NEW STRAINS OF LACTIC ACID BACTERIA PROMOTING CALCIUM ABSORPTION – PEPTIDES AND ASSOCIATED PRODUCTS

Abstract

The present invention relates to the Lactobacillus delbrueckii ssp. bulgaricus VF50b strain filed with the CNCM under order number CNCM-I-5316 and its mutants and variants exhibiting at least 80% identity, preferably at least 90% identity, preferably at least 95% identity with the genome of said VF50b strain and capable of producing at least one peptide corresponding to sequences SEQ ID 87 to SEQ ID NO 199 and / or capable of increasing intestinal calcium absorption. The present invention also relates to an isolated peptide, a peptide mixture, and associated pharmaceutical and food compositions.

Description

Title of the invention: NEW STRAINS OF LACTIC ACID BACTERIA PROMOTING CALCIUM ABSORPTION - PEPTIDES AND ASSOCIATED PRODUCTS

[0001] The present invention relates to novel strains of lactic acid bacteria as well as isolated peptides and mixtures of peptides derived from [3-casein] and produced by these strains. These peptides are active either as FACE inhibitors or as calcium absorption promoting agents.

[0002] The present invention also relates to a food or pharmaceutical composition as well as associated products.

[0003] Document WO 2007 / 096498 A1 describes a new strain of lactic acid bacteria, more precisely Lactobacillus helveticus, capable of producing, by fermentation of milk, two tripeptides having properties of inhibition of the angiotensin converting enzyme (ACE). These two peptides of sequences IPP and VPP are known to inhibit ACE and therefore make it possible to reduce blood pressure and thus combat hypertension and the pathologies resulting from it.

[0004] On the other hand, the publication entitled "Bioactive peptide: production and functionality" by H. Korhonen et al and published in International Dairy Journal vol 16, page 945 to 960 in 2006 reviews the peptides obtained by hydrolysis of milk proteins by lactic acid bacteria, and possessing biological activity; this publication describes several peptides different from the IPP and VPP peptides, but also known as ACE inhibitors.

[0005] Furthermore, it is known that in addition to its role in regulating blood pressure, ACE is also involved in bone resorption / formation mechanisms. Indeed, the article entitled "Inhibition of angiotensin-converting enzyme exerts beneficial effects on trabecular bone in orchidectimozed mice" by XF Chen, published in the journal Pharmacological reports 70, page 705-711 in 2018, indicates that an ACE inhibitor, namely captopril, exhibits bone-preserving activity.

[0006] Regarding calcium absorption, the aforementioned publication by H. Korhonen cites caseino-phospho-peptides known to improve the absorption of calcium and zinc. It cites in particular the brand name product Capolac® which contains a caseino-phospho-peptide (CPP) known to improve the absorption of minerals. Regarding the mechanism of action, it appears that these phospho-peptides are known to bind to calcium, thus making it bioavailable.

[0007] Document JP H0641191A describes a strain of Lactobacillus helveticus which produces peptides, which increase the solubility of calcium. On the other hand, this document does not describe any biological activity of peptides for calcium absorption in intestinal cell cultures.

[0008] Furthermore, the publication "Recent advances in microbial fermentation for dairy and health" by D. Hill et al, published on May 26, 2017 in the journal in F 1000 Research, also reports on bacteria capable of producing bioactive peptides by proteolysis as an ACE inhibitor. It also indicates that a fructo-oligosaccharide can be used as a preventative measure against osteoporosis. The mechanism of action of this fructo-oligosaccharide is as follows: in the subject's stomach, the fructo-oligosaccharide generates small acid molecules by fermentation, which reduce the pH in vivo and lead to the dissolution of calcium phosphates which would thus be bioavailable.

[0009] Insufficient absorption of calcium (hypocalcemia) can lead to various symptoms or pathologies such as osteoporosis, high blood pressure or metabolic syndrome. Indeed, calcium is involved regardless of the patient's age, in bone formation, skeletal solidification, tooth rigidity, muscle contraction and therefore cardiac contraction, transmission of nerve impulses at synapses, learning and memorization, salivary secretion, cell growth and proliferation. Calcium helps activate numerous enzymes, release several hormones, coagulate blood and contributes to body weight balance.Hypocalcemia is also linked to various rare pathologies such as autoimmune hypoparathyroidism, vitamin-D dependent hypocalcemic rickets, progressive skeletal heteroplasia, isolated hypoparathyroidism, syndromic hypoparathyroidism, pseudohypoparathyroidism and hypo-deficiency rickets and more generally diseases caused by an anomaly in the regulation of calcemia due to dysfunction of parathyroid hormone, vitamin D absorption or calcium receptor function.

[0010] To date, osteoporosis is not treated effectively. Thus, bisphosphonates, which are the most widely used treatment, prove to be of little effect in patients who have a low risk of fracture. Prevention through regular physical activity, a balanced diet and limiting tobacco and alcohol consumption proves to be more effective.

[0011] An aim of the present invention is to provide a strain of lactic acid bacteria resistant to gastrointestinal digestion and capable of acting in the intestine by acidifying the medium, thus making the calcium soluble, in order to facilitate its absorption and its passage through the intestinal wall.

[0012] Another aim of the present invention is to provide a strain of lactic acid bacteria resistant to gastrointestinal digestion and capable of stimulating the absorption of calcium by intestinal cells, acting directly or indirectly on them.

[0013] Another aim of the present invention is to provide a strain of lactic acid bacteria which has greater growth than certain known lactic acid bacteria and / or which allows greater acidification of the fermentation medium, in particular milk.

[0014] Another aim of the present invention is to provide a strain of lactic acid bacteria capable of producing new phosphorylated peptides capable of promoting the absorption of calcium at the intestinal level.

[0015] Another aim of the present invention is to provide a strain of lactic acid bacteria capable of producing new peptides having ACE inhibitory activity.

[0016] Another aim of the present invention is to provide at least one peptide, or even a mixture of peptides which exhibits FACE inhibitory activity and / or promotes intestinal absorption of calcium and which is preferably non-toxic to intestinal cells.

[0017] Another aim of the present invention is to provide at least one peptide, or even a mixture of peptides which has an ACE inhibitory activity which is greater than the activity of the IPP and VPP peptides.

[0018] Another aim of the present invention is to provide a pharmaceutical or food composition capable of treating hypocalcemia and therefore the pathologies which result from it. First aspect

[0019] According to a first aspect, the invention relates to a strain of Lactobacillus helveticus having the genes prtH2 and prlH3c{ capable of reducing by anaerobic fermentation the pH of milk, in particular cow's milk and in particular skimmed cow's milk to a value substantially equal to or less than 3.36, in particular equal to 3.32 after 48 hours of fermentation at 37°C. By reducing the pH, the strain allows the dissolution of compounds containing calcium, making the latter absorbable by the intestinal wall.

[0020] According to this first aspect, the present invention also relates to the strain of Lactobacillus helveticus VF45A deposited at the CNCM under the order number CNCM-1-5300, its mutants and variants having at least 80% identity, preferably at least 90% identity, preferably at least 95% identity with the genome of said strain VF45A and capable of producing at least one peptide corresponding to the sequences SEQ ID 1 to SEQ ID NO 43 and / or capable of reducing by anaerobic fermentation the pH of milk, in particular cow's milk and in particular skimmed cow's milk to a value substantially equal to or less than 3.36, in particular equal to 3.32 after 48 hours of fermentation at 37°C.

[0021] According to this first aspect, the invention also relates to the strains mentioned above with reference to the first aspect for their use as a medicament and in particular as a medicament for the treatment of hypocalcemia or in the treatment of a pathology caused by a deficiency in calcium absorption and in particular chosen from arterial hypertension, metabolic syndrome, osteoporosis or in the treatment of hypocalcemia induced by a pathology chosen from autoimmune hypoparathyroidism, vitamin-D dependent hypocalcemic rickets, progressive bone heteroplasia, isolated hypoparathyroidism, syndromic hypoparathyroidism, pseudohypoparathyroidism and hypo-deficiency rickets, diseases caused by an anomaly in the regulation of calcemia due to the dysfunction of parathyroid hormone, of vitamin D absorption or of the functioning of the calcium receptor in a subject, in particular a mammal and particularly a human having such a need.

[0022] According to this first aspect, the present invention also relates to an isolated peptide obtainable by fermentation of milk, in particular cow's milk, by at least one strain according to the first aspect of the invention and chosen from the peptides corresponding to the sequences SEQ ID 1 to SEQ ID NO 43, the peptides having at least 80% identity, in particular at least 90% identity, in particular at least 95% identity with said peptides corresponding to the sequences SEQ ID 1 to SEQ ID NO 19 and capable of inhibiting ACE and the peptides having at least 80% identity, in particular at least 90% identity, in particular at least 95% identity with said peptides corresponding to the sequences SEQ ID 20 to SEQ ID NO 43 and capable of increasing the intestinal absorption of calcium.The Applicant has in fact demonstrated either the ACE inhibitory activity of the aforementioned peptides - which activity is also linked to good bone health - or the activity of improving the absorption of calcium through the intestinal wall due to certain of the aforementioned peptides. Thus, the peptides of the invention act on bone health via the absorption of calcium through the intestinal wall, and / or via the inhibition of ACE.

[0023] According to this first aspect, the present invention also relates to a mixture of peptides chosen from the mixtures comprising or consisting of all the peptides of sequence SEQ ID NO 1 to SEQ ID NO 43, the mixtures comprising or consisting of said peptides of sequence SEQ ID NO 1 to SEQ ID NO 5, the mixtures comprising or consisting of the 5 peptides of sequence SEQ ID NO 1 to SEQ ID NO 5 and of at least one peptide chosen from the peptides corresponding to the sequences SEQ ID 20 to SEQ ID NO 43, preferably the mixtures containing or consisting of the 5 peptides of sequence SEQ ID NO 1 to SEQ ID NO 5 and of the peptides of sequences SEQ ID 20 to SEQ ID NO 43 and the mixtures comprising or consisting of the peptides of sequence SEQ ID 20 to SEQ ID 43.

[0024] These mixtures prove to be active in inhibiting ACE and / or improving intestinal absorption of calcium.

[0025] The present invention also relates to the abovementioned isolated peptides and the abovementioned mixtures for their use as a medicament and in particular as a medicament in the treatment of hypocalcemia or in the treatment of a pathology caused by a deficiency in calcium absorption and in particular chosen from arterial hypertension, metabolic syndrome, osteoporosis or in the treatment of hypocalcemia induced by a pathology chosen from autoimmune hypoparathyroidism, vitamin-D dependent hypocalcemic rickets, progressive bone heteroplasia, isolated hypoparathyroidism, syndromic hypoparathyroidism, pseudohypoparathyroidism and hypo-deficiency rickets, diseases caused by an anomaly in the regulation of calcemia due to the dysfunction of parathyroid hormone, of vitamin D absorption or of the functioning of the calcium receptor, in a subject,especially a mammal and particularly a human having such a need.

[0026] According to this first aspect, the present invention also relates to a food or pharmaceutical composition which contains at least one pharmaceutically acceptable excipient or a medium capable of being ingested and as active ingredient at least one peptide chosen from the isolated peptides mentioned above with reference to the first aspect and / or a mixture of peptides as mentioned above with reference to the first aspect and / or a strain according to the first aspect of the invention and in particular the strain VF45A.

[0027] Advantageously, according to a first embodiment of the first aspect, the food or pharmaceutical composition comprises, at least or only as active peptides, the 5 peptides corresponding to the sequences SEQ ID NO 1 to SEQ ID NO 5. These peptides are the most active as ACE inhibitors. They are more active than the tripeptides VPP and IPP of the prior art.

[0028] According to this first aspect and according to a second embodiment, the food or pharmaceutical composition according to the first aspect of the invention contains as active ingredient or is constituted by the fermentate obtained by anaerobic fermentation of cow's milk, optionally skimmed using a strain according to the first aspect of the invention, said fermentate having optionally undergone ultrafiltration at a cut-off threshold of 10 kDa or it contains or is constituted by the fermentate obtained by anaerobic fermentation and optionally after ultrafiltration at a cut-off threshold of 10 kDa of a protein substrate chosen from protein substrates of plant origin originating from at least one cereal and / or at least one pea and / or at least one mushroom and / or at least one nut, mixtures of at least two protein substrates of plant origin, milks of animal origin, optionally thermally sterilized, and / or at least partially skimmed,in particular cow's, goat's or sheep's milk with the exception of yak's milk for the ferment, non-ultrafiltered to a cut-off threshold of 10kDa, mixtures of at least two milks of animal origin and mixtures of at least one protein substrate of plant origin and at least one milk of animal origin.

[0029] The fermentate as mentioned above obtained by anaerobic fermentation and ultrafiltration at a cut-off threshold of 10 kDa is part of the fermentates according to the first aspect of the invention, including the ultrafiltered fermentate obtained from yak milk.

[0030] With regard to the fermentate obtained from cow's milk, it is advantageously obtained according to the temperature and duration conditions indicated in the part relating to the experimental results.

[0031] Throughout the present application, the protein substrate of plant origin may be chosen from plant milks such as oat milk, almond milk, rice milk, soy milk, spelt milk, hazelnut milk and mixtures of these milks. Whatever the milk, it may be thermally sterilized before fermentation by the bacteria according to the invention.

[0032] According to a particular embodiment, said fermentate is obtained by fermentation of the aforementioned strain with reference to the first aspect, in milk, in particular cow's milk, optionally skimmed and / or thermally sterilized, at a temperature of 40°C at pH=6 for 72 hours, said fermentate optionally also being subjected to ultrafiltration at a cut-off threshold of 10 kDa at the end of the fermentation. The ultrafiltered or non-ultrafiltered fermentate proves to be active for the inhibition of ACE and / or for the absorption of calcium.

[0033] In all aspects of the invention, the food or pharmaceutical composition contains as active ingredient, the peptide(s) and / or the strain. It may also comprise, advantageously also calcium and / or vitamin D.

[0034] In all aspects of the invention, performing ultrafiltration on the fermentate makes it possible to separate the peptides produced by the strain from the proteins. The ultrafiltered fermentate therefore no longer contains proteins. When the ultrafiltered fermentate is subjected to gastrointestinal digestion, there is no generation of other peptides, due to the absence of proteins. The filtrate obtained by ultrafiltration of the fermentate proves to be more active when it is ingested and digested due to the absence of interference by the peptides resulting from the digestion of the proteins.

[0035] According to a particular embodiment of the food or pharmaceutical composition according to the first aspect of the invention, it contains a concentration of at least one of said strains and preferably of one of said strains, in particular the strain Lactobacillus helveticus VF45A equal to or greater than 107 CFU per gram and / or a concentration of peptides which are identical or different and chosen from the peptides of sequence SEQ ID NO 1 to SEQ ID NO 43, greater than or equal to 18 mg per gram. Preferably, the peptides are the peptides contained in the aforementioned fermentate with reference to the first aspect and in particular the peptides of the sequences SEQ ID NO 1 to SEQ ID NO 43.

[0036] According to this first aspect, the present invention also relates to a product chosen in particular from food products, in particular fermented milks, fruit juices and / or vegetable juices, fermented vegetables and / or fruits, fermented mushrooms, charcuterie, food preparations based on fish(es) and dairy products obtained from milk, optionally skimmed, in particular from cow, goat, sheep and with the exception of yak milk, or from a mixture of milks. According to the first aspect of the invention, this product contains at least one strain according to the first aspect and / or at least one peptide according to the first aspect and / or at least one mixture of peptides according to the first aspect of the invention and / or a food or pharmaceutical composition according to the first aspect of the invention.

[0037] According to this first aspect, the invention also relates to a food supplement suitable for a subject, in particular a human or an animal in particular chosen from cats, dogs, poultry, sheep, goats, cattle, reptiles, in particular iguanas, which characteristically comprises at least one strain according to the first aspect and / or at least one peptide according to the first aspect and / or at least one mixture of peptides according to the first aspect and / or a food or pharmaceutical composition according to the first aspect.

[0038] Whatever the aspect of the invention, the food / pharmaceutical composition or the food supplement may be in the form of a powder, a solution, in particular an aqueous solution, a tablet, a capsule containing the strain in lyophilized form and / or the peptide or the mixture of peptides in powder or solution form. The capsule may have an outer shell capable of resisting gastrointestinal digestion so as to deliver its contents into the patient's intestine. The strain may also be, for example, microencapsulated by a lipid coating and be in the form of an ingestible powder.

[0039] In the case of a food supplement according to the first aspect, the tablet, capsule or any other unit form of daily dosage preferably contains at least 0.6 g of active peptides and / or 107 CFU of strain according to the first aspect, optionally as a mixture.

[0040] The pharmaceutical composition may preferably be adapted for oral administration.

[0041] Throughout the application, the dairy product is not limited according to the invention. It may be a milk drink, fermented milk, kefir, yogurt, a milk-based product coagulated by the addition of acid or a fresh or leavened cheese, for example. Second aspect

[0042] According to a second aspect, the present invention relates to a strain of Lactobacillus helveticus having the prtHl gene and capable of reducing by anaerobic fermentation the pH of milk, in particular cow's milk, to a value substantially equal to or less than 3.45 and in particular equal to 3.43 after 48 hours at 37°C and having a parietal hydrophobicity of 40% and resistant to acidity and / or capable of increasing the absorption of calcium by intestinal cells.

[0043] According to this second aspect, the present invention relates to the strain of Lactobacillus helveticus VFH049 deposited at the CNCM under the order number CNCM-I-5403 and its mutants and variants having at least 80% identity, preferably at least 90% identity, preferably at least 95% identity with the genome of said strain VFH049 and capable of producing at least one peptide corresponding to the sequences SEQ ID 44 to SEQ ID NO 86 and / or capable of reducing by anaerobic fermentation the pH of milk, in particular cow's milk, to a value substantially equal to or less than 3.45 and in particular equal to 3.43 after 48 hours at 37°C and / or capable of increasing the absorption of calcium by intestinal cells.

[0044] This strain has been shown to be capable of forming acids which are capable of making calcium soluble in the intestine of a host / patient. It is also capable of producing, by proteolysis of [3-casein], peptides which are active as ACE inhibitors or which allow for better intestinal absorption of calcium. The strain itself is resistant to digestion and, when in contact with intestinal cells, allows for better absorption of calcium by the latter.

[0045] According to this second aspect, the present invention also relates to the strains cited with reference to the second aspect and in particular the strain VFH049 or its mutants or variants for its use as a medicament and in particular as a medicament in the treatment of hypocalcemia or in the treatment of a pathology caused by a deficiency in calcium absorption and in particular chosen from arterial hypertension, metabolic syndrome, osteoporosis or in the treatment of hypocalcemia induced by a pathology chosen from autoimmune hypoparathyroidism, vitamin-D dependent hypocalcemic rickets, progressive bone heteroplasia, isolated hypoparathyroidism, syndromic hypoparathyroidism, pseudohypoparathyroidism and hypo-deficiency rickets, diseases caused by an anomaly in the regulation of calcemia due to parathyroid hormone dysfunction,of the absorption of vitamin D or of the functioning of the calcium receptor, in a subject, in particular a mammal and particularly a human having such a need.

[0046] According to this second aspect, the present invention also relates to an isolated peptide which can be obtained by fermentation of milk, in particular cow's milk, by at least at least one strain according to the second aspect of the invention and chosen from the peptides corresponding to the sequences SEQ ID 44 to SEQ ID NO 86, the peptides having at least 80% identity, in particular at least 90% identity, in particular at least 95% identity with said peptides corresponding to the sequences SEQ ID 44 to SEQ ID NO 74 and capable of inhibiting ACE and the peptides having at least 80% identity, in particular at least 90% identity, in particular at least 95% identity with said peptides corresponding to the sequences SEQ ID 75 to SEQ ID NO 86 and capable of increasing the intestinal absorption of calcium.

[0047] According to this second aspect, the invention also relates to a mixture of peptides chosen from mixtures of peptides containing or consisting of all the peptides of sequence SEQ ID 44 to SEQ ID 86, mixtures comprising or consisting of peptides of sequence SEQ ID NO 44 to SEQ ID NO 58, mixtures consisting of peptides of sequence SEQ ID NO 44 to SEQ ID NO 58 and at least one of the peptides of sequence SEQ ID NO 75 to SEQ ID NO 86, mixtures comprising or consisting of peptides of sequence SEQ ID NO 44 to SEQ ID NO 58 and peptides of sequence SEQ ID NO 75 to SEQ ID NO 86 and mixtures containing or consisting of peptides of sequence SEQ ID NO 75 to SEQ ID NO 86. The peptides of sequence SEQ ID NO 44 to SEQ ID NO 58 are the most active as inhibitors of the ACE.

[0048] According to this second aspect, the invention also relates to an isolated peptide of the second aspect or the mixture according to the second aspect for its use as a medicament and in particular as a medicament in the treatment of hypocalcemia or of a pathology caused by a deficiency in calcium absorption and in particular chosen from arterial hypertension, metabolic syndrome, osteoporosis or for the treatment of hypocalcemia induced by a pathology chosen from autoimmune hypoparathyroidism, vitamin-D dependent hypocalcemic rickets, progressive bone heteroplasia, isolated hypoparathyroidism, syndromic hypoparathyroidism, pseudohypoparathyroidism and hypo-deficiency rickets, diseases caused by an anomaly in the regulation of calcemia due to the dysfunction of parathyroid hormone, of vitamin D absorption or of the functioning of the calcium receptor, in a subject, in particular a mammal,especially a human with such a need.

[0049] According to this second aspect, the present invention also relates to a food or pharmaceutical composition which contains at least one pharmaceutically acceptable excipient or at least one medium suitable for being ingested and as active ingredient, at least one peptide corresponding to the peptides isolated according to the second aspect of the invention, and / or a mixture of peptides according to the second aspect of the invention, and / or a strain according to the second aspect of the invention, in particular the strain VFH049. Preferably, the food or pharmaceutical composition contains a mixture containing all the peptides of sequences SEQ ID NO 44 to SEQ ID NO 86 or a mixture containing at least or only the peptides corresponding to the sequences SEQ ID NO 44 to SEQ ID NO 58 and optionally the peptides of sequence SEQ ID NO 75 to SEQ ID NO 86.

[0050] According to this second aspect, the food or pharmaceutical composition contains or consists of the fermentate obtained by anaerobic fermentation of cow's milk, optionally skimmed, using a strain according to the second aspect of the invention, said fermentate having optionally undergone ultrafiltration at a cut-off threshold of 10 kDa or contains or consists of the fermentate obtained by anaerobic fermentation and optionally after ultrafiltration at a cut-off threshold of 10 kDa of a protein substrate chosen from protein substrates of plant origin originating from at least one cereal and / or at least one pea and / or at least one mushroom and / or at least one nut including almond, mixtures of at least two protein substrates of plant origin, milks of animal origin, optionally thermally sterilized and / or at least partially skimmed, in particular cow's milk,goat or sheep milk with the exception of mare's milk for non-ultrafiltered fermentate with a cut-off threshold of 10kDa, mixtures of at least two milks and mixtures of at least one substrate of plant origin and at least one milk of animal origin.

[0051] According to a particular embodiment of the second aspect of the invention, the food or pharmaceutical composition contains or consists of the fermentate obtained by anaerobic fermentation of the strain VFH049 or of a strain as mentioned above, in milk, in particular cow's milk, optionally skimmed, at a temperature of 40°C at pH=6 for 72 hours, said fermentate optionally being subjected to ultrafiltration at a cut-off threshold of 10 kDa. This fermentate contains all the peptides of the second aspect of the invention; it is therefore active in promoting bone health, both as an ACE inhibitor and as an agent promoting intestinal absorption of calcium.

[0052] Whatever the embodiment, the fermentate itself, ultrafiltered or not, can be considered as a pharmaceutical or food composition.

[0053] According to this second aspect, the aforementioned food or pharmaceutical composition preferably contains a concentration of at least one of said strains and preferably of one of said strains, in particular the strain Lactobacillus helveticus VFH049 equal to or greater than 107 CFU per gram and / or a concentration of peptides which are identical or different and chosen from the peptides of sequence SEQ ID NO 44 to SEQ ID NO 86, greater than or equal to 6 mg per gram.

[0054] According to this second aspect, the invention also relates to a product chosen in particular from food products, in particular fermented milks, juices of optionally fermented fruit(s) and / or vegetable(s), fermented vegetables and / or fruits, fermented mushrooms, charcuterie, food preparations based on fish(es) and dairy products obtained from optionally skimmed milk, with the exception of mare's milk, in particular from cow's milk, goat's milk, sheep's milk or a mixture of milks, which contains at least one strain according to the second aspect of the invention and / or at least one peptide according to the second aspect of the invention and / or at least one mixture of peptides according to the second aspect of the invention and / or a food or pharmaceutical composition according to the second aspect of the invention.

[0055] According to this second aspect, the invention also relates to a food supplement suitable for a subject, in particular a human or an animal in particular chosen from cats, dogs, poultry, sheep, goats, cattle, reptiles, in particular iguanas, which characteristically comprises at least one strain according to the second aspect of the invention and / or at least one peptide according to the second aspect of the invention and / or at least one mixture of peptides according to the second aspect of the invention and / or a food or pharmaceutical composition according to the second aspect of the invention.

[0056] By way of example, according to the second aspect of the invention, the pharmaceutical or food composition is in the form of a liquid, in particular the aforementioned cow's milk fermentate. A volume of 30 mL of this solution containing 0.2 g of the mixture of peptides of the invention is administered daily, orally. Third aspect

[0057] According to a third aspect, the present invention relates to a strain of Lactobacillus delbrueckii ssp. bulgaricus having the prtB gene and capable of reducing by anaerobic fermentation the pH of milk, in particular cow's milk, to a value substantially equal to or less than 4.55 and in particular equal to 4.51 after 48 hours at 37°C and having a parietal hydrophobicity of at least 35% and / or capable of increasing the absorption of calcium. Such a strain has been found to be active in the intestine and resistant to gastrointestinal digestion. It is capable of increasing the passage of calcium through the intestinal wall. The acids it produces also make it possible to solubilize the calcium.

[0058] According to this third aspect, the invention relates to the strain of Lactobacillus delbrueckii ssp. b ulgaricus VF50b deposited at the CNCM under the order number CNCM-L5316 and its mutants and variants having at least 80% identity, preferably at least 90% identity, preferably at least 95% identity with the genome of said strain VF50b and capable of producing at least one peptide corresponding to the sequences SEQ ID 87 to SEQ ID NO 199 and / or capable of reduce by anaerobic fermentation the pH of milk, in particular cow's milk, to a value substantially equal to or less than 4.55 and in particular equal to 4.51 after 48 hours at 37°C and / or capable of increasing the intestinal absorption of calcium.

[0059] The third aspect also relates to each of the strains as mentioned above for its use as a medicament, and in particular as a medicament in the treatment of hypocalcemia or in the treatment of a pathology caused by a deficiency in calcium absorption and in particular chosen from arterial hypertension, metabolic syndrome, osteoporosis or in the treatment of hypocalcemia induced by a pathology chosen from autoimmune hypoparathyroidism, vitamin-D dependent hypocalcemic rickets, progressive bone heteroplasia, isolated hypoparathyroidism, syndromic hypoparathyroidism, pseudohypoparathyroidism and hypo-deficiency rickets, diseases caused by an anomaly in the regulation of calcemia due to the dysfunction of parathyroid hormone, of vitamin D absorption or of the functioning of the calcium receptor, in a subject,especially a mammal and particularly a human having such a need.

[0060] According to this third aspect, the present invention relates to an isolated peptide chosen from the peptides corresponding to the sequences SEQ ID 87 to SEQ ID NO 199, the peptides having at least 80% identity, in particular at least 90% identity, in particular at least 95% identity with said peptides corresponding to the sequences SEQ ID 87 to SEQ ID NO 161 and capable of inhibiting ACE and the peptides having at least 80% identity, in particular at least 90% identity, in particular at least 95% identity with said peptides corresponding to the sequences SEQ ID 162 to SEQ ID NO 199 and capable of increasing the intestinal absorption of calcium.

[0061] According to this third aspect, the invention also relates to a mixture of peptides chosen from mixtures containing or consisting of all the peptides of sequence SEQ ID NO 87 to SEQ ID 199, mixtures containing or consisting of the peptides of sequence SEQ ID 87 to SEQ ID 112, mixtures containing or consisting of the peptides of sequence SEQ ID 87 to SEQ ID 112 and at least one of the peptides of sequence SEQ ID NO 162 to SEQ ID NO 199 and mixtures containing or consisting of the peptides of sequence SEQ ID NO 162 to SEQ ID NO 199.

[0062] According to the third aspect, the invention also relates to an isolated peptide cited with reference to the third aspect or a mixture cited above with reference to the third aspect for its use as a medicament and in particular in the treatment of hypocalcemia or of a pathology caused by a deficiency in calcium absorption and in particular chosen from arterial hypertension, metabolic syndrome, osteoporosis or for the treatment of hypocalcemia induced by a pathology chosen from autoimmune hypoparathyroidism, Vitamin-D dependent hypocalcemic rickets, progressive skeletal heteroplasia, isolated hypoparathyroidism, syndromic hypoparathyroidism, pseudohypoparathyroidism and hypo-deficiency rickets, diseases caused by an abnormality in the regulation of serum calcium due to dysfunction of parathyroid hormone, vitamin D absorption or calcium receptor function, in a subject, in particular a mammal, in particular a human having such a need.

[0063] According to this third aspect, the invention also relates to a food or pharmaceutical composition which contains at least one pharmaceutically acceptable excipient or at least one medium suitable for being ingested and as active ingredient, at least one isolated peptide according to the third aspect of the invention and / or a mixture of peptides according to the third aspect.

[0064] Preferably, the composition contains a mixture containing at least or only as peptides, the peptides corresponding to the sequences SEQ ID NO 87 to SEQ ID NO 161, or a mixture preferably containing all the peptides corresponding to the sequences SEQ ID NO 87 to SEQ ID NO 199 and / or a strain according to the third aspect.

[0065] According to a preferred embodiment of the pharmaceutical or food composition according to the third aspect of the invention, it comprises or is constituted by the fermentate obtained by anaerobic fermentation of cow's milk, optionally skimmed using a strain according to the third aspect of the invention, said fermentate having optionally undergone ultrafiltration at a cut-off threshold of 10 kDa or it contains or is constituted by the fermentate obtained by anaerobic fermentation and optionally after ultrafiltration at a cut-off threshold of 10 kDa of a protein substrate chosen from protein substrates of plant origin originating from at least one cereal and / or at least one pea and / or at least one mushroom and / or at least one nut, mixtures of at least two protein substrates of plant origin, milks optionally thermally sterilized and / or at least partially skimmed, in particular cow's, goat's or sheep's milk,with the exception of yak milk for said non-ultrafiltered fermentate at a cut-off threshold of 10kDa, mixtures of at least two milks and mixtures of at least one protein substrate of plant origin and at least one milk of animal origin,

[0066] The fermentate obtained by anaerobic fermentation of yak milk by a strain according to the first or third aspect of the invention and ultrafiltered to a cut-off threshold of 10kDa is part of the fermentates according to the first and third aspects of the invention respectively. The fermentate obtained by anaerobic fermentation of mare's milk and ultrafiltered to a cut-off threshold of 10kDa is part of the fermentates according to the second aspect of the invention.

[0067] Advantageously, said food or pharmaceutical composition according to the third aspect of the invention contains a concentration of at least one of said strains and preferably of only one of said strains, in particular the strain Lactobacillus delbrueckii ssp. bulgaricus VF50b equal to or greater than 107 CFU per gram and / or a concentration of peptides which are identical or different and chosen from the peptides of sequence SEQ ID NO 87 to SEQ ID NO 199, greater than or equal to 4 mg per gram.

[0068] The food or pharmaceutical composition preferably comprises the fermentate obtained by anaerobic fermentation of the strain according to the third aspect of the invention, in milk, in particular cow's milk, optionally skimmed, at a temperature of 40°C at pH=6 for 72 hours, said fermentate optionally being subjected to ultrafiltration at a cut-off threshold of 10 kDa.

[0069] According to this third aspect, the present invention also relates to a product chosen in particular from food products, in particular fermented milks, juices of fruit(s) and / or vegetable(s) optionally fermented, fermented vegetables and / or fruits, fermented mushrooms, charcuterie, food preparations based on fish(es) and dairy products obtained from milk, optionally skimmed, in particular from cow, goat, sheep with the exception of yak milk, or from a mixture of milks, which characteristically contains at least one strain according to the third aspect of the invention and / or at least one peptide according to the third aspect and / or at least one mixture of peptides according to the third aspect and / or a food or pharmaceutical composition according to the third aspect of the invention.

[0070] According to this third aspect, the present invention also relates to a food supplement suitable for a subject, in particular a human or an animal in particular chosen from cats, dogs, poultry, sheep, goats, cattle, reptiles, in particular iguanas, which characteristically comprises at least one strain according to the third aspect and / or at least one peptide according to the third aspect and / or at least one mixture of peptides according to the third aspect and / or a food or pharmaceutical composition according to the third aspect of the invention.

[0071] According to this third aspect, for example, the food or pharmaceutical composition is in the form of a liquid. A volume of 30 mL of this composition containing 0.2 g of peptides is administered daily, orally. Fourth aspect

[0072] According to a fourth aspect of the invention, the present invention relates to a mixture of at least two strains chosen from the strains of Lactobacillus helveticus having the genes prtH2 and prtH3 and capable of reducing by anaerobic fermentation the pH of milk, in particular cow's milk and in particular skimmed cow's milk, to a value substantially equal to or less than 3.36, in particular equal to 3.32 after 48 hours of fermentation at 37°C and in particular the strain of Lactobacillus helveticus VF45A deposited at the CNCM under the order number CNCM-I-5300, the strains of Lactobacillus helveticus presenting the prtHl gene, in particular the strain of Lactobacillus helveticus VFH049 deposited at the CNCM under the order number CNCM-1-5403, capable of reducing by anaerobic fermentation the pH of milk, in particular cow's milk, to a value substantially equal to or less than 3.45 and in particular equal to 3.43 after 48 hours at 37°C and having a parietal hydrophobicity of 40% and resistant to acidity and / or capable of increasing the absorption of calcium and Lactobacillus delbrueckii ssp. bulgaricus strains containing the prtB gene, including Lactobacillus delbrueckii ssp.bulgaricus VF50b deposited at the CNCM under the order number CNCM-I-5316, capable of reducing by anaerobic fermentation the pH of milk, in particular cow's milk, to a value substantially equal to or less than 4.55 and in particular equal to 4.51 after 48 hours at 37°C and having a parietal hydrophobicity of at least 35% and / or capable of increasing the absorption of calcium by intestinal cells and in particular the mixtures of the three strains VF45A, VFH049 and VF50b.

[0073] According to this fourth aspect, the invention relates to a mixture of peptides chosen from the mixtures comprising the peptides of sequences SEQ ID NO 1 to SEQ ID NO 199, the mixtures containing the peptides of sequence SEQ ID NO 1 to SEQ ID NO 5, the peptides of sequence SEQ ID NO 44 to SEQ ID NO 86 and the peptides of sequence SEQ ID NO 87 to SEQ ID NO 112.

[0074] According to this fourth aspect, the invention also relates to an isolated peptide chosen from the peptides of sequences SEQ ID NO 1 to SEQ ID NO 199 or a mixture according to the fourth aspect of the invention for its use as a medicament and in particular in the treatment of hypocalcemia or in the treatment of a pathology caused by a deficiency in calcium absorption and in particular chosen from arterial hypertension, metabolic syndrome, osteoporosis or in the treatment of hypocalcemia induced by a pathology chosen from autoimmune hypoparathyroidism, vitamin-D dependent hypocalcemic rickets, progressive bone heteroplasia, isolated hypoparathyroidism, syndromic hypoparathyroidism, pseudohypoparathyroidism and hypo-deficiency rickets, diseases caused by an anomaly in the regulation of calcemia due to parathyroid hormone dysfunction,of vitamin D absorption or calcium receptor function.

[0075] According to this fourth aspect, the invention relates to a food or pharmaceutical composition which comprises at least one pharmaceutically acceptable excipient or at least one medium suitable for being ingested and at least one mixture of strains according to the fourth aspect of the invention and / or at least one mixture of peptides according to the fourth aspect of the invention and / or at least the fermentate obtained by fermentation of the mixture of strains according to the fourth aspect of the invention, in milk, in particular cow's milk, optionally skimmed, at a temperature of 40°C at pH=6 for 72 hours, said fermentate optionally being subjected to ultrafiltration at a cut-off threshold of 10 kDa.

[0076] According to this fourth aspect, the invention relates to a food or pharmaceutical composition which contains a pharmaceutically acceptable excipient or a medium capable of being ingested and at least one peptide as mentioned above or a mixture of peptides according to the fourth aspect of the invention and / or a mixture of strains according to the fourth aspect of the invention.

[0077] According to this fourth aspect, the invention also relates to a product chosen from food products, in particular fermented milks, fruit juices and / or vegetable juices, fermented vegetables and / or fruits, fermented mushrooms, charcuterie, food preparations based on fish(es) and dairy products obtained from milk, optionally skimmed, from cow, goat, sheep or a mixture of milks which contains a mixture of strains according to the fourth aspect of the invention and / or at least one mixture of peptides according to the fourth aspect of the invention and / or a food or pharmaceutical composition according to the fourth aspect of the invention.

[0078] Advantageously, the food or pharmaceutical composition contains a concentration of said strains equal to or greater than 107 CFU per gram of product and / or a concentration of peptides which are identical or different greater than or equal to 4 mg per gram. Definitions

[0079] The term “milk”, in the absence of precision, refers to cow’s milk.

[0080] The term "yogurt" refers to a dairy product made by fermentation by addition of lactic acid bacteria Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus.

[0081] The term “fermented milk” refers to a dairy product obtained by coagulation of caseins following the addition of a lactic ferment to the milk.

[0082] The term “fermentate” designates the supernatant obtained at the end of fermentation.

[0083] The terms "increase calcium absorption" and other related terms refer to the ability of the strain or peptides to increase the overall passage of calcium across the intestinal wall of a mammal (between the cells of the latter due to the increase in the expression of the cld-2 gene, for example), or to increase fluorescence in Caco-2 cells as indicated in the experimental part (greater passage of calcium through the cells of the intestinal wall) or to increase the expression of at least one gene chosen from trpvô, and vdr in intestinal cells as indicated in the experimental part of the present application (better absorption by the cells themselves).

[0084] The terms "acid resistant" refer to class 3 indicated in the experimental part of this application with reference to acid resistance.

[0085] The term "probiotic" refers to a microorganism capable of surviving in the intestine of a host, in particular a human, and of interacting with the cells of the intestinal wall and / or of interacting with other microorganisms living in the intestine of the host and of exerting a beneficial effect on the health of the host.

[0086] The term “hypocalcemia” refers to a concentration of calcium in the blood, corrected with the albumin level, of less than 2.20 mmol / L.

[0087] The term "active ingredient" means that the ingredient considered (peptide, mixture of peptides and / or strain) is contained in a quantity / concentration making it possible to obtain a technical effect at least in vitro on the inhibition of ACE and / or on the absorption of calcium.

[0088] The term “subject” refers to a human or an animal, in particular a mammal (in particular, a dog, a cat, a poultry, a sheep, a bovine, a goat or a reptile).

[0089] The term “treatment” includes both preventive (prophylactic) treatment and treatment enabling an improvement in at least one symptom of the pathology in question to be obtained.

[0090] The percentage identity refers to the percentage of identical amino acid residues between the sequence to be compared and the reference sequence, by aligning the entire sequence compared to the reference sequence. The protein sequence that has a % identity with the reference sequence may thus include insertions or deletions. The percentage identity is calculated by determining the number of positions at which an identical amino acid residue is observed for the two sequences compared, then dividing the number of positions for which there is identity between the two nucleic bases, or between the two amino acid residues, by the total number of positions in the comparison window, then multiplying the result by one hundred in order to obtain the percentage identity in nucleotides or amino acids of the two sequences with each other.

[0091] The peptides defined by their % identity can thus comprise one or more deletions and / or one or more substitutions, the insertion or substitution by a dextrorotatory amino acid, the replacement of the terminal carboxylic acid group and / or the terminal amine group by a protective group, for example, the introduction of a retro-type bond (i.e. a peptide bond -NH-CO- resulting from the reaction between the amine function of the first amino acid in the sequence with the carboxylic acid function of the following amino acid in the same sequence) or the introduction of a retro-inverso type bond (i.e. the introduction of a peptide bond of the aforementioned retro type with an amino acid in the opposite configuration to that of the amino acid of the reference sequence) or comprise a longer chain of amino acids.

[0092] Regardless of the aspect of the invention, the peptides may or may not be phosphorylated.

[0093] A pharmaceutical composition is defined as being a composition containing an active ingredient and a pharmaceutically acceptable excipient and in particular chosen from water, oils, alcohols, in particular ethyl alcohol, vegetable oils, cyclodextrins, starch, maltodextrin, lactose, sucrose, propylene glycol and physiological serum.

[0094] The term "consisting" when used in reference to one or more peptides indicates that the mixture or composition contains as peptide(s) only the peptides cited with the exception of other peptides but other compounds or constituents such as solvents, vitamins, proteins or others may be present.

[0095] An “ingestible medium” means any mixture or substance regardless of its physical phase which can be ingested and digested without causing problems to the digestive tract. Pharmaceutically acceptable excipients and in particular the examples cited in the present application are ingestible media.

[0096] Throughout the present application, the sequences are conventionally indicated in the direction from their N-terminus to their C-terminus.

[0097] Throughout the present application, strain VFH049 may also be referred to as VF49d.

[0098] Throughout the invention, the term "strain" refers without distinction to the living strain, i.e. capable of developing in a suitable nutrient medium, and to the inactivated strain, i.e. dead and therefore incapable of developing in a medium suitable for its development. Figures

[0099] [Fig.l]: [Fig.l] represents electron microscope photographs of each of the three strains of the invention; the leftmost photograph represents strain VF45A, the middle one strain VFH049 and the right one strain VF50b.

[0100] [Fig.2]: [Fig.2] represents the map obtained by ACP which evaluates the correlations between the proteolytic activity on milk agar, the growth during fermentation in liquid medium (milk), the pH at the end of fermentation, the quantity of peptides produced and 5 other criteria linked to the analysis of the chromatographic profiles of the peptides produced by the strains (distribution in apparent molecular weights);

[0101] [Fig.3]: [Fig.3] represents the IC50 in mg / mL for the ACE inhibitory activity of the control and crude fermentates obtained by fermentations of strains VF45A and VFH049;

[0102] [Fig.4]: [Fig.4] represents the IC50 in mg / mL for the inhibitory activity of the ACE of the control and fermentates obtained by fermentation of the VF45A and VFH049 strains and having undergone ultrafiltration;

[0103] [Fig.5]: [Fig.5] represents the calcium absorption rate (fluorescence emission ratio / basal emission) of the control and the crude fermentates obtained by fermentation of the strains VF45A and VFH049;

[0104] [Fig.6]: [Fig.6] represents the calcium absorption rate (fluorescence emission ratio / basal emission) of the control and of the fermentates obtained by fermentation of the strains VF45A and VFH049 and having undergone ultrafiltration;

[0105] [Fig.7]: [Fig.7] represents the mRNA level of the trpvô gene compared to that of the PBS condition of the crude fermentates obtained by fermentations of strains VF45A and VFH049;

[0106] [Fig.8]: [Fig.8] represents the mRNA level of the trpvô gene compared to that of the PBS condition of the fermentates obtained by fermentation of the strains VF45A and VFH049 and having undergone ultrafiltration;

[0107] [Fig.9]: [Fig.9] represents the percentages of parietal hydrophobicity obtained for strains tested according to their acidity tolerance class.

[0108] [Fig. 10]: [Fig. 10] represents the mRNA level relative to the control of the vdr, trpvô and cld-2 genes obtained after 24 hours of contact with the VFH049 strain and the VF50b strain with HT-29 MTX cells. Experimental part Isolation and characterization of strains

[0109] The three strains of the invention were extracted from different dairy products.

[0110] Samples of each dairy product are collected in sterile tubes, kept at 4°C for a maximum of two days before analysis. The samples are subjected to a series of dilutions in saline buffer (0.85% NaCl solution), then plated on MRS-agar plates (De Man, Rogosa and Sharpe). The plates are incubated for 48 hours at 37°C in an anaerobic environment. Morphologically distinct colonies are separated and subcultured onto plates of the same medium for purification. To ensure the purity of the isolates, the re-plating is repeated at least three times.

[0111] Table 1 below shows the dairy products from which the strains were extracted. All of these dairy products come from Mongolia and were prepared in the fall.

[0112] Optical microscope observations are carried out to determine the shape of the bacteria. These observations are visible in [Fig. 1]. The Gram of each strain is determined in a conventional manner by the Gram staining technique and observation under a microscope. The search for catalase is carried out for each strain in a conventional manner by taking each strain from an agar medium and placing it in contact with hydrogen peroxide.

[0113] The results are collected in Table 1 below.

[0114] [Tables 1] Dairy product source strain catalase Gram form Species Yogurt (yak milk) VF45A negative + bacillus L. helveticus Fermented mare's milk VF49d negative + bacillus L. helveticus Yogurt (yak milk) VF50b negative + Bacillus incurvatus L. delbrueckii ss bulgaric us Deposit of strains

[0115] The Lactobacillus helveticus VF45A strain was deposited by the Applicant on March 29, 2018 with the CNCM (National Collection of Cultures of Microorganisms), located at 25 rue du Docteur ROUX 75724 Paris Cedex 15 under the order number CNCM-L5300 (deposit according to the Budapest Treaty).

[0116] The Lactobacillus helveticus VFH049 strain was deposited by the Applicant on February 19, 2019, with the CNCM (National Collection of Cultures of Microorganisms), located at 25 rue du Docteur ROUX 75724 Paris Cedex 15 under the order number CNCM-I-5403 (deposit according to the Budapest Treaty). In the remainder of the application, this strain is also referred to as VF49d.

[0117] The strain Lactobacillus delbrueckii ssp. bulgaricus VF50b was deposited by the Applicant on April 20, 2018 with the CNCM (National Collection of Cultures of Microorganisms), located at 25 rue du Docteur ROUX 75724 Paris Cedex 15 under the order number CNCM-L5316 (deposit according to the Budapest Treaty).

[0118] Sequence of the genome coding for 16S ribosomal RNA

[0119] Determination of the sequence coding for the 16S ribosomal RNA of the strains confirmed that strains VF45A and VFH049 are indeed strains of the species Lactobacillus helveticus.

[0120] Similarly, genome analysis confirmed that strain VF50b is indeed a strain of the species Lactobacillus. delbrueckii ssp. bulgaricus.

[0121] PCR detection of genes coding for cell wall proteases

[0122] Identification of cell wall proteases present in the selected strains is performed by PCR detection of the genes coding for these enzymes. Bacterial cells are recovered from skimmed milk cultures, and bacterial DNA is then isolated using a wizard genomic DNA purification kit (Promega, Madison, USA). Lactobacillus helveticus strain CNRZ32 CIRM-BIA 103 (provided by the International Center for Microbial Resources - Bacteria of Food Interest, CIRM-BIA, INRA, Rennes, France) was used as a control for Lactobacillus helveticus genes. This strain (CNRZ32) is known to possess the 4 prtH genes (prtH1 to prtH4).

[0123] Each strain is tested for 5 pairs of primers corresponding to 5 different genes, namely, prtB, prtH1, prtH2, prtH3 and prtH4. The primers described by Hou et al., 2015 are used for the detection of prtB in Lactobacillus delbrueckii. Concerning the strains of Lactobacillus helveticus, the primers described by Genay et al., 2009 are used for the detection of the genes prtH1 and prtH2 and finally those described by Broadbent et al., 2011 for the detection of prtH3 and prtH4.

[0124] PCR reactions are carried out in a final volume of 25 pL comprising 12.5 pL of PCR Master Mix (2x) (ThermoFisher Scientific, Waltham, USA), 2 pL of each primer (12.5 pM), 2 pL of extracted bacterial DNA (approximately 200 ng.pL ') and 6.5 pL of H2O. PCR cycles are carried out in a labcycler thermocycler (SensoQuest, Gôttingen, Germany). After an initial denaturation at 95°C for 5 min, 30 PCR cycles are repeated successively, one cycle consists of a denaturation at 95°C for 30 sec, an annealing for 1 min at the required annealing temperature for each primer and an elongation at 72°C for 30 sec (4 min for the prtH4 gene). A final elongation at 72°C for 10 min takes place after the 30 PCR cycles. The PCR products are analyzed by electrophoresis on 1% (w / v) agarose gel prepared in TBE buffer (Tris, Borate, EDTA). The revelation of the DNA fragments is carried out by adding 0.008% (v / v) of GelRed® (10) to the gel.OOOx) (Biotium, Fremont, USA). Ten μL of PCR products are mixed with 4 μL of loading buffer (6x) (ThermoFisher Scientific, Waltham, USA) before being loaded onto the agarose gel. O'GeneRuler DNA Ladder Mix (ThermoFisher Scientific, Waltham, USA) is used as a size marker. Migration takes place for 45 min at a constant voltage of 100 V. The amplification products are revealed with Gel Doc™ (Bio-Rad, Hercules, USA).

[0125] The results are shown in Table 2 below. The prtB gene is detected for Lactobacillus delbrueckii strain VF50b but not in VF45A strains and VFH049 of Lactobacillus helveticus. The prtHl gene is detected in Lactobacillus helveticus strain VFH049 and in the control. Interestingly, other strains (not shown) were tested and it turns out that all Lactobacillus helveticus strains with the prtHl gene were isolated from fermented mare's milk. The prtH2 and prtH3 genes are detected in Lactobacillus helveticus strain VF45A and in the control. The prtH4 gene is detected in the control, but not in the tested strains.

[0126] [Tables2] prtf-ffa prtH2* pdH^ prtH4® pÆa VF50bo L- » na □ + S s Lait-deyak» CNRZ32 L- +a 35 s CIRM(INRA> VF49d» L- +s » O « H Laitdejument» VF45A= L- H +o +n H sa Laitdeyak»

[0127] Determination of the proteolytic and fermentative activity of the strains

[0128] The tests used cover both fermentative capacity (growth rate, acidification) and proteolytic activity (capacity to hydrolyze proteins). In fact, the two aspects are largely linked, the ability of bacteria to grow depends on their ability to hydrolyze proteins (since they need the amino acids released during hydrolysis to ensure their growth). It is also already known that acidification of the medium and protein hydrolysis are correlated. 1. Lab scale - fermentation without pH control#

[0129] Determination of proteolytic activity according to the milk agar method

[0130] Each strain is cultured in milk agar wells; the appearance of a halo around the well indicates proteolysis. Measuring the diameter of the halo allows the proteolytic capacities of the strain to be evaluated. Milk agar is prepared by mixing skimmed milk powder (Sigma-Aldrich, St Louis, USA) at a concentration of 5% (m / v) supplemented with 1.5% (m / v) agar in water. After sterilization at 110°C for 10 min, the milk is poured into Petri dishes. Wells of 4 mm diameter are then formed in the agar. The strain is cultured in liquid MRS medium (Man, Rogosa, Sharpe agar) for 48 h at 37°C under anaerobic conditions. The bacterial cells are then washed twice in MRS medium and finally re-suspended in a volume of MRS medium to obtain an OD600 equal to 1 (Prim spectrophotometer, Secomam, Aqualabo Group, Champigny, France). A volume of 20 pL of the bacterial suspension is placed in the milk agar wells. The inoculated plates are then incubated for 72 hours at 37°C under anaerobic conditions. The proteolytic activity of the strains is quantified by measuring the diameter (expressed in mm) of the halos appearing around the wells after incubation. Cultures in skimmed milk#: growth, PH

[0131] From a bacterial culture in liquid MRS medium, a 5 mL pre-culture is carried out in a medium composed of 100% UHT skimmed milk (Cora, Paris, France), for 72 hours at 37°C, under anaerobic conditions. The strain is then inoculated in a final volume of 30 mL of the same medium, with an initial OD60o of 0.3. The cultures take place for 48 hours at 37°C under anaerobic conditions. As a control, the same non-inoculated milk medium (NI Milk) is incubated under the same conditions. At the end of the fermentation, the acidity of the medium is evaluated by measuring the pH with a pH meter (Mettler Toledo, Greifensee, Switzerland). For the evaluation of bacterial growth, a direct measurement of the OD cannot be carried out due to the opacity of the medium. The phenomenon of coagulation of caseins after fermentation is also a problem, with caseins precipitating as soon as the pH is below 4.6.A preliminary protocol for recovering bacterial cells from the milk culture is therefore carried out. A volume of 1 mL of culture is diluted (1 / 10) in a 2% (m / v) EDTA solution at pH 12, in order to completely re-suspend the precipitated caseins. The cells are then recovered by centrifugation at 13,400 rpm for 10 min. This protocol is repeated a second time and the bacterial pellet obtained is re-suspended in 1 mL of PBS buffer. The measurement of OD600 is carried out from this suspension, the blank is obtained by carrying out the same protocol with non-inoculated milk.

[0132] Cell growth and pH were measured after 48 hours of incubation in skimmed milk. Lactobacillus helveticus strains exhibit very rapid growth, reaching an average OD60 of 2.7, while Lactobacillus delbrueckii strains only reach 0.85 on average.

[0133] The acidification of the inoculated milk was compared with that of the control (NI milk). The initial pH of the non-inoculated milk was 6.5, it reached 6.45 after 48 hours of incubation. In almost all cases the Lactobacillus helveticus strains led to a decrease in pH of 3 units, reaching an average of 3.68, while the pH of the samples inoculated with the Lactobacillus delbrueckii strain^ decreased by a maximum of 2 pH units, reaching an average of 4.57. In all cases, the fermentation resulted in milk coagulation because caseins precipitate when the pH drops below 4.6.

[0134] Measurement of the quantities of peptides produced and their molecular weight distribution

[0135] The peptides produced during the fermentation of the strains are analyzed by two methods. The peptide concentrations are first evaluated by Folin-Ciocalteu (FC) reagent assay; the peptides are also analyzed according to their apparent molecular weight distribution by size exclusion chromatography (SEC). Extraction and purification of the produced peptides

[0136] From the skimmed milk cultures, a 4 mL sample is taken and then mixed with a volume of 400 pL of a trichloroacetic acid (TCA) solution at a concentration of 10% (m / v) to reach a final TCA concentration of 1%. The addition of such a concentration of TCA allows the precipitation of high molecular weight proteins. After centrifugation at 10,000 rpm for 10 min, the supernatant containing the peptides is recovered.

[0137] The peptides are then purified from the supernatant to remove TCA, sugars, and salts. Purification is carried out by solid phase extraction (SPE), the principle of this method is a separation of the compounds from a mixture by selective adsorption on a solid phase. Bond Elut Ci8 micro-columns (1000 mg) (Agilent Technologies, Santa Clara, USA) are used; these are columns composed of a solid phase of silica grafted with Cig groups allowing the retention of hydrophobic compounds. The columns are equilibrated by passing a minimum volume of 10 mL of a 100% acetonitrile (ACN) solution supplemented with 0.1% trifluoroacetic acid (TFA) (v / v). After rinsing the column with a H2O solution containing 0.1% TFA (v / v), a volume of 4 mL of supernatant containing the extracted peptides is then loaded onto the column.A further rinse with H2O supplemented with 0.1% TFA elutes all compounds not retained by the column. The retained peptides are finally eluted in a volume of 2 mL of a solution of 80% (v / v) ACN, 20% H2O (v / v) and containing 0.1% TFA. The samples are then stored at -20°C until analysis. Folin-Ciocalteu reagent assay

[0138] The extracted peptides are quantified by a Folin-Ciocalteu (FC) reagent assay. This is a solution of sodium tungstate and molybdate prepared in phosphoric and hydrochloric acids. The yellow-colored phosphotungstic acid and phosphomolybdic acid complex is reduced by tyrosine, tryptophan, cysteine ​​residues or by peptide bonds in an alkaline medium to give a blue color. The appearance of the blue color, proportional to the peptide concentration, is monitored by spectrophotometry. For the assay, the reaction is carried out in a final volume of 800 pL comprising 200 pL of extracted peptides, 500 pL of a 500 mM sodium carbonate (NaHCO3) solution and 100 pL of Folin-Ciocalteu reagent (Sigma-Aldrich, St Louis, USA). The reaction is incubated at 37°C in the dark for 30 min, then the OD at 750 nm of the mixture is measured by a Prim spectrophotometer (Secomam, Groupe Aqualabo, Champigny, France). The blank is made from the solution used to elute the peptides from the SPE columns (80% ACN, 20% H2O, 0.1% TFA). The concentration in the samples is determined by a standard range of a commercial peptide solution (peptide digest assay standard, ThermoFisher Scientific, Waltham, USA). Size exclusion chromatography analysis

[0139] The purpose of size exclusion chromatography (SEC) is the separation of compounds from a mixture based on their hydrodynamic sizes or volumes. In this study, SEC allows the analysis of the apparent molecular weight distribution of peptides extracted after fermentation. The column used for peptide separation is a Superdex Peptide 10 / 300 GL (10 x 300-310 mm, 13 pm, GE Healthcare, Little Chalfont, UK) connected to an AKTA Protein purification system (GE Healthcare, Little Chalfont, UK). A volume of 25 pL of sample is eluted under isocratic conditions in a solvent composed of 30% ACN (v / v), 70% H2O (v / v) and 0.1% TFA (v / v), at a flow rate of 0.5 mL / min for 60 min. A 214 nm UV detector allows the detection of peptide bonds. The quantity of peptides in the samples is analyzed by integration of the profiles obtained by SEC.Two molecular weight ranges were chosen for the integrations, the first concerns peptides with an apparent molecular weight greater than 1,700 Da (called PHPM, high molecular weight peptides) and the second peptides with an apparent molecular weight less than 1,700 Da (called PB PM, low molecular weight peptides). The quantity of peptides belonging to each size class is expressed either as a percentage of the total area of ​​the chromatogram (% PHPM and % PB PM), or as a percentage of the area of ​​the chromatogram obtained for the non-inoculated milk control condition (% PHPM / NI Milk and % PBPM / NI Milk).

[0140] Concentration measurements using the FC reagent showed an increase in the amount of peptides after 48 h, with concentrations above 4 g / L in all cases, compared to 2 / 06 g / L in the uninoculated sample.

[0141] The Lactobacillus helveticus VF4-5A strain is one of the most effective strains with a final peptide concentration greater than 6 g / L (see Table 3 below).

[0142] The molecular weight of the generated peptides was analyzed by SEC as mentioned above. The quantity of peptides belonging to each size class (less than or greater than 1,700 Da) is expressed either as a percentage of the total area of ​​the chromatogram (% PHPM and % PB PM), or as a percentage of the area of ​​the chromatogram obtained for the non-inoculated milk control condition (% PHPM / MILK NI and % PBPM / MILK NI). Inoculation and fermentation lead to an increase in low molecular weight peptides compared to the control (1.5 times on average for Lactobacillus delbrueckii strains, 2 times on average for Lactobacillus helveticus).

[0143] The results obtained for each strain are grouped in Table 3 below.

[0144] [Tables3] Strain; 0* agar* milk- Acidifies ation* (pH)n Growth nce-(OD> Reactive dosage* FC*(s / L) Total-area* %PHPM %PBPM %PHMP / CTLFa %PBPM / CTLFa N!SM« XK 6.45+- 0.05» 85.62-+- 2.72" 14.39+- 2.72" 100" 100" VF50b" 30-+ 1.5 4.51-±0 0.973-+- 0.199" 4.89+-0.3" 114.70-±-12.5" 58.12 ■+■ 6.22" 40.90-+- 4.26" 21.12-+- 1.81" 140.37-±•28.22" VF45At 32-+-4" 3.32+- 0.04" 3.57+- 0.12" 6.16+- 1.32" 289.95-±■52" 40 -± ■ 3.74" 60.1+- 3.77" 37.35-+ 11.95" 514.7+- 86.67" VF49d" 35-+-4.3 3.43-±-0.01" 2.72-+- 0.05" 4.46-+- 0.46" 225.08- ±■118.3' 58.56+- 14.51« 42.19-+- 14.63« 43.87-+ 29.24« 263.68- ±■77.95«

[0145] Principal component analyses (PCA) are performed with R software (R core team, 2016, Vienna, Austria), on the R Commander package and its FactorMineR plug-in.

[0146] A PCA analysis took into account 9 quantitative parameters: proteolytic activity on milk agar, growth during fermentation in liquid medium (milk), pH at the end of fermentation, quantity of peptides produced, and 5 other criteria related to the analysis of the chromatographic profiles of the peptides (distribution in apparent molecular weights. [Fig.2] shows the map obtained. The principal components Diml and Dim2 represent 60.82% and 23.56% of the total variance, respectively. A positive correlation is observed between the pH value and high molecular weight peptides. In addition, growth is correlated with a series of variables related to peptide production (quantification by FC reagent, %PBPM, %PBPM / Milk NI) and the diameter of the proteolysis halo. The pH value and high molecular weight peptides are negatively correlated with variables such as growth, the proportion of PBPM and the proteolysis halo. 1. Production of peptides at controlled pH, ultrafiltration, identification of peptides# Bioreactor fermentation

[0147] Each strain is cultured in a 500 mL bioreactor (MiniBio 500, my-Control, Applikon Biotechnology, Delft, Netherlands). The medium consists of skimmed milk (10 g / L (see previous paragraph), autoclaved for 30 min at 110°C. The strain is inoculated at an OD600 equal to 0.3. The fermentation is carried out for 72 hours at a constant temperature of 40°C with stirring at 300 rpm in a final volume of 330 mL. The anaerobic condition is obtained by injecting N2 into the bioreactor at a flow rate of 20 mL / min. Throughout the experiment, the pH is maintained at 6 using HCl (1 M) and NaOH (3 M) solutions, the supply is carried out by means of two peristaltic pumps located on the bioreactor control unit. Samples of approximately 5 mL are taken under aseptic conditions at 0, 2, 17, 24, 41, 48, 65 and 72 hours of fermentation for analysis of the growth of the bacterial strains as well as the evolution of peptide concentration.The latter is evaluated by an FC reagent assay after TCA precipitation. A volume of 1 mL of fermentate is diluted (1 / 10) in a 2% (m / v) EDTA solution at pH 12 and then centrifuged at 13,400 rpm for 10 min, and 25 pL of supernatant is analyzed by SEC. The bacterial pellet is resuspended in 1 mL of PBS buffer for measurement of the OD600 in order to evaluate bacterial growth. After 72 hours of fermentation, the entire fermentate is recovered and then centrifuged at 10,000 rpm for 10 min, the supernatant is then stored at -20°C until analysis. The dry matter concentration in the fermentates is measured using a desiccator (XM60, Précisa, Poissy, France) and is always equal to 100 g / L. In order to confirm the impact of bacterial fermentation on the properties of the final product, a control is carried out (CTLF). This is the fermentation medium incubated under the same conditions but not inoculated.After 72 hours of incubation, this medium is centrifuged and stored like other fermentations.

[0148] Identification of peptides produced during fermentation at controlled pH

[0149] In order to remove non-hydrolyzed proteins, a portion of the crude fermentate is fractionated using an ultrafiltration membrane. The membrane is a 0.1 m2 Hydrosart® cassette (Sartocon® Slice Hydrosart® Cassette, Sartorius, Göttingen, Germany) with a cut-off threshold of 10 kDa connected to a Sartocon® Slice 200 Hölder system (Sartorius, Göttingen, Germany). The fermentate feed is carried out by a peristaltic pump and the retentate pressure is maintained at approximately 1 bar during filtration. Thus, the ultrafiltration permeate (UFP) containing molecules below 10 kDa is separated from the retentate (UFR). The two subfractions are then stored at -20°C until analysis. The ultrafiltration permeates are dried to 10% of the initial volume by centrifugal evaporation (miVac, Gene Vac, Ipswich, UK) for 15 hours at 40°C. The dry matter concentration in the products (fermentate and ultrafilter fermentate) is then measured using a desiccator (XM60, Précisa, Poissy, France).

[0150] Peptides purified by SPE from culture supernatants (non-ultrafiltered) are dried by centrifugal evaporation (miVac, Gene Vac, Ipswich, UK) for 2 h at 40°C and then re-suspended in 100 μL of H2O containing 0.1% TFA (v / v) and centrifuged for 10 min at 8,000 rpm. Ten microliters of sample are injected onto a Ci8-Kinetex column (150 x 4.6 mm, 2.6 μm, 100 Å, Phenomenex, Torrance, USA), connected to an Ultra Performance Liquid Chromatography (UPLC) Acquity chromatographic system (Waters, Manchester, UK). A linear gradient of ACN containing 0.1% formic acid (FA) (v / v) is used (from 5 to 15% ACN for 30 min, then from 15 to 30% ACN for 60 min, from 30 to 50% ACN for 10 min and finally from 50 to 95% ACN for 10 min) with a flow rate of 500 pL.min *.UPLC eluents are directly electrosprayed at 3 kV, desolvation is achieved using nitrogen (N2) at a flow rate of 600 Lh 1 at a temperature of 300°C. The chromatographic system is coupled to a Synapt-G2-Si mass spectrometer (Waters, Manchester, UK). MS measurements are performed in data dependent analysis (DD A) mode and data are collected in a mass range of 100 to 2000 m / z. A maximum of 15 precursor ions with an intensity threshold of 10,000 are selected for fragmentation by the collision-induced dissociation (CID) method at a power of 8 to 9 V for low masses and a power of 40 to 90 V for high masses. MS / MS spectra were collected in a mass range from 100 to 2000 m / z. Spectra were processed by Mass Lynx software (version 4.1.) (Waters, Manchester, UK).Analysis of the control sample (CTLF) allowed to define the basic heterogeneity. 596 peptides from 22 milk proteins (aSi-casein, [3-casein, aS2-casein, GLYCAM1, K-casein, BTN1A1, [3-lactoglobulin, FGFBP, lactoperoxidase, osteopontin, perilipin, collagen a2, TRIP6, NPT2B, acylCoA desaturase, dysferlin, COG8, B4GT1, PSME4, DHX9, RALYL and apolipoprotein A2) were identified in this sample. 32% of them originated from [3-casein. By comparison, between 150 and 722 peptides were identified in the samples fermented by the different strains tested. In these samples, [3-casein] peptides represent 44 to 67% of all identified sequences. Due to the preponderance of [3-casein] peptides among the identified peptides, and the natural abundance of [3-casein] in milk, only peptides derived from [3-casein] will be studied. The peptides produced by the strains of the invention are therefore all derived from the proteolysis of [3-casein] from cow's milk. The database search is carried out via Peaks Studio software (version 7.0.) (Bioinformatics Solutions, Waterloo, Canada) using the UniProt database (as of May 15, 2017) restricted to the complete proteome of the Bos taurus species. The tolerance thresholds for the masses of precursor and fragment ions are set at 35 ppm and 0.2 Da. The peptide sequences identified by the software are filtered according to a false positive rate (false discovery rate) strictly less than 1%.

[0151] For all strains, the identified peptides come from the fermentate that has not undergone ultrafiltration. These same peptides should also be found, given their mass, in the ultrafiltered fermentate.

[0152] It should be noted that when identifying the peptides, peptides that could originate from yeast were considered. After analysis by mass spectrometry, the Applicant found, using the databases, that no peptides originating from yeast were present in the fermentate, ultrafiltered or not.

[0153] Table 4 groups the non-phosphorylated peptides considered to be new which are produced by the VF45A strain according to the fermentation method indicated above at pH 6.

[0154] Table 5 groups together the phosphorylated peptides considered to be new which are produced by the VF45A strain according to the fermentation method indicated above at pH 6.

[0155] [Tables4] SC fUCHE VF 45A SSQ 10 NO 1 mvPN 1 SEBWN S SSEBWN 4 ŒWEN 5 SSQQQT3O3LQD S HRSLPQ 7 LPVPQKAVWq a VLPWQKAVPyPQ s DMRQAF sa OELQDKÎHPF u HPF 12 EEQQQTgDELWCIHPF 13 3QCW£O£LQDKIHFF 14 QOKIHFF 15 QQQT3DELQOIPHPF 13 QQTEOE1QOM1HFF n OTOacmiHPF n SEEQOQTEOEW^HPF 13 TEOELODKiHPF

[0156] [Tableaux5] SOUCHE W3SA SEQ iD MO 21 22 ESTEUQAWEMmM 23 ESTEOQAMlEmKQMEAE 24 FQSEEQQ 2S 2S «STEUQAWUmQME 27 HNSEFQ 2S iGSCSimUAMEOmCWE 29 fôSESTEDQÀMmmQM 30 40 SESTEUQAMEO^ 31 SEWSUQAMOIMQM 32 SESTEOQAMEOIKQME 33 0157

[0158] Table 7 groups together the phosphorylated peptides considered to be new which are produced by the strain VFH049 according to the fermentation method indicated above at pH 6.

[0159] It is known that phosphorylated peptides can be active in calcium absorption (see the publication entitled “Casein phosphopeptide promotion of calcium uptake in HT-29 cells - Relationship between biological activity and supramolecular structure” by Gravaghi, C., et al. published in 2007, FEBS J. 274, 4999-5011. doi: 10.1111 / j. 1742-4658.2007.06015.X.

[0160] [Tableauxô] SOUCHE W49d pepBiie « T i SLVYPFPGRPHSLPQH IBVm 47 IMWBYPN 48 SLWPfWRFBI 49 FPKYPVEPFTESa 5© POPVEPFTE5Q 51 MHWVEPFÎBQ 52 HKEMWOWEPFTESQ 53 emirfpicypwrfi^^ 54 TLTDVŒ 55 WPFIWWM 56 SLWPH»«3PIHN 57 LVYPFPGPIHN *1» 7WWPWL <liWMWSWKE6»»AP 59 ipprrQ 69 r*to g s g. «IPPTO VWPGHHNSEPQ KAVWQ 64 SLSQSKVEPVm^AVPYPQ 65 wïwiHimm 66 LWPFPGPlHHSim 67 68 StWRFPGPlHNSlPa TOW^NL SR 1 cOcLL§L> nIorr sivw 71 ELQP«»F 72 NimwmwpPF 73 HKEMPFPKYPVEPF 74 DELQpKIHPF

[0161] [Tableaux?] __________souche wiad__________| SEQIONO j TsJ / WVÎE | wÎmpboé ] 77 j EASÎWIESFPE1MWQ | _____] 79)¾¾¾ | æ|MBrŒw | __________«l]sEBGmreDELQ_____| _______^SŒ(WffB)BXW j __________o|tŒASPE_____________| | _________8S|TŒDSPBOOPPBMWQ | I

[0162] Table 8 below groups together the non-phosphorylated peptides considered to be new which are produced by the VF50b strain according to the fermentation method indicated above at pH 6.

[0163] Table 9 groups together the phosphorylated peptides considered to be new which are produced by the VF50b strain according to the fermentation method indicated above at pH 6.

[0164] [Tables8] STRAIN VF 56b 162 WEQKHtQ j sechdno ISliMESTEVFTK 163 SVFQKHiQK 182!MEST£VFDat 164 ME5TEVFTK • 183 ' H R&MSTSFŒSKKWO 165 MEStEVRKK 184:SA£ESLHS 166 WERtHSM IS^SAEFRLHSMK 167 DiGSESH? ! l^SAEFRiHSMKEG 168 OLISKEQWm WiSAEERUiSMKEiGm 169 EKtOSEE! 188SSEEQQQTEÜE1Q 170 GKEKVNO.SKD 189iSFEQQQTEŒlQD 171 1SKEQMR ; 190!SKt»GSESTE 172 WK3S6STE 19d 5KDKSSE5TE0QAM 173 KfHGSËCTEDtWE WJ 174 193i»æQMR 175 KFQSE£QC(QïEŒ1 176 ! 19S^ÏSŒNSKKrVO 177 WEKFQSE IQ^WEQKUÎ 178 KKiEKFQSŒ î 197^5VEQKH!Q 179 KVPQlEWWSÂEEKtH 198iSV£QKHSQKE 180 lŒEfWIR 199 i VPQ1EIVPNSAEER1H

[0166] Biological activities of ferments and peptides

[0167] The fermentates (before and after ultrafiltration) were tested for two biological activities, namely FACE inhibition and the ability to modulate calcium absorption. Furthermore, the toxicity of the hydrolysates was evaluated. For the analyses, the different samples were diluted in H2O at a concentration of 15 g / L of dry matter. Cytotoxicity test

[0168] The aim of this experiment is to test the possible toxicity of fermentates towards intestinal cells. Cell viability is measured by the use of the CCK-8 reagent (Cell Counting Kit-8), this method is based on the reduction of a tetrazolium salt by cellular dehydrogenases producing formazan whose formation is monitored at 450 nm. Caco-2 cells are seeded in 96-well plates at a density of 8,000 cells per well in a volume of 200 pL of complete DMEM medium, and cultured for 7 days at 37°C, 5% CO2. The fermentates are diluted in complete DMEM medium at a concentration of 5 and 10 g / L. A PBS buffer also diluted in DMEM medium (same dilution factor as the samples) is used as a control. A volume of 150 pL of sample is placed in each well, followed by incubation for 7 or 24 hours at 37°C, 5% CO2.After incubation, Caco-2 cells were washed twice with PBS buffer and then a volume of 150 pL of complete DMEM medium supplemented with 5% (v / v) CCK-8 reagent (Sigma-Aldrich, St Louis, USA) was added to each well. The plate was then incubated for 2 h at 37°C, 5% CO2 in the dark, and then read at 450 nm with a Xenius XC spectrofluorimeter (Safas Monaco, Monaco, France). Cell viability . is calculated relative to the absorbance obtained for the control wells (corresponding to 100% viable cells). At a concentration of 5 g / L, the crude (unfiltered) fermentates of each of the strains of the invention do not show any toxicity towards Caco-2 cells even after 24 hours of contact. The same observation is made for a concentration of 10 g / L of dry matter. The ultrafiltered fermentates of each of the strains also do not show any cytotoxicity.

[0169] Inhibition of angiotensin converting enzyme

[0170] The aim is to study the inhibitory potential of fermentates towards ACE. It is based on the use of a fluorescent substrate, o-aminobenzoyl-Gly-p-nitro-L-Phe-Pro (Abz-Gly-Phe(NO2)-Pro). The hydrolysis of this substrate by ACE generates the fluorophore group Abz-Gly which can be monitored by excitation and emission wavelengths of 355-375 nm and 400-430 nm respectively. The samples, the enzyme and the substrate are prepared and diluted in a Tris-HCl buffer (150 mM) at pH 8.3 at the desired concentrations. The hydrolysis reaction is carried out in a 96-well plate in a final volume of 300 pL comprising 50 pL of sample or Tris-HCl buffer (for the negative inhibition control), 50 pL of ACE solution (0.05 U / mL) (Sigma-Aldrich, St Louis, USA) and 200 pL of Abz-Gly-Phe(NO2)-Pro substrate (0.45 mM) (Bachem, Bubendorf, Switzerland). A control containing no enzyme (replaced by Tris-HCl buffer) is also carried out.The plate is then incubated at 37°C for 1 h, a fluorescence measurement takes place every 2 min with excitation and emission wavelengths of 365 and 415 nm respectively by a Xenius XC spectrofluorimeter (Safas Monaco, Monaco, France) equipped with a water bath at 37°C. The inhibition percentages and IC50 of the different samples tested are calculated based on the negative inhibition control.

[0171] For the analysis of biological activities (of all biological activities tested in the present application), the significance of the results is assessed by a one-way analysis of variance (ANOVA) followed by a Tukey test for multiple comparison of means. The difference between the means is considered significant for a p value < 0.05. The statistical tests were conducted using R software (R core team, 2016, Vienna, Austria), on the R Commander package.

[0172] To demonstrate the interest of fermentation at the level of the biological activities studied, the activities are compared to those of the control fermentate (CTLF), fermentation medium incubated without inoculation.

[0173] The samples were tested at different dry matter concentrations in order to calculate the concentration inhibiting half of the enzymatic activity (IC50). The results are shown in [Fig.3] and 4.

[0174] The crude fermentates have IC50s ranging from 12.76 mg / mL for the crude control fermentate to 0.56 mg / mL for the fermentate produced by strain VF45A. For strain VFH049, the IC50 of the crude fermenta is 0.76 mg / mL. For the ultrafiltered fermentates, the IC50s are 8 mg / mL for the control, 0.47 mg / mL for the fermenta produced by strain VF45A and 1.76 mg / mL for the fermenta produced by strain VFH049. Strains VF45A and VFH049 very significantly improve the ability of the fermentates to inhibit ACE compared to the control. The same effect is obtained with the ultrafiltered fermentates. Molecules of interest are therefore produced by the strains during fermentation and exhibit FACE inhibition activity.

[0175] Prediction of FACE inhibition activity by QSAR model; comparison with prior art peptides

[0176] In order to predict the ACE inhibitory activity of each of the identified peptides (non-phosphorylated peptides), a QSAR (Quantitative Structure Activity Relationship) statistical model was used. This model was developed by Pripp et al., (2004), using as amino acid descriptors the z-scores (zl, z2 and z3), described by Hellberg et al., (1987). The prediction is based on the physicochemical characteristics of the last two amino acids of the peptides (in the C terminal position) allowing to obtain via the model equation a predictive IC50 value. The QSAR approach used to determine the IC50 of our peptides was used on the VPP and IPP peptides of the prior art. Their IC50 is 26 pM, while some of the peptides of the invention have an IC50 value below 20 pM (up to 8.7 pM for the most active), and are therefore a priori more effective.

[0177] The results are grouped in Tables 10 to 12 below.

[0178] [TableauxlO] SOUCHE VF45A SEQIDMO LogOS ïCSQtpMj 1 1.2729 18.7456282 ? 12729 18.7456282 3 12729 18.7456282 4 1.3041 20.1418798 5 1.4138 25.9298497 6 15225 33.3042762 7 15225 33.3042762 8 1.,5225 33,3042762 9 16101 40,7474091 lû 1,6498 44,6477934 11 1,6498 44,6477934 12 1,6498 44,6477934 13 1,.6498 44.6477934 14 1.6498 44.6477934 15 1.6498 44.6477934. 16 1.6498 44.6477934 17 1.6498 44.6477934 18 1.6498 44.6477934 19 1.6498 44.6477934

[0179] [Tableauxll] SOUCHE VF 49d SEQIDW Log 1C50 ÎCSO(pM) 44 0.9406 8.72167702 ■sr 0.9405 8.72167702 46 1.2729 18.7456282 47 1.2729 18.7456282 48 1.2729 18.7456282 49 1.2809 19.0941355 50 1.2809 19.0941355 51 1.2809 19.0941355 52; 1.2809 19.0941355 53 1.2809 19.0941355 54 13041 20.1418798 55 1.3124 20.5305224 56 1.3124 20.5305224 57 1.3124 20.5305224 58 1.3893 24.5075558 59 1.5164 32.8397619 60 1.5164 32.8397619 61 15164 32.8397619 (N WJ 15225 33.3042762 63 1.5225 33.3042762 64 1.5225 33.3042762 65 15225 33.3042762 66 15225 33.3042762 67 1.5225 33.3042762 68 1.5249 33.4888319 69 1.6498 44.6477934 70 1.6498 44.6477934 71 16498 44.6477934 72 1.6498 44.6477934 73 1.6498 44.6477934 74 1.6498 44.6477934

[0180] [Tableauxl2] SOUCHE VF 50b ; seqiono LogiCSO ] iC50{p^) SEQWO LogîŒ? JCSO(uM) ] 87 03406] 8.72167702 124 1.5225 33.3042762] 88 LÛ94L 12.4251031 125 1^225 333042762] J} tjmi 12.4251031 12.4251031 1.0943] 12.4251031 126] 15225 ------->A® 128] 15225 3330427621 33.3042762] 92 13943] 12.4251031 129 1^225 33^)42762] 93 1.0943] 12.4251031 130 15225 33.3042762] 94 1.2729] 18.7456282 131 1.5225 333042762] 35 1.2729] 18.7456282 132 15225 333042762] 96 1.2809] 19.0941355 133 1^225 33^)42762] 97 1.2809] 19.0941355 134 15225 33.3042762, 38 12®Q9] 19.0941355 135 1^225 333042762.] 99 1.2809] 193941355 136 15225 333042762] 100 1.2809] 19.0941355 137 15225] 333042762.] 101 102 103 1.2809] 193941355 1.2809( 1.9,0941355 1,2809] 193941355 138] 15225 139| 1,5249 140] 1,6101 333042762, 33,4888319, 40,7474091, 104 V803] 193941355 141 1,6101 40,7474091] 105 1,2809] 194)941355 142 1,6101 40,7474091] 106 1,2809] 19,0941355 143 1,6101 40,7474091] 107 1,2809] 19,0941355 144 1,61,01 40,7474091] 108 1,2809] 19,0941355 145 1,6101. 40,7474091] 1.03 1.28091 19.0941355 146 1.6101 40.2474091] 110 1.2809] 19.0941355 147 1.649^ 443477934] 111 13041] 263418798 148] 1.6498 44.6477934] 112 113 114 1.4138] 25.9298497 1.4138] 253298497 1329] 263534445 149] 1.6498( 443477934] 1.6498^ ISO 44.64 / 7931 151J 1.6498^ 44^477934] 115 1.4648] 29.160838 152 1.6498 44.6477934] 116 1.5164] 32.8397619 153 1.6498 443477934] 117 1.5164] 323397619 154 1.6498 4434 / 7934] 118 15164] 323397619 155 1.6498 44.6477934] 113 1.5164] 323397619 156 1.6498 44.6477934, 120 1.5164] 323397619 157 1.6498 443477934] 121 1.5225] 333042762 158 V498 44.6477934] 122 1.5225] 333042762 159 1.6498 443477934] 123 1.52251 333042762 160 161 1.64^ 1.6498 44.6477934, 443477934] .

[0181] The QSAR approach used to determine the IC50 of the peptides of the invention was used on the VPP and IPP peptides described in the prior art. Their IC50 is 26 pM, whereas some of our peptides are below 20 pM (up to 8.7 pM for the most active), and are therefore a priori more effective. Modulation of calcium absorption

[0182] The majority of calcium consumed is absorbed at the intestinal level, two calcium transport pathways have been identified in the intestine, the paracellular pathway and the transcellular pathway. Paracellular calcium transport is a passive diffusion of this element from the lumen to the intestinal mucosa, according to the gradient formed between these two compartments. Two proteins are involved in this transport, claudins 2 and 12 (CLD-2 -12) which are part of the tight junctions between cells and act as calcium channels (Fujita et al., 2008). Transcellular calcium transport is an active transport involving the incorporation of calcium into intestinal cells by a transporter called TRPV6. Calcium is subsequently transported and excreted at the basal pole of the cell in the intestinal mucosa.These two calcium transport pathways are regulated by vitamin D, a hormone which, once bound to its nuclear receptor VDR (Vitamin D Receptor), acts as a transcription factor controlling the genes of CLD-2 -12 and TRPV6.

[0183] On Caco-2 cells, measurement of calcium incorporation

[0184] The ability of fermentates to modulate calcium absorption was evaluated using Caco-2 cells. The test consists of contacting the fermentates (concentration of 10 g / L) with the Caco-2 cells for 7 hours. After contact, the incorporation of calcium by the cells is evaluated using an intracellular probe capable of emitting fluorescence in the presence of calcium. After rinsing the Caco-2 cells, the FluoForte® probe is added following the instructions of the FluoForte® calcium assay kit (Enzo Life Sciences, Farmingdale, USA), the plate is then incubated at room temperature for 1 hour, the penetration time of the probe. The fluorescence emission is then monitored by a Xenius XC spectrofluorimeter (Safas Monaco, Monaco, France) with an excitation wavelength at 490 nm for a monitored emission at 525 nm.The emission is measured for 30 sec with an injection of 25 pL of a 250 mM CaCl2 solution between 9 and 10 sec of kinetics using an injector module coupled to the spectrofluorimeter. This injection causes a sudden entry of calcium into the intestinal cells which leads to an increase in fluorescence emission. The capacity of bacterial strains to modulate the incorporation of calcium into the cells is determined by this increase in fluorescence after calcium injection. The results are thus expressed for each well relative to the average fluorescence measured between 0 and 9 sec of kinetics, considered as the basal fluorescence of a well. A fluorescence increase ratio, for the different contact conditions, is therefore obtained.

[0185] The effect of the fermentates obtained with the strains VF45A and VFH049 is compared with that of the PBS buffer and that of the control fermentate. The results show that the crude fermentates obtained with these two strains are capable of positively modulating calcium incorporation compared to PBS buffer and control ([Fig.5]). Thus, the ratio of fluorescence emission to basal emission is 1.08 for PBS, 1.23 for the control fermentate, 1.3 for the fermentate produced by strain VF45A and 1.31 for the fermentate produced by strain VFH049. When ultrafiltered fermentates are tested, however, the effect is less pronounced for strain VF45a than for VF49d ([Fig.6]). Nevertheless, a tendency towards increased absorption is observed for both strains.

[0186] Modulation of trpv6 gene expression in Caco-2 cells

[0187] The objective of this part is to evaluate the ability of fermentates to modulate trpvô gene expression by intestinal cells. An RT-qPCR approach is conducted using Caco-2 cells as a model. Caco-2 cells are seeded in 24-well plates at a density of 40,000 cells per well in a final volume of 500 pL of complete DMEM medium and incubated for 15 days at 37°C, 5% CO2 with a medium change every two days after 7 days of culture. The fermentates are diluted in complete DMEM medium at a concentration of 10 g / L of dry matter. PBS buffer diluted in DMEM medium (same dilution factor as for the samples) is used as a control. After incubation, the cells are washed twice with PBS buffer, then a volume of 300 pL of each sample is deposited in the wells. The plate is then incubated for 7 hours at 37°C, 5% CO2.After contact between Caco-2 cells and samples, the wells are rinsed twice with PBS buffer and then RNA extraction with TRIzol™ reagent is performed. RNA samples are first treated with DNase to remove any co-extracted and / or remaining DNA fragments following extraction. A volume of 8 pL containing 1,000 ng of RNA is mixed with 1 pL of DNase, and 1 pL of DNase buffer (ThermoScientific, Waltham, USA). The reaction takes place at 37°C for 30 min, it is stopped by the addition of 1 pL of 50 mM EDTA solution (ThermoScientific, Waltham, USA) followed by incubation at 65°C for 10 min. Subsequently, the samples were reverse transcribed into cDNA using the RevertAid H minus first strand cDNA synthesis kit (ThermoScientific, Waltham, USA), according to the provided instructions. For the qPCR reaction, the cDNA samples were diluted (1 / 16) in H2O.For a sample volume of 2 pL, 18 pL of qPCR mix is ​​added containing 10 pL of Power SYBR® Green PCR Master Mix (2x) (Applied Biosystems, Life Technologies, Foster City, USA), 0.6 pL of each primer (10 pM) and 6.8 pL of H2O. Fluorescence is monitored during the reaction in a CFX Connect Real Time Detection System thermocycler (Bio-Rad, Hercules, USA). After a denaturation step at 95°C for 10 min, 40 PCR cycles are performed successively, one cycle includes . denaturation at 95°C for 15 sec, annealing at 58 or 60°C depending on the primer pair used for 30 sec and elongation at 72°C for 30 sec. The creation of a melting curve completes the reaction.

[0188] The gene studied is the gene coding for the calcium transporter (transient receptor potential selective for calcium) (trpvô) also called CaTl (calcium transporter 1). The expression of this gene is normalized relative to that of the gene coding for peptidylprolyl isomerase A (ppiA). The primer pairs used, as well as their hybridization temperatures, are presented below in Table 13 below:

[0189] [Tables 13] Gene« Primers (5'-3')« Size-of-i'ampiicon-(pb)» Tm-(°C^U trpvte ppia* sense-r-TGATGCGGCTCATCAGTGCCAGC-(SEQIDNO-200H 251o 58« antisense: -G 1AGAAG 1GGCC 1AGC1CC 1 CG (SEQ-fD-NO-201)n sense-: TGCTGACTGTGGACAACTCG (SEQ IDNO-202)^ antisense:TGCAGCGAGAGCACAAAGAT- (SEQ-ID-NO-203)o 136« 60 k

[0190] The fermentate samples were contacted with Caco-2 cells and variations in trpvô gene expression were then studied by qPCR.

[0191] The fermentates obtained with the VF45A and VFH049 strains are capable of positively modulating gene expression. More specifically, the fermentate produced by the VFH049 strain results in overexpression of the gene 20 times higher than the control ([Fig.7]). The effect of the ultrafiltered fermentates is less pronounced, not significant even if a tendency towards gene induction is clearly visible for both strains ([Fig.8]). The fermentates produced by the two strains are therefore capable of modulating both calcium incorporation and trpvô expression compared to unfermented milk. Study of probiotic characteristics

[0192] The significance of the results is assessed by a one-way analysis of variance (ANOVA) followed by a Tukey test for multiple comparison of means. Concerning the calcium transport experiment across a Caco-2 cell membrane, the post-ANOVA test is a Dunn test resulting in a comparison with the mean of the control condition. The difference between the means is considered significant for a p value < 0.05. Statistical tests have were conducted using R software (R core team, 2016, Vienna, Austria), using the R Commander package. Acid tolerance test

[0193] The principle of this test is based on the comparison of the survival of a bacterial strain between a 2-hour incubation at pH 2 and an incubation at the pH of the MRS medium (pH 6.2). For this experiment, each strain in the collection was cultured in liquid MRS medium for 24 hours at 37°C under anaerobic conditions. A volume of 200 pL of culture was then diluted (1 / 10) either in the same MRS medium at pH 6.2 (called tube A), or in an MRS medium adjusted to pH 2 with hydrochloric acid (HCl) (called tube B). Tubes A and B were incubated at 37°C for 2 hours and then 10 pL of each tube were spread on MRS agar. The inoculated dishes were incubated for 48 hours at 37°C under anaerobic conditions.

[0194] Acidity tolerance was assessed by comparing the colony numbers between plates A and B. The strains were divided into different acidity tolerance classes according to the result of the B / A ratio. Class 0 includes strains that are not acid-tolerant (no colonies on plate B). Class 1 corresponds to strains with low acidity tolerance (plate B = 0 to 30% of the colonies on plate A). Class 2 includes strains with moderate acidity tolerance (plate B = 30 to 80% of the colonies on plate A). Finally, class 3 corresponds to strains that are acid-tolerant (plate B has more than 80% of the colonies on plate A).

[0195] The strains were divided into 4 tolerance classes ranging from class 0 (non-tolerant strains) to class 3 (tolerant strains).

[0196] Determination of the parietal hydrophobicity of strains

[0197] The objective of this test is to evaluate the hydrophobic character of the cell wall of the different strains. A simple test has already been developed to evaluate this criterion, it is the MATS (Microbial Adhesion To Solvents) test. It consists of measuring the affection of a bacterial strain for an apolar hydrocarbon (most often n-hexadecane) in order to estimate the hydrophobicity of the cell wall. For the experiment, the strains of the collection were cultivated in liquid MRS medium for 24 hours at 37°C in anaerobic conditions. The cells are then washed twice by successively repeating a centrifugation step at 10,000 rpm for 10 min, followed by a step of resuspension of the cells in a Phosphate Buffered Saline (PBS) buffer pH 7.4. Optical Density (OD at 630 nm (initial OD630nm)) was determined using an ELx8O8 spectrophotometer (BioTek Instruments Inc., Vermont, USA).A volume of 1 mL of suspension was then mixed with 100 pL of n-hexadecane (Acros Organics, Geel, Belgium) by vortexing the mixture for 1 min. The solution was then allowed to stand at room temperature for 15 min and then 100 pL of the aqueous phase was added. were recovered for a new determination of the OD at 630 nm (final OD63onm). The wall hydrophobicity of the strains was calculated according to the following formula:

[0198] [Math.l] zD£JS3ûf;w initial - %rf = -----::::--------IX lùù^

[0199] With %H: the percentage of parietal hydrophobicity, initial D063onm: the initial OD of the suspension and final D063onm: the OD measured after addition and mixing of the suspension with n-hexadecane.

[0200] The results of the acidity resistance and parietal hydrophobicity tests are shown in [Fig.9] which represents the percentages of parietal hydrophobicity obtained for the strains tested according to their acidity tolerance class. In [Fig.9], we note that the VF50b strain does not tolerate acidity, which is not the case for the VFH049 strain. Self-aggregation test

[0201] This test allows to evaluate the capacity of strains to aggregate with each other in a liquid medium. It is based on the comparison of the bacterial concentration above a suspension at time 0 with the bacterial concentration of the same suspension incubated for a given time without any agitation. Strains capable of strong self-aggregation will aggregate with each other, thus increasing their sedimentation rate. The strains are cultured in MRS for 24 hours at 37°C then washed and re-suspended in PBS buffer at an OD at 600 nm of 1. A volume of 4 mL of suspension is agitated to form a vortex for 10 sec and then incubated at room temperature without agitation. After 2.5 and 5 hours of incubation, 100 pL of medium are carefully taken from the surface of the suspension. The collected samples are then diluted (1 / 10) in PBS buffer for measurement of the OD at 600 nm.The percentage of self-aggregation of the strains (%A) is then calculated according to the relationship: .

[0202] [Math.2] = i - — 1 x X -'AV

[0203] With A0: the initial absorbance at 600 nm of the suspension, measured at the start of the experiment (and equal to 1) and At: the absorbance at 600 nm measured at 2.5 or 5 hours of incubation. The % aggregation of strain VFH049 is 5.38% ± 5.24 after 2.5 hours and 67.44% ± 6.99 after 5 hours. For strain VF50b, the % aggregation is 33.33% ± 14.8 after 2.5 hours and 66.67% ± 17.97 after 5 hours. The strains are therefore able to adhere to intestinal cells.

[0204] Evaluation of tolerance to gastrointestinal digestion

[0205] In order to evaluate the survival of the strains during and after their passage through the digestive tract, a static digestion model was used (Belguesmia et al. 2016). This model simulates the 3 main compartments of the digestive tract, namely the mouth, the stomach and the intestine sequentially. Each compartment is simulated by the addition of a fluid mimicking the physiological conditions of this stage. The entire digestion is carried out under sterile conditions, all fluids are autoclaved at 121°C for 20 min before the experiment, the addition of enzymes takes place after sterilization and is followed by sterilizing filtration (at 0.2 μm). The strains are cultured in MRS medium for 24 hours at 37°C. The bacterial cells are washed twice and then re-suspended in PBS buffer at a concentration of 109 CFU / mL. For digestion, the buccal phase is simulated by the addition of 8 mL of PBS, adjusted to pH 6.8, to 1 mL of the bacterial suspension.The mixture is incubated with constant stirring at 200 rpm for 5 min at 37°C. The gastric phase is simulated by adding 12 mL of PBS at pH 3 supplemented with bovine pepsin (Sigma-Aldrich, St Louis, USA) at 1.56 mg / mL. The suspension is incubated for 2 h at 37°C with stirring at 200 rpm. During incubation, the pH of the solution is maintained between 3 and 3.5 by the addition of hydrochloric acid (HCl) (1 M) or sodium hydroxide (NaOH) (1 M). For the intestinal phase, 1 mL of 1 M sodium carbonate (NaHCO3) is added to the mixture to raise the pH to approximately 7 and inactivate the pepsin. A volume of 12 mL of PBS at pH 8.2 supplemented with bovine pancreatic enzymes (Sigma-Aldrich, St Louis, USA) at 0.28 mg / mL, then a volume of 6 mL of PBS at pH 8.1 containing 60 g / L of Ox-bile (Sigma-Aldrich, St Louis, USA) are added to the mixture to simulate intestinal conditions.This step takes place for 2 hours at 37°C with stirring at 200 rpm while maintaining the pH between 7 and 7.5. At the end of each digestion step, a sample of 100 pL of the reaction mixture is taken, thus for the same digestion, 4 samples are obtained including the sample of the mother tube (TM), the salivary phase (S), the gastric phase after 2 hours of incubation (G2), and finally that after 2 hours of intestinal phase (12). Each sample is then diluted (1 / 10) successively in PBS buffer. To determine the bacterial concentration in the samples, 100 pL of the appropriate dilutions are spread on MRS agar. The seeded plates are then incubated at 37°C for 48 hours in anaerobic conditions. After incubation, the CFU count allows the determination of the bacterial concentration in the samples. The results are expressed in CFU / mL. The initial number of viable bacterial cells is 109 CFU / mL in the salivary phase.During the DGI, the quantity of bacteria decreases more or less depending on the strains, the gastric phase being the most deleterious for all strains. At the end of this phase, the VFH049 strain is present in a quantity. of 107.8 CFU / mL while strain VF50b is present in an amount equal to 107.2 CFU / mL. Strains VFH049 and VF50b therefore tolerate gastrointestinal digestion. Cytotoxicity test

[0206] The aim of this test is to evaluate the possible toxicity of the strains with respect to the intestinal barrier. Caco-2 and HT-29 MTX cells are used for this purpose.

[0207] For the cytotoxicity test, the cells are seeded in 96-well plates at a density of 8,000 cells per well in a volume of 150 pL of medium and cultured for 7 days at 37°C, 5% CO2. Before adding the bacterial strains, the intestinal cells are washed twice with PBS buffer. The bacterial strains are cultured as described above and suspended in DMEM medium without addition at a concentration of 107 CFU / mL. For each well, 150 pL of bacterial suspension is added. PBS buffer, diluted with DMEM without addition as for the strains, is used as a negative control. Contact between the bacterial strains and the intestinal cells takes place for 24 h at 37°C, 5% CO2. The strains are contacted with both Caco-2 cells and HT-29 MTX cells independently.The determination of intestinal cell mortality is used here to assess the possible toxicity of bacterial strains. Cell mortality is assessed by assaying lactate dehydrogenase (LDH) activity. This activity is assayed by the LDH activity assay kit (Sigma-Aldrich, St Louis, USA). This kit is based on the reduction reaction of oxidized Nicotinamide Adenine Dinucleotide (NAD) to its reduced form (NADH) by lactate dehydrogenase, NADH being detectable at 450 nm. After contact, 50 pL of supernatant is collected from each well and LDH activity is assayed following the kit protocol. The absorbance of the plate is read at 450 nm by a Xenius XC spectrofluorimeter (Safas Monaco, Monaco, France). Intestinal cell mortality is calculated as a percentage of the mean absorbance of the control condition (the proportion of LDH released under this condition is taken as 100% reference).For strains VFH049 and VF50b, the results show an absence of significant toxicity towards both cell lines, suggesting that under these experimental conditions, the selected bacterial strains are not deleterious to intestinal cells.

[0208] Evaluation of strain adhesion to intestinal cells

[0209] The objective of this test is to evaluate the ability of strains to adhere to intestinal cells. It is based on the comparison between the quantity of bacterial cells adhering to the Caco-2 cell monolayer compared to the quantity of bacteria initially added. The strains are cultured and prepared as described previously, a suspension in DMEM medium without addition is prepared at a concentration of 107 CFU / mL. Caco-2 cells are seeded in 24-well plates at a concentration of 40,000 cells per well in a volume of 500 pL of complete DMEM. After incubation for 7 days at 37°C, 5% CO2, the cells are washed twice with PBS buffer. A volume of 300 pL of bacterial suspension is added to each well, the plate is then incubated at 37°C, 5% CO2, for 2 hours. The used bacterial suspension is kept for determination of the CFU concentration. After 2 hours of contact, the Caco-2 cells are washed twice with PBS buffer to remove non-adherent bacteria. The intestinal cells are then lysed by the addition of 100 pL of PBS buffer supplemented with 0.1% (v / v) Triton X-100. After incubation for 15 min at room temperature, the lysate and the stock suspension used are successively diluted (1 / 10) in PBS, then spread on MRS agar.The seeded plates are incubated for 48 hours at 37°C under anaerobic conditions. After counting and determining the bacterial concentration in CFU / mL, the percentage of adherent bacterial cells is calculated relative to the concentration obtained in the stock suspension representing the quantity of bacteria added at the beginning of the experiment (set at 100%). The % of cells adherent to Caco-2 cells is 1.48 ± 0.41 for strain VFH049 and 0.18 ± 0.13 for strain VF50b. Strain VFH049 is much more adherent to intestinal cells, which tends to indicate that it is more likely to have a probiotic action.

[0210] Biological activities of the strains on calcium absorption

[0211] General protocol for contact between bacterial strains and intestinal cells

[0212] This contact protocol is used for each technique employed in this section. The bacterial strains are cultured in MRS for 24 hours at 37°C under anaerobic conditions. The cells are recovered by centrifugation at 10,000 rpm for 10 min and then re-suspended in PBS buffer; this step is repeated a second time to wash the bacterial cells. A bacterial suspension is finally prepared with DMEM medium without addition at a concentration of 107 CFU / mL.

[0213] HT-29 MTX cells are seeded in 24-well plates at a concentration of 40,000 cells per well in a volume of 500 pL of complete DMEM. Caco-2 cells are seeded in 96-well plates at a concentration of 8,000 cells per well in a volume of 200 pL of complete DMEM medium. For another experiment, Caco-2 cells are seeded on inserts placed in 12-well plates (polyester membrane, 0.4 μm, Costar®, Corning, New York, USA) apical side in a volume of 500 pL of complete DMEM medium, a volume of 1,500 pL of this same medium is added to the basal side of the insert. All cell cultures are cultured for 15 days with a medium renewal every 2 days during the second week of culture. The intestinal cells are washed twice with PBS buffer before contact with the bacterial strains. A volume of 150 pL of bacterial suspension is added to each well for a 96-well plate culture, and a volume of 300 pL is added for contact in a 24-well plate or in inserts on a 12-well plate. In all cases, contact takes place for 24 h at 37°C, 5% CO2. The negative control used is a PBS buffer diluted in complete DMEM medium. Measurement of total calcium transport

[0214] Total calcium transport is defined as the portion of calcium passing from the apical pole to the basal pole across the epithelial barrier. This transport is assessed by the variation of calcium concentration at the basal pole of the cell barrier over time. Caco-2 cells cultured in 12-well plate inserts are used for this experiment. At the beginning of contact with the bacterial strains (t = Oh), 10 pL of a 250 mM calcium chloride (CaCl2) solution is added to the apical side of the insert. During contact, 100 pL samples are taken from the basal side of the insert at 30 min, 7 and 24 h of contact. The samples are stored at -20°C until analysis. At the time of the different samples, a measurement of the transepithelial electrical resistance (TEER) is carried out to verify the integrity of the Caco-2 cell barrier.This resistance is measured by a MilliCell Electrical Resistance System voltmeter / ohmmeter (Merck Millipore, Burlington, USA). An empty insert without cells is used as a blank to obtain the cell barrier resistance. The resistance (in Q) measured for each well is then multiplied by the area of ​​the insert (equal to 1.12 cm2 for the insert used) to give a resistance in Q.cm2. The results are expressed as a percentage of the value obtained at 30 min of contact (set at 100%) for each well. In order to measure total calcium transport, a calcium concentration assay is performed in samples taken from the basal pole of the Caco-2 cell membrane during contact. The calcium concentration determination is performed using the calcium colorimetry assay kit (Sigma-Aldrich, St Louis, USA).This kit is based on the colorimetric reaction between calcium ions and ortho-cresolphthalein forming a colored complex that can be detected at 575 nm. The assay is performed using 25 pL of samples diluted (1 / 2) in H2O Milli-Q®, following the kit protocol. The absorbance of the samples at 575 nm is measured using a Xenius XC spectrofluorimeter (Safas Monaco, Monaco, France). The calcium concentration in the samples is determined using a standard range of CaCl2, and is then expressed in . function of the ratio of the concentration at time t to the concentration at time t = 30 min of contact.

[0215] The results show that the TEER increases over the incubation time with the strains as well as in the control condition (PBS buffer). Thus, for the VFH049 strain, the TEER increases from 100% at t=0 to 245% after 24 hours in a quasi-linear manner. For the VF50b strain, the TEER increases from 100% at t=0 to 231% after 24 hours in a quasi-linear manner. Furthermore, it is noted that the strains of the invention do not allow significant modulation of absorption after 7 hours of contact compared to the PBS buffer. However, after 24 hours of incubation, the calcium concentration decreases in the basal compartment for the control condition, while a significant increase in the amount of calcium is observed for the VFH049 and VF50b strains. Thus, for the VFH049 strain, the concentration ratio at t=2h / concentration at t=0 reaches the value of 1.08 while for the VF50b strain, the same ratio is 1.05.

[0216] Study of the expression of different genes involved in calcium and vitamin D metabolism

[0217] In this section, changes in the expression of several genes after 24-hour contact between bacterial strains and HT-29 MTX cells were studied. Contact took place in a 24-well plate as previously described. After contact, HT-29 MTX cells were rinsed twice with PBS buffer. RNA extraction was then performed using TRIzol™ reagent (Sigma-Aldrich, St Louis, USA). RNA samples were first treated with DNase to remove any co-extracted and / or remaining DNA fragments following extraction. A volume of 8 μL containing 1,000 ng of RNA was mixed with 1 μL of DNase, and 1 μL of DNase buffer (ThermoScientific, Waltham, USA). The reaction takes place at 37°C for 30 min in a Mastercycler gradient thermocycler (Eppendorf, Hamburg, Germany), it is stopped by the addition of 1 pL of 50 mM EDTA solution (ThermoScientific, Waltham, USA) followed by incubation at 65°C for 10 min.Subsequently, the samples were reverse transcribed into cDNA using the RevertAid H minus first strand cDNA synthesis kit (ThermoScientific, Waltham, USA), according to the provided instructions. For the qPCR reaction, the cDNA samples were diluted (1 / 16) in H2O. For a 2 pL sample volume, 18 pL of qPCR mix was added containing 10 pL of Power SYBR® Green PCR Master Mix (2x) (Applied Biosystems, Life Technologies, Foster City, USA), 0.6 pL of each primer (10 pM) and 6.8 pL of H2O. Fluorescence was monitored during the reaction in a CFX Connect Real Time Detection System thermocycler (Bio-Rad, Hercules, USA). After a denaturation step at 95°C for 10 min, 40 PCR cycles are carried out successively, one cycle includes denaturation at 95°C for 15 min. dry, hybridization from 58 to 61°C depending on the primer pair used for 30 sec and elongation at 72°C for 30 sec. The creation of a melting curve completes the reaction. In this part, 4 genes are studied, it is a gene coding for Claudin 2 ((77-2), involved in tight junctions and acting as a channel for the passage of calcium. The gene coding for the vitamin D receptor (vdr) and finally the gene coding for the calcium transporter (trpvôY The expression of these genes is normalized compared to that of the gene coding for peptidylprolyl isomerase A (ppiA) taken as reference. The primer pairs used for the genes studied, as well as their hybridization temperatures, are presented in the table below:

[0218] [Tables 14] :• fæa SDîm SW 707^ • jxea m • asm e&W» »! J'f'W-15 « 5 -^kQ JD NO 2"s

[0219] The results are shown in [Fig. 10]. The expression of the gene coding for the vitamin D receptor (vdr) is significantly increased in the presence of strain VF50b; it is increased by 1.8 times compared to the PBS buffer. Regarding strain VFH049, it causes an increase in the expression of the gene coding for the calcium transporter (trpvô) of at least 3 times higher than the control. Strain VF50b is the only strain causing a 2.8 times higher increase in expression of the cld-2 gene compared to the PBS buffer. Fermentation capacity of strain VF50b

[0220] The growth and acidification properties of strain VF50b are superior to those of other strains of the same species, making it a particularly interesting for artisanal or industrial production of fermented dairy products (use as a fermentation starter).

[0221] Table 15 below compares the properties of the VF50b strain with those of other strains of the same species (tests carried out with cow's milk):

[0222] [Tables 15] Strain» Final-concentration-in-fermentation-pro^ (ODsoû)** Acidification- (pH)» VF50b» 0.973« 4.51« ï Strain As 0.473» 4.68» ï Strain-B» 0.825» 4.64»

[0223] Greater growth (higher optical density) and more efficient acidification (lower pH) are observed.

[0224] The VF50b strain can be used for the manufacture of yogurt, for example.

[0225] It is within the reach of those skilled in the art to envisage the study of reverse peptides and dextrorotatory peptides corresponding to the sequences of the peptides of the invention in order to determine whether these peptides have an effect on ACE and / or calcium absorption.

Claims

Claims

1. Strain of Lactobacillus delbrueckii ssp. b ulgaricus VF50b deposited at the CNCM under the accession number CNCM-I-5316 and its mutants and variants having at least 80% identity, preferably at least 90% identity, preferably at least 95% identity with the genome of said strain VF50b and capable of producing at least one peptide corresponding to the sequences SEQ ID 87 to SEQ ID NO 199 and / or capable of reducing by anaerobic fermentation the pH of milk, in particular cow's milk, to a value substantially equal to or less than 4.55 and in particular equal to 4.51 after 48 hours at 37°C and / or capable of increasing the intestinal absorption of calcium.

2. Strain according to claim 1 for its use as a medicament, in particular as a medicament in the treatment of hypocalcemia or a pathology caused by a deficiency in calcium absorption and in particular chosen from arterial hypertension, metabolic syndrome, osteoporosis or for the treatment of hypocalcemia induced by a pathology chosen from autoimmune hypoparathyroidism, vitamin-D dependent hypocalcemic rickets, progressive bone heteroplasia, isolated hypoparathyroidism, syndromic hypoparathyroidism, pseudohypoparathyroidism and hypo-deficiency rickets, diseases caused by an anomaly in the regulation of calcemia due to the dysfunction of parathyroid hormone, of vitamin D absorption or of the functioning of the calcium receptor, in a subject, in particular a mammal and particularly a human having such a need.

3. Food or pharmaceutical composition characterized in that it contains at least one pharmaceutically acceptable excipient or a medium suitable for being ingested and as active ingredient, at least one strain according to claim 1 or 2

4. Food or pharmaceutical composition according to claim 3, characterized in that it comprises or is constituted by the fermentate obtained by anaerobic fermentation of cow's milk, optionally skimmed using a strain according to claim 1 or 2, said fermentate having optionally undergone ultrafiltration at a cut-off threshold of 10 kDa or in that it contains or is constituted by the fermentate obtained by anaerobic fermentation and optionally after ultrafiltration at a cut-off threshold of 10kDa of a protein substrate chosen from protein substrates of plant origin originating from at least one cereal and / or at least one pea and / or at least one mushroom and / or at least one nut, mixtures of at least two protein substrates of plant origin, milks which may be thermally sterilized and / or at least partially skimmed, in particular cow's, goat's or sheep's milk, with the exception of yak's milk for said fermentate not ultrafiltered at a cut-off threshold of 10kDa, mixtures of at least two milks and mixtures of at least one protein substrate of plant origin and at least one milk of animal origin.

5. Food or pharmaceutical composition according to claim 3 or 4, characterized in that it contains a concentration of at least one of said strains and preferably of one of said strains, in particular the strain Lactobacillus delbrueckii ssp. b ulgaricus VF50b equal to or greater than 107 CFU per gram.

6. Product chosen in particular from food products, in particular fermented milks, fruit juices and / or vegetable juices, fermented vegetables and / or fruits, fermented mushrooms, charcuterie, food preparations based on fish(es) and dairy products obtained from milk, possibly skimmed, in particular from cow, goat, sheep with the exception of yak milk, or from a mixture of milks, characterized in that it contains at least one strain according to claim 1 and / or a food or pharmaceutical composition according to one of claims 3 to 5.

7. Food supplement suitable for a subject, in particular a human or an animal chosen in particular from cats, dogs, poultry, sheep, goats, cattle, reptiles, in particular iguanas, characterized in that it comprises at least one strain according to claim 1 and / or a food or pharmaceutical composition according to one of claims 3 to 5.

Images