Disease marker
The method of detecting chromosome conformation signatures in muscular atrophy allows for early detection and personalized treatment by identifying stable chromosome interactions, addressing the limitations of current diagnostic methods.
Patent Information
- Application Number
- GB2023006949
- Authority / Receiving Office
- GB · GB
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-10-12
- Filing Date
- 2021-10-11
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2041-10-11
AI Technical Summary
Current methods are inadequate for accurately detecting and diagnosing muscular atrophy at an early stage, determining its severity, and personalizing treatment based on individual chromosomal interactions.
A method involving the detection of specific chromosome conformation signatures, or chromosome interactions, using probes to determine the presence or absence of these interactions, allowing for early detection and personalized therapy for muscular atrophy.
Enables early detection of muscular atrophy and personalized treatment by identifying stable chromosome interactions that reflect the disease state, providing a reliable means for prognosis and therapy selection.
Smart Images

Figure 00000016_0000
Abstract
Description
Field of the Invention The invention relates to disease processes. Background of the Invention Muscular atrophy (MD) is a group of muscle diseases that typically results in increasing weakening and breakdown of skeletal muscles over time. The disorders differ in which muscles are primarily affected, the degree of weakness, how fast they worsen, and when symptoms begin. Many people will eventually become unable to walk. Some types are also associated with problems in other organs. Summary of the Invention The inventors have identified chromosome conformation signatures relevant to muscular atrophy. Accordingly the invention provides a method of detecting the muscular atrophy status in an individual, comprising determining the presence or absence of one or more chromosome interactions represented by the probes shown in Table 1, to thereby detect muscular atrophy in the individual. Preferably the method is carried out to select an individual for receiving therapy or a treatment for muscular atrophy. The method may be carried out on individual that has been preselected based on a physical characteristic, risk factor or the presence of a symptom. The method is typically carried out to diagnose muscular atrophy or to determine prognosis for muscular atrophy, and preferably to determine severity of muscular atrophy. Brief Description of the Drawings Figure 1 shows a description of the spinal and bulbar muscular atrophy (SBMA) samples used in the experimental work. Figure 2 shows the PCA of all SBMA arrays. PCA of more than 900k EpiSwitch CCSs. Sample SBMA0007 shows an issue. Squares show pHC and circles shows SMBA in all the figures. Figure 3 shows the PCA of all SBMA arrays with SBMA0007 removed. The data then separates out disease and control samples. Figure 4 shows a PCA with the samples labelled up by the FRS scope. There are no obvious clusters due to FRS score. Figure 5 shows a PCA with samples labelled up by the CAG repeat. There are no obvious clusters by CAG repeat. Figure 6 shows a PCA with samples labelled up by disease duration. There are no obvious clusters dues to disease duration. Figure 7 shows top significant chromosome interactions (also termed 'CCS', chromosome conformation signature) which are present and absent in SBMA. The top 200 interactions for each set were below <=0.05 FDR identified. The two tables show the top 40 interactions per cohort, ranked by interaction frequency. Figure 8 shows genetic location mapping for SBMA present interactions. Although the drawing is not included here, but PD-L1 expression and PD-1 checkpoint pathways in cancer were looked at and interactions associated with them were identified as present in SBMA patients. Figures 9 and 10 show a pathway analysis of the top SBMA present interaction associated genes. Figure 11 shows RET signalling associated pathways. Figure 12 shows genetic location mapping for SBMA absent interactions. Figure 13 shows a pathway analysis of top absent SBMA interaction associated genes. Figure 14 shows disease analysis of top SBMA absent interaction associated genes, going from the left box to the right box. The figure shows disease enrichment analysis of the genes associated to the top CCSs absent in SBMA. Figure 15 shows a preferred method for carrying out the marker detection step of the invention. Detailed Description of the Invention Terms Used Herein The method of the invention may be referred to as the 'process' of the invention herein. The chromosome interactions which are typed may be referred to as 'markers', 'CCS', 'chromosome conformation signature' or 'epigenetic interaction' herein. Such interactions are recognised in the art as regions of the chromosome coming together in a stable manner and this represents a distinct mode of regulation. A chromosome interaction can also be referred to as a 'juxtaposition' of chromosomes, chromosome 'folding' or 'chromatin interaction'. Such interactions can be detected, for example, using the 3C (chromosome conformation capture) method. The word 'type' will be interpreted as per the context, but will usually refer to detection of whether a specific chromosome interaction is present or absent. The chromosome interactions which are typed in the method of the invention are defined in Table 1. They are defined by means of the probe sequences which detect the ligated product made by an EpiSwitch method (see Figure 15). They are also defined by the position numbers of the interaction which are included within the probe name and they are also defined by the primer sequences which allow detection of the ligated sequence. The chromosome interaction can be defined by the 'probe location' given in the tables with reference to the chromosome number and the 'Start' and 'End' positions given for the chromosome regions which come together to form the interaction. Aspects of the Invention The invention relates to determining different aspects of muscular atrophy, including in respect to the presence or stage of muscular atrophy. This determining is by typing any of the relevant markers disclosed herein, for example in Table 1, or preferred combinations of markers, or markers in defined specific regions disclosed herein. Specific number of markers may be chosen from any group of markers which is specifically disclosed herein. Preferred numbers of markers are at least 3, 5, 8,10,15 and at least 20. Preferred groups of markers are those shown in each table, or each part of a table (for example "Table 1A (part la)"), or all the markers associated with a distinct characteristic of muscular atrophy. The invention includes a process of typing a patient to identify whether they have muscular atrophy and / or the stage of muscular atrophy. The invention includes diagnosis of an individual for any condition or stage of disease as defined herein (i.e. prognosis), which can be thought of as determining the subgroup they belong to. The invention also concerns a panel of epigenetic markers which relates to muscular atrophy. The panel may have been optimised in some way, for example by GLMNET analysis. The invention therefore allows personalised therapy to be given to the patient which accurately reflects the patient's needs. Any therapy, for example drug, which is mentioned herein may be administered to an individual based on the result of the process. Marker sets are disclosed in the Tables and Figures. In one embodiment at least 10 markers from any disclosed marker set are used in the invention. In another embodiment at least 20% of the markers from any disclosed marker set are used in the invention. The Epigenetic Interactions Relevant to the Invention The chromosome interactions which are typed in the invention are typically interactions between distal regions of a chromosome, said interactions being dynamic and altering, forming or breaking depending upon the state of the region of the chromosome. That state will reflect different aspects of muscular atrophy and therefore the invention can be carried out to the presence, type, severity or stage of muscular atrophy. The chromosome interaction may, for example, reflect if it is being transcribed or repressed. Chromosome interactions which are specific to muscular atrophy subgroups as defined herein have been found to be stable, thus providing a reliable means of measuring the differences between the two subgroups (for example a muscular atrophy group and a healthy group that does not have muscular atrophy). Chromosome interactions specific to muscular atrophy will normally occur early in the disease process, for example compared to other epigenetic markers such as methylation or changes to binding of histone proteins. Thus the process of the invention is able to detect disease at an early stage. This allows early intervention (for example treatment) which as a consequence will be more effective. Chromosome interactions also reflect the current state of the individual and therefore can be used to assess changes to disease status. Furthermore there is little variation in the relevant chromosome interactions between individuals within the same subgroup. Detecting chromosome interactions is highly informative with up to 50 different possible interactions per gene, and so processes of the invention can for example interrogate 500,000 possible different interactions. Chromosomal interactions may overlap and include the regions of chromosomes shown to encode relevant or undescribed genes, but equally may be in intergenic regions. It should further be noted that the inventors have discovered that chromosome interactions in all regions are equally important in determining the status of a chromosomal locus. The chromosome interactions which are detected in the invention could be impacted by changes to the underlying DNA sequence, by environmental factors, DNA methylation, non-coding antisense RNA transcripts, non-mutagenic carcinogens, histone modifications, chromatin remodelling and specific local DNA interactions. However it must be borne in mind that chromosome interactions as defined herein are a regulatory modality in their own right and do not have a one to one correspondence with any genetic marker (DNA sequence change) or any other epigenetic marker. The changes which lead to the chromosome interactions may be impacted by changes to the underlying nucleic acid sequence which themselves do not directly affect a gene product or the mode of gene expression. Such changes may be for example, SNPs within and / or outside of the genes, gene fusions and / or deletions of intergenic DNA, microRNA, and non-coding RNA. For example, it is known that roughly 20% of SNPs are in non-coding regions, and therefore the process as described is also informative in non-coding situation. In one aspect the regions of the chromosome which come together to form the interaction are less than 5 kb, 3 kb, 1 kb, 500 base pairs or 200 base pairs apart on the same chromosome. The chromosome interaction which is detected may be within a gene, such as any gene mentioned herein. However it may also be upstream or downstream of the gene, for example up to 50,000, up to 30,000, up to 20,000, up to 10,000 or up to 5000 bases upstream or downstream from the gene or from the coding sequence. The Process of the Invention The process of the invention comprises a typing system for detecting chromosome interactions relevant to muscular atrophy. Any suitable typing method can be used, for example a method in which the proximity of the chromosomes in the interaction is detected. The typing method may be performed using the EpiSwitch™ system mentioned herein which for example may be carried out by a method comprising the following steps (for example on a sample from the subject): (i) cross-linking regions of chromosome which have come together in a chromosome interaction, (ii) optionally isolating the cross-linked DNA from said chromosomal locus (iii) subjecting the cross-linked DNA to cleavage, and (iv) ligating the nucleic acids present in the cross-linked entity to derive a ligated nucleic acid with sequence from both the regions which formed a chromosomal interaction. Detection of this ligated nucleic acid allows determination of the presence or absence of a particular chromosome interaction. The ligated nucleic acid therefore acts as a marker for the presence of the chromosome interaction. Preferably the ligated nucleic acid is detected by PCR or a probe based method, including a qPCR method. In the method the chromosomes can be cross-linked by any suitable means, for example by a crosslinking agent, which is typically a chemical compound. In a preferred aspect, the interactions are cross-5 linked using formaldehyde, but may also be cross-linked by any aldehyde, or D-Biotinoyl-e-aminocaproic acid-N-hydroxysuccinimide ester or Digoxigenin-3-O-methylcarbonyl-e-aminocaproic acid-N-hydroxysuccinimide ester. Para-formaldehyde can cross link DNA chains which are 4 Angstroms apart. Preferably the chromosome interactions are on the same chromosome. Typically the chromosome interactions are 2 to 10 Angstroms apart. The cross-linking is preferably in vitro. The cleaving is preferably by restriction digestion with an enzyme, such as TaqL The ligating may form DNA loops. Where PCR (polymerase chain reaction) is used to detect or identify the ligated nucleic acid, the size of the PCR product produced may be indicative of the specific chromosome interaction which is present, and may therefore be used to identify the status of the locus. In preferred aspects the primers shown in any table herein are used, for example the primer pairs shown in Table 1 are used (corresponding to the chromosome interaction which is being detected). Homologues of such primers or primer pairs may also be used, which can have at least 70% identity to the original sequence. Where a probe is used to detect or identify the ligated nucleic acid, this is generally by Watson-Crick based base-pairing between the probe and ligated nucleic acid. Probe sequences as shown in any table herein may be used, for example the probe sequences shown in Table 1 (corresponding to the chromosome interaction which is being detected). Homologues of such probe sequences may also be used, which can have at least 70% identity to the original sequence. Typing according to the process of the invention may be carried out at multiple time points, for example to monitor the progression of the disease. This may be at one or more defined time points, for example at at least 1, 2, 5, 8 or 10 different time points. The durations between at least 1, 2, 5 or 8 of the time points may be at least 5,10, 20, 50, 80 or 100 days. Typically there are 3 time points at least 50 days apart. Subgroups and Personalised Treatment As used herein, a "subgroup" preferably refers to a population subgroup, more preferably a subgroup in the population of a particular animal such as a particular eukaryote, or mammal. Most preferably, a "subgroup" refers to a subgroup in the human population. Therefore the process of the invention is preferably carried out to detect the presence of muscular atrophy in a human. The process of the invention may be carried out for diagnostic or prognostic purposes. The invention includes detecting and treating particular subgroups in a population. The inventors have discovered that chromosome interactions differ between subsets (for example at least two subsets) in the relevant population. Identifying these differences will allow physicians to categorize their patients as a part of one subset of the population. The invention therefore provides physicians with a process of personalizing medicine for the patient based on their epigenetic chromosome interactions. Such testing may be used to select how to subsequently treat the patient, for example the type of drug and / or its dose and / or its frequency of administration. The individual that is tested in the process of the invention may have been selected in some way. The individual may be susceptible to any condition mentioned herein and / or may be in need of any therapy mentioned in. The individual may be receiving any therapy mentioned herein. In particular, the individual may have, or be suspected of having, muscular atrophy. Thus the invention includes a process of typing a patient to diagnose muscular atrophy, which is equivalent to determining the subgroup they belong to. The muscular atrophy may be any of the following conditions: spinal bulbar muscle atrophy (SBMA), a polyglutamine disease, dentatorubral-pallidoluysian atrophy, spinocerebellar ataxia, sarcopenia or cachexia. Therefore the process of the invention may comprise detecting (or diagnosing) any of these conditions. The process of the invention may comprise determining prognosis of any of these conditions, such as determining the severity. The individual may be receiving any of the following or may have received any of these in the previous 365 days: physiotherapy, rehabilitation, therapeutic agents against tremor and muscle cramps, hormone therapy, surgical treatment of gynecomastia, tube feeding or ventilatory support. The individual may have cancer. The individual may be a human male of age 30 to 60, for example of age 40 to 50. The individual may have gynecomastia, testicular atrophy, reduced fertility or androgen insensitivity. The individual may have reduced fertility due to androgen insensitivity. Tables Provided Herein Table 1 shows 400 specific markers which can be used to detect muscular atrophy, i.e. their presence or absence can be used in such a detection (i.e. they are 'disseminating' markers). Table 1A shows 200 markers which are only present in muscular atrophy. Table IB shows 200 markers which are present only healthy controls, i.e. they are absent in muscular atrophy. The process of the invention can therefore be carried out using markers from Table 1A or from Table IB, or from a selection of markers from both Table 1A and Table IB. The markers are defined using probe sequences (which detect a ligated product as defined herein). The first two sets of Start-End positions show probe positions, and the second two sets of Start-End positions show the relevant 4kb region. The following information is provided in the probe data table: RP - Rsum the Rank Product statistics evaluated per each chromosome interaction. FC - Interaction frequency (positive or negative). Pfp - estimated percentage of false positive predictions (pfp), both considering positive and negative chromosome interactions. Pval - estimated pvalues per each CCSs being positive and negative. Adj.P.value(FDR) - False discovery rate adjusted p.value. Loop Detected - which state the loop is found in. Simple permutation-based estimation is used to determine how likely a given RP value or better is observed in a random experiment. This has the following steps: 1. Generate p permutations of k rank lists of length n. 2. Calculate the rank products of the n CCS in the p permutations. 3. Count (c) how many times the rank products of the CCS in the permutations are smaller or equal to the observed rank product. Set c to this value. 4. Calculate the average expected value for the rank product by: Erp(g)=c / p. 5. Calculate the percentage of false positives as: pfp (g)=Erp(g) / rank (g) where rank(g) is the rank of CCS g in a list of all n CCSs sorted by increasing RP. The rank product statistic ranks chromosome interactions according to intensities within each microarray and calculates the product of these ranks across multiple microarrays. This technique can identify chromosome interactions that are consistently detected among the most differential chromosome interactions in a number of replicated microarrays. Where the p-value is 0 this indicates that there is very little variation in the Rank Product of the CCS across the samples, this is a good example of the signal to noise and effect size of CCS. Where p value is 0 and pfp is 0 this means that permutated Rank Product doesn't differ from the actual observed Rank Product. These methods are described Breitling R and Herzyk P (2005) Rank-based methods as a non-parametric alternative of the t-test for the analysis of biological microarray data. J Bioinf Comp Biol 3,1171-1189. The FC indicates prevalence of marker in each comparison, 2 means twice over average test, 1.5 means 1.5 over the average test, etc., and so FC indicates the weight of a marker to phenotype / group. The FC value can be used to give an indication of how many markers are needed for a highly effective test. Typically 5 to 10 markers will give a highly effective test, though even smaller numbers of markers will give a functional test for detection of muscular atrophy. The probes are designed to be 30bp away from the Taql site. In case of PCR, PCR primers are typically designed to detect ligated product but their locations from the Taql site vary. Probe locations: Start 1 - 30 bases upstream of Taql site on fragment 1 End 1 - Taql restriction site on fragment 1 Start 2 - Taql restriction site on fragment 2 End 2 - 30 bases downstream of Taql site on fragment 2 4kb Sequence Location: Start 1 - 4000 bases upstream of Taql site on fragment 1 End 1 - Taql restriction site on fragment 1 Start 2 - Taql restriction site on fragment 2 End 2 - 4000 bases downstream of Taql site on fragment 2 Preferred Marker Sets The invention relates to detecting the presence of muscular atrophy by typing chromosome interaction markers, such as any of the specific markers disclosed herein, for example in Table 1, or preferred combinations of markers, or markers in defined specific regions disclosed herein. Markers present in genes and regions mentioned in the tables may be typed. Specific markers are defined herein by location or by probe and / or primer sequences. Therefore preferred markers are those which are represented by the probes and / or primer pairs disclosed in tables herein. Combinations of markers can be defined in different ways, such as: - by ranking by any parameter defined herein, or - by any 'part' of Table 1, - by reference to the 'number' of the marker which is listed in the left hand column of Table 1. In a preferred aspect at least 10 markers are typed from the top 40 markers for any parameter mentioned in Table 1, such as FC. In one aspect one or more markers are typed which: (i) are present in any one of the regions listed in Table 1; and / or (ii) corresponds to any one of the chromosome interactions represented by any probe shown in Table 1; and / or (iii) is present in a 4,000 base region which comprises or which flanks (i) or (ii). In a preferred aspect: - at least 5 chromosome interactions are typed from Table 1A, and / or - at least 5 chromosome interactions are typed from Table IB. In another preferred aspect at least 5 chromosome interactions are typed selected from: - interaction numbers 1 to 40 from Table 1A, or - interaction numbers 1 to 40 from Table IB. Preferred Numbers of Markers to be Typed Typing a very low number of the markers disclosed herein will result in an effective test due to the nature of regulation by chromosome interaction, including their network-like properties. The different numbers and combination of markers give rise to different performance properties. Further as will be appreciated the markers can be selected from Table 1 as a whole or from the parts of the table defined by Table 1A and Table IB, or from parts defined by a number and letter (reflecting certain marker numbers). In one aspect the process comprising typing at least 3, 5, 8, 10, 15 or 20 of the chromosome interactions represented by the probes in Table 1. In one embodiment at least 10 chromosome interactions represented by the probes in Table 1 are typed. In one aspect the process comprising typing at least 50, 80,100,150, 200, 250, 300, 350 or all of the chromosome interactions represented by the probes in Table 1. In one aspect the process comprising typing at least 3, 5, 8, 10, 15 or 20 of the chromosome interactions represented by the probes in Table 1A. In one embodiment at least 10 chromosome interactions represented by the probes in Table 1A are typed. In one aspect the process comprising typing at least 30, 50, 80,100,150 or all of the chromosome interactions represented by the probes in Table 1A. In one aspect the process comprising typing at least 3, 5, 8, 10,15 or 20 of the chromosome interactions represented by the probes in Table IB. In one embodiment at least 10 chromosome interactions represented by the probes in Table IB are typed. In one aspect the process comprising typing at least 30, 50, 80,100,150 or all of the chromosome interactions represented by the probes in Table IB. In one aspect at least 3, 5, 8, 10, 15 or 20 chromosome interactions are typed from the markers listed as numbers 1 to 40 in Table 1A and / or at least 3, 5, 8,10,15 or 20 chromosome interactions are typed from the markers listed as numbers 1 to 40 in Table IB. In one aspect at least 10 chromosome interactions are typed from the markers listed as numbers 1 to 40 in Table 1A and / or at least 10 chromosome interactions are typed from the markers listed as numbers 1 to 40 in Table IB. Types of Chromosome Interaction In one aspect the locus (including the gene and / or place where the chromosome interaction is detected) may comprise a CTCF binding site. This is any sequence capable of binding transcription repressor CTCF. That sequence may consist of or comprise the sequence CCCTC which may be present in 1, 2 or 3 copies at the locus. The CTCF binding site sequence may comprise the sequence CCGCGNGGNGGCAG (in IUPAC notation). The CTCF binding site may be within at least 100, 500, 1000 or 4000 bases of the chromosome interaction or within any of the chromosome regions shown Table 1. When detection is performed using a probe, typically sequence from both regions of the probe (i.e. from both sites of the chromosome interaction) could be detected. In preferred aspects probes are used in the process which comprise or consist of the same or complementary sequence to a probe shown in any table. In some aspects probes are used which comprise sequence which is homologous to any of the probe sequences shown in the tables. The Approach Taken to Identify Markers and Panels of Markers The invention described herein relates to chromosome conformation profile and 3D architecture as a regulatory modality in its own right, closely linked to the phenotype. The discovery of biomarkers was based on annotations through pattern recognition and screening on representative cohorts of clinical samples representing the differences in phenotypes. We annotated and screened significant parts of the genome, across coding and non-coding parts and over large sways of non-coding 5' and 3' of known genes for identification of statistically disseminating consistent conditional disseminating chromosome conformations, which for example anchor in the non-coding sites within (intronic) or outside of open reading frames. In selection of the best markers we are driven by statistical data and p values for the marker leads. Selected and validated chromosome conformations within the signature are disseminating stratifying entities in their own right, irrespective of the expression profiles of the genes used in the reference. Further work may be done on relevant regulatory modalities, such as SNPs at the anchoring sites, changes in gene transcription profiles, changes at the level of H3K27ac. We are taking the question of clinical phenotype differences and their stratification from the basis of fundamental biology and epigenetic controls over phenotype - including for example from the framework of network of regulation. As such, to assist stratification, one can capture changes in the network and it is preferably done through signatures of several biomarkers, for example through following a machine learning algorithm for marker reduction which includes evaluating the optimal number of markers to stratify the testing cohort with minimal noise. This may end with 3-20 markers. Selection of markers for panels may be done by cross-validation statistical performance (and not for example by the functional relevance of the neighbouring genes, used for the reference name). A panel of markers (with names of adjacent genes) is a product of clustered selection from the screening across significant parts of the genome, in non-biased way analysing statistical disseminating powers over 14,000-60,000 annotated EpiSwitch sites across significant parts of the genome. It should not be perceived as a tailored capture of a chromosome conformation on the gene of know functional value for the question of stratification. The total number of sites for chromosome interaction are 1.2 million, and so the potential number of combinations is 1.2 million to the power 1.2 million. The approach that we have followed nevertheless allows the identifying of the relevant chromosome interactions. The specific markers that are provided by this application have passed selection, being statistically (significantly) associated with the condition or subgroup. This is what the data in the relevant table demonstrates. Each marker can be seen as representing an event of biological epigenetic as part of network deregulation that is manifested in the relevant condition. In practical terms it means that these markers are prevalent across groups of patients when compared to controls. On average, as an example, an individual marker may typically be present in 80% of patients tested and in 10% of controls tested. Simple addition of all markers would not directly represent the network interrelationships between some of the deregulations. This is where the standard multivariate biomarker analysis GLMNET (R package) can be brought in. GLMNET package helps to identify interdependence between some of the markers, that reflect their joint role in achieving deregulations leading to disease phenotype. Modelling and then testing markers with highest GLMNET scores offers not only identify the minimal number of markers that accurately identifies the patient cohort, but also the minimal number that offers the least false positive results in the control group of patients, due to background statistical noise of low prevalence in the control group. Typically a group (combination) of selected markers (such as 3 to 10) offers the best balance between both sensitivity and specificity of detection, emerging in the context of multivariate analysis from individual properties of all the selected statistical significant markers for the condition. The tables herein show the reference names for the array probes (60-mer) for array analysis that overlaps the juncture between the long range interaction sites, the chromosome number and the start and end of two chromosomal fragments that come into juxtaposition. Samples and Sample Treatment The process of the invention will normally be carried out on a sample. The sample may be obtained at a defined time point, for example at any time point defined herein. The sample will normally contain DNA from the individual. It will normally contain cells. In one aspect a sample is obtained by minimally invasive means, and may for example be a blood sample. DNA may be extracted and cut up with a standard restriction enzyme. This can pre-determine which chromosome conformations are retained and will be detected with the EpiSwitch™ platforms. Due to the synchronisation of chromosome interactions between tissues and blood, including horizontal transfer, a blood sample can be used to detect the chromosome interactions in tissues, such as tissues relevant to disease. Preferred Aspects for Sample Preparation and Chromosome Interaction Detection Methods of preparing samples and detecting chromosome conformations are described herein. Optimised (non-conventional) versions of these processes can be used, for example as described in this section. Typically the sample will contain at least 2 xlO5 cells. The sample may contain up to 5 xlO5 cells. In one aspect, the sample will contain 2 xlO5 to 5.5 xlO5 cells Crosslinking of epigenetic chromosomal interactions present at the chromosomal locus is described herein. This may be performed before cell lysis takes place. Cell lysis may be performed for 3 to 7 minutes, such as 4 to 6 or about 5 minutes. In some aspects, cell lysis is performed for at least 5 minutes and for less than 10 minutes. Digesting DNA with a restriction enzyme is described herein. Typically, DNA restriction is performed at about 55°C to about 70°C, such as for about 65°C, for a period of about 10 to 30 minutes, such as about 20 minutes. Preferably a frequent cutter restriction enzyme is used which results in fragments of ligated DNA with an average fragment size up to 4000 base pair. Optionally the restriction enzyme results in fragments of ligated DNA have an average fragment size of about 200 to 300 base pairs, such as about 256 base pairs. In one aspect, the typical fragment size is from 200 base pairs to 4,000 base pairs, such as 400 to 2,000 or 500 to 1,000 base pairs. In one aspect of the EpiSwitch process a DNA precipitation step is not performed between the DNA restriction digest step and the DNA ligation step. DNA ligation is described herein. Typically the DNA ligation is performed for 5 to 30 minutes, such as about 10 minutes. The protein in the sample may be digested enzymatically, for example using a proteinase, optionally Proteinase K. The protein may be enzymatically digested for a period of about 30 minutes to 1 hour, for example for about 45 minutes. In one aspect after digestion of the protein, for example Proteinase K digestion, there is no cross-link reversal or phenol DNA extraction step. In one aspect PCR detection is capable of detecting a single copy of the ligated nucleic acid, preferably with a binary read-out for presence / absence of the ligated nucleic acid. Figure 15 shows a preferred process of detecting chromosome interactions. Processes and Uses of the Invention The process of the invention can be described in different ways. It can be described as a process of making a ligated nucleic acid comprising (i) in vitro cross-linking of chromosome regions which have come together in a chromosome interaction; (ii) subjecting said cross-linked DNA to cutting or restriction digestion cleavage; and (iii) ligating said cross-linked cleaved DNA ends to form a ligated nucleic acid, wherein detection of the ligated nucleic acid may be used to determine the chromosome state at a locus, and wherein preferably: - the locus may be any of the loci or regions mentioned in Table 1, and / or - wherein the chromosomal interaction may be any of the chromosome interactions mentioned herein or corresponding to any of the probes disclosed in Table 1, and / or - wherein the ligated product may have or comprise (i) sequence which is the same as or homologous to any of the probe sequences disclosed in Table 1; or (ii) sequence which is complementary to (ii). The process of the invention can be described as a process for detecting chromosome states which represent different subgroups in a population comprising determining whether a chromosome interaction is present or absent within a defined epigenetically active region of the genome, wherein preferably: the subgroup is defined by presence or stage of muscular atrophy, and / or the chromosome state may be at any locus or region mentioned in Table 1; and / or the chromosome interaction may be any of those mentioned in Table 1 or corresponding to any of the probes disclosed in those tables. Use of the Process of the Invention to Identify New Treatments Knowledge of chromosome interactions can be used to identify new treatments for conditions. The invention provides processes and uses of chromosome interactions defined herein to identify or design new therapeutic agents, for example relating to therapy of muscular atrophy or related sub-conditions. Homologues Homologues of polynucleotide / nucleic acid (e.g. DNA) sequences are referred to herein. Such homologues typically have at least 70% homology, preferably at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% homology, for example over a region of at least 10, 15, 20, 30,100 or more contiguous nucleotides, or across the portion of the nucleic acid which is from the region of the chromosome involved in the chromosome interaction. The homology may be calculated on the basis of nucleotide identity (sometimes referred to as "hard homology"). Therefore, in a particular aspect, homologues of polynucleotide / nucleic acid (e.g. DNA) sequences are referred to herein by reference to percentage sequence identity. Typically such homologues have at least 70% sequence identity, preferably at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% sequence identity, for example over a region of at least 10,15, 20, 30, 100 or more contiguous nucleotides, or across the portion of the nucleic acid which is from the region of the chromosome involved in the chromosome interaction. The homologues may have at least 70% sequence identity, preferably at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% sequence identity across the entire probe, primer or primer pair. For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology and / or % sequence identity (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p387-395). The PILEUP and BLAST algorithms can be used to calculate homology and / or % sequence identity and / or line up sequences (such as identifying equivalent or corresponding sequences (typically on their default settings)), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S, Feta / (1990) J Mol Biol 215:403-10. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pair (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positivevalued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al, supra). These initial neighbourhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W5 T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands. The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two polynucleotide sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001. The homologous sequence typically differs by 1, 2, 3, 4 or more bases, such as less than 10,15 or 20 bases (which may be substitutions, deletions or insertions of nucleotides). These changes may be measured across any of the regions mentioned above in relation to calculating homology and / or % percentage sequence identity. Homology of a 'pair of primers' can be calculated, for example, by considering the two sequences as a single sequence (as if the two sequences are joined together) for the purpose of then comparing against the another primer pair which again is considered as a single sequence. EpiSwitch™ Technology The EpiSwitch™ Technology also relates to the use of microarray EpiSwitch™ marker data in the detection of epigenetic chromosome conformation signatures specific for phenotypes. Aspects such as EpiSwitch™ which utilise ligated nucleic acids in the manner described herein have several advantages. They have a low level of stochastic noise, for example because the nucleic acid sequences from the first set of nucleic acids of the present invention either hybridise or fail to hybridise with the second set of nucleic acids. This provides a binary result permitting a relatively simple way to measure a complex mechanism at the epigenetic level. EpiSwitch™ technology also has fast processing time and low cost. In one aspect the processing time is 3 hours to 6 hours. Arrays All nucleic acids disclosed herein may be bound to an array, and in one aspect there are at least 15,000, 45,000,100,000 or 250,000 different nucleic acids bound to the array, which preferably represent at least 300, 900, 2000 or 5000 loci. In one aspect one, or more, or all of the different populations of nucleic acids are bound to more than one distinct region of the array, in effect repeated on the array allowing for error detection. The array may be based on an Agilent SurePrint G3 Custom CGH microarray platform. Detection of binding of first nucleic acids to the array may be performed by a dual colour system. The Threshold of Detection The markers which are disclosed herein have been found to be 'disseminating markers' capable of determining muscular atrophy status or subgroup. In practical terms it means that these markers are prevalent across groups of patients when compared to controls (as is shown by the FC value, for example). On average, as an example, an individual marker may typically be present in 80% of patients tested and in 10% of controls tested. Thus in one aspect of the method an individual is deemed to be part of the relevant muscular atrophy subgroup if least 80% of the markers that are tested for that subgroup are present in the individual and / or if at least 80% of the markers that are tested which are related to the control (non-muscular atrophy group) are absent from the individual. Typically presence / absence of at least 8 markers out of 10 compared to the 'ideal' result shown in the table can be used to assign the individual to a subgroup. Therapeutic Agents and Treatments This section is relevant both to: - therapeutic agents which are given to individuals selected by the process of the invention, and - therapeutic agents which are selected based on the results of the process of the invention. The invention provides therapeutic agents for use in preventing or treating a disease condition in certain individuals, for example those identified by a process of the invention. This may comprise administering to an individual in need a therapeutically effective amount of the agent. The invention provides use of the agent in the manufacture of a medicament to prevent or treat a condition in certain individuals. The disease or condition may be muscular atrophy, any type of muscular atrophy sub-condition or a stage of muscular atrophy. The formulation of the agent will depend upon the nature of the agent. The agent will be provided in the form of a pharmaceutical composition containing the agent and a pharmaceutically acceptable carrier or diluent. Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. Typical oral dosage compositions include tablets, capsules, liquid solutions and liquid suspensions. The agent may be formulated for parenteral, intravenous, intramuscular, subcutaneous, transdermal or oral administration. The dose of an agent may be determined according to various parameters, especially according to the substance used; the age, weight and condition of the individual to be treated; the route of administration; and the required regimen. A physician will be able to determine the required route of administration and dosage for any particular agent. A suitable dose may however be from 0.1 to 100 mg / kg body weight such as 1 to 40 mg / kg body weight, for example, to be taken from 1 to 3 times daily. The therapeutic agent may be any such agent disclosed herein, or may target any 'target' disclosed herein, including any protein or gene disclosed herein in any table. It is understood that any agent that is disclosed in a combination should be seen as also disclosed for administration individually. Therapeutic agents and treatments which can be used in the invention include physiotherapy, rehabilitation, agents that treat muscle tremors, agents that treat muscle cramps, hormone therapy, anti-testosterone leuprorelin. Properties of Nucleic Acids of the Invention The invention relates to certain nucleic acids, such as the ligated nucleic acids which are described herein as being used or generated in the process of the invention. These may be the same as, or have any of the properties of, the first and second nucleic acids mentioned herein. The nucleic acids of the invention typically comprise two portions each comprising sequence from one of the two regions of the chromosome which come together in the chromosome interaction. Typically each portion is at least 8, 10, 15, 20, 30 or 40 nucleotides in length, for example 10 to 40 nucleotides in length. Preferred nucleic acids comprise sequence from any of the genes mentioned in any of the tables. Typically preferred nucleic acids comprise the specific probe sequences mentioned in Table 1; or fragments and / or homologues of such sequences. Preferably the nucleic acids are DNA. It is understood that where a specific sequence is provided the invention may use the complementary sequence as required in the particular aspect. Preferably the nucleic acids are DNA. It is understood that where a specific sequence is provided the invention may use the complementary sequence as required in the particular aspect. The primers shown in Table 1 may also be used in the invention as mentioned herein. In one aspect primers are used which comprise any of: the sequences shown in Table 1; or fragments and / or homologues of any sequence shown in Table 1. Screening to Identify Relevant Chromosome Interactions In one aspect one or more of the chromosome interactions which are typed have been identified by a process of determining which chromosomal interactions are relevant to a chromosome state corresponding to a muscular atrophy subgroup of the population, comprising contacting a first set of nucleic acids from subgroups with different states of the chromosome with a second set of index nucleic acids, and allowing complementary sequences to hybridise, wherein the nucleic acids in the first and second sets of nucleic acids represent a ligated product comprising sequences from both the chromosome regions that have come together in chromosomal interactions, and wherein the pattern of hybridisation between the first and second set of nucleic acids allows a determination of which chromosomal interactions are specific to the subgroup. The second set of nucleic acid sequences has the function of being a set of index sequences, and is essentially a set of nucleic acid sequences which are suitable for identifying subgroup specific sequence. They can represents the 'background' chromosomal interactions and might be selected in some way or be unselected. They are in general a subset of all possible chromosomal interactions. The second set of nucleic acids may be derived by any suitable process. They can be derived computationally or they may be based on chromosome interaction in individuals. They typically represent a larger population group than the first set of nucleic acids. In one particular aspect, the second set of nucleic acids represents all possible epigenetic chromosomal interactions in a specific set of genes. In another particular aspect, the second set of nucleic acids represents a large proportion of all possible epigenetic chromosomal interactions present in a population described herein. In one particular aspect, the second set of nucleic acids represents at least 50% or at least 80% of epigenetic chromosomal interactions in at least 20, 50,100 or 500 genes, for example in 20 to 100 or 50 to 500 genes. The second set of nucleic acids typically represents at least 100 possible epigenetic chromosome interactions which modify, regulate or in anyway mediate a phenotype in population. The second set of nucleic acids may represent chromosome interactions that affect a disease state (typically relevant to diagnosis or prognosis) in a species. The second set of nucleic acids typically comprises sequences representing epigenetic interactions both relevant and not relevant to a prognosis subgroup. In one particular aspect the second set of nucleic acids derive at least partially from naturally occurring sequences in a population, and are typically obtained by in silica processes. Said nucleic acids may further comprise single or multiple mutations in comparison to a corresponding portion of nucleic acids present in the naturally occurring nucleic acids. Mutations include deletions, substitutions and / or additions of one or more nucleotide base pairs. In one particular aspect, the second set of nucleic acids may comprise sequence representing a homologue and / or orthologue with at least 70% sequence identity to the corresponding portion of nucleic acids present in the naturally occurring species. In another particular aspect, at least 80% sequence identity or at least 90% sequence identity to the corresponding portion of nucleic acids present in the naturally occurring species is provided. Properties of the Second Set of Nucleic Acids In one particular aspect, there are at least 100 different nucleic acid sequences in the second set of nucleic acids, preferably at least 1000, 2000 or 5000 different nucleic acids sequences, with up to 100,000, 1,000,000 or 10,000,000 different nucleic acid sequences. A typical number would be 100 to 1,000,000, such as 1,000 to 100,000 different nucleic acids sequences. All or at least 90% or at least 50% or these would correspond to different chromosomal interactions. In one particular aspect, the second set of nucleic acids represent chromosome interactions in at least 20 different loci or genes, preferably at least 40 different loci or genes, and more preferably at least 100, at least 500, at least 1000 or at least 5000 different loci or genes, such as 100 to 10,000 different loci or genes. The lengths of the second set of nucleic acids are suitable for them to specifically hybridise according to Watson Crick base pairing to the first set of nucleic acids to allow identification of chromosome interactions specific to subgroups. Typically the second set of nucleic acids will comprise two portions corresponding in sequence to the two chromosome regions which come together in the chromosome interaction. The second set of nucleic acids typically comprise nucleic acid sequences which are at least 10, preferably 20, and preferably still 30 bases (nucleotides) in length. In another aspect, the nucleic acid sequences may be at the most 500, preferably at most 100, and preferably still at most 50 base pairs in length. In a preferred aspect, the second set of nucleic acids comprises nucleic acid sequences of between 17 and 25 base pairs. In one aspect at least 100, 80% or 50% of the second set of nucleic acid sequences have lengths as described above. Preferably the different nucleic acids do not have any overlapping sequences, for example at least 100%, 90%, 80% or 50% of the nucleic acids do not have the same sequence over at least 5 contiguous nucleotides. Given that the second set of nucleic acids acts as an 'index' then the same set of second nucleic acids may be used with different sets of first nucleic acids which represent subgroups for different characteristics, i.e. the second set of nucleic acids may represent a 'universal' collection of nucleic acids which can be used to identify chromosome interactions relevant to different characteristics. The First Set of Nucleic Acids (Screening for Relevant Chromosome Interactions) The first set of nucleic acids are typically from subgroups relevant to muscular atrophy. The first nucleic acids may have any of the characteristics and properties of the second set of nucleic acids mentioned herein. The first set of nucleic acids is normally derived from samples from the individuals which have undergone treatment and processing as described herein, particularly the EpiSwitch™ cross-linking and cleaving steps. Typically the first set of nucleic acids represents all or at least 80% or 50% of the chromosome interactions present in the samples taken from the individuals. Typically, the first set of nucleic acids represents a smaller population of chromosome interactions across the loci or genes represented by the second set of nucleic acids in comparison to the chromosome interactions represented by second set of nucleic acids, i.e. the second set of nucleic acids is representing a background or index set of interactions in a defined set of loci or genes. Library of Nucleic Acids Any of the types of nucleic acid populations mentioned herein may be present in the form of a library comprising at least 200, at least 500, at least 1000, at least 5000 or at least 10000 different nucleic acids of that type, such as 'first' or 'second' nucleic acids. Such a library may be in the form of being bound to an array. The library may comprise some or all of the probes or primer pairs shown in Table 1A or IB. The library may comprise all of the probe sequence from any of the tables disclosed herein. Hybridisation The invention typically requires a means for allowing wholly or partially complementary nucleic acid sequences to hybridise, for example in the method of the invention or between the first set of nucleic acids and the second set of nucleic acids to hybridise. In one aspect all of the first set of nucleic acids is contacted with all of the second set of nucleic acids in a single assay, i.e. in a single hybridisation step. However any suitable assay can be used. Labelled Nucleic Acids and Pattern of Hybridisation The nucleic acids mentioned herein may be labelled, preferably using an independent label such as a fluorophore (fluorescent molecule) or radioactive label which assists detection of successful hybridisation. Certain labels can be detected under UV light. The pattern of hybridisation, for example on an array described herein, represents differences in epigenetic chromosome interactions between the two subgroups, and thus provides a process of comparing epigenetic chromosome interactions and determination of which epigenetic chromosome interactions are specific to a subgroup in the population of the present invention. The term 'pattern of hybridisation' broadly covers the presence and absence of hybridisation, for example between the first and second set of nucleic acids, i.e. which specific nucleic acids from the first set hybridise to which specific nucleic acids from the second set, and so it not limited to any particular assay or technique, or the need to have a surface or array on which a 'pattern' can be detected. Forms of the Substance Mentioned Herein Any of the substances, such as nucleic acids or therapeutic agents, mentioned herein may be in purified or isolated form. They may be in a form which is different from that found in nature, for example they may be present in combination with other substance with which they do not occur in nature. The nucleic acids (including portions of sequences defined herein) may have sequences which are different to those found in nature, for example having at least 1, 2, 3, 4 or more nucleotide changes in the sequence as described in the section on homology. The nucleic acids may have heterologous sequence at the 5' or 3' end. The nucleic acids may be chemically different from those found in nature, for example they may be modified in some way, but preferably are still capable of Watson-Crick base pairing. Where appropriate the nucleic acids will be provided in double stranded or single stranded form. The invention provides all of the specific nucleic acid sequences mentioned herein in single or double stranded form, and thus includes the complementary strand to any sequence which is disclosed. The invention provides a kit for carrying out any process of the invention, including detection of a chromosomal interaction relating to prognosis. Such a kit can include a specific binding agent capable of detecting the relevant chromosomal interaction, such as agents capable of detecting a ligated nucleic acid generated by processes of the invention. Preferred agents present in the kit include probes capable of hybridising to the ligated nucleic acid or primer pairs, for example as described herein, capable of amplifying the ligated nucleic acid in a PCR reaction. A kit of the invention may comprise means to detect a panel of markers, such as any number of combination of markers disclosed herein. The invention provides use of a reagent for preparing kit for carrying out the process of the invention. Such a reagent may be any suitable substance mentioned herein, such as the agents which are capable of detection of products of detection processes, including reagents which are any of the probes or primers mentioned herein. The invention provides use of the reagent in the process of the invention. The invention provides use of the reagent in the preparing of a means for carrying out the invention. The invention provides a device that is capable of detecting the relevant chromosome interactions. The device preferably comprises any specific binding agents, probe or primer pair capable of detecting the chromosome interaction, such as any such agent, probe or primer pair described herein. The invention provides use of detection of chromosome interactions as defined herein (for example by number or specific combination) to detect muscular atrophy or any characteristic of muscular atrophy, for example as defined herein. The invention provides use of a reagent (for example a probe, primer, label, device or array) in any method of the invention. Detection Process In one aspect quantitative detection of the ligated sequence which is relevant to a chromosome interaction is carried out using a probe which is detectable upon activation during a PCR reaction, wherein said ligated sequence comprises sequences from two chromosome regions that come together in an epigenetic chromosome interaction, wherein said process comprises contacting the ligated sequence with the probe during a PCR reaction, and detecting the extent of activation of the probe, and wherein said probe binds the ligation site. The process typically allows particular interactions to be detected in a MIQE compliant manner using a dual labelled fluorescent hydrolysis probe. The probe is generally labelled with a detectable label which has an inactive and active state, so that it is only detected when activated. The extent of activation will be related to the extent of template (ligation product) present in the PCR reaction. Detection may be carried out during all or some of the PCR, for example for at least 50% or 80% of the cycles of the PCR. The probe can comprise a fluorophore covalently attached to one end of the oligonucleotide, and a quencher attached to the other end of the nucleotide, so that the fluorescence of the fluorophore is quenched by the quencher. In one aspect the fluorophore is attached to the 5'end of the oligonucleotide, and the quencher is covalently attached to the 3' end of the oligonucleotide. Fluorophores that can be used in the process of the invention include FAM, TET, JOE, Yakima Yellow, HEX, Cyanine3, ATTO 550, TAM RA, ROX, Texas Red, Cyanine 3.5, LC610, LC 640, ATTO 647N, Cyanine 5, Cyanine 5.5 and ATTO 680. Quenchers that can be used with the appropriate fluorophore include TAM, BHQ1, DAB, Eclip, BHQ2 and BBQ650, optionally wherein said fluorophore is selected from HEX, Texas Red and FAM. Preferred combinations of fluorophore and quencher include FAM with BHQ1 and Texas Red with BHQ2. Use of the Probe in a qPCR Assay Hydrolysis probes of the invention are typically temperature gradient optimised with concentration matched negative controls. Preferably single-step PCR reactions are optimized. More preferably a standard curve is calculated. An advantage of using a specific probe that binds across the junction of the ligated sequence is that specificity for the ligated sequence can be achieved without using a nested PCR approach. The processes described herein allow accurate and precise quantification of low copy number targets. The target ligated sequence can be purified, for example gel-purified, prior to temperature gradient optimization. The target ligated sequence can be sequenced. Preferably PCR reactions are performed using about lOng, or 5 to 15 ng, or 10 to 20ng, or 10 to 50ng, or 10 to 200ng template DNA. Forward and reverse primers are designed such that one primer binds to the sequence of one of the chromosome regions represented in the ligated DNA sequence, and the other primer binds to other chromosome region represented in the ligated DNA sequence, for example, by being complementary to the sequence. Choice of Ligated DNA Target The invention includes selecting primers and a probe for use in a PCR process as defined herein comprising selecting primers based on their ability to bind and amplify the ligated sequence and selecting the probe sequence based properties of the target sequence to which it will bind, in particular the curvature of the target sequence. Probes are typically designed / chosen to bind to ligated sequences which are juxtaposed restriction fragments spanning the restriction site. In one aspect of the invention, the predicted curvature of possible ligated sequences relevant to a particular chromosome interaction is calculated, for example using a specific algorithm referenced herein. The curvature can be expressed as degrees per helical turn, e.g. 10.5° per helical turn. Ligated sequences are selected for targeting where the ligated sequence has a curvature propensity peak score of at least 5° per helical turn, typically at least 10°, 15° or 20° per helical turn, for example 5° to 20° per helical turn. Preferably the curvature propensity score per helical turn is calculated for at least 20, 50,100, 200 or 400 bases, such as for 20 to 400 bases upstream and / or downstream of the ligation site. Thus in one aspect the target sequence in the ligated product has any of these levels of curvature. Target sequences can also be chosen based on lowest thermodynamic structure free energy. Particular Aspects In one aspect only intrachromosomal interactions are typed / detected, and no extrachromosomal interactions (between different chromosomes) are typed / detected. In particular aspects certain chromosome interactions are not typed, for example any specific interaction mentioned herein (for example as defined by any probe or primer pair mentioned herein). In some aspects chromosome interactions are not typed in any of the genes relevant to chromosome interactions mentioned herein. The data provided herein shows that the markers are 'disseminating' ones able to differentiate cases and non-cases for the relevant disease situation. Therefore when carrying out the invention the skilled person will be able to determine by detection of the interactions which subgroup the individual is in. In one embodiment a threshold value of detection of at least 70% of the tested markers in the form they are associated with the relevant disease situation (either by absence or presence) may be used to determine whether the individual is in the relevant subgroup. In one embodiment the process of the invention does not detect the presence of Huntington's disease, and is not carried out for the purpose of detection of Huntington's disease. In one embodiment the process of the invention is not carried out on an individual who is suspected of having Huntington's disease or who has symptoms of Huntington's disease. Use of a Classifier The method of the invention may include analysis of the chromosome interactions identified in the individual, for example using a classifier, which may increase performance, such as sensitivity or specificity. The classifier is typically one that has been 'trained' on samples from the population and such training may assist the classifier to detect any subgroup mentioned herein. Screening process The invention provides a process of determining which chromosomal interactions are relevant to a chromosome state corresponding to an prognosis subgroup of the population, comprising contacting a first set of nucleic acids from subgroups with different states of the chromosome with a second set of index nucleic acids, and allowing complementary sequences to hybridise, wherein the nucleic acids in the first and second sets of nucleic acids represent a ligated product comprising sequences from both the chromosome regions that have come together in chromosomal interactions, and wherein the pattern of hybridisation between the first and second set of nucleic acids allows a determination of which chromosomal interactions are specific to an prognosis subgroup. The subgroup may be any of the specific subgroups defined herein, for example with reference to particular conditions or therapies. Publications The contents of all publications mentioned herein are incorporated by reference into the present specification and may be used to further define the features relevant to the invention. The contents of the priority document, UK Patent Application No. 2016176.6 filed 12 October 2021, is also incorporated herein by reference. Techniques Used to Identify the Specific Relevant Chromosome Interactions The EpiSwitch™ platform technology detects epigenetic regulatory signatures of regulatory changes between normal and abnormal conditions at loci. The EpiSwitch™ platform identifies and monitors the fundamental epigenetic level of gene regulation associated with regulatory high order structures of human chromosomes also known as chromosome conformation signatures. Chromosome signatures are a distinct primary step in a cascade of gene deregulation. They are high order biomarkers with a unique set of advantages against biomarker platforms that utilize late epigenetic and gene expression biomarkers, such as DNA methylation and RNA profiling. EpiSwitch ™ Array Assay The custom EpiSwitch™ array-screening platforms come in 4 densities of, 15K, 45K, 100K, and 250K unique chromosome conformations, each chimeric fragment is repeated on the arrays 4 times, making the effective densities 60K, 180K, 400K and 1 Million respectively. Custom Designed EpiSwitch ™ Arrays The 15K EpiSwitch™ array can screen the whole genome including around 300 loci interrogated with the EpiSwitch™ Biomarker discovery technology. The EpiSwitch™ array is built on the Agilent SurePrint G3 Custom CGH microarray platform; this technology offers 4 densities, 60K, 180K, 400K and 1 Million probes. The density per array is reduced to 15K, 45K, 100K and 250K as each EpiSwitch™ probe is presented as a quadruplicate, thus allowing for statistical evaluation of the reproducibility. The average number of potential EpiSwitch™ markers interrogated per genetic loci is 50, as such the numbers of loci that can be investigated are 300, 900, 2000, and 5000. EpiSwitch™ Custom Array Pipeline The EpiSwitch™ array is a dual colour system with one set of samples, after EpiSwitch™ library generation, labelled in Cy5 and the other of sample (controls) to be compared / analyzed labelled in Cy3. The arrays are scanned using the Agilent SureScan Scanner and the resultant features extracted using the Agilent Feature Extraction software. The data is then processed using the EpiSwitch™ array processing scripts in R. The arrays are processed using standard dual colour packages in Bioconductor in R: Limma*. The normalisation of the arrays is done using the normalisedWithinArrays function in Umma* and this is done to the on chip Agilent positive controls and EpiSwitch™ positive controls. The data is filtered based on the Agilent Flag calls, the Agilent control probes are removed and the technical replicate probes are averaged, in order for them to be analysed using Limma*. The probes are modelled based on their difference between the 2 scenarios being compared and then corrected by using False Discovery Rate. Probes with Coefficient of Variation (CV) <=30% that are <=-1.1 or =>1.1 and pass the p<=0.1 FDR p-value are used for further screening. To reduce the probe set further Multiple Factor Analysis is performed using the FactorMineR package in R. * Note: LIMMA is Linear Models and Empirical Bayes Processes for Assessing Differential Expression in Microarray Experiments. Limma is an R package for the analysis of gene expression data arising from microarray or RNA-Seq. The pool of probes is initially selected based on adjusted p-value, FC and CV <30% (arbitrary cut off point) parameters for final picking. Further analyses and the final list are drawn based only on the first two parameters (adj. p-value; FC). Statistical Pipeline EpiSwitch™ screening arrays are processed using the EpiSwitch™ Analytical Package in R in order to select high value EpiSwitch™ markers for translation on to the EpiSwitch™ PCR platform. Step 1 Probes are selected based on their corrected p-value (False Discovery Rate, FDR), which is the product of a modified linear regression model. Probes below p-value <= 0.1 are selected and then further reduced by their Epigenetic ratio (ER), probes ER have to be <=-1.1 or =>1.1 in order to be selected for further analysis. The last filter is a coefficient of variation (CV), probes have to be below <=0.3. Step 2 The top 40 markers from the statistical lists are selected based on their ER for selection as markers for PCR translation. The top 20 markers with the highest negative ER load and the top 20 markers with the highest positive ER load form the list. Step 3 The resultant markers from step 1, the statistically significant probes form the bases of enrichment analysis using hypergeometric enrichment (HE). This analysis enables marker reduction from the significant probe list, and along with the markers from step 2 forms the list of probes translated on to the EpiSwitch™ PCR platform. The statistical probes are processed by HE to determine which genetic locations have an enrichment of statistically significant probes, indicating which genetic locations are hubs of epigenetic difference. The most significant enriched loci based on a corrected p-value are selected for probe list generation. Genetic locations below p-value of 0.3 or 0.2 are selected. The statistical probes mapping to these genetic locations, with the markers from step 2, form the high value markers for EpiSwitch™ PCR translation. Array design and processing Array Design Genetic loci are processed using the Sil software (currently v3.2) to: - Pull out the sequence of the genome at these specific genetic loci (gene sequence with 50kb upstream and 20kb downstream) - Define the probability that a sequence within this region is involved in CCs - Cut the sequence using a specific RE - Determine which restriction fragments are likely to interact in a certain orientation - Rank the likelihood of different CCs interacting together. - Determine array size and therefore number of probe positions available (x) - Pull out x / 4 interactions. - For each interaction define sequence of 30bp to restriction site from part 1 and 30bp to restriction site of part 2. Check those regions aren't repeats, if so exclude and take next interaction down on the list. Join both 30bp to define probe. - Create list of x / 4 probes plus defined control probes and replicate 4 times to create list to be created on array - Upload list of probes onto Agilent Sure design website for custom CGH array. - Use probe group to design Agilent custom CGH array. Array Processing - Process samples using EpiSwitch™ Standard Operating Procedure (SOP) for template production. - Clean up with ethanol precipitation by array processing laboratory. - Process samples as per Agilent SureTag complete DNA labelling kit - Agilent Oligonucleotide Arraybased CGH for Genomic DNA Analysis Enzymatic labelling for Blood, Cells or Tissues - Scan using Agilent C Scanner using Agilent feature extraction software. EpiSwitch™ biomarker signatures demonstrate high robustness, sensitivity and specificity in the stratification of complex disease phenotypes. This technology takes advantage of the latest breakthroughs in the science of epigenetics, monitoring and evaluation of chromosome conformation signatures as a highly informative class of epigenetic biomarkers. Current research methods deployed in academic environment require from 3 to 7 days for biochemical processing of cellular material in order to detect CCSs. Those procedures have limited sensitivity, and reproducibility; and furthermore, do not have the benefit of the targeted insight provided by the EpiSwitch™ Analytical Package at the design stage. EpiSwitch ™ Array in silica marker identification CCS sites across the genome are directly evaluated by the EpiSwitch™ Array on clinical samples from testing cohorts for identification of all relevant stratifying lead biomarkers. The EpiSwitch™ Array platform is used for marker identification due to its high-throughput capacity, and its ability to screen large numbers of loci rapidly. The array used was the Agilent custom-CGH array, which allows markers identified through the in silico software to be interrogated. EpiSwitch ™ PCR Potential markers identified by EpiSwitch™ Array are then validated either by EpiSwitch™ PCR or DNA sequencers (i.e. Roche 454, Nanopore MinlON, etc.). The top PCR markers which are statistically significant and display the best reproducibility are selected for further reduction into the final EpiSwitch™ Signature Set, and validated on an independent cohort of samples. EpiSwitch™ PCR can be performed by a trained technician following a standardised operating procedure protocol established. All protocols and manufacture of reagents are performed under ISO 13485 and 9001 accreditation to ensure the quality of the work and the ability to transfer the protocols. EpiSwitch™ PCR and EpiSwitch™ Array biomarker platforms are compatible with analysis of both whole blood and cell lines. The tests are sensitive enough to detect abnormalities in very low copy numbers using small volumes of blood. The invention is illustrated by the following: Example 1 Spinal and bulbar muscular atrophy (SBMA) is an exemplifying model muscle atrophy disease that can be used to identify the chromosome interactions relevant to muscle atrophy. SBMA is a rare disease with predominant manifestation in males (2.6:100,000) associated with genetic mutations in androgen receptor (AR) gene and inherited in X-linked recessive manner. Modulation of endocrine, neurological and muscular regulatory networks associated with impairment of AR gene lead to significant pathophysiology and extreme disability. Interestingly, in homozygous females with AR impairment the symptoms are very mild, indicating the significance of the regulatory context in compensating the defect. As part of its pathophysiology, SBMA leads to muscle atrophy, largely due to lower motor neuron degeneration and lack of adequate stimulation. The disease has no treatment and there are limited prognostic insights. Spinal muscular atrophy is a recognized model disease for the better understanding of spinal sarcopenia, motor neuron loss in sarcopenia, muscle atrophy, muscle wasting phenomenon as a result of ageing (sarcopenia) and as a result of underlying pathological signalling (cachexia, as particularly often observed in cancer) and for understanding shared mechanisms of muscle wasting with cancer. Here we have analysed chromosome interactions of SBMA patients in comparison to healthy cohorts. We have done whole genome screening across over 900,000 chromosome conformations covering all annotated genes and ncRNA across the genome. A whole blood sample was provided from a United Kingdom cohort consisting of 12 SBMA patients and 7 age matched controls. The 12 SBMA patients were split between early and late disease onset patients, and are described in the table below. Code YOB CAG size Age 1st medical encounter Disease duration SBMAFRS UCH0206 1939 40 66 21 32 UCH0081 1943 37 64 13 43 UCH0307 1950 57 13 26 UCH0213 1950 39 60 10 43 UCH0190 1951 45 63 6 47 UCH0210 1955 59 6 42 UCH0309 1956 52 12 UCH0292 1958 57 5 40 UCH0189 1967 45 42 11 34 UCH0179 1969 46 46 5 50 UCH0312 1969 48 3 50 UCH0169 1974 49 35 11 36 In case of bulbar and spinal muscular atrophy genetic confirmation of CAG repeats in AR gene acts a accepted diagnostic readout. One challenge is to have a readout that confirms the severity of disease manifestation, especially as genetic disorder in many patients is compensated by epigenetic network. 5 That is why the present work is based on samples representing both early and late stages of muscular atrophy allowing prognosis to be determined, in particular in respect of severity in clinical manifestation of the disease, as well as a general diagnosis. We have identified top 200 disseminating SBMA-specific CCS, with a False Discovery Rate FDR<0.05. Analysing genetic loci affected by conditional CCS, we performed pathway analysis and demonstrated 10 heavy involvement in SBMA specific profiling of Keratinization (24 genetic loci affected) and Olfactory Transduction (31 genetic loci affected). Importantly, the same analysis demonstrated heavy involvement of T Cell Receptor Signalling Pathway (12 genes affected) and L1CAM Interactions (8 genes affected, L1CAM is a neuronal cell adhesion molecule with a strong implication in cell migration, adhesion, neurite outgrowth, myelination and neuronal differentiation). Most importantly, this analysis reveals an overlap 5 between sites implicated in SBMA regulation and PD-1 checkpoint network implicated in cancer immuno-therapy. This is a first molecular evidence for SBMA and cancer overlap, in the context of muscular atrophy being observed under both conditions. The results of the work are shown in the Figures and tables herein. The identified markers are suitable for detection on nested PCR platform. Tables 1A and Table IB show the markers that were identified by this work. They represent part of the 10 3D genomic regulatory control. There were distinct CCSs in the early phenotype compared to the late showing the CCSs change as the disease progresses and varies between phenotypes. The CCSs can be linked to each clinically defined subgroup to be used as a biomarker tool to predict outcome and progression in patients. The present work therefore provides both diagnostic and prognostic markers. No. Probe RP / Rsum Rprank FC:(classl / class2) 1 Hg38_2_151357305_151361853_151612320_151619007_RF 87.63840883 1 2.283 2 Hg38_13_41466343_41476518_41555919_41561354_RF 288.7780393 2 2.007 3 Hg38_20_23380285_23385557_23532159_23546814_RR 534.5889718 4 1.878 4 Hg38_l_84316044_84322127_84529225_84540074_RF 663.6694959 10 1.87 5 Hg38_l_209333922_209340142_209404224_209420680_FF 446.7372857 3 1.87 6 Hg38_5_177834278_177839098_178009945_178017869_FR 662.5483965 9 1.832 7 Hg38_llJ77781318J77787851J77893153J77899469_FR 732.8885954 12 1.798 8 Hg38_8_48489316_48497835_48710460_48716484_RR 755.6786775 13 1.794 9 Hg38833042243330476753324363733249598F 930.5017332 18 1.788 10 Hg38_ll_7823466_7827013_7890344_7893739_FR 1064.533822 22 1.776 11 Hg38_2_242078290_242088090_242115056_242117195_RR 626.2882701 6 1.776 12 Hg38_4_64204635_64210880_64341978_64349763_RF 1183.854495 T1 1.771 13 Hg38_9_4737518_4739216_4871409_4877222_FF 855.3083509 15 1.767 14 Hg38_6_144636121_144641243_144691336_144697440_RF 578.9188967 5 1.767 15 Hg38_22_47207724_47217624_47356169_47358600_FF 665.6838613 11 1.765 16 Hg381631853018318606633 836.8314653 14 1.764 17 Hg381067354556749237^6 648.2374782 8 1.764 18 Hg381426681688266875502 1342.435576 33 1.76 19 Hg38_ll_63024617_63034264_63124362_63131307_RR 639.5975048 7 1.758 20 Hg38_ll_55823665_55829626_55865366_55868750_FR 866.3041714 17 1.726 21 Hg38_2_20791146_20796987_20975471_20980938_RR 857.2109811 16 1.716 22 Hg38_l_114264796_114271415_114388190_114393574_FF 1043.317342 20 1.702 23 Hg38_3_150148357_150152202_150276483_150282205_RF 1018.4725 19 1.692 24 Hg3833070802307395431626903172869FF 2146.093548 53 1.684 25 Hg382228849719228856896228936338228946445RR 2144.540397 52 1.682 26 Hg38J(J26618971J26632078J26813931J26821389^RR 1596.946758 38 1.682 27 Hg38 17 3298600 3300356 3435567 3441497 RF 1286.046191 32 1.682 28 Hg38_6_141949457_141959891_142112622_142115111_FF 1073.365868 23 1.681 29 Hg38_2_221629362_221633765_221703220_221711044_FF 1177.041857 26 1.679 30 Hg38_18_8164110_8169146_8228637_8240170_RF 1187.605744 28 1.675 31 Hg38_X_83389647_83396643_83505067_83507528_RR 1123.648127 25 1.67 32 Hg38_2_38740614_38746415_38982199_38993639_FF 1062.516677 21 1.666 33 Hg38_2_169562452_169564303_169638099_169647209_FF 1122.728889 24 1.664 34 Hg38^51609399^51612166^5186190V5187484VRF 1207.025498 29 1.658 35 Hg38_l_96786343_96792340J?6953170_96960029_RR 1260.746357 30 1.657 36 Hg38_13_76879860_76881474_77089881_77098142_FF 1281.56965 31 1.653 37 Hg38_12_10235418_10237590_10417499_10425564_RF 1635.909028 39 1.647 38 Hg38_3_151888504_151893566_151931687_151943298_RR 1384.989976 35 1.643 39 Hg38_8_81036889_81041061_81244260_81253029_RF 2113.213401 50 1.641 40 Hg38_21_25447238_25454612_25514175_25521235_RF 2472.139306 68 1.639 41 Hg38_12_39724269_39737447_39830409_39841867_RF 2034.859484 48 1.637 42 Hg3822911175291642630084033014033FR 1376.720339 34 1.635 43 Hg385390377373904695639197630 2497.876062 69 1.63 44 Hg38_2_127388555J.27395831_127412534_127416129_RR 3444.281703 126 1.623 45 Hg38_21_14583254_14600479_14842273_14847749_RF 1987.875145 45 1.622 46 Hg38_22_32455270_32461039_32549159_32556587_FR 1392.694528 36 1.621 47 Hg38_13_77416226_77433379_77635636_77642621_RR 2244.157946 57 1.617 48 Hg38_X_66017310_66021076_66266598_66279138_RR 1554.424806 37 1.616 49 Hg38_9_119814503_119824066_119942887_119944563_RR 2152.405439 54 1.61 50 Hg38_15_96378302_96385292_96582969_96587891_FR 1671.300538 40 1.607 Table 1A (part la) Probe sequence No. Pfp P.value Type 60 mer 1 0 0 SBMA AATGTTGATAAGTATTAGACGACTGGTTTCGATTTTCTTTTAATCACTGCTAAATCTGCA 2 0 0 SBMA TACTTACACTCAACAGGAGGGATATATTTCGAATCATTTTGGGGGCATAAACATAAAACC 3 0 0 SBMA GTAAGAGAAACTGTTCTTTCTGTCAGCTTCGAACTACATTGAAAATCTCTTGTTTGTGTA 4 0 0 SBMA TTTGCATTTATTTGATATATTCCCATTCTCGACCAI111 1 1CAATTGAGTTATTAGTTTT 5 0 0 SBMA CAAACATGTCTAACTCATGCAATTTTCTTCGAGTCTCCATTTGAAAAAAGAGG1111 1IG 6 0 0 SBMA GACTGAAAAAGTTAAGAAAACTTTCTACTCGATTAACACCTATTTTATTTGTGCTGCATT 7 0 0 SBMA CTTCAGAACAGTAAAAAAAAAAAAAAGTTCGACTCCTAI 1 1 Cl ICATCAAGC11ICCATT 8 0 0 SBMA GCTGACTTGATTTTGCTGGATAAGCTTTTCGACTTCCTTATACTAGTAAGAGACTTAAGC 9 0 0 SBMA CAGAGAGGGACATTATATAATGAAATAGTCGAGGTCTGATAGCAACCATTTACCAAACTT 10 0 0 SBMA GCTTCAAAAGGTCCTAGAAATAATCCACTCGAATCCTTGGCTTTTAI 1 1 1 1 Cl ICAGGGA 11 0 0 SBMA AGGAAAGAAACATAAGAATATTATTATTTCGAAGTCATTGAAGATTCACAGCAGGAGACA 12 0 0 SBMA CCAGGCCTTGAAGAGATAATACAGGAATTCGAACCAATGTACATGTTACACATATTGATT 13 0 0 SBMA ACAATCTCTGTTCTTTCTTTCTTTTTTTTCGAGAATCATGGCTTTAAAGACACAGAGATG 14 0 0 SBMA AAATTTAAAGTTTCTTCTTACAAAGCATTCGAAGTGTAAGCCGTCATGATTTGTTTCATA 15 0 0 SBMA AGTACTGAAATATTGTATTGCTACTATTTCGACACACACTTGTATTGAATAAAAGGCGTA 16 0 0 SBMA GTCI 1 1 1 1AGAGATGAACAAAAATAAATTCGATCTGTCTGGTCAACATTCTGGGACAATG 17 0 0 SBMA AAGTGTTAGAGAAAGAAGATTAAGCAATTCGACATTCCCACCAATAAGGTATAAGTATTT 18 0 0 SBMA TCAAGTCACTGGCAGGAAGAACAAGCTCTCGAAAAAATACAGTGACATCTTTATTTGTCT 19 0 0 SBMA TATCCATTTCCAGAAAI 11 1 1CATTATCTCGATGTATGGATTAACTGTGTGATATTAACA 20 0 0 SBMA ATATTGGGATTACTATGCAGATTACATTTCGAGTGTTTTAGGAAGTCATATAATGAACAA 21 0 0 SBMA ATAAAAATGGAGTAGAAATCAGTGAAATTCGAATCATTCATGAAAGGAAAATCTGAGAAG 22 0 0 SBMA GTGTCTGTTACTGATCCTTATAGCTTCTTCGAAGAAACAAAACTATCTTCAAAAATAAGT 23 0 0 SBMA AGTTTGGTAAAGTTTCAGGATAAAAAAATCGAATTAGGAGTCTTGTAATTCCATGTTCAT 24 0 0 SBMA TGTATTGGCATAAAGATAGACAAATAGATCGAGAAGAACAGGATTTTGGAATTGAGATAG 25 0 0 SBMA TGTGAAACAAAGCCCGCTATTCACAGTCTCGACTTTGTTCAGAGTTCAGAATCAATATCT 26 0 0 SBMA CAAATCTTTCCCAAAGTTAAAGTCCAAGTCGAACACAGCTACTACATTAAATATAACAAT 27 0 0 SBMA CTCATCAGAATTGTTATAATAAAAAAGATCGAACAAGACTCTCTTTCTCTAGTAAGTCCT 28 0 0 SBMA AGAAATAAAAGAAGGAGTCAAAATACCTTCGATTTGAGCAGAAAGTCCTGAAGGCACACA 29 0 0 SBMA GATTGTATTACTTCAAAATAAAACTTGATCGAAGAAGTACAAGTCAAAGGCAGACAGCAC 30 0 0 SBMA GAAAAAGAGAGAAACAAACTATTACTTATCGAGTTTTAGATTCTAAAATGTTGTTTAGTA 31 0 0 SBMA AATCAAATGATAGAAACATAGACCAAAGTCGAGTTTAAGGCAAAATGCAGTCTATGAAAA 32 0 0 SBMA TAATCTTTTACATTCTGCTTTAAGCACATCGAI 1 111AAGATTCTCTCAGTTGGAAGAAA 33 0 0 SBMA TTGAACACAGACAAGGTACTAGGTAATATCGAI11IAGCI 1 1 1 1 1 1 IGACI 1 11 ICICCA 34 0 0 SBMA TTCTTGGTATGCCTGG111 1 1 1 1 1 1AATTCGAI111AGCCCTAATCCCATTGTGCTGTAA 35 0 0 SBMA TGACTTCTGCTAGGATACACCAGAAAATTCGAGTATGACAAAGAGCTTAAGCCAAGGTAG 36 0 0 SBMA TACATGGCTTTATTGAAATAACATTCCATCGAGI1 1ICI 1 1 1CAAAGGAGATGGATCCAA 37 0 0 SBMA CGTGACTGTATATCATGTCCTTTGTTAATCGAGACTGGTTAATTTAAAAAGAAAAGAGGT 38 0 0 SBMA TAGAAACAAAAGTTACAGAAATAATCCCTCGATAACATTGTTTTAATTTTCTGAGAAAAA 39 0 0 SBMA CAAGCAAAACAATGGCTTAAATTGTTTCTCGAACAGCTGAAATCCCTGATGTATGCAAAG 40 0 0 SBMA TCCTACAAGAAATGCTAAAGAGAGTTATTCGATGAATTAATACATGCATTTTGAAATTGA 41 0 0 SBMA TCTTAGGTTTGCAAACAGACCAAGTAAGTCGATATTGGTTGGGAACTGGTTAGTAATTAA 42 0 0 SBMA CTAAAAGAAAACATAGGGGAAAAAGTCCTCGATTTTCATAACATTTATCTTAGCCTCAAA 43 0 0 SBMA TTACCCTTTAAGTCAATGCCTCAAAAGTTCGAAAACTGCCTTTGATAATACCAGTGTCTT 44 0 0 SBMA AATGTACACAACCAGTCATAACCAAGTATCGACI11 ICICTTCCCAAGGGAGAGTTTACT 45 0 0 SBMA TATAAACTGGAACTTTCAAATTTCATGCTCGATTACTTAAGGCATGCTATTATAAATAAA 46 0 0 SBMA TTGTGTACTAGTAAACTGCAGGCATCCATCGAATGCTTTGCAGTCAAGAGAAGGCAATGA 47 0 0 SBMA TAAACACGAGCTTTCTCAGCTGTGCTGCTCGAGAI111 1 1AATTAATAGGATAGATGGAT 48 0 0 SBMA CATGGTCACCAAATATGGCATGACAGAATCGACAGAGAAAGCTACGACGCAATAGGAGGT 49 0 0 SBMA ATATTATTCTTTTGAI11 11CCAACCATTCGACGCTGTCCAGTGAAAATATAACACGAGC 50 0 0 SBMA ATCTGTGAGAI1IGCAGCIICI 1 1 1 1GCTCGAATTGAGTTTATTTCAAAGATATTGATAA Table 1A (part lb) Probe Location No. Chr Startl Endl Start2 End2 1 2 151357307 151357336 151618976 151619005 2 13 41466345 41466374 41561323 41561352 3 20 23380287 23380316 23532161 23532190 4 1 84316046 84316075 84540043 84540072 5 1 209340111 209340140 209420649 209420678 6 5 177839067 177839096 178009947 178009976 7 11 77787820 77787849 77893155 77893184 8 8 48489318 48489347 48710462 48710491 9 8 33047644 33047673 33243639 33243668 10 11 7826982 7827011 7890346 7890375 11 2 242078292 242078321 242115058 242115087 12 4 64204637 64204666 64349732 64349761 13 9 4739185 4739214 4877191 4877220 14 6 144636123 144636152 144697409 144697438 15 22 47217593 47217622 47358569 47358598 16 16 31860632 31860661 31871567 31871596 17 10 6735457 6735486 6769271 6769300 18 14 26687519 26687548 26802036 26802065 19 11 63024619 63024648 63124364 63124393 20 11 55829595 55829624 55865368 55865397 21 2 20791148 20791177 20975473 20975502 22 1 114271384 114271413 114393543 114393572 23 3 150148359 150148388 150282174 150282203 24 3 3073923 3073952 3172838 3172867 25 2 228849721 228849750 228936340 228936369 26 X 126618973 126619002 126813933 126813962 27 17 3298602 3298631 3441466 3441495 28 6 141959860 141959889 142115080 142115109 29 2 221633734 221633763 221711013 221711042 30 18 8164112 8164141 8240139 8240168 31 X 83389649 83389678 83505069 83505098 32 2 38746384 38746413 38993608 38993637 33 2 169564272 169564301 169647178 169647207 34 X 51609401 51609430 51874810 51874839 35 1 96786345 96786374 96953172 96953201 36 13 76881443 76881472 77098111 77098140 37 12 10235420 10235449 10425533 10425562 38 3 151888506 151888535 151931689 151931718 39 8 81036891 81036920 81252998 81253027 40 21 25447240 25447269 25521204 25521233 41 12 39724271 39724300 39841836 39841865 42 2 2916395 2916424 3008405 3008434 43 5 39046925 39046954 39197632 39197661 44 2 127388557 127388586 127412536 127412565 45 21 14583256 14583285 14847718 14847747 46 22 32461008 32461037 32549161 32549190 47 13 77416228 77416257 77635638 77635667 48 X 66017312 66017341 66266600 66266629 49 9 119814505 119814534 119942889 119942918 50 15 96385261 96385290 96582971 96583000 Table 1A (part lc) 4 kb Sequence Location No. Chr Startl Endl StartZ EndZ 1 2 151357307 151361306 151615006 151619005 2 13 41466345 41470344 41557353 41561352 3 20 23380287 23384286 23532161 23536160 4 1 84316046 84320045 84536073 84540072 5 1 209336141 209340140 209416679 209420678 6 5 177835097 177839096 178009947 178013946 7 11 77783850 77787849 77893155 77897154 8 8 48489318 48493317 48710462 48714461 9 8 33043674 33047673 33243639 33247638 10 11 7823012 7827011 7890346 7894345 11 2 242078292 242082291 242115058 242119057 12 4 64204637 64208636 64345762 64349761 13 9 4735215 4739214 4873221 4877220 14 6 144636123 144640122 144693439 144697438 15 22 47213623 47217622 47354599 47358598 16 16 31856662 31860661 31871567 31875566 17 10 6735457 6739456 6765301 6769300 18 14 26683549 26687548 26802036 26806035 19 11 63024619 63028618 63124364 63128363 20 11 55825625 55829624 55865368 55869367 21 2 20791148 20795147 20975473 20979472 22 1 114267414 114271413 114389573 114393572 23 3 150148359 150152358 150278204 150282203 24 3 3069953 3073952 3168868 3172867 25 2 228849721 228853720 228936340 228940339 26 X 126618973 126622972 126813933 126817932 27 17 3298602 3302601 3437496 3441495 28 6 141955890 141959889 142111110 142115109 29 2 221629764 221633763 221707043 221711042 30 18 8164112 8168111 8236169 8240168 31 X 83389649 83393648 83505069 83509068 32 2 38742414 38746413 38989638 38993637 33 2 169560302 169564301 169643208 169647207 34 X 51609401 51613400 51870840 51874839 35 1 96786345 96790344 96953172 96957171 36 13 76877473 76881472 77094141 77098140 37 12 10235420 10239419 10421563 10425562 38 3 151888506 151892505 151931689 151935688 39 8 81036891 81040890 81249028 81253027 40 21 25447240 25451239 25517234 25521233 41 12 39724271 39728270 39837866 39841865 42 2 2912425 2916424 3008405 3012404 43 5 39042955 39046954 39197632 39201631 44 2 127388557 127392556 127412536 127416535 45 21 14583256 14587255 14843748 14847747 46 22 32457038 32461037 32549161 32553160 47 13 77416228 77420227 77635638 77639637 48 X 66017312 66021311 66266600 66270599 49 9 119814505 119818504 119942889 119946888 50 15 96381291 96385290 96582971 96586970 Table 1A (part Id) No. probe Primer ID 1 Hg38_2_151357305_151361853_151612320_151619007_RF OBD160.001 2 Hg38_13_41466343_41476518_41555919_41561354_RF OBD160.005 3 Hg38_20_23380285_23385557_23532159_23546814_RR OBD160.009 4 Hg38_l_84316044_84322127_84529225_84540074_RF OBD160.013 5 Hg38_l_209333922_209340142_209404224_209420680_FF OBD160.017 6 Hg38_5_177834278_177839098_178009945_178017869_FR OBD160.021 7 Hg38_ll_77781318_77787851_77893153_77899469_FR OBD160.025 8 Hg38_8_48489316_48497835_48710460_48716484_RR OBD160.029 9 Hg38_8_33042243_33047675_33243637_33249598_FR OBD160.033 10 Hg38_ll_7823466_7827013_7890344_7893739_FR OBD160.037 11 Hg38_2_242078290_242088090_242115056_242117195_RR OBD160.041 12 Hg38_4_64204635_64210880_64341978_64349763_RF OBD160.045 13 Hg38_9_4737518_4739216_4871409_4877222_FF OBD160.049 14 Hg38_6_144636121_144641243_144691336_144697440_RF OBD160.053 15 Hg38_22_47207724_47217624_47356169_47358600_FF OBD160.057 16 Hg38_16_31853018_31860663_31871565_31877473_FR OBD160.061 17 Hg38_10_6735455_6749237_6766912_6769302_RF OBD160.065 18 Hg38_14_26681688_26687550_26802034_26810557_FR OBD160.069 19 Hg38_ll_63024617_63034264_63124362_63131307_RR OBD160.073 20 Hg38_ll_55823665_55829626_55865366_55868750_FR OBD160.077 21 Hg38_2_20791146_20796987_20975471_20980938_RR OBD160.081 22 Hg38_l_114264796_114271415_114388190_114393574_FF OBD160.085 23 Hg38_3_150148357_150152202_150276483_150282205_RF OBD160.089 24 Hg38_3_3070802_3073954_3162690_3172869_FF OBD160.093 25 Hg38_2_228849719_228856896_228936338_228946445_RR OBD160.097 26 Hg38_X_126618971_126632078_126813931_126821389_RR OBD160.101 27 Hg38_17_3298600_3300356_3435567_3441497_RF OBD160.105 28 Hg38_6_141949457_141959891_142112622_142115111_FF OBD160.109 29 Hg38_2_221629362_221633765_221703220_221711044_FF OBD160.113 30 Hg38_18_8164110_8169146_8228637_8240170_RF OBD160.117 31 Hg38_X_83389647_83396643_83505067_83507528_RR OBD160.121 32 Hg38_2_38740614_38746415_38982199_38993639_FF OBD160.125 33 Hg38_2_169562452_169564303_169638099_169647209_FF OBD160.129 34 Hg38_X_51609399_51612166_51861901_51874841_RF OBD160.133 35 Hg38_l_96786343_96792340_96953170_96960029_RR OBD160.137 36 Hg38_13_76879860_76881474_77089881_77098142_FF OBD160.141 37 Hg38_12_10235418_10237590_10417499_10425564_RF OBD160.145 38 Hg38_3_151888504_151893566_151931687_151943298_RR OBD160.149 39 Hg38_8_81036889_81041061_81244260_81253029_RF OBD160.153 40 Hg38_21_25447238_25454612_25514175_25521235_RF OBD160.157 41 Hg38_12_39724269_39737447_39830409_39841867_RF OBD160.161 42 Hg38_2_2911175_2916426_3008403_3014033_FR OBD160.165 43 Hg38_5_39037737_39046956_39197630_39209276_FR OBD160.169 44 Hg38_2_127388555_127395831_127412534_127416129_RR OBD160.173 45 Hg38_21_14583254_14600479_14842273_14847749_RF OBD160.177 46 Hg38_22_32455270_32461039_32549159_32556587_FR OBD160.181 47 Hg38_13_77416226_77433379_77635636_77642621_RR OBD160.185 48 Hg38_X_66017310_66021076_66266598_66279138_RR OBD160.189 49 Hg38_9_119814503_119824066_119942887_119944563_RR OBD160.193 50 Hg38_15_96378302_96385292_96582969_96587891_FR OBD160.197 Table 1A (part le) No. Sequence Primer ID Sequence 1 CACACTGAGACTGATGGTGCGTGAGT OBD160.003 CAGTGTCTGAAGCAAATCCTCTGAC 2 AAACTTCTTAGTGGAGGAGGCTC OBD160.007 AGCCTGGGTGACAGAGTGAGACT 3 AGTGTCTGGAGTTGGAAGAGCAG OBD160.011 ACAGCAAGTTATCCCGAAGATGC 4 CACCTCCTGTGGTTTCTGCTTTATGTGT OBD160.015 GCTTCAAGACATTAGTTTTGGCAATAGT 5 CCCTGTGAGATAGGTGAAGTGGGTGT OBD160.019 ATGGCTGAGTCTGAAAATGGAATGGG 6 GCAAAAGCAATAGCCAGCACCATAGA OBD160.023 ACCAACCTCTCTTCCTTCTCAGCCTG 7 GAGCCCACAAAGCCTAAAATACG OBD160.027 GCCCACACTGTTCTTACACTTGC 8 TGCGTATGTTGAACCAGTCTTGC OBD160.031 GCCTGGAAATGAGGAACCCTGGT 9 GATAATGCCATCGTCAGGTTGAAATC OBD160.035 GCCAAAGCGGAACCAGGTAACTA 10 GCCCTCCTCCATACCAACTCGCT OBD160.039 CCCTTTGCCACCACAGACTTCAG 11 AGGCAATGTGGATGCTGTAGTCAACT OBD160.043 CTTCCCCTGCTGCCATCTAACATCCT 12 CCCTGAGTGAAAATCCAAAATCCTTG OBD160.047 CATTTGCCCAGGATGGTCGGTGGTA 13 ACCCCAACCAGTAGCAGTATCTG OBD160.051 GTTGGCTATCCACTCTTTCTCATCT 14 CTAAAGGAGTGAACTGAAGCAGC OBD160.055 GTTTGCTGAGAATGATGGTTTCCAG 15 CGTTCAGACTTTCCATCAATGTAACA OBD160.059 GCTGTGGTTTACCTCTCTGCTATCTT 16 GGGCTGGAAGAAAATGAAGAGTGACTAC OBD160.063 GCTATTTGCCAAGACCACAGTCAGACCA 17 CATAACTGACTTTACTTTTGGGATGATG OBD160.067 GTAGACAGCATCCAGATTCCTTGAGTGT 18 TTGATGCCCAGGTGCTTGTTTGATGC OBD160.071 GCTGAGAGCATTGTGGAAGAATCT 19 GCAGCCCTTAGGTAGCAAGATGC OBD160.075 GAAGTTATCAAGTTCAACCTCCTATC 20 TGACATCAGGAAGAGACTCAGTGTAT OBD160.079 CTGACTGATGTATCCTACCAATAAGC 21 ACACAGTTGGTAAGTGGCAAAGCC OBD160.083 AACTATTCTAAGGGTCTTGGAAAT 22 TCTGTGATTTTCCTTCTCAAGTTGTG OBD160.087 CATTTTGGTGCCTTCCCACACATAAA 23 GCCAAATAGGACAGACCCACAGC OBD160.091 GTCATTCGTTCCCCAGTCACCTGCTTCA 24 AACACAATCTCACCCCAAATCCCAGC OBD160.095 CTTACCCATCTGACTGTGIICIIAGC 25 CTACTCTCAATGTGACGACTGGAAGG OBD160.099 GTAGGGAGGCAGAAATGGTGTGTTTG 26 TATGAGTCCCCAGAGGATAGAAGAAT OBD160.103 TGGCACTACATAAAATCACCCATTGT 27 CAGCAAGATGCCTGAACAGACTTTAC OBD160.107 TATCCACAACGAGGTGAGGACTCTCC 28 CCAGAAAAGCAGCAGTTACACCTACAGG OBD160.111 CTTGAGAGTAAAGGTGGTAACATAACAC 29 ATGAAGGGCACCAAAAGATGCTACCT OBD160.115 TGGCAGCAAACTCTCACCTTCTGGAG 30 CGGGAGGCTCAAAAGAGGGAGAAAGA OBD160.119 TTGGCTAACACAGTCTCATCCAGTGA 31 GAGGTGTTTCAGTGAGAGTAGAGAGG OBD160.123 AGAGCCACATTCAATAGACGACCCGT 32 TGTAGTCACCAATACCGTAAAACCCC OBD160.127 CAAAGACTACTGGGTAACTACAGACG 33 TTTCCTTATCTTGGTGCTGTTACATAGC OBD160.131 GGCTTTTCTGTGATGCTCTGGTTGGCAA 34 TTTCTCCTCAAGATGGGTCCTATTTT OBD160.135 CTGCCACCTCCTCTGTATGGI IO IA 35 GACACACACAGAGGTAGTAGAGATTC OBD160.139 GCTCTCTCAGCCCAGGTGCTTAGTTT 36 CGAAGGATTGACTCTGATAGGCTTAC OBD160.143 TGCTTGGCTGGCTCTAAAGGCTTGGA 37 ACTTTTATTCCACTGGCAGCAAGGTAAT OBD160.147 GAAGACAGATGACAGAAGACAGGTGGCT 38 AAGGAGTTGTTCTCAAGGTATGTTAC OBD160.151 CTGACTGATTGCTCCTATTGGTAAAT 39 CAGCCCAAAGCGAGGGTGGAAAACAT OBD160.155 GTGAACTACTCTTTCTTGCTGCTTCC 40 ACCTGTCCTACAAGAAATGCT OBD160.159 ACATGCATTTTGAAATTGATAGTT 41 CAGTAACTAATCTTCTCTGGTGACAA OBD160.163 ACTCTACAGATTCCCAGGACCTACTG 42 CAAGACCACCAAAATACAGAATGGAG OBD160.167 GAGAAACGATTCCTAACCCCTACCAT 43 CCTTTTCCTCAGG1 1 1C1CTTTTCCC OBD160.171 GAAGCCAAGCGAAGGCATCTGACTCA 44 GAGGAGCGAAAGAAAGGGTTTTAGACTC OBD160.175 CACTAAAAGTCCTAAAGAAGAAGCCAAA 45 GGAATCAGAAGAACTTGTGTGACCCA OBD160.179 CAGTGAGAGAGAGCAATGGAGGAAGC 46 GTTGGTAGAATGAATCAATGGTAGAATG OBD160.183 GCCTGGGTGACAGAGGGAGACTC 47 GCTTCAAACAGACAAAGGTATTTCCT OBD160.187 GCCCAGAGACTATGCTTTGAGAAT 48 CCACCCAGCAGCAAAAGCAGCAG OBD160.191 CCTTCTGCTTCTCCACCACCCAT 49 CCCTTGTAGTTGGAAAGCAGCCGCAGCC OBD160.195 AATGTAGCCAGTGTCACAGGCAGAAGTG 50 GTGCCTCTCCTTACACTCATCTCTCA OBD160.199 GCGAAAGACTCTGTAACTGTGTTGGC Table 1A (part If) No. Probe Marker 1 Hg38_2_151357305_151361853_151612320_151619007_RF OBD160.001.003 2 Hg38_13_41466343_41476518_41555919_41561354_RF OBD160.005.009 3 Hg38_20_23380285_23385557_23532159_23546814_RR OBD160.011.013 4 Hg38_l_84316044_84322127_84529225_84540074_RF OBD160.015.017 5 Hg38_l_209333922_209340142_209404224_209420680_FF OBD160.019.021 6 Hg38_5_177834278_177839098_178009945_178017869_FR OBD160.023.025 7 Hg38_ll_77781318_77787851_77893153_77899469_FR OBD160.025.027 8 Hg38_8_48489316_48497835_48710460_48716484_RR OBD160.029.031 9 Hg38_8_33042243_33047675_33243637_33249598_FR OBD160.033.035 10 Hg38_ll_7823466_7827013_7890344_7893739_FR OBD160.037.039 11 Hg38_2_242078290_242088090_242115056_242117195_RR OBD160.041.043 12 Hg38_4_64204635_64210880_64341978_64349763_RF OBD160.045.047 13 Hg38_9_4737518_4739216_4871409_4877222_FF OBD160.049.051 14 Hg38_6_144636121_144641243_144691336_144697440_RF OBD160.053.055 15 Hg38_22_47207724_47217624_47356169_47358600_FF OBD160.057.059 16 Hg38_16_31853018_31860663_31871565_31877473_FR OBD160.061.063 17 Hg38_10_6735455_6749237_6766912_6769302_RF OBD160.065.067 18 Hg38_14_26681688_26687550_26802034_26810557_FR OBD160.069.071 19 Hg38_ll_63024617_63034264_63124362_63131307_RR OBD160.073.075 20 Hg38_ll_55823665_55829626_55865366_55868750_FR OBD160.077.079 21 Hg38_2_20791146_20796987_20975471_20980938_RR OBD160.081.083 22 Hg38_l_114264796_114271415_114388190_114393574_FF OBD160.085.087 23 Hg38_3_150148357_150152202_150276483_150282205_RF OBD160.089.091 24 Hg38_3_3070802_3073954_3162690_3172869_FF OBD160.093.095 25 Hg38_2_228849719_228856896_228936338_228946445_RR OBD160.097.099 26 Hg38_X_126618971_126632078_126813931_126821389_RR OBD160.101.103 27 Hg38_17_3298600_3300356_3435567_3441497_RF OBD160.105.107 28 Hg38_6_141949457_141959891_142112622_142115111_FF OBD160.109.111 29 Hg38_2_221629362_221633765_221703220_221711044_FF OBD160.113.115 30 Hg38_18_8164110_8169146_8228637_8240170_RF OBD160.117.119 31 Hg38_X_83389647_83396643_83505067_83507528_RR OBD160.121.123 32 Hg38_2_38740614_38746415_38982199_38993639_FF OBD160.125.127 33 Hg38_2_169562452_169564303_169638099_169647209_FF OBD160.129.131 34 Hg38_X_51609399_51612166_51861901_51874841_RF OBD160.133.135 35 Hg38_l_96786343_96792340_96953170_96960029_RR OBD160.137.139 36 Hg38_13_76879860_76881474_77089881_77098142_FF OBD160.141.143 37 Hg38_12_10235418_10237590_10417499_10425564_RF OBD160.145.147 38 Hg38_3_151888504_151893566_151931687_151943298_RR OBD160.149.151 39 Hg38_8_81036889_81041061_81244260_81253029_RF OBD160.153.155 40 Hg38_21_25447238_25454612_25514175_25521235_RF OBD160.157.159 41 Hg38_12_39724269_39737447_39830409_39841867_RF OBD160.161.163 42 Hg38_2_2911175_2916426_3008403_3014033_FR OBD160.165.167 43 Hg38_5_39037737_39046956_39197630_39209276_FR OBD160.169.171 44 Hg38_2_127388555_127395831_127412534_127416129_RR OBD160.173.175 45 Hg38_21_14583254_14600479_14842273_14847749_RF OBD160.177.179 46 Hg38_22_32455270_32461039_32549159_32556587_FR OBD160.181.183 47 Hg38_13_77416226_77433379_77635636_77642621_RR OBD160.185.187 48 Hg38_X_66017310_66021076_66266598_66279138_RR OBD160.189.191 49 Hg38_9_119814503_119824066_119942887_119944563_RR OBD160.193.195 50 Hg38_15_96378302_96385292_96582969_96587891_FR OBD160.197.199 Table 1A (part lg) No. probe RP / Rsum Rprank FC:(classl / class2) 51 Hg38_4_37200238_37206260_37300406_37312473_FF 2932.387886 93 1.603 52 Hg38^ 1732.032487 41 1.602 53 Hg38^21J6639172J6644423J6670368J6680104JF 3320.296898 119 1.601 54 Hg38 2 4265627T4^ 2433.098065 66 1.599 55 Hg38_10_25043685_25049585_25100349_25104868_RR 2030.307559 47 1.598 56 Hg38_l_229090863_229096006_229196083_229202342_FR 2179.775328 55 1.597 57 Hg38_13_105283036_105288043_105320265_105325556_RR 1894.786347 43 1.597 58 Hg38_12_103957683_103963295_104120354_104125638_RR 2134.567802 51 1.592 59 Hg38_6_114008656_114013787_114232226_114238214_RF 1834.397344 42 1.588 60 Hg38_8_140877455_140883144_140932435_140938098_RF 2969.154809 97 1.585 61 Hg38_4_136781505J.36792883J36902701J36917925JR 1926.209278 44 1.584 62 Hg3817447262084472833144900687^4 3766.109078 142 1.583 63 Hg38_8_116664671J.16672423J16798829_116802256_RR 2372.310095 62 1.582 64 Hg38_3_105989527_105998279_106059965_106070080_FR 150657.5165 69345 1.581 65 Hg38_2_112740760_112742979_112765786_112772711_RF 2216.789753 56 1.58 66 Hg38_18_9337930_9343491_9573987_9583586_RR 2016.059075 46 1.58 67 Hg38_ll_19074376_19084676_19339671_19348554_FR 2412.878673 65 1.579 68 Hg38_ll_57219000_57228121_57426633_57429019_FF 52224.03779 6959 1.576 69 Hg38_ll_12078291_12088535_12276885_12282796_FF 2992.859117 99 1.575 70 Hg38^152885427J52900293^15306811V153076707^FR 2107.102525 49 1.574 71 Hg38^ 3119.590551 104 1.572 72 Hg38^ 2412.337745 64 1.572 73 Hg38_8_31019968_31023828_31152507_31157947_F R 3265.30875 113 1.571 74 Hg38_7_30496219_30498858_30628404_30631817_FF 2885.244353 89 1.571 75 Hg38_X_41694532_41696489_41776262_41781759_FF 2614.17827 75 1.57 76 Hg38_6_51827509_51843341_51906482_51917695_FF 24590.08703 1846 1.568 77 Hg38_4_52550935_52553766_52741887_52744874_RF 2398.639908 63 1.568 78 Hg38_4_143208146_143211670143254394143265663FR 117290.0204 40943 1.567 79 Hg3827^ 2822.115975 86 1.567 80 Hg383386460393029417553_4 2371.626586 61 1.567 81 Hg38^8J05746180J05747310J05814873J05824107JR 2281.090504 58 1.567 82 Hg38_20_47934845_47942853_47960362_47966156_RF 2812.677411 84 1.566 83 Hg38_l_193673926_193687017_193767073_193774723_FR 2511.193509 70 1.566 84 Hg38_X_55562087_55565924_55755522_55768422_RF 2890.107857 90 1.565 85 Hg38_12_22051055_22053335_22293062_22296971_FR 3103.749832 103 1.564 86 Hg38_5_168367648_168371678_168496703_168499633_RF 2705.325572 80 1.564 87 Hg38_9_13378184_13386623_13453370_13455410_RR 2293.493641 59 1.564 88 Hg38JL13607623J3610565J3677034J3689726^RR 3789.680583 144 1.563 89 Hg381158836157158842400158905246158912243FF 2663.851596 76 1.563 90 Hg38^59529259^59533399^59556418^59563869^RF 3642.187614 135 1.56 91 Hg38_l_172365073_172375924_172561646_172570053_RR 3195.829634 108 1.558 92 Hg38_l_167272741_167278581_167541602_167544034_FF 2582.676531 72 1.558 93 Hg38_l_27783032_27786599_27834284_27836433_FF 2679.371207 78 1.557 94 Hg38_2_144038117_144048675_144274589_144280493_FF 2464.995797 67 1.557 95 Hg38_17_41002849_41006661_41059440_41062968_RF 2959.335905 96 1.556 96 Hg38_ll_90904893_90913850_91035518_91039190_F F 2939.352384 94 1.554 97 Hg38_l_247706861_247710350_247812273_247815652JR 2718.801607 81 1.554 98 Hg381223014365230203772 2861.202321 88 1.552 99 Hg38JL28348510J8364344J8414655J8418162JF 2688.720003 79 1.551 100 Hg38_17_35578150_35580887_35656691_35659920_FF 3346.702466 121 1.55 Table 1A (part 2a) Probe sequence No. pfp P.value Type 60 mer 51 0 0 SBMA ATACAGGTATCAAATCATCTAGTTGTACTCGATGTATAAAAATCACAAGCATTCCTATAC 52 0 0 SBMA TTTAGGGTCI 111 Cl 11ATCCTTGATCTTCGAGAAGATGTTGAGTTTTATCAGATGCTTT 53 0 0 SBMA TATTTGTTATCTATTACTTCCTAACAAATCGAGGACCTGAATTACTTATCACCCTTCTCA 54 0 0 SBMA TCTGTTTAGCAAATAAACACAAAAAGTATCGACAGATTGACCAG 1 1 1 1 1 AG 1TGTAGCAC 55 0 0 SBMA ACTGAAGTCCCAGTAGAACAGAAGAGAATCGAAAGATTCTGAATGGGGAAAAACTTACTC 56 0 0 SBMA CACTTAAGAGCCAGCTATTTGACTGAATTCGAAAAGCTTCTACCAAAAAAATCCTTAAAA 57 0 0 SBMA TTTCCACTGTTTTCTTACAACTTTCCCTTCGATTTGTCTTAGCAGACATTTTAAGTTACA 58 0 0 SBMA AATGGAAAAATTCCTGGATTAAGTTATGTCGATACAATCAAAI Illi 1AAGCATTTAAAA 59 0 0 SBMA CCCATGAGTAAATGTAGACCTATGTCTATCGACGTATACCCTATGGAGAGGATATTCCCT 60 0 0 SBMA CACATCTAACACAATTCACAGTACAAAATCGAATCAAAGCTGTGTCACAAACTATGTAAC 61 0 0 SBMA TAAAAATGTAAACGGCCTG Illi 1AAACTCGATGTTTGATCATTTAAATGCATTATGTCT 62 0 0 SBMA ATAATTTCCACATGTTCTATTGGTCCAATCGACTGAAGCACCAAAATTAAAAATAI Illi 63 0 0 SBMA CTTGATCTACTGAACATATCTTGAGTTTTCGACTGG1 1 1 1 1C1CCTCATTATATTTTCCT 64 0.087 8738 67 0.0065 61035 SBMA AGCCTGTGATGGCAAGACTTGCCAAAACTCGAGTTGCCCAGGTATGCATCTTTAGAAAGG 65 0 0 SBMA AAAATCTTTTCCAGAAGTTGTTTCCAGATCGAGACTTGGACTAGAATTAAGTCTGTGAAC 66 0 0 SBMA TGCCTTGATGATTGGAAGAGATATAACTTCGAAAGTATAAATTCTCTAAATTCTAATTTT 67 0 0 SBMA CTGCCTI 1 1AATCCTATGTGGAAATTGGTCGAGTTAI Illi GACAATTGAACI1 11IGGT 68 0.000 1820 18 0.0000 013638 285394 7602 SBMA ACCCAGAAGAAAGACTGCCAAATCTTCCTCGAACCAAAGAACATGGGAATGGTTCAGAGG 69 0 0 SBMA TAGTCTATTTCTGTTCTAGTATTTATTGTCGAACACATTTCTCAATATCATCTATTTGGT 70 0 0 SBMA CACTCAGAATGTTAATGTATGTAATTATTCGATCATGTCTCTTTCCACATGTCTTCTTCT 71 0 0 SBMA AACAAACTAGACATTGAAGAAATGTACCTCGATACTATTCTAATCTCCCATTTAGTAGGC 72 0 0 SBMA AGATCCCTTGTACACTGTATACTGTTTGTCGAAATACCTACGAGTCCTAAAATATAGTTC 73 0 0 SBMA GATATTGGACAGGATCAACAAAAAGGAATCGACTCGTGTATATGTTTGATATATCCCACA 74 0 0 SBMA CACTTTCGTAATTTGTCATCAGATAACTTCGATGAACTTGGCACCAAGGTCAGTATGAGA 75 0 0 SBMA CTATATGTTTTGTTCCCTATCATGCCTTTCGATTACTCTAAGATTTAAAGTCATGTGGAG 76 0 0 SBMA GGAATCACATGGGCAAGAGAGCTGAGACTCGAATGTCCCCCACCATCTTACACATCATTG 77 0 0 SBMA CATTACCTGACCAGGTCAATCCAGAATTTCGACAAAAACATTGTAGGATGAAAAGAGGAG 78 0.024 2079 64 0.0010 67174 SBMA TCCAAAGTTTCAACTTACAATCACATCTTCGACTCCTTTGCATGTTTTCTTGCATCCACT 79 0 0 SBMA CCTTTTCAAAAAAAAACAACTCTCATTCTCGATGACATCAATGGTTTTGCAGTATTGAGC 80 0 0 SBMA GGAATCTTCAAAGAATAAGTG1 1 1 1 1CATCGAACATCATAATGTTCTACTTGCAAAACAG 81 0 0 SBMA TTAACTCCAAATTTCCAAGTCAGTTAACTCGACLI1 1 1 1C1GTTTCAGTAACCAACCCAG 82 0 0 SBMA ACTGCAGATCTGTACCCAAGTGATATGATCGACATTCCAGTAAGACTTGTCTTTTATTGG 83 0 0 SBMA GGAACACTTCTCTAAGAACCTGAATTATTCGAGCTTCAAATACAAAACATTTGGGCTCAA 84 0 0 SBMA TAATCCCTTTCAATTTCGTTAAGTTTCCTCGATTAAGCCATGCATTGATACCTGACCCAA 85 0 0 SBMA ATGCAGTTCATCTTTCCCTCAGTAGATATCGAGACTAAGAAACAAACACTTGTCAAAATA 86 0 0 SBMA TTATAAACATCTTTTGGAGTTCTGTACTTCGAGTTTTGGAATCTGGCAGTGGAACTTCAG 87 0 0 SBMA 1 1 1 ILI ICCTAATTTTGGTTAGCCAGTATCGAGTCTTAGAAGTATTCAATTTGCAATTTG 88 0 0 SBMA AAATTGAAATGTAACAAGTCTGCATTTGTCGAAACAAATATTTGTCTACTGCATTGTTAA 89 0 0 SBMA CATCACTTAAAAACCTTGTTAACAATCTTCGAGGTTACCATAACCCATTATTTTAAGCTG 90 0 0 SBMA TTTTAAAGAATGCAGAAAAAAAACAAAATCGACAAACAGTTCACACAATAACACTATGTG 91 0 0 SBMA Illi 1AAGGTTATGTGTTTGAGTTTGAATCGAAAAGAAGTATTACACTATTTTGCTCCCC 92 0 0 SBMA ACGATGAAGATAATGTTACATTTATCATTCGAAGTTAAAGTTTACTTTCACAGGACATAA 93 0 0 SBMA TTGTCTATCTCTTTTCCTTAGAAGACTCTCGAAAACAAAAACAAACAAAAAAATAAAAAT 94 0 0 SBMA CTATGATTTAACTTTACTTCATTAGGTATCGAATTACAACAAAAAAACCCCCAAAATCCT 95 0 0 SBMA CTTGGAAGGTTCAATGTGAAAGAAAGAGTCGATTTTGAAATATTATATAGATTCAGGAGA 96 0 0 SBMA AATTTATCTCATTTCAGCATTGTATCAGTCGAATAATCCCACAGGAAAACCAAGTTGGCC 97 0 0 SBMA CATCATAGGTACCTTAAGAGGTAGACTTTCGAAATACATAGTCAGTTCCCAGTTTGTATA 98 0 0 SBMA TTTGTATATGGGCTCAGTAAAATGTGAATCGAACTTCTGCTTTTAAAATACTCTACTCTC 99 0 0 SBMA CAAAGAAATGTTGTTCATGAAACTTATATCGACATAAAGAGCGTTAGGGCAAATTATAAG 100 0 0 SBMA AAAAAAAAAGAAAACAGAAATTTGCAACTCGAAAAAGGAACCTTGATTCTCTGAGTGAAT Table 1A (part 2b) Probe Location No. Chr Startl Endl Start2 End2 51 4 37206229 37206258 37312442 37312471 52 3 98365697 98365726 98383507 98383536 53 21 16644392 16644421 16680073 16680102 54 2 42656273 42656302 42702637 42702666 55 10 25043687 25043716 25100351 25100380 56 1 229095975 229096004 229196085 229196114 57 13 105283038 105283067 105320267 105320296 58 12 103957685 103957714 104120356 104120385 59 6 114008658 114008687 114238183 114238212 60 8 140877457 140877486 140938067 140938096 61 4 136792852 136792881 136902703 136902732 62 17 44728300 44728329 44900689 44900718 63 8 116664673 116664702 116798831 116798860 64 3 105998248 105998277 106059967 106059996 65 2 112740762 112740791 112772680 112772709 66 18 9337932 9337961 9573989 9574018 67 11 19084645 19084674 19339673 19339702 68 11 57228090 57228119 57428988 57429017 69 11 12088504 12088533 12282765 12282794 70 4 152900262 152900291 153068113 153068142 71 1 47119404 47119433 47242495 47242524 72 13 27257536 27257565 27412664 27412693 73 8 31023797 31023826 31152509 31152538 74 7 30498827 30498856 30631786 30631815 75 X 41696458 41696487 41781728 41781757 76 6 51843310 51843339 51917664 51917693 77 4 52550937 52550966 52744843 52744872 78 4 143211639 143211668 143254396 143254425 79 2 79146469 79146498 79293197 79293226 80 3 386462 386491 428168 428197 81 8 105747279 105747308 105814875 105814904 82 20 47934847 47934876 47966125 47966154 83 1 193686986 193687015 193767075 193767104 84 X 55562089 55562118 55768391 55768420 85 12 22053304 22053333 22293064 22293093 86 5 168367650 168367679 168499602 168499631 87 9 13378186 13378215 13453372 13453401 88 4 13607625 13607654 13677036 13677065 89 1 158842369 158842398 158912212 158912241 90 2 59529261 59529290 59563838 59563867 91 1 172365075 172365104 172561648 172561677 92 1 167278550 167278579 167544003 167544032 93 1 27786568 27786597 27836402 27836431 94 2 144048644 144048673 144280462 144280491 95 17 41002851 41002880 41062937 41062966 96 11 90913819 90913848 91039159 91039188 97 1 247710319 247710348 247812275 247812304 98 12 23014367 23014396 23180777 23180806 99 4 28364313 28364342 28418131 28418160 100 17 35580856 35580885 35659889 35659918 Table 1A (part 2c) 4 kb Sequence Location No. Chr Startl Endl Start2 End2 51 4 37202259 37206258 37308472 37312471 52 3 98361727 98365726 98383507 98387506 53 21 16640422 16644421 16676103 16680102 54 2 42656273 42660272 42698667 42702666 55 10 25043687 25047686 25100351 25104350 56 1 229092005 229096004 229196085 229200084 57 13 105283038 105287037 105320267 105324266 58 12 103957685 103961684 104120356 104124355 59 6 114008658 114012657 114234213 114238212 60 8 140877457 140881456 140934097 140938096 61 4 136788882 136792881 136902703 136906702 62 17 44724330 44728329 44900689 44904688 63 8 116664673 116668672 116798831 116802830 64 3 105994278 105998277 106059967 106063966 65 2 112740762 112744761 112768710 112772709 66 18 9337932 9341931 9573989 9577988 67 11 19080675 19084674 19339673 19343672 68 11 57224120 57228119 57425018 57429017 69 11 12084534 12088533 12278795 12282794 70 4 152896292 152900291 153068113 153072112 71 1 47115434 47119433 47238525 47242524 72 13 27253566 27257565 27412664 27416663 73 8 31019827 31023826 31152509 31156508 74 7 30494857 30498856 30627816 30631815 75 X 41692488 41696487 41777758 41781757 76 6 51839340 51843339 51913694 51917693 77 4 52550937 52554936 52740873 52744872 78 4 143207669 143211668 143254396 143258395 79 2 79142499 79146498 79293197 79297196 80 3 386462 390461 424198 428197 81 8 105743309 105747308 105814875 105818874 82 20 47934847 47938846 47962155 47966154 83 1 193683016 193687015 193767075 193771074 84 X 55562089 55566088 55764421 55768420 85 12 22049334 22053333 22293064 22297063 86 5 168367650 168371649 168495632 168499631 87 9 13378186 13382185 13453372 13457371 88 4 13607625 13611624 13677036 13681035 89 1 158838399 158842398 158908242 158912241 90 2 59529261 59533260 59559868 59563867 91 1 172365075 172369074 172561648 172565647 92 1 167274580 167278579 167540033 167544032 93 1 27782598 27786597 27832432 27836431 94 2 144044674 144048673 144276492 144280491 95 17 41002851 41006850 41058967 41062966 96 11 90909849 90913848 91035189 91039188 97 1 247706349 247710348 247812275 247816274 98 12 23014367 23018366 23180777 23184776 99 4 28360343 28364342 28414161 28418160 100 17 35576886 35580885 35655919 35659918 Table 1A (part 2d) No. probe Primer ID 51 Hg38_4_37200238_37206260_37300406_37312473_FF OBD160.201 52 Hg38_3_98352533_98365728_98383505_98386616_FR OBD160.205 53 Hg38_21_16639172_16644423_16670368_16680104_FF OBD160.209 54 Hg38_2_42656271_42661181_42695432_42702668_RF OBD160.213 55 Hg38_10_25043685_25049585_25100349_25104868_RR OBD160.217 56 Hg38_l_229090863_229096006_229196083_229202342_FR OBD160.221 57 Hg38_13_105283036_105288043_105320265_105325556_RR OBD160.225 58 Hg38_12_103957683_103963295_104120354_104125638_RR OBD160.229 59 Hg38_6_114008656_114013787_114232226_114238214_RF OBD160.233 60 Hg38_8_140877455_140883144_140932435_140938098_RF OBD160.237 61 Hg38_4_136781505_136792883_136902701_136917925_FR OBD160.241 62 Hg38_17_44726208_44728331_44900687_44908527_FR OBD160.245 63 Hg38_8_116664671_116672423_116798829_116802256_RR OBD160.249 64 Hg38_3_105989527_105998279_106059965_106070080_FR OBD160.253 65 Hg38_2_112740760_112742979_112765786_112772711_RF OBD160.257 66 Hg38_18_9337930_9343491_9573987_9583586_RR OBD160.261 67 Hg38_ll_19074376_19084676_19339671_19348554_FR OBD160.265 68 Hg38_ll_57219000_57228121_57426633_57429019_FF OBD160.269 69 Hg38_ll_12078291_12088535_12276885_12282796_FF OBD160.273 70 Hg38_4_152885427_152900293_153068111_153076707_FR OBD160.277 71 Hg38_l_47112037_47119435_47237146_47242526_FF OBD160.281 72 Hg38_13_27255589_27257567_27412662_27420769_FR OBD160.285 73 Hg38_8_31019968_31023828_31152507_31157947_FR OBD160.289 74 Hg38_7_30496219_30498858_30628404_30631817_FF OBD160.293 75 Hg38_X_41694532_41696489_41776262_41781759_FF OBD160.297 76 Hg38_6_51827509_51843341_51906482_51917695_FF OBD160.301 77 Hg38_4_52550935_52553766_52741887_52744874_RF OBD160.305 78 Hg38_4_143208146_143211670_143254394_143265663_FR OBD160.309 79 Hg38_2_79143668_79146500_79293195_79300892_FR OBD160.313 80 Hg38_3_386460_393029_417553_428199_RF OBD160.317 81 Hg38_8_105746180_105747310_105814873_105824107_FR OBD160.321 82 Hg38_20_47934845_47942853_47960362_47966156_RF OBD160.325 83 Hg38_l_193673926_193687017_193767073_193774723_FR OBD160.329 84 Hg38_X_55562087_55565924_55755522_55768422_RF OBD160.333 85 Hg38_12_22051055_22053335_22293062_22296971_FR OBD160.337 86 Hg38_5_168367648_168371678_168496703_168499633_RF OBD160.341 87 Hg38_9_13378184_13386623_13453370_13455410_RR OBD160.345 88 Hg38_4_13607623_13610565_13677034_13689726_RR OBD160.349 89 Hg38_l_158836157_158842400_158905246_158912243_FF OBD160.353 90 Hg38_2_59529259_59533399_59556418_59563869_RF OBD160.357 91 Hg38_l_172365073_172375924_172561646_172570053_RR OBD160.361 92 Hg38_l_167272741_167278581_167541602_167544034_FF OBD160.365 93 Hg38_l_27783032_27786599_27834284_27836433_FF OBD160.369 94 Hg38_2_144038117_144048675_144274589_144280493_FF OBD160.373 95 Hg38_17_41002849_41006661_41059440_41062968_RF OBD160.377 96 Hg38_ll_90904893_90913850_91035518_91039190_FF OBD160.381 97 Hg38_l_247706861_247710350_247812273_247815652_FR OBD160.385 98 Hg38_12_23014365_23020377_23180775_23184338_RR OBD160.389 99 Hg38_4_28348510_28364344_28414655_28418162_F F OBD160.393 100 Hg38_17_35578150_35580887_35656691_35659920_FF OBD160.397 Table 1A (part 2e) No. Sequence Primer ID Sequence 51 GGAATAGAGGGAAGAAAACCCATAAA OBD160.203 CTCTCTGTTTGTCTGTTATTGGTGTAT 52 AGTCTGTAAGGTTTCCTATGAGAAGC OBD160.207 GAAACGAATACCCCTGATGAAGATAG 53 CTCAGATTTCTCACCTGTAGAGCAGT OBD160.211 GGAAAAGTGAAGAATAAGCACCCATC 54 TTCTGGTAGCAGTGGTGGGAGTGTCA OBD160.215 AATGCCATACTCATACTCACCGTGCT 55 GCCTTGAGAACCTTAGAACAATGCCA OBD160.219 GGAGAAATCCCAGTTACACAGTTGGC 56 TAAGTCCAGGAGATTGAGGCTGC OBD160.223 AGTAACTAAGTCTCTACCTTCTTTGC 57 CAATGTGTCTAAGTAACGCCTGTGTG OBD160.227 GAAGAACATAACTGCCCCTGCTCCAG 58 TGCTGGCTGGGATTACAGGCGTA OBD160.231 CCACAGACGGTCAACAACAAAATGT 59 GATTGGTAGAGGAAAGAGAAGCAGAGAA OBD160.235 GTGCCAGAAAGGGTTATGCTGTTAGTGA 60 CTAAGAAGACAACACAACCTCCTC OBD160.239 GTATGCTGCTTACACCAGATAACTTA 61 GAGGAACTCAGAAGACTGGCTTTAGG OBD160.243 CACTGGAAAAGAGGCAGGTTTGAGAC 62 GCCACCTTCCCAGAAAGTGAGGC OBD160.247 GACCCCAAAGCACTCTGGACATC 63 GCTCTACTCTTTCCCTACAGGCTG OBD160.251 AGGAATAGAAAAGTGTAGCCACCCTA 64 TTGTGCTGTCTGGAGTTGTAGGAGGG OBD160.255 CCCTACTTCATCTCCTCTACACACAA 65 TCATTGTGTGGCTCTGACTTCCCAGT OBD160.259 CCGAATAGCCAAGGCAGAACAGCATA 66 TACTTCCTCTTACTTTTCTCCCCAGA OBD160.263 GTCCTCTGGTGCTCTTGATACCTACG 67 CCATCTTTCATCCACTCATCCCTCCA OBD160.267 GAATCCATCATAATGCTGACTCTGAA 68 CCCTGGGTCCCTCTCTTATCATC OBD160.271 GCCTCCACTCCACATCTCCCATC 69 AGAGCCGAGTTGTCCCAGCAGAG OBD160.275 GCAGGTCTCTGAGTAGGCACAAC 70 GAAAATGAGAGAGGGAGAAGGGAGGG OBD160.279 CCAATACGACTGGTGTTCCTTGTAAG 71 CTCAGTAGACGCAGAAAACGCTT OBD160.283 ATCTCTCTATTCCTATTTCCAGCCTA 72 GCTGGCAGGTTCGGTGTCTTGTG OBD160.287 GGAAAAGTCTGGCTGGGAGATGC 73 CAGTTCACAGGTCAGTATCCTTTCTG OBD160.291 CTTTGCCAACTTTTGTCCTTATTGCC 74 GTAATCACCACCAGTCTGTAAATAGC OBD160.295 GGTAGGACCCAAGAGTCAGATTTA 75 CTATTGAGGATTTCTAAAAGGAGGTC OBD160.299 TGAGCAATGAGCCCCTAAATACCAGG 76 GTGTCAGCAGATGTAGCCAGTAGCCA OBD160.303 TGCCAGATGACAAAATGGGAAGCGTA 77 GATTGGAACCTGTGAGCCACCAG OBD160.307 CTCACAGGCAAGATACTTCCACGGG 78 GGCTAAACTTCCTTCCTTCAGAATGC OBD160.311 CTCAAGTTGGGAGGGCTGATGGAAAC 79 TGGGTCTTCTA1 1 1 1 (_ 1 1AGTCTGGC OBD160.315 ACACCCACAGAAACTAAGCAGCCAGT 80 CTTGTTTCTCTGCTCACTGGCTACTC OBD160.319 GGCI......1......1......IGGTTTTGCI 1 1 IGGTGTCC 81 GCACTTCACTGCTCCCCTTGCCAGC OBD160.323 CTGTTCTCCCAAGTCTCTAACTGTAGGC 82 CCCCAGCCTCGTGAGAGAGTCTA OBD160.327 CGAAGAGCCCCAACCCAACACAT 83 CCTGTGCTTCTGAAATGTGCTCTGCT OBD160.331 GCTATTTACCCTCAGAGTAGTATCAT 84 TAGCCGACTCTTGGCATTTATGAGGG OBD160.335 GCACCCTTGTATTACTTATCTATGGC 85 GCCTGGGTGACAGAGCAAGACTC OBD160.339 CAGCAAATACCCCAAATCCTGGA 86 TTCCAACCTCAGTGACAGAGTGA OBD160.343 ACACAGTTAGTAAACACCACAGGTAT 87 GGAAGTTCAGGAATGTGGTGTGCTCT OBD160.347 CAACTCTGGAAAATGCTTCTTGTGC 88 GGGATTGTGCTCTCCTTTGTTGACCA OBD160.351 CAGAACTTTCACTTGAGGTCCCATCA 89 CCTGGGACACTCACTCACAAAAGCATA OBD160.355 GTAGAAAGACTAAAAGACAAACCTCTCA 90 GCTGGAACAATGTATCACTTTAGGGA OBD160.359 TATTGAAGTTTCCCTGTCCGCCCAGC 91 CCTTAGAAAACATAAACACAATAC OBD160.363 GACAAGAGTAGAGGTGAGTGGGTA 92 GGGACCTTGTCTGCTTTACTCACTGC OBD160.367 CAGTGTGGAGACTTATGGGAAAACAG 93 TATCCTCTGCCCACCACTGTCACTT OBD160.371 GAGAGTTATTCCTCAAGTGCTCCCAC 94 GCAGAGGTAAAACAGGTAGAAAGGTC OBD160.375 GTCTCCTAAAGCCAAAACACCACCAT 95 CTAAAGTCAGGGAAGGCAAAGTAATC OBD160.379 CAGTATGAACGAGGTCACAGAGGGTA 96 HILI 1AGAGATACAATCATTCTGGCAG OBD160.383 CCTCATAGGCTGC11C1 1 1 1G11 1C1CC 97 GCCTCGGTCAGATGTTCAATGGCAGGAA OBD160.387 TACTGGCTGAGGGATTTTCTTCACCAT 98 TCAGTTTCAGAGACCTCACCACATTA OBD160.391 GTCCTCAGAGAAAATCGCAGGGAGTC 99 GGGACTTACACAGCCCTATGCTTCCTTG OBD160.395 GCCGAGTGGGCTCTTCTGCCTACACAAC 100 GGCAGGAGAATCACTTGAACCCG OBD160.399 CTTGGTGTTACAGCCCCAGAAAT Table 1A (part 2f) No. probe Marker 51 Hg38_4_37200238_37206260_37300406_37312473_FF OBD160.201.203 52 Hg38_3_98352533_98365728_98383505_98386616_FR OBD160.205.207 53 Hg38_21_16639172_16644423_16670368_16680104_FF OBD160.209.211 54 Hg38_2_42656271_42661181_42695432_42702668_RF OBD160.213.215 55 Hg38_10_25043685_25049585_25100349_25104868_RR OBD160.217.219 56 Hg38_l_229090863_229096006_229196083_229202342_FR OBD160.221.223 57 Hg38_13_105283036_105288043_105320265_105325556_RR OBD160.225.227 58 Hg38_12_103957683_103963295_104120354_104125638_RR OBD160.229.231 59 Hg38_6_114008656_114013787_114232226_114238214_RF OBD160.233.235 60 Hg38_8_140877455_140883144_140932435_140938098_RF OBD160.237.239 61 Hg38_4_136781505_136792883_136902701_136917925_FR OBD160.241.243 62 Hg38_17_44726208_44728331_44900687_44908527_FR OBD160.245.247 63 Hg38_8_116664671_116672423_116798829_116802256_RR OBD160.249.251 64 Hg38_3_105989527_105998279_106059965_106070080_FR OBD160.253.255 65 Hg38_2_112740760_112742979_112765786_112772711_RF OBD160.257.259 66 Hg38_18_9337930_9343491_9573987_9583586_RR OBD160.261.263 67 Hg38_ll_19074376_19084676_19339671_19348554_FR OBD160.265.267 68 Hg38_ll_57219000_57228121_57426633_57429019_FF OBD160.269.271 69 Hg38_ll_12078291_12088535_12276885_12282796_FF OBD160.273.275 70 Hg38_4_152885427_152900293_153068111_153076707_FR OBD160.277.279 71 Hg38_l_47112037_47119435_47237146_47242526_FF OBD160.281.283 72 Hg38_13_27255589_27257567_27412662_27420769_FR OBD160.285.287 73 Hg38_8_31019968_31023828_31152507_31157947_FR OBD160.289.291 74 Hg38_7_30496219_30498858_30628404_30631817_FF OBD160.293.295 75 Hg38_X_41694532_41696489_41776262_41781759_FF OBD160.297.299 76 Hg38_6_51827509_51843341_51906482_51917695_FF OBD160.301.303 77 Hg38_4_52550935_52553766_52741887_52744874_RF OBD160.305.307 78 Hg38_4_143208146_143211670_143254394_143265663_FR OBD160.309.311 79 Hg38_2_79143668_79146500_79293195_79300892_FR OBD160.313.315 80 Hg38_3_386460_393029_417553_428199_RF OBD160.317.319 81 Hg38_8_105746180_105747310_105814873_105824107_FR OBD160.321.323 82 Hg38_20_47934845_47942853_47960362_47966156_RF OBD160.325.327 83 Hg38_l_193673926_193687017_193767073_193774723_FR OBD160.329.331 84 Hg38_X_55562087_55565924_55755522_55768422_RF OBD160.333.335 85 Hg38_12_22051055_22053335_22293062_22296971_FR OBD160.337.339 86 Hg38_5_168367648_168371678_168496703_168499633_RF OBD160.341.343 87 Hg38_9_13378184_13386623_13453370_13455410_RR OBD160.345.347 88 Hg38_4_13607623_13610565_13677034_13689726_RR OBD160.349.351 89 Hg38_l_158836157_158842400_158905246_158912243_FF OBD160.353.355 90 Hg38_2_59529259_59533399_59556418_59563869_RF OBD160.357.359 91 Hg38_l_172365073_172375924_172561646_172570053_RR OBD160.361.363 92 Hg38_l_167272741_167278581_167541602_167544034_FF OBD160.365.367 93 Hg38_l_27783032_27786599_27834284_27836433_FF OBD160.369.371 94 Hg38_2_144038117_144048675_144274589_144280493_FF OBD160.373.375 95 Hg38_17_41002849_41006661_41059440_41062968_RF OBD160.377.379 96 Hg38_ll_90904893_90913850_91035518_91039190_FF OBD160.381.383 97 Hg38_l_247706861_247710350_247812273_247815652_FR OBD160.385.387 98 Hg38_12_23014365_23020377_23180775_23184338_RR OBD160.389.391 99 Hg38_4_28348510_28364344_28414655_28418162_FF OBD160.393.395 100 Hg38_17_35578150_35580887_35656691_35659920_FF OBD160.397.399 Table 1A (part 2g) No. probe RP / Rsum Rprank FC:(classl / class2) 101 Hg38_13_28438004_28449201_28551336_28558541_RR 5473.459527 216 1.548 102 Hg388132637112132642401132681711132690255F 3591.973084 130 1.545 103 Hg382033827938338304673 3359.632084 122 1.545 104 Hg38_4_55932433_55939189_55969220_55974802_FF 2903.160734 91 1.545 105 Hg38_7_142995810_142998826_143057496_143064818_RR 3759.403871 140 1.544 106 Hg38_18_75676630_75682929_75700545_75706785_RR 2791.763006 83 1.544 107 Hg38_5_12486934_12496757_12590668_12597008_FF 2558.874957 71 1.544 108 Hg38_7_113374693_113380998_113411335_113420030_FR 2582.839821 73 1.542 109 Hg38_3_98493912_98497028_98612320_98617232_RF 2676.998144 77 1.54 110 Hg38^6J71312879J71323494J71524385J71527337JR 2845.485946 87 1.539 111 Hg38^71700748^71714803 71741385 71749255 F F 3490.546135 128 1.537 112 Hg381362231930622374956 2587.198527 74 1.537 113 Hg38_12_90700058_90702509_90796185_90802319_RF 3605.32438 131 1.536 114 Hg38_4_67686135_67693477_67782747_67789927_RR 2955.347004 95 1.536 115 Hg38_6_39611834_39623490_39813403_39823235_FF 3385.094489 123 1.535 116 Hg38_6_125238508_125249295_125290548_125297233_FF 3558.225301 129 1.534 117 Hg38_4_126064916_126070028_126094394_126106891_RR 3138.820724 105 1.534 118 Hg38_10_12235815_12238464_12383561_12388246_FR 2359.06621 60 1.534 119 Hg38788599386_8^ 2728.216 82 1.533 120 Hg38^52892382^52905124^52921980^52933672^RR 3219.804543 110 1.532 121 Hg3817460359774607998747789 3742.651266 139 1.531 122 Hg38_Y_22721647_22725457_22859118_22870072_RF 3212.534981 109 1.53 123 Hg38_4_97463862_97470977_97576564_97590463_RR 3052.561735 101 1.53 124 Hg38_l_96357496_96364474_96392998_96404426_RF 2982.624056 98 1.53 125 Hg38_l_158905246_158912243_159126541_159136350_FF 2817.776717 85 1.53 126 Hg38_ll_106098496_106106725_106275961_106290738_RR 3268.3717 114 1.529 127 Hg38_ll_72859306_72866489_72925691_72936492_RF 3458.227037 127 1.525 128 Hg3814^ 4442.91003 165 1.524 129 Hg38JL173125717J.73130524JL73207477J73215489JR 3607.202568 132 1.524 130 Hg38141982 3185.904497 107 1.524 131 Hg38_15_56425187_56434244_56691312_56696438_FR 2916.936995 92 1.524 132 Hg38_7_30612223_30619592_30804622_30809524_FR 4045.43792 152 1.523 133 Hg38_20_46372997_46377307_46622048_46631132_FF 3314.955421 118 1.523 134 Hg38_14_24423148_24425179_24517993_24525921_RR 5033.707838 189 1.522 135 Hg38_7_93821969_93826969_93960806_93964392_FR 3286.118138 115 1.522 136 Hg38_2_36912180_36914993_37085573_37089692_RR 3310.62397 117 1.521 137 Hg38477717993777273647798227077985832R 3083.119716 102 1.521 138 Hg38^ 3239.086494 111 1.518 139 Hg38_4_121310394_121315169_121339971_121354127_RF 3150.912042 106 1.518 140 Hg38_2_15677778_15684445_15733618_15739157_RR 4181.003667 156 1.517 141 Hg38_12_29701302_29708431_29828391_29843699_FF 3425.857677 124 1.517 142 Hg38_3_64067438_64075904_64228797_64236262_FR 3767.332371 143 1.516 143 Hg38_17_40700822_40703790_40868811_40875117_FR 3434.139591 125 1.516 144 Hg38_9_120795804_120798748_120831347_120833895_RR 3002.794717 100 1.515 145 Hg38_7_144246203_144258031144391768144394587FR 5823.554282 235 1.513 146 Hg381271685734716870057177199271780701F 4285.485291 160 1.513 147 Hg381182067024820731^ 3887.012897 147 1.513 148 Hg38J7J44153639J.44162181J44246203J4425803LRF 6897.235002 308 1.512 149 Hg38_2_21769905_21774394_21960934_21972734_FR 5044.788457 190 1.512 150 Hg38_4_38385027_38395353_38450896_38455314_RF 3309.983405 116 1.512 Table 1A (part 3a) Probe sequence No. pfp P.value Type 60 mer 101 0 0 SBMA AATAAAATGATGGTGTCTTAAGCATAAATCGATTGATGTAGGAGTATTAGTAGTAATTGA 102 0 0 SBMA TCATGCTATTTCTCATGGAGAGATGGCATCGAAGATGAAATTAATTTTAAATGATTGTCT 103 0 0 SBMA ATTTATTTTCTCAGTTCTGGAGACTCAGTCGAAGGCTAGAGTTATCAGAAAATGTTAATT 104 0 0 SBMA AGTTAATATAGAAACAACATTCTTCTTTTCGACGTTTTATTCCATGTTCTAGTCTCATCC 105 0 0 SBMA TTGTTTGTTTACTTTGCTATTGAGTTCTTCGATTTCCAGACATTTCCATACGTCCTCTGA 106 0 0 SBMA ACATCTGATTTAACCAAATCTTTGCCAATCGATTGTATCTTCTATAATTAGCAATAGCTA 107 0 0 SBMA ATATATTTAATGAAATAAAATTACTATATCGATTACACTCTGGGCTAGAGGTTCCTAAAT 108 0 0 SBMA CCATAAI 1 1 1 1AGCACATAAAACTTTTCTCGACAGAAGTGAAGAAACAATCCTGAAAAAA 109 0 0 SBMA TGACATGATCTAAGATAATCTCCTTATCTCGAGGTGAGAATTTAACACATTATTAAATTA 110 0 0 SBMA ATGTCAATAAAATTGTACAGGATTACATTCGAAAAAACCAAAAACCAAACAAACAAAAAA 111 0 0 SBMA ATAAAACAGATGAATAGACTGTAAATAATCGACAGTAAATTTATAGCAGCTGAGTAGCCT 112 0 0 SBMA ACTGAGTTTATACAACCTTTTAAAATTTTCGAGAATAACTCAGGATAAAATAGATACAAG 113 0 0 SBMA TATTGTGGGG 1 1 1 1111ATTGTTTGTTTTCGAGTAAAAAACAG1 1 1 1 1GCAATATCAAGT 114 0 0 SBMA GTTCTTTCATAAAAGGGTGAAI 1 1 1 1AATCGATGTTTACCATTTTGACTGAAGATATAAT 115 0 0 SBMA AAAATGTACTATCTTGTTCATAAAGTTCTCGATGTAGCCTTTCTTAATCTTTGGGCCTTT 116 0 0 SBMA Al 1 1 1 1CCCTCTAI1 Cl 1 1AAAAACTTTTCGAGATTCTTAGTTGCAGAAAGGAATTAGCA 117 0 0 SBMA TCTGCATTTAATGTTGCAACATGAGGAATCGATGTATAATGTTGTTCAGTTAAACTATGT 118 0 0 SBMA TGACTTTTTTTCTCCTTTACAGTTGTGTTCGAGCTTGTTATTTTCTCTTTCTTACCTAGT 119 0 0 SBMA ACACAACTATGATGCATAAGAAAAAAAATCGAATTTAAAAACAAAAAAAGCCCCTAATAT 120 0 0 SBMA AATAACTGCAGAATATACAI 1 1 1 1CCCATCGAGTCTGATTGATTCAGACTCTGAAATCAA 121 0 0 SBMA TATCATCACCACTTTACAAATGAGAAAATCGAAAATAGAAACTTACGTTATCAGGTTCAA 122 0 0 SBMA ACTATATTATGACCTGTATCAAGATGTATCGAAATACAAGAATCTAGTCTGATTAGATTA 123 0 0 SBMA ATGGGATCTCAGAATAGAAAAAGAACATTCGACCTCTACATATCATCTAAAGAAATTAAC 124 0 0 SBMA Al 1 1 1 1AAAATGAAAAAAATGACATAATTCGACCTCTCTTTTCTTGCTGGAAAATATGCT 125 0 0 SBMA CAGCTTAAAATAATGGGTTATGGTAACCTCGAGGTAGATACATAGGAGGTGCAAACACAA 126 0 0 SBMA AAACATTCAAAI 1 1111 ICI 1 1 1ACTAATCGAGGGATATGATGTTCTCAGTTGGAI Illi 127 0 0 SBMA CAGTGTGATTTTATCAAACTCAAGAATCTCGAGTATATGCAAGCTATGTAAGCTACTTGT 128 0 0 SBMA ATTTTATAAAGCCAGAATAACCCTGATATCGAACCCTATAAATACTG1 1 1 1 1 1CCTATAA 129 0 0 SBMA AATGTTATGAAATGAAGACATATGTGACTCGAAACCATCTTTCATACCATTAAATATTTT 130 0 0 SBMA GCTATTTTAAACAAAACATCATTTAATATCGATTTTGGAAGGGACTTAATTTCAGCTACC 131 0 0 SBMA TTTGTTTCTGAGCATTCATTAATTCTATTCGATTACTGATAGATATACTGTAGGTACATT 132 0 0 SBMA GGTTAAGAACATAAGTATACTTAACCAGTCGATATCTGTTGAGTCCTCACTATCTGACTG 133 0 0 SBMA TTTATTACTTGTTGAAATGGTAACGTTTTCGAGAACCACTGGATTAAATGATCTCAGCTT 134 0 0 SBMA AAATATTGTAGTACAAATGTCTACACTCTCGATTTGTGGTTGTTGCCAGGAATGGAGGCA 135 0 0 SBMA ACAGAAATGAGAAAAACAATAGAGAATATCGACTCTAAAGTCTATGTAGAGAAGCAAAGG 136 0 0 SBMA ACCAATAAAAGGGAAAGAGTAGAGATACTCGAGAAAATGAAGGAAATGATTGCCATAAAA 137 0 0 SBMA AAACAGCTTAAGTTTATTTTGTGTATGATCGATAAGCTACCCTTCCTTAGGATAACAAAT 138 0 0 SBMA CCGGATAAI 1 1 1 11 11ATTTCTTACTTTTCGATCCTACCTATTTCCCCAACCATTAATAT 139 0 0 SBMA TTTGATTCCTATAGTTTTGCAGTATAATTCGAAGATCAAAACATGCAAATACTAGCAGTC 140 0 0 SBMA CAGGACTGTAAAAGAGCCTTTTCTTCTTTCGATTGGAACCTTTATGTCTGGACTCTGAAA 141 0 0 SBMA ACCAAAAGTCAGAGGAACAAATAATTTGTCGATTCTTCAGAACTTCCTTGATATTTTAAA 142 0 0 SBMA ATTCTCTATCTCCATGAATTTAATTGTTTCGACCTTCAGAACTTTCTGTTTAGGTAGAAT 143 0 0 SBMA CTGCCI 1 1 1 IGGCCI11ATATACACACTTCGAAATCCTTTGTTGGATTCAGATTTCTAAA 144 0 0 SBMA AAACATCATTTCTACCAGCAAGTTTATTTCGAACAATGTCATTTGTTTTCATTACACTTT 145 0 0 SBMA AAACAGAACCCGGAI11 11ACAGACTGATCGAAGTTAACTGCACATCCI 1 1 1 1 11IATCT 146 0 0 SBMA GCCTTTAATAAATGCTTGTTGTGATAATTCGAGTCATTTAGGTTGAAAGGGACCAGTTGT 147 0 0 SBMA GAATGCACAATGTAAAACTATTAACCTTTCGAACTTATCTCTAI 1 1 1 1ACTGTACTGTGG 148 0 0 SBMA AAACAGAACCCGGAI 1 111ACAGACTGATCGACTCAAAAATTACTGTATGTGATATGGGA 149 0 0 SBMA TGTCCCAGTAAATCGCTGGGGAATAGAATCGATAAGAACTATGAAAAATTTTAATTTAAA 150 0 0 SBMA ATCACTTTCAGAAAAGAATAGAGG1 1 1 1 1CGATATTCAAGCTCACAAAATAAGCTCAAAC Table 1A (part 3b) Probe Location No. Chr Startl Endl Start2 End2 101 13 28438006 28438035 28551338 28551367 102 8 132642370 132642399 132681713 132681742 103 20 33830436 33830465 34035298 34035327 104 4 55939158 55939187 55974771 55974800 105 7 142995812 142995841 143057498 143057527 106 18 75676632 75676661 75700547 75700576 107 5 12496726 12496755 12596977 12597006 108 7 113380967 113380996 113411337 113411366 109 3 98493914 98493943 98617201 98617230 110 6 71323463 71323492 71524387 71524416 111 4 71714772 71714801 71749224 71749253 112 13 62237464 62237493 62330218 62330247 113 12 90700060 90700089 90802288 90802317 114 4 67686137 67686166 67782749 67782778 115 6 39623459 39623488 39823204 39823233 116 6 125249264 125249293 125297202 125297231 117 4 126064918 126064947 126094396 126094425 118 10 12238433 12238462 12383563 12383592 119 7 88615094 88615123 88745597 88745626 120 2 52892384 52892413 52921982 52922011 121 1 74607967 74607996 74778980 74779009 122 Y 22721649 22721678 22870041 22870070 123 4 97463864 97463893 97576566 97576595 124 1 96357498 96357527 96404395 96404424 125 1 158912212 158912241 159136319 159136348 126 11 106098498 106098527 106275963 106275992 127 11 72859308 72859337 72936461 72936490 128 14 49028784 49028813 49076511 49076540 129 4 173130493 173130522 173207479 173207508 130 14 19829382 19829411 19975558 19975587 131 15 56434213 56434242 56691314 56691343 132 7 30619561 30619590 30804624 30804653 133 20 46377276 46377305 46631101 46631130 134 14 24423150 24423179 24517995 24518024 135 7 93826938 93826967 93960808 93960837 136 2 36912182 36912211 37085575 37085604 137 4 77717995 77718024 77982272 77982301 138 3 87995258 87995287 88133386 88133415 139 4 121310396 121310425 121354096 121354125 140 2 15677780 15677809 15733620 15733649 141 12 29708400 29708429 29843668 29843697 142 3 64075873 64075902 64228799 64228828 143 17 40703759 40703788 40868813 40868842 144 9 120795806 120795835 120831349 120831378 145 7 144258000 144258029 144391770 144391799 146 12 71686974 71687003 71771994 71772023 147 11 82067026 82067055 82146345 82146374 148 7 144153641 144153670 144258000 144258029 149 2 21774363 21774392 21960936 21960965 150 4 38385029 38385058 38455283 38455312 Table 1A (part 3c) 4 kb Sequence Location No. Chr Startl Endl Start2 End2 101 13 28438006 28442005 28551338 28555337 102 8 132638400 132642399 132681713 132685712 103 20 33826466 33830465 34035298 34039297 104 4 55935188 55939187 55970801 55974800 105 7 142995812 142999811 143057498 143061497 106 18 75676632 75680631 75700547 75704546 107 5 12492756 12496755 12593007 12597006 108 7 113376997 113380996 113411337 113415336 109 3 98493914 98497913 98613231 98617230 110 6 71319493 71323492 71524387 71528386 111 4 71710802 71714801 71745254 71749253 112 13 62233494 62237493 62330218 62334217 113 12 90700060 90704059 90798318 90802317 114 4 67686137 67690136 67782749 67786748 115 6 39619489 39623488 39819234 39823233 116 6 125245294 125249293 125293232 125297231 117 4 126064918 126068917 126094396 126098395 118 10 12234463 12238462 12383563 12387562 119 7 88611124 88615123 88741627 88745626 120 2 52892384 52896383 52921982 52925981 121 1 74603997 74607996 74778980 74782979 122 Y 22721649 22725648 22866071 22870070 123 4 97463864 97467863 97576566 97580565 124 1 96357498 96361497 96400425 96404424 125 1 158908242 158912241 159132349 159136348 126 11 106098498 106102497 106275963 106279962 127 11 72859308 72863307 72932491 72936490 128 14 49024814 49028813 49076511 49080510 129 4 173126523 173130522 173207479 173211478 130 14 19825412 19829411 19971588 19975587 131 15 56430243 56434242 56691314 56695313 132 7 30615591 30619590 30804624 30808623 133 20 46373306 46377305 46627131 46631130 134 14 24423150 24427149 24517995 24521994 135 7 93822968 93826967 93960808 93964807 136 2 36912182 36916181 37085575 37089574 137 4 77717995 77721994 77982272 77986271 138 3 87991288 87995287 88129416 88133415 139 4 121310396 121314395 121350126 121354125 140 2 15677780 15681779 15733620 15737619 141 12 29704430 29708429 29839698 29843697 142 3 64071903 64075902 64228799 64232798 143 17 40699789 40703788 40868813 40872812 144 9 120795806 120799805 120831349 120835348 145 7 144254030 144258029 144391770 144395769 146 12 71683004 71687003 71771994 71775993 147 11 82067026 82071025 82142375 82146374 148 7 144153641 144157640 144254030 144258029 149 2 21770393 21774392 21960936 21964935 150 4 38385029 38389028 38451313 38455312 Table 1A (part 3d) No. probe Primer ID 101 Hg38_13_28438004_28449201_28551336_28558541_RR OBD160.401 102 Hg38_8_132637112_132642401_132681711_132690255_FR OBD160.405 103 Hg38_20_33827938_33830467_34035296_34047038_FR OBD160.409 104 Hg38_4_55932433_55939189_55969220_55974802_FF OBD160.413 105 Hg38_7_142995810_142998826_143057496_143064818_RR OBD160.417 106 Hg38_18_75676630_75682929_75700545_75706785_RR OBD160.421 107 Hg38_5_12486934_12496757_12590668_12597008_FF OBD160.425 108 Hg38_7_113374693_113380998_113411335_113420030_FR OBD160.429 109 Hg38_3_98493912_98497028_98612320_98617232_RF OBD160.433 110 Hg38_6_71312879_71323494_71524385_71527337_FR OBD160.437 111 Hg38_4_71700748_71714803_71741385_71749255_FF OBD160.441 112 Hg38_13_62231930_62237495_62330216_62339040_FR OBD160.445 113 Hg38_12_90700058_90702509_90796185_90802319_RF OBD160.449 114 Hg38_4_67686135_67693477_67782747_67789927_RR OBD160.453 115 Hg38_6_39611834_39623490_39813403_39823235_FF OBD160.457 116 Hg38_6_125238508_125249295_125290548_125297233_FF OBD160.461 117 Hg38_4_126064916_126070028_126094394_126106891_RR OBD160.465 118 Hg38_10_12235815_12238464_12383561_12388246_FR OBD160.469 119 Hg38_7_88599386_88615125_88740721_88745628_FF OBD160.473 120 Hg38_2_52892382_52905124_52921980_52933672_RR OBD160.477 121 Hg38_l_74603597_74607998_74778978_74800362_FR OBD160.481 122 Hg38_Y_22721647_22725457_22859118_22870072_RF OBD160.485 123 Hg38_4_97463862_97470977_97576564_97590463_RR OBD160.489 124 Hg38_l_96357496_96364474_96392998_96404426_RF OBD160.493 125 Hg38_l_158905246_158912243_159126541_159136350_FF OBD160.497 126 Hg38_ll_106098496_106106725_106275961_106290738_RR OBD160.501 127 Hg38_ll_72859306_72866489_72925691_72936492_RF OBD160.505 128 Hg38_14_49020009_49028815_49076509_49078072_FR OBD160.509 129 Hg38_4_173125717_173130524_173207477_173215489_FR OBD160.513 130 Hg38_14_19825779_19829413_19968132_19975589_FF OBD160.517 131 Hg38_15_56425187_56434244_56691312_56696438_FR OBD160.521 132 Hg38_7_30612223_30619592_30804622_30809524_FR OBD160.525 133 Hg38_20_46372997_46377307_46622048_46631132_FF OBD160.529 134 Hg38_14_24423148_24425179_24517993_24525921_RR OBD160.533 135 Hg38_7_93821969_93826969_93960806_93964392_FR OBD160.537 136 Hg38_2_36912180_36914993_37085573_37089692_RR OBD160.541 137 Hg38_4_77717993_77727364_77982270_77985832_RR OBD160.545 138 Hg38_3_87991842_87995289_88126188_88133417_FF OBD160.549 139 Hg38_4_121310394_121315169_121339971_121354127_RF OBD160.553 140 Hg38_2_15677778_15684445_15733618_15739157_RR OBD160.557 141 Hg38_12_29701302_29708431_29828391_29843699_FF OBD160.561 142 Hg38_3_64067438_64075904_64228797_64236262_FR OBD160.565 143 Hg38_17_40700822_40703790_40868811_40875117_FR OBD160.569 144 Hg38_9_120795804_120798748_120831347_120833895_RR OBD160.573 145 Hg38_7_144246203_144258031_144391768_144394587_F R OBD160.577 146 Hg38_12_71685734_71687005_71771992_71780701_FR OBD160.581 147 Hg38_ll_82067024_82073102_82131728_82146376_RF OBD160.585 148 Hg38_7_144153639_144162181_144246203_144258031_RF OBD160.589 149 Hg38_2_21769905_21774394_21960934_21972734_FR OBD160.593 150 Hg38_4_38385027_38395353_38450896_38455314_RF OBD160.597 Table 1A (part 3e) No. Sequence Primer ID Sequence 101 GTGGACTTTCCTGTAACATCCTTTTA OBD160.403 GGCTGGGTTCTAAAGATGAAGACTT 102 GTGGGCACTTGGCTCTGAGATGC OBD160.407 GCCCTCAACGGTGGAGTAGGATA 103 GGTGGGAGAGACACTGAGGCTGT OBD160.411 CACCACCTACCTGCCAAGTTGCT 104 GATGTCCCACTACCTTGCCTGAGG OBD160.415 GCAGGGAGACTTGGACCTATTGG 105 CCAGCAGTGGATGAGGGCTCGCCTGTCT OBD160.419 CACAGCAGCCTCTTTCATCACAGCCCAG 106 GGAATGATAGAGATAGGGAGAAATGGAA OBD160.423 GAGAAGCAGACGGAAACTGTGACTGACA 107 CTCAAGCAACTCAGCAGCATAAAACACA OBD160.427 CTTCCCCACTCA111L1 1GTGATTCTAT 108 TTTATTTGTCAAGTGCCAAGGAATGC OBD160.431 TAGGAAACACCAGTGAGTCCAAGGCT 109 CACAGTCCCCTCTTACTACAGCGTGAAA OBD160.435 ACACTATTTCATTGTAGAGGTTACCACG 110 CTTGGAAATGTCAGACCCTTGCCCAT OBD160.439 ATTGAGCCGTGTGTTTGGTGCTTGC 111 GGCTGGATGGCAGTAGAATGCTGTTC OBD160.443 CTCCATTCATCGCACTCTACTTTAGC 112 CCTGCCTCAACCTCCCAAGTAGC OBD160.447 CTGAGGTAAACGGAGTAAAGGGTA 113 CTGTTGGTAGTTCCTAACCTCATA OBD160.451 CAATAAGAAGTAAACAAAGCATAAC 114 GCCCCAAGGGAATAAAACTAAGACTA OBD160.455 CTTCTTCTCTCTTCATCACAACAGTC 115 CTTCTTGGTTGTCTATCCTTTCAGAT OBD160.459 CAAGTTGGCACCGAGTGGTTTCCTAA 116 ACCAAAAGTTCTCACTGGAGGCACCA OBD160.463 CTCGTCCACAATGTCCAGATTTACCC 117 CCATCCCCAGGACCCCACTGTGC OBD160.467 CAGACAAAGGTGACTTCAGAGCAAGAAC 118 GTGACTCCCATCTTTCCCATAGAACCAG OBD160.471 CACTCTTGTGTCGCTCCTGAGGCTA 119 CGGGATTCATAAAGGAGAAAGCAAGA OBD160.475 GTGCCAACCCCACAGAGCAACTTATG 120 GGAAAAGGAAGGACGCAAATGGTGTCAC OBD160.479 GTCTTGTGCCAGTTTTCAAAGGGAGAGC 121 TAAGATTATTGAGCACTCTCTCTGTG OBD160.483 GGGTGTAGGGCACAGAI ICIIAC 122 TCCAGCAAAAGTATCCTTCAACAGG OBD160.487 CTGCTGTATGCTCAGGCTTTGCTCC 123 TACAGCAATAGAAAGGAGTGCGGTAT OBD160.491 GTCAAAGCCAGTGTCCAGAAGGGTAT 124 GCCTCATTAGGAAAGTGTAGAAGAGA OBD160.495 GACTATCCTGGAGACTCTGGAAAACT 125 GTAGAAAGACTAAAAGACAAACCTCTC OBD160.499 CACGCACAGCCTCCAAGAAACTA 126 CTTGACCTTTATTTACTATGCTTGGC OBD160.503 CAAGGGACCTCTCAAAGCAGAAGCAA 127 ATTTTGGTGACAGACTGGGCTTCT OBD160.507 CATCTCTCTCTTCTTCATTACAGTCCCC 128 AAGGATTGGTGAACTCAAAGACAGGTTA OBD160.511 GGTATTTTGAGAGAGAGTCCACATTGAC 129 CGGAACTTTAGCATCTGGAAGAAGAA OBD160.515 CAACATCAGAGAGGTGAGAAACAACC 130 CAGTCI 1 1 IGGTAGAGCAATCAGGAT OBD160.519 GAACATCTCCTTGACAACCCTCCCCT 131 GTTGGCGACGCTCTTCAATAAGTTTT OBD160.523 GGAGCAACACAAGCCAAACACAGCAG 132 CCATCCAGAGAAGTAACCACTATCCC OBD160.527 GACTGCTTGGTCATTTTGTGCCTCAG 133 CCTGTGAGGTCCAGTTTGGTAGCCCC OBD160.531 CCTTCAGTTTCCTTGTGTGCTGTAGACA 134 ACTCACTCCTTCCCTTCAGCAGC OBD160.535 ACTGCCTCAGGAGTTGGCTGCCT 135 ATGAAACAGAAATGAGAAAAACA OBD160.539 TCTATGTAGAGAAGCAAAGGGCCAA 136 GTGATGTGTGTCTTAGAGGAGTAACC OBD160.543 AGCCCTCTTTGTCCCCTATCCAGTTG 137 TTGGGTGGGTTTTCTGCTCTGGAGGTAT OBD160.547 ATCAGGAGAAGAGCAAGAGTTGAAATCA 138 CTCACCTCAGTCTCCCAAGTAGC OBD160.551 GTGTGCCACTCCAATCACTGTAT 139 TTATTGAAGAGACTGTCCTTTCCCTA OBD160.555 GTGAATAGTGCCGCAATAAACATACG 140 ATTATGCCTCCTACATTCCCTCCCCG OBD160.559 CCTCCCTGTCTTCCCTGTTGATAAAA 141 GAATGAGTGAATACAGCCAGGGAATG OBD160.563 TGGCTATGGAGATGTCACCTGAAGGG 142 ACCCATCCCCAAGCATTTATCCTTTGTG OBD160.567 GTTGCTGCTGTTTTGCTGTCTTGTGTCC 143 GGCGAATAGGAGAGGTGATGACG OBD160.571 GCCCTGTTTCCCACGAGGTAGGA 144 GTCATCTAAACTACCTCCCCAGGCAAGT OBD160.575 GGTTTAGAATGGATGATTTGCGTAATGG 145 CAGCGGCAAACACAGGCAGATGT OBD160.579 CCCCAGAGCCCCATCCTGTCAAT 146 CCTCTGAATGGTTATGAATGGTTGTG OBD160.583 CCTGCCTGGTCAACCCACAGAATCAT 147 ATTCAGTGTAATCCCTATCAAAAT OBD160.587 TCTGCCATAAAGTCATTCTCAAAA 148 CCATTGAACAGTAGAGACAGGGTCCC OBD160.591 GGCACTC111C1GC1CTAT111G1GG 149 GTTATTACTGGTTGATGACTCCACAT OBD160.595 GCAATCTCAGAAATCAACACTAAAGAAC 150 GATGTCTGAGAATGTGGAGTGTGCTA OBD160.599 TTTACCGCC1 1 11CC rCCCACCTCTC Table 1A (part 3f) No. probe Marker 101 Hg38_13_28438004_28449201_28551336_28558541_RR OBD160.401.403 102 Hg38_8_132637112_132642401_132681711_132690255_FR OBD160.405.407 103 Hg38_20_33827938_33830467_34035296_34047038_FR OBD160.409.411 104 Hg38_4_55932433_55939189_55969220_55974802_FF OBD160.413.415 105 Hg38_7_142995810_142998826_143057496_143064818_RR OBD160.417.419 106 Hg38_18_75676630_75682929_75700545_75706785_RR OBD160.421.423 107 Hg38_5_12486934_12496757_12590668_12597008_FF OBD160.425.427 108 Hg38_7_113374693_113380998_113411335_113420030_FR OBD160.429.431 109 Hg38_3_98493912_98497028_98612320_98617232_RF OBD160.433.435 110 Hg38_6_71312879_71323494_71524385_71527337_FR OBD160.437.439 111 Hg38_4_71700748_71714803_71741385_71749255_FF OBD160.441.443 112 Hg38_13_62231930_62237495_62330216_62339040_FR OBD160.445.447 113 Hg38_12_90700058_90702509_90796185_90802319_RF OBD160.449.451 114 Hg38_4_67686135_67693477_67782747_67789927_RR OBD160.453.455 115 Hg38_6_39611834_39623490_39813403_39823235_FF OBD160.457.459 116 Hg38_6_125238508_125249295_125290548_125297233_FF OBD160.461.463 117 Hg38_4_126064916_126070028_126094394_126106891_RR OBD160.465.467 118 Hg38_10_12235815_12238464_12383561_12388246_FR OBD160.469.471 119 Hg38_7_88599386_88615125_88740721_88745628_FF OBD160.473.475 120 Hg38_2_52892382_52905124_52921980_52933672_RR OBD160.477.479 121 Hg38_l_74603597_74607998_74778978_74800362_FR OBD160.481.483 122 Hg38_Y_22721647_22725457_22859118_22870072_RF OBD160.485.487 123 Hg38_4_97463862_97470977_97576564_97590463_RR OBD160.489.491 124 Hg38_l_96357496_96364474_96392998_96404426_RF OBD160.493.495 125 Hg38_l_158905246_158912243_159126541_159136350_FF OBD160.497.499 126 Hg38_ll_106098496_106106725_106275961_106290738_RR OBD160.501.503 127 Hg38_ll_72859306_72866489_72925691_72936492_RF OBD160.505.507 128 Hg38_14_49020009_49028815_49076509_49078072_FR OBD160.509.511 129 Hg38_4_173125717_173130524_173207477_173215489_FR OBD160.513.515 130 Hg38_14_19825779_19829413_19968132_19975589_FF OBD160.517.519 131 Hg38_15_56425187_56434244_56691312_56696438_FR OBD160.521.523 132 Hg38_7_30612223_30619592_30804622_30809524_FR OBD160.525.527 133 Hg38_20_46372997_46377307_46622048_46631132_FF OBD160.529.531 134 Hg38_14_24423148_24425179_24517993_24525921_RR OBD160.533.535 135 Hg38_7_93821969_93826969_93960806_93964392_FR OBD160.537.539 136 Hg38_2_36912180_36914993_37085573_37089692_RR OBD160.541.543 137 Hg38_4_77717993_77727364_77982270_77985832_RR OBD160.545.547 138 Hg38_3_87991842_87995289_88126188_88133417_FF OBD160.549.551 139 Hg38_4_121310394_121315169_121339971_121354127_RF OBD160.553.555 140 Hg38_2_15677778_15684445_15733618_15739157_RR OBD160.557.559 141 Hg38_12_29701302_29708431_29828391_29843699_FF OBD160.561.563 142 Hg38_3_64067438_64075904_64228797_64236262_FR OBD160.565.567 143 Hg38_17_40700822_40703790_40868811_40875117_FR OBD160.569.571 144 Hg38_9_120795804_120798748_120831347_120833895_RR OBD160.573.575 145 Hg38_7_144246203_144258031_144391768_144394587_F R OBD160.577.579 146 Hg38_12_71685734_71687005_71771992_71780701_FR OBD160.581.583 147 Hg38_ll_82067024_82073102_82131728_82146376_RF OBD160.585.587 148 Hg38_7_144153639_144162181_144246203_144258031_RF OBD160.589.591 149 Hg38_2_21769905_21774394_21960934_21972734_FR OBD160.593.595 150 Hg38_4_38385027_38395353_38450896_38455314_RF OBD160.597.599 Table 1A (part 3g) No. probe RP / Rsum Rprank FC:(classl / class2) 151 Hg38_17_36023309_36028028_36272442_36275457_FF 181419.9448 102901 1.51 152 Hg38_12_78435225_78440781_78459801_78476525_RF 5179.767063 196 1.51 153 Hg38_X_40477200_40482652_40589768_40592788_RF 3846.655135 146 1.51 154 Hg38_Y_3584113_3585230_3719457_3726617_FF 5222.745707 200 1.508 155 Hg38J7_103380032J.03385339_103627677_103636524_RR 3342.65815 120 1.508 156 Hg381152724530152728363152991207152992512FR 3244.654375 112 1.508 157 Hg38J0_103825506_103831138J03895197J.03900793_FR 4497.05848 167 1.504 158 Hg38_Y_2866835_2871971_2958559_2972902_RF 3649.087311 136 1.502 159 Hg38_4_142475549_142484776_142514277_142521702_RR 4031.321645 150 1.501 160 Hg38_4_124396134_124401011_124507033_124522866_FR 3626.70075 134 1.501 161 Hg38_12_31992399_31994148_32218403_32222271_RF 4824.003128 175 1.499 162 Hg38_X_2551528_2553681_2721164_2724566_FR 4920.501174 180 1.498 163 Hg38_4_12250997_12254184_12322283_12330696_FF 4300.114047 161 1.498 164 Hg38^203737190^203742853^203950615^203958558^RR 4856.527848 177 1.497 165 Hg38JL171028618J71040398J71297049J71298480JR 4401.334551 164 1.497 166 Hg38187445 4203.559159 157 1.497 167 Hg38_7_10927538_10936617_11059573_11063361_FF 4045.05349 151 1.497 168 Hg38_2_199918581_199920573_200063524_200066499_FF 3765.522187 141 1.497 169 Hg38_20_40684507_40687277_40697330_40701314_RF 3823.485364 145 1.495 170 Hg38_l_69381686_69386805_69431002_69439637_FF 5021.561295 188 1.494 171 Hg38_X_80882210_80890038_81125945_81129443_RF 3947.387733 148 1.494 172 Hg38_X_81004388_81008183_81249768_81260862_RR 3665.225818 137 1.494 173 Hg38243218506432229544333899343342008RR 4532.348136 168 1.493 174 Hg38127800179 4479.616333 166 1.493 175 Hg38^8J38470025J.38485193J38738624J38748013JR 3670.508224 138 1.493 176 Hg38_12_85366513_85378853_85614124_85622896_FF 4696.514771 172 1.492 177 Hg38_7_112896017_112908366_113061946_113067988_RR 3616.071678 133 1.492 178 Hg38_2_200576039_200582576_200625910_200631991_FF 4070.103419 153 1.491 179 Hg38_15_30512275_30516087_30637530_30644724_RF 5643.964375 225 1.49 180 Hg38_7_25392695_25398339_25542599_25548176_FR 4947.457038 183 1.49 181 Hg38_6_56692561_56704365_56788190_56791583_FR 4933.771069 182 1.49 182 Hg38963901466639078146408035264086066R 4265.343025 158 1.49 183 Hg381321325011213273902157541321582625RF 46100.56928 5384 1.488 184 Hg38^L164713694JL64729294J64967949J64972230^RF 5809.93205 233 1.488 185 Hg38_l_63238122_63243108_63375818_63382270_FR 4098.295424 154 1.488 186 Hg38_ll_106045994_106053482_106098496_106106725_FR 5214.04095 199 1.486 187 Hg38_2_191681747_191683098_191825543_191836084_RF 5765.279979 232 1.485 188 Hg38_14_70326561_70339130_70362648_70369731_RR 5337.378645 208 1.485 189 Hg38_5_3428156_3436940_3502869_3506924_RF 97200.98548 27570 1.484 190 Hg38_9_93834125_93843642_94033256_94043963_RR 5264.953933 204 1.484 191 Hg38^L166975421J.66983791JL67173650J.67191011JF 4931.651686 181 1.484 192 Hg38^12^114559051J14568056J14591211J14602162JF 5641.122845 223 1.483 193 Hg381391314238913257889144890191460521RR 5289.858609 205 1.483 194 Hg38_X_107971578_107974327_108029689_108034634_RR 4958.888197 185 1.483 195 Hg38_8_24835942_24839566_24905842_24907666_FR 4823.525297 174 1.483 196 Hg38_8_115234769_115239118_115394021_115408137_FR 4268.313107 159 1.483 197 Hg38_12_126756498_126769103_126960572_126965968_RF 4607.573373 170 1.482 198 Hg38_ll_93302415_93309584_93391985_93400931_RF 5161.045697 194 1.481 199 Hg38_3_81259865_81272497_81351596_81353868_RR 4609.489918 171 1.481 200 Hg3833^ 12F R 4308.252287 162 1.479 Table 1A (part 4a) Probe sequence No. Pfp P.valu e Type 60 mer 151 0.201 2369 82 0.022 2958 9 SBMA TGAGCTAATAAACTATTTCTGGTTTTGCTCGAGTTCCACATTCTATACCATGI 1ICI 11 1 152 0 0 SBMA TGTCTTCTGGAI11IATTAI 1 1 1 1 1C1GTCGAAATGATCATATAATTTTACTCCTTCAGT 153 0 0 SBMA 1 1 1 1 1 1 1 1 1 1 1 1 1CAGACTTTCCTGTGGTCGACAAGGAGGTAAGATTAGATACATACATC 154 0 0 SBMA TACATTCGGTCACTGAAAACATTAGTTTTCGATGAGGGTGTCTTTTCTCCAGTTTATGTT 155 0 0 SBMA TTTGAGTGTTCTTTTCTTCTGTGGAATATCGATTGCTCACATGTGGTTGTTAATAAAACT 156 0 0 SBMA GCATGTCAGGTAATGAAAACAGACATTATCGAAAGACATTTATACACGACTTTAACCGTT 157 0 0 SBMA TGAATAAI 1 1 1 1AATTTACATAAATGGATCGATTCTTTTTAAACATATAGCACCAGGCAG 158 0 0 SBMA AAACTTCAGTTTGCTTTACTGTAAAATGTCGACTTACTGTTGCTGAAGAGAGAGATAAGA 159 0 0 SBMA GAATTGGGIIICIICIIICIIIIGAATGTCGACTTTAATTTATCCTTTCTTTGAAAGCCA 160 0 0 SBMA TTACACTCATTGA111ICAGATATTAAATCGAA11C11GTACATGTAAGTGGCAGATAAG 161 0 0 SBMA CAGAAGATTGGAGTTATCAAATGAATTATCGAAGAGAAGCTTCAGTGCAGATGGATTTGA 162 0 0 SBMA GCCAAGGCAAAACTCCAATTATTAGTTTTCGAAAGTTTATATGTTTAGG1 1 111 1IGTTT 163 0 0 SBMA AAGGGACTAGAAGAAGAAATCATTAAGTTCGACAAI 1 1 1 1AAATAACTGCCTGAAGATAA 164 0 0 SBMA CTTAAAAATCAACCAAAGTACAGTATTTTCGAACTGCAGACTTAGAGCTGTCAAGCGGTT 165 0 0 SBMA TAGCTTTGCATGAACTAAATGTCAAATTTCGAAAAATTATACTGCGAGAAAATTCATACC 166 0 0 SBMA GGCAAATCTCGTATAGATTTGTATTTCATCGATATAATTTTAATGAGTGCTCAATTACAG 167 0 0 SBMA TTAGAGGCAAAATATAACACAGATGAGATCGACATATTGCAAAATTTATACTGTGGTCAG 168 0 0 SBMA AACTATAAAAAGGATTTAGATGAGCCCTTCGAGATTTAAAACACACACACACACATATTT 169 0 0 SBMA TCTAAACTTGGAGTCAGAAGAACTGAGTTCGAGCTAGAATTCCAAGCTTCTCTCCTATTG 170 0 0 SBMA TTGCTA1 1C1 1 1C11CATTCATCACTCTTCGATTTGTAAACTTACAAAACCTAAACATTC 171 0 0 SBMA CCATTTGTATTTCCTGTCTGTGAAI 1 1 1 1CGAAATGTATGAATCAGAATAATTCAGAGGA 172 0 0 SBMA TTCACTCAAAGCCTGAATGATTTTAGGGTCGAAAGAAACCAGAAAGTAACTATGCAAGTA 173 0 0 SBMA CTGAAATAGAAGGAAAGATATTAAGGACTCGAGTGAAAAAAGGAAGGAAGCTATAACTTA 174 0 0 SBMA TTGCTTGTTGTTCTGTGATTTGTTTTAATCGACAGAACATCTTCTGGTGTTCTGTTCACC 175 0 0 SBMA ATTTCAGCAGAGTTTACAGACTGTAATTTCGAGGCTCAGACCTCATGTCTCTCTTGTTGC 176 0 0 SBMA AGTAAGGCAGAAGTGATATTGTATGACTTCGAACI11 1 1 1 1 1 1 1CIACTGCATACATATA 177 0 0 SBMA TATGTAAGCTTTGCTGGAGAAGTTTTAGTCGAGTTTGAGGCACTAAGGTAAATAAAACAT 178 0 0 SBMA GCAGATTATAGCTGGAATTCACAATATTTCGAAAATCTGAGTTTAAAAAAAGAGCACAGA 179 0 0 SBMA ATTTTCAGGTAGGATCATAAAGGACTTATCGAAAAGAAAAAAAAGAATTATTTAACTTAA 180 0 0 SBMA CTTCAAGTAGTCACAGAGAATGACAGAATCGAAGTACTGTTTTGTTTATTGCTGTATCCC 181 0 0 SBMA AGTCTTCATAGAGATCATTCACATGTTTTCGAAAGTATTAAG1 1C1 1C1 1 1 1 11 1111 1 1 182 0 0 SBMA CCATCTGATTACAGTTACATGTATCATATCGAATGACCTCCCTTCTATTCCTGTTAATAA 183 0.000 0854 3833 5809 8068 0.000 0004 9528 5101 1781 33 SBMA ACTTAACTTCCTTCTAAAACAACCI 1 1 1 1CGACTTTAGTTGGTGACATCATCATCCCCCT 184 0 0 SBMA CAGCTATTGACTGTGTATCTTTAGAAAATCGATCTCTAAATAAACTGCAGAGGAGGAGGT 185 0 0 SBMA CCTTAAAAGATGTGAAACAGAGAACAGCTCGAATTA1 1 1 1 1G1AATTTATA11 111C1 AG 186 0 0 SBMA AG 1 1 1 1 1CCACCTATGACAAATAATCTATCGATTAGTAAAAGAAAAAAATTTGAATGTTT 187 0 0 SBMA CTCCTCTTCATCTTCCACAATAGTCAAGTCGACAGAAI 1 1 1 1GTATTCTTTTGTAAATAG 188 0 0 SBMA GTAGTTGATTTATTTGCTACAGTTGTAATCGAAAGATTAGTTACTTCATGAATCTTTGTT 189 0.008 3194 29 0.000 2469 61 SBMA AATATTAGAATGGGCTACTCGCCTTTCCTCGAGACGTGGGCAAATGTATTTAAAAGTCAT 190 0 0 SBMA AAGTTCAACACAGTTGCAGAATATAGGATCGAAATGI 1 ICI ICAGAATCATGI11IATAT 191 0 0 SBMA CCCCTATGTGGAATTATGTAGTTATCTCTCGAAACAGTATGTTCTGGCATAAAAACAGAC 192 0 0 SBMA CTGTACTTAGGGTATCATAAGGCTGAAATCGATTTCCTGTCTTACCCACACATTCAGGCT 193 0 0 SBMA GAATATTTTATTTGCCATTTCAACAAAATCGAAATGCGGCTGCTTTTCAAGGTAAGTGGA 194 0 0 SBMA CCACCACCACCAGTGGTCCTCCCAGTATTCGATGGAATAGTGAAAACCTTCACCAATTGC 195 0 0 SBMA CTTCAACTCAATATAAATAAGATCTCTATCGAGGTAACTAGGTCTTTACTTGCCTGAATC 196 0 0 SBMA GTGTCCTTTACATCCTAAGTACAGAGATTCGATGGAGAAAGTGGTGTGCACACCAGTACA 197 0 0 SBMA AGAAACAAGTAAGAGATTCTAAAAGTTCTCGAI11IGAAGGTAATTTGCACI 11 ICI ACT 198 0 0 SBMA ATTTCACCACTTTTATTCAACATAATACTCGACAGAATGAAGAACAAAAACGATTTGATC 199 0 0 SBMA TTAAAATGATTTAGCAGGGCACAAAATGTCGATAAATAATACGACATTTGCATCACTACC 200 0 0 SBMA ATTTG1 1 1 1 1CAGAATAGAAATGTACTGTCGACCTATCTTCAGACTCACTGTTTCTTTCC Table 1A (part 4b) Probe Location No. Chr Startl Endl Start2 End2 151 17 36027997 36028026 36275426 36275455 152 12 78435227 78435256 78476494 78476523 153 X 40477202 40477231 40592757 40592786 154 Y 3585199 3585228 3726586 3726615 155 7 103380034 103380063 103627679 103627708 156 1 152728332 152728361 152991209 152991238 157 10 103831107 103831136 103895199 103895228 158 Y 2866837 2866866 2972871 2972900 159 4 142475551 142475580 142514279 142514308 160 4 124400980 124401009 124507035 124507064 161 12 31992401 31992430 32222240 32222269 162 X 2553650 2553679 2721166 2721195 163 4 12254153 12254182 12330665 12330694 164 2 203737192 203737221 203950617 203950646 165 4 171040367 171040396 171297051 171297080 166 18 74451501 74451530 74653961 74653990 167 7 10936586 10936615 11063330 11063359 168 2 199920542 199920571 200066468 200066497 169 20 40684509 40684538 40701283 40701312 170 1 69386774 69386803 69439606 69439635 171 X 80882212 80882241 81129412 81129441 172 X 81004390 81004419 81249770 81249799 173 2 43218508 43218537 43338995 43339024 174 12 78008367 78008396 78106513 78106542 175 8 138485162 138485191 138738626 138738655 176 12 85378822 85378851 85622865 85622894 177 7 112896019 112896048 113061948 113061977 178 2 200582545 200582574 200631960 200631989 179 15 30512277 30512306 30644693 30644722 180 7 25398308 25398337 25542601 25542630 181 6 56704334 56704363 56788192 56788221 182 9 63901468 63901497 64086035 64086064 183 13 21325013 21325042 21582594 21582623 184 4 164713696 164713725 164972199 164972228 185 1 63243077 63243106 63375820 63375849 186 11 106053451 106053480 106098498 106098527 187 2 191681749 191681778 191836053 191836082 188 14 70326563 70326592 70362650 70362679 189 5 3428158 3428187 3506893 3506922 190 9 93834127 93834156 94033258 94033287 191 4 166983760 166983789 167190980 167191009 192 12 114568025 114568054 114602131 114602160 193 13 91314240 91314269 91448903 91448932 194 X 107971580 107971609 108029691 108029720 195 8 24839535 24839564 24905844 24905873 196 8 115239087 115239116 115394023 115394052 197 12 126756500 126756529 126965937 126965966 198 11 93302417 93302446 93400900 93400929 199 3 81259867 81259896 81351598 81351627 200 3 38506839 38506868 38670655 38670684 Table 1A (part 4c) 4 kb Sequence Location No. Chr Startl Endl Start! End2 151 17 36024027 36028026 36271456 36275455 152 12 78435227 78439226 78472524 78476523 153 X 40477202 40481201 40588787 40592786 154 Y 3581229 3585228 3722616 3726615 155 7 103380034 103384033 103627679 103631678 156 1 152724362 152728361 152991209 152995208 157 10 103827137 103831136 103895199 103899198 158 Y 2866837 2870836 2968901 2972900 159 4 142475551 142479550 142514279 142518278 160 4 124397010 124401009 124507035 124511034 161 12 31992401 31996400 32218270 32222269 162 X 2549680 2553679 2721166 2725165 163 4 12250183 12254182 12326695 12330694 164 2 203737192 203741191 203950617 203954616 165 4 171036397 171040396 171297051 171301050 166 18 74451501 74455500 74653961 74657960 167 7 10932616 10936615 11059360 11063359 168 2 199916572 199920571 200062498 200066497 169 20 40684509 40688508 40697313 40701312 170 1 69382804 69386803 69435636 69439635 171 X 80882212 80886211 81125442 81129441 172 X 81004390 81008389 81249770 81253769 173 2 43218508 43222507 43338995 43342994 174 12 78004397 78008396 78102543 78106542 175 8 138481192 138485191 138738626 138742625 176 12 85374852 85378851 85618895 85622894 177 7 112896019 112900018 113061948 113065947 178 2 200578575 200582574 200627990 200631989 179 15 30512277 30516276 30640723 30644722 180 7 25394338 25398337 25542601 25546600 181 6 56700364 56704363 56788192 56792191 182 9 63901468 63905467 64082065 64086064 183 13 21325013 21329012 21578624 21582623 184 4 164713696 164717695 164968229 164972228 185 1 63239107 63243106 63375820 63379819 186 11 106049481 106053480 106098498 106102497 187 2 191681749 191685748 191832083 191836082 188 14 70326563 70330562 70362650 70366649 189 5 3428158 3432157 3502923 3506922 190 9 93834127 93838126 94033258 94037257 191 4 166979790 166983789 167187010 167191009 192 12 114564055 114568054 114598161 114602160 193 13 91314240 91318239 91448903 91452902 194 X 107971580 107975579 108029691 108033690 195 8 24835565 24839564 24905844 24909843 196 8 115235117 115239116 115394023 115398022 197 12 126756500 126760499 126961967 126965966 198 11 93302417 93306416 93396930 93400929 199 3 81259867 81263866 81351598 81355597 200 3 38502869 38506868 38670655 38674654 Table 1A (part 4d) No. probe Primer ID 151 Hg38_17_36023309_36028028_36272442_36275457_FF OBD160.601 152 Hg38_12_78435225_78440781_78459801_78476525_RF OBD160.605 153 Hg38_X_40477200_40482652_40589768_40592788_RF OBD160.609 154 Hg38_Y_3584113_3585230_3719457_3726617_FF OBD160.613 155 Hg38_7_103380032_103385339_103627677_103636524_RR OBD160.617 156 Hg38_l_152724530_152728363_152991207_152992512_FR OBD160.621 157 Hg38101038255061038311381 OBD160.625 158 Hg38_Y_2866835_2871971_2958559_2972902_RF OBD160.629 159 Hg38^L142475549J42484776J42514277J42521702^RR OBD160.633 160 Hg38_4_124396134_124401011_124507033_124522866_FR OBD160.637 161 Hg38_12_31992399_31994148_32218403_32222271_RF OBD160.641 162 Hg38_X_2551528_2553681_2721164_2724566_FR OBD160.645 163 Hg38_4_12250997_12254184_12322283_12330696_FF OBD160.649 164 Hg38_2_203737190_203742853_203950615_203958558_RR OBD160.653 165 Hg38_4_171028618_171040398_171297049_171298480_FR OBD160.657 166 Hg38187^ OBD160.661 167 Hg3871092753810936617^1 OBD160.665 168 Hg382199918581199920573^2^ F OBD160.669 169 Hg38_20_40684507_40687277_40697330_40701314_RF OBD160.673 170 Hg38_l_69381686_69386805_69431002_69439637_FF OBD160.677 171 Hg38_X_80882210_80890038_81125945_81129443_RF OBD160.681 172 Hg38_X_81004388_81008183_81249768_81260862_RR OBD160.685 173 Hg38_2_43218506_43222954_43338993_43342008_RR OBD160.689 174 Hg381278001793780083987810454378106544FF OBD160.693 175 Hg38^138470025J38485193J38738624J38748013JR OBD160.697 176 Hg38128536651385378^^ OBD160.701 177 Hg38 7 112896017 112908366 113061946 113067988 RR OBD160.705 178 Hg38_2_200576039_200582576_200625910_200631991_FF OBD160.709 179 Hg38_15_30512275_30516087_30637530_30644724_RF OBD160.713 180 Hg38_7_25392695_25398339_25542599_25548176_FR OBD160.717 181 Hg38_6_56692561_56704365_56788190_56791583_FR OBD160.721 182 Hg38_9_63901466_63907814_64080352_64086066_RF OBD160.725 183 Hg38_13_21325011_21327390_21575413_21582625_RF OBD160.729 184 Hg38JL164713694J64729294J64967949J64972230^RF OBD160.733 185 Hg3816323812263243108^6 OBD160.737 186 Hg38_ll_106045994_106053482_106098496_106106725_FR OBD160.741 187 Hg38_2_191681747_191683098_191825543_191836084_RF OBD160.745 188 Hg38_14_70326561_70339130_70362648_70369731_RR OBD160.749 189 Hg38_5_3428156_3436940_3502869_3506924_RF OBD160.753 190 Hg38_9_93834125_93843642_94033256_94043963_RR OBD160.757 191 Hg38_4_166975421_166983791_167173650_167191011_FF OBD160.761 192 Hg381211455905l_114568056_l14591211_114602162FF OBD160.765 193 Hg38J3^91314238^91325788^9144890V9146052OR OBD160.769 194 Hg38_X_107971578_107974327_108029689_108034634_RR OBD160.773 195 Hg38_8_24835942_24839566_24905842_24907666_FR OBD160.777 196 Hg38_8_115234769_115239118_115394021_115408137_FR OBD160.781 197 Hg38_12_126756498_126769103_126960572_126965968_RF OBD160.785 198 Hg38_ll_93302415_93309584_93391985_93400931_RF OBD160.789 199 Hg38_3_81259865_81272497_81351596_81353868_RR OBD160.793 200 Hg38_3_38500849_38506870_38670653_38683212_FR OBD160.797 Table 1A (part 4e) No. Sequence Primer ID Sequence 151 TACGCCTGCCATCCACTCTGAAT OBD160.603 GGATTACAGATGTGAGCCACCAC 152 ATGTGTTGCTCTACTGGTTTGTAAGTTA OBD160.607 AGACACATCCAATAAAGAAACTGCGGGC 153 GGTCTATGTGATGCTGAAGTTTTGGG OBD160.611 GCCCTGG 1 1 1 1U G1AGGCAATCAGC 154 ATGAAGGGAAAACATTGGAGTGGAAT OBD160.615 CACACACCTACAGTGAACTCATTTTC 155 ATAGTGGTCAAAGTGAAAAGTCTGAGC OBD160.619 GCACCTTGAGCAGCACCATAGGAGTTT 156 GCTCACAGTCTCCTGGCTGAACC OBD160.623 GAGGGTTCTGCGGTATCTGCCTA 157 AAGCATCCTTCCAGTCTGTGTTTGC OBD160.627 TAATCATTTAGAGGCGGCTCAAAGC 158 CCAGAGGTTGATGGTGG1 1 1C1 1G I G OBD160.631 GGTTTATTTACTGGAGGGTCAGAGGA 159 CCTCCTCTTGGTTGATTTTGCTGTTA OBD160.635 CACCTTTGGTTGGAAGTTTAGGGAGG 160 CTACAACCAGTGAAAGATGGCTCCAA OBD160.639 CTGCCATCCCCACTAATGTCACCTCT 161 GAATGCAGAAGATTGGAGTT OBD160.643 TGCAGATGGATTTGAGATGC 162 GCACACTCTGAGGATTTTAGACTTC OBD160.647 CACAAATAGCCATCAAAATGTCAACAAG 163 GAACAACTACCTGTGCCTCAAAAGAC OBD160.651 CAACTCTGAAGCCTACTGTGTTTATC 164 CAACAGTTCTTCAGCACCCAAGT OBD160.655 GAAGGCTGACTTAGGTTTCCACATA 165 GGGTGTCACTGHUHCCAGATAGC OBD160.659 TCTTCTCATTCTGGAACAACCGATTG 166 TCACAACTCCTGTTTGGAATCGCCCT OBD160.663 CTTCCTCAAATGGTCCTTCAATAACA 167 ACCCATAGATTCCAATACGCTCTTTG OBD160.667 GTAGTTCCAAGTTCAGGAGATACACC 168 ACTGTAGTTTCCAGGACCTCAGG OBD160.671 AGCATTGACTTTTGTCCCTCTTGGGC 169 CCTACCCCTCTCTTAGCCTCACT OBD160.675 CCTGGAGGTAGTGATGGCTGAGG 170 CGG1 1 1UCCAATGCCCTTTATTCTA OBD160.679 GTGAGAAGGGTAAAATCTTAGGCAGC 171 CTGGCACTGGAGAGCAGCACCAA OBD160.683 GCGAACACTGCCTTGAATCTGCC 172 TTGTAAGGCATTGACCTGTTCTACCATA OBD160.687 AAAAGCAAGTCCATAACTCCAGAACA 173 CCTTGGTGCCGCTGGCTGTCTGC OBD160.691 CCGTTTTCCCCTTCATTGTTGTGTGC 174 TTCCCACAGCAAGGCATAGGTTTCTA OBD160.695 GTGAAGAGATACTCATTTGTGGATTG 175 TCAACGAGGTTTCACCAAAGCCACCAAT OBD160.699 CAGAGTTGCTGAATGAGAGGAGAGGACG 176 GCTGGCAGGAAAAGTGTAGACTGTTT OBD160.703 GAGGCAAAGTAATAAGAGAGGAAAAC 177 CGCACACTCACCCTGACTTTGTTATC OBD160.707 CCATTTGTAAACTGCTGACTTCATTG 178 TTGCTCAGCCCCAGGAAATAACTTGG OBD160.711 GTGGATAGGCAGAATCAATAATACTG 179 CAGATAATGAAACAACCACCATCGGT OBD160.715 GACTTCCTATTCCTGCTGCCTATGGT 180 TCATAACACCTCCCTCCTCTGTGGAACA OBD160.719 CCTTCGGGAGATGTATTTAGGAGTTGCG 181 ACCAAGGTATCTCCTGAAAGAACC OBD160.723 TAATACTTAGGCTGGGAGCGATGGCT 182 GGAATGAAGCCCAGTTGAGTTGC OBD160.727 GCCCAAACCCGTGTGGTCCAACA 183 TTTCCTTTTGACI 1 1 1CCCCTAAT OBD160.731 ATTGGCAGGAGGAATAAGGAAGAG 184 ATTGAGAGGACACCAGGTTTGAATCC OBD160.735 GGTGATTAGGTTATGAGGGCTCCGTC 185 ATTTGAGTTACTTGTTTAGGGCTCCT OBD160.739 CAATGGTTGAACAATGACTAAACTGCCA 186 TATGCCTCTGGGTAATGGGCTAACAG OBD160.743 CTTGACCTTTATTTACTATGCTTGGC 187 AGGATGGCACGGTGGCTCTAAGC OBD160.747 ATCAAGCCCTCTCTATCCACCATA 188 CAGCCTTTTCCTTGTCCTCTCAA OBD160.751 GCCCAGGAGTTCAAGACCAGCCT 189 CAGAGACGGTTTCCACGGTTGTC OBD160.755 ACACCTGGGACTGGCTCCAACTC 190 CACTTCCGTTCAACTTTTACTGGAGG OBD160.759 ATGTTGCCTCCACAGAAACCAGAAAA 191 TAATGTCCTCTGGGCTCATCCAT OBD160.763 CTGCTCTATTGGTCTAAGTGTCTG 192 GTTAGAAATCTGGTATGAAATGACTGG OBD160.767 TTTATTAGGAATGCTGGAGAACTCAG 193 GCCTAAACTCCTCAAATAATGCTAATGA OBD160.771 AATGTTGGCAGACCTGGAAGAACCCTAT 194 GCTCAACTCTGCCATCTTACTGTGAA OBD160.775 CTCACCTTCCTCTCACCTTTTGACCC 195 GGCTCAAAGAGAATGTGTAAGAGAGAAA OBD160.779 GTCCCTGAACTTGATTGCCTGTGGTCTA 196 CTGTTTACTCCCTTGGCATCTGCTGC OBD160.783 GGCTATTTGCTCTTGCTACTTCTTTC 197 GCTGCCTTCCTGTTTTGATACCCTGC OBD160.787 AATACTACCAAATGACAGCCCAGCAT 198 GACTTCCAGTTTCAAAATGGTGGC OBD160.791 ATTGTGTTGAGGTATGTTCCTTCCAT 199 GACATCTCTATCTTTACAGACTGCCCCT OBD160.795 GCCTCCCAAAGCACTGAGATTATGACAT 200 IIICIIGGTATCTTTCATAGGAAT OBD160.799 AATAACAGCAGTGAAGAATACCTT Table 1A (part 4f) No. probe Marker 151 Hg38_17_36023309_36028028_36272442_36275457_FF OBD160.601.603 152 Hg38_12_78435225_78440781_78459801_78476525_RF OBD160.605.607 153 Hg38_X_40477200_40482652_40589768_40592788_RF OBD160.609.611 154 Hg38_Y_3584113_3585230_3719457_3726617_FF OBD160.613.615 155 Hg38_7_103380032_103385339_103627677_103636524_RR OBD160.617.619 156 Hg38_l_152724530_152728363_152991207_152992512_FR OBD160.621.623 157 Hg38_10_103825506_103831138_103895197_103900793_FR OBD160.625.627 158 Hg38_Y_2866835_2871971_2958559_2972902_RF OBD160.629.631 159 Hg38_4_142475549_142484776_142514277_142521702_RR OBD160.633.635 160 Hg38_4_124396134_124401011_124507033_124522866_FR OBD160.637.639 161 Hg38_12_31992399_31994148_32218403_32222271_RF OBD160.641.643 162 Hg38_X_2551528_2553681_2721164_2724566_FR OBD160.645.647 163 Hg38_4_12250997_12254184_12322283_12330696_FF OBD160.649.651 164 Hg38_2_203737190_203742853_203950615_203958558_RR OBD160.653.655 165 Hg38_4_171028618_171040398_171297049_171298480_FR OBD160.657.659 166 Hg38_18_74451499_74454993_74653959_74660559_RR OBD160.661.663 167 Hg38_7_10927538_10936617_11059573_11063361_FF OBD160.665.667 168 Hg38_2_199918581_199920573_200063524_200066499_FF OBD160.669.671 169 Hg38_20_40684507_40687277_40697330_40701314_RF OBD160.673.675 170 Hg38_l_69381686_69386805_69431002_69439637_FF OBD160.677.679 171 Hg38_X_80882210_80890038_81125945_81129443_RF OBD160.681.683 172 Hg38_X_81004388_81008183_81249768_81260862_RR OBD160.685.687 173 Hg38_2_43218506_43222954_43338993_43342008_RR OBD160.689.691 174 Hg38_12_78001793_78008398_78104543_78106544_FF OBD160.693.695 175 Hg38_8_138470025_138485193_138738624_138748013_FR OBD160.697.699 176 Hg38_12_85366513_85378853_85614124_85622896_FF OBD160.701.703 177 Hg38_7_112896017_112908366_113061946_113067988_RR OBD160.705.707 178 Hg38_2_200576039_200582576_200625910_200631991_FF OBD160.709.711 179 Hg38_15_30512275_30516087_30637530_30644724_RF OBD160.713.715 180 Hg38_7_25392695_25398339_25542599_25548176_FR OBD160.717.719 181 Hg38_6_56692561_56704365_56788190_56791583_FR OBD160.721.723 182 Hg38_9_63901466_63907814_64080352_64086066_RF OBD160.725.727 183 Hg38_13_21325011_21327390_21575413_21582625_RF OBD160.729.731 184 Hg38_4_164713694_164729294_164967949_164972230_RF OBD160.733.735 185 Hg38_l_63238122_63243108_63375818_63382270_FR OBD160.737.739 186 Hg38_ll_106045994_106053482_106098496_106106725_FR OBD160.741.743 187 Hg38_2_191681747_191683098_191825543_191836084_RF OBD160.745.747 188 Hg38_14_70326561_70339130_70362648_70369731_RR OBD160.749.751 189 Hg38_5_3428156_3436940_3502869_3506924_RF OBD160.753.755 190 Hg38_9_93834125_93843642_94033256_94043963_RR OBD160.757.759 191 Hg38_4_166975421_166983791_167173650_167191011_FF OBD160.761.763 192 Hg38_12_114559051_114568056_114591211_114602162_FF OBD160.765.767 193 Hg38_13_91314238_91325788_91448901_91460521_RR OBD160.769.771 194 Hg38_X_107971578_107974327_108029689_108034634_RR OBD160.773.775 195 Hg38_8_24835942_24839566_24905842_24907666_FR OBD160.777.779 196 Hg38_8_115234769_115239118_115394021_115408137_FR OBD160.781.783 197 Hg38_12_126756498_126769103_126960572_126965968_RF OBD160.785.787 198 Hg38_ll_93302415_93309584_93391985_93400931_RF OBD160.789.791 199 Hg38_3_81259865_81272497_81351596_81353868_RR OBD160.793.795 200 Hg38_3_38500849_38506870_38670653_38683212_FR OBD160.797.799 Table 1A (part 4g) No probe RP / Rsum Rpran k FC:(class l / class2) Pfp 1 Hg38_3_100733021_100742761_100862282_100875494_RF 1276.982875 9 -1.862 0 2 Hg38_3_100750954_100758578_100862282_100875494_RF 1853.765048 19 -1.807 0 3 Hg38_5_150272362_150278699_150330165_150332483_FR 1170.349245 3 -1.745 0 4 Hg38_3_100862282_100875494_101052914_101071675_F F 3484.363128 62 -1.739 0 5 Hg38_5_150008962J50014465_150272362_150278699_RF 1191.048051 5 -1.715 0 6 Hg38^150272362J.50278699J50382773J50387928JF 1176.134465 4 -1.708 0 7 Hg38 12 69346683 69349534 69539751 69542024 FF 1240.559047 8 -1.633 0 8 Hg38_8_143073684_143079751_143219138_143224471_RF 891.0362935 1 -1.62 0 9 Hg38_l_32214585_32217213_32237144_32241139_RF 1916.433227 20 -1.612 0 10 Hg38_X_46498682_46508989_46616810_46620218_FR 1191.059693 6 -1.611 0 11 Hg38_10_8256256_8258992_8314718_8322822_FF 1997.333433 23 -1.604 0 12 Hg38_6_3027907_3030237_3146778_3149848_FR 1332.376903 10 -1.598 0 13 Hg387^2^ 2411.122208 36 -1.597 0 14 Hg3872537068425382177^2 2022.117984 24 -1.596 0 15 Hg38_6_2898813_2902737_3146778_3149848_RR 1435.327398 11 -1.59 0 16 Hg38_5_150036868_150040595_150272362_150278699_RF 2126.214981 28 -1.579 0 17 Hg38_8_142863175_142868397_143073684_143079751_RR 1054.173681 2 -1.578 0 18 Hg38_5_150194890_150198993_150272362_150278699_RF 2149.76038 31 -1.576 0 19 Hg38_3_100862282_100875494_101027240_101038115_F F 3687.763264 73 -1.572 0 20 Hg38_8_26561792_26565691_26638318_26644530_RR 2165.336533 32 -1.571 0 21 Hg38727151628271542802730254827312509FF 2361.083379 34 -1.57 0 22 Hg38_3_100677572J00682399_100862282_100875494_RF 3589.606187 67 -1.568 0 23 Hg38984621528^8 1828.923149 17 -1.564 0 24 Hg38_X_46498682_46508989_46571235_46574591_FR 1785.89045 15 -1.563 0 25 Hg38_7_25274699_25276258_25370684_25382177_RF 2139.963434 30 -1.563 0 26 Hg38_6_3146778_3149848_3232412_3234356_RF 1805.502041 16 -1.557 0 27 Hg38_Y_7774814_7781345_7901883_7918222_RR 2848.762302 43 -1.557 0 28 Hg38_6_47291785_47297630_47538465_47543792_RF 1946.170671 22 -1.556 0 29 Hg38_5_150272362_150278699_150390262_150397231_FR 2615.809608 40 -1.555 0 30 Hg38628917802^ 1661.21676 12 -1.555 0 31 Hg381333481982334885 1752.746474 13 -1.549 0 32 Hg386304554531_3146778_3149848FR 1924.507183 21 -1.549 0 33 Hg38_8_26561792_26565691_26776216_26787349_RR 3150.83329 51 -1.548 0 34 Hg38_6_2860707_2865436_3146778_3149848_FR 1839.184279 18 -1.544 0 35 Hg38_7_27250080_27251352_27302548_27312509_FF 2509.589873 38 -1.544 0 36 Hg38_12_114767229_114770912_114977828_114985191_RF 2775.735277 42 -1.54 0 37 Hg38_7_22390272_22396878_22624843_22634759_FF 7861.738142 308 -1.539 0 38 Hg381291718135917262409189541691906634FR 3218.63397 53 -1.538 0 39 Hg38108^ 3243.075285 57 -1.537 0 40 Hg38^142835475J42844052J43073684J43079751_F R 1213.884569 7 -1.535 0 41 Hg38^3146778^3149848^3207080^3212780^RF 2066.688372 25 -1.533 0 42 Hg38_10_102798644_102804186_102874567_102879563_RR 1775.993146 14 -1.527 0 43 Hg38_6_3146778_3149848_3196920_3199851_RF 2136.395315 29 -1.525 0 44 Hg38_12_114977828_114985191_115073537_115080207_FR 3454.341156 60 -1.521 0 45 Hg38_X_46498682_46508989_46621627_46624211_FF 2395.87684 35 -1.521 0 46 Hg38_5_150272362_150278699_150335788_150341587_FF 3220.31145 54 -1.518 0 47 Hg381291718135917262409188828391891782FR 3918.107486 81 -1.515 0 48 Hg38X46498682465089894662421146629863_ 2684.932505 41 -1.514 0 49 Hg3872720141827203903^2 3018.091514 48 -1.513 0 50 Hg38_5_132650160_132653783_132755645_132763810_RR 3592.88293 68 -1.51 0 Table IB (part la) Probe sequence No. P.va lue Type 60 mer 1 0 Healthy Control CCCGATTTGCTTAATCTCGGCATAGATTTCGAATTATATTTGATTTGTCTTATCTCCTCA 2 0 Healthy Control CCCGATTTGCTTAATCTCGGCATAGATTTCGAATCAAATAGTTTATTTAGAGAACCTCCA 3 0 Healthy Control AGTGCCTGTGAAAGTGTTTCTGAATTCCTCGATCAGCTTCTCAGAAAAATGAAATTGACT 4 0 Healthy Control CCCGATTTGCTTAATCTCGGCATAGATTTCGAATTACAGATTTTATCCAAAATATCTGTC 5 0 Healthy Control AGTGCCTGTGAAAGTGTTTCTGAATTCCTCGACTTCTTGCTTTTGATTTATTGAAGAATC 6 0 Healthy Control AGTGCCTGTGAAAGTGTTTCTGAATTCCTCGACAAAAATCAGAGGGGGTTTAATCACCTT 7 0 Healthy Control AGTTATTTTATAGTTTAGTACATAGTTGTCGAGTGTGTGAGGAAAAATTATTCTGAAAAT 8 0 Healthy Control CATGTTTTGGAGTCTTTTATCTAGTTTATCGAGGAGACAGCCGTTGTCCCCAGGGCTCCT 9 0 Healthy Control AAGGGCTCGGGAGCTCCCTCGGCACACCTCGAGGAGTGCCAGGCATCTACTGCTCTGTCC 10 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCGCATATCGATGAGAAGTCTGATTCTTGCI1 11IGGAG 11 0 Healthy Control TGGGGTGATTGGGTTCATTTATGTATTATCGAGAGACATAACAATATTTATAAAGTTTGG 12 0 Healthy Control AAACTTGGTATGTGTCTAATAAACAGCTTCGAGTGCTGGTTTGGGTCGGAGTGCTGGTTC 13 0 Healthy Control CTTTAAGTCAACAAATACACTGAAGACTTCGAAGTAATGAAGAGGGAGGTGGTTTTCTTT 14 0 Healthy Control AGCCAGCCATTGTTAACATAGTTCAACTTCGAAGGAATGATTCI 1 1 1 1 1 Cl 1AACCATGC 15 0 Healthy Control CCTCCAGTCCTAI11 Cl 11 1 1 1 1 1 1 1 1 1 1CGAGTGCTGGTTTGGGTCGGAGTGCTGGTTC 16 0 Healthy Control AGTGCCTGTGAAAGTGTTTCTGAATTCCTCGAATTATTATGAGTCTCCGTCCACGCAGTG 17 0 Healthy Control TCGTCTATGCATGGAATATTCTCCAAAATCGAGGAGACAGCCGTTGTCCCCAGGGCTCCT 18 0 Healthy Control AGTGCCTGTGAAAGTGTTTCTGAATTCCTCGAGCGTACACCAATGGAGGAGGTATGGGCC 19 0 Healthy Control CCCGATTTGCTTAATCTCGGCATAGATTTCGAAAGGCCTGAGAAAAAAGGGAGCTGGTGG 20 0 Healthy Control CAGCCAGCCAGTAGATCTTCATAGGAGCTCGAAATTTTGCTATAAATGTGAGCTTTGAAA 21 0 Healthy Control ATGCI 1 1 1 IGGAATAAATATATTAI 1 1 1 1CGAAGTAATGAAGAGGGAGGTGGTTTTCTTT 22 0 Healthy Control CCCGATTTGCTTAATCTCGGCATAGATTTCGAAGAACTCCTTTTAGCATTTCTTGTAGGT 23 0 Healthy Control CTCTTCAGGGGTGTGTGGAGTAAATAGCTCGAGGAAACCTAAAAGTGTCATGTTATCCAT 24 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCGCATATCGAGGATCTATCTCCTTTCTCACCTGTCTGG 25 0 Healthy Control AGCCAGCCATTGTTAACATAGTTCAACTTCGATAI11 1 1ACAICATAATTTTGTTTTATT 26 0 Healthy Control GCCCCATTCTGAGAACTCCTGATTGGATTCGAGTGCTGGTTTGGGTCGGAGTGCTGGTTC 27 0 Healthy Control TGCCCAGCCCATTATTGAI 1 ICI 1 1ATGTCGAACTTGCCAACGGAAATTGAGGAAAATTG 28 0 Healthy Control TGGGTGTTAGGGTTTCAATATATGAATTTCGAAGGCCTCTTCCAATTCTGAAGTAAACAG 29 0 Healthy Control AGTGCCTGTGAAAGTGTTTCTGAATTCCTCGAGTCCCTCATGAGATTTTCCAGCGTAGTG 30 0 Healthy Control TGAGGATGGTGAAAGATACCTAAGTCACTCGAGTGCTGGTTTGGGTCGGAGTGCTGGTTC 31 0 Healthy Control AAGGCGGGCAGATCACGAGGTCAGGCAATCGAAAAAAAAAAAAAAGAAAGAAAAAAAAA G 32 0 Healthy Control TGATCACTCCAAACACCCAAAGGTGACTTCGAGTGCTGGTTTGGGTCGGAGTGCTGGTTC 33 0 Healthy Control CAGCCAGCCAGTAGATCTTCATAGGAGCTCGAATTCCTATCCAGCACTGGTCATTAGGGG 34 0 Healthy Control AGTGGTGTAACCTCAGTTGACTGCAGCCTCGAGTGCTGGTTTGGGTCGGAGTGCTGGTTC 35 0 Healthy Control TTGTGAAAGTCATATCCTTGCGTCTTCATCGAAGTAATGAAGAGGGAGGTGGTTTTCTTT 36 0 Healthy Control GGCAGGGGCAGTATTCTCAGGTGGTTCCTCGAAGAACGGGCCTGGCCCAAGGCACTTTGG 37 0 Healthy Control TGTCTTGAGGCTTACTAGTGCACTCCCGTCGATGTATTCACTAATAAAAAAGGAAGATTC 38 0 Healthy Control GTCAGGGTCAGATATTGATTTAACGAAGTCGAAGAACTAAAAACI 1 1 1 1 ILIAGTTTCAC 39 0 Healthy Control TGGGGTGATTGGGTTCATTTATGTATTATCGACTCATAGATCCAGGTACAACGTATAATT 40 0 Healthy Control AAGCAGTCTTGGGGAAAAAGAAAAAAGCTCGAGGAGACAGCCGTTGTCCCCAGGGCTCCT 41 0 Healthy Control TCAAAGTCCAAGTTAGAATTCTGAGAACTCGAGTGCTGGTTTGGGTCGGAGTGCTGGTTC 42 0 Healthy Control AAGGCGGGCAGATCACGAGGTCAACAGATCGACATTTCATCTGTTCTCTTTTAGATCAAA 43 0 Healthy Control ACTATGGTGGATTTAAAAATAAATGCCCTCGAGTGCTGGTTTGGGTCGGAGTGCTGGTTC 44 0 Healthy Control GGCAGGGGCAGTATTCTCAGGTGGTTCCTCGATACACTTCTCATAAAAAATGGCACTGAA 45 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCGCATATCGATAATTTGCTAGAATGACTCACAGAACAC 46 0 Healthy Control AGTGCCTGTGAAAGTGTTTCTGAATTCCTCGATGTGTTTTGGGGACTGAAAAGTCCTGCA 47 0 Healthy Control GTCAGGGTCAGATATTGATTTAACGAAGTCGACATGCGATTTGAACAGGGACACAAATCC 48 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCGCATATCGAGGCTAATTTAGAGTATAACAGTTTGGGA 49 0 Healthy Control AAAAGGAAAAAGGGAAACCAGGTTTTAATCGAAGTAATGAAGAGGGAGGTGGTTTTCTTT 50 0 Healthy Control TCI 1 1 1 1ATTGAAGAGCGTGTTTTAAAATCGAATATTAGTAGTCCCGTGGCAAGCCTTTG Table IB (part lb) Probe Location No. Chr Startl Endl Start2 End2 1 3 100733023 100733052 100875463 100875492 2 3 100750956 100750985 100875463 100875492 3 5 150278668 150278697 150330167 150330196 4 3 100875463 100875492 101071644 101071673 5 5 150008964 150008993 150278668 150278697 6 5 150278668 150278697 150387897 150387926 7 12 69349503 69349532 69541993 69542022 8 8 143073686 143073715 143224440 143224469 9 1 32214587 32214616 32241108 32241137 10 X 46508958 46508987 46616812 46616841 11 10 8258961 8258990 8322791 8322820 12 6 3030206 3030235 3146780 3146809 13 7 27205434 27205463 27312478 27312507 14 7 25382146 25382175 25548145 25548174 15 6 2898815 2898844 3146780 3146809 16 5 150036870 150036899 150278668 150278697 17 8 142863177 142863206 143073686 143073715 18 5 150194892 150194921 150278668 150278697 19 3 100875463 100875492 101038084 101038113 20 8 26561794 26561823 26638320 26638349 21 7 27154249 27154278 27312478 27312507 22 3 100677574 100677603 100875463 100875492 23 9 84621530 84621559 84814294 84814323 24 X 46508958 46508987 46571237 46571266 25 7 25274701 25274730 25382146 25382175 26 6 3146780 3146809 3234325 3234354 27 Y 7774816 7774845 7901885 7901914 28 6 47291787 47291816 47543761 47543790 29 5 150278668 150278697 150390264 150390293 30 6 2893746 2893775 3146780 3146809 31 13 33481984 33482013 33717459 33717488 32 6 3051360 3051389 3146780 3146809 33 8 26561794 26561823 26776218 26776247 34 6 2865405 2865434 3146780 3146809 35 7 27251321 27251350 27312478 27312507 36 12 114767231 114767260 114985160 114985189 37 7 22396847 22396876 22634728 22634757 38 12 91726209 91726238 91895418 91895447 39 10 8258961 8258990 8544591 8544620 40 8 142844021 142844050 143073686 143073715 41 6 3146780 3146809 3212749 3212778 42 10 102798646 102798675 102874569 102874598 43 6 3146780 3146809 3199820 3199849 44 12 114985160 114985189 115073539 115073568 45 X 46508958 46508987 46624180 46624209 46 5 150278668 150278697 150341556 150341585 47 12 91726209 91726238 91888285 91888314 48 X 46508958 46508987 46629832 46629861 49 7 27203872 27203901 27312478 27312507 50 5 132650162 132650191 132755647 132755676 Table IB (part lc) 4 kb Sequence Location No. Chr Startl Endl StartZ EndZ 1 3 100733023 100737022 100871493 100875492 2 3 100750956 100754955 100871493 100875492 3 5 150274698 150278697 150330167 150334166 4 3 100871493 100875492 101067674 101071673 5 5 150008964 150012963 150274698 150278697 6 5 150274698 150278697 150383927 150387926 7 12 69345533 69349532 69538023 69542022 8 8 143073686 143077685 143220470 143224469 9 1 32214587 32218586 32237138 32241137 10 X 46504988 46508987 46616812 46620811 11 10 8254991 8258990 8318821 8322820 12 6 3026236 3030235 3146780 3150779 13 7 27201464 27205463 27308508 27312507 14 7 25378176 25382175 25544175 25548174 15 6 2898815 2902814 3146780 3150779 16 5 150036870 150040869 150274698 150278697 17 8 142863177 142867176 143073686 143077685 18 5 150194892 150198891 150274698 150278697 19 3 100871493 100875492 101034114 101038113 20 8 26561794 26565793 26638320 26642319 21 7 27150279 27154278 27308508 27312507 22 3 100677574 100681573 100871493 100875492 23 9 84621530 84625529 84810324 84814323 24 X 46504988 46508987 46571237 46575236 25 7 25274701 25278700 25378176 25382175 26 6 3146780 3150779 3230355 3234354 27 Y 7774816 7778815 7901885 7905884 28 6 47291787 47295786 47539791 47543790 29 5 150274698 150278697 150390264 150394263 30 6 2889776 2893775 3146780 3150779 31 13 33481984 33485983 33713489 33717488 32 6 3047390 3051389 3146780 3150779 33 8 26561794 26565793 26776218 26780217 34 6 2861435 2865434 3146780 3150779 35 7 27247351 27251350 27308508 27312507 36 12 114767231 114771230 114981190 114985189 37 7 22392877 22396876 22630758 22634757 38 12 91722239 91726238 91895418 91899417 39 10 8254991 8258990 8540621 8544620 40 8 142840051 142844050 143073686 143077685 41 6 3146780 3150779 3208779 3212778 42 10 102798646 102802645 102874569 102878568 43 6 3146780 3150779 3195850 3199849 44 12 114981190 114985189 115073539 115077538 45 X 46504988 46508987 46620210 46624209 46 5 150274698 150278697 150337586 150341585 47 12 91722239 91726238 91888285 91892284 48 X 46504988 46508987 46625862 46629861 49 7 27199902 27203901 27308508 27312507 50 5 132650162 132654161 132755647 132759646 Table IB (part Id) No. probe Primer ID 1 Hg38_3_100733021_100742761_100862282_100875494_RF OBD160.801 2 Hg38_3_100750954_100758578_100862282_100875494_RF OBD160.805 3 Hg38_5_150272362_150278699_150330165_150332483_FR OBD160.809 4 Hg38_3_100862282_100875494_101052914_101071675_FF OBD160.813 5 Hg38_5_150008962_150014465_150272362_150278699_RF OBD160.817 6 Hg38_5_150272362_150278699_150382773_150387928_FF OBD160.821 7 Hg38_12_69346683_69349534_69539751_69542024_FF OBD160.825 8 Hg38_8_143073684_143079751_143219138_143224471_RF OBD160.829 9 Hg38_l_32214585_32217213_32237144_32241139_RF OBD160.833 10 Hg38_X_46498682_46508989_46616810_46620218_FR OBD160.837 11 Hg38_10_8256256_8258992_8314718_8322822_FF OBD160.841 12 Hg38_6_3027907_3030237_3146778_3149848_FR OBD160.845 13 Hg38_7_27204432_27205465_27302548_27312509_FF OBD160.849 14 Hg38_7_25370684_25382177_25542599_25548176_FF OBD160.853 15 Hg38_6_2898813_2902737_3146778_3149848_RR OBD160.857 16 Hg38^5J50036868J50040595J50272362J50278699JiF OBD160.861 17 Hg38_8_142863175_142868397_143073684_143079751_RR OBD160.865 18 Hg38_5_150194890_150198993_150272362_150278699_RF OBD160.869 19 Hg38_3_100862282_100875494_101027240_101038115_FF OBD160.873 20 Hg38_8_26561792_26565691_26638318_26644530_RR OBD160.877 21 Hg38_7_27151628_27154280_27302548_27312509_FF OBD160.881 22 Hg38_3_100677572_100682399_100862282_100875494_RF OBD160.885 23 Hg38_9_84621528_84639678_84804816_84814325_RF OBD160.889 24 Hg38_X_46498682_46508989_46571235_46574591_FR OBD160.893 25 Hg38_7_25274699_25276258_25370684_25382177_RF OBD160.897 26 Hg38_6_3146778_3149848_3232412_3234356_RF OBD160.901 27 Hg38_Y_7774814_7781345_7901883_7918222_RR OBD160.905 28 Hg38_6_47291785_47297630_47538465_47543792_RF OBD160.909 29 Hg38_5_150272362_150278699_150390262_150397231_FR OBD160.913 30 Hg38_6_2891780_2893777_3146778_3149848_FR OBD160.917 31 Hg38_13_33481982_33488531_33704999_33717490_RF OBD160.921 32 Hg38_6_3045545_3051391_3146778_3149848_FR OBD160.925 33 Hg38_8_26561792_26565691_26776216_26787349_RR OBD160.929 34 Hg38_6_2860707_2865436_3146778_3149848_FR OBD160.933 35 Hg38_7_27250080_27251352_27302548_27312509_FF OBD160.937 36 Hg38_12_114767229_114770912_114977828_114985191_RF OBD160.941 37 Hg38_7_22390272_22396878_22624843_22634759_FF OBD160.945 38 Hg38_12_91718135_91726240_91895416_91906634_FR OBD160.949 39 Hg38_10_8256256_8258992_8533854_8544622_FF OBD160.953 40 Hg38_8_142835475_142844052_143073684_143079751_FR OBD160.957 41 Hg38_6_3146778_3149848_3207080_3212780_RF OBD160.961 42 Hg38_10_102798644_102804186_102874567_102879563_RR OBD160.965 43 Hg38_6_3146778_3149848_3196920_3199851_RF OBD160.969 44 Hg38_12_114977828_114985191_115073537_115080207_FR OBD160.973 45 Hg38_X_46498682_46508989_46621627_46624211_FF OBD160.977 46 Hg38_5_150272362_150278699_150335788_150341587_FF OBD160.981 47 Hg38_12_91718135_91726240_91888283_91891782_FR OBD160.985 48 Hg38_X_46498682_46508989_46624211_46629863_FF OBD160.989 49 Hg38_7_27201418_27203903_27302548_27312509_FF OBD160.993 50 Hg38_5_132650160_132653783_132755645_132763810_RR OBD160.997 Table IB (part le) No. Primer Sequence Primer ID Primer Sequence 1 GCAGGTAGGACAGGTGCCATCATTCCC OBD160.803 CCCAACCTGAAGAACAGAGAGAAGACTG 2 GGACACGAGCCAGGATGCTAAACAGTGA OBD160.807 GCTGTGTAATGAGGACTGAATAAGACTG 3 GGGCAAGGGTGGGAAGCGATGGC OBD160.811 TTCCCTGCCACCATTCTCCAGACGGGCG 4 GCAGGTAGGACAGGTGCCATCATTCCC OBD160.815 CCTCCCACATCTGATACTCCTCACCCC 5 AGCCCAGAAACCTTGGCAAACAGAAGAG OBD160.819 GCACCCAATAAGGAAAACAGAAAAGTTC 6 GGGCAAGGGTGGGAAGCGATGGC OBD160.823 GAGGGTCAGGTGGGCTCTGGGAGTTGTG 7 TAGTTCCCTTCAGTCACTCTTTGTAT OBD160.827 TGAGCCCTGGAGGTGGAGGTTGC 8 CCAACCAACTGATTTATGCCAGG OBD160.831 GACGACGGCTGTCTCCTCAAACA 9 CGCCCTTTCCAGCCCCTCAGTCC OBD160.835 CTCCCTCCTTGCTGCCTCTTCCCACCAG 10 AGATTTTGGGCTGAGACAATGGG OBD160.839 GGGCATTCCATAACTACAAGAGAAAA 11 AGAGCAGAGGGAAGAAGGAAGTCT OBD160.843 TATTATTATCCATTCTGCCAAAGC 12 GAAGGTCTCTGTGTAATGATGAACCC OBD160.847 AACCAGCACTCGCCCAAACCAGCA 13 CAACAAAACAGGAAACCAGGACTG OBD160.851 CAACAGAGATGGGAGACTTGAAG 14 GCCCTATCCTTACTCCCTGAACCTTGGG OBD160.855 GAACTGGCATCTCACGAATCCTCCCTGC 15 ATCCATCAAACAGAGACAACCACCCTTG OBD160.859 CGCCCAAACCAGCACTCCGACCC 16 CAGCCAGCAGATGGGTGGGTGGGC OBD160.863 ATAATGGGCTGCTACAGAGAAGGCACTG 17 CAACACCTCATTGACACCACTGGACAG OBD160.867 CTCAAACAGGGACCACGAGGATGATGGC 18 GGGCAAGGGTGGGAAGCGATGGC OBD160.871 ACCCCAGACACCCTCCGACAGGACCTCA 19 GCAGGTAGGACAGGTGCCATCATTCCC OBD160.875 CACTCACTAAGGTGGGTGGAGGTAATCC 20 GAGCAGCAAGTGAGCCAGCATTACCGCC OBD160.879 GCGTGTCTCTCAGGGAAGGCAGGATGC 21 GCCAGAGAAGGAGGGATTGATTC OBD160.883 CAACAGAGATGGGAGACTTGAAG 22 GCAGGTAGGACAGGTGCCATCATTCCC OBD160.887 GGGATTTCATCAACACCAGCCCTGACCT 23 CATTAGTTAGATTCTCATAAGGATGGC OBD160.891 TCACGGCGAACCCAATGTCTATT 24 AGATTTTGGGCTGAGACAATGGG OBD160.895 AAACAAGCCTGCTGACCGCCAGA 25 GCCCTATCCTTACTCCCTGAACCTTGGG OBD160.899 GTCTGGAGAACACGGCAGTTTGGCAGG 26 GCATCCTGTGAGGGCACCTGTGTCATTT OBD160.903 CTCCGACCCAAACCAGCACTCCAGCCG 27 AGGTTACAGCCACTGAGCCTGGATGTG OBD160.907 GGGAAATGAGTAAGTCTGAGGGAAACAA 28 GGGAGGGCAATGGTGGGCTGATGTCTCT OBD160.911 AATCAGAGGGCTGCCACCAGGCGAGTG 29 ACAGGACAGGGCAGGAGAGGCAACGAGG OBD160.915 GCCTTGCTGAATGCTGGTCACATCGCAG 30 GTAGATGGCATTGACAAGAACCAGCCTG OBD160.919 CCGACCCAAACCAGCACTCCAGCCG 31 ATGCCCACTTTCACCACTGCTATTGGAC OBD160.923 CGTCCACCTACATCTCCCTTACCTAT 32 GGTGGGTGCTGAGGAGTGGGCTC OBD160.927 ACTCCGACCCAAACCAGCACTCCAGCCG 33 GAGCAGCAAGTGAGCCAGCATTACCGCC OBD160.931 TGGGTGAGGTGGAGCCGAGTTTGGGTC 34 CCTTCCTCCCTCCCTCCCCGCTT OBD160.935 ACTCCGACCCAAACCAGCACTCCAGCCG 35 TAGTTAGATTCTCATAAGGATGGC OBD160.939 TTTCGTCCTTCGTCACATTCACGG 36 CTGGCTCAGAGGAGGTGGTGATTATGGA OBD160.943 GCCGAGGTCTCCAGTAACACCCTTGC 37 CAGTCTTGTGATAGAGGTTGGTGAGTGT OBD160.947 GATTTCAGAAGCACCTCCCTCCCCAGC 38 CTTTGTCAGTGCCTGTTGCCACCTTGGT OBD160.951 CTGTGGAGGAAAATAGTTGAGCAGGAAC 39 GCTCTTGGGTAGGCAGCCAGCAGCC OBD160.955 CCCACTTACTCTCTGACCTATCACCCAG 40 GTGTTTTGACAAGTTGGTGCCGAATGCT OBD160.959 CTCAAACAGGGACCACGAGGATGATGGC 41 CAGGGAGGGAGAAACCCAGACAG OBD160.963 CAAACCAGCACTCCGACCCAAAC 42 AACAGCAAGCCAGCCAGGTGTGGTGG OBD160.967 CACTCTCCTCCTCACCTTCAGCACCCG 43 GTGAGCAGGAGGCTTGGGCAGGC OBD160.971 ACTCCGACCCAAACCAGCACTCCAGCCG 44 CTGGCTCAGAGGAGGTGGTGATTATGGA OBD160.975 CCAACCCCAGCCACACACAGCAGACCC 45 AGATTTTGGGCTGAGACAATGGG OBD160.979 GGCTATTTCCGAGTTGTATCCTTTAT 46 GGGCAAGGGTGGGAAGCGATGGC OBD160.983 AGGTTGGCTGGCTGCTCCTGCTCCCTTG 47 TTTGTCAGTGCCTGTTGCCACCTTGGT OBD160.987 G1I1ICTGAGGCTGA1 1 1C1 1G11 GAGA 48 AGATTTTGGGCTGAGACAATGGG OBD160.991 AGAGCCATTATCTTTCCTTTGGTGAA 49 CAGGCATTAGTTAGATTCTCATAAGG OBD160.995 TCACGGCGAACCCAATGTCTATT 50 CAACCACTTCACCAAGGAGCCAGAGTTC OBD160.999 GGGATGGAGGGAAGAGTCACAGGAAAGT Table IB (part If) No. probe Markers 1 Hg38_3_100733021_100742761_100862282_100875494_RF OBD160.801.803 2 Hg38_3_100750954_100758578_100862282_100875494_RF OBD160.805.807 3 Hg38_5_150272362_150278699_150330165_150332483_FR OBD160.809.811 4 Hg38_3_100862282_100875494_101052914_101071675_FF OBD160.813.815 5 Hg38_5_150008962_150014465_150272362_150278699_RF OBD160.817.819 6 Hg38_5_150272362_150278699_150382773_150387928_FF OBD160.821.823 7 Hg38_12_69346683_69349534_6953975l_69542024_F F OBD160.825.827 8 Hg38_8_143073684_143079751_143219138_143224471_RF OBD160.829.831 9 Hg38_l_32214585_32217213_32237144_32241139_RF OBD160.833.835 10 Hg38^46498682^46508989^46616810^46620218^FR OBD160.837.839 11 Hg38_10_8256256_8258992_8314718_8322822_FF OBD160.841.843 12 Hg38_6_3027907_3030237_3146778_3149848_F R OBD160.845.847 13 Hg38_7_27204432_27205465_27302548_27312509_F F OBD160.849.851 14 Hg38_7_25370684_25382177_25542599_25548176_F F OBD160.853.855 15 Hg38_6_2898813_2902737_3146778_3149848_RR OBD160.857.859 16 Hg38_5_150036868_150040595_150272362_150278699_RF OBD160.861.863 17 Hg38_8_142863175_142868397_143073684_143079751_RR OBD160.865.867 18 Hg38_5_150194890_150198993_150272362_150278699_RF OBD160.869.871 19 Hg38_3_100862282_100875494_101027240_101038115_FF OBD160.873.875 20 Hg38_8_26561792_26565691_26638318_26644530_RR OBD160.877.879 21 Hg38_7_27151628_27154280_27302548_27312509_FF OBD160.881.883 22 Hg38_3_100677572_100682399_100862282_100875494_RF OBD160.885.887 23 Hg38_9_84621528_84639678_84804816_84814325_RF OBD160.889.891 24 Hg38_X_46498682_46508989_46571235_46574591_FR OBD160.893.895 25 Hg38_7_25274699_25276258_25370684_25382177_RF OBD160.897.899 26 Hg38_6_3146778_3149848_3232412_3234356_RF OBD160.901.903 27 Hg38_Y_7774814_7781345_7901883_7918222_RR OBD160.905.907 28 Hg38_6_47291785_47297630_47538465_47543792_RF OBD160.909.911 29 Hg38_5_150272362_150278699_150390262_150397231_FR OBD160.913.915 30 Hg38_6_2891780_2893777_3146778_3149848_FR OBD160.917.919 31 Hg38_13_33481982_33488531_33704999_33717490_RF OBD160.921.923 32 Hg38_6_3045545_3051391_3146778_3149848_F R OBD160.925.927 33 Hg38_8_26561792_26565691_26776216_26787349_RR OBD160.929.931 34 Hg38_6_2860707_2865436_3146778_3149848_F R OBD160.933.935 35 Hg38_7_27250080_27251352_27302548_27312509_FF OBD160.937.939 36 Hg38_12_114767229_114770912_114977828_114985191_RF OBD160.941.943 37 Hg38_7_22390272_22396878_22624843_22634759_FF OBD160.945.947 38 Hg38_12_91718135_91726240_91895416_91906634_FR OBD160.949.951 39 Hg38_10_8256256_8258992_8533854_8544622_FF OBD160.953.955 40 Hg38_8_142835475_142844052_143073684_143079751_FR OBD160.957.959 41 Hg38_6_3146778_3149848_3207080_3212780_RF OBD160.961.963 42 Hg38_10_102798644_102804186_102874567_102879563_RR OBD160.965.967 43 Hg38_6_3146778_3149848_3196920_3199851_RF OBD160.969.971 44 Hg38_12_114977828_114985191_115073537_115080207_FR OBD160.973.975 45 Hg38_X_46498682_46508989_46621627_46624211_FF OBD160.977.979 46 Hg38_5_150272362_150278699_150335788_150341587_FF OBD160.981.983 47 Hg38_12_91718135_91726240_91888283_91891782_FR OBD160.985.987 48 Hg38_X_46498682_46508989_46624211_46629863_FF OBD160.989.991 49 Hg38_7_27201418_27203903_27302548_27312509_FF OBD160.993.995 50 Hg38_5_132650160_132653783_132755645_132763810_RR OBD160.997.999 Table IB (part lg) No. probe RP / Rsum Rprank FC:(classl / class2) Pfp 51 Hg38_21_44826248_44830834_44873351_44875256_RF 2956.424781 46 -1.509 0 52 Hg38_6_3114019_3116008_3146778_3149848_RR 2593.745836 39 -1.508 0 53 Hg38_5_132755645_132763810_132924803_132929300_RF 3865.979955 80 -1.507 0 54 Hg38_6_2882362_2886326_3146778_3149848_FR 2479.56492 37 -1.504 0 55 Hg38_12_68747488_68752550_68814505_68818951_RR 2290.703965 33 -1.503 0 56 Hg381846958975_4^ 3240.639266 56 -1.5 0 57 Hg3818469589754696279947114979^4 3161.351495 52 -1.498 0 58 Hg38_19_34277524_34285717_34302513_34306297_RF 4267.515378 97 -1.497 0 59 Hg38_5_132755645_132763810_132929300_132935025_RF 3744.91901 77 -1.495 0 60 Hg38_5_132755645_132763810_132845490_132849804_RF 3637.844194 69 -1.491 0 61 Hg38_12_89512516_89520005_89567382_89573321_FF 3120.819609 49 -1.491 0 62 Hg38_18_46958975_46962799_47181285_47187993_FF 4071.28168 87 -1.489 0 63 Hg38_4_145441661_145450618_145639668_145646739_FR 4351.192236 102 -1.489 0 64 Hg38865429758654381456560342365608237F 3669.316935 70 -1.488 0 65 Hg382144873351448752564500977445011942FR 3284.39733 59 -1.484 0 66 Hg3872717691527178105^2 3462.395102 61 -1.481 0 67 Hg38_8_143073684_143079751_143187205_143191965_RF 2069.623189 26 -1.48 0 68 Hg38_21_44873351_44875256_44975178_44979847_FF 3715.369973 75 -1.477 0 69 Hg38_X_104167549_104169666_104260928_104265364_RF 2992.791924 47 -1.47 0 70 Hg38_X_46474993_46482135_46498682_46508989_RF 4532.171008 111 -1.469 0 71 Hg38_18_46958975_46962799_47152390_47157459_FR 4325.866296 101 -1.469 0 72 Hg38_18_46958975_46962799_47218671_47222248_FF 4552.140095 116 -1.467 0 73 Hg38_12_8943814_8945391_9061693_9073885_RR 3991.953624 85 -1.467 0 74 Hg3818^ 4425.666246 106 -1.465 0 75 Hg38^3J26843341J.26854251J26975387J26980610JR 4230.256246 96 -1.463 0 76 Hg38_X_46451412_46455647_46498682_46508989_RF 5850.564876 178 -1.463 0 77 Hg38_6_47538465_47543792_47623265_47631675_FR 3781.879009 78 -1.462 0 78 Hg38_l_69357288_69362673_69431002_69439637_RF 4224.385254 95 -1.461 0 79 Hg38_2_3461060_3464337_3620203_3628632_RR 4223.660735 94 -1.461 0 80 Hg38_3_126715028_126724613_126843341_126854251_RF 4187.552449 92 -1.459 0 81 Hg38_X_104123664_104126241_104260928_104265364_RF 3137.27664 50 -1.455 0 82 Hg38JC147757585J47771392J48009858J4801106VRF 4078.660813 88 -1.454 0 83 Hg38X46402474464048154649868246508989R 5728.942859 169 -1.454 0 84 Hg38_2_191868245J.91877609_192052829_192065719_RR 3706.781886 74 -1.453 0 85 Hg38_20_19501430_19515696_19750261_19752596_RF 4044.106873 86 -1.453 0 86 Hg38_3_13325884_13327571_13490970_13499186_FF 4953.040936 132 -1.452 0 87 Hg38_18_46958975_46962799_47093730_47099291_FF 4534.435881 112 -1.452 0 88 Hg38_4_145441661_145450618_145487239_145494181_FR 6098.1236 198 -1.451 0 89 Hg38_X_104171401_104174188_104260928_104265364_RF 3522.63992 64 -1.45 0 90 Hg38_5_150272362_150278699_150355072_150357974_FR 4630.538732 120 -1.449 0 91 Hg38J7J48757046J48761950J48843816J48853209^RF 3272.699272 58 -1.447 0 92 Hg38_X_46462567_46466475_46498682_46508989_RF 5873.726154 181 -1.447 0 93 Hg38 1 211900971 211908280 212023996 212027825 FF 3673.530159 71 -1.447 0 94 Hg38_7_27236651_27239035_27302548_27312509_FF 3973.626367 83 -1.447 0 95 Hg38_18_46917333_46922591_46958975_46962799_RF 6372.471571 218 -1.445 0 96 Hg38_17_17926103_17934669_18063962_18066155_RF 4609.709066 117 -1.443 0 97 Hg38_17_44261859_44271957_44545451_44548502_RF 6733.043227 242 -1.443 0 98 Hg38_4_145441661_145450618_145529286_145534613_FF 5808.960219 173 -1.443 0 99 Hg38352542416525481245278756652791869FR 3941.729282 82 -1.441 0 100 Hg38^ 5608.079466 162 -1.439 0 Table IB (part 2a) Probe sequence No. P.va lue Type 60 mer 51 0 Healthy Control TTTGCAGGTGTGTGGTTAACACTATCCTTCGATGAGTTCTTTGAGAGTTCTGTATTGTTT 52 0 Healthy Control AATATAAATTCAATTCATTAAAAAATAATCGAGTGCTGGTTTGGGTCGGAGTGCTGGTTC 53 0 Healthy Control AAAATTTGATTTAATTCTCCAATTATCATCGAATATTAGTAGTCCCGTGGCAAGCCTTTG 54 0 Healthy Control CAAATAAAGCCAGAACTCACTCATTACCTCGAGTGCTGGTTTGGGTCGGAGTGCTGGTTC 55 0 Healthy Control AGGCGGGCAGATCACCTGAGGTCAGAGTTCGAAGGAAAAGCTAAATTCTAGTTAGAAGTT 56 0 Healthy Control ATCGTCGGGAGAATCTTCCCTTGTAGTCTCGATTTTCCTAAGCCCAAATAAAATGGTTCA 57 0 Healthy Control ATCGTCGGGAGAATCTTCCCTTGTAGTCTCGACAGGAAACCTCATTTTATAGGTAGCCAT 58 0 Healthy Control AGGACTGTGGGTGAGAAAAGCTCTGGATTCGATTAGATTTTGATTCAGTATTTTAGGCAA 59 0 Healthy Control ATATAATTCTGAACTAATTTTCCAAACTTCGAATATTAGTAGTCCCGTGGCAAGCCTTTG 60 0 Healthy Control AGTTTTTAATGTCAAATATGATATACAGTCGAATATTAGTAGTCCCGTGGCAAGCCTTTG 61 0 Healthy Control GCCAAAGAGAGCTTTGGTACCAATAAATTCGAG I1FGCGTGGGCAGGAAATTTAI ICI1 1 62 0 Healthy Control ATCGTCGGGAGAATCTTCCCTTGTAGTCTCGATAGTTTAATTTCCTAAGAGGAAAGTACT 63 0 Healthy Control TCCCAGCCCAGTGTACAGAGTAAAAACATCGAATGGCGACI 1 1 1 11CACAATATTTGGAT 64 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCACATATCGAGCAATTCATGTTTTAAAGTTGGACTCTA 65 0 Healthy Control TTTGCAGGTGTGTGGTTAACACTATCCTTCGAAAAAAAAGCCTTTTGAGACTTCAGTTGG 66 0 Healthy Control CCTAATGAAAAGATACCAGGTCCTGAGATCGAAGTAATGAAGAGGGAGGTGGTTTTCTTT 67 0 Healthy Control GATCGGTCAGACATTGCCCATCTGTTGATCGAGGAGACAGCCGTTGTCCCCAGGGCTCCT 68 0 Healthy Control TTTGCAGGTGTGTGGTTAACACTATCCTTCGATTACCGAGGGATTCATGTTCCTGCTCCT 69 0 Healthy Control GGCAGGCAGATCACTTGAGGTCAGTAGTTCGATTCTCTCI Illi 1 ICCTCCTCCI1FATT 70 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCGCATATCGAAACCATGAAGCTAGCAAACACTGGAATG 71 0 Healthy Control ATCGTCGGGAGAATCTTCCCTTGTAGTCTCGAATGTTTTCACAATATTTGACTTCTAATG 72 0 Healthy Control ATCGTCGGGAGAATCTTCCCTTGTAGTCTCGACTTCCCAGGTGATTCTCCTACCTCAGCC 73 0 Healthy Control GTCGTGCAGTGGTGATGATCTCCTGCAATCGATCATGATGGCAGGCAATCAAAGAATCTT 74 0 Healthy Control ATCGTCGGGAGAATCTTCCCTTGTAGTCTCGAGCATCAGATGAAGAAAAAATTAATCCAC 75 0 Healthy Control GCATATGCAGGTGTGGGCI 1 1 1 1AAAAATCGATTAAG Illi 1A1TCTGATTATTGTATGT 76 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCGCATATCGATATATAAAGATTGTTTTAAI 1ICIATCT 77 0 Healthy Control TGGGTGTTAGGGTTTCAATATATGAATTTCGAAGCTAGCCAAAGCATGTATTGTTTATGT 78 0 Healthy Control GAATGTTTAGGTTTTGTAAGTTTACAAATCGAGTGCCCAGTTACAGAATTTTCTGGAGTT 79 0 Healthy Control ATGGGTGTGGGAGTTAAGGTCGCTGTCTTCGATTGGAGAI 1 1 1 1GACTACAGAATCAGTC 80 0 Healthy Control GCATATGCAGGTGTGGGCI 1 1 1 1AAAAATCGACTAG1 1 1 1 1AAAGTAGGTTGTCTGTTTT 81 0 Healthy Control GGCAGGCAGATCACTTGAGGTCAGTAGTTCGACCTGTCATCTACATTAGGTAI 1 ICI GCI 82 0 Healthy Control AAGGCGGGCAGATCACGAGGTCAGGAGTTCGATCTCATATAGATATAAACCAAGTCTGTG 83 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCGCATATCGACAAGCACTTTTCTGCTAGAATGTGATAT 84 0 Healthy Control GGCGGGCAGATCACTTGAGGTCAGGGATTCGAAGTCCATCCTTAATGAAAGATACCTCTA 85 0 Healthy Control AGAATGGGCGATGTTTCTCAGGGCTGCTTCGAAAAGCATTTATTAAACACCTACCTTGCT 86 0 Healthy Control TGACTGAGGTCCCAGGTGTGGCCCCAACTCGAAAAAGAAAAAAAGAGCCTGGTGAAAAAG 87 0 Healthy Control ATCGTCGGGAGAATCTTCCCTTGTAGTCTCGACCAGAATCCTCTTCTCCAGGCGGCGTAA 88 0 Healthy Control TCCCAGCCCAGTGTACAGAGTAAAAACATCGAAAACAAATCACATTCCTAACCAAAAGCT 89 0 Healthy Control GGCAGGCAGATCACTTGAGGTCAGTAGTTCGAAGTGTTAGGTAACTTTCTCTTAGTGGAA 90 0 Healthy Control AGTGCCTGTGAAAGTGTTTCTGAATTCCTCGACAACTTCTCATCTTCATCTCTAGCCCAG 91 0 Healthy Control GGCAGGCAGATCACTTGAGGTCAGGAATTCGATTTTCAAGCAAAGTGCTGAATGGAATTT 92 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCGCATATCGACTCCCCTCATTCCTGGCTGTGTGACCTG 93 0 Healthy Control GGCAGGCAGATCACTTGAGGTCAGGAGCTCGATGCCAACCTTTTCAAAGTAGTTAAACAG 94 0 Healthy Control CTCATCTACCTGCAAGTGTGAGATCCACTCGAAGTAATGAAGAGGGAGGTGG1 11 ICI 1 1 95 0 Healthy Control ATCGTCGGGAGAATCTTCCCTTGTAGTCTCGAAATCCGCCATTTTATACCACCCGCGGGC 96 0 Healthy Control AGCAAATGTTGACTTAGTAAI 1 1 1 1AIATCGAGGCCGCAGTGAGTTGTGATCATACCACT 97 0 Healthy Control GTTCTAGAAGGTTCTGGAAGACAAAATATCGAGGACACCCGGGATTCAGCCAGGGAGGCC 98 0 Healthy Control TCCCAGCCCAGTGTACAGAGTAAAAACATCGAGTCTTTTAGACATTTAATTCCACTACAT 99 0 Healthy Control TGTTGAGGGTGTCCCGGAGCATCAAATCTCGATAATATGTCCTTGTCTTCTACAGAGATG 100 0 Healthy Control GGGCGCGGGTCTGCGGAGCCCCCAGGGCTCGAGAAGACTTATTGTTTTGTCTGCCCAGAA Table IB (part 2b) Probe Location No. Chr Startl Endl Start2 End2 51 21 44826250 44826279 44875225 44875254 52 6 3114021 3114050 3146780 3146809 53 5 132755647 132755676 132929269 132929298 54 6 2886295 2886324 3146780 3146809 55 12 68747490 68747519 68814507 68814536 56 18 46962768 46962797 47078771 47078800 57 18 46962768 46962797 47114981 47115010 58 19 34277526 34277555 34306266 34306295 59 5 132755647 132755676 132934994 132935023 60 5 132755647 132755676 132849773 132849802 61 12 89519974 89520003 89573290 89573319 62 18 46962768 46962797 47187962 47187991 63 4 145450587 145450616 145639670 145639699 64 8 65438114 65438143 65603425 65603454 65 21 44875225 44875254 45009776 45009805 66 7 27178074 27178103 27312478 27312507 67 8 143073686 143073715 143191934 143191963 68 21 44875225 44875254 44979816 44979845 69 X 104167551 104167580 104265333 104265362 70 X 46474995 46475024 46508958 46508987 71 18 46962768 46962797 47152392 47152421 72 18 46962768 46962797 47222217 47222246 73 12 8943816 8943845 9061695 9061724 74 18 46962768 46962797 47108745 47108774 75 3 126854220 126854249 126975389 126975418 76 X 46451414 46451443 46508958 46508987 77 6 47543761 47543790 47623267 47623296 78 1 69357290 69357319 69439606 69439635 79 2 3461062 3461091 3620205 3620234 80 3 126715030 126715059 126854220 126854249 81 X 104123666 104123695 104265333 104265362 82 X 147757587 147757616 148011030 148011059 83 X 46402476 46402505 46508958 46508987 84 2 191868247 191868276 192052831 192052860 85 20 19501432 19501461 19752565 19752594 86 3 13327540 13327569 13499155 13499184 87 18 46962768 46962797 47099260 47099289 88 4 145450587 145450616 145487241 145487270 89 X 104171403 104171432 104265333 104265362 90 5 150278668 150278697 150355074 150355103 91 7 148757048 148757077 148853178 148853207 92 X 46462569 46462598 46508958 46508987 93 1 211908249 211908278 212027794 212027823 94 7 27239004 27239033 27312478 27312507 95 18 46917335 46917364 46962768 46962797 96 17 17926105 17926134 18066124 18066153 97 17 44261861 44261890 44548471 44548500 98 4 145450587 145450616 145534582 145534611 99 3 52548093 52548122 52787568 52787597 100 2 27495025 27495054 27726473 27726502 Table IB (part 2c) 4 kb Sequence Location No. Chr Startl Endl Start2 End2 51 21 44826250 44830249 44871255 44875254 52 6 3114021 3118020 3146780 3150779 53 5 132755647 132759646 132925299 132929298 54 6 2882325 2886324 3146780 3150779 55 12 68747490 68751489 68814507 68818506 56 18 46958798 46962797 47078771 47082770 57 18 46958798 46962797 47114981 47118980 58 19 34277526 34281525 34302296 34306295 59 5 132755647 132759646 132931024 132935023 60 5 132755647 132759646 132845803 132849802 61 12 89516004 89520003 89569320 89573319 62 18 46958798 46962797 47183992 47187991 63 4 145446617 145450616 145639670 145643669 64 8 65434144 65438143 65603425 65607424 65 21 44871255 44875254 45009776 45013775 66 7 27174104 27178103 27308508 27312507 67 8 143073686 143077685 143187964 143191963 68 21 44871255 44875254 44975846 44979845 69 X 104167551 104171550 104261363 104265362 70 X 46474995 46478994 46504988 46508987 71 18 46958798 46962797 47152392 47156391 72 18 46958798 46962797 47218247 47222246 73 12 8943816 8947815 9061695 9065694 74 18 46958798 46962797 47104775 47108774 75 3 126850250 126854249 126975389 126979388 76 X 46451414 46455413 46504988 46508987 77 6 47539791 47543790 47623267 47627266 78 1 69357290 69361289 69435636 69439635 79 2 3461062 3465061 3620205 3624204 80 3 126715030 126719029 126850250 126854249 81 X 104123666 104127665 104261363 104265362 82 X 147757587 147761586 148007060 148011059 83 X 46402476 46406475 46504988 46508987 84 2 191868247 191872246 192052831 192056830 85 20 19501432 19505431 19748595 19752594 86 3 13323570 13327569 13495185 13499184 87 18 46958798 46962797 47095290 47099289 88 4 145446617 145450616 145487241 145491240 89 X 104171403 104175402 104261363 104265362 90 5 150274698 150278697 150355074 150359073 91 7 148757048 148761047 148849208 148853207 92 X 46462569 46466568 46504988 46508987 93 1 211904279 211908278 212023824 212027823 94 7 27235034 27239033 27308508 27312507 95 18 46917335 46921334 46958798 46962797 96 17 17926105 17930104 18062154 18066153 97 17 44261861 44265860 44544501 44548500 98 4 145446617 145450616 145530612 145534611 99 3 52544123 52548122 52787568 52791567 100 2 27491055 27495054 27722503 27726502 Table IB (part 2d) No. probe Primer ID 51 Hg38_21_44826248_44830834_44873351_44875256_RF OBD160.1001 52 Hg38_6_3114019_3116008_3146778_3149848_RR OBD160.1005 53 Hg38_5_132755645_132763810_132924803_132929300_RF OBD160.1009 54 Hg38_6_2882362_2886326_3146778_3149848_FR OBD160.1013 55 Hg38_12_68747488_68752550_68814505_68818951_RR OBD160.1017 56 Hg38_18_46958975_46962799_47078769_47089265_FR OBD160.1021 57 Hg38_18_46958975_46962799_47114979_47119139_FR OBD160.1025 58 Hg38_19_34277524_34285717_34302513_34306297_RF OBD160.1029 59 Hg38_5_132755645_132763810_132929300_132935025_RF OBD160.1033 60 Hg38_5_132755645_132763810_132845490_132849804_RF OBD160.1037 61 Hg38_12_89512516_89520005_89567382_89573321_FF OBD160.1041 62 Hg38_18_46958975_46962799_47181285_47187993_FF OBD160.1045 63 Hg38_4_145441661_145450618_145639668_145646739_FR OBD160.1049 64 Hg38_8_65429758_65438145_65603423_65608237_FR OBD160.1053 65 Hg38_21_44873351_44875256_45009774_45011942_FR OBD160.1057 66 Hg38_7_27176915_27178105_27302548_27312509_FF OBD160.1061 67 Hg38_8_143073684_143079751_143187205_143191965_RF OBD160.1065 68 Hg38_21_44873351_44875256_44975178_44979847_FF OBD160.1069 69 Hg38_X_104167549_104169666_104260928_104265364_RF OBD160.1073 70 Hg38_X_46474993_46482135_46498682_46508989_RF OBD160.1077 71 Hg38_18_46958975_46962799_47152390_47157459_FR OBD160.1081 72 Hg38_18_46958975_46962799_47218671_47222248_FF OBD160.1085 73 Hg38_12_8943814_8945391_9061693_9073885_RR OBD160.1089 74 Hg38_18_46958975_46962799_47102132_47108776_FF OBD160.1093 75 Hg38_3_126843341_126854251_126975387_126980610_FR OBD160.1097 76 Hg38_X_46451412_46455647_46498682_46508989_RF OBD160.1101 77 Hg38_6_47538465_47543792_47623265_47631675_FR OBD160.1105 78 Hg38_l_69357288_69362673_69431002_69439637_RF OBD160.1109 79 Hg38_2_3461060_3464337_3620203_3628632_RR OBD160.1113 80 Hg38_3_126715028_126724613_126843341_126854251_RF OBD160.1117 81 Hg38_X_104123664_104126241_104260928_104265364_RF OBD160.1121 82 Hg38_X_147757585_147771392_148009858_148011061_RF OBD160.1125 83 Hg38_X_46402474_46404815_46498682_46508989_RF OBD160.1129 84 Hg38_2_191868245_191877609_192052829_192065719_RR OBD160.1133 85 Hg38_20_19501430_19515696_19750261_19752596_RF OBD160.1137 86 Hg38_3_13325884_13327571_13490970_13499186_FF OBD160.1141 87 Hg38_18_46958975_46962799_47093730_47099291_FF OBD160.1145 88 Hg38_4_145441661_145450618_145487239_145494181_FR OBD160.1149 89 Hg38_X_104171401_104174188_104260928_104265364_RF OBD160.1153 90 Hg38_5_150272362_150278699_150355072_150357974_FR OBD160.1157 91 Hg38_7_148757046_148761950_148843816_148853209_RF OBD160.1161 92 Hg38_X_46462567_46466475_46498682_46508989_RF OBD160.1165 93 Hg38_l_211900971_211908280_212023996_212027825_FF OBD160.1169 94 Hg38_7_27236651_27239035_27302548_27312509_FF OBD160.1173 95 Hg38_18_46917333_46922591_46958975_46962799_RF OBD160.1177 96 Hg38_17_17926103_17934669_18063962_18066155_RF OBD160.1181 97 Hg38_17_44261859_44271957_4454545l_44548502_RF OBD160.1185 98 Hg38_4_145441661_145450618_145529286_145534613_FF OBD160.1189 99 Hg38_3_52542416_52548124_52787566_52791869_FR OBD160.1193 100 Hg38_2_27492451_27495056_27719544_27726504_FF OBD160.1197 Table IB (part 2e) No. Primer Sequence Primer ID Primer Sequence 51 CTCTGTTCCGCCTACCCAGGTCCACACC OBD160.1003 CCTTCTTCCTGTCTCCTTCTCCTCCATC 52 CAGGGCACTCAGGCTGGGTGAAGG OBD160.1007 AGCACTCGCCCAAACCAGCACTCCGACC 53 TTCCCAGTGGTTGACACAAAGTAGGTGC OBD160.1011 GGGATGGAGGGAAGAGTCACAGGAAAGT 54 TCACTTTGACATTCATCCCTGGG OBD160.1015 TGATGGAGAAGTTTATGATGAAGGAATC 55 GGCTCACCACTGTAACCCCAGCG OBD160.1019 CCAGGGATGCCCAAGAAGTCCTT 56 GCAGTGGCTGGGTGTGGGAGGCA OBD160.1023 GGGAGATGGTGGGTTCATTCTGCTTTT 57 GCAGTGGCTGGGTGTGGGAGGCA OBD160.1027 GGCACTGGCTGTGAACCTGAGGAGGCTG 58 1 1 1C1AAATGTGATTGCCAAGCATAGGC OBD160.1031 GATGAAGGAATCAGGCATAACACCT 59 GCTGGGTGCGGGTCCTACTGGAGTCC OBD160.1035 GGGATGGAGGGAAGAGTCACAGGAAAGT 60 GGCAATGGTCAAGGGCACGAACACAATG OBD160.1039 GGGATGGAGGGAAGAGTCACAGGAAAGT 61 CCGTAAAGTTGGACACTAAATGACATAG OBD160.1043 TTCAGCGTTTGACTTTTGAGAAGAGTGC 62 CCGTCGCAAGTTTCGTTCCCCAACCCGC OBD160.1047 CTCGGCACTGACTCCCAACCCGC 63 CTGCCCTCAGAGAGTAAAGAGACAGGAC OBD160.1051 AGGCTGGGTTTACAGTCACTCCGAGAAA 64 CAAGTCTACAGTAACCAAAACAGCAT OBD160.1055 TTTTGGAGACTGTTTGAATGTGACCA 65 CTCTGTTCCGCCTACCCAGGTCCACACC OBD160.1059 CCATACCCCAGCAACGGACAGCCAG 66 GCCAATAAGGGTCTCTCTCAGAA OBD160.1063 GATGAAGGAATCAGGCATAACACC 67 GGAAGACCTCACAGGGACTCTGC OBD160.1067 GACGACGGCTGTCTCCTCAAACA 68 CTCTGTTCCGCCTACCCAGGTCCACACC OBD160.1071 GTGGCAGCAGGTGTCCCATCGGC 69 AGTGCTGAGGTTGAGAAGCCCCAAGTTA OBD160.1075 TTGTGTAAGTCAGTCCATCCTAAGCCTT 70 AGATTTTGGGCTGAGACAATGGG OBD160.1079 GATGACACCTCACTTCTTTCCGAA 71 TATCCGTAAGGCAAGTCCTGAGT OBD160.1083 TGGCTACACAGTGAGACTCCGTC 72 TATCCGTAAGGCAAGTCCTGAGT OBD160.1087 GCCCAGGAGTTTGAGACCAGCCT 73 GCTCCATTTTCCTTGTCCCTCCTCAGGT OBD160.1091 ACCGATGTGGACAATGAAGACCTGTGGG 74 CCGTCGCAAGTTTCGTTCCCCAACCCGC OBD160.1095 CCCCACAGCCCCACCTAACCTGATG 75 GGCAGAAAGGAAAGAGCCTCGCAGCATT OBD160.1099 GTCATAGCAAGAACCAGAGAAATGTCAG 76 AGATTTTGGGCTGAGACAATGGG OBD160.1103 GAAAGTTGTTTATGAGGCACTGTTTACA 77 GGGAGGGCAATGGTGGGCTGATGTC OBD160.1107 ATGGCATCACCTTCCTCAAGAGTGC 78 TTGTGAGAAGGGTAAAATCTTAGGCAGC OBD160.1111 CTATGCCCCAAGCCAGAATGAAGCGGTT 79 CCGTGAGCACAGTTCTCCGCTGGTAAAT OBD160.1115 GCTGTAGCAAAGCGACAAAACTAAGAGT 80 GGCAGAAAGGAAAGAGCCTCGCAGCATT OBD160.1119 CCCCAGGGAGATGGACGGGCAGAGC 81 TAATCCCAGCAAGTTGAGAGGCT OBD160.1123 TAGAGGAGGGATAGCATTAGCAG 82 CACCTAAGGAGCCAGCAACTGACAAGAG OBD160.1127 GGGTCTGCTGTGCTCCACGGCTGAAGG 83 AGATTTTGGGCTGAGACAATGGG OBD160.1131 TAGGAGTTTTGCTTTGGGACTTGTTA 84 CACCTGTAATCCCAGCACTTTGG OBD160.1135 GGACAAGTTATTCACACGCCAGTA 85 GCCTGACATTCCTGCCTTCTTAT OBD160.1139 GCAAGTGTCAGATTTTGATGTCCCAT 86 GGTGCTCTGCGTCCCACACACGG OBD160.1143 GTTGGGTTGGGTGGGCACATCCTGGGTC 87 CCGTCGCAAGTTTCGTTCCCCAACCCGC OBD160.1147 CTTCCCTTCCTTCCCTCCCTCAGTTCTC 88 CTGCCCTCAGAGAGTAAAGAGACAGGAC OBD160.1151 GGTGGCTACAGCAGAGTGATGAAAATAC 89 TGGCTCATACCTGTAATCCCAGCAAGTT OBD160.1155 CAGATTATTCAAAAGGAAAACACCCAAC 90 GGGCAAGGGTGGGAAGCGATGGC OBD160.1159 GGGAGGGTGCTGGTGGCAGTGGAGTTGA 91 CCCAACAGATACCAAAATCCACGAAGAC OBD160.1163 CCAGGCAAACTGTGATGGTAGGGTCAGG 92 AGATTTTGGGCTGAGACAATGGG OBD160.1167 GAGCCTAAGTAACTAACCCAGGT 93 ATCTACTTTCAGGCAGTGGCTCACGCC OBD160.1171 CTCTCTTCCTTTTCTGTGCCTGGACTTA 94 GCAAGGAGGTGACAGGAGTGGTC OBD160.1175 CAACAGAGATGGGAGACTTGAAG 95 CGTCGCAAGTTTCGTTCCCCAACCCGCA OBD160.1179 TCGTTGGCGGCAGCGGGAGTGGGT 96 GTCCCTGCTGGGCTGCCTCAGTC OBD160.1183 CCGCATCTCCCCTTGTGCCAGTCCAGAC 97 CCCATCACCCCAAGGACCCCTCC OBD160.1187 CACTCAGGGCTCTGCCGTCACCTTGGAG 98 CTGCCCTCAGAGAGTAAAGAGACAGGAC OBD160.1191 ACACTGAAAAGGAAGAACTGTGAGAGGG 99 ATTATCCTCCTTTGTTCCTTCCCC OBD160.1195 GCCACTTACTCCTTCTGGGTCCC 100 TCCGCCCTGCCCACACCCACCTC OBD160.1199 GGTGTTGAGATTGAAGGAGACTGTCAGG Table IB (part 2f) No. probe Markers 51 Hg38_21_44826248_44830834_44873351_44875256_RF OBD160.1001.1003 52 Hg38_6_3114019_3116008_3146778_3149848_RR OBD160.1005.1007 53 Hg38_5_132755645_132763810_132924803_132929300_RF OBD160.1009.1011 54 Hg38_6_2882362_2886326_3146778_3149848_F R OBD160.1013.1015 55 Hg38_12_68747488_68752550_68814505_68818951_RR OBD160.1017.1019 56 Hg38_18_46958975_46962799_47078769_47089265_FR OBD160.1021.1023 57 Hg38_18_46958975_46962799_47114979_47119139_FR OBD160.1025.1027 58 Hg38_19_34277524_34285717_34302513_34306297_RF OBD160.1029.1031 59 Hg38_5_132755645_132763810_132929300_132935025_RF OBD160.1033.1035 60 Hg38_5_132755645_132763810_132845490_132849804_RF OBD160.1037.1039 61 Hg38_12_89512516_89520005_89567382_89573321_FF OBD160.1041.1043 62 Hg38_18_46958975_46962799_47181285_47187993_FF OBD160.1045.1047 63 Hg38_4_145441661_145450618_145639668_145646739_FR OBD160.1049.1051 64 Hg38_8_65429758_65438145_65603423_65608237_FR OBD160.1053.1055 65 Hg38_21_44873351_44875256_45009774_45011942_F R OBD160.1057.1059 66 Hg38_7_27176915_27178105_27302548_27312509_FF OBD160.1061.1063 67 Hg38_8_143073684_143079751_143187205_143191965_RF OBD160.1065.1067 68 Hg38_21_44873351_44875256_44975178_44979847_FF OBD160.1069.1071 69 Hg38_X_104167549_104169666_104260928_104265364_RF OBD160.1073.1075 70 Hg38_X_46474993_46482135_46498682_46508989_RF OBD160.1077.1079 71 Hg38_18_46958975_46962799_47152390_47157459_FR OBD160.1081.1083 72 Hg38_18_46958975_46962799_47218671_47222248_FF OBD160.1085.1087 73 Hg38_12_8943814_8945391_9061693_9073885_RR OBD160.1089.1091 74 Hg38_18_46958975_46962799_47102132_47108776_FF OBD160.1093.1095 75 Hg38_3_126843341_126854251_126975387_126980610_FR OBD160.1097.1099 76 Hg38_X_46451412_46455647_46498682_46508989_RF OBD160.1101.1103 77 Hg38_6_47538465_47543792_47623265_47631675_FR OBD160.1105.1107 78 Hg38_l_69357288_69362673_69431002_69439637_RF OBD160.1109.1111 79 Hg38_2_3461060_3464337_3620203_3628632_RR OBD160.1113.1115 80 Hg38_3_126715028_126724613_126843341_126854251_RF OBD160.1117.1119 81 Hg38_X_104123664_104126241_104260928_104265364_RF OBD160.1121.1123 82 Hg38_X_147757585_147771392_148009858_148011061_RF OBD160.1125.1127 83 Hg38_X_46402474_46404815_46498682_46508989_RF OBD160.1129.1131 84 Hg38^191868245J91877609^192052829^192065719^RR OBD160.1133.1135 85 Hg38_20_19501430_19515696_19750261_19752596_RF OBD160.1137.1139 86 Hg38_3_13325884_13327571_13490970_13499186_FF OBD160.1141.1143 87 Hg38_18_46958975_46962799_47093730_47099291_FF OBD160.1145.1147 88 Hg38_4_145441661_145450618_145487239_145494181_FR OBD160.1149.1151 89 Hg38_X_104171401_104174188_104260928_104265364_RF OBD160.1153.1155 90 Hg38_5_150272362_150278699_150355072_150357974_FR OBD160.1157.1159 91 Hg38_7_148757046_148761950_148843816_148853209_RF OBD160.1161.1163 92 Hg38_X_46462567_46466475_46498682_46508989_RF OBD160.1165.1167 93 Hg38_l_211900971_211908280_212023996_212027825_FF OBD160.1169.1171 94 Hg38_7_27236651_27239035_27302548_27312509_FF OBD160.1173.1175 95 Hg38_18_46917333_46922591_46958975_46962799_RF OBD160.1177.1179 96 Hg38_17_17926103_17934669_18063962_18066155_RF OBD160.1181.1183 97 Hg38_17_44261859_44271957_44545451_44548502_RF OBD160.1185.1187 98 Hg38_4_145441661_145450618_145529286_145534613_FF OBD160.1189.1191 99 Hg38_3_52542416_52548124_52787566_52791869_FR OBD160.1193.1195 100 Hg38_2_27492451_27495056_27719544_27726504_FF OBD160.1197.1199 Table IB (part 2g) No. probe RP / Rsum Rprank FC:(classl / class2) Pfp 101 Hg38_7_148843816_148853209_149049131_149053931_FF 3724.759194 76 -1.439 0 102 Hg38_5_150134627_150137703_150272362_150278699_RF 5047.498487 139 -1.438 0 103 Hg38^46398622^46399662^46498682^46508989^RF 6153.043315 200 -1.438 0 104 Hg383525424165254812452688436 4290.852063 98 -1.438 0 105 Hg3813779298057793375 4895.079027 128 -1.437 0 106 Hg38_X_77891626_77893835_78036858_78043877_RR 4737.136557 123 -1.437 0 107 Hg38_5_132755645_132763810_132995308_132998933_RF 5427.156748 152 -1.436 0 108 Hg38_8_65429758_65438145_65628655_65630980_FF 5313.744389 148 -1.436 0 109 Hg38_5_94505842_94514405_9464171l_94646370_F R 5118.072112 141 -1.436 0 110 Hg38_2_13845156_13854426_13990532_13998047_FF 4209.708849 93 -1.435 0 111 Hg38_18_46958975_46962799_47121690_47124504_FR 5139.553936 144 -1.435 0 112 Hg38X46498682^4 7085.42019 267 -1.435 0 113 Hg38Jl_83253501_83261801_83434843_83442656_RF 4953.072097 133 -1.435 0 114 Hg38^34366017^34372954^34527904^3453042VRR 4740.961086 124 -1.434 0 115 Hg38_18_46958975_46962799_47058015_47062163 FR 6552.392969 229 -1.434 0 116 Hg38_19_45210518_45212404_45410404_45414235_FF 4098.241985 89 -1.433 0 117 Hg38_3_126755033_126764525_126843341_126854251_RF 5104.936168 140 -1.433 0 118 Hg38_12_6595585_6598606_6681014_6683610_FF 4353.353812 103 -1.432 0 119 Hg38_9_87096089_87101882_87143570_87148986_RR 5684.666484 166 -1.431 0 120 Hg38_3_52542416_52548124_52699561_52701305_FF 4512.767485 108 -1.43 0 121 Hg381717^ 4946.982257 131 -1.429 0 122 Hg383126604176126607234126843341126854251RF 5936.323554 185 -1.429 0 123 Hg38_2_27492451_27495056_27657039_27659544_FR 6695.897118 239 -1.428 0 124 Hg38_20_45581538_45584773_45643172_45649623_FR 6225.863337 205 -1.426 0 125 Hg38_3_126627400_126630792_126843341_126854251_RF 5809.854722 174 -1.425 0 126 Hg38_4_112653708_112659532_112867641_112872043_RR 4539.896621 114 -1.425 0 127 Hg38_17_17840582_17849843_17926103_17934669_FR 5118.63214 142 -1.424 0 128 Hg38_15_88873420_88883875_88904252_88906658_FF 3854.072433 79 -1.424 0 129 Hg38_5_132755645_132763810_132790667_132795213_RF 5630.548983 163 -1.423 0 130 Hg38_8_65429758_65438145_65633322J55635344JR 5572.230006 159 -1.422 0 131 Hg38JL145339443J.45344834J45441661J45450618^RF 7036.536906 262 -1.422 0 132 Hg38_X_155860883_155870741_155953718_155958970_FR 5391.94258 150 -1.422 0 133 Hg38_3_39518499_39534447_39571894_39578360_RF 5227.376758 147 -1.422 0 134 Hg38_18_34889295_34890326_35083399_35092622_RR 7546.609989 292 -1.421 0 135 Hg38_3_52500907_52509286_52542416_52548124_RF 5037.934163 138 -1.421 0 136 Hg38_3_52542416_52548124_52570196_52574410_FF 4864.647822 126 -1.421 0 137 Hg38_X_109485286_109494606_109613112_109617390_RR 6064.912335 194 -1.42 0 138 Hg38_7_148843816_148853209_148905600_148909514_FF 4627.431815 119 -1.42 0 139 Hg381174480087457037^7 7829.755413 306 -1.419 0 140 Hg38_21_44873351_44875256_45059036_45065042_FF 5784.979186 171 -1.418 0 141 Hg38630412143^ 5786.571716 172 -1.418 0 142 Hg38_8_142901645_142903892_143073684_143079751_FR 2855.548039 44 -1.418 0 143 Hg38_17_44261859_44271957_44488590_44490000_RF 8062.138802 317 -1.418 0 144 Hg38_l_224692837_224704390_224807715_224812345_RF 4525.738485 110 -1.417 0 145 Hg38_17_17728293_17735070_17926103_17934669_FR 5426.454521 151 -1.417 0 146 Hg38_4_36078971_36105117_36290916_36293184_FR 4482.618456 107 -1.416 0 147 Hg38_5_132679860_132681735_132755645_132763810_FR 6289.515975 209 -1.416 0 148 Hg38J7 J43128013J.43133284J43335881J43341356_RF 4633.985604 121 -1.415 0 149 Hg382229467180294693282 6305.561422 213 -1.415 0 150 Hg382223382061223395131223446116223450606RR 5584.38367 160 -1.414 0 Table IB (part 3a) Probe sequence No. P.val ue Type 60 mer 101 0 Healthy Control GGCAGGCAGATCACTTGAGGTCAGGAATTCGATGTCTTCTTCCGCCATGGTGCTGAATCC 102 0 Healthy Control AGTGCCTGTGAAAGTGTTTCTGAATTCCTCGAAGGCTGTGGTGAGAATCCACTGGGAAGT 103 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCGCATATCGAGGCCCTTGCATTCG 1 1 1 IUAITGTTAA 104 0 Healthy Control TGTTGAGGGTGTCCCGGAGCATCAAATCTCGACTCTAGCTTATGCTGTTTAATGCCTTTC 105 0 Healthy Control ATAATGGGCGATGTTTCTCAGGGCTGCTTCGATTCTTATGACATTAACTTTCAI 1111 Al 106 0 Healthy Control AGCCCAGCCATTTATTCTCTGATATTTATCGAGGTGAAACATAATGGTAGCTTGGACCAG 107 0 Healthy Control TAAAAGCAATTTCA111 1 1 1 1 1 1 1C1 1 1 1CGAATATTAGTAGTCCCGTGGCAAGCCTTTG 108 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCACATATCGAAAATACTGTACAATAGTCTCAGGATTTG 109 0 Healthy Control TGATGTGGATTTGTACTCTATTACAGTTTCGAGGGTGTGGGTAGATATATTCTCAGTTTT 110 0 Healthy Control GGCAGGCAGATCACTTGAGGTCACGAGTTCGATAGGTAAAGACTTACTGTTGTCATTTTG 111 0 Healthy Control ATCGTCGGGAGAATCTTCCCTTGTAGTCTCGAAAGCCTTGCCCTATCTATCCCCAACCCC 112 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCGCATATCGACCATTTTGTAAAAACAGGAGTGGCAATT 113 0 Healthy Control ATAATGGGCGATGTTTCTCAGGGCTGCTTCGACAAACCTGTTCTTTCAGGGCAAAAAAAT 114 0 Healthy Control ACATATTTCAAATGAGCTTTATAAATGTTCGAGGCGGGCAGATCACTTGAGGCCAGAAGT 115 0 Healthy Control ATCGTCGGGAGAATCTTCCCTTGTAGTCTCGAGGAGGCAATCTTAGAAGAACCCAGTGAG 116 0 Healthy Control TTAAATAGAAACCTCTTTATTCTAAGTATCGAAAGTGCTGGGATTATTAGGCATGAGCCA 117 0 Healthy Control GCATATGCAGGTGTGGGCI 1 1 1 1AAAAATCGAGTACCTGAAGAACGATGGCCTGGAAAAG 118 0 Healthy Control GAGGCGGGCAGATCACGAGGTCAAGAGATCGACTTACTGCACTCAGGTGATTCTCCTGCC 119 0 Healthy Control GAGCCAGCCAGCCCTGGAATTAACTTCCTCGAGATACCATCATGTAGAAAAGTCACAAAC 120 0 Healthy Control TGTTGAGGGTGTCCCGGAGCATCAAATCTCGATTGGAT1 1 1G 1GAA1 1 1 1 1G1AGCTTTT 121 0 Healthy Control GCTCTTTAACTTTGGCCATTGTCTATCCTCGAGGCCGCAGTGAGTTGTGATCATACCACT 122 0 Healthy Control GCATATGCAGGTGTGGGCI 1 1 1 1AAAAATCGACTCTGTCAAGGCTGAGCTCTTCCTTGCT 123 0 Healthy Control GGGCGCGGGTCTGCGGAGCCCCCAGGGCTCGACTCTCAACAGGCACTCAATAAATACTTG 124 0 Healthy Control ATAATGGGCGATGTTTCTCAGGGCTGCTTCGATAACATAAAAAACTATAAGAI1 111 1GG 125 0 Healthy Control GCATATGCAGGTGTGGGCI 1 1 1 1AAAAATCGATGACTGGGAAAAAGCACAGAGCGCTTTC 126 0 Healthy Control GGCAGGCAGATCACCTGAGGTCCGGGGTTCGAATCATACAATACATGGCCTTTTAAGTCT 127 0 Healthy Control TTGCTTCTGTGAGAGAAGCAAI 1 1C1 1 1 1CGAGGCCGCAGTGAGTTGTGATCATACCACT 128 0 Healthy Control GGCGGGCAGATCACTTGAGGCCACGAGTTCGATTTCATCCATGATGTTAATAAAAAACAC 129 0 Healthy Control ATAAATTAAAAGAGACTCAAGAGACATATCGAATATTAGTAGTCCCGTGGCAAGCCTTTG 130 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCACATATCGAAGAGTTAACTGTAACTTTGAGAAGTTAA 131 0 Healthy Control TCCCAGCCCAGTGTACAGAGTAAAAACATCGAI 1ICIACCAAATGGCTTCTGTGGTGAAA 132 0 Healthy Control TGACTTGTCCTGTTATGGTTGTTATTCCTCGAGGTTTATGGTAAGGGTTAGGGTTGGAAT 133 0 Healthy Control ATAATGGGCGATGTTTCTCAGGGCTGCTTCGACATTAACCAAATCTACCCTTCATGCAGA 134 0 Healthy Control CCTGAGGTGGGGCTTACAAATTAGTATTTCGAACTTG1 1 1 1 1CA111GTAGTAAAAGCTT 135 0 Healthy Control TGTTGAGGGTGTCCCGGAGCATCAAATCTCGATGTGACATTAACAACTTGTAACAGACAG 136 0 Healthy Control TGTTGAGGGTGTCCCGGAGCATCAAATCTCGAAATTCATGACTTAAAGTGTAATCCCTAG 137 0 Healthy Control AGGGTTAGGTGAAAAATCTAAAGGAAGGTCGATGATGAAAATGTTTTGGAGTTGATAGTG 138 0 Healthy Control GGCAGGCAGATCACTTGAGGTCAGGAATTCGAAGACTAAATTGTACTACTTAAAAAGAAA 139 0 Healthy Control TGGTGAGGGTGI111 ICATTCAGCI 1 1 1 1CGA1TTATTA1 1 1 1 1AGAGGTTCTCTATCTA 140 0 Healthy Control TTTGCAGGTGTGTGGTTAACACTATCCTTCGAGGAGAAAAGTCTCTGCCGTCCTGTGCGG 141 0 Healthy Control TATAATTGAGGGTGTAATTGCAATGGGCTCGAGTGCTGGTTTGGGTCGGAGTGCTGGTTC 142 0 Healthy Control CCATGCTAATGCTTACCAAAGTGTGACCTCGAGGAGACAGCCGTTGTCCCCAGGGCTCCT 143 0 Healthy Control TAGATGATCATATATCATACAAACCACTTCGAGGACACCCGGGATTCAGCCAGGGAGGCC 144 0 Healthy Control GACAGGCAGATCACTTGAGGTCAGGCATTCGAAACATGCTCCTTAAGGACCACCGCTACA 145 0 Healthy Control CCAAATAGAAACTTACI 1 1 1 1 1 1 1 1 1 1 1 1CGAGGCCGCAGTGAGTTGTGATCATACCACT 146 0 Healthy Control GGCAGGTGGATCACTTGAGGTCAGCAATTCGAACACCTACCAAATGTTAI111 11ICACC 147 0 Healthy Control TGTAGCCCAGAGTGGATGTTATCTAATATCGAATATTAGTAGTCCCGTGGCAAGCCTTTG 148 0 Healthy Control GGCAGGCAGATCACTTGAGGCCAGGAATTCGACAATAGCAAGACCACCTTTGCTAGCCAG 149 0 Healthy Control CAGGCAGGCAGAATGCACCATCAATGAATCGATTCTGATGACATGGTTGTTCCTCCTGTT 150 0 Healthy Control GGCAGGTGGATCATTTGTGGTCAGCAGTTCGATCTCCTGGATTCAATTGATCCTCGCATC Table IB (part 3b) Probe Location No. Chr Startl Endl Start2 End2 101 7 148853178 148853207 149053900 149053929 102 5 150134629 150134658 150278668 150278697 103 X 46398624 46398653 46508958 46508987 104 3 52548093 52548122 52688438 52688467 105 13 77933720 77933749 77995327 77995356 106 X 77891628 77891657 78036860 78036889 107 5 132755647 132755676 132998902 132998931 108 8 65438114 65438143 65630949 65630978 109 5 94514374 94514403 94641713 94641742 110 2 13854395 13854424 13998016 13998045 111 18 46962768 46962797 47121692 47121721 112 X 46508958 46508987 46604757 46604786 113 11 83253503 83253532 83442625 83442654 114 5 34366019 34366048 34527906 34527935 115 18 46962768 46962797 47058017 47058046 116 19 45212373 45212402 45414204 45414233 117 3 126755035 126755064 126854220 126854249 118 12 6598575 6598604 6683579 6683608 119 9 87096091 87096120 87143572 87143601 120 3 52548093 52548122 52701274 52701303 121 17 17926105 17926134 18142964 18142993 122 3 126604178 126604207 126854220 126854249 123 2 27495025 27495054 27657041 27657070 124 20 45584742 45584771 45643174 45643203 125 3 126627402 126627431 126854220 126854249 126 4 112653710 112653739 112867643 112867672 127 17 17849812 17849841 17926105 17926134 128 15 88883844 88883873 88906627 88906656 129 5 132755647 132755676 132795182 132795211 130 8 65438114 65438143 65633324 65633353 131 4 145339445 145339474 145450587 145450616 132 X 155870710 155870739 155953720 155953749 133 3 39518501 39518530 39578329 39578358 134 18 34889297 34889326 35083401 35083430 135 3 52500909 52500938 52548093 52548122 136 3 52548093 52548122 52574379 52574408 137 X 109485288 109485317 109613114 109613143 138 7 148853178 148853207 148909483 148909512 139 11 7448010 7448039 7491525 7491554 140 21 44875225 44875254 45065011 45065040 141 6 3041216 3041245 3146780 3146809 142 8 142903861 142903890 143073686 143073715 143 17 44261861 44261890 44489969 44489998 144 1 224692839 224692868 224812314 224812343 145 17 17735039 17735068 17926105 17926134 146 4 36105086 36105115 36290918 36290947 147 5 132681704 132681733 132755647 132755676 148 7 143128015 143128044 143341325 143341354 149 22 29469297 29469326 29549135 29549164 150 2 223382063 223382092 223446118 223446147 Table IB (part 3c) 4 kb Sequence Location No. Chr Startl Endl StartZ EndZ 101 7 148849208 148853207 149049930 149053929 102 5 150134629 150138628 150274698 150278697 103 X 46398624 46402623 46504988 46508987 104 3 52544123 52548122 52688438 52692437 105 13 77929750 77933749 77995327 77999326 106 X 77891628 77895627 78036860 78040859 107 5 132755647 132759646 132994932 132998931 108 8 65434144 65438143 65626979 65630978 109 5 94510404 94514403 94641713 94645712 110 2 13850425 13854424 13994046 13998045 111 18 46958798 46962797 47121692 47125691 112 X 46504988 46508987 46600787 46604786 113 11 83253503 83257502 83438655 83442654 114 5 34366019 34370018 34527906 34531905 115 18 46958798 46962797 47058017 47062016 116 19 45208403 45212402 45410234 45414233 117 3 126755035 126759034 126850250 126854249 118 12 6594605 6598604 6679609 6683608 119 9 87096091 87100090 87143572 87147571 120 3 52544123 52548122 52697304 52701303 121 17 17926105 17930104 18138994 18142993 122 3 126604178 126608177 126850250 126854249 123 2 27491055 27495054 27657041 27661040 124 20 45580772 45584771 45643174 45647173 125 3 126627402 126631401 126850250 126854249 126 4 112653710 112657709 112867643 112871642 127 17 17845842 17849841 17926105 17930104 128 15 88879874 88883873 88902657 88906656 129 5 132755647 132759646 132791212 132795211 130 8 65434144 65438143 65633324 65637323 131 4 145339445 145343444 145446617 145450616 132 X 155866740 155870739 155953720 155957719 133 3 39518501 39522500 39574359 39578358 134 18 34889297 34893296 35083401 35087400 135 3 52500909 52504908 52544123 52548122 136 3 52544123 52548122 52570409 52574408 137 X 109485288 109489287 109613114 109617113 138 7 148849208 148853207 148905513 148909512 139 11 7448010 7452009 7491525 7495524 140 21 44871255 44875254 45061041 45065040 141 6 3041216 3045215 3146780 3150779 142 8 142899891 142903890 143073686 143077685 143 17 44261861 44265860 44485999 44489998 144 1 224692839 224696838 224808344 224812343 145 17 17731069 17735068 17926105 17930104 146 4 36101116 36105115 36290918 36294917 147 5 132677734 132681733 132755647 132759646 148 7 143128015 143132014 143337355 143341354 149 22 29465327 29469326 29549135 29553134 150 2 223382063 223386062 223446118 223450117 Table IB (part 3d) No. probe Primer ID 101 Hg38_7_148843816_148853209_149049131_149053931_FF OBD160.1201 102 Hg38_5_150134627_150137703_150272362_150278699_RF OBD160.1205 103 Hg38_X_46398622_46399662_46498682_46508989_RF OBD160.1209 104 Hg38_3_52542416_52548124_52688436_52689750_FR OBD160.1213 105 Hg38_13_77929805_77933751_77995325_78000878_FR OBD160.1217 106 Hg38_X_77891626_77893835_78036858_78043877_RR OBD160.1221 107 Hg38_5_132755645_132763810_132995308_132998933_RF OBD160.1225 108 Hg38_8_65429758_65438145_65628655_65630980_FF OBD160.1229 109 Hg38_5_94505842_94514405_94641711_94646370_FR OBD160.1233 110 Hg38_2_13845156_13854426_13990532_13998047_FF OBD160.1237 111 Hg38_18_46958975_46962799_47121690_47124504_FR OBD160.1241 112 Hg38_X_46498682_46508989_46603634_46604788_FF OBD160.1245 113 Hg38_ll_83253501_83261801_83434843_83442656_RF OBD160.1249 114 Hg38_5_34366017_34372954_34527904_34530421_RR OBD160.1253 115 Hg3818469 OBD160.1257 116 Hg38_19_45210518_45212404_45410404_45414235_FF OBD160.1261 117 Hg38_3_126755033_126764525_126843341_126854251_RF OBD160.1265 118 Hg38_12_6595585_6598606_6681014_6683610_FF OBD160.1269 119 Hg38_9_87096089_87101882_87143570_87148986_RR OBD160.1273 120 Hg38_3_52542416_52548124_52699561_52701305_FF OBD160.1277 121 Hg38_17_17926103_17934669_18141138_18142995_RF OBD160.1281 122 Hg38_3_126604176_126607234_126843341_126854251_RF OBD160.1285 123 Hg38_2_27492451_27495056_27657039_27659544_FR OBD160.1289 124 Hg38_20_45581538_45584773_45643172_45649623_FR OBD160.1293 125 Hg38_3_126627400_126630792_126843341_126854251_RF OBD160.1297 126 Hg38_4_112653708_112659532_112867641_112872043_RR OBD160.1301 127 Hg38_17_17840582_17849843_17926103_17934669_FR OBD160.1305 128 Hg38_15_88873420_88883875_88904252_88906658_FF OBD160.1309 129 Hg38_5_132755645_132763810_132790667_132795213_RF OBD160.1313 130 Hg38_8_65429758_65438145_65633322_65635344_FR OBD160.1317 131 Hg38_4_145339443_145344834_145441661_145450618_RF OBD160.1321 132 Hg38_X_155860883_155870741_155953718_155958970_FR OBD160.1325 133 Hg38_3_39518499_39534447_39571894_39578360_RF OBD160.1329 134 Hg38_18_34889295_34890326_35083399_35092622_RR OBD160.1333 135 Hg38_3_52500907_52509286_52542416_52548124_RF OBD160.1337 136 Hg38_3_52542416_52548124_52570196_52574410_FF OBD160.1341 137 Hg38_X_109485286_109494606_109613112_109617390_RR OBD160.1345 138 Hg38_7_148843816_148853209_148905600_148909514_FF OBD160.1349 139 Hg38_ll_7448008_7457037_7491523_7495793_RR OBD160.1353 140 Hg38_21_44873351_44875256_45059036_45065042_FF OBD160.1357 141 Hg38_6_3041214_3044157_3146778_3149848_RR OBD160.1361 142 Hg38_8_142901645_142903892_143073684_143079751_FR OBD160.1365 143 Hg38_17_44261859_44271957_44488590_44490000_RF OBD160.1369 144 Hg38_l_224692837_224704390_224807715_224812345_RF OBD160.1373 145 Hg38_17_17728293_17735070_17926103_17934669_FR OBD160.1377 146 Hg38_4_36078971_36105117_36290916_36293184_FR OBD160.1381 147 Hg38_5_132679860_132681735_132755645_132763810_FR OBD160.1385 148 Hg38_7_143128013_143133284_143335881_143341356_RF OBD160.1389 149 Hg38_22_29467180_29469328_29549133_29556322_FR OBD160.1393 150 Hg38_2_223382061_223395131_223446116_223450606_RR OBD160.1397 Table IB (part 3e) No. Primer Sequence Primer ID Primer Sequence 101 CATTAGTTAGATTCTCATAAGGATGGC OBD160.1203 GGAATCTCAGTCACTCAACTACAAAAT 102 ACAGGACAGGGCAGGAGAGGCAACGAG OBD160.1207 CGTGGGCTTCCTCCCTAATGATGCCGAG 103 AGATTTTGGGCTGAGACAATGGG OBD160.1211 GCTGCTACATTTGTGGTAACTTCTTA 104 ATTATCCTCCTTTGTTCCTTCCCC OBD160.1215 ATGCTTACAGGCAGAACCAGTTTTGTGC 105 GTGGTAAAGTGTGAGGATGGCA OBD160.1219 CTTGGGAGAAAGAGACAGATAGC 106 CTATTGCTAAATGGAATGCTACCCTGCT OBD160.1223 TTTTCCCAATACCGTCCCTCCTGTGG 107 GAGGTTGTGGAGGAGGCTGAGGATGAGG OBD160.1227 GGGATGGAGGGAAGAGTCACAGGAAAGT 108 CAAGTCTACAGTAACCAAAACAGCAT OBD160.1231 GCAGTTGGTGCTCTGTATCCACA 109 ATCTCAAACCTGGTAATAATCAGC OBD160.1235 AATGCTGAGAAAGCCCCAAACCCA 110 GCCTACCACTCTGCCTCACTTGCTCC OBD160.1239 GCACAAGGGAAAATGGAGGGAGAAAGGA 111 GGCAGTGGCTGGGTGTGGGAGGC OBD160.1243 AAAGGTAACTTGAGAGTGGAGATGCGGG 112 AGATTTTGGGCTGAGACAATGGG OBD160.1247 GGGATTACAGGCATAAGCCACTG 113 CCAGGATGAGCCAGAAGGAGTTTCACAA OBD160.1251 TCACTGAAGGTTCCAAATCTCCCAAT 114 GCACCTTACTTACTGTATCTCTTCAG OBD160.1255 CCTGCCTCAGCCTCCAAAGTAGC 115 CCGTCGCAAGTTTCGTTCCCCAACCCGC OBD160.1259 GTCCCCTGTCTTCCCCGCTGTGG 116 CTCCCTCTACCTCCACTACCCTGCCCAG OBD160.1263 AGGAGGGCAGGGCTGGGTCACAG 117 GGCAGAAAGGAAAGAGCCTCGCAGCATT OBD160.1267 CCAGCCAGGGATGTTACCCAGAGCCCC 118 TGCCTGAAATCCCAGCACCTTGG OBD160.1271 TGGCACACACCTGTAGTCCCAGC 119 GAGCCCTGAGCCCCTCCTGACCA OBD160.1275 GAAGCCAGGAGAAATGAAATGATGGGTG 120 ATTATCCTCCTTTGTTCCTTCCCC OBD160.1279 CACTTGACAAACCCACAGCACAGAAA 121 CTCCCCACTACCCCAACCCAGGC OBD160.1283 CCGCATCTCCCCTTGTGCCAGTCCAGAC 122 GGCAGAAAGGAAAGAGCCTCGCAGCATT OBD160.1287 GCAAACAAGGAAACCCCAAGCAGAGAAG 123 CCTATTTTCTCTACGCCCTCCCGCCCC OBD160.1291 GGTGAGGCGACCCTGTTGAAAAGTGGGC 124 GGTAAAGTGTTGGGAAGGCGAAA OBD160.1295 CAGAGATGAGG 1 1 1 1C1ATGTTGGC 125 GTCATTCTCCCCTCTCATCTCTACCCTA OBD160.1299 CACACTCCTTTAGGTAACAGAACATTTC 126 TGTCTGTAATCCCAGCACTTTGG OBD160.1303 CCAAGAGAAATGAAAATGTTATGTCCAC 127 TCCCCTCCCTGTCTGGACCCTGG OBD160.1307 CCGCATCTCCCCTTGTGCCAGTCCAGAC 128 AGTGGCTCACGCCTGTAATCCTA OBD160.1311 TGGACCACAGCCCTTCTTTCGGG 129 CAAGGACAATCAATGGCTGCTCACATCA OBD160.1315 GGGATGGAGGGAAGAGTCACAGGAAAGT 130 CAAGTCTACAGTAACCAAAACAGCAT OBD160.1319 TGAGATAACTGAGGCTCTAAGAACTT 131 CTGCCCTCAGAGAGTAAAGAGACAGGAC OBD160.1323 CTGTTAGGCTCAAAGGTTGGGTATGGGC 132 TCTCCTACCTCTCTACACACTTTATTGA OBD160.1327 CAAGAGTCTAATCCCAAACCCCAACCAG 133 TGGTAAAGTGTTAGGACGGTGAAAAT OBD160.1331 GGAAGTATTTTCAGTGTATTTCAGAGAC 134 GTCAGGACTTGGCTGGGCACCTACC OBD160.1335 GCACTGGGAGCACAGGGCAGGAATGGTG 135 ATTATCCTCCTTTGTTCCTTCCCC OBD160.1339 TGCCACTTCCCATCTGCTCAGGG 136 ATTATCCTCCTTTGTTCCTTCCCC OBD160.1343 CCCATTCAGACAGAGCAGACCCATTT 137 GCTAACAGTGCCAGTTGAAAGGAGATGC OBD160.1347 CCCAGACAGGAGTGCCTTTGGAGTGGC 138 CATTAGTTAGATTCTCATAAGGATGGC OBD160.1351 GAATAGGACTGCCTGATAACTTGTAT 139 GCCTCCCCATTTCTCCTCAGTTTCACAA OBD160.1355 CTATGGCAAGGAGAGGCTGTAGGAGC 140 CTCTGTTCCGCCTACCCAGGTCCACACC OBD160.1359 GGCGGGAGACCCTTGCCCCTGAA 141 ACTTGTCTCCCATTCCTGGTGTGTTTGG OBD160.1363 CCGACCCAAACCAGCACTCCAGCCG 142 CAGAGAACAGAGAGGACTGAAGC OBD160.1367 GACGACGGCTGTCTCCTCAAACA 143 GCCTCCTAACCCACCTCCCCACC OBD160.1371 CACTCAGGGCTCTGCCGTCACCTTGGAG 144 CGTCTTCCACCCTGGGCTGTTCGTCCC OBD160.1375 CGGACCCATCAACAGTGAGCCAAGCATC 145 CCTGCCTGTGTGTCTGCGTGTGAGC OBD160.1379 CCGCATCTCCCCTTGTGCCAGTCCAGAC 146 GGCTCCCACCCTGTTAGAGATGTGACG OBD160.1383 CCTAACCAGTCTTCTTCCACAGCCCACA 147 GCTGGAGTGGGCTCACCGAGGATAGGG OBD160.1387 GGGATGGAGGGAAGAGTCACAGGAAAGT 148 TGTCCACAGTATGATTCTCGGGTTTTCA OBD160.1391 TACAGTGGTGCTACAGGTTATGGGAGGG 149 CCTCTTTCCCAAATGTCATCTTTTAGC OBD160.1395 GGAGGAAAATAGTTGAGCAGGAACAAT 150 CGATGGCTCATAGTGCTGTAATCCAAGC OBD160.1399 CACTTTGAGAGCCTGAAGCAGCAGCATC Table IB (part 3f) No. probe Markers 101 Hg38_7_148843816_148853209_149049131_149053931_FF OBD160.1201.1203 102 Hg38_5_150134627_150137703_150272362_150278699_RF OBD160.1205.1207 103 Hg38_X_46398622_46399662_46498682_46508989_RF OBD160.1209.1211 104 Hg38_3_52542416_52548124_52688436_52689750_FR OBD160.1213.1215 105 Hg38_13_77929805_77933751_77995325_78000878_FR OBD160.1217.1219 106 Hg38_X_77891626_77893835_78036858_78043877_RR OBD160.1221.1223 107 Hg38_5_132755645_132763810_132995308_132998933_RF OBD160.1225.1227 108 Hg38_8_65429758_65438145_65628655_65630980_FF OBD160.1229.1231 109 Hg38_5_94505842_94514405_94641711_94646370_FR OBD160.1233.1235 110 Hg38_2_13845156_13854426_13990532_13998047_FF OBD160.1237.1239 111 Hg38_18_46958975_46962799_47121690_47124504_FR OBD160.1241.1243 112 Hg38_X_46498682_46508989_46603634_46604788_FF OBD160.1245.1247 113 Hg38_ll_83253501_83261801_83434843_83442656_RF OBD160.1249.1251 114 Hg38_5_34366017_34372954_34527904_34530421_RR OBD160.1253.1255 115 Hg38_18_46958975_46962799_47058015_47062163_FR OBD160.1257.1259 116 Hg38_19_45210518_45212404_45410404_45414235_FF OBD160.1261.1263 117 Hg38_3_126755033_126764525_126843341_126854251_RF OBD160.1265.1267 118 Hg38_12_6595585_6598606_6681014_6683610_FF OBD160.1269.1271 119 Hg38_9_87096089_87101882_87143570_87148986_RR OBD160.1273.1275 120 Hg38_3_52542416_52548124_52699561_52701305_FF OBD160.1277.1279 121 Hg38_17_17926103_17934669_18141138_18142995_RF OBD160.1281.1283 122 Hg38_3_126604176_126607234_126843341_126854251_RF OBD160.1285.1287 123 Hg38_2_27492451_27495056_27657039_27659544_FR OBD160.1289.1291 124 Hg38_20_45581538_45584773_45643172_45649623_FR OBD160.1293.1295 125 Hg38_3_126627400_126630792_126843341_126854251_RF OBD160.1297.1299 126 Hg38_4_112653708_112659532_112867641_112872043_RR OBD160.1301.1303 127 Hg38_17_17840582_17849843_17926103_17934669_FR OBD160.1305.1307 128 Hg38_15_88873420_88883875_88904252_88906658_FF OBD160.1309.1311 129 Hg38_5_132755645_132763810_132790667_132795213_RF OBD160.1313.1315 130 Hg38_8_65429758_65438145_65633322_65635344_FR OBD160.1317.1319 131 Hg38_4_145339443_145344834_145441661_145450618_RF OBD160.1321.1323 132 Hg38_X_155860883_155870741_155953718_155958970_FR OBD160.1325.1327 133 Hg38_3_39518499_39534447_39571894_39578360_RF OBD160.1329.1331 134 Hg38_18_34889295_34890326_35083399_35092622_RR OBD160.1333.1335 135 Hg38_3_52500907_52509286_52542416_52548124_RF OBD160.1337.1339 136 Hg38_3_52542416_52548124_52570196_52574410_FF OBD160.1341.1343 137 Hg38_X_109485286_109494606_109613112_109617390_RR OBD160.1345.1347 138 Hg38_7_148843816_148853209_148905600_148909514_FF OBD160.1349.1351 139 Hg38_ll_7448008_7457037_7491523_7495793_RR OBD160.1353.1355 140 Hg38_21_44873351_44875256_45059036_45065042_FF OBD160.1357.1359 141 Hg38_6_3041214_3044157_3146778_3149848_RR OBD160.1361.1363 142 Hg38_8_142901645_142903892_143073684_143079751_FR OBD160.1365.1367 143 Hg38_17_44261859_44271957_44488590_44490000_RF OBD160.1369.1371 144 Hg38_l_224692837_224704390_224807715_224812345_RF OBD160.1373.1375 145 Hg38_17_17728293_17735070_17926103_17934669_FR OBD160.1377.1379 146 Hg38_4_36078971_36105117_36290916_36293184_FR OBD160.1381.1383 147 Hg38_5_132679860_132681735_132755645_132763810_FR OBD160.1385.1387 148 Hg38_7_143128013_143133284_143335881_143341356_RF OBD160.1389.1391 149 Hg38_22_29467180_29469328_29549133_29556322_FR OBD160.1393.1395 150 Hg38_2_223382061_223395131_223446116_223450606_RR OBD160.1397.1399 Table IB (part 3g) No. probe RP / Rsum Rprank FC:(classl / class2) Pfp 151 Hg38_3_52542416_52548124_52606123_52609751_FF 5189.071535 145 -1.414 0 152 Hg38_8_14301283l_143021167_143073684_143079751_FR 3503.491132 63 -1.414 0 153 Hg381212366521212376213212547138212548374RR 4620.284986 118 -1.413 0 154 Hg38X46498682^4 6204.522114 202 -1.412 0 155 Hg3821448733514487525644906478^4 6433.604863 223 -1.412 0 156 Hg38_9_78097129_78101713_78276332_78285196_FF 6925.240863 254 -1.412 0 157 Hg38_3_126673758_126686020_126843341_126854251_RF 6344.512786 216 -1.411 0 158 Hg38_17_68575027_68578789_68785810_68796098_RF 5846.061342 177 -1.411 0 159 Hg38_5_24349034_24361029_24564285_24566267_FR 5934.820934 184 -1.411 0 160 Hg38_ll_7448008_7457037_7633311_7640164_RR 8160.203972 325 -1.411 0 161 Hg38_7_27161846_27163700_27302548_27312509_FF 4965.220225 134 -1.411 0 162 Hg381380339373803406968 6070.077564 196 -1.409 0 163 Hg38^ 5825.482506 175 -1.409 0 164 Hg38_3 J26843341J.26854251_127025761_127027674JR 6302.840977 212 -1.409 0 165 Hg38_2_13845156_13854426_13894360_13900303_FR 4127.259421 90 -1.409 0 166 Hg38_3_126619219_126620249_126843341_126854251_RF 6736.278815 243 -1.409 0 167 Hg38_ll_19587032_19595878_19772073_19777708_RF 5137.562086 143 -1.408 0 168 Hg38_3_107106310_107120834_107363175_107364266_RF 4138.382317 91 -1.408 0 169 Hg38_2_172327203_172330194_172401667_172407636_FF 7018.881201 259 -1.408 0 170 Hg38_2_27492451_27495056_27626184_27635183_FF 7280.572764 284 -1.407 0 171 Hg38_6_108138075J.08144989_108280425_108286846_RR 5889.114204 182 -1.407 0 172 Hg381295793441957974559 4522.319776 109 -1.407 0 173 Hg38_17_34470224_34473967_34596926_34605729_RF 181704.137 102782 -1.406 0.2035 24936 174 Hg38_3_52542416_52548124_52770196_52773754_FR 5666.285584 164 -1.405 0 175 Hg38_l_186902459_186905074_187113187_187139713_RR 6803.129009 247 -1.405 0 176 Hg38_X_46498682_46508989_46576307_46579924_FR 5869.244424 180 -1.405 0 177 Hg38_6_3017794_3021910_3146778_3149848_RR 6256.127058 207 -1.403 0 178 Hg38_l_32149028_32153363_32237144_32241139_RF 6853.104399 250 -1.402 0 179 Hg38Jl_316800J318015_481419_487611_FR 7179.47109 277 -1.402 0 180 Hg381553424923534273975 7090.153633 268 -1.401 0 181 Hg38176866685^ 6909.88586 253 -1.401 0 182 Hg38_ll_7448008_7457037_7610329_7615891_RR 9210.499261 399 -1.401 0 183 Hg38_17_77934896_77938750_78117632_78120001_RF 6333.571605 214 -1.4 0 184 Hg38_5_43590188_43596508_43695191_43701837_RR 5995.126969 190 -1.4 0 185 Hg38_l_60428956_60435934_60549270_60560051_FR 6237.112636 206 -1.399 0 186 Hg38_5_150272362_150278699_150370575_150373999_FF 6930.555298 255 -1.398 0 187 Hg38_9_130859900_130867193_130899377_130901466_RR 6344.951249 217 -1.398 0 188 Hg3819140482591416231^9160620091614477FR 3987.770204 84 -1.397 0 189 Hg381491576230915806379 5505.97469 156 -1.397 0 190 Hg38 2 27349601 27353190 27492451 27495056 RF 7684.120774 302 -1.396 0 191 Hg38_5_150051979_150055894_150272362_150278699_RF 6705.504005 240 -1.396 0 192 Hg38_l_185167238_185172841_185287397_185290374_FR 6618.356808 234 -1.395 0 193 Hg38_3_112416500_112418982_112549606_112554897_FF 6393.210055 220 -1.395 0 194 Hg38_6_132376734_132385044_132542354_132547678_FR 6379.766204 219 -1.395 0 195 Hg38_l_189027657_189033909_189210801_189218947_FR 5745.204415 170 -1.395 0 196 Hg38_2_233409972_233419808_233475741_233480083_FR 8183.893064 330 -1.395 0 197 Hg381735250006^3^ 7536.563459 291 -1.395 0 198 Hg385140984243140987011141123576141128793FF 5530.550379 157 -1.394 0 199 Hg38_13_40670004_40674221_40797038_40804771_RR 6292.929057 210 -1.394 0 200 Hg38_15_34800440_34807454_35007401_35010342_RR 5850.979126 179 -1.393 0 Table IB (part 4a) Probe sequence No. P.va lue Type 60 mer 151 0 Healthy Control TGTTGAGGGTGTCCCGGAGCATCAAATCTCGAAGTCACATGATGGCCAACAAGTACCAAG 152 0 Healthy Control CTGTGTGTTTGAGTGTCGCTTGACCTGCTCGAGGAGACAGCCGTTGTCCCCAGGGCTCCT 153 0 Healthy Control G AG GCAG GCG GATCACG AG GTCATAAG ATCGAATTTCCAGTTTCTAAAAAGTTTAAG AAT 154 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCGCATATCGAAGGCTCCAAGGTTTTCGTGATCTTTTCA 155 0 Healthy Control TTTGCAGGTGTGTGGTTAACACTATCCTTCGAAACAGGTGCTCTGGTCAAGTCAGTTTGG 156 0 Healthy Control AGTGTGTGTGAGGAAATGCAGGGGTGAATCGAGCCCCTGCTTTCAATTCTTTTGGATATA 157 0 Healthy Control GCATATGCAGGTGTGGGCI 1 1 1 1AAAAATCGAAATCCAGCTCCACTACTCACTAGTTGGT 158 0 Healthy Control ATAATGGGCGATGTTTCTCAGGGCTGCTTCGATAGGTACAACTATTATGTATCAATATTT 159 0 Healthy Control GGAGGGGAACATTACACACTGGGGCCTGTCGAATGCTTTATCTGGACCTACTTTTGTGAA 160 0 Healthy Control TGGTGAGGGTG1 111 1CATTCAGC1 1 1 1 1CGAAGC111C1AGGGAAGGCCATGTCTTCTC 161 0 Healthy Control TGACCTGCCTCTCGGTGAGGTTGAGCAGTCGAAGTAATGAAGAGGGAGGTGGTTTTCTTT 162 0 Healthy Control CAGGTGTGTCCATGATTAAACTTTTAATTCGAGAGAAAAAAAAAAGATATCATATTTCTT 163 0 Healthy Control GGCAGGCGGATCACTTGAGGCCAGGGATTCGACACACAGAGCTGTGTGGAGTCTCAGCAG 164 0 Healthy Control GCATATGCAGGTGTGGGCI 1 1 1 1AAAAATCGACAGATGAATGAATAAGCAAAATGTGGTC 165 0 Healthy Control GGCAGGCAGATCACTTGAGGTCACGAGTTCGATCATTTCAAGAACCTACCTTCAAGTTCA 166 0 Healthy Control GCATATGCAGGTGTGGGCI 1 1 1 1AAAAATCGAAAGGAAAGAATCAGTGTATCAAAAAGAT 167 0 Healthy Control GGAGGTGTGTGTGTTTAAACCAGGAAAGTCGAGCTTCACGGCCGCTTTGTTTACCTACTC 168 0 Healthy Control GGCGGGCAGATCACTTGAGGTCAGAACTTCGAACTCTGCTTTCTATTTCAGCAGCATTTG 169 0 Healthy Control AGGGCAGGGGCACTAGGATGAAAGGCCGTCGATCAATGGATAAAAACAAATATAAGAGCT 170 0 Healthy Control GGGCGCGGGTCTGCGGAGCCCCCAGGGCTCGATGTGTCCATTACATAGATGACAACTGTT 171 0 Healthy Control AAGGCAGGCGGATCACGAGGTCAGTAGATCGAAGATTACTCTGTGATTTTCTCCAATTAT 172 0 Healthy Control GGCAGGCAGATCACTTGAGGTCAGGAATTCGAGGTGCCATCTGTCACCCCTTTCTTTGAC 173 0.0 225 233 05 Healthy Control GAAACAGTGAGTGTTTAI 1 ICICGTGAGTCGAAGCCTTTATCAAAGTCTCAAAGGGGTCT 174 0 Healthy Control TGTTGAGGGTGTCCCGGAGCATCAAATCTCGAGTTTTAAGTGAATCCAGCAGTCTACAGT 175 0 Healthy Control ATAATGGGCGATGTTTCTCAGGGCTGCTTCGATACAAAGAGATGGCCAGATTTCATCTGA 176 0 Healthy Control ACAGAGCCCTCAGAAATAATGCCGCATATCGACAAGACCTCAGGGTTGGGTGTCCCCCAC 177 0 Healthy Control CCCCTCAAGAACGAGCTCTCCCCCTGTCTCGAGTGCTGGTTTGGGTCGGAGTGCTGGTTC 178 0 Healthy Control AAGGGCTCGGGAGCTCCCTCGGCACACCTCGATTCTGTTCAI 1 1 11CTTCATTCTTTATT 179 0 Healthy Control GAGCTGGGTTAGGGTTGGGAAGACAGCTTCGAATCTGCAAGTCTGTTTTGGGAGTAGTGT 180 0 Healthy Control AGAATGGGCGATG1 11C1CAGGGCTGCTTCGAGCATATGCTACACAGTGGAGCAACCTTC 181 0 Healthy Control ATAATGGGCGATGTTTCTCAGGGCTGCTTCGAATGGTAGTTCTGCGTTTAGCTCTTTGAG 182 0 Healthy Control TGGTGAGGGTG 1 1111 CATTCAGC 1 1 1 1 1CGATCTGATGACTGAAGTGTCTGAGCTGAAG 183 0 Healthy Control Illi 1AITATTATTAAATTCATATATTCTCGAAGGTGTGTGTGGAI Illi CTTGTTTGCT 184 0 Healthy Control AGCAGGCAGATCACTTGAGGTCAGGAGTTCGAAAACAATTTCTCACTTGTCTGGGCAAAA 185 0 Healthy Control AGGGACAGCCAGCCAGCCACAGATGATGTCGATCAGACTAGATATCTGTTTTGTGAGCTA 186 0 Healthy Control AGTGCCTGTGAAAGTGTTTCTGAATTCCTCGATCAGCTTCACACACTCTCACTCCTGGAG 187 0 Healthy Control AAGGAGGGCAGATCACGAGGTCAGGCGTTCGATAAATACTGGATTTTATTAAATAAACTC 188 0 Healthy Control ATGTGTTTGCTTATTTATCATTAATAATTCGAACATCTTAGAGACCAAGACCAAAAGGGG 189 0 Healthy Control GGCAGGAGGATCACTTGAGGCCAGGCATTCGAAAACTTATATCTATACAAAACCTGCAAA 190 0 Healthy Control GGGCGCGGGTCTGCGGAGCCCCCAGGGCTCGAATTTAGGGGGAAAACATTAAATAGGAAT 191 0 Healthy Control AGTGCCTGTGAAAGTGTTTCTGAATTCCTCGACAATGCCACTCACTATTACCTCTACAAC 192 0 Healthy Control GCCGAGGTGGGCAGATCACGAGGTCAAATCGAAAGGATCAGGAATTGGAATAATTCCTCT 193 0 Healthy Control AGAATGGGCGATGTTTCTCAGGGCTGCTTCGAAGTAAAAGAACAGAAACATAAAGTTTCT 194 0 Healthy Control GAGAGGTGGGCAGGTGTTAGATTTAGTTTCGATTAATCTTTTATATTTAAAAACTTGGCC 195 0 Healthy Control GGCAGGCAGATCACTTGAGGTCAGCAGTTCGACACAGACACCCTCCCAAGACTAAACCAG 196 0 Healthy Control GGGTGTGGGTGGATTTTCACCTTGTCTGTCGAAGGCAAAGCTTTTCAGCGATTTCATTAA 197 0 Healthy Control ATTGTTTAAGCCAGCCAGCCTATGGTATTCGAACCTACAGTTGAAGGCCTTATATGCAAA 198 0 Healthy Control GGCAGGCAGATCACTTGAGGTCATGAGTTCGAAAAAAAAAAAAAAAGTAI1ICI11 IAGI 199 0 Healthy Control TCGCCTAGGCTGGAGCAGTGGTGTGATCTCGATCTTTGAGAACCTACTAGGTGTCAGTCT 200 0 Healthy Control GGCGGGCAGATCACTTGAGGCCAGGAGCTCGATCAGTGATGTTAAATTAAATGAGCAGGA Table IB (part 4b) Probe Location No. Chr Startl Endl Start! End! 151 3 52548093 52548122 52609720 52609749 152 8 143021136 143021165 143073686 143073715 153 1 212366523 212366552 212547140 212547169 154 X 46508958 46508987 46602212 46602241 155 21 44875225 44875254 44906480 44906509 156 9 78101682 78101711 78285165 78285194 157 3 126673760 126673789 126854220 126854249 158 17 68575029 68575058 68796067 68796096 159 5 24360998 24361027 24564287 24564316 160 11 7448010 7448039 7633313 7633342 161 7 27163669 27163698 27312478 27312507 162 13 80339375 80339404 80535836 80535865 163 9 4970359 4970388 5177461 5177490 164 3 126854220 126854249 127025763 127025792 165 2 13854395 13854424 13894362 13894391 166 3 126619221 126619250 126854220 126854249 167 11 19587034 19587063 19777677 19777706 168 3 107106312 107106341 107364235 107364264 169 2 172330163 172330192 172407605 172407634 170 2 27495025 27495054 27635152 27635181 171 6 108138077 108138106 108280427 108280456 172 12 95797424 95797453 95929304 95929333 173 17 34470226 34470255 34605698 34605727 174 3 52548093 52548122 52770198 52770227 175 1 186902461 186902490 187113189 187113218 176 X 46508958 46508987 46576309 46576338 177 6 3017796 3017825 3146780 3146809 178 1 32149030 32149059 32241108 32241137 179 11 317984 318013 481421 481450 180 15 53427366 53427395 53454652 53454681 181 17 68666855 68666884 68796067 68796096 182 11 7448010 7448039 7610331 7610360 183 17 77934898 77934927 78119970 78119999 184 5 43590190 43590219 43695193 43695222 185 1 60435903 60435932 60549272 60549301 186 5 150278668 150278697 150373968 150373997 187 9 130859902 130859931 130899379 130899408 188 1 91416200 91416229 91606202 91606231 189 14 91576232 91576261 91629035 91629064 190 2 27349603 27349632 27495025 27495054 191 5 150051981 150052010 150278668 150278697 192 1 185172810 185172839 185287399 185287428 193 3 112418951 112418980 112554866 112554895 194 6 132385013 132385042 132542356 132542385 195 1 189033878 189033907 189210803 189210832 196 2 233419777 233419806 233475743 233475772 197 17 35250008 35250037 35289043 35289072 198 5 140986980 140987009 141128762 141128791 199 13 40670006 40670035 40797040 40797069 200 15 34800442 34800471 35007403 35007432 Table IB (part 4c) 4 kb Sequence Location No. Chr Startl Endl Start2 End2 151 3 52544123 52548122 52605750 52609749 152 8 143017166 143021165 143073686 143077685 153 1 212366523 212370522 212547140 212551139 154 X 46504988 46508987 46602212 46606211 155 21 44871255 44875254 44906480 44910479 156 9 78097712 78101711 78281195 78285194 157 3 126673760 126677759 126850250 126854249 158 17 68575029 68579028 68792097 68796096 159 5 24357028 24361027 24564287 24568286 160 11 7448010 7452009 7633313 7637312 161 7 27159699 27163698 27308508 27312507 162 13 80339375 80343374 80531866 80535865 163 9 4966389 4970388 5177461 5181460 164 3 126850250 126854249 127025763 127029762 165 2 13850425 13854424 13894362 13898361 166 3 126619221 126623220 126850250 126854249 167 11 19587034 19591033 19773707 19777706 168 3 107106312 107110311 107360265 107364264 169 2 172326193 172330192 172403635 172407634 170 2 27491055 27495054 27631182 27635181 171 6 108138077 108142076 108280427 108284426 172 12 95793454 95797453 95929304 95933303 173 17 34470226 34474225 34601728 34605727 174 3 52544123 52548122 52770198 52774197 175 1 186902461 186906460 187113189 187117188 176 X 46504988 46508987 46576309 46580308 177 6 3017796 3021795 3146780 3150779 178 1 32149030 32153029 32237138 32241137 179 11 314014 318013 481421 485420 180 15 53423396 53427395 53450682 53454681 181 17 68666855 68670854 68792097 68796096 182 11 7448010 7452009 7610331 7614330 183 17 77934898 77938897 78116000 78119999 184 5 43590190 43594189 43695193 43699192 185 1 60431933 60435932 60549272 60553271 186 5 150274698 150278697 150369998 150373997 187 9 130859902 130863901 130899379 130903378 188 1 91412230 91416229 91606202 91610201 189 14 91576232 91580231 91629035 91633034 190 2 27349603 27353602 27491055 27495054 191 5 150051981 150055980 150274698 150278697 192 1 185168840 185172839 185287399 185291398 193 3 112414981 112418980 112550896 112554895 194 6 132381043 132385042 132542356 132546355 195 1 189029908 189033907 189210803 189214802 196 2 233415807 233419806 233475743 233479742 197 17 35250008 35254007 35285073 35289072 198 5 140983010 140987009 141124792 141128791 199 13 40670006 40674005 40797040 40801039 | 200 | 15 | 34800442 | 34804441 | 35007403 | 35011402 Table IB (part 4d) No. probe Primer ID 151 Hg38_3_52542416_52548124_52606123_52609751_FF OBD160.1401 152 Hg38_8_143012831_143021167_143073684_143079751_FR OBD160.1405 153 Hg38_l_212366521_212376213_212547138_212548374_RR OBD160.1409 154 Hg38_X_46498682_46508989_46602210_46603634_FR OBD160.1413 155 Hg38_21_44873351_44875256_44906478_44910319_FR OBD160.1417 156 Hg38_9_78097129_78101713_78276332_78285196_FF OBD160.1421 157 Hg38_3_126673758_126686020_126843341_126854251_RF OBD160.1425 158 Hg38_17_68575027_68578789_68785810_68796098_RF OBD160.1429 159 Hg38_5_24349034_24361029_24564285_24566267_FR OBD160.1433 160 Hg38_ll_7448008_7457037_7633311_7640164_RR OBD160.1437 161 Hg38_7_27161846_27163700_27302548_27312509_FF OBD160.1441 162 Hg38_13_80339373_80340696_80530340_80535867_RF OBD160.1445 163 Hg38_9_4966910_4970390_5177459_5185304_F R OBD160.1449 164 Hg38_3_126843341_126854251_127025761_127027674_FR OBD160.1453 165 Hg38_2_13845156_13854426_13894360_13900303_FR OBD160.1457 166 Hg38_3_126619219_126620249_126843341_126854251_RF OBD160.1461 167 Hg38_ll_19587032_19595878_19772073_19777708_RF OBD160.1465 168 Hg38_3_107106310_107120834_107363175_107364266_RF OBD160.1469 169 Hg38_2_172327203_172330194_172401667_172407636_FF OBD160.1473 170 Hg38_2_27492451_27495056_27626184_27635183_FF OBD160.1477 171 Hg38_6_108138075_108144989_108280425_108286846_RR OBD160.1481 172 Hg38_12_95793441_95797455_95929302_95940423_FR OBD160.1485 173 Hg38_17_34470224_34473967_34596926_34605729_RF OBD160.1489 174 Hg38_3_52542416_52548124_52770196_52773754_FR OBD160.1493 175 Hg38_l_186902459_186905074_187113187_187139713_RR OBD160.1497 176 Hg38_X_46498682_46508989_46576307_46579924_FR OBD160.1501 177 Hg38_6_3017794_3021910_3146778_3149848_RR OBD160.1505 178 Hg38_l_32149028_32153363_32237144_32241139_RF OBD160.1509 179 Hg38_ll_316800_318015_481419_487611_FR OBD160.1513 180 Hg38_15_53424923_53427397_53442412_53454683_FF OBD160.1517 181 Hg38_17_68666853_68670189_68785810_68796098_RF OBD160.1521 182 Hg38_ll_7448008_7457037_7610329_7615891_RR OBD160.1525 183 Hg38_17_77934896_77938750_78117632_78120001_RF OBD160.1529 184 Hg38_5_43590188_43596508_43695191_43701837_RR OBD160.1533 185 Hg38_l_60428956_60435934_60549270_60560051_FR OBD160.1537 186 Hg38_5_150272362_150278699_150370575_150373999_FF OBD160.1541 187 Hg38_9_130859900_130867193_130899377_130901466_RR OBD160.1545 188 Hg38 J^9140482591416231^9160620091614477FR OBD160.1549 189 Hg38_14_91576230_91580637_91629033_91639298_RR OBD160.1553 190 Hg38_2_27349601_27353190_27492451_27495056_RF OBD160.1557 191 Hg38_5_150051979_150055894_150272362_150278699_RF OBD160.1561 192 Hg38_l_185167238_185172841_185287397_185290374_FR OBD160.1565 193 Hg38_3_112416500_112418982_112549606_112554897_FF OBD160.1569 194 Hg38_6_132376734_132385044_132542354_132547678_FR OBD160.1573 195 Hg38_l_189027657_189033909_189210801_189218947_FR OBD160.1577 196 Hg38_2_233409972_233419808_233475741_233480083_FR OBD160.1581 197 Hg38_17_35250006_35254814_35287155_35289074_RF OBD160.1585 198 Hg38_5_140984243_140987011_141123576_141128793_FF OBD160.1589 199 Hg38_13_40670004_40674221_40797038_40804771_RR OBD160.1593 200 Hg38_15_34800440_34807454_35007401_35010342_RR OBD160.1597 Table IB (part 4e) No. Primer Sequence Primer ID Primer Sequence 151 ATTATCCTCCTTTGTTCCTTCCCC OBD160.1403 CCCTCCAGGTCTCTGCGTGTTTC 152 GCTCCCAGCAGAGGGCTCACCCG OBD160.1407 ATCCCGAGGACGACGGCTGTCTC 153 CTTCACAGCAGTCAAGTGGTGGTATCAC OBD160.1411 CTCCTTGTTTGACTGACTTAGTTTCTCA 154 AGATTTTGGGCTGAGACAATGGG OBD160.1415 CAGAACTCAAGAACATACTCCATAAAGT 155 CTCTGTTCCGCCTACCCAGGTCCACACC OBD160.1419 CCCAGCCCTTACCATCGGTGCCC 156 GCTCTAACTGATGC1 1 1C1CCAAG OBD160.1423 TGAGTAACAAAGTGAGACCTTATGTC 157 GGCAGAAAGGAAAGAGCCTCGCAGCATT OBD160.1427 TCCTCATCCTTGCTTTCCTCATCTGTGA 158 CTGGCTATTTTCACTTCTTTTGTGGA OBD160.1431 GCAAGGCTGTGTCCCCTCCTGAG 159 GTGGGAGTTGAACAATGAGAACAC OBD160.1435 AATGCCACCACCAGTAATG111C1A1 160 GCCTCCCCATTTCTCCTCAGTTTCACAA OBD160.1439 GGCTCTGGAGACTCAGCACCATTCTGGG 161 CATTTTCATCCTGCGGTTCTGGA OBD160.1443 CAACAGAGATGGGAGACTTGAAG 162 CGTGGCTCCTACAGAACTCCATA OBD160.1447 AAAGCAG 1 1 1C1G1GTCCGTTTGCCCCA 163 GCCTCTCTCCCATCAACATCCTTCAGAC OBD160.1451 ATGGCGGCTGCCCCTCCTCCCAGG 164 GGCAGAAAGGAAAGAGCCTCGCAGCATT OBD160.1455 CTCAGACTCCTCCCAGCCCCACTCAGG 165 AATAGGGAACAGGTGTGTGACCCATAGC OBD160.1459 GAAATGCCAGAGAAGAAAGACAACAACT 166 GGCAGAAAGGAAAGAGCCTCGCAGCATT OBD160.1463 CTCCCCATCCTCCCCTTTACCCTACCC 167 CTTGGTATTTCCCTTATTGTTTTGAAGC OBD160.1467 CCACCATTGCTGAGGCTTGAGTA 168 CCACATCTTCCACCCCTGACACC OBD160.1471 GGTGGAGGAGAACGGTTTGATGC 169 CTCCCCAAGCCTCCCCAAGCAGG OBD160.1475 GCTGGTGTTGGATTGAATAGGAGGAAGA 170 TCCGCCCTGCCCACACCCACCTCC OBD160.1479 GCACACCCTGCCTAAAGTGGTTTTCCCT 171 CAGTGTCTCTGCTACAGGCTACAACATC OBD160.1483 CAAAGAATAAACAAGGAGACAAGGGCTT 172 GTGCGGTGGCTCACACTTGTAAT OBD160.1487 AGCCGAAGCAGGGCAAGGCATTG 173 CCACCCTGCTGTCCTGCTTGGGC OBD160.1491 GAGTTGGGAGGAATCTAAAGGGTTACCT 174 ATTATCCTCCTTTGTTCCTTCCCC OBD160.1495 CTCGGATGGCGTTTCCTCAGGGA 175 AGGAGAAGGAATGTCACAAGGTAAGGTC OBD160.1499 GTAGAGAAGGACAATGGTATGGGTTCAG 176 AGATTTTGGGCTGAGACAATGGG OBD160.1503 AAGGCTCCATCTGTCAAACGGAT 177 TAGGAGGAGAAAACAGCAAATGGTCGGG OBD160.1507 CCGACCCAAACCAGCACTCCAGCCG 178 GCCCTTTCCAGCCCCTCAGTCCTGTAGC OBD160.1511 CCATCCCTCAGGAAGCCCAGAGACTG 179 CCAGGAATGTCAGGCGACCCCTCAGGTG OBD160.1515 GCCATCCCATCTTCAAGGACTGACGGAG 180 TGAAGTCTTGAGGCGGCGAAAAT OBD160.1519 GGTAACCAACATCTTGTATTGTATTAGC 181 CTGGCTATTTTCACTTCTTTTGTGGA OBD160.1523 GTTGTGGAAAGCAGTATCGTGATTC 182 GCCTCCCCATTTCTCCTCAGTTTCACAA OBD160.1527 CTGCTTCTCCTCCTGCTCTCTCTGCTCC 183 GGGCTGGAGCACAGTGACGCAATCGTGG OBD160.1531 GACTCCCTTTGTTCTGCCTGGCTTCTGA 184 CTCTGCCTCCTCTGCCCTGTTCCTACTG OBD160.1535 GCCACCACAACACACTGCTGCCTCACAC 185 CACACAGATAAAGATGAGCAGGAGGGAC OBD160.1539 GCTCTCCTGGACTTGAGTGTGGAAGGG 186 GGGCAAGGGTGGGAAGCGATGGC OBD160.1543 AGGGAGCCAGAGACAGAGGAGGCAGTGG 187 AGGTGCTCAGTCAGGGCTGCTGCCTCTC OBD160.1547 TCCTGTGGGTCCCTGTGGCTGGG 188 GTAACTACATCGCTCCCAACTTTCAATG OBD160.1551 CTGCTCCTTTGCCCTTCCAGAGAGACAA 189 ACAI 1 ICI 1GCCCACTGTTCAGCCGAT OBD160.1555 CCCTCACCCCTGGCAACCACCGAT 190 CCTGCCCACACCCACCTCCGCCG OBD160.1559 GGCAACAGAGAGAGGCTCCGTCT 191 ACAGGACAGGGCAGGAGAGGCAACGAGG OBD160.1563 CCCAAGGCGGTAGAGGGTGTCACG 192 ACCACTATGACCTCTTTCCCAAATG OBD160.1567 CTGTGGCTATTACTGTGTTACAAT 193 GCCTGACATTCCTGCCGTCTTAT OBD160.1571 GTGACACCCACATACTTGCCAAAT 194 CAGTGCCCAAAGAGGTCCCTGAGGTC OBD160.1575 GTGGCTTTACAACCTCACTCTGAACCTT 195 CTGGGCTATTCTAAATGCCAACTAAT OBD160.1579 ATTCAGAGATTCAACTTCTTCCTGGT 196 GGCAGCAGGTAAGAGCCCCAGGG OBD160.1583 CCGCTCAGGAGACTCGCACTGGGTGTAG 197 TCTACTAACCAGAAAGACAGCCCTCACC OBD160.1587 GATGGTGTGTGGGTTAGGCACTACTGGG 198 ATTCTCAGGATGGAGGCTGGGTGTGGT OBD160.1591 GGAAAGCATCTCAAGACCAAAGTCAAAG 199 GTCACCCTTCAGAGATGGCAACATTTAC OBD160.1595 TAGCAACAACTGTCTCCCGTCCTCTGC 200 CCTCTTTCCCAAATGTCATCTTTTAG OBD160.1599 GGAGGAAAATAGTTGAGCAGGAACA Table IB (part 4f) No. Probe Markers 151 Hg38_3_52542416_52548124_52606123_52609751_FF OBD160.1401.1403 152 Hg38_8_143012831_143021167_143073684_143079751_FR OBD160.1405.1407 153 Hg38_l_212366521_212376213_212547138_212548374_RR OBD160.1409.1411 154 Hg38_X_46498682_46508989_46602210_46603634_FR OBD160.1413.1415 155 Hg38_21_44873351_44875256_44906478_44910319_F R OBD160.1417.1419 156 Hg38_9_78097129_78101713_78276332_78285196_FF OBD160.1421.1423 157 Hg38_3_126673758_126686020_126843341_126854251_RF OBD160.1425.1427 158 Hg38_17_68575027_68578789_68785810_68796098_RF OBD160.1429.1431 159 Hg38_5_24349034_24361029_24564285_24566267_FR OBD160.1433.1435 160 Hg38_ll_7448008_7457037_7633311_7640164_RR OBD160.1437.1439 161 Hg38_7_27161846_27163700_27302548_27312509_FF OBD160.1441.1443 162 Hg38_13_80339373_80340696_80530340_80535867_RF OBD160.1445.1447 163 Hg38_9_4966910_4970390_5177459_5185304_F R OBD160.1449.1451 164 Hg38_3_126843341_126854251_127025761_127027674_FR OBD160.1453.1455 165 Hg38_2_13845156_13854426_13894360_13900303_FR OBD160.1457.1459 166 Hg38_3_126619219_126620249_126843341_126854251_RF OBD160.1461.1463 167 Hg38_ll_19587032_19595878_19772073_19777708_RF OBD160.1465.1467 168 Hg38_3_107106310_107120834_107363175_107364266_RF OBD160.1469.1471 169 Hg38_2_172327203_172330194_172401667_172407636_FF OBD160.1473.1475 170 Hg38_2_27492451_27495056_27626184_27635183_FF OBD160.1477.1479 171 Hg38_6_108138075_108144989_108280425_108286846_RR OBD160.1481.1483 172 Hg38_12_95793441_95797455_95929302_95940423_FR OBD160.1485.1487 173 Hg38_17_34470224_34473967_34596926_34605729_RF OBD160.1489.1491 174 Hg38_3_52542416_52548124_52770196_52773754_FR OBD160.1493.1495 175 Hg38_l_186902459_186905074_187113187_187139713_RR OBD160.1497.1499 176 Hg38_X_46498682_46508989_46576307_46579924_FR OBD160.1501.1503 177 Hg38_6_3017794_3021910_3146778_3149848_RR OBD160.1505.1507 178 Hg38_l_32149028_32153363_32237144_32241139_RF OBD160.1509.1511 179 Hg38_ll_316800_318015_481419_487611_FR OBD160.1513.1515 180 Hg38_15_53424923_53427397_53442412_53454683_FF OBD160.1517.1519 181 Hg38_17_68666853_68670189_68785810_68796098_RF OBD160.1521.1523 182 Hg3811744800874570377610329_7 OBD160.1525.1527 183 Hg38_17_77934896_77938750_78117632_78120001_RF OBD160.1529.1531 184 Hg38_5_43590188_43596508_43695191_43701837_RR OBD160.1533.1535 185 Hg38_l_60428956_60435934_60549270_60560051_FR OBD160.1537.1539 186 Hg38_5_150272362_150278699_150370575_150373999_FF OBD160.1541.1543 187 Hg38_9_130859900_130867193_130899377_130901466_RR OBD160.1545.1547 188 Hg38_l_91404825_91416231_91606200_91614477_F R OBD160.1549.1551 189 Hg38_14_91576230_91580637_91629033_91639298_RR OBD160.1553.1555 190 Hg38_2_27349601_27353190_27492451_27495056_RF OBD160.1557.1559 191 Hg38_5_150051979_150055894_150272362_150278699_RF OBD160.1561.1563 192 Hg38_l_185167238_185172841_185287397_185290374_FR OBD160.1565.1567 193 Hg38_3_112416500_112418982_112549606_112554897_FF OBD160.1569.1571 194 Hg38_6_132376734_132385044_132542354_132547678_FR OBD160.1573.1575 195 Hg38_l_189027657_189033909_189210801_189218947_FR OBD160.1577.1579 196 Hg38_2_233409972_233419808_233475741_233480083_FR OBD160.1581.1583 197 Hg38_17_35250006_35254814_35287155_35289074_RF OBD160.1585.1587 198 Hg38_5_140984243_140987011_141123576_141128793_FF OBD160.1589.1591 199 Hg38_13_40670004_40674221_40797038_40804771_RR OBD160.1593.1595 200 Hg38_15_34800440_34807454_35007401_35010342_RR OBD160.1597.1599 Table IB (part 4g)
Claims
01 07 251. A method of detecting the spinal and bulbar muscular atrophy status in an individual, comprising determining the presence or absence of at least 10 chromosome interactions represented by the probes shown for interaction numbers 1 to 40 in Table 1 A, to thereby detect spinal and bulbar muscular atrophy in the individual.
2. A method according to claim 1 wherein the presence or absence of at least 5 chromosome interactions from Table IB is also determined.
3. A method according to claim 1 or 2 wherein the presence or absence of chromosome interactions is determined:- in a sample from an individual, and / or- by detecting the presence or absence of a DNA loop at the site of the chromosome interactions, and / or- detecting the presence or absence of distal regions of a chromosome being brought together in a chromosome conformation, and / or- by detecting the presence of a ligated DNA which is generated during said typing and whose sequence comprises two regions each corresponding to the regions of the chromosome which come together in the chromosome interaction, and / or- by a process which detects the proximity of the chromosome regions which have come together in the chromosome interaction.
4. A method according to any one of the preceding claims wherein said detecting of the presence or absence of the chromosome interactions is by a process comprising:(i) in vitro crosslinking of epigenetic chromosomal interactions which are present;(ii) subjecting the cross-linked DNA to cleaving;(iii) ligating the cross-linked cleaved DNA ends to form ligated DNA; and(iv) identifying the presence or absence of said ligated DNA;to thereby determine the presence or absence of the chromosome interaction.
5. A method according to claim 3 or 4 wherein said ligated DNA is detected by PCR or by use of a probe.01 07 256. A method according to claim 5 wherein(i) detection of the ligated DNA is by use of a probe, wherein said probe has the same sequence as of any of the probes shown in Table 1, or(ii) detection of the ligated DNA is by use of PCR, wherein the PCR uses a primer pair that have the same sequence as any of the primer pairs shown in Table 1.
7. A method according to any one of the preceding claims wherein the method is carried out on individual that has been preselected based on a physical characteristic, risk factor or the presence of a symptom.
8. A method according to claim 7 wherein the individual is preselected for one or more of the following characteristics:(a) being male, and / or(b) being aged 30 to 60, and / or(c) having gynecomastia, and / or(d) having testicular atrophy, and / or(e) having androgen insensitivity, and / or(e) having reduced fertility.
9. A method according to claim 8, wherein the reduced fertility is as a result of androgen insensitivity.
10. A method according to any one of the preceding claims wherein the presence or absence of at least 5 chromosome interactions is also determined which are selected frominteraction numbers 1 to 40 from Table IB.
11. A method according to claim 5, wherein determining the presence or absence of the chromosome interactions comprises specific detection of the ligated DNA by quantitative PCR (qPCR) which uses primers capable of amplifying the ligated DNA and a probe which binds the ligation site during the PCR reaction, wherein said probe comprises sequence which is complementary to sequence from each of the chromosome regions that have come together in the chromosome interaction.
12. A method according to claim 11, wherein said probe comprises an oligonucleotide which specifically binds to said ligated DNA, and:- a fluorophore covalently attached to the 5’ end of the oligonucleotide, and / or- a quencher covalently attached to the 3’ end of the oligonucleotide.
13. A method according to claim 12, wherein said fluorophore is selected from HEX, Texas Red and FAM.
14. A method according to any one of claims 11 to 13, wherein said probe comprises a nucleic acid sequence of length 10 to 40 nucleotide bases.
15. A method according to claim 14, wherein said probe comprises a nucleic acid sequence of length 20 to 30 nucleotide bases.01 07 25
Citation Information
Patent Citations
biomarker
WO2019069067A1
Genetic regulation
WO2019086898A2