Diagnostic chromosome marker

Chromosome conformation signatures using EpiSwitch™ technology allow for precise ASD identification and severity assessment, enabling personalized treatment strategies.

GB2604247BActive Publication Date: 2025-07-02OXFORD BIODYNAMICS PLC
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
GB2022004550
Authority / Receiving Office
GB · GB
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-09-11
Filing Date
2020-09-10
Publication Date
2025-07-02
Estimated Expiration
2040-09-10

AI Technical Summary

Technical Problem

Current methods lack the ability to accurately identify and differentiate between various forms and severities of Autism Spectrum Disorder (ASD) based on genetic markers, hindering personalized treatment approaches.

Method used

The use of chromosome conformation signatures, specifically detecting interactions at defined chromosome positions, to identify specific ASD markers through EpiSwitch™ technology, allowing for the detection of ligated nucleic acids indicative of ASD presence or absence.

Benefits of technology

Enables precise identification of ASD types and severities, facilitating personalized therapy by accurately determining the presence or absence of chromosome interactions, thereby improving treatment efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000001_0000
    Figure 00000001_0000
  • Figure 00000003_0000
    Figure 00000003_0000
  • Figure 00000005_0000
    Figure 00000005_0000
Patent Text Reader

Abstract

A process for analysing chromosome regions and interactions relating to prognosis of Autism Spectrum Disorder.
Need to check novelty before this filing date? Find Prior Art

Description

Field of the Invention The invention relates to disease markers. Background of the Invention 5 Autism Spectrum Disorder (ASD) is believed to be associated with a combination of genetic and environmental factors. Risk factors may include certain infections, toxins, autoimmune diseases, cocaine and air pollutants. Globally, autism is estimated to affect 24.8 million people (estimate at 2015). In developed countries almost 1.5% of children are diagnosed with ASD (estimated at 2017). This rate has significantly increased from 0.7%, as estimated in 2000. 10 Summary of the Invention The invention is based on the finding that using chromosome conformation signatures to measure systemic significant differences in 3D genome architecture as detected in surrogate systemic profiling, one is able to identify disseminating individual chromosome conformations specific for autism spectrum disorder (ASD) and for different forms of ASD. 15 Accordingly, the invention provides a process for determining prognosis for autism spectrum disorder (ASD) in an individual comprising detecting in a sample from the individual the presence or absence of one or more of the chromosome interactions (i) to (xx) listed below: (i) the chromosome interaction on chromosome 7 formed by the first region of chromosome position 20 number 106136913 to 106136942 and the second region of chromosome position number 106155637 to 106155666 the presence of which is associated with severe ASD, (ii) the chromosome interaction on chromosome 2 formed by the first region of chromosome position number 209638896 to 209638925 and the second region of chromosome position number 209692609 to 209692638 the presence of which is associated with severe ASD, 25 (iii) the chromosome interaction on chromosome 2 formed by the first region of chromosome position number 39609951 to 39609980 and the second region of chromosome position number 39623227 to 39623256 the presence of which is associated with severe ASD, (iv) the chromosome interaction on chromosome 6 formed by the first region of chromosome position number 46267217 to 46267246 and the second region of chromosome position number 46295957 to 30 46295986 the presence of which is associated with mild ASD, 05 03 25 (v) the chromosome interaction on chromosome 3 formed by the first region of chromosome position number 120809117 to 120809146 and the second region of chromosome position number 120844724 to 120844753 the presence of which is associated with mild ASD, (vi) the chromosome interaction on chromosome 10 formed by the first region of chromosome position 5 number 3161201 to 3161230 and the second region of chromosome position number 3210552 to 3210581 the presence of which is associated with mild ASD, (vii) the chromosome interaction on chromosome 2 formed by the first region of chromosome position number 198099688 to 198099717 and the second region of chromosome position number 198137326 to 198137355 the presence of which is associated with severe ASD, 10 (viii) the chromosome interaction on chromosome 12 formed by the first region of chromosome position number 30144612 to 30144641 and the second region of chromosome position number 30181631 to 30181660 the presence of which is associated with mild ASD, (ix) the chromosome interaction on chromosome 19 formed by the first region of chromosome position number 52224154 to 52224183 and the second region of chromosome position number 52267683 to 15 52267712 the presence of which is associated with severe ASD, (x) the chromosome interaction on chromosome 6 formed by the first region of chromosome position number 157189220 to 157189249 and the second region of chromosome position number 157240029 to 157240058 the presence which is associated with mild ASD, (xi) the chromosome interaction on chromosome 7 formed by the first region of chromosome position 20 number 106136913 to 106136942 and the second region of chromosome position number 106183994 to 106184023 the presence of which is associated with severe ASD, (xii) the chromosome interaction on chromosome 21 formed by the first region of chromosome position number 17087460 to 17087489 and the second region of chromosome position number 17114098 to 17114127 the presence of which is associated with mild ASD, 25 (xiii) the chromosome interaction on chromosome 10 formed by the first region of chromosome position number 106496979 to 106497008 and the second region of chromosome position number 106538148 to 106538177 the presence of which is associated with mild ASD, (xiv) the chromosome interaction on chromosome 8 formed by the first region of chromosome position number 31178906 to 31178935 and the second region of chromosome position number 31205591 to 30 31205620 the presence of which is associated with mild ASD, (xv) the chromosome interaction on chromosome 13 formed by the first region of chromosome position number 34433098 to 34433127 and the second region of chromosome position number 34463900 to 34463929 the presence of which is associated with mild ASD, (xvi) the chromosome interaction on chromosome 5 formed by the first region of chromosome position 35 number 149610434 to 149610463 and the second region of chromosome position number 149663577 to 149663606 the presence of which is associated with severe ASD, 05 03 25 (xvii) the chromosome interaction on chromosome 3 formed by the first region of chromosome position number 43042541 to 43042570 and the second region of chromosome position number 43075798 to 43075827 the presence of which is associated with mild ASD, (xviii) the chromosome interaction on chromosome 14 formed by the first region of chromosome position 5 number 99794537 to 99794566 and the second region of chromosome position number 99818383 to 99818412 the presence of which is associated with mild ASD, (xix) the chromosome interaction on chromosome 7 formed by the first region of chromosome position number 22368714 to 22368743 and the second region of chromosome position number 22401548 to 22401577 the presence of which is associated with severe ASD, 10 (xx) the chromosome interaction on chromosome 18 formed by the first region of chromosome position number 58202024 to 58202053 and the second region of chromosome position number 58217905 to 58217934 the presence of which is associated with severe ASD; and wherein at least the presence or absence of chromosome interaction (iii) is detected. Detailed Description of the Invention 15 Aspects of the Invention The invention concerns determining prognosis in ASD, including in respect to the severity and / or type of ASD is aggressive or indolent. This determining is by typing any of the relevant markers disclosed herein, for example in any of the Tables, or preferred combinations of markers, or markers in defined specific regions disclosed herein. Thus the invention relates to a method of typing an individual to determine the 20 ASD status, for example to diagnose ASD or the type of ASD, or to determine prognosis for ASD or the type of ASD. Essentially in the process of the invention subpopulations of ASD can be identified by typing of the markers. Therefore the invention, for example, concerns a panel of epigenetic markers which relates to prognosis ASD. The invention therefore allows personalised therapy to be given to the patient which 25 accurately reflects the patient's needs. Any therapy, for example drug, which is mentioned herein may be administered to an individual based on the result of the typing. The process of the invention may thus be carried out to select an individual for a medical treatment. Preferably the markers which are typed in the process are those represented by probe or primer sequences in the tables. The Process of the Invention 05 03 25 The process of the invention comprises a typing system for detecting chromosome interactions relevant to prognosis. This typing may be performed using the EpiSwitch™ system mentioned herein which is based on cross-linking regions of chromosome which have come together in the chromosome interaction, 5 subjecting the chromosomal DNA to cleavage and then ligating the nucleic acids present in the crosslinked entity to derive a ligated nucleic acid with sequence from both the regions which formed the chromosomal interaction. Detection of this ligated nucleic acid allows determination of the presence or absence of a particular chromosome interaction. The chromosomal interactions may be identified using the above described method in which populations 10 of first and second nucleic acids are used. These nucleic acids can also be generated using EpiSwitch™ technology. The Epigenetic Interactions Relevant to the Invention As used herein, the term 'epigenetic' and 'chromosome' interactions typically refer to interactions between distal regions of a chromosome, said interactions being dynamic and altering, forming or 15 breaking depending upon the status of the region of the chromosome. In particular processes of the invention chromosome interactions are typically detected by first generating a ligated nucleic acid that comprises sequence from both regions of the chromosomes that are part of the interactions. In such processes the regions can be cross-linked by any suitable means. In a preferred aspect, the interactions are cross-linked using formaldehyde, but may also be cross-linked by any 20 aldehyde, or D-Biotinoyl-e- aminocaproic acid-N-hydroxysuccinimide ester or Digoxigenin-3-O-methylcarbonyl-e-aminocaproic acid-N-hydroxysuccinimide ester. Para-formaldehyde can cross link DNA chains which are 4 Angstroms apart. Preferably the chromosome interactions are on the same chromosome and optionally 2 to 10 Angstroms apart. The chromosome interaction may reflect the status of the region of the chromosome, for example, if it is 25 being transcribed or repressed in response to change of the physiological conditions. Chromosome interactions which are specific to subgroups as defined herein have been found to be stable, thus providing a reliable means of measuring the differences between the two subgroups. In addition, chromosome interactions specific to a characteristic (such as prognosis) will normally occur early in a biological process, for example compared to other epigenetic markers such as methylation or 30 changes to binding of histone proteins. Thus the process of the invention is able to detect early stages of a biological process. This allows early intervention (for example treatment) which may as a consequence 05 03 25 be more effective. Chromosome interactions also reflect the current state of the individual and therefore can be used to assess changes to prognosis. Furthermore, there is little variation in the relevant chromosome interactions between individuals within the same subgroup. Detecting chromosome interactions is highly informative with up to 50 different possible interactions per gene, and so processes 5 of the invention can interrogate 500,000 different interactions. There is no one-to-one correspondence between chromosome interactions and genetic markers or other types of epigenetic markers, such as methylation. Chromosome interactions therefore represent a separate modality of regulation. Preferred Marker Sets 10 Herein the term 'marker' or 'biomarker' refers to a specific chromosome interaction which can be detected (typed) in the invention. Specific markers are disclosed herein, any of which may be used in the invention. Further sets of markers may be used, for example in the combinations or numbers disclosed herein. The specific markers disclosed in the tables herein are preferred as well as markers presents in genes and regions mentioned in the tables herein are preferred. These may be typed by any suitable 15 method, for example the PCR or probe based methods disclosed herein, including a qPCR method. The markers are defined herein by location or by probe and / or primer sequences. Location and Causes of Chromosome Interactions Chromosome interactions may overlap and include the regions of chromosomes shown to encode relevant or undescribed genes, but equally may be in intergenic regions. It should further be noted that 20 the inventors have discovered that epigenetic interactions in all regions are equally important in determining the status of the chromosomal locus. These interactions are not necessarily in the coding region of a particular gene located at the locus and may be in intergenic regions. The chromosome interactions which are detected in the invention could be impacted by changes to the underlying DNA sequence, by environmental factors, DNA methylation, non-coding antisense RNA 25 transcripts, non-mutagenic carcinogens, histone modifications, chromatin remodelling and specific local DNA interactions. The changes which lead to the chromosome interactions may be impacted by changes to the underlying nucleic acid sequence, which themselves do not directly affect a gene product or the mode of gene expression. Such changes may be for example, SNPs within and / or outside of the genes, gene fusions and / or deletions of intergenic DNA, microRNA, and non-coding RNA. For example, it is 30 known that roughly 20% of SNPs are in non-coding regions, and therefore the process as described is also informative in non-coding situation. In one aspect the regions of the chromosome which come 05 03 25 together to form the interaction are less than 5 kb, 3 kb, 1 kb, 500 base pairs or 200 base pairs apart on the same chromosome. The chromosome interaction which is detected is preferably within any of the genes mentioned in any of Tables 1, 2, 3 or 4. However it may also be upstream ordownstream of the gene, for example upto 50,000, 5 up to 30,000, up to 20,000, up to 10,000 or up to 5000 bases upstream or downstream from the gene or from the coding sequence. Subgroups, Time Points and Personalised Treatment In one aspect the present invention determines prognosis. This may be at one or more defined time points, for example at at least 1, 2, 5, 8 or 10 different time points. The durations between at least 1, 2, 5 10 or 8 of the time points may be at least 5,10, 20, 50, 80 or 100 days. As used herein, a "subgroup" preferably refers to a population subgroup, more preferably a subgroup in the population of a particular animal such as a particular eukaryote, or mammal (e.g. human, non-human, non-human primate, or rodent e.g. mouse or rat). Most preferably, a "subgroup" refers to a subgroup in the human population. 15 The invention includes detecting and treating particular subgroups in a population. The inventors have discovered that chromosome interactions differ between subsets (for example at least two subsets) in a given population. Identifying these differences will allow physicians to categorize their patients as a part of one subset of the population as described in the process. The invention therefore provides physicians with a process of personalizing medicine for the patient based on their epigenetic chromosome 20 interactions, for example the type of drug and / or its dose and / or its frequency of administration. The invention relates toany specific condition that comes within the broad definition of ASD. In one aspect the condition is autistic disorder or childhood autism. The condition may be Asperger's syndrome, PDD-NOS (Pervasive Development Disorder) or childhood disintegrative disorder. The invention relates to any PDD-NOS condition including an addictive condition, such as addiction to substances or digital media 25 devices. ASD EpiSwitch markers reveal epigenetic deregulations and regulatory defects in addiction pathways, pathways of neuroxins and neuroligins regulation, estrogen signalling, TH17 differentiation and regullation of NK cells, Hippo, IL4 and IL13 regulation, HPV infection and mTOR signalling. Generating Ligated Nucleic Acids Certain aspects of the invention utilise ligated nucleic acids, in particular ligated DNA. These comprise 30 sequences from both of the regions that come together in a chromosome interaction and therefore 05 03 25 provide information about the interaction. The EpiSwitch™ method described herein uses generation of such ligated nucleic acids to detect chromosome interactions. Thus a process of the invention may comprise a step of generating ligated nucleic acids (e.g. DNA) by the following steps (including a method comprising these steps): 5 (i) cross-linking of epigenetic chromosomal interactions present at the chromosomal locus, preferably in vitro; (ii) optionally isolating the cross-linked DNA from said chromosomal locus; (iii) subjecting said cross-linked DNA to cutting, for example by restriction digestion with an enzyme that cuts it at least once (in particular an enzyme that cuts at least once within said chromosomal locus); 10 (iv) ligating said cross-linked cleaved DNA ends (in particular to form DNA loops); and (v) optionally identifying the presence of said ligated DNA and / or said DNA loops, in particular using techniques such as PCR (polymerase chain reaction), to identify the presence of a specific chromosomal interaction. These steps may be carried out to detect the chromosome interactions for any aspect mentioned herein. 15 The steps may also be carried out to generate the first and / or second set of nucleic acids mentioned herein. PCR (polymerase chain reaction) may be used to detect or identify the ligated nucleic acid, for example the size of the PCR product produced may be indicative of the specific chromosome interaction which is present, and may therefore be used to identify the status of the locus. In preferred aspects at least 1, 2 20 or 3 primers or primer pairs as shown in Table 5 are used in the PCR reaction. In other aspects at least 1, 10, 20, 30, 50 or 80 of the primers or primer pairs as shown in Table 1, 2, 3 or 4 are used in the PCR reaction. The skilled person will be aware of numerous restriction enzymes which can be used to cut the DNA within the chromosomal locus of interest. It will be apparent that the particular enzyme used will depend upon the locus studied and the sequence of the DNA located therein. A non-limiting example of 25 a restriction enzyme which can be used to cut the DNA as described in the present invention is TaqL EpiSwitch™ Technology The EpiSwitch™ Technology also relates to the use of microarray EpiSwitch™ marker data in the detection of epigenetic chromosome conformation signatures specific for phenotypes. Aspects such as EpiSwitch™ which utilise ligated nucleic acids in the manner described herein have several advantages. They have a 05 03 25 low level of stochastic noise, for example because the nucleic acid sequences from the first set of nucleic acids of the present invention either hybridise or fail to hybridise with the second set of nucleic acids. This provides a binary result permitting a relatively simple way to measure a complex mechanism at the epigenetic level. EpiSwitch™ technology also has fast processing time and low cost. In one aspect the 5 processing time is 3 hours to 6 hours. Samples and Sample Treatment The process of the invention will normally be carried out on a sample. The sample may be obtained at a defined time point, for example at any time point defined herein. The sample will normally contain DNA from the individual. It will normally contain cells. In one aspect a sample is obtained by minimally invasive 10 means, and may for example be a blood sample. DNA may be extracted and cut up with a standard restriction enzyme. This can pre-determine which chromosome conformations are retained and will be detected with the EpiSwitch™ platforms. Due to the synchronisation of chromosome interactions between tissues and blood, including horizontal transfer, a blood sample can be used to detect the chromosome interactions in tissues, such as tissues relevant to disease. 15 Properties of Nucleic Acids of the Invention The invention relates to certain nucleic acids, such as the ligated nucleic acids which are described herein as being used or generated in the process of the invention. These may be the same as, or have any of the properties of, the first and second nucleic acids mentioned herein. The nucleic acids of the invention 20 typically comprise two portions each comprising sequence from one of the two regions of the chromosome which come together in the chromosome interaction. Typically each portion is at least 8, 10, 15, 20, 30 or 40 nucleotides in length, for example 10 to 40 nucleotides in length. Preferred nucleic acids comprise sequence from any of the genes mentioned in any of the tables. Typically preferred nucleic acids comprise the specific probe sequences mentioned in Table 1, 2, 3 or 4; or fragments and / or homologues 25 of such sequences. Preferably the nucleic acids are DNA. It is understood that where a specific sequence is provided the invention may use the complementary sequence as required in the particular aspect. Preferably the nucleic acids are DNA. It is understood that where a specific sequence is provided the invention may use 30 the complementary sequence as required in the particular aspect. The primers shown in any of Tables 1, 2, 3 or 4 may also be used in the invention as mentioned herein. In one aspect primers are used which comprise any of: the sequences shown in Table 1, 2, 3 or 4; or fragments and / or homologues of any sequence shown in Table 1, 2, 3 or 4. 05 03 25 The 'First' and 'Second' Nucleic Acids In one aspect of the invention: - the second set of nucleic acids is from a larger group of individuals than the first set of nucleic acids; and / or 5 - the first set of nucleic acids is from at least 8 individuals; and / or - the first set of nucleic acids is from at least 4 individuals from a first subgroup and at least 4 individuals from a second subgroup which is preferably non-overlapping with the first subgroup. In a further aspect of the invention: 10 - the second set of nucleic acids represents an unselected group; and / or - wherein the second set of nucleic acids is bound to an array at defined locations; and / or -wherein the second set of nucleic acids represents chromosome interactions in least 100 different genes; and / or - wherein the second set of nucleic acids comprises at least 1,000 different nucleic acids representing at 15 least 1,000 different chromosome interactions; and / or - wherein the first set of nucleic acids and the second set of nucleic acids comprise at least 100 nucleic acids with length 10 to 100 nucleotide bases. The Second Set of Nucleic Acids - the 'Index' Sequences 20 The second set of nucleic acid sequences has the function of being a set of index sequences, and is essentially a set of nucleic acid sequences which are suitable for identifying subgroup specific sequence. They can represents the 'background' chromosomal interactions and might be selected in some way or be unselected. They are in general a subset of all possible chromosomal interactions. The second set of nucleic acids may be derived by any suitable process. They can be derived 25 computationally or they may be based on chromosome interaction in individuals. They typically represent a larger population group than the first set of nucleic acids. In one particular aspect, the second set of nucleic acids represents all possible epigenetic chromosomal interactions in a specific set of genes. In another particular aspect, the second set of nucleic acids represents a large proportion of all possible epigenetic chromosomal interactions present in a population described herein. In one particular aspect, 30 the second set of nucleic acids represents at least 50% or at least 80% of epigenetic chromosomal interactions in at least 20, 50, 100 or 500 genes, for example in 20 to 100 or 50 to 500 genes. The second set of nucleic acids typically represents at least 100 possible epigenetic chromosome interactions which modify, regulate or in any way mediate a phenotype in population. The second set of nucleic acids may represent chromosome interactions that affect a disease state (typically relevant to 05 03 25 diagnosis or prognosis) in a species. The second set of nucleic acids typically comprises sequences representing epigenetic interactions both relevant and not relevant to a prognosis subgroup. In one particular aspect the second set of nucleic acids derive at least partially from naturally occurring sequences in a population, and are typically obtained by in silico processes. Said nucleic acids may further 5 comprise single or multiple mutations in comparison to a corresponding portion of nucleic acids present in the naturally occurring nucleic acids. Mutations include deletions, substitutions and / or additions of one or more nucleotide base pairs. In one particular aspect, the second set of nucleic acids may comprise sequence representing a homologue and / or orthologue with at least 70% sequence identity to the corresponding portion of nucleic acids present in the naturally occurring species. In another particular 10 aspect, at least 80% sequence identity or at least 90% sequence identity to the corresponding portion of nucleic acids present in the naturally occurring species is provided. Properties of the Second Set of Nucleic Acids In one particular aspect, there are at least 100 different nucleic acid sequences in the second set of nucleic acids, preferably at least 1000, 2000 or 5000 different nucleic acids sequences, with up to 100,000, 15 1,000,000 or 10,000,000 different nucleic acid sequences. A typical number would be 100 to 1,000,000, such as 1,000 to 100,000 different nucleic acids sequences. All or at least 90% or at least 50% or these would correspond to different chromosomal interactions. In one particular aspect, the second set of nucleic acids represent chromosome interactions in at least 20 different loci or genes, preferably at least 40 different loci or genes, and more preferably at least 100, at 20 least 500, at least 1000 or at least 5000 different loci or genes, such as 100 to 10,000 different loci or genes. The lengths of the second set of nucleic acids are suitable for them to specifically hybridise according to Watson Crick base pairing to the first set of nucleic acids to allow identification of chromosome interactions specific to subgroups. Typically the second set of nucleic acids will comprise two portions corresponding in sequence to the two chromosome regions which come together in the 25 chromosome interaction. The second set of nucleic acids typically comprise nucleic acid sequences which are at least 10, preferably 20, and preferably still 30 bases (nucleotides) in length. In another aspect, the nucleic acid sequences may be at the most 500, preferably at most 100, and preferably still at most 50 base pairs in length. In a preferred aspect, the second set of nucleic acids comprises nucleic acid sequences of between 17 and 25 base pairs. In one aspect at least 100, 80% or 50% of the second set of nucleic acid 30 sequences have lengths as described above. Preferably the different nucleic acids do not have any overlapping sequences, for example at least 100%, 90%, 80% or 50% of the nucleic acids do not have the same sequence over at least 5 contiguous nucleotides. 05 03 25 Given that the second set of nucleic acids acts as an 'index' then the same set of second nucleic acids may be used with different sets of first nucleic acids which represent subgroups for different characteristics, i.e. the second set of nucleic acids may represent a 'universal' collection of nucleic acids which can be used to identify chromosome interactions relevant to different characteristics. 5 The First Set of Nucleic Acids The first set of nucleic acids are typically from subgroups relevant to prognosis. The first nucleic acids may have any of the characteristics and properties of the second set of nucleic acids mentioned herein. The first set of nucleic acids is normally derived from samples from the individuals which have undergone treatment and processing as described herein, particularly the EpiSwitch™ cross-linking and cleaving 10 steps. Typically the first set of nucleic acids represents all or at least 80% or 50% of the chromosome interactions present in the samples taken from the individuals. Typically, the first set of nucleic acids represents a smaller population of chromosome interactions across the loci or genes represented by the second set of nucleic acids in comparison to the chromosome 15 interactions represented by second set of nucleic acids, i.e. the second set of nucleic acids is representing a background or index set of interactions in a defined set of loci or genes. Library of Nucleic Acids Any of the types of nucleic acid populations mentioned herein may be present in the form of a library 20 comprising at least 200, at least 500, at least 1000, at least 5000 or at least 10000 different nucleic acids of that type, such as 'first' or 'second' nucleic acids. Such a library may be in the form of being bound to an array. The library may comprise some or all of the probes or primer pairs shown in any of Tables 1, 2, 3 or 4. The library may be in the form of a composition or may be in the form of a kit where the nucleic acids are provided in separate containers. 25 Hybridisation The invention requires a means for allowing wholly or partially complementary nucleic acid sequences from the first set of nucleic acids and the second set of nucleic acids to hybridise. In one aspect all of the first set of nucleic acids is contacted with all of the second set of nucleic acids in a single assay, i.e. in a single hybridisation step. However any suitable assay can be used. 30 Labelled Nucleic Acids and Pattern of Hybridisation 05 03 25 The nucleic acids mentioned herein may be labelled, preferably using an independent label such as a fluorophore (fluorescent molecule) or radioactive label which assists detection of successful hybridisation. Certain labels can be detected under UV light. The pattern of hybridisation, for example on an array described herein, represents differences in epigenetic chromosome interactions between the two 5 subgroups, and thus provides a process of comparing epigenetic chromosome interactions and determination of which epigenetic chromosome interactions are specific to a subgroup in the population of the present invention. The term 'pattern of hybridisation' broadly covers the presence and absence of hybridisation between the first and second set of nucleic acids, i.e. which specific nucleic acids from the first set hybridise to 10 which specific nucleic acids from the second set, and so it not limited to any particular assay or technique, or the need to have a surface or array on which a 'pattern' can be detected. Selecting a Subgroup with Particular Characteristics The invention provides a process which comprises detecting the presence or absence of chromosome interactions, typically 5 to 20 or 5 to 500 such interactions, preferably 20 to 300 or 50 to 100 interactions, 15 in order to determine the presence or absence of a characteristic relating to prognosis in an individual. Preferably the chromosome interactions are those in any of the genes mentioned herein. In one aspect the chromosome interactions which are typed are those represented by the nucleic acids in Table 1, 2, 3 or 4. The column titled 'Loop Detected' in the tables shows which subgroup is detected by each probe. Detection can either of the presence or absence of the chromosome interaction in that subgroup. 20 The Individual that is Tested The individual who is tested is typically of any species mentioned herein. In addition the individual that is tested in the process of the invention may have been selected in some way. The individual may be susceptible to any condition mentioned herein and / or may be in need of any therapy mentioned in. The individual may be receiving any therapy mentioned herein. In particular, the individual may have, or be 25 suspected of having ASD. The individual may be suspected of having any specific condition that comes within the broad definition of ASD. That may be autistic disorder, childhood autism, Asperger's syndrome, PDD-NOS (Pervasive Development Disorder), childhood disintegrative disorder, addiction (for example addiction to substances or digital media devices). 05 03 25 The invention includes a process wherein a specific combination of chromosome interactions are typed: (i) comprising all of the chromosome interactions represented by the probes in Table 1, 2, 3 or 4; and / or (ii) comprising at least 25, 50, 100, 150 or 200 of the chromosome interactions represented by the probes in Table 1, 2, 3 or 4; and / or 5 (iii) which together are present in at least 10, 20, 30 or 40 of the regions or genes listed in Table 1, 2, 3 or 4;and / or (iv) wherein at least 10, 20, 30 or 40 of the chromosome interactions which are typed are present in a 4,000 base region which comprises or which flanks the chromosome interactions represented by the probes in Table 1, 2, 3 or 4. 10 Typically in the process of the invention at least 20, 30, 40 or 50 chromosome interactions are typed. Preferred Gene Regions, Loci, Genes and Chromosome Interactions For all aspects of the invention preferred gene regions, loci, genes and chromosome interactions are mentioned in the tables, for example in Table 1, 2, 3 or 4. Typically in the process of the invention chromosome interactions are detected from at least 10, 20, 30, 40 or 50 of the genes listed in Table 1. 15 Typically in the process of the invention chromosome interactions are detected from at least 10, 20, 30, 40 or 50 of the genes listed in Table 2. Typically in the process of the invention chromosome interactions are detected from at least 10, 20, 30, 40 or 50 of the genes listed in Table 3. Typically in the process of the invention chromosome interactions are detected from at least 10, 20, 30, 40 or 50 of the genes listed in Table 4. 20 Preferably the presence or absence of at least 10, 20, 50,150 or 200 of the relevant specific chromosome interactions represented by the probe sequences in Table 1 are detected. Preferably the presence or absence of at least 10, 20, 50, 150 or 200 of the relevant specific chromosome interactions represented by the probe sequences in Table 2 are detected. Preferably the presence or absence of at least 10, 20, 50, 150 or 200 of the relevant specific chromosome interactions represented by the probe sequences in Table 25 3 are detected. Preferably the presence or absence of at least 10, 20,50,150 or 200 of the relevant specific chromosome interactions represented by the probe sequences in Table 4 are detected. The chromosome interaction may be upstream or downstream of any of the genes mentioned herein, for example within 50 kb upstream or 20 kb downstream, for example from the coding sequence. 05 03 25 In one aspect the invention relates to typing markers represented in Table 1. In this aspect the markers which are typed may or may not be present in any other table. The invention therefore includes a process for determining prognosis to ASD by typing one or more of the chromosome interactions represented in Table 1. Typically the presence or absence of at least 1, 5, 8, 10, 15, 20 chromosome interactions from 5 Table 1 are detected. In one aspect the invention relates to typing markers represented in Table 2. In this aspect the markers which are typed may or may not be present in any other table. The invention therefore includes a process for determining prognosis to ASD by typing one or more of the chromosome interactions represented in Table 2. Typically the presence or absence of at least 1, 5, 8, 10, 15, 20 chromosome interactions from 10 Table 2 are detected. In one aspect the invention relates to typing markers represented in Table 3. In this aspect the markers which are typed may or may not be present in any other table. The invention therefore includes a process for determining prognosis to ASD by typing one or more of the chromosome interactions represented in Table 3. Typically the presence or absence of at least 1, 5, 8, 10, 15, 20 chromosome interactions from 15 Table 3 are detected. In one aspect the invention relates to typing markers represented in Table 4. In this aspect the markers which are typed may or may not be present in any other table. The invention therefore includes a process for determining prognosis to ASD by typing one or more of the chromosome interactions represented in Table 4. Typically the presence or absence of at least 1, 5, 8, 10, 15, 20 chromosome interactions from 20 Table 4 are detected. In one aspect the invention relates to typing markers represented in Table 8. In this aspect the markers which are typed may or may not be present in any other table. The invention therefore includes a process for determining prognosis to ASD by typing one or more of the chromosome interactions represented in Table 8. Typically the presence or absence of at least 1, 5, 8, 10, 15, 20 chromosome interactions from 25 Table 8 are detected. In one aspect the presence or absence of at least 30, 50, 80,100 or 150 interactions from Table 8 are detected. Table 8 contains groups of markers within in it defined as follows: Group A: markers numbered 1 to 12 Group B: markers numbered 13 to 76 and 139 to 167 30 Group C: markers numbered 77 to 138 05 03 25 Group D: markers numbered 168 to 183 Typically the presence or absence of at least 1, 5, 8,10 or all the chromosome interactions from Group A of Table 8 are detected. In one aspect the presence or absence of at least 1, 5, 8, 10, 15, 20 or all the chromosome interactions from Group B of Table 8 are detected. Typically the presence or absence of at 5 least 1, 5, 8,10,15, 20 or all the chromosome interactions from Group C of Table 8 are detected. In one aspect the presence or absence of at least 1, 5, 8, 10, 15, 20 or all the chromosome interactions from Group D of Table 8 are detected. In one aspect the invention relates to typing markers represented in Table 9. In this aspect the markers which are typed may or may not be present in any other table. The invention therefore includes a process 10 for determining prognosis to ASD by typing one or more of the chromosome interactions represented in Table 9. Typically the presence or absence of at least 1, 5, 8, 10, 15, 20 chromosome interactions from Table 9 are detected. In one aspect the presence or absence of at least 30, 50, 80, 100 or 150 interactions from Table 9 are detected. Table 9 contains groups of markers within in it defined as follows: 15 Group A: markers numbered 2 to 7 and 9 to 15 Group B: markers numbered 1, 8, 16 to 87 and 149 to 171 Group C: markers numbered 88 to 148 Group D: markers numbered 172 to 182 Typically the presence or absence of at least 1, 5, 8,10 or all the chromosome interactions from Group A 20 of Table 9 are detected. In one aspect the presence or absence of at least 1, 5, 8, 10, 15, 20 or all the chromosome interactions from Group B of Table 9 are detected. Typically the presence or absence of at least 1, 5, 8,10,15, 20 or all the chromosome interactions from Group C of Table 9 are detected. In one aspect the presence or absence of at least 1, 5, 8 or all the chromosome interactions from Group D of Table 9 are detected. 25 In one aspect the presence or absence of at least 1, 5, 8, 10, 15, 20 or all the chromosome interactions from Table 10 are detected. In a preferred aspect one or both of the first two markers of Table 10 are typed. 05 03 25 Typing Chromosome Interactions Mentioned in the Figures In one aspect the method of the invention comprises typing one or more chromosome interactions which relate to any gene mentioned in any of the Figures (as defined in the tables). Typically at least 1, 5, 8, 10, 15 or 20 such interactions are typed. 5 Typing Different Types of ASD As will be appreciated from the tables different markers are specific for different types of ASD (defined either by their presence or absence). The process of the invention typically comprises typing markers with any of the following characteristics: (i) present in healthy controls (HC), but absent in mild and severe ASD 10 (ii) unique of either mild or severe ASD, and absent in HC (iii) common or present in severe and mild ASD, but absent in HC (iv) present or absent in either severe or mild ASD. In one aspect at least 1, 5, 8, 10, 15 or 20 chromosome interactions are typed which have characteristic (i). In a further aspect at least 1, 5, 8, 10, 15 or 20 chromosome interactions are typed which have 15 characteristic (ii). In one aspect at least 1, 5, 8, 10, 15 or 20 chromosome interactions are typed which have characteristic (iii). In a further aspect at least 1, 5,8, 10,15 or 20 chromosome interactions are typed which have characteristic (vi). Types of Chromosome Interaction In one aspect the locus (including the gene and / or place where the chromosome interaction is detected) 20 may comprise a CTCF binding site. This is any sequence capable of binding transcription repressor CTCF. That sequence may consist of or comprise the sequence CCCTC which may be present in 1, 2 or 3 copies at the locus. The CTCF binding site sequence may comprise the sequence CCGCGNGGNGGCAG (in IUPAC notation). The CTCF binding site may be within at least 100, 500, 1000 or 4000 bases of the chromosome interaction or within any of the chromosome regions shown Table 1, 2, 3 or 4. The CTCF binding site may 25 be within at least 100, 500, 1000 or 4000 bases of the chromosome interaction or within any of the chromosome regions shown Table 1, 2, 3 or 4. 05 03 25 In one aspect the chromosome interactions which are detected are present at any of the gene regions shown Table 1, 2, 3 or 4. In the case where a ligated nucleic acid is detected in the process then sequence shown in any of the probe sequences in Table 1, 2, 3 or 4 may be detected. Thus typically sequence from both regions of the probe (i.e. from both sites of the chromosome 5 interaction) could be detected. In preferred aspects probes are used in the process which comprise or consist of the same or complementary sequence to a probe shown in any table. In some aspects probes are used which comprise sequence which is homologous to any of the probe sequences shown in the tables. In one aspect one or more of the chromosome interactions which are typed are at a locus / region that: 10 (i) comprises a single nucleotide polymorphism (SNP); and / or (ii) expresses a microRNA (miRNA); and / or (iii) expresses a non-coding RNA (ncRNA); and / or (iv) expresses a nucleic acid sequence encoding at least 10 contiguous amino acid residues; and / or (v) expresses a regulating element; and / or 15 (vii) comprises a CTCF binding site. Description of the Tables Table 1 shows markers present in healthy control, but absent in severe and mild autism. The designation 'mHC' means it is absent both in mild and severe (mHC, means from the mild comparison with HC). The designation 'sHC' means it is absent both in mild and severe (sHC, means from the severe comparison 20 with HC). Table 2 shows unique markers present in mild and severe autism. The designation 'sAD' means it is absent in control and mild. The designation 'mAD' means it is absent in control and severe. Table 3 shows shared markers, present in severe and mild autism. The designation 'sAD' means present in mild (means from the severe comparison with HC). The designation 'mAD' means present in severe 25 (means from the mild comparison with HC). Table 4 shows unique markers either absent in severe or mild autism. The designation 'sHC' means present in healthy control, but only for the comparison between severe and HC patients. This doesn't say anything about the mild status. The designation 'mHC' means present in healthy control, but only for the comparison between mild and HC patients. This doesn't say anything about the severe status. 05 03 25 Table 8 shows markers relating to severe autism. Four groups of markers are shown in this table, Group A, B, C and D as defined above and shown in the table. Markers may be selected from the entire table or from a group. Table 9 shows markers relating to mild autism. Four groups of markers are shown in this table, Group A, 5 B, C and D as defined above and shown in the table. Markers may be selected from the entire table or from a group. Table 10 shows markers with a high performance and is an optimised panel. In particular this panel comprises chromosome interactions relating to NAMPT and MAP2 (marker numbers 1 and 2 in the table). 10 The LS column in all tables either has '1' or '-1'. This reflects how the comparison is done, the healthy control is always the numerator, and so significant markers present in HC will be 1 and the disease samples (mild or severe) are always the denominator, and so significant markers present in the disease samples will always be -1. The tables shows probe (Episwitch™ marker) data and gene data representing chromosome interactions 15 relevant to prognosis. The probe sequences show sequence which can be used to detect a ligated product generated from both sites of gene regions that have come together in chromosome interactions, i.e. the probe will comprise sequence which is complementary to sequence in the ligated product. The first two sets of Start-End positions show probe positions, and the second two sets of Start-End positions show the relevant 4kb region. The following information is provided in the probe data table: 20 - HyperG_Stats: p-value for the probability of finding that number of significant EpiSwitch™ markers in the locus based on the parameters of hypergeometric enrichment Probe Count Total: Total number of EpiSwitch™ Conformations tested at the locus Probe Count Sig: Number of EpiSwitch™ Conformations found to be statistically significant at the locus 25 - FDR HyperG: Multi-test (False Discovery Rate) corrected hypergeometric p-value Percent Sig: Percentage of significant EpiSwitch™ markers relative the number of markers tested at the locus logFC: logarithm base 2 of Epigenetic Ratio (FC) AveExpr: average Iog2-expression for the probe over all arrays and channels 30 - T: moderated t-statistic p-value: raw p-value adj. p-value: adjusted p-value or q-value B - B-statistic (lods or B) is the log-odds that that gene is differentially expressed. FC - non-log Fold Change 35 - FC_1 - non-log Fold Change centred around zero LS - Binary value this relates to FC_1 values. FC_1 value below -1.1 it is set to -1 and if the FC_1 05 03 25 value is above 1.1 it is set to 1. Between those values the value is 0 The tables show genes where a relevant chromosome interaction has been found to occur. The p-value in the loci table is the same as the HyperG Stats (p-value for the probability of finding that number of significant EpiSwitch™ markers in the locus based on the parameters of hypergeometric enrichment). The 5 LS column shows presence or absence of the relevant interaction with that particular subgroup (prognosis status). The probes are designed to be 30bp away from the Taql site. In case of PCR, PCR primers are typically designed to detect ligated product but their locations from the Taql site vary. Probe locations: 10 Start 1 - 30 bases upstream of Taql site on fragment 1 End 1 - Taql restriction site on fragment 1 Start 2 - Taql restriction site on fragment 2 End 2 - 30 bases downstream of Taql site on fragment 2 4kb Sequence Location: 15 Start 1 - 4000 bases upstream of Taql site on fragment 1 End 1 - Taql restriction site on fragment 1 Start 2 - Taql restriction site on fragment 2 End 2 - 4000 bases downstream of Taql site on fragment 2 GLMNET values related to procedures for fitting the entire lasso or elastic-net regularization (Lambda 20 set to 0.5 (elastic-net)). Certain markers are shown twice where they relate to shared markers, once referred to for presence / absence in mild and once in severe autism. Preferred Aspects for Sample Preparation and Chromosome Interaction Detection Methods of preparing samples and detecting chromosome conformations are described herein. 25 Optimised (non-conventional) versions of these methods can be used, for example as described in this section. 05 03 25 Typically the sample will contain at least 2 xlO5 cells. The sample may contain up to 5 xlO5 cells. In one aspect, the sample will contain 2 xlO5 to 5.5 xlO5 cells. Crosslinking of epigenetic chromosomal interactions present at the chromosomal locus is described herein. This may be performed before cell lysis takes place. Cell lysis may be performed for 3 to 7 5 minutes, such as 4 to 6 or about 5 minutes. In some aspects, cell lysis is performed for at least 5 minutes and for less than 10 minutes. Digesting DNA with a restriction enzyme is described herein. Typically, DNA restriction is performed at about 55°C to about 70°C, such as for about 65°C, for a period of about 10 to 30 minutes, such as about 20 minutes. 10 Preferably a frequent cutter restriction enzyme is used which results in fragments of ligated DNA with an average fragment size up to 4000 base pair. Optionally the restriction enzyme results in fragments of ligated DNA have an average fragment size of about 200 to 300 base pairs, such as about 256 base pairs. In one aspect, the typical fragment size is from 200 base pairs to 4,000 base pairs, such as 400 to 2,000 or 500 to 1,000 base pairs. 15 In one aspect of the EpiSwitch method a DNA precipitation step is not performed between the DNA restriction digest step and the DNA ligation step. DNA ligation is described herein. Typically the DNA ligation is performed for 5 to 30 minutes, such as about 10 minutes. The protein in the sample may be digested enzymatically, for example using a proteinase, optionally 20 Proteinase K. The protein may be enzymatically digested for a period of about 30 minutes to 1 hour, for example for about 45 minutes. In one aspect after digestion of the protein, for example Proteinase K digestion, there is no cross-link reversal or phenol DNA extraction step. In one aspect PCR detection is capable of detecting a single copy of the ligated nucleic acid, preferably with a binary read-out for presence / absence of the ligated nucleic acid. 25 Figure 10 shows a preferred method of detecting chromosome interactions. Processes and Uses of the Invention The process of the invention can be described in different ways. It can be described as a method of making 30 a ligated nucleic acid comprising (i) in vitro cross-linking of chromosome regions which have come 05 03 25 together in a chromosome interaction; (ii) subjecting said cross-linked DNA to cutting or restriction digestion cleavage; and (iii) ligating said cross-linked cleaved DNA ends to form a ligated nucleic acid, wherein detection of the ligated nucleic acid may be used to determine the chromosome state at a locus, and wherein preferably: 5 - the locus may be any of the loci, regions or genes mentioned in Table 1, 2, 3 or 4, and / or - wherein the chromosomal interaction may be any of the chromosome interactions mentioned herein or corresponding to any of the probes disclosed in Table 1, 2, 3 or 4, and / or - wherein the ligated product may have or comprise (i) sequence which is the same as or homologous to any of the probe sequences disclosed in Table 1, 2, 3 or 4; or (ii) sequence which is complementary to (ii). 10 The process of the invention can be described as a process for detecting chromosome states which represent different subgroups in a population comprisingdeterminingwhether a chromosome interaction is present or absent within a defined epigenetically active region of the genome, wherein preferably: the subgroup is defined by presence or absence of a condition or by the type of condition, and / or 15 - the chromosome state may be at any locus, region or gene mentioned in Table 1, 2, 3 or 4; and / or the chromosome interaction may be any of those mentioned in Table 1, 2, 3 or 4 or corresponding to any of the probes disclosed in that table. The invention includes detecting chromosome interactions at any locus, gene or region mentioned Table 20 1, 2, 3 or 4. The invention includes use of the nucleic acids and probes mentioned herein to detect chromosome interactions, for example use of at least 1, 5, 10, 20 or 50 such nucleic acids or probes to detect chromosome interactions. The nucleic acids or probes preferably detect chromosome interactions in at least 1, 5, 10, 20 or 50 different loci or genes. The invention includes detection of chromosome interactions using any of the primers or primer pairs listed in Table 1, 2, 3 or 4 or using variants of these 25 primers as described herein (sequences comprising the primer sequences or comprising fragments and / or homologues of the primer sequences). When analysing whether a chromosome interaction occurs 'within' a defined gene, region or location, either both the parts of the chromosome which have together in the interaction are within the defined 30 gene, region or location or in some aspects only one part of the chromosome is within the defined, gene, region or location. The markers shown in the tables are 'disseminating' ones whose presence or absence is associated with a particular ASD status as defined herein (as shown in the relevant table). Therefore the result of the process of the invention is analysed with reference to the way in which the marker associates with the ASD status. 05 03 25 Use of the Method of the Invention to Identify New Treatments Knowledge of chromosome interactions can be used to identify new treatments for ASD. The invention 10 provides methods and uses of chromosomes interactions defined herein to identify or design new therapeutic agents, for example relating to therapy of ASD. Homologues Homologues of polynucleotide / nucleic acid (e.g. DNA) sequences are referred to herein. Such homologues typically have at least 70% homology, preferably at least 80%, at least 85%, at least 90%, at 15 least 95%, at least 97%, at least 98% or at least 99% homology, for example over a region of at least 10, 15, 20, 30,100 or more contiguous nucleotides, or across the portion of the nucleic acid which is from the region of the chromosome involved in the chromosome interaction. The homology may be calculated on the basis of nucleotide identity (sometimes referred to as "hard homology"). Therefore, in a particular aspect, homologues of polynucleotide / nucleic acid (e.g. DNA) sequences are 20 referred to herein by reference to percentage sequence identity. Typically such homologues have at least 70% sequence identity, preferably at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% sequence identity, for example over a region of at least 10,15, 20, 30, 100 or more contiguous nucleotides, or across the portion of the nucleic acid which is from the region of the chromosome involved in the chromosome interaction. 25 For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology and / or % sequence identity (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p387-395). The PILEUP and BLAST algorithms can be used to calculate homology and / or % sequence identity and / or line up sequences (such as identifying equivalent or corresponding sequences (typically on their default settings)), for example as described in Altschul S. F. 30 (1993) J Mol Evol 36:290-300; Altschul, S, F et al (1990) J Mol Biol 215:403-10. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pair (HSPs) by 05 03 25 identifying short words of length W in the query sequence that either match or satisfy some positivevalued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul etal, supra). These initial neighbourhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in 5 both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W5 T and X determine the sensitivity and speed of the 10 alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands. The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787. One measure of similarity provided 15 by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two polynucleotide sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001. 20 The homologous sequence typically differs by 1, 2, 3, 4 or more bases, such as less than 10,15 or 20 bases (which may be substitutions, deletions or insertions of nucleotides). These changes may be measured across any of the regions mentioned above in relation to calculating homology and / or % sequence identity. 25 Homology of a 'pair of primers' can be calculated, for example, by considering the two sequences as a single sequence (as if the two sequences are joined together) for the purpose of then comparing against the another primer pair which again is considered as a single sequence. Arrays The second set of nucleic acids may be bound to an array, and in one aspect there are at least 15,000, 30 45,000,100,000 or 250,000 different second nucleic acids bound to the array, which preferably represent at least 300, 900, 2000 or 5000 loci. In one aspect one, or more, or all of the different populations of second nucleic acids are bound to more than one distinct region of the array, in effect repeated on the array allowing for error detection. The array may be based on an Agilent SurePrint G3 Custom CGH 05 03 25 microarray platform. Detection of binding of first nucleic acids to the array may be performed by a dual colour system. Therapeutic Agents (for example which are selected based on typing individuals or which are selected 5 based on testing according to the invention) Therapeutic agents are mentioned herein. The invention provides such agents for use in preventing or treating a disease condition in certain individuals, for example those identified by a process of the invention. The invention provides use of the agent in the manufacture of a medicament to prevent or treat a condition in certain individuals. 10 The formulation of the agent will depend upon the nature of the agent. The agent will be provided in the form of a pharmaceutical composition containing the agent and a pharmaceutically acceptable carrier or diluent. Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. Typical oral dosage compositions include tablets, capsules, liquid solutions and liquid suspensions. The agent may be formulated for parenteral, intravenous, intramuscular, subcutaneous, 15 transdermal or oral administration. The dose of an agent may be determined according to various parameters, especially according to the substance used; the age, weight and condition of the individual to be treated; the route of administration; and the required regimen. A physician will be able to determine the required route of administration and 20 dosage for any particular agent. A suitable dose may however be from 0.1 to 100 mg / kg body weight such as 1 to 40 mg / kg body weight, for example, to be taken from 1 to 3 times daily. The therapeutic agent may be any such agent disclosed herein, or may target any 'target' disclosed herein, including any protein or gene disclosed herein in any table (including Table 1, 2, 3 or 4). 25 ASD Therapy An anti-ASD therapy may, for example, be any drug that targets ASD symptoms, such as aiming to modulate behaviour. The therapy may be a psychoactive drug, anticonvulsant, antidepressant, or antipsychotics. The antipsychotic may be risperidone or aripiprazole. Forms of the Substance Mentioned Herein 30 Any of the substances, such as nucleic acids or therapeutic agents, mentioned herein may be in purified or isolated form. They may be in a form which is different from that found in nature, for example they may be present in combination with other substance with which they do not occur in nature. The nucleic acids (including portions of sequences defined herein) may have sequences which are different to those 05 03 25 found in nature, for example having at least 1, 2, 3, 4 or more nucleotide changes in the sequence as described in the section on homology. The nucleic acids may have heterologous sequence at the 5' or 3' end. The nucleic acids may be chemically different from those found in nature, for example they may be modified in some way, but preferably are still capable of Watson-Crick base pairing. Where appropriate 5 the nucleic acids will be provided in double stranded or single stranded form. The invention provides all of the specific nucleic acid sequences mentioned herein in single or double stranded form, and thus includes the complementary strand to any sequence which is disclosed. The invention provides a kit for carrying out any process of the invention, including detection of a chromosomal interaction relating to prognosis. Such a kit can include a specific binding agent capable of 10 detecting the relevant chromosomal interaction, such as agents capable of detecting a ligated nucleic acid generated by processes of the invention. Preferred agents present in the kit include probes capable of hybridising to the ligated nucleic acid or primer pairs, for example as described herein, capable of amplifying the ligated nucleic acid in a PCR reaction. The invention provides a device that is capable of detecting the relevant chromosome interactions. The 15 device preferably comprises any specific binding agents, probe or primer pair capable of detecting the chromosome interaction, such as any such agent, probe or primer pair described herein. Detection Methods In one aspect quantitative detection of the ligated sequence which is relevant to a chromosome interaction is carried out using a probe which is detectable upon activation during a PCR reaction, 20 wherein said ligated sequence comprises sequences from two chromosome regions that come together in an epigenetic chromosome interaction, wherein said method comprises contacting the ligated sequence with the probe during a PCR reaction, and detecting the extent of activation of the probe, and wherein said probe binds the ligation site. The method typically allows particular interactions to be detected in a MIQE compliant manner using a dual labelled fluorescent hydrolysis probe. 25 The probe is generally labelled with a detectable label which has an inactive and active state, so that it is only detected when activated. The extent of activation will be related to the extent of template (ligation product) present in the PCR reaction. Detection may be carried out during all or some of the PCR, for example for at least 50% or 80% of the cycles of the PCR. The probe can comprise a fluorophore covalently attached to one end of the oligonucleotide, and a 30 quencher attached to the other end of the nucleotide, so that the fluorescence of the fluorophore is quenched by the quencher. In one aspect the fluorophore is attached to the 5'end of the oligonucleotide, and the quencher is covalently attached to the 3' end of the oligonucleotide. 05 03 25 Fluorophores that can be used in the methods of the invention include FAM, TET, JOE, Yakima Yellow, HEX, Cyanine3, ATTO 550, TAMRA, ROX, Texas Red, Cyanine 3.5, LC610, LC 640, ATTO 647N, Cyanine 5, Cyanine 5.5 and ATTO 680. Quenchers that can be used with the appropriate fluorophore include TAM, BHQ1, DAB, Eclip, BHQ2 and BBQ650, optionally wherein said fluorophore is selected from HEX, Texas 5 Red and FAM. Preferred combinations of fluorophore and quencher include FAM with BHQ1 and Texas Red with BHQ2. Use of the Probe in a qPCR Assay Hydrolysis probes of the invention are typically temperature gradient optimised with concentration matched negative controls. Preferably single-step PCR reactions are optimized. More preferably a 10 standard curve is calculated. An advantage of using a specific probe that binds across the junction of the ligated sequence is that specificity for the ligated sequence can be achieved without using a nested PCR approach. The methods described herein allow accurate and precise quantification of low copy number targets. The target ligated sequence can be purified, for example gel-purified, prior to temperature gradient optimization. The target ligated sequence can be sequenced. Preferably PCR reactions are 15 performed using about lOng, or 5 to 15 ng, or 10 to 20ng, or 10 to 50ng, or 10 to 200ng template DNA. Forward and reverse primers are designed such that one primer binds to the sequence of one of the chromosome regions represented in the ligated DNA sequence, and the other primer binds to other chromosome region represented in the ligated DNA sequence, for example, by being complementary to the sequence. 20 Choice of Ligated DNA Target The invention includes selecting primers and a probe for use in a PCR method as defined herein comprising selecting primers based on their ability to bind and amplify the ligated sequence and selecting the probe sequence based properties of the target sequence to which it will bind, in particular the curvature of the target sequence. 25 Probes are typically designed / chosen to bind to ligated sequences which are juxtaposed restriction fragments spanning the restriction site. In one aspect of the invention, the predicted curvature of possible ligated sequences relevant to a particular chromosome interaction is calculated, for example using a specific algorithm referenced herein. The curvature can be expressed as degrees per helical turn, e.g. 10.5° per helical turn. Ligated sequences are selected for targeting where the ligated sequence has a 30 curvature propensity peak score of at least 5° per helical turn, typically at least 10°, 15° or 20° per helical turn, for example 5° to 20° per helical turn. Preferably the curvature propensity score per helical turn is calculated for at least 20, 50, 100, 200 or 400 bases, such as for 20 to 400 bases upstream and / or 05 03 25 downstream of the ligation site. Thus in one aspect the target sequence in the ligated product has any of these levels of curvature. Target sequences can also be chosen based on lowest thermodynamic structure free energy. Particular Aspects 5 In one aspect only intrachromosomal interactions are typed / detected, and no extrachromosomal interactions (between different chromosomes) are typed / detected. In particular aspects certain chromosome interactions are not typed, for example any specific interaction mentioned herein (for example as defined by any probe or primer pair mentioned herein). In some aspects chromosome interactions are not typed in any of the genes mentioned herein. 10 In one aspect markers not listed in any one of the tables are not typed, for example only markers listed in Table 10 are typed. Screening method The invention provides a method of determining which chromosomal interactions are relevant to a chromosome state corresponding to an prognosis subgroup of the population, comprising contacting a 15 first set of nucleic acids from subgroups with different states of the chromosome with a second set of index nucleic acids, and allowing complementary sequences to hybridise, wherein the nucleic acids in the first and second sets of nucleic acids represent a ligated product comprising sequences from both the chromosome regions that have come together in chromosomal interactions, and wherein the pattern of hybridisation between the first and second set of nucleic acids allows a determination of which 20 chromosomal interactions are specific to an prognosis subgroup. The subgroup may be any of the specific subgroups defined herein, for example with reference to particular conditions or therapies. The invention further provides a process which uses the prognosis / detection method of the invention to identify or design a therapeutic agent for ASD; - wherein preferably said process is used to detect whether a candidate agent is able to cause a change 25 to a chromosome state which is associated with ASD; - wherein the chromosomal interaction is represented by any probe in Table 1, 2, 3 or 4; and / or - the chromosomal interaction is present in any region or gene listed in Table 1, 2, 3 or 4; and wherein optionally: 05 03 25 the chromosomal interaction has been identified by the method of determining which chromosomal interactions are relevant to a chromosome state as defined in claim 1, and / or the change in chromosomal interaction is monitored using (i) a probe that has at least 70% identity to any of the probe sequences mentioned in Table 1, 2, 3 or 4, and / or (ii) by a primer pair which has 5 at least 70% identity to any primer pair in Table 1, 2, 3 or 4. Typing of the 'Disseminating' Markers The data provided herein shows that the markers are 'disseminating' ones able to differentiate cases and non-cases for the relevant disease situation. Therefore when carrying out the invention the skilled 10 person will be able to determine by detection of the interactions which subgroup the individual is in. In one aspect a threshold value of detection of at least 70% of the tested markers in the form they are associated with the relevant disease situation (either by absence or presence) may be used to determine whether the individual is in the relevant subgroup. In other aspects a threshold value of at least 80% or at least 90% may be used. 15 In one aspect a classifier may be used to as part of the detection process, for example utilising a trained algorithm which comprises information relating to one or more disseminating markers, for example as defined in any one of the table herein. Publications The contents of all publications mentioned herein are incorporated by reference into the present 20 specification and may be used to further define the features relevant to the invention. The Approach Taken to Identify Markers and Panels of Markers The invention described herein relates to chromosome conformation profile and 3D architecture as a regulatory modality in its own right, closely linked to the phenotype. The discovery of biomarkers was 25 based on annotations through pattern recognition and screening on representative cohorts of clinical samples representing the differences in phenotypes. We annotated and screened significant parts of the genome, across coding and non-coding parts and over large sways of non-coding 5' and 3' of known genes for identification of statistically disseminating consistent conditional disseminating chromosome conformations, which for example anchor in the non-coding sites within (intronic) or outside of open 30 reading frames. In selection of the best markers we are driven by statistical data and p values for the marker leads. Selected and validated chromosome conformations within the signature are disseminating stratifying 05 03 25 entities in their own right, irrespective of the expression profiles of the genes used in the reference. Further work may be done on relevant regulatory modalities, such as SNPs at the anchoring sites, changes in gene transcription profiles, changes at the level of H3K27ac. 5 We are taking the question of clinical phenotype differences and their stratification from the basis of fundamental biology and epigenetics controls over phenotype - including for example from the framework of network of regulation. As such, to assist stratification, one can capture changes in the network and it is preferably done through signatures of several biomarkers, for example through following a machine learning algorithm for marker reduction which includes evaluating the optimal 10 number of markers to stratify the testing cohort with minimal noise. This may end with 3-20 markers. Selection of markers for panels may be done by cross-validation statistical performance (and not for example by the functional relevance of the neighbouring genes, used for the reference name). A panel of markers (with names of adjacent genes) is a product of clustered selection from the screening across significant parts of the genome, in non-biased way analysing statistical disseminating powers over 15 14,000-60,000 annotated EpiSwitch sites across significant parts of the genome. It should not be perceived as a tailored capture of a chromosome conformation on the gene of know functional value for the question of stratification. The total number of sites for chromosome interaction are 1.2 million, and so the potential number of combinations is 1.2 million to the power 1.2 million. The approach that we have followed nevertheless allows the identifying of the relevant chromosome interactions. 20 The specific markers that are provided by this application have passed selection, being statistically (significantly) associated with the condition. This is what the data in the relevant table demonstrates. Each marker can be seen as representing an event of biological epigenetic as part of network deregulation that is manifested in the relevant condition. In practical terms it means that these markers are prevalent across groups of patients when compared to controls. On average, as an example, an 25 individual marker may typically be present in 80% of patients tested and in 10% of controls tested. Simple addition of all markers would not represent the network interrelationships between some of the deregulations. This is where the standard multivariate biomarker analysis GLMNET (R package) is brought in. GLMNET package helps to identify interdependence between some of the markers, that reflect their joint role in achieving deregulations leading to disease phenotype. Modelling and then 30 testing markers with highest GLMNET scores offers not only identify the minimal number of markers that accurately identifies the patient cohort, but also the minimal number that offers the least false positive results in the control group of patients, due to background statistical noise of low prevalence in the control group. Typically a group (combination) of selected markers (such as 3 to 10) offers the best 05 03 25 balance between both sensitivity and specificity of detection, emerging in the context of multivariate analysis from individual properties of all the selected statistical significant markers for the condition. The tables herein show the reference names for the array probes (60-mer) for array analysis that overlaps the juncture between the long range interaction sites, the chromosome number and the start 5 and end of two chromosomal fragments that come into juxtaposition. Specific Aspects The EpiSwitch™ platform technology detects epigenetic regulatory signatures of regulatory changes between normal and abnormal conditions at loci. The EpiSwitch™ platform identifies and monitors the fundamental epigenetic level of gene regulation associated with regulatory high order structures of 10 human chromosomes also known as chromosome conformation signatures. Chromosome signatures are a distinct primary step in a cascade of gene deregulation. They are high order biomarkers with a unique set of advantages against biomarker platforms that utilize late epigenetic and gene expression biomarkers, such as DNA methylation and RNA profiling. EpiSwitch ™ Array Assay 15 The custom EpiSwitch™ array-screening platforms come in 4 densities of, 15K, 45K, 100K, and 250K unique chromosome conformations, each chimeric fragment is repeated on the arrays 4 times, making the effective densities 60K, 180K, 400K and 1 Million respectively. Custom Designed EpiSwitch ™ Arrays 20 The 15K EpiSwitch™ array can screen the whole genome including around 300 loci interrogated with the EpiSwitch™ Biomarker discovery technology. The EpiSwitch™ array is built on the Agilent SurePrint G3 Custom CGH microarray platform; this technology offers 4 densities, 60K, 180K, 400Kand 1 Million probes. The density per array is reduced to 15K, 45K, 100K and 250K as each EpiSwitch™ probe is presented as a quadruplicate, thus allowing for statistical evaluation of the reproducibility. The average number of 25 potential EpiSwitch™ markers interrogated per genetic loci is 50; as such the numbers of loci that can be investigated are 300, 900, 2000, and 5000. EpiSwitch™ Custom Array Pipeline The EpiSwitch™ array is a dual colour system with one set of samples, after EpiSwitch™ library generation, 30 labelled in Cy5 and the other of sample (controls) to be compared / analyzed labelled in Cy3. The arrays are scanned using the Agilent SureScan Scanner and the resultant features extracted using the Agilent Feature Extraction software. The data is then processed using the EpiSwitch™ array processing scripts in 05 03 25 R. The arrays are processed using standard dual colour packages in Bioconductor in R: Limma *. The normalisation of the arrays is done using the normalisedWithinArrays function in Limma * and this is done to the on chip Agilent positive controls and EpiSwitch™ positive controls. The data is filtered based on the Agilent Flag calls, the Agilent control probes are removed and the technical replicate probes are averaged, 5 in order for them to be analysed using Limma *. The probes are modelled based on their difference between the 2 scenarios being compared and then corrected by using False Discovery Rate. Probes with Coefficient of Variation (CV) <=30% that are <=-1.1 or =>1.1 and pass the p<=0.1 FDR p-value are used for further screening. To reduce the probe set further Multiple Factor Analysis is performed using the FactorMineR package in R. 10 * Note: LIMMA is Linear Models and Empirical Bayes Processes for Assessing Differential Expression in Microarray Experiments. Limma is an R package for the analysis of gene expression data arising from microarray or RNA-Seq. The pool of probes is initially selected based on adjusted p-value, FC and CV <30% (arbitrary cut off point) 15 parameters for final picking. Further analyses and the final list are drawn based only on the first two parameters (adj. p-value; FC). Statistical Pipeline EpiSwitch™ screening arrays are processed using the EpiSwitch™ Analytical Package in R in order to select high value EpiSwitch™ markers for translation on to the EpiSwitch™ PCR platform. 20 Step 1 Probes are selected based on their corrected p-value (False Discovery Rate, FDR), which is the product of a modified linear regression model. Probes below p-value <= 0.1 are selected and then further reduced by their Epigenetic ratio (ER), probes ER have to be <=-1.1 or =>1.1 in order to be selected for further analysis. The last filter is a coefficient of variation (CV), probes have to be below <=0.3. 25 Step 2 The top 40 markers from the statistical lists are selected based on their ER for selection as markers for PCR translation. The top 20 markers with the highest negative ER load and the top 20 markers with the highest positive ER load form the list. 05 03 25 Step 3 The resultant markers from step 1, the statistically significant probes form the bases of enrichment analysis using hypergeometric enrichment (HE). This analysis enables marker reduction from the significant probe list, and along with the markers from step 2 forms the list of probes translated on to the 5 EpiSwitch™ PCR platform. The statistical probes are processed by HE to determine which genetic locations have an enrichment of statistically significant probes, indicating which genetic locations are hubs of epigenetic difference. The most significant enriched loci based on a corrected p-value are selected for probe list generation. Genetic locations below p-value of 0.3 or 0.2 are selected. The statistical probes mapping to these genetic 10 locations, with the markers from step 2, form the high value markers for EpiSwitch™ PCR translation. Array design and processing Arroy Design 1. Genetic loci are processed using the Sil software (currently v3.2) to: a. Pull out the sequence of the genome at these specific genetic loci (gene sequence with 15 50kb upstream and 20kb downstream) b. Define the probability that a sequence within this region is involved in CCs c. Cut the sequence using a specific RE d. Determine which restriction fragments are likely to interact in a certain orientation e. Rank the likelihood of different CCs interacting together. 20 2. Determine array size and therefore number of probe positions available (x) 3. Pull out x / 4 interactions. 4. For each interaction define sequence of 30bp to restriction site from part 1 and 30bp to restriction site of part 2. Check those regions aren't repeats, if so exclude and take next interaction down on the list. Join both 30bp to define probe. 25 5. Create list of x / 4 probes plus defined control probes and replicate 4 times to create list to be created on array 6. Upload list of probes onto Agilent Sure design website for custom CGH array. 7. Use probe group to design Agilent custom CGH array. Arrgy Processing 30 1. Process samples using EpiSwitch™ Standard Operating Procedure (SOP) for template production. 05 03 25 2. Clean up with ethanol precipitation by array processing laboratory. 3. Process samples as per Agilent SureTag complete DN A labelling kit - Agilent Oligonucleotide Arraybased CGH for Genomic DNA Analysis Enzymatic labelling for Blood, Cells or Tissues 4. Scan using Agilent C Scanner using Agilent feature extraction software. 5 EpiSwitch™ biomarker signatures demonstrate high robustness, sensitivity and specificity in the stratification of complex disease phenotypes. This technology takes advantage of the latest breakthroughs in the science of epigenetics, monitoring and evaluation of chromosome conformation signatures as a highly informative class of epigenetic biomarkers. Current research methodologies deployed in academic environment require from 3 to 7 days for biochemical processing of cellular material in order to detect 10 CCSs. Those procedures have limited sensitivity, and reproducibility; and furthermore, do not have the benefit of the targeted insight provided by the EpiSwitch™ Analytical Package at the design stage. EpiSwitch™ Array in silica marker identification CCS sites across the genome are directly evaluated by the EpiSwitch™ Array on clinical samples from testing cohorts for identification of all relevant stratifying lead biomarkers. The EpiSwitch™ Array 15 platform is used for marker identification due to its high-throughput capacity, and its ability to screen large numbers of loci rapidly. The array used was the Agilent custom-CGH array, which allows markers identified through the in silica software to be interrogated. EpiSwitch™ PCR Potential markers identified by EpiSwitch™ Array are then validated either by EpiSwitch™ PCR or DNA 20 sequencers (i.e. Roche 454, Nanopore MinlON, etc.). The top PCR markers which are statistically significant and display the best reproducibility are selected for further reduction into the final EpiSwitch™ Signature Set, and validated on an independent cohort of samples. EpiSwitch™ PCR can be performed by a trained technician following a standardised operating procedure protocol established. All protocols and manufacture of reagents are performed under ISO 13485 and 9001 accreditation to ensure the quality of 25 the work and the ability to transfer the protocols. EpiSwitch™ PCR and EpiSwitch™ Array biomarker platforms are compatible with analysis of both whole blood and cell lines. The tests are sensitive enough to detect abnormalities in very low copy numbers using small volumes of blood. 05 03 25 Example 1 Identifying disseminating individual chromosome conformations specific not only for autism spectrum disorder, but also for more specific differences in mild vs severe autism and healthy controls Research into causes of ASD has been complicated by the inability of objective biomarker-based 5 identification of biologically meaningful subgroups in the autistic population, with current diagnosis and care being affected by limitations, boundaries and differences between psychiatric, psychological and paediatric approaches. Current diagnostic tools are based on 1) Autism Diagnostic Interview-Revised (ADI-R); 2) Autism Diagnostic Observation Schedule (ADOS); Childhood Autism Rating Scale (CARS), especially for assessment of severity through observation of the child. The Diagnostic interview for 10 social and communicative disorders (DISCO) is also used. In general, social development deficits distinguish autism spectrum disorders from other developmental disorders. Current medications target ADS symptoms aiming to modulate behavioural treatments in social environment. Psychoactive drugs, anticonvulsants, antidepressants, antipsychotics. For example, antipsychotics risperidone and aripiprazole are FDA approved. Side effects of these treatments: weight 15 gain, drooling, aggressiveness - often outweigh the benefits. Without objective biomarkers linked to biological subtypes of disease deregulation it remains difficult to choose the beneficial medication for individual patient, in the context of personalized medicine. We have used non-biased full genome screening of blood profiles by chromosome conformations for 12 individual patients clinically annotated as mild ASD, and 12 patients with severe ASD against the 20 averaged profiles of pooled healthy controls. Detection of chromosome conformations in these comparisons is not driven by any specific genes or any bias or interest in specific genes. Identification of statistically significant chromosome conformations for one of the subgroups identifies regulatory domains of assembled topological autonomous chromosome domains which by nature of 3D architecture affect the regulation of genes captured within range. That 25 will allow an assessment of biological relevance, comparing discovered non-biased systemic biomarkers with biological relevance to ASD for the genes captured through EpiSwitch screening. Physically the targeted sites of chromosome conformation long range interactions / anchoring points always lie within non-coding parts of the genome (including introns). They do not change genomic sequence (i.e. non-genetic by its regulatory nature) and thus does not have immediate relationship with any effect on 30 protein amino acid composition from any of the genes. Figure 1 shows the top 200 statistically significant markers present in either mild or severe ASD (against health controls (HC) were identified). These two groups of markers has an overlap -145 markers were 05 03 25 statistically significant and were present in both severe and mild ASD when compared to HC. 51 severe ASD markers were unique for severe type. 55 mild ASD markers were unique for mild type. Figure 2 show for the established significant markers, as chromatin long range domains, the closest coding regions - genes - were identified in multiple scenarios of combinations for overlapping - 5 upstream, downstream, overlapping inside the domain. All these combinations of overlapping with protein coding regions have been shown to have biological examples of how a chromosome conformation domain can affect regulation of a gene. Markers unique for mild ASD (chromosome conformations either present only in mild ASD, or absent only in ASD) were analysed for genes they potentially would affect by being within their range of 10 regulation. These genes through their protein products were then used in the standard Cytoscape network build up, where the proteins are checked against known systemic databases of protein regulatory networks and pathways. The results show the selected genes under mild ASD deregulation by chromosome conformation conform to the one tight network of known regulatory interactions and several key biological pathways. At the top of the list were the pathway of neuroxins and neuroligins 15 regulation. The Hippo pathway was also identified. Similar analysis has been done for specific markers against known Transcriptional Factors Binding Sites (TFBS). This was done for markers unique for severe ADS, unique for mild ASD, and common for both severe and mild ASD. The number of significantly enriched TFs for each group is plotted on the VENN diagram in Figure 3. For example, for markers unique for mild ASD 18 TFs were uniquely enriched, 7+5 20 TFs were shared with enrichment observed in regions of severe ASD markers, 5+5 TFs were shared with TFs enriched for common shared mild and severe ASD markers, and 5 TFs were shared as enriched for all three groups of ASD makers - mild, severe, shared as common. The identified groups of enriched TFs were used for standard STRING network and pathway enrichment tool to evaluate which regulatory pathways and networks are affected by the three groups of markers through the TFs. 25 String Network with TFs for unique mild AD markers was enriched for the controls of estrogen signalling and Thl7 differentiation. Figure 4 shows pathway enrichment with TFs for unique mild ASD markers. Please note neurexins and neuroligins, hippo, addictions pathways. Table 5 shows the same analysis but based not only on chromosome conformation markers uniquely present in mild ASD, but also uniquely absent in mild ASD. Unique presence of the maker has an 30 important practical advantage for the detection test, while unique absence of the marker carries valuable biological insight in term of regulation. The same analysis was done for the markers shared by both mild and severe ASD with IL4, IL13 and Hippo identified. 05 03 25 Table 6 shows the same analysis as Table 5, but for shared (common) ASD markers for both mild and severe. Please note the HPV infection pathway. A Cytoscape network for severe ASD identified the IL-4 mediated signalling pathway. Table 7 is a network analysis taking into account all severe ASD unique absent chromosome 5 conformations, not just uniquely present ones. Figure 7 is repeat of Figure 3 as a reminder before String network and enrichment analysis for severe ASD markers String Analysis and Pathway Enrichment through TFs for severe ASD markers identified a viral infection pathway, brain development and estrogen dependent GEX. 10 Figure 6 shows a selection of identified mild ASD markers pathways for further analysis. Figure 7 shows the same, but for severe ASD. Figure 8 shows Principal Component Analysis based on Mild Pathway Markers. Left hand large ellipse -mild ASD, left hand small ellipse - severe ASD, right hand ellipse - Healthy Controls. Note complete separation of HC from both types of ASD, with severe ASD driven in a tight group compared to mild ASD 15 - a clear difference in mild and severe ASD profiles from mild ASD marker perspective. Figure 9 shows the same analysis but using Severe ASD pathways Markers. Note strong separation of HC (right hand ellipse) from both types of ASD (left hand ellipses). Genetic location GRIN2A was analysed, where unique significant EpiSwitch™ binary markers for severe or mild ASD, as detected in blood, with reference to the position of peaks for H3K27ac (the peaks 20 themselves are broad and carry background noise), as detected on brain post mortem biopsy. H3K27ac is considered to correlate on certain occasions with elements of 3D chromosome architecture. It was observed retrospectively that non-invasive binary markers correlate with marked peak positions on two occasions. Not all H3K27ac peaks correlate with significant disseminating differences between mild and severe ASD patients. 25 Tables 8 to 10 provide lists and panels of further markers with particular performance criteria. For Table 10 SHAP values are given, i.e. SHapley Additive exPlanations. SHAP values show how much each predictor contributes to the target variable. Figure 11 shows the network and pathways for markers unique to mild ASD. 05 03 25 Figure 12 shows enrichment in the network developed on all mild ASD markers. Figure 13 shows pathway enrichment for the common ASD markers. Figure 14 shows enrichment in a network developed on all common ASD markers. Figure 15 shows pathways for a network for markers unique for severe ASD. 5 Figure 16 shows enrichment in a network developed from markers unique for severe ASD. Figure 17 shows enrichment in a network developed for all severe ASD markers. Figure 18 shows a TF network built using severe ASD markers. Figure 19 shows performance characteristics for the markers of Table 10. The training data is on left and testing on the right. 10 Conclusions EpiSwitch custom Agilent CGH array whole genome screening provided statistically significant markers which are significant between the groups: 1. Present in healthy controls (HC), but absent in mild and severe ASD 2. Unique of either mild or sever ASD, and absent in HC 15 3. Common in severe and mild ASD, but absent in HC 4. Unique of absent in either severe or mild ASD In the context of potentially confusing, subjective and contradictory means of identifying and sub-typing patients with ASD, a non-biased total genomic screen at the level of chromosome conformations in blood, as a measurement of systemic non-genetic deregulations associated with ASD, has identified 20 statistically significant non-invasive biomarkers with disseminating powers to distinguish consistently between healthy controls, mild and severe ASD. Analysis of the regions of the genome subjected to identified chromosome conformation controls is con-concordant with biological pathway mechanisms implicated in ASD, with neurological deregulations (neuroxins, etc), addiction, estrogen, HPV infection, and immune system resetting (NK cells). The immune response shows particular presence in the severe 25 ASD subgroup. 05 03 25 Probe GeneLocus 1 C)RFl_13_31010097_31011555_31022136_31024228_FF HSPH1; TEX26 2 C)RFl_13_31010097_31011555_31022136_31024228_FF HSPH1; TEX26 3 ORF1_2_227779837_227782633_227875567_227878014_FF CCL20; DAW1; rsll3776284; rs7556897; rs4973341; rsl811711; rsl3384448; rs7591163 4 ORF1_2_227779837_227782633_227875567_227878014_FF CCL20; DAW1; rsll3776284; rs7556897; rs4973341; rsl811711; rsl3384448; rs7591163 5 ORF1_8_21022651_21025530_21093029_21096890_RR rs7015657; rs500816 6 ORF1_8_21022651_21025530_21093029_21096890_RR rs7015657; rs500816 7 ORF10_11_49143461_49148959_49212875_49219818_FF FOLH1; TRIM64C; rs368939818; rs61886492; rs770894245; rs747052707; rs202680; rs2O2676 8 ORF10_11_49143461_49148959_49212875_49219818_FF FOLH1; TRIM64C; rs368939818; rs61886492; rs770894245; rs747052707; rs202680; rs202676 9 ORF10_11_75290920_75295115_75323931_75326829_RR ARRB1; rs7952044; rs737410 10 ORF10_11_75290920_75295115_75323931_75326829_RR ARRB1; rs7952044; rs737410 11 ORF10_13_27276527_27282043_27309940_27312084_RR RASL11A; rs9512637 12 ORF10_13_27276527_27282043_27309940_27312084_RR RASL11A; rs9512637 13 ORF10_2_169020149_169021769_169092304_169105070_FF ABCB11; DHRS9; rs886043986; rs2161037 14 ORF10_2_169020149_169021769_169092304_169105070_FF ABCB11; DHRS9; rs886043986; rs2161037 15 ORF10_4_175807779_175809817_175829279_175833051_FR GPM6A; rsl3144140 16 C)RF10_4_175807779_175809817_175829279_175833051_FR GPM6A; rsl3144140 17 ORF10_5_78549630_78552354_78564492_78567388_RF LHFPL2; rs72315235; rs344650 18 ORF10_5_78549630_78552354_78564492_78567388_RF LHFPL2; rs72315235; rs344650 19 ORF10_9_38681931_38686861_38745325_38749296_FF ANKRD18A; CNTNAP3 20 ORF10_9_38681931_38686861_38745325_38749296_FF ANKRD18A; CNTNAP3 21 ORF100_2_209628749_209631690_209659511_209662054_FF MAP2; rsl46432517; rs9288410 22 ORF100_2_209628749_209631690_209659511_209662054_FF MAP2; rsl46432517; rs9288410 23 ORF101_6_127085111_127088243_127117219_127121367_RR RSPO3; rsl936807; rs4580892; rs719726; rs2745349; rsl936792; rsl936797; rsl936799; rsl936800; rsl555091 24 ORF101_6_127085111_127088243_127117219_127121367_RR RSPO3; rsl936807; rs4580892; rs719726; rs2745349; rsl936792; rsl936797; rsl936799; rsl936800; rsl555091 25 C)RF102_3_179882870_179885277_179956050_179960326_FR PEX5L; rsl46906651 26 ORF102_3_179882870_179885277_179956050_179960326_FR PEX5L; rsl46906651 27 ORF104_6_159103259_159105928_159122150_159125286_RF rs2249937; rs9355260 28 ORF104_6_159103259_159105928_159122150_159125286_RF rs2249937; rs9355260 29 ORF106_1_152738349_152759424_152785124_152809368_RF KPRP; LCE1B; LCE1C; LCE1D; LCE1E; LCE1F; rs7517755; rs77199844; rs6701216 30 ORF106_1_152738349_152759424_152785124_152809368_RF KPRP; LCE1B; LCE1C; LCE1D; LCE1E; LCE1F; rs7517755; rs77199844; rs6701216 31 C)RF106_8_74050342_74056528_74077219_74079715_RR LY96; rs6472827 32 C)RF106_8_74050342_74056528_74077219_74079715_RR LY96; rs6472827 33 C)RF107_18_10063278_10067780_9946347_9948516_RF VAPA; rs8089099; rs29067; rs29066 34 ORF107_18_10063278_10067780_9946347_9948516_RF VAPA; rs8089099; rs29067; rs29066 35 ORF107_6_140794230_140798634_140883673_140900284_RF rsl46383502; rslll55133 36 ORF107_6_140794230_140798634_140883673_140900284_RF rslll55133 37 ORF11_12_10066384_10067858_10157054_10158072_FF CLEC1A; CLEC7A; 0LR1; rsl6910526; rsl6910527; rs7309123; rs2O78178; rs3901533 38 C)RFll_12_10066384_10067858_10157054_10158072_FF CLEC1A; CLEC7A; OLR1; rsl6910526; rsl691O527; rs7309123; rs2O78178; rs3901533 39 C)RFll_2_20303337_20304942_20328998_20331608_FR PUM2; rslll612372 40 C)RFll_2_20303337_20304942_20328998_20331608_FR PUM2; rslll612372 41 ORF11_2_216695404_216702694_216719705_216724855_FR IGFBP2; IGFBP5 42 ORF11_2_216695404_216702694_216719705_216724855_FR IGFBP2; IGFBP5 43 ORF11_4_152216416_152218364_152265231_152270280_FF FBXW7; rs522743 44 ORF11_4_152216416_152218364_152265231_152270280_FF FBXW7; rs522743 45 ORF11_4_153729106_153731311_153760093_153764783_FF RNF175;SFRP2 46 ORF11_4_153729106_153731311_153760093_153764783_FF RNF175;SFRP2 47 ORF11_4_153729106_153731311_153764783_153769098_FF RNF175;SFRP2 48 ORF11_4_153729106_153731311_153764783_153769098_FF RNF175;SFRP2 49 ORF11_5_6223946_6226870_6298491_6302848_FR rsl2518614 50 ORF11_5_6223946_6226870_6298491_6302848_FR rsl2518614 51 ORF11_9_38681931_38686861_38758125_3876O727_FF ANKRD18A; CNTNAP3 52 ORF11_9_38681931_38686861_38758125_3876O727_FF ANKRD18A; CNTNAP3 Table l.al 05 03 25 Probe_Count_Total Probe_Count_Sig HyperG_Stats 1 41; 40 2; 2; 2; 2 0.26460109; 0.271883499; 0.261899069; 0.269983451 2 41; 40 2; 2; 2; 2 0.26460109; 0.271883499; 0.261899069; 0.269983451 3 52; 38 1; 1; 2; 1 0.266738689; 0.244043749; 0.255573168; 0.325888812 4 52; 38 1; 1; 2; 1 0.266738689; 0.244043749; 0.255573168; 0.325888812 5 NA NA NA 6 NA NA NA 7 25; 22 3; 4; 1; 2 0.05677955; 0.016055763; 0.372324987; 0.173304212 8 25; 22 3; 4; 1; 2 0.05677955; 0.016055763; 0.372324987; 0.173304212 9 27 1; 1 0.374553651; 0.37173223 10 27 1; 1 0.374553651; 0.37173223 11 136 1; 1 0.024430673; 0.016981585 12 136 1; 1 0.024430673; 0.016981585 13 28; 49 2; 2; 2; 3 0.204457601; 0.219149094; 0.276096976; 0.190339907 14 28; 49 2; 2; 2; 3 0.204457601; 0.219149094; 0.276096976; 0.190339907 15 68 3; 4 0.224345313; 0.163371308 16 68 3; 4 0.224345313; 0.163371308 17 32 1; 1 0.363856051; 0.35529211 18 32 1; 1 0.363856051; 0.35529211 19 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 20 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 21 60 5; 7 0.05512946; 0.009185497 22 60 5; 7 0.05512946; 0.009185497 23 7 1; 1 0.215038813; 0.227740664 24 7 1; 1 0.215038813; 0.227740664 25 9 1; 1 0.255358235; 0.268692312 26 9 1; 1 0.255358235; 0.268692312 27 NA NA NA 28 NA NA NA 29 5; 14; 14; 14; 14; 12 1; 1; 1; 1; 1; 1; 1; 1; 1; 1; 1; 1 0.166301763; 0.177271291; 0.325643034; 0.337131196; 0.325643034; 0.337131196; 0.325643034; 0.337131196; 0.325643034; 0.337131196; 0.302214299; 0.314913912 30 5; 14; 14; 14; 14; 12 1; 1; 1; 1; 1; 1; 1; 1; 1; 1; 1; 1 0.166301763; 0.177271291; 0.325643034; 0.337131196; 0.325643034; 0.337131196; 0.325643034; 0.337131196; 0.325643034; 0.337131196; 0.302214299; 0.314913912 31 29 2; 2 0.211050406; 0.22548219 32 29 2; 2 0.211050406; 0.22548219 33 111 2; 2 0.12134432; 0.099229264 34 111 2; 2 0.12134432; 0.099229264 35 NA NA NA 36 NA NA NA 37 44; 68; 79 2; 2; 2; 2; 2; 3 0.270943694; 0.275697963; 0.251156755; 0.236353672; 0.219227; 0.224909805 38 44; 68; 79 2; 2; 2; 2; 2; 3 0.270943694; 0.275697963; 0.251156755; 0.236353672; 0.219227; 0.224909805 39 54 5; 6 0.040491239; 0.018151611 40 54 5; 6 0.040491239; 0.018151611 41 27; 73 1; 1; 1; 1 0.374553651; 0.37173223; 0.162201186; 0.138576645 42 27; 73 1; 1; 1; 1 0.374553651; 0.37173223; 0.162201186; 0.138576645 43 143 3; 2 0.107765005; 0.041422991 44 143 3; 2 0.107765005; 0.041422991 45 22; 13 2; 3; 2; 2 0.158567173; 0.050708849; 0.076537269; 0.086128906 46 22; 13 2; 3; 2; 2 0.158567173; 0.050708849; 0.076537269; 0.086128906 47 22; 13 2; 3; 2; 2 0.158567173; 0.050708849; 0.076537269; 0.086128906 48 22; 13 2; 3; 2; 2 0.158567173; 0.050708849; 0.076537269; 0.086128906 49 NA NA NA 50 NA NA NA 51 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 52 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 Table l.a2 05 03 25 FDR_HyperG Percent_Sig logFC AveExpr 1 0.375519541; 0.376115439; 0.375519541; 0.376115439 4.88; 4.88; 5; 5 0.868612787 0.868612787 2 0.375519541; 0.376115439; 0.375519541; 0.376115439 4.88; 4.88; 5; 5 0.598904033 0.598904033 3 0.375519541; 0.376115439; 0.375519541; 0.376115439 1.92; 1.92; 5.26; 2.63 0.62710618 0.62710618 4 0.375519541; 0.376115439; 0.375519541; 0.376115439 1.92; 1.92; 5.26; 2.63 0.530641835 0.530641835 5 NA NA 0.7513734 0.7513734 6 NA NA 0.747960815 0.747960815 7 0.375519541; 0.376115439; 0.375519541; 0.376115439 12; 16; 4.55; 9.09 0.674825025 0.674825025 8 0.375519541; 0.376115439; 0.375519541; 0.376115439 12; 16; 4.55; 9.09 0.65954888 0.65954888 9 0.375519541; 0.376115439 3.7; 3.7 0.602294433 0.602294433 10 0.375519541; 0.376115439 3.7; 3.7 0.595906629 0.595906629 11 0.375519541; 0.376115439 0.74; 0.74 0.555587425 0.555587425 12 0.375519541; 0.376115439 0.74; 0.74 0.550786641 0.550786641 13 0.375519541; 0.376115439; 0.375519541; 0.376115439 7.14; 7.14; 4.08; 6.12 0.938628219 0.938628219 14 0.375519541; 0.376115439; 0.375519541; 0.376115439 7.14; 7.14; 4.08; 6.12 0.755897322 0.755897322 15 0.375519541; 0.376115439 4.41; 5.88 0.650827971 0.650827971 16 0.375519541; 0.376115439 4.41; 5.88 0.561812306 0.561812306 17 0.375519541; 0.376115439 3.12; 3.12 0.7178366 0.7178366 18 0.375519541; 0.376115439 3.12; 3.12 0.664533836 0.664533836 19 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.720345164 0.720345164 20 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.585763865 0.585763865 21 0.375519541; 0.275564898 8.33; 11.67 0.728255496 0.728255496 22 0.375519541; 0.275564898 8.33; 11.67 0.626985795 0.626985795 23 0.375519541; 0.376115439 14.29; 14.29 0.805818181 0.805818181 24 0.375519541; 0.376115439 14.29; 14.29 0.754843188 0.754843188 25 0.375519541; 0.376115439 11.11; 11.11 0.569380297 0.569380297 26 0.375519541; 0.376115439 11.11; 11.11 0.500263031 0.500263031 27 NA NA 0.509897575 0.509897575 28 NA NA 0.50657948 0.50657948 29 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 20; 20; 7.14; 7.14; 7.14; 7.14; 7.14; 7.14; 7.14; 7.14; 8.33; 8.33 0.866207217 0.866207217 30 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 20; 20; 7.14; 7.14; 7.14; 7.14; 7.14; 7.14; 7.14; 7.14; 8.33; 8.33 0.796884387 0.796884387 31 0.375519541; 0.376115439 6.9; 6.9 0.676235261 0.676235261 32 0.375519541; 0.376115439 6.9; 6.9 0.65992899 0.65992899 33 0.375519541; 0.376115439 1.8; 1.8 0.537783958 0.537783958 34 0.375519541; 0.376115439 1.8; 1.8 0.525514832 0.525514832 35 NA NA 0.613602351 0.613602351 36 NA NA 0.577796521 0.577796521 37 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 4.55; 4.55; 2.94; 2.94; 2.53; 3.8 0.850834682 0.850834682 38 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 4.55; 4.55; 2.94; 2.94; 2.53; 3.8 0.799471663 0.799471663 39 0.375519541; 0.376115439 9.26; 11.11 0.700295531 0.700295531 05 03 25 40 0.375519541; 0.376115439 9.26; 11.11 0.659362838 0.659362838 41 0.375519541; 0.376115439; 0.375519541; 0.376115439 3.7; 3.7; 1.37; 1.37 0.604361909 0.604361909 42 0.375519541; 0.376115439; 0.375519541; 0.376115439 3.7; 3.7; 1.37; 1.37 0.538807176 0.538807176 43 0.375519541; 0.376115439 2.1; 1.4 0.517282981 0.517282981 44 0.375519541; 0.376115439 2.1; 1.4 0.507863493 0.507863493 45 0.375519541; 0.376115439; 0.375519541; 0.376115439 9.09; 13.64; 15.38; 15.38 0.64156671 0.64156671 46 0.375519541; 0.376115439; 0.375519541; 0.376115439 9.09; 13.64; 15.38; 15.38 0.573819811 0.573819811 47 0.375519541; 0.376115439; 0.375519541; 0.376115439 9.09; 13.64; 15.38; 15.38 0.652146396 0.652146396 48 0.375519541; 0.376115439; 0.375519541; 0.376115439 9.09; 13.64; 15.38; 15.38 0.555942825 0.555942825 49 NA NA 0.609340305 0.609340305 50 NA NA 0.59761426 0.59761426 51 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.677345043 0.677345043 52 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.57758614 0.57758614 Table l.a3 t P.Value adj.P.Val B FC FC_1 LS 1 15.48213629 0.00000000290 0.00000295 11.76634134 1.825906369 1.825906369 1 2 10.90560599 0.000000141 0.0000121 7.993827062 1.514565565 1.514565565 1 3 14.54112017 0.00000000592 0.00000425 11.09715078 1.544463932 1.544463932 1 4 12.04390392 0.0000000472 0.00000648 9.09410211 1.444571722 1.444571722 1 5 25.72439074 0.00000000000747 0.00000021 17.12798872 1.683394607 1.683394607 1 6 12.9172327 0.0000000225 0.00000846 9.819863175 1.679417371 1.679417371 1 7 12.13583206 0.0000000433 0.00000621 9.17851343 1.596403143 1.596403143 1 8 6.326625846 0.0000389 0.000771167 2.314278452 1.579588621 1.579588621 1 9 11.19275614 0.000000106 0.0000101 8.281365671 1.518129049 1.518129049 1 10 14.86623147 0.00000000460 0.00000374 11.3338263 1.511422107 1.511422107 1 11 9.97024001 0.000000387 0.0000415 7.010942014 1.469766959 1.469766959 1 12 7.304237986 0.0000095 0.000168592 3.689574847 1.464884218 1.464884218 1 13 5.188268027 0.000230155 0.002611351 0.486477599 1.916704881 1.916704881 1 14 7.96757943 0.00000396 0.0000951 4.592800505 1.688681585 1.688681585 1 15 8.406146792 0.00000234 0.000126067 5.19109577 1.570069009 1.570069009 1 16 9.176454561 0.00000091 0.0000378 6.102024196 1.47612235 1.47612235 1 17 10.68763964 0.000000176 0.0000138 7.770816129 1.644713846 1.644713846 1 18 7.604376575 0.0000065 0.000238672 4.149051664 1.585056027 1.585056027 1 19 5.982165578 0.0000653 0.001097327 1.780661324 1.647576169 1.647576169 1 20 6.985570256 0.0000148 0.00022515 3.235258081 1.500833427 1.500833427 1 21 11.11001278 0.000000119 0.0000206 8.182990839 1.656634681 1.656634681 1 22 14.50519177 0.00000000581 0.00000221 11.15480936 1.544335061 1.544335061 1 23 15.37164789 0.000000003 0.00000157 11.79292692 1.748136914 1.748136914 1 24 13.21152003 0.0000000175 0.00000747 10.06384086 1.687448167 1.687448167 1 25 3.215141267 0.007467378 0.029467513 -3.045565381 1.483886037 1.483886037 1 26 2.948006208 0.012206989 0.030334629 -3.634544291 1.414471424 1.414471424 1 27 8.348609612 0.00000251 0.000132277 5.118936878 1.423949097 1.423949097 1 28 9.450440119 0.000000665 0.0000309 6.42147295 1.420677881 1.420677881 1 29 17.02141727 0.000000000928 0.000000911 12.90295478 1.822864364 1.822864364 1 30 10.01427596 0.000000369 0.0000403 7.058479282 1.737345139 1.737345139 1 31 12.30252086 0.0000000372 0.00000569 9.329970688 1.597964392 1.597964392 1 32 14.06352468 0.00000000863 0.00000511 10.73843464 1.580004854 1.580004854 1 33 7.952019371 0.00000404 0.0000963 4.572250314 1.451740867 1.451740867 1 34 7.231237094 0.0000107 0.000330369 3.636164955 1.439447161 1.439447161 1 35 15.15831191 0.00000000369 0.00000351 11.54146845 1.530074979 1.530074979 1 36 18.45463633 0.000000000364 0.000000599 13.76937805 1.492567856 1.492567856 1 37 9.704773837 0.000000517 0.0000497 6.720302935 1.803544078 1.803544078 1 05 03 25 38 11.49090413 0.0000000795 0.00000863 8.572631871 1.740463626 1.740463626 1 39 11.48453583 0.000000083 0.0000165 8.543169301 1.624837601 1.624837601 1 40 11.05061974 0.000000122 0.000011 8.139913014 1.579384939 1.579384939 1 41 10.20129572 0.000000302 0.0000361 7.258274228 1.520306187 1.520306187 1 42 11.03643039 0.000000124 0.0000111 8.12569815 1.452770866 1.452770866 1 43 19.27838714 0.000000000219 0.000000503 14.23104616 1.43125723 1.43125723 1 44 12.12361632 0.0000000456 0.000012 9.1316772 1.42194286 1.42194286 1 45 10.64291847 0.000000191 0.0000275 7.716972128 1.560022363 1.560022363 1 46 9.673151208 0.000000519 0.0000266 6.675396652 1.488459339 1.488459339 1 47 11.98349768 0.0000000519 0.0000129 9.005365404 1.571504492 1.571504492 1 48 8.403692855 0.00000229 0.0000672 5.156809921 1.470129073 1.470129073 1 49 8.55926631 0.00000189 0.0000595 5.352541561 1.525561463 1.525561463 1 50 13.03017616 0.0000000204 0.00000803 9.91419092 1.513212144 1.513212144 1 51 5.77751212 0.0000896 0.001355138 1.455590078 1.599194087 1.599194087 1 52 6.932319235 0.0000159 0.000237022 3.158007229 1.492350217 1.492350217 1 Table l.a4 Probe sequence Probe Location Loop Detected 60 mer Chr 1 mHC GAAACAGAATTTCAAAAGGATACTATATTCGATTGATACATGAG Illi AGTA1 1 1 1 1 1 GA 13 2 sHC GAAACAGAATTTCAAAAGGATACTATATTCGATTGATACATGAG Illi AGTA 1 1 1 1 1 1 GA 13 3 mHC GCATTGIIICIICATTTTA1 1 1 1 Al 1 1 1 1CGAAGTCTTCAAGCTGACTACTAAAAATTGG 2 4 sHC GCATTG IIICII CATTTTA 1 1 1 1 Al 1 1 1 1CGAAGTCTTCAAGCTGACTACTAAAAATTGG 2 5 sHC CAGTAATCCTAGAAAGACAACTGATACATCGATTTTCATTTGAAATCTTTCTAATATTCC 8 6 mHC CAGTAATCCTAGAAAGACAACTGATACATCGATTTTCATTTGAAATCTTTCTAATATTCC 8 7 sHC Al 1 1 1 1 1 1 1 IATTATTATACI 1 1 1AAGTTCGAGC1 1 1 1 IGATAAAAI1IGAAAAACACAT 11 8 mHC Al 1 1 1 1 1 1 1 1A1 1AITATACT111AAGTTCGAGC 1 1 1 1 IGATAAAAI1IGAAAAACACAT 11 9 sHC ATAATAAACAAGCAAAATATGTGTACATTCGAGATACTACGAGTTAATAGCATAGGAGAT 11 10 mHC ATAATAAACAAGCAAAATATGTGTACATTCGAGATACTACGAGTTAATAGCATAGGAGAT 11 11 mHC TATTATAATTGACTTA1 1 1 1 1 CCA FTATTCGAATACA1 1 1 1 1CTCTTTGAGTGGGAAGAA 13 12 sHC TATTATAATTGACTTA1 1 1 1 1CCATTATTCGAATACA1 1 1 1 1C1C1 1 1GAGTGGGAAGAA 13 13 mHC TATATTTAATTATAATTGTAACACAATGTCGATATTGAATGACTTCATGTTGTGAAGTTG 2 14 sHC TATATTTAATTATAATTGTAACACAATGTCGATATTGAATGACTTCATGTTGTGAAGTTG 2 15 mHC AATGCTTAAACACCAAGTATATATATTTTCGATATAGTTTAGTTATAACCATAATCATAT 4 16 sHC AATGCTTAAACACCAAGTATATATATTTTCGATATAGTTTAGTTATAACCATAATCATAT 4 17 sHC 1111CA1 1 1 1 1 1 1 1 1 lAAATATGCTAI1ICGAI1 1 1C1 1 1CATCAGGAGTAAG11lATAG 5 18 mHC 111IGAI 1 1 1 1 1 1 1 1 lAAATATGCTAI1ICGAI 1 1 1C1 1 1 CATCAGGAGTAAG!1lATAG 5 19 mHC CCACGGAGGGGTCCTTCTGAACTGCAATTCGATGTTACTCTGGAAACAAAGGTCCCCTTG 9 20 sHC CCACGGAGGGGTCCTTCTGAACTGCAATTCGATGTTACTCTGGAAACAAAGGTCCCCTTG 9 21 mHC ATATGAAACCAAATATATAAACTTATTTTCGATTAAGAATTACCGTCTTAAGAAAATCTC 2 22 sHC ATATGAAACCAAATATATAAACTTATTTTCGATTAAGAATTACCGTCTTAAGAAAATCTC 2 23 sHC Al 1 1 1 1 1 1 1AGCCCTATCTTCACAGGTATCGACTAAATACTTCTTCAGTAATTACTGAAA 6 24 mHC Al 1 1 1 1 1 1 1AGCCCTATCTTCACAGGTATCGACTAAATACTTCTTCAGTAATTACTGAAA 6 25 mHC ATATTACCTTAI 1 IGGAAACAGTTTCATTCGAGTGGCTCAAATGATTAI 1 1 1 lATAG 1 1 1 3 26 sHC ATATTACCTTATTTGGAAACAGTTTCATTCGAGTGGCTCAAATGATTAI 1 1 1 IAIAGTTT 3 27 mHC ACTTGCTTCTATAAACATTATTGTAAGATCGAGACTCAAAATCATTTGACTCTTCTACAA 6 28 sHC ACTTGCTTCTATAAACATTATTGTAAGATCGAGACTCAAAATCATTTGACTCTTCTACAA 6 29 sHC CTATAGAAATTAAAATAATATTAAGAGTTCGATTATTCTGCTATAC1 1 1 1C1 CA 1TATAA 1 30 mHC CTATAGAAATTAAAATAATATTAAGAGTTCGATTATTCTGCTATAC1 1 1 1C1CATTATAA 1 31 sHC ACTAAA 1 1 1ATTTTAAC1 1 1 1 1 1 1 1 1AATCGAGAG 1 1 1 1 1ATAGCACTTACTCTGAGTCT 8 32 mHC ACTAAA 1 1 1 ATTTTAAC 1 1 1 1 1 1 1 1 1 AATCGAGAG 1 1 1 1 1 ATAGCACTTACTCTGAGTCT 8 33 sHC ATGTAAAGAA1 1 1AAAAATAATCAGTTGTCGAGATTA1 1 1 1 1CAAT1 1 1GGGTGCTCTTC 18 34 mHC ATGTAAAGAA1 1 1 AAAAATAATCAGTTGTCGAGATTA 1 1 1 1 1 CAAT 1 1 1 GGGTGCTCTTC 18 35 mHC TACC1 1 1AACAAAATTCTCTAGAC1 1 1 1 1CGA1 1 1ACATTCTGTTG1 1 1CATTGCATTAT 6 36 sHC TACC1.......1.......r AACAAAATTCTCTAGAC 11 1 1 1CGATTTACATTCTGTTGTTTCATTGCATTAT 6 37 mHC ATATTGGTAGAATAATAGTAGATACTATTCGAATGGTATATCCTCATAGTTTTAATCTGT 12 38 sHC ATATTGGTAGAATAATAGTAGATACTATTCGAATGGTATATCCTCATAGTTTTAATCTGT 12 39 mHC TATATGGTACATATTATACATAI 1 ICIATCGAI 1 1 1 IACAAGAAAI 1 IAAAAATTAGCTT 2 40 sHC TATATGGTACATATTATACATAI 1 ICIATCGAI 1 1 1 IACAAGAAAI 1 1 AAAAATTAGCTT 2 05 03 25 41 mHC ATCCAGATGACCTAAAATATGTTTATTTTCGAAACAATCTCATTTGACAGATGAAGAAAC 2 42 sHC ATCCAGATGACCTAAAATATGTTTATTTTCGAAACAATCTCATTTGACAGATGAAGAAAC 2 43 sHC AACTCTGTAI 1 1 ICI 1 1 1GTAAGATTCATCGATCAATAAATCTTTAATCACATTCACAAA 4 44 mHC AACTCTGTAI 1 1 ICI 1 1 1GTAAGATTCATCGATCAATAAATCTTTAATCACATTCACAAA 4 45 mHC CATAAATAAACACATGAAATATATGAAATCGAAATTAACCAGAAATCCGAGAACCTGAAA 4 46 sHC CATAAATAAACACATGAAATATATGAAATCGAAATTAACCAGAAATCCGAGAACCTGAAA 4 47 mHC CATAAATAAACACATGAAATATATGAAATCGAAAACTAAATCTCTAATCTCTAACCTTTC 4 48 sHC CATAAATAAACACATGAAATATATGAAATCGAAAACTAAATCTCTAATCTCTAACCTTTC 4 49 sHC TATCTAGATGTAGGTATATATTTATCTATCGATATCTCTGTTTTCTTTTGACTGGTGGTT 5 50 mHC TATCTAGATGTAGGTATATATTTATCTATCGATATCTCTGTTTTCTTTTGACTGGTGGTT 5 51 mHC CCACGGAGGGGTCCTTCTGAACTGCAATTCGAAGTGAAACTGCCTTTGATGGGCTCATCA 9 52 sHC CCACGGAGGGGTCCTTCTGAACTGCAATTCGAAGTGAAACTGCCTTTGATGGGCTCATCA 9 Table l.a5 Probe Location 4 kb Sequence Location Startl Endl StartZ End2 Chr Startl Endl Start2 End2 1 31011524 31011555 31024197 31024228 13 31007554 31011555 31020227 31024228 2 31011524 31011555 31024197 31024228 13 31007554 31011555 31020227 31024228 3 227782602 227782633 227877983 227878014 2 227778632 227782633 227874013 227878014 4 227782602 227782633 227877983 227878014 2 227778632 227782633 227874013 227878014 5 21022651 21022682 21093029 21093060 8 21022651 21026652 21093029 21097030 6 21022651 21022682 21093029 21093060 8 21022651 21026652 21093029 21097030 7 49148928 49148959 49219787 49219818 11 49144958 49148959 49215817 49219818 8 49148928 49148959 49219787 49219818 11 49144958 49148959 49215817 49219818 9 75290920 75290951 75323931 75323962 11 75290920 75294921 75323931 75327932 10 75290920 75290951 75323931 75323962 11 75290920 75294921 75323931 75327932 11 27276527 27276558 27309940 27309971 13 27276527 27280528 27309940 27313941 12 27276527 27276558 27309940 27309971 13 27276527 27280528 27309940 27313941 13 169021738 169021769 169105039 169105070 2 169017768 169021769 169101069 169105070 14 169021738 169021769 169105039 169105070 2 169017768 169021769 169101069 169105070 15 175809786 175809817 175829279 175829310 4 175805816 175809817 175829279 175833280 16 175809786 175809817 175829279 175829310 4 175805816 175809817 175829279 175833280 17 78549630 78549661 78567357 78567388 5 78549630 78553631 78563387 78567388 18 78549630 78549661 78567357 78567388 5 78549630 78553631 78563387 78567388 19 38686830 38686861 38749265 38749296 9 38682860 38686861 38745295 38749296 20 38686830 38686861 38749265 38749296 9 38682860 38686861 38745295 38749296 21 209631659 209631690 209662023 209662054 2 209627689 209631690 209658053 209662054 22 209631659 209631690 209662023 209662054 2 209627689 209631690 209658053 209662054 23 127085111 127085142 127117219 127117250 6 127085111 127089112 127117219 127121220 24 127085111 127085142 127117219 127117250 6 127085111 127089112 127117219 127121220 25 179885246 179885277 179956050 179956081 3 179881276 179885277 179956050 179960051 26 179885246 179885277 179956050 179956081 3 179881276 179885277 179956050 179960051 27 159103259 159103290 159125255 159125286 6 159103259 159107260 159121285 159125286 28 159103259 159103290 159125255 159125286 6 159103259 159107260 159121285 159125286 29 152738349 152738380 152809337 152809368 1 152738349 152742350 152805367 152809368 30 152738349 152738380 152809337 152809368 1 152738349 152742350 152805367 152809368 31 74050342 74050373 74077219 74077250 8 74050342 74054343 74077219 74081220 32 74050342 74050373 74077219 74077250 8 74050342 74054343 74077219 74081220 33 10063278 10063309 9948485 9948516 18 10063278 10067279 9944515 9948516 34 10063278 10063309 9948485 9948516 18 10063278 10067279 9944515 9948516 35 140794230 140794261 140900253 140900284 6 140794230 140798231 140896283 140900284 36 140794230 140794261 140900253 140900284 6 140794230 140798231 140896283 140900284 37 10067827 10067858 10158041 10158072 12 10063857 10067858 10154071 10158072 38 10067827 10067858 10158041 10158072 12 10063857 10067858 10154071 10158072 39 20304911 20304942 20328998 20329029 2 20300941 20304942 20328998 20332999 40 20304911 20304942 20328998 20329029 2 20300941 20304942 20328998 20332999 41 216702663 216702694 216719705 216719736 2 216698693 216702694 216719705 216723706 42 216702663 216702694 216719705 216719736 2 216698693 216702694 216719705 216723706 43 152218333 152218364 152270249 152270280 4 152214363 152218364 152266279 152270280 44 152218333 152218364 152270249 152270280 4 152214363 152218364 152266279 152270280 45 153731280 153731311 153764752 153764783 4 153727310 153731311 153760782 153764783 46 153731280 153731311 153764752 153764783 4 153727310 153731311 153760782 153764783 47 153731280 153731311 153769067 153769098 4 153727310 153731311 153765097 153769098 48 153731280 153731311 153769067 153769098 4 153727310 153731311 153765097 153769098 49 6226839 6226870 6298491 6298522 5 6222869 6226870 6298491 6302492 50 6226839 6226870 6298491 6298522 5 6222869 6226870 6298491 6302492 51 38686830 38686861 38760696 38760727 9 38682860 38686861 38756726 38760727 52 38686830 38686861 38760696 38760727 9 38682860 38686861 38756726 38760727 Table l.a6 05 03 25 Probe PCR- Primerl_ID PCR_Primerl 1 ORF1_13_31010097_31011555_31022136_31024228_FF OBD159_OO 1 CTTCTGGAGTCACTTTCTCTTTTAGA 2 ORF1_13_31010097_31011555_31022136_31024228_FF OBD159_OO 1 CTTCTGGAGTCACTTTCTCTTTTAGA 3 ORF1_2_227779837_227782633_227875567_227878014_FF OBD159_OO 5 CTGAAGTTGTAGCAGGCAGCATCCAT 4 ORF1_2_227779837_227782633_227875567_227878014_FF OBD159_OO 5 CTGAAGTTGTAGCAGGCAGCATCCAT 5 ORF1_8_21022651_21025530_21093029_21096890_RR OBD159_OO 9 GGTGAGGCTTCTGTTTTCGGGAGG 6 ORF1_8_21022651_21025530_21093029_21096890_RR OBD159_OO 9 GGTGAGGCTTCTGTTTTCGGGAGG 7 ORF10_11_49143461_49148959_49212875_49219818_FF OBD159_O1 3 GTTTCAGGACCACCCTCTACACC 8 ORF10_11_49143461_49148959_49212875_49219818_FF OBD159_O1 3 GTTTCAGGACCACCCTCTACACC 9 ORF10_11_75290920_75295115_75323931_75326829_RR OBD159_O1 7 CTGTTCTG GGTG CTTGGGATAGATG C 1 0 ORF10_11_75290920_75295115_75323931_75326829_RR OBD159_O1 7 CTGTTCTG GGTG CTTGGG ATAGATG C 1 1 ORF10_13_27276527_27282043_27309940_27312084_RR OBD159_O2 1 GTGCCCTTCGCCTAAACACAAGC 1 2 ORF10_13_27276527_27282043_27309940_27312084_RR OBD159_O2 1 GTGCCCTTCGCCTAAACACAAGC 1 3 ORF10_2_169020149_169021769_169092304_169105070_FF OBD159_O2 5 CAACCTAACACAACATAGCCTGC 1 4 ORF10_2_169020149_169021769_169092304_169105070_FF OBD159_O2 5 CAACCTAACACAACATAGCCTGC 1 5 ORF10_4_175807779_175809817_175829279_175833051_FR OBD159_O2 9 TCTGACTGAACACATATGCT 1 6 ORF10_4_175807779_175809817_175829279_175833051_FR OBD159_O2 9 TCTGACTGAACACATATGCT 1 7 ORF10_5_78549630_78552354_78564492_78567388_RF OBD159_O3 3 GTGAAACCACCAGAGTAGTCAGGAAG 1 8 ORF10_5_78549630_78552354_78564492_78567388_RF OBD159_O3 3 GTGAAACCACCAGAGTAGTCAGGAAG 1 9 ORF10_9_38681931_38686861_38745325_38749296_FF OBD15903 7 GCCAGAAGTTCACAGGCAGGGTG 2 0 ORF10_9_38681931_38686861_38745325_38749296_FF OBD159_O3 7 GCCAGAAGTTCACAGGCAGGGTG 2 0RF1OO 2 209628749 209631690 209659511 209662054 F OBD159_O4 1 F 1 CCCTCAG G CTTCTGTTGTTGGCA 2 0RF1OO 2 209628749 209631690 209659511 209662054 F OBD159_O4 2 F 1 CCCTCAG G CTTCTGTTGTTGGCA 2 0RF1O1 6 127085111 127088243 127117219 127121367 R OBD159_O4 3 R 5 GTTGCTGCCAGAGACCCATCCCA 2 0RF1O1 6 127085111 127088243 127117219 127121367 R OBD159_O4 4 R 5 GTTGCTGCCAGAGACCCATCCCA 2 0RF1O2 3 179882870 179885277 179956050 179960326 F OBD159_O4 5 R 9 GGAGAGTATTATGGATTGAGTGGTCT 05 03 25 2 6 ORF102_3_179882870_179885277_179956050_179960326_F R OBD159_O4 9 GGAGAGTATTATGGATTGAGTGGTCT 2 7 ORF104_6_159103259_159105928_159122150_159125286_R F 0BD159_05 3 CCACTTGCCCTGTGCTCGCCAGC 2 8 ORF104_6_159103259_159105928_159122150_159125286_R F OBD159_O5 3 CCACTTGCCCTGTGCTCGCCAGC 2 9 ORF106_1_152738349_152759424_152785124_152809368_R F OBD159_O5 7 GACATTTGGTGACCCATTACTCAACA 3 0 ORF106_1_152738349_152759424_152785124_152809368_R F 0BD159_05 7 GACATTTGGTGACCCATTACTCAACA 3 1 ORF106_8_74050342_74056528_74077219_74079715_RR OBD159_O6 1 GGCGGGTGGGTATGTGTTATGGG 3 2 ORF106_8_74050342_74056528_74077219_74079715_RR OBD159_O6 1 GGCGGGTGGGTATGTGTTATGGG 3 3 ORF107_18_10063278_10067780_9946347_9948516_RF OBD159_O6 5 TTTGGCAAGGCATAGAATAGAATA 3 4 ORF107_18_10063278_10067780_9946347_9948516_RF OBD159_O6 5 TTTGGCAAGGCATAGAATAGAATA 3 5 ORF107_6_140794230_140798634_140883673_140900284_R F 0BD159_06 9 GTGTCACAATAAAATGGCATAAAA 3 6 ORF107_6_140794230_140798634_140883673_140900284_R F OBD159_O6 9 GTGTCACAATAAAATGGCATAAAA 3 7 ORF11_12_10066384_10067858_10157054_10158072_FF OBD159_O7 3 TC1L1 1 1CATTGAGTTCTAAGTTA 3 8 ORF11_12_10066384_10067858_10157054_10158072_FF OBD159_O7 3 TCTCTTTCATTGAGTTCTAAGTTA 3 9 ORF11_2_20303337_20304942_20328998_20331608_FR 0BD159_07 7 CATTTGTCAACTCACACTCTAAAA 4 0 ORF11_2_20303337_20304942_20328998_20331608_FR OBD159_O7 7 CATTTGTCAACTCACACTCTAAAA 4 1 ORF11_2_216695404_216702694_216719705_216724855_FR OBD159_O8 1 GGTGTTACTTGGCTTCTATGCCTTAG 4 2 ORF11_2_216695404_216702694_216719705_216724855_FR OBD159_O8 1 GGTGTTACTTGGCTTCTATGCCTTAG 4 3 ORF11_4_152216416_152218364_152265231_152270280_FF OBD159_O8 5 TG AAATG AG CAG GTG GG AGTAG GTG G 4 4 ORF11_4_152216416_152218364_152265231_152270280_FF OBD159_O8 5 TG AAATG AG CAG GTG GG AGTAG GTG G 4 5 ORF11_4_153729106_153731311_153760093_153764783_FF OBD159_O8 9 TATGAAATGTAGGAATGCTGTCCCTC 4 6 ORF11_4_153729106_153731311_153760093_153764783_FF OBD159_O8 9 TATGAAATGTAGGAATGCTGTCCCTC 4 7 ORF11_4_153729106_153731311_153764783_153769098_FF OBD159_O9 3 TATGAAATGTAGGAATGCTGTCCCTC 4 8 ORF11_4_153729106_153731311_153764783_153769098_FF OBD159_O9 3 TATGAAATGTAGGAATGCTGTCCCTC 4 9 ORF11_5_6223946_6226870_6298491_6302848_FR OBD159_O9 7 CTGTTCTCAGCAATGGAATCTCAGGT 5 0 ORF11_5_6223946_6226870_6298491_6302848_FR OBD159_O9 7 CTGTTCTCAGCAATGGAATCTCAGGT 5 1 ORF11_9_38681931_38686861_38758125_3876O727_FF OBD159_1O 1 CAGAAGTTCACAGGCAGGGTGTCTTG 5 2 ORF11_9_38681931_38686861_38758125_3876O727_FF OBD159_1O 1 CAGAAGTTCACAGGCAGGGTGTCTTG Table l.a7 PCR- Primer2_ID PCR_Primer2 Gene Marker GLMNET 1 OBD159_003 AGCCTGGGCGACAGAGTGAGACT HSPH1; TEX26 OBD159_001_003 -0.00243741 2 OBD159_003 AGCCTGGGCGACAGAGTGAGACT HSPH1; TEX26 OBD159_001_003 -0.00243741 3 OBD159_007 GAGGTTTTGTCACAGCGAAGCAGTCA CCL2O; DAW1; rsll3776284; rs7556897; rs4973341; OBD159_005_007 -0.002876667 05 03 25 rsl811711; rsl3384448; rs7591163 4 OBD159_007 GAGGTTTTGTCACAGCGAAGCAGTCA CCL20; DAW1; rsll3776284; rs7556897; rs4973341; rsl811711; rsl3384448; rs7591163 OBD159_005_007 -0.002876667 5 OBD159_011 AGGATTTGGGTCCCTGGTCTCCA rs7015657; rs5OO816 OBD159_009_011 -0.002158394 6 OBD159_011 AGGATTTGGGTCCCTGGTCTCCA rs7015657; rs5OO816 OBD159_009_011 -0.002158394 7 OBD159_015 CCAGTTCTTCCCTTCCAGAGCAGG FOLH1;TRIM64C; rs368939818; rs61886492; rs770894245; rs747052707; rs202680; rs202676 OBD159_013_015 -0.000632005 8 OBD159_015 CCAGTTCTTCCCTTCCAGAGCAGG FOLH1; TRIM64C; rs368939818; rs61886492; rs770894245; rs747052707; rs202680; rs202676 OBD159_013_015 -0.000632005 9 OBD159_019 TTTGTG CTTCTTG CTGTGTGTGTGTG ARRB1; rs7952O44; rs737410 OBD159_017_019 -0.004167216 10 OBD159_019 TTTGTG CTTCTTG CTGTGTGTGTGTG ARRB1; rs7952O44; rs737410 OBD159_017_019 -0.004167216 11 OBD159_023 GAGACTCTGACCCGTCCCCTGAT RASL11A; rs9512637 OBD159_021_023 -0.003093498 12 OBD159_023 GAGACTCTGACCCGTCCCCTGAT RASL11A; rs9512637 OBD159_021_023 -0.003093498 13 OBD159_027 CAAGTGACTCCATTTTGGTTGTGACA ABCB11; DHRS9; rs886043986; rs2161037 OBD159_025_027 -0.002380456 14 OBD159_027 CAAGTGACTCCATTTTGGTTGTGACA ABCB11; DHRS9; rs886043986; rs2161O37 OBD159_025_027 -0.002380456 15 OBD159_031 AATACCAACAATAATTTGT GPM6A; rsl3144140 OBD159_029_031 -0.000660848 16 OBD159_031 AATACCAACAATAATTTGT GPM6A; rsl3144140 OBD159_029_031 -0.000660848 17 OBD159_035 GAAAGTGGTCTTCCTCCGCCTCTAT LHFPL2; rs72315235; rs344650 OBD159_033_035 -0.000406493 18 OBD159_035 GAAAGTGGTCTTCCTCCGCCTCTAT LHFPL2; rs72315235; rs344650 OBD159_033_035 -0.000406493 19 OBD159_039 GCCCAACTCTG CCTG CTG AAATC ANKRD18A; CNTNAP3 OBD159_037_039 -0.002198949 20 OBD159_039 GCCCAACTCTG CCTG CTG AAATC ANKRD18A; CNTNAP3 OBD159_037_039 -0.002198949 21 OBD159_043 GCAG GTATTG CCAG CCACAGCGT MAP2; rsl46432517; rs9288410 OBD159_041_043 -0.003078755 22 OBD159_043 GCAG GTATTG CCAG CCACAGCGT MAP2; rsl46432517; rs9288410 OBD159_041_043 -0.003078755 23 OBD159_047 CGGTAG CACCAG CCGATGAACTT RSPO3; rsl9368O7; rs4580892; rs719726; rs2745349; rsl936792; rsl936797; rsl936799; rsl936800; rsl555091 OBD159_045_047 -0.002660313 24 OBD159_047 CGGTAG CACCAG CCGATGAACTT RSPO3; rsl936807; rs4580892; rs719726; rs2745349; rsl936792; rsl936797; rsl936799; rsl936800; rsl555O91 OBD159_045_047 -0.002660313 25 OBD159_051 CTCTAAGCCTTGACTTCCCTATCAGC PEX5L; rsl46906651 OBD159_049_051 0.000980386 26 OBD159_051 CTCTAAGCCTTGACTTCCCTATCAGC PEX5L; rsl46906651 OBD159_049_051 0.000980386 27 OBD159_055 GAGAAAATCTTGAATGGGAATCCAGT rs2249937; rs9355260 OBD159_053_055 -0.004017137 28 OBD159_055 GAGAAAATCTTGAATGGGAATCCAGT rs2249937; rs9355260 OBD159_053_055 -0.004017137 29 OBD159_059 GGAGGCATTTGGCTTGTCCCCAGATT KPRP; LCE1B; LCE1C; LCE1D; LCE1E; LCE1F; rs7517755; rs77199844; rs6701216 OBD159_057_059 -0.001306703 30 OBD159_059 GGAGGCATTTGGCTTGTCCCCAGATT KPRP; LCE1B; LCE1C; LCE1D; LCE1E; LCE1F; rs7517755; rs77199844; rs6701216 OBD159_057_059 -0.001306703 31 OBD159_063 GGTCTTCATTCCTGGTTCCTGGC LY96; rs6472827 OBD159_061_063 -0.003175406 32 OBD159_063 GGTCTTCATTCCTGGTTCCTGGC LY96; rs6472827 OBD159_061_063 -0.003175406 33 OBD159_067 TTTG G CAAG G CATAG AATAG AATA VAPA; rs8089099; rs29067; rs29066 OBD159_065_067 -0.001345057 34 OBD159_067 TTTG G CAAG G CATAG AATAG AATA VAPA; rs8089099; rs29067; rs29066 OBD159_065_067 -0.001345057 35 OBD159_071 CATCCCATTCTCAG CATTTG ATTA rsl46383502; rslll55133 OBD159_069_071 -0.003773782 36 OBD159_071 CATCCCATTCTCAG CATTTG ATTA rslll55133 OBD159_069_071 -0.003773782 37 OBD159_075 TGAGATTGTGCCACTGAACTCCAG CLEC1A; CLEC7A; OLR1; rsl6910526; rsl6910527; rs73O9123; rs2O78178; rs39O1533 OBD159_073_075 -0.002317351 38 OBD159_075 TGAGATTGTGCCACTGAACTCCAG CLEC1A; CLEC7A; OLR1; rsl691O526; rsl691O527; rs73O9123; rs2078178; rs39O1533 OBD159_073_075 -0.002317351 39 OBD159_079 TGGTTTACTG CTGTAG CCTTG ACCT PUM2; rslll612372 OBD159_077_079 -0.003104042 40 OBD159_079 TGGTTTACTG CTGTAG CCTTGACCT PUM2; rslll612372 OBD159_077_079 -0.003104042 41 OBD159_083 GCTGCTTAGGGACACCGAAAAGGTTC IGFBP2; IGFBP5 OBD159_081_083 -0.000193892 42 OBD159_083 GCTGCTTAGGGACACCGAAAAGGTTC IGFBP2; IGFBP5 OBD159_081_083 -0.000193892 43 OBD159_087 CGGAAAATGAGGAAGAGAGGAGGA TA FBXW7; rs522743 OBD159_085_087 -0.003996906 44 OBD159_087 CGGAAAATGAGGAAGAGAGGAGGA TA FBXW7; rs522743 OBD159_085_087 -0.003996906 45 OBD159_091 GGTTCGTGTAACAGCCAGTTCATTTA RNF175; SFRP2 OBD159_089_091 -0.000814697 46 OBD159_091 GGTTCGTGTAACAGCCAGTTCATTTA RNF175; SFRP2 OBD159_089_091 -0.000814697 47 OBD159_095 CCAG G CTACACAGACATAGTTGT RNF175; SFRP2 OBD159_093_095 -0.000471857 48 OBD159_095 CCAG G CTACACAGACATAGTTGT RNF175; SFRP2 OBD159_093_095 -0.000471857 49 OBD159_099 CAATAACTGAATGGCTGAGTCTGAAA rsl2518614 OBD159_097_099 -0.004138741 50 OBD159_099 CAATAACTGAATGGCTGAGTCTGAAA rsl2518614 OBD159_097_099 -0.004138741 51 OBD159_103 CATTTGGAATCTTCTCACGGTTGCTG ANKRD18A; CNTNAP3 OBD159_101_103 -0.002219289 52 OBD159_103 CATTTGGAATCTTCTCACGGTTGCTG ANKRD18A; CNTNAP3 OBD159_101_103 -0.002219289 Table l.a8 05 03 25 Probe GeneLocus 53 ORF11_9_38681931_38686861_38760727_38762491_FF ANKRD18A; CNTNAP3 54 ORF11_9_38681931_38686861_38760727_38762491_FF ANKRD18A; CNTNAP3 55 ORF11_X_38261316_38264212_38327821_38333719_FR RP5-972B16.2; RPGR; rs5963409; rs771214648; rs606231180; rs606231181; rsl37852551; rs267607019; rs730882261; rs398122960; rs527236108; rs869312185; rsl060501181; rs62635004; rs771039023; rs527236109; rs62640593; rs527236112; rs62640590; rs62640589; rs527236111; rs62640587; rs62642057; rs878853374; rsl38018739; rs62650220; rs62638651; rs62650218; rsl37852550; rs62638646; rs62638644; rs62638643; rs62638637; rs62638636; rslll631988; rs62638634; rs62638630; rs62638629 56 ORF11_X_38261316_38264212_38327821_38333719_FR RP5-972B16.2; RPGR; rs5963409; rs771214648; rs606231180; rs606231181; rsl37852551; rs267607019; rs730882261; rs398122960; rs527236108; rs869312185; rsl060501181; rs62635004; rs771039023; rs527236109; rs62640593; rs527236112; rs62640590; rs62640589; rs527236111; rs62640587; rs62642057; rs878853374; rsl38018739; rs62650220; rs62638651; rs62650218; rsl37852550; rs62638646; rs62638644; rs62638643; rs62638637; rs62638636; rslll631988; rs62638634; rs62638630; rs62638629 57 ORF110_2_21300802_21304831_21382106_21387178_FF rs59014890; rs2337901 58 ORF110_2_21300802_21304831_21382106_21387178_FF rs59014890; rs2337901 59 ORF111_9_28333777_28339631_28367003_28368817_FR LINGO2; rs7851437 60 ORF111_9_28333777_28339631_28367003_28368817_FR LINGO2; rs7851437 61 ORF112_2_21325579_21332004_21387178_21390560_FR rs2337901; rsll897825 62 ORF112_2_21325579_21332004_21387178_21390560_FR rs2337901; rsll897825 63 ORF112_3_127239888_127246012_127301511_127306201_RR C3orf56; rs7610266 05 03 25 64 ORF112_3_127239888_127246012_127301511_127306201_RR C3orf56; rs7610266 65 ORF113_2_21325579_21332004_21387178_21390560_FF rs2337901; rsll897825 66 C)RF113_2_21325579_21332004_21387178_21390560_FF rs2337901; rsll897825 67 C)RF115_9_105415801_105419712_105449848_105451637_RF FKTN; FSD1L; SLC44A1 68 C)RF115_9_105415801_105419712_105449848_105451637_RF FKTN; FSD1L; SLC44A1 69 ORF116_3_37914711_37917540_37993419_37999345_FR CTDSPL; PLCD1; VILL; rs7372209 70 ORF116_3_37914711_37917540_37993419_37999345_FR CTDSPL; PLCD1; VILL; rs7372209 71 ORF117_13_87499323_87503053_87526042_87529747_FF SLITRK5 72 ORF117_13_87499323_87503053_87526042_87529747_FF SLITRK5 73 ORF117_2_209621630_209626755_209659511_209662054_FF MAP2; rsl46432517; rs9288410 74 ORF117_2_209621630_209626755_209659511_209662054_FF MAP2; rsl46432517; rs9288410 75 ORF119_1_213896516_213907154_213954211_213958027_RF rs7529073; rs4342822 76 ORF119_1_213896516_213907154_213954211_213958027_RF rs7529O73; rs4342822 77 ORF119_8_13602479_13607345_13658646_13661358_RR C8orf48 78 ORF119_8_13602479_13607345_13658646_13661358_RR C8orf48 79 ORF12_1_13873315_13874983_13945271_13952984_RF rs7542939 80 ORF12_1_13873315_13874983_13945271_13952984_RF rs7542939 81 ORF12_1_240091688_240094684_240158711_240162261_FR FMN2; rs727502861; rs727502860 82 ORF12_1_240091688_240094684_240158711_240162261_FR FMN2; rs727502861; rs727502860 83 ORF12_1_364O9666_36411937_36433268_36434547_RR LSM10; 0SCP1 84 ORF12_1_364O9666_36411937_36433268_36434547_RR LSM10; 0SCP1 85 ORF12_12_75070822_75072825_75136236_75139196_RR CAPS2; KCNC2 86 ORF12_12_75070822_75072825_75136236_75139196_RR CAPS2; KCNC2 87 C)RF12_14_50687093_50690663_50737547_50743189_FR NIN; rs387907308; rsl46291102 88 C)RF12_14_50687093_50690663_50737547_50743189_FR NIN; rs387907308; rsl46291102 89 ORF12_2_11479893_11482767_11532162_11535545_RR NIN; rs387907308; rsl46291102 90 ORF12_2_11479893_11482767_11532162_11535545_RR E2F6; GREB1; rs77294520 91 ORF12_4_37796365_37802481_37862832_37864637_RR GAFA3; PGM2 92 ORF12_4_37796365_37802481_37862832_37864637_RR GAFA3; PGM2 93 ORF12_9_38681931_38686861_38738766_38743OO8_FF ANKRD18A; CNTNAP3 94 ORF12_9_38681931_38686861_38738766_38743OO8_FF ANKRD18A; CNTNAP3 95 ORF12_X_1158847O2_115886518_115936O15_115945579_RF PLS3; rs201386833 96 ORF12_X_1158847O2_115886518_115936O15_115945579_RF PLS3; rs201386833 97 ORF12_X_38261316_38264212_38327821_38333719_FF RP5-972B16.2; RPGR; rs5963409; rs771214648; rs606231180; rs606231181; rsl37852551; rs267607019; rs730882261; rs398122960; rs527236108; rs869312185; rsl060501181; rs62635004; rs771039023; rs527236109; rs62640593; rs527236112; rs62640590; rs62640589; rs527236111; rs62640587; rs62642057; rs878853374; rsl38018739; rs62650220; rs62638651; rs62650218; rsl37852550; rs62638646; rs62638644; rs62638643; rs62638637; rs62638636; rslll631988; rs62638634; rs62638630; rs62638629 98 ORF12_X_38261316_38264212_38327821_38333719_FF RP5-972B16.2; RPGR; rs5963409; rs771214648; rs606231180; rs606231181; rsl37852551; rs267607019; rs730882261; rs398122960; rs527236108; rs869312185; rsl060501181; rs62635004; rs771039023; rs527236109; rs62640593; rs527236112; rs62640590; rs62640589; rs527236111; rs62640587; rs62642057; rs878853374; rsl38018739; rs62650220; rs62638651; rs62650218; rsl37852550; rs62638646; rs62638644; rs62638643; rs62638637; rs62638636; rslll631988; rs62638634; rs62638630; rs62638629 99 ORF123_6_84727932_84732502_84775145_84786636_FF TBX18; rs72912698; rs760905589; rs869320679; rs797045022; rs77693245 100 ORF123_6_84727932_84732502_84775145_84786636_FF TBX18; rs72912698; rs760905589; rs869320679; rs797045022; rs77693245 05 03 25 101 ORF125_21_15444025_15470065_15500094_15503881_RF rsl736020; rsl297265; rs2823286; rs2823288; rs2823310 102 C)RF125_21_15444025_15470065_15500094_15503881_RF rsl736020; rsl297265; rs2823286; rs2823288; rs2823310 103 ORF127_5_127434266_127436041_127487600_127490915_RF MEGF10; rs794726677; rs387907071; rs387907072; rsl99750143; rs794726678; rs989552169 104 ORF127_5_127434266_127436041_127487600_127490915_RF MEGF10; rs794726677; rs387907071; rs387907072; rsl99750143; rs794726678; rs989552169 105 ORF13_1_207936305_207938059_207957832_207960627_RR rs2745959; rs2745967; rsll578508 106 ORF13_1_207936305_207938059_207957832_207960627_RR rs2745959; rs2745967; rsll578508 107 ORF13_11_49143461_49148959_49200052_49204610_FR F0LH1; rs202676; rs368939818; rs61886492; rs770894245; rs747052707; rs202680 108 C)RF13_ll_49143461_49148959_49200052_49204610_FR F0LH1; rs202676; rs368939818; rs61886492; rs770894245; rs747052707; rs202680 109 C)RF13_12_83941063_83942894_83954032_83957600_FF rsllll6045; rsl545843 110 ORF13_12_83941063_83942894_83954032_83957600_FF rsllll6045; rsl545843 111 ORF13_13_98188349_98189635_98215516_98217335_FR FARP1; RNF113B 112 ORF13_13_98188349_98189635_98215516_98217335_FR FARP1; RNF113B Table l.bl Probe_Count_Total Probe_Count_Sig HyperG_Stats 53 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 54 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 55 37; 34 2; 2; 2; 2 0.251937703; 0.262259643; 0.239085742; 0.251319324 56 37; 34 2; 2; 2; 2 0.251937703; 0.262259643; 0.239085742; 0.251319324 57 NA NA NA 58 NA NA NA 59 20 6; 4 7.69e-05; 0.007618647 60 20 6; 4 7.69e-05; 0.007618647 61 NA NA NA 62 NA NA NA 63 31 1; 1 0.366789724; 0.359323344 64 31 1; 1 0.366789724; 0.359323344 65 NA NA NA 66 NA NA NA 67 4; 18; 18 1; 1; 2; 2; 2; 2 0.138432982; 0.14804367; 0.123103064; 0.136301816; 0.123103064; 0.136301816 68 4; 18; 18 1; 1; 2; 2; 2; 2 0.138432982; 0.14804367; 0.123103064; 0.136301816; 0.123103064; 0.136301816 69 47; 8; 34 1; 1; 1; 1; 1; 1 0.29419612; 0.273584951; 0.236185646; 0.249326315; 0.357029649; 0.346365974 70 47; 8; 34 1; 1; 1; 1; 1; 1 0.29419612; 0.273584951; 0.236185646; 0.249326315; 0.357029649; 0.346365974 71 6 1; 1 0.191789359; 0.203777963 72 6 1; 1 0.191789359; 0.203777963 73 60 5; 7 0.05512946; 0.009185497 74 60 5; 7 0.05512946; 0.009185497 75 NA NA NA 76 NA NA NA 77 8 2; 1 0.033505489; 0.249326315 78 8 2; 1 0.033505489; 0.249326315 79 NA NA NA 80 NA NA NA 81 52 1; 1 0.266738689; 0.244043749 82 52 1; 1 0.266738689; 0.244043749 83 124; 112 3; 3; 3; 3 0.149414204; 0.126913559; 0.17713842; 0.156487188 84 124; 112 3; 3; 3; 3 0.149414204; 0.126913559; 0.17713842; 0.156487188 85 13; 13 4; 4; 4; 4 0.001148684; 0.001517434; 0.001148684; 0.001517434 86 13; 13 4; 4; 4; 4 0.001148684; 0.001517434; 0.001148684; 0.001517434 87 19 1; 1 0.362286681; 0.369026848 88 19 1; 1 0.362286681; 0.369026848 89 48; 40 4; 1; 4; 1 0.078104352; 0.267628012; 0.050377953; 0.314741981 90 48; 40 4; 1; 4; 1 0.078104352; 0.267628012; 0.050377953; 0.314741981 91 37; 37 5; 8; 5; 8 0.010942367; 0.000107113; 0.010942367; 0.000107113 92 37; 37 5; 8; 5; 8 0.010942367; 0.000107113; 0.010942367; 0.000107113 93 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 94 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 95 29 2; 5 0.211050406; 0.005560973 96 29 2; 5 0.211050406; 0.005560973 97 37; 34 2; 2; 2; 2 0.251937703; 0.262259643; 0.239085742; 0.251319324 98 37; 34 2; 2; 2; 2 0.251937703; 0.262259643; 0.239085742; 0.251319324 99 20 4; 5 0.005899409; 0.001067155 100 20 4; 5 0.005899409; 0.001067155 101 NA NA NA 102 NA NA NA 103 26 3; 3 0.061689421; 0.072111 104 26 3; 3 0.061689421; 0.072111 105 NA NA NA 106 NA NA NA 107 25 3; 4 0.05677955; 0.016055763 108 25 3; 4 0.05677955; 0.016055763 109 NA NA NA 110 NA NA NA 111 22; 19 1; 1; 1; 1 0.372324987; 0.375573766; 0.362286681; 0.369026848 112 22; 19 1; 1; 1; 1 0.372324987; 0.375573766; 0.362286681; 0.369026848 Table l.b2 05 03 25 FDR_HyperG Percent_Sig logFC AveExpr 53 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.821558647 0.821558647 54 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.657823469 0.657823469 55 0.375519541; 0.376115439; 0.375519541; 0.376115439 5.41; 5.41; 5.88; 5.88 0.605549866 0.605549866 56 0.375519541; 0.376115439; 0.375519541; 0.376115439 5.41; 5.41; 5.88; 5.88 0.509980504 0.509980504 57 NA NA 0.829723114 0.829723114 58 NA NA 0.704138453 0.704138453 59 0.008046243; 0.242844385 30; 20 0.572598955 0.572598955 60 0.008046243; 0.242844385 30; 20 0.527267248 0.527267248 61 NA NA 0.79819641 0.79819641 62 NA NA 0.714249608 0.714249608 63 0.375519541; 0.376115439 3.23; 3.23 0.549593463 0.549593463 64 0.375519541; 0.376115439 3.23; 3.23 0.519184321 0.519184321 65 NA NA 0.76945482 0.76945482 66 NA NA 0.637422788 0.637422788 67 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 25; 25; 11.11; 11.11; 11.11; 11.11 0.633540142 0.633540142 68 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 25; 25; 11.11; 11.11; 11.11; 11.11 0.567144081 0.567144081 69 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 2.13; 2.13; 12.5; 12.5; 2.94; 2.94 0.734451615 0.734451615 70 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 2.13; 2.13; 12.5; 12.5; 2.94; 2.94 0.541384922 0.541384922 71 0.375519541; 0.376115439 16.67; 16.67 0.565217156 0.565217156 72 0.375519541; 0.376115439 16.67; 16.67 0.553862818 0.553862818 73 0.375519541; 0.275564898 8.33; 11.67 0.778409164 0.778409164 74 0.375519541; 0.275564898 8.33; 11.67 0.551177343 0.551177343 75 NA NA 0.669924722 0.669924722 76 NA NA 0.611561332 0.611561332 77 0.375519541; 0.376115439 25; 12.5 0.752596399 0.752596399 78 0.375519541; 0.376115439 25; 12.5 0.707611524 0.707611524 79 NA NA 0.667711917 0.667711917 80 NA NA 0.583354186 0.583354186 81 0.375519541; 0.376115439 1.92; 1.92 0.54528191 0.54528191 05 03 25 82 0.375519541; 0.376115439 1.92; 1.92 0.536628352 0.536628352 83 0.375519541; 0.376115439; 0.375519541; 0.376115439 2.42; 2.42; 2.68; 2.68 0.604378471 0.604378471 84 0.375519541; 0.376115439; 0.375519541; 0.376115439 2.42; 2.42; 2.68; 2.68 0.584997109 0.584997109 85 0.069549998; 0.082088441; 0.069549998; 0.082088441 30.77; 30.77; 30.77; 30.77 0.577457295 0.577457295 86 0.069549998; 0.082088441; 0.069549998; 0.082088441 30.77; 30.77; 30.77; 30.77 0.529824851 0.529824851 87 0.375519541; 0.376115439 5.26; 5.26 0.569001696 0.569001696 88 0.375519541; 0.376115439 5.26; 5.26 0.502346815 0.502346815 89 0.375519541; 0.376115439; 0.375519541; 0.376115439 8.33; 2.08; 10; 2.5 0.575891896 0.575891896 90 0.375519541; 0.376115439; 0.375519541; 0.376115439 8.33; 2.08; 10; 2.5 0.543154472 0.543154472 91 0.357678624; 0.013656923; 0.357678624; 0.013656923 13.51; 21.62; 13.51; 21.62 0.839780241 0.839780241 92 0.357678624; 0.013656923; 0.357678624; 0.013656923 13.51; 21.62; 13.51; 21.62 0.778361716 0.778361716 93 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.683977936 0.683977936 94 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.589298368 0.589298368 95 0.375519541; 0.217379602 6.9; 17.24 0.548467044 0.548467044 96 0.375519541; 0.217379602 6.9; 17.24 0.495803892 0.495803892 97 0.375519541; 0.376115439; 0.375519541; 0.376115439 5.41; 5.41; 5.88; 5.88 0.760795331 0.760795331 98 0.375519541; 0.376115439; 0.375519541; 0.376115439 5.41; 5.41; 5.88; 5.88 0.635541076 0.635541076 99 0.242080288; 0.077749847 20; 25 1.005383323 1.005383323 100 0.242080288; 0.077749847 20; 25 0.876730419 0.876730419 101 NA NA 0.616499755 0.616499755 102 NA NA 0.49510704 0.49510704 103 0.375519541; 0.376115439 11.54; 11.54 0.716763408 0.716763408 104 0.375519541; 0.376115439 11.54; 11.54 0.599380997 0.599380997 105 NA NA 0.656992374 0.656992374 106 NA NA 0.50757894 0.50757894 107 0.375519541; 0.376115439 12; 16 0.840543337 0.840543337 108 0.375519541; 0.376115439 12; 16 0.786719361 0.786719361 109 NA NA 0.657267171 0.657267171 110 NA NA 0.630565161 0.630565161 111 0.375519541; 0.376115439; 0.375519541; 0.376115439 4.55; 4.55; 5.26; 5.26 0.635562953 0.635562953 112 0.375519541; 0.376115439; 0.375519541; 0.376115439 4.55; 4.55; 5.26; 5.26 0.533287999 0.533287999 Table l.b3 t P.Value adJ.P.Val B FC FC_1 LS 53 5.778191883 0.0000895 0.001353955 1.456679722 1.767314318 1.767314318 1 54 6.892181385 0.0000168 0.000246011 3.099524657 1.57770062 1.57770062 1 55 9.253302738 0.000000833 0.0000357 6.19242406 1.521558567 1.521558567 1 56 11.26586399 0.000000103 0.0000188 8.334293711 1.424030952 1.424030952 1 57 10.28202262 0.000000278 0.0000341 7.34348108 1.777344217 1.777344217 1 58 9.413999651 0.000000693 0.0000319 6.379439954 1.629171467 1.629171467 1 59 10.11175044 0.000000332 0.000038 7.163032837 1.487200288 1.487200288 1 60 11.94636528 0.0000000516 0.00000675 9.003842662 1.441196694 1.441196694 1 61 24.58135563 0.0000000000137 0.000000456 16.37874866 1.738925843 1.738925843 1 62 15.25333763 0.00000000327 0.00000161 11.70817215 1.640629652 1.640629652 1 63 7.860091111 0.00000465 0.000194825 4.490099359 1.463673189 1.463673189 1 64 5.522644599 0.00013213 0.001008571 0.969392732 1.43314474 1.43314474 1 65 18.32758338 0.000000000417 0.00000139 13.52750828 1.704625501 1.704625501 1 66 13.94718949 0.00000000907 0.00000273 10.72148372 1.555547865 1.555547865 1 67 11.52508667 0.0000000798 0.0000163 8.581472574 1.551367132 1.551367132 1 68 10.08307691 0.000000332 0.0000201 7.12980296 1.481587756 1.481587756 1 69 9.299955364 0.000000813 0.0000651 6.263268508 1.663764933 1.663764933 1 05 03 25 70 9.505890351 0.000000625 0.0000298 6.485169411 1.455368935 1.455368935 1 71 5.824949583 0.0000832 0.001291332 1.531472866 1.479610205 1.479610205 1 72 4.959175271 0.000332747 0.001973317 0.016938829 1.46801104 1.46801104 1 73 9.757225935 0.000000488 0.0000478 6.778287569 1.715238465 1.715238465 1 74 10.54534743 0.000000204 0.0000152 7.622959726 1.465280982 1.465280982 1 75 9.815136335 0.000000444 0.0000241 6.834662497 1.59098995 1.59098995 1 76 9.53516435 0.000000623 0.0000554 6.530885843 1.527911871 1.527911871 1 77 17.23990268 0.000000000801 0.000000846 13.04055978 1.684822255 1.684822255 1 78 10.60096551 0.000000199 0.0000282 7.674168825 1.633098177 1.633098177 1 79 12.12630571 0.0000000455 0.000012 9.134087029 1.588551561 1.588551561 1 80 9.576235943 0.000000578 0.0000284 6.5655214 1.498328734 1.498328734 1 81 13.7603685 0.000000011 0.00000579 10.50364376 1.459305472 1.459305472 1 82 7.554087927 0.00000679 0.00013468 4.036394527 1.450578481 1.450578481 1 83 17.27604989 0.000000000782 0.000000844 13.06312691 1.52032364 1.52032364 1 84 20.77446481 0.0000000000975 0.00000086 14.78427402 1.500035983 1.500035983 1 85 9.476856238 0.000000646 0.0000303 6.451857113 1.492216944 1.492216944 1 86 4.701168771 0.000520651 0.00463369 -0.350283943 1.443753907 1.443753907 1 87 7.730294698 0.00000551 0.000216233 4.318032369 1.483496677 1.483496677 1 88 10.01953707 0.000000355 0.0000209 7.060443564 1.416515919 1.416515919 1 89 9.902517743 0.000000416 0.0000434 6.937463666 1.490598689 1.490598689 1 90 15.22110504 0.00000000335 0.00000164 11.68495444 1.457155126 1.457155126 1 91 14.63678274 0.00000000549 0.0000041 11.16741021 1.789777493 1.789777493 1 92 11.54363869 0.0000000755 0.00000841 8.623396595 1.715182054 1.715182054 1 93 6.528038663 0.0000289 0.000636125 2.618471694 1.606563423 1.606563423 1 94 7.982440923 0.00000388 0.0000941 4.612400208 1.504514872 1.504514872 1 95 3.325957648 0.006084037 0.025942826 -2.841364307 1.462530837 1.462530837 1 96 3.959937544 0.001899013 0.007183188 -1.766742449 1.41010627 1.41010627 1 97 13.39746234 0.0000000143 0.00000343 10.27616465 1.694424472 1.694424472 1 98 8.949997713 0.00000122 0.000084 5.854134441 1.553520281 1.553520281 1 99 16.50897497 0.00000000139 0.00000219 12.44435513 2.007476811 2.007476811 1 100 8.460462909 0.00000213 0.0000643 5.228560837 1.836209179 1.836209179 1 101 11.89527738 0.0000000563 0.0000134 8.925067536 1.533150958 1.533150958 1 102 11.69713138 0.0000000653 0.00000768 8.769894288 1.409425322 1.409425322 1 103 12.45056206 0.0000000326 0.00000533 9.462780811 1.643490831 1.643490831 1 104 13.56747572 0.0000000129 0.00000631 10.35127768 1.515066372 1.515066372 1 105 14.74583165 0.00000000505 0.00000398 11.24686929 1.576792013 1.576792013 1 106 9.135658327 0.000000954 0.0000389 6.053777075 1.421662428 1.421662428 1 107 13.74582787 0.0000000112 0.00000579 10.49223964 1.790724424 1.790724424 1 108 14.26887695 0.000000007 0.00000243 10.97352139 1.725147074 1.725147074 1 109 12.63211522 0.0000000277 0.00000492 9.6235096 1.577092381 1.577092381 1 110 6.351029156 0.0000375 0.000753966 2.35144083 1.548171355 1.548171355 1 111 11.79956703 0.0000000592 0.00000729 8.866629894 1.553543839 1.553543839 1 112 6.37193688 0.0000363 0.000737519 2.383212703 1.44722376 1.44722376 1 Table l.b4 Probe sequence Probe Location Loop Detected 60 mer Chr 53 mHC CCACGGAGGGGTCCTTCTGAACTGCAATTCGAAACAGTATTTTCAAAAATAAAATAGACC 9 54 sHC CCACGGAGGGGTCCTTCTGAACTGCAATTCGAAACAGTATTTTCAAAAATAAAATAGACC 9 55 sHC AAAGGAAATATTAAGTATGGAAATACTTTCGACACACAATTATGACACTACTAGTAATAG X 56 mHC AAAGGAAATATTAAGTATGGAAATACTTTCGACACACAATTATGACACTACTAGTAATAG X 57 mHC CAATTCAGATAATAATAC1 1 1 1ATAATGTCGACAGAGCTACATTAAAAAGGAGAATCTCC 2 58 sHC CAATTCAGATAATAATAC 1 1 1 1ATAATGTCGACAGAGCTACATTAAAAAGGAGAATCTCC 2 59 mHC GCCCACTAAATAGTAATATTAGGATCTATCGATTTCCCACATGGAATATACAGATTTAGC 9 60 sHC GCCCACTAAATAGTAATATTAGGATCTATCGATTTCCCACATGGAATATACAGATTTAGC 9 61 mHC CAAGAAGAAGGGATAAAATACTACTTCTTCGAAAGTGACAATAACCTCCATAATTAAGGG 2 62 sHC CAAGAAGAAGGGATAAAATACTACTTCTTCGAAAGTGACAATAACCTCCATAATTAAGGG 2 63 mHC TTATATGTTTTAAATAACAAAAATTATATCGATCATCTATCTACATGTGTGTATCTCTAT 3 64 sHC TTATATGTTTTAAATAACAAAAATTATATCGATCATCTATCTACATGTGTGTATCTCTAT 3 65 mHC CAAGAAGAAGGGATAAAATACTACTTCTTCGAGATAATTTGAGATTAAATTGACAACATA 2 05 03 25 66 sHC CAAGAAGAAGGGATAAAATACTACTTCTTCGAGATAATTTGAGATTAAATTGACAACATA 2 67 mHC GGAAATAAACAGAGGGATTTTGTTTATATCGATTATCTTACATGTTTCTTAGAATGAATG 9 68 sHC GGAAATAAACAGAGGGATTTTGTTTATATCGATTATCTTACATGTTTCTTAGAATGAATG 9 69 mHC TAGATGAATAAATTTAGACCTTATTAGGTCGAAAAAACTGGAAAAAAAAATTGTCAAGTG 3 70 sHC TAGATGAATAAATTTAGACCTTATTAGGTCGAAAAAACTGGAAAAAAAAATTGTCAAGTG 3 71 mHC CTACTCTTATTCTTCTCTCAAGAAATTATCGATGTTTGAGAAATATACAAATAAAGTAAT 13 72 sHC CTACTCTTATTCTTCTCTCAAGAAATTATCGATGTTTGAGAAATATACAAATAAAGTAAT 13 73 mHC CAATATTATATGTAGAGATTCTTTCATATCGATTAAGAATTACCGTCTTAAGAAAATCTC 2 74 sHC CAATATTATATGTAGAGATTCTTTCATATCGATTAAGAATTACCGTCTTAAGAAAATCTC 2 75 sHC AGCACAAAATAATATAGCATAAAACATATCGACTTATCTGATTTTCACCTCAAATGACCT 1 76 mHC AGCACAAAATAATATAGCATAAAACATATCGACTTATCTGATTTTCACCTCAAATGACCT 1 77 sHC TATTTGTAAATATTTTAGTATTTACAAATCGATTTTCATAATATCCTAAATATGATATAG 8 78 mHC TATTTGTAAATATTTTAGTATTTACAAATCGATTTTCATAATATCCTAAATATGATATAG 8 79 mHC TACAI 1 1 1 IAGLICATCATAAAAGATATTCGATTATTTAGAAAAAGAAATGAAGAGATGG 1 80 sHC TACAI 1 1 1 1AGC1CATCATAAAAGATATTCGATTATTTAGAAAAAGAAATGAAGAGATGG 1 81 mHC atgaaatagagtgttagaatttaatgaatcgaactgattaataattttcttctgaacccc 1 82 sHC atgaaatagagtgttagaatttaatgaatcgaactgattaataattttcttctgaacccc 1 83 sHC TGGTAAATTGGAGCAGGTGACCTGGGAGTCGAGGCAGCTGCAGGATTTAAATTGGCTGAG 1 84 mHC TGGTAAATTGGAGCAGGTGACCTGGGAGTCGAGGCAGCTGCAGGATTTAAATTGGCTGAG 1 85 sHC TTAACATCTTATTCTAAAAAATAGTTTATCGAAAAATCAGAAATCAGTAACCTAATACTG 12 86 mHC TTAACATCTTATTCTAAAAAATAGTTTATCGAAAAATCAGAAATCAGTAACCTAATACTG 12 87 mHC GGTAATATTTAACTATAGTTCTCAATACTCGAGTGATAAATATTTTGCCAACTTATAAGG 14 88 sHC GGTAATATTTAACTATAGTTCTCAATACTCGAGTGATAAATATTTTGCCAACTTATAAGG 14 89 mHC 1 1 1 1L1CAGCTAAGAAAACAAATGAGATTCGAGTCATTAATTCTTGCTTCTTAACTGCTT 2 90 sHC TTTTCTCAGCTAAGAAAACAAATGAGATTCGAGTCATTAATTCTTGCTTCTTAACTGCTT 2 91 mHC AAAGATATAATGTTTCACATATTTTAAATCGATATATTCTACAAACTGCTTTATTGTAGA 4 92 sHC AAAGATATAATGTTTCACATATTTTAAATCGATATATTCTACAAACTGCTTTATTGTAGA 4 93 mHC CCACGGAGGGGTCCTTCTGAACTGCAATTCGACATCCAAGGTCTTCACAATGTGGCTGAC 9 94 sHC CCACGGAGGGGTCCTTCTGAACTGCAATTCGACATCCAAGGTCTTCACAATGTGGCTGAC 9 95 mHC CACACTTGAGCTCATTGTAAACCAAAGCTCGAGAGCGGTCCCGTGGGGGCGGTGTTACTC X 96 sHC CACACTTGAGCTCATTGTAAACCAAAGCTCGAGAGCGGTCCCGTGGGGGCGGTGTTACTC X 97 sHC AAAGGAAATATTAAGTATGGAAATACTTTCGAGAAAGAAACAAATACAGCTAGGAAGCAT X 98 mHC AAAGGAAATATTAAGTATGGAAATACTTTCGAGAAAGAAACAAATACAGCTAGGAAGCAT X 99 mHC AATTATTCAAAAAGACACAATTG1 1 1 1L1CGAACATGTTTTAGTGATTTATATTCACTCA 6 100 sHC AATTATTCAAAAAGACACAATTGTTTTCTCGAACATGTTTTAGTGATTTATATTCACTCA 6 101 mHC AATTCCATAI1 1 1L1AGAAAACAAAAAATCGATTTTAGAAGACTTGAAAAAGTTGTAATT 21 102 sHC AATTCCATAI1 1 1L1AGAAAACAAAAAATCGATTTTAGAAGACTTGAAAAAGTTGTAATT 21 103 sHC AAACTATGTAAAGAAAATTTGAAGAATTTCGA1 1 1 1 1 ATTGCCAGAAACGACTCTTAAAG 5 104 mHC AAACTATGTAAAGAAAATTTGAAGAATTTCGA1 1 1 1 1 ATTGCCAGAAACGACTCTTAAAG 5 105 mHC CATGTATTTATATTAATATCAAACAAGATCGACCATTATAAAGATTTAACTATTTTATGC 1 106 sHC CATGTATTTATATTAATATCAAACAAGATCGACCATTATAAAGATTTAACTATTTTATGC 1 107 mHC A1 1 1 1 1 1 1 1 1ATTATTATAC Illi AAGTTCGAATC1 1 1C1AAAACACAGTAAACTCAAAC 11 108 sHC A1 1 1 1 1 1 1 1 1 ATTATTATAC Illi AAGTTCGAATC 1 1 1C1 AAAACACAGTAAACTCAAAC 11 109 sHC TATGTATTTATATATGATTACCATTATGTCGATGAATCAACATTTTCCAAAATAATACAT 12 110 mHC TATGTATTTATATATGATTACCATTATGTCGATGAATCAACATTTTCCAAAATAATACAT 12 111 sHC CCAATATGTATTCAAATTAAATACGTATTCGACTTTATACTATATGAGAATAAAAAAAGA 13 112 mHC CCAATATGTATTCAAATTAAATACGTATTCGACTTTATACTATATGAGAATAAAAAAAGA 13 Table l.b5 Probe Location 4 kb Sequence Location Startl Endl Start2 End2 Chr Startl Endl Start2 End2 53 38686830 38686861 38762460 38762491 9 38682860 38686861 38758490 38762491 54 38686830 38686861 38762460 38762491 9 38682860 38686861 38758490 38762491 55 38264181 38264212 38327821 38327852 X 38260211 38264212 38327821 38331822 56 38264181 38264212 38327821 38327852 X 38260211 38264212 38327821 38331822 57 21304800 21304831 21387147 21387178 2 21300830 21304831 21383177 21387178 58 21304800 21304831 21387147 21387178 2 21300830 21304831 21383177 21387178 59 28339600 28339631 28367003 28367034 9 28335630 28339631 28367003 28371004 60 28339600 28339631 28367003 28367034 9 28335630 28339631 28367003 28371004 61 21331973 21332004 21387178 21387209 2 21328003 21332004 21387178 21391179 62 21331973 21332004 21387178 21387209 2 21328003 21332004 21387178 21391179 63 127239888 127239919 127301511 127301542 3 127239888 127243889 127301511 127305512 05 03 25 64 127239888 127239919 127301511 127301542 3 127239888 127243889 127301511 127305512 65 21331973 21332004 21390529 21390560 2 21328003 21332004 21386559 21390560 66 21331973 21332004 21390529 21390560 2 21328003 21332004 21386559 21390560 67 105415801 105415832 105451606 105451637 9 105415801 105419802 105447636 105451637 68 105415801 105415832 105451606 105451637 9 105415801 105419802 105447636 105451637 69 37917509 37917540 37993419 37993450 3 37913539 37917540 37993419 37997420 70 37917509 37917540 37993419 37993450 3 37913539 37917540 37993419 37997420 71 87503022 87503053 87529716 87529747 13 87499052 87503053 87525746 87529747 72 87503022 87503053 87529716 87529747 13 87499052 87503053 87525746 87529747 73 209626724 209626755 209662023 209662054 2 209622754 209626755 209658053 209662054 74 209626724 209626755 209662023 209662054 2 209622754 209626755 209658053 209662054 75 213896516 213896547 213957996 213958027 1 213896516 213900517 213954026 213958027 76 213896516 213896547 213957996 213958027 1 213896516 213900517 213954026 213958027 77 13602479 13602510 13658646 13658677 8 13602479 13606480 13658646 13662647 78 13602479 13602510 13658646 13658677 8 13602479 13606480 13658646 13662647 79 13873315 13873346 13952953 13952984 1 13873315 13877316 13948983 13952984 80 13873315 13873346 13952953 13952984 1 13873315 13877316 13948983 13952984 81 240094653 240094684 240158711 240158742 1 240090683 240094684 240158711 240162712 82 240094653 240094684 240158711 240158742 1 240090683 240094684 240158711 240162712 83 36409666 36409697 36433268 36433299 1 36409666 36413667 36433268 36437269 84 36409666 36409697 36433268 36433299 1 36409666 36413667 36433268 36437269 85 75070822 75070853 75136236 75136267 12 75070822 75074823 75136236 75140237 86 75070822 75070853 75136236 75136267 12 75070822 75074823 75136236 75140237 87 50690632 50690663 50737547 50737578 14 50686662 50690663 50737547 50741548 88 50690632 50690663 50737547 50737578 14 50686662 50690663 50737547 50741548 89 11479893 11479924 11532162 11532193 2 11479893 11483894 11532162 11536163 90 11479893 11479924 11532162 11532193 2 11479893 11483894 11532162 11536163 91 37796365 37796396 37862832 37862863 4 37796365 37800366 37862832 37866833 92 37796365 37796396 37862832 37862863 4 37796365 37800366 37862832 37866833 93 38686830 38686861 38742977 38743008 9 38682860 38686861 38739007 38743008 94 38686830 38686861 38742977 38743008 9 38682860 38686861 38739007 38743008 95 115884702 115884733 115945548 115945579 X 115884702 115888703 115941578 115945579 96 115884702 115884733 115945548 115945579 X 115884702 115888703 115941578 115945579 97 38264181 38264212 38333688 38333719 X 38260211 38264212 38329718 38333719 98 38264181 38264212 38333688 38333719 X 38260211 38264212 38329718 38333719 99 84732471 84732502 84786605 84786636 6 84728501 84732502 84782635 84786636 100 84732471 84732502 84786605 84786636 6 84728501 84732502 84782635 84786636 101 15444025 15444056 15503850 15503881 21 15444025 15448026 15499880 15503881 102 15444025 15444056 15503850 15503881 21 15444025 15448026 15499880 15503881 103 127434266 127434297 127490884 127490915 5 127434266 127438267 127486914 127490915 104 127434266 127434297 127490884 127490915 5 127434266 127438267 127486914 127490915 105 207936305 207936336 207957832 207957863 1 207936305 207940306 207957832 207961833 106 207936305 207936336 207957832 207957863 1 207936305 207940306 207957832 207961833 107 49148928 49148959 49200052 49200083 11 49144958 49148959 49200052 49204053 108 49148928 49148959 49200052 49200083 11 49144958 49148959 49200052 49204053 109 83942863 83942894 83957569 83957600 12 83938893 83942894 83953599 83957600 110 83942863 83942894 83957569 83957600 12 83938893 83942894 83953599 83957600 111 98189604 98189635 98215516 98215547 13 98185634 98189635 98215516 98219517 112 98189604 98189635 98215516 98215547 13 98185634 98189635 98215516 98219517 Table l.b6 Probe PCR- Primerl_ID PCR_Primerl 53 ORF11_9_38681931_38686861_38760727_38762491_FF OBD159_1O 5 GCCAGAAGTTCACAGGCAGGGTG 54 ORF11_9_38681931_38686861_38760727_38762491_FF OBD159_1O 5 GCCAGAAGTTCACAGGCAGGGTG 55 ORF11_X_38261316_38264212_38327821_38333719_FR OBD159_1O 9 TTACAG G CGTGAG CCACCAAGCC 56 ORF11_X_38261316_38264212_38327821_38333719_FR OBD159_1O 9 TTACAG G CGTGAG CCACCAAGCC 57 ORF110_2_21300802_21304831_21382106_21387178 FF OBD159_11 3 ATGGCGAACAGAGTGATGGAGGTGA T 05 03 25 58 ORF110_2_21300802_21304831_21382106_21387178_FF OBD159_11 3 ATGGCGAACAGAGTGATGGAGGTGA T 59 ORF111_9_28333777_28339631_28367003_28368817_FR OBD159_11 7 CCAGTAGTATG GTG GCTGTGAATA 60 ORF111_9_28333777_28339631_28367003_28368817_FR OBD159_11 7 CCAGTAGTATG GTG GCTGTGAATA 61 ORF112_2_21325579_21332004_21387178_21390560_FR OBD159_12 1 GAGGGAGAGAGACTGAAGGCAGG 62 ORF112_2_21325579_21332004_21387178_21390560_FR OBD159_12 1 GAGGGAGAGAGACTGAAGGCAGG 63 ORF112_3_127239888_127246012_127301511_127306201_R R OBD159_12 5 TCACCCTCTGCCTCTGTGTTCTCATC 64 ORF112_3_127239888_127246012_127301511_127306201_R R OBD159_12 5 TCACCCTCTGCCTCTGTGTTCTCATC 65 ORF113_2_21325579_21332004_21387178_21390560_FF OBD159_12 9 GGAGAGAGACTGAAGGCAGGAATGC T 66 ORF113_2_21325579_21332004_21387178_21390560_FF OBD159_12 9 GGAGAGAGACTGAAGGCAGGAATGC T 67 ORF115_9_105415801_105419712_105449848_105451637_R F OBD159_13 3 GAAAATAACTTGGACTTCAGTGTT 68 ORF115_9_105415801_105419712_105449848_105451637_R F OBD159_13 3 GAAAATAACTTGGACTTCAGTGTT 69 ORF116_3_37914711_37917540_37993419_37999345_FR OBD159_13 7 ACTCAGTCCCCTCCCTCAGTAGC 70 ORF116_3_37914711_37917540_37993419_37999345_FR OBD159_13 7 ACTCAGTCCCCTCCCTCAGTAGC 71 ORF117_13_87499323_87503053_87526042_87529747_FF OBD159_14 1 ACAGGTAGGTAAACATTTCATAAA 72 ORF117_13_87499323_87503053_87526042_87529747_FF OBD159_14 1 ACAGGTAGGTAAACATTTCATAAA 73 ORF117_2_209621630_209626755_209659511_209662054_F F OBD159_14 5 CCATTCTTCCAGAGATGTCAAAACCC 74 ORF117_2_209621630_209626755_209659511_209662054_F F OBD159_14 5 CCATTCTTCCAGAGATGTCAAAACCC 75 ORF119_1_213896516_213907154_213954211_213958027_R F OBD159_14 9 GCTCCTGCCATTCAGTTTACCATCTA 76 ORF119_1_213896516_213907154_213954211_213958027_R F OBD159_14 9 GCTCCTGCCATTCAGTTTACCATCTA 77 ORF119_8_13602479_13607345_13658646_13661358_RR OBD159_15 3 ATACAGCCACTTCAACTTGTCCTAAT 78 ORF119_8_13602479_13607345_13658646_13661358_RR OBD159_15 3 ATACAGCCACTTCAACTTGTCCTAAT 79 ORF12_1_13873315_13874983_13945271_13952984_RF OBD159_15 7 TGCTGTGTGACCTTGGGATGTCC 80 ORF12_1_13873315_13874983_13945271_13952984_RF OBD159_15 7 TGCTGTGTGACCTTGGGATGTCC 81 ORF12_1_240091688_240094684_240158711_240162261_FR OBD159_16 1 G GTCAGTGTCAAG CAGTCCAATGAGT 82 ORF12_1_240091688_240094684_240158711_240162261_FR OBD159_16 1 G GTCAGTGTCAAG CAGTCCAATGAGT 83 ORF12_1_364O9666_36411937_36433268_36434547_RR OBD159_16 5 GAAGCGAGTTGCTGTCACTGGAG 84 ORF12_1_364O9666_36411937_36433268_36434547_RR OBD159_16 5 GAAGCGAGTTGCTGTCACTGGAG 85 ORF12_12_75070822_75072825_75136236_75139196_RR OBD159_16 9 G G GACACAAATAGACCAAGTAAAT 86 ORF12_12_75070822_75072825_75136236_75139196_RR OBD159_16 9 G G GACACAAATAGACCAAGTAAAT 87 ORF12_14_50687093_50690663_50737547_50743189_FR OBD159_17 3 GGTGAAATGGGATGGTGTGCTAT 88 ORF12_14_50687093_50690663_50737547_50743189_FR OBD159_17 3 GGTGAAATGGGATGGTGTGCTAT 89 ORF12_2_11479893_11482767_11532162_11535545_RR OBD159_17 7 CATAAACTCCTACCAACTAAGAAT 05 03 25 90 ORF12_2_11479893_11482767_11532162_11535545_RR OBD159_17 7 CATAAACTCCTACCAACTAAGAAT 91 ORF12_4_37796365_37802481_37862832_37864637_RR OBD159_18 1 AATAAATAGATACCATCCCAGAGC 92 ORF12_4_37796365_37802481_37862832_37864637_RR OBD159_18 1 AATAAATAGATACCATCCCAGAGC 93 ORF12_9_38681931_38686861_38738766_38743OO8_FF OBD159_18 5 CAGAAGTTCACAGGCAGGGTGTC 94 ORF12_9_38681931_38686861_38738766_38743OO8_FF OBD159_18 5 CAGAAGTTCACAGGCAGGGTGTC 95 ORF12_X_1158847O2_115886518_115936O15_115945579_RF OBD159_18 9 CAGGAATCATTTGACACAATCCCC 96 ORF12_X_1158847O2_115886518_115936O15_115945579_RF OBD159_18 9 CAGGAATCATTTGACACAATCCCC 97 ORF12_X_38261316_38264212_38327821_38333719_FF OBD159_19 3 AAACAACTACTATCAGATGAGAAAT 98 ORF12_X_38261316_38264212_38327821_38333719_FF OBD159_19 3 AAACAACTACTATCAGATGAGAAAT 99 ORF123_6_84727932_84732502_84775145_84786636_FF OBD159_19 7 GGATGTGTGTGTTGATTCAGCCTTGT 10 0 ORF123_6_84727932_84732502_84775145_84786636_FF OBD159_19 7 GGATGTGTGTGTTGATTCAGCCTTGT 10 1 ORF125_21_15444025_15470065_15500094_15503881_RF 0BD159_20 1 CTCTACCTGTATTGTTGGCTAATCAA 10 2 ORF125_21_15444025_15470065_15500094_15503881_RF 0BD159_20 1 CTCTACCTGTATTGTTGGCTAATCAA 10 ORF127 5 127434266 127436041 127487600 127490915 R OBD159_2O 3 F 5 G G CAAAAG ATTTATTAGGG ACAACCA 10 ORF127 5 127434266 127436041 127487600 127490915 R OBD159_2O 4 F 5 G G CAAAAG ATTTATTAGGG ACAACCA 10 ORF13 1 207936305 207938059 207957832 207960627 R 0BD159_20 CAGAAATGTCAAAAGTAAGAGGCAA 5 R 9 G 10 ORF13 1 207936305 207938059 207957832 207960627 R OBD159_2O CAGAAATGTCAAAAGTAAGAGGCAA 6 R 9 G 10 7 ORF13_11_49143461_49148959_49200052_49204610_FR OBD159_21 3 G GTTTCAG G ACCACCCTCTACACCAA 10 8 ORF13_11_49143461_49148959_49200052_49204610_FR OBD159_21 3 G GTTTCAG G ACCACCCTCTACACCAA 10 9 ORF13_12_83941063_83942894_83954032_83957600_FF OBD159_21 7 ACATATATTAATATAATAATGTA 11 0 ORF13_12_83941063_83942894_83954032_83957600_FF OBD159_21 7 ACATATATTAATATAATAATGTA 11 1 ORF13_13_98188349_98189635_98215516_98217335_FR OBD159_22 1 GAGCAGAACAGAAAGGAACTTGAGT A 11 2 ORF13_13_98188349_98189635_98215516_98217335_FR OBD159_22 1 GAGCAGAACAGAAAGGAACTTGAGT A Table l.b7 PCR- Primer2_ID PCR_Primer2 Marker GLMNET 53 OBD159_107 GCCCTTGCCCTGTCTCAGAATCT OBD159_105_107 -0.002149419 54 OBD159_107 GCCCTTGCCCTGTCTCAGAATCT OBD159_105_107 -0.002149419 55 OBD159_111 CAGATGTTGGTTTAGATGCTGGG OBD159_109_111 -0.002801859 56 OBD159_111 CAGATGTTGGTTTAGATGCTGGG OBD159_109_111 -0.002801859 57 OBD159_115 TTCTGTGGAGGACCTGGGAAATACTC OBD159_113_115 -0.00307575 58 OBD159_115 TTCTGTGGAGGACCTGGGAAATACTC OBD159_113_115 -0.00307575 59 OBD159_119 CCAGAAAGAATGATGAATGTGTTC OBD159_117_119 -0.001168646 60 OBD159_119 CCAGAAAGAATGATGAATGTGTTC OBD159_117_119 -0.001168646 61 OBD159_123 GCTGG CTGTCCTCTAAAACTCTTA OBD159_121_123 -0.003274843 62 OBD159_123 GCTGG CTGTCCTCTAAAACTCTTA OBD159_121_123 -0.003274843 63 OBD159_127 CCCATTGGCATTCAGTAGAACACTTC OBD159_125_127 -0.000325793 05 03 25 64 OBD159_127 CCCATTGGCATTCAGTAGAACACTTC OBD159_125_127 -0.000325793 65 OBD159_131 GATTGAAGGAGAGAGACTAAAGACGC OBD159_129_131 -0.002905869 66 OBD159_131 GATTGAAGGAGAGAGACTAAAGACGC OBD159_129_131 -0.002905869 67 OBD159_135 TTCAGTCAATCCTTTCAGAGAATA OBD159_133_135 -0.003158055 68 OBD159_135 TTCAGTCAATCCTTTCAGAGAATA OBD159_133_135 -0.003158055 69 OBD159_139 GAGTGGGTTGGGCAGATTAGGCA OBD159_137_139 -0.001264904 70 OBD159_139 GAGTGGGTTGGGCAGATTAGGCA OBD159_137_139 -0.001264904 71 OBD159_143 ATCTCAGGTAACTTGATTCACAAAG OBD159_141_143 -0.001918388 72 OBD159_143 ATCTCAGGTAACTTGATTCACAAAG OBD159_141_143 -0.001918388 73 OBD159_147 CAGGTATTGCCAGCCACAGCGTTTGA OBD159_145_147 -0.003019215 74 OBD159_147 CAGGTATTGCCAGCCACAGCGTTTGA OBD159_145_147 -0.003019215 75 OBD159_151 GACTCAAACAGTAAAATAGGGCACCA OBD159_149_151 -0.003218412 76 OBD159_151 GACTCAAACAGTAAAATAGGGCACCA OBD159_149_151 -0.003218412 77 OBD159_155 GCAAGTG CTCATCTCTAAACAACAAC OBD159_153_155 -0.000118105 78 OBD159_155 GCAAGTG CTCATCTCTAAACAACAAC OBD159_153_155 -0.000118105 79 OBD159_159 CTCCCTTTCCCAGTTTGAGCCCC OBD159_157_159 -0.00349468 80 OBD159_159 CTCCCTTTCCCAGTTTGAGCCCC OBD159_157_159 -0.00349468 81 OBD159_163 TTTATGAGAGTGTGGACAAAATAGGG OBD159_161_163 -0.000877317 82 OBD159_163 TTTATGAGAGTGTGGACAAAATAGGG OBD159_161_163 -0.000877317 83 OBD159_167 CCCCAACACAAACTGTCCTCAGGC OBD159_165_167 -0.005982598 84 OBD159_167 CCCCAACACAAACTGTCCTCAGGC OBD159_165_167 -0.005982598 85 OBD159_171 GTTTCACTTAGTTCTATTCTGATTT OBD159_169_171 -0.000811956 86 OBD159_171 GTTTCACTTAGTTCTATTCTGATTT OBD159_169_171 -0.000811956 87 OBD159_175 AGCCTGGGTAACAGAGTGAGACT OBD159_173_175 -0.001474355 88 OBD159_175 AGCCTGGGTAACAGAGTGAGACT OBD159_173_175 -0.001474355 89 OBD159_179 AGAGTGTTGACTGATGAAGGGCTC OBD159_177_179 -0.002586393 90 OBD159_179 AGAGTGTTGACTGATGAAGGGCTC OBD159_177_179 -0.002586393 91 OBD159_183 CTAACATTTC1 1 1 1C1CCACAGTA OBD159_181_183 -0.003333301 92 OBD159_183 CTAACATTTC1 1 1 1C1 CCACAGTA OBD159_181_183 -0.003333301 93 OBD159_187 TTTGGCTGGAGCACGGAGTCTGC OBD159_185_187 -0.001801783 94 OBD159_187 TTTGGCTGGAGCACGGAGTCTGC OBD159_185_187 -0.001801783 95 OBD159_191 CTCCACTTCTACCACCACGAGTA OBD159_189_191 -0.002029191 96 OBD159_191 CTCCACTTCTACCACCACGAGTA OBD159_189_191 -0.002029191 97 OBD159_195 TTTCTGGAGCATTGTATGTCAACT OBD159_193_195 -0.002251075 98 OBD159_195 TTTCTGGAGCATTGTATGTCAACT OBD159_193_195 -0.002251075 99 OBD159_199 GATGACTGTTTTCAGAGACAATGGAA OBD159_197_199 -0.001778734 100 OBD159_199 GATGACTGTTTTCAGAGACAATGGAA OBD159_197_199 -0.001778734 101 OBD159_203 TTTTCCTGTCAGTGAACACCGTG OBD159_201_203 -0.000267413 102 OBD159_203 TTTTCCTGTCAGTGAACACCGTG OBD159_201_203 -0.000267413 103 OBD159_207 TTGGCATAAAGCAGGGCTCCAGGAAT OBD159_205_207 -0.002392578 104 OBD159_207 TTGGCATAAAGCAGGGCTCCAGGAAT OBD159_205_207 -0.002392578 105 OBD159_211 GCTTCCTCTG CCCCATCTACAAACAT OBD159_209_211 -0.004107822 106 OBD159_211 GCTTCCTCTG CCCCATCTACAAACAT OBD159_209_211 -0.004107822 107 OBD159_215 CCTACCCAAATAAGACTCATCCCAAC OBD159_213_215 -0.002783152 108 OBD159_215 CCTACCCAAATAAGACTCATCCCAAC OBD159_213_215 -0.002783152 109 OBD159_219 TTGCAACTAACCATGAAGAA OBD159_217_219 -0.001155074 110 OBD159_219 TTGCAACTAACCATGAAGAA OBD159_217_219 -0.001155074 111 OBD159_223 TAGACAGAACAGGCAGGCAGTTGGAC OBD159_221_223 -0.002281455 112 OBD159_223 TAGACAGAACAGGCAGGCAGTTGGAC OBD159_221_223 -0.002281455 Table l.b8 Gene 53 ANKRD18A; CNTNAP3 54 ANKRD18A; CNTNAP3 55 RP5-972B16.2; RPGR; rs5963409; rs771214648; rs606231180; rs606231181; rsl37852551; rs267607019; rs730882261; rs398122960; rs527236108; rs869312185; rsl060501181; rs62635004; rs771039023; rs527236109; rs62640593; rs527236112; rs62640590; rs62640589; rs527236111; rs62640587; rs62642057; rs878853374; rsl38018739; rs62650220; rs62638651; rs62650218; rsl37852550; rs62638646; rs62638644; rs62638643; rs62638637; rs62638636; rslll631988; rs62638634; rs62638630; rs62638629 56 RP5-972B16.2; RPGR; rs5963409; rs771214648; rs606231180; rs606231181; rsl37852551; rs267607019; rs730882261; rs398122960; rs527236108; rs869312185; rsl060501181; rs62635004; rs771039023; rs527236109; rs62640593; rs527236112; rs62640590; rs62640589; rs527236111; rs62640587; rs62642057; rs878853374; rsl38018739; rs62650220; rs62638651; 05 03 25 rs62650218; rsl37852550; rs62638646; rs62638644; rs62638643; rs62638637; rs62638636; rslll631988; rs62638634; rs62638630; rs62638629 57 rs59014890; rs2337901 58 rs59014890; rs2337901 59 LINGO2; rs7851437 60 LINGO2; rs7851437 61 rs2337901; rsll897825 62 rs2337901; rsll897825 63 C3orf56; rs7610266 64 C3orf56; rs7610266 65 rs2337901; rsll897825 66 rs2337901; rsll897825 67 FKTN; FSD1L; SLC44A1 68 FKTN; FSD1L; SLC44A1 69 CTDSPL; PLCD1; VILL; rs7372209 70 CTDSPL; PLCD1; VILL; rs7372209 71 SLITRK5 72 SLITRK5 73 MAP2; rsl46432517; rs9288410 74 MAP2; rsl46432517; rs9288410 75 rs7529073; rs4342822 76 rs7529073; rs4342822 77 C8orf48 78 C8orf48 79 rs7542939 80 rs7542939 81 FMN2; rs7275O2861; rs727502860 82 FMN2; rs727502861; rs727502860 83 LSM10; 0SCP1 84 LSM10; 0SCP1 85 CAPS2; KCNC2 86 CAPS2; KCNC2 87 NIN; rs387907308; rsl46291102 88 NIN; rs387907308; rsl46291102 89 E2F6; GREB1; rs77294520 90 E2F6; GREB1; rs77294520 91 GAFA3; PGM2 92 GAFA3; PGM2 93 ANKRD18A; CNTNAP3 94 ANKRD18A; CNTNAP3 95 PLS3; rs201386833 96 PLS3; rs201386833 97 RP5-972B16.2; RPGR; rs5963409; rs771214648; rs606231180; rs606231181; rsl37852551; rs267607019; rs730882261; rs398122960; rs527236108; rs869312185; rsl060501181; rs62635004; rs771039023; rs527236109; rs62640593; rs527236112; rs62640590; rs62640589; rs527236111; rs62640587; rs62642057; rs878853374; rsl38018739; rs62650220; rs62638651; rs62650218; rsl37852550; rs62638646; rs62638644; rs62638643; rs62638637; rs62638636; rslll631988; rs62638634; rs62638630; rs62638629 98 RP5-972B16.2; RPGR; rs5963409; rs771214648; rs606231180; rs606231181; rsl37852551; rs267607019; rs730882261; rs398122960; rs527236108; rs869312185; rsl060501181; rs62635004; rs771039023; rs527236109; rs62640593; rs527236112; rs62640590; rs62640589; rs527236111; rs62640587; rs62642057; rs878853374; rsl38018739; rs62650220; rs62638651; rs62650218; rsl37852550; rs62638646; rs62638644; rs62638643; rs62638637; rs62638636; rslll631988; rs62638634; rs62638630; rs62638629 99 TBX18; rs72912698; rs760905589; rs869320679; rs797045022; rs77693245 100 TBX18; rs72912698; rs760905589; rs869320679; rs797045022; rs77693245 101 rsl736020; rsl297265; rs2823286; rs2823288; rs2823310 102 rsl736020; rsl297265; rs2823286; rs2823288; rs2823310 103 MEGF10; rs794726677; rs387907071; rs387907072; rsl99750143; rs794726678; rs989552169 104 MEGF10; rs794726677; rs387907071; rs387907072; rsl99750143; rs794726678; rs989552169 105 rs2745959; rs2745967; rsll578508 106 rs2745959; rs2745967; rsll578508 107 F0LH1; rs202676; rs368939818; rs61886492; rs770894245; rs747052707; rs202680 108 F0LH1; rs202676; rs368939818; rs61886492; rs770894245; rs747052707; rs202680 109 rsllll6045; rsl545843 110 rsllll6045; rsl545843 111 FARP1; RNF113B 112 FARP1; RNF113B Table l.b9 05 03 25 Probe GeneLocus 113 ORF13_16_10047306_10049395_10119747_10125313_FF GRIN2A; rs7192557 114 ORF13_16_10047306_10049395_10119747_10125313_FF GRIN2A; rs7192557 115 ORF13_19_46459835_46460902_46479838_46481514_RF PNMAL1; PNMAL2; PPP5D1 116 ORF13_19_46459835_46460902_46479838_46481514_RF PNMAL1; PNMAL2; PPP5D1 117 ORF13_21_41872387_41876215_41926859_4193O173_RR C2CD2; PRDM15; ZBTB21; rs45139O 118 ORF13_21_41872387_41876215_41926859_4193O173_RR C2CD2; PRDM15; ZBTB21; rs45139O 119 ORF13_22_16921135_16923046_16987493_16991720_FR GAB4; rs41433045 120 ORF13_22_16921135_16923046_16987493_16991720_FR GAB4; rs41433045 121 ORF13_3_65738736_65743505_65758131_65766427_RR MAGI1; rsll924265 122 ORF13_3_65738736_65743505_65758131_65766427_RR MAGI1; rsll924265 123 ORF13_3_65738736_65743505_65827279_65831993_RR MAGI1; rs7633294; rsll924265; rsl909492; rs 145965284 124 ORF13_3_65738736_65743505_65827279_65831993_RR MAGI1; rs7633294; rsll924265; rsl909492; rs 145965284 125 ORF13_7_794O9384_79415984_79434265_79448888_FF MAGI2; rsll35402912 126 ORF13_7_794O9384_79415984_79434265_79448888_FF MAGI2; rsll35402912 127 C)RF13_8_10137237_10138418_10247633_10250634_RR MSRA; rs7001567; rsl0107815; rs73191547; rsl7749155; rs2975735 128 ORF13_8_10137237_10138418_10247633_10250634_RR MSRA; rs7001567; rsl0107815; rs73191547; rsl7749155; rs2975735 129 ORF130_3_16438382_16444965_16496760_16499694_FR RFTN1; rs3856834 130 ORF130_3_16438382_16444965_16496760_16499694_FR RFTN1; rs3856834 131 ORF131_13_36625595_36628054_36670823_36673255_FR SERTM1; rsll619726 132 ORF131_13_36625595_36628054_36670823_36673255_FR SERTM1; rsll619726 133 C)RF132_X_38848295_38850360_38907082_38913455_RR Ml Dll Pl; rsl99860 134 C)RF132_X_38848295_38850360_38907082_38913455_RR MID1IP1; rsl99860 135 ORF133_14_68255587_68260022_68325745_68327713_FF RAD51B; rsl570106; rsl7105278; rs4902562; rs3784O99; rs2208397; rs911263; rs2104047; rsl95O897; rslll58728; rs927220; rs61985136; rs8017304; rsl956529; rs4902566 136 ORF133_14_68255587_68260022_68325745_68327713_FF RAD51B; rsl570106; rsl7105278; rs4902562; rs3784099; rs2208397; rs911263; rs2104047; rsl950897; rslll58728; rs927220; rs61985136; rs8017304; rsl956529; rs4902566 137 ORF133_5_127388766_127390678_127434266_127436041_FR MEGF10; rs387907071; rsl43954261; rs387907073; rs794726679; rsl057518682; rs794726677 138 ORF133_5_127388766_127390678_127434266_127436041_FR MEGF10; rs387907071; rsl43954261; rs387907073; rs794726679; rsl057518682; rs794726677 139 ORF134_21_30984126_30988102_30998437_31002269_RF KRTAP19-8; rs8134605 140 ORF134_21_30984126_30988102_30998437_31002269_RF KRTAP19-8; rs8134605 141 ORF135_14_78345645_78349226_78398O12_784OO321_RF NRXN3; rsll624704 142 ORF135_14_78345645_78349226_78398O12_784OO321_RF NRXN3; rsll624704 143 ORF135_6_84752549_84755954_84775145_84786636_FR TBX18; rs869320679; rs797045022; rs77693245 144 ORF135_6_84752549_84755954_84775145_84786636_FR TBX18; rs869320679; rs797045022; rs77693245 145 ORF135_8_3431982_3435558_3460548_3464200_RF CSMD1; rs2938236; rsl7066135 146 ORF135_8_3431982_3435558_3460548_3464200_RF CSMD1; rs2938236; rsl7066135 147 ORF136_11_33584612_33595244_33612657_33615678_FF KIAA1549L; rs4755718; rs2076625 148 ORF136_11_33584612_33595244_33612657_33615678_FF KIAA1549L; rs4755718; rs2076625 149 ORF136_16_23139410_23143862_23210381_23212701_RR SCNN1G; USP31; rsl37853342; rs5736 150 ORF136_16_23139410_23143862_23210381_23212701_RR SCNN1G; USP31; rsl37853342; rs5736 151 ORF136_3_65835051_65839403_65852931_65856153_FF MAGI1; rsl45965284 152 ORF136_3_65835051_65839403_65852931_65856153_FF MAGI1; rsl45965284 153 ORF138_11_84067130_84068735_84120868_84126600_FR DLG2; rs790356 05 03 25 154 ORF138_11_84067130_84068735_84120868_84126600_FR DLG2; rs790356 155 ORF139_2_38148629_38155476_38206549_38210637_FR ATL2; CYP1B1 156 ORF139_2_38148629_38155476_38206549_38210637_FR ATL2; CYP1B1 157 ORF139_3_43868341_43870688_43889253_43893962_RR rs6441806; rs75594032 158 ORF139_3_43868341_43870688_43889253_43893962_RR rs6441806; rs75594032 159 ORF139_X_103107164_103111839_103149176_103158530_FF BEX4; NXF3 160 ORF139_X_103107164_103111839_103149176_103158530_FF BEX4; NXF3 161 ORF14_1_364O9666_36411937_36433268_36434547_RR LSM1O; 0SCP1 162 ORF14_1_364O9666_36411937_36433268_36434547_RR LSM10; 0SCP1 163 ORF14_11_49143461_49148959_49200052_49204610_FF F0LH1; rs202676; rs368939818; rs61886492; rs770894245; rs747052707; rs202680 164 ORF14_11_49143461_49148959_49200052_49204610_FF F0LH1; rs202676; rs368939818; rs61886492; rs770894245; rs747052707; rs202680 165 ORF14_12_13672704_13680228_13739178_13742093_RF GRIN2B; rslO6O499526; rs219297O; rs2284411; rs2268118 166 ORF14_12_13672704_13680228_13739178_13742093_RF GRIN2B; rslO6O499526; rs2192970; rs2284411; rs2268118 167 ORF14_2_169020149_169021769_169079530_169081990_FR ABCB11; DHRS9; rs886043986; rs2161037 168 ORF14_2_169020149_169021769_169079530_169081990_FR ABCB11; DHRS9; rs886043986; rs2161037 169 ORF14_2_20283807_20286153_20303337_20304942_RF PUM2; rslll612372 170 ORF14_2_20283807_20286153_20303337_20304942_RF PUM2; rslll612372 171 ORF14_2_20303337_20304942_20379482_20381283_FF PUM2; rs585017 172 ORF14_2_20303337_20304942_20379482_20381283_FF PUM2; rs585O17 173 ORF14_6_84752549_84755954_84775145_84786636_FR TBX18; rs869320679; rs797045022; rs77693245 174 ORF14_6_84752549_84755954_84775145_84786636_FR TBX18; rs869320679; rs797045022; rs77693245 175 ORF14_8_52230322_52233827_52248401_52253166_FF ST18; rs2360806 176 ORF14_8_52230322_52233827_52248401_52253166_FF ST18; rs2360806 177 ORF14_8_65560550_65562514_65658401_65661888_FR ARMCI; MTFR1; rs6991838 178 ORF14_8_65560550_65562514_65658401_65661888_FR ARMCI; MTFR1; rs6991838 179 ORF14_9_38648333_38653476_38681931_38686861_RF ANKRD18A; CNTNAP3 180 ORF14_9_38648333_38653476_38681931_38686861_RF ANKRD18A; CNTNAP3 181 ORF140_7_28717278_28719857_28731416_28736388_RR CREB5; rs56388170 182 ORF140_7_28717278_28719857_28731416_28736388_RR CREB5; rs56388170 183 ORF140_7_36976432_36980351_37039732_37049390_RR ELMO1; rs6942726; rsl7170851 184 ORF140_7_36976432_36980351_37039732_37049390_RR ELMO1; rs6942726; rsl7170851 185 ORF141_2_77514867_77519288_775767O5_7758O735_RF LRRTM4; rs61354037 186 ORF141_2_77514867_77519288_775767O5_7758O735_RF LRRTM4; rs61354037 187 ORF142_1_55502863_55511336_55533743_55538240_RR rsl998013; rsl0888935 188 ORF142_1_55502863_55511336_55533743_55538240_RR rsl998013; rsl0888935 189 ORF142_2_195535991_195542111_195583610_195589061_RF DNAH7; SLC39A10 190 ORF142_2_195535991_195542111_195583610_195589061_RF DNAH7; SLC39A10 191 ORF144_9_33273553_33275175_33317596_33319558_RR BAG1; CHMP5; NFX1 192 ORF144_9_33273553_33275175_33317596_33319558_RR BAG1; CHMP5; NFX1 193 ORF145_2_42093750_42101196_42140119_42144540_RF EML4; rsl7O29233 194 ORF145_2_42093750_42101196_42140119_42144540_RF EML4; rsl7029233 195 ORF145_7_45364155_45370311_45421686_45426816_FR ADCY1; rsl294908 196 ORF145_7_45364155_45370311_45421686_45426816_FR ADCY1; rsl294908 197 ORF147_15_96308452_96311035_96328347_96331473_FR NR2F2; rs587777373; rs2398180 198 ORF147_15_96308452_96311035_96328347_96331473_FR NR2F2; rs587777373; rs2398180 199 ORF148_10_22661441_22663284_22705207_22709478_FF PIP4K2A; rsl409395; rs370356098 200 ORF148_10_22661441_22663284_22705207_22709478_FF PIP4K2A; rsl409395; rs370356098 201 ORF148_2_198067347_198074546_198099686_198102962_FR PLCL1; rs7587251; rs6745726; rsl368989; rsl2105927; rs7590828; rsl866666; rsl036333; rs2164068; rsl064213; rsll684176 202 ORF148_2_198067347_198074546_198099686_198102962_FR PLCL1; rs7587251; rs6745726; rsl368989; rsl2105927; rs7590828; rsl866666; rsl036333; rs2164068; rsl064213; rsll684176 203 ORF15_10_76403646_76410014_76480867_76489182_RR ClOorfll; rslO5O9373; rsll593840 204 ORF15_10_76403646_76410014_76480867_76489182_RR ClOorfll; rslO5O9373; rsll593840 205 ORF15_2_66539108_66541258_66592400_66595314_RR MEIS1; rsl0865355; rsll897119; rs2300478; rs2300481 206 ORF15_2_66539108_66541258_66592400_66595314_RR MEIS1; rsl0865355; rsll897119; rs2300478; rs2300481 207 ORF15_8_10100695_10103743_10173552_10175271_FF MSRA; rs73191547; rsl0087178; rsl0107815 208 ORF15_8_10100695_10103743_10173552_10175271_FF MSRA; rs73191547; rsl0087178; rsl0107815 209 ORF15_8_6556O55O_65562514_65637133_6564O837_FR ARMCI; rs6991838 210 ORF15_8_6556O55O_65562514_65637133_6564O837_FR ARMCI; rs6991838 211 ORF151_14_106693397_106698909_106739902_106745380_FF rs23374O6; rsll846409 212 ORF151_14_106693397_106698909_106739902_106745380_FF rs23374O6; rsll846409 Table l.cl 05 03 25 Probe_Count _Total Probe_Count _Sig HyperG_Stats 113 105 2; 1 0.137861813; 0.050084955 114 105 2; 1 0.137861813; 0.050084955 115 28; 32; 32 3; 4; 3; 4; 3; 4 0.071800115; 0.02285211; 0.09275567; 0.033810966; 0.09275567; 0.033810966 116 28; 32; 32 3; 4; 3; 4; 3; 4 0.071800115; 0.02285211; 0.09275567; 0.033810966; 0.09275567; 0.033810966 117 42; 25; 43 1; 1; 1; 1; 1; 1 0.320791853; 0.303213711; 0.375519541; 0.375121431; 0.315614698; 0.297350686 118 42; 25; 43 1; 1; 1; 1; 1; 1 0.320791853; 0.303213711; 0.375519541; 0.375121431; 0.315614698; 0.297350686 119 19 1; 1 0.362286681; 0.369026848 120 19 1; 1 0.362286681; 0.369026848 121 55 5; 5 0.042810093; 0.05348201 122 55 5; 5 0.042810093; 0.05348201 123 55 5; 5 0.042810093; 0.05348201 124 55 5; 5 0.042810093; 0.05348201 125 18 1; 1 0.357137933; 0.364965787 126 18 1; 1 0.357137933; 0.364965787 127 115 4; 4 0.193790369; 0.18374459 128 115 4; 4 0.193790369; 0.18374459 129 55 2; 3 0.274632664; 0.209439509 130 55 2; 3 0.274632664; 0.209439509 131 29 2; 2 0.211050406; 0.22548219 132 29 2; 2 0.211050406; 0.22548219 133 10 1; 1 0.272678156; 0.285987033 134 10 1; 1 0.272678156; 0.285987033 135 17 3; 2 0.023054538; 0.126473611 136 17 3; 2 0.023054538; 0.126473611 137 26 3; 3 0.061689421; 0.072111 138 26 3; 3 0.061689421; 0.072111 139 60 2; 2 0.268298503; 0.259153243 140 60 2; 2 0.268298503; 0.259153243 141 41 1; 1 0.325868449; 0.309016356 142 41 1; 1 0.325868449; 0.309016356 143 20 4; 5 0.005899409; 0.001067155 144 20 4; 5 0.005899409; 0.001067155 145 34 1; 1 0.357029649; 0.346365974 146 34 1; 1 0.357029649; 0.346365974 147 65 1; 2 0.198659276; 0.245566966 148 65 1; 2 0.198659276; 0.245566966 149 26; 18 2; 1; 1; 1 0.19032457; 0.373699919; 0.357137933; 0.364965787 150 26; 18 2; 1; 1; 1 0.19032457; 0.373699919; 0.357137933; 0.364965787 151 55 5; 5 0.042810093; 0.05348201 152 55 5; 5 0.042810093; 0.05348201 153 22 3; 3 0.042821316; 0.050708849 154 22 3; 3 0.042821316; 0.050708849 155 23; 34 4; 3; 4; 3 0.009574125; 0.055866229; 0.0324282; 0.117734198 156 23; 34 4; 3; 4; 3 0.009574125; 0.055866229; 0.0324282; 0.117734198 157 NA NA NA 158 NA NA NA 159 17; 17 1; 2; 1; 2 0.350975055; 0.126473611; 0.350975055; 0.126473611 160 17; 17 1; 2; 1; 2 0.350975055; 0.126473611; 0.350975055; 0.126473611 161 124; 112 3; 3; 3; 3 0.149414204; 0.126913559; 0.17713842; 0.156487188 162 124; 112 3; 3; 3; 3 0.149414204; 0.126913559; 0.17713842; 0.156487188 163 25 3; 4 0.05677955; 0.016055763 164 25 3; 4 0.05677955; 0.016055763 05 03 25 165 60 1; 2 0.22379944; 0.259153243 166 60 1; 2 0.22379944; 0.259153243 167 28; 49 2; 2; 2; 3 0.204457601; 0.219149094; 0.276096976; 0.190339907 168 28; 49 2; 2; 2; 3 0.204457601; 0.219149094; 0.276096976; 0.190339907 169 54 5; 6 0.040491239; 0.018151611 170 54 5; 6 0.040491239; 0.018151611 171 54 5; 6 0.040491239; 0.018151611 172 54 5; 6 0.040491239; 0.018151611 173 20 4; 5 0.005899409; 0.001067155 174 20 4; 5 0.005899409; 0.001067155 175 78 2; 4 0.222357541; 0.186212358 176 78 2; 4 0.222357541; 0.186212358 177 48; 28 5; 4; 2; 1 0.02780594; 0.092112824; 0.204457601; 0.369266824 178 48; 28 5; 4; 2; 1 0.02780594; 0.092112824; 0.204457601; 0.369266824 179 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 180 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 181 54 3; 3 0.193670022; 0.206710786 182 54 3; 3 0.193670022; 0.206710786 183 135 4; 2 0.167299602; 0.052146884 184 135 4; 2 0.167299602; 0.052146884 185 9 3; 2 0.00391071; 0.047199169 186 9 3; 2 0.00391071; 0.047199169 187 NA NA NA 188 NA NA NA 189 61; 81 2; 3; 3; 3 0.26657373; 0.222001213; 0.227770757; 0.222648484 190 61; 81 2; 3; 3; 3 0.26657373; 0.222001213; 0.227770757; 0.222648484 191 12; 22; 28 4; 1; 5; 1; 5; 1 0.000827358; 0.314913912; 0.001196845; 0.375573766; 0.003522831; 0.369266824 192 12; 22; 28 4; 1; 5; 1; 5; 1 0.000827358; 0.314913912; 0.001196845; 0.375573766; 0.003522831; 0.369266824 193 35 1; 1 0.353195365; 0.341533433 194 35 1; 1 0.353195365; 0.341533433 195 30 2; 2 0.21731878; 0.231426351 196 30 2; 2 0.21731878; 0.231426351 197 62 3; 3 0.214894644; 0.223472567 198 62 3; 3 0.214894644; 0.223472567 199 51 1; 1 0.272236181; 0.249886334 200 51 1; 1 0.272236181; 0.249886334 201 27 1; 2 0.374553651; 0.212429916 202 27 1; 2 0.374553651; 0.212429916 203 76 4; 4 0.169506823; 0.182516854 204 76 4; 4 0.169506823; 0.182516854 205 57 4; 2 0.110951788; 0.26588291 206 57 4; 2 0.110951788; 0.26588291 207 115 4; 4 0.193790369; 0.18374459 208 115 4; 4 0.193790369; 0.18374459 209 48 5; 4 0.02780594; 0.092112824 210 48 5; 4 0.02780594; 0.092112824 211 NA NA NA 212 NA NA NA Table l.c2 FDR_HyperG Percent_Sig logFC AveExpr 113 0.375519541; 0.376115439 1.9; 0.95 0.642054929 0.642054929 114 0.375519541; 0.376115439 1.9; 0.95 0.534888101 0.534888101 115 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 10.71; 14.29; 9.38; 12.5; 9.38; 12.5 0.559389203 0.559389203 116 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 10.71; 14.29; 9.38; 12.5; 9.38; 12.5 0.527003029 0.527003029 117 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 2.38; 2.38; 4; 4; 2.33; 2.33 0.777909524 0.777909524 118 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 2.38; 2.38; 4; 4; 2.33; 2.33 0.685362008 0.685362008 119 0.375519541; 0.376115439 5.26; 5.26 0.69171806 0.69171806 05 03 25 120 0.375519541; 0.376115439 5.26; 5.26 0.674817566 0.674817566 121 0.375519541; 0.376115439 9.09; 9.09 0.833849291 0.833849291 122 0.375519541; 0.376115439 9.09; 9.09 0.695864718 0.695864718 123 0.375519541; 0.376115439 9.09; 9.09 0.608567925 0.608567925 124 0.375519541; 0.376115439 9.09; 9.09 0.574949497 0.574949497 125 0.375519541; 0.376115439 5.56; 5.56 0.639632985 0.639632985 126 0.375519541; 0.376115439 5.56; 5.56 0.536103928 0.536103928 127 0.375519541; 0.376115439 3.48; 3.48 0.525096445 0.525096445 128 0.375519541; 0.376115439 3.48; 3.48 0.501604871 0.501604871 129 0.375519541; 0.376115439 3.64; 5.45 0.629919082 0.629919082 130 0.375519541; 0.376115439 3.64; 5.45 0.546528148 0.546528148 131 0.375519541; 0.376115439 6.9; 6.9 0.611119135 0.611119135 132 0.375519541; 0.376115439 6.9; 6.9 0.590770741 0.590770741 133 0.375519541; 0.376115439 10; 10 0.834668158 0.834668158 134 0.375519541; 0.376115439 10; 10 0.631440161 0.631440161 135 0.375519541; 0.376115439 17.65; 11.76 0.680155782 0.680155782 136 0.375519541; 0.376115439 17.65; 11.76 0.664622124 0.664622124 137 0.375519541; 0.376115439 11.54; 11.54 0.607866815 0.607866815 138 0.375519541; 0.376115439 11.54; 11.54 0.552626553 0.552626553 139 0.375519541; 0.376115439 3.33; 3.33 0.669529858 0.669529858 140 0.375519541; 0.376115439 3.33; 3.33 0.665404676 0.665404676 141 0.375519541; 0.376115439 2.44; 2.44 0.592000703 0.592000703 142 0.375519541; 0.376115439 2.44; 2.44 0.574160237 0.574160237 143 0.242080288; 0.077749847 20; 25 0.635545627 0.635545627 144 0.242080288; 0.077749847 20; 25 0.565387572 0.565387572 145 0.375519541; 0.376115439 2.94; 2.94 0.570456105 0.570456105 146 0.375519541; 0.376115439 2.94; 2.94 0.535588266 0.535588266 147 0.375519541; 0.376115439 1.54; 3.08 0.621664701 0.621664701 148 0.375519541; 0.376115439 1.54; 3.08 0.567979364 0.567979364 149 0.375519541; 0.376115439; 0.375519541; 0.376115439 7.69; 3.85; 5.56; 5.56 0.786058889 0.786058889 150 0.375519541; 0.376115439; 0.375519541; 0.376115439 7.69; 3.85; 5.56; 5.56 0.664874819 0.664874819 151 0.375519541; 0.376115439 9.09; 9.09 0.913306418 0.913306418 152 0.375519541; 0.376115439 9.09; 9.09 0.85049037 0.85049037 153 0.375519541; 0.376115439 13.64; 13.64 0.89651913 0.89651913 154 0.375519541; 0.376115439 13.64; 13.64 0.797428847 0.797428847 155 0.357661967; 0.376115439; 0.375519541; 0.376115439 17.39; 13.04; 11.76; 8.82 0.709322488 0.709322488 156 0.357661967; 0.376115439; 0.375519541; 0.376115439 17.39; 13.04; 11.76; 8.82 0.689453202 0.689453202 157 NA NA 0.8399913 0.8399913 158 NA NA 0.71642198 0.71642198 159 0.375519541; 0.376115439; 0.375519541; 0.376115439 5.88; 11.76; 5.88; 11.76 1.020404508 1.020404508 160 0.375519541; 0.376115439; 0.375519541; 0.376115439 5.88; 11.76; 5.88; 11.76 0.96486656 0.96486656 161 0.375519541; 0.376115439; 0.375519541; 0.376115439 2.42; 2.42; 2.68; 2.68 0.600126118 0.600126118 162 0.375519541; 0.376115439; 0.375519541; 0.376115439 2.42; 2.42; 2.68; 2.68 0.587561129 0.587561129 163 0.375519541; 0.376115439 12; 16 0.752070326 0.752070326 164 0.375519541; 0.376115439 12; 16 0.646095977 0.646095977 165 0.375519541; 0.376115439 1.67; 3.33 0.772231914 0.772231914 166 0.375519541; 0.376115439 1.67; 3.33 0.756505991 0.756505991 167 0.375519541; 0.376115439; 0.375519541; 0.376115439 7.14; 7.14; 4.08; 6.12 0.707732194 0.707732194 168 0.375519541; 0.376115439; 0.375519541; 0.376115439 7.14; 7.14; 4.08; 6.12 0.647895485 0.647895485 169 0.375519541; 0.376115439 9.26; 11.11 0.634884917 0.634884917 170 0.375519541; 0.376115439 9.26; 11.11 0.537608783 0.537608783 171 0.375519541; 0.376115439 9.26; 11.11 0.873814619 0.873814619 172 0.375519541; 0.376115439 9.26; 11.11 0.66582529 0.66582529 05 03 25 173 0.242080288; 0.077749847 20; 25 0.592740002 0.592740002 174 0.242080288; 0.077749847 20; 25 0.567930462 0.567930462 175 0.375519541; 0.376115439 2.56; 5.13 0.650656625 0.650656625 176 0.375519541; 0.376115439 2.56; 5.13 0.57605457 0.57605457 177 0.375519541; 0.376115439; 0.375519541; 0.376115439 10.42; 8.33; 7.14; 3.57 0.882684402 0.882684402 178 0.375519541; 0.376115439; 0.375519541; 0.376115439 10.42; 8.33; 7.14; 3.57 0.78560934 0.78560934 179 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.56533113 0.56533113 180 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.493648488 0.493648488 181 0.375519541; 0.376115439 5.56; 5.56 0.899280884 0.899280884 182 0.375519541; 0.376115439 5.56; 5.56 0.754589946 0.754589946 183 0.375519541; 0.376115439 2.96; 1.48 0.54191602 0.54191602 184 0.375519541; 0.376115439 2.96; 1.48 0.536557556 0.536557556 185 0.185936467; 0.376115439 33.33; 22.22 0.528816654 0.528816654 186 0.185936467; 0.376115439 33.33; 22.22 0.510412189 0.510412189 187 NA NA 0.570106196 0.570106196 188 NA NA 0.547188195 0.547188195 189 0.375519541; 0.376115439; 0.375519541; 0.376115439 3.28; 4.92; 3.7; 3.7 0.925148196 0.925148196 190 0.375519541; 0.376115439; 0.375519541; 0.376115439 3.28; 4.92; 3.7; 3.7 0.860859073 0.860859073 191 0.069549998; 0.376115439; 0.069549998; 0.376115439; 0.184244052; 0.376115439 33.33; 8.33; 22.73; 4.55; 17.86; 3.57 0.830272909 0.830272909 192 0.069549998; 0.376115439; 0.069549998; 0.376115439; 0.184244052; 0.376115439 33.33; 8.33; 22.73; 4.55; 17.86; 3.57 0.605028673 0.605028673 193 0.375519541; 0.376115439 2.86; 2.86 0.629699885 0.629699885 194 0.375519541; 0.376115439 2.86; 2.86 0.608805138 0.608805138 195 0.375519541; 0.376115439 6.67; 6.67 0.688184104 0.688184104 196 0.375519541; 0.376115439 6.67; 6.67 0.631925311 0.631925311 197 0.375519541; 0.376115439 4.84; 4.84 0.66816546 0.66816546 198 0.375519541; 0.376115439 4.84; 4.84 0.496321797 0.496321797 199 0.375519541; 0.376115439 1.96; 1.96 0.559048166 0.559048166 200 0.375519541; 0.376115439 1.96; 1.96 0.546506729 0.546506729 201 0.375519541; 0.376115439 3.7; 7.41 0.660605853 0.660605853 202 0.375519541; 0.376115439 3.7; 7.41 0.620982224 0.620982224 203 0.375519541; 0.376115439 5.26; 5.26 0.548392035 0.548392035 204 0.375519541; 0.376115439 5.26; 5.26 0.544462095 0.544462095 205 0.375519541; 0.376115439 7.02; 3.51 0.633583316 0.633583316 206 0.375519541; 0.376115439 7.02; 3.51 0.527645503 0.527645503 207 0.375519541; 0.376115439 3.48; 3.48 0.5396147 0.5396147 208 0.375519541; 0.376115439 3.48; 3.48 0.532813708 0.532813708 209 0.375519541; 0.376115439 10.42; 8.33 0.694623516 0.694623516 210 0.375519541; 0.376115439 10.42; 8.33 0.669053043 0.669053043 211 NA NA 0.677090319 0.677090319 212 NA NA 0.525571424 0.525571424 Table l.c3 t P.Value adj.P.Val B FC FC_1 LS 113 12.29657599 0.0000000389 0.0000112 9.28555547 1.560550375 1.560550375 1 114 9.863570244 0.000000421 0.0000233 6.888532755 1.448829775 1.448829775 1 115 8.570462938 0.00000186 0.000059 5.366520046 1.473645185 1.473645185 1 116 7.239748622 0.0000106 0.000327829 3.648069676 1.440932774 1.440932774 1 117 12.23174867 0.0000000397 0.00000589 9.265915789 1.714644539 1.714644539 1 118 8.825906239 0.00000141 0.0000917 5.705820315 1.608105445 1.608105445 1 119 7.339515775 0.00000926 0.000301666 3.786888778 1.615205871 1.615205871 1 120 8.215028312 0.00000289 0.0000778 4.915625384 1.59639489 1.59639489 1 121 19.14681066 0.000000000252 0.00000103 13.97183644 1.782434783 1.782434783 1 122 14.54846247 0.00000000561 0.00000218 11.18765775 1.619855045 1.619855045 1 123 11.04549051 0.000000127 0.0000213 8.119748088 1.524744937 1.524744937 1 05 03 25 124 15.11740631 0.00000000362 0.00000171 11.60988606 1.489625316 1.489625316 1 125 7.756918889 0.00000532 0.000211946 4.353501606 1.557932778 1.557932778 1 126 8.756135369 0.00000149 0.0000515 5.596232128 1.450051287 1.450051287 1 127 18.04698486 0.000000000499 0.00000152 13.3693963 1.439029777 1.439029777 1 128 11.23507651 0.000000102 0.00000993 8.323155136 1.415787626 1.415787626 1 129 16.15349133 0.00000000170 0.00000121 12.33518156 1.547478196 1.547478196 1 130 12.83197859 0.0000000242 0.00000874 9.748081285 1.460566603 1.460566603 1 131 13.87996531 0.00000001 0.0000055 10.59694422 1.527443626 1.527443626 1 132 11.16934802 0.000000109 0.0000103 8.258187013 1.506051121 1.506051121 1 133 15.50546579 0.00000000285 0.00000294 11.78233016 1.783446771 1.783446771 1 134 7.456443365 0.00000774 0.000146321 3.901820902 1.549110612 1.549110612 1 135 9.171197371 0.000000915 0.0000379 6.095816878 1.602312763 1.602312763 1 136 15.72367178 0.00000000243 0.00000276 11.93052546 1.585153029 1.585153029 1 137 8.352727895 0.00000244 0.0000699 5.092073514 1.524004133 1.524004133 1 138 8.826468071 0.00000141 0.0000917 5.706495712 1.46675362 1.46675362 1 139 9.778292783 0.000000476 0.0000471 6.801498437 1.590554557 1.590554557 1 140 16.33513633 0.00000000149 0.00000114 12.45688849 1.586013087 1.586013087 1 141 6.305428984 0.0000401 0.000788065 2.28193028 1.507335644 1.507335644 1 142 12.84449383 0.000000023 0.00000441 9.808591378 1.488810605 1.488810605 1 143 13.38587721 0.0000000151 0.00000688 10.20566573 1.553525182 1.553525182 1 144 12.59163536 0.0000000287 0.000005 9.587875271 1.479784992 1.479784992 1 145 9.442845356 0.000000671 0.0000311 6.412723986 1.484992974 1.484992974 1 146 7.596849376 0.00000656 0.000239887 4.138885561 1.449533088 1.449533088 1 147 11.62558761 0.0000000725 0.0000153 8.67583038 1.538649579 1.538649579 1 148 15.26126084 0.00000000325 0.00000161 11.71387103 1.482445805 1.482445805 1 149 6.105674865 0.0000541 0.000962931 1.973943798 1.724357475 1.724357475 1 150 8.371648256 0.00000238 0.0000689 5.116142152 1.585430702 1.585430702 1 151 15.88124985 0.00000000217 0.00000259 12.03604736 1.883356898 1.883356898 1 152 18.19418346 0.000000000429 0.000000653 13.61809441 1.803113697 1.803113697 1 153 20.04156697 0.000000000148 0.00000103 14.42944596 1.86156905 1.86156905 1 154 12.881791 0.0000000222 0.00000435 9.840773338 1.738000921 1.738000921 1 155 12.3642085 0.0000000366 0.0000108 9.345123175 1.635036099 1.635036099 1 156 9.152158447 0.000000935 0.0000385 6.073312254 1.612672181 1.612672181 1 157 19.10878979 0.000000000257 0.00000103 13.95176635 1.790039347 1.790039347 1 158 10.43275288 0.000000229 0.0000161 7.504665857 1.643101929 1.643101929 1 159 21.00404466 0.0000000000807 0.00000039 15.12202904 2.028487635 2.028487635 1 160 12.79168312 0.0000000251 0.00000885 9.713978326 1.951882976 1.951882976 1 161 21.66770766 0.0000000000597 0.000000663 15.19411522 1.515849073 1.515849073 1 162 13.98057328 0.00000000883 0.00000269 10.74792677 1.502704282 1.502704282 1 163 13.876189 0.00000000961 0.00000281 10.66502031 1.684208004 1.684208004 1 164 11.81234601 0.0000000608 0.0000138 8.849033958 1.564927669 1.564927669 1 165 11.53329799 0.0000000792 0.0000162 8.589212532 1.707909954 1.707909954 1 166 14.31826594 0.00000000673 0.00000237 11.01167664 1.689394186 1.689394186 1 167 11.24102356 0.000000105 0.000019 8.31031525 1.633234778 1.633234778 1 168 14.54104319 0.00000000565 0.00000218 11.18203304 1.566880858 1.566880858 1 169 19.3999006 0.000000000204 0.000000503 14.29706452 1.552813878 1.552813878 1 170 10.07154199 0.000000347 0.000039 7.12001582 1.451564605 1.451564605 1 171 15.60748179 0.00000000264 0.00000286 11.85191731 1.832501804 1.832501804 1 172 10.83942215 0.000000151 0.0000126 7.926551142 1.586475553 1.586475553 1 173 11.54164794 0.0000000757 0.00000841 8.621484254 1.508108266 1.508108266 1 174 9.732052458 0.000000501 0.0000487 6.750493527 1.482395556 1.482395556 1 175 9.854433288 0.000000438 0.0000448 6.885017151 1.569882546 1.569882546 1 176 9.330647052 0.000000762 0.0000339 6.282774663 1.490766774 1.490766774 1 177 12.25442736 0.0000000405 0.0000114 9.24826214 1.843802848 1.843802848 1 178 12.90483498 0.0000000218 0.00000431 9.860609412 1.723820242 1.723820242 1 179 6.227858807 0.000045 0.000850219 2.163006432 1.4797271 1.4797271 1 180 7.44435462 0.00000786 0.000147933 3.885074196 1.408001126 1.408001126 1 181 13.07374694 0.0000000196 0.00000788 9.950348451 1.865136068 1.865136068 1 182 19.91676727 0.000000000150 0.000000464 14.57215105 1.687151988 1.687151988 1 183 10.98867694 0.000000135 0.0000221 8.063765262 1.455904797 1.455904797 1 184 16.12532926 0.00000000173 0.00000121 12.31617161 1.4505073 1.4505073 1 185 9.761017839 0.000000471 0.000025 6.774194723 1.442745323 1.442745323 1 05 03 25 186 8.292905428 0.00000269 0.000138197 5.048700551 1.424457116 1.424457116 1 187 14.16188606 0.00000000763 0.00000252 10.89037664 1.48463285 1.48463285 1 188 10.9669012 0.000000138 0.0000224 8.042234039 1.46123498 1.46123498 1 189 12.41082654 0.0000000351 0.0000105 9.385986987 1.898879288 1.898879288 1 190 15.0227439 0.00000000389 0.00000178 11.54085912 1.816119422 1.816119422 1 191 7.831039921 0.00000472 0.000106638 4.411447921 1.778021672 1.778021672 1 192 6.383716681 0.0000357 0.000729587 2.40108624 1.521008982 1.521008982 1 193 14.04269586 0.00000000839 0.00000263 10.796955 1.547243096 1.547243096 1 194 9.786691524 0.000000472 0.0000468 6.810739504 1.524995661 1.524995661 1 195 11.80999999 0.0000000609 0.0000138 8.846875259 1.611254183 1.611254183 1 196 10.87786687 0.000000145 0.0000123 7.965676533 1.549631635 1.549631635 1 197 12.34739858 0.0000000372 0.0000109 9.330349145 1.589051035 1.589051035 1 198 19.10074585 0.000000000244 0.000000514 14.13358838 1.410612566 1.410612566 1 199 11.15023282 0.000000111 0.0000104 8.239225146 1.473296873 1.473296873 1 200 10.17124154 0.000000312 0.0000369 7.226393871 1.46054492 1.46054492 1 201 10.98010134 0.000000136 0.0000222 8.05529085 1.580746311 1.580746311 1 202 17.71105209 0.000000000586 0.000000747 13.330373 1.537921882 1.537921882 1 203 22.07702074 0.0000000000450 0.00000032 15.62922376 1.462454799 1.462454799 1 204 10.42317496 0.000000239 0.0000316 7.490992927 1.458476453 1.458476453 1 205 14.44991956 0.00000000607 0.00000227 11.11269518 1.551413559 1.551413559 1 206 14.9951486 0.00000000417 0.00000369 11.42604699 1.441574607 1.441574607 1 207 12.26156198 0.0000000386 0.00000581 9.292944196 1.453584258 1.453584258 1 208 16.76008538 0.00000000117 0.0000021 12.60248449 1.446748058 1.446748058 1 209 11.64102375 0.0000000688 0.00000796 8.716560039 1.618462027 1.618462027 1 210 8.321741849 0.0000026 0.000135064 5.085106196 1.590028961 1.590028961 1 211 8.075983057 0.00000353 0.000163981 4.771615491 1.598911756 1.598911756 1 212 11.47180426 0.0000000809 0.00000873 8.554190275 1.439503627 1.439503627 1 l.c4 Probe sequence Probe Location Loop Detected 60 mer Chr 113 mHC 1 1 1A1 1 GA 1 1 1 1 1 1 AC 1A1 1 1 1 1 1 1 1 1 1 1CGACAATAAATGCAAAAAGTTTGAAAAAATC 16 114 sHC 1 1 1A1 1 GA 1 1 1 1 1 1 AC 1A1 1 1 1 1 1 1 1 1 1 1CGACAATAAATGCAAAAAGTTTGAAAAAATC 16 115 sHC Illi IAAAGAAGGTTTGTATCATAI 1 ICTCGATATTATTCTATCAGTCCTGCAGTCCTGT 19 116 mHC Illi IAAAGAAGGTTTGTATCATATTTCTCGATATTATTCTATCAGTCCTGCAGTCCTGT 19 117 sHC CAATATTTTCAGAGTCATAATATATACATCGAATAATTTTCACTTTCATCACATTCTGTA 21 118 mHC CAATATTTTCAGAGTCATAATATATACATCGAATAATTTTCACTTTCATCACATTCTGTA 21 119 mHC TACC1 1 1A1 1 1 1 1GAAGCATATCTTCACTCGAAATTTAA1 1 1AA1 1 1 1AATTAGCTTAAA 22 120 sHC TACC1 1 1A1 1 1 1 1 GAAGCATATCTTCACTCGAAATTTAA 1 1 1 AA 1 1 1 1 AATTAGCTTAAA 22 121 mHC CCTTTCAATGTATTGTTACTGCTACTCATCGAGGAGATAAATCTCCCAGTCCTAGTTGGT 3 122 sHC CCTTTCAATGTATTGTTACTGCTACTCATCGAGGAGATAAATCTCCCAGTCCTAGTTGGT 3 123 mHC CCTTTCAATGTATTGTTACTGCTACTCATCGAAAGTTGATGCCAAATTGGGAAGTAAGAC 3 124 sHC CCTTTCAATGTATTGTTACTGCTACTCATCGAAAGTTGATGCCAAATTGGGAAGTAAGAC 3 125 mHC AATTGTATATTAGACTAGATTAGACTATTCGAATGTTAAATATGATTATTTGCI 1 1 1 IAT 7 126 sHC AATTGTATATTAGACTAGATTAGACTATTCGAATGTTAAATATGATTATTTGCI 1 1 1 IAT 7 127 mHC AACCAAI Illi IAAAATATGCI 1 1 1AAGTCGATTGGATATGAACACTACCTGCTAAGTTA 8 128 sHC AACCAAI Illi IAAAATATGCI11TAAGTCGATTGGATATGAACACTACCTGCTAAGTTA 8 129 sHC TTTAGTATTAGAAATGTTTTGGTCTTTATCGAAAGACACGTATGAGAAAGCTAACAGTAG 3 130 mHC TTTAGTATTAGAAATGTTTTGGTCTTTATCGAAAGACACGTATGAGAAAGCTAACAGTAG 3 131 mHC GGATCAAACCCTTCATATATACCAATTATCGAAATATGAATCATCTTTGTCCAGTATGGA 13 132 sHC GGATCAAACCCTTCATATATACCAATTATCGAAATATGAATCATCTTTGTCCAGTATGGA 13 133 mHC 1 1 1 1 1 1A TATCATAC1 1 1 1GG1 1 1 1AAATCGATTTCCTCTGTAAAATTATAGAATGGACT X 134 sHC 1 1 1 1 1 1A TATCATAC 1 1 1 1 GG 1 1 1 1AAATCGATTTCCTCTGTAAAATTATAGAATGGACT X 135 sHC CACAAAATAACAAATATATAAGATATTTTCGAAGATTAATATCTACTCATAATGGTTAGA 14 136 mHC CACAAAATAACAAATATATAAGATATTTTCGAAGATTAATATCTACTCATAATGGTTAGA 14 137 sHC TCATCTTCTATAAAAATCATTTAATTAATCGATTTTTATTGCCAGAAACGACTCTTAAAG 5 138 mHC TCATCTTCTATAAAAATCA1 1 1 AA ITAATCGA1 1 1 1 1ATTGCCAGAAACGACTCTTAAAG 5 139 mHC AATAACAATTCACCAAAAT1 1 1AAACATTCGAA 1 1 1 1 1 AAA 1 1 1A111C1GTAAATAAAG 21 140 sHC AATAACAATTCACCAAAAT1 1 1 AAACATTCG AA 1 1 1 1 IAAA1 1 1A1 1 1CTGTAAATAAAG 21 05 03 25 141 mHC AAAGATTAGTTTCAAAA1 1 1C1A1AAACTCGATGGATATAGCAAACCAATTGG!1ICCCT 14 142 sHC AAAGATTAGTTTCAAAA1 1 1CIA1 AAACTCGATGGATATAGCAAACCAATTGG 11ICCCT 14 143 mHC GGTAI 1 Id 1 1 IAIGTATGATATATTCTTCGAGTCGCTCAGAAGCGACCTAAAGAAGGCA 6 144 sHC GGTAI 1 Id 1 1 IAIGTATGATATATTCTTCGAGTCGCTCAGAAGCGACCTAAAGAAGGCA 6 145 sHC ATGCAGTTCATCAACTAGTGTGATGAACTCGAATGTGATCATGTAAGAGATCACTGTGTG 8 146 mHC ATGCAGTTCATCAACTAGTGTGATGAACTCGAATGTGATCATGTAAGAGATCACTGTGTG 8 147 mHC CTATA1 1 1GCTTCATAA1 1 1 1 1 1C1 1 1 1 1CGACATTGAAGTGTATACCAGTCTAC1 1 1 1G 11 148 sHC CTATA1 1 1 GCTTCATAA 1 1 1 1 1 1C1 1 1 1 1 CGACATTGAAGTGTATACCAGTCTAC 1 1 1 1G 11 149 mHC ATCAGTTTA1111ACI 1 IAI 1 1 1 1 1ATTTCGAAAAAATGAAACGATACAGCAACATTGAG 16 150 sHC ATCAGTTTAI111 ACI 1 IAI 1 1 1 1 1ATTTCGAAAAAATGAAACGATACAGCAACATTGAG 16 151 mHC TTATATCATTATTTTATAATGTATTCCTTCGAAATATAAGTTAGTTAAAATTAAACATAA 3 152 sHC TTATATCATTATTTTATAATGTATTCCTTCGAAATATAAGTTAGTTAAAATTAAACATAA 3 153 mHC CTCATTATACTGAGTTTATTTGTTTTATTCGAATAACTATATCCTTACATTCAGTCACTA 11 154 sHC CTCATTATACTGAGTTTATTTGTTTTATTCGAATAACTATATCCTTACATTCAGTCACTA 11 155 mHC TCATAAAATAATAATTAACAAACATACATCGAACATACTAATCI 1 1 1 1ACCAAGTGTTTG 2 156 sHC TCATAAAATAATAATTAACAAACATACATCGAACATACTAATCI 1 1 1 1 ACCAAGTGTTTG 2 157 mHC TAGCTGTTTAATTATCAATATATTAA1 1 1CG ATAA1 1 1 1C1 Cl CTTCCA1 1 1 1C1 1 1 ATT 3 158 sHC TAGCTGTTTAATTATCAATATATTAA1 1 1 CG ATAA 1 1 1 1C1C1 CTTCCA 1 1 1 1 Cl 1 1A1 1 3 159 sHC AATATATTTCTAAAATATGTAAATATATTCGATATATGTTTTATGAGTAAAGAAGCAGAT X 160 mHC AATATA1 1 1 Cl AAAATATGTAAATATATTCGATATATGI1ITATGAGTAAAGAAGCAGAT X 161 mHC TGGTAAATTGGAGCAGGTGACCTGGGAGTCGAGGCAGCTGCAGGATTTAAATTGGCTGAG 1 162 sHC TGGTAAATTGGAGCAGGTGACCTGGGAGTCGAGGCAGCTGCAGGATTTAAATTGGCTGAG 1 163 sHC AIIIIIIIIIAIIA FTATAC Illi AAGTTCGAAC1 1 Cl 1 1ATC1 1 1GTGGAAAACCCTCC 11 164 mHC AIIIIIIIIIAIIA FTATAC Illi AAGTTCG AAC 1 1 Cl 1 1 ATC 1 1 1 GTGGAAAACCCTCC 11 165 mHC GTTCTCTGACI 1 1 1 1A FACCTAAGATAATCGATATGAAAATGTTCTATTCTATTATCTCA 12 166 sHC GTTCTCTGACI 1 1 1 1A FACCTAAGATAATCGATATGAAAATGTTCTATTCTATTATCTCA 12 167 mHC TATATTTAATTATAATTGTAACACAATGTCGAAGGAAAAATTAGGAAATAATTGTAAGAA 2 168 sHC TATATTTAATTATAATTGTAACACAATGTCGAAGGAAAAATTAGGAAATAATTGTAAGAA 2 169 sHC TATATGGTACATATTATACATATTTCTATCGAAGAAGAAGGATTAAAAAAACTGGGAGTA 2 170 mHC TATATGGTACATATTATACATATTTCTATCGAAGAAGAAGGATTAAAAAAACTGGGAGTA 2 171 mHC TATATGGTACATATTATACATA1 1 1 Cl ATCGAGAAATAAACTCATATA111A1GATCTAC 2 172 sHC TATATGGTACATATTATACATAI 1 ICIATCGAGAAATAAACTCATATATTTATGATCTAC 2 173 sHC GGTAI 1 ICI 1 1 1 Al GTATGATATATTCTTCGAGTCGCTCAGAAGCGACCTAAAGAAGGCA 6 174 mHC GGTA1 1 1 Cl 1 1 1A1GTATGATATATTCTTCGAGTCGCTCAGAAGCGACCTAAAGAAGGCA 6 175 mHC GTTTCI 1 1 1 IAAAGTAAATTAAATTTAATCGAAGTATGCACTGTAACTTCTATAATCTTA 8 176 sHC GTTTCI 1 1 1 IAAAGTAAATTAAATTTAATCGAAGTATGCACTGTAACTTCTATAATCTTA 8 177 mHC TATCTCTATGTAATAATCACTAAAAGTATCGAGCTACATACTATTATATATTTTCACAGT 8 178 sHC TATCTCTATGTAATAATCACTAAAAGTATCGAGCTACATACTATTATATATTTTCACAGT 8 179 mHC CCACGGAGGGGTCCTTCTGAACTGCAATTCGAGAGCTGGTCTTGACGAGGTGTGCCTTGC 9 180 sHC CCACGGAGGGGTCCTTCTGAACTGCAATTCGAGAGCTGGTCTTGACGAGGTGTGCCTTGC 9 181 mHC TATGAAAATATAAAAGAATATAAAGAGTTCGATTATGTGTCTTGAAAACAAGAATTGAGA 7 182 sHC TATGAAAATATAAAAGAATATAAAGAGTTCGATTATGTGTCTTGAAAACAAGAATTGAGA 7 183 mHC CTAATAATAATTATGCTGTTAAGCTCAATCGACAATAAATACTTAAAATTCACACGGTTT 7 184 sHC CTAATAATAATTATGCTGTTAAGCTCAATCGACAATAAATACTTAAAATTCACACGGTTT 7 185 sHC TATATATTAAGTTATACAACATGATATTTCGAAGGAAAAAATTGATATACAGAATGAAGC 2 186 mHC TATATATTAAGTTATACAACATGATATTTCGAAGGAAAAAATTGATATACAGAATGAAGC 2 187 sHC GTTATTATACTGCTAAATAATAAGATCCTCGAGCTTCACTTTTTATATATGTAAAATGGA 1 188 mHC GTTATTATACTGCTAAATAATAAGATCCTCGAGCTTCACI 1 1 1 1 Al ATATGTAAAATGGA 1 189 mHC Al 1 1 1 1AATTATTAAAAAATAATG1 1 1 1 1 CGACTTGTATTACCTCATGTAGTTCTCATAT 2 190 sHC Al 1 1 1 1 AATTATTAAAAAATAATG 1 1 1 1 1 CGACTTGTATTACCTCATGTAGTTCTCATAT 2 191 sHC TTTAGGAAAATAAATCTGACCAAAAAATTCGAGGCCGCAGTAAGCTGTGTTCACACCACT 9 192 mHC TTTAGGAAAATAAATCTGACCAAAAAATTCGAGGCCGCAGTAAGCTGTGTTCACACCACT 9 193 sHC 1 1 1AA FCAGTTTCC1 1 1 1 1 1 1 1 1 1 1 1 1 1 1CGAAAAAAAAAAAAAGCCATTGAAGGGA1 1 1 2 194 mHC 1 1 1AA FCAGTTTCC 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 CGAAAAAAAAAAAAAGCCATTGAAGGGA 1 1 1 2 195 mHC TTACTCACTTATTAGTCTATTAAGA1 1 1 1 CG A1TAAGTCTAATTTAGCAC1 1 1 Cl Cl 1 1 1 7 196 sHC TTACTCACTTATTAGTCTATTAAGAI 1 1 1CGAITAAGTCTAATTTAGCACTTTCTC1 1 1 1 7 197 mHC AAATAACTTACATATGGACATGAGTATATCGATATTGTTCCTTCCCATGTTTGTAAAAGG 15 198 sHC AAATAACTTACATATGGACATGAGTATATCGATATTGTTCCTTCCCATGTTTGTAAAAGG 15 199 sHC TCTGATATATATTTGCTAAGGTAGTAAATCGAAATACAAATTTTGGAATTGAAGGGAATT 10 200 mHC TCTGATATATATTTGCTAAGGTAGTAAATCGAAATACAAATTTTGGAATTGAAGGGAATT 10 201 mHC GTAAATATTACCATTAAAAACTGAAAAGTCGATTATCTCTTTATGACGTTTATTAGACAA 2 202 sHC GTAAATATTACCATTAAAAACTGAAAAGTCGATTATCTCTTTATGACGTTTATTAGACAA 2 05 03 25 203 sHC ACTCTTCAAAATTATAATTATCAACAATTCGAAGAATACCTTAAAGGTAATCATATGTAT 10 204 mHC ACTCTTCAAAATTATAATTATCAACAATTCGAAGAATACCTTAAAGGTAATCATATGTAT 10 205 sHC AAGGCAGGTGGATCATAAGGTCAGGAGATCGAAAAAAAAATAAAAAAATAAAAAAATAAA 2 206 mHC AAGGCAGGTGGATCATAAGGTCAGGAGATCGAAAAAAAAATAAAAAAATAAAAAAATAAA 2 207 sHC TTTAAAATGCTTTAAAATTGTTTAAATATCGATTCTAGAGGAAGTCAAATAAAACAATGG 8 208 mHC TTTAAAATGCTTTAAAATTGTTTAAATATCGATTCTAGAGGAAGTCAAATAAAACAATGG 8 209 sHC TATCTCTATGTAATAATCACTAAAAGTATCGAGTACATAGCTCTGACATATTTATATGTA 8 210 mHC TATCTCTATGTAATAATCACTAAAAGTATCGAGTACATAGCTCTGACATATTTATATGTA 8 211 mHC AATACACTACAGCTATATGTCCCTGTCTTCGAAGACAGGGACATATAGCTGTAGTGTATT 14 212 sHC AATACACTACAGCTATATGTCCCTGTCTTCGAAGACAGGGACATATAGCTGTAGTGTATT 14 Table l.c5 Probe Location 4 kb Sequence Location Startl Endl Start2 End2 Chr Startl Endl Start2 End2 113 10049364 10049395 10125282 10125313 16 10045394 10049395 10121312 10125313 114 10049364 10049395 10125282 10125313 16 10045394 10049395 10121312 10125313 115 46459835 46459866 46481483 46481514 19 46459835 46463836 46477513 46481514 116 46459835 46459866 46481483 46481514 19 46459835 46463836 46477513 46481514 117 41872387 41872418 41926859 41926890 21 41872387 41876388 41926859 41930860 118 41872387 41872418 41926859 41926890 21 41872387 41876388 41926859 41930860 119 16923015 16923046 16987493 16987524 22 16919045 16923046 16987493 16991494 120 16923015 16923046 16987493 16987524 22 16919045 16923046 16987493 16991494 121 65738736 65738767 65758131 65758162 3 65738736 65742737 65758131 65762132 122 65738736 65738767 65758131 65758162 3 65738736 65742737 65758131 65762132 123 65738736 65738767 65827279 65827310 3 65738736 65742737 65827279 65831280 124 65738736 65738767 65827279 65827310 3 65738736 65742737 65827279 65831280 125 79415953 79415984 79448857 79448888 7 79411983 79415984 79444887 79448888 126 79415953 79415984 79448857 79448888 7 79411983 79415984 79444887 79448888 127 10137237 10137268 10247633 10247664 8 10137237 10141238 10247633 10251634 128 10137237 10137268 10247633 10247664 8 10137237 10141238 10247633 10251634 129 16444934 16444965 16496760 16496791 3 16440964 16444965 16496760 16500761 130 16444934 16444965 16496760 16496791 3 16440964 16444965 16496760 16500761 131 36628023 36628054 36670823 36670854 13 36624053 36628054 36670823 36674824 132 36628023 36628054 36670823 36670854 13 36624053 36628054 36670823 36674824 133 38848295 38848326 38907082 38907113 X 38848295 38852296 38907082 38911083 134 38848295 38848326 38907082 38907113 X 38848295 38852296 38907082 38911083 135 68259991 68260022 68327682 68327713 14 68256021 68260022 68323712 68327713 136 68259991 68260022 68327682 68327713 14 68256021 68260022 68323712 68327713 137 127390647 127390678 127434266 127434297 5 127386677 127390678 127434266 127438267 138 127390647 127390678 127434266 127434297 5 127386677 127390678 127434266 127438267 139 30984126 30984157 31002238 31002269 21 30984126 30988127 30998268 31002269 140 30984126 30984157 31002238 31002269 21 30984126 30988127 30998268 31002269 141 78345645 78345676 78400290 78400321 14 78345645 78349646 78396320 78400321 142 78345645 78345676 78400290 78400321 14 78345645 78349646 78396320 78400321 143 84755923 84755954 84775145 84775176 6 84751953 84755954 84775145 84779146 144 84755923 84755954 84775145 84775176 6 84751953 84755954 84775145 84779146 145 3431982 3432013 3464169 3464200 8 3431982 3435983 3460199 3464200 146 3431982 3432013 3464169 3464200 8 3431982 3435983 3460199 3464200 147 33595213 33595244 33615647 33615678 11 33591243 33595244 33611677 33615678 148 33595213 33595244 33615647 33615678 11 33591243 33595244 33611677 33615678 149 23139410 23139441 23210381 23210412 16 23139410 23143411 23210381 23214382 150 23139410 23139441 23210381 23210412 16 23139410 23143411 23210381 23214382 151 65839372 65839403 65856122 65856153 3 65835402 65839403 65852152 65856153 152 65839372 65839403 65856122 65856153 3 65835402 65839403 65852152 65856153 153 84068704 84068735 84120868 84120899 11 84064734 84068735 84120868 84124869 154 84068704 84068735 84120868 84120899 11 84064734 84068735 84120868 84124869 155 38155445 38155476 38206549 38206580 2 38151475 38155476 38206549 38210550 156 38155445 38155476 38206549 38206580 2 38151475 38155476 38206549 38210550 157 43868341 43868372 43889253 43889284 3 43868341 43872342 43889253 43893254 158 43868341 43868372 43889253 43889284 3 43868341 43872342 43889253 43893254 05 03 25 159 103111808 103111839 103158499 103158530 X 103107838 103111839 103154529 103158530 160 103111808 103111839 103158499 103158530 X 103107838 103111839 103154529 103158530 161 36409666 36409697 36433268 36433299 1 36409666 36413667 36433268 36437269 162 36409666 36409697 36433268 36433299 1 36409666 36413667 36433268 36437269 163 49148928 49148959 49204579 49204610 11 49144958 49148959 49200609 49204610 164 49148928 49148959 49204579 49204610 11 49144958 49148959 49200609 49204610 165 13672704 13672735 13742062 13742093 12 13672704 13676705 13738092 13742093 166 13672704 13672735 13742062 13742093 12 13672704 13676705 13738092 13742093 167 169021738 169021769 169079530 169079561 2 169017768 169021769 169079530 169083531 168 169021738 169021769 169079530 169079561 2 169017768 169021769 169079530 169083531 169 20283807 20283838 20304911 20304942 2 20283807 20287808 20300941 20304942 170 20283807 20283838 20304911 20304942 2 20283807 20287808 20300941 20304942 171 20304911 20304942 20381252 20381283 2 20300941 20304942 20377282 20381283 172 20304911 20304942 20381252 20381283 2 20300941 20304942 20377282 20381283 173 84755923 84755954 84775145 84775176 6 84751953 84755954 84775145 84779146 174 84755923 84755954 84775145 84775176 6 84751953 84755954 84775145 84779146 175 52233796 52233827 52253135 52253166 8 52229826 52233827 52249165 52253166 176 52233796 52233827 52253135 52253166 8 52229826 52233827 52249165 52253166 177 65562483 65562514 65658401 65658432 8 65558513 65562514 65658401 65662402 178 65562483 65562514 65658401 65658432 8 65558513 65562514 65658401 65662402 179 38648333 38648364 38686830 38686861 9 38648333 38652334 38682860 38686861 180 38648333 38648364 38686830 38686861 9 38648333 38652334 38682860 38686861 181 28717278 28717309 28731416 28731447 7 28717278 28721279 28731416 28735417 182 28717278 28717309 28731416 28731447 7 28717278 28721279 28731416 28735417 183 36976432 36976463 37039732 37039763 7 36976432 36980433 37039732 37043733 184 36976432 36976463 37039732 37039763 7 36976432 36980433 37039732 37043733 185 77514867 77514898 77580704 77580735 2 77514867 77518868 77576734 77580735 186 77514867 77514898 77580704 77580735 2 77514867 77518868 77576734 77580735 187 55502863 55502894 55533743 55533774 1 55502863 55506864 55533743 55537744 188 55502863 55502894 55533743 55533774 1 55502863 55506864 55533743 55537744 189 195535991 195536022 195589030 195589061 2 195535991 195539992 195585060 195589061 190 195535991 195536022 195589030 195589061 2 195535991 195539992 195585060 195589061 191 33273553 33273584 33317596 33317627 9 33273553 33277554 33317596 33321597 192 33273553 33273584 33317596 33317627 9 33273553 33277554 33317596 33321597 193 42093750 42093781 42144509 42144540 2 42093750 42097751 42140539 42144540 194 42093750 42093781 42144509 42144540 2 42093750 42097751 42140539 42144540 195 45370280 45370311 45421686 45421717 7 45366310 45370311 45421686 45425687 196 45370280 45370311 45421686 45421717 7 45366310 45370311 45421686 45425687 197 96311004 96311035 96328347 96328378 15 96307034 96311035 96328347 96332348 198 96311004 96311035 96328347 96328378 15 96307034 96311035 96328347 96332348 199 22663253 22663284 22709447 22709478 10 22659283 22663284 22705477 22709478 200 22663253 22663284 22709447 22709478 10 22659283 22663284 22705477 22709478 201 198074515 198074546 198099686 198099717 2 198070545 198074546 198099686 198103687 202 198074515 198074546 198099686 198099717 2 198070545 198074546 198099686 198103687 203 76403646 76403677 76480867 76480898 10 76403646 76407647 76480867 76484868 204 76403646 76403677 76480867 76480898 10 76403646 76407647 76480867 76484868 205 66539108 66539139 66592400 66592431 2 66539108 66543109 66592400 66596401 206 66539108 66539139 66592400 66592431 2 66539108 66543109 66592400 66596401 207 10103712 10103743 10175240 10175271 8 10099742 10103743 10171270 10175271 208 10103712 10103743 10175240 10175271 8 10099742 10103743 10171270 10175271 209 65562483 65562514 65637133 65637164 8 65558513 65562514 65637133 65641134 210 65562483 65562514 65637133 65637164 8 65558513 65562514 65637133 65641134 211 106698878 106698909 106745349 106745380 14 106694908 106698909 106741379 106745380 212 106698878 106698909 106745349 106745380 14 106694908 106698909 106741379 106745380 Table l.c6 Probe PCR- PrimerlJD PCR_Primerl 11 3 ORF13_16_10047306_10049395_10119747_10125313_FF OBD159_22 5 CTCAAGTTGTCACAGCATTACCACCT 11 4 ORF13_16_10047306_10049395_10119747_10125313_FF OBD159_22 5 CTCAAGTTGTCACAGCATTACCACCT 05 03 25 11 5 ORF13_19_46459835_46460902_46479838_46481514_RF OBD159_22 9 CAGTCTTGGCTGGTGATGATTCCTGA 11 6 ORF13_19_46459835_46460902_46479838_46481514_RF OBD159_22 9 CAGTCTTGGCTGGTGATGATTCCTGA 11 7 ORF13_21_41872387_41876215_41926859_4193O173_RR OBD159_23 3 CCTCCTGAACCACCACCTCTGGC 11 8 ORF13_21_41872387_41876215_41926859_4193O173_RR OBD159_23 3 CCTCCTGAACCACCACCTCTGGC 11 9 ORF13_22_16921135_16923046_16987493_16991720_FR OBD159_23 7 CAAGTAATCATTTCTCTTCATTTTG 12 0 ORF13_22_16921135_16923046_16987493_16991720_FR OBD159_23 7 CAAGTAATCATTTCTCTTCATTTTG 12 1 ORF13_3_65738736_65743505_65758131_65766427_RR OBD159_24 1 AAGCCCTTGTTGAGACCTACTTCCTC 12 2 ORF13_3_65738736_65743505_65758131_65766427_RR OBD159_24 1 AAGCCCTTGTTGAGACCTACTTCCTC 12 3 ORF13_3_65738736_65743505_65827279_65831993_RR OBD159_24 5 AAGCCCTTGTTGAGACCTACTTCCTC 12 4 ORF13_3_65738736_65743505_65827279_65831993_RR OBD159_24 5 AAGCCCTTGTTGAGACCTACTTCCTC 12 5 ORF13_7_794O9384_79415984_79434265_79448888_FF OBD159_24 9 TAAACTTG CTG GTCTCTTCCACAGTA 12 6 ORF13_7_794O9384_79415984_79434265_79448888_FF OBD159_24 9 TAAACTTG CTG GTCTCTTCCACAGTA 12 7 ORF13_8_10137237_10138418_10247633_10250634_RR OBD159_25 3 G G CAG CCTACTTTG CTTGCTCTCAA 12 8 ORF13_8_10137237_10138418_10247633_10250634_RR OBD159_25 3 G G CAG CCTACTTTG CTTGCTCTCAA 12 9 ORF130_3_16438382_16444965_16496760_16499694_FR OBD159_25 7 CCACTACAACCACCATCACTCGC 13 0 ORF130_3_16438382_16444965_16496760_16499694_FR OBD159_25 7 CCACTACAACCACCATCACTCGC 13 1 ORF131_13_36625595_36628054_36670823_36673255_FR OBD159_26 1 G GTAGTCTCTG AG GTGTCATTCT 13 2 ORF131_13_36625595_36628054_36670823_36673255_FR OBD159_26 1 G GTAGTCTCTG AG GTGTCATTCT 13 3 ORF132_X_38848295_38850360_38907082_38913455_RR OBD159_26 5 GCCAACACATCAGGAGTGGGAAG 13 4 ORF132_X_38848295_38850360_38907082_38913455_RR OBD159_26 5 GCCAACACATCAGGAGTGGGAAG 13 5 ORF133_14_68255587_68260022_68325745_68327713_FF OBD159_26 9 GTGTTGGGCATTGAGAAAGTGGTGA A 13 6 ORF133_14_68255587_68260022_68325745_68327713_FF OBD159_26 9 GTGTTGGGCATTGAGAAAGTGGTGA A 13 7 ORF133_5_127388766_127390678_127434266_127436041_F R OBD159_27 3 CTCCTGACCTCAAATGATACTCTTGT 13 8 ORF133_5_127388766_127390678_127434266_127436041_F R OBD159_27 3 CTCCTGACCTCAAATGATACTCTTGT 13 9 ORF134_21_30984126_30988102_30998437_31002269_RF OBD159_27 7 TAACCAGG GTAG CCTTG ATGCCAG C 14 0 ORF134_21_30984126_30988102_30998437_31002269_RF OBD159_27 7 TAACCAGG GTAG CCTTG ATGCCAG C 14 1 ORF135_14_78345645_78349226_78398O12_784OO321_RF OBD159_28 1 GCCAAGAAGTAGTAGTTATTCCCTCC 14 2 ORF135_14_78345645_78349226_78398O12_784OO321_RF OBD159_28 1 GCCAAGAAGTAGTAGTTATTCCCTCC 14 3 ORF135_6_84752549_84755954_84775145_84786636_FR OBD159_28 5 AAGACATTGTTTAGCAACTTCCAA 14 4 ORF135_6_84752549_84755954_84775145_84786636_FR OBD159_28 5 AAGACATTGTTTAGCAACTTCCAA 14 5 ORF135_8_3431982_3435558_3460548_3464200_RF OBD159_28 9 CAG CAG CACATCACAGGAAACAGTT C 14 6 ORF135_8_3431982_3435558_3460548_3464200_RF OBD159_28 9 CAG CAG CACATCACAGGAAACAGTT C 05 03 25 14 7 ORF136_11_33584612_33595244_33612657_33615678_FF OBD159_29 3 G AATAAG CACTTCTTCTTGG ATTAG C 14 OBD159_29 8 ORF136_11_33584612_33595244_33612657_33615678_FF 3 G AATAAG CACTTCTTCTTGG ATT AG C 14 OBD159_29 9 ORF136_16_23139410_23143862_23210381_23212701_RR 7 GCAGGAAAACCAGGAAGGCAGAG 15 OBD159_29 0 ORF136_16_23139410_23143862_23210381_23212701_RR 7 GCAGGAAAACCAGGAAGGCAGAG 15 OBD159_3O 1 ORF136_3_65835051_65839403_65852931_65856153_FF 1 ACCTACTGTG CTG CCAGACATAG AAA 15 OBD159_3O 2 ORF136_3_65835051_65839403_65852931_65856153_FF 1 ACCTACTGTG CTG CCAGACATAG AAA 15 OBD159_3O 3 ORF138_11_84067130_84068735_84120868_84126600_FR 5 CCAGTTATTTGCTCCAGTGTTCCTCC 15 OBD159_3O 4 ORF138_11_84067130_84068735_84120868_84126600_FR 5 CCAGTTATTTGCTCCAGTGTTCCTCC 15 OBD159_3O 5 ORF139_2_38148629_38155476_38206549_38210637_FR 9 CCCG CCCACATCCTG AG AATCCTTTT 15 OBD159_3O 6 ORF139_2_38148629_38155476_38206549_38210637_FR 9 CCCG CCCACATCCTG AG AATCCTTTT 15 OBD159_31 7 ORF139_3_43868341_43870688_43889253_43893962_RR 3 CTCTTCTGACCCTTTGCCCTTCCCAT 15 OBD159_31 8 ORF139_3_43868341_43870688_43889253_43893962_RR 3 CTCTTCTGACCCTTTGCCCTTCCCAT 15 ORF139 X 103107164 103111839 103149176 103158530 F OBD159_31 G G GATG CCTG GGACATAAGTCAGAT 9 F 7 G 16 ORF139 X 103107164 103111839 103149176 103158530 F OBD159_31 G G GATG CCTG GGACATAAGTCAGAT 0 F 7 G 16 OBD159_16 1 ORF14_1_364O9666_36411937_36433268_36434547_RR 5 GAAGCGAGTTGCTGTCACTGGAG 16 OBD159_16 2 ORF14_1_364O9666_36411937_36433268_36434547_RR 5 GAAGCGAGTTGCTGTCACTGGAG 16 OBD159_32 3 ORF14_11_49143461_49148959_49200052_49204610_FF 1 GTTTCAGGACCACCCTCTACACC 16 OBD159_32 4 ORF14_11_49143461_49148959_49200052_49204610_FF 1 GTTTCAGGACCACCCTCTACACC 16 OBD159_32 5 ORF14_12_13672704_13680228_13739178_13742093_RF 5 AG CCCTTG GCACATAGTATTCACTCA 16 OBD159_32 6 ORF14_12_13672704_13680228_13739178_13742093_RF 5 AG CCCTTG GCACATAGTATTCACTCA 16 OBD159_32 7 ORF14_2_169020149_169021769_169079530_169081990_FR 9 CAACCTAACACAACATAGCCTGC 16 OBD159_32 8 ORF14_2_169020149_169021769_169079530_169081990_FR 9 CAACCTAACACAACATAGCCTGC 16 OBD159_33 9 ORF14_2_20283807_20286153_20303337_20304942_RF 3 CATTTGTCAACTCACACTCTAAAA 17 OBD159_33 0 ORF14_2_20283807_20286153_20303337_20304942_RF 3 CATTTGTCAACTCACACTCTAAAA 17 OBD159_33 1 ORF14_2_20303337_20304942_20379482_20381283_FF 7 ACATTTGTCAACTCACACTCTAAA 17 OBD159_33 2 ORF14_2_20303337_20304942_20379482_20381283_FF 7 ACATTTGTCAACTCACACTCTAAA 17 OBD159_28 3 ORF14_6_84752549_84755954_84775145_84786636_FR 5 AAGACATTGTTTAGCAACTTCCAA 17 OBD159_28 4 ORF14_6_84752549_84755954_84775145_84786636_FR 5 AAGACATTGTTTAGCAACTTCCAA 17 OBD159_34 5 ORF14_8_52230322_52233827_52248401_52253166_FF 1 TATTATTTTCATTGGCTTTCACCAG 17 OBD159_34 6 ORF14_8_52230322_52233827_52248401_52253166_FF 1 TATTATTTTCATTGGCTTTCACCAG 17 OBD159_34 7 ORF14_8_65560550_65562514_65658401_65661888_FR 5 CCTTGATAGAGAAAACAAAATGCTT 17 OBD159_34 8 ORF14_8_65560550_65562514_65658401_65661888_FR 5 CCTTGATAGAGAAAACAAAATGCTT 05 03 25 17 9 ORF14_9_38648333_38653476_38681931_38686861_RF OBD159_34 9 CAGAAGTTCACAGGCAGGGTGTC 18 OBD159_34 0 ORF14_9_38648333_38653476_38681931_38686861_RF 9 CAGAAGTTCACAGGCAGGGTGTC 18 OBD159_35 1 ORF140_7_28717278_28719857_28731416_28736388_RR 3 CCCCAGAGTTCCTTTGGCTCCCA 18 OBD159_35 2 ORF140_7_28717278_28719857_28731416_28736388_RR 3 CCCCAGAGTTCCTTTGGCTCCCA 18 OBD159_35 3 ORF140_7_36976432_36980351_37039732_37049390_RR 7 CAATGGGATACTTCTCTTGGGTTTGG 18 OBD159_35 4 ORF140_7_36976432_36980351_37039732_37049390_RR 7 CAATGGGATACTTCTCTTGGGTTTGG 18 OBD159_36 5 ORF141_2_77514867_77519288_775767O5_7758O735_RF 1 G GTG ATG G G ACTAAGCCTCAGGTTTT 18 OBD159_36 6 ORF141_2_77514867_77519288_775767O5_7758O735_RF 1 G GTG ATG G G ACTAAGCCTCAGGTTTT 18 OBD159_36 7 ORF142_1_55502863_55511336_55533743_55538240_RR 5 CCAGAGAGCCAGTGCTTTCAACTCCA 18 OBD159_36 8 ORF142_1_55502863_55511336_55533743_55538240_RR 5 CCAGAGAGCCAGTGCTTTCAACTCCA 18 ORF142 2 195535991 195542111 195583610 195589061 R OBD159_36 CAGGCTATTGGAATGGCTGAAGTGT 9 F 9 G 19 ORF142 2 195535991 195542111 195583610 195589061 R OBD159_36 CAGGCTATTGGAATGGCTGAAGTGT 0 F 9 G 19 OBD159_37 1 ORF144_9_33273553_33275175_33317596_33319558_RR 3 CCTACACACACACAACAGCAAAATAA 19 OBD159_37 2 ORF144_9_33273553_33275175_33317596_33319558_RR 3 CCTACACACACACAACAGCAAAATAA 19 OBD159_37 AGGGAAGAAGGCTGCTATGTATTGG 3 ORF145_2_42093750_42101196_42140119_42144540_RF 7 G 19 OBD159_37 AGGGAAGAAGGCTGCTATGTATTGG 4 ORF145_2_42093750_42101196_42140119_42144540_RF 7 G 19 OBD159_38 5 ORF145_7_45364155_45370311_45421686_45426816_FR 1 TTTAGCAGTGAAGTCATCAGGTCCT 19 OBD159_38 6 ORF145_7_45364155_45370311_45421686_45426816_FR 1 TTTAGCAGTGAAGTCATCAGGTCCT 19 OBD159_38 7 ORF147_15_96308452_96311035_96328347_96331473_FR 5 TCAAAATGATAGGTTCACAGTTCGTG 19 OBD159_38 8 ORF147_15_96308452_96311035_96328347_96331473_FR 5 TCAAAATGATAGGTTCACAGTTCGTG 19 OBD159_38 9 ORF148_10_22661441_22663284_22705207_22709478_FF 9 CACAI ICI 1 1 IGGGCICIGCCACICC 20 OBD159_38 0 ORF148_10_22661441_22663284_22705207_22709478_FF 9 CACAI ICI 1 1 IGGGCICIGCCACICC 20 ORF148 2 198067347 198074546 198099686 198102962 F OBD159_39 1 R 3 GGACTCCAAAGTGACTAAAATCAATG 20 ORF148 2 198067347 198074546 198099686 198102962 F OBD159_39 2 R 3 GGACTCCAAAGTGACTAAAATCAATG 20 OBD159_39 3 ORF15_10_76403646_76410014_76480867_76489182_RR 7 AGAACCCTGGTCCCACCCCTTTA 20 OBD159_39 4 ORF15_10_76403646_76410014_76480867_76489182_RR 7 AGAACCCTGGTCCCACCCCTTTA 20 0BD159_40 5 ORF15_2_66539108_66541258_66592400_66595314_RR 1 GTAATACCAG CACTTTAGG AGG C 20 0BD159_40 6 ORF15_2_66539108_66541258_66592400_66595314_RR 1 GTAATACCAG CACTTTAGG AGG C 20 0BD159_40 AGTGAGATAATGTGCCTGAAAGCAA 7 ORF15_8_10100695_10103743_10173552_10175271_FF 5 T 20 0BD159_40 AGTGAGATAATGTGCCTGAAAGCAA 8 ORF15_8_10100695_10103743_10173552_10175271_FF 5 T 20 0BD159_40 9 ORF15_8_6556O55O_65562514_65637133_6564O837_FR 9 ACCTTGATAGAGAAAACAAAATGCT 21 0BD159_40 0 ORF15_8_6556O55O_65562514_65637133_6564O837_FR 9 ACCTTGATAGAGAAAACAAAATGCT 21 1 ORF151_14_106693397_106698909_106739902_106745380_ FF OBD159_41 3 CG CAACG G GTCCCAGCATCATCT 21 ORF151 14 106693397 106698909 106739902 106745380 OBD159_41 2 FF 3 CG CAACG G GTCCCAGCATCATCT Table l.c7 05 03 25 PCR-Primer2_ID PCR_Primer2 Marker GLMNET 113 OBD159_227 CTTGACCTCTTGACGCCTTCTACTTC OBD159_225_227 -0.003478138 114 OBD159_227 CTTGACCTCTTGACGCCTTCTACTTC OBD159_225_227 -0.003478138 115 OBD159_231 CCCTTCAGTG GAACCTTACCCAACAA OBD159_229_231 -0.002532463 116 OBD159_231 CCCTTCAGTG G AACCTTACCCAACAA OBD159_229_231 -0.002532463 117 OBD159_235 GGAG 1 1C111CC 1 1GGGTGTTACAG OBD159_233_235 -0.001863826 118 OBD159_235 GGAG 1 1C111CC 1 1 GGGTGTTACAG OBD159_233_235 -0.001863826 119 OBD159_239 GATTCCTAAGAAACCTACCATTAT OBD159_237_239 -0.001138844 120 OBD159_239 GATTCCTAAGAAACCTACCATTAT OBD159_237_239 -0.001138844 121 OBD159_243 TGTGGAAAGGTGATTGGCTCAACAGC OBD159_241_243 -0.00258233 122 OBD159_243 TGTGGAAAGGTGATTGGCTCAACAGC OBD159_241_243 -0.00258233 123 OBD159_247 GAGCAAGAGCAGTTTGGCTGTGTTGT OBD159_245_247 -0.00500142 124 OBD159_247 GAGCAAGAGCAGTTTGGCTGTGTTGT OBD159_245_247 -0.00500142 125 OBD159_251 CATTGCTCTACCCCACCTTCTGAGGA OBD159_249_251 -0.000699189 126 OBD159_251 CATTGCTCTACCCCACCTTCTGAGGA OBD159_249_251 -0.000699189 127 OBD159_255 CTCTCCTTCTGTGTATG GGTAAG ACC OBD159_253_255 -0.004180686 128 OBD159_255 CTCTCCTTCTGTGTATG GGTAAG ACC OBD159_253_255 -0.004180686 129 OBD159_259 GTTTGGGCGGTTTCCAGGATGGG OBD159_257_259 -0.003029176 130 OBD159_259 GTTTGGGCGGTTTCCAGGATGGG OBD159_257_259 -0.003029176 131 OBD159_263 CTACTAAGTGGCTAATGGGTGGG OBD159_261_263 -0.003552931 132 OBD159_263 CTACTAAGTGGCTAATGGGTGGG OBD159_261_263 -0.003552931 133 OBD159_267 GCTTCCCTCCTCTGTAGCCAATAGC OBD159_265_267 -0.001420022 134 OBD159_267 GCTTCCCTCCTCTGTAGCCAATAGC OBD159_265_267 -0.001420022 135 OBD159_271 GCCAAAG ACTCCTCTG GG AATCCAAC OBD159_269_271 -0.003881009 136 OBD159_271 GCCAAAG ACTCCTCTG GG AATCCAAC OBD159_269_271 -0.003881009 137 OBD159_275 TCTTG G CATAAAGCAG GGCTCCAG GA OBD159_273_275 -0.000941074 138 OBD159_275 TCTTG G CATAAAGCAG GGCTCCAG GA OBD159_273_275 -0.000941074 139 OBD159_279 TTGTCAGTGTTACAGGATTAGACTCC OBD159_277_279 -0.002446219 140 OBD159_279 TTGTCAGTGTTACAGGATTAGACTCC OBD159_277_279 -0.002446219 141 OBD159_283 CCTCAACATCCCAAAACGGGTTCCTC OBD159_281_283 -0.003527946 142 OBD159_283 CCTCAACATCCCAAAACGGGTTCCTC OBD159_281_283 -0.003527946 143 OBD159_287 TTTGTAAACGGTTGGGAGACTTAG OBD159_285_287 -0.002652581 144 OBD159_287 TTTGTAAACGGTTGGGAGACTTAG OBD159_285_287 -0.002652581 145 OBD159_291 AACTGGGTTCTGGGAC1 1 1 1CC1CAG OBD159_289_291 -0.003934436 146 OBD159_291 AACTGGGTTCTGGGAC1 1 1 1CC1 CAG OBD159_289_291 -0.003934436 147 OBD159_295 GG G ATGTTG CCTCCG AG ACAAAA OBD159_293_295 -0.005396785 148 OBD159_295 GG G ATGTTG CCTCCG AG ACAAAA OBD159_293_295 -0.005396785 149 OBD159_299 GGGAGCCAGAGAACACCTGCTTC OBD159_297_299 -0.000755854 150 OBD159_299 GGGAGCCAGAGAACACCTGCTTC OBD159_297_299 -0.000755854 151 OBD159_303 GAGGGACTGGGTGGGAGGAGTATTTT OBD159_3O1_3O3 -0.000778321 152 OBD159_303 GAGGGACTGGGTGGGAGGAGTATTTT OBD159_3O1_3O3 -0.000778321 153 OBD159_307 CTCCAACTGACCACTAAAACCACATA OBD159_3O5_3O7 -0.001663304 154 OBD159_307 CTCCAACTGACCACTAAAACCACATA OBD159_3O5_3O7 -0.001663304 155 OBD159_311 AGTTCCACTTCCCCATACTCACAAAC OBD159_3O9_311 -0.001494243 156 OBD159_311 AGTTCCACTTCCCCATACTCACAAAC OBD159_3O9_311 -0.001494243 157 OBD159_315 GG G CTAAAGTG G GTAAAGTCTCAAAA OBD159_313_315 -0.001782575 158 OBD159_315 GG G CTAAAGTG G GTAAAGTCTCAAAA OBD159_313_315 -0.001782575 159 OBD159_319 GACACTCACACACAGAAATACTGCCA OBD159_317_319 -0.002307627 160 OBD159_319 GACACTCACACACAGAAATACTGCCA OBD159_317_319 -0.002307627 161 OBD159_167 CCCCAACACAAACTGTCCTCAGGC OBD159_165_167 -0.005406694 162 OBD159_167 CCCCAACACAAACTGTCCTCAGGC OBD159_165_167 -0.005406694 163 OBD159_323 GACCATACCTTGCCAGACCTCCAC OBD159_321_323 -0.000820401 164 OBD159_323 GACCATACCTTGCCAGACCTCCAC OBD159_321_323 -0.000820401 165 OBD159_327 TATGTTGTTGCCCTTGATACGGTAGC OBD159_325_327 -0.003236838 05 03 25 166 OBD159_327 TATGTTGTTGCCCTTGATACGGTAGC OBD159_325_327 -0.003236838 167 OBD159_331 GGATTACAGGCGTGAGCCACCAC OBD159_329_331 -0.001954353 168 OBD159_331 GGATTACAGGCGTGAGCCACCAC OBD159_329_331 -0.001954353 169 OBD159_335 ATG AG G CACTTG ATTTTGAACTTC OBD159_333_335 -0.003110365 170 OBD159_335 ATG AG G CACTTG ATTTTGAACTTC OBD159_333_335 -0.003110365 171 OBD159_339 TATCCAGTCTCCCAACATCATTTGT OBD159_337_339 -0.002009345 172 OBD159_339 TATCCAGTCTCCCAACATCATTTGT OBD159_337_339 -0.002009345 173 OBD159_287 TTTGTAAACGGTTGGGAGACTTAG OBD159_285_287 -0.00372894 174 OBD159_287 TTTGTAAACGGTTGGGAGACTTAG OBD159_285_287 -0.00372894 175 OBD159_343 TATTTCCCTAACATAACGATAGTGC OBD159_341_343 -0.002079504 176 OBD159_343 TATTTCCCTAACATAACGATAGTGC OBD159_341_343 -0.002079504 177 OBD159_347 GTAGAAGAGAAACCCAGATAAATA OBD159_345_347 -0.001315086 178 OBD159_347 GTAGAAGAGAAACCCAGATAAATA OBD159_345_347 -0.001315086 179 OBD159_351 GACCACAG G CACCACCATACCCT OBD159_349_351 -0.002703631 180 OBD159_351 GACCACAG G CACCACCATACCCT OBD159_349_351 -0.002703631 181 OBD159_355 CCCGAACTCCCTTCCTGTTTTGG OBD159_353_355 -0.001783895 182 OBD159_355 CCCGAACTCCCTTCCTGTTTTGG OBD159_353_355 -0.001783895 183 OBD159_359 ACAGGAAAGCCTACTGGACAACATTG OBD159_357_359 -0.002901823 184 OBD159_359 ACAGGAAAGCCTACTGGACAACATTG OBD159_357_359 -0.002901823 185 OBD159_363 AGTGTG CTTG GTTGAACTGAATCATT OBD159_361_363 -0.002666837 186 OBD159_363 AGTGTG CTTG GTTGAACTGAATCATT OBD159_361_363 -0.002666837 187 OBD159_367 GG CAACTAACACTTGTCTCACCTTCA OBD159_365_367 -0.002519385 188 OBD159_367 GG CAACTAACACTTGTCTCACCTTCA OBD159_365_367 -0.002519385 189 OBD159_371 CCTG CTCTG CCACTAACCAAGTATGT OBD159_369_371 -0.003311287 190 OBD159_371 CCTG CTCTG CCACTAACCAAGTATGT OBD159_369_371 -0.003311287 191 OBD159_375 GGACTACAGGCGTGAGCCACCAC OBD159_373_375 -0.002586717 192 OBD159_375 GGACTACAGGCGTGAGCCACCAC OBD159_373_375 -0.002586717 193 OBD159_379 ATCCATCCTTCTCACAGCAGCCAAGA OBD159_377_379 -0.000261394 194 OBD159_379 ATCCATCCTTCTCACAGCAGCCAAGA OBD159_377_379 -0.000261394 195 OBD159_383 ATTG AATAG CCATCAG CAAGAAAA OBD159_381_383 -0.003357596 196 OBD159_383 ATTG AATAG CCATCAG CAAGAAAA OBD159_381_383 -0.003357596 197 OBD159_387 TGAGACTTCCATAGCAGATTACCTTT OBD159_385_387 -0.004574718 198 OBD159_387 TGAGACTTCCATAGCAGATTACCTTT OBD159_385_387 -0.004574718 199 OBD159_391 GAACCTCATCTGTCTAACCACAAACC OBD159_389_391 -0.002633812 200 OBD159_391 GAACCTCATCTGTCTAACCACAAACC OBD159_389_391 -0.002633812 201 OBD159_395 TAGTTCAAGTTCTTCTCAAAAGCCCC OBD159_393_395 -0.003551604 202 OBD159_395 TAGTTCAAGTTCTTCTCAAAAGCCCC OBD159_393_395 -0.003551604 203 OBD159_399 GAGTCGCTGTCCCAATGGCAGGA OBD159_397_399 -0.004114077 204 OBD159_399 GAGTCGCTGTCCCAATGGCAGGA OBD159_397_399 -0.004114077 205 OBD159_403 CCATTTTACAGGTGAACAAACTGATG 0BD159_401_403 -0.004584406 206 OBD159_403 CCATTTTACAGGTGAACAAACTGATG 0BD159_401_403 -0.004584406 207 OBD159_407 TAGCCCCTTTCCCACAAC1 1 1 1U GC OBD159_4O5_4O7 -0.002097489 208 OBD159_407 TAGCCCCTTTCCCACAAC1 1 1 1U GC OBD159_4O5_4O7 -0.002097489 209 OBD159_411 GTTCAAGGTTTCCCTCTGCTTCTA OBD159_4O9_411 -0.001313422 210 OBD159_411 GTTCAAGGTTTCCCTCTGCTTCTA OBD159_4O9_411 -0.001313422 211 OBD159_415 CTTGCCTTACCACCTGCTCTTCC OBD159_413_415 -0.003147124 212 OBD159_415 CTTGCCTTACCACCTGCTCTTCC OBD159_413_415 -0.003147124 Table 1x8 Gene 113 GRIN2A; rs7192557 114 GRIN2A; rs7192557 115 PNMAL1; PNMAL2; PPP5D1 116 PNMAL1; PNMAL2; PPP5D1 117 C2CD2; PRDM15; ZBTB21; rs451390 118 C2CD2; PRDM15; ZBTB21; rs451390 119 GAB4; rs41433045 120 GAB4; rs41433045 121 MAGI1; rsll924265 122 MAGI1; rsll924265 05 03 25 123 MAGI1; rs7633294; rsll924265; rsl909492; rsl45965284 124 MAGI1; rs7633294; rsll924265; rsl909492; rsl45965284 125 MAGI2; rsll35402912 126 MAGI2; rsll35402912 127 MSRA; rs7001567; rsl0107815; rs73191547; rsl7749155; rs2975735 128 MSRA; rs7001567; rsl0107815; rs73191547; rsl7749155; rs2975735 129 RFTN1; rs3856834 130 RFTN1; rs3856834 131 SERTM1; rsll619726 132 SERTM1; rsll619726 133 MID1IP1; rsl99860 134 MID1IP1; rsl99860 135 RAD51B; rsl570106; rsl7105278; rs4902562; rs3784099; rs2208397; rs911263; rs2104047; rsl950897; rslll58728; rs92722O; rs61985136; rs8017304; rsl956529; rs49O2566 136 RAD51B; rsl570106; rsl7105278; rs4902562; rs3784099; rs2208397; rs911263; rs2104047; rsl950897; rslll58728; rs927220; rs61985136; rs8017304; rsl956529; rs49O2566 137 MEGF10; rs387907071; rsl43954261; rs387907073; rs794726679; rsl057518682; rs794726677 138 MEGF10; rs387907071; rsl43954261; rs387907073; rs794726679; rsl057518682; rs794726677 139 KRTAP19-8; rs8134605 140 KRTAP19-8; rs8134605 141 NRXN3; rsll624704 142 NRXN3; rsll624704 143 TBX18; rs869320679; rs797045022; rs77693245 144 TBX18; rs869320679; rs797045022; rs77693245 145 CSMD1; rs2938236; rsl7066135 146 CSMD1; rs2938236; rsl7066135 147 KIAA1549L; rs4755718; rs2076625 148 KIAA1549L; rs4755718; rs2076625 149 SCNN1G; USP31; rsl37853342; rs5736 150 SCNN1G; USP31; rsl37853342; rs5736 151 MAG 11; rsl45965284 152 MAG 11; rsl45965284 153 DLG2; rs790356 154 DLG2; rs790356 155 ATL2; CYP1B1 156 ATL2; CYP1B1 157 rs6441806; rs75594032 158 rs6441806; rs75594032 159 BEX4; NXF3 160 BEX4; NXF3 161 LSM10; 0SCP1 162 LSM10; 0SCP1 163 F0LH1; rs202676; rs368939818; rs61886492; rs770894245; rs747052707; rs202680 164 F0LH1; rs202676; rs368939818; rs61886492; rs770894245; rs747052707; rs202680 165 GRIN2B; rsl060499526; rs2192970; rs2284411; rs2268118 166 GRIN2B; rsl060499526; rs2192970; rs2284411; rs2268118 167 ABCB11; DHRS9; rs886043986; rs2161037 168 ABCB11; DHRS9; rs886043986; rs2161037 169 PUM2; rslll612372 170 PUM2; rslll612372 171 PUM2; rs585017 172 PUM2; rs585017 173 TBX18; rs869320679; rs797045022; rs77693245 174 TBX18; rs869320679; rs797045022; rs77693245 175 ST18; rs2360806 176 ST18; rs2360806 177 ARMCI; MTFR1; rs6991838 178 ARMCI; MTFR1; rs6991838 179 ANKRD18A; CNTNAP3 180 ANKRD18A; CNTNAP3 181 CREB5; rs56388170 182 CREB5; rs56388170 05 03 25 183 ELMO1; rs6942726; rsl7170851 184 ELMO1; rs6942726; rsl7170851 185 LRRTM4; rs61354037 186 LRRTM4; rs61354037 187 rsl998013; rsl0888935 188 rsl998013; rslO888935 189 DNAH7; SLC39A1O 190 DNAH7; SLC39A1O 191 BAG1; CHMP5; NFX1 192 BAG1; CHMP5; NFX1 193 EML4; rsl7029233 194 EML4; rsl7029233 195 ADCY1; rsl294908 196 ADCY1; rsl294908 197 NR2F2; rs587777373; rs2398180 198 NR2F2; rs587777373; rs2398180 199 PIP4K2A; rsl409395; rs370356098 200 PIP4K2A; rsl409395; rs370356098 201 PLCL1; rs7587251; rs6745726; rsl368989; rsl2105927; rs7590828; rsl866666; rslO36333; rs2164068; rsl064213; rsll684176 202 PLCL1; rs7587251; rs6745726; rsl368989; rsl2105927; rs7590828; rsl866666; rslO36333; rs2164068; rsl064213; rsll684176 203 ClOorfll; rsl0509373; rsll593840 204 ClOorfll; rsl0509373; rsll593840 205 MEIS1; rsl0865355; rsll897119; rs2300478; rs2300481 206 MEIS1; rsl0865355; rsll897119; rs2300478; rs23OO481 207 MSRA; rs73191547; rsl0087178; rsl0107815 208 MSRA; rs73191547; rsl0087178; rsl0107815 209 ARMCI; rs6991838 210 ARMCI; rs6991838 211 rs2337406; rsll846409 212 rs2337406; rsll846409 Table l.c9 Probe GeneLocus 213 ORF152_14_106693397_106698909_106739902_106745380_RR rs2337406; rsll846409 214 ORF152_14_106693397_106698909_106739902_106745380_RR rs2337406; rsll846409 215 ORF153_3_65835051_65839403_65898255_65903690_FF MAGI1; rsl45965284 216 ORF153_3_65835051_65839403_65898255_65903690_FF MAGI1; rsl45965284 217 ORF153_7_131130568_131132000_131219450_131221740_RR MKLN1; rsll4034759 218 ORF153_7_131130568_131132000_131219450_131221740_RR MKLN1; rsll4034759 219 ORF154_6_73688989_73690148_73751804_73758297_FF CD109; SLC17A5 220 ORF154_6_73688989_73690148_73751804_73758297_FF CD109; SLC17A5 221 ORF155_18_3106299_3108561_3129940_3131675_RR MY0M1; rs751200138 222 ORF155_18_3106299_3108561_3129940_3131675_RR MYOM1; rs751200138 223 ORF155_5_36136424_36142007_36160830_36164969_FF LMBRD2; SKP2; rs2270909; rsl2657634; rsl0941274; rsl2655052; rs3804446 224 ORF155_5_36136424_36142007_36160830_36164969_FF LMBRD2; SKP2; rs2270909; rsl2657634; rsl0941274; rsl2655052; rs3804446 225 ORF158_5_26999889_27004744_27042244_27044606_RF CDH9; rs201058683 226 ORF158_5_26999889_27004744_27042244_27044606_RF CDH9; rs201058683 227 ORF16_1_364O9666_36411937_36433268_36434547_RR LSM10; OSCP1 228 ORF16_1_364O9666_36411937_36433268_36434547_RR LSM10; OSCP1 229 ORF16_2_66446190_66449017_66470757_66475654_FR MEIS1; rsll692361 230 ORF16_2_66446190_66449017_66470757_66475654_FR MEIS1; rsll692361 231 ORF16_3_107626100_107637571_107708851_107713617_RR BBX; rsll710737 232 ORF16_3_107626100_107637571_107708851_107713617_RR BBX; rsll710737 233 ORF16_4_175829279_175833051_175892267_175894404_RR GPM6A; rsll06568 234 ORF16_4_175829279_175833051_175892267_175894404_RR GPM6A; rsll06568 235 ORF16_5_6223946_6226870_6283431_6289065_FR rsl2518614 236 ORF16_5_6223946_6226870_6283431_6289065_FR rsl2518614 237 ORF16_8_52380368_52388099_52462030_52466077_RR ST18; rs7820212 05 03 25 238 ORF16_8_52380368_52388099_52462030_52466077_RR ST18; rs7820212 239 ORF16_8_67971637_67976278_68010294_68014710_RR PREX2; rs4512367 240 ORF16_8_67971637_67976278_68010294_68014710_RR PREX2; rs4512367 241 ORF16_9_38681931_38686861_38768696_38769724_FR ANKRD18A; CNTNAP3 242 ORF16_9_38681931_38686861_38768696_38769724_FR ANKRD18A; CNTNAP3 243 ORF160_5_93562856_93565579_93582366_93583770_FF NR2F1; nSZll-nTn 244 ORF160_5_93562856_93565579_93582366_93583770_FF NR2F1; rs587777277 245 ORF162_14_51804670_51807147_51886119_51892276_RF FRMD6; GNG2; rs8015138 246 ORF162_14_51804670_51807147_51886119_51892276_RF FRMD6; GNG2; rs8015138 247 ORF162_6_146094504_146104695_146155392_146161780_RR GRM1; SHPRH 248 ORF162_6_146094504_146104695_146155392_146161780_RR GRM1; SHPRH 249 ORF163_19_36775089_36776260_36803032_36806792_FR ZNF79O; ZNF850 250 ORF163_19_36775089_36776260_36803032_36806792_FR ZNF790; ZNF850 251 0RF164_l_229859020_229862315_229908605_229911291_RF GALNT2; rs4925506 252 ORF164_1_229859O2O_229862315_2299O86O5_229911291_RF GALNT2; rs4925506 253 ORF164_7_45364155_45370311_45384350_45391053_FF ADCY1; rsl294908 254 ORF164_7_45364155_45370311_45384350_45391053_FF ADCY1; rsl294908 255 ORF166_12_130196441_130198032_130248318_130252496_FF FZD10; PIWIL1 256 ORF166_12_130196441_130198032_130248318_130252496_FF FZD10; PIWIL1 257 ORF166_14_89880613_89884758_89952946_89954082_RR EFCAB11; TDP1 258 ORF166_14_89880613_89884758_89952946_89954082_RR EFCAB11; TDP1 259 ORF169_1_206307932_206310423_206383244_206385305_FF SRGAP2; rs2987927 260 ORF169_1_206307932_206310423_206383244_206385305_FF SRGAP2; rs2987927 261 ORF17_1_76086337_76098934_76123667_76127663_FF ST6GALNAC3; rs915404 262 ORF17_1_76086337_76098934_76123667_76127663_FF ST6GALNAC3; rs915404 263 ORF17_11_128975846_128978309_129021767_129026895_FR ARHGAP32; rsll221522 264 ORF17_11_128975846_128978309_129021767_129026895_FR ARHGAP32; rsll221522 265 ORF17_2_78763526_78765449_78792347_78798562_FF REG3G 266 ORF17_2_78763526_78765449_78792347_78798562_FF REG3G 267 ORF17_21_17393292_17394472_1743419O_17435748_RR CXADR 268 ORF17_21_17393292_17394472_1743419O_17435748_RR CXADR 269 ORF17_4_37859966_37862832_37927829_37933173_FF GAFA3; PGM2; PTTG2; TBC1D1; rsl7578878; rs35859249 270 ORF17_4_37859966_37862832_37927829_37933173_FF GAFA3; PGM2; PTTG2; TBC1D1; rsl7578878; rs35859249 271 ORF17_7_23187280_23192079_23219086_23222886_FR NUPL2; rs858249 272 ORF17_7_23187280_23192079_23219086_23222886_FR NUPL2; rs858249 273 ORF17_8_65560550_65562514_65630980_65632323_FR ARMCI; rs6991838 274 ORF17_8_65560550_65562514_65630980_65632323_FR ARMCI; rs6991838 275 ORF17_8_88542O85_88553888_88592759_88597112_RF rsl0504861; rs7838490; rs7819570; rsll995572 276 ORF17_8_88542O85_88553888_88592759_88597112_RF rsl0504861; rs7838490; rs7819570; rsll995572 277 ORF170_2_56323476_56329636_56390760_56394124_FF CCDC85A; rsl86920977; rs6747380; rsl7268785 278 ORF170_2_56323476_56329636_56390760_56394124_FF CCDC85A; rsl86920977; rs6747380; rsl7268785 279 ORF171_3_63280859_63282281_63308360_63313318_FR SYNPR; rsl3098482 280 ORF171_3_63280859_63282281_63308360_63313318_FR SYNPR; rsl3098482 281 ORF171_8_27764811_27768513_27798255_278OO731_RF CCDC25; ESC02; rs80359869; rs80359844; rs80359845; rs80359846; rs80359847; rs80359848; rs80359849; rs80359850; rs80359851; rs80359852; rs80359853; rs80359854; rs80359855; rs80359856; rs80359857; rs797045565; rs797045566; rs80359858; rs80359859; rs80359861; rs80359862; rsl46312522; rs80359863; rs80359864; rs80359865; rs80359866; rs80359867; rs80359868 282 ORF171_8_27764811_27768513_27798255_278OO731_RF CCDC25; ESC02; rs80359869; rs80359844; rs80359845; rs80359846; rs80359847; rs80359848; rs80359849; rs80359850; rs80359851; rs80359852; rs80359853; rs80359854; rs80359855; rs80359856; rs80359857; rs797045565; rs797045566; rs80359858; rs80359859; rs80359861; rs80359862; rsl46312522; rs80359863; rs80359864; rs8O359865; rs80359866; rs8O359867; rs80359868 283 ORF173_8_113409304_113413871_113438847_113446082_FF CSMD3; rsl89590409 284 ORF173_8_113409304_113413871_113438847_113446082_FF CSMD3; rsl89590409 285 ORF176_12_96187243_96188661_96237O99_96241349_RF CDK17; ELK3; rs4762284 286 ORF176_12_96187243_96188661_96237O99_96241349_RF CDK17; ELK3; rs4762284 Table l.dl 05 03 25 Probe_Count _Total Probe_Count _Sig HyperG_Stats 213 NA NA NA 214 NA NA NA 215 55 5; 5 0.042810093; 0.05348201 216 55 5; 5 0.042810093; 0.05348201 217 121 1; 1 0.039588815; 0.028906509 218 121 1; 1 0.039588815; 0.028906509 219 34; 34 3; 3; 3; 3 0.103367502; 0.117734198; 0.103367502; 0.117734198 220 34; 34 3; 3; 3; 3 0.103367502; 0.117734198; 0.103367502; 0.117734198 221 13 1; 1 0.314642613; 0.32680192 222 13 1; 1 0.314642613; 0.32680192 223 16; 16 1; 2; 1; 2 0.343724359; 0.116490918; 0.343724359; 0.116490918 224 16; 16 1; 2; 1; 2 0.343724359; 0.116490918; 0.343724359; 0.116490918 225 30 3; 1 0.082195447; 0.363021342 226 30 3; 1 0.082195447; 0.363021342 227 124; 112 3; 3; 3; 3 0.149414204; 0.126913559; 0.17713842; 0.156487188 228 124; 112 3; 3; 3; 3 0.149414204; 0.126913559; 0.17713842; 0.156487188 229 57 4; 2 0.110951788; 0.26588291 230 57 4; 2 0.110951788; 0.26588291 231 30 4; 5 0.022454364; 0.006393518 232 30 4; 5 0.022454364; 0.006393518 233 68 3; 4 0.224345313; 0.163371308 234 68 3; 4 0.224345313; 0.163371308 235 NA NA NA 236 NA NA NA 237 78 2; 4 0.222357541; 0.186212358 238 78 2; 4 0.222357541; 0.186212358 239 10 1; 1 0.272678156; 0.285987033 240 10 1; 1 0.272678156; 0.285987033 241 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 242 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 243 20 1; 2 0.366490901; 0.155331399 244 20 1; 2 0.366490901; 0.155331399 245 13; 36 1; 1; 2; 3 0.314642613; 0.32680192; 0.247980559; 0.12891994 246 13; 36 1; 1; 2; 3 0.314642613; 0.32680192; 0.247980559; 0.12891994 247 28; 28 1; 2; 1; 2 0.373281001; 0.219149094; 0.373281001; 0.219149094 248 28; 28 1; 2; 1; 2 0.373281001; 0.219149094; 0.373281001; 0.219149094 249 7; 12 1; 1; 1; 1 0.215038813; 0.227740664; 0.302214299; 0.314913912 250 7; 12 1; 1; 1; 1 0.215038813; 0.227740664; 0.302214299; 0.314913912 251 44 4; 3 0.063857117; 0.169607427 252 44 4; 3 0.063857117; 0.169607427 253 30 2; 2 0.21731878; 0.231426351 254 30 2; 2 0.21731878; 0.231426351 255 52; 88 1; 1; 1; 1 0.266738689; 0.244043749; 0.107508983; 0.08745761 256 52; 88 1; 1; 1; 1 0.266738689; 0.244043749; 0.107508983; 0.08745761 257 81; 71 1; 2; 1; 2 0.130826821; 0.192025586; 0.170848338; 0.226583412 258 81; 71 1; 2; 1; 2 0.130826821; 0.192025586; 0.170848338; 0.226583412 259 41 2; 2 0.26460109; 0.271883499 260 41 2; 2 0.26460109; 0.271883499 261 45 5; 5 0.022343156; 0.028833151 262 45 5; 5 0.022343156; 0.028833151 263 3 1; 1 0.108032075; 0.115907508 264 3 1; 1 0.108032075; 0.115907508 265 3 3; 2 0; 0.001770535 266 3 3; 2 0; 0.001770535 267 45 6; 1 0.006017292; 0.285503815 268 45 6; 1 0.006017292; 0.285503815 269 37; 37; 16; 40 5; 8; 5; 8; 1; 2; 2; 3 0.010942367; 0.000107113; 0.010942367; 0.000107113; 0.343724359; 0.116490918; 0.261899069; 0.150241062 270 37; 37; 16; 40 5; 8; 5; 8; 1; 2; 2; 3 0.010942367; 0.000107113; 0.010942367; 0.000107113; 0.343724359; 0.116490918; 0.261899069; 0.150241062 271 51 1; 1 0.272236181; 0.249886334 272 51 1; 1 0.272236181; 0.249886334 273 48 5; 4 0.02780594; 0.092112824 274 48 5; 4 0.02780594; 0.092112824 275 NA NA NA 276 NA NA NA 277 35 4; 2 0.035189793; 0.255336195 278 35 4; 2 0.035189793; 0.255336195 279 41 2; 1 0.26460109; 0.309016356 280 41 2; 1 0.26460109; 0.309016356 281 64; 45 1; 1; 1; 1 0.203553997; 0.179089876; 0.305019886; 0.285503815 282 64; 45 1; 1; 1; 1 0.203553997; 0.179089876; 0.305019886; 0.285503815 283 12 1; 2 0.302214299; 0.076075379 284 12 1; 2 0.302214299; 0.076075379 285 13; 13 1; 1; 2; 3 0.314642613; 0.32680192; 0.076537269; 0.013853987 286 13; 13 1; 1; 2; 3 0.314642613; 0.32680192; 0.076537269; 0.013853987 Table l.d2 05 03 25 FDR_HyperG Percent_Sig logFC AveExpr 213 NA NA 0.555765552 0.555765552 214 NA NA 0.492575943 0.492575943 215 0.375519541; 0.376115439 9.09; 9.09 0.984216332 0.984216332 216 0.375519541; 0.376115439 9.09; 9.09 0.904733665 0.904733665 217 0.375519541; 0.376115439 0.83; 0.83 0.679292964 0.679292964 218 0.375519541; 0.376115439 0.83; 0.83 0.675599569 0.675599569 219 0.375519541; 0.376115439; 0.375519541; 0.376115439 8.82; 8.82; 8.82; 8.82 0.631496413 0.631496413 220 0.375519541; 0.376115439; 0.375519541; 0.376115439 8.82; 8.82; 8.82; 8.82 0.624545129 0.624545129 221 0.375519541; 0.376115439 7.69; 7.69 0.686983289 0.686983289 222 0.375519541; 0.376115439 7.69; 7.69 0.655999636 0.655999636 223 0.375519541; 0.376115439; 0.375519541; 0.376115439 6.25; 12.5; 6.25; 12.5 0.70992284 0.70992284 224 0.375519541; 0.376115439; 0.375519541; 0.376115439 6.25; 12.5; 6.25; 12.5 0.685092872 0.685092872 225 0.375519541; 0.376115439 10; 3.33 0.579134595 0.579134595 226 0.375519541; 0.376115439 10; 3.33 0.525435803 0.525435803 227 0.375519541; 0.376115439; 0.375519541; 0.376115439 2.42; 2.42; 2.68; 2.68 0.583374913 0.583374913 228 0.375519541; 0.376115439; 0.375519541; 0.376115439 2.42; 2.42; 2.68; 2.68 0.546729205 0.546729205 229 0.375519541; 0.376115439 7.02; 3.51 1.050848942 1.050848942 230 0.375519541; 0.376115439 7.02; 3.51 0.997588794 0.997588794 231 0.375519541; 0.217379602 13.33; 16.67 0.718226025 0.718226025 232 0.375519541; 0.217379602 13.33; 16.67 0.518370475 0.518370475 233 0.375519541; 0.376115439 4.41; 5.88 0.587276619 0.587276619 234 0.375519541; 0.376115439 4.41; 5.88 0.553712202 0.553712202 235 NA NA 0.528734129 0.528734129 236 NA NA 0.519765114 0.519765114 237 0.375519541; 0.376115439 2.56; 5.13 0.657404682 0.657404682 238 0.375519541; 0.376115439 2.56; 5.13 0.652559324 0.652559324 239 0.375519541; 0.376115439 10; 10 0.615586809 0.615586809 240 0.375519541; 0.376115439 10; 10 0.562580238 0.562580238 241 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.755371177 0.755371177 242 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.610723495 0.610723495 243 0.375519541; 0.376115439 5; 10 0.726687643 0.726687643 244 0.375519541; 0.376115439 5; 10 0.684934753 0.684934753 245 0.375519541; 0.376115439; 0.375519541; 0.376115439 7.69; 7.69; 5.56; 8.33 0.592746388 0.592746388 05 03 25 246 0.375519541; 0.376115439; 0.375519541; 0.376115439 7.69; 7.69; 5.56; 8.33 0.50869677 0.50869677 247 0.375519541; 0.376115439; 0.375519541; 0.376115439 3.57; 7.14; 3.57; 7.14 0.57957564 0.57957564 248 0.375519541; 0.376115439; 0.375519541; 0.376115439 3.57; 7.14; 3.57; 7.14 0.569686123 0.569686123 249 0.375519541; 0.376115439; 0.375519541; 0.376115439 14.29; 14.29; 8.33; 8.33 0.731224565 0.731224565 250 0.375519541; 0.376115439; 0.375519541; 0.376115439 14.29; 14.29; 8.33; 8.33 0.634525197 0.634525197 251 0.375519541; 0.376115439 9.09; 6.82 0.60784154 0.60784154 252 0.375519541; 0.376115439 9.09; 6.82 0.521330725 0.521330725 253 0.375519541; 0.376115439 6.67; 6.67 0.913741587 0.913741587 254 0.375519541; 0.376115439 6.67; 6.67 0.742478856 0.742478856 255 0.375519541; 0.376115439; 0.375519541; 0.376115439 1.92; 1.92; 1.14; 1.14 0.968228342 0.968228342 256 0.375519541; 0.376115439; 0.375519541; 0.376115439 1.92; 1.92; 1.14; 1.14 0.860213569 0.860213569 257 0.375519541; 0.376115439; 0.375519541; 0.376115439 1.23; 2.47; 1.41; 2.82 0.63321845 0.63321845 258 0.375519541; 0.376115439; 0.375519541; 0.376115439 1.23; 2.47; 1.41; 2.82 0.620644012 0.620644012 259 0.375519541; 0.376115439 4.88; 4.88 0.687605502 0.687605502 260 0.375519541; 0.376115439 4.88; 4.88 0.672032414 0.672032414 261 0.375519541; 0.376115439 11.11; 11.11 0.727600901 0.727600901 262 0.375519541; 0.376115439 11.11; 11.11 0.657100455 0.657100455 263 0.375519541; 0.376115439 33.33; 33.33 0.716018427 0.716018427 264 0.375519541; 0.376115439 33.33; 33.33 0.648215413 0.648215413 265 0; 0.082088441 100; 100 0.608572853 0.608572853 266 0; 0.082088441 100; 100 0.581521773 0.581521773 267 0.242080288; 0.376115439 13.33; 2.22 0.784915067 0.784915067 268 0.242080288; 0.376115439 13.33; 2.22 0.643748555 0.643748555 269 0.357678624; 0.013656923; 0.357678624; 0.013656923; 0.375519541; 0.376115439; 0.375519541; 0.376115439 13.51; 21.62; 13.51; 21.62; 6.25; 12.5; 5; 7.5 0.732003297 0.732003297 270 0.357678624; 0.013656923; 0.357678624; 0.013656923; 0.375519541; 0.376115439; 0.375519541; 0.376115439 13.51; 21.62; 13.51; 21.62; 6.25; 12.5; 5; 7.5 0.59203768 0.59203768 271 0.375519541; 0.376115439 1.96; 1.96 0.837432144 0.837432144 272 0.375519541; 0.376115439 1.96; 1.96 0.75493067 0.75493067 273 0.375519541; 0.376115439 10.42; 8.33 0.78755073 0.78755073 274 0.375519541; 0.376115439 10.42; 8.33 0.702870259 0.702870259 275 NA NA 1.046784237 1.046784237 276 NA NA 0.973096611 0.973096611 277 0.375519541; 0.376115439 11.43; 5.71 0.623032467 0.623032467 278 0.375519541; 0.376115439 11.43; 5.71 0.513312306 0.513312306 279 0.375519541; 0.376115439 4.88; 2.44 0.715626316 0.715626316 280 0.375519541; 0.376115439 4.88; 2.44 0.653108277 0.653108277 281 0.375519541; 0.376115439; 0.375519541; 0.376115439 1.56; 1.56; 2.22; 2.22 0.542949491 0.542949491 282 0.375519541; 0.376115439; 0.375519541; 0.376115439 1.56; 1.56; 2.22; 2.22 0.541851946 0.541851946 283 0.375519541; 0.376115439 8.33; 16.67 0.64477187 0.64477187 284 0.375519541; 0.376115439 8.33; 16.67 0.525770097 0.525770097 285 0.375519541; 0.376115439; 0.375519541; 0.376115439 7.69; 7.69; 15.38; 23.08 0.711747903 0.711747903 286 0.375519541; 0.376115439; 0.375519541; 0.376115439 7.69; 7.69; 15.38; 23.08 0.691863386 0.691863386 Table l.d3 t P.Value adj.P.Val B FC FC_1 LS 213 7.260165345 0.0000103 0.00032205 3.676586181 1.46994844 1.46994844 1 214 5.339439015 0.000177541 0.001246386 0.664445729 1.406954763 1.406954763 1 215 16.23202167 0.00000000169 0.00000233 12.26654232 1.978238447 1.978238447 1 216 14.18093827 0.00000000751 0.00000251 10.90523174 1.872198837 1.872198837 1 217 11.80434759 0.0000000613 0.0000138 8.841672429 1.601354771 1.601354771 1 218 12.02061316 0.0000000482 0.00000654 9.072614972 1.597260439 1.597260439 1 219 10.02330272 0.000000354 0.0000209 7.064564936 1.549171014 1.549171014 1 220 9.704432552 0.000000517 0.0000497 6.719924741 1.541724654 1.541724654 1 221 19.221459 0.000000000240 0.00000103 14.01108919 1.609913627 1.609913627 1 05 03 25 222 11.9389033 0.000000052 0.00000676 8.996907807 1.575707374 1.575707374 1 223 18.5672982 0.000000000359 0.00000126 13.66014624 1.635716631 1.635716631 1 224 15.02118219 0.00000000390 0.00000178 11.53971631 1.607805479 1.607805479 1 225 10.45337524 0.000000232 0.0000309 7.522312852 1.493952827 1.493952827 1 226 5.727638406 0.0000955 0.000800788 1.305056222 1.439368313 1.439368313 1 227 13.09171547 0.0000000185 0.00000396 10.02014744 1.49835026 1.49835026 1 228 15.57027442 0.00000000272 0.00000287 11.82659932 1.460770165 1.460770165 1 229 17.46312676 0.000000000729 0.00000168 13.03019046 2.071748592 2.071748592 1 230 19.47078279 0.000000000195 0.000000498 14.33533501 1.996660151 1.996660151 1 231 10.18859459 0.000000306 0.0000364 7.244811857 1.645157862 1.645157862 1 232 7.424246798 0.00000808 0.000150679 3.857176398 1.432336509 1.432336509 1 233 9.162816338 0.000000951 0.0000719 6.104525201 1.502407967 1.502407967 1 234 9.514869484 0.000000619 0.0000296 6.495454048 1.467857789 1.467857789 1 235 9.57959508 0.000000576 0.0000283 6.569345699 1.442662798 1.442662798 1 236 5.872975811 0.0000773 0.001227022 1.607969852 1.433721804 1.433721804 1 237 12.8429881 0.000000024 0.00000869 9.757379266 1.577242709 1.577242709 1 238 14.62271022 0.00000000530 0.00000212 11.24377521 1.571954352 1.571954352 1 239 2.726005115 0.018424033 0.04224655 -4.03847984 1.532181078 1.532181078 1 240 9.344586893 0.000000773 0.0000634 6.314497427 1.476908285 1.476908285 1 241 5.878256372 0.0000766 0.001219955 1.616360692 1.688065842 1.688065842 1 242 6.610580495 0.0000252 0.000320602 2.6830041 1.527024802 1.527024802 1 243 15.96846986 0.00000000204 0.00000251 12.09392263 1.654835306 1.654835306 1 244 12.97764894 0.0000000205 0.00000415 9.92304991 1.607629273 1.607629273 1 245 14.16069263 0.00000000799 0.00000491 10.81250789 1.508114941 1.508114941 1 246 10.13226105 0.000000315 0.0000195 7.183226122 1.422764389 1.422764389 1 247 12.12472668 0.0000000455 0.000012 9.132672207 1.494409613 1.494409613 1 248 6.558598076 0.0000272 0.000336042 2.604916707 1.484200628 1.484200628 1 249 14.28865646 0.00000000721 0.00000475 10.90919894 1.660047548 1.660047548 1 250 12.23181776 0.0000000397 0.00000589 9.265978503 1.552426749 1.552426749 1 251 9.36635516 0.000000732 0.000033 6.324274905 1.523977434 1.523977434 1 252 9.435204652 0.000000697 0.0000594 6.417862317 1.435278522 1.435278522 1 253 13.53412308 0.0000000133 0.00000636 10.3246933 1.883925072 1.883925072 1 254 13.06000286 0.0000000191 0.000004 9.993240024 1.673048022 1.673048022 1 255 9.932830648 0.000000403 0.0000425 6.970408871 1.956436576 1.956436576 1 256 11.97244336 0.0000000504 0.00000668 9.028045246 1.815307019 1.815307019 1 257 13.38530727 0.0000000151 0.00000688 10.20520537 1.551021248 1.551021248 1 258 16.21810555 0.00000000162 0.00000118 12.3786542 1.537561388 1.537561388 1 259 13.08809821 0.0000000194 0.00000782 9.96222989 1.610608109 1.610608109 1 260 17.49673479 0.000000000675 0.000000801 13.19969713 1.59331599 1.59331599 1 261 11.3234876 0.0000000934 0.00000943 8.40997782 1.655883186 1.655883186 1 262 10.33956834 0.000000261 0.0000331 7.403844592 1.576910145 1.576910145 1 263 13.37427123 0.0000000146 0.00000347 10.25695904 1.642642382 1.642642382 1 264 10.50748087 0.000000219 0.00003 7.578213938 1.567228364 1.567228364 1 265 13.60186555 0.000000012 0.00000309 10.44395365 1.524750145 1.524750145 1 266 11.90195534 0.0000000559 0.0000134 8.931166808 1.496426866 1.496426866 1 267 11.22011494 0.000000107 0.0000193 8.290092068 1.722990882 1.722990882 1 268 9.919790976 0.000000396 0.0000224 6.95077435 1.562383432 1.562383432 1 269 11.68690688 0.0000000684 0.0000148 8.73300385 1.660943844 1.660943844 1 270 12.30985713 0.000000037 0.00000569 9.336589654 1.507374278 1.507374278 1 271 14.15860604 0.000000008 0.00000491 10.81092318 1.786866862 1.786866862 1 272 17.42726451 0.000000000707 0.000000818 13.15692781 1.687550493 1.687550493 1 273 11.35923764 0.0000000902 0.00000925 8.44490275 1.726141495 1.726141495 1 274 15.50537662 0.00000000285 0.00000294 11.7822691 1.627739982 1.627739982 1 275 6.671069956 0.0000235 0.000553643 2.831017554 2.065919783 2.065919783 1 276 9.939739376 0.000000387 0.000022 6.972784712 1.96304958 1.96304958 1 277 10.48658633 0.000000224 0.0000303 7.556657964 1.540109008 1.540109008 1 278 10.6808888 0.000000177 0.0000139 7.763842221 1.427323451 1.427323451 1 279 16.7420602 0.00000000112 0.000000998 12.72395428 1.642195988 1.642195988 1 280 17.0717273 0.000000000946 0.00000189 12.79475608 1.572552603 1.572552603 1 281 11.71698674 0.0000000665 0.0000146 8.760940678 1.456948105 1.456948105 1 282 19.31548313 0.000000000214 0.000000503 14.25125578 1.455840138 1.455840138 1 283 10.21192721 0.000000289 0.0000186 7.269270408 1.563492036 1.563492036 1 284 11.53933542 0.0000000787 0.0000162 8.59489991 1.439701874 1.439701874 1 285 11.4882289 0.0000000797 0.00000864 8.57005061 1.637787183 1.637787183 1 286 12.53535025 0.0000000314 0.00000988 9.494366239 1.615368583 1.615368583 1 Table l.d4 05 03 25 Probe sequence Probe Location Loop Detected 60 mer Chr 213 mHC TTTGTGTTTCATGACCTGCTAAATACTTTCGAAAGTATTTAGCAGGTCATGAAACACAAA 14 214 sHC TTTGTGTTTCATGACCTGCTAAATACTTTCGAAAGTATTTAGCAGGTCATGAAACACAAA 14 215 mHC TTATATCATTATTTTATAATGTATTCCTTCGAAATAAGCACTTAGGAAGTTTGAGTAAAT 3 216 sHC TTATATCATTATTTTATAATGTATTCCTTCGAAATAAGCACTTAGGAAGTTTGAGTAAAT 3 217 mHC TCTGTCATCTTCTTACGTATTAACATTATCGAATATTTGTGATTTGAAATTTGTCCTGGT 7 218 sHC TCTGTCATCTTCTTACGTATTAACATTATCGAATATTTGTGATTTGAAATTTGTCCTGGT 7 219 sHC IIICIIGTA1 1 1C A1 TATGTACATCTATTCGATAAAAC1 1 1 1 1 1 1C1ATAGTTCTCTG AC 6 220 mHC 1......1......ICI.....1G 1A1.......1.......rCATTATGTACATCTATTCGATAAAAC 1 1 Illi ICIATAGTTCTCTGAC 6 221 mHC GTTTCATTTCATATTTTCACAAAAG ATCTCG AATTATGTG CAGTACTACAATAGTAATG G 18 222 sHC GTTTCATTTCATATTTTCACAAAAG ATCTCG AATTATGTG CAGTACTACAATAGTAATG G 18 223 mHC AACATATATAAGCI 1 1 1 1ACTTAAAAGTTCGATAATACTGTATTGTAGTCAGAATGTTTG 5 224 sHC AACATATATAAGCI 1 1 1 1ACTTAAAAGTTCGATAATACTGTATTGTAGTCAGAATGTTTG 5 225 mHC CACTTAACAATATAATGTATAAATCTCCTCGAAGAAAATGCTGAAGAATATCTTAATGAC 5 226 sHC CACTTAACAATATAATGTATAAATCTCCTCGAAGAAAATGCTGAAGAATATCTTAATGAC 5 227 sHC TGGTAAATTGGAGCAGGTGACCTGGGAGTCGAGGCAGCTGCAGGATTTAAATTGGCTGAG 1 228 mHC TGGTAAATTGGAGCAGGTGACCTGGGAGTCGAGGCAGCTGCAGGATTTAAATTGGCTGAG 1 229 mHC CAAAGTACTACTTTAATTTATGACATAATCGAACACAGAAGTATTTATCTGAAAAGTGGA 2 230 sHC CAAAGTACTACTTTAATTTATGACATAATCGAACACAGAAGTATTTATCTGAAAAGTGGA 2 231 mHC TTTAAAATTGTTGACAGAAAATATATTATCGACATATATTTACCTACATAGAAGAGTATG 3 232 sHC TTTAAAATTGTTGACAGAAAATATATTATCGACATATATTTACCTACATAGAAGAGTATG 3 233 mHC ATATGATTATGGTTATAACTAAACTATATCGAACTTACTTCATTAACCTTAAAAAATACA 4 234 sHC ATATGATTATGGTTATAACTAAACTATATCGAACTTACTTCATTAACCTTAAAAAATACA 4 235 sHC TATCTAGATGTAGGTATATATTTATCTATCGACTTTCAAGCAAAGAAAATGCAAATATGC 5 236 mHC TATCTAGATGTAGGTATATATTTATCTATCGACTTTCAAGCAAAGAAAATGCAAATATGC 5 237 mHC CTGGAAGCCTTACAGATGACATAAACAATCGAATAAATAATGGAGCTAAATGGCATATAT 8 238 sHC CTGGAAGCCTTACAGATGACATAAACAATCGAATAAATAATGGAGCTAAATGGCATATAT 8 239 sHC CTAATTTCA1 1 1C1 1 1 11 AG 111CC1CTTCGATACCTTGAATTATAATACTTGTTCTGAT 8 240 mHC CTAATTTCA111C1 1 1 1 1AGTTTCCTCTTCGATACCTTGAATTATAATACTTGTTCTGAT 8 241 mHC CCACGGAGGGGTCCTTCTGAACTGCAATTCGAGGTTCAGCACCGTAGGTGTAGCGCAGGC 9 242 sHC CCACGGAGGGGTCCTTCTGAACTGCAATTCGAGGTTCAGCACCGTAGGTGTAGCGCAGGC 9 243 mHC TTCAATTGTACTGTTAATA1 1 1 1A1 1 1CTCGAATAAATAATCCTC1 1U 1 1 1 CC 1C1 1 1C 5 244 sHC TTCAATTGTACTGTTAATA1 1 1 1A1 1 1 CTCGAATAAATAATCCTC 1 1C1 1 1 1 CC 1C1 1 1C 5 245 mHC ATATGTAGATATATGTTTTCAAGCAATATCGAAGAGTAGTACCTTATCAAAGCTTTGCAG 14 246 sHC ATATGTAGATATATGTTTTCAAGCAATATCGAAGAGTAGTACCTTATCAAAGCTTTGCAG 14 247 mHC AATAGTATAATTAAAATAGTAAAGAAAATCGATATACCATAGGTGTATAGTAGGTTATGC 6 248 sHC AATAGTATAATTAAAATAGTAAAGAAAATCGATATACCATAGGTGTATAGTAGGTTATGC 6 249 mHC GTACATTTAATGAAACTACTAAAATATTTCGAATAGAAATACAATGCCAGACACATAAGT 19 250 sHC GTACATTTAATGAAACTACTAAAATATTTCGAATAGAAATACAATGCCAGACACATAAGT 19 251 sHC GATGATCAACATTCATTGAGAATGAAAATCGATTTATAACAAAAATAAACACTGTAGAAA 1 252 mHC GATGATCAACATTCATTGAGAATGAAAATCGATTTATAACAAAAATAAACACTGTAGAAA 1 253 mHC TTACTCACTTATTAGTCTATTAAGATTTTCGATATAAAACTTATAAATGG 1 1 1A1 1 1C1G 7 254 sHC TTACTCACTTATTAGTCTATTAAGATTTTCGATATAAAACTTATAAATGG 1 1 1A1 1 1C1G 7 255 mHC ACATATATATATATATATTTAATATACATCGATAGATAATTGTCTTCCAGAATATTTTAA 12 256 sHC ACATATATATATATATATTTAATATACATCGATAGATAATTGTCTTCCAGAATATTTTAA 12 257 mHC AATTAGTAIIIAIIIIIICIAIIIIAITTCGAATGAATGTAACAGGAAAGCAGAAAAGCA 14 258 sHC AATTAGTA IIIAIIIIIICIAIIIIA ITTCGAATGAATGTAACAGGAAAGCAGAAAAGCA 14 259 mHC TTATTATAAATAAGTGTATATGTGAAATTCGATGTGTTTCTA1 1 1 1 1AAAACCTCTTAAC 1 260 sHC TTATTATAAATAAGTGTATATGTGAAATTCGATGTG 1 1 1C1A1 1 1 1 1 AAAACCTCTTAAC 1 261 sHC CCTTTCAAATTTAGATTTAAAATCTATTTCGATGCTACTAAAAGCAGCAATAATACTTTC 1 262 mHC CCTTTCAAATTTAGATTTAAAATCTATTTCGATGCTACTAAAAGCAGCAATAATACTTTC 1 263 sHC 1 1 IAAACTAI 1 1 1 IAAAAGAGTACI 1 1 1 1CGACTTGGTACAAAATCAAAGTAAGAAGTAT 11 264 mHC 1 1 IAAACTAI 1 1 1 IAAAAGAGTACI 1 1 1 1CGACTTGGTACAAAATCAAAGTAAGAAGTAT 11 265 sHC CTATATTGTAGCTCTA11 1 1CILIAAATTCGAAGAATCATGCCTTAATGGATTGAAACAA 2 266 mHC CTATATTGTAGCTCTA11 1 1CICIAAATTCGAAGAATCATGCCTTAATGGATTGAAACAA 2 267 mHC 1111 IAI 1 1 1AICI 1 1 1 Al 1 1 IAI11 11ICGAATTCATG1 1 1 1 1 ICICI IGGAAI 1 1 ICI 21 268 sHC 1111 IAI 1 1 1AICI 1 1 1 Al 1 1 IAI11 11ICGAATTCATG1 1 1 1 1 ICICI IGGAAI 1 1 ICI 21 269 mHC CCTACCAGAACTCTTAAATCTATAATATTCGAAATTTTATTATCTTAGGTGAGAAAATAG 4 270 sHC CCTACCAGAACTCTTAAATCTATAATATTCGAAATTTTATTATCTTAGGTGAGAAAATAG 4 271 mHC GTAACTACTACA Illi AGTATA11 1C11 1CGATCAGAAGTTAACTCTAATTGAATCATAG 7 272 sHC GTAACTACTACA Illi AGTATA 11 1C11 1CGATCAGAAGTTAACTCTAATTGAATCATAG 7 273 sHC TATCTCTATGTAATAATCACTAAAAGTATCGATTCATGCTTGGTTGAATCAGACAATGTC 8 274 mHC TATCTCTATGTAATAATCACTAAAAGTATCGATTCATGCTTGGTTGAATCAGACAATGTC 8 275 mHC ATCTCATTTAACAAAAGATGAGTAAAAATCGA1 1 1 1 1 1AACGAATGTATCTGAAAATAGC 8 276 sHC ATCTCAI 1 IAACAAAAGATGAGTAAAAATCGAI 1 1 1 1 1 AACGAATGTATCTGAAAATAGC 8 277 mHC TCGC1 1 1 1L1 1ATATAAAGGAACA1 11C1CGAGTGGTAATGTACCAATCATTCATTGATT 2 278 sHC TCGC1 1 1 1C1 1A1ATAAAGGAACA HILI CGAGTGGTAATGTACCAATCATTCATTGATT 2 279 sHC TTCTCATG 1 1 1C1 1 1 1 1C1GACTAAATGTCGATTGAGATATAATTGACATAATAAATTAC 3 280 mHC TTCTCATG 1 1 1C1 1 1 1 1C1GACTAAATGTCGATTGAGATATAATTGACATAATAAATTAC 3 281 mHC TCTGTGATTAATGGATAAATGTGATATATCGACAGCATTTACTATTCATGTTACTTCATT 8 282 sHC TCTGTGATTAATGGATAAATGTGATATATCGACAGCATTTACTATTCATGTTACTTCATT 8 283 sHC TTTATTTACCTTCTTGTATGAATATTGATCGAATCTCAACATCCTTAACATAGTTACATC 8 284 mHC TTTATTTACCTTCTTGTATGAATATTGATCGAATCTCAACATCCTTAACATAGTTACATC 8 285 sHC ATATGCI 1 1 1 1 1 IAAATTACAAAACTTATCGATCAI 1 1 1 1 1 AAATTTAAAACTCTGAAGC 12 286 mHC ATATGCI 1 1 1 1 1 IAAATTACAAAACTTATCGATCAI 1 1 1 1 1 AAATTTAAAACTCTGAAGC 12 Table l.d5 05 03 25 Probe Location 4 kb Sequence Location Startl Endl Start2 End2 Chr Startl Endl Start2 End2 213 106693397 106693428 106739902 106739933 14 106693397 106697398 106739902 106743903 214 106693397 106693428 106739902 106739933 14 106693397 106697398 106739902 106743903 215 65839372 65839403 65903659 65903690 3 65835402 65839403 65899689 65903690 216 65839372 65839403 65903659 65903690 3 65835402 65839403 65899689 65903690 217 131130568 131130599 131219450 131219481 7 131130568 131134569 131219450 131223451 218 131130568 131130599 131219450 131219481 7 131130568 131134569 131219450 131223451 219 73690117 73690148 73758266 73758297 6 73686147 73690148 73754296 73758297 220 73690117 73690148 73758266 73758297 6 73686147 73690148 73754296 73758297 221 3106299 3106330 3129940 3129971 18 3106299 3110300 3129940 3133941 222 3106299 3106330 3129940 3129971 18 3106299 3110300 3129940 3133941 223 36141976 36142007 36164938 36164969 5 36138006 36142007 36160968 36164969 224 36141976 36142007 36164938 36164969 5 36138006 36142007 36160968 36164969 225 26999889 26999920 27044575 27044606 5 26999889 27003890 27040605 27044606 226 26999889 26999920 27044575 27044606 5 26999889 27003890 27040605 27044606 227 36409666 36409697 36433268 36433299 1 36409666 36413667 36433268 36437269 228 36409666 36409697 36433268 36433299 1 36409666 36413667 36433268 36437269 229 66448986 66449017 66470757 66470788 2 66445016 66449017 66470757 66474758 230 66448986 66449017 66470757 66470788 2 66445016 66449017 66470757 66474758 231 107626100 107626131 107708851 107708882 3 107626100 107630101 107708851 107712852 232 107626100 107626131 107708851 107708882 3 107626100 107630101 107708851 107712852 233 175829279 175829310 175892267 175892298 4 175829279 175833280 175892267 175896268 234 175829279 175829310 175892267 175892298 4 175829279 175833280 175892267 175896268 235 6226839 6226870 6283431 6283462 5 6222869 6226870 6283431 6287432 236 6226839 6226870 6283431 6283462 5 6222869 6226870 6283431 6287432 237 52380368 52380399 52462030 52462061 8 52380368 52384369 52462030 52466031 238 52380368 52380399 52462030 52462061 8 52380368 52384369 52462030 52466031 239 67971637 67971668 68010294 68010325 8 67971637 67975638 68010294 68014295 240 67971637 67971668 68010294 68010325 8 67971637 67975638 68010294 68014295 241 38686830 38686861 38768696 38768727 9 38682860 38686861 38768696 38772697 242 38686830 38686861 38768696 38768727 9 38682860 38686861 38768696 38772697 243 93565548 93565579 93583739 93583770 5 93561578 93565579 93579769 93583770 244 93565548 93565579 93583739 93583770 5 93561578 93565579 93579769 93583770 245 51804670 51804701 51892245 51892276 14 51804670 51808671 51888275 51892276 246 51804670 51804701 51892245 51892276 14 51804670 51808671 51888275 51892276 247 146094504 146094535 146155392 146155423 6 146094504 146098505 146155392 146159393 248 146094504 146094535 146155392 146155423 6 146094504 146098505 146155392 146159393 05 03 25 249 36776229 36776260 36803032 36803063 19 36772259 36776260 36803032 36807033 250 36776229 36776260 36803032 36803063 19 36772259 36776260 36803032 36807033 251 229859020 229859051 229911260 229911291 1 229859020 229863021 229907290 229911291 252 229859020 229859051 229911260 229911291 1 229859020 229863021 229907290 229911291 253 45370280 45370311 45391022 45391053 7 45366310 45370311 45387052 45391053 254 45370280 45370311 45391022 45391053 7 45366310 45370311 45387052 45391053 255 130198001 130198032 130252465 130252496 12 130194031 130198032 130248495 130252496 256 130198001 130198032 130252465 130252496 12 130194031 130198032 130248495 130252496 257 89880613 89880644 89952946 89952977 14 89880613 89884614 89952946 89956947 258 89880613 89880644 89952946 89952977 14 89880613 89884614 89952946 89956947 259 206310392 206310423 206385274 206385305 1 206306422 206310423 206381304 206385305 260 206310392 206310423 206385274 206385305 1 206306422 206310423 206381304 206385305 261 76098903 76098934 76127632 76127663 1 76094933 76098934 76123662 76127663 262 76098903 76098934 76127632 76127663 1 76094933 76098934 76123662 76127663 263 128978278 128978309 129021767 129021798 11 128974308 128978309 129021767 129025768 264 128978278 128978309 129021767 129021798 11 128974308 128978309 129021767 129025768 265 78765418 78765449 78798531 78798562 2 78761448 78765449 78794561 78798562 266 78765418 78765449 78798531 78798562 2 78761448 78765449 78794561 78798562 267 17393292 17393323 17434190 17434221 21 17393292 17397293 17434190 17438191 268 17393292 17393323 17434190 17434221 21 17393292 17397293 17434190 17438191 269 37862801 37862832 37933142 37933173 4 37858831 37862832 37929172 37933173 270 37862801 37862832 37933142 37933173 4 37858831 37862832 37929172 37933173 271 23192048 23192079 23219086 23219117 7 23188078 23192079 23219086 23223087 272 23192048 23192079 23219086 23219117 7 23188078 23192079 23219086 23223087 273 65562483 65562514 65630980 65631011 8 65558513 65562514 65630980 65634981 274 65562483 65562514 65630980 65631011 8 65558513 65562514 65630980 65634981 275 88542085 88542116 88597081 88597112 8 88542085 88546086 88593111 88597112 276 88542085 88542116 88597081 88597112 8 88542085 88546086 88593111 88597112 277 56329605 56329636 56394093 56394124 2 56325635 56329636 56390123 56394124 278 56329605 56329636 56394093 56394124 2 56325635 56329636 56390123 56394124 279 63282250 63282281 63308360 63308391 3 63278280 63282281 63308360 63312361 280 63282250 63282281 63308360 63308391 3 63278280 63282281 63308360 63312361 281 27764811 27764842 27800700 27800731 8 27764811 27768812 27796730 27800731 282 27764811 27764842 27800700 27800731 8 27764811 27768812 27796730 27800731 283 113413840 113413871 113446051 113446082 8 113409870 113413871 113442081 113446082 284 113413840 113413871 113446051 113446082 8 113409870 113413871 113442081 113446082 285 96187243 96187274 96241318 96241349 12 96187243 96191244 96237348 96241349 286 96187243 96187274 96241318 96241349 12 96187243 96191244 96237348 96241349 Table l.d6 Probe PCR- Primerl_ID PCR_Primerl 21 ORF152 14 106693397 106698909 106739902 106745380 OBD159_41 3 RR 7 TTATGCCCCACCTTCTTCAGTGTAAT 21 ORF152 14 106693397 106698909 106739902 106745380 OBD159_41 4 RR 7 TTATGCCCCACCTTCTTCAGTGTAAT 21 OBD159_42 5 ORF153_3_65835051_65839403_65898255_65903690_FF 1 ACCTACTGTG CTG CCAGACATAG AAA 21 OBD159_42 6 ORF153_3_65835051_65839403_65898255_65903690_FF 1 ACCTACTGTG CTG CCAGACATAG AAA 21 ORF153 7 131130568 131132000 131219450 131221740 R OBD159_42 7 R 5 TCCCTTGAAAACCTGTGTCCAATGAC 21 ORF153 7 131130568 131132000 131219450 131221740 R OBD159_42 8 R 5 TCCCTTGAAAACCTGTGTCCAATGAC 21 OBD159_42 9 ORF154_6_73688989_73690148_73751804_73758297_FF 9 1 LAb 1 b 1 1 1 bb Illi LUU 1 1 bAA 1 22 OBD159_42 0 ORF154_6_73688989_73690148_73751804_73758297_FF 9 1 LAb 1 b 1 1 1 bb Illi LUU 1 1 bAA 1 22 OBD159_43 1 ORF155_18_3106299_3108561_3129940_3131675_RR 3 AG GTTGAAGTTGAAACACAGATGT 05 03 25 22 2 ORF155_18_3106299_3108561_3129940_3131675_RR OBD159_43 3 AG GTTGAAGTTGAAACACAGATGT 22 OBD159_43 3 ORF155_5_36136424_36142007_36160830_36164969_FF 7 IlliIAAIAGIGCIICAAA 22 OBD159_43 4 ORF155_5_36136424_36142007_36160830_36164969_FF 7 Illi IAAIAGIGCIICAAA 22 OBD159_44 CTCTTTTATTTACCACTCCATTCTTCC 5 ORF158_5_26999889_27004744_27042244_27044606_RF 1 A 22 OBD159_44 CTCTTTTATTTACCACTCCATTCTTCC 6 ORF158_5_26999889_27004744_27042244_27044606_RF 1 A 22 OBD159_16 7 ORF16_1_364O9666_36411937_36433268_36434547_RR 5 GAAGCGAGTTGCTGTCACTGGAG 22 OBD159_16 8 ORF16_1_364O9666_36411937_36433268_36434547_RR 5 GAAGCGAGTTGCTGTCACTGGAG 22 OBD159_44 CCACTGTCAGGGAAATAGTTGAAGG 9 ORF16_2_66446190_66449017_66470757_66475654_FR 5 A 23 OBD159_44 CCACTGTCAGGGAAATAGTTGAAGG 0 ORF16_2_66446190_66449017_66470757_66475654_FR 5 A 23 OBD159_44 CAGAAAAGCCCAGGAAGGTATCAGA 1 ORF16_3_107626100_107637571_107708851_107713617_RR 9 T 23 OBD159_44 CAGAAAAGCCCAGGAAGGTATCAGA 2 ORF16_3_107626100_107637571_107708851_107713617_RR 9 T 23 OBD159_45 3 ORF16_4_175829279_175833051_175892267_175894404_RR 3 CCACTGACTTCACTGTTTAA 23 OBD159_45 4 ORF16_4_175829279_175833051_175892267_175894404_RR 3 CCACTGACTTCACTGTTTAA 23 OBD159_45 5 ORF16_5_6223946_6226870_6283431_6289065_FR 7 CTGTTCTCAGCAATGGAATCTCAGGT 23 OBD159_45 6 ORF16_5_6223946_6226870_6283431_6289065_FR 7 CTGTTCTCAGCAATGGAATCTCAGGT 23 OBD159_46 AGGGAGAGGAGACAGATGTTCTTTC 7 ORF16_8_52380368_52388099_52462030_52466077_RR 1 T 23 OBD159_46 AGGGAGAGGAGACAGATGTTCTTTC 8 ORF16_8_52380368_52388099_52462030_52466077_RR 1 T 23 OBD159_46 9 ORF16_8_67971637_67976278_68010294_68014710_RR 5 CACTGTTGTCTTATTGCCTTGCTCAG 24 OBD159_46 0 ORF16_8_67971637_67976278_68010294_68014710_RR 5 CACTGTTGTCTTATTGCCTTGCTCAG 24 OBD159_46 1 ORF16_9_38681931_38686861_38768696_38769724_FR 9 CAGAAGTTCACAGGCAGGGTGTC 24 OBD159_46 2 ORF16_9_38681931_38686861_38768696_38769724_FR 9 CAGAAGTTCACAGGCAGGGTGTC 24 OBD159_47 3 ORF160_5_93562856_93565579_93582366_93583770_FF 3 ATG CCCAGTCATAG GTG ATAAG ATTA 24 OBD159_47 4 ORF160_5_93562856_93565579_93582366_93583770_FF 3 ATG CCCAGTCATAG GTG ATAAG ATTA 24 OBD159_47 5 ORF162_14_51804670_51807147_51886119_51892276_RF 7 GTTCCTCTTGCTCCACTTGTCAACAG 24 OBD159_47 6 ORF162_14_51804670_51807147_51886119_51892276_RF 7 GTTCCTCTTGCTCCACTTGTCAACAG 24 ORF162 6 146094504 146104695 146155392 146161780 R OBD159_48 CACATACACAG G GTAACCTAAG G AA 7 R 1 G 24 ORF162 6 146094504 146104695 146155392 146161780 R OBD159_48 CACATACACAG G GTAACCTAAG G AA 8 R 1 G 24 OBD159_48 9 ORF163_19_36775089_36776260_36803032_36806792_FR 5 ATGATAGGCACATACTCTCCTCTG 25 OBD159_48 0 ORF163_19_36775089_36776260_36803032_36806792_FR 5 ATGATAGGCACATACTCTCCTCTG 25 ORF164 1 229859020 229862315 229908605 229911291 R OBD159_48 1 F 9 TGTCATTTTCACACCATCCTCCCCAT 25 ORF164 1 229859020 229862315 229908605 229911291 R OBD159_48 2 F 9 TGTCATTTTCACACCATCCTCCCCAT 25 OBD159_49 3 ORF164_7_45364155_45370311_45384350_45391053_FF 3 GAGTTTGGAGGTGTTCTCTGCCCTTT 05 03 25 25 4 ORF164_7_45364155_45370311_45384350_45391053_FF OBD159_49 3 GAGTTTGGAGGTGTTCTCTGCCCTTT 25 ORF166 12 130196441 130198032 130248318 130252496 OBD159_49 5 FF 7 G CG G AG GG AG AGTCACGCAAG AT 25 ORF166 12 130196441 130198032 130248318 130252496 OBD159_49 6 FF 7 G CG G AG GG AG AGTCACGCAAG AT 25 OBD159_5O 7 ORF166_14_89880613_89884758_89952946_89954082_RR 1 ACCCAGGTGGTATGACTCCAGAG 25 OBD159_5O 8 ORF166_14_89880613_89884758_89952946_89954082_RR 1 ACCCAGGTGGTATGACTCCAGAG 25 OBD159_5O 9 ORF169_1_206307932_206310423_206383244_206385305_FF 5 G AGG CTCAG G CAACATCCTACTTTCA 26 OBD159_5O 0 ORF169_1_206307932_206310423_206383244_206385305_FF 5 G AGG CTCAG G CAACATCCTACTTTCA 26 OBD159_5O 1 ORF17_l_76086337_76098934_76123667_76127663_FF 9 C1 1 1ACIGG1G1C1 1 I IAIGAACAA 26 OBD159_5O 2 ORF17_1_76086337_76098934_76123667_76127663_FF 9 CTTTACTG GTGTCTTTTATG AACAA 26 ORF17 11 128975846 128978309 129021767 129026895 F OBD159_51 3 R 3 GCTGGTCTTGAACTCCTGGCTTC 26 ORF17 11 128975846 128978309 129021767 129026895 F OBD159_51 4 R 3 GCTGGTCTTGAACTCCTGGCTTC 26 OBD159_51 5 ORF17_2_78763526_78765449_78792347_78798562_FF 7 GAI 1 ICILAG 11IACAIAGIICAAA 26 OBD159_51 6 ORF17_2_78763526_78765449_78792347_78798562_FF 7 GAI 1 ICIGAG 11IACAIAGIICAAA 26 OBD159_52 TACCAG G GCTG AG GGTGTTGTCCTA 7 ORF17_21_17393292_17394472_1743419O_17435748_RR 1 T 26 OBD159_52 TACCAG G GCTG AG GGTGTTGTCCTA 8 ORF17_21_17393292_17394472_1743419O_17435748_RR 1 T 26 OBD159_52 9 ORF17_4_37859966_37862832_37927829_37933173_FF 5 ACCTAAATAGTTATGAACAGTTTC 27 OBD159_52 0 ORF17_4_37859966_37862832_37927829_37933173_FF 5 ACCTAAATAGTTATGAACAGTTTC 27 OBD159_52 1 ORF17_7_23187280_23192079_23219086_23222886_FR 9 AAGTCAAG G CG GCAGTGAGCCAC 27 OBD159_52 2 ORF17_7_23187280_23192079_23219086_23222886_FR 9 AAGTCAAG G CG GCAGTGAGCCAC 27 OBD159_53 3 ORF17_8_65560550_65562514_65630980_65632323_FR 3 CATTTCTCTGCTGCCATCTCGTGGAT 27 OBD159_53 4 ORF17_8_65560550_65562514_65630980_65632323_FR 3 CAI 1 1C1C1GC1GCCAICICGIGGA1 27 OBD159_53 5 ORF17_8_88542O85_88553888_88592759_88597112_RF 7 ACCTGACCAAACTTGAATAAATCA 27 OBD159_53 6 ORF17_8_88542O85_88553888_88592759_88597112_RF 7 ACCTGACCAAACTTGAATAAATCA 27 OBD159_54 CTGGAGAGGAGGAGTCTTGTTTGCT 7 ORF170_2_56323476_56329636_56390760_56394124_FF 1 T 27 OBD159_54 CTGGAGAGGAGGAGTCTTGTTTGCT 8 ORF170_2_56323476_56329636_56390760_56394124_FF 1 T 27 OBD159_54 9 ORF171_3_63280859_63282281_63308360_63313318_FR 5 AACTATTTTCACATCATCTTGTAAG 28 OBD159_54 0 ORF171_3_63280859_63282281_63308360_63313318_FR 5 AACTATTTTCACATCATCTTGTAAG 28 OBD159_54 1 ORF171_8_27764811_27768513_27798255_278OO731_RF 9 G GTGTG G AATACAATCTG ATGGTTTC 28 OBD159_54 2 ORF171_8_27764811_27768513_27798255_278OO731_RF 9 G GTGTG G AATACAATCTG ATGGTTTC 28 OBD159_55 3 ORF173_8_113409304_113413871_113438847_113446082_FF 3 AGTTCTCAACCTGTG GG ATGTATTAT 28 OBD159_55 4 ORF173_8_113409304_113413871_113438847_113446082_FF 3 AGTTCTCAACCTGTG GG ATGTATTAT 28 OBD159_55 5 ORF176_12_96187243_96188661_96237O99_96241349_RF 7 G G CTTTATGCCTG G GTCAGTTCTCCT 28 6 ORF176_12_96187243_96188661_96237O99_96241349_RF OBD159_55 7 G G CTTTATGCCTG G GTCAGTTCTCCT Table l.d7 05 03 25 PCR-Primer2_ID PCR_Primer2 Marker GLMNET 213 OBD159_419 TTATGCCCCACCTTCTTCAGGGTAAT OBD159_417_419 -0.00076144 214 OBD159_419 TTATGCCCCACCTTCTTCAGGGTAAT OBD159_417_419 -0.00076144 215 OBD159_423 CCAGGATAACAGCAATGCCTACTTCC OBD159_421_423 -0.001555895 216 OBD159_423 CCAGGATAACAGCAATGCCTACTTCC OBD159_421_423 -0.001555895 217 OBD159_427 ATTACCTCACCCTTCCTCCTGTGCTG OBD159_425_427 -0.002923934 218 OBD159_427 ATTACCTCACCCTTCCTCCTGTGCTG OBD159_425_427 -0.002923934 219 OBD159_431 TTGAATGGTGAGGTGCCTTGTTAT OBD159_429_431 -0.000485603 220 OBD159_431 TTGAATGGTGAGGTGCCTTGTTAT OBD159_429_431 -0.000485603 221 OBD159_435 AAGAAAACGAAGGAAGGAAGATTC OBD159_433_435 -0.00351129 222 OBD159_435 AAGAAAACGAAGGAAGGAAGATTC OBD159_433_435 -0.00351129 223 OBD159_439 TTATAACAAAATATCATG OBD159_437_439 -0.002029871 224 OBD159_439 TTATAACAAAATATCATG OBD159_437_439 -0.002029871 225 OBD159_443 AAAACTCATTGCCAAACCCAAGGTCAT OBD159_441_443 -0.002006752 226 OBD159_443 AAAACTCATTGCCAAACCCAAGGTCAT OBD159_441_443 -0.002006752 227 OBD159_167 CCCCAACACAAACTGTCCTCAGGC OBD159_165_167 -0.005793058 228 OBD159_167 CCCCAACACAAACTGTCCTCAGGC OBD159_165_167 -0.005793058 229 OBD159_447 ATCAATG CCTGTG AACTATG AAAAG C OBD159_445_447 -0.002760872 230 OBD159_447 ATCAATG CCTGTG AACTATG AAAAG C OBD159_445_447 -0.002760872 231 OBD159_451 CCCTCCAACTGCTTGCCTATCCTTTG OBD159_449_451 -0.002333999 232 OBD159_451 CCCTCCAACTGCTTGCCTATCCTTTG OBD159_449_451 -0.002333999 233 OBD159_455 TCAAATGTCCAATACTGTCTATC OBD159_453_455 -0.001769071 234 OBD159_455 TCAAATGTCCAATACTGTCTATC OBD159_453_455 -0.001769071 235 OBD159_459 TCCCTTCTCCTGATTTTCCCTGTGGA OBD159_457_459 -0.002314144 236 OBD159_459 TCCCTTCTCCTGATTTTCCCTGTGGA OBD159_457_459 -0.002314144 237 OBD159_463 CTTCAAGTCTGTTTGCCTATTATTGC OBD159_461_463 -0.002502897 238 OBD159_463 CTTCAAGTCTGTTTGCCTATTATTGC OBD159_461_463 -0.002502897 239 OBD159_467 CCCTTTCTCCTCCTCTCTGCTCCTAT OBD159_465_467 -0.001657289 240 OBD159_467 CCCTTTCTCCTCCTCTCTGCTCCTAT OBD159_465_467 -0.001657289 241 OBD159_471 GCTCCAGCACCGTATTTCGCCTG OBD159_469_471 -0.001827556 242 OBD159_471 GCTCCAGCACCGTATTTCGCCTG OBD159_469_471 -0.001827556 243 OBD159_475 GAAGCAGAAGAAGGAGCAAGAAAG OBD159_473_475 -0.003164542 244 OBD159_475 GAAGCAGAAGAAGGAGCAAGAAAG OBD159_473_475 -0.003164542 245 OBD159_479 GCTTCAGTAAATACCGCCAAACG OBD159_477_479 -0.003908131 246 OBD159_479 GCTTCAGTAAATACCGCCAAACG OBD159_477_479 -0.003908131 247 OBD159_483 CTGAAAAGATGCTCTGCTACTGGGTG OBD159_481_483 -0.000935051 248 OBD159_483 CTGAAAAGATGCTCTGCTACTGGGTG OBD159_481_483 -0.000935051 249 OBD159_487 TATCG G AACG GTAACCAATCTCATTA OBD159_485_487 -0.002492994 250 OBD159_487 TATCG G AACG GTAACCAATCTCATTA OBD159_485_487 -0.002492994 251 OBD159_491 TGAAAGAGGCACCAGATGCGGAGGAA OBD159_489_491 -0.003044831 252 OBD159_491 TGAAAGAGGCACCAGATGCGGAGGAA OBD159_489_491 -0.003044831 253 OBD159_495 CCAACAACAATCTCCTTCCTCTCTAT OBD159_493_495 -0.000859479 254 OBD159_495 CCAACAACAATCTCCTTCCTCTCTAT OBD159_493_495 -0.000859479 255 OBD159499 GCTGGGAGGGTCTTACACTGAGT OBD159 497 499 -0.002097728 256 OBD159_499 GCTGGGAGGGTCTTACACTGAGT OBD159_497_499 -0.002097728 257 OBD159_503 GG CAAGTTTCCTG CTCACCCCTG OBD159_5O1_5O3 -0.003841992 258 OBD159_503 GG CAAGTTTCCTG CTCACCCCTG OBD159_5O1_5O3 -0.003841992 259 OBD159_507 CTCTGAAGCCAAGCATAGATAGATGG OBD159_5O5_5O7 -0.003217459 260 OBD159_507 CTCTGAAGCCAAGCATAGATAGATGG OBD159_5O5_5O7 -0.003217459 261 OBD159_511 G AAG GTTCTGTCTTTATTTACAAT OBD159_5O9_511 -0.001863975 262 OBD159_511 G AAG GTTCTGTCTTTATTTACAAT OBD159_5O9_511 -0.001863975 263 OBD159_515 CGAGGTGGTAAAGTCAGCAAGTTA OBD159_513_515 -0.00204202 264 OBD159_515 CGAGGTGGTAAAGTCAGCAAGTTA OBD159_513_515 -0.00204202 265 OBD159_519 ATCTCTTAGTCTTAG CATCTATCA OBD159_517_519 -0.002864437 266 OBD159_519 ATCTCTTAGTCTTAG CATCTATCA OBD159_517_519 -0.002864437 267 OBD159_523 GGTATTGGCAACTAAAACGATTCCTC OBD159_521_523 -0.002896744 05 03 25 268 OBD159_523 GGTATTGGCAACTAAAACGATTCCTC OBD159_521_523 -0.002896744 269 OBD159_527 GGTGACAGACTGAGACTCCATTTA OBD159_525_527 -0.002960188 270 OBD159_527 GGTGACAGACTGAGACTCCATTTA OBD159_525_527 -0.002960188 271 OBD159_531 GCCTTCCACCAAGTCACAAAGAC OBD159_529_531 -0.003593697 272 OBD159_531 GCCTTCCACCAAGTCACAAAGAC OBD159_529_531 -0.003593697 273 OBD159_535 CAGTGACCACAG HILI GCCTCTG OBD159_533_535 -0.003278418 274 OBD159_535 CAGTGACCACAG HILI GCCTCTG OBD159_533_535 -0.003278418 275 OBD159_539 CATTTCATTCTACTGGATTCAGAT OBD159_537_539 -0.002009464 276 OBD159_539 CATTTCATTCTACTGGATTCAGAT OBD159_537_539 -0.002009464 277 OBD159_543 CTCACTAATGACATCCCACATCG CAG OBD159_541_543 -0.005427277 278 OBD159_543 CTCACTAATGACATCCCACATCG CAG OBD159_541_543 -0.005427277 279 OBD159_547 AGAAAGTCTCAAACAGAAGGCAAAT OBD159_545_547 -0.004238773 280 OBD159_547 AGAAAGTCTCAAACAGAAGGCAAAT OBD159_545_547 -0.004238773 281 OBD159_551 GGGTTAGTAGGAGAAATGTAAAACTC OBD159_549_551 -0.002929423 282 OBD159_551 GGGTTAGTAGGAGAAATGTAAAACTC OBD159_549_551 -0.002929423 283 OBD159_555 AAAGTGCTAAGTTTGTGAGGTGATAG OBD159_553_555 -0.003533315 284 OBD159_555 AAAGTGCTAAGTTTGTGAGGTGATAG OBD159_553_555 -0.003533315 285 OBD159_559 CCTAACACCTGCCAAGAAAGTGCTAA OBD159_557_559 -0.001914862 286 OBD159_559 CCTAACACCTGCCAAGAAAGTGCTAA OBD159_557_559 -0.001914862 Table l.d8 Gene 213 rs2337406; rsll846409 214 rs2337406; rsll846409 215 MAG 11; rsl45965284 216 MAG 11; rsl45965284 217 MKLN1; rsll4034759 218 MKLN1; rsll4034759 219 CD109; SLC17A5 220 CD109; SLC17A5 221 MYOM1; rs751200138 222 MYOM1; rs751200138 223 LMBRD2; SKP2; rs2270909; rsl2657634; rsl0941274; rsl2655052; rs3804446 224 LMBRD2; SKP2; rs2270909; rsl2657634; rsl0941274; rsl2655052; rs3804446 225 CDH9; rs201058683 226 CDH9; rs201058683 227 LSM10; 0SCP1 228 LSM10; 0SCP1 229 MEIS1; rsll692361 230 MEIS1; rsll692361 231 BBX; rsll710737 232 BBX; rsll710737 233 GPM6A; rsll06568 234 GPM6A; rsll06568 235 rsl2518614 236 rsl2518614 237 ST18; rs7820212 238 ST18; rs7820212 239 PREX2; rs4512367 240 PREX2; rs4512367 241 ANKRD18A; CNTNAP3 242 ANKRD18A; CNTNAP3 243 NR2F1; rs587777277 244 NR2F1; rs587777277 245 FRMD6; GNG2; rs8015138 246 FRMD6; GNG2; rs8015138 247 GRM1;SHPRH 248 GRM1;SHPRH 249 ZNF790; ZNF850 250 ZNF790; ZNF850 251 GALNT2; rs4925506 252 GALNT2; rs4925506 05 03 25 253 ADCY1; rsl294908 254 ADCY1; rsl294908 255 FZD10; PIWIL1 256 FZD10; PIWIL1 257 EFCAB11; TDP1 258 EFCAB11; TDP1 259 SRGAP2; rs2987927 260 SRGAP2; rs2987927 261 ST6GALNAC3; rs915404 262 ST6GALNAC3; rs915404 263 ARHGAP32; rsll221522 264 ARHGAP32; rsll221522 265 REG3G 266 REG3G 267 CXADR 268 CXADR 269 GAFA3; PGM2; PTTG2; TBC1D1; rsl7578878; rs35859249 270 GAFA3; PGM2; PTTG2; TBC1D1; rsl7578878; rs35859249 271 NUPL2; rs858249 272 NUPL2; rs858249 273 ARMCI; rs6991838 274 ARMCI; rs6991838 275 rsl0504861; rs7838490; rs7819570; rsll995572 276 rsl0504861; rs7838490; rs7819570; rsll995572 277 CCDC85A; rsl86920977; rs6747380; rsl7268785 278 CCDC85A; rsl86920977; rs6747380; rsl7268785 279 SYNPR; rsl3098482 280 SYNPR; rsl3098482 281 CCDC25; ESC02; rs80359869; rs80359844; rs80359845; rs80359846; rs80359847; rs80359848; rs80359849; rs80359850; rs80359851; rs80359852; rs80359853; rs80359854; rs80359855; rs80359856; rs80359857; rs797045565; rs797045566; rs80359858; rs80359859; rs80359861; rs80359862; rsl46312522; rs80359863; rs80359864; rs80359865; rs80359866; rs80359867; rs80359868 282 CCDC25; ESC02; rs80359869; rs80359844; rs80359845; rs80359846; rs80359847; rs80359848; rs80359849; rs80359850; rs80359851; rs80359852; rs80359853; rs80359854; rs80359855; rs80359856; rs80359857; rs797045565; rs797045566; rs80359858; rs80359859; rs80359861; rs80359862; rsl46312522; rs80359863; rs80359864; rs80359865; rs80359866; rs80359867; rs80359868 283 CSMD3; rsl89590409 284 CSMD3; rsl89590409 285 CDK17; ELK3; rs4762284 286 CDK17; ELK3; rs4762284 Table l.d9 Probe GeneLocus 287 ORF176_6_70049970_70053583_70128487_70130693_RR COL19A1; rs771562232 288 ORF176_6_70049970_70053583_70128487_70130693_RR COL19A1; rs771562232 289 ORF177_4_175618295_175622237_175657671_175665421_FF GPM6A; rsl3144140 290 ORF177_4_175618295_175622237_175657671_175665421_FF GPM6A; rsl3144140 291 ORF178_6_157189218_157193153_157237058_157240060_FF ARID1B; rsl057518918; rsl057518691; rs773740590; rs886044620; rs797044859; rs879253746; rs797045278; rsl057518984; rs797045279; rs797045280; rs797045281; rs797045282; rs886041706; rs797045283; rs9406316 292 ORF178_6_157189218_157193153_157237058_157240060_FF ARID1B; rsl057518918; rsl057518691; rs773740590; rs886044620; rs797044859; rs879253746; rs797045278; rsl057518984; rs797045279; rs797045280; rs797045281; rs797045282; rs886041706; rs797045283; rs9406316 293 ORF179_6_151443530_151449164_151503790_151504867_FR C6orf211; CCDC170; RMND1; rs370863743; rs6933660; rsl971256 05 03 25 294 ORF179_6_151443530_151449164_151503790_151504867_FR C6orf211; CCDC170; RMND1; rs370863743; rs6933660; rsl971256 295 ORF179_X_110436218_110442213_110470734_110476806_FF AMMECR1; RGAG1; rsl573036 296 ORF179_X_110436218_110442213_110470734_110476806_FF AMMECR1; RGAG1; rsl573036 297 ORF18_12_75093036_75104058_75141366_75143140_RF CAPS2; KCNC2 298 ORF18_12_75093036_75104058_75141366_75143140_RF CAPS2; KCNC2 299 ORF18_2_20303337_20304942_20340862_20341927_FR PUM2; rslll612372 300 ORF18_2_20303337_20304942_20340862_20341927_FR PUM2; rslll612372 301 ORF18_3_107703592_107708851_107736901_107739665_RR BBX; rsll710737 302 ORF18_3_107703592_107708851_107736901_107739665_RR BBX; rsll710737 303 ORF18_4_37845589_37847420_37859966_37862832_RF GAFA3; PGM2 304 ORF18_4_37845589_37847420_37859966_37862832_RF GAFA3; PGM2 305 ORF18_4_37845589_37847420_37862832_37864637_RR GAFA3; PGM2 306 ORF18_4_37845589_37847420_37862832_37864637_RR GAFA3; PGM2 307 ORF18_8_2237O928_22373682_22443319_22445881_FF PIWIL2; PPP3CC; SLC39A14; rs879253763; rs879253764; rs879253765; rsl039778197; rs879253766; rs750281602; rs7833266; rs2272080 308 ORF18_8_2237O928_22373682_22443319_22445881_FF PIWIL2; PPP3CC; SLC39A14; rs879253763; rs879253764; rs879253765; rsl039778197; rs879253766; rs750281602; rs7833266; rs2272080 309 ORF18_9_38681931_38686861_38768696_38769724_FF ANKRD18A; CNTNAP3 310 ORF18_9_38681931_38686861_38768696_38769724_FF ANKRD18A; CNTNAP3 311 ORF18_X_130743981_130757818_130793708_130805512_RR ARHGAP36; ENOX2 312 ORF18_X_130743981_130757818_130793708_130805512_RR ARHGAP36; ENOX2 313 ORF180_2_195583610_195589061_195640867_195645128_FR DNAH7; SLC39A10 314 ORF180_2_195583610_195589061_195640867_195645128_FR DNAH7; SLC39A10 315 ORF181_2_129231919_129233302_129249318_129258610_FF rs7567687; rsl660895 316 ORF181_2_129231919_129233302_129249318_129258610_FF rs7567687; rsl660895 317 ORF182_7_28717278_28719857_28738396_28739641_RF CREB5; rs56388170 318 ORF182_7_28717278_28719857_28738396_28739641_RF CREB5; rs56388170 319 ORF185_18_58155952_58157838_58215328_58217936_RF NEDD4L; rs4149601 320 ORF185 18 58155952 58157838 58215328 58217936 RF NEDD4L; rs4149601 321 ORF185_4_8258168O_82585686_826188O1_82621987_FR rsl3138355; rs72909131 322 ORF185_4_8258168O_82585686_826188O1_82621987_FR rsl3138355; rs72909131 323 ORF185_6_15144353O_151449164_151537463_151538576_FR C6orf211; CCDC170; RMND1; rs370863743; rs6933660; rsl971256; rs9479055; rs6931664 324 ORF185_6_15144353O_151449164_151537463_151538576_FR C6orf211; CCDC170; RMND1; rs370863743; rs6933660; rsl971256; rs9479055; rs6931664 325 ORF185_9_13159O628_131592768_131652374_131654389_FF RAPGEF1; rs4740283; rsll243444 326 ORF185_9_13159O628_131592768_131652374_131654389_FF RAPGEF1; rs4740283; rsll243444 327 ORF187_9_28314155_28333777_28367003_28368817_FR LINGO2; rsl0812774 328 ORF187_9_28314155_28333777_28367003_28368817_FR LINGO2; rsl0812774 329 ORF188_2_209095320_209098567_209157796_209164211_RR MAP2; PTH2R 330 ORF188_2_209095320_209098567_209157796_209164211_RR MAP2; PTH2R 331 ORF19_2_78765449_78768597_78804372_78809080_RF REG3G 332 ORF19_2_78765449_78768597_78804372_78809080_RF REG3G 333 ORF19_3_107708851_107713617_107779656_107783232_FF BBX; rs670752; rsll710737; rs6437740 334 ORF19_3_107708851_107713617_107779656_107783232_FF BBX; rs670752; rsll710737; rs6437740 335 ORF19_3_24254159_24259126_24306563_24314015_FF THRB; rsl505297; rs826230; rs826231; rs862247; rs826236; rs826238; rs826240; rsl868575; rsll3700287; rsll58265; rs9830674; rs2167115; rsl505307; rsl505283; rsl2485694; rs869785; rs869784; rs9310736; rs7622481 336 ORF19_3_24254159_24259126_24306563_24314015_FF THRB; rsl505297; rs826230; rs826231; rs862247; rs826236; rs826238; rs826240; rsl868575; rsll3700287; rsll58265; rs9830674; rs2167115; rsl505307; rsl505283; rsl2485694; rs869785; rs869784; rs9310736; rs7622481 337 ORF19_6_169185535_169187937_16923O654_169232256_FR THBS2; rs9406328 338 ORF19_6_169185535_169187937_16923O654_169232256_FR THBS2; rs9406328 339 ORF19_8_65560550_65562514_65628655_65630980_FF ARMCI; rs6991838 340 ORF19_8_65560550_65562514_65628655_65630980_FF ARMCI; rs6991838 05 03 25 341 ORF19_8_89905359_89910373_89958362_89963906_FR NBN; OSGIN2; rsl21908973; rsl0464867; rsl4448; rsl3312986; rsl063054; rs2735383; rsl42301194; rsl057517262; rs756363734; rs786204181; rsl064795816; rs730881864; rs730881857; rs7862O1965; rs775397477; rsl057517075; rs7862O3223; rs786203920; rsl057516869; rsl061302; rslO57516852; rs587782653; rsl057516668; rs587782545; rsl060503466; rsl37758O273; rsl057516611; rs61753717; rs864622143; rs786201745; rs749918573; rs766044684; rsl060503481; rs776417262; rsl057516332; rsl060503480; rs587782344; rs759232O53; rs786203180; rs587782130; rs864622333; rs876659666; rs730881850; rsl060503467; rs709816; rs746965O7O; rs587781969; rsl057519588; rsl057517102; rsl057517209; rsl21908974; rs876660290; rs767215758; rs876659521 342 ORF19_8_89905359_89910373_89958362_89963906_FR NBN; OSGIN2; rsl21908973; rsl0464867; rsl4448; rsl3312986; rsl063054; rs2735383; rsl42301194; rsl057517262; rs756363734; rs7862O4181; rsl064795816; rs730881864; rs730881857; rs7862O1965; rs775397477; rsl057517075; rs7862O3223; rs786203920; rsl057516869; rsl061302; rslO57516852; rs587782653; rsl057516668; rs587782545; rsl060503466; rsl37758O273; rsl057516611; rs61753717; rs864622143; rs786201745; rs749918573; rs766044684; rsl060503481; rs776417262; rsl057516332; rsl060503480; rs587782344; rs759232053; rs786203180; rs58778213O; rs864622333; rs876659666; rs730881850; rsl060503467; rs709816; rs746965O7O; rs587781969; rsl057519588; rsl057517102; rsl057517209; rsl21908974; rs876660290; rs767215758; rs876659521 343 ORF19_9_38681931_38686861_38760727_38762491_FR ANKRD18A; CNTNAP3 344 ORF19_9_38681931_38686861_38760727_38762491_FR ANKRD18A; CNTNAP3 345 ORF190_6_70118659_70128487_70187099_70190406_RF COL19A1; rs658805; rs771562232 346 ORF190_6_70118659_70128487_70187099_70190406_RF COL19A1; rs658805; rs771562232 347 ORF191_10_31830982_31838036_31880198_31881483_FF ARHGAP12; rs211257 348 ORF191_10_31830982_31838036_31880198_31881483_FF ARHGAP12; rs211257 349 ORF191_2_72535662_72545373_72613114_72619302_FR EXOC6B; rs2421095 350 ORF191_2_72535662_72545373_72613114_72619302_FR EXOC6B; rs2421095 351 ORF194_3_24254159_24259126_24306563_24314015_FF THRB; rsl5O5297; rs826230; rs826231; rs862247; rs826236; rs826238; rs826240; rsl868575; rsll37OO287; rsll58265; rs9830674; rs2167115; rsl5O53O7; rsl505283; rsl2485694; rs869785; rs869784; rs9310736; rs7622481 352 ORF194_3_24254159_24259126_24306563_24314015_FF THRB; rsl505297; rs826230; rs826231; rs862247; rs826236; rs826238; rs826240; rsl868575; rsll37OO287; rsll58265; rs9830674; rs2167115; rsl5O53O7; rsl505283; rsl2485694; rs869785; rs869784; rs9310736; rs7622481 353 C)RF194_5_24638174_24644400_24709728_24712840_RF CDH1O 354 C)RF194_5_24638174_24644400_24709728_24712840_RF CDH1O 355 ORF194_X_46916544_46918054_46983732_46995250_RR JADE3; RP2 356 ORF194_X_46916544_46918054_46983732_46995250_RR JADE3; RP2 357 ORF197_19_44168555_44170532_44257710_44261871_RR ZNF226; ZNF227; ZNF233; ZNF234; ZNF235 358 ORF197_19_44168555_44170532_44257710_44261871_RR ZNF226; ZNF227; ZNF233; ZNF234; ZNF235 359 ORF198_7_7793942_7796470_7867790_7872166_RR rsl7137412; rs37972 360 ORF198_7_7793942_7796470_7867790_7872166_RR rsl7137412; rs37972 Table l.el 05 03 25 Probe_Count_Total Probe_Count_Sig HyperG_Stats 287 18 3; 3 0.026589963; 0.031898647 288 18 3; 3 0.026589963; 0.031898647 289 68 3; 4 0.224345313; 0.163371308 290 68 3; 4 0.224345313; 0.163371308 291 73 1; 1 0.162201186; 0.138576645 292 73 1; 1 0.162201186; 0.138576645 293 63; 46; 75 3; 5; 2; 4; 3; 5 0.216848517; 0.076682692; 0.273777277; 0.084172061; 0.228845362; 0.1125292 294 63; 46; 75 3; 5; 2; 4; 3; 5 0.216848517; 0.076682692; 0.273777277; 0.084172061; 0.228845362; 0.1125292 295 8; 8 1; 1; 1; 1 0.236185646; 0.249326315; 0.236185646; 0.249326315 296 8; 8 1; 1; 1; 1 0.236185646; 0.249326315; 0.236185646; 0.249326315 297 13; 13 4; 4; 4; 4 0.001148684; 0.001517434; 0.001148684; 0.001517434 298 13; 13 4; 4; 4; 4 0.001148684; 0.001517434; 0.001148684; 0.001517434 299 54 5; 6 0.040491239; 0.018151611 300 54 5; 6 0.040491239; 0.018151611 301 30 4; 5 0.022454364; 0.006393518 302 30 4; 5 0.022454364; 0.006393518 303 37; 37 5; 8; 5; 8 0.010942367; 0.000107113; 0.010942367; 0.000107113 304 37; 37 5; 8; 5; 8 0.010942367; 0.000107113; 0.010942367; 0.000107113 305 37; 37 5; 8; 5; 8 0.010942367; 0.000107113; 0.010942367; 0.000107113 306 37; 37 5; 8; 5; 8 0.010942367; 0.000107113; 0.010942367; 0.000107113 307 52; 32; 49 2; 2; 1; 2; 2; 2 0.276304155; 0.273929087; 0.363856051; 0.242145801; 0.276096976; 0.276409079 308 52; 32; 49 2; 2; 1; 2; 2; 2 0.276304155; 0.273929087; 0.363856051; 0.242145801; 0.276096976; 0.276409079 309 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 310 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 311 9; 34 1; 2; 1; 2 0.255358235; 0.047199169; 0.357029649; 0.251319324 312 9; 34 1; 2; 1; 2 0.255358235; 0.047199169; 0.357029649; 0.251319324 313 61; 81 2; 3; 3; 3 0.26657373; 0.222001213; 0.227770757; 0.222648484 314 61; 81 2; 3; 3; 3 0.26657373; 0.222001213; 0.227770757; 0.222648484 315 NA NA NA 316 NA NA NA 317 54 3; 3 0.193670022; 0.206710786 318 54 3; 3 0.193670022; 0.206710786 319 33 4; 2 0.029769861; 0.246924146 320 33 4; 2 0.029769861; 0.246924146 321 NA NA NA 322 NA NA NA 323 63; 46; 75 3; 5; 2; 4; 3; 5 0.216848517; 0.076682692; 0.273777277; 0.084172061; 0.228845362; 0.1125292 324 63; 46; 75 3; 5; 2; 4; 3; 5 0.216848517; 0.076682692; 0.273777277; 0.084172061; 0.228845362; 0.1125292 325 65 2; 2 0.258408092; 0.245566966 326 65 2; 2 0.258408092; 0.245566966 327 20 6; 4 7.69e-05; 0.007618647 328 20 6; 4 7.69e-05; 0.007618647 329 60; 1 5; 7; 1; 1 0.05512946; 0.009185497; 0.038988153; 0.042102538 330 60; 1 5; 7; 1; 1 0.05512946; 0.009185497; 0.038988153; 0.042102538 331 3 3; 2 0; 0.001770535 332 3 3; 2 0; 0.001770535 333 30 4; 5 0.022454364; 0.006393518 334 30 4; 5 0.022454364; 0.006393518 335 14 3; 2 0.013899641; 0.096260668 336 14 3; 2 0.013899641; 0.096260668 337 46 2; 3 0.273777277; 0.178397403 338 46 2; 3 0.273777277; 0.178397403 339 48 5; 4 0.02780594; 0.092112824 340 48 5; 4 0.02780594; 0.092112824 341 11; 14 1; 1; 1; 2 0.288260522; 0.301350316; 0.325643034; 0.096260668 342 11; 14 1; 1; 1; 2 0.288260522; 0.301350316; 0.325643034; 0.096260668 343 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 344 21; 8 8; 8; 8; 8 6.3e-07; 1.12e-06; 5.16e-12; 9.55e-12 345 18 3; 3 0.026589963; 0.031898647 346 18 3; 3 0.026589963; 0.031898647 347 12 1; 1 0.302214299; 0.314913912 348 12 1; 1 0.302214299; 0.314913912 349 20 1; 1 0.366490901; 0.372098641 350 20 1; 1 0.366490901; 0.372098641 351 14 3; 2 0.013899641; 0.096260668 352 14 3; 2 0.013899641; 0.096260668 353 13 1; 1 0.314642613; 0.32680192 354 13 1; 1 0.314642613; 0.32680192 355 17; 3 1; 1; 1; 1 0.350975055; 0.359834557; 0.108032075; 0.115907508 356 17; 3 1; 1; 1; 1 0.350975055; 0.359834557; 0.108032075; 0.115907508 357 7; 10; 10; 4; 10 1; 1; 1; 1; 1; 1; 1; 1; 1; 1 0.215038813; 0.227740664; 0.272678156; 0.285987033; 0.272678156; 0.285987033; 0.138432982; 0.14804367; 0.272678156; 0.285987033 358 7; 10; 10; 4; 10 1; 1; 1; 1; 1; 1; 1; 1; 1; 1 0.215038813; 0.227740664; 0.272678156; 0.285987033; 0.272678156; 0.285987033; 0.138432982; 0.14804367; 0.272678156; 0.285987033 359 NA NA NA 360 NA NA NA Table l.e2 05 03 25 FDR_HyperG Percent_Sig logFC AveExpr 287 0.375519541; 0.376115439 16.67; 16.67 0.743060399 0.743060399 288 0.375519541; 0.376115439 16.67; 16.67 0.69286775 0.69286775 289 0.375519541; 0.376115439 4.41; 5.88 0.572881601 0.572881601 290 0.375519541; 0.376115439 4.41; 5.88 0.554041986 0.554041986 291 0.375519541; 0.376115439 1.37; 1.37 0.847472811 0.847472811 292 0.375519541; 0.376115439 1.37; 1.37 0.826205454 0.826205454 293 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 4.76; 7.94; 4.35; 8.7; 4; 6.67 0.546916456 0.546916456 294 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 4.76; 7.94; 4.35; 8.7; 4; 6.67 0.535096369 0.535096369 295 0.375519541; 0.376115439; 0.375519541; 0.376115439 12.5; 12.5; 12.5; 12.5 0.676303004 0.676303004 296 0.375519541; 0.376115439; 0.375519541; 0.376115439 12.5; 12.5; 12.5; 12.5 0.533842136 0.533842136 297 0.069549998; 0.082088441; 0.069549998; 0.082088441 30.77; 30.77; 30.77; 30.77 0.608450973 0.608450973 298 0.069549998; 0.082088441; 0.069549998; 0.082088441 30.77; 30.77; 30.77; 30.77 0.52321187 0.52321187 299 0.375519541; 0.376115439 9.26; 11.11 0.843438189 0.843438189 300 0.375519541; 0.376115439 9.26; 11.11 0.825036898 0.825036898 301 0.375519541; 0.217379602 13.33; 16.67 0.519816137 0.519816137 302 0.375519541; 0.217379602 13.33; 16.67 0.518513646 0.518513646 303 0.357678624; 0.013656923; 0.357678624; 0.013656923 13.51; 21.62; 13.51; 21.62 0.616631247 0.616631247 304 0.357678624; 0.013656923; 0.357678624; 0.013656923 13.51; 21.62; 13.51; 21.62 0.578396959 0.578396959 305 0.357678624; 0.013656923; 0.357678624; 0.013656923 13.51; 21.62; 13.51; 21.62 0.791519135 0.791519135 306 0.357678624; 0.013656923; 0.357678624; 0.013656923 13.51; 21.62; 13.51; 21.62 0.69245514 0.69245514 307 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 3.85; 3.85; 3.12; 6.25; 4.08; 4.08 0.701431344 0.701431344 308 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 3.85; 3.85; 3.12; 6.25; 4.08; 4.08 0.658724646 0.658724646 309 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.694869829 0.694869829 05 03 25 310 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.571266171 0.571266171 311 0.375519541; 0.376115439; 0.375519541; 0.376115439 11.11; 22.22; 2.94; 5.88 0.682462284 0.682462284 312 0.375519541; 0.376115439; 0.375519541; 0.376115439 11.11; 22.22; 2.94; 5.88 0.609898655 0.609898655 313 0.375519541; 0.376115439; 0.375519541; 0.376115439 3.28; 4.92; 3.7; 3.7 0.875323772 0.875323772 314 0.375519541; 0.376115439; 0.375519541; 0.376115439 3.28; 4.92; 3.7; 3.7 0.803435131 0.803435131 315 NA NA 0.593346815 0.593346815 316 NA NA 0.499638042 0.499638042 317 0.375519541; 0.376115439 5.56; 5.56 0.934419976 0.934419976 318 0.375519541; 0.376115439 5.56; 5.56 0.841538744 0.841538744 319 0.375519541; 0.376115439 12.12; 6.06 0.6441859 0.6441859 320 0.375519541; 0.376115439 12.12; 6.06 0.589681807 0.589681807 321 NA NA 0.698803831 0.698803831 322 NA NA 0.561454343 0.561454343 323 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 4.76; 7.94; 4.35; 8.7; 4; 6.67 0.506604445 0.506604445 324 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 4.76; 7.94; 4.35; 8.7; 4; 6.67 0.494121362 0.494121362 325 0.375519541; 0.376115439 3.08; 3.08 0.731953563 0.731953563 326 0.375519541; 0.376115439 3.08; 3.08 0.654724778 0.654724778 327 0.008046243; 0.242844385 30; 20 0.843775275 0.843775275 328 0.008046243; 0.242844385 30; 20 0.684458116 0.684458116 329 0.375519541; 0.275564898; 0.375519541; 0.376115439 8.33; 11.67; 100; 100 0.870854788 0.870854788 330 0.375519541; 0.275564898; 0.375519541; 0.376115439 8.33; 11.67; 100; 100 0.686466545 0.686466545 331 0; 0.082088441 100; 100 0.534288724 0.534288724 332 0; 0.082088441 100; 100 0.519928663 0.519928663 333 0.375519541; 0.217379602 13.33; 16.67 0.610561918 0.610561918 334 0.375519541; 0.217379602 13.33; 16.67 0.564884491 0.564884491 335 0.375519541; 0.376115439 21.43; 14.29 0.574528501 0.574528501 336 0.375519541; 0.376115439 21.43; 14.29 0.53282889 0.53282889 337 0.375519541; 0.376115439 4.35; 6.52 0.796010876 0.796010876 338 0.375519541; 0.376115439 4.35; 6.52 0.739967602 0.739967602 339 0.375519541; 0.376115439 10.42; 8.33 0.516922094 0.516922094 340 0.375519541; 0.376115439 10.42; 8.33 0.515009153 0.515009153 341 0.375519541; 0.376115439; 0.375519541; 0.376115439 9.09; 9.09; 7.14; 14.29 0.537064279 0.537064279 342 0.375519541; 0.376115439; 0.375519541; 0.376115439 9.09; 9.09; 7.14; 14.29 0.534110975 0.534110975 343 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.688184297 0.688184297 344 0.000109745; 0.00028483; 1.35e-09; 4.87e-09 38.1; 38.1; 100; 100 0.561280923 0.561280923 345 0.375519541; 0.376115439 16.67; 16.67 0.6396234 0.6396234 346 0.375519541; 0.376115439 16.67; 16.67 0.62977534 0.62977534 347 0.375519541; 0.376115439 8.33; 8.33 0.797414414 0.797414414 348 0.375519541; 0.376115439 8.33; 8.33 0.712359797 0.712359797 349 0.375519541; 0.376115439 5; 5 0.575759347 0.575759347 350 0.375519541; 0.376115439 5; 5 0.49258676 0.49258676 351 0.375519541; 0.376115439 21.43; 14.29 0.565428207 0.565428207 352 0.375519541; 0.376115439 21.43; 14.29 0.529609408 0.529609408 353 0.375519541; 0.376115439 7.69; 7.69 0.554546607 0.554546607 354 0.375519541; 0.376115439 7.69; 7.69 0.528816642 0.528816642 355 0.375519541; 0.376115439; 0.375519541; 0.376115439 5.88; 5.88; 33.33; 33.33 0.703969549 0.703969549 356 0.375519541; 0.376115439; 0.375519541; 0.376115439 5.88; 5.88; 33.33; 33.33 0.676506328 0.676506328 357 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 14.29; 14.29; 10; 10; 10; 10; 25; 25; 10; 10 0.688148639 0.688148639 358 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439; 0.375519541; 0.376115439 14.29; 14.29; 10; 10; 10; 10; 25; 25; 10; 10 0.659914521 0.659914521 359 NA NA 0.671202878 0.671202878 360 NA NA 0.575613955 0.575613955 Table l.e3 05 03 25 t P.Value adj.P.Val B FC FC_1 LS 287 14.79804494 0.00000000485 0.00000387 11.28467862 1.673722555 1.673722555 1 288 17.82482686 0.000000000545 0.000000726 13.3989763 1.616493549 1.616493549 1 289 12.91122911 0.0000000226 0.00000847 9.814824696 1.487491682 1.487491682 1 290 11.21353517 0.000000104 0.00001 8.301902675 1.468193363 1.468193363 1 291 12.15769748 0.0000000442 0.000012 9.162175379 1.799346224 1.799346224 1 292 7.763755476 0.00000515 0.000113029 4.321223889 1.773015875 1.773015875 1 293 11.40568259 0.0000000895 0.0000173 8.468302773 1.460959775 1.460959775 1 294 8.861237956 0.00000132 0.0000474 5.724536025 1.449038944 1.449038944 1 295 9.499895126 0.000000629 0.0000299 6.478297904 1.598039428 1.598...

Claims

1. A process for determining prognosis for autism spectrum disorder (ASD) in an individual comprising detecting in a sample from the individual the presence or absence of one or more of5 the chromosome interactions (i) to (xx) listed below:(i) the chromosome interaction on chromosome 7 formed by the first region of chromosome position number 106136913 to 106136942 and the second region of chromosome position number 106155637 to 106155666 the presence of which is associated with severe ASD,(ii) the chromosome interaction on chromosome 2 formed by the first region of chromosome 10 position number 209638896 to 209638925 and the second region of chromosome positionnumber 209692609 to 209692638 the presence of which is associated with severe ASD,(iii) the chromosome interaction on chromosome 2 formed by the first region of chromosome position number 39609951 to 39609980 and the second region of chromosome position number 39623227 to 39623256 the presence of which is associated with severe ASD,15 (iv) the chromosome interaction on chromosome 6 formed by the first region of chromosome position number 46267217 to 46267246 and the second region of chromosome position number 46295957 to 46295986 the presence of which is associated with mild ASD,(v) the chromosome interaction on chromosome 3 formed by the first region of chromosome position number 120809117 to 120809146 and the second region of chromosome position20 number 120844724 to 120844753 the presence of which is associated with mild ASD,(vi) the chromosome interaction on chromosome 10 formed by the first region of chromosome position number 3161201 to 3161230 and the second region of chromosome position number 3210552 to 3210581 the presence of which is associated with mild ASD,(vii) the chromosome interaction on chromosome 2 formed by the first region of chromosome 25 position number 198099688 to 198099717 and the second region of chromosome positionnumber 198137326 to 198137355 the presence of which is associated with severe ASD,(viii) the chromosome interaction on chromosome 12 formed by the first region of chromosome position number 30144612 to 30144641 and the second region of chromosome position number 30181631 to 30181660 the presence of which is associated with mild ASD,30 (ix) the chromosome interaction on chromosome 19 formed by the first region of chromosome position number 52224154 to 52224183 and the second region of chromosome position number 52267683 to 52267712 the presence of which is associated with severe ASD,(x) the chromosome interaction on chromosome 6 formed by the first region of chromosome position number 157189220 to 157189249 and the second region of chromosome position35 number 157240029 to 157240058 the presence which is associated with mild ASD,(xi) the chromosome interaction on chromosome 7 formed by the first region of chromosome position number 106136913 to 106136942 and the second region of chromosome position number 106183994 to 106184023 the presence of which is associated with severe ASD,05 03 25(xii) the chromosome interaction on chromosome 21 formed by the first region of chromosome position number 17087460 to 17087489 and the second region of chromosome position number 17114098 to 17114127 the presence of which is associated with mild ASD,(xiii) the chromosome interaction on chromosome 10 formed by the first region of chromosome 5 position number 106496979 to 106497008 and the second region of chromosome positionnumber 106538148 to 106538177 the presence of which is associated with mild ASD,(xiv) the chromosome interaction on chromosome 8 formed by the first region of chromosome position number 31178906 to 31178935 and the second region of chromosome position number 31205591 to 31205620 the presence of which is associated with mild ASD,10 (xv) the chromosome interaction on chromosome 13 formed by the first region of chromosome position number 34433098 to 34433127 and the second region of chromosome position number 34463900 to 34463929 the presence of which is associated with mild ASD,(xvi) the chromosome interaction on chromosome 5 formed by the first region of chromosome position number 149610434 to 149610463 and the second region of chromosome position15 number 149663577 to 149663606 the presence of which is associated with severe ASD,(xvii) the chromosome interaction on chromosome 3 formed by the first region of chromosome position number 43042541 to 43042570 and the second region of chromosome position number 43075798 to 43075827 the presence of which is associated with mild ASD,(xviii) the chromosome interaction on chromosome 14 formed by the first region of chromosome 20 position number 99794537 to 99794566 and the second region of chromosome position number99818383 to 99818412 the presence of which is associated with mild ASD,(xix) the chromosome interaction on chromosome 7 formed by the first region of chromosome position number 22368714 to 22368743 and the second region of chromosome position number 22401548 to 22401577 the presence of which is associated with severe ASD,25 (xx) the chromosome interaction on chromosome 18 formed by the first region of chromosome position number 58202024 to 58202053 and the second region of chromosome position number 58217905 to 58217934 the presence of which is associated with severe ASD;and wherein at least the presence or absence of chromosome interaction (iii) is detected.30 2. A process according to claim 1 wherein the presence or absence of at least 5, 8, 10, 15 or 20of chromosome interactions (i) to (xx) of claim 1 are detected in a sample from the individual.

3. A process according to claim 1 or 2 in which the presence or absence of the chromosome interactions is detected:- by detecting the presence or absence of a DNA loop at the site of the chromosome interactions, and / or05 03 25- by detecting the presence or absence of distal regions of a chromosome being brought together in a chromosome conformation.

4. A process according to any one of the preceding claims, wherein detection of the presence or 5 absence of the chromosome interaction is by a method comprising the steps of: -(a) cross-linking of chromosome regions which have come together in a chromosome interaction;(b) subjecting said cross-linked regions to cleavage;(c) ligating said cross-linked cleaved DNA ends to form ligated DNA; and(d) detection of the of the presence or absence of the ligated DNA.

105. A process according to claim 4, wherein the detecting of the presence or absence of the chromosome interactions comprises specific detection of the ligated DNA by quantitative PCR (qPCR) which uses primers capable of amplifying the ligated DNA and a probe which binds the ligation site during the PCR reaction, wherein said probe comprises sequence which is 15 complementary to sequence from each of the chromosome regions that have come together in the chromosome interaction.

6. A process according to claim 5 wherein said probe comprises:20 - a fluorophore covalently attached to the 5’ end of the probe, and / or- a quencher covalently attached to the 3’ end of the probe.

7. A process according to claim 6 wherein: 25- said fluorophore is selected from HEX, Texas Red and FAM; and / or- said probe comprises a nucleic acid sequence of length 10 to 40 nucleotide bases.30 8. A process according to any one of the preceding claims wherein:- the result of the process is provided in a report, and / or- the result of the process is used to select a patient treatment schedule.

9. A process according to any one of the preceding claims wherein the individual has been preselected based on a physical characteristic, risk factor or symptom.

10. A process according to claim 9 wherein the individual has been preselected based on having5 a symptom of, or risk factor for; autistic disorder, childhood autism, Asperger’s syndrome, PDD-NOS (Pervasive Development Disorder), childhood disintegrative disorder or addiction.03 25

Citation Information

Patent Citations

  • Epigenetic chromosome interactions

    WO2016207647A1

  • Typing method

    WO2018115802A1

  • biomarker

    WO2019069067A1

  • Genetic regulation

    WO2019086898A2