DETECTION OF A PARASITE NUCLEIC ACID BY ISOTHERMAL AMPLIFICATION
The LAMP-based method for detecting Schistosoma DNA from urine samples addresses the limitations of existing tools by providing rapid, sensitive, and specific detection in resource-limited areas, enhancing schistosomiasis diagnosis with improved sensitivity and simplicity.
Patent Information
- Application Number
- FR2024013617
- Authority / Receiving Office
- FR · FR
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-12-06
- Publication Date
- 2026-06-12
Smart Images

Figure 00000044_0000 
Figure 00000047_0000 
Figure 00000047_0001
Abstract
Description
Title of the invention: DETECTION OF A PARASITE NUCLEIC ACID BY ISOTHERMAL AMPLIFICATION FIELD OF INVENTION
[0001] The present invention relates in particular to an in vitro method for detecting parasite DNA of the genus Schistosoma by isothermal amplification, designed for simple and rapid use, from the collection and processing of the subject sample to the test itself, deployable in the field and particularly in endemic areas. PRIOR TECHNOLOGY
[0002] Schistosomiasis, or bilharzia, is the second most widespread parasitic disease after malaria. Epidemiological estimates associated with this infection are staggering, with 600 to 800 million people exposed and 200,000 to 250,000 deaths annually. The number of people suffering from severe parasitic infections with measurable morbidity is estimated at 300 million, more than 50% of whom are school-aged children. Indeed, it is particularly prevalent among children due to their greater exposure to water compared to adults. Schistosomiasis is a widespread disease in impoverished communities where the lack of safe drinking water in homes leads to poor hygiene, resulting in the contamination of nearby freshwater sources.
[0003] Various strategies are employed to control or eliminate the transmission of schistosomiasis, depending on the prevalence in the targeted areas and the corresponding objectives. In areas with high prevalence and a significant parasite load, the primary objective is to control disease morbidity, as complete elimination is impossible. In such cases, preventive chemotherapy through mass praziquantel treatment is the treatment strategy employed without prior individual diagnosis. Institutions advocate population-based diagnostic surveys to determine prevalence and map areas requiring treatment (Crompton 2006). Consequently, a significant number of children are diagnosed in schools through microscopic examination of their urine or stool.If the prevalence among the tested groups exceeds the infection control threshold (i.e., a prevalence of 10%), a mass treatment campaign with praziquantel is launched. Otherwise, only children with a positive diagnosis are treated. Below a prevalence threshold of 10%, a more sensitive diagnostic approach is needed for individualized treatment of subjects (Gebreyesus et al. 2020).
[0004] When the objective is to control infection or its transmission in low-prevalence areas where the parasite load is low, microscopic examination is not suitable due to its low sensitivity and numerous false negatives. In these cases, the detection of parasite antigens (via POC-CCA or UCP-LF CAA) or DNA (via qPCR) is essential (WHO 2004; Lamberton et al. 2014). Finally, during the phase of transmission interruption or disease elimination, when there are only cases of very low parasite intensity or for migrating populations (i.e., outside endemic areas), indirect methods (antibody detection by ELISA, IHA, or Western blot) are ideally used.
[0005] A growing number of countries are thus succeeding in reducing the prevalence of this infection through efforts deployed within the framework of disease control programs. However, the decrease in disease prevalence is correlated with a reduction in parasite intensity in individuals. Consequently, low-intensity infections are increasing, particularly in resource-limited countries. The diagnostic tools used should focus on controlling transmission by detecting these low parasite intensities. However, sensitive DNA detection techniques (e.g., qPCR) or currently available antibody detection methods cannot be deployed in developing countries.
[0006] There therefore remains a need to develop diagnostic tests that are: - simple, both with regard to sample collection and the test itself, - quick and feasible without equipment or with simple equipment powered by solar energy or battery, for field use in endemic areas, and - whose sensitivity and specificity performance is acceptable for detecting small amounts of parasite DNA in subjects likely to have been infected. Description of the invention
[0007] It is in this context that the applicant developed an in vitro method for detecting the DNA of a specific parasite: parasites belonging to the genus Schistosoma. The DNA amplification method used, known as Loop-Mediated Isothermal Amplification (LAMP), is one of the new techniques that emerged after Polymerase Chain Reaction (PCR), which is the conventional DNA amplification technique. Isothermal amplification, particularly LAMP, is characterized by its simplicity and cost-effectiveness compared to traditional PCR methods. Furthermore, the invention incorporates a simplified extraction process for The parasite's DNA is detected from the subject's sample, specifically the subject's urine. The simplified sample processing includes filtering a significant volume of the subject's urine sample to concentrate traces of parasites, thereby increasing the test's sensitivity.
[0008] A first object of the invention therefore relates to an in vitro method for detecting the DNA of a parasite of the genus Schistosoma from a urine sample of a subject likely to have been infected by said parasite, comprising an isothermal amplification step with a set of pan-specific primers capable of simultaneously amplifying and detecting the species S. haematobium, S. mansoni, S. bovis, S. curassoni and S. japonicum, comprising two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the sequence of the intergenic space (IGS marker, accession number AJ223838 for S. haematobium) and advantageously further comprising two 'loop' primers (LF / LB), or alternatively two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the sequence of the space internal of transcripts (ITS marker, accession number GU257398 for S. haematobium) and advantageously also two 'loop' primers (LF / LB).
[0009] Another object of the invention relates to a reaction mixture for the amplification and detection of parasite DNA of the genus Schistosoma comprising at least one set of pan-specific primers capable of simultaneously amplifying and detecting the species S. haematobium, S. mansoni, S. bovis, S. curassoni and S. japonicum, comprising two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the intergenic space sequence (IGS marker, accession number AJ223838 for S. haematobium) and advantageously further comprising two 'loop' primers (LF / LB), or alternatively two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the internal space sequence of transcripts (ITS marker, accession number GU257398 for S. haematobium) and advantageously also two 'loop' primers (LF / LB).
[0010] The invention also relates to a kit or case for the amplification and detection of parasite DNA of the genus Schistosoma, comprising: i. The equipment and reagents for carrying out the steps of processing the urine sample and (ii) extracting parasite DNA, including a 10-50 mL S syringe, 16G or 18G gauge conical dispensing tips, 0.2pm to 1pm porosity filters, in particular 0.45pm, 2mL microtubes, lysis buffer (solution A) and wash buffer (solution B), ii. The lyophilized reaction mixture as defined in the invention, and iii. Reagents for the detection of target sequences of parasite DNA, chosen from reagents revealing a change in colorimetry or revealing fluorescence, in particular Sybr-green.
[0011] Another object of the invention relates to an in vitro process for extracting DNA from a parasite, in particular of the genus Schistosoma, from a urine sample of a subject likely to have been infected by said parasite, comprising the following steps: i. DNA concentration by decantation of the sample without agitation or centrifugation, ii. lysis of the decanted fraction, with heating and without agitation or centrifugation, and iii. Filtration and elution of parasitic DNA.
[0012] In particular, the parasite's DNA is DNA of the genus Shistosoma.
[0013] The invention further relates to the use of the in vitro method for detecting DNA of parasite of the genus Schistosoma from a urine sample of a subject likely to have been infected by said parasite as defined according to the invention, in an in vitro diagnostic method for schistosomiasis or bilharziasis.
[0014] The process according to the invention has, in particular, the following advantages: - the LAMP amplification reaction uses new primers that are pan-specific to all species of the genus Schistosoma, including S. japonicum, unlike previous work of a pan-specific LAMP not amplifying S. japonicum (Crego-Vicente et al. 2021); - DNA can be extracted from a large sample volume (10 to 50 mL), which is then concentrated (up to 50x) by decantation; - the porosity of the filters used in the treatment process, in particular a porosity of 0.45pm, allows the retention of circulating DNA emanating from previously lysed eggs and that already present in the urine; - the specific syringes for extraction solutions A and B ([Fig.l]) are reusable for all extracts; - the process according to the invention is rapid: it can be carried out in 1 hour for a single sample and up to 1 hour and 20 minutes for 8 samples, which includes sample processing, DNA amplification by LAMP and the revelation of the result; compared to a qPCR test in a laboratory or hospital setting, the commercial DNA extraction protocol alone takes at least two hours, followed by the qPCR process and the analysis of the results, which require at least half a day; - the process according to the invention is simple to use without requiring a centrifugation device to extract the DNA, which makes it a process suitable for use in the field, in endemic areas of Southern countries; - the use of a control (DNA from a conserved human sequence, such as 18S rDNA) makes it possible to ensure the proper execution of the extraction and amplification of the sequences according to the process of the invention; - finally, the method according to the invention meets the expected sensitivity and specificity performance; the results illustrated in the examples below further show that, compared to the gold standard for the diagnosis of schistosomiasis, namely microscopic methods (kato-katz or urine filtration), the method according to the invention allows a prevalence gain of 36% thanks to the sensitivity of DNA detection, and compared to qPCR, the most sensitive DNA detection technique available, the method according to the invention has a sensitivity of 87%.
[0015] The method according to the invention therefore meets the criteria defined by the World Health Organization (WHO) by proposing a protocol that is entirely feasible in low-resource environments such as areas endemic to Schistosomiasis, requiring neither sophisticated equipment nor qualified personnel, and can be implemented quickly and at minimal cost, with better results than microscopic methods (prevalence gain of 36%) and with very good sensitivity, close to qPCR. DESCRIPTION OF THE FIGURES
[0016] [Fig-1] represents a schematic diagram illustrating one embodiment of the process sample processing, prior to LAMP amplification.
[0017] [Fig.2a] represents a multiple alignment of intergenic ribosomal sequences spacer (IGS) of the species S. japonicum (EU835689.1), S. mansoni (AJ223842), S. haematobium (AJ223838), and S. guineensis (AJ223840). The position of the PROSIMDIA-Schisto-I primers is marked by the arrows above the sequences. A right-pointing arrow indicates a forward primer. A left-pointing arrow indicates an antisense primer.
[0018] [Fig.2b] represents a multiple alignment of internally transcribed sequences spacer (ITS) of the species S. japonicum (FJ852563.1), S. mansoni (AY446082.1), S. haematobium (GU257398.1), and S. guineensis (Z21717.1). The position of the PROSIMDIA-Schisto-II primers is marked by the arrows above the sequences. A right-pointing arrow indicates a forward primer. A left-pointing arrow indicates an antisense primer.
[0019] [Fig.2c] represents an alignment of PROSIMDIA-Schisto-III primers on the Human 18S ribosomal RNA sequence (accession number M10098.1). The position of the PROSIMDIA-Schisto-III primers is indicated by the arrows above the sequences. A right-pointing arrow indicates a forward primer. A left-pointing arrow indicates an antisense primer.
[0020] [Fig.3] represents the reaction kinetics (real-time reading) of an amplification of a series dilution range of S. haematobium DNA, from 1.10 1 to 1.108 ng / pL with a lyophilized reaction mixture according to the invention, 6 months after lyophilization. The numbers indicate the concentration of each DNA extract (1: 1.10 1 ng / pL; 2: 1.102 ng / pL; 3: 1.103 ng / pL; 4: 1.104 ng / pL; 5: 1.105 ng / pL; 6: 1.106 ng / pL; 7: 1.107 ng / pL; 8: 1.108 ng / pL).
[0021] [Fig.4] represents a 2% agarose gel electrophoresis of the tests specificity carried out on the PROSIMDIA-SCHISTO-I (left) and PROSIMDIA-SCHISTO-II (right) primer sets. Abbreviations: Fg: Fasciola gigantica, Fh: Fasciola hepatica, Te: Taenia crassiceps, Eg: Echinococcus granulosus, Dd: Dicrocoelium dendriticum, Hs: Homo sapiens, Sj-C, J, P: S. japonicum strains respectively, Sm: Schistosoma mansoni, Sb: Schistosoma bovis, Sc: Schistosoma curassoni, Sh: Schistosoma haematobium, C-: negative control.
[0022] [Fig.5] represents the prevalence of the sample with the three diagnostic methods tested. DETAILED DESCRIPTION OF THE INVENTION Definitions
[0023] By 'parasite' according to the invention, we mean an organism that lives in close association with a host, on which it depends for its survival, and this at the latter's expense. Indeed, the parasite is pathogenic, that is to say, it is associated with or responsible for a disease or condition in a subject infected by said parasite. The interaction between the parasite and its host is called parasitism. The consequences of parasitism can be more or less harmful to the host, ranging from a slight deterioration of health to death in some extreme cases. Parasites can be classified into several groups: unicellular parasites, such as protozoa (e.g., Plasmodium, responsible for malaria); multicellular parasites, such as intestinal worms (helminths) or arthropods (e.g.ticks, fleas) and microbial parasites, including viruses and certain types of bacteria or fungi that exploit the host for food and reproduction. Viruses, although not living organisms in the traditional sense (they do not have their own metabolism and cannot reproduce without infecting a host cell), are also considered. like parasites. A virus infects a host cell and hijacks its cellular machinery to produce copies of itself. This can cause considerable damage to the host, as in the case of viral diseases (influenza, HIV, COVID-19). Thus, viruses are included in a broader definition of parasitism. According to a particular embodiment of the invention, the parasite is a flatworm, in particular of the genus Schistosoma.
[0024] By 'parasite DNA' according to the invention, we mean the DNA from the parasite, in other words the DNA isolated and purified from an extraction step applied to the sample of the subject infected by said parasite.
[0025] By 'subject' likely to have been infected by said parasite according to the invention, we mean in particular a definitive mammalian host.
[0026] The term 'mammalian definitive host' according to the invention means the host in which the parasite reaches its final stage of development and reproduces sexually. Indeed, in complex parasitic life cycles, a parasite may have several different hosts. In the case of schistosomes, the definitive hosts of this parasite are mammals, while the intermediate hosts are freshwater mollusks. The list of definitive mammalian hosts of schistosomes varies depending on the schistosomes species in question. It is notably available in Tables 2, 3, and 4 of the website https: / / www.waterpathogens.org / book / schistosoma.
[0027] Thus, according to a particular mode of the invention, the subject is a definitive mammalian host, in particular a human or an animal chosen from among cattle and sheep, preferably the subject is a human.
[0028] 'Isothermal amplification' or 'loop-mediated isothermal amplification (LAMP)' is an isothermal (constant-temperature) amplification technique that does not require a thermocycler, unlike polymerase chain reaction (PCR) technology. Generally, four different primers are used to amplify six distinct regions on the target gene, thus increasing specificity: two internal primers (FIP for Forward Inner Primer and BIP for Backward Inner Primer), each composed of two target regions, and two external primers (F3 and B3). The internal primers FIP and BIP play a crucial role in initiating amplification and extension. They are each made up of two targeted segments: F2 / or B2 and the complementary sequence to Fl / or B1 (Fie / or B le): one hybridizes to the 3' end of the target DNA strand, while the other hybridizes to the complementary strand, thus ensuring a loop that promotes polymerization.The external primers F3 and B3 initiate the initial synthesis of a DNA strand, thus facilitating amplification of the target sequence by the internal primers. These primers hybridize to sequences distant from the binding sites of the internal primers, allowing for continuous loop amplification. In addition, and optionally, supplementary primers, called . Loop primers can be used to increase the speed and sensitivity of the LAMP reaction. These primers, LF and LB, hybridize to the loops generated by internal primers and improve the overall efficiency of the reaction. Initially, a DNA polymerase with strand-displacement activity initiates synthesis, and then two of the primers form loop structures to facilitate subsequent amplification cycles.
[0029] By 'pan-specific primers' according to the invention, we mean specific primers complementary single-stranded DNA sequences to which they will bind, capable of hybridizing with the target sequences of the same gene, for all species of the same genus, such as Schistosoma. Within the framework of the present invention, the pan-specific primers are capable of simultaneously amplifying and detecting all species of the genus Schistosoma, and in particular the species S. haematobium, S. mansoni, S. bovis, S. curassoni, and S. japonicum, as illustrated in the examples. Indeed, S. japonicum is phylogenetically the species most distantly related to S. haematobium (BL Webster et al., 2012, in particular Figure 2 of this article) for which the DNA sequence is most similar to the primers used according to the invention. Therefore, the fact that the primers amplify the DNA of S.Japonicum allows us to assert that they can amplify all other species between these two most distantly related species, since they are phylogenetically closer (therefore with more similar DNA sequences). The Applicant has thus confirmed, even though it has not tested it experimentally (due to lack of access to its DNA), that the primers defined according to the invention were capable, as visualized computer-based (in silico) and in Figures 2a and 2b, of hybridizing to the DNA sequence of S. guineensis (one of the 6 parasitic schistosomes of humans).
[0030] Method for detecting parasite DNA by isothermal amplification
[0031] A first object of the invention is therefore an in vitro method for detecting parasite DNA of the genus Schistosoma from a urine sample of a subject likely to have been infected by said parasite, comprising an isothermal amplification step with a set of pan-specific primers capable of simultaneously amplifying and detecting the species S. haematobium, S. mansoni, S. bovis, S. curassoni and S. japonicum, comprising two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the intergenic space sequence (IGS marker, accession number AJ223838 for S. haematobium) and advantageously further comprising two loop primers (LF / LB), or alternatively two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the intergenic space sequence internal of transcripts (ITS marker, accession number GU257398 for S. haematobium) and advantageously also two 'loop' primers (LF / LB).
[0032] According to a particular mode, the process of the invention further includes a step of detecting the amplified DNA.
[0033] The steps of amplification and detection of the amplified DNA are described below.
[0034] Development of primers targeting the parasite's DNA
[0035] In the context of the isothermal LAMP amplification reaction, and as described previously, a "primer" refers to a single-stranded oligonucleotide or DNA fragment that hybridizes to a target sequence on a nucleic acid strand in such a way that the 3' or 5' end of the primer can serve as a polymerization and extension site using a DNA polymerase enzyme. In the LAMP reaction, several primers are used, including two internal primers (FIP and BIP), each composed of two target regions, and two external primers (F3 and B3), and optionally additional primers, called "loop" primers as defined previously.
[0036] According to a particular method, the primers are designed so that the distance between the 5' ends of F2 and B2 (the amplified region) is between 120 and 160 bases. The primers are also designed so that the distance between the 5' end of F2 or B2 and the 5' end of F1 or B1 (the looping portion) is between 40 and 60 bases. The primers are also designed so that the distance between F2 or B2 and F3 or B3 is between 0 and 60 bases. These primers thus allow for efficient amplification without thermal cycling through the action of a DNA polymerase possessing strand-displacement activity, in particular a DNA polymerase isolated from Bacillus stearothermophilus, Bst polymerase. The primer can consist of any combination of nucleotides or analogues thereof, which may optionally be linked to form a linear polymer of any length.A primer can thus have any suitable length, for example, at least 10, 20, 30, or 40 nucleotides. In most cases, the primer length is between approximately 10 and 60 nucleotides. Preferably, the length of F3 / B3 primers is between 15 and 25 nucleotides, and the length of FIP / BIP primers, resulting from the linking of F2 and F3 or B2 and B3 primers, is between 30 and 50 nucleotides. Additionally, and optionally, the length of loop primers is generally between 15 and 25 nucleotides. Primers are designed so that their G or C nucleotide content is generally between 40 and 65%, preferably between 50 and 60%.
[0037] The examples and Table 1 described below illustrate examples of Schistosoma-specific pan-genus primers, defined from the target sequences of the IGS (accession number AJ223838 for S. haematobium) and ITS (accession number GU257398 for S. haematobium) regions. Figures 2a and 2b also illustrate their positioning on said target sequences.
[0038] Table 1: Primer sequences used in the amplification reaction
[0039] [Tables 1] Marker Name of the love rce Sequence SEQ ID NO : IGS PROSIMDIA -SCHISTO-I- F3 agtctgaatcccgtccaa 1 PROSIMDIA -SCHISTO-I- B3 acattaagtcgtctacaaacg 2 PROSIMDIA -SCHISTO-I-FIP (Flc+F2) ggtccagtccagacaccaaaagttttcattctgtatccgacacgt 3 PROSIMDIA -SCHISTO-I-BIP (Blc+B2) ccagagcgatgaccataaaccgttttctcacgctcataccacaa 4 PROSIMDIA -SCHISTO-I-LF acgtaagcttgcccagcc 5 PROSIMDIA -SCHISTO-I-LB tacgggggtcgacacga 6 ITS PROSIMDIA -SCHISTO-II- F3 ccgccccgttattgttcc 7 PROSIMDIA -SCHISTO-II- B3 acgagccgagtgatccac 8 PROSIMDIA -SCHISTO-II-FIP (Flc+F2) cgaagccaggtgcatgccagttttttgaagcgatccggtttgg 9 PROSIMDIA -SCHISTO-II-BIP (Blc+B2) atcctaggctgcagcgttaaccttttcgctcaaagttgtacgccaa 10 PROSIMDIA -SCHISTO-II- LF gcagcaaacccgtgaatgg 11 PROSIMDIA -SCHISTO-II- LB tgcatttgggaaaccaatgtatgg 12 18S omal ribose DNA (EUR CO NTROLE MARQUE 18 SHS) PROSIMDIA -SCHISTO-F3 PROSIMDIA -SCHISTO-III -B3 acctccgactttcgttcttg 14 PROSIMDIA-SCHISTO-III-FIP(Flc+F2) tggcctcagttccgaaaaccaatttcctggataccgcagctagg 15 PROSIMDIA-SCHIST-III-BIPc+B2) ggcattcgtattgcgcgctattttggcaaatgctttcgctctg 16 PROSIMDIA -SCHISTO-III -LF tagaaccgcggtcctattccatta 17 PROSIMDIA -SCHISTO-III -LB aaattcttggacc ouggcgcaag 18 Markers for the concentrated ITS (IGS) (18SHS) PROSIMDIA -SCHISTO-I(M)-FIP(Flc +F2) FAM-ggtccagtccagacaccaaaagttttcattctgtatccg acacgt 19 PROSIMDIA -SCHISTO-II(M)-FIP(Flc +F2) PROSIMDIA -SCHISTO-III ALEXA594-tggcctcagttccgaaaccaatttcctggat accgcagctagg 21 (M)-FIP(Flc +F2) PROSIMDIA -SCHISTO- I(M)-QP actggacc-EDQ 22 PROSIMDIA -SCHISTO-II( M)-QP tggcttcg-EDQ 23 PROSIMDIA -SCHISTO-III (M)-QP tgaggcca-EDQ 24
[0040] Other pan-specific primer sets targeting the same target regions and meeting the criteria described above in terms of primer length, GC content of primers, and distance between them, also fall within the scope of the invention.
[0041] In particular, the invention also relates to any primer set defined from the IGS and / or ITS target sequences of Schistosoma, in particular S. haematobium, in which: - The length of the F3 / B3 primers is between 15 and 25 nucleotides, - the length of the FIP / BIP primers, resulting from the binding of the F2 primers and Fie or B2 and B is between 30 and 50 nucleotides. - the length of the "loop" primers, when present, is between 15 and 25 nucleotides, - The content of the G or C nucleotide in the primers is between 40 and 65%, preferably between 50 and 60%. - the distance between the 5' ends of F2 and B2 (the amplified region) is between 120 and 160 bases, - the distance between the 5' end of F2 or B2 and the 5' end of Fie or B (the part that forms the loop) is between 40 and 60 bases, and - the distance between F2 or B2 and F3 or B3 is between 0 and 60 bases.
[0042] The expression "target-specific primer" generally refers to a single- or double-stranded polynucleotide, usually an oligonucleotide, that comprises a sequence at least 90% complementary, more generally at least 95% complementary, more generally at least 99% complementary, or identical to at least a portion of a nucleic acid molecule that comprises a target sequence. In such cases, the target-specific primer and the target sequence are described as complementary to each other. In most cases, the primer Target-specific primers are substantially non-complementary to other nucleic acid molecules present in the sample. In some embodiments, target-specific primers exhibit minimal cross-hybridization with non-specific sequences in the amplification reaction mixture. In some embodiments, a target-specific forward primer and a target-complementary-strand-specific reverse primer define a target-specific primer pair that can be used to amplify the target sequence by primer extension according to the model. In some embodiments, the target-specific primer may exhibit minimal cross-hybridization with other target-specific primers in the amplification reaction. In some embodiments, the target-specific primer may exhibit minimal cross-hybridization with itself in the amplification reaction.This phenomenon is called primer homodimerization. Preferably, target-specific primers should be designed to avoid secondary structures, i.e., to exhibit minimal homodimerization, heterodimerization, or heteropolymerization. To achieve this, the primer end serves as the starting point for DNA synthesis and therefore must exhibit a certain degree of stability. The 3' ends of F2 / B2, F3 / B3, and LF / LB, and the 5' end of Flc / Blc, are designed so that the free energy difference is less than or equal to -4 kcal / mol. The 5' end of Fie after amplification corresponds to the 3' end of Fl, so stability is important (the free energy change (FEC) is the difference between the free energy of the product and the free energy of the reactant). The reaction proceeds toward a negative free energy change (FEC). The hybridization between the primer and the target gene is an equilibrium reaction.The hybridization reaction must therefore take place with an GA as close to zero as possible.
[0043] Thus, primers suitable for the invention are primers comprising a sequence at least 90% complementary, more generally at least 95% complementary, more generally at least 99% complementary, or identical, to at least a portion of a nucleic acid molecule which comprises a target sequence, preferably a target sequence of the IGS (accession number AJ223838 for S. haematobium) and ITS (accession number GU257398 for S. haematobium) regions and characterized in that the 3' ends of F2 / B2, F3 / B3 and LF / LB and the 5' end of Flc / Blc are designed so that the free energy difference is less than or equal to -4 kcal / mol.
[0044] According to a particular method, the primers for amplification have a concentration in the reaction medium ranging from 0.2 to 1.6 pM. Preferably, the FIP / BIP primers should be present in an amount 8 times greater than the F3 / B3 primers. Furthermore Optionally, the LF / LB loop primers should preferably be present in a quantity twice greater than the F3 / B3 primers.
[0045] Primers can be prepared by various methods, including, but not limited to, cloning of suitable sequences and direct chemical synthesis using methods well known in the art. In a particular mode, the melting temperature of regions F3, B3, F2, and B2 is approximately 60°C (59–61°C), while that of regions F1 and B1, and optionally LF / LB, is approximately 65°C (64–66°C). Computer programs can also be used to design primers, including the online NEB® LAMP Primer Design Tool available at https: / / lamp.neb.com / , or preferably the Primer Explorer V5 software (Eiken Chemical Co) available at https: / / primerexplorer.jp / e / .The nuclear regions of the small and large subunits of ribosomal DNA (18S; 5.8S; 28S as well as the internal transcribed spacers ITS1 and ITS2); and respectively the intergenic spacer of this ribosomal DNA (IGS) were selected as target sequences of the DNA of the parasite of the genus Schistosoma.
[0046] To simplify primer design, only two species were chosen to serve as the basis for creating pan-Schistosoma primers. Priority was given to S. haematobium and S. mansoni, which are the two species responsible for the highest prevalence of schistosomiasis. For each candidate region, the S. haematobium and S. mansoni sequences were downloaded from the GenBank database (NCBI, https: / / www.ncbi.nlm.nih.gov / genbank / ).
[0047] Table 2 below describes the sequences of the IGS and ITS regions of S. haematobium and S. mansoni respectively, but also those of S. Japonicum and S. guineensis which are illustrated in Figures 2a and 2b of sequence alignment, as well as the sequence of the human 18S ribosomal RNA which serves as a control.
[0048] Table 2: GenBank sequences used as the basis for the design of LAMP primers specific to IGS and ITS regions respectively, and for the design of LAMP primers specific to internal control (18S rRNA)
[0049] [Tables2] TARGET SEQUENCE OF THE SCHISTOSO PARASIT MA Sequence SEQ ID NO : Target sequence of the ribos omal intergenic spacer ( IGS) of S. japonicum (EU835689.1) agtctgaatcccgtccaaatttgcaacggtacattgtgtatccgacac gtggctgggcaagcttacgtattccttttggtgtctggactggactat gtgttcggctaggcccattaggtctggtattatgccagagcgatgacc atatactgtgctccggatatcggggtacaggggtcgacacgataa ctaattgtggtatgagcgtgaggatactaaatcgtttgtagacgactt aatgt 25 Séquence cible du ribos omal intergenic spacer ( IGS) of S. mansoni (AJ22 3842) agtctgaatcccgtccaaatttgcaacggtacattctgtatccgacac gtggctgggcaagcttacgtattccttttggtgtctggactggact accataaaccgtgctccggattttggggtacgggggtcgacacga tatctaattgtggtatgagcgtgaggatactaaatcgtttgtagacga cttaatgt 26 Target sequence of the ribos omal intergenic spacer ( IGS) of S.haematobium (AJ223838) agtctgaatcccgtccaaatttgcaacggtacattctgtatccgacac gtggctgggcaagcttacgtattccttttggtgtctggactggaccat gtgttcggctaggcccattaggtctgtgttatgccagagcgatt tatctaattgtggtatgagcgtgaggatactaaatcgtttgtagacga cttaatgt 27 Target sequence of the ribos omal intergenic spacer (IGS) of S. guineensis (AJ223840). agtctgaatcccgtccaaatttgcaacggtacattctgtatccgacac gtggctgggcaagcgtattccttttggtctggactggaccat gtgttcggctaggcccattaggtctgtgttatgccagagcgatg accataaccgtgctccggattttggggc tatctaattgtggtatgagcgtgaggatactaaatcgtttgtagacga cttaatgt 28 Target sequence of the in temal transcribed spacer (ITS) of S. japonicum (FJ852563.1) ccgccccgttatgttcctttccaaacattttacactgttgaagttcgat ccggtttgcttgccaatcacgggtttgctgcctggcatgcacctggc cttgtgctggactgcatgctgctggcttagcggtaaatatcctaggc tgcagcgataaccattagttctatgcactttgtgtatagagttattgg cgtacaactttgagcggtggatcggcgtcgt 29 decible de sequence transcribed spacer » (I TS) de , S.mansoni (AY44 6082.1) ccgccccgttattgttcctatttcaaaccttttacactgttgaagcgatcc ggattggcttgccattcacgggtttgctgcctggcatgcacctggctt cgtgctggactgcatgtacgctggcttagcggtaaatatcctgagctg 30 . target sequence of the "internal transcribed spacer" (I TS) of S. haematobium (GU257398.1) ccgccccgttattgttcctatttcaaacttttacactgttgaagcgat ccggtttggcttgccattcacgggtttgctgctgcatgcacctggc ttcgtgctggactgcatgtacgctggcttagcggtaaatatcctaggc tgcagcgttaaccattagttcttgcatttgggcattgtagg attattggcgtacaactttgagcggtggatcactcggctcgt 31 Target sequence of the "inter nal transcribed spacer" (I TS) of S. guineensis (Z21 717.1) ccgccccgttattgttcctatttcaaacttttacactgttgaagcgat ccggttgcttgccattcacgggtttnctgcctggcatgcacctggc tcgtgctggactgcatcgctggcttagcggtaaatcctagnc tgcagcgttaaccattagttctatgcatttgggaaaccaatgtatggg attattggcgtacaactttgagcggtcctcgcgtgcgtcgcgt Human 18s Ribosomal RNA (M10098.1) gttcaaagcaggcccgagccgcctggataccgcagctaggaataa tggaataggaccgcggttctattttgttggttttcggaactgaggcca tgattaagagggacggccgggggcattcgtattgcgccgctagag gtgaaattcttggaccggcgcaagacggaccagagcgaaagcatt tgccaagaatgttttcattaatcaagaacgaaagtcggaggt 33 .
[0050] Homologous sequences from each species were aligned using Geneious Prime versions 2020.0.5, 2021.2.2, and 2022.1.2. From these alignments, visibly conserved regions were prioritized for LAMP primer design. To obtain a file format readable by LAMP primer design software, these regions were extracted in 200–500 bp fragments to perform a new multi-sequence alignment in omega clustal format using Clustal Omega EMBL-EBI (Madeira et al., 2019). Figures 2a and 2b illustrate an example of target sequence alignment (IGS and ITS of S. haematobium and “other species”) and the positioning of the primers developed on these target sequences. Figure 2c illustrates the positioning of the primers developed for human 18S rRNA control.
[0051] Thus, according to an embodiment of the invention as illustrated in the examples, the LAMP primers used according to the invention and as described in Table 1 above were developed from S. haematobium DNA sequences. In particular, the intergenic space (IGS, accession number AJ223838 for S. haematobium on Genbank) and internal transcript space (ITS, accession number GU257398 for S. haematobium on Genbank) sequences are defined according to the invention as the target regions of the DNA of the parasite of the genus Schistosoma.
[0052] According to a particular method, the development of specific primers uses the Primer Explorer V5 software (Eiken Chemical CO., Ltd., Japan) following the criteria described in the primer development manual for LAMP (https: / / primerexplorer.jp / e / v5_manual / index.html), in particular: - Less than 10 mismatches in total in a set of LAMP primers; - Mismatch allowed only in areas with low specificity (the 5' terminal regions of primers F3, B3, F2, and B2; the 3' terminal regions of primers Fie and B le as well as the internal regions of all primers; - Distance between F2 and B2 (inclusive) between 120 and 160 bp; - Distance between F2 / B2 and F3 / B3 (inclusive) between 0 and 60 bp; - Distance between Flc / Blc and F2 / B2 (not included) between 40 and 60 bp to allow insertion of the LOOP primers to be designed at a later stage; - Length of Flc / B primers between 20 and 22 bp, F2 / B2 / F3 / B3 between 18 and 20 bp; - Hybridization temperature of primers Fie and B1 between 64 and 66°C; F2, B2, F3, and B3 between 59 and 61 °C; - GC rates between 40 and 65% at the widest range, with optimal efficiency between 50 and 60%; and - AG threshold less than -4 Kcal / mol for the stability of the 5'-ter and 3'-ter ends of each primer and between 0 and -2.5 Kcal / mol per set of primers for the control of the dimers.
[0053] Although all the recommended parameters are important, priority was given to (i) minimizing the impact of mismatches (number and position) to ensure the pan-specificity of the tool; (ii) primer stability and dimer control to avoid recurrent non-specific amplifications in LAMP (Hardinge and Murray, 2019). Primer hybridization to the target gene releases energy (AG). The more negative the AG, the more easily the primers will hybridize to the target and the better their stability. The primer end serves as the starting point for DNA synthesis and therefore must exhibit a high degree of stability. The 3' ends of F2 / B2, F3 / B3, and LF / LB, and the 5' end of Flc / Blc, must be designed so that the energy released is less than or equal to -4 kcal / mol.The 5' end of Fie after amplification corresponds to the 3' end of Fl, which initiates the elongation of all new strands generated from the dumbbell-shaped strand. Therefore, the stability of the 5' end of Fie is crucial. The control of primer dimers (homo- and heterodimers) is verified by the overall value. of the energy released during the reaction. Since LAMP amplification is an entropic equilibrium reaction, this GA of the primer set must be as close to zero as possible.
[0054] After designing all the simple LAMP primer sets (with four primers: FIP, BIP, F3, and B3), the so-called LOOP primers (LB and LF) can also be generated by Primer Explorer. These primers reduce the amplification time and improve the sensitivity and specificity of the simple primer sets. They must have a hybridization temperature equivalent to that of the FIP and B3 primers, i.e., between 64 and 66°C, and meet the same requirements as the other primers in terms of AG, GC content, and length.
[0055] Thus, according to a particular and preferred mode, the primer set satisfies the parameters detailed in the previous description: that is to say the length of the primers preferentially between 18 and 22 base pairs, the Tm close to 60°C (59-61°C) for primers F3, B3, F2 and B2 and close to 65°C (64-66°C) for primers Fie, B le, LF and LB; an AG at the 5' end of primers F3, B3, F2, B2, LF and LB and at the 3' end of primers Fie and B le less than -4kcal / mol; ; an overall AG of the primer set between 0 and -1kcal / mol. The stability and polymerization capacity between primers, although already verified for the design tool, was additionally checked using online tools such as 'Multiple Primer Analyzer' (Thermo Scientific Web Tool) and OligoAnalyzer™Tool (IDT™).
[0056] According to a first embodiment, the primer set amplifying target sequences from the IGS regions (accession number AJ223838 for S. haematobium) is used. According to another embodiment, the primer set amplifying target sequences from the ITS regions (accession number GU257398 for S. haematobium) is used.
[0057] Thus, according to a particular embodiment of the invention, the primer set comprises two external F3 / B3 primers of sequences SEQ ID NO: 1 and SEQ ID NO: 2, two internal FIP / BIP primers of respective sequences SEQ ID NO: 3 and SEQ ID NO: 4 and advantageously in addition two loop primers of sequences SEQ ID NO: 5 and SEQ ID NO: 6 for the IGS marker, or alternatively two external F3 / B3 primers of sequences SEQ ID NO: 7 and SEQ ID NO: 8, two internal FIP / BIP primers of respective sequences SEQ ID NO: 9 and SEQ ID NO: 10 and advantageously in addition two loop primers of sequences SEQ ID NO: 11 and SEQ ID NO: 12 for the ITS marker.
[0058] According to a particular method, the amplification reaction uses a control, corresponding to an endogenous and conserved target of the subject to be tested. In particular, this endogenous target is 18S ribosomal DNA (SEQ ID NO: 33). This control ensures that the steps of extracting parasite DNA and subject DNA by the 18S marker from the sample of the subject to be tested, and amplification of said target sequences (parasite and 18S marker) were successfully carried out.
[0059] Thus, according to a particular and preferred embodiment of the invention, the primer set further comprises an internal control comprising two external primers (F3 / B3) and two internal primers (FIP / BIP) and advantageously further two loop primers hybridizing with a conserved human sequence, in particular the 18S ribosomal DNA sequence (18S rDNA).
[0060] Amplification of the control sequence can be used to determine the quality of test data measured from a sample, for example to verify the qualitative accuracy of the test data and / or to determine the reliability of the test data.
[0061] The control sequence can be a positive control of sample preparation, nucleic acid extraction, and amplification. Such a positive control can be useful when no amplification is observed in the reaction mixture with control target reagents. Conversely, if the control data identify positive signals in the reaction mixture, this demonstrates that amplification in the mixture is not substantially inhibited and suggests that the absence of positive signals in the test data is due to an absence or an undetectable level of the test target in the sample. Consequently, the control data support and help validate the negative result of the test data. On the other hand, the absence of amplification in the control sequence indicates that the amplification of the test target is also defective and that the negative test result is invalid.
[0062] Thus, this control (conserved human DNA sequence) ensures the proper execution of the extraction and amplification of the sequences according to the process of the invention. In a particular method, a conserved human sequence, in particular the 18S rDNA sequence, is used as the control sequence.
[0063] According to a particular embodiment of the invention, the primer set comprises two external F3 / B3 primers of sequences SEQ ID NO: 13 and SEQ ID NO: 14, two internal FIP / BIP primers of sequences SEQ ID NO: 15 and SEQ ID NO: 16, and advantageously in addition two loop primers of sequences SEQ ID NO: 17 and SEQ ID NO: 18 of the 18S marker.
[0064] In the case of an external control, a tube containing a reaction mixture containing primers designed to amplify a human marker (18S) is used, tested in parallel with the amplification reaction of the target sequences of parasite DNA.
[0065] In the case of an internal control, the reaction mixture comprises primers for the target marker (parasite DNA) and respectively for the control marker (18S). Thus, the FIP primers of each marker (parasite DNA and 18S marker) are labeled with a fluorochrome (or fluorophore) of a different wavelength, the fluorescence of which will be read by two beams of the detection device, which will discriminate the results of the target from those of the control. The addition of two quenching probes (QPs) to the reaction mixture is then necessary to quench the free labeled primers (in excess in positive reactions or in the case of a negative reaction).
[0066] Examples of fluorophores used to label primers, in particular FIP primers, include FAM (carboxyfluorescein), Alexa Fluor® 594, TET (carboxy-2',4,7,7' tetrachlorofluorescein succinimidyl ester), HEX (carboxy-2,4,4,5,7,7-hexachlorofluorescein succinimidyl ester), ROX (carboxy-X-rhodamine) and NED, preferably FAM (carboxyfluorescein) or 6-FAM (6-carboxyfluorescein) and Alexa Fluor® 594. Examples of quenchers include, but are not limited to, TAMRA (tetramethylrhodamine), BHQ™ (Black Hole Quencher™), and EDQ (Eclipse® Dark Quencher), preferably EDQ.
[0067] Thus, according to a particular method, differentiating fluorochromes will be used in the FIP primers of the target sequences of the parasite DNA, such as the PROSIMDIA-SCHISTO-I(M)-FIP primer labeled at 5' with FAM of sequence SEQ ID NO: 19 or the PROSIMDIA-SCHISTO-II(M)-FIP primer labeled at 5' with FAM of sequence SEQ ID NO: 20, and the FIP sequence of the control sequence, such as the PROSIMDIA-SCHISTO-III(M)-FIP primer labeled at 5' with Alexa Fluor® 594 of sequence SEQ ID NO: 21), in order to be able to differentiate the two in the detection step. According to this embodiment, the corresponding quencher probes are the PROSIMDIA-SCHISTO-I(M)-QP probes (modification of 3' Eclipse® Dark Quencher) of sequence SEQ ID NO: 22, PROSIMDIA-SCHISTO-II(M)-QP (modification of 3' Eclipse® Dark Quencher) of sequence SEQ ID NO: 23, and PROSIMDIA-SCHISTO-I(M)-QP (modification of 3' Eclipse® Dark Quencher) of sequence SEQ ID NO: 24. Amplification of target sequences
[0068] The terms "amplification" or "amplification reaction" generally refer to any action or process by which at least a portion of a nucleic acid molecule (called the template nucleic acid molecule) is replicated or copied into at least one additional nucleic acid molecule by means of an enzyme-catalyzed, in vitro, template-dependent reaction. The template nucleic acid molecule may be single- or double-stranded, and the additional nucleic acid molecule may independently be single- or double-stranded. Generally, nucleic acid primers that are complementary to the opposite strands of a Nucleic acid amplification target sequences are allowed to reconnect to the denatured sample. Then, DNA polymerase (usually thermostable) extends the DNA duplex from the hybridized primer.
[0069] According to a particular mode, the target nucleic acid is a deoxyribonucleic acid (DNA) from a parasite, in particular from the genus Schistosoma.
[0070] Amplification reaction mixture
[0071] Generally, amplification conditions refer to a reaction mixture sufficient to amplify nucleic acids such as one or more target sequences, and comprising a catalyst for amplification or nucleic acid synthesis, for example, a polymerase; a primer that possesses a certain degree of complementarity with the nucleic acid to be amplified; and nucleotides, such as deoxyribonucleotide triphosphates (dNTPs), to promote primer extension once it is hybridized to the nucleic acid. Amplification conditions also generally include the duration, buffer, number of cycles, temperature, etc.
[0072] Thus, the preparation of the nucleic acid solution for the LAMP test may include any appropriate manipulation of the nucleic acid, such as collection, dilution, concentration, purification, lyophilization, freezing, extraction, combination with one or more test reagents, performing at least one preliminary reaction to prepare the nucleic acid for one or more test reactions, or any combination thereof, among other things. The preparation of the nucleic acid solution may consist of rendering the nucleic acid solution competent for the subsequent performance of one or more reactions, such as one or more enzyme-catalyzed reactions.
[0073] In some embodiments, the preparation of the nucleic acid solution may include combining the nucleic acid solution with reagents for amplification and for indicating whether amplification has occurred. The amplification reagents may include any combination of primers for the targets, dNTPs and / or NTPs, at least one enzyme, preferably a Bst polymerase, a reaction buffer, a reaction cofactor, preferably a mineral solution, a reaction facilitator, and / or other similar components. Consequently, the nucleic acid preparation may render the nucleic acid solution capable of amplifying each of one or more targets, if they are present in the nucleic acid solution. The reagents may include a different marker for each target of interest.Consequently, the preparation of the nucleic acid solution can make the nucleic acid solution capable of indicating, or being analyzed, whether or not there has been amplification, target by target, and possibly the extent of that amplification.
[0074] The LAMP reaction mixture generally comprises a buffered solution and reagents to carry out an enzymatic amplification reaction.
[0075] The reaction mixture may include nucleotides. The nucleotides may include deoxyribonucleotide triphosphate molecules, in particular dATP, dCTP, dGTP, dTTP, at concentrations of approximately 1.4 mM each.
[0076] The mixture may comprise one or more divalent cations, in particular Mg2+.
[0077] The reaction mixture may include one or more additives, such as amplification activators (for example, betaine (N,N,N-trimethylglycine; [carboxymethyljtrimethylammonium], etc.).
[0078] Thus, the reaction mixture may include, in addition to the specific primers defined above, a buffered solution and reagents for carrying out an enzymatic amplification reaction comprising: - dNTPs, - an isothermal amplification buffer, specific to the enzyme used, - a salt, preferably MgSO4 - a reaction facilitator, preferably betaine, and - a B st polymerase.
[0079] According to a particular method, the reaction mixture for the amplification reaction of the target sequences (parasite DNA) shall comprise: - the internal FIP / BIP primers of the IGS marker or alternatively of the ITS marker, as defined previously, - the external F3 / B3 primers of the IGS marker or alternatively of the ITS marker, as defined above, - possibly also the LF / LB loop primers of the IGS marker or alternatively of the ITS marker, as defined previously, - dNTPs, - an isothermal amplification buffer, specific to the enzyme used, - a salt, preferably MgSO4 - a reaction facilitator, preferably betaine - possibly also the FIP / BIP, F3 / B3 and Loop LF / LB primers of the 18S control marker, as defined previously, - possibly an intercalating agent such as Sybr-green (if real-time fluorescence reading is required), and - a B st polymerase.
[0080] For DNA extracted from 1 to 2 pL, 0.2 to 1.6 pM of each primer, 1.4 mM of dNTPs, and an isothermal amplification buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 150 mM KCl, 2 mM MgSO4, 0.1% Tween® 20, pH 8.8 at 25°C) will generally be used. additional mM of MgSO4 and one unit of Bst polymerase, in a total reaction mixture volume of 25 pL.
[0081] According to a particular method, the amplification reaction mixture comprises 1.2 pM of internal FIP / BIP primers, 0.2 pM of external F3 / B3 primers, 0.4 pM of LOOP LF / LB primers, 1.0 mM of dNTPs, IX isothermal amplification buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 150 mM KC1, 2 mM MgSO4, 0.1% Tween® 20, pH 8.8 at 25°C), an additional 5 mM MgSO4, 1.2 M Betaine, 0.25X Sybr-green (if real-time fluorescence readout) and 1 U Bst 2.0 glycerol-free DNA polymerase (New England Biolabs, UK) in a total volume of 10 or 20 pL depending on the type of detection, with 1 or 2 pL of DNA extract respectively, as obtained according to the upstream processing step to amplification.
[0082] Lyophilization of the reaction mixture
[0083] Advantageously, the reaction mixture is lyophilized. The LAMP reaction mixture in lyophilized form can thus be stored at room temperature for up to at least 6 months.
[0084] According to a particular method, the mixture is lyophilized by adding one or more excipients selected from buffer systems, bulking agents, thermal stabilizing agents, cryoprotectants, and mixtures thereof. In particular, the bulking agents are selected from sugars such as sucrose, lactose, or mannitol; the thermal stabilizing agents are selected from PEGs, dextran, and mannitol; and the cryoprotectants are notably selected from sugars such as trehalose, sucrose, and glucose. A person skilled in the art will be able to determine the formulation of the product to be lyophilized based on the volume of the reaction mixture and the industrial production lyophilizer used. They will also be able to adapt the lyophilization cycle to the formulation thus defined.
[0085] According to a particular method, and without being limiting, D-trehalose is used as a bulking agent, in particular at a concentration of 15 to 30% by weight, in particular 20 to 30% by weight and better a concentration of 25% by weight relative to the weight of the reaction mixture.
[0086] According to a particular method, the tube containing the reaction mixture and the filler is immersed in liquid nitrogen for rapid freezing before being transferred to a freeze dryer for a defined drying time.
[0087] In cases where real-time detection is desired, an intercalating agent such as SYBR Green can also be added. According to a specific method, the Sybr Green supplemented with the same bulking agent can be placed in the stopper of the tube (Eppendorf type), which allows for separate lyophilization of the reaction mixture.
[0088] According to a particular method, as illustrated in the examples, the reaction mixture is lyophilized according to the following protocol: - 25% D-Trehalose is added to the mixture. The mixture is then The tube is immersed in liquid nitrogen for 30 seconds to achieve instant freezing. It is then rapidly transferred to a laboratory freeze dryer, directly into the column, for a primary drying time of at least 4 hours, regardless of the volume (between 20 and 500 pL). The mixture is reconstituted with an aqueous solution to which 1.2 M betaine is added. The amplification reactions are then carried out in a total volume of 1 pL with 2 pL of DNA, at 63°C for 45 minutes. - If the mixture to be lyophilized is revealed in real time, the lyophilization of SYBR Green 0.25X with 25% D-Trehalose is carried out upstream, in the stopper of the tube in which the reaction mixture is to be placed.
[0089] In the LAMP amplification process according to the invention, the target sequence (parasite DNA) is generally amplified at a constant temperature between 60 and 65 °C, preferably 63 °C, for a duration of 40 to 50 minutes, preferably 45 minutes, using a set of LAMP primers (F3 B3 F2 B2 Fl and Bl) and a polymerase with strand displacement activity in addition to replication activity. Each action of the Bst polymerase results in strand displacement and loop formation from the beginning to the end of the amplification. If the results are not immediately visible after the reaction, the Bst polymerase is inactivated by heating at 80 °C for approximately 5 minutes. Detection of amplified DNA
[0090] The detection of amplified DNA is generally carried out according to the protocols classically used in LAMP amplification, for example by the detection of turbidity or a colorimetric change or fluorescence in real time, in particular: i. Detection of the turbidity naturally present in the positive tubes at the end of the reaction, generated by one of the co-products of the amplification reaction: magnesium pyrophosphate; this detection of the turbidity of the reaction liquid in the positive tubes (tubes where there is amplification of the target sequences of the parasite) can be done with the naked eye or with the help of a turbidimeter. ii. Detection of a change in colorimetry or fluorescence at the end of the reaction after the addition of an intercalating agent such as SYBR Green at high concentration (Invitrogen) (green: positive; orange: negative); iii. Detection at the end of the reaction of LAMP products on an agarose gel revealed by UV light, with the addition of a reagent such as MIDORI Green Advance (Nippon Genetics), iv. Real-time detection by incorporating an intercalator such as SYBR Green at low concentration in the amplification reaction mixture and monitoring of the amplification using a detection device such as the Genie III portable device (Optigene Ltd).
[0091] Methods (i), (ii) and (iv) are suitable for use in the field, in developing countries, which do not require non-transportable laboratory equipment (no agarose gel).
[0092] Depending on a particular and preferred mode, method (ii) or (iv) is used.
[0093] Dyes such as SYBR Green can be used as indicators, so it can be seen with the naked eye without the need for expensive equipment. The LAMP method can also be semi-quantitative, since the speed of reaction can be correlated with the parasite load of the subjects.
[0094] According to a particular method, the addition of an intercalating agent such as SYBR green at a high concentration to the sample at the end of the amplification reaction allows the amplified DNA to be detected by a colorimetric change (from orange to green). As an example, 1 µL of 10,000X SYBR green diluted 1:50 is added to each sample (1 µL) at the end of the reaction.
[0095] According to another method, the amplified DNA is detected in real time: in this case, a lyophilized reaction mixture containing SYBR Green, or a mixture containing the internal control, is used and run in a detection device. The SYBR Green at a very low concentration (not visible to the naked eye) intercalates into the amplified DNA fragments, producing a DNA curve whose fluorescence is measurable in real time. Similarly, the labeled primers hybridizing to the target and control DNAs will emit fluorescence that is measurable in real time. The result is displayed directly on the device's screen.
[0096] Thus, according to a particular embodiment of the invention, the detection of target sequences of parasite DNA is carried out by the detection of turbidity or a colorimetric change or fluorescence in real time, in particular using a dual-beam fluorescence reader.
[0097] According to another particular embodiment of the invention, the specific primers (e.g., FIP primers) of the target sequences of parasite DNA, in particular of parasite DNA of the genus Schistosoma, are labeled with fluorochromes of a different wavelength from the fluorochromes of the specific primers (e.g., FIP primers) of the control sequence (e.g., 18S rDNA), as described in the preceding chapter.
[0098] Sample treatment upstream of the amplification reaction
[0099] According to a particular and preferred embodiment of the invention, parasite DNA of the genus Schistosoma is obtained from a urine sample subjected to a treatment comprising at least the following steps: i. DNA concentration by decantation of the sample without agitation or centrifugation, ii. lysis of the decanted fraction, with heating and without agitation or centrifugation, and iii. filtration and elution of parasite DNA.
[0100] The urine sample is collected according to conventional methods known to those skilled in the art. In particular, the urine of a subject is collected in a container, such as a collection bottle.
[0101] The volume of the sample collected will range in particular from 10 to 50 mL.
[0102] Schistosoma eggs are heavy and settle quickly to the bottom of their container. Therefore, the sample processing procedure is preceded by the collection of 10 to 50 mL of sample (subject's urine), using a circular motion to sweep the bottom of the collection bottle (steps 1 and 2 of [Fig. 1]).
[0103] Sample processing is generally estimated at 15-20 minutes for 1 to 8 tests.
[0104] Concentration of DNA by decantation of the sample without agitation or centrifugation
[0105] Decanting of the sample is carried out to concentrate the parasite eggs in the last millilitre of the tube or syringe, thereby reducing the sample volume for the subsequent lysis step.
[0106] The volume of the sample used in the process of the invention shall in particular range from 50 mL to 10 mL. This volume is allowed to settle in a tube or advantageously a syringe, for a period of 1 to 20 minutes depending on the number of samples to be treated simultaneously, in particular 1 to five minutes, preferably two minutes, allowing the concentration of the parasite eggs, circulating DNA and various sediments, at the bottom of the tube or syringe.
[0107] According to a particular embodiment of the invention, a volume of 10 to 50 mL of urine sample is used to obtain a decanted fraction of ImL.
[0108] According to a particular embodiment of the invention, a syringe equipped with a filter is used.
[0109] Lysis of the decanted fraction, with heating and without agitation or centrifugation
[0110] This lysis step allows the parasite DNA to be released from the eggs and substantially purified of the other components that naturally accompany it in the parasite cell. Such isolated parasite DNA can be prepared by simple cell wall lysis. Extraction of parasite DNA generally produces a solution comprising the isolated parasite DNA and water. This solution, or a portion thereof, of this, is then used in the next step to amplify the desired target sequences.
[0111] Thus, after the decantation step, only the decanted fraction (the last milliliters at the bottom of the tube or at the end of the syringe) is transferred into a tube containing a cell lysis buffer (solution A). The tube is then incubated at a temperature and for a duration suitable for the lysis reaction. In particular, the decanted fraction of ImL is transferred into a 2 mL tube containing ImL of lysis buffer, and the 2 mL tube is then incubated at a temperature ranging from 70°C to 100°C, in particular 90°C, for a duration ranging from 5 minutes to 15 minutes, preferably 10 minutes.
[0112] Thus, according to a particular method as illustrated in the examples, after two minutes of decantation, only the last millilitre at the end of the syringe is transferred into a 2 mL tube, which also contains 1 mL of lysis buffer, referred to as solution A (100 mM NaCl, 250 mM EDTA, 5% SDS and 10 mM Tris-HCl (pH=8)) (Javier Gandasegui et al. 2018) (steps 3 and 4 of [Fig. 1]). The 2 mL tube is then incubated at 90°C for 10 minutes (step 5 of [Fig. 1]). Parasite DNA filtration and elution
[0113] The volume of the tube is then withdrawn and filtered through a filter with a porosity ranging from 0.2 µm to 1 µm, in particular 0.45 µm, in order to recover the DNA contained in the lysed cells as well as the circulating DNA initially present in the urine sample. The filter is then washed with a volume of water (solution B) and then dried with an equivalent volume of air. The extracted DNA is then eluted with a volume of solution B by means of filtration in the opposite direction to the filter.
[0114] The "front-to-back" use of the filter thus makes it possible to trap the DNA on the membrane initially, using the conventional filtration direction (front), and then to recover this DNA at the end of the protocol by filtering in the opposite direction (back).
[0115] Thus, according to a particular method, as illustrated in the examples below, after the cell lysis step by heating, the entire tube is withdrawn using a syringe, preferably the same syringe used at the beginning of the process, with the addition of an 18G tip (step 6 of [Fig. 1]). The tip is replaced by the Whatman® GD / XP 0.45 µm, 13 mm filter of the syringe to allow filtration of the 2 mL (step 7 of [Fig. 1]). The filter membrane is washed with 5 mL of water, referred to as solution B, and then dried with an equivalent volume of air (step 8 of [Fig. 1]). Finally, the extracted DNA is eluted with 0.5 mL of solution B, using the syringe coupled with a new 18G tip to allow filtration in the opposite direction to the filter (step 9 of [Fig. 1]).
[0116] According to a particular embodiment of the invention, step i) is carried out in a syringe, step ii) is carried out with a lysis buffer and heating from 70 to 100°C, in in particular 90°C and step iii) of filtration is carried out with a filter with a porosity ranging from 0.2pm to Ipm, in particular 0.45pm.
[0117] According to a particular embodiment of the invention, a volume of 10 to 50 mL of urine sample is used to obtain a decanted fraction of ImL in step i), and double filtration is used in the forward and reverse directions in step iii).
[0118] Reaction mixture for parasite DNA amplification
[0119] Another object of the invention relates to a reaction mixture for the amplification of parasite DNA of the genus Schistosoma comprising at least one set of pan-specific primers capable of simultaneously amplifying and detecting all species of the genus Schistosoma and in particular the species S. haematobium, S. mansoni, S. bovis, S. curassoni and S. japonicum, comprising two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the sequence of the intergenic space (IGS marker, accession number AJ223838 for S. haematobium) and advantageously in addition two 'loop' primers (LF / LB), or alternatively two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the sequence of the internal space of transcripts (ITS marker, accession number GU257398 for S. haematobium) and advantageously also two 'loop' primers (LF / LB).
[0120] According to a particular embodiment of the invention, the primer set of the reaction mixture further comprises an internal control comprising two external primers (F3 / B3) and two internal primers (FIP / BIP) and advantageously further two 'loop' primers (LF / LB) hybridizing with a conserved human sequence, in particular the 18S rDNA sequence.
[0121] According to a particular and preferred embodiment of the invention, the set of primers for the reaction mixture comprises: - two external primers F3 / B3 of sequences SEQ ID NO: 1 and SEQ ID NO: 2, two internal primers FIP / BIP of respective sequences SEQ ID NO: 3 and SEQ ID NO: 4 and advantageously in addition two loop primers of sequences SEQ ID NO: 5 and SEQ ID NO: 6 for the IGS marker, or alternatively two external F3 / B3 primers from sequences SEQ ID NO: 7 and SEQ ID NO: 8, two internal FIP / BIP primers from respective sequences SEQ ID NO: 9 and SEQ ID NO: 10, and advantageously also two loop primers from sequences SEQ ID NO: 11 and SEQ ID NO: 12 for the ITS marker, and - two external primers F3 / B3 of sequences SEQ ID NO: 13 and SEQ ID NO: 14, two internal primers FIP / BIP of sequences SEQ ID NO: 15 and SEQ ID NO: 16, and advantageously in addition two loop primers of sequences SEQ ID NO: 17 and SEQ ID NO: 18 of marker 18S (control).
[0122] The other reagents of the reaction mixture are described previously in the chapter 'amplification reaction mixture'. In particular, the LAMP reaction mixture generally comprises a buffered solution and reagents to carry out an enzymatic amplification reaction, in particular dNTPs and / or NTPs nucleotides, a Bst polymerase, a reaction buffer, a reaction cofactor, preferably a mineral solution, a reaction facilitator, and the primer sets described above.
[0123] According to a particular embodiment, the reaction mixture according to the invention comprises: - the internal FIP / BIP primers of the IGS marker or alternatively of the ITS marker, as defined above, - the external F3 / B3 primers of the IGS marker or alternatively of the ITS marker, as defined above, - possibly also the LF / LB loop primers of the IGS marker or alternatively of the ITS marker, as defined previously, - dNTPs, - an isothermal amplification buffer, specific to the enzyme used, - a salt, preferably MgSO4 - a reaction facilitator, preferably betaine, - possibly also the FIP / BIP, F3 / B3 and Loop LF / LB primers of the 18S control marker, as defined previously, - possibly an intercalating agent such as Sybr-green (if real-time fluorescence reading is required), and - a Bst polymerase.
[0124] For DNA extracted from 1 to 2pL, 0.2 to 1.6pM of each primer, 1.4mM of dNTPs, an isothermal amplification buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 150 mM KC1, 2 mM MgSO4, 0.1% Tween® 20, pH 8.8 at 25°C), an additional 6 mM of MgSO4 and one unit of Bst polymerase will generally be used, in a total reaction mixture volume of 25 pL.
[0125] According to a particular method, the amplification reaction mixture comprises 1.2 pM of internal FIP / BIP primers, 0.2 pM of external F3 / B3 primers, 0.4 pM of LOOP LF / LB primers, 1.0 mM of dNTPs, IX isothermal amplification buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 150 mM KC1, 2 mM MgSO4, 0.1% Tween® 20, pH 8.8 at 25°C), an additional 5 mM MgSO4, 1.2 M Betaine, 0.25X Sybr-green (if real-time fluorescence readout) and 1 U Bst 2.0 glycerol-free DNA polymerase (New England Biolabs, UK) in a total volume of 10 or 20 pL depending on the type of detection, with 1 or 2 pL of DNA extract respectively, as obtained according to the upstream processing step to amplification.
[0126] Advantageously, the reaction mixture is lyophilized as described in the paragraph 'lyophilization of the reaction mixture' described above.
[0127] According to a particular method, D-trehalose is used as a bulking agent, in particular at a concentration of 15 to 30% by weight, in particular 20 to 30% by weight and better a concentration of 25% by weight relative to the weight of the reaction mixture.
[0128] According to a particular method, as illustrated in the examples, the reaction mixture is lyophilized according to the following protocol: - 25% D-Trehalose is added to the mixture. The mixture is then The tube is immersed in liquid nitrogen for 30 seconds to achieve instant freezing. It is then rapidly transferred to a laboratory freeze dryer, directly into the column, for a primary drying time of at least 4 hours, regardless of the volume (between 20 and 500 pL). The mixture is reconstituted with an aqueous solution to which 1.2 M betaine is added. The amplification reactions are then carried out in a total volume of 1 pL with 2 pL of DNA, at 63°C for 45 minutes. - If the mixture to be lyophilized is revealed in real time, the lyophilization of SYBR Green 0.25X with 25% D-Trehalose is carried out upstream, in the stopper of the tube in which the reaction mixture is to be placed.
[0129] According to a particular mode, the reaction mixture of the invention comprises: - D-trehalose, in particular at a content ranging from 15 to 30% by weight of the non-freeze-dried mixture, - sets of Schistosoma-specific pan-specific primers as defined previously, - a set of primers specific to a conserved human sequence (18S) (control), - dNTPs, - an isothermal amplification buffer, specific to the enzyme used, - of MgSO4 - betaine, - a B st DNA polymerase, and - possibly also reagents for detecting target sequences of parasite DNA, such as Sybr-green. Kit or case
[0130] Another object of the invention is a kit or case for the amplification and detection of DNA from a parasite of the genus Schistosoma, comprising: i. The equipment and reagents for carrying out the steps of processing the urine sample and (ii) extracting parasite DNA, including a 10-50 mL S syringe, 16G or 18G gauge tapered dispensing tips, 0.2pm to 1pm porosity filters, in particular 0.45pm, 2mL microtubes, lysis buffer (solution A) and wash buffer (solution B), ii. The lyophilized reaction mixture as defined above, and iii. Reagents for the detection of target sequences of parasite DNA, chosen from reagents revealing a change in colorimetry or revealing fluorescence, in particular Sybr-green.
[0131] In vitro method for extracting parasite DNA
[0132] Another object of the invention is an in vitro process for extracting DNA from parasite, in particular of the genus Schistosoma, from a urine sample of a subject likely to have been infected by said parasite, comprising the following steps: i. DNA concentration by decantation of the sample without agitation or centrifugation, ii. lysis of the decanted fraction, with heating and without agitation or centrifugation, and iii. filtration and elution of parasite DNA.
[0133] The concentration, lysis and filtration steps are described in the chapter 'sample treatment upstream of the amplification reaction' described previously.
[0134] According to a particular mode, step i) is carried out in a syringe, step ii) is carried out with a lysis buffer and heating from 70 to 100°C, in particular 90°C and step iii) of filtration is carried out with a filter of porosity from 0.2pm to 1pm, in particular 0.45pm.
[0135] According to a particular method, a volume of 10 to 50 mL of urine sample is used to obtain a decanted fraction of ImL in step i), and double filtration is used in the forward and reverse directions in step iii).
[0136] Use in an in vitro diagnostic process
[0137] Another object of the invention relates to the use of the in vitro method for detecting DNA from a parasite of the genus Schistosoma from a urine sample of a subject likely to have been infected by said parasite as defined according to the invention, in an in vitro diagnostic method for schistosomiasis or bilharziasis.
[0138] The present invention will now be illustrated in the following non-limiting examples. EXAMPLES 1. Materials and Methods
[0139] a- Sample processing
[0140] Sample processing is generally estimated at 15-20 minutes for 1 to 8 tests.
[0141] Schistosoma eggs are heavy and settle quickly to the bottom of their container. The sample processing begins by collecting 10 ml of sample (subject urine), using a circular motion to sweep the bottom of the jar (steps 1 and 2 of [Fig. 1]). After two minutes of settling, only the first milliliter at the tip of the syringe (concentrated eggs, circulating DNA, and various sediments) is transferred into a 2 mL tube, which also contains 1 mL of lysis buffer, referred to as solution A (100 mM NaCl, 250 mM EDTA, 5% SDS, and 10 mM Tris-HCl (pH=8)) (Javier Gandasegui et al. 2018) (steps 3 and 4 of [Fig. 1]). The 2 mL tube is then incubated at 90°C for 10 minutes (step 5 of [Fig. 1]). The entire tube is withdrawn using the same syringe as at the beginning of the process, with the addition of an 18G tip (step 6 of [Fig. 1]).The tip is replaced with the Whatman® GD / XP 0.45 µm, 13 mm syringe filter to allow filtration of the 2 mL (step 7 of [Fig. 1]). The filter membrane is washed with 5 mL of water, referred to as solution B, and then dried with an equivalent volume of air (step 8 of [Fig. 1]). Finally, the extracted DNA is eluted with 0.5 mL of solution B, using the syringe coupled with a new 18 G tip to allow filtration in the opposite direction to the filter (step 9 of [Fig. 1]).
[0142] b- LAMP reaction
[0143] The LAMP reaction is generally estimated to take 45 minutes.
[0144] Two primer sets were designed for two different markers: the internal transcript spacer (ITS) and the intergenic spacer (IGS) (accession numbers GU257398 and AJ223838, respectively, for S. haematobium) (see Table 1). The primer set amplifying a portion of the IGS is used as a first-line test. If this test is inconclusive, the primer set amplifying a portion of the ITS should be used.
[0145] The reaction mixture selected for the process of the invention consists of 1.2 pM of internal FIP / BIP primers, 0.2 qM of external F3 / B3 primers, 0.4 qM of LOOP LF / LB primers, 1.0 mM of dNTPs, IX isothermal amplification buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 150 mM KCl, 2 mM MgSO4, 0.1% Tween® 20, pH 8.8 at 25°C), an additional 5 mM MgSO4, 1.2 M Betaine, 0.25X Sybr-green (if real-time fluorescence reading is required), and 1 U of WarmStart Bst 2.0 glycerol-free DNA polymerase (New England Biolabs, UK) in a total volume of 10 or 20 qL depending on the type of detection, with 1 qL or 2 of DNA extract respectively.
[0146] The reaction mixture thus prepared is lyophilized according to the following protocol: - 25% D-Trehalose is added to the mixture. The mixture is then The tube is immersed in liquid nitrogen for 30 seconds to achieve instant freezing. It is then rapidly transferred to a laboratory freeze dryer, directly into the column, for a primary drying time of at least 4 hours, regardless of the volume (between 20 and 500 pL). The mixture is reconstituted with an aqueous solution to which 1.2 M betaine is added. The amplification reactions are then carried out in a total volume of 1 pL with 2 pL of DNA, at 63°C for 45 minutes. - If the mixture to be lyophilized is revealed in real time, the lyophilization of SYBR Green 0.25X with 25% D-Trehalose is carried out upstream, in the stopper of the tube in which the reaction mixture is to be placed.
[0147] Controls: - External: A tube containing a reaction mixture containing primers designed to amplify a human marker (18S) is tested in parallel with the reaction (see Table 1). - Internal: The lyophilized mixture includes primers for the target marker (parasite DNA) and the control marker (18S). The FIP primers for each marker are labeled with a fluorochrome of a different wavelength, the fluorescence of which will be read by two beams of the detection instrument, which will discriminate the results for the target from those for the control. The addition of two quenching probes (QPs) to the reaction mixture is necessary to quench free labeled primers (in excess in positive reactions or in the case of a negative reaction) (see Table 1).
[0148] c- Methods of revelation
[0149] The results of the process according to the invention can be obtained by: - Detection of the turbidity naturally present in the positive tubes at the end of the reaction, generated by one of the co-products of the amplification reaction: magnesium pyrophosphate; or - Reading the colorimetric change visible to the naked eye after adding 1 pL of 10,000X SYBR green diluted 1:50 to each sample at the end of the reaction (less expensive method); when the result is positive (detection of parasite DNA, the color changes from the initial orange to fluorescent yellow-green); or - Read the fluorescence in real time with a lyophilized mixture containing SYBR Green in the cap, or a mixture containing the internal control, and run it in the Genie III detection instrument (Optigene). The SYBR Green at a very low concentration (not visible to the naked eye) is intercalated. in the amplified DNA fragments, producing a DNA curve whose fluorescence is measurable in real time. The result is displayed directly on the device's screen. 2. Results
[0150] a- Sensitivity and stability
[0151] The detection limits obtained by coupling the protocol thus defined with the LAMP reaction using the selected candidates (PROSIMDIA-Schisto-I and PROSIMDIA-Schisto-II) are, for circulating DNA, 100 fg / pL of urine, and for eggs, 1 egg in 10 mL of urine. The detection limit in terms of DNA concentration is the same for the sample processing method according to the invention as that obtained with DNA extracted by the QIAGEN kit. In other words, the sample processing method according to the invention does not limit the sensitivity of the diagnostic tool. As for the detection limit in terms of the number of eggs, it is the lowest possible given a sample volume limited to 10 mL. The processing method according to the invention has therefore reached its maximum optimization threshold at 10 mL.Such a lyophilized reaction mixture can be stored for up to 6 months at room temperature in an airtight container including a desiccant sachet, protected from sunlight and light, without loss of efficacy ([Fig.3]).
[0152] b- Specificity
[0153] To complement the in silico specificity study of the primer sets, in vitro specificity tests were performed to experimentally confirm that the primers were pan-specific to the genus Schistosoma and did not amplify other flatworm species (Fasciola gigantica, Fasciola hepatica, Taenia crassiceps, Echinococcus granulosus, Dicrocoelium dendriticum), or human DNA. Figure 4 shows the agarose gel electrophoresis of the specificity tests performed on the ProSh-IGS and ProSh-ITS-1 primer sets, both of which amplify all the tested schistosome species, namely S. haematobium, S. mansoni, S. bovis, S. curassoni, and three strains of S. japonicum (Chinese, Japanese, and Philippine).
[0154] c- Clinical test
[0155] Samples were collected from schoolchildren aged 9 to 12 years in Lampsar, Senegal, as part of the EDCTP2 program (TMA2018CDF-2370), directed by Bruno Senghor, supported by the European Union, and approved by the National Ethics Committee of Senegal (reference no. 000073 / MSAS / DPRS / CNERS). Each child was sampled twice, on two consecutive days, in order to establish three different diagnoses for the same subject: the method according to the invention named 'PROSIMDIA Schisto', qPCR, and parasitology. Since PROSIMDIA Schisto has its own extraction method, designed to concentrate eggs from a complete urine sample, it was not possible to use the same sample for all three diagnoses.
[0156] Each child was therefore sampled twice for the clinical performance analysis of PROSIMDIA Schisto. Sampling continued for five days. A total of 128 children were sampled. The parasitemia of each sample was examined microscopically. For this purpose, 10 mL of urine was filtered, and each slide was read within one hour of collection. Microscopic examination of the urine was considered positive when at least one egg was detected, and negative when no eggs were detected. The remainder of the first sample (maximum 10 mL) was subjected to the PROSIMDIA Schisto treatment protocol according to the invention for detection by LAMP PROSIMDIA Schisto according to the invention, while the remainder of the second sample underwent DNA extraction in the QIAGEN Blood & Tissue kit to obtain a reference Dral qPCR diagnosis. (Guegan et al. 2019; Cnops et al. 2013).Five additional negative control samples without matrix (ultrapure water) were incorporated into the assay, distributed over the 5 sampling days to evaluate the analytical performance of the process according to the PROSIMDIA Schisto invention. Parasitological examinations and all extraction protocols (PROSIMDIA Schisto and QIAGEN extraction) were carried out on-site at UFR 2S, Gaston Berger University, Saint-Louis. LAMP and qPCR were performed at the PARADEV laboratory upon return from the mission.
[0157] On sample No. 1, the method according to the invention detected 36.2%*** (Fisher's exact test, p-value = 3.7 x 10⁻³) more positive subjects than the corresponding microscopic diagnosis of the parasitological examination ([Fig. 5]). On samples No. 2, qPCR detected 54.9% (Fisher's exact test, p-value = 0.09) more subjects compared to the parasitological examination, while LAMP PROSIMDIA Schisto according to the method of the invention combined with conventional DNA extraction showed a prevalence gain of 36.6%** (Fisher's exact test, p-value = 7.9 x 10⁻³), again compared to the microscopic examination. By comparing these prevalence gain ratios, it can be established that the sensitivity of the PROSIMDIA Schisto process according to the invention is 88.2% compared to qPCR when comparing the two techniques on the same sample No. 2, and 87.9% compared to qPCR when comparing the results of samples No. 1 and No. 2.The reproducibility of the PROSIMDIA Schisto method of the invention should be emphasized, maintaining a constant sensitivity of approximately 88% compared to qPCR when applied to two separate samples. The sample processing procedure according to the method of the invention does not limit the sensitivity of the instrument. This assertion is based on the fact that the test performance remains equivalent whether the sample is processed using the method according to the invention or whether a high-performance and costly DNA extraction is performed with the QIAGEN kit. The sensitivity disparities observed between the PROSIMDIA Schisto tests according to... The invention and qPCR therefore appear to be exclusively due to the amplification techniques used.
[0158] All these results therefore show that the in vitro method according to the invention meets the criteria defined by the WHO, in that it is entirely feasible in resource-poor environments such as developing countries, requiring neither sophisticated equipment nor qualified personnel, and can be implemented rapidly and at minimal cost, with better results than microscopic methods (prevalence gain of 36%) and with very good sensitivity, close to qPCR. References
[0159] Cnops, Lieselotte, Patrick Soentjens, Jan Clerinx, and Marjan Van Esbroeck. 2013. “A Schistosoma Haematobium-Specïüc Real-Thne PCR for Diagnosis of Urogenital Schistosomiasis in Serum Samples of International Travelers and Migrants.” PLoS Neglected Tropical Diseases 7 (8): e2413. https: / / doi.org / 10.1371 / journal.pntd.0002413.
[0160] Crego-Vicente, Beatriz, Pedro Femândez-Soto, Begona Febrer-Sendra, Juan Garcia-Bemalt Diego, Jérôme Boissier, Etienne K. Angora, Ana Oleaga, et Antonio Muro. 2021. « Application of a Genus-Specific LAMP Assay for Schistosome Species to Detect Schistosoma Haematobium x Schistosoma Bovis Hybrids ». Journal ofClinical Medicine 10 (6): 1308. https: / / doi.org / 10.3390 / jcml0061308.
[0161] Crompton, David W. T. 2006. « Préventive chemotherapy in human helminthiasis#: coordinated use of anthelminthic drugs in control interventions#: a manual for health professionals and programme managers ». World Health Organization. https: / / apps.who.int / iris / handle / 10665 / 43545.
[0162] Gandasegui, Javier, Pedro Femandez-Soto, Antonio Muro, Constance Simon Barbosa, Fabio Lopes de Melo, Rodrigo Loyo, and Elainne Christine de Souza Gomes. 2018. « A Field Survey Using LAMP Assay for Detection of Schistosoma Mansoni in a Low-Transmission Area of Schistosomiasis in Umbuzeiro, Brazil: Assessment in Human and Snail Samples ». PLOS Neglected Tropical Diseases 12(3):e0006314. https: / / doi.org / 10.137l / journal.pntd.0006314.
[0163] Gebreyesus, Tigist Dires, Tafesse Tadele, Chalkidan Mekete, Abbie Barry, Habtamu Gashaw, Workagegnehu Degefe, Birkneh Tilahun Tadesse, et al. 2020. « Prevalence, Intensity, and Correlates of Schistosomiasis and Soil-Transmitted Helminth Infections after Five Rounds of Preventive Chemotherapy among School Children in Southern Ethiopia ». Pathogens 9(11):920.
[0164] Guegan, Hélène, Judith Filiaux, Eléna Charpentier, Florence Robert-Gangneux, Pamela Chauvin, Emilie Guemas, Jérôme Boissier, et al. 2019. « Real-Thne PCR for Diagnosis of Imported Schistosomiasis ». PLoS Neglected Tropical Diseases 13 (9): e0007711. https: / / doi.org / 10.137 l / journal.pntd.0007711.
[0165] Hardinge, P. and Murray, J.A.H. (2019) ‘Reduced False Positives and Improved Reporting of Loop-Mediated Isothermal Amplification using Quenched Fluorescent Primers’, Scientific Reports, 9(1), p. 7400. Available at: https: / / doi.org / 10.1038 / s41598-019-43817-z.
[0166] Lamberton, Poppy H. L., Narcis B. Kabatereine, David W. Oguttu, Alan Fenwick, et Joanne P. Webster. 2014. « Sensitivity and Specificity of Multiple Kato-Katz Thick Smears and a Circulating Cathodic Antigen Test for Schistosoma Mansoni Diagnosis Pre- and Post-Repeated-Praziquantel Treatment ». PLoS Neglected Tropical Diseases 8 (9): e3139. https: / / doi.org / 10.1371 / joumal.pntd.0003139.
[0167] Madeira, F. et al. (2019) ‘The EMBL-EBI search and sequence analysis tools APIs in 2019.’, Nucleic Acids Research, 47(W1), pp. W636-W641. Available at: https: / / doi.org / 10.1093 / nar / gkz268
[0168] Webster, B.L. and Littlewood, D.T.J. (2012) ‘Mitochondrial gene order change in Schistosoma (Platyhelminthes: Digenea: Schistosomatidaef, International Journal for Parasitology, 42(3), pp. 313-321. Available at: https: / / doi.org / 10.1016 / j.ijpara.2012.02.001.
Claims
Demands
1. An in vitro method for detecting Schistosoma parasite DNA from a urine sample of a subject suspected of having been infected with said parasite, comprising an isothermal amplification step with a pan-specific primer set capable of simultaneously amplifying and detecting the species S. haematobium, S. mansoni, S. bovis, S. curassoni, and S. japonicum, comprising two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the intergenic space sequence (IGS marker, SEQ ID NO: 27 for S. haematobium) and advantageously further comprising two loop primers (LF / LB), or alternatively two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the internal space sequence of transcripts (ITS marker, SEQ ID NO: 27 for S. haematobium) NO: 31 for S. haematobium) and advantageously also two 'loop' primers (LF / LB).
2. The method according to claim 1, characterized in that the primer set comprises two external F3 / B3 primers of sequences SEQ ID NO: 1 and SEQ ID NO: 2, two internal FIP / BIP primers of respective sequences SEQ ID NO: 3 and SEQ ID NO: 4 and advantageously further two loop primers of sequences SEQ ID NO: 5 and SEQ ID NO: 6 for the IGS marker, or alternatively two external F3 / B3 primers of sequences SEQ ID NO: 7 and SEQ ID NO: 8, two internal FIP / BIP primers of respective sequences SEQ ID NO: 9 and SEQ ID NO: 10 and advantageously further two loop primers of sequences SEQ ID NO: 11 and SEQ ID NO: 12 for the ITS marker.
3. A method according to claim 1 or claim 2, characterized in that the primer set further comprises an internal control comprising two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with a conserved human sequence, in particular the 18S rDNA sequence.
4. The method according to claim 3, characterized in that the internal control comprises two external primers F3 / B3 of sequences SEQ ID NO: 13 and SEQ ID NO: 14, two internal primers FIP / BIP of sequences SEQ ID NO: 15 and SEQ ID NO: 16, and advantageously further two loop primers of sequences SEQ ID NO: 17 and SEQ ID NO: 18 of the 18S marker.
5. A method according to any one of claims 3 or 4, characterized in that the pan-specific primers of the target sequences of parasite DNA of the genus Schistosoma are labeled with fluorochromes of a different wavelength from the fluorochromes of the control sequence-specific primers.
6. A method according to any one of claims 1 to 5, characterized in that the detection of target sequences of parasite DNA is carried out by the detection of turbidity or colorimetric change or fluorescence in real time.
7. A method according to any one of claims 1 to 6, characterized in that the subject is a definitive mammalian host, in particular a human or an animal selected from cattle and sheep, preferably the subject is a human.
8. A reaction mixture for the amplification of parasite DNA of the genus Schistosoma comprising at least one set of pan-specific primers capable of simultaneously amplifying and detecting the species S. haematobium, S. mansoni, S. bovis, S. curassoni and S. japonicum, comprising two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the intergenic space sequence (IGS marker, SEQ ID NO: 27 for S. haematobium) and advantageously further two loop primers (LF / LB), or alternatively two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the internal space sequence of transcripts (ITS marker, SEQ ID NO: 31 for S. haematobium) and advantageously further two primers 'loop' (LF / LB).
9. Reaction mixture according to claim 8, characterized in that the primer set further comprises an internal control comprising two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with a conserved human sequence, in particular the 18S rDNA sequence.
10. Reaction mixture according to claim 8 or claim 9, characterized in that the primer set comprises: - two external F3 / B3 primers of sequences SEQ ID NO: 1 and SEQ ID NO: 2, two internal FIP / BIP primers of respective sequences SEQ ID NO: 3 and SEQ ID NO: 4 and advantageously in addition two loop primers of sequences SEQ ID NO: 5 and SEQ ID NO: 6 for the IGS marker, or alternatively two external F3 / B3 primers of sequences SEQ ID NO: 7 and SEQ ID NO: 8, two internal FIP / BIP primers of respective sequences SEQ ID NO: 9 and SEQ ID NO: 10 and advantageously in addition two loop primers of sequences SEQ ID NO: 11 and SEQ ID NO: 12 for the ITS marker, and - two external F3 / B3 primers of sequences SEQ ID NO: 13 and SEQ ID NO: 14, two internal FIP / BIP primers of sequences SEQ ID NO: 15 and SEQ ID NO: 16, and advantageously in addition two loop primers of sequences SEQ ID NO: 17 and SEQ ID NO: 18 of marker 18S (control).
11. Reaction mixture according to any one of claims 8 to 10, characterized in that it is a lyophilized reaction mixture, comprising one or more excipients selected from bulking agents, thermal stabilizing agents, cryoprotectants, and mixtures thereof.
12. Mixture according to claim 11, characterized in that it comprises: - D-trehalose, in particular in a content of 15 to 30% by weight of the unlyophilized mixture, - Schistosoma pan-specific primer sets as defined in claims 8 and 10, - a conserved human sequence (18S) specific primer set (control), - dNTPs, - an isothermal amplification buffer, - a B st DNA polymerase, and - optionally further, reagents for detecting parasite DNA target sequences, such as Sybr-green.
13. Kit or case for the detection and amplification of parasite DNA of the genus Schistosoma, comprising:
14. i. The equipment and reagents for carrying out the steps of processing the urine sample and (ii) extracting parasite DNA, including a 10-50 mL S syringe, 16G or 18G gauge tapered dispensing tips, 0.2pm to 1pm porosity filters, in particular 0.45pm, 2mL microtubes, lysis buffer (solution A) and wash buffer (solution B), ii. The lyophilized reaction mixture as defined in claims 11 and 12, and iii. Reagents for the detection of target sequences of parasite DNA, chosen from reagents revealing a change in colorimetry or revealing fluorescence, in particular Sybr-green. An in vitro method for extracting and detecting parasite DNA, in particular of the genus Schistosoma, from a urine sample of a subject likely to have been infected by said parasite, comprising the following steps:
15.
16.
17. i. DNA concentration by decantation of the sample without agitation or centrifugation, ii. lysis of the decanted fraction, with heating and without agitation or centrifugation, iii. filtration and elution of parasite DNA, and iv. an isothermal amplification step with a pan-specific primer set capable of simultaneously amplifying and detecting the species S. haematobium, S. mansoni, S. bovis, S. curassoni, and S. japonicum, comprising two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the intergenic space sequence (IGS marker, accession number AJ223838 or SEQ ID NO: 27 for S. haematobium) and advantageously further two loop primers (LF / LB), or alternatively two external primers (F3 / B3) and two internal primers (FIP / BIP) hybridizing with the internal space sequence of transcripts (ITS marker, accession number GU257398 or SEQ ID NO: 31 for S. haematobium) and advantageously in in addition to two 'loop' primers (LF / LB), in particular the primer set as defined in claim 2. A process according to claim 16, characterized in that step i) is carried out in a syringe, step ii) is carried out with a lysis buffer and heating from 70 to 100°C, in particular 90°C and step iii) of filtration is carried out with a filter of porosity from 0.2pm to 1pm, in particular 0.45pm. A method according to claim 18, characterized in that a volume of 10 to 50 mL of urine sample is used to obtain a decanted fraction of ImL in step i), and double filtration is used in the forward and reverse directions in step iii). Use of the in vitro method for detecting parasite DNA of the genus Schistosoma from a urine sample of a subject likely to have been infected by said parasite as defined in any one of claims 1 to 7, in an in vitro diagnostic method for schistosomiasis or bilharzia.