Methods for treating nervous system diseases using target sequences of AIMP2-DX2 and optionally miR-142 and compositions thereof

Abstract

Disclosed herein is a method for treating a nervous system disease, comprising administering to a subject in need of such treatment a vector comprising AIMP2-DX2 and, if necessary, a target sequence of miR-142. The vector may further comprise a promoter operably linked to AIMP2-DX2. The target sequence of miR-142 may be located 3' to the AIMP2-DX2 gene. The method may include a method for delaying the onset of amyotrophic lateral sclerosis (ALS) in a subject.

Description

[Technical Field]

[0001] Cross-references to related applications This application claims the benefits as of the filing date of U.S. Application No. 63 / 085,950, filed on 30 September 2020. This disclosure is incorporated herein by reference in its entirety. Reference to electronically submitted sequence listings

[0002] The contents of the sequence listing submitted electronically in the ASCII text file (name: 2493-0004WO01_Sequence Listing_ST25.txt; size: 28KB; creation date: September 30, 2021) filed with this application are incorporated herein by reference in their entirety. Field of Invention

[0003] A method for treating neurological disorders is disclosed herein, comprising administering a vector containing AIMP2-DX2 and, optionally, the target sequence of miR-142, to subjects requiring treatment for neurological disorders. [Background technology]

[0004] Background technology of the invention The mammalian brain can perform complex functions by constructing a systemic neural network after a series of processes including the division, differentiation, survival, death, and synapse formation of neural stem cells. Neurons in the animal brain, even in their mature state, continuously produce a wide range of substances necessary for nerve growth, thereby inducing the growth of axons and dendrites. Furthermore, it can be said that they are continuously differentiating due to the constant synaptic remodeling of neural networks and synaptic connections each time new learning and memory are performed. Neurons undergo apoptosis when they are unable to receive target-derived survival factors such as nerve growth factors during the processes of cell differentiation and synapse formation, and apoptosis induced by stress and cytotoxic agents is a major cause of degenerative brain damage. Unlike the central nervous system, when the peripheral nervous system of an animal is damaged, axons regenerate over a long period of time. Axons distal to the damaged nerve degenerate through a process known as Wallerian degeneration, the nerve cell body resumes axonal regrowth, and Schwann cells regenerate after undergoing a regeneration process that includes the determination of target nerves through post-division survival and regression before undergoing differentiation again.

[0005] Globally, with the rapid increase in the elderly population, the incidence of neurodegenerative diseases continues to rise year after year. Since definitive preventive and therapeutic methods have yet to be discovered, there are currently no drugs that demonstrate significant efficacy in treating such diseases. Furthermore, existing drugs and therapies used for these disorders often exhibit side effects and toxicity resulting from long-term administration. Moreover, they do not provide a complete cure for the disease, only temporarily reducing the severity of symptoms or slowing their progression; therefore, there is an urgent need to explore and develop materials that offer definitive therapeutic effects while minimizing side effects and toxicity.

[0006] Since the first clinical trials began in 1990, approximately 600 clinical trials of gene therapy in humans had been conducted and were ongoing by 2002. Following the completion of the human genome sequencing in 2003, exploring diverse genes will likely accelerate the development of new gene therapies in the future. However, 75% of gene therapies approved to date target cancer or monogenic diseases such as cystic fibrosis, and the development of gene therapies for neurological disorders or regeneration is not widespread (Recombinant DNA consultation paper of NIH, USA (2002); Gene Therapy Clinical Trials, J. Gene Med. (2002) www.wiley.co.uk / genmed). Nevertheless, attempts have already been made to develop gene therapies using nerve growth factors such as NT-3 and glial-derived neuronal factor (GDNF) to treat and regenerate sensory neurons in Parkinson's disease (GDNF family ligands activate multiple events during axonal growth in mature sensory neurons (Mol.Cell.Neurosci.25:4453-4459(2004)). However, progress in neuroscience research as a whole regarding brain function related to nervous system disorders is slow, and the development of therapeutic drugs for various chronic nervous system disorders also faces difficulties. AIMP2-DX2 is an alternative antagonistic splicing variant of the multi-factor apoptosis gene AIMP2. AIMP2-DX2 is known to suppress cell apoptosis by interfering with the function of AIMP2. AIMP2-DX2, which acts as a competitive inhibitor of AIMP2, suppresses TNF-α-mediated apoptosis by inhibiting the ubiquitination / degradation of TRAF2. Furthermore, it has been reported that AIMP2-DX2 has already been identified as a lung cancer inducer, and in existing studies, it has been confirmed that AIMP2-DX2, which widely appears in cancer cells, induces cancer by interfering with the cancer-suppressing function of AIMP2. Furthermore, it has been discovered that the appearance of AIMP2-DX2 in normal cells promotes the carcinogenesis of cells, whereas the suppression of the appearance of AIMP2-DX2 suppresses the growth of cancer and thereby exhibits a treatment effect. It has also been revealed that AIMP2-DX2 may be useful for treating nervous system diseases (KR10-2015-0140723 (2017) and US2019 / 0298858 (published on October 23, 2019)).

Prior Art Documents

Patent Documents

[0007]

Patent Document 1

Patent Document 2

Non-Patent Documents

[0008]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

[0009] Summary of the Invention A method for delaying the onset of disease in subjects with amyotrophic lateral sclerosis (ALS), comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject, is disclosed herein.

[0010] A method for inhibiting neuronal cell death in subjects with amyotrophic lateral sclerosis (ALS), comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject, is disclosed herein.

[0011] Disclosed herein are methods for treating muscular atrophy in subjects requiring treatment for muscular atrophy, comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject. In some embodiments, the subject has amyotrophic lateral sclerosis (ALS). In some embodiments, the subject has spinal muscular atrophy (SMA).

[0012] A method for improving the survival rate or extending the survival period of subjects with Parkinson's disease (PD) is disclosed herein, which includes administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject.

[0013] Disclosed herein are methods for preventing behavioral deficits, restoring motor symptoms, and / or mitigating neurological damage in subjects with Parkinson's disease (PD), comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject.

[0014] A method for inhibiting amyloid-beta oligomer (Aβ-O)-induced neuronal cell death or Aβ-O-induced p53 expression in subjects with Alzheimer's disease (AD) is disclosed herein, comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject.

[0015] A method for inhibiting neuromuscular junction (NMJ) injury in subjects with spinal muscular atrophy (SMA), comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject, is disclosed herein.

[0016] Disclosed herein are methods for inhibiting neuromuscular junction (NMJ) injury, NMJ block-induced respiratory failure, dyspnea, and NMJ block-induced muscle contractions or fasciculations in subjects with amyotrophic lateral sclerosis (ALS), the methods comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject.

[0017] A method for suppressing anoikis and / or increasing laminin receptor stabilization in subjects with amyotrophic lateral sclerosis (ALS) and Parkinson's disease (PD), comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject is disclosed herein.

[0018] The recombinant vector may further contain the miR-142 target sequence.

[0019] The vector may further include a promoter operably linked to AIMP2-DX2. In some embodiments, the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Roussarcoma virus (RSV) promoter, an MT promoter, an EF-1α promoter, a UB6 promoter, a chicken β-actin promoter, a CAG promoter, a RPE65 promoter, or an opsin promoter.

[0020] The miR-142 target sequence may be located 3' relative to the AIMP2-DX2 gene.

[0021] In some embodiments, the AIMP2-DX2 gene includes a nucleotide sequence that encodes an amino acid sequence that is at least 90% identical to sequence numbers 2, 13, 14, 15, 16, 17, 18, 19, or 20.

[0022] In some embodiments, the AIMP2-DX2 gene includes a nucleotide sequence that encodes the amino acid sequence of SEQ ID NOs: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

[0023] In some embodiments, the AIMP2-DX2 gene does not have an exon containing a nucleotide sequence that encodes an amino acid sequence that is at least 90% identical to sequence number 10 or 11.

[0024] In some embodiments, the AIMP2-DX2 gene does not have an exon containing a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10 or 11.

[0025] The miR-142 target sequence may include a nucleotide sequence containing ACACTA. In some embodiments, the miR-142 target sequence includes ACACTA and 1 to 17 additional consecutive nucleotides from sequence number 5. In some embodiments, the miR-142 target sequence includes a nucleotide sequence that is at least 50% identical to the nucleotide sequence of sequence number 5 (TCCATAAAGTAGGAAACACTACA). In some embodiments, the miR-142 target sequence may include the nucleotide sequence of sequence number 5.

[0026] In some embodiments, the miR-142 target sequence includes ACTTTA. In some embodiments, the miR-142 target sequence includes ACTTTA and 1 to 15 additional consecutive nucleotides from SEQ ID NO: 7. In some embodiments, the miR-142 target sequence includes a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG). In some embodiments, the miR-142 target sequence includes the nucleotide sequence of SEQ ID NO: 7.

[0027] The miR-142 target sequence may be repeated 2 to 10 times in the vectors disclosed herein.

[0028] The vector may be a viral vector. Viral vectors may be adenovirus, adeno-associated virus, lentivirus, retrovirus, human immunodeficiency virus (HIV), mouse leukemia virus (MLV), aerozoic sarcoma / leukemia (ASLV), splenic necrosis virus (SNV), Rous sarcoma virus (RSV), mouse mammary tumor virus (MMTV), herpes simplex virus, or vaccinia virus. Brief explanation of the drawing [Brief explanation of the drawing]

[0029] [Figure 1] Figure 1 shows an exemplary recombinant vector.

[0030] [Figure 2] Figure 2 shows the neuronal cell-specific expression effect of recombinant vectors in an in vitro environment.

[0031] [Figure 3] Figure 3 shows brain-specific expression of scAAV-DX2-miR142-3pT after intraparenchymal (substantia nigra) injection in a Parkinson's disease model.

[0032] [Figure 4] Figure 4 shows the miR142-3pT (target) sequence (SEQ ID NO: 6) which has four repeats of miR142-3pT (underlined).

[0033] [Figure 5] Figure 5A shows schematic diagrams of miR142-3pT with 1×, 2×, and 3× repeats and mutant sequences. Figure 5B shows the inhibition of DX2 expression by miR142-3p by 1×, 2×, and 3× repeats of miR-142-3pT.

[0034] [Figure 6] Figure 6 shows that the core binding sequence is important for DX2 inhibition. A vector with Tseq x3 repeats (Figure 5B) that showed significant inhibition of DX2 and a DX2 construct were used as controls. Treatment with 100 pmol of miR-142-3p significantly inhibited the Tseq x3 vector, but not DX2 or the mutant sequence.

[0035] [Figure 7] Figure 7 shows the total RNA extracted from the spinal cord of an ALS model after intrathecal injection of scAAV2-DX2-miR142-3p. qRT-PCR was performed.

[0036] [Figure 8] Figure 8 shows the neuronal cell-specific expression effect of the expression vector of the present invention under in vitro conditions.

[0037] [Figure 9-1]DX2 transgenic mice recover motor symptoms in mice treated with rotenone. Figure 9A shows analysis of TH expression using the brains of the shown mice. Black dotted squares indicate TF-stained areas. Figure 9B is a rotarod analysis. Latency to fall in rotenone-treated wild-type and DX2 transgenic (TG) mice. Figure 9C is a pole test. Vertical movement (left panel) and T-turn time (right panel) in rotenone-treated wild-type and DX2 TG mice. Animals; n=6 (each group), ns; not significant, **P<0.01, *P<0.05, t-test. Figures 9D and 9E show that DX2 improves neurological injury and behavior in a rotenone-induced PD mouse model. Figure 9D is a pole test. scAAV-DX2 recovered motor coordination and balance in a rotenone-treated PD mouse model. "Con" and "GFP" represent wild-type and GFP-injected mice treated with rotenone. "Dose 1" and "Dose 2" represent different injection doses of DX2 in rotenone-treated mice. Figure 9E shows immunohistochemical and immunofluorescence images of mouse substantia nigra. The upper panel shows TH-positive cells in the striatum, and the lower panel shows the distribution of the injected GFP-expressing virus. Black dotted squares indicate stained areas of TH. Animals; n=5 (each group), ns; not significant, **P<0.05, *P<0.01, t-test. [Figure 9-2]DX2 transgenic mice recover motor symptoms in mice treated with rotenone. Figure 9A shows analysis of TH expression using the brains of the shown mice. Black dotted squares indicate TF-stained areas. Figure 9B is a rotarod analysis. Latency to fall in rotenone-treated wild-type and DX2 transgenic (TG) mice. Figure 9C is a pole test. Vertical movement (left panel) and T-turn time (right panel) in rotenone-treated wild-type and DX2 TG mice. Animals; n=6 (each group), ns; not significant, **P<0.01, *P<0.05, t-test. Figures 9D and 9E show that DX2 improves neurological injury and behavior in a rotenone-induced PD mouse model. Figure 9D is a pole test. scAAV-DX2 recovered motor coordination and balance in a rotenone-treated PD mouse model. "Con" and "GFP" represent wild-type and GFP-injected mice treated with rotenone. "Dose 1" and "Dose 2" represent different injection doses of DX2 in rotenone-treated mice. Figure 9E shows immunohistochemical and immunofluorescence images of mouse substantia nigra. The upper panel shows TH-positive cells in the striatum, and the lower panel shows the distribution of the injected GFP-expressing virus. Black dotted squares indicate stained areas of TH. Animals; n=5 (each group), ns; not significant, **P<0.05, *P<0.01, t-test. [Figure 9-3]DX2 transgenic mice recover motor symptoms in mice treated with rotenone. Figure 9A shows analysis of TH expression using the brains of the shown mice. Black dotted squares indicate TF-stained areas. Figure 9B is a rotarod analysis. Latency to fall in rotenone-treated wild-type and DX2 transgenic (TG) mice. Figure 9C is a pole test. Vertical movement (left panel) and T-turn time (right panel) in rotenone-treated wild-type and DX2 TG mice. Animals; n=6 (each group), ns; not significant, **P<0.01, *P<0.05, t-test. Figures 9D and 9E show that DX2 improves neurological injury and behavior in a rotenone-induced PD mouse model. Figure 9D is a pole test. scAAV-DX2 recovered motor coordination and balance in a rotenone-treated PD mouse model. "Con" and "GFP" represent wild-type and GFP-injected mice treated with rotenone. "Dose 1" and "Dose 2" represent different injection doses of DX2 in rotenone-treated mice. Figure 9E shows immunohistochemical and immunofluorescence images of mouse substantia nigra. The upper panel shows TH-positive cells in the striatum, and the lower panel shows the distribution of the injected GFP-expressing virus. Black dotted squares indicate stained areas of TH. Animals; n=5 (each group), ns; not significant, **P<0.05, *P<0.01, t-test.

[0038] [Figure 10-1]DX2 prevents behavioral deficits in a 6-OHDA-induced PD model. Figure 10A shows that mice treated with scAAV-DX2 exhibited lower levels of contralateral rotation compared to those treated with saline or vehicle (GFP), indicating that DX2 attenuated damage to dopaminergic neurons. Figure 10B shows that mice treated with DX2 exhibited increased contralateral forelimb contact, indicating that AAV-DX2 attenuated unilateral damage to dopaminergic neurons. In Figure 10C, mice treated with AAV-DX2 showed less rightward body swing. Animals; Saline (wild-type mice treated with saline) n=4, GFP (6-OHDA-treated mice injected with GFP) n=5, DX2 (6-OHDA-treated mice injected with DX2) n=11 (each mouse), scAAV; scAAV-GFP 4×10⁹vg, scAAV-DX2 low 1.6×10⁸vg, scAAV-DX2 4×10⁹vg, ns; not significant, *P<0.05, **P<0.005, ***P<0.001, t-test. Figure 10D is immunofluorescence images of mouse brains injected with GFP and DX2. White square boxes indicate TH-positive dopaminergic neuronal cells, and white arrows indicate indicated virus injection sites. Figure 10E is survival rates in each mouse group. Animals; n=15, Saline (Saline) indicates wild-type mice treated with saline. L-DOPA, GFP, and DX2 represent injections of L-DOPA, GFP, and DX2 in mice treated with 6-OHDA. scAAV; scAAV-GFP (GFP) 4 × 10⁹ vg, scAAV-DX2 (DX2) (low) 1.6 × 10⁸ vg, scAAV-DX2 (DX2) (high) 4 × 10⁹ vg. Figures 10F and 10G show mRNA expression of DX2 and Bax in naive, 6-OHDA, and DX2-treated mice. ***P<0.001, t-test. Figure 10H shows RNA in situ hybridization to identify cells expressing DX2 in a 6-OHDA mouse model injected with AAV-DX2. [Figure 10-2]DX2 prevents behavioral deficits in a 6-OHDA-induced PD model. Figure 10A shows that mice treated with scAAV-DX2 exhibited lower levels of contralateral rotation compared to those treated with saline or vehicle (GFP), indicating that DX2 attenuated damage to dopaminergic neurons. Figure 10B shows that mice treated with DX2 exhibited increased contralateral forelimb contact, indicating that AAV-DX2 attenuated unilateral damage to dopaminergic neurons. In Figure 10C, mice treated with AAV-DX2 showed less rightward body swing. Animals; Saline (wild-type mice treated with saline) n=4, GFP (6-OHDA-treated mice injected with GFP) n=5, DX2 (6-OHDA-treated mice injected with DX2) n=11 (each mouse), scAAV; scAAV-GFP 4×10⁹vg, scAAV-DX2 low 1.6×10⁸vg, scAAV-DX2 4×10⁹vg, ns; not significant, *P<0.05, **P<0.005, ***P<0.001, t-test. Figure 10D is immunofluorescence images of mouse brains injected with GFP and DX2. White square boxes indicate TH-positive dopaminergic neuronal cells, and white arrows indicate indicated virus injection sites. Figure 10E is survival rates in each mouse group. Animals; n=15, Saline (Saline) indicates wild-type mice treated with saline. L-DOPA, GFP, and DX2 represent injections of L-DOPA, GFP, and DX2 in mice treated with 6-OHDA. scAAV; scAAV-GFP (GFP) 4 × 10⁹ vg, scAAV-DX2 (DX2) (low) 1.6 × 10⁸ vg, scAAV-DX2 (DX2) (high) 4 × 10⁹ vg. Figures 10F and 10G show mRNA expression of DX2 and Bax in naive, 6-OHDA, and DX2-treated mice. ***P<0.001, t-test. Figure 10H shows RNA in situ hybridization to identify cells expressing DX2 in a 6-OHDA mouse model injected with AAV-DX2. [Figure 10-3]DX2 prevents behavioral deficits in a 6-OHDA-induced PD model. Figure 10A shows that mice treated with scAAV-DX2 exhibited lower levels of contralateral rotation compared to those treated with saline or vehicle (GFP), indicating that DX2 attenuated damage to dopaminergic neurons. Figure 10B shows that mice treated with DX2 exhibited increased contralateral forelimb contact, indicating that AAV-DX2 attenuated unilateral damage to dopaminergic neurons. In Figure 10C, mice treated with AAV-DX2 showed less rightward body swing. Animals; Saline (wild-type mice treated with saline) n=4, GFP (6-OHDA-treated mice injected with GFP) n=5, DX2 (6-OHDA-treated mice injected with DX2) n=11 (each mouse), scAAV; scAAV-GFP 4×10⁹vg, scAAV-DX2 low 1.6×10⁸vg, scAAV-DX2 4×10⁹vg, ns; not significant, *P<0.05, **P<0.005, ***P<0.001, t-test. Figure 10D is immunofluorescence images of mouse brains injected with GFP and DX2. White square boxes indicate TH-positive dopaminergic neuronal cells, and white arrows indicate indicated virus injection sites. Figure 10E is survival rates in each mouse group. Animals; n=15, Saline (Saline) indicates wild-type mice treated with saline. L-DOPA, GFP, and DX2 represent injections of L-DOPA, GFP, and DX2 in mice treated with 6-OHDA. scAAV; scAAV-GFP (GFP) 4 × 10⁹ vg, scAAV-DX2 (DX2) (low) 1.6 × 10⁸ vg, scAAV-DX2 (DX2) (high) 4 × 10⁹ vg. Figures 10F and 10G show mRNA expression of DX2 and Bax in naive, 6-OHDA, and DX2-treated mice. ***P<0.001, t-test. Figure 10H shows RNA in situ hybridization to identify cells expressing DX2 in a 6-OHDA mouse model injected with AAV-DX2. [Figure 10-4]DX2 prevents behavioral deficits in a 6-OHDA-induced PD model. Figure 10A shows that mice treated with scAAV-DX2 exhibited lower levels of contralateral rotation compared to those treated with saline or vehicle (GFP), indicating that DX2 attenuated damage to dopaminergic neurons. Figure 10B shows that mice treated with DX2 exhibited increased contralateral forelimb contact, indicating that AAV-DX2 attenuated unilateral damage to dopaminergic neurons. In Figure 10C, mice treated with AAV-DX2 showed less rightward body swing. Animals; Saline (wild-type mice treated with saline) n=4, GFP (6-OHDA-treated mice injected with GFP) n=5, DX2 (6-OHDA-treated mice injected with DX2) n=11 (each mouse), scAAV; scAAV-GFP 4×10⁹vg, scAAV-DX2 low 1.6×10⁸vg, scAAV-DX2 4×10⁹vg, ns; not significant, *P<0.05, **P<0.005, ***P<0.001, t-test. Figure 10D is immunofluorescence images of mouse brains injected with GFP and DX2. White square boxes indicate TH-positive dopaminergic neuronal cells, and white arrows indicate indicated virus injection sites. Figure 10E is survival rates in each mouse group. Animals; n=15, Saline (Saline) indicates wild-type mice treated with saline. L-DOPA, GFP, and DX2 represent injections of L-DOPA, GFP, and DX2 in mice treated with 6-OHDA. scAAV; scAAV-GFP (GFP) 4 × 10⁹ vg, scAAV-DX2 (DX2) (low) 1.6 × 10⁸ vg, scAAV-DX2 (DX2) (high) 4 × 10⁹ vg. Figures 10F and 10G show mRNA expression of DX2 and Bax in naive, 6-OHDA, and DX2-treated mice. ***P<0.001, t-test. Figure 10H shows RNA in situ hybridization to identify cells expressing DX2 in a 6-OHDA mouse model injected with AAV-DX2.

[0039] [Figure 11-1]DX2 restores motor symptoms in an MPTP-induced PD model. Figure 11A shows that mice treated with scAAV-DX2 exhibited slightly longer latency to fall in the rotarod test compared to the vehicle (scAAV-GFP, GFP), indicating that scAAV-DX2 attenuated damage to dopaminergic neurons. In Figure 11B, mice treated with DX2 showed improved spontaneous motor activity based on the SHIRPA test. In Figure 11C, mice treated with DX2 showed relatively low levels of limb loss. In Figure 11D, DX2-overexpressing mice showed improved grooming rates compared to the vehicle control (GFP). Figure 11E is an immunofluorescence image of TH-positive cells in the mouse substantia nigra. White square boxes indicate TH expression regions. Figures 11F and 11G show mRNA expression of DX2 (Figure 11F) and Bax (Figure 11G) in the shown mouse brain. Naive, GFP, and DX2 represent wild-type mice treated with saline, MPTP-treated mice injected with GFP, and MPTP-treated mice injected with DX2. Animals; naive n=6, GFP n=9, DX2 n=12; scAAV; scAAV-GFP 4×10⁹vg, scAAV-DX2 4×10⁹vg, *P<0.05, **P<0.001, ***P<0.0001, t-test. [Figure 11-2]DX2 restores motor symptoms in an MPTP-induced PD model. Figure 11A shows that mice treated with scAAV-DX2 exhibited slightly longer latency to fall in the rotarod test compared to the vehicle (scAAV-GFP, GFP), indicating that scAAV-DX2 attenuated damage to dopaminergic neurons. In Figure 11B, mice treated with DX2 showed improved spontaneous motor activity based on the SHIRPA test. In Figure 11C, mice treated with DX2 showed relatively low levels of limb loss. In Figure 11D, DX2-overexpressing mice showed improved grooming rates compared to the vehicle control (GFP). Figure 11E is an immunofluorescence image of TH-positive cells in the mouse substantia nigra. White square boxes indicate TH expression regions. Figures 11F and 11G show mRNA expression of DX2 (Figure 11F) and Bax (Figure 11G) in the shown mouse brain. Naive, GFP, and DX2 represent wild-type mice treated with saline, MPTP-treated mice injected with GFP, and MPTP-treated mice injected with DX2. Animals; naive n=6, GFP n=9, DX2 n=12; scAAV; scAAV-GFP 4×10⁹vg, scAAV-DX2 4×10⁹vg, *P<0.05, **P<0.001, ***P<0.0001, t-test.

[0040] [Figure 12] Figures 12A and 12B show that DX2 administration delayed disease onset (Figure 12A) and extended survival time (Figure 12B) in a Lou Gehrig's disease model. Animals; n=5.

[0041] [Figure 13]Figure 13 shows cell morphology in bright-field microscopy. Overexpression of DX2 in AAV-DX2-infected cells inhibits Aβ-O-mediated cell death. DX2 increases the cell viability of cells treated with Aβ-O. SK-SY5Y cells were incubated with AAV-DX2 or AAV-GFP in the absence or presence of 25 μM Aβ-O, and cell death was observed by microscopy after 48 hours. Original magnification images: X40 (upper panel), X100 (lower panel).

[0042] [Figure 14] Figure 14 shows the quantification of cell death in Figure 13. The white boxes represent the percentage of cell death, and the black boxes represent the percentage of cell viability.

[0043] [Figure 15] Figure 15 shows the expression levels of p53. DX2 expression plays a crucial role in neurotoxin-induced p53 expression. *AAV-DX2(#1) and AAV-DX2(#2) show AAV-DX2 viruses produced in different batches.

[0044] [Figure 16-1] Mutant SOD1 selectively interacts with KARS1. In Figure 16A, the binding affinity of Lex-KARS1 to B42-SOD1 WT and mutants G85R and G93A was tested by a yeast two-hybrid assay. In Figure 16B, HEK293 cells were transfected with HA-SOD1 WT, G85R, and G93A, and immunoprecipitation (IP) was performed using HA antibody. The levels of KARS1 and SOD1 were determined by immunoblotting. Figure 16C shows the binding affinity of KARS1 fragments to SOD1 mutants as determined by a yeast two-hybrid assay. In Figure 16D, N2A cells were transfected with myc-KARS1 and SOD1 WT, G93A, and G85RA. IP of myc-KARS1 was performed, and immunoblotting was performed for the detection of AIMP2 and 67LR (laminin receptor). [Figure 16-2]Mutant SOD1 selectively interacts with KARS1. In Figure 16A, the binding affinity of Lex-KARS1 to B42-SOD1 WT and mutants G85R and G93A was tested by a yeast two-hybrid assay. In Figure 16B, HEK293 cells were transfected with HA-SOD1 WT, G85R, and G93A, and immunoprecipitation (IP) was performed using HA antibody. The levels of KARS1 and SOD1 were determined by immunoblotting. Figure 16C shows the binding affinity of KARS1 fragments to SOD1 mutants as determined by a yeast two-hybrid assay. In Figure 16D, N2A cells were transfected with myc-KARS1 and SOD1 WT, G93A, and G85RA. IP of myc-KARS1 was performed, and immunoblotting was performed for the detection of AIMP2 and 67LR (laminin receptor).

[0045] [Figure 17-1]Mutant SOD1 reduced the 67 laminin receptor, which induces anoikis. In Figure 17A, SK-N-SH cells were transfected with SOD1 WT and G93A. Cells were collected and immunoblotted for the 67 laminin receptor (LR). In Figure 17B, neuronal cells were transfected with SOD1 WT and G93A and then seeded on 22×22 coverslips. Cells were fixed and then treated with KARS1 or 67LR antibody, and images were then acquired by confocal microscopy. White arrows indicate stained laminin receptors. In Figure 17C, to observe the effect of SOD1 transfection with WT and G93A on migration, neuronal cells were loaded into the upper chamber, and WT and G93A were loaded into the lower chamber of a Transwell plate separated by a membrane with a pore size of 8.0 μm. The membrane was excised and stained. In Figure 17D, neuronal cells were transfected with SOD1 WT or G93A and then treated with laminin 1 (LN1) for 0, 15, 30, and 60 minutes. pERK and ERK levels were checked by Western blotting. In Figure 17E, the binding affinity of KARS1 to 67LR in WT and mutant SOD1-expressing cells was determined by immunoprecipitation. In Figure 17F, SH-SY5Y cells transfected with KARS1 for 24 hours, then with SOD1 WT, G85R, and G93A for 24 hours, were seeded. They were then seeded on hema coatings and subsequently treated with TNF-α and cycloheximide (CHX) for 6 hours. MTT assays were performed to observe cell viability. [Figure 17-2]Mutant SOD1 reduced the 67 laminin receptor, which induces anoikis. In Figure 17A, SK-N-SH cells were transfected with SOD1 WT and G93A. Cells were collected and immunoblotted for the 67 laminin receptor (LR). In Figure 17B, neuronal cells were transfected with SOD1 WT and G93A and then seeded on 22×22 coverslips. Cells were fixed and then treated with KARS1 or 67LR antibody, and images were then acquired by confocal microscopy. White arrows indicate stained laminin receptors. In Figure 17C, to observe the effect of SOD1 transfection with WT and G93A on migration, neuronal cells were loaded into the upper chamber, and WT and G93A were loaded into the lower chamber of a Transwell plate separated by a membrane with a pore size of 8.0 μm. The membrane was excised and stained. In Figure 17D, neuronal cells were transfected with SOD1 WT or G93A and then treated with laminin 1 (LN1) for 0, 15, 30, and 60 minutes. pERK and ERK levels were checked by Western blotting. In Figure 17E, the binding affinity of KARS1 to 67LR in WT and mutant SOD1-expressing cells was determined by immunoprecipitation. In Figure 17F, SH-SY5Y cells transfected with KARS1 for 24 hours, then with SOD1 WT, G85R, and G93A for 24 hours, were seeded. They were then seeded on hema coatings and subsequently treated with TNF-α and cycloheximide (CHX) for 6 hours. MTT assays were performed to observe cell viability.

[0046] [Figure 18-1]Effects of the AIMP2-DX2 gene on KARS1 and 67LR. In Figure 18A, SK-N-SH cells were transfected with SOD1 WT or G93A and then treated with KARS1 along with DX2 or AIMP2. Cells were collected and Western blotted. In Figure 18B, neuroblastoma cells were transfected with strep-DX2 for 24 hours and then with SOD1 WT, G93A, and G85R for 24 hours. Cells were collected, cellular component fractionation was performed, and the samples were immunoblotted. In Figure 18C, neuronal cells were transfected with SOD1 WT or G93A and then treated with AAV-EV or AAV-DX2. Cells were then treated with laminin 1 (LN1) for 0, 15, 30, and 60 minutes. Cells were lysed and then immunoblotted for p-ERK and ERK levels. In Figure 18D, SH-SY5Y cells were transfected with SOD1 WT or G93A and then treated with TNF-α (30 ng / mL) for 24 hours. Cell adhesion was measured by iCelligence. [Figure 18-2] Effects of the AIMP2-DX2 gene on KARS1 and 67LR. In Figure 18A, SK-N-SH cells were transfected with SOD1 WT or G93A and then treated with KARS1 along with DX2 or AIMP2. Cells were collected and Western blotted. In Figure 18B, neuroblastoma cells were transfected with strep-DX2 for 24 hours and then with SOD1 WT, G93A, and G85R for 24 hours. Cells were collected, cellular component fractionation was performed, and the samples were immunoblotted. In Figure 18C, neuronal cells were transfected with SOD1 WT or G93A and then treated with AAV-EV or AAV-DX2. Cells were then treated with laminin 1 (LN1) for 0, 15, 30, and 60 minutes. Cells were lysed and then immunoblotted for p-ERK and ERK levels. In Figure 18D, SH-SY5Y cells were transfected with SOD1 WT or G93A and then treated with TNF-α (30 ng / mL) for 24 hours. Cell adhesion was measured by iCelligence.

[0047] [Figure 19] Administration of DX2 rescue variant SOD1 induced neuronal death. In Figure 19A, SH-SY5Y cells were transfected with SOD1 WT, G85R, and G93A, treated with TNF-α and cycloheximide (CHX) for 6 hours, followed by treatment with adeno-associated virus (AAV) control vector (GFP) or DX2. Cell viability was checked by MTT assay. In Figure 19B, primary neuronal cells were isolated from each mouse, seeded in 24-well plates, treated with AAV-GFP or AAV-DX2, and their viability was checked by MTT assay.

[0048] [Figure 20-1] Figure 20A shows that binding assays demonstrate that DX2 binds to PARP-1 more strongly than AIMP2. In Figure 20B, cells transfected with AIMP2 showed a significant increase in PARP-1 cleavage compared to expression observed in other transfected cells under oxidative stress conditions. However, no PARP-1 cleavage was observed in cells transfected with DX2. [Figure 20-2] In Figure 20C, the parylation of AIMP2 increased in the presence of H2O2, but the parylation of DX2 remained unchanged.

[0049] [Figure 21-1] Figures 21A to 21C show a comparison of the amino acid sequences of AIMP2-DX2 and its variant (Figures 21B and 21C are a continuation of Figure 21A). [Figure 21-2] Figures 21A to 21C show a comparison of the amino acid sequences of AIMP2-DX2 and its variant (Figures 21B and 21C are a continuation of Figure 21A). [Figure 21-3] Figures 21A to 21C show a comparison of the amino acid sequences of AIMP2-DX2 and its variant (Figures 21B and 21C are a continuation of Figure 21A).

[0050] [Figure 22]Inhibition of neuromuscular junction injury. In Figure 22A, the neuromuscular junction was stained with α-bungarotoxin, and synaptic vesicles and endplates were stained with SV2 and 2H3. In Figure 22B, the number of innervated endplates was counted and shown. [Modes for carrying out the invention]

[0051] Detailed description of the invention AIMP2-DX2 is an alternative antagonistic splicing variant of AIMP2 (aminoacyl-tRNA synthase complex interacting multifunctional protein 2), a multifactorial apoptotic gene. AIMP2-DX2 is known to suppress cellular apoptosis by inhibiting the function of AIMP2.

[0052] AIMP2-DX2, acting as a competitive inhibitor of AIMP2, suppresses TNF-α-mediated apoptosis by inhibiting TRAF2 ubiquitination / degradation. Furthermore, AIMP2-DX2 has been previously identified as an inducer of lung cancer.

[0053] Furthermore, it has been shown that AIMP2-DX2 can treat neurological disorders (US2019 / 0298858 A1).

[0054] A method for delaying the onset of disease in subjects with amyotrophic lateral sclerosis (ALS), comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject, is disclosed herein.

[0055] A method for inhibiting neuronal cell death in subjects with amyotrophic lateral sclerosis (ALS), comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject, is disclosed herein.

[0056] Disclosed herein are methods for treating muscular atrophy in subjects requiring treatment for muscular atrophy, comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject. In some embodiments, the subject has amyotrophic lateral sclerosis (ALS). In some embodiments, the subject has spinal muscular atrophy (SMA).

[0057] A method for improving the survival rate or extending the survival period of subjects with Parkinson's disease (PD) is disclosed herein, which includes administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject.

[0058] Disclosed herein are methods for preventing behavioral deficits, restoring motor symptoms, and / or mitigating neurological damage in subjects with Parkinson's disease (PD), comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject.

[0059] A method for inhibiting amyloid-beta oligomer (Aβ-O)-induced neuronal cell death or Aβ-O-induced p53 expression in subjects with Alzheimer's disease (AD) is disclosed herein, comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject.

[0060] A method for inhibiting neuromuscular junction (NMJ) injury in subjects with spinal muscular atrophy (SMA), comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject, is disclosed herein.

[0061] Disclosed herein are methods for inhibiting neuromuscular junction (NMJ) injury, NMJ block-induced respiratory failure, dyspnea, and NMJ block-induced muscle contractions or fasciculations in subjects with amyotrophic lateral sclerosis (ALS), the methods comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject.

[0062] A method for suppressing anoikis and / or increasing laminin receptor stabilization in subjects with amyotrophic lateral sclerosis (ALS) and Parkinson's disease (PD), comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject is disclosed herein.

[0063] Also disclosed are methods for inhibiting inflammation in subjects with ALS, preventing behavioral defects, inhibiting neuronal cell death and / or muscle atrophy in subjects with PD, restoring motor symptoms in subjects with PD, treating Alzheimer's disease (AD) in subjects with AD, and / or treating congenital muscular dystrophy, multiple sclerosis, muscular dystrophy, myasthenia gravis, myopathy, myositis (including polymyositis and dermatomyositis), peripheral neuropathy, spinal muscular atrophy and / or other cell death-inducing CNS diseases in subjects requiring treatment, the methods comprising administering a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject.

[0064] The recombinant vectors disclosed herein may further comprise the miR-142 target sequence. The vectors may further comprise a promoter operably ligated to AIMP2-DX2. In some embodiments, the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Roussarcoma virus (RSV) promoter, an MT promoter, an EF-1α promoter, a UB6 promoter, a chicken β-actin promoter, a CAG promoter, a RPE65 promoter, a synapsin promoter, a MeCP2 promoter, a CaMKII promoter, an Hb9 promoter, or an opsin promoter.

[0065] In some embodiments of the methods disclosed herein, the recombinant vector comprises an exon 2 deletion AIMP2 variant (AIMP2-DX2) gene and a miR-142 target sequence. The miR-142 target sequence may be 3' relative to the AIMP2-DX2 gene. The vectors described herein can express AIMP2-DX2 in nervous system cells but not in hematopoietic cells such as leukocytes and lymphoid cells. Therefore, the vectors described herein may be useful for specifically targeting nervous system cells to treat nervous system diseases.

[0066] The AIMP2-DX2 polypeptide (SEQ ID NO: 2) is a splice variant of AIMP2 (e.g., the aa sequence in SEQ ID NO: 12; e.g., the nt sequence in SEQ ID NO: 3), in which the second exon of AIMP2 (SEQ ID NO: 10; the nt sequence in SEQ ID NO: 4) is omitted. In some embodiments, the AIMP2-DX2 gene has the nucleotide sequence described in SEQ ID NO: 1, and the AIMP2-DX2 polypeptide has the amino acid sequence described in SEQ ID NO: 2. Variants or isoforms of the AIMP2-DX2 polypeptide are also known and can be determined by those skilled in the art (see, for example, SEQ ID NOs: 13-19). For example, Figures 21A-21C show a comparison of AIMP2 (SEQ ID NO: 2) and its variants, SEQ ID NOs: 13-19, as well as the consensus or core sequence (SEQ ID NO: 20).

[0067] In some embodiments, the AIMP2-DX2 gene may include a nucleotide sequence encoding an amino acid sequence that is at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or any range of identity percentages within that range, to SEQ ID NOs: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

[0068] The AIMP2-DX2 gene may contain a nucleotide sequence that is at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or any range of identity percentages within that range, to the nucleotide sequence of Sequence ID No. 1. The AIMP2-DX2 gene may contain the nucleotide sequence of Sequence ID No. 1.

[0069] In some embodiments, the AIMP2-DX2 gene does not have an exon containing a nucleotide sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 10 or 11. In some embodiments, the AIMP2-DX2 gene does not have an exon containing a nucleotide sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 4.

[0070] The miR-142 target sequence (miR-142T) may include a nucleotide sequence containing ACACTA. The miR-142 target sequence may include a nucleotide sequence containing ACACTA and 1 to 17 additional consecutive nucleotides from Sequence ID No. 5. For example, the miR-142 target sequence may include a nucleotide sequence containing ACACTA and a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 additional nucleotides consecutive to the 5' or 3' end of ACACTA, as shown in Sequence ID No. 5.

[0071] The miR-142 target sequence may contain a nucleotide sequence that is at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to the nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA;miR-142-3pT). The miR-142 target sequence may contain the nucleotide sequence of SEQ ID NO: 5.

[0072] The miR-142 target sequence may include a nucleotide sequence containing ACTTTA. The miR-142 target sequence may include a nucleotide sequence containing ACTTTA and 1 to 15 additional consecutive nucleotides from Sequence ID No. 7. For example, the miR-142 target sequence may include a nucleotide sequence containing ACTTTA and a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 additional nucleotides consecutive to the 5' or 3' end of ACTTTA, as shown in Sequence ID No. 7.

[0073] The miR-142 target sequence may contain a nucleotide sequence that is at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG;miR-142-5pT). The miR-142 target sequence may contain the nucleotide sequence of SEQ ID NO: 7.

[0074] Exemplary miR142-3pT variant sequence: Ccgctgcagtgtgacagtgccagccaatgtgcagaggtggatgaggtcttgtgaaaacctggctccttttaacacggccctcaagctccttaagtgaccagaagcttgctagctccataaagtag gaCCACTGCAatcactccataaagtaggaCCACTGCAagatatctccataaagtaggaCCACTGCAatcactccataaagtaggaCCACTGCAaaagcttgtagggatccgcc (SEQ ID NO: 25).

[0075] The mutant sequence refers to one or more regions of the miR142 3pT core sequence that are substituted as follows, e.g., four regions: (5'-AACACTAC-3'→5'-CCACTGCA-3'). Inhibition of DX2 expression in HEK293 cells transfected with the vector was observed with miR142-3p x1 repeats (100 pmol) miR142-3p target sequences, and the miR142-3p inhibition of DX2 expression increased as the number of core binding sequences in the miR142-3p target sequence increased. A Tseq x3 core sequence-containing vector showed significant inhibition, but no inhibition was observed with the mutant 3x sequence.

[0076] MicroRNAs (miRNAs) are non-coding RNA molecules that function to regulate gene expression. miRNAs function by base-pairing with complementary sequences within mRNA molecules, i.e., miRNA target sequences. miRNAs can bind to target messenger RNA (mRNA) transcripts of protein-coding genes, negatively regulating their translation or causing mRNA degradation. Currently, over 2000 human miRNAs have been identified, and the miRbase database is publicly available. Many miRNAs are expressed in tissue-specific ways and play a crucial role in maintaining tissue-specific function and differentiation.

[0077] miRNAs act at the post-transcriptional stage of genes, and it is known that in mammals, approximately 60% of gene expression is regulated by miRNAs. miRNAs play important roles in a variety of biological processes and have been disclosed to be correlated with cancer, cardiac disorders, and neurological disorders. For example, miR-142 exists as miR-142-3p and miR-142-5p, and either of their target sequences can be used. Therefore, "miR-142" or "miRNA-142" refers to, for example, miR-142-3p and / or miR-142-5p, and can bind to miR-142 target sequences, such as miR-142-3pT or miR-142-5pT.

[0078] The miR-142 target sequence may be located at the 5' or 3' end of the AIMP2-DX2 gene.

[0079] For example, it is known that "miR-142-3p" can be located in the region where the translocation of its gene occurs in aggressive B-cell leukemia, and that it is expressed in hematopoietic tissues (bone marrow, spleen, thymus, etc.). Furthermore, it is known that miR-142-3p has been confirmed to be expressed in the liver (hematopoietic tissue of mice) of fetal mice and is involved in the differentiation of the hematopoietic system.

[0080] In some embodiments, the miR-142-3p and / or miR-142-5p target sequences are repeated at least 2 to 10 times, at least 2 to 8 times, at least 2 to 6 times, at least 4 times, or any range or number of times.

[0081] For example, miR-142-3p having the nucleotide sequence of SEQ ID NO: 23 may have a corresponding target sequence, for example, the nucleotide sequence of SEQ ID NO: 5, but not limited to this, which is the miR-142-3p target sequence (miR-142-3pT). For example, miR-142-5p having the nucleotide sequence of SEQ ID NO: 24 may have a corresponding target sequence, for example, the nucleotide sequence of SEQ ID NO: 7, but not limited to this, which is the miR-142-5p target sequence (miR-142-5pT).

[0082] In some embodiments, miR-142-3p may have the nucleotide sequence of SEQ ID NO: 23, and miR-142-5p may have the nucleotide sequence of SEQ ID NO: 24.

[0083] This specification discloses recombinant vectors that can control the side effects of AIMP2-DX2 variant overexpression in tumors by inserting the miR-142-3p and / or miR-142-5p target sequences (miR-142-3pT and / or miR-142-5pT, respectively) into the terminals of AIMP2-DX2 and controlling the suppression of AIMP2-DX2 expression in CD45-derived cells, particularly lymphoid and leukocytes. Thus, the expression of the AIMP2-DX2 variant can be restricted to injected nervous system cells and tissues only, but not to non-nerve hematopoietic cells, which are the major population in the injected tissue region. miR142-3p is expressed only in hematopoietic cells.

[0084] Recombinant vectors containing the miR-142-3p and / or miR-142-5p target sequences are disclosed herein. Recombinant vectors containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene and the miR-142-3p and / or miR-142-5p target sequences are disclosed herein.

[0085] The term "recombinant vector" refers to a gene construct that includes a vector that can be expressed as a target protein or RNA in a suitable host cell, and operably linked regulatory factors essential for enabling the inserted gene to be properly expressed.

[0086] The term "operatably linked" refers to a functional linkage between a regulatory sequence of nucleic acid expression and a nucleic acid sequence that codes for a target protein or RNA and performs a general function. For example, it can affect the expression of a nucleic acid sequence that codes for a promoter and a protein or RNA linked for the operability of the nucleic acid sequence. Operatable linkage with recombinant vectors is well known in the art and can be produced by using recombination techniques that utilize enzymes commonly known in the art for region-specific DNA cleavage and linking.

[0087] The recombinant vector may further include a promoter operably linked to AIMP2-DX2, as disclosed herein. In some embodiments, the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Roussarcoma virus (RSV) promoter, an MT promoter, an EF-1α promoter, a UB6 promoter, a chicken β-actin promoter, a CAG promoter, a RPE65 promoter, a synapsin promoter, a MeCP2 promoter, a CaMKII promoter, a Hb9 promoter, or an opsin promoter.

[0088] The recombinant vector may further include an exogenous promoter and an exogenous gene operably ligated to the promoter.

[0089] As used herein, “exogenous gene” may include a biologically appropriate activation protein or polypeptide, and the cryptographic sequence of a target product such as an immunogen or antigen protein or polypeptide, or a treatment-activated protein or polypeptide.

[0090] Polypeptides can compensate for deficiencies or absences in the expression of endogenous proteins in host cells. Gene sequences can be derived from a variety of sources, including DNA, cDNA, synthetic DNA, RNA, or combinations thereof. Gene sequences may include genomic DNA with or without native introns. Furthermore, genomic DNA may be obtained together with promoter sequences or polyadenylated sequences. Genomic DNA or cDNA can be obtained by various methods. Genomic DNA may be extracted and purified from suitable cells by methods publicly known in the region. Alternatively, cDNA can be produced using mRNA by reverse transcription or by other methods such as isolation from cells. Alternatively, polynucleotide sequences may include sequences complementary to RNA sequences, such as antisense RNA sequences, and the expression of complementary polynucleotides in the cells of an individual can be suppressed by administering antisense RNA to the individual.

[0091] For example, the exogenous gene may be an AIMP-2 splicing variant lacking exon 2, and the miR-142-3p target sequence may be linked to the 3'UTR of the exogenous gene. The sequence of the AIMP2 protein (312aa version: AAC50391.1 or GI: 1215669; 320aa version: AAH13630.1, GI: 15489023, BC0 13630.1) is described in the literature (312aa version: Nicolaides, NC, Kinzler, KW and Vogelstein, B. Analysis of the 5' region of PMS2 reveals heterogeneous transcripts and a novel overlapping gene, Genomics 29(2), 329-334 (1995) / 320aa version: Generation and initial analysis of more 15,000 full-length human and mouse cDNA sequences, Proc. Natl. Acad. Sci. USA 99(26), 16899-16903 (2002)).

[0092] The term "AIMP2 splicing variant" refers to a variant generated due to the partial or complete loss of exon 2 of exons 1-4. Therefore, the variant implies interference with the normal function of AIMP2 by forming AIMP2 proteins and heterodimers. The injected AIMP2-DX2 gene is hardly expressed in tissues other than the injected tissue. However, as a further safety measure, it is possible to insert the miR142 target sequence to completely block the possibility of AIMP2-DX2 expression in hematopoietic cells, the dominant population of non-neuronal cells in the injected tissue region.

[0093] Recombinant vectors may include sequence numbers 1 and 5.

[0094] The terms "percentage of sequence homology," "percentage of identity," or "percentage of identity" for nucleotide or amino acid sequences can be verified, for example, by comparing two optimally positioned sequences with a comparison domain, where some of the nucleotide sequences within the comparison domain may contain additions or deletions (i.e., gaps) compared to the reference sequence in the optimal position of the two sequences (without additions or deletions).

[0095] The proteins disclosed herein include not only those having their native amino acid sequence, but also those having variant amino acid sequences.

[0096] A protein variant refers to a protein having a different sequence resulting from the deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of one or more amino acid residues from the native amino acid sequence. Amino acid exchanges in proteins and peptides that do not alter the overall molecular activation are known in this area (H. Neurath, RL Hill, The Proteins, Academic Press, New York, 1979).

[0097] The protein or its variants are obtained through natural extraction, synthesis (Merrifield, J. Amer. Chem. Soc. 85:2149-2156, 1963), or genetic modification based on DNA sequences (Sambrook et al., Molecular Cloning, Cold Spring Harbour Laboratory Press, New York, USA, 2 nd It can be manufactured by Ed., 1989.

[0098] Amino acid mutations can occur based on the relative similarities of amino acid side-chain substituents, such as hydrophilicity, hydrophobicity, charge, and size. Analysis of the size, shape, and type of amino acid side-chain substituents reveals that arginine, lysine, and histidine are positively charged residues; alanine, glycine, and serine have similar sizes; and phenylalanine, tryptophan, and tyrosine have similar shapes. Therefore, based on these considerations, arginine, lysine, and histidine; alanine, glycine, and serine; as well as phenylalanine, tryptophan, and tyrosine, can be considered biologically functional equivalents.

[0099] In the introduction of one or more mutations, the hydrophobicity index of the amino acids may be considered. The hydrophobicity index is assigned to each amino acid according to its degree of hydrophobicity and charge: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine ​​(+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamic acid (-3.5); glutamine (-3.5); aspartic acid (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).

[0100] Hydrophobic amino acid indicators are crucial when assigning the interactive biological functions of proteins. Similar biological activation is only possible when substitutions are made with amino acids that have similar hydrophobic indicators. Examples of introducing mutations by referencing hydrophobic indicators include substitutions between amino acids where the difference in hydrophobic indicators is within ±2, ±1, or ±0.5.

[0101] On the other hand, it is well known that substitutions between amino acids with similar hydrophilicity values ​​can induce proteins with equivalent biological activity. As shown in U.S. Patent No. 4,554,101, the following hydrophilicity values ​​are assigned to each amino acid residue: arginine (+3.0); lysine (+3.0); aspartic acid (+3.0±1); glutamic acid (+3.0±1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5±1); alanine (-0.5); histidine (-0.5); cysteine ​​(-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

[0102] In cases where one or more mutations are introduced by referencing the hydrophilicity value, substitutions can be made between amino acids where the difference in hydrophilicity value is within ±2, ±1, or ±0.5, but is not limited to these limits.

[0103] Amino acid exchanges of proteins that do not alter the overall activation of the molecule are known in this field (H. Neurath, RL Hill, The Proteins, Academic Press, New York, 1979). The most common exchanges are between amino acid residues including Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly. Vector systems can be constructed by a variety of methods published in the industry. Specific methods are described in Sambrook et al. (2001), Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press.

[0104] The vectors disclosed herein can be constructed as typical vectors for cloning or expression. Furthermore, the vectors can be constructed using prokaryotic or eukaryotic cells as hosts. When the vector is an expression vector and prokaryotic cells are used as hosts, it typically contains a strong promoter for performing transcription (e.g., tac promoter, lac promoter, lacUV5 promoter, 1pp promoter, pL X promoter, pRX promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, and T7 promoter), a ribosome binding site for decoding initiation, and a transcription / decode termination sequence. When using Escherichia coli (E. coli) (e.g., HB101, BL21, DH5a, etc.) as host cells, the promoter and operator sites of the E. coli tryptophan biosynthesis pathway (Yanofsky, C. (1984), J. Bacteriol., 158:1018-1024) and the left-directing promoter of phage X (pLX promoter, Herskowitz, I. and Hagen, D. (1980), Ann. Rev. Genet. 14:399-445) can be used as control sites.

[0105] On the other hand, the vectors that can be used may be one or more types, such as viral vectors, linear DNA, or plasmid DNA.

[0106] A "viral vector" refers to a viral vector that can deliver genes or genetic material to desired cells, tissues, and / or organs.

[0107] The viral vector includes, but is not limited to, one or more selected from the group consisting of adenoviruses, adeno-associated viruses, lentiviruses, retroviruses, HIV (human immunodeficiency virus), MLV (mouse leukemia virus), ASLV (bird sarcoma / leukemia virus), SNV (splenic necrosis virus), RSV (Rous sarcoma virus), MMTV (mouse mammary tumor virus), and herpes simplex virus. In some embodiments, the viral vector may be an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, vaccinia virus, or herpes simplex virus vector.

[0108] Retroviruses possess the ability to integrate into the genome of host cells and are harmless to humans, but they may have characteristics including the suppression of normal cell function upon integration, the ability to infect a variety of cells, easy replication, the ability to contain external genes of approximately 1-7 kb, and the production of replication-deficient viruses. However, retroviruses may also have drawbacks, including difficulty in infecting post-mitotic cells, gene delivery under in vivo conditions, and the need to grow somatic cells under in vitro conditions. Furthermore, retroviruses can integrate into proto-oncogenes, thereby potentially leading to cell necrosis, and thus carry the risk of spontaneous mutation.

[0109] On the other hand, adenoviruses offer several advantages as cloning vectors, including their ability to replicate even within the nuclei of medium-sized cells, their clinically non-toxic nature, their stability even after insertion of external genes, the absence of gene rearrangement or loss, their ability to transform eukaryotes, and their stable, high-level expression even after integration into the chromosomes of host cells. Good host cells for adenoviruses are those responsible for hematopoiesis, lymphoid systems, and myeloma in humans. However, proliferation is difficult due to their linear DNA and the low infection rate of the virus, making it difficult to recover infected viruses. Furthermore, gene expression is most significant during the first 1-2 weeks, and persists for 3-4 weeks in only some cells. Another challenge is their high immunogenicity.

[0110] Adeno-associated virus (AAV) has become popular in recent years because it can complement the aforementioned problems and has many advantages as a gene therapy agent. It is also called adenosatellite virus. Adeno-associated virus particles have a diameter of 20 nm and are known to be of little harm to the human body. For this reason, it has been approved for sale as a gene therapy agent in Europe.

[0111] AAV is a single-stranded provirus that requires an auxiliary virus for replication. The AAV genome has 4,680 bp and can be inserted into a specific region of chromosome 19 in infected cells. The transgene is inserted into plasma DNA ligated by two 145 bp inverted end repeat (ITR) sequence sections and a signal sequence section. Transfection is performed with other plasmid DNA expressing the AAV rep and cap sections, and adenovirus is added as an auxiliary virus. AAV has the advantages of delivering genes to a wide range of host cells, having few immunological side effects with repeated administration, and having a long gene expression period. Furthermore, even if the AAV genome is integrated into the host cell chromosome, it is safe without altering or rearranging host gene expression.

[0112] Adeno-associated virus (AAV) is known to have a total of four serotypes. Among the many AAV serotypes that can be used for target gene delivery, the most widely studied vector is AAV serotype 2, currently used for the delivery of clinical genes for cystic fibrosis, hemophilia, and Canavan disease. Furthermore, recombinant AAV (rAAV) has recently shown increasing potential in the field of cancer gene therapy. This was also AAV serotype 2 used in this invention. While it is possible to select and apply an appropriate viral vector, this is not limited to that.

[0113] Furthermore, if the vector is an expression vector and eukaryotic cells are used as the host, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or promoters derived from mammalian viruses (e.g., post-adenovirus promoter, vaccine virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and HSV TK promoter) may be used. Specifically, this may include, but is not limited to, one or more promoters selected from the group consisting of retroviral LTRs, cytomegalovirus (CMV) promoters, Roussarcoma virus (RSV) promoters, MT promoters, EF-1α promoters, UB6 promoters, chicken β-actin promoters, CAG promoters, RPE65 promoters, and opsin promoters. In addition, it generally has a polyadenylated sequence as a transcription termination sequence.

[0114] The vectors disclosed herein may be fused with other sequences as needed to facilitate protein purification. For example, fused sequences such as glutathione S-transferase (Pharmacia, USA), maltose-binding protein (NEB, USA), FLAG (IBI, USA), and 6xHis (hexahistidine; Quiagen, USA) may be used, but are not limited to these. Furthermore, expression vectors may contain resistance genes to antibiotics commonly used in the industry as selection markers, such as ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, genethecin, neomycin, and tetracycline.

[0115] Furthermore, gene carriers comprising recombinant vectors containing the respective target sequences of miR-142, such as miR-142-3pT and / or miR-142-5pT, are disclosed herein.

[0116] The term "gene transfer" generally refers to the delivery of genetic material to cells for transcription and expression. The method is ideal for protein expression and treatment purposes. A variety of delivery methods have been described, including DNA transfection and viral transduction. Viral-mediated gene transfer refers to the high delivery efficiency and high levels of expression of the delivered gene, as well as the possibility of being environmentally friendly or targeting specific receptors and / or cell types by pseudotyping, if necessary.

[0117] Gene carriers can be transformants transformed with recombinant vectors, and transformation encompasses all methods of introducing nucleic acids into organisms, cells, tissues, or organs, and it is possible to select and perform appropriate standard techniques according to the host cell, as published in the field. Such methods include, but are not limited to, electroporation, protoplasmic fusion, calcium phosphate (CaP04) precipitation, calcium chloride (CaCl2) precipitation, mixing with the use of silicone carbide fibers, agribacteria-mediated transformation, PEG, dextran sulfate, and lipofectamine.

[0118] Gene carriers aim to suppress the expression of exogenous genes in neurons. Therefore, they can suppress the expression of exogenous genes in CD45-derived cells and increase the expression of exogenous genes in brain tissue. The majority of CD45 is a transmembrane protein tyrosine phosphatase located in hematopoietic cells. Cells can be defined according to molecules located on the cell surface, and CD45 is a cellular marker for all leukocytes and B lymphocytes. Gene carriers are not expressed in CD45-derived cells, particularly in cells ranging from lymphoids to leukocytes.

[0119] The gene carrier may further include carriers, excipients, or diluents that can be used pharmacologically.

[0120] Furthermore, a method for delivering and expressing an exogenous gene in a neuron is disclosed herein, which includes the step of introducing a recombinant vector into a corresponding entity.

[0121] The method may increase the expression of exogenous genes in brain tissue and control the expression of exogenous genes in other tissues.

[0122] Furthermore, vectors comprising an expression cassette containing 1) a promoter; 2) a nucleotide sequence encoding a target protein linked to the promoter to enable activation; and 3) a nucleotide sequence targeting miR-142-3p inserted at the 3'UTR of the nucleotide sequence are disclosed herein. In some embodiments, the vector may comprise an expression cassette containing 1) a promoter; 2) a nucleotide sequence encoding a target protein linked to the promoter to enable activation; and 3) a nucleotide sequence targeting miR-142-5p inserted at the 3'UTR of the nucleotide sequence.

[0123] The term "expression cassette" refers to a unit cassette that includes a gene encoding a target protein, as well as nucleotide sequences encoding a promoter and a signal peptide, and is capable of performing expression for the production and secretion of a target protein operably linked downstream of the signal peptide. The secretory expression cassette of the present invention may be used in combination with a secretory system. A variety of factors that can assist in the efficient production of the target protein may be included both inside and outside such an expression cassette.

[0124] Furthermore, prophylactic or therapeutic formulations for neurodegenerative diseases are disclosed herein, comprising a nucleotide sequence encoding an AIMP-2 splicing variant lacking exon 2, and a nucleotide sequence targeting miR-142-3p ligated to the 3'UTR of the nucleotide sequence.

[0125] Accordingly, methods for treating neurological disorders in subjects requiring such treatment, comprising administering one of the vectors disclosed herein, are also disclosed herein. Neurodegenerative disorders may be one or more of the disorders selected from the group consisting of Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), retinal degeneration, mild cognitive impairment, multiple infarct dementia, frontotemporal dementia, Lewy body dementia, Huntington's disease, degenerative neurological disorders, metabolic brain disorders, depression, epilepsy, multiple sclerosis, corticobasal degeneration, multiple system atrophy, progressive supranuclear palsy, dentatorubral-pallidoluysian atrophy, spinocerebellar ataxia, primary lateral sclerosis, spinal muscular atrophy, and stroke. In some embodiments, the neurological disorder is ALS. Treatment can improve memory, dyskinesia, motor activity, and / or extend survival in subjects having a neurological disorder, such as ALS, Alzheimer's disease, or Parkinson's disease. In some embodiments, the treatment can improve motor activity and / or extend survival time in subjects with neurological diseases, such as ALS.

[0126] The vectors disclosed herein, but not limited to them, can induce inhibition of apoptosis, improvement of dyskinesia, and / or inhibition of oxidative stress, and thus can prevent or treat neurological diseases.

[0127] The term "treatment" includes not only the complete treatment of a neurodegenerative disease, but also the partial treatment, improvement, and / or reduction of the overall symptoms of a neurodegenerative disease as a result of the application of any of the pharmacological agents disclosed herein.

[0128] The term "prevention" means preventing the onset of the overall symptoms of a neurodegenerative disease by suppressing or blocking symptoms or phenomena such as cognitive impairment, behavioral disorders, and neuronal destruction, by applying the pharmacological agents disclosed herein.

[0129] Adjuvants other than the active ingredient may be included in addition to the pharmacological agents disclosed herein. Adjuvants may be used without limitation as long as they are known in the art, but the immune response can be enhanced by further including, for example, Freund's complete and incomplete adjuvants.

[0130] The pharmacological agents disclosed herein may be prepared in the form of a mixture of the active ingredient with a pharmacologically acceptable carrier. Here, pharmacologically acceptable carriers include carriers, excipients, and diluents commonly used in the field of pharmacology. Pharmacologically acceptable carriers that may be used with the pharmacological agents disclosed herein include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0131] The pharmacological agents disclosed herein may be used by being manufactured in various forms, including for oral administration such as powders, granules, pills, capsules, suspensions, emulsions, syrups, and aerosols, as well as for topical use, suppositories, or antiseptic injections, according to their respective common manufacturing methods.

[0132] When manufactured into formulations, diluents or excipients such as commonly used fillers, bulking agents, binders, humectants, disintegrants, and surfactants can be used in the manufacture. Solid formulations for oral administration include pills, tablets, powders, granules, and capsules, which can be manufactured by mixing one or more excipients such as starch, calcium carbonate, sucrose, lactose, and gelatin with the active ingredient. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid formulations for oral administration include suspensions, oral solutions, oils, and syrups containing various excipients such as humectants, sweeteners, and flavoring / preservatives, in addition to water and liquid paraffin, which are commonly used diluents. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, oils, lyophilized agents, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, and vegetable oils such as olive oil, as well as injection esters such as ethylates. The medications used in suppositories include witepsol, tween® 61, cocoa oil, lauric acid oil, and glycerogelatin.

[0133] Pharmacological agents can be administered to a target or entity through a variety of channels. All modes of administration, including oral administration, as well as intravenous, intramuscular, subcutaneous, and intraperitoneal injections, may be used.

[0134] The desirable dosage of the therapeutic agent disclosed in this specification varies depending on various factors including the production method of the formulation, mode of administration, age, weight and gender of the patient, degree of disease symptoms, diet, administration period, administration route, excretion rate and reaction sensitivity. Nevertheless, it can be appropriately selected by the corresponding manufacturer. However, regarding the treatment effect, a skilled physician can determine and prescribe the effective dosage for the targeted treatment. For example, treatment agents include intravenous, subcutaneous and intramuscular injections, as well as directional injections into the ventricle or spinal cord using micro needles. Multiple injections and repeated administrations are possible. For example, the effective dosage is 0.05 - 15 mg / kg in the case of a vector, 5×10 11 ~3.3×10 14 virus particles (2.5×10 12 ~1.5×10 16 IU) / kg, and 5×10 2 ~5×10 7 cells / kg in the case of cells. Desirably, the dosage is 0.1 - 10 mg / kg in the case of a vector, 5×10 12 ~3.3×10 13 particles (2.5×10 13 to 1.5×10 15 IU) / kg, and 5×10 3 ~5×10 6 cells / kg in the case of cells, and the administration rate is 2 - 3 times a week. The dosage is not strictly limited. Rather, it can be adjusted according to the patient's symptoms and the degree of manifestation of neurological disorders. The effective dosage for other subcutaneous fat and muscle injections and direct administration to the affected area is 9×10 10 ~3.3×10 14 recombinant virus particles, and the rate is 2 - 3 times a week at 10 cm intervals. The dosage is not strictly limited. Rather, it can be adjusted according to the patient's symptoms and the degree of manifestation of neurological disorders. More specifically, the pharmacological agent according to the present invention contains recombinant adeno-associated virus at 1×10 10 ~1×10 12 vg (virus genome) / mL, and generally, once every two days over a two-week period, 1×10 12It is advisable to inject vg. It can be administered once daily or by dividing the dose for several doses throughout the day. In some embodiments, the vector is 0.1 × 10⁶ 8 vg~500×10 8 vg, 1×10 8 vg~100×10 8 vg, 1×10 8 vg~10×10 8 vg, for example 5×10 8 It may be administered in VG or any range of doses derived therefrom. For IV injection, for example, VG can be converted to a human dose based on body weight for IV injection. For local tissue injection, for example, VG can also be converted to a human dose based on target cell count and effective MOI (multiple doses of infection).

[0135] In some embodiments, the vectors disclosed herein may be injected into a subject, for example, by subretinal injection, intravitreous injection, or subchoroidal injection. The injection may be in liquid form. In other embodiments, the vectors disclosed herein may be administered to a subject in the form of eye drops or ointment.

[0136] Pharmacological formulations can be produced in a variety of forms for oral and parenteral administration. In some embodiments, the vectors disclosed herein can be administered to the brain or spinal cord. In some embodiments, the vectors disclosed herein can be administered to the brain by stereotactic injection.

[0137] Orally administered drugs include pills, tablets, hard and soft capsules, liquids, suspensions, oils, syrups, and granules. These drugs, in addition to the active ingredient, may contain diluents (e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, and / or glycine) and flow enhancers (glydents) (e.g., silica, talc, and stearic acid and its magnesium or calcium salts, and / or polyethylene glycol). Furthermore, pills may contain binders such as magnesium aluminum silicate, starch paste, gelatin, tragacanthine, methylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidine, and, depending on the situation, disintegrants such as starch, agar, alginic acid or its sodium salts, or similar mixtures, and / or absorbents, colorants, flavorings, and sweeteners. Drugs can be manufactured by general mixing, granulation, or coating methods.

[0138] In addition, injectable preparations are a typical form of parenterally administered formulations. Solvents for such injectable preparations include water, Ringer's solution, isotonic saline, and suspensions. Sterile fixative oils can be used as solvents or suspension media for injectable preparations, and any non-irritating fixative oil, including mono- and di-glycerides, can be used for such purposes. Furthermore, fatty acids such as oleic acid can be used in injectable preparations.

[0139] The present invention will be described in more detail using the following examples. However, the following examples are for the purpose of illustrating the content of the invention and do not limit the application of the present invention to these examples. [Examples]

[0140] Examples Example 1. Preparation of recombinant vectors The majority of CD45s are transmembrane protein tyrosine phosphatases in hematopoietic cells and can be used to define cells according to molecules on their cell surface. CD45 is a marker for all leukocytes and B lymphocytes. Recombinant vectors have been created that are not expressed in CD45-derived cells, particularly lymphoid and leukocytes, but are specifically expressed only in neurons. These recombinant vectors contain a splicing variant of aminoacyl-tRNA synthetase complex interacting pluripotent protein 2 (AIMP2) with exon 2 deleted, and miRNAs that can regulate the expression of the AIMP2 splicing variant.

[0141] As a safety measure for distribution, the recombinant vector was prepared as described above to induce specific expression of the AIMP2 splicing variant only in injected nervous system tissue, completely blocking the possibility of AIMP2-DX2 expression in hematopoietic cells, which are the major population of non-nerve cells in the injected tissue region. Example 1.1. Preparation of AIMP2 variant

[0142] AIMP2 is one of the proteins involved in the formation of aminoacyl-tRNA synthetase (ARS) and acts as a multifactorial apoptotic protein. To construct a plasmid expressing a variant of AIMP2 lacking exon 2, the cDNA of the AIMP2 splicing variant was cloned into pcDNA3.1-myc. After amplifying the AIMP2 splicing variant using primers with EcoR1 and Xho1 linkers bound to H322 cDNA, subcloning was performed into pcDNA3.1-myc using EcoR1 and Xho1.

[0143] An AIMP2 variant having the nucleotide sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2 was used. Example 1.2. Selection of miRNAs and their target sequences

[0144] As described above, as a safety measure for distribution, the recombinant vector was prepared as described to limit the expression of the AIMP2 variant in injected nervous system cells and to completely block the possibility of AIMP2-DX2 expression in hematopoietic cells, which are the major population of non-nerve cells in the injected tissue region.

[0145] For this purpose, we selected miR-142-3p as a target, as it is specifically expressed only in hematopoietic cells that produce leukocytes and lymphoid-related cells. To construct a sequence that targets only miR-142-3p, we used microarray data of mouse B cells and miR - Computer programming (mirSVR score) of the genes targeted by 142-3p was used. miR-142-3p is the nucleotide sequence shown in SEQ ID NO: 3. Sequences targeting miR-142-3p are shown in SEQ ID NO: 4, which binds complementaryly to miR-142-3p. miR-142-3p target sequences may have the nucleotide sequence shown in SEQ ID NO: 5.

[0146] The miR-142-3p target sequence includes restriction enzyme (Nhe 1 and Hind III, Bmt 1) site sequences (ccagaagcttgctagc) and restriction enzyme (Hind H) site sequences (aagcttgtag). It also contains the nucleotide sequence of SEQ ID NO: 5 repeated four times using linkers (tcac and gatatc) to connect them (Figure 3; SEQ ID NO: 6). Example 1.3. Preparation of recombinant vectors

[0147] To construct the recombinant vector, the miR-142-3p target sequence (SEQ ID NO: 5) was inserted into the 3'UTR of the AIMP2 variant (SEQ ID NO: 1). The linkage between the AIMP-2 variant and the miR-142-3p target sequence is shown in nucleotide SEQ ID NO: 6, specifically, by cleavage and insertion using the Nhe I and Hind III sites. The recombinant vector is shown in Figure 1. Example 2. Confirmation of neuronal-specific expression of recombinant vector. Example 2.1. Confirmation of neuron-specific expression effect under in vitro conditions

[0148] Since miR142-3p is specifically expressed only in hematopoietic cells, we confirmed the degree of AIMP2 variant expression in specific cells by knocking down the AIMP2 variant through the expression of the miR142-3p target sequence in a recombinant vector.

[0149] Specifically, the study included a group that did not receive recombinant vector treatment (SHAM), a group treated with an empty / control vector (NC vector), a group treated with a single AIMP2 variant vector (pscAAV_DX2), and a group treated with a recombinant vector (pscAAV-DX2-miR142-3pT). All vector concentrations were in ug / ul units, with each group treated with 2.5 ul (2.5 ug). In each treatment group, THP-1 cell lines (human monocytic leukemia cells) and SH-SY5Y cell lines (neuroblastoma) were treated while confirming AIMP2 variant knockdown. qPCR was performed using the primers shown in Table 1 below (15 seconds of denaturation, annealing and extension over 40 cycles of 30 seconds each at 60°C). [Table 1]

[0150] As a result, it was confirmed that the AIMP2 variant was not expressed in the SHAM and NC vector groups. Furthermore, expression was confirmed in both the THP-1 cell line and the SH-SY5Y cell line in the group treated with a single AIMP2 variant vector (pscAAV-DX2), confirming that neuronal-specific expression was not induced. On the other hand, in the group treated with the recombinant vector, it was confirmed that the AIMP2 variant was specifically expressed only in the SH-SY5Y cell line (Figure 2). Example 2.2. Confirmation of neuronal cell-specific expression effect under in vivo conditions

[0151] Specifically, the groups included those treated with an empty / control vector (NC vector), those treated with a single AIMP2 variant vector (pscAAV-DX2), and those treated with the recombinant vector of the present invention (pscAAV-DX2-miR142-3pT). 10 8 Each virus at a concentration of vg / ul (10 ul) 9 Intracellular treatment was performed using vg). AIMP2 expression was confirmed one week after intracranial injection into each group of treated mice in colon tissue, lung tissue, brain tissue, liver tissue, kidney tissue, thymic tissue, spleen tissue, and peripheral blood mononuclear cells (PBMCs). qPCR was performed using the primers shown in Table 1 below (15 seconds of denaturation, followed by annealing and extension over 40 cycles of 30 seconds each at 60°C).

[0152] As a result, in the group treated with the recombinant vector of the present invention, AIMP2 variant expression was specifically increased only in brain tissue containing highly enriched neurons (Figure 3). On the other hand, in tissues other than brain tissue, AIMP2 variant expression was inhibited. Example 3. Materials and Methods Example 3.1. qRT-PCR

[0153] Total RNA was isolated from the spinal cord using TRIzol (Invitrogen, Waltham, MA, USA) according to the manufacturer's protocol. The extracted RNA was quantified using a spectrophotometer (ASP-2680, ACTgene, USA) for quantitative analysis. Reverse transcription was performed using SuperScript III First-Strand (Invitrogen) according to the manufacturer's protocol to prepare cDNA. The resulting cDNA was used for real-time PCR using SYBR Green PCR Master Mix (ThermoFisher Scientific, USA). For 2-ΔΔCt statistical analysis, expression data from the denominations were used, and GADPH expression was used for normalization. Example 3.2. Animals

[0154] The hSOD1 G93A transgenic mice used in this study (B6.Cg-Tg(SOD1) * G93A)1Gur / J) was purchased from Jackson Laboratories (Bar Harbor, ME, USA). Same-age wild-type control mice were also used. Animals were housed in individual cages at the animal facility of Seoul National University, South Korea, under specific pathogen-free and controlled environmental conditions (temperature 21-23°C, humidity 50-60%, and a 12-hour light / dark cycle). All experimental procedures were conducted in accordance with the guidelines of the Seoul National University Institutional Animal Care and Use Committee (SNUIACUC, August 7, 2017), and this study was approved by the inventors' regional ethics committee "SNUIACUC" (approval number SNU-170807-1). In the pre-symptomatic stage, same-age female mice were administered AAV-GFP and DX2 vectors. Transduction of AAV-DX2 was performed by intrathecal injection via direct lumbar puncture. Using a Hamilton syringe (Switzerland), a total of 8 μl (4 μl / point) of AAV-GFP or DX2 vector was slowly injected at two points (1 μl / min) while slowly withdrawing the needle to prevent loss of the injected vector. Example 3.3. miR142-3p inhibition experiment

[0155] miR-142-3p inhibition of DX2 expression was observed from the x1 miR-142-3p target sequence. HEK293 cells were transiently transfected with x1, x2, and x3 repeat miR-142-3p target sequence vectors, plus 100 pmol of miR-142-3p, using lipofectamine 2000 (Invitrogen, US), and then incubated for 48 hours. The amount of DX2 mRNA was analyzed by PCR. miR142-3p inhibition of DX2 expression was observed from the Tseq x1 repeat miR142-3p target sequence (Figure 5B). Example 4 Example 4.1. Three types of vectors created for the inhibitory effect on core binding sequences.

[0156] Tseq x1 contains one core binding sequence, Tseq x2 contains two core binding sequences, and Tseq x3 contains three core binding sequences (Figure 5A).

[0157] miR142-3p (100 pmol) inhibition of DX2 expression was initially observed from the x1 repeat miR142-3p target sequence. HEK293 cells were transiently transfected with x1, x2, and x3 repeat miR-142-3p Tseq vectors, plus 100 pmol of miR-142-3p, using lipofectamine 2000 (invitrogen, US), and then incubated for 48 hours. DX2 mRNA levels were analyzed by PCR. As the number of core binding sequences in the miR142-3p target sequence increased, so did the miR142-3p inhibition of DX2 expression. Vectors containing the Tseq x3 core sequence showed significant inhibition (Figure 5B). Example 4.2. Core sequence mutation.

[0158] The core sequence was predicted using mouse B cell microarray data and mirSVR scores of miR-142-3p target genes. Four regions of the core sequence were substituted as follows: (5'-AACACTAC-3'→5'-CCACTGCA-3') (see Figure 4 for the original sequence and Figure 5A for a schematic diagram). Example 4.3. The core binding sequence is an important DX2 inhibitor.

[0159] Four core sequences were substituted (Figure 5A). HEK293 cells were transiently transfected with DX2-miR-142-3p Tseq x3 repeat vector (Tseq3x) or core sequence mutant vector (mut) and 100 pmol of miR-142-3p using lipofectamine 2000 (Invitrogen, US), and then incubated for 48 hours. DX2 mRNA expression was analyzed by PCR. Tseq x3 repeat vectors (Figure 5B) and DX2 constructs that showed significant inhibition of DX2 were used as controls. Treatment with 100 pmol of miR142-3p significantly inhibited the Tseq x3 vector, but not DX2 or the mut sequence (Figure 6). Example 4.4. Tissue distribution data in an ALS mouse model.

[0160] Total RNA was extracted from the spinal cord after intrathecal injection of scAAV2-DX2-miR142-3p. qRT-PCR was performed. DX2 expression should be limited to the local injection site, specifically the spinal cord. In hSOD1 G93A transgenic mice, scAAV-DX2 miR142-3p was expressed after intrathecal injection. Injection with the control vehicle showed expression only in the spinal cord, and not in the brain or sciatic nerve (Figure 7). Example 5

[0161] In Example 2, HEK293T cells were cotransfected with three plasmids (from Oxgene, UK) that encoded all the components necessary to produce recombinant AAV2 particles.

[0162] HEK293T cells were also transfected with pSF-AAV-ITR-CMV-EGFP-ITR-KanR(Oxgene, UK) only, with insertion of the target nucleotide of AIMP2-DX2 or DX2-miR142, as an expression vector and not for AAV particle production.

[0163] DX2 coding vector (2µg) and DX2-miR142 target sequence coding vector (2µg) were transfected into THP-1 cells (human monocytes, CD45+ cells) and SH-SY5Y (neuronal cells). After 48 hours, cells were collected and mRNA was isolated. DX2 expression was analyzed using synthesized cDNA by real-time PCR.

[0164] DX2 expression levels were similar between SH-SY5Y cells transfected with the DX2 coding vector and the DX2-miR142 target sequence coding vector; however, DX2 expression was dramatically reduced in THP-1 cells transfected with the DX2-miR142 target sequence coding vector. Therefore, miR142-3p functioned only in THP-1 cells (Figure 8). Example 6 Example 6.1. Experimental Method

[0165] Animal models

[0166] hSOD1 used in this study G93A Transgenic mouse (B6.Cg-Tg(SOD1) * G93A)1Gur / J) was purchased from Jackson Laboratories (Bar Harbor, ME, USA). Animals were housed in individual cages under specific pathogen-free conditions and constant environmental conditions (temperature 21–23°C, humidity 50–60%, and a 12-hour light / dark cycle). Female mice of the same age were administered AAV2-GFP or AAV2-DX2 in the presymptomatic stage. Transduction of AAV2-DX2 was performed by intrathecal injection via direct lumbar puncture. Using a Hamilton syringe (Switzerland), a total of 8 μl (4 μl / point) of AAV-GFP or DX2 vector was slowly injected at two points (1 μl / min), with the needle slowly withdrawn to prevent loss of the injected virus.

[0167] Behavioral Analysis To determine the onset of the disease, the inventors focused on the day when mice began to lose 5-6% of their maximum body weight. It is generally known that the severe onset stage is observed from 12 weeks of age in SOD1G93A mice, but motor dysfunction began several weeks before the onset of obvious symptoms (45 days postnatally) (CRHayworth et al., Neuroscience. 2009 / 12 / 15;164(3):975-985). In this study, female mice of the same age were administered scAAV-GFP or scAAV-DX2 (GO102) at 9 weeks of age when lameness was observed and the mice began to lose 5-6% of their maximum body weight. Transduction of AAV2-DX2 (GO102) was achieved by intrathecal injection via direct lumbar puncture. Example 6.2. Results

[0168] Figures 9A–9C show that DX2 transgenic mice recover motor symptoms in mice treated with rotenone. Figure 9A shows the analysis of TH expression using the brains of the mice shown. The black dotted squares indicate TF-stained areas. Figure 9B shows rotarod analysis. Latency to fall in rotenone-treated wild-type and DX2 transgenic (TG) mice. Figure 9C shows the pole test. Vertical movement (left panel) and T-turn time (right panel) in rotenone-treated wild-type and DX2 TG mice. Animals; n=6 (each group), ns; not significant. ** P<0.01, *P<0.05, t-test. Figures 9D and 9E show that DX2 improves neurological injury and behavior in a rotenone-inducible PD mouse model. Figure 9D shows the Pall test. scAAV-DX2 recovered motor coordination and balance in a rotenone-treated PD mouse model. "Con" and "GFP" show wild-type and rotenone-treated GFP-injected mice. "Dose 1" and "Dose 2" represent different injection doses of DX2 in rotenone-treated mice. Figure 9E shows immunohistochemistry and immunofluorescence images of the mouse substantia nigra. The upper panel shows TH-positive cells in the striatum, and the lower panel shows the distribution of the injected GFP-expressing virus. Black dotted squares indicate stained areas of TH. Animals; n=5 (each group), ns; not significant. ** P<0.05, * P<0.01, t-test.

[0169] Figures 10A–10H demonstrate that DX2 prevents behavioral deficits in a 6-OHDA-induced PD model. Figure 10A demonstrates that mice treated with scAAV-DX2 showed lower levels of contralateral rotation compared to those treated with saline or vehicle (GFP), indicating that DX2 attenuated damage to dopaminergic neurons. Figure 10B demonstrates that mice treated with DX2 showed increased contralateral forelimb contact, indicating that AAV-DX2 attenuated unilateral damage in dopaminergic neurons. Figure 10C demonstrates that mice treated with AAV-DX2 showed less rightward body swing. Animals: Saline (wild-type mice treated with saline) n=4, GFP (6-OHDA-treated mice injected with GFP) n=5, DX2 (6-OHDA-treated mice injected with DX2) n=11, scAAV; scAAV-GFP 4×10 9 vg, scAAV-DX2 4x10 9 vg, ns; non-significant, * P<0.05, ** P<0.005, ***P<0.001, t-test. Figure 10D shows immunofluorescence images of mouse brains injected with GFP and DX2. White square boxes indicate TH-positive dopaminergic nervous system cells, and white arrows indicate indicated viral injection sites. Figure 10E shows survival rates in each mouse group. Animals; n=15, Saline represents wild-type mice treated with saline. L-DOPA, GFP and DX2 represent injections of L-DOPA, GFP and DX2 in mice treated with 6-OHDA. scAAV; scAAV-GFP (GFP) 4×10 9 vg, scAAV-DX2 (DX2) (low) 1.6×10 8 vg, scAAV-DX2 (DX2) (high) 4×10 9 vg. Figures 10F and 10G show mRNA expression of DX2 and Bax in naive, 6-OHDA, and DX2-treated mice. *** P<0.001, t-test. Figure 10H shows RNA in situ hybridization to identify cells expressing DX2 in a 6-OHDA mouse model injected with AAV-DX2.

[0170] Figures 11A–11G demonstrate that DX2 restores motor symptoms in an MPTP-induced PD model. Figure 11A shows that mice treated with scAAV-DX2 exhibited slightly longer latency to fall in the rotarod test compared to the vehicle (scAAV-GFP, GFP), indicating that scAAV-DX2 attenuated damage to dopaminergic neurons. Figure 11B demonstrates that mice treated with DX2 showed improved spontaneous motor activity based on the SHIRPA test. Figure 11C demonstrates that mice treated with DX2 showed relatively low levels of limb loss. Figure 11D demonstrates that DX2-overexpressing mice showed improved grooming rates compared to the vehicle control (GFP). Figure 11E shows immunofluorescence images of TH-positive cells in the mouse substantia nigra. White square boxes indicate TH expression regions. Figures 11F and 11G show mRNA expression of DX2 (Figure 11F) and Bax (Figure 11G) in the mouse brains shown. Naive, GFP, and DX2 represent wild-type mice treated with saline, MPTP-treated mice injected with GFP, and MPTP-treated mice injected with DX2. Animals; naive n=6, GFP n=9, DX2 n=12, scAAV; scAAV-GFP 4×10 9 vg, scAAV-DX2 4x10 9 vg, * P<0.05, ** P<0.001, *** P<0.0001, t-test. Example 7

[0171] The in vivo effects of AAV-DX2 were investigated by treating SOD1 transgenic mice with AAV-GFP (GFP) or AAV-DX2 in the spinal canal. Disease onset was delayed in the DX2-injected mouse group compared to the GFP-injected mouse group. Furthermore, mice treated with DX2 survived significantly longer than mice treated with GFP. The overall survival time of DX2-injected mice was extended compared to mice treated with GFP.

[0172] Figures 12A and 12B show that administration of DX2 improves disease onset and extends mouse survival in a Lou Gehrig's disease model. Figure 12A: Disease onset was improved in the AAV-DX2 group. Figure 12B: Mouse survival was extended in the AAV-DX2 group compared to the AAV-GFP group. Animals; n=5. Example 8 Example 8.1. Experimental Method

[0173] Cell culture and treatment

[0174] Human neuroblastoma cell line SK-SY5Y cells were maintained in RPMI 1640 containing 10% fetal bovine serum, 100 units / ml penicillin, and 100 μg / ml streptomycin. To induce Alzheimer's disease (AD) in nervous system cells, SK-SY5Y cells were placed in 6-well plates at a dose of 1 × 10⁶. 6 Cells were seeded at a cell / well density, and after 16 hours, the culture medium was replaced with RPMI 1640 containing 25 μM amyloid-beta protein oligomer (Aβ-O) for 24 hours. To identify the inhibitory effect of DX2 expression on neuronal cell death, SK-SY5Y cells were incubated with Aβ-O for 24 hours, and then treated with either a vehicle (scAAV2-GFP) or overexpressed DX2 (scAAV2-DX2) virus in RPMI 1640 growth medium for 48 hours. Cell death was analyzed by Western blotting and microscopy.

[0175] Immunoblot analysis

[0176] SH-SY5Y cells were dissolved in 25 mM Tris-HCl, pH 7.4, containing 150 mM NaCl, 0.5% Triton® X-100, and a protease inhibitor cocktail. Samples containing 50 μg of protein were blotted onto a 10% polyacrylamide gel and transferred to a membrane electrophoretically. The membrane was blocked with 5% skim milk powder in Tris-buffered saline containing 20% ​​Tween®-20 and incubated with primary antibodies against p53 and actin. Antibodies on the membrane were detected with secondary mouse anti-goat and anti-rabbit antibodies conjugated to horseradish peroxidase. The membrane was analyzed using SuperSignal West Dura extended-duration substrate according to the manufacturer's manual (Thermo Fisher Scientific, Waltham, MA, USA). Example 8.2. Results

[0177] AIMP2-DX2 attenuates Aβ-O-induced neuronal cell death.

[0178] Alzheimer's disease (AD) is a progressive neurodegenerative disease caused by the accumulation of abnormal proteins such as amyloid-beta protein (Aβ) and phosphorylated tau (p-tau) protein in the brain (Duyckaerts 2009). It is known that the aggregation of amyloid-beta protein by proteolytic cleavage of amyloid precursor protein plays an important role in the development of AD (Viola 2015 and De Strooper 2010). Therefore, we investigated whether overexpression of AIMP2-DX2 (DX2) (Choi 2011), an inhibitor of cell death in AD-induced cells, can affect neuronal cell death. In Figure 13, there was no difference in cell survival between untreated, vehicle (AAV-GFP) treated, and DX2 (AAV-DX2) treated cells during normal proliferation, suggesting that increased DX2 expression under normal conditions is not responsible for neuronal cell survival. Under Aβ-O treatment conditions, a reduction in neural cell death was observed in DX2-treated cells (Aβ+AAV-DX2) compared to vehicles-treated cells (Aβ+AAV-GFP). Furthermore, after observing cells in three different fields of view (Figure 13), neural cell death was quantitatively analyzed in Figure 14, and the percentage of cells was scored. As shown in Figure 14, cells overexpressing DX2 had a significantly increased neural cell survival rate (up to 47%) compared to the vehicles-treated group. These results indicate that DX2 expression is a crucial factor for the protective effect against Aβ-O-induced cell death.

[0179] DX2 inhibits Aβ-O-induced p53 expression.

[0180] P53, a tumor suppressor protein, is a crucial factor in regulating biological events such as the cell cycle and apoptosis (Finlay 1989). As previously reported (Choi 2011), AIMP2 binds to the N-terminus of p53, the Mdm2 binding domain, and this binding induces p53 stability and pro-apoptotic activity. It is also known that DX2 inhibits the apoptotic activity of AIMP2 by interfering with its interaction with p53. Therefore, we investigated whether increased DX2 expression by viral transduction of the DX2 gene affects p53 expression in Aβ-O-treated neural cells. In Figure 15, the cellular expression level of p53 did not change under normal growth conditions, but the expression level of p53 increased in the presence of Aβ-O. Furthermore, in cells treated with DX2, DX2 expression decreased Aβ-O-induced p53 expression. These results suggest that DX2 inhibits Aβ-O-induced apoptosis and the expression of pro-apoptotic proteins, such as p53, in nervous cells.

[0181] DX2 expression plays a crucial role in neurotoxin-induced p53 expression (Figure 15). SK-SY5Y cells were incubated with AAV-DX2 or AAV-GFP in the absence or presence of 25 μM Aβ-O. After 48 hours, total protein lysates were prepared and p53 protein levels were analyzed by immunoblotting. β-actin levels were analyzed as a loading control. Red square boxes indicate increased levels of p53 in cells treated with Aβ-O. Example 9 Example 9.1. Materials and Methods

[0182] Cell culture and reagents

[0183] The HEK293 cell line was obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA), and Neuro-2A (N2A), SK-N-SH, and SH-SY5Y cells were obtained from the Korean Cell Line Bank (KCLB, Seoul, KOREA). HEK293 and N2A cells were grown in Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (HyClone, Pittsburgh, PA, USA). SK-N-SH cells were incubated in RPMI-1640 containing 10% FBS and 1% antibiotic. Transient transfection of myc-tagged KARS, HA-tagged mutant SOD1, GFP-tagged KARS, and GFP-tagged mutant SOD1 was performed using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Additionally, 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and HEMA (2-hydroxyethyl methacrylate) are sourced from Sigma-Aldrich (St. Louis, MO, USA).

[0184] Yeast-to-Hybrid Assay

[0185] Full-length and fragmented KARS were cloned into the pLexA plasmid, and SOD1 WT, SOD1 G85R, and SOD1 G93A were cloned into the pB42 plasmid. Positive interactions between the LexA fragment of KARS and B42-SODWT / SOD85 / SOD93 in yeast were determined using LEU2 and LacZ reporter systems with X-gal plates (21).

[0186] Immunoprecipitation assay

[0187] Cell lysates were collected and prepared using RIPA buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 150 mM NaCl, 20% glycerol, 1% NP-40, 0.5% sodium deoxycholate, and PMSF). The cell lysates were incubated on ice for 30 minutes, followed by centrifugation at 12,000 g for 10 minutes, after which the supernatant was collected. Anti-HA or anti-Myc agarose beads were added to the lysates, and the mixture was incubated overnight at 4°C using a rocking platform. Proteins bound to the agarose beads were washed three times, and the collected samples were separated by SDS-PAGE and analyzed by Western blotting.

[0188] Western blotting and antibodies

[0189] Cells were dissolved in 150 mM NaCl, 0.5% Triton® X-100, and 25 mM Tris-HCl, pH 7.4, containing a protease inhibitor cocktail. Samples containing 50 μg of protein were blotted onto a 10% polyacrylamide gel and transferred to a membrane electrophoretically. The membrane was blocked with 5% skim milk powder in Tris-buffered saline containing Tween®-20 and incubated with primary antibodies against Myc (Santa Cruz Biotechnology, sc-40), HA, GFP, 67 laminin receptor, IκB, tubulin, β-actin, TRAF2, EPRS, KARS, AIMP2, Erk, and phosphorylated Erk. Antibodies on the membrane were detected with secondary mouse anti-goat and anti-rabbit antibodies conjugated to horseradish peroxidase. The membranes were analyzed using SuperSignal West Dura extended duration substrate according to the manufacturer's (Thermo Fisher Scientific, Waltham, MA, USA) manual.

[0190] immunocytochemistry

[0191] Cells were fixed with 4% PFA at room temperature for 10 minutes, then washed with PBS and incubated overnight with antibodies against SOD1 and 67LR. The stained cells were then washed and incubated with Alexa Fluor-linked IgG (Vector Laboratories INC, Burlingame, CA, USA). Nuclear DNA was stained with DAPI (4',6-diamidino-2-phenylindole, Thermo Fisher Scientific, Waltham, MA, USA).

[0192] Cell migration assay

[0193] The cell migration assay was performed using an 8 μm Transwell chamber (Corning INC, Corning, NY, USA). N2A cells in serum-free medium were seeded into the upper chamber of a 24-well migration plate. The lower chamber was filled with 400 μL of DMEM containing 10% FBS. After 24 hours, the upper chamber was fixed with 10% PFA at room temperature for 10 minutes, followed by staining with crystal violet. The migrated cells were then counted.

[0194] Cell viability assay

[0195] For MTT assay, 5 × 10 4 Cells / well were seeded in a 96-well plate and treated with a specific molecule for 24 hours. After appropriate incubation, 15 μL of 5 mg / mL MTT solution in PBS (pH 7.2) was added to each well, and the mixture was incubated at 37°C for 4 hours in a 5% CO2 atmosphere. The solution was removed, and dimethyl sulfoxide (DMSO) was added to each well to dissolve the insoluble formazan precipitate. Absorbance was measured at 620 nm using a plate reader.

[0196] Cellular component fractionation

[0197] To determine the cellular localization of KARS1, cytosolic and membrane fractions were collected using a cell component fractionation kit (Biovision, Milpitas, CA, USA). Briefly, cells were lysed, centrifuged at 1,000 rpm for 10 minutes at 4°C, and the supernatant was used as the cytosolic fraction. The pellet was then washed and incubated with sodium deoxycholate buffer at 4°C for 10 minutes to be used as the membrane fraction.

[0198] Cell adhesion strength test

[0199] SH-SY5Y cells transfected with SOD1 G93A and DX2 were seeded in 96-well e plates (ACEA Biosciences, San Diego, CA, USA) (1.0 × 10⁶). 4 Cell adhesion was screened after treatment with TNF-α (cells / mL) for 24 hours. Subsequently, adhered cells were counted using iCELLigence (ACEA Biosciences, San Diego, CA, USA). Example 9.2. Results

[0200] It has been previously reported that mitochondrial KARS interacts with mutant SOD1, and that mutant SOD1 and mitoKARS result in mitochondrial morphological abnormalities and cytotoxicity. Therefore, to investigate whether KARS can modulate neuronal cell death through SOD1 mutations, we first examined the binding efficiency of mutant SOD1 and KARS. For the experiment, we prepared WT SOD1, SOD1 G93A, SOD1 G85R, and KARS, and analyzed the interactions between KARS and each SOD1 by yeast two-hybrid (Figure 16A) and immunoprecipitation analysis (Figure 16B). We observed that KARS binds to mutant SOD1 with much stronger binding than WT SOD1 (Figures 16A and 16B).

[0201] Next, to study the specific binding sites of KARS and mutant SOD1, the inventors used a yeast two-hybrid assay system to confirm the interaction between cleaved KARS and mutant SOD1. As shown in Figure 16C, binding of KARS and mutant SOD1 was observed at the N-terminus of KARS. AIMP2 and the 67 laminin receptor have been shown to interact at the N-terminus of KARS to regulate cancer cell migration and cell survival. Since AIMP2, 67LR, and mutant SOD1 bind to the N-terminus of KARS, the inventors investigated whether the interaction between KARS and mutant SOD1 affects the binding of KARS to AIMP2 and 67LR. As shown in Figure 16D, AIMP2 and 67LR bound to KARS in the presence of WT SOD1, but a decrease in the binding of KARS to AIMP2 and 67LR was observed in the presence of mutant SOD1. The results showed that mutant SOD1 reduced the binding of KARS to AIMP2 and 67LR due to competition for binding to the N-terminus of KARS.

[0202] Since the inventors demonstrated that mutant SOD1 G93A had the best binding to KARS, they wanted to investigate its effect on 67LR and whether it correlated with neuronal cell death. When the inventors transfected SK-N-SH cells with mutant SOD1, they were able to find a decrease in 67LR levels (Figure 17A).

[0203] To confirm the expression site of 67LR, the inventors performed immunofluorescence (IF) on cells transfected with mutant SOD1. KARS levels were shown to be concentrated in the cytoplasm rather than the membrane, and significantly reduced from the membrane region (Figure 17B).

[0204] It has been previously shown that KARS induces cell migration via 67LR. When cells were transfected with SOD1 wild-type or mutant SOD1, cell migration was suppressed with mutant SOD1 compared to wild-type SOD1 (Figure 17C).

[0205] Since mutant SOD1 affects the expression of 67LR, the inventors investigated its effect on the laminin signaling pathway and confirmed that mutant SOD1 significantly reduces pERK activity (Figure 17D).

[0206] The inventors also investigated whether the expression of mutant SOD1 affects the binding affinity between KARS and 67LR. In Figure 17E, the inventors observed a decrease in the interaction between KARS and 67LR upon expression of mutant SOD1.

[0207] Anoikis is a type of apoptosis caused by the loss of contact between the extracellular matrix (ECM) and cell membrane proteins, and resistance to anoikis plays a crucial role in cell survival. To induce anoikis, cells were cotransfected with mutant SOD1 and KARS and incubated with or without TNF-α / CHX under suspension conditions. As a result, we observed that cell death was not reversed by overexpression of KARS (Figure 17F). This result suggests that the regulation of cell death by the laminin receptor is due to increased downstream signaling via the interaction between the laminin receptor and the ECM.

[0208] The inventors investigated whether DX2 plays a crucial role in mutant SOD1-induced 67LR expression. SK-N-SH cells were transfected with SOD1 WT and SOD1 G93A mutant genes. One group was then transfected with the pro-apoptotic AIMP2 gene, and the other group with the anti-apoptotic DX2 gene. In the presence of DX2, the inventors observed that the decrease in 67LR protein due to AIMP2 overexpression was restored (Figure 18A).

[0209] Next, the inventors investigated whether the expression of 67LR, which was reduced in the plasma membrane by mutant SOD1, could be restored by the DX2 gene. Overexpression of DX2 in cells expressing mutant SOD1 increased the 67LR protein in the cell membrane (Figure 18B), and the inventors also observed that the downstream signaling of 67LR was recovered by introducing the DX2 gene (Figure 18C).

[0210] Next, the inventors tested cell detachment after treatment with TNF-α, followed by transfection with EV, mutant SOD1, and mutant SOD1+DX2. Treatment with DX2 prevented cell detachment and anokis (Figure 18D).

[0211] The inventors confirmed the effect of DX2 on neural cell death induced by mutant SOD1. When AAV-DX2 was transduced into WT SOD1 or cells overexpressing mutant SOD1, the inventors observed that apoptosis induced by mutant SOD1 was reduced to control levels (Figure 19A). The cell death rates of WT and two mutants, G85R and G93A, induced by CHX / TNF-α treatment increased by approximately 20% in GFP-infected cells, respectively. However, the cell death rate in DX2-infected cells induced by CHX / TNF-α treatment was approximately 20% lower than that of GFP-transduced cells, a statistically significant difference (p<0.001).

[0212] Furthermore, the reduction of CHX / TNF-α-induced cell death by DX2 overexpression was also demonstrated in primary neurons. Primary neuronal cells extracted from wild-type or SOD1 transgenic mice were infected with AAV overexpressing DX2, and the transfected cells were treated with CHX / TNF-α. Cell death rates were then analyzed. Primary neuronal cells of G93A showed increased cell death under CHX / TNF-α treatment conditions, but DX2 significantly reduced cell death in both wild-type and G93A primary neuronal cells treated with CHX / TNF-α (Figure 19B). Example 10

[0213] Previous studies have shown that AIMP2 acts as a substrate for parkin and interacts with PARP-1, and that this interaction modulates neuronal cell death in PD (Lee 2013). Therefore, to investigate whether DX2 is a competitive inhibitor of AIMP2 and modulates neuronal cell death, we first performed a binding assay between PARP-1 and AIMP2 or DX2. Expression of PARP-1, AIMP2, and DX2 was induced by transfection of each plasmid in SH-SY5Y cells, followed by analysis using a PARP-1 pull-down assay (Figure 20A). Cells were transfected with EV (empty vector), AIMP2, and DX2, and after 24 hours, the transfected cells were incubated with 10 μM H2O2 for 4 hours. Cleavage PARP-1 levels (Figure 20B) and PARlyation (Figure 20C) were examined using immunoblotting assays. Under oxidative stress-induced cell damage conditions, DX2 attenuates PARP-1 cleavage (Figure 20B) and PARylation (Figure 20C), which are associated with cell death.

[0214] As shown in Figure 20A, we found that DX2 binds to PARP-1 more strongly than AIMP2. To evaluate whether AIMP2 and DX2 can affect PARP-1 cleavage under oxidative stress conditions, we transfected empty controls (EVs), vectors expressing AIMP2 or DX2, and then treated them with hydrogen peroxide. Cells transfected with AIMP2 showed a significant increase in PARP-1 cleavage under oxidative stress conditions compared to the expression observed in other transfected cells. However, no PARP-1 cleavage was observed in cells transfected with DX2 (Figure 20B).

[0215] PARylation is a post-translational process that regulates biological events such as DNA damage response and apoptosis (Szabo 1996 and Virag (1998)). PARP-1 is an enzyme that recognizes damaged DNA in the nucleus, forms PAR chains, and induces the degradation of damaged proteins by PARylation. Since PARlylation, i.e., the formation of PAR polymers, requires the catalytic activity of cleaved PARP-1 (Barkauskaite 2015), we investigated the effect of AIMP2 or DX2 on PARlylation. As shown in Figure 20C, PARlylation with AIMP2 increased in the presence of H2O2, while PARlylation with DX2 remained unchanged. Based on these results, we conclude that DX2 is an inhibitory molecule of oxidative stress-induced PARP-1 cleavage.

[0216] Example 11

[0217] DX2 inhibition in neuromuscular junction injury

[0218] Motor neurons are essential for communication between the brain and muscles, transmitting vital commands for mobility. When these nerve cells malfunction or are damaged, they gradually cease to communicate with the muscles, and the brain loses its ability to control and initiate spontaneous movement. This leads to progressive weakness of voluntary skeletal muscles throughout the body, muscle fasciculations (single contractions), and atrophy. Furthermore, degeneration of the NMJ, which leads to denervation of skeletal muscles, is thought to play an essential role in the development of ALS. Muscle fasciculations / single contractions and respiratory failure typically occur within 2-3 years of the onset of ALS. In the final stages of the disease, this leads to death due to fatal paralysis and respiratory failure.

[0219] Muscle tissue was fixed overnight with 4% PFA at 4°C. The muscle was dehydrated with 30% sucrose and embedded in OCT compound for tissue freezing sections. All muscle frozen section samples were obtained from 20 μm thick sections containing the neuromuscular junction.

[0220] Frozen sections with a thickness of 20 μm were washed twice in 1XPBS (for 5 minutes each time) and then incubated in blocking solution (5% BSA) at room temperature for 1 hour.

[0221] BSA was aspirated, and sections were incubated overnight in blocking solution at room temperature with primary antibodies against neurofilaments (stained green using anti-neurofilament + anti-2H3, SV2) and postsynaptic acetylcholine receptors (AChR) (stained red using fluorescent α-bungarotoxin conjugate). Several defects may be readily observed, including partially innervated or completely denervated postsynaptic receptor sites, fragmented or contracted postsynaptic receptors, atrophied axons or terminals, and swollen or dystrophic axons or terminals.

[0222] Immunofluorescence ROI sets and overlap coefficient measurements were performed using Image J.

[0223] Based on this, denervation of skeletal muscle in each group—wild-type (WT), ALS-inducible model (AAV-GFP), and ALS-inducible model (GO102)—was measured by double staining of gastrocnemius muscle with α-bungarotoxin and SV2, 2H3.

[0224] In Figure 22A, the neuromuscular junction was stained with α-bungarotoxin, and synaptic vesicles and endplates were stained with SV2 and 2H3. In Figure 22B, the number of innervated endplates was counted and shown.

[0225] GO102 improved the percentage reduction in innervated endplate (75.6±12.6 vs. 41.0±2.03%) observed in ALS disease models.

[0226] In summary, DX2 is expected to inhibit neuromuscular junction (NMJ) injury and restore NMJ block-induced respiratory failure and muscle monocontraction or fasciculations.

[0227] References KR10-1067816(2011). Rosen DR, et al.(1993) Mutations in Cu / Zn superoxide dismutase gene are associated withfamilial amyotrophic lateral sclerosis. Nature 362(6415):59-62. Fridovich I (1995)Superoxide radical and superoxide dismutases. Annu Rev Biochem64:97-112. Fridovich I (1997)Superoxide anion radical (O2-.), superoxide dismutases, and related matters. JBiol Chem 272(30):18515-18517. Bruijn LI, et al.(1998) Aggregation and motor neuron toxicity of an ALS-linked SOD1 mutantindependent from wild-type SOD1. Science 281(5384):1851-1854. Iancu, R, Mohapel, P, Brundin, P, andPaul, G (2005). Behavioral characterization of a unilateral 6-OHDA-lesion modelof Parkinson's disease in mice. Behavioural brain research 162: 1-10. Meredith, GE, and Rademacher, DJ (2011).MPTP mouse models of Parkinson's disease: an update. Journal of Parkinson'sdisease 1: 19-33. Dawson, TM, and Dawson, VL (2014).Parkin plays a role in sporadic Parkinson's disease. Neuro-degenerativediseases 13: 69-71. Alzheimer's Association. "2019Alzheimer's disease facts and figures." Alzheimer's & Dementia 15.3(2019): 321-387. Choi, Jin Woo, et al."Cancer-associated splicing variant of tumor suppressor AIMP2 / p38:pathological implication in tumorigenesis." PLoS genetics (2011). Duyckaerts C, Delatour B, Potier MC."Classification and basic pathology of Alzheimer disease." Acta Neuropathol. (2009): 5-36. Viola KL, Klein WL. "Amyloid βoligomers in Alzheimer's disease pathogenesis, treatment, and diagnosis."Acta Neuropathol. (2015): 183-206. De Strooper B, Vassar R, Golde T."The secretases: enzymes with therapeutic potential in Alzheimer disease." Nat Rev Neurol. (2010): 99-107. Finlay CA, Hinds PW, Levine AJ. "The p53 proto-oncogene can act as a suppressor of transformation. " Cell.(1989): 1083-93. Lee, Y, Karuppagounder, SS, Shin, JH,Lee, YI, Ko, HS, Swing, D, et al. (2013). Parthanatos mediatesAIMP2-activated age-dependent dopaminergic neuronal loss. Natureneuroscience. Szabo, C, Zingarelli, B, O'Connor, M, and Salzman, AL(1996). DNA strand breakage, activation of poly (ADP-ribose) synthetase, andcellular energy depletion are involved in the cytotoxicity of macrophages andsmooth muscle cells exposed to peroxynitrite. Proceedings of the NationalAcademy of Sciences of the United States of America 93: 1753-1758. Virag, L, Salzman, AL, and Szabo, C (1998). Poly(ADP-ribose) synthetase activation mediates mitochondrial injury duringoxidant-induced cell death. Journal of immunology 161: 3753-3759. Barkauskaite, E, Jankevicius, G, and Ahel, I (2015).Structures and Mechanisms of Enzymes Employed in the Synthesis and Degradationof PARP-Dependent Protein ADP-Ribosylation. Molecular cell 58: 935-946. Brown et al., Endogenous microRNA regulation suppressestransgene expression in hematopoietic lineages and enables stable genetransfer, Nature Med. 12:585-591 (2006). Brown et al., Endogenous microRNA can broadly exploited toregulate transggene expression acording to tissue, lineage and diffferentiationstate, Nature Biotech. 25:12457-1467 (2007).

[0228] The foregoing description of specific embodiments is sufficient to illustrate the general nature of the invention, and others can readily modify and / or adapt it for various applications by applying their knowledge of the art without departing from the general concept of the invention. Such adaptations and modifications are therefore intended to be within the meaning and scope of equivalents of the disclosed embodiments, based on the teachings and guidance presented herein. It should be understood that the expressions or terms herein are for illustrative purposes only, and not limiting, so that they may be interpreted by those skilled in the art in light of the teachings and guidance herein.

[0229] The breadth and scope of the present invention should not be limited by any of the exemplary embodiments described above, but should be defined solely in accordance with the following claims and their equivalents.

[0230] All of the various aspects, embodiments, and options described herein can be combined in any and all possible variations.

[0231] All publications, patents, and patent applications referenced herein are incorporated by reference to the same extent as each individual publication, patent, or patent application is specifically and individually indicated as being incorporated by reference.

Claims

1. A composition for delaying disease onset in a subject with amyotrophic lateral sclerosis (ALS), comprising a recombinant vector containing an exon 2 deleted AIMP2 variant (AIMP2-DX2) gene.

2. A composition for inhibiting nervous system cell death in a subject with amyotrophic lateral sclerosis (ALS), comprising a recombinant vector containing an exon 2 deleted AIMP2 variant (AIMP2-DX2) gene.

3. A composition for treating muscle atrophy in a subject in need thereof, comprising a recombinant vector containing an exon 2 deleted AIMP2 variant (AIMP2-DX2) gene.

4. 5. The composition of claim 4, wherein the subject has amyotrophic lateral sclerosis (ALS).

5. The composition of claim 4 , wherein the subject has spinal muscular atrophy (SMA).

6. A composition for improving the survival rate or extending the survival period of a subject with Parkinson's disease (PD), comprising a recombinant vector containing an exon 2 deleted AIMP2 variant (AIMP2-DX2) gene.

7. A composition for preventing behavioral deficits, reversing motor symptoms, and / or reducing nervous system damage in a subject with Parkinson's disease (PD), comprising a recombinant vector containing an exon 2 deleted AIMP2 variant (AIMP2-DX2) gene.

8. A composition for inhibiting amyloid beta oligomer (Aβ-O)-induced neuronal cell death or Aβ-O-induced p53 expression in a subject with Alzheimer's disease (AD), comprising a recombinant vector containing an exon 2 deleted AIMP2 variant (AIMP2-DX2) gene.

9. A composition for inhibiting neuromuscular junction (NMJ) damage in a subject with spinal muscular atrophy (SMA), comprising a recombinant vector containing an exon 2 deleted AIMP2 variant (AIMP2-DX2) gene.

10. A composition for inhibiting neuromuscular junction (NMJ) damage, inhibiting NMJ block-induced respiratory failure, respiratory distress, and inhibiting NMJ block-induced muscle twitching or fasciculations in a subject with amyotrophic lateral sclerosis (ALS), comprising a recombinant vector containing an exon 2 deleted AIMP2 variant (AIMP2-DX2) gene.

11. A composition for suppressing anoikis and / or increasing laminin receptor stabilization in a subject with amyotrophic lateral sclerosis (ALS) or Parkinson's disease (PD), comprising a recombinant vector containing an exon 2 deleted AIMP2 variant (AIMP2-DX2) gene.

12. The composition according to any one of claims 1 to 11, wherein the vector further comprises a miR-142 target sequence.

13. The composition according to any one of claims 1 to 12, wherein the vector further comprises a promoter operably linked to the AIMP2-DX2.

14. The composition of claim 13, wherein the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MT promoter, an EF-1α promoter, a UB6 promoter, a chicken β-actin promoter, a CAG promoter, an RPE65 promoter, a synapsin promoter, a MeCP2 promoter, a CaMKII promoter, an Hb9 promoter, or an opsin promoter.

15. The composition according to any one of claims 12 to 14, wherein the miR-142 target sequence is 3' to the AIMP2-DX2 gene.

16. The composition of any one of claims 1 to 15, wherein the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

17. The composition of claim 16, wherein the AIMP2-DX2 gene comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

18. The composition according to any one of claims 1 to 17, wherein the AIMP2-DX2 gene does not have an exon containing a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 or 11.

19. The composition according to any one of claims 1 to 18, wherein the AIMP2-DX2 gene does not have an exon containing a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10 or 11.

20. The composition of any one of claims 12 to 19, wherein the miR-142 target sequence comprises ACACTA.

21. The composition of claims 12-19, wherein the miR-142 target sequence comprises ACACTA and 1 to 17 additional contiguous nucleotides of SEQ ID NO:

5.

22. The composition of any one of claims 12 to 19, wherein the miR-142 target sequence comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA).

23. The composition of claim 22, wherein the miR-142 target sequence comprises the nucleotide sequence of SEQ ID NO:

5.

24. The composition of any one of claims 12 to 19, wherein the miR-142 target sequence comprises ACTTTA.

25. The composition of claims 12-19, wherein the miR-142 target sequence comprises ACTTTA and 1 to 15 additional consecutive nucleotides of SEQ ID NO:

7.

26. The composition of any one of claims 12 to 19, wherein the miR-142 target sequence comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG).

27. The composition of claim 26, wherein the miR-142 target sequence comprises the nucleotide sequence of SEQ ID NO:

7.

28. The composition of any one of claims 12 to 27, wherein the miR-142 target sequence is repeated 2 to 10 times.

29. The composition according to any one of claims 1 to 28, wherein the vector is a viral vector.

30. 30. The composition of claim 29, wherein the viral vector is an adenovirus, adeno-associated virus, lentivirus, retrovirus, human immunodeficiency virus (HIV), murine leukemia virus (MLV), avian sarcoma / leukosis virus (ASLV), spleen necrosis virus (SNV), Rous sarcoma virus (RSV), mouse mammary tumor virus (MMTV), vaccinia virus, or herpes simplex virus vector.

Images