Polypeptides having alkaline phosphatase activity for animal feed

Abstract

An animal feed additive comprising a polypeptide having alkaline phosphatase activity is described, wherein the selected polypeptides have activity against relevant biological targets, are thermostable, and have high three-dimensional similarity to each other and to human intestinal alkaline phosphatase and close proximity on the phylogenetic tree.

Description

[0001] POLYPEPTIDES HAVING ALKALINE PHOSPHATASE ACTIVITY FOR ANIMAL FEED

[0002] Reference to a Sequence Listing

[0003] This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference.

[0004] FIELD OF THE INVENTION

[0005] The present invention relates to polypeptides having alkaline phosphatase activity, polynucleotides encoding the polypeptides, nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

[0006] BACKGROUND OF THE INVENTION

[0007] ALP is an enzyme that removes phosphates from a variety of substrates. ALPs are active in diverse biological processes. ALPs are found in all tissues in the human body but is mostly concentrated in the bones, kidneys, liver, intestines, and placenta. Intestinal alkaline phosphatase (IAP) has been most studied to date.

[0008] Calf Intestinal Alkaline Phosphatase (CIAP) is a well known and commercially available alkaline phosphatase. WO2022196538 discloses variants of a Calf Intestinal Alkaline Phosphatase (CIAP) with improved thermal stability. However, CIAP has low or no gastric or pepsin stability. CIAP is therefore not suitable for use as an animal feed additive. Accordingly, there is a need in the art for novel alkaline phosphatases.

[0009] Elanco (US20180326020) describes methods and compositions for reducing the environmental impact of animal waste using an alkaline phosphatase from Paenibacillus lentus. The alkaline phosphatase described in US20180326020 corresponds to SEQ ID NO:50 of the present invention. WO2023 / 102002 describes variants of a Paenibacillus lentus alkaline phosphatase with improved heat tolerance.

[0010] SUMMARY OF THE INVENTION

[0011] Polypeptides having alkaline phosphatase activity for use in animal feed are described.

[0012] It has surprisingly been found that polypeptides having alkaline phosphatase activity of bacterial origin, that, despite having low sequence identity to human intestinal alkaline phosphatase and low sequence identity to each other, have high three-dimensional overlap, as measured on Alphafold™. Furthermore, the polypeptides share a structural feature with human intestinal alkaline phosphatase in that they comprise a similar yet generally unstructured variable sequence that loops out from the rest of the polypetide. Still further, it has been found that these polypeptides, despite being of bacterial origin, have a close proximity with human intestinal alkaline phosphatase on the phylogenetic tree when measuring the ancestral distance matrix between the polypeptides. The polypeptides with these three-dimensional structural similarities and taxonomic proximity to human alkaline phosphatase, have high activity on key biotarget and good thermostability compared to known alkaline phosphatases.

[0013] An aspect of the invention is directed to an animal feed additive comprising a polypeptide having alkaline phosphatase activity, wherein the polypeptide is characterized as having at least two, such as at least three properties selected from the group consisting of; i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a Template Modelling score, as calculated in Example 9, versus the human intestinal ALP (SEQ ID NO: 108) of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NQ:108); iii. the polypeptide has a Template Modelling score, as calculated in Example 9, versus human intestinal ALP (SEQ ID NQ:108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.88; and iv. the polypeptide has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1.0 and 2.0, such as from 1.1 to 1.9; wherein the polypeptide is of bacterial origin or a variant thereof.

[0014] Another aspect of the invention is directed to an animal feed additive comprising a polypeptide having alkaline phosphatase activity selected from the group consisting of a. a polypeptide having at least 70% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56; b. a polypeptide having at least 70% sequence identity to a mature polypeptide of polypeptide of (a) c. a polypeptide encoded by a polynucleotide having at least 70% sequence identity to the mature polypeptide coding sequence of a polypeptide of (a) or (b); d. a polypeptide derived from a polypeptide of (a) or (c), or a mature polypeptide of (b) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids; e. a polypeptide derived from the polypeptide of (a), (b), (c), or (d) wherein the N- and / or C-terminal end has been extended by the addition of 1 to 50 amino acids, such as 1 to 40, 1 to 30 or 1 to 20 amino acids; and f. a fragment of the polypeptide of (a), (b), (c), (d), or (e); wherein the polypeptide of (a), (b), (c), (d), or (e) or the fragment of (f) has alkaline phosphatase activity; and wherein the polypeptide is of bacterial origin or a variant thereof.

[0015] Another aspect of the invention is directed to a use of a polypeptide as defined by the invention for the preparation of an animal feed additive, an animal feed composition or a zootechnical additive.

[0016] Another aspect of the invention is directed to a method of increasing body weight gain in an animal comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention. Another aspect of the invention is directed to a method of improving the food conversion ratio of an animal comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention.

[0017] Another aspect of the invention is directed to a method of the detoxification of lipopolysaccharide in an animal comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention.

[0018] Another aspect of the invention is directed to a method of reducing the immune response in an animal comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention. Another aspect of the invention is directed to a method of reducing inflammation in an animal comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention. Another aspect of the invention is directed to a method of reducing IL or TNF response in an animal comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention.

[0019] Another aspect of the invention is directed to a method of maintaining or supporting intestinal health, or improving intestinal health promoting growth of commensal bacteria, in an animal comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention. Another aspect of the invention is directed to a method for the maintenance of an effective gut barrier comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention. Another aspect of the invention is directed to a method to prevent colitis or the inflammation of the lining of the colon in an animal comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention. Another aspect of the invention is directed to a method of maintaining or restoring (healthy) gut flora in an antibiotic treated animal comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention. Another aspect of the invention is directed to a method of preventing or reducing intestinal colonization or systemic translocation of unwanted bacteria, or for “dysbiosis”, namely for changing of the bacterial and / or archaeal balance of the intestinal microbiota, comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention.

[0020] Another aspect of the invention is directed to a method to prevent low birth weight, such as induced by perinatal undernutrition comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention. Another aspect of the invention is directed to a method of improving weight gain in animals with below average birth weight comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention. Another aspect of the invention is directed to a method of preventing weight loss in infected animal comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention.

[0021] Another aspect of the invention is directed to a method of regulating fat absorption or neutralising acidic digesta entering the small intestine via stimulation of bicarbonate secretions and surface pH comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention. Another aspect of the invention is directed to a method of preventing antibiotic-associated infections from Salmonella, such as Salmonella entericaserovar Typhimurium (S. Typhimurium) and / or Clostridium, such as Clostridium difficile comprising feeding said animal the polypeptide or the animal feed additive as defined by the invention.

[0022] BRIEF DESCRIPTION OF THE FIGURES

[0023] Figure 1 is a phylogenetic tree of the bacterial full-length sequences of wt ALPs of the invention including vs human intenstinal ALP (hiALP; SWISSPROT P09923). The closest bacterial ALPs to hiALP are in the box.

[0024] Figure 2 illustrates the 3-dimensional structure of the hiALP as calculated using AlphaFold™. The same was generated for all sequences of the invention and the structures were then inspected using a common 3D protein visualization tool, PyMol [3.1]. After applying the align function within PyMol, a common ‘variable region’ is identified in the bacterial backbones of the invention and in hiALP. The variable region is highlighted in the black box in black, while the remaining structure of hiALP is shown in grey.

[0025] Figure 3 illustrates the variable regions of many different bacterial ALPSs. In hiALP, the ‘variable region’ spans from aa 370-460. To identify the bacterial ALPs that share a common fold of the ‘variable region’, all structures are visually inspected and grouped. This results in 7 groups as visualized in the figure. For simplicity, only the ‘variable region’ is shown. It was found that those in group 4 and 5 were structurally similar, as determined by the Template Modelling score using AlphaFold™.

[0026] Figure 4 (Figure 4a, 4b, 4c) shows the sequence alignment of the variable regions of the thirteen polypeptides with high Template Modelling scores with the variable region of human intestinal ALP.

[0027] BRIEF DESCRIPTION OF THE SEQUENCES

[0028] SEQ ID NO: 1 is a polypeptide obtained from Parageobacillus caldoxylosilyticus having alkaline phosphatase activity.

[0029] SEQ ID NO: 2 is a polypeptide obtained from Geobacillus thermoleovorans having alkaline phosphatase activity.

[0030] SEQ ID NO: 3 is a polypeptide obtained from Sporolactobacillus sp-63357 having alkaline phosphatase activity.

[0031] SEQ ID NO: 4 is a polypeptide obtained from Anoxybacillus caldiproteolyticus having alkaline phosphatase activity.

[0032] SEQ ID NO: 5 is a polypeptide obtained from Geobacillus thermoleovorans having alkaline phosphatase activity.

[0033] SEQ ID NO: 6 is a polypeptide obtained from Paenibacillus xylanexedens having alkaline phosphatase activity.

[0034] SEQ ID NO: 7 is a polypeptide obtained from Sporolactobacillus sp-63357 having alkaline phosphatase activity.

[0035] SEQ ID NO: 8 is a polypeptide obtained from Paenibacillus panacisoli having alkaline phosphatase activity.

[0036] SEQ ID NO: 9 is a polypeptide obtained from Collimonas pratensis having alkaline phosphatase activity. SEQ ID NO: 10 is a polypeptide obtained from Paenibacillus illinoisensis having alkaline phosphatase activity.

[0037] SEQ ID NO: 11 is a polypeptide obtained from Neobacillus bataviensis having alkaline phosphatase activity.

[0038] SEQ ID NO: 12 is a polypeptide obtained from Aeromonas salmonicida subsp. salmonicida having alkaline phosphatase activity.

[0039] SEQ ID NO: 13 is a polypeptide obtained from Paenibacillus amylolyticus having alkaline phosphatase activity.

[0040] SEQ ID NO: 14 is a polypeptide obtained from Serratia plymuthica having alkaline phosphatase activity.

[0041] SEQ ID NO: 15 is a polypeptide obtained from Cytobacillus firmus having alkaline phosphatase activity.

[0042] SEQ ID NO: 16 is a polypeptide obtained from Priestia megaterium having alkaline phosphatase activity.

[0043] SEQ ID NO:17 is a polypeptide obtained from Trichoderma citrinoviride having alkaline phosphatase activity.

[0044] SEQ ID NO: 18 is a polypeptide obtained from Truncatella angustata having alkaline phosphatase activity.

[0045] SEQ ID NO: 19 is a polypeptide obtained from Morchella semilibera having alkaline phosphatase activity.

[0046] SEQ ID NO: 20 is a polypeptide obtained from Serratia ficaria having alkaline phosphatase activity.

[0047] SEQ ID NO: 21 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0048] SEQ ID NO: 22 a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0049] SEQ ID NO: is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0050] SEQ ID NO: 24 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0051] SEQ ID NO: 25 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0052] SEQ ID NO: 26 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0053] SEQ ID NO: 27 is a polypeptide obtained from Sporormia fimetaria having alkaline phosphatase activity. SEQ ID NO: 28 is a polypeptide obtained from Thermoascus crustaceus having alkaline phosphatase activity.

[0054] SEQ ID NO: 29 is a polypeptide obtained from Thielavia australiensis having alkaline phosphatase activity.

[0055] SEQ ID NO: 30 is a polypeptide obtained from Chaetomium thermophilum var. thermophilum having alkaline phosphatase activity.

[0056] SEQ ID NO: 31 is a polypeptide obtained from Aspergillus sp. XZ2669 having alkaline phosphatase activity.

[0057] SEQ ID NO: 32 is a polypeptide obtained from Colletotrichum sp-53045having alkaline phosphatase activity.

[0058] SEQ ID NO: 33 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0059] SEQ ID NO: 34 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0060] SEQ ID NO: 35 is a polypeptide obtained from Caulobacter sp-63731 having alkaline phosphatase activity.

[0061] SEQ ID NO: 36 is a polypeptide obtained from Caulobacter vibrioides having alkaline phosphatase activity.

[0062] SEQ ID NO: 37 is a polypeptide obtained from Serratia nematodiphila having alkaline phosphatase activity.

[0063] SEQ ID NO: 38 is a polypeptide obtained from Loktanella salsilacus having alkaline phosphatase activity.

[0064] SEQ ID NO: 39 is a polypeptide obtained from Sphingopyxis chilensis having alkaline phosphatase activity.

[0065] SEQ ID NO: 40 is a polypeptide obtained from Tolypocladium sp. XZ2657 having alkaline phosphatase activity.

[0066] SEQ ID NO: 41 is a polypeptide obtained from Penicillium vasconiae having alkaline phosphatase activity.

[0067] SEQ ID NO: 42 is a polypeptide obtained from Cladobotryum sp having alkaline phosphatase activity.

[0068] SEQ ID NO: 43 is a polypeptide obtained from Taifanglania sp. ZY039 having alkaline phosphatase activity.

[0069] SEQ ID NO: 44 is a polypeptide obtained from Achaetomium sp. ZY150 having alkaline phosphatase activity.

[0070] SEQ ID NO: 45 is a polypeptide obtained from Chaetomium sp. ZY474 having alkaline phosphatase activity. SEQ ID NO: 46 is a polypeptide obtained from Fontibacillus aquaticus having alkaline phosphatase activity.

[0071] SEQ ID NO: 47 is a polypeptide obtained from Paenibacillus sp-19179 having alkaline phosphatase activity.

[0072] SEQ ID NO: 48 is a polypeptide obtained from Paenibacillus sp-62606 having alkaline phosphatase activity.

[0073] SEQ ID NO: 49 is a polypeptide obtained from Paenibacillus woosongensis having alkaline phosphatase activity.

[0074] SEQ ID NO: 50 is a polypeptide obtained from Bacillus lentus / Lederbergia lenta having alkaline phosphatase activity and is the polypeptide described in LIS20180326020.

[0075] SEQ ID NO: 51 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0076] SEQ ID NO: 52 is a polypeptide obtained from Paenibacillus sp-62603 having alkaline phosphatase activity.

[0077] SEQ ID NO: 53 is a polypeptide obtained from Neobacillus bataviensis having alkaline phosphatase activity.

[0078] SEQ ID NO: 54 is a polypeptide obtained from Paenibacillus taohuashanense having alkaline phosphatase activity.

[0079] SEQ ID NO: 55 is a polypeptide obtained from Hyphomonas hirschiana having alkaline phosphatase activity.

[0080] SEQ ID NO: 56 is a polypeptide obtained from Hyphomonas oceanitis having alkaline phosphatase activity.

[0081] SEQ ID NO: 57 is a polypeptide obtained from Deinococcus radiodurans having alkaline phosphatase activity.

[0082] SEQ ID NO: 58 is a polypeptide obtained from Deinococcus gobiensis having alkaline phosphatase activity.

[0083] SEQ ID NO: 59 is a polypeptide obtained from Deinococcus pimensis having alkaline phosphatase activity.

[0084] SEQ ID NO: 60 is a polypeptide obtained from Deinococcus sp-17890 having alkaline phosphatase activity.

[0085] SEQ ID NO: 61 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity,

[0086] SEQ ID NO: 62 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity,

[0087] SEQ ID NO: 63 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity,

[0088] SEQ ID NO: 64 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity,

[0089] SEQ ID NO: 65 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity,

[0090] SEQ ID NO: 66 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 67 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 68 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 69 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 70 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 71 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 72 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 73 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 74 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 75 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 76 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 77 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 78 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 79 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity, SEQ ID NO: 80 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity, SEQ ID NO: 81 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity, SEQ ID NO: 82 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity, SEQ ID NO: 83 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity, SEQ ID NO: 84 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity, SEQ ID NO: 85 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity, SEQ ID NO: 86 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity, SEQ ID NO: 87 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 88 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 89 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 90 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 91 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 92 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 93 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 94 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity, SEQ ID NO: 95 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity, SEQ ID NO: 96 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity, SEQ ID NO: 97 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity, SEQ ID NO: 98 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity, SEQ ID NO: 99 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0091] SEQ ID NO: 100 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity SEQ ID NO: 101 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity SEQ ID NO: 102 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity SEQ ID NO: 103 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0092] SEQ ID NO: 104 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0093] SEQ ID NO: 105 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0094] SEQ ID NO: 106 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0095] SEQ ID NO: 107 is the polypeptide described as SEQ ID NO: 1 in WO2023 / 102002, a variant of

[0096] SEQ ID NQ:50.

[0097] SEQ ID NQ:109: is the ‘variable region’ of SEQ ID NQ:108, spanning from aa 370 to 460.

[0098] SEQ ID NQ:110: is the ‘variable region’ of SEQ ID NO:55, spanning from aa 370 to 479.

[0099] SEQ ID NO: 111 : is the ‘variable region’ of SEQ ID NO:38, spanning from aa 342 to 451.

[0100] SEQ ID NO:112: is the ‘variable region’ of SEQ ID NO:21 , spanning from aa 353 to 462.

[0101] SEQ ID NO:113: is the ‘variable region’ of SEQ ID NO:37 , spanning from aa 354 to 452.

[0102] SEQ ID NO:114: is the ‘variable region’ of SEQ ID NO:56, spanning from aa 379 to 481.

[0103] SEQ ID NO: 115: is the ‘variable region’ of SEQ ID NQ:20, spanning from aa 354 to 452.

[0104] SEQ ID NO:116: is the ‘variable region’ of SEQ ID NO:14, spanning from aa 354 to 452.

[0105] SEQ ID NO: 117: is the ‘variable region’ of SEQ ID NO:36, spanning from aa 350 to 447.

[0106] SEQ ID NO: 118: is the ‘variable region’ of SEQ ID NO:35, spanning from aa 353 to 450.

[0107] SEQ ID NO:119: is the ‘variable region’ of SEQ ID NO:34, spanning from aa 310 to 407.

[0108] SEQ ID NQ:120: is the ‘variable region’ of SEQ ID NO:39, spanning from aa 332 to 428.

[0109] SEQ ID NO:121 : is the ‘variable region’ of SEQ ID NO:12, spanning from aa 313 to 408.

[0110] SEQ ID NO:122: is the ‘variable region’ of SEQ ID NO:9, spanning from aa 317 to 418.

[0111] DETAILED DESCRIPTION OF THE INVENTION

[0112] Definitions

[0113] In accordance with this detailed description, the following definitions apply. Note that the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0114] Unless defined otherwise or clearly indicated by context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0115] Animal: The term “animal” refers to all animals except humans. Examples of animals are non-ruminants, and ruminants. Ruminant animals include, for example, animals such as sheep, goats, cattle, e.g. beef cattle, cows, and young calves, deer, yank, camel, llama and kangaroo. Non-ruminant animals include mono-gastric animals, e.g. pigs or swine (including, but not limited to, piglets, growing pigs, and sows); poultry such as turkeys, ducks and chicken (including but not limited to broiler chicks, layers); horses (including but not limited to hotbloods, coldbloods and warm bloods), young calves; fish (including but not limited to amberjack, arapaima, barb, bass, bluefish, bocachico, bream, bullhead, cachama, carp, catfish, catla, chanos, char, cichlid, cobia, cod, crappie, dorada, drum, eel, goby, goldfish, gourami, grouper, guapote, halibut, java, labeo, lai, loach, mackerel, milkfish, mojarra, mudfish, mullet, paco, pearlspot, pejerrey, perch, pike, pompano, roach, salmon, sampa, sauger, sea bass, seabream, shiner, sleeper, snakehead, snapper, snook, sole, spinefoot, sturgeon, sunfish, sweetfish, tench, terror, tilapia, trout, tuna, turbot, vendace, walleye and whitefish); and crustaceans (including but not limited to shrimps and prawns).

[0116] Animal feed: The term “animal feed” refers to any compound, preparation, or mixture suitable for, or intended for intake by an animal. Animal feed for a mono-gastric animal typically comprises concentrates as well as vitamins, minerals, enzymes, direct fed microbial, amino acids and / or other feed ingredients (such as in a premix) whereas animal feed for ruminants generally comprises forage (including roughage and silage) and may further comprise concentrates as well as vitamins, minerals, enzymes direct fed microbial, amino acid and / or other feed ingredients (such as in a premix).

[0117] Body Weight Gain: The term “body weight gain” means an increase in live weight of an animal during a given period of time e.g. the increase in weight from day 1 to day 21.

[0118] Composition: The term “composition” refers to a composition comprising a carrier and at least one bacterial strain / enzyme of the present invention. The compositions described herein may be mixed with an animal feed and referred to as a “mash feed.”

[0119] Concentrates: The term “concentrates” means feed with high protein and energy concentrations, such as fish meal, molasses, oligosaccharides, sorghum, seeds and grains (either whole or prepared by crushing, milling, etc from e.g. corn, oats, rye, barley, wheat), oilseed press cake (e.g. from cottonseed, safflower, sunflower, soybean, rapeseed / canola, peanut or groundnut), palm kernel cake, yeast derived material and distillers grains (such as wet distillers grains (WDS) and dried distillers grains with solubles (DDGS)).

[0120] Direct Fed Microbial: The term “direct fed microbial” means live micro-organisms including spores which, when administered in adequate amounts, confer a benefit, such as improved digestion or health, on the host.

[0121] Effective amount / concentration / dosage: The terms “effective amount”, “effective concentration”, or “effective dosage” are defined as the amount, concentration, or dosage of the bacterial strain(s) / enzyme(s) sufficient to improve the digestion or yield of an animal. The actual effective dosage in absolute numbers depends on factors including: the state of health of the animal in question, other ingredients present. The “effective amount”, “effective concentration”, or “effective dosage” of the bacterial strain(s) / enzyme(s) may be determined by routine assays known to those skilled in the art. Feed Conversion Ratio: The term “feed conversion ratio” the amount of feed fed to an animal to increase the weight of the animal by a specified amount. An improved feed conversion ratio means a lower feed conversion ratio. By "lower feed conversion ratio" or "improved feed conversion ratio" it is meant that the use of a feed additive composition in feed results in a lower amount of feed being required to be fed to an animal to increase the weight of the animal by a specified amount compared to the amount of feed required to increase the weight of the animal by the same amount when the feed does not comprise said feed additive composition.

[0122] Feed efficiency: The term “feed efficiency” means the amount of weight gain per unit of feed when the animal is fed ad-libitum or a specified amount of food during a period of time. By "increased feed efficiency" it is meant that the use of a feed additive composition according the present invention in feed results in an increased weight gain per unit of feed intake compared with an animal fed without said feed additive composition being present.

[0123] Forage: The term “forage” as defined herein also includes roughage. Forage is fresh plant material such as hay and silage from forage plants, grass and other forage plants, seaweed, sprouted grains and legumes, or any combination thereof. Examples of forage plants are Alfalfa (lucerne), birdsfoot trefoil, brassica (e.g. kale, rapeseed (canola), rutabaga (swede), turnip), clover (e.g. alsike clover, red clover, subterranean clover, white clover), grass (e.g. Bermuda grass, brome, false oat grass, fescue, heath grass, meadow grasses, orchard grass, ryegrass, Timothy-grass), corn (maize), millet, barley, oats, rye, sorghum, soybeans and wheat and vegetables such as beets. Forage further includes crop residues from grain production (such as corn stover; straw from wheat, barley, oat, rye and other grains); residues from vegetables like beet tops; residues from oilseed production like stems and leaves form soy beans, rapeseed and other legumes; and fractions from the refining of grains for animal or human consumption or from fuel production or other industries.

[0124] Nutrient Digestibility: The term “nutrient digestibility” means the fraction of a nutrient that disappears from the gastro-intestinal tract or a specified segment of the gastro-intestinal tract, e.g. the small intestine. Nutrient digestibility may be measured as the difference between what is administered to the subject and what, comes out in the faeces of the subject, or between what is administered to the subject and what remains in the digesta on a specified segment of the gastro intestinal tract, e.g. the ileum.

[0125] Nutrient digestibility as used herein may be measured by the difference between the intake of a nutrient and the excreted nutrient by means of the total collection of excreta during a period of time; or with the use of an inert marker that is not absorbed by the animal, and allows the researcher calculating the amount of nutrient that disappeared in the entire gastro-intestinal tract or a segment of the gastro-intestinal tract. Such an inert marker may be titanium dioxide, chromic oxide or acid insoluble ash. Digestibility may be expressed as a percentage of the nutrient in the feed, or as mass units of digestible nutrient per mass units of nutrient in the feed. Nutrient digestibility as used herein encompasses starch digestibility, fat digestibility, protein digestibility, and amino acid digestibility.

[0126] Energy digestibility as used herein means the gross energy of the feed consumed minus the gross energy of the faeces or the gross energy of the feed consumed minus the gross energy of the remaining digesta on a specified segment of the gastro-intestinal tract of the animal, e.g. the ileum. Metabolizable energy as used herein refers to apparent metabolizable energy and means the gross energy of the feed consumed minus the gross energy contained in the faeces, urine, and gaseous products of digestion. Energy digestibility and metabolizable energy may be measured as the difference between the intake of gross energy and the gross energy excreted in the faeces or the digesta present in specified segment of the gastro-intestinal tract using the same methods to measure the digestibility of nutrients, with appropriate corrections for nitrogen excretion to calculate metabolizable energy of feed.

[0127] Pellet: The terms “pellet" and / or "pelleting" refer to solid rounded, spherical and / or cylindrical tablets or pellets and the processes for forming such solid shapes, particularly feed pellets and solid extruded animal feed. As used herein, the terms "extrusion" or "extruding" are terms well known in the art and refer to a process of forcing a composition, as described herein, through an orifice under pressure.

[0128] Poultry: The term “poultry” means domesticated birds kept by humans for the eggs they produce and / or their meat and / or their feathers. Poultry includes broilers and layers. Poultry include members of the superorder Galloanserae (fowl), especially the order Galliformes (which includes chickens, Guineafowls, quails and turkeys) and the family Anatidae, in order Anseriformes, commonly known as "waterfowl" and including domestic ducks and domestic geese. Poultry also includes other birds that are killed for their meat, such as the young of pigeons. Examples of poultry include chickens (including layers, broilers and chicks), ducks, geese, pigeons, turkeys and quail.

[0129] Roughage: The term “roughage” means dry plant material with high levels of fiber, such as fiber, bran, husks from seeds and grains and crop residues (such as stover, copra, straw, chaff, sugar beet waste).

[0130] Ruminant: The term “ruminant” means a mammal that digests plant-based food by initially fermenting / degrading it within the animal's first compartment of the stomach, principally through bacterial actions, then regurgitating the semi-digested mass, now known as cud, and chewing it again. The process of re-chewing the cud to further break down plant matter and stimulate digestion is called "ruminating". Examples of ruminants are cattle, cow, beef cattle, young calf, goat, sheep, lamb, deer, yank, camel and llama. Silage: The term “silage” means fermented, high-moisture stored fodder which can be fed to ruminants (cud-chewing animals such as cattle and sheep) or used as a biofuel feedstock for anaerobic digesters. It is fermented and stored in a process called ensilage, ensiling or silaging, and is usually made from grass or cereal crops (e.g. maize, sorghum, oats, rye, timothy etc forage grass plants),) or legume crops like clovers / trefoils, alfalfa, vetches, using the entire green plant (not just the grain). Silage can be made from many field crops, and special terms may be used depending on type (oatlage for oats, haylage for alfalfa). Silage is made either by placing cut green vegetation in a silo, by piling it in a large heap covered with plastic sheet, or by wrapping large bales in plastic film.

[0131] Spore: The terms “spore” and “endospore” are interchangeable and have their normal meaning which is well known and understood by those of skill in the art. As used herein, the term spore refers to a microorganism in its dormant, protected state.

[0132] Stable: The term "stable" is a term that is known in the art, and in a preferred aspect, stable is intended to mean the ability of the microorganism to remain in a spore form until it is administered to an animal to improve the health of the animal.

[0133] Swine: The term “swine” or “pigs” means domesticated pigs kept by humans for food, such as their meat. Swine includes members of the genus Sus, such as Sus scrofa domesticus or Sus domesticus and include piglets, growing pigs, and sows.

[0134] Vegetable protein: The term “vegetable protein” refers to any compound, preparation or mixture that includes at least one protein derived from or originating from a vegetable, including modified proteins and protein-derivatives.

[0135] Alkaline phosphatase The term “alkaline phosphatase” means an enzyme having EC number 3.1.3.1 cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.

[0136] Coding sequence: The term “coding sequence” means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon, such as ATG, GTG, or TTG, and ends with a stop codon, such as TAA, TAG, or TGA. The coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0137] Control sequences: The term “control sequences” means nucleic acid sequences involved in regulation of expression of a polynucleotide in a specific organism or in vitro. Each control sequence may be native ( / .e., from the same gene) or heterologous ( / .e., from a different gene) to the polynucleotide encoding the polypeptide, and native or heterologous to each other. Such control sequences include, but are not limited to leader, polyadenylation, prepropeptide, propeptide, signal peptide, promoter, terminator, enhancer, and transcription or translation initiator and terminator sequences. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide.

[0138] Expression: The term “expression” means any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0139] Expression vector: An "expression vector" refers to a linear or circular DNA construct comprising a DNA sequence encoding a polypeptide, which coding sequence is operably linked to a suitable control sequence capable of effecting expression of the DNA in a suitable host. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control transcription, a sequence encoding suitable ribosome binding sites on the mRNA, enhancers and sequences which control termination of transcription and translation.

[0140] Extension: The term “extension” means an addition of one or more amino acids to the amino and / or carboxyl terminus of a polypeptide, wherein the “extended” polypeptide has alkaline phosphatase activity.

[0141] Fragment: The term “fragment” means a polypeptide having one or more amino acids absent from the amino and / or carboxyl terminus of the mature polypeptide, wherein the fragment has alkaline phosphatase activity.

[0142] Fusion polypeptide: The term “fusion polypeptide” is a polypeptide in which one polypeptide is fused at the N-terminus and / or the C-terminus of a polypeptide of the present invention. A fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention, or by fusing two or more polynucleotides of the present invention together. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fusion polypeptide is under control of the same promoter(s) and terminator. Fusion polypeptides may also be constructed using intein technology in which fusion polypeptides are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779). A fusion polypeptide can further comprise a cleavage site between the two polypeptides. Upon secretion of the fusion protein, the site is cleaved releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, the sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 7Q: 245-251 ; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995, Biotechnology 13: 498-503; and Contreras et al., 1991 , Biotechnology 9: 378-381 ; Eaton etal., 1986, Biochemistry 25: 505-512; Collins-Racie et al., 1995, Biotechnology 13: 982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240-248; and Stevens, 2003, Drug Discovery World 4: 35-48.

[0143] Heterologous: The term "heterologous" means, with respect to a host cell, that a polypeptide or nucleic acid does not naturally occur in the host cell. The term "heterologous" means, with respect to a polypeptide or nucleic acid, that a control sequence, e.g., promoter, of a polypeptide or nucleic acid is not naturally associated with the polypeptide or nucleic acid, i.e., the control sequence is from a gene other than the gene encoding the mature polypeptide.

[0144] Host Strain or Host Cell: A "host strain" or "host cell" is an organism into which an expression vector, phage, virus, or other DNA construct, including a polynucleotide encoding a polypeptide of interest (e.g., an amylase) has been introduced. Exemplary host strains are microorganism cells (e.g., bacteria, filamentous fungi, and yeast) capable of expressing the polypeptide of interest and / or fermenting saccharides. The term "host cell" includes protoplasts created from cells.

[0145] Introduced: The term "introduced" in the context of inserting a nucleic acid sequence into a cell, means "transfection", "transformation" or "transduction," as known in the art.

[0146] Isolated: The term “isolated” means a polypeptide, nucleic acid, cell, or other specified material or component that has been separated from at least one other material or component, including but not limited to, other proteins, nucleic acids, cells, etc. An isolated polypeptide, nucleic acid, cell or other material is thus in a form that does not occur in nature. An isolated polypeptide includes, but is not limited to, a culture broth containing the secreted polypeptide expressed in a host cell.

[0147] Mature polypeptide: The term “mature polypeptide” means a polypeptide in its mature form following N-terminal and / or C-terminal processing (e.g., removal of signal peptide).

[0148] Native: The term "native" means a nucleic acid or polypeptide naturally occurring in a host cell.

[0149] Nucleic acid: The term "nucleic acid" encompasses DNA, RNA, heteroduplexes, and synthetic molecules capable of encoding a polypeptide. Nucleic acids may be single stranded or double stranded, and may be chemical modifications. The terms "nucleic acid" and "polynucleotide" are used interchangeably. Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid, and the present compositions and methods encompass nucleotide sequences that encode a particular amino acid sequence. Unless otherwise indicated, nucleic acid sequences are presented in 5'-to-3' orientation.

[0150] Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, and which comprises one or more control sequences operably linked to the nucleic acid sequence.

[0151] Operably linked: The term "operably linked" means that specified components are in a relationship (including but not limited to juxtaposition) permitting them to function in an intended manner. For example, a regulatory sequence is operably linked to a coding sequence such that expression of the coding sequence is under control of the regulatory sequence.

[0152] Purified: The term “purified” means a nucleic acid, polypeptide or cell that is substantially free from other components as determined by analytical techniques well known in the art (e.g., a purified polypeptide or nucleic acid may form a discrete band in an electrophoretic gel, chromatographic eluate, and / or a media subjected to density gradient centrifugation). A purified nucleic acid or polypeptide is at least about 50% pure, usually at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, about 99.6%, about 99.7%, about 99.8% or more pure (e.g., percent by weight or on a molar basis). In a related sense, a composition is enriched for a molecule when there is a substantial increase in the concentration of the molecule after application of a purification or enrichment technique. The term "enriched" refers to a compound, polypeptide, cell, nucleic acid, amino acid, or other specified material or component that is present in a composition at a relative or absolute concentration that is higher than a starting composition.

[0153] In one aspect, the term "purified" as used herein refers to the polypeptide or cell being essentially free from components (especially insoluble components) from the production organism. In other aspects, the term "purified" refers to the polypeptide being essentially free of insoluble components (especially insoluble components) from the native organism from which it is obtained. In one aspect, the polypeptide is separated from some of the soluble components of the organism and culture medium from which it is recovered. The polypeptide may be purified ( / .e., separated) by one or more of the unit operations filtration, precipitation, or chromatography.

[0154] Accordingly, the polypeptide may be purified such that only minor amounts of other proteins, in particular, other polypeptides, are present. The term "purified" as used herein may refer to removal of other components, particularly other proteins and most particularly other enzymes present in the cell of origin of the polypeptide. The polypeptide may be "substantially pure", i.e., free from other components from the organism in which it is produced, e.g., a host organism for recombinantly produced polypeptide. In one aspect, the polypeptide is at least 40% pure by weight of the total polypeptide material present in the preparation. In one aspect, the polypeptide is at least 50%, 60%, 70%, 80% or 90% pure by weight of the total polypeptide material present in the preparation. As used herein, a "substantially pure polypeptide" may denote a polypeptide preparation that contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polypeptide material with which the polypeptide is natively or recombinantly associated.

[0155] It is, therefore, preferred that the substantially pure polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99% pure, most preferably at least 99.5% pure by weight of the total polypeptide material present in the preparation. The polypeptide of the present invention is preferably in a substantially pure form ( / .e., the preparation is essentially free of other polypeptide material with which it is natively or recombinantly associated). This can be accomplished, for example by preparing the polypeptide by well-known recombinant methods or by classical purification methods.

[0156] Recombinant: The term "recombinant" is used in its conventional meaning to refer to the manipulation, e.g., cutting and rejoining, of nucleic acid sequences to form constellations different from those found in nature. The term recombinant refers to a cell, nucleic acid, polypeptide or vector that has been modified from its native state. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell, or express native genes at different levels or under different conditions than found in nature. The term “recombinant” is synonymous with “genetically modified” and “transgenic”.

[0157] Recover: The terms "recover" or “recovery” means the removal of a polypeptide from at least one fermentation broth component selected from the list of a cell, a nucleic acid, or other specified material, e.g., recovery of the polypeptide from the whole fermentation broth, or from the cell-free fermentation broth, by polypeptide crystal harvest, by filtration, e.g. depth filtration (by use of filter aids or packed filter medias, cloth filtration in chamber filters, rotary-drum filtration, drum filtration, rotary vacuum-drum filters, candle filters, horizontal leaf filters or similar, using sheed or pad filtration in framed or modular setups) or membrane filtration (using sheet filtration, module filtration, candle filtration, microfiltration, ultrafiltration in either cross flow, dynamic cross flow or dead end operation), or by centrifugation (using decanter centrifuges, disc stack centrifuges, hyrdo cyclones or similar), or by precipitating the polypeptide and using relevant solidliquid separation methods to harvest the polypeptide from the broth media by use of classification separation by particle sizes. Recovery encompasses isolation and / or purification of the polypeptide.

[0158] Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter “sequence identity”. For purposes of the present invention, the sequence identity between two amino acid sequences is determined as the output of “longest identity” using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 6.6.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. In order for the Needle program to report the longest identity, the -nobrief option must be specified in the command line. The output of Needle labeled “longest identity” is calculated as follows:

[0159] (Identical Residues x 100) / (Length of Alignment - Total Number of Gaps in Alignment)

[0160] For purposes of the present invention, the sequence identity between two polynucleotide sequences is determined as the output of “longest identity” using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 6.6.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NLIC4.4) substitution matrix. In order for the Needle program to report the longest identity, the nobrief option must be specified in the command line. The output of Needle labeled “longest identity” is calculated as follows:

[0161] (Identical Deoxyribonucleotides x 100) / (Length of Alignment- Total Number of Gaps in Alignment) Signal Peptide: A "signal peptide" is a sequence of amino acids attached to the N-terminal portion of a protein, which facilitates the secretion of the protein outside the cell. The mature form of an extracellular protein lacks the signal peptide, which is cleaved off during the secretion process.

[0162] Structural Similarity: The relatedness between two amino acid sequences has conventionally been described by the parameter “sequence identity”. However, since the biological function of a polypeptide is defined by its three-dimensional structure rather than its amino acid sequence, a better way of assessing a functional relationship between polypeptides is by comparing their three-dimensional structures. Thus, for the purposes of the present invention, the relatedness between the three-dimensional structure of two polypeptides is described by the parameter “structural similarity”.

[0163] A three-dimensional structure of any polypeptide may be obtained experimentally via, e.g., X-ray crystallography or using in silico methods such as AlphaFold (vide supra). The structural similarity between three-dimensional structures may then be determined by the TM-score, which is calculated using the following general formula (Zhang & Skolnick, Proteins 57:702-710, 2004): TM-score where LN is the length of the native structure, LT is the length of the aligned residues to the template structure, d, is the distance between the / th pair of aligned residues and do is a scale to normalize the match difference. ‘Max’ denotes the maximum value after optimal spatial superposition.

[0164] For the purposes of the present invention, LN is always the length of the reference protein, indicating the use of a fixed reference length L to prevent artificially large TM-scores from alignment of substructures:

[0165] TM-score

[0166] A structural alignment of the three-dimensional structures of two polypeptides is necessary before the TM-score can be calculated. This is achieved via algorithms that optimize the structural overlap, and several methods are available, such as CEalign (Shindyalov and Bourne, Protein Eng., 11 , 739-747, 1998), DALI (Holm and Sander, Trends Biochem. Sci., 20, 478-480, 1995), or TM-align (Nucleic Acids Res. 33:2302-2309, 2005).

[0167] For the purposes of the present invention, TM-align is applied. For convenience, TM-score is integrated in the TM-align software, which is available from the author’s website. The version of TM-align is preferably updated 2019-08-22 or later, and the TM-score between a reference and a query protein is determined by running this command:

[0168] TMalign <query . pdb> <ref erence . pdb> -L <length of reference>

[0169] Where <query.pdb> is the name of the PDB file containing coordinates of the query polypeptide, <reference.pdb> is the name of the PDB file containing coordinates of the reference polypeptide. The TM-score is calculated and reported in the output, along with several other parameters from the alignment.

[0170] The maximal TM-score is 1 , e.g., 1.0, corresponding to identical three-dimensional structures.

[0171] Subsequence: The term “subsequence” means a polynucleotide having one or more nucleotides absent from the 5' and / or 3' end of a mature polypeptide coding sequence; wherein the subsequence encodes a fragment having alkaline phosphatase activity.

[0172] Variant: The term “variant” means a polypeptide having alkaline phosphatase activity comprising a man-made mutation, / .e., a substitution, insertion (including extension), and / or deletion (e.g., truncation), at one or more positions. A substitution means replacement of the amino acid occupying a position with a different amino acid; a deletion means removal of the amino acid occupying a position; and an insertion means adding 1-5 amino acids (e.g., 1-3 amino acids, in particular, 1 amino acid) adjacent to and immediately following the amino acid occupying a position.

[0173] Wild-type: The term "wild-type" in reference to an amino acid sequence or nucleic acid sequence means that the amino acid sequence or nucleic acid sequence is a native or naturally- occurring sequence. As used herein, the term "naturally-occurring" refers to anything (e.g., proteins, amino acids, or nucleic acid sequences) that is found in nature. Conversely, the term "non-naturally occurring" refers to anything that is not found in nature (e.g., recombinant nucleic acids and protein sequences produced in the laboratory or modification of the wild-type sequence).

[0174] Alkaline Phosphatases of the Invention

[0175] When measuring the activity of various wild-type alkaline phosphatases, certain polypeptides, including SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56, had higher activity in the dephosphorylation of LPS than others (see Table 1). This activity is physiologically highly relevant. These polypeptides were further investigated to try to understand the rationale for their relatively high activity, as measured by LPS dephosphorylation.

[0176] First it was surprisingly determined that there was relatively low sequence identity among these sequences and also relatively low identity to human intestinal alkaline phosphatase.

[0177] In a continued attempt to understand the rationale for this high LPS dephosphorylation activity, these polypeptides were further investigated. Variants were made of SEQ ID NO: 21 , namely SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO:

[0178] 71 , SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID

[0179] NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90,

[0180] SEQ ID NO: 91 , SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94. These were also found to have high LPS dephosphorylation activity.

[0181] As investigations continued, the wild-type alkaline phosphatases with high LPS dephosphorylation activity were found to have common properties. Surprisingly, the wild-type alkaline phosphatases of SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56 were found to have common ancestry according to phylogenetic tree and to also have a common feature in their three-dimensional structures as measured on AlphaFold™.

[0182] As part of the investigations to determine the rationale behind the high activity, the alkaline phosphatases were modelled using AlphaFold™. The Template Modelling™ score was calculated for the bacterial ALPs vs the human intestinal ALP (SEQ ID NO: 108 as described in patent application in Example 9. In one embodiment, the polypeptide of the invention has a Template Modelling score, as calculated in Example 9, versus human intestinal ALP (SEQ ID NO: 108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.88.

[0183] Furthermore, the polypeptides comprise a variable region, which have high three-dimensional similarity with human intestinal ALP. The residues of this variable region will of course depend on the polypeptide but are all in the same region, such as from 353-462 from residue 353 to 462 in SEQ ID NO:21 , as shown in the table in Example 10.

[0184] In an embodiment of the invention, the variable region of the polypeptide has a Template Modelling score, as calculated in Example 9, versus the human intestinal ALP (SEQ ID NO: 108) of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96.

[0185] In a continued investigation of the polypeptides of the invention, it was surprisingly found that the polypeptides of the invention are clustered together in the phylogenetic tree and equally surprisingly, are close to human intestinal alkaline phosphatase in the phylogenetic tree. Accordingly, in an embodiment of the invention, the polypeptides of the invention have a distance in the phylogenetic tree relative to human intestinal alkaline phosphatase of between 1.0 and 2.0, such as from 1.1 to 1.9. This is measured by a method as described in Example 8 and illustrated in Figure 1.

[0186] An aspect of the invention is directed to an animal feed additive comprising a polypeptide having alkaline phosphatase activity, wherein the polypeptide is characterized as having at least two, such as at least three properties selected from the group consisting of; i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a Template Modelling score, as calculated in Example 9, versus the human intestinal ALP (SEQ ID NO: 108) of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NQ:108); and iii. the polypeptide has a Template Modelling score, as calculated in Example 9, versus human intestinal ALP (SEQ ID NO: 108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.86: iv. the polypeptide has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1.0 and 2.0, such as from 1.1 to 1.9; wherein the polypeptide is of bacterial origin or a variant thereof.

[0187] In an embodiment of the invention, the animal feed additive comprises a polypeptide having alkaline phosphatase activity, wherein the polypeptide is characterized in that; i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a Template Modelling score, as calculated in Example 9, versus the human intestinal ALP of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NQ:108); and iii. the polypeptide has a Template Modelling score, as calculated in Example 9 versus human intestinal ALP (SEQ ID NQ:108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.86: iv. the polypeptide has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1.0 and 2.0, such as from 1.1 to 1.9; and wherein the polypeptide is of bacterial origin or a variant thereof.

[0188] In a typical embodiment, the polypeptide having alkaline phosphatase activity, is characterized in that: i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a Template Modelling score, as calculated in Example 9, versus the human intestinal ALP of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO: 108), and iii. the polypeptide has a Template Modelling score, as calculated in Example 9, versus human intestinal ALP (SEQ ID NO: 108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.86; and wherein the polypeptide is of bacterial origin or a variant thereof. In a suitable embodiment, the polypeptide furthermore has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1 and 1.9, such as from 1.1 to 1.8, or from 1.1 to 1.7.

[0189] In another embodiment of the invention, the polypeptide having alkaline phosphatase activity, is characterized in that: i. the polypeptide has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1.0 and 2.0, such as from 1.1 to 1.9;, wherein the polypeptide is of bacterial origin or a variant thereof; and ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO: 108), wherein the polypeptide is of bacterial origin or a variant thereof.

[0190] In another embodiment of the invention, the polypeptide having alkaline phosphatase activity, is characterized in that: i. the polypeptide has a Template Modelling score, as calculated in Example 9, versus human intestinal ALP (SEQ ID NO: 108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.86; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO: 108), wherein the polypeptide is of bacterial origin or a variant thereof.

[0191] In another embodiment of the invention, the polypeptide having alkaline phosphatase activity, is characterized in that: i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a Template Modelling score, as calculated in Example 9, versus the human intestinal ALP of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO: 108), wherein the polypeptide is of bacterial origin or a variant thereof.

[0192] Furthermore, the folding temperature of the polypeptides of the invention were investigated and compared to prior art alkaline phosphatase. In a preferred aspect of the invention, the polypeptide having alkaline phosphatase activity is thermostable. Thermostability allows for good pelleting stability. As seen in Example 12, several of the molecules having a variable region have a high thermostability (Tm) at different pHs, between 50-72 °C at pH4 between 66-80 °C at pH5 and 65- 86 °C at pH7 in the presence of ions Zn, Ca and Mg.

[0193] SEQ ID NO:21 has a Tm at pH 7 of notably higher than SEQ ID NO:50, at different pH levels as seen in Table 12.1. From Table 12.2, it is demonstrated that SEQ ID NO: 21 has a Tm of 77 °C at pH 7, SEQ ID NO: 14 has a Tm of 80 °C at pH 7, SEQ ID NO: 34 has a Tm of 72°C at pH 8, SEQ ID NO: 35 has a Tm of 75 °C at pH 7 , SEQ ID NO: 36 has a Tm of 69 °C at pH 7, SEQ ID NO: 37 has a Tm of 79 °C at pH 7, SEQ ID NO: 38 has a Tm of 88 °C at pH 7, SEQ ID NO: 39 has a Tm of 71 °C at pH 7, SEQ ID NO: 55 has a Tm of 62 °C at pH 7, and SEQ ID NO: 56 has a Tm of 76 °C at pH 7;

[0194] Accordingly, an aspect of the invention is directed to an animal feed additive comprising a polypeptide having alkaline phosphatase activity selected from the group consisting of a. a polypeptide having at least 70% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56; b. a polypeptide having at least 70% sequence identity to a mature polypeptide of polypeptide of (a) c. a polypeptide encoded by a polynucleotide having at least 70% sequence identity to the mature polypeptide coding sequence of a polypeptide of (a) or (b); d. a polypeptide derived from a polypeptide of (a) or (c), or a mature polypeptide of (b) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids; e. a polypeptide derived from the polypeptide of (a), (b), (c), or (d) wherein the N- and / or C-terminal end has been extended by the addition of 1 to 50 amino acids, such as 1 to 40, 1 to 30 or 1 to 20 amino acids; and f. a fragment of the polypeptide of (a), (b), (c), (d), or (e); wherein the polypeptide is of bacterial origin or a variant thereof; and wherein the polypeptide of (a), (b), (c), (d), or (e) or the fragment of (f) has alkaline phosphatase activity.

[0195] In a preferred embodiment, the a polypeptide has at least 75% sequence identity to a polypeptide selected from SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56, more preferably at least 80% sequence identity, such as at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to a polypeptide selected from SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0196] In one embodiment, the polypeptide has at least 75% sequence identity to a polypeptide which is a variant SEQ ID NO: 21, namely SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 , SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94.

[0197] In one embodiment the polypeptide having alkaline phosphatase activity is a polypeptide having at least 80% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0198] In one embodiment, the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 70% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0199] In one embodiment, the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 75% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0200] In one embodiment, the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 80% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0201] In one embodiment, the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 85% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0202] In one embodiment, the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 90% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0203] In one embodiment, the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 95% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56, such as at least 96%, at least 97%, at least 98%, such as at least 99% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0204] In one embodiment, the polypeptide having alkaline phosphatase activity is selected from the group consisting of a polypeptide having at least 90% sequence identity SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56, such as at least 95%, at least 96%, at least 97%, at least 98%, such as at least 99% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56

[0205] ALP targets for improving gut health: Lipopolysaccharide (LPS), ATP and Cellular Activity The intestinal activity of alkaline phosphatase is related to intestinal inflammation. ALPs play a in limiting intestinal inflammation by detoxification of MAMPs (Lipopolysaccharide (LPS) and flagellin. IAP exerts its effects through dephosphorylation of proinflammatory molecules including lipopolysaccharide (LPS), flagellin, and adenosine triphosphate (ATP) released from cells during stressful events. ALP dephosphorylates bacterial LPS which leads to LPS detoxification preventing downstream activation of immune cells and subsequent inflammatory responses.

[0206] Intestinal alkaline phosphatase (IAP) is one of the most abundant human proteins in stools and its activity has been speculated to correlate negatively with type 2 diabetes and intestinal inflammation. IAP has been shown to possess many roles in limiting intestinal inflammation: 1) Detoxification of MAMPs (LPS, flagellin), 2) De-phosphorylation of extracellular ATP, 3) Induction of autophagy 4) bacterial growth inhibition.

[0207] Without being bound to a particular theory, gut health relies on the microbiome and its coexistence with the host. Introduction of pathogenic bacteria to the microbiome creates a dysbiosis potentially leading to leaking barrier and immune cell activation. Free LPS from the gut bacteria may impose a health risk on the host by activation of immune cells. Especially under already compromized health conditions LPS may more freely enter the tissue and do damage. ATP is produced by some bacteria and has growth inhibitory action on certain other bacteria. Literature indicates that ATP secretion may be more typical for Gram-negative species, whereas growth inhibition is characteristic for Gram-positive bacteria. ATP is produced by immune cells during their activation and by dying cells and functions as an alarm molecule to warn their surroundings to prepare for e.g. infection. This results in the activation of other immune cells adding to the ongoing inflammation. Specifically, ATP activates the inflammasome, which causes release of the pro-inflammatory cytokine IL-1 p. During a chronic state of mild intestinal inflammation (which may be the situation in livestock) increased levels of both free LPS and intestinal ATP would add on the inflammatory process and increase risk of disease.

[0208] An aspect of the invention is directed to detoxification of LPS and / or ATP by ALP mediated dephosphorylation. This leads to a to decrease in ongoing intestinal inflammation by limiting health risk factors. Potential health benefits include decreased infectious disease, leading to higher survival rates.

[0209] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of the detoxification of lipopolysaccharide in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention.

[0210] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of reducing the immune response in an animal, said method comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention.

[0211] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of reducing inflammation in an animal, said method comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention.

[0212] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of reducing IL or TNF 29esponse in an animal, said method comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention

[0213] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of maintaining or supporting intestinal health, or improving intestinal health promoting growth of commensal bacteria, in an animal, said method comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention.

[0214] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method for the maintenance of an effective gut barrier comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention.

[0215] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of preventing colitis or the inflammation of the lining of the colon in an animal, said method comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention.

[0216] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of preventing or reducing intestinal colonization or systemic translocation of unwanted bacteria, or for “dysbiosis”, namely for changing of the bacterial and / or archaeal balance of the intestinal microbiota, said method comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention.

[0217] Accordingly, an apect of the invention is directed to the alkaline phosphatases of the invention for use, typically by ATP de-phosphorylation, to maintain gut health including but no limited to maintaining gut barrier function, reducing leaky gut and reducing or preventing intestinal inflammation. Lipopolysaccharides as a target for Alkaline Phosphatase of the invention

[0218] The intestinal activity of alkaline phosphatase is related to intestinal inflammation. ALPs play a in limiting intestinal inflammation by detoxification of MAMPs (Lipopolysaccharide (LPS), flagellin. IAP exerts its effects through dephosphorylation of proinflammatory molecules including lipopolysaccharide (LPS), flagellin, and adenosine triphosphate (ATP) released from cells during stressful events.

[0219] Increased LPS stimulation of the intestinal tissue increases inflammation and compromises general health. Lipopolysaccharide (LPS) contains a Lipid A structure, which has two PO4 groups attached. These are essential for binding to TLR4 and MD2 during cell stimulation. In the present invention, LPS de-phosphorylation was measured with the Malachite Green Phosphate Detection kit, which detects free PO4. E. coli LPS was treated with titration of ALP followed by detection of released PO4. Results showed LPS-dephosphorylation by polypeptides having alkaline phosphatase of the invention.

[0220] One aspect of the invention is directed to an ALP of the invention dephosphorylates bacterial LPS which leads to LPS detoxification thereby preventing downstream activation of immune cells and subsequent inflammatory responses. According, the invention is directed to a method of dephosphorylating bacterial LPS using an ALP of the invention. The invention is also directed to a method of detoxificating LPS by dephosphorylation using using an ALP of the invention. A further aspect of the invention is directed to reducing the activation of immune cells comprising the ingestion of an ALP of the invention. A further aspect of the invention is directed to reducing or preventing an inflammatory response, or reducing or preventing an inflammation in an animal comprising the ingestion of an ALP of the invention.

[0221] An aspect of the invention is directed to detoxification of LPS through ALP mediated dephosphorylation. This leads to a to decrease in ongoing intestinal inflammation by limiting health risk factors. Potential health benefits include decreased infectious disease, leading to higher survival rates.

[0222] Adenosine triphosphate (ATP) as target for Alkaline Phosphatase

[0223] Cellular Activity as a target for Alkaline Phosphatases of the invention

[0224] ATP can suppress Gram-positive bacteria growth. ALPS of the invention can eliminate this effect. Suppression of intestinal Gram-positive bacteria favours growth of pathogenic Gramnegatives. Accordingly, ALPs of the invention eliminate the suppressive role of ATP on Grampositive bacteria.

[0225] ALP dephosphorylates ATP promoting commensal bacterial growth A further aspect of the invention is directed to the use of the ALPs of the invention to promote the growth of favourable Gram positive bacteria and / or suppress the growth of pathogenic Gram-negative bacteria.

[0226] Example 12 shows that Gram-negative and Gram-positive bacteria were grown in presence of ATP, ADP, AMP or adenosine.

[0227] ALP suppresses ATP-induced LPS activity on IL-1 / 3 secretion

[0228] ATP also plays a role in the activity of LPS in the formation of Pro-IL- ip. Increased LPS stimulation of the intestinal tissue increases inflammation and compromises general health. In an apect of the invention, an ALP of the invention reduces ATP-induced LPS activity on I L-1 p secretion.

[0229] ALP suppresses ATP induced IL-1 / 3 secretion; ALP to suppress inflammation

[0230] ATP is also involved in activation of the inflammasome, leading to secretion of I L-1 p. This is a rapid danger signal that increases inflammation, which is useful during infection but may be harmful under chronic conditions. In Example 14, it is demonstrated that treatment with the ALPs of invention suppresses the ATP induced inflammasome activation.

[0231] ALP dephosphorylates ATP promoting commensal bacterial growth. Accordingly, an aspect of the invention is directed to supporting or promoting commensal bacterial growth in livestock animals, comprising feeding an animal a polypeptide of the invention.

[0232] Similarly, a further aspect of the invention is directed a method of suppressing, reducing or preventing inflammation in an animal comprising administering an ALP as defined herein. Accordingly, an aspect of the invention is directed to a method of suppressing, reducing or preventing inflammation by lowering the levels of I L-1 p in an animal comprising administering an ALP as defined herein. A further aspect of the invention is directed to an ALP as defined herein for use in the suppression, reduction or prevention of inflammation in an animal. A further aspect of the invention is directed to ther use of an ALP of the invention for the suppression, prevention or reduction of ALP in an animal. Preferably, the inflammation is chronic or associated with a chronic condition.

[0233] ALP suppresses TNF-a; ALP to suppress inflammation

[0234] The inflammasome activating effect of ATP is not a capability held by its de-phosphorylation products ADP, AMP or adenosine. In fact, the inventors have found adenosine possess immunosuppressive potential. The inventors have found that by converting ATP to ADP, AMP or adenosine, ALP suppresses, reduces or prevents inflammation. The inventors have found that the ALPs of the invention suppresses the secretion of IL-8 by means of adenosine suppression of the secretion of IL-8.

[0235] An increase in the levels of adenosine, the de-phosphorylated product of ATP, led to decreased levels of TNF-a. Accordingly, an aspect of the invention is directed to a method of suppressing, reducing or preventing inflammation by lowering the levels of TNF-a in an animal comprising administering an ALP as defined herein. Accordingly, an aspect of the invention is directed to a method of suppressing, reducing or preventing inflammation in an animal comprising administering an ALP as defined herein. A further aspect of the invention is directed to an ALP as defined herein for use in the suppression, reduction or prevention of inflammation in an animal. A further aspect of the invention is directed to ther use of an ALP of the invention for the suppression, prevention or reduction of ALP in an animal.

[0236] Use in Animal Feed

[0237] A polypeptide having alkaline phosphatase activity of the invention may also be used in animal feed. In an embodiment, the present invention provides a method for preparing an animal feed composition comprising adding one or more polypeptides having alkaline phosphatase activity of the present invention to one or more animal feed ingredients.

[0238] The polypeptide having alkaline phosphatase activity of the present invention may also be used in animal feed as feed enhancing enzymes that improve feed digestibility to increase the efficiency of its utilization according to WO 00 / 21381 and WO 04 / 026334. In a further embodiment the polypeptides having alkaline phosphatase activity of the present invention may also be used in animal feed as feed enhancing enzymes that improve feed digestibility to increase the efficiency of its utilization according to WO 00 / 21381 and WO 04 / 026334.

[0239] An aspect of the invention is directed to a use of the polypeptide of the invention for the preparation of a feed additive, a feed composition or a zootechnical additive. In accordance with any methods of the invention, the polypeptide may be administered to an animal, such as a a sow, during one or more of the starter phase, the grower phase, and / or the finisher phase. In accordance with any methods of the invention, the polypeptide may be formulated in animal feed, such as a starter feed, a grower feed, or a finisher feed for an animal such as a sow.

[0240] In accordance with any methods of the invention, the polypeptide may be provided incompositions suitable for oral administration to an animal, comprising an effective amount of an enzyme that reduces the amount of a detrimental compound present in or released from animal waste. The composition may comprise an orally acceptable carrier for the enzyme. In a further embodiment a polypeptide having alkaline phosphatase activity of the present invention may be used as a feed additive, where it may provide a positive effect on the animal’s digestive tract and in this way improve animal performance in accordance to weight gain, feed conversion ratio (FCR), or improved animal health such as decreased mortality rate. FCR is calculated as the feed intake in g / animal relative to the weight gain in g / animal.

[0241] The one or more polypeptides having alkaline phosphatase activity of the present invention may for example be used to stabilize the healthy microflora of animals, such as ruminants and nonruminants, in particular livestock such as, but not limited to, sheep, goats, cattle (including, but not limited to, beef cattle, cows, and young calves), deer, pigs or swine (including, but not limited to, piglets, growing pigs, and sows), poultry (including, but not limited to, geese, turkeys, ducks and chicken such as broilers, chicks and layers); horses (including but not limited to hotbloods, coldbloods and warm bloods), moose and rabbits but also in fish (including but not limited to salmon, trout, tilapia, catfish and carps; and crustaceans (including but not limited to shrimps and prawns)) by suppressing growth / intestinal colonization of viral (such as Coronaviridae, Porcine reproductive and respiratory syndrome virus (PRRSV), Persivirus coursing Bovin virus diarre and likewise), parasitic pathogens (coccidian protozoa, Eimeria maxima, Eimeria mitis) or bacterial pathogens such as Clostridium perfringens, Escherichia coli, Campylobacter coli, C. hyointestinalis and C. jejuni, Yersinia ssp., Treponema suis, Brachyspira hyodysenteriae, Lawsonia intracellularis and Salmonella, such as Salmonella enterica, Salmonella Typhimurium and Salmonella Mbandaka. A preferred embodiment is directed to a method of preventing antibiotic-associated infections from Salmonella entericaserovar Typhimurium (S. Typhimurium) and / or Clostridium difficile comprising feeding said animal the polypeptide of the invention, the composition of the invention or the animal feed additive of the invention. In a preferred embodiment a polypeptide having alkaline phosphatase activity is applied to chicken and has activity against Clostridium perfringens. In a further embodiment a polypeptide having alkaline phosphatase activity of the present invention is used as a feed additive, where it may provide a positive effect on the microbial balance of the chicken digestive tract and in this way improve animal performance. The term animal typically refers to livestock, such as swine (e.g., pigs or hogs), sheep, fowl or poultry (e.g., chicken, ducks, turkeys, and geese), cows and other ruminants, buffalo, horses, and aquaculture animals (e.g., fish and shrimp and eels). In accordance with any of methods of the invention, the animal is preferably poultry or swine animal.

[0242] An aspect of the invention is directed to a method of maintaining or restoring (healthy) gut flora in an antibiotic treated animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a a method of maintaining or supporting intestinal health, or improving intestinal health promoting growth of commensal bacteria, in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention.

[0243] An aspect of the invention is directed to a method of preventing antibiotic-associated infections from E. coli, Salmonella such as Salmonella entericaserovar, Typhimurium (S. Typhimurium) and / or Clostridium such as Clostridium difficile comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method of preventing or reducing intestinal colonization or systemic translocation of unwanted bacteria, or for “dysbiosis”, namely for changing of the bacterial and / or archaeal balance of the intestinal microbiota, comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention.

[0244] The polypeptide having alkaline phosphatase activity of the present invention may also be used in animal feed as feed enhancing enzymes that improve feed digestibility to increase the efficiency of its utilization according to WO 00 / 21381 and WO 04 / 026334.

[0245] In a further embodiment a polypeptide having alkaline phosphatase activity of the present invention may be used as a feed additive, where it may provide a positive effect on the animal’s digestive tract and in this way improve animal performance in accordance to weight gain, feed conversion ratio (FOR), or improved animal health such as decreased mortality rate. FOR is calculated as the feed intake in g / animal relative to the weight gain in g / animal. An aspect of the invention is directed to a method of increasing body weight gain in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. A further aspect of the invention is directed to a method of improving the food conversion ratio (FCR) of an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention.

[0246] An aspect of the invention is directed to a method of preventing weight loss in infected animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method to prevent low birth weight, such as induced by perinatal undernutrition comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method of improving weight gain in animals with below average birth weight comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method of regulating fat absorption or neutralising acidic digesta entering the small intestine via stimulation of bicarbonate secretions and surface pH comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention.

[0247] An interesting aspect of the invention is directed to a method of the detoxification of lipopolysaccharide in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method of reducing the immune response in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention.

[0248] An interesting aspect of the invention is directed to a method of reducing inflammation in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention.

[0249] An aspect of the invention is directed to reducing IL or TNF respsonse in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method for the maintenance of an effective gut barrier comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention.

[0250] An aspect of the invention is directed to a method to prevent colitis or the inflammation of the lining of the colon in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention.

[0251] In the use or method according to the invention, polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention can be fed to the animal before, after, or simultaneously with the diet. The latter is preferred.

[0252] For the use in animal feed, however, the polypeptide having alkaline phosphatase activity need not be pure; it may e.g. include other enzymes, in which case it could be termed a polypeptide having alkaline phosphatase activity preparation.

[0253] The polypeptide having alkaline phosphatase activity composition can be (a) added directly to the feed, or (b) it can be used in the production of one or more intermediate compositions such as feed additives or premixes that is subsequently added to the feed (or used in a treatment process). The degree of purity described above refers to the purity of the original polypeptide having alkaline phosphatase activity preparation, whether used according to (a) or (b) above. The invention further provides methods for reducing the environmental impact of animal waste. In particular, the invention provides methods comprising administering to an animal an enzyme that is effective to reduce the amount of a detrimental compound present in or released from animal waste, and compositions suitable for use in such methods. Also provided is a method for increasing phosphorus digestion in an animal. Animal waste may contain or release one or more compounds that have a detrimental effect, such as a detrimental effect on the animal, on other animals, on humans, or on the environment. One such compound is ammonia (NH3). Another such compound is phosphorous (P). Atmospheric ammonia can have adverse effects on the environment, as well as on animal production performance, health, and welfare. Ammonia generation and emission in, for example, poultry housing, mostly result from the microbiological decomposition of poultry waste. Ammonia levels as low as 50 ppm can be detrimental to poultry, and such low levels may go unnoticed. Exposure to ammonia at 50 ppm can contribute to 5-10% of birds being runts, and can be associated with a loss of 0.5 pounds of meat per bird and / or a loss of 8 points of feed conversion. There is a need, therefore, for methods of reducing the amount of a detrimental compound present in or released from animal waste, such as for reducing the ammonia and / or the phosphorous content of animal waste. In accordance with some embodiments, there are provided methods for reducing the environmental impact of animal waste, comprising administering to an animal an effective amount of an enzyme that reduces the amount of a detrimental compound present in or released from animal waste. In accordance with some embodiments, there are provided methods for reducing the amount of ammonia in animal waste, comprising administering to an animal an effective amount of an enzyme that reduces the amount of ammonia present in or released from animal waste. In accordance with some embodiments, there are provided methods for reducing the amount of phosphorous in animal waste, comprising administering to an animal an effective amount of an enzyme that reduces the amount of phosphorous present in or released from animal waste. Also provided is a method for increasing phosphorus digestion in an animal, comprising administering an effective amount of alkaline phosphatase to the animal.

[0254] An aspect of the invention is directed to methods comprising administering to an animal an alkaline phosphatase that is effective to reduce the amount of a detrimental compound present in or released from animal waste, such as ammonia (NH 3) or phosphorous (P), and compositions suitable for use in such methods. The methods offer a number of advantages in the context of animal production, including poultry and swine production. In an embodiment, the methods may offer advantages selected from the group consisting of reduced phosphate input into an animal production system, decreased ammonia in animal manure, reduced ventilation air requirements to dilute indoor ammonia concentration in animal housing (and associated energy savings), and reduced need to further treat exhaust air. While not wanting to be bound by any theory, the methods described herein may help animals (such as young broilers) utilize and digest the phosphorus that is present in their diets, which in turn may lead to better growth rate and less nutrient loss through excretion. Additionally, or alternatively, the methods described herein may decrease NH3 emission because the enzyme treatments may increase the metabolism and growth of favorable bacterial populations in the intestine, such that more of the excess nitrogen in the diet remains in the manure as bacterial protein instead of uric acid, which is typically degraded and emitted as NH3. Moreover, both the lower pH and lower nitrogen content in manure of treated animals may deter and prevent the formation of gaseous NH 3 in the manure and reduce the NH3 emission. The relationship between pH and degradation of uric acid (the major nitrogen source in poultry manure) has been reported such that a sharp increase in pH may be associated with a decrease in the uric acid content of poultry manure. Elliot & Collins, 1982, Transactions of ASAE 25: 413-24, indicated that high pH in the stored manure would result in the majority of nitrogen loss as NH 3. Additionally, reducing the phosphorus content of animal waste may impact other properties of the manure, such as the bacterial flora.

[0255] An aspect of the invention is directed to a method of maintaining or protecting intestinal or gut integrity, or reducing intestinal permeability in livestock animals, such as swine and poultry, comprising feeding the animal an animal feed additive comprising a polypeptide of the invention. As discussed, an aspect of the invention is directed to a method of preventing or reducing inflammation of the gastrointestinal tract of an animal. Similarly, an aspect of the invention is directed to a method of preventing or reducing inflammation bowel disease or diarrhea in livestock animals, preferably swine and poultry.

[0256] A related aspect of the invention is directed to a method of maintaining or improving the intestinal health of livestock animals, such as swine and poultry, comprising feeding the animal an animal feed additive comprising a polypeptide of the invention.

[0257] A further aspect of the invention is directed to improving the immunity of new born livestock comprising feeding the animal an animal feed additive comprising a polypeptide of the invention. Alkaline phosphatase (ALP) is abundant in raw milk. For livestock being weened away from its mother, feeding the young animal Alkaline phosphatase may be used to improve the immune system of the piglet or other young animals. Accordingly, an aspect of the invention is directed to improving the immunity of new born, weening or post-weening livestock animals comprising feeding the animal an animal feed additive comprising a polypeptide of the invention. Similarly, an aspect of the invention is directed to reducing or preventing allergies and / or improving or maintaining the immunity of livestock animals comprising feeding the animal an animal feed additive comprising a polypeptide of the invention.

[0258] Animal Feed and Animal Feed Additives

[0259] The present invention also relates to animal feed compositions and animal feed additives comprising a polypeptide having alkaline phosphatase activity of the invention. In an embodiment, the animal feed or animal feed additive comprises a formulating agent and a polypeptide of the invention having alkaline phosphatase activity. In a further embodiment, the formulating agent comprises one or more of the following compounds: glycerol, ethylene glycol, 1 , 2-propylene glycol or 1 , 3-propylene glycol, sodium chloride, sodium benzoate, potassium sorbate, sodium sulfate, potassium sulfate, magnesium sulfate, sodium thiosulfate, calcium carbonate, sodium citrate, dextrin, glucose, sucrose, sorbitol, lactose, starch, kaolin and cellulose.

[0260] Animal feed compositions or diets have a relatively high content of protein. Poultry and pig diets can be characterised as indicated in Table B of WO 01 / 58275, columns 2-3. Fish diets can be characterised as indicated in column 4 of this Table B. Furthermore, such fish diets usually have a crude fat content of 200-310 g / kg.

[0261] An animal feed composition according to the invention has a crude protein content of 50-800 g / kg, and furthermore comprises at least one polypeptide having alkaline phosphatase activity as claimed herein.

[0262] In particular embodiments, the content of metabolisable energy, crude protein, calcium, phosphorus, methionine, methionine plus cysteine, and / or lysine is within any one of ranges 2, 3, 4 or 5 in Table B of WO 01 / 58275 (R. 2-5).

[0263] Crude protein is calculated as nitrogen (N) multiplied by a factor 6.25, i.e. Crude protein (g / kg)= N (g / kg) x 6.25. The nitrogen content is determined by the Kjeldahl method (A.O.A.C., 1984, Official Methods of Analysis 14th ed., Association of Official Analytical Chemists, Washington DC).

[0264] In a particular embodiment, the animal feed composition of the invention contains at least one vegetable protein as defined above.

[0265] The animal feed composition of the invention may also contain animal protein, such as Meat and Bone Meal, Feather meal, and / or Fish Meal, typically in an amount of 0-25%. The animal feed composition of the invention may also comprise Dried Distillers Grains with Solubles (DDGS), typically in amounts of 0-30%. In still further particular embodiments, the animal feed composition of the invention contains 0- 80% maize; and / or 0-80% sorghum; and / or 0-70% wheat; and / or 0-70% Barley; and / or 0-30% oats; and / or 0-40% soybean meal; and / or 0-25% fish meal; and / or 0-25% meat and bone meal; and / or 0-20% whey.

[0266] The animal feed may comprise vegetable proteins. In particular embodiments, the protein content of the vegetable proteins is at least 10, 20, 30, 40, 50, 60, 70, 80, or 90% (w / w). Vegetable proteins may be derived from vegetable protein sources, such as legumes and cereals, for example, materials from plants of the families Fabaceae (Leguminosae), Cruciferaceae, Chenopodiaceae, and Poaceae, such as soy bean meal, lupin meal, rapeseed meal, and combinations thereof.

[0267] In a particular embodiment, the vegetable protein source is material from one or more plants of the family Fabaceae, e.g., soybean, lupine, pea, or bean. In another particular embodiment, the vegetable protein source is material from one or more plants of the family Chenopodiaceae, e.g., beet, sugar beet, spinach or quinoa. Other examples of vegetable protein sources are rapeseed, and cabbage. In another particular embodiment, soybean is a preferred vegetable protein source. Other examples of vegetable protein sources are cereals such as barley, wheat, rye, oat, maize (corn), rice, and sorghum.

[0268] Animal diets can e.g., be manufactured as mash feed (non-pelleted) or pelleted feed. Typically, the milled feedstuffs are mixed, and sufficient amounts of essential vitamins and minerals are added according to the specifications for the species in question. Enzymes can be added as solid or liquid enzyme formulations. For example, for mash feed a solid or liquid enzyme formulation may be added before or during the ingredient mixing step. For pelleted feed the (liquid or solid) polypeptide having alkaline phosphatase activity I enzyme preparation may also be added before or during the feed ingredient step. Typically, a liquid polypeptide having alkaline phosphatase activity or enzyme preparation comprises the polypeptide having alkaline phosphatase activity of the invention optionally with a polyol, such as glycerol, ethylene glycol or propylene glycol, and is added after the pelleting step, such as by spraying the liquid formulation onto the pellets. The enzyme may also be incorporated in a feed additive or premix.

[0269] Alternatively, the polypeptide having alkaline phosphatase activity can be prepared by freezing a mixture of liquid enzyme solution with a bulking agent such as ground soybean meal, and then lyophilizing the mixture.

[0270] In an embodiment, the animal feed or animal feed additive comprises one or more additional enzymes. In an embodiment, the animal feed comprises one or more microbes. In an embodiment, the animal feed comprises one or more vitamins. In an embodiment, the animal feed comprises one or more minerals. In an embodiment, the animal feed comprises one or more amino acids. In an embodiment, the animal feed comprises one or more other feed ingredients.

[0271] In another embodiment, the animal feed or animal feed additive comprises the polypeptide of the invention, one or more formulating agents and one or more additional enzymes. In an embodiment, the animal feed or animal feed additive comprises the polypeptide of the invention, one or more formulating agents and one or more microbes. In an embodiment, the animal feed comprises the polypeptide of the invention, one or more formulating agents and one or more vitamins. In an embodiment, the animal feed or animal feed additive comprises one or more minerals. In an embodiment, the animal feed or animal feed additive comprises the polypeptide of the invention, one or more formulating agents and one or more amino acids. In an embodiment, the animal feed or animal feed additive comprises the polypeptide of the invention, one or more formulating agents and one or more other feed ingredients.

[0272] In a further embodiment, the animal feed or animal feed additive comprises the polypeptide of the invention, one or more formulating agents and one or more components selected from the list consisting of: one or more additional enzymes; one or more microbes; one or more vitamins; one or more minerals; one or more amino acids; and one or more other feed ingredients.

[0273] The final enzyme concentration in the diet is within the range of 0.01-200 mg enzyme protein per kg diet, preferably between 0.05-100 mg / kg diet, more preferably 0.1-50 mg, even more preferably 0.2-20 mg enzyme protein per kg animal diet.

[0274] In a particular embodiment, the animal feed additive of the invention is intended for being included (or prescribed as having to be included) in animal diets or feed at levels of 0.01 to 10.0%; more particularly 0.05 to 5.0%; or 0.2 to 1.0% (% meaning g additive per 100 g feed). This is so in particular for premixes.

[0275] Alkaline Phosphatase Granules

[0276] The present invention also relates to enzyme granules / particles comprising a polypeptide of the invention. In an embodiment, the granule comprises a core, and optionally one or more coatings (outer layers) surrounding the core.

[0277] The core may have a diameter, measured as equivalent spherical diameter (volume based average particle size), of 20-2000 pm, particularly 50-1500 pm, 100-1500 pm or 250-1200 pm. The core diameter, measured as equivalent spherical diameter, can be determined using laser diffraction, such as using a Malvern Mastersizer and / or the method described under ISO13320 (2020). In an embodiment, the core comprises a polypeptide having alkaline phosphatase activity of the present invention.

[0278] The core may include additional materials such as fillers, fiber materials (cellulose or synthetic fibers), stabilizing agents, solubilizing agents, suspension agents, viscosity regulating agents, light spheres, plasticizers, salts, lubricants and fragrances.

[0279] The core may include a binder, such as synthetic polymer, wax, fat, or carbohydrate.

[0280] The core may include a salt of a multivalent cation, a reducing agent, an antioxidant, a peroxide decomposing catalyst and / or an acidic buffer component, typically as a homogenous blend.

[0281] The core may include an inert particle with the polypeptide absorbed into it, or applied onto the surface, e.g., by fluid bed coating.

[0282] The core may have a diameter of 20-2000 pm, particularly 50-1500 pm, 100-1500 pm or 250-1200 pm.

[0283] The core may be surrounded by at least one coating, e.g., to improve the storage stability, to reduce dust formation during handling, or for coloring the granule. The optional coating(s) may include a salt coating, or other suitable coating materials, such as polyethylene glycol (PEG), methyl hydroxy-propyl cellulose (MHPC) and polyvinyl alcohol (PVA).

[0284] The coating may be applied in an amount of at least 0.1% by weight of the core, e.g., at least 0.5%, at least 1 %, at least 5%, at least 10%, or at least 15%. The amount may be at most 100%, 70%, 50%, 40% or 30%.

[0285] The coating is preferably at least 0.1 pm thick, particularly at least 0.5 pm, at least 1 pm or at least 5 pm. In some embodiments, the thickness of the coating is below 100 pm, such as below 60 pm, or below 40 pm.

[0286] The coating should encapsulate the core unit by forming a substantially continuous layer. A substantially continuous layer is to be understood as a coating having few or no holes, so that the core unit has few or no uncoated areas. The layer or coating should, in particular, be homogeneous in thickness.

[0287] The coating can further contain other materials as known in the art, e.g. , fillers, antisticking agents, pigments, dyes, plasticizers and / or binders, such as titanium dioxide, kaolin, calcium carbonate or talc.

[0288] A salt coating may comprise at least 60% by weight of a salt, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% by weight.

[0289] To provide acceptable protection, the salt coating is preferably at least 0.1 pm thick, e.g., at least 0.5 pm, at least 1 pm, at least 2 pm, at least 4 pm, at least 5 pm, or at least 8 pm. In a particular embodiment, the thickness of the salt coating is below 100 pm, such as below 60 pm, or below 40 pm.

[0290] The salt may be added from a salt solution where the salt is completely dissolved or from a salt suspension wherein the fine particles are less than 50 pm, such as less than 10 pm or less than 5 pm.

[0291] The salt coating may comprise a single salt or a mixture of two or more salts. The salt may be water soluble, in particular, having a solubility at least 0.1 g in 100 g of water at 20°C, preferably at least 0.5 g per 100 g water, e.g., at least 1 g per 100 g water, e.g., at least 5 g per 100 g water.

[0292] The salt may be an inorganic salt, e.g., salts of sulfate, sulfite, phosphate, phosphonate, nitrate, chloride or carbonate or salts of simple organic acids (less than 10 carbon atoms, e.g., 6 or less carbon atoms) such as citrate, malonate or acetate. Examples of cations in these salts are alkali or earth alkali metal ions, the ammonium ion or metal ions of the first transition series, such as sodium, potassium, magnesium, calcium, zinc or aluminum. Examples of anions include chloride, bromide, iodide, sulfate, sulfite, bisulfite, thiosulfate, phosphate, monobasic phosphate, dibasic phosphate, hypophosphite, dihydrogen pyrophosphate, tetraborate, borate, carbonate, bicarbonate, metasilicate, citrate, malate, maleate, malonate, succinate, lactate, formate, acetate, butyrate, propionate, benzoate, tartrate, ascorbate or gluconate. In particular, alkali- or earth alkali metal salts of sulfate, sulfite, phosphate, phosphonate, nitrate, chloride or carbonate or salts of simple organic acids such as citrate, malonate or acetate may be used.

[0293] The salt in the coating may have a constant humidity at 20°C above 60%, particularly above 70%, above 80% or above 85%, or it may be another hydrate form of such a salt (e.g., anhydrate). The salt coating may be as described in WO 00 / 01793 or WO 2006 / 034710.

[0294] Specific examples of suitable salts are NaCI (CH2o°c=76%), Na2CO3 (CH2o°c=92%), NaNO3(CH20°C=73%), Na2HPO4(CH20°c=95%), Na3PO4(CH25°c=92%), NH4CI (CH2o°c = 79.5%), (NH4)2HPO4(CH2O°C = 93,0%), NH4H2PO4(CH20°c = 93.1%), (NH4)2SO4(CH2o°c=81 .1%), KOI (CH2O°C=85%), K2HPO4(CH2O°C=92%), KH2PO4(CH2O°C=96.5%), KNO3(CH2O°C=93.5%), Na2SO4(CH2O°C=93%), K2SO4(CH2O°C=98%), KHSO4(CH2O°C=86%), MgSO4(CH2o°c=9O%), ZnSO4(CH2O°C=9O%) and sodium citrate (CH25°c=86%). Other examples include NaH3PO4, (NH4)H3PO4, CuSO4, Mg(NO3)2 and magnesium acetate.

[0295] The salt may be in anhydrous form, or it may be a hydrated salt, i.e., a crystalline salt hydrate with bound water(s) of crystallization, such as described in WO 99 / 32595. Specific examples include anhydrous sodium sulfate (Na3SO4), anhydrous magnesium sulfate (MgSO4), magnesium sulfate heptahydrate (MgSO47H2O), zinc sulfate heptahydrate (ZnSO47H2O), sodium phosphate dibasic heptahydrate (Na2HPO47H2O), magnesium nitrate hexahydrate (Mg(NO3)2(6H2O)), sodium citrate dihydrate and magnesium acetate tetrahydrate.

[0296] Preferably the salt is applied as a solution of the salt, e.g., using a fluid bed. The coating materials can be waxy coating materials and film-forming coating materials. Examples of waxy coating materials are poly(ethylene oxide) products (polyethyleneglycol, PEG) with mean molar weights of 1000 to 20000; ethoxylated nonylphenols having from 16 to 50 ethylene oxide units; ethoxylated fatty alcohols in which the alcohol contains from 12 to 20 carbon atoms and in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and mono- and di- and triglycerides of fatty acids. Examples of film-forming coating materials suitable for application by fluid bed techniques are given in GB 1483591.

[0297] The granule may optionally have one or more additional coatings. Examples of suitable coating materials are polyethylene glycol (PEG), methyl hydroxy-propyl cellulose (MHPC) and polyvinyl alcohol (PVA). Examples of enzyme granules with multiple coatings are described in WO 93 / 07263 and WO 97 / 23606.

[0298] The core can be prepared by granulating a blend of the ingredients, e.g., by a method comprising granulation techniques such as crystallization, precipitation, pan-coating, fluid bed coating, fluid bed agglomeration, rotary atomization, extrusion, prilling, spheronization, size reduction methods, drum granulation, and / or high shear granulation.

[0299] Methods for preparing the core can be found in the Handbook of Powder Technology; Particle size enlargement by C. E. Capes; Vol. 1 ; 1980; Elsevier. Preparation methods include known feed and granule formulation technologies, e.g.,

[0300] (a) Spray dried products, wherein a liquid polypeptide-containing solution is atomized in a spray drying tower to form small droplets which during their way down the drying tower dry to form a polypeptide-containing particulate material. Very small particles can be produced this way (Michael S. Showell (editor); Powdered detergents’, Surfactant Science Series; 1998; Vol. 71 ; pages 140-142; Marcel Dekker).

[0301] (b) Layered products, wherein the polypeptide is coated as a layer around a pre-formed inert core particle, wherein a polypeptide-containing solution is atomized, typically in a fluid bed apparatus wherein the pre-formed core particles are fluidized, and the polypeptide-containing solution adheres to the core particles and dries up to leave a layer of dry polypeptide on the surface of the core particle. Particles of a desired size can be obtained this way if a useful core particle of the desired size can be found. This type of product is described in, e.g., WO 97 / 23606.

[0302] (c) Absorbed core particles, wherein rather than coating the polypeptide as a layer around the core, the polypeptide is absorbed onto and / or into the surface of the core. Such a process is described in WO 97 / 39116.

[0303] (d) Extrusion or pelletized products, wherein a polypeptide-containing paste is pressed to pellets or under pressure is extruded through a small opening and cut into particles which are subsequently dried. Such particles usually have a considerable size because of the material in which the extrusion opening is made (usually a plate with bore holes) sets a limit on the allowable pressure drop over the extrusion opening. Also, very high extrusion pressures when using a small opening increase heat generation in the polypeptide paste, which is harmful to the polypeptide (Michael S. Showell (editor); Powdered detergents’, Surfactant Science Series; 1998; Vol. 71 ; pages 140-142; Marcel Dekker).

[0304] (e) Prilled products, wherein a polypeptide-containing powder is suspended in molten wax and the suspension is sprayed, e.g., through a rotating disk atomizer, into a cooling chamber where the droplets quickly solidify (Michael S. Showell (editor); Powdered detergents’, Surfactant Science Series; 1998; Vol. 71 ; pages 140-142; Marcel Dekker). The product obtained is one wherein the polypeptide is uniformly distributed throughout an inert material instead of being concentrated on its surface. US 4,016,040 and US 4,713,245 describe this technique.

[0305] (f) Mixer granulation products, wherein a polypeptide-containing liquid is added to a dry powder composition of conventional granulating components. The liquid and the powder in a suitable proportion are mixed and as the moisture of the liquid is absorbed in the dry powder, the components of the dry powder will start to adhere and agglomerate and particles will build up, forming granulates comprising the polypeptide. Such a process is described in US 4,106,991 , EP 170360, EP 304332, EP 304331 , WO 90 / 09440 and WO 90 / 09428. In a particular aspect of this process, various high-shear mixers can be used as granulators. Granulates consisting of polypeptide, fillers and binders etc. are mixed with cellulose fibers to reinforce the particles to produce a so-called T-granulate. Reinforced particles, are more robust, and release less enzymatic dust.

[0306] (g) Size reduction, wherein the cores are produced by milling or crushing of larger particles, pellets, tablets, briquettes etc. containing the polypeptide. The wanted core particle fraction is obtained by sieving the milled or crushed product. Over and undersized particles can be recycled. Size reduction is described in Martin Rhodes (editor); Principles of Powder Technology; 1990; Chapter 10; John Wiley & Sons.

[0307] (h) Fluid bed granulation. Fluid bed granulation involves suspending particulates in an air stream and spraying a liquid onto the fluidized particles via nozzles. Particles hit by spray droplets get wetted and become tacky. The tacky particles collide with other particles and adhere to them to form a granule.

[0308] (i) The cores may be subjected to drying, such as in a fluid bed drier. Other known methods for drying granules in the feed or enzyme industry can be used by the skilled person. The drying preferably takes place at a product temperature of from 25 to 90°C. For some polypeptides, it is important the cores comprising the polypeptide contain a low amount of water before coating with the salt. If water sensitive polypeptides are coated with a salt before excessive water is removed, the excessive water will be trapped within the core and may affect the activity of the polypeptide negatively. After drying, the cores preferably contain 0.1-10% w / w water. Non-dusting granulates may be produced, e.g., as disclosed in US 4,106,991 and US 4,661 ,452 and may optionally be coated by methods known in the art.

[0309] The granulate may further comprise one or more additional enzymes, e.g., hydrolase, isomerase, ligase, lyase, oxidoreductase, and transferase. The one or more additional enzymes are preferably selected from the group consisting of acetylxylan esterase, acylglycerol lipase, amylase, alpha-amylase, beta-amylase, arabinofuranosidase, cellobiohydrolases, cellulase, feruloyl esterase, galactanase, alpha-galactosidase, beta-galactosidase, beta-glucanase, betaglucosidase, lysophospholipase, lysozyme, alpha-mannosidase, beta-mannosidase (mannanase), phytase, phospholipase A1 , phospholipase A2, phospholipase D, protease, pullulanase, pectin esterase, triacylglycerol lipase, xylanase, beta-xylosidase or any combination thereof. Each enzyme will then be present in more granules securing a more uniform distribution of the enzymes, and also reduces the physical segregation of different enzymes due to different particle sizes. Methods for producing multi-enzyme co-granulates is disclosed in the ip.com disclosure IPCOM000200739D.

[0310] Another example of formulation of polypeptides by the use of co-granulates is disclosed in WO 2013 / 188331.

[0311] The present invention also relates to protected polypeptides prepared according to the method disclosed in EP 238216.

[0312] Liquid Formulations

[0313] The present invention also relates to liquid compositions comprising a polypeptide of the invention. The composition may comprise an enzyme stabilizer (examples of which include polyols such as propylene glycol or glycerol, sugar or sugar alcohol, lactic acid, reversible protease inhibitor, boric acid, or a boric acid derivative, e.g., an aromatic borate ester, or a phenyl boronic acid derivative such as 4-formyl phenyl boronic acid).

[0314] In some embodiments, filler(s) or carrier material(s) are included to increase the volume of such compositions. Suitable filler or carrier materials include, but are not limited to, various salts of sulfate, carbonate and silicate as well as talc, clay and the like. Suitable filler or carrier materials for liquid compositions include, but are not limited to, water or low molecular weight primary and secondary alcohols including polyols and diols. Examples of such alcohols include, but are not limited to, methanol, ethanol, propanol and isopropanol. In some embodiments, the compositions contain from about 5% to about 90% of such materials.

[0315] In an aspect, the liquid formulation comprises 20-80% w / w of polyol. In one embodiment, the liquid formulation comprises 0.001-2% w / w preservative. In another embodiment, the invention relates to liquid formulations comprising:

[0316] (A) 0.001-25% w / w of polypeptide having alkaline phosphatase activity of the present invention;

[0317] (B) 20-80% w / w of polyol;

[0318] (C) optionally 0.001-2% w / w preservative; and

[0319] (D) water.

[0320] In another embodiment, the invention relates to liquid formulations comprising:

[0321] (A) 0.001-25% w / w of a polypeptide having alkaline phosphatase activity of the present invention;

[0322] (B) 0.001-2% w / w preservative;

[0323] (C) optionally 20-80% w / w of polyol; and

[0324] (D) water.

[0325] In another embodiment, the liquid formulation comprises one or more formulating agents, such as a formulating agent selected from the group consisting of polyol, sodium chloride, sodium benzoate, potassium sorbate, sodium sulfate, potassium sulfate, magnesium sulfate, sodium thiosulfate, calcium carbonate, sodium citrate, dextrin, glucose, sucrose, sorbitol, lactose, starch, PVA, acetate and phosphate, preferably selected from the group consisting of sodium sulfate, dextrin, cellulose, sodium thiosulfate, kaolin and calcium carbonate. In one embodiment, the polyols is selected from the group consisting of glycerol, sorbitol, propylene glycol (MPG), ethylene glycol, diethylene glycol, triethylene glycol, 1 ,2-propylene glycol or 1 ,3-propylene glycol, dipropylene glycol, polyethylene glycol (PEG) having an average molecular weight below about 600 and polypropylene glycol (PPG) having an average molecular weight below about 600, more preferably selected from the group consisting of glycerol, sorbitol and propylene glycol (MPG) or any combination thereof.

[0326] In another embodiment, the liquid formulation comprises 20-80% polyol ( / .e., total amount of polyol), e.g., 25-75% polyol, 30-70% polyol, 35-65% polyol, or 40-60% polyol. In one embodiment, the liquid formulation comprises 20-80% polyol, e.g., 25-75% polyol, 30-70% polyol, 35-65% polyol, or 40-60% polyol, wherein the polyol is selected from the group consisting of glycerol, sorbitol, propylene glycol (MPG), ethylene glycol, diethylene glycol, triethylene glycol, 1 ,2-propylene glycol or 1 ,3-propylene glycol, dipropylene glycol, polyethylene glycol (PEG) having an average molecular weight below about 600 and polypropylene glycol (PPG) having an average molecular weight below about 600. In one embodiment, the liquid formulation comprises 20-80% polyol ( / .e., total amount of polyol), e.g., 25-75% polyol, 30-70% polyol, 35-65% polyol, or 40-60% polyol, wherein the polyol is selected from the group consisting of glycerol, sorbitol and propylene glycol (MPG). In another embodiment, the preservative is selected from the group consisting of sodium sorbate, potassium sorbate, sodium benzoate and potassium benzoate or any combination thereof. In one embodiment, the liquid formulation comprises 0.02-1.5% w / w preservative, e.g., 0.05-1% w / w preservative or 0.1-0.5% w / w preservative. In one embodiment, the liquid formulation comprises 0.001-2% w / w preservative ( / .e., total amount of preservative), e.g., 0.02- 1.5% w / w preservative, 0.05-1% w / w preservative, or 0.1-0.5% w / w preservative, wherein the preservative is selected from the group consisting of sodium sorbate, potassium sorbate, sodium benzoate and potassium benzoate or any combination thereof.

[0327] In another embodiment, the liquid formulation further comprises one or more additional enzymes, e.g., hydrolase, isomerase, ligase, lyase, oxidoreductase, and transferase. The one or more additional enzymes are preferably selected from the group consisting of acetylxylan esterase, acylglycerol lipase, amylase, alpha-amylase, beta-amylase, arabinofuranosidase, cellobiohydrolases, cellulase, feruloyl esterase, galactanase, alpha-galactosidase, betagalactosidase, beta-glucanase, beta-glucosidase, lysophospholipase, lysozyme, alpha- mannosidase, beta-mannosidase (mannanase), phytase, phospholipase A1, phospholipase A2, phospholipase D, protease, pullulanase, pectin esterase, triacylglycerol lipase, xylanase, beta- xylosidase or any combination thereof.

[0328] EXAMPLES

[0329] Example 1 : Cloning, expression and fermentation of fungal ALP

[0330] Materials and Methods

[0331] Strains

[0332] Escherichia coli Top-10 strain purchased from TIANGEN (TIANGEN Biotech Co. Ltd., Beijing, China) was used to propagate our expression vector.

[0333] Aspergillus oryzae strain MT3568 (described in WO2015040159) was used for heterologous expression of the genes described in Table 5.

[0334] Aspergillus oryzae strain DAU785 (described in WO2018 / 113745) was used for heterologous expression of the genes described in the Table 6.

[0335] Media

[0336] Dap4C medium was composed of 11 g MgSCu HhO, 1 g KH2 O4, 2.2 g Citric acidTW, 20 g glucose, 10 g maltose, 5.2 g K3PO4 H2O, 0.5 g yeast extract, 1.25 g CaCOs, 0.5 ml AMG Trace element solution and deionized water to 1 liter. After autoclave, 3.3 ml of 20% Lactic Acid (autoclaved) and 9.3 ml of 50% (NH4)2HPO4 (sterile filtered) were added to every 400 ml above medium. AMG Trace element solution was composed of 6.8 g ZnCh, 2.5 g CUSO4.5H2O, 0.24 g NiCl2'5H2O, 13.9 g FeSO .7H2O, 13.6 g MnSO4.5H2O, 3 g Citric acid FLO, and deionised water to 1000 ml.

[0337] LB plates were composed of 10 g of Bacto-tryptone, 5 g of yeast extract, 5 g of sodium chloride, 15g of Bacto-agar, and deionised water to 1000 ml. LB medium was composed of 10g of Bacto- tryptone, 5 g of yeast extract, and 5 g of sodium chloride, and deionised water to 1000 ml. COVE sucrose plates were composed of 342 g of sucrose, 20 g of agar powder, 20 ml of COVE salt solution, and deionized water to 1 liter. The medium was sterilized by autoclaving at 15 psi for 15 minutes. For the transformation of MT3568, 10 mM acetamide was added, when the medium was cooled to 60°C. For the transformation of Dau785, simply add 10ml of 1 M NaNOs instead of acetamide. TOP agar was composed of 6g SeaKem GTG agarose, 20ml of COVE salt solution, 342g sucrose in a final volume of 1 L with ddH2O. After autoclaving, add 10ml of 1M Acetamide for the transformation selection of MT3568 or add 10ml of 1 M NaNOs for the transformation selection of Dau785.

[0338] COVE-2 plate / tube for isolation: 30 g / L sucrose, 20 ml / L COVE salt solution, 10 mM acetamide (for transformation of MT3568) or 10mM NaNO3 (for transformation of Dau785), 30 g / L noble agar (Difco, Cat#214220). COVE salt solution was composed of 26 g of MgSO4'7H2O, 26g of KCL, 76g of KH2PO4, 50 ml of COVE trace metal solution, and deionised water to 1000 ml. COVE trace metal solution was composed of 0.04g of Na2B40y 10H20, 0.4g of CUSO4 5H2O, 0.8g of FeSO4'7H2O, 0.8g of MnSO4'H2O, 0.8g of Na2MoO4'2H2O, 8g of ZnSO4'7H2O, and deionised water to 1000 ml.

[0339] The alkaline phosphatase (ALP) genes derived from fungal strains isolated from environmental samples by standard microbiological isolation techniques. Strains were identified, and taxonomy was assigned based on DNA sequencing of the ITS (Table 5 and Table 6).

[0340] Table 5:

[0341] Table 6:

[0342] Chromosomal DNA from individual strains (Table 5 and Table 6) was isolated by DNeasy® Plant Maxi Kit (Qiagen, Hilden, Germany). 5 pg of chromosomal DNA were sent for full genome sequencing using Illumina technology. Genome sequencing, the subsequent assembly of reads and the gene discovery (i.e. annotation of gene functions) is known to the person skilled in the art and the service can be purchased commercially. The genome sequences were analyzed for putative ALP from the PFAM database families PF00245. This analysis identified genes encoding putative ALP, which were subsequently cloned and recombinantly expressed in Aspergillus oryzae.

[0343] The ALP genes were amplified by PCR respectively from above isolated genomic DNA. The purified PCR product was cloned into the previously digested pCaHj505 (for the genes listed in Table 1) or pDAU724 (for the genes listed in Table 2) by ligation with an IN-FUSION™ CF Drydown Cloning Kit (Clontech Laboratories, Inc., Mountain View, CA, USA) according to the manufacturer's instructions. The ligation mixture was used to transform E. coli TOP10 chemically competent cells (described in Strains). Colonies containing the corresponding ALP genes were selected and verified by DNA sequencing (by SinoGenoMax Company Limited, Beijing, China). The correct ALP containing colony was cultivated overnight in 3 ml of LB medium supplemented with 100 pg of ampicillin per ml. Plasmid DNA was purified using a Qiagen Spin Miniprep kit (Cat. 27106) (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions.

[0344] Protoplasts of Aspergillus oryzae MT3568 were prepared according to WQ95 / 002043. Protoplasts of Aspergillus oryzae DAU785 were prepared according to WQ2018 / 113745. 100 pl of protoplasts were mixed with 2.5-10 pg of the Aspergillus expression vector (above extracted plasmid) comprising the ALP gene and 250 pl of 60% PEG 4000, 10mM CaCh, and 10mM Tris- HCI pH7.5 and gently mixed. The mixture was incubated at 37°C for 30 minutes and the protoplasts were spread onto COVE sucrose plates for selection. After incubation for 4-7 days at 37°C spores of 4 transformants were inoculated into 3 ml of Dap4C medium. After 3 days cultivation at 30°C, the culture broths were analyzed by SDS-PAGE using

[0345] Novex® 4-20% Tris-Glycine Gel (Invitrogen Corporation, Carlsbad, CA, USA) to identify the transformants producing the largest amount of recombinant ALP with respective estimated mature peptide size. Spores of the best expressed transformant were spread on COVE-2 plates for re-isolation in order to isolate single colonies. Then a single colony was spread on a COVE-2 tube until sporulation. Spores from the best expressed transformant were cultivated in 1600-2400 ml of Dap4C medium in shake flasks during 3 days at a temperature of 30°C under 80 rpm agitation. Culture broth was harvested by filtration using a 0.22 pm filter device. The filtered fermentation broth was used for enzyme characterization.

[0346] Example 2: Cloning and expression of bacterial alkaline phosphatase polypeptides Examples of the polypeptide having alkaline phosphatases of bacterial, annotated with the IPR001952 domain as defined in the InterPro database (Blum et al., 2021; Nucleic Acids Research, D344-D354) were identified from either isolated bacterial strains or metagenomes subjected to full genome Next Generation Sequencing or from public databases (Table 7).

[0347] Table 7:

[0348] The DNA encoding sequences of the alkaline phosphatase mature peptides were ordered as synthetic genes at Twist Bioscience. The synthetic DNA fragments were directionally assembled to a Bacillus expression vector described in WO12 / 025577 by the standard Golden Gate cloning method using Bsal and T4 DNA ligase enzymes. Briefly, the DNA encoding the mature peptide of the gene was cloned in frame to a Bacillus clausii secretion signal (BcSP; with the following amino acid sequence: MKKPLGKIVASTALLISVAFSSSIASA (SEQ ID NO: E). BcSP replaced the native secretion signal in the gene. Downstream of the BcSP sequence, an affinity tag sequence was introduced to ease the purification process (His-tag; with the following amino acid sequence: HHHHHHPR (SEQ ID NO: F). The gene that was expressed therefore comprised the BcSP sequence followed by the His-tag sequence followed by the mature wild type alkaline phosphatase gene sequence. The final expression plasmid (BcSP-His-tag-alkaline phosphatase) was transformed into a Bacillus subtilis expression host. The alkaline phosphatase BcSP-fusion gene was integrated by homologous recombination into the Bacillus subtilis host cell genome upon transformation. The gene construct was expressed under the control of a triple promoter system (as described in WO 99 / 43835). The gene coding for chloramphenicol acetyltransferase was used as marker (as described in Diderichsen et al., 1993, Plasmid 30: 312-315)). Transformants were selected on LB media agar supplemented with 6 microgram of chloramphenicol per ml. One recombinant Bacillus subtilis clone containing the alkaline phosphatase expression construct was selected and was cultivated on a rotary shaking table in 500 ml baffled Erlenmeyer flasks each containing 100 ml yeast extract-based media. After 3 days cultivation time at 30 °C, the enzyme containing supernatant was harvested by centrifugation and the enzyme was purified by His-tag purification.

[0349] Example 3: Cloning and expression of fungal ALPs

[0350] Sequences

[0351] SEQ ID NO: 17 from Trichoderma citrinoviride

[0352] SEQ ID NO: 18 from Truncatella angustata

[0353] SEQ ID NO: 19 Morchella semilibera

[0354] Cloning and expression of SEQ ID NO: 17 from Trichoderma citrinoviride

[0355] Strains

[0356] Escherichia coli Top-10 strain purchased from Invitrogen (Life Technologies, Carlsbad, CA, USA) was used to propagate our expression vectors encoding for alkaline phosphatase polypeptides. Aspergillus oryzae strain MT3568 was used for heterologous expression of the alkaline phosphatase polypeptide encoding seguences. A. oryzae MT3568 is an amdS (acetamidase) disrupted gene derivative of Aspergillus oryzae JaL355 (WO 2002 / 40694) in which pyrG auxotrophy was restored by disrupting the A. oryzae acetamidase (amdS) gene with the pyrG gene.

[0357] Media

[0358] DAP4C-1 medium was composed of 0.5g yeast extract, 15g Maltodextrin, 15g Glucose, 11g magnesium sulphate heptahydrate, 1g dipotassium phosphate, 2g citric acid monohydrate, 5.2g potassium phosphate tribasic monohydrate, 1mL Dowfax 63N10 (antifoaming agent), 2.5g calcium carbonate, supplemented with 1 mL KU6 metal solution, and deionised water to 1000mL.

[0359] KU6 metal solution was composed of 6.8g ZnCh, 2.5g CUSO4.5H2O, 0.13 g NiCh, 13.9g FeSO4.7H2O, 8.45g MnSO4.H2O, 3g CeHsOy.tW, and deionised water to 1000mL.

[0360] YP 2% glucose medium was composed of 10g yeast extract, 20g Bacto-peptone, 20g glucose, and deionised water to 1000mL. LB plates were composed of 10g of Bacto-tryptone, 5g of yeast extract, 10g of sodium chloride, 15g of Bacto-agar, and deionised water to 1000 mL. LB medium was composed of 10g of Bacto-tryptone, 5g of yeast extract, and 10g of sodium chloride, and deionised water to 1000mL. COVE-Sucrose-T plates were composed of 342g of sucrose, 20g of agar powder, 20mL of COVE salt solution, and deionised water to lOOOmL. The medium was sterilized by autoclaving at 15psi for 15 minutes (Bacteriological Analytical Manual, 8th Edition, Revision A, 1998). The medium was cooled to 60°C and 10mM acetamide, Triton X-100 (50pL / 500mL) were added. COVE-N-Agar tubes were composed of 218g Sorbitol, 10g Dextrose, 2.02g KNO3, 25g agar, 50mL Cove salt solution, and deionised water up to 1000mL. COVE salt solution was composed of 26g of MgSO4'7H2O, 26g of KCL, 26g of KH2PO4, 50mL of COVE trace metal solution, and deionised water to 1000mL. COVE trace metal solution was composed of 0.04g of Na2B4O7'10H2Q, 0.4g of CuSO4-5H2O, 1.2g of FeSO4-7H2O, 0.7g of MnSO4H2O, 0.8g of Na2MoO4'2H2O, 10g of ZnSO4'7H2O, and deionised water to 1000mL.

[0361] The SEQ ID NO: 17 polypeptide coding sequence was cloned from Trichoderma citrinoviride DNA by PCR. Trichoderma citrinoviride was cultivated in 100 ml of YP + 2% glucose medium in 1000 ml Erlenmeyer shake flasks for 5 days at 20°C. Mycelia were harvested from the flasks by filtration of the medium through a Buchner vacuum funnel lined with MIRACLOTH® (EMD Millipore, Billerica, MA, USA). Mycelia were frozen in liquid nitrogen and stored at -80C until further use. Genomic DNA was isolated using a DNEASY® Plant Maxi Kit (QIAGEN GMBH, Hilden Germany) according to the manufacturer’s instructions.

[0362] Genomic sequence information was generated by Illumina MySeq (Illumina Inc., San Diego, CA). 5 pgs of the isolated Trichoderma citrinoviride genomic DNA was used for library preparation and analysis according to the manufacturer’s instructions. A 300 bp, paired end strategy was employed with a library insert size of 200-500 bp. The reads were subsequently fractionated to 25% followed by trimming (extracting longest sub-sequences having Phred- scores of 10 or more). These reads were assembled using Idba version 0.18. Contigs shorter than 200 bp were discarded. Genes were called using GeneMark.hmm ES version 2.3c and identification of the catalytic domain was made using " Alk_Phosphatase PF00245 " Hidden Markov Model provided by Pfam. The polypeptide coding sequence for the entire coding region was cloned from Trichoderma citrinoviride genomic DNA by PCR using the primers (SEQ ID NO: A and SEQ ID NO: B) described below.

[0363] 5’-ACACAACTGGGGATCCACCATGATTGCCAAGCTCGGA-3’ (SEQ ID NO: A)

[0364] 5’-AGATCTCGAGAAGCTTACTAGTAGCTCTCCTTGCC-3’ (SEQ ID NO: B) Bold letters represent Trichoderma citrinoviride enzyme coding sequence. Restriction sites are underlined. The sequence to the left of the restriction sites is homologous to the insertion sites of pDau109 (WO 2005 / 042735).

[0365] In-Fusion™ Advantage PCR Cloning Kit Cat. nr 639620

[0366] The amplification reaction (50 pl) was performed according to the manufacturer’s instructions (Thermo Scientific) with the following final concentrations: 1X Phusion HC buffer 200uM dNTP 2.0 mM MgCh

[0367] 0.5uM of each primer of SEQ ID NO: 3 + 4 10ng of Trichoderma citrinoviride genomic DNA.

[0368] The PCR reaction was incubated in a DYAD® Dual-Block Thermal Cycler (BioRad, USA) programmed for 1 cycle at 98°C for 30 seconds; 30 cycles each at 98°C for 10 seconds, 57°C for 20 seconds and 72°C for two minutes followed by 1 cycle at 72°C for 5 minutes. Samples were cooled to 10°C before removal and further processing.

[0369] Five pl of the PCR reaction were analyzed by 1% agarose gel electrophoresis using 40 mM Tris base, 20 mM sodium acetate, 1 mM disodium EDTA (TAE) buffer. A major band of about 2,3 kb was observed. The remaining PCR reaction was purified directly with an ILLUSTRA™ GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer's instructions.

[0370] Two pg of plasmid pDau109 was digested with Bam HI and Hind III and the digested plasmid was run on a 1% agarose gel using 50 mM Tris base-50 mM boric acid-1 mM disodium EDTA (TBE) buffer in order to remove the stuffer fragment from the restricted plasmid. The bands were visualized by the addition of SYBR® Safe DNA gel stain (Life Technologies Corporation, Grand Island, NY, USA) and use of a 470 nm wavelength transilluminator. The band corresponding to the restricted plasmid was excised and purified using an ILLUSTRA™ GFX™ PCR DNA and Gel Band Purification Kit. The plasmid was eluted into 10 mM Tris pH 8.0 and its concentration adjusted to 20 ng per pl. An IN-FUSION® PCR Cloning Kit (Clontech Laboratories, Inc., Mountain View, CA, USA) was used to clone the 2.3 kb PCR fragment into pDau109 digested with Bam HI and Hind III (20 ng). The IN-FUSION® total reaction volume was 10 pl. The IN-FUSION® total reaction volume was 10 pl. The IN-FUSION® reaction was transformed into FUSION-BLUE™ E. coli cells (Clontech Laboratories, Inc., Mountain View, CA, USA) according to the manufacturer’s protocol and plated onto LB agar plates supplemented with 50 pg of ampicillin per ml. After incubation overnight at 37°C, transformant colonies were observed growing under selection on the LB plates supplemented with 50 pg of ampicillin per ml.

[0371] Several colonies were selected for analysis by colony PCR using the pDau222 pDau109 vector primers described below. Four colonies were transferred from the LB plates supplemented with 50 pg of ampicillin per ml with a yellow inoculation pin (Nunc A / S, Denmark) to new LB plates supplemented with 50 pg of ampicillin per ml and incubated overnight at 37°C.

[0372] Primer 8653: 5’-GCAAGGGATGCCATGCTTGG-3’ (SEQ ID NO: C)

[0373] Primer 8654: 5’-CATATAACCAATTGCCCTC-3’ (SEQ ID NO: D)

[0374] Each of the three colonies were transferred directly into 200 pl PCR tubes composed of 5 pl of 2X Thermo Scientific Dream Taq™ PCR Master Mix (Thermo Fisher Scientific, Rockford, IL, USA), 0.5 pl of primer 8653 (10 pm / pl), 0.5 pl of primer 8654 (10 pm / pl), and 4 pl of deionized water. Each colony PCR was incubated in a DYAD® Dual-Block Thermal Cycler programmed for 1 cycle at 94°C for 60 seconds; 30 cycles each at 95°C for 30 seconds, 60°C for 45 seconds, 72°C for 120 seconds, 68°C for 10 minutes, and 10°C for 10 minutes.

[0375] Four pl of each completed PCR reaction were submitted to 1% agarose gel electrophoresis using TAE buffer. All four E. coli transformants showed a PCR band of about 2,3 kb. Plasmid DNA was isolated from each of the four colonies using a QIAprep Spin Miniprep Kit (QIAGEN GMBH, Hilden Germany). The resulting plasmid DNA was sequenced with primers 8653 and 8654 using an Applied Biosystems Model 3730 Automated DNA Sequencer using version 3.1 BIG-DYE™ terminator chemistry (Applied Biosystems, Inc., Foster City, CA, USA).

[0376] The plasmid was chosen for transforming Aspergillus oryzae MT3568. A. oryzae MT3568 is an amdS (acetamidase) disrupted gene derivative of Aspergillus oryzae JaL355 (WO 2002 / 40694) in which pyrG auxotrophy was restored by inactivating the A. oryzae amdS gene. Protoplasts of A. oryzae MT3568 were prepared according to the method described in European Patent, EP0238023, pages 14-15.

[0377] E. coli 190 containing the plasmid was grown overnight according to the manufacturer’s instructions (Genomed) and plasmid DNA was isolated using a Plasmid Midi Kit (Genomed JETquick kit, cat.nr. 400250, GENOMED GmbH, Germany) according to the manufacturer’s instructions. The purified plasmid DNA was transformed into Aspergillus oryzae MT3568. A. oryzae MT3568 protoplasts were prepared according to the method of Christensen et al., 1988, Bio / Technology 6: 1419-1422. The selection plates consisted of COVE sucrose with +10 mM acetamide +15 mM CsCI + TRITON® X-100 (50pl / 500ml). The plates were incubated at 37°C. Briefly, 8uls of plasmid DNA representing 3ugs of DNA was added to 100uls MT3568 protoplasts. 250 ul of 60% PEG solution was added and the tubes were gently mixed and incubate at 37° for 30 minutes. The mix was added to 10 ml of pre- melted Cove top agarose (The top agarose melted and then the temperature equilibrated to 40 C in a warm water bath before being added to the protoplast mixture). The combined mixture was then plated on two Cove-sucrose selection petri plates with 10mM Acetamide. The plates are incubated at 37°C for 4 days. Single Aspergillus transformed colonies were identified by growth on the selection Acetimide as a carbon source. Each of the four A. oryzae transformants were inoculated into 750 pl of YP medium supplemented with 2% glucose and also 750 pl of 2% maltodextrin and also DAP4C in 96 well deep plates and incubated at 37°C stationary for 4 days. At same time the four transformants were restreaked on COVE-2 sucrose agar medium.

[0378] Culture broth from the Aspergillus oryzae transformants were then analyzed for production of the P63TNK ALP polypeptide by SDS-PAGE using NLIPAGE® 10% Bis-Tris SDS gels (Invitrogen, Carlsbad, CA, USA) according to the manufacturer. A single band at approximately 90 kDa was observed for each of the Aspergillus oryzae transformants. The larger than predicted size of 69 kDa is most likely due to glycosylation. One A. oryzae transformant producing the SEQ ID NO: 17 was designated A. oryzae EXP08508. A. oryzae EXP13030 was cultivated in 1000 ml Erlenmeyer shake flasks containing 100 ml of DAP4C medium at 30°C for 3 days with agitation at 150 rpm.

[0379] Cloning and expression of SEQ ID NO:18 from Truncatella angustata and SEQ ID NO:18 from Morchella semilibera were performed exactly in the above description with the following specifics:

[0380] Primers used for PCR amplification of InFusion inserts:

[0381] SEQ ID NO:18

[0382] ACACAACTGGGGATCCACCATGTTCAGCCGACTAGCC

[0383] AGATCTCGAGAAGCTTACTATTTCTGGCAAGATCCAC

[0384] PCR fragment size produced: 2,2 kb

[0385] Aspergillus recombinant protein size: 70,5 kDA, observed: approx. 85 kDa

[0386] SEQ ID NO:19

[0387] ACACAACTGGGGATCCACCATGAACGTCAACAGCCTG

[0388] AGATCTCGAGAAGCTTATTAGTGATGGAAGTGAGTAAGA

[0389] PCR fragment size produced: 1,8 kb Aspergillus recombinant protein size: 53,3 kDA, observed: approx. 55 kDa.

[0390] Example 4: Purification of alkaline phosphatase

[0391] Typically, the purification process for alkaline phosphatase (ALP) from culture broth was firstly applied with hydrophobic interaction chromatography on AKTA Chromatography system (Cytiva), then if needed, ion exchange chromatography was applied. The difference for all the molecules was buffer type, pH, and salt concentration.

[0392] The conductivity of culture supernatant of recombinant ALP was adjusted to about 190 mS / cm by adding ammonium sulfate, then the culture broth was loaded into Phenyl Sepharose High Performance column (Cytiva, 17108203) equilibrated with 20mM Tris-HCI at pH7.0 containing 2.0M ammonium sulfate. A gradient decrease of ammonium sulfate concentration from 2.0M to 0 was set up as elution condition. The elution fractions and flow-through faction were assayed by SDS-PAGE. ALP activity was determined as described below.

[0393] Ion exchange chromatography process was applied for further purification. The fractions with ALP activity were pooled together and dialyzed with 20mM Tris-HCI at pH8.0, then loaded into a MonoQ HR16 / 10 (Cytiva, 17050601) or CaptoQ column (Cytiva, 17547003) equilibrated with 20mM Tris-HCI at pH8.0. A gradient increase of NaCI concentration from 0 to 1M with 20mM Tris-HCI at pH8.0 was set up as elution process. The elution fractions and flow-through fraction were assayed for SDS-PAGE and ALP activity.

[0394] Finally, the fractions with enzyme activity were pooled together and then diafiltrated with 20mM PBS at pH7.0. The protein concentration was determined by Qubit™ Protein Assay Kit (Invitrogen, Q33212).

[0395] Example 5: His tag purification method

[0396] His-tagged alkaline phosphatases were purified by immobilized metal chromatography (IMAC) using Ni2+as the metal ion on 5 mL HisTrap Excel columns (GE Healthcare Life Sciences). The purification took place at pH 7 and the bound protein was eluted with imidazole. The purity of the purified enzymes was checked by SDS-PAGE and the concentration of the enzyme determined by Absorbance 280 nm after a buffer exchange in 50mM HEPES, 100mM NaCI pH7.0 Ref: “The InterPro protein families and domains database: 20 years on". Blum M1 , Chang HY1 , Chuguransky S1 , Grego T1 , Kandasaamy S1 , Mitchell A1 , Nuka G1 , Paysan-Lafosse T1 , Qureshi M 1 , Raj S1 , Richardson L1 , Salazar GA1 , Williams L1 , Bork P2, Bridge A3, Gough J4, Haft DH5, Letunic I6, Marchler-Bauer A5, Mi H7, Natale DA8, Necci M9, Orengo CA10, Pandurangan AP4, Rivoire C3, Sigrist CJA3, Sillitoe 110, Thanki N5, Thomas PD7, Tosatto SCE9, Wu CH8, Bateman A1, Finn RD1. Nucleic Acids Research, 01 Jan 2021 , 49(D1):D344- D354

[0397] Example 6: Identification of stabilized variants

[0398] The stabilized variants of SEQ ID 11 , SEQ ID NO:61 to SEQ ID NO: 85, were identified by site saturation. Libraries were and screened as described below. After improved substitutions were identified, the improved substitutions were combined using SOE PCR, transformed into bacillus subtilis, and the resulting variants screened in the same assay to identify the stabilized combination variants.

[0399] Cultivation of variants for assay

[0400] Variants are inoculated in 2.2mL deep-well plates with 600 pL CAL18 medium and grown for 2 days at 37C, 700 RPM. The cells are spun down and the supernatant is used for the assay.

[0401] Screening of variants for identification of stabilized variants

[0402] In this example, variants wered stressed at pH 4.0. This was used to identify the stabilizing substitutions. To identify stabilizing combinations and rank the top hits, pH was lowered to pH 3.4, pH 3.2 and pH 3.0. The supernatant sample is split in two, called “stressed” and “unstressed” sample. The stressed sample is diluted 8 pL into 70 pL of pH 4.0 buffer (660ml 1M Citric acid + 340 ml 1M Na-citrate). The unstressed sample is diluted 8 pL into 255 pL pH 8.0 buffer (200mM Tris pH 8, 0,1 mM CaCh, 10uM ZnCh, 5uM MgCh, 0,01% Tween). Both samples are incubated for 60 minutes at room temperature while shaking. After incubation the stressed sample is diluted by first adding 78 pL of the stressed ample into 185 pL pH 8 buffer, and then from there diluting 35 pL into 175 mL of pH 8 buffer. The unstressed sample is similarly diluted by adding 35 pL into 175 pL pH 8.0 buffer. After mixing reading is done by adding 10 pL diluted sample (stressed or unstressed) to a 385-well reader plate. Then 40 pL pNP-phosphate disodiumsalt hexahydrate, CAS 333338-18-4, 2mg / ml in 100mM Tris pH8,0, 0,01% tween, 0,1 mM CaCh is added to each well, and the plate is immediately put in the reader for data collection. We used a BioTek Neo2 plate-reader. Absorbanse is measured at 405 nm over 30 minutes, and the activity of each well is determined by the maximal slope of the kinetic curve. Hits are variants showing a higher residual activity (activity of stressed sample divided by activity of unstressed sample) than the reference and an unstressed activity not lower than the reference.

[0403] Example 7 - LPS Activity

[0404] A titration of alkaline phosphatase was mixed with 300 pg / mL LPS in 50 mM HEPES buffer supplemented with 0.0% Triton X-100. The mixture was incubated shaking for 60 min at 40 degrees C. Free phosphate was detected with Malachite Green Phosphate Detection Kit (R&D Systems) following manufactures protocol.

[0405] In short, 10 pL of Reagent A (ammonium molybdate in 3 M sulfuric acid) was added to all samples followed by 10 min incubation. Then 10 pL of Reagent B (malachite green oxalate and polyvinyl alcohol) was added and samples were incubated for an additional 20 min. The plate was read at OD620. Background from individual components (alkaline phosphatase, LPS, buffer) was substratcted to reveal OD values from only LPS dephosphorylation. From the measured levels of free phosphate by the alkaline phosphatase titration a non-linear curve fitting was done and EC50 calculated.

[0406] MAMP - Detoxification Assays

[0407] LPS de-phosphorylation was measured with the Malachite Green Phosphate Detection kit, which detects free PO4. E. coli LPS was treated with titration of ALP followed by detection of released PO4. LPS, flagellin and bacteria de-toxification was measured in: TLR4 reporter cells, HT-29 epithelial cell line and Primary immune cells

[0408] ALP-treated LPS was added to cells and luminescence (for reporter cells) or cytokines were measured for evaluation of stimulatory capacity of LPS and flagellin

[0409] LPS: Malachite green phosphate detection kit - Results

[0410] 300 pg / mL E. coli 0111:B4 LPS is treated with titration of ALPs for 1 hour at 40 °C. Buffer: 50 mM HEPES with 0.01% Triton X-100. Background from LPS, ALP and buffer is subtracted. CIAP is from Sigma and is used as reference.

[0411] Table 8

[0412]

[0413]

[0414] Example 8 - Determination of the Phylogenetic Tree

[0415] A phylogenetic tree of all bacterial full-length sequences of wild type ALPs vs human iALP was designed using the MUSCLE [1], FastTree [2] and FigTree [4] software application. See the detailed protocol for creating these trees in Example 2.

[0416] The ancestral distance matrix between each pair of sequences constructed by measuring the distances of the different nodes in the phylogenetic tree. The resulting distance matrix listed below includes scores for each of the different pairs of bacterial ALPS versus hiALP.

[0417] The 13 closest bacterial ALPs to hiALP are highlighted in a box in Figure 1. The closest ones to hiALP with lowest scores between 1,0 and 2,0 are marked in the box, namely SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0418] Calculation of ancestral distances

[0419] The calculation of ancestral distances requires several steps. This section describes these steps from a collection of sequences, which must include SEQ ID NQ:108 (SWISSPRQT:P09923) and SEQ ID NO:21 (HEAL1032). The sequences are saved in the commonly used Fasta format.

[0420] In brief, the creation of a phylogenetic tree is state of the art and widely used. First a multiple sequence alignment is performed. From this, the tree is calculated and the newick file exported, which can be visualized in any common phylogenetic tree software (see resulting picture in Example 1 using Figtree [4]). This file contains the ancestral distances of one leaf to another. The distance to SEQ ID NO: 108 can then be calculated by hand or using python by summing up the distance. For detailed instructions, see protocol below.

[0421] All software mentioned are available for the Ubuntu Linux operating system version 20.04 and the examples below are run from the command line here.

[0422] 1. Create multiple alignment

[0423] Multiple sequence alignments are well known in the art. Here we used the software “muscle” version 3.8.1551 [1] mus cle -in all sequences . fasta -out all sequences align . fasta

[0424] 2. Creating the tree (Newick file) from multiple sequence alignment

[0425] Creating phylogenetic trees is well known in the art. Here, the software “FastTree” version

[0426] 2.1.11 [2] is used to create a tree file: fasttree all sequences align . fasta > all sequences . newick

[0427] 3. Calculate the ancestral distances between all sequences in the tree

[0428] From the tree file, ancestral distances between sequences can be calculated using the ete3 Python package version 3.1.3 [3]

[0429] The calculation requires a Python script that reads the tree file and writes a table with all pairwise ancestral distances (Excel format in this example): from ete3 import Tree import pandas as pd

[0430] # Load the tree from a Newick file t = Tree ( "all sequences . newick" ) nodellist= [ ] node21ist= [ ] distlist= [ ]

[0431] # Calculate and print distances between all pairs of leaves for nodel in t . iter leaf names ( ) : for node2 in t . iter leaf names ( ) : i f nodel ! = node2 : distance = t . get distance ( nodel , node2 ) else : distance=0 node Hi st . append ( nodel ) node21ist . append ( node2 ) distlist . append ( distance ) df = pd . DataFrame ( { ' Nodel nodellist , ' Node2 ' : node21ist , ' Distance ' : distlist } ) df . to excel ( "ancestral distances . xlsx" )

[0432] From this table, which contains ancestral distances between all nodes, the distances between SEQ ID NO: 108 (SWISSPROT:P09923) and all other nodes are extracted.

[0433] [1] MUSCLE V3.8.1551: Edgar, R.C. Nucleic Acids Res 32(5), 1792-97.

[0434] [2] Fasttree: Price, M.N., Dehal, P.S., and Arkin, A.P. (2010) FastTree 2 -- Approximately Maximum-Likelihood Trees for Large Alignments. PLoS ONE, 5(3):e9490. doi: 10.1371 / journal. pone.0009490 [3] ete Python package: Jaime Huerta-Cepas, Frangois Serra and Peer Bork. "ETE 3: Reconstruction, analysis and visualization of phylogenomic data." Mol Biol Evol (2016) doi: 10.1093 / molbev / msw046

[0435] [4] FigTree: FigTree v1.4.4, 2006-2018; Tree Figure Drawing Tool; Andrew Rambaut; Institute of Evolutionary Biology, University of Edinburgh

[0436] The closest bacterial ALPs to hiALP are marked in bold (correspond to the box in the tree). The corresponding distance scores are between 1 ,4 and 1 ,9, with a clear gap of 0.8_lower than the rest of the molecules.

[0437] Example 9. Template Modeling (TM) Score of ALPs vs hiALP:

[0438] The Template Modeling ™ score was calculated based on AlphaFold™. As described, a structural alignment of the three-dimensional structures of two polypeptides is necessary before the TM-score can be calculated. This is achieved via algorithms that optimize the structural overlap, and several methods are available, such as CEalign (Shindyalov and Bourne, Protein Eng., 11 , 739-747, 1998), DALI (Holm and Sander, Trends Biochem. Sci., 20, 478-480, 1995), or TM-align (Nucleic Acids Res. 33:2302-2309, 2005). For the purposes of the present invention, TM-align is applied. For convenience, TM-score is integrated in the TM-align software, which is available from the author’s website. The version of TM-align is preferably updated 2019-08-22 or later, and the TM-score between a reference and a query protein is determined by running this command:

[0439] TMalign <query . pdb> <ref erence . pdb> -L <length of reference> Where <query.pdb> is the name of the PDB file containing coordinates of the query polypeptide, <reference.pdb> is the name of the PDB file containing coordinates of the reference polypeptide. The TM-score is calculated and reported in the output, along with several other parameters from the alignment. The maximal TM-score is 1, e.g., 1.0, corresponding to identical three-dimensional structures.

[0440] For the bacterial ALPs of the invention versus the human intestinal ALP (SWISSPROT: P09923; SEQ ID 108), the resulted scores are listed below. The resulting scores are listed below. In bold are the 13 backbones that have a low ancestral distance are having scores between 0.74 and 0.86 indicating that the molecules exhibit a remarkable structural similarity.

[0441] In bold the 13 backbones that contain a variable region having scores between 0,74 and 0,86 indicating that the molecules exhibit a remarkable structural similarity.

[0442] Example 10. PyMol Structural Analysis and identification of ‘Variable Region’

[0443] 3-Dimensional structures of the ALP sequences are calculated using AlphaFold. The structures are then inspected using a common 3D protein visualization tool, here PyMol [3.1] was used. After applying the align function within PyMol, a common ‘variable region’ is identified in 13 WT bacterial backbones. (See Figure 2, where w the variable region is highlighted in the black box in black, while the remaining structure of hiALP is shown in grey (for simplicity, the secondary structure is shown in graphic representation in Figure 2). This ‘variable region’ spans from aa 370 to 460 in hiALP.

[0444] To identify the ALPs that share a common fold of the ‘variable region’, all structures are visually inspected and grouped. This results in 7 groups as visualized in the picture below. For simplicity, only the ‘variable region’ is shown. Groups 4 and 5 (Figure 3) are the groups that are structurally similar to hiALP.

[0445] The same regions and sequences can be obtained by extracting the ‘variable region’ sequences at position 495 to 634 in the multiple sequence alignment which contains the identified ‘variable region’ of hiALP.

[0446] Cutting out the variable region from the alignment

[0447] Knowing the start and end of the variable region in the alignment, we can use the software “seqkit” (version 0.16.1) to extract that region. seqkit subseq -r 495 : 634 all sequences align . fasta > vr . fasta

[0448] Structural analysis using PyMol identified 13 WT bacterial backbones containing a common variable region:

[0449] Reference:

[0450] [3.1] PyMol by Schrodinger (https: / / pymol.org)

[0451] [3.2] Seqkit: Shen W, Le S, Li Y, Hu F (2016) SeqKit: A Cross-Platform and Ultrafast Toolkit for FASTA / Q File Manipulation. PLoS ONE 11(10): e0163962. doi:10.1371 / journal.pone.0163962

[0452] Example 11: Template Modeling (TM) Score of ‘variable regions’ of ALPs vs hiALP:

[0453] The Template Modeling ™ score was calculated as described in Example 9 but only the structure of the variable region of all ALPs was used.

[0454] To extract the structure of the ‘variable region’ of all ALPs, the following steps were performed:

[0455] 1. As described in Example 9, the full-length structures of the sequences is calculated using Alphafold.

[0456] 2. The structures are loaded into a visualization software, such as PyMol and aligned by applying PyMols align function (see Example 9 for details).

[0457] 3. Remove the amino acid sequences that are not part of the ‘variable region’ (use the amino acid coordinates and sequence as previously defined in Example 5). This leaves only the ‘variable region’. Save the structures as .pdb files (world standard format for structures).

[0458] 4. Calculate the TM-score of the ‘variable region’ structures of all ALP vs the ‘variable region’ of hiALP.

[0459] The resulting scores are listed below. In bold and highlighted in green are the 13 backbones that have a low ancestral distance are having scores between 0.85 and 0.95 indicating that the ‘variable region’ of the molecules exhibit a remarkable structural similarity and has a conserved structural conformation.

[0460] Example 12- Thermostability profiles

[0461] Protein thermal unfolding analysis (TSA, Thermal shift assay)

[0462] Protein thermal unfolding of alkaline phosphatase polypeptides was monitored with Sypro Orange (Invitrogen, S-6650) using a real-time PCR instrument (Applied Biosystems; Step-One- Plus). Purified enzyme samples were diluted to 0.8 mg / mL in 100 mM glycine, 100 mM acetic acid, 100 mM MES and 100 mM HEPES, adjusted to pH, 3.0, 4.0, 5.0, 7.0, 8.0, 9.0, 10.0 and 11.0 with and without 1 mM CaCh, 1 mM MgCh, 1 mM ZnCh. Next, 15 pl enzyme sample diluted in a buffer solution adjusted to relevant pH, was mixed (1 :1) with Sypro Orange (Cone. = 10X; stock solution from supplier = 5000X) in water.

[0463] The plate was sealed with an optical PCR seal. The PCR instrument was set at a scan-rate of 76°C per hour, starting at 25°C and finishing at 96°C. Fluorescence was monitored every 20 seconds using in-built LED blue light for excitation and ROX-filter (610 nm, emission). Tm- values were calculated as: The temperature causing the maximum value of the first derivative (dF / dK) (Gregory et al., 2009, J. Biomol. Screen. 14: 700). Results are listed in Table 12.2. As can be seen at pH 7 and all other tested pHs, the polypeptides of the invention are more thermal stable than SEQ ID NO:50.

[0464] Table 12.1

[0465] Several of the molecules having a variable region have a high thermostability (Tm) at different pHs, between 50-72 °C at pH4 between 66-80 °C at pH5 and 65- 86 °C at pH7 in the presence of ions Zn, Ca and Mg. Table 12.2

[0466] Example 13: Sequence Identity of bacterial ALPs vs hiALP

[0467] Percent sequence identity is calculated of hiALP to all ALP sequences as described in the method above The % sequence identity between the backbones that have a low ancestral distance and hiALP is very low.

[0468]

Claims

CLAIMS1. An animal feed additive comprising a polypeptide having alkaline phosphatase activity, wherein the polypeptide is characterized as having at least two, such as at least three properties selected from the group consisting of; i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a Template Modelling score, as calculated in Example 9, versus the human intestinal ALP (SEQ ID NO: 108) of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NQ:108); iii. the polypeptide has a Template Modelling score, as calculated in Example 9, versus human intestinal ALP (SEQ ID NO: 108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.88; and iv. the polypeptide has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1.0 and 2.0, such as from 1.1 to 1.9; wherein the polypeptide is of bacterial origin or a variant thereof.

2. The animal feed additive according to claim 1, wherein the polypeptide is characterized in that; i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a Template Modelling score, as calculated in Example 9, versus the human intestinal ALP of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NQ:108); iii. the polypeptide has a Template Modelling score, as calculated in Example 9 versus human intestinal ALP (SEQ ID NQ:108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.86: and iv. the polypeptide has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1.0 and 2.0, such as from 1.1 to 1.9;.

3. The animal feed additive according to claims 1 or 2, wherein the polypeptide is characterized in that i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a TemplateModelling score, as calculated in Example 9, versus the human intestinal ALP of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO: 108), and iii. the polypeptide has a Template Modelling score, as calculated in Example 9, versus human intestinal ALP (SEQ ID NO: 108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.86.

4. The animal feed additive according to claim 3, wherein the polypeptide furthermore has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1.0 and 2.0, such as from 1.1 to 1.9.

5. The animal feed additive according to claim 1, wherein the polypeptide is characterized in that, the polypeptide having alkaline phosphatase activity, is characterized in that: i. the polypeptide has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1 and 1.9, such as from 1.1 to 1.8, or from 1.1 to 1.7, and ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO: 108.

6. The animal feed additive according to claim 1, wherein the polypeptide is characterized in that, the polypeptide having alkaline phosphatase activity, is characterized in that: i. the polypeptide has a Template Modelling score, as calculated in Example 9, versus human intestinal ALP (SEQ ID NO: 108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.86; and ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO: 108).

7. The animal feed additive according to claim 1, wherein the polypeptide is characterized in that, the polypeptide having alkaline phosphatase activity, is characterized in that: i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a Template Modelling score, as calculated in Example 9, versus the human intestinal ALP of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; and ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO: 108).

8. An animal feed additive comprising a polypeptide having alkaline phosphatase activity selected from the group consisting of(a) a polypeptide having at least 70% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56;(b) a polypeptide having at least 70% sequence identity to a mature polypeptide of polypeptide of (a)(c) a polypeptide encoded by a polynucleotide having at least 70% sequence identity to the mature polypeptide coding sequence of a polypeptide of (a) or (b);(d) a polypeptide derived from a polypeptide of (a) or (c), or a mature polypeptide of (b) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids;(e) a polypeptide derived from the polypeptide of (a), (b), (c), or (d) wherein the N- and / or C-terminal end has been extended by the addition of 1 to 50 amino acids, such as 1 to 40, 1 to 30 or 1 to 20 amino acids; and(f) a fragment of the polypeptide of (a), (b), (c), (d), or (e); wherein the polypeptide of (a), (b), (c), (d), or (e) or the fragment of (f) has alkaline phosphatase activity; and wherein the polypeptide is of bacterial origin or a variant thereof.

9. The animal feed additive according to any of claims 1 to 3 wherein the polypeptide having alkaline phosphatase activity is a polypeptide having at least 80% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO:71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76,SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89,SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94,SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

10. The animal feed additive according to claims 1 to 9, wherein the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 70% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQID NO: 20, SEQ ID NO: 21, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

11. The animal feed additive according to any of claims 1 to 10, wherein the polypeptide having alkaline phosphatase activity is selected from the group consisting of a polypeptide having at least 90% sequence identity SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

12. The animal feed additive according to any of claims 1 to 11 , wherein the polypeptide having alkaline phosphatase activity is SEQ ID NO: 21.

13. Use of a polypeptide as defined in any of claims 1 to 12 for the preparation of an animal feed additive, a animal feed composition or a zootechnical additive.

14. A method of increasing body weight gain in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

15. A method of improving the food conversion ratio of an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

16. A method of the detoxification of lipopolysaccharide in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

17. A method of reducing the immune response in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

18. A method of reducing inflammation in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

19. A method of reducing IL or TN F response in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

20. A method of maintaining or supporting intestinal health, or improving intestinal health promoting growth of commensal bacteria, in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12..

21. A method for the maintenance of an effective gut barrier comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

22. A method to prevent colitis or the inflammation of the lining of the colon in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

23. A method to prevent low birth weight, such as induced by perinatal undernutrition comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

24. A method of improving weight gain in animals with below average birth weight comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

25. A method of regulating fat absorption or neutralising acidic digesta entering the small intestine via stimulation of bicarbonate secretions and surface pH comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

26. A method of preventing antibiotic-associated infections from Salmonella entericaserovar Typhimurium (S. Typhimurium) and / or Clostridium difficile comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

27. A method of preventing weight loss in infected animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

28. A method of maintaining or restoring (healthy) gut flora in an antibiotic treated animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

29. A method of preventing or reducing intestinal colonization or systemic translocation of unwanted bacteria, or for “dysbiosis”, namely for changing of the bacterial and / or archaeal balance of the intestinal microbiota, comprising feeding said animal the polypeptide as defined in any of claims 1 to 12, or the animal feed additive of claims 1 to 12.

Images