RiboCAR-8), generating constructs RiboCAR-1 to RiboCAR-8, respectively.

[0376] These 8 constructs were first tested for the cell surface expression of the CAR molecule in HEK 293 cells in response to the riboswitch small molecule inducer compound 004. As shown in Figure 2A, HEK 293 cells transfected with RiboCAR-6 construct expressed the same level of CAR as with the ConstCAR construct, irrespective of the presence or absence of the riboswitch inducer, indicating the lack of regulatability of expression of CAR by riboswitch. Cells transfected with RiboCAR-2, 5, 7 and 8 also expressed CAR, albeit at a reduced level, in the absence of compound 004, but expressed increased level of CAR when treated with compound 004. In contrast, HEK 293 cells transfected with the RiboCAR-1 or RiboCAR-3 constructs did not express CAR in the absence of riboswitch inducer compound 004 but expressed high levels of CAR in the presence of riboswitch inducer compound 004. These test results indicate that a riboswitch-containing gene regulation cassette provided a particularly high increase in induction of CAR expression when the gene regulation cassette was positioned between nucleotide 148 and 149 (RiboCAR-1) or in between nucleotide 571 and 572 (RiboCAR-3) in the coding sequence of CAR.

[0377] To further improve the induced expression level of the CARs, the riboswitch cassette was modified by adding a base pair to the effector stem (aptamer P1 stem) region in construct RiboCAR-3 construct, generating the RiboCAR-9 construct. As shown in Figure 2B, there was no detectable CAR molecule on the cell surface of HEK 293 cells in the absence of compound 004 in cells expressing RiboCAR-1, 3 or 9, respectively. However, treatment of compound 004 induced high levels of CAR expression, with RiboCAR-9 construct expressing the highest CAR levels among these three constructs. Further, the RiboCAR-9 construct expressed CARs in response to compound 004 in a dose-dependent manner. Also, when treated with 25 µM compound 004, the CAR expression level in cells expressing RiboCAR-9 construct reached the CAR expression level of cells expressing a ConstCAR, which did not contain the riboswitch cassette and expresses the CAR constitutively (Figures 1B, 3A, and 3B). The RiboCAR-9 construct was selected for further testing.

[0378] Example 2. RiboCAR constructs enable the inducible and reversible expression of a CAR molecule in Jurkat T cells

[0379] CAR expression in response to multiple small molecule compounds disclosed herein was tested in a lymphocyte-relevant cell line (Jurkat cells) transfected with the RiboCAR-9 construct. As shown in Figure 4A, Jurkat T cells transfected with the RiboCAR-9 construct did not express the CAR molecule on the cell surface in the absence of riboswitch inducer. However, the cells expressed the CAR when treated with the indicated inducer compounds. Compounds 074, 076, 111, and 114 were particularly potent in inducing CAR expression in Jurkat cells (Figures 4A and 4B). To further test the dynamics of riboswitch-regulated CAR, a stable Jurkat cell line was generated by knock-in of the RiboCAR-9 or ConstCAR expression cassettes, respectively, into the TRAC locus. Consistent with the transient transfection experiment, Jurkat T cells stably transfected with RiboCAR-9 did not express the CAR on the cell surface in the absence of compound 004. Treatment of the cells with compound 004 induced CAR expression on the cell surface of the stably transfected Jurkat cells in a dose dependent fashion (Figure 4C). Removal of the small molecule inducer led to rapid decrease in CAR cell surface expression in Jurkat cells stably transfected with RiboCAR-9 (Figures 4D and 4E). This data demonstrates the inducibility and reversibility of CAR expression regulated by riboswitches via small molecule compounds.

[0380] Example 3. Riboswitch-controlled CARs prevent T cell exhaustion induced by tonic CAR signaling during CAR-T cell expansion

[0381] Experimental Procedures:

[0382] AAV vector: Gibson assembly was used to clone the AAV plasmid containing AAV2 Inverted Terminal Repeats (ITRs) and EF1a promoter-driven RiboCAR cDNA or ConstCAR cDNA followed 3’ by bovine growth hormone polyA signal (bGHpA). The homology arms from the TRAC locus genomic sequences flanking the cas9 target site were cloned in reverse orientation flanking the promoter-CAR-polyA cassette. The left homology arm was 302 bp and the right homology arm was 304 bp. The AAV genome was packaged into AAV6 capsids (SignaGen Laboratories).

[0383] RNP production: RNP was produced by complexing two component gRNA (crRNA and tracrRNAs, synthesized by IDT) to Alt-R Cas9 (IDT) following IDT protocol for preparing RNP complex. The RNP complex contains 30 pmol / µl gRNA and 25 pmol / µl Alt-R Cas9 enzyme.

[0384] CAR-T cell generation: Human peripheral pan-T cells (Stemcell Technologies) were activated 24 hours post-thaw with Dynabeads (1:1 beads:cell) Human T-Activator CD3 / CD28 (ThermoFisher) in X-VIVOTM 15 medium (Lonza) supplemented with 5% human serum (Valley Biomedical), 200 U / ml IL-2 (R&D), 5 ng / ml IL-7 and 5 ng / ml IL-15 (R&D) at a density of 0.5 to 1 x 106cells per ml. The medium was changed every 2 days, and cells were re-plated at 0.5 to 1 x 106per ml. Forty-eight hours after initiating T cell activation, the CD3 / CD28 beads were magnetically removed, and T cells were resuspended in the P3 Primary Cell 4D-Nucleofector™ Solution using 20 μl buffer per one million cells.1 million T cells in 20 µl P3 buffer were mixed with 2 µl RNP complex and electroporated using 4D- NucleofectorTM X Unit (Lonza, EO-15 program). Following electroporation, cells were diluted into T cell culture medium without exogenous cytokines and incubated at 37°C, 5% CO2for 1 hour. Recombinant AAV6 donor vector containing ConstCAR or RiboCAR expression cassette and the homology arms, was added to T cells in RPMI 1640 medium 1 hour after electroporation at the multiplicity of infection (MOI) of 1 x 105and incubated at 37°C, 5% CO2for 3~4 hours. Subsequently, edited cells were cultured using standard conditions and expanded in T cell growth medium. Medium was replenished as needed to maintain a density of ~1 x 106cells per ml every 2 to 3 days.

[0385] Antibodies and Flow cytometry: The following antibodies were used to determine the CAR expression and the T cell phenotype: PE anti-FMC63 antibody (Acrobiosystems), APC anti-human CD62L (eBiosciences), FITC anti-human CD45RA (Invitrogen), APC anti- human CD39 antibody (eBiosciences), APC anti-human TCRalpha antibody (eBiosciences).2 x 104T cells in 200 µl T cell growth medium were treated with riboswitch inducer compound004 at the indicated concentrations for 24 hour in normal culture conditions. The treated T cells were then stained with fluorochrome-labeled antibodies at 4°C for 30 min and subjected to flow cytometric analysis using Guava easyCyte HT.

[0386] Results

[0387] The EF1a promoter-driven complementary DNA (cDNA) of ConstCAR or RiboCAR containing riboswitch cassette was targeted to the TRAC locus using a CRISPR / cas9 system and rAAV6 HDR donor vector, generating T cells with the knock-in of the CAR gene and simultaneous knock-out of endogenous T cell receptors (TCRs).

[0388] First, the expression of the CARs on the cell surface of the engineered T cells was examined. To assess CAR expression on the cell surface of the primary T cells, four days after CAR gene targeting, RiboCAR-T cells were treated for 20 hours with increasing concentrations of compound 004 and were examined for phenotype five days after CAR gene targeting. As shown in Figures 5A and 5B, in the absence of riboswitch inducer compound 004, CARs were not detectable on the cell surface of the RiboCAR-T cells, indicating the complete OFF state of the CAR gene in engineered T cells. However, in the presence of compound 004, RiboCAR- T cells expressed CARs on the cell surface robustly. Further, the levels of induced CAR expression were in correspondence with the concentration of the riboswitch inducer, indicating that the small molecule induced a riboswitch-regulated ON state of CAR expression in primary human T cells.

[0389] To determine whether the RiboCAR-T cells that were generated in the absence of an inducer (i.e., with the CAR gene expression in OFF state) were phenotypically different from T cells that constitutively express CAR, the expression of CD62L and CD45RA on T cells was examined. As shown in Figure 6A, the RiboCAR-T cell populations without or with compound 004 treatment exhibited a high fraction of CD62L+cells. Approximately 52% of the population (without compound 004 treatment) or CAR+cells (with compound 004 treatment) were CD45A+CD62L+cells that consisted mainly of naïve and stem cell-like memory T cells (naïve / Tscm cells). About17% of the population were CD45RA–CD62L–cells that constited mainly effector memory T cells. This less differentiated, naïve / stem cell-like memory T cell- enriched phenotype of RiboCAR-T cells was essentially indistinguishable from that of T cells without CAR engineering (the mock-transduced T cells in Figure 6A). In contrast, T cells engineered with ConstCAR were more differentiated, resulting in a significantly lower percentage of CD45A+CD62L+cells (approximately 11%) and a higher percentage of CD45RA–CD62L–cells (approximately 47%) that were mainly more differentiated effector memory T cells. In addition to the more differentiated phenotype, a higher fraction ofConstCAR-T cells (48%) expressed the CD39 molecule, a marker of exhausted T cells that inhibits T cell functionality. In contrast only a small fraction of RiboCAR-T cells or mock-T cells expressed CD39 (Figure 6B). These results indicate that RiboCAR-T cells in an OFF state essentially avoid tonic CAR signaling and prevent tonic CAR signaling induced T cell differentiation, thus preserving the CAR-T cell functionality.

[0390] Example 4. RiboCAR-T cells are more cytotoxic to tumor cells and produce lower level of cytokines than ConstCAR-T cells

[0391] Experimental Procedures

[0392] Cytotoxicity assay: The cytotoxicity of CAR-T cells was measured using standard luciferase-based assay. This assay employed Raji cells expressing firefly luciferase (Raji- ffLuc) as target cells. Raji-ffLuc cells were generated by stably transfecting Raji cells (ATCC) with CMV promoter-driven firefly luciferase cDNA. Briefly, the effector (E) and tumor target (T) cells were co-cultured in triplicates at E:T ratio of 2:1 using 96-well, flat-bottom plates with 1 × 104target cells in a total volume of 200 μl per well in medium without exogenous cytokines. Target cells alone were plated at the same cell density to determine the maximal luciferase expression (relative light units; RLUmax).48 h later, supernatants were collected for cytokine assay and 100 μl luciferase substrate (Bright-Glo, Promega) was added to the cell pellet in each well. Emitted luminescence was measured and quantified using a Tecan machine with 500 ms integration time. Cytotoxicity / Lysis was determined as (1−(RLUsample) / (RLUmax)) × 100.

[0393] Cytokine secretion assays: Supernatants were harvested from the cytotoxicity assay 48 hours after the CAR-T cells and Raji-ffLuc coculture and IL-2 and IFNγ were assayed using Human IL-2 or IFN-gamma Quantikine ELISA Kit (R&D systems) following the manufacturer’s instructions.

[0394] Antigen stimulation and CAR-T cell proliferation assay: For the repeat antigen stimulation expansion assay, on Day 0, Raji cells were treated with 8 µg / ml mitomycin C (Sigma) at 37 ºC for 2 hours and washed with PBS twice. Then, 2 x 105mitomycin C-treated Raji cells were plated in 12‐well plates and co-cultured with 2 x 105engineered T cells in 2 ml T cell cytokine-free culture medium containing 2.8 or 8.3 µM compound 004. On Day 3, viable CAR‐T cells were counted using Trypan Blue, and 2 × 105CAR-T cells were remixed with 2 x 105freshly prepared mitomycin C‐treated Raji cells in fresh culture medium containing compound 004 as on Day 0. The process was repeated for a total of three rounds of stimulation. The fold expansion after each stimulation was calculated by dividing the absolute number ofviable T cells number after three days culture by the absolute number of CAR+T cells seeded at the time of co-culture. The absolute number of CAR+T cells seeded was determined by multiplying 2 x 105by the percentage of CAR+T cells determined by flow cytometry. The cumulative fold expansion was calculated by multiplying the expansion folds after each round of stimulation.

[0395] Results

[0396] To assess antigen-induced cytotoxicity and cytokine secretion of RiboCAR-T cells and the effect of CAR expression level on the functionality of CAR-T cells, RiboCAR-T or ConstCAR-T cells were co-cultured with CD19+target cell Raji expressing firefly luciferase (Raji-ffLuc) at 2:1 ratio of effector to target cell (E:T ratio) in the absence or presence of increasing concentration of compound 004. In this cytotoxicity assay, RiboCAR-T cells were not pretreated with riboswitch inducer to induce the expression of CAR. Rather, RiboCAR-T cells, target Raji cells and riboswitch inducer were added together at the time of co-culture. As shown in Figure 7A, in the absence of riboswitch inducer, RiboCAR-T cells did not exhibit cytotoxic activity against target Raji-ffLuc cells. Inthe presence of riboswitch inducer compound 004, RiboCAR-T cells elicited robust tumor cell lysis in a dose dependent manner. In contrast, ConstCAR-T cells exhibited cytotoxic activity irrespective of the presence of riboswitch inducer, nevertheless, were less active in target cell killing (approximately 20%) when compared with RiboCAR-T cells treated with riboswitch inducer compound 004 (Figure 7A). These results indicate that riboswitches can regulate CAR-T cytotoxic functionality via regulating CAR expression, and riboswitch-controlled CAR-T cells are more effective in killing tumor cells than CAR-T cells with un-controlled CAR expression.

[0397] Additionally, antigen-induced cytokine IL-2 and INFγ secretion by CAR-T cells was determined. As noted above, cytotoxic activity of RiboCAR-T cells required the presence of both tumor antigen and riboswitch inducer. Similarly, RiboCAR-T cells secreted cytokines IL- 2 and INFγ only when both tumor antigen and riboswitch inducer were present. Further, the cells released cytokines in a dose-dependent manner upon exposure to increasing concentrations of riboswitch inducer compound 004 (Figures 7B and 7C). Notably, the levels of IL-2 and IFNγ produced by RiboCAR-T cells treated with compound 004 were significantly lower than the levels released by ConstCAR-T cells. Given the known cytokine release syndrome from conventional CAR-T cells treatment, the reduced cytokine secretion by RiboCAR-T cells could potentially avert this toxicity from CAR-T cell therapy.

[0398] Next, the expansion capacity of RiboCAR-T cells following tumor antigen stimulation was evaluated in vitro. As shown in Figure 7D, following three rounds of antigenchallenge, RiboCAR-T cells expanded approximately 218 fold, whereas ConstCAR-T cells underwent exhaustion following the third round of antigen stimulation. This observed robust antigen-stimulated proliferation and expansion capacity of RiboCAR-T cells was in corroboration with their less-differentiated and stem cell-like memory T cell phenotype which has been shown to be associated with the efficacy of CAR-T cell treatments.

[0399] Collectively, these in vitro results demonstrate that regulating CAR expression can modulate CAR-T cell functionality. RiboCAR-T cells produced in absence of the riboswitch inducer, resulting in no CAR expression, exhibited superior cytotoxicity against tumor cells, robust antigen-stimulated expansion capacity and yet reduced inflammatory cytokine release. Thus, riboswitch-controlled CAR-T cells can provide a more effective and safer option for CAR-T cell treatment.

[0400] Example 5. RiboCAR-T cells outperform ConstCAR-T cells in anti-tumor efficacy in vivo

[0401] Experimental Procedures

[0402] RiboCAR-T and ConstCAR-T cells were generated as described in Example 2. T cells were expanded in culture without riboswitch inducer such as compound 004.

[0403] Mouse xenograft model of human lymphoma: The animal study was performed at Mispro vivarium under a protocol approved by Mispro Institutional Animal Care and Use Committee. 8–10-week-old, female NOD / SCID / IL2Rγ− / −(NSG) mice (Jackson Laboratory) were injected with 1 x 106Raji-ffLuc cells via tail vein injection. Four days post Raji cell engraftment, mice were dosed once daily via oral gavage with either vehicle (0.5% Methyl cellulose (viscosity: 400 cP) and 0.25% Tween 80), or 100 mg / kg compound 004 formulated in vehicle. Four hours post first inducer dosing, 2 x 106CAR+T cells were infused intravenously into the Raji cell-bearing mice. Tumor progression or regression was monitored via bioluminescence imaging using LI-COR Pearl Trilogy Imaging System and quantified using Image Studio Ver 5.2 (LI-COR). Mice were euthanized when mice manifested persistent hunched posture, persistent scruffy coat, paralysis, impaired mobility, greater than 20% weight loss.

[0404] Results

[0405] The anti-tumor efficacy of riboswitch-regulatable CAR-T (RiboCAR-T) cells was compared with that of T cells constitutively expressing CARs (ConstCAR-T cells) in a mouse xenograft model of human B-cell lymphoma xenograft. NSG mice were inoculated with 1 x 106Raji-ffLuc cells by tail vein injection and 4 days later, were dosed orally with riboswitchsmall molecule inducer 4 hours before 2 x 106CAR-T cells injection. As shown in Figure 8A, in such lymphoma mice, 7 days post CAR-T cells injection, mice injected with ConstCAR-T cells exhibited lower tumor growth compared with mice injected with control mock-T cells or RiboCAR-T cells but without riboswitch inducer treatment, indicating the anti-tumor functionality of ConstCAR-T cells. However, in mice injected with the same number of RiboCAR-T cells but treated with small molecule inducer compound 004, the tumor burden was even lower than that in ConstCAR-T cells-injected mice. An additional 7 days post CAR- T cell injection, further tumor regression was observed in RiboCAR-T group with compound 004 treatment, whereas tumor progressed significantly in the control T cell group as well as in RiboCAR-T group without compound 004 treatment. Tumor progression was also observed in mice injected with ConstCAR-T cells that showed tumor growth inhibition 7 days post CAR- T cell injection (Figure 8A). Further, a prolonged survival was observed in mice with RiboCAR-T cells small molecule dosed group (Figure 8B).

[0406] These results from an in vivo anti-tumor study demonstrate the robust anti-tumor functionality of RibCAR-T cells and this robust antitumor efficacy only occurs in the presence of small molecule inducer. Further, these results demonstrate that RiboCAR-T cells that were produced in the absence of riboswitch inducer, and thus without expression of the CAR on T cells, outperformed the CAR-T cells that constitutively expressed CAR during in vitro expansion, suggesting incorporating the gene regulation riboswitch cassettes disclosed herein into a CAR in CAR-T cell manufacturing can significantly improve CAR-T cell therapy.

[0407] Example 6. Riboswitch inducers remotely regulate the anti-tumor efficacy of RiboCAR-T cells in vivo in a dose-dependent fashion

[0408] Experimental Procedures

[0409] RiboCAR-T and ConstCAR-T cells were generated as described in Example 2. T cells were expanded in culture without riboswitch inducer such as MXU-001 (also referred to herein as compound 004).

[0410] Mouse xenograft model of human lymphoma: The animal study was performed at Mispro vivarium under a protocol approved by Mispro Institutional Animal Care and Use Committee. 8–10-week-old, female NOD / SCID / IL2Rγ− / − (NSG) mice (Jackson Laboratory) were injected with 1 x 106Raji-ffLuc cells via tail vein injection. Three days post Raji cell engraftment, mice were dosed once daily via oral gavage with either vehicle (0.5% Methyl cellulose (viscosity: 400 cP) and 0.25% Tween 80), or 30 mg / kg or 100 mg / kg small molecule inducer formulated in vehicle.16 hr hours post first inducer dosing, 2 x 106CAR+RiboCAR-T cells were infused intravenously into the Raji cell-bearing mice. Tumor progression or regression was monitored via bioluminescence imaging using IVIS®Lumina III Imaging System (PerkinElmer), and tumor burden was analyzed and quantified using Living Image®4.7.4 software (PerkinElmer). Mice were euthanized when mice manifested persistent hunched posture, persistent scruffy coat, paralysis, impaired mobility, greater than 20 % weight loss.

[0411] Results

[0412] The anti-tumor efficacy of riboswitch-regulatable CAR-T cells (RiboCAR-T) in response to various doses of orally dosed riboswitch inducer Comp.004 and Comp.111 was evaluated in the same mouse xenograft model of human B-cell lymphoma as in Example 5. NSG mice inoculated with 1 x 106Raji-ffLuc cells by tail vein injection were dosed orally and daily with various doses of riboswitch small molecule inducer with the first dose starting 20 hours before injection of 2 x 106CAR-T cells.

[0413] 6 days post CAR-T cells injection, mice injected with ConstCAR-T cells exhibited lower tumor growth compared with mice injected with control mock-T cells or RiboCAR-T cells but without riboswitch inducer treatment, supporting the anti-tumor functionality of ConstCAR-T cells (Figures 9A-D). In mice injected with the same dose of RiboCAR-T cells but dosed orally with small molecule inducer Comp.004 or Comp.111, the tumor burden was significantly lower than that in RiboCAR-T cells-injected mice without inducer treatment or mock-T cell control group, indicating an enhanced anti-tumor activity of RiboCAR-T cells in the presence of riboswitch inducer. Further, there was no detectable tumor growth in mice treated with higher dose of either Comp. 004 or Comp. 111, indicating a potent and dose- responsive anti-tumor efficacy of riboswitch-controlled CAR-T cells. Further, 9 days post CAR-T cell injection, tumor progressed significantly in mock-T cell control group as well as in RiboCAR-T group without inducer treatment. Tumor progression was also observed in mice injected with ConstCAR-T cells and RiboCAR-T group with low dose inducer treatment, whereas tumor regression was retained in RiboCAR-T group treated with 100 mg / kg Comp. 004 or Comp.111. (Figures 9E and 9F) Consistent with the results in Example 5, RiboCAR- T cells exposed to a 100 mg / kg inducer treatment outperformed the same dose of ConstCAR- T cells (2 x 106CAR+T cells) in clearing tumor cells. With such superior anti-tumor activity of RiboCAR-T cells, a significantly prolonged survival was observed in those inducer-treated mice (Figure 10). These results from in vivo anti-tumor study further demonstrate the robust anti-tumor efficacy of RibCAR-T cells that can be remotely controlled by orally delivered riboswitch inducers.

[0414] Example 7. RiboCAR constructs enable the inducible and reversible expression of an anti-HER2 CAR

[0415] Experimental Procedures:

[0416] Generation of ConstCAR and RiboCAR targeting HER2 constructs: The sequence of anti-HER2 antibody clone 4D5-8 was used to replace the scFv in the 19BBz CAR, generating generate pEF1α-HER2 ConstCAR (without riboswitch cassette). Gene fragments containing DNA sequences of the riboswitch cassette were synthesized (IDT) and assembled using a Gibson Assembly kit (NEB) to generate pEF1α-HER2 RiboCAR containing the riboswitch cassette.

[0417] Transfection and Flow cytometry: As described in Example 1.

[0418] Results:

[0419] To further test the general utility of using a riboswitch to regulate CAR expression and CAR-T cell activity, several RiboCAR constructs were generated that target the HER2 antigen, which is highly expressed in various types of tumors. To generate these anti-HER2 CAR constructs, the sequences of the heavy and light chain variable domains of anti-HER2 clone 4D5-8 antibody was used. The gene regulation cassette containing a riboswitch containing the aptamer N5-12G6 (SEQ ID NO: 592) (disclosed in PCT Publication No. WO2023 / 111686, which is incorporated herein in its entirety) was inserted at various positions in the coding sequence of the HER2 CAR (SEQ ID NO: 1186): Insertion between nucleotide 148 and 149 (HER2-RiboCAR-A), between nucleotide 188 and 189 (HER2-RiboCAR-B), between nucleotide 376 and 377 (HER2-RiboCAR-C), between nucleotide 568 and 569 (HER2-RiboCAR-D), generating HER2-RiboCAR constructs-HER2 RiboCAR-A to HER2- RiboCAR-D, respectively. The aptamer stem (effector) in these constructs was 9 base pairs long. The riboswitch cassette with additional 1 base pair to the aptamer (effector) stem region (total of 10 base pair (bp) stem length) was inserted between nucleotide 568 and 569 (HER2- RiboCAR-E), between nucleotide 588 and 589 (HER2-RiboCAR-F), between nucleotide 634 and 635 (HER2-RiboCAR-G), between nucleotide 706 and 707 (HER2-RiboCAR-H), between nucleotide 740 and 741 (HER2-RiboCAR-I), or between nucleotide 776 and 777 (HER2- RiboCAR-J), generating HER2-RiboCAR constructs HER2-RiboCAR-E to HER2-RiboCAR- J, respectively.

[0420] First, the ten HER2-RiboCAR constructs were tested for the cell surface expression of the anti-HER2-CAR molecule in response to the riboswitch small molecule inducer compound 004 in HEK 293 cells. HEK 293 cells transfected with the different HER2- RiboCAR constructs expressed either undetectable or very minimal level of HER2 CARmolecule on the cell surface in the absence of the small molecule inducer compound 004 (Figure 11). However, cells transfected with HER2-RiboCAR constructs expressed increasing levels of CAR when treated with compound 004 in a dose dependent manner (Figure 11). These test results indicate that riboswitch regulates the CAR expression when positioned in the above listed positions.

[0421] Example 8. RiboCAR-T cells targeting HER2 are more cytotoxic to tumor cells than T cells constitutively expressing a HER2 CAR

[0422] Experimental Procedures

[0423] AAV vector, RNP complex and CAR-T generation: The ConstCAR construct constitutively expressing the anti-Her2 CAR and RiboCAR construct HER2 CAR-D were used to generate human primary CAR-T cells. The procedures are as described in Example 3.

[0424] Cytotoxicity assay: The cytotoxicity of CAR-T cells was measured using CellTiter- Glo Cell Viability Assay (Promega) with HER2-positive Calu-3 cells being the tumor target cells. Briefly, 1 x 10^4 target cells were seeded the day before the co-culture. The effector (E) and tumor target (T) cells were co-cultured in triplicates at E:T ratio of 2:1 using 96-well, flat- bottom plates in a total volume of 200 μl per well in medium with exogenous cytokines with increasing concentrations of comp 111.48 h later, cell viability was measured using CellTiter- Glo following the manufacturer’s manual. Emitted luminescence was measured and quantified using a Tecan machine with 500 ms integration time. Cytotoxicity / Lysis was determined as (1−(RLUsample) / (RLUmock-T)) × 100.

[0425] Cytokine secretion assays: Supernatants were harvested from the cytotoxicity assay 48 hours after the CAR-T cells and Calu-3 cell coculture. IFN-γ was assayed using Human IFN-gamma Quantikine ELISA Kit (R&D systems) following the manufacturer’s instructions.

[0426] Results:

[0427] The EF1a promoter-driven HER2 ConstCAR or the EF1a promoter-driven RiboCAR containing riboswitch cassette were targeted to the TRAC locus using a CRISPR / cas9 system and rAAV6 HDR donor vector. This generated T cells with the knock-in of the HER2 CAR or RiboCAR gene, respectively, and simultaneously the knock-out of endogenous T cell receptors (TCRs).

[0428] To assess HER2 CAR expression on the cell surface of the primary T cells, three days after CAR gene targeting, RiboCAR-T cells were treated for 20 hours with or without 25 µM compound 004 to induce CAR expression. As shown in Figure 12A, in the absence of riboswitch inducer compound 004, CARs were not detectable on the cell surface of theRiboCAR-T cells, indicating a complete OFF state of the HER2 CAR gene in the engineered T cells, a phenomenon observed with CD19 RiboCAR. However, in the presence of compound 004, RiboCAR-T cells expressed CARs on the cell surface robustly, indicating that the small molecule induced a riboswitch-regulated ON state of CAR expression in primary human T cells.

[0429] Furthermore, RiboCAR-T cells in the presence of inducer compound 111 (also referred to as M310) were activated more robustly by HER2 antigen on target Calu-3 cells indicated by CD69 expression, than ConstCAR-T cells (Figure 12B). This observed difference in T cell activation between RiboCAR-T cells and ConstCAR-T cells indicates that RiboCAR- T cells, which are expanded in absence of the small molecule inducer (i.e., expanded without expression of CAR molecules) are in a more active and functional state as compared to ConstCAR-T cells, which might be differentiated and exhausted by tonic signaling from CAR.

[0430] To assess antigen-induced cytotoxicity and cytokine secretion of RiboCAR-T cells, as well as the effect of CAR expression level on the functionality of CAR-T cells, RiboCAR- T or ConstCAR-T cells, respectively, were co-cultured with HER2+Calu-3 cells at 2:1 ratio of effector to target cell (E:T ratio) in the absence or presence of different concentrations of compound 111 for 48 h. T cells, target Calu-3 cells, and the small molecule inducer were added together at the time of co-culture. In the absence of riboswitch inducer, RiboCAR-T cells did not exhibit any cytotoxic activity against target Calu-3 cells (Figures 12C and 12E). In contrast, in the presence of riboswitch inducer compound 111, RiboCAR-T cells elicited robust tumor cell lysis in a dose dependent manner (Figures 12C and 12E). In contrast, ConstCAR- T cells exhibited cytotoxic activity irrespective of the presence of riboswitch inducer, nevertheless, were less active in target cell killing (approximately 30%) when compared with RiboCAR-T cells treated with riboswitch inducer compound 111 (Figure 12D). Similar results were observed at lower E:T ratios (Figure 12E). These results indicate that riboswitches can regulate CAR-T cytotoxic functionality via regulating CAR expression. Further, this data shows that riboswitch-controlled CAR-T cells are more effective in killing tumor cells than CAR-T cells with constitutive CAR expression.

[0431] Cytotoxic activity of RiboCAR-T cells requires the presence of both tumor antigen and riboswitch inducer (Figure 12E). Accordingly, antigen-induced IFN-γ secretion by CAR- T cells was determined. RiboCAR-T cells secreted IFN-γ only when both tumor antigen and riboswitch inducer were present (Figure 12F). Further, RiboCAR-T cells released cytokines in a dose-dependent manner upon exposure to riboswitch inducer compound 111 (Figure 12F). Notably, RiboCAR-T cells treated with lower inducer concentrations produced lower levels ofIFN-γ but elicited higher cytotoxic activity against tumor cells than ConstCAR-T cells, which is same as observed with CD19 CAR-T cells.

[0432] These results demonstrate that regulating CAR expression can modulate CAR-T cell functionality. RiboCAR-T cells expanded in absence of the small molecule inducer (i.e., expanded without CAR expression), exhibited superior cytotoxicity against tumor cells, yet reduced inflammatory cytokine release. Additionally, this data shows that riboswitch-regulated CAR expression and CAR-T cell activity is not limited to a specific CAR, underscoring the broad applicability of riboswitch technology in CAR-T cell therapy.

[0433] Example 9. Small molecule inducers can remotely regulate the anti-tumor activity of RiboCAR-T cells targeting HER2+tumors in vivo

[0434] Experimental Procedures:

[0435] RiboCAR-T and ConstCAR-T cells targeting HER2 antigen were generated as described in Example 8. T cells were expanded in culture without riboswitch inducer such as MXU-001 (compound 004).

[0436] Mouse xenograft model of human HER2+solid tumor: The animal study was performed at Mispro vivarium under a protocol approved by Mispro Institutional Animal Care and Use Committee. 8 to 10-week-old, female NOD / SCID / IL2Rγ− / −(NSG) mice (Jackson Laboratory) were injected with 2.5x106Calu-3 cells subcutaneously. 7 days post Calu-3 cell engraftment, mice were dosed once daily via oral gavage with either vehicle (0.5% Methyl cellulose (viscosity: 400 cP) and 0.25% Tween 80), or 300 mg / kg MXU-001 or M310 (compound 111) formulated in vehicle. 6 hours post first dosing of inducers, 2 x 106CAR+RiboCAR-T cells or ConstCAR-T cells, respectively, were infused intravenously into the Calu- 3 tumor-bearing mice. Tumor progression or regression was monitored, and tumor volume was calculated as V (mm3)=L (mm) xW (mm)^2*3.14 / 6.

[0437] Results:

[0438] The anti-tumor activity of riboswitch-regulatable CAR-T cells (RiboCAR-T) targeting HER2 against solid tumors in response to orally administered riboswitch inducers MXU-001 and M310 was assessed. To that end, NSG mice were inoculated with 2.5 x 106Calu-3 cells subcutaneously and dosed orally and daily with 300 mg / kg of riboswitch small molecule inducer MXU-001 or M310, respectively. The first dose was administered 6 hours before injection of 2 x 106ConstCAR-T or RiboCAR-T cells, respectively.

[0439] 8 days post CAR-T cell injection, mice injected with ConstCAR-T cells exhibited lower tumor growth compared with mice injected with control mock-T cells or RiboCAR-Tcells in the absence of riboswitch inducer treatment, confirming anti-tumor activity of the ConstCAR-T cells. In contrast, no anti-tumor activity was observed for RiboCAR-T cells in the absence of the riboswitch inducer. However, in mice that had been injected with the RiboCAR-T cells and further dosed orally with small molecule inducers MXU-001 or M310, respectively, tumor growth was significantly lower as compared to RiboCAR-T cells-injected mice without inducer treatment or the mock-T cell control group. This data shows the anti- tumor activity of RiboCAR-T cells in mice treated with a riboswitch inducer. By day 13 post CAR-T injection, tumor progressed significantly in mock-T cell control group as well as in RiboCAR-T group without inducer treatment. In contrast, tumor progression was halted, and the tumors were eliminated in the RiboCAR-T group treated with either MXU-001 or M310, respectively (Figures 13A and 13B). Consistent with the results in Example 5, RiboCAR-T cells treated with small molecule inducer outperformed the same dose of ConstCAR-T cells (2 x 106CAR+ T cells) in clearing tumor cells. As the result of the superior anti-tumor activity of RiboCAR-T cells, a significantly prolonged survival was observed in those inducer-treated mice (data not shown).

[0440] These results from an in vivo anti-tumor study further demonstrate the robust anti- tumor activity of RibCAR-T cells targeting solid tumors – an anti-tumor activity that can be remotely controlled by orally administered riboswitch inducers. The anti-tumor efficacy of CAR-T cells targeting the HER2 antigen on solid tumor is comparable with the anti-tumor efficacy observed for RiboCAR-T cells targeting CD19 on liquid tumors.

[0441] Taken together, these results provide evidence that incorporating a riboswitch into the CAR gene and expanding CAR-T cells in the absence of riboswitch inducer (i.e., without CAR molecule expression on T cells), can significantly improve CAR-T cell anti-tumor activity and CAR-T cell therapy efficacy. As shown herein, CAR expression cannot only be tightly regulated in dose dependent manner using riboswitches and small molecule inducers, but also that one can fine-tune the level of RiboCAR expression using small molecules. RiboCAR-T cells also have more naïve / stem cell memory T cell phenotype in culture as compared to ConstCAR-T cells. Further, RiboCAR-T cells have more potent cancer cell killing activity in vitro and in vivo, release lower levels of cytokines following tumor cell stimulation in vitro, and show higher tumor cell stimulated expansion capacity in vitro. Importantly, this effect is not limited to a specific CAR, as illustrated by the data provided herein, using CARs targeting liquid tumor (e.g., an anti-CD19 CAR), or CARs targeting solid tumor (e.g., an anti- HER2 CAR).SEQUENCE INFORMATION:

[0442] Fold induction in Tables 2-5 is calculated based on expression of luciferase in response to compound 004, in which the luciferase gene contains the aptamer sequence in the context of the gene regulation cassette of SEQ ID NO:598.

[0443] The sequences in Tables 2-5 were isolated from a screen, in which different regions of aptamer sequence 12C6-1 (SEQ ID NO:1), which contains a putative TPP aptamer sequence (AP008955.1 / 944373-944459; CP030117.1 / 954080-954166; CP023474.1 / 977011-977097) were randomized. Regions randomized included (1) junction (J) region (J2-4), which links paired (P) regions P2 and P4 (see Table 2); (2) loop (L) region L3a (see Table 3); (3) P4 / J4- 5 / J5-4 region (see Table 4); and in L5 region (see Table 5). Table 2. Aptamer sequences in which nucleotides at positions X7to X12were randomized as provided in the sequence CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCC X7X8X9X10X11X12CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4). The sequences in column 3, for the J2-4 (X7X8X9X10X11X12) (SEQ ID NO:600) region, are understood to be in the context of SEQ ID NO:4. As such, the SEQ ID NO listed in column 1 refers to the aptamer sequence in which the shorter sequence provided in column 3 is presented in the context of SEQ ID NO:4. Merely to illustrate, SEQ ID NO:7 (CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCC ACACCACCTGATCCGGATCATGCCGGCGCAGGGAG) referenced in column 1 corresponds to CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCC X7X8X9X10X11X12CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4), but the sequence X7X8X9X10X11X12(SEQ ID NO:600) within SEQ ID NO:4 is replaced with ACACCA (SEQ ID NO:602). The same system for nomenclature is used in Tables 3-6.Table 3. Aptamer sequences in which nucleotides at positions X1to X6were randomized as provided in the sequence CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX1X2AX3X4X5X6CCATCGA CCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3). The sequences in column 3, for the L3a (X1X2AX3X4X5X6) (SEQ ID NO:684) region, are understood to be in the context of SEQ ID NO:3. As such, the SEQ ID NO listed in column 1 refers to the aptamer sequence in which the shorter sequence provided in column 3 is presented in the context of SEQ ID NO:3.Table 4. Aptamer sequences in which nucleotides at positions X13to X15,X22and X23were randomized as provided in the sequence CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCC ATTGCACCTX13X14X15CCGGATCATGCCGGX22X23CAGGGAG (SEQ ID NO:5). The sequences in column 3, for the P4 / J4-5 to J5-4 (X13X14X15CCGGATCATGCCGGX22X23) (SEQ ID NO:770) region, are understood to be in the context of SEQ ID NO:5. As such, the SEQ ID NO listed in column 1 refers to the aptamer sequence in which the shorter sequence provided in column 3 is presented in the context of SEQ ID NO:5.Table 5. Aptamer sequences in which nucleotides at positions X16to X21were randomized as provided in the sequence CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCC ATTGCACCTGATCCGGX16X17X18X19X20X21CCGGCGCAGGGAG (SEQ ID NO:6). The sequences in column 3, for the L5 (X16X17X18X19X20X21) (SEQ ID NO:954) region, are understood to be in the context of in SEQ ID NO:6. As such, the SEQ ID NO listed in column 1 refers to the aptamer sequence in which the shorter sequence provided in column 3 is presented in the context of SEQ ID NO:6.Table 6. Additional sequences. SN= SEQ ID NO.

Claims

CLAIMS We Claim:

1. A composition comprising a population of T cells capable of expressing a chimeric antigen receptor (CAR) in response to a small molecule inducer wherein the T cells in the population comprise a polynucleotide comprising: (i) a first sequence encoding the chimeric antigen receptor, and (ii) a second sequence comprising a polynucleotide cassette encoding (a) an alternatively spliced exon flanked by a 5ʹ intron and a 3ʹ intron; and (b) a riboswitch, wherein the riboswitch comprises an aptamer linked to an effector region comprising stem-forming sequence that comprises the 5ʹ splice site sequence of the 3ʹ intron and sequence complementary to the 5ʹ splice site sequence of the 3ʹ intron; wherein the second sequence is inserted into the first sequence.

2. The composition of claim 1, wherein the T cells in the population of T cells have one or more of the following properties: (a) greater than about 30 %, greater than about 35 %, greater than about 40 %, greater than about 45 %; or greater than about 50 % of the T cells in the population of T cells have a naïve phenotype; (b) less than about 35 %; less than about 30 %; less than about 25 %; less than about 20 %; less than about 18 %; or less than about 16 % of the T cells in the population of T cells have a differentiated phenotype; (c) less than about 35 %; less than about 30 %; less than about 25 %; less than about 20 %; less than about 18 %; or less than about 16 % of the T cells in the population of T cells are CD45RA–,and / or CD62L–; (d) less than about 35 %; less than about 30 %; less than about 25 %; less than about 20 %; less than about 18 %; or less than about 16 % of the T cells in the population of T cells are exhausted T cells; (e) enhanced cytotoxicity against cancer cells expressing the CAR antigen as compared to T cells that constitutively express the CAR; (f) reduced cytokine production when exposed to cancer cells expressing the CAR antigen as compared to T cells that constitutively express the CAR; (g) enhanced capacity for expansion in response to exposure to the CAR antigen as compared to T cells that constitutively express the CAR; and / or(h) reduced levels of T cell exhaustion following exposure to the CAR antigen as compared to T cells that constitutively express the CAR.

3. The composition of claim 2, wherein greater than about 30 %, greater than about 35 %, greater than about 40 %, greater than about 45 %, or greater than about 50 % of the T cells in the population of T cells are CD62L+CD45RA+, CCR7+, CD127+, or CD132+, or any combination thereof.

4. The composition of claim 3, wherein greater than about 30 %; greater than about 35 %; greater than about 40 %; greater than about 45 %, or greater than about 50 % of the T cells in the population of T cells are CD62L+and / or CD45RA+.

5. The composition of claim 4, wherein greater than about 30 %, greater than about 35 %, greater than about 40 %, greater than about 45 %, or greater than about 50 % of the T cells in the population of T cells are CD62L+.

6. The composition of any one of claims 2-5, wherein less than about 35 %, less than about 30 %, less than about 25 %, less than about 20 %, less than about 18 %, or less than about 16 % of the T cells in the population of T cells have a differentiated phenotype effector memory or effector cell type.

7. The composition of any one of claims 2-6, wherein the exhausted T cells are CD39+, PD- 1+, CTLA-4+, LAG-3+, TIM-3+, 2B4 / CD244 / SLAMF4+, CD160+, or TIGIT+, or any combination thereof.

8. The composition of claim 7, wherein the exhausted T cells are CD39+.

9. The composition of any one of claims 2-8, wherein the reduced cytokine production is reduced production of TNFα, IL-2, IFNγ, or combinations thereof.

10. The composition according any one of the preceding claims, wherein the polynucleotide sequence comprising the first and the second sequence is present in the T cell receptor alpha constant chain (TRAC) locus of the T cells.

11. A method for making the composition according to any one of the preceding claims, the method comprising: (a) obtaining a population of T cells; (b) introducing into the T cells in the population a polynucleotide comprising: (i) a first sequence encoding the chimeric antigen receptor, and (ii) a second sequence comprising a polynucleotide cassette encoding (a) an alternatively spliced exon flanked by a 5ʹ intron and a 3ʹ intron; and (b) a riboswitch, wherein the riboswitch comprises an aptamer linked to an effector region comprising stem-forming sequence that comprises the 5ʹ splice site sequence of the 3ʹ intron and sequence complementary to the 5ʹ splice site sequence of the 3ʹ intron; wherein the second sequence is inserted into the first sequence; and (c) expanding the T cells in culture.

12. The composition of any one of claims 1-10 or the method of claim 11, wherein the aptamer binds a small molecule ligand.

13. The composition of any one of claims 1-10 or 12 or the method of claim 11 or 12, wherein the 5ʹ splice site sequence of the 3ʹ intron comprises GTGAGT, GTAAGC, GTAAGT, GTGTGG, or GTANGT, wherein and N represents A, G, C, or T.

14. The composition or the method of claim 13, wherein the 5ʹ splice site sequence of the 3ʹ intron comprises GTAAGT, GTGAGT, or GTAATG.

15. The composition or the method of claim 14, wherein the 5ʹ splice site sequence of the 3ʹ intron comprises GTAATG.

16. The composition of any one of claims 1-10 or 12-15 or the method of any one of claims 11-14, wherein the alternatively-spliced exon (a) is derived from exon 2 of the human dihydrofolate reductase gene, human Wilms tumor 1 exon 5, mouse calcium / calmodulin- dependent protein kinase II delta exon 16, or SIRT1 exon 6; or (b) is synthetic.

17. The composition or the method of claim 16, wherein the alternatively-spliced exon is the modified exon 2 from human DHFR 18. The composition or the method of claim 16, wherein the alternatively-spliced exon comprises SEQ ID NO: 590 or 591.

19. The composition of any one of claims 1-10 or 12-18 or the method of any one of claims 11-18, wherein the alternatively-spliced exon has been modified by one or more of the group consisting of altering the sequence of an exon splice enhancer, altering the sequence of exon splice silencer, adding an exon splice enhancer, and adding an exon splice silencer.

20. The composition of any one of claims 1-10 or 12-19 or the method of any one of claims 11-19, wherein the 5ʹ intron comprises a stop codon in frame with the target gene.

21. The composition of any one of claims 1-10 or 12-20 or the method of any one of claims 11-20, wherein the 5ʹ and 3ʹ introns (a) are derived from an endogenous intron from the target gene, (b) are exogenous to the target gene, (c) are derived from intron 2 of the human β-globin gene.

22. The composition of any one of claims 1-10 or 12-21 or the method of any one of claims 11-21, wherein the 5ʹ and 3ʹ introns are each independently from about 50 to about 300 nucleotides in length.

23. The composition or the method of claim 22, wherein the 5ʹ and 3ʹ introns are each independently from about 125 to about 240 nucleotides in length.

24. The composition of any one of claims 1-10 or 12-23 or the method of any one of claims 11-23, wherein the stem-forming sequence is 8 to 11 base pairs in length.

25. The method of any one on claims 11-24, wherein the step of expanding the T cells in culture occurs in absence of the small molecule ligand.

26. A method for treating cancer by administering to a subject in need thereof (i) a composition according to any one of claims 1-10 or 12-24; and (ii) a composition comprising a small molecule ligand that binds the aptamer.

27. The method of claim 26, wherein the composition and the small molecule ligand are administered concurrently.

28. The method of claim 26, wherein the composition and the small molecule ligand are administered consecutively.

29. The method of any of claims 26-28, wherein the subject is a human.

30. The composition according to any one of claims 1-10 or 12-24 or the method according to any one of claims 11-29, wherein the aptamer comprises a sequence that is at least 90% identical to any one of SEQ ID NOs:1 or 7-588.

31. The composition or the method according to claim 30, wherein the aptamer comprises a sequence that is at least 95% identical to any one of SEQ ID NOs:1 or 7-588.

32. The composition or the method according to claim 31, wherein the aptamer comprises any one of SEQ ID NOs:1 or 7-588.

33. The composition according to any one of claims 1-10, 12-24, or 29-32, or the method according to any one of claims 11-32, wherein the small molecule inducer is selected from a compound according to any one of Formulas I – XXII .

34. The composition according to any one of claims 1-10, 12-24, or 29-32, or the method according to any one of claims 11-32, wherein the small molecule inducer is selected from the group consisting of:NH HN 035 N 042 N N NHN Cl HN N N 077 N N 084 N N

Images