METHOD FOR DETECTING THE PRESENCE OF A PATHOGENE AND DETERMINING ITS CHARACTERISTICS IN HUMAN AND ANIMAL HEALTH

Abstract

The invention relates to the field of diagnostics for the detection of pathogens in human and animal health. More specifically, it concerns a method for detecting the presence of a pathogen and determining its virulence and resistance characteristics to treatments for appropriate management. It also relates to a ready-to-use diagnostic kit for implementing the method.

Description

Title of the invention: METHOD FOR DETECTING THE PRESENCE OF A PATHOGEN AND DETERMINING ITS HUMAN AND ANIMAL HEALTH CHARACTERISTICS

[0001] The invention relates to the field of diagnosis for the detection of pathogens in human and animal health. More particularly, it relates to a method for detecting the presence of a pathogen and determining its virulence characteristics and resistance to treatments for appropriate management. It also relates to a ready-to-use diagnostic kit for implementing the method. Field of invention

[0002] Being able to simply and quickly diagnose the presence of a pathogen in human or animal health is a major public health issue. The need is supported by the emergence of new infections such as that caused by SARS-Cov2.

[0003] Diagnostic tools are valuable aids for the identification of infectious diseases but also for their monitoring: propagation, appearance of new variants, evolution of variants,

[0004] The state of the art teaches numerous methods for detecting the presence of pathogens using the PCR method. However, the reliability of these methods can be uncertain depending on the detection method used. Indeed, when carrying out a conventional PCR method, polymers can form, resulting from poor pairing of the primer sequences and the targeted DNA sequences. The formation of these polymers, in particular dimers, plays a determining role in the reliability of the results obtained when revealing the amplified sequences. The presence of polymerizations in fact leads to false positives, in particular if the revelation is done on an immunological strip. The neutralization of these polymers is therefore essential to obtaining reliable results.

[0005] To limit the formation of these polymers, the state of the art offers different solutions.

[0006] Document WO2006112818A2 describes a method reducing dimer formation by adding modified nucleobases to the 3' end of primers. The document provides polynucleotides comprising at least one modified pyrimidine nucleobases and no more than 4 nucleotides at the 3' end of the polynucleotide.

[0007] Document EP2814976 B1 proposes a method for reducing the non-specific formation of dimeric or polymeric nucleic acid in which the 2-amino- deoxyadenosine (2-amino-dA), 2-thio-deoxythymidine (2-thio-dT) or other nucleotide analogs of interest are incorporated into the random hexamers used for amplification of the target nucleic acid.

[0008] Although functional, the known methods of the state of the art are imperfect. Indeed, they propose the design of specific Single Nucleotide Polymorphism (SNP) primers by a PCR method with additions of nucleo-bases, which is more complex, a certain level of technicality and requires more time.

[0009] One of the detection methods already known from the state of the art is that using recombinase polymerase amplification which makes it possible to highlight the presence of a specific marker characterizing a bio-aggressor of a plant (also known as Flashdiag). This method is characterized by: the collection of a piece of leaf showing a symptom, the extraction of the DNA from the sample by grinding and filtration steps, the sample is then placed in a tube containing the probes and primers necessary for detection and the mixture undergoes amplification by recombinase polymerase, finally, to reveal the results, an immunological strip is placed in the mix tube, with the PCR reagents including specific 3' and 5' DNA primers.

[0010] There is a real need for new diagnostic tools intended for the health field which allow rapid, reliable detections, which are easy to use and accessible to the greatest number in order to democratize this use. Presentation of the invention

[0011] The invention relates to a method for diagnosing the presence of at least one pathogen infecting humans or animals. It also makes it possible to determine the characteristics of interest associated with the detected pathogens such as a genetic variation associated with a modification of the behavior of the pathogen, resistance to a treatment, multi-resistance.

[0012] The method according to the invention comprises providing a biological sample from an individual suspected of being infected, extracting the DNA or RNA from said sample, amplifying by PCR or RT-PCR DNA or RNA sequences of the pathogen to determine i) the presence of the latter using a pair of specific primers making it possible to amplify a sequence characteristic of this pathogen, ii) the possible presence of at least one genetic variation associated with a modification of the behavior of the pathogen, or responsible for resistance to a treatment, this amplification being carried out in the presence of interfering DNA complementary to the parts of the primers capable of forming polymers between them in order to avoid the formation of non-specific bands on the strips immunological tests responsible for false positives; the revelation of the presence of said pathogen and possibly of resistance of the latter is carried out on immunological strips (for example nitrocellulose DAS-ELISA type). In a preferred embodiment of the invention, a restriction enzyme is added to the sample after extraction and before amplification so as to eliminate the wild-type copy of the codon corresponding to the codon carrying the mutation sought to avoid the amplification of non-specific sequences which would give false positives.

[0013] The invention also relates to a kit for detecting the presence of a pathogen and determining its characteristics of interest, suitable for use outside the laboratory (in the field, for example in a natural environment) but also usable in the laboratory, in particular in laboratories which do not have equipment dedicated to molecular diagnosis. Advantage of the invention

[0014] The present invention meets a need in the medical world by proposing a rapid, reliable and easy-to-interpret diagnostic method making it possible to both highlight the presence of a pathogen and characterize the latter in terms of the existence of a genetic variation associated with a modification of the behavior of the pathogen or resistance to a treatment. This method is based on amplification by quantitative PCR which can be carried out using a portable “point-of-care” type device and detection on immunological strips.

[0015] PCR amplification allows rapid and efficient determination of a pathogen and a genetic mutation / variation of interest. The DNA or RNA extract from the sample is directly introduced into a mixture containing primers specific to the pathogen and others specific to other mutations of interest and the whole is subjected to a PCR or RT-PCR amplification step followed by the revelation of the results using an immunological strip. The results are obtained by detection via antibodies fixed on the strip of an antigenic marker fixed to the end of the amplified primers. This method does not require any DNA or RNA probe and allows a simple and rapid sequence of steps.

[0016] During a PCR, the primers used in the mixture can form polymers. As a general rule and when reading on gel, this only induces a loss of efficiency of the system, more or less significant depending on the polymer formed. On the other hand, when the technology uses immunological strip revelation, this also induces the formation of "false positives". Indeed, the strip is capable of detecting a polymer, if it has the two necessary antigenic markers at each end of the dimer or polymer formed. In this case, a band will light up while the sample is negative.

[0017] Thus, to avoid the appearance of false positives and increase the reliability of the method, the inventors have unexpectedly demonstrated that the addition of interfering DNA acts significantly on the formation of polymers between primers, thus avoiding the appearance of aspecific bands responsible for false positives. Contrary to what the prior art teaches, the added interfering DNA is not linked here to a primer.

[0018] By using interfering DNA, it is possible to increase the number of primers present in the mixture, while being able to avoid the appearance of false positives. Thus, the invention proposes to simultaneously detect 4 markers in the same PCR reaction by using two revealing bands for 2 markers each.

[0019] In order to further increase the robustness and reliability required for an application of the method to medical diagnosis, the inventors added a step of eliminating wild-type sequences likely to be amplified in an aspecific manner by cutting the latter at the level of the wild-type codon corresponding to the codon comprising the desired mutation, thanks to the use of restriction enzymes. The restriction enzymes used are specific to the wild-type codon corresponding to the mutated codon carrying the desired mutation.

[0020] The combination of the use of restriction enzymes on the one hand and interfering DNA on the other hand, as described above, produces a result on strips for which the reliability is very high, which is expected in the health field.

[0021] This technology therefore provides access to a high-performance and reliable diagnostic tool - in the field - for effective and targeted patient care.

[0022] The kit according to the invention is easy and quick to use, with the result available in less than an hour. In addition, the kit has been designed to allow use by people without any laboratory experience, without special protective equipment and without risk to the environment or the handler (without toxic components). The result is presented in the form of strips and is easy to interpret (point of care quick diagnosis).

[0023] At the level of the medical service provided, the method according to the invention and the associated kits therefore allow: - To detect the presence of one or more pathogens, - To determine the characteristics of interest of pathogens for treatment, in particular the existence of drug resistance or multi-drug resistance, - To detect the appearance of a variant or resistance during an infection, - To set up monitoring of the development of an infection at the level of an individual or a population.

[0024] The present invention is applicable at the medical level in both humans and animals. It is suitable for use in the natural environment (field diagnosis), but also in the laboratory, particularly when the latter only has rudimentary equipment. The provision of the method in the form of a kit makes it possible to carry out diagnostics in general practitioners' offices and in pharmacies. DETAILED DESCRIPTION OF THE INVENTION

[0025] A first subject of the invention relates to a method for diagnosing the presence of a pathogen in a biological sample originating from an individual suspected of being infected, comprising the steps of:

[0026] a. Provision of said sample

[0027] b. Extraction of DNA or RNA from said sample

[0028] c. Amplification by PCR or RT-PCR of the sequences of said DNA or RNA of the pathogen to determine the presence of said pathogen using a pair of specific primers making it possible to amplify a sequence characteristic of said pathogen

[0029] d. Revelation on immunological strip of the presence of said pathogen

[0030] in which the amplification step is carried out in the presence of interfering DNA complementary to the parts of the primers capable of forming polymers between them in order to avoid the formation of non-specific bands on the immunological strips responsible for false positives.

[0031] This method makes it possible to determine whether the individual suspected of being infected by a pathogen is actually infected or whether it is another pathology. It also makes it possible to determine whether the pathogen in question has resistance to a known drug treatment or whether it carries another point mutation / genetic variation associated with a modification of the pathogen's behavior in order to guide management.

[0032] Thanks to several pairs of primers which are specific to the pathogen(s) and / or other pairs of primers specific to the main mutations responsible for one or more drug resistances or characteristics of known variants, this method offers a complete diagnosis.

[0033] The presence of interfering DNA during the amplification step makes it possible to reduce the number of false positives during strip detection. In a preferred embodiment of the invention, the extracted DNA is treated by contacting it with a restriction enzyme before amplification. This enzyme is chosen so as to cut the genomic DNA, specifically at a wild-type codon (the mutated codon being the desired target) before carrying out the PCR specifically targeting the mutated codon. (SNP). This step ensures that only the desired sequence is amplified and prevents non-specific amplifications; therefore, false positives are avoided. This reduction in false positives is crucial for veterinary and medical applications.

[0034] Since restriction enzymes are specific for DNA, the method comprising a step of using such enzymes will preferably be implemented using genomic DNA. However, it is possible to adapt this method in order to detect the presence or characteristics of a pathogen from RNA. In this particular case, a step of converting the RNA into cDNA by RT-PCR will be required before the enzymatic digestion step. The person skilled in the art knows the RT-PCR method. Furthermore, he knows how to choose the restriction enzymes adapted to the sequences that one wishes not to be amplified (i.e. the wild-type sequences to be eliminated).

[0035] The enzymatic digestion step is carried out after extraction of the DNA and can be done in a portable PCR device (point-of-care). Indeed, this just requires adding a step (incubation at a given temperature for a given time depending on the enzyme used, generally between 20 and 30 min maximum) at the beginning of the PCR program for amplification of the targeted mutations. The restriction enzyme is then inactivated at the very beginning of the PCR cycles (by raising the temperature to 95°C).

[0036] In a preferred embodiment of the invention, this method makes it possible to detect, in addition to the presence of a first pathogen, the presence of at least one other pathogen and / or to determine at least one characteristic associated with at least one of the pathogens chosen from a genetic variation associated with a modification of the behavior of the pathogen, resistance to a treatment, multi-resistance.

[0037] Thus, the method makes it possible to simultaneously obtain up to 4 results associated with the detection and / or characterization of one or more pathogens from the same amplification reaction. In such an embodiment, the revelation will be carried out using two strips which will both be impregnated in the same amplification reaction mixture.

[0038] For the purposes of the invention, the term “pathogen” means any biologically active agent responsible for symptoms in humans or animals, such as single- or double-stranded DNA viruses, bacteria or fungi.

[0039] "Interfering DNA" means small DNA sequences complementary to a part of a primer. This identified primer part can, during poor pairing during amplification, form polymers with the other primers. This then creates false positives when revealing the results on the strips. Thanks to total complementarity to the corresponding primer part, the interfering DNA sequence will compete with the other primers and prevent the polymer formation by avoiding pairing between them. These sequences are short, generally less than 15 nucleotides, for example around ten nucleotides. The concentration of these interfering DNAs and the interfering DNA / primer ratio must be adapted so as not to harm the efficiency of the PCR.

[0040] By "genetic variation associated with a modification of the behavior of the pathogen" within the meaning of the invention, we mean a point mutation or SNP, which induces modifications in virulence (infectious capacity, aggressiveness).

[0041] By "characteristics of interest" of a pathogen is meant any characteristic making it possible to direct, adapt a treatment or monitor the evolution of an infection at the level of an individual or a population. The characteristics of interest include genetic variations associated with a modification of the behavior of the pathogen, but also the characteristics of resistance or multiresistance to a drug or drug cocktail.

[0042] In a preferred embodiment, the duplex format, i.e. four results (2 bands) on the same strip, the detection on the strip is carried out using: a. The presence of antibodies fixed on the strip and forming two distinct bands, each band consisting of antibodies specific to a particular antigenic marker b. the presence of a specific antigenic marker at the 5' end of one of the sense or antisense primers and the presence of an antigenic marker common to all pairs of primers at the 5' end of the other primer, said markers being recognized by an antibody specific to one of the bands of the strip c. antibodies capable of binding to the antigenic marker common to all primer pairs and carrying a revelation system.

[0043] In a particular embodiment, two bands of a strip make it possible to reveal respectively (i) the presence of a first pathogen in the sample, and (ii) the presence of a second pathogen or the existence of resistance of the latter to drugs or another characteristic of interest.

[0044] It is possible to use a second strip with a second amplification mixture to reveal two or more other markers chosen from the presence of a second pathogen or the existence of resistance of the latter to drugs or another characteristic of interest.

[0045] Strip revelation makes it possible to simultaneously obtain two or more results arranged on two bands, the third band being a control band attesting that the migration was carried out correctly. The two “results” bands can give simple information (for example: presence or absence of a pathogen) or complex information (resistance to a drug without allowing distinction between several resistances revealed simultaneously by the strip). Different markers can thus be combined on the same strip giving an overall result.

[0046] The antigenic markers can be chosen from markers well known to those skilled in the art such as biotin, digoxigenin, FAM, etc. Alternatively, the revelation system can be based on ligands such as the biotin-steptavidin system.

[0047] A second subject of the invention relates to a kit for detecting the presence of a pathogen or its characteristics of interest suitable for use in the field comprising: • A lyophilized PCR reaction mixture comprising: - a pair of specific primers allowing the amplification of a sequence characteristic of said pathogen - interfering DNAs complementary to the parts of the primers capable of forming polymers between them - a polymerase amplification enzyme - at least one restriction enzyme capable of cutting the DNA of said pathogen specifically at at least one wild-type codon corresponding to the codon carrying at least one of the mutations sought • At least one immunological detection strip to reveal the presence of said pathogen.

[0048] In order to provide a more complete diagnosis, in a preferred embodiment of the invention the kit also comprises at least one other pair of primers making it possible either to detect the presence of another pathogen, or to determine at least one characteristic of interest associated with a pathogen chosen from a genetic variation associated with a modification of the behavior of the pathogen, resistance to a treatment, multi-resistance.

[0049] In a particular embodiment, the kit makes it possible to detect the presence of a pathogen and the characterization of a genetic variation associated with a modification of the behavior of the pathogen, resistance to a treatment, multi-resistance; in this kit, the PCR mixture comprises, in addition to the pair of specific primers making it possible to amplify a sequence characteristic of said pathogen and interfering DNAs, one or more pairs of specific primers making it possible to amplify at least one mutation responsible for a modification of the behavior of the pathogen, resistance to a treatment or multi-resistance. In this configuration, the strip comprises a migration control band and two distinct bands formed by the fixation of antibodies specific for a particular antigenic marker, namely respectively: • an antibody / ligand specific to an antigenic marker located at the 5' end of one of the primers allowing the amplification of a specific sequence of the pathogen, • an antibody / ligand specific to an antigenic marker located at the 5' end of one of the primers allowing the amplification of a sequence specific to a characteristic of interest • an antibody specific to an antigenic marker common to the 3' ends of the different amplification products allowing the bands to be revealed.

[0050] The revelation of the bands is based on the presence of a marker at the 3' end of each amplification product. This marker present at the 3' end of the primers is amplified with the sequence of interest and is found at the 3' position of the amplification product.

[0051] The kit may comprise 1 immunological strip to be used to reveal 2 or more results from the same amplification. Beyond two results, several markers are associated on the same strip. These results are chosen from the detection of the presence of at least one pathogen and the determination of at least one characteristic of interest associated with a pathogen. This type of kit comprising several markers is efficient and very informative for the user, while having a limited cost due to the fact that these results are obtained in a single operation. The use of interfering DNA is particularly crucial to avoid the appearance of false positives linked to the complexity of the PCR mixture (high number of primers). In addition, the use of restriction enzymes specific to wild-type codons corresponding to the codons carrying the desired mutations makes it possible to optimize the elimination of false positives.

[0052] The revealing strip, in duplex format, comprises three distinct bands formed by the fixation of antibodies specific to a particular antigenic marker, namely respectively: - an antibody / ligand specific to an antigenic marker located at the 5' end of one of the primers allowing the amplification of a specific sequence of the pathogen - an antibody / ligand specific to an antigenic marker located at the 5' end of one of the primers allowing the amplification of a sequence specific to resistance or multi-resistance to a treatment or another characteristic of interest. - an antibody specific to an antigenic marker located at the 3' end of the different amplification products allowing the bands to be revealed.

[0053] The invention also relates to a method for detecting in the field the presence of a pathogen in a biological sample originating from an individual suspected of being infected and possibly the presence of another pathogen or determination of a characteristic of interest of a pathogen using a kit as defined previously, and comprising the following steps:

[0054] A) Provision of a biological sample likely to contain a pathogen,

[0055] B) Extraction of DNA or RNA from said sample

[0056] C) Introduction of the extracted DNA into a tube containing said PCR mixture lyophilized and at least one restriction enzyme.

[0057] D) Carrying out amplification by PCR

[0058] E) Introduction of one or two immunological strip(s) for impregnation into the tube containing the amplicons to reveal whether the pathogen is present and possibly whether a second pathogen is present or whether the pathogen presents a characteristic of interest.

[0059] In a preferred embodiment of the invention, this diagnostic method comprises an additional step of digesting the DNA with a restriction enzyme specific to the codons of the wild-type sequences corresponding to the codon of the mutated sequence sought to eliminate false positives.

[0060] This diagnostic method can be adapted to suit medical needs. In the medical field, some examples of diseases of interest are Lyme disease, covid-19, and any other disease of viral, bacterial or fungal origin. In the veterinary field, swine fever can be cited as a non-limiting example. BRIEF DESCRIPTION OF THE FIGURES

[0061] [Fig. 1] [Fig. 1]: Schematic representation of the steps of the method for detecting a bio-aggressor in a plant sample.

[0062] [Fig.2] [Fig.2]: General principle of immunological strip revelation. EXAMPLES

[0063] EXAMPLE 1: Example of implementation of the non-health method: application to the detection and characterization of strains of the pathogen Zymo-septoria tritici with revelation of two markers

[0064] The present invention is illustrated using the following example which presents an embodiment which, although outside the scope of the invention, describes the principles of the method for the detection and characterization of strains of the pathogen Zymo-septoria tritici.

[0065] A synthetic representation of the steps of the method is presented in [Fig.l].

[0066] Amplification of the specific sequences of the pathogen Zymo-Septoria tritici in straw cereals such as soft wheat, barley and durum wheat, is carried out by the PCR method. The person skilled in the art is familiar with this method. The elements Specific primers developed within the framework of the present invention are the primers and interfering DNAs described below.

[0067] For the amplification of the pathogen Zymo-Septoria tritici: - Sense primer SEP_F1: 5'- [5' Digoxigenin] GCCTTCCTACCCCACCATGT -3' (SEQ ID NO.l) Antisense primer SEP_R1: 5'- [5' 6-FAM] CCTGAATCGCGCATCGTTA -3' (SEQ ID NO.2)

[0068] For the amplification of a mutation inducing resistance to MDR type fungicides: - Non-specific MDR1 forward primer for multi-drug resistance: 5'-[5'BiotinTEG]TACGAGACGAGAAAAAAGACAG -3' (SEQ ID NO.3) - MDR2 antisense primer specific for multidrug resistance 1: 5'- [5' 6-FAM]GTCCTAATCGGGTAAAAGA -3' (SEQ ID NO.4) - MDR3 antisense primer specific for multidrug resistance II: 5'- [5' 6-FAM]CCCCTAAGGTCAAAGAA -3' (SEQ ID NO.5) - MDR4 antisense primer specific for multidrug resistance III: 5'- [5' 6-FAM] GGTAGGCTTGGCACTC -3' (SEQ ID NO.6)

[0069] For the addition of interfering DNAs: iDNA 1 5'- GGGTAGGA -3' (SEQ ID NO.7) iDNA 2 5'- ACGATGCG -3' (SEQ ID NO.8)

[0070] The composition of the PCR mixture is detailed in Table 1.

[0071] [Tables 1] | Reagent Volume 1 Taq Promeqa GoTaq 5pl | SER F ûiSyiàSMM Ôjipl to SpM WR1JF Opl to | Ô>1 to | MDR3_R 0.3pl to 5pM | yDR4 RO Jyl to | iDNA ï üs4pl to 20pM Iwm 0.4pl to 2ÔyM

[0072] Table 1: PCR mix for the detection of Zymo-Septoria tritici and MDR resistance in this pathogen

[0073] The method is implemented by following the following protocol using a kit according to the invention: 1. - Taking a sample of a leaf showing a symptom of infection

[0074] 2 - DNA extraction

[0075] 3 - Rehydration of the lyophilized pellet of the PCR mixture with a buffer of rehydration and addition of the DNA extract from the sample

[0076] 4 - Amplification of the sequences by PCR; for this step, a Jeulin® machine battery-operated (9 tubes or 16 tubes depending on the model) was used. It can be used near the field.

[0077] The PCR program used is as follows: 95T 3 minutes 95'C 3 seconds ~ GCC 20 seconds _J x 40 cycles

[0078] 5 - Revelation of the result on nitrocellulose strip on which are fixed antibodies / ligands capable of recognizing the antigenic markers located at the ends of the primers amplified by impregnating the strip with the mixture obtained.

[0079] The principle of revealing the result on a strip is illustrated in [Fig.2].

[0080] EXAMPLE 2: Example of implementation of the non-health method: Application to the detection and characterization of strains of the pathogen Fusarium with revelation of 4 markers using 2 strips

[0081] This example illustrates the application of the method to the simultaneous detection of 4 markers. Although this example is not within the scope of the present invention, it presents the principles of the method in a particular embodiment of simultaneous revelation of 4 markers.

[0082] In practice, 1 strip is introduced into the PCR reaction tube to reveal 2 markers per strip; this is a quadruplex format. It can be used to address the following problem:

[0083] - On wheat and corn, Fusarium is very common and causes very serious damage. significant on the foliage, the roots causing significant lodging. In addition, these Fusarium ssp. produce mycotoxins, some of which are lethal to humans and animals when their levels in food exceed certain limits (cumulative effects in tissues such as the liver, for example, nervous tissue, etc.;

[0084] - These Fusarium produce Trichothecene type mycotoxins (deoxynivalenol = DON, Nivalenol, T2 and HT2, Zearalenone, Fumonisin, etc.).

[0085] In the presence of Fusarium in a wheat field, it is possible to characterize the strains for their resistance to certain fungicides and simultaneously know the type of mycotoxins they can produce. With 4 markers available, it is possible to:

[0086] o use 2 markers for fungicide resistance (TSR and MDR or equivalent) and 2 markers for the most toxic types of mycotoxins such as DON and Zearalenone for example.

[0087] o If the 2 fungicide resistance markers indicate that cefusarium can be effectively eliminated, the harvest will be usable for food even if the mycotoxin markers are positive;

[0088] o If both fungicide resistance markers indicate that Cefusarium cannot be effectively eliminated, the harvest will be usable for food even if the mycotoxin markers are negative; on the other hand, the harvest will have to be destroyed if one of the mycotoxin markers is positive.

[0089] EXAMPLE 3: Example of an application in animal health - Application to the diagnosis of swine fever

[0090] The method according to the invention can be applied to the diagnosis of swine fever which is caused by different viruses in pigs and wild boars.

[0091] A first form of plague is African swine fever, which affects pigs, but also wild boars, warthogs, bushpigs, and ticks. The agent is Asfivirus, a large double-stranded DNA virus that replicates in the cytoplasm of infected cells.

[0092] A second form is European swine fever, known as classical swine fever, another contagious viral disease that affects suids (including domestic pigs and wild boars, which are thought to be the only "known wild reservoirs"), without being transmissible to humans. Its vector is an RNA virus of the Flaviviridae family, of the genus Pestivirus (same genus as the virus responsible for hepatitis C).

[0093] The interest of portable technology, Flashdiag® Pedestrian kits (Point-of-care type), for the detection of these different DNA and RNA viruses, would be to be able to detect not only the infecting viruses, on animals, in the open air or in livestock, but also their variants, mainly due to mutations of the single base pair type (SNPs), phenotypically different, with different aggressiveness characteristics and infectious capacities.

[0094] Pedestrian kits that can be used on site can also enable surface and air tests (e.g.: covid-19) to be carried out to detect such viruses in the direct environment of pigs, in particular, in confined breeding and / or fattening conditions.

[0095] EXAMPLE 4: Example of an application in human health - Application to the diagnosis of Lyme disease

[0096] Lyme disease is a human infection whose main vector of transmission of the infectious agent is the tick, present in tall grass, Pastures, recreational lawns, undergrowth, and other natural habitats. Transmitted by the bite of hard Ixodes ticks, it is a bacterial disease caused by Borrelia.

[0097] The expression "Lyme borreliosis" often refers to "European Lyme disease", due to a greater diversity of borrelia (mainly Borrelia garinii, B. afzelii... or B. burgdorferi in the broad sense).

[0098] Lyme disease is characterized by great diversity (genetic, epidemiological, clinical and diagnostic) because it is multi-visceral (can affect various organs) and multi-systemic, can affect various systems with therefore polymorphic clinical manifestations (cutaneous, rheumatological and neurological). It is expanding, becoming the most frequent vector-borne disease.

[0099] The interest of portable technology, Flashdiag® Pedestrian kits (point-of-care type), to detect these different bacteria vectors of Lyme disease, would be to be able to detect not only the infecting bacteria, on ticks, in the open air, on domestic or stray dogs, but also their variants, mainly due to mutations of the single base pair (SNP) type, phenotypically different, with characteristics of aggressiveness and different infectious capacities.

[0100] The detection and characterization of variant bacteria carried by infected people is essential to be able to administer the most suitable antibiotics to eradicate the bacteria in question.

[0101] Thus, the Flashdiag® Pedestrian kits could be useful to general practitioners, pharmacists and in hospital environments for better monitoring of this pathology which is expanding in France, Europe and the USA.

[0102] These tests carried out upstream on vector ticks and downstream after infection of humans can make the monitoring of variants for this pathology more reliable.

[0103] In conclusion, for these 2 examples of veterinary and medical applications, the concepts and technologies applied to DNA and RNA in the plant field (Examples 1 and 2) are, without any doubt, easily transposable to applications on mammals.

[0104] The combined use of interfering DNA and so-called restriction enzymes which reduces the obtaining of false positives in the overall approach of our technology is a certain guarantee of better reliability and sensitivity, particularly sought after in the veterinary and medical fields.

Claims

Claims

1. A method for diagnosing the presence of a pathogen in a biological sample from an individual suspected of being infected, comprising the steps of: a. Providing said sample b. Extracting DNA or RNA from said sample c. Amplifying by PCR said DNA or RNA sequences of the pathogen to determine the presence of said pathogen using a pair of specific primers for amplifying a sequence characteristic of said pathogen d. Revealing on an immunological strip the presence of said pathogen in which the amplification step is carried out in the presence of interfering DNAs of a length less than 15 nucleotides and which are complementary to the parts of the primers capable of forming polymers between them in order to avoid the formation of non-specific bands on the immunological strips responsible for false positives.

2. Method according to claim 1 further comprising the addition of a restriction enzyme between step b. of extraction and step c. of amplification, this enzyme being capable of cutting the DNA of said pathogen specifically at the level of the wild-type codon corresponding to the codon carrying the desired mutation.

3. Method according to one of claims 1 or 2 also making it possible to detect the presence of at least one other pathogen and / or to determine at least one characteristic associated with at least one of the pathogens chosen from a genetic variation associated with a modification of the behavior of the pathogen, resistance to a treatment, multi-resistance.

4. Method according to one of the preceding claims making it possible to simultaneously obtain several results associated with the detection and / or characterization of one or more pathogens using a strip.

5. Method according to one of the preceding claims in which the pathogen to be detected is a virus, a bacterium or a fungus.

6. A kit for detecting the presence of a pathogen suitable for use in the field comprising: o A lyophilized PCR reaction mixture comprising: - a pair of specific primers making it possible to amplify a sequence characteristic of said pathogen - interfering DNAs of a length less than 15 nucleotides which are complementary to the parts of the primers capable of forming polymers between them - a polymerase amplification enzyme - a restriction enzyme capable of cutting the DNA of said pathogen specifically at the level of the wild-type codon corresponding to the codon carrying the desired mutation o At least one immunological revelation strip making it possible to reveal the presence of said pathogen.

7. Kit according to claim 6 wherein said PCR mixture further comprises at least one other pair of primers making it possible (i) either to detect the presence of another pathogen, (ii) or to determine at least one characteristic of interest associated with a pathogen chosen from a genetic variation associated with a modification of the behavior of the pathogen, resistance to a treatment, multi-resistance.

8. Kit according to claim 7 for detecting the presence of a pathogen and determining a characteristic associated with this pathogen in which: - The PCR mixture further comprises one or more pairs of specific primers for amplifying at least one mutation associated with a characteristic of interest in the pathogen - The strip comprises a control band and two separate bands formed by the binding of antibodies specific for a particular antigenic marker, namely respectively: o an antibody / ligand specific for an antigenic marker located at the 5' end of one of the primers allowing the amplification of a sequence specific for the pathogen, o an antibody / ligand specific for an antigenic marker located at the 5' end of one of the primers allowing the amplification of a sequence specific for a characteristic,o an antibody specific to an antigenic marker common to the 3' ends of the different amplification products to reveal the bands.,

9. Kit according to one of claims 6 to 8, comprising 1 immunological strip for simultaneously revealing several results

10. from the same amplification, said results being chosen from the detection of the presence of at least one pathogen and the determination of at least one characteristic associated with a pathogen chosen from a genetic variation associated with a modification of the behavior of the pathogen, resistance to a treatment, multi-resistance. Method for diagnosing the presence of a pathogen in a biological sample from an individual suspected of being infected, and for possibly determining the presence of another pathogen or a characteristic of interest suitable for field diagnosis, using a kit as defined in one of claims 6 to 9, and comprising the following steps: A) Provision of a biological sample likely to contain a pathogen, B) Extraction of DNA from said sample C) Introduction of the extracted DNA into a tube containing said lyophilized PCR mixture and at least one restriction enzyme D) Carrying out a PCR amplification E) Introduction of one or two immunological strip(s) for impregnation into the tube containing the amplicons to reveal whether the pathogen is present and possibly whether it presents a characteristic of interest.

Images