Compositions and methods for reducing intracellular MHC class II

Abstract

Compositions and methods for reducing expression of MHC class II proteins in cells, for example for use in adoptive cell transfer therapy, comprising genetically modifying CIITA.

Description

Technical field

[0001] This application is filed under 35 U.S.C. 119(e) in U.S. Provisional Application No. 63 / 124,064 filed on December 11, 2020 and in U.S. Provisional Application No. 63 / 124,064 filed on December 23, 2020. No. 130,106, the disclosures of each of which are incorporated herein by reference in their entirety.

[0002] This application has been filed with a sequence listing in electronic format. The sequence listing is provided as a file (size: 392,081 bytes) named "2021-12-10_01155-0034-00PCT_Seq_List_ST25.txt" created on December 10, 2021. The information in the electronic form of the sequence listing is incorporated herein by reference in its entirety. [Summary of the invention]

[0003] The ability to down-regulate MHC class II is useful for many in vivo and ex vivo applications, e.g. transplantation and / or in vitro generation of cell populations that do not activate T cells, e.g. essential when using donor-derived cells). In particular, the transfer of allogeneic cells into a subject is of great interest in the field of cell therapy. The use of allogeneic cells is limited by the problem of rejection by the recipient subject's immune cells, which recognize the transplanted cells as foreign and attack them. To circumvent the problem of immune rejection, cell-based therapies have focused on autologous transplant approaches that use the subject's own cells as the source of therapy, an approach that is time consuming and costly.

[0004] Typically, immune rejection of allogeneic cells is due to a mismatch in major histocompatibility complex (MHC) molecules between donor and recipient. In the human population, MHC molecules exist in a variety of forms, including, for example, many genetic variants of any given MHC gene, ie, alleles that encode different forms of MHC proteins. The main classes of MHC molecules are called MHC class I and MHC class II. MHC class I molecules (e.g., HLA-A, HLA-B, and HLA-C in humans) are expressed on all nucleated cells and present antigens to cytotoxic T cells (CD8+ T cells or CTLs). ) is activated. MHC class II molecules (e.g., human HLA-DP, HLA-DQ, and HLA-DR) are expressed only on certain cell types (e.g., B cells, dendritic cells, and macrophages) and are capable of presenting antigens. , activates helper T cells (CD4+ T cells or Th cells), so that helper T cells provide signals to B cells to produce antibodies.

[0005] For example, slight differences in MHC alleles between individuals can activate T cells in recipients. During T cell development, an individual's T cell repertoire becomes tolerant to its own MHC molecules, but T cells that recognize another individual's MHC molecules can persist in the circulation; are called alloreactive T cells. Alloreactive T cells can be activated, for example, by the presence in the body of another individual's cells expressing MHC molecules, causing, for example, graft-versus-host disease and graft rejection.

[0006] For example, there is interest in methods and compositions for reducing the susceptibility of allogeneic cells to rejection, including methods and compositions for reducing cellular expression of MHC proteins to circumvent recipient T cell responses. has been received. In practice, the ability to perform genetic modification of allogeneic cells in order to perform transplantation into a target allows for the ability to edit multiple genes and all This has been hampered by the need to reduce the expression of MHC proteins. For example, strategies to deplete MHC class I proteins can reduce CTL activation, while cells lacking MHC class I on their surface are less susceptible to lysis by natural killer (NK) cells of the immune system. Easy to accept. This is because NK cell activation is regulated by MHC class I-specific inhibitory receptors. Gene editing strategies that deplete MHC class II molecules have also proven difficult, especially in certain cell types, for reasons including low editing efficiency and low cell viability, hindering their practical use as cell therapies. It is being

[0007] Therefore, in order to overcome the problem of recipient immune rejection and the technical problems associated with the multiple genetic modifications required to create safer cells for transplantation, methods and techniques for modifying allogeneic cells and A need exists for improved compositions.

[0008] The present disclosure provides engineered cells in which surface expression of MHC class II is reduced or eliminated. The engineered cells contain genetic modifications in the CIITA gene (class II major histocompatibility complex transactivator), and the cells may be useful in cell therapy. The present disclosure further applies compositions and methods for reducing or eliminating surface expression of MHC class II proteins in cells by genetically modifying the CIITA gene. CIITA protein functions as a transcriptional activator (a factor that activates MHC class II promoters) and is essential for the expression of MHC class II proteins. In some embodiments, the present disclosure further provides compositions and methods for reducing or eliminating surface expression of MHC class I proteins in cells by genetically modifying B2M (β-2-microglobulin). . B2M proteins form heterodimers with MHC class I molecules and are required for the expression of MHC class I proteins at the cell surface. The present disclosure further provides for the expression of NK cell inhibitor molecules by cells that reduce or eliminate the lytic activity of NK cells. In some embodiments, the methods and compositions further include exogenous nucleic acids, such as those encoding targeting receptors, other polypeptides expressed on the surface of a cell, or polypeptides secreted from the cell. Insert the nucleic acid. That is, in some embodiments, the engineered cells are useful as "cell factories" in the recipient that secrete foreign proteins. In some embodiments, the engineered cells are useful as adoptive cell therapy.

[0009] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , containing at least one splice site nucleotide within genomic coordinates chr16:10902171-10923242. In some embodiments, the genetic modification comprises modification of at least one nucleotide of a splice acceptor site. In some embodiments, that one nucleotide is A. In some embodiments, that one nucleotide is G. In some embodiments, the genetic modification comprises modification of at least one nucleotide of the splice donor site. In some embodiments, that one nucleotide is G. In some embodiments, that one nucleotide is T. In some embodiments, the genetic modification comprises modification of splice site boundary nucleotides.

[0010] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , chr16:10895410-10895430, chr16:10898649-10898669, chr16:10898658-10898678, chr16:10902171-10902191, chr16:10902173-10902193, chr16:10 902174-10902194, chr16:10902179-10902199, chr16:10902183-10902203, chr16 :10902184-10902204, chr16:10902644-10902664, chr16:10902779-10902799, chr16:10902788-10902808, chr16:10902789-10902809, chr16:10902790 -10902810, chr16:10902795-10902815, chr16:10902799-10902819, chr16:10903708 -10903728, chr16:10903713-10903733, chr16:10903718-10903738, chr16:10903721-10903741, chr16:10903723-10903743, chr16:10903724-10903744 , chr16:10903873-10903893, chr16:10903878-10903898, chr16:10903905-10903925 , chr16:10903906-10903926, chr16:10904736-10904756, chr16:10904790-10904810, chr16:10904811-10904831, chr16:10906481-10906501, chr16:10 906485-10906505, chr16:10906486-10906506, chr16:10906487-10906507, chr16 :10906492-10906512, chr16:10908127-10908147, chr16:10908130-10908150, chr16:10908131-10908151, chr16:10908132-10908152, chr16:10908137 -10908157, chr16:10908138-10908158, chr16:10908139-10908159, chr16:10909006 -10909026, chr16:10909007-10909027, chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022-10909042, chr16:10909172-10909192 , chr16:10910165-10910185, chr16:10910176-10910196, chr16:10910186-10910206 , chr16:10915547-10915567, chr16:10915551-10915571, chr16:10915552-10915572, chr16:10915567-10915587, chr16:10916348-10916368, chr16:10 916359-10916379, chr16:10916362-10916382, chr16:10916449-10916469, chr16 :10916450-10916470, chr16:10916455-10916475, chr16:10916456-10916476, chr16:10918423-10918443, chr16:10918504-10918524, chr16:10918511 -10918531, chr16:10918512-10918532, chr16:10918539-10918559, chr16:10922153 -10922173, chr16:10922478-10922498, chr16:10922487-10922507, chr16:10922499-10922519, chr16:10923205-10923225, chr16:10923214-10923234 , chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923220-10923240 , chr16:10923221-10923241 and chr16:10923222-10923242, including indels, C to T substitutions, or A to G substitutions. In some embodiments, the genetic modification is chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-109090 42, chr16:10918512-10918532, chr16: 10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492 -10906512, chr16:10909006-10909026, chr16:10922478-10922498, chr16:10895747- 10895767, chr16:10916348-10916368, chr16:10910186-10910206, chr16:10906481-10906501, chr16:10909007-10909027, chr16:10895410-10895430 and at least one of the splice sites within the genomic coordinates selected from chr16:10908130-10908150 Contains one nucleotide. In some embodiments, the genetic modification is chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-109065 05, chr16:10916359-10916379, chr16: 10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, chr16:10916450-10916470, chr16:10923222-10923242, chr16:10916449 splice sites within the genomic coordinates selected from -10916469 and chr16:10923214-10923234, Contains at least one nucleotide. In some embodiments, the genetic modification is chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-109065 05, chr16:10916359-10916379, chr16: 10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, and chr16:10916450-10916470.

[0011] In some embodiments, a) i) targeting a CIITA genomic target sequence comprising at least one nucleotide of a splice site, or ii) directing an RNA-guided DNA binding agent away from a splice site boundary nucleotide; Provided are compositions comprising a CIITA guide RNA comprising a guide sequence that causes cleavage of a CIITA genomic target sequence that is 5 or fewer nucleotides, the CIITA guide RNA comprising at least 10 contiguous CIITA genomic target sequences within the genomic coordinates chr16:10902171-10923242. Target CIITA genomic target sequences containing nucleotides that

[0012] In some embodiments, a) at least 17, 18, 19, or 20 contiguous sequences of a) i) a guide sequence selected from SEQ ID NOs: 1-101; ii) a sequence selected from SEQ ID NOs: 1-101; nucleotides; iii) a guide sequence that is at least 95%, 90% or 85% identical to a sequence selected from SEQ ID NOs: 1-101; iv) 10 contiguous nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 1. v) at least 17, 18, 19 or 20 contiguous nucleotides of the sequence of (iv), or vi) at least 95%, 90% or 85% of the sequence selected from (v); Compositions are provided that include CIITA guide RNAs (gRNAs) that include guide sequences that are identical.

[0013] In some embodiments, a) at least 17, 18, 19, or 20 contiguous sequences of a) i) a guide sequence selected from SEQ ID NOs: 1-101; ii) a sequence selected from SEQ ID NOs: 1-101; nucleotides; iii) a guide sequence that is at least 95%, 90% or 85% identical to a sequence selected from SEQ ID NOs: 1-101; iv) 10 contiguous nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 1. v) at least 17, 18, 19 or 20 contiguous nucleotides of the sequence of (iv), or vi) at least 95%, 90% or 85% of the sequence selected from (v); Compositions are provided that include a CIITA guide RNA that is a single guide RNA (sgRNA) that includes guide sequences that are identical.

[0014] In some embodiments, a method of producing engineered cells in which surface expression of MHC class II proteins is reduced or eliminated relative to unmodified cells, the method comprising: A method is provided comprising contacting a composition of any of the forms. In some embodiments, the composition comprises SEQ ID NO: 47, SEQ ID NO: 55, SEQ ID NO: 71, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 100 and SEQ ID NO: 101. In some embodiments, the composition comprises SEQ ID NO:47, SEQ ID NO:55, SEQ ID NO:71, SEQ ID NO:80, SEQ ID NO:83, SEQ ID NO:87, SEQ ID NO:91, SEQ ID NO:97, SEQ ID NO:98, and SEQ ID NO: Contains a CIITA guide RNA containing nucleotides selected from 100.

[0015] In some embodiments, a method of reducing surface expression of MHC class II proteins in an engineered cell compared to an unmodified cell, the method comprising: a composition of the invention. [Brief explanation of the drawing]

[0016] [Figure 1A] Shows the results of a screen in T cells comparing editing of CIITA guide RNA (for Cas9 clivase (Cas9)). [Figure 1B] Shows the results of a screen in T cells comparing editing of CIITA guide RNA (for deaminase (BC22)). [Figure 1C] In the case of Cas9, it is the average percentage (%) of T cells that were negative for MHC class II expression on the cell surface by flow cytometry (“MHCII negative rate (%)”). [Figure 1D] In the case of BC22, it is the average percentage (%) of T cells that were negative for MHC class II expression on the cell surface by flow cytometry (“MHCII negative rate (%)”).

Figure 2

[0017] The present disclosure describes engineered cells that are useful, e.g., in adoptive cell transfer (ACT) therapy, and methods of genetically modifying cells to produce engineered cells and engineered cell populations that are useful, e.g., in adoptive cell transfer (ACT) therapy. and a composition. The present disclosure provided herein provides certain advantages over conventional methods by providing methods and compositions for genetically modifying CIITA to reduce the expression of MHC class II proteins on the surface of cells. Eliminate hurdles. In some embodiments, the present disclosure provides engineered cells in which surface expression of MHC class II is reduced or eliminated as a result of genetic modification in the CIITA gene. In some embodiments, the present disclosure provides compositions and methods for reducing or eliminating expression of MHC class II proteins, and further for reducing the susceptibility of cells to immune rejection. For example, in some embodiments, the methods and compositions reduce or eliminate surface expression of MHC class II proteins, reduce or eliminate surface expression of MHC class I proteins, by genetically modifying CIITA. and / or introducing exogenous nucleic acids encoding NK cell inhibitor molecules, targeting receptors, or other polypeptides (polypeptides expressed on the cell surface or secreted) into cells by genetic modification. Including inserting. Engineered cell compositions produced by the methods disclosed herein exhibit, for example, reduced expression of MHC molecules, decreased immunogenicity in vitro and in vivo, increased survival rates, and increased It has desirable characteristics, including increased genetic compatibility with the transplant recipient.

[0018] The term "about" or "approximately" means a tolerance of a particular value as determined by one of ordinary skill in the art, which tolerance depends, in part, on the manner in which the value was measured or determined, or on the matter being described. The degree of variation does not substantially affect the properties of the material or is within tolerances in the art, for example, 10%, 5%, 2% or 1%. Accordingly, unless stated to the contrary, the numerical parameters set forth in the following specification and appended claims are approximations that may vary depending on the desired properties sought to be obtained. Each numerical parameter shall be determined, at a minimum, and without any attempt to limit the application of the doctrine of equivalents to the claims, taking into account the number of significant figures reported and using ordinary rounding techniques. By applying it, we must at least interpret it.

[0019] I. Definition Unless otherwise stated, the following terms and phrases, when used herein, are intended to have the following meanings.

[0020] The term "or combinations thereof" as used herein refers to all permutations and combinations of the terms listed before the term. For example, "A, B, C or a combination thereof" is intended to include at least one of A, B, C, AB, AC, BC or ABC and, in certain contexts, in the order is also intended to include BA, CA, CB, ACB, CBA, BCA, BAC or CAB, where that is important. Continuing with this example, combinations containing one or more repeated items or terms (BB, AAA, AAB, BBC, CBBA, CABA, etc.) are also explicitly included. Those skilled in the art will understand that there is typically no limit to the number of items or terms that can be combined in any one, unless the context clearly dictates otherwise.

[0021] As used herein, the term "kit" refers to the combination of associated components (one or more polynucleotides or compositions) and one or more associated materials (delivery devices (e.g., syringes), solvents, solutions, etc.). , buffer solution, instructions, desiccant, etc.) is a packaged set.

[0022] "Allogeneic" cells, as used herein, refer to cells obtained from a donor subject of the same species as the recipient subject, where the donor subject and the recipient subject exhibit genetic differences; For example, the genes at one or more loci are not identical. That is, for example, a cell is allogeneic to the subject to whom it is administered. As used herein, cells that are removed or isolated from a donor and are not reintroduced into the original donor are considered allogeneic cells.

[0023] "Autologous" cells, as used herein, refer to cells taken from the same subject whose cellular material will later be reintroduced. That is, for example, a cell is considered autologous if it is removed from a subject and later reintroduced into the same subject.

[0024] "β2M" or "B2M" as used herein refers to the nucleic acid or protein sequence of "β-2 microglobulin," the human gene for which the human gene has accession number NC_000015 (range 44711492.. 44718877) (Reference GRCh38.p13). B2M proteins associate as heterodimers with MHC class I molecules on the surface of nucleated cells and are required for MHC class I protein expression.

[0025] "CIITA" or "C2TA" as used herein refers to the nucleic acid or protein sequence of "Class II major histocompatibility complex transactivator", the human gene for which has accession number NC_000016 .10 (range 10866208..10941562) (Reference GRCh38.p13). CIITA proteins in the nucleus act as positive regulators of MHC class II gene transcription and are required for MHC class II protein expression.

[0026] As used herein, "MHC," "MHC molecule(s)," "MHC protein," or "MHC complex(s)" refers to major histocompatibility complex molecule(s). Examples include MHC class I molecules and MHC class II molecules. In humans, MHC molecules are referred to as "human leukocyte antigen" complexes, "HLA molecules" or "HLA proteins." The use of the terms "MHC" and "HLA" is not intended to be limiting, and as used herein, the term "MHC" is used to refer to human MHC molecules, i.e., HLA It can also refer to molecules. Accordingly, the terms "MHC" and "HLA" are used interchangeably herein.

[0027] The term "HLA-A", as used herein, in the context of HLA-A proteins, refers to MHC class I protein molecules, which include heavy chains (encoded by the HLA-A gene) and It is a heterodimer consisting of light chains (ie β-2 microglobulin). The term "HLA-A" or "HLA-A gene" as used herein, in the context of nucleic acids, refers to the gene encoding the heavy chain of the HLA-A protein molecule. The HLA-A gene is also referred to as "HLA class I histocompatibility, A alpha chain," and the human gene has the accession number NC_000006.12 (29942532..29945870). The HLA-A gene is known to exist in thousands of different forms (also called "alleles") across the population (individuals can receive two different alleles of the HLA-A gene) . A public database on HLA-A alleles, including sequence information, is available at IPD-IMGT / HLA: https: / / www.ebi.ac.uk / ipd / imgt / hla / . All alleles of HLA-A are included in the terms "HLA-A" and "HLA-A gene."

[0028] "HLA-B" as used herein, in the context of nucleic acids, refers to the gene encoding the heavy chain of the HLA-B protein molecule. HLA-B is also referred to as "HLA class I histocompatibility, B alpha chain," and its human gene has the accession number NC_000006.12 (31353875..31357179).

[0029] "HLA-C" as used herein, in the context of nucleic acids, refers to the gene encoding the heavy chain of the HLA-C protein molecule. HLA-C is also referred to as "HLA class I histocompatibility, C alpha chain," and its human gene has the accession number NC_000006.12 (31268749..31272092).

[0030] As used herein, the term "within genomic coordinates" includes the boundaries of a given genomic coordinate range. For example, when chr6:29942854-chr6:29942913 is shown, the coordinates chr6:29942854-chr6:29942913 are included. Throughout this application, genomic coordinates referred to are based on the genome annotation in the Genome Reference Consortium's GRCh38 (also referred to as hg38) assembly of the human genome, which is available on the National Center for Biotechnology Information website. . Tools and methods for converting genomic coordinates between one assembly and another assembly are known in the art and can be used to convert genomic coordinates between assemblies made by the same institution or using the same algorithms. Conversions to earlier assemblies (e.g., conversion of GRCh38 to GRCh37) and conversions of assemblies made by different institutions or algorithms (e.g., conversion of GRCh38 to NCBI33, made by the International Human Genome Sequencing Consortium) The genomic coordinates presented herein can be converted to corresponding coordinates in another assembly of the human genome, including. Available methods and tools known in the art include the NCBI Genome Remapping Service (available at the National Center for Biotechnology Information website), UCSC LiftOver (available at the UCSC Genome Brower website), and Examples include, but are not limited to, Assembly Converter (available at the Ensembl.org website).

[0031] As used herein, the term "homozygous" refers to having two identical alleles of a particular gene.

[0032] "Splice site", as used herein, refers to the three nucleotides that make up the acceptor or donor splice site (as defined below), or any other known in the art. refers to other nucleotides that are part of the splice site. See, eg, Burset et al., Nucleic Acids Research 28(21):4364-4375 (2000) (describing canonical and non-canonical splice sites in mammalian genomes). The three nucleotides that make up the "acceptor splice site" are the two conserved residues 3' of the intron (e.g., AG in humans) and the border nucleotide (i.e., the first of the exon 3' of the nucleotide). The "splice site boundary nucleotides" of the acceptor splice site are designated as "Y" in the diagram below and are also referred to herein as "acceptor splice site boundary nucleotides" or "splice acceptor site boundary nucleotides." Sometimes. The terms "acceptor splice site," "splice acceptor site," "acceptor splice sequence," or "splice acceptor sequence" may be used interchangeably herein.

[0033] The three nucleotides that make up the "donor splice site" are the two conserved residues at the 5' end of the intron (e.g. GT (gene) or GU (for RNA such as pre-mRNA) in humans) and , is the border nucleotide (i.e., the first nucleotide of the exon 5' of the GT). The "splice site boundary nucleotides" of the donor splice site are represented by an "X" in the figures below, and may also be referred to herein as "donor splice site boundary nucleotides" or "splice donor site boundary nucleotides." The terms "donor splice site," "splice donor site," "donor splice sequence," or "splice donor sequence" may be used interchangeably herein. [ka]

[0034] As used herein, "splice site region" includes the nucleotides at the splice site and the nucleotides adjacent to the splice site.

[0035] As used herein, the term "subject" is intended to include any organism capable of eliciting an immune response, including, for example, mammals, primates, and humans.

[0036] "Polynucleotide" and "nucleic acid" are used herein to refer to nitrogen-containing heterocyclic bases or bases attached along the backbone, including conventional RNA, DNA, RNA-DNA mixtures, and polymers that are analogs thereof. Used to refer to nucleosides with base analogs or multimeric compounds containing nucleoside analogs. The "backbone" of a nucleic acid can include a sugar-phosphodiester linkage, a peptide-nucleic acid linkage ("peptide nucleic acid" or PNA; WO 95 / 32305), a phosphorothioate linkage, a methylphosphonate linkage, or a combination thereof. Can be composed of various combinations, including one or more. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or similar compounds with substituents, such as 2'methoxy or 2'halide substituents. Nitrogen-containing bases include conventional bases (A, G, C, T, U), their analogs (e.g. modified uridines such as 5-methoxyuridine, pseudouridine or N1-methylpseudouridine), inosine, purine. or derivatives of pyrimidine (e.g. N 4 -Methyldeoxyguanosine, deazapurine or azapurine, deazapyrimidine or azapyrimidine, pyrimidine base with a substituent in the 5th or 6th position (e.g. 5-methylcytosine), purine with a substituent in the 2nd, 6th or 8th position Base, 2-amino-6-methylaminopurine, O 6 -Methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4 -alkyl-pyrimidine (US Pat. No. 5,378,825 and International Publication No. WO 93 / 13121). For a general discussion, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11 th ed., 1992). Nucleic acids can have one or more "abasic" residues in which the backbone does not contain a nitrogenous base at the polymeric position(s) (US Pat. No. 5,585,481). Nucleic acids can include only conventional RNA or DNA sugars, bases, and linkages, or both conventional components and substituents (e.g., conventional bases with 2' methoxy linkages, or conventional bases and , one or more base analogs). Nucleic acids include "locked nucleic acids" (LNAs), i.e. LNA nucleotide monomers that have bicyclic furanose units locked in RNA, mimicking the conformation of sugars. (which has enhanced hybridization affinity for complementary RNA and DNA sequences) (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). RNA and DNA have different sugar moieties, which can differ by the presence of uracil or its analog in RNA and the presence of thymine or its analog in DNA.

[0037] "Guide RNA," "gRNA," and simply "guide" are used synonymously herein to refer to, for example, a guide that directs an RNA-guided DNA binding agent to a target DNA, and a single guide It can be RNA, or a combination of crRNA and trRNA (also known as tracrRNA). Exemplary gRNAs include modified or unmodified forms of class II Cas nuclease guide RNA. crRNA and trRNA may be associated as one RNA molecule (single guide RNA, sgRNA) or in two separate RNA strands (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to each type. The trRNA may be a natural sequence or a trRNA sequence with modifications or diversity compared to the natural sequence.

[0038] As used herein, "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and that allows the guide RNA to be bound or modified (e.g. cleavage). A "guide sequence" is sometimes referred to as a "targeting sequence" or a "spacer sequence." The guide sequence can be, for example, 20 base pairs long in the case of Streptococcus pyogenes (ie, Spy Cas9 (SpCas9)) and related Cas9 homologs / orthologs. shorter or longer sequences, such as sequences 15 nucleotides long, 16 nucleotides long, 17 nucleotides long, 18 nucleotides long, 19 nucleotides long, 21 nucleotides long, 22 nucleotides long, 23 nucleotides long, 24 nucleotides long or 25 nucleotides long can also be used as a guide. In some embodiments, the target sequence is within a gene or on a chromosome, eg, complementary to a guide sequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence is about 75%, about 80%, about 85%, about 90%, about 95%, about 96% , about 97%, about 98%, about 99% or 100%. In some embodiments, the guide sequence and target region may be 100% complementary or identical. In another embodiment, the guide sequence and target region may contain at least one mismatch. For example, the guide sequence and target sequence may contain 1, 2, 3, or 4 mismatches, and the total length of the target sequence is at least 17 base pairs, 18 base pairs, 19 base pairs, or 20 base pairs or more. It is. In some embodiments, the guide sequence and target region may include 1-4 mismatches, and the guide sequence includes at least 17, 18, 19, or 20 or more nucleotides. In some embodiments, the guide sequence and target region may contain 1, 2, 3 or 4 mismatches, and the guide sequence contains 20 nucleotides.

[0039] Target sequences for RNA-guided DNA binding agents include both the positive and negative strands of genomic DNA (ie, the given sequence and the reverse complement of that sequence). This is because the nucleic acid substrate of the RNA-induced DNA binding agent is a double-stranded nucleic acid. Thus, when a guide sequence is said to be "complementary to a target sequence," it is understood that the guide sequence is capable of directing the guide RNA to bind to the reverse complement of the target sequence. That is, in some embodiments, when a guide sequence binds to the reverse complement of a target sequence, the guide sequence, except for the T to U substitution in the guide sequence, nucleotides (e.g., a target sequence that does not contain PAM).

[0040] As used herein, "RNA-guided DNA binding agent" refers to a polypeptide or polypeptide complex that has RNA-binding activity and DNA-binding activity, or a DNA-binding subunit of such a complex. , its DNA-binding activity is sequence-specific and determined by its RNA sequence. Exemplary RNA-guided DNA binders include Cas clivases / Cas nickases and inactivated forms thereof (“dCas DNA binders”). As used herein, "Cas nuclease" (also referred to as "Cas protein") includes Cas clivase, Cas nickase, and dCas DNA binding agent. Cas clivase / Cas nickase and dCas DNA binding agents include the Csm complex or Cmr complex of type III CRISPR systems, their Cas10 subunit, Csm1 subunit or Cmr2 subunit, the Cascade complex of type I CRISPR systems, their These include the Cas3 subunit, and class 2 Cas nucleases. As used herein, a "class 2 Cas nuclease" is a single-stranded polypeptide with RNA-guided DNA binding activity. Class 2 Cas nucleases include class 2 Cas cleivases / Cas nickases (e.g., H840A variant, D10A variant, or N863A variant) that additionally have RNA-guided DNA cleivase activity or DNA nickase activity, and cleivase activity / nickase activity. Class 2 dCas DNA binders, in which dCas DNA binding agents are inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A variant, R661A variant, Q695A variant, Q926A variant), HypaCas9 (e.g., N692A variant, M694A variant, Q695A variant). , H698A variant), eSPCas9(1.0) (e.g., K810A variant, K1003A variant, R1060A variant), and eSPCas9(1.1) (e.g., K848A variant, K1003A variant, R1060A variant), and modified forms thereof . The Cpf1 protein (Zetsche et al., Cell, 163:1-13 (2015)) is homologous to Cas9 and contains a RuvC-like nuclease domain. The Cpf1 sequence of the Zetsche reference is incorporated by reference in its entirety. See, for example, Tables S1 and S3 of the Zetsche literature. See, for example, Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015), Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0041] As used herein, the term "editor" refers to an agent that includes a polypeptide that can make modifications within a DNA sequence. In some embodiments, the editor is a clivase, such as Cas9 clivase. In some embodiments, the editor can deaminate bases within the DNA molecule. In some embodiments, the editor can deaminate cytosine (C) in the DNA. In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to cytidine deaminase. In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to the deaminase APOBEC3A (A3A). In some embodiments, the editor comprises a Cas9 nickase fused to the deaminase APOBEC3A (A3A). In some embodiments, the editor is a fusion protein comprising a cytidine deaminase and an RNA-guided nickase fused to UGI. In some embodiments, the editor is UGI-deficient.

[0042] As used herein, "cytidine deaminase" refers to a cytidine deaminase activity capable of catalyzing the hydrolytic deamination of cytidine or deoxycytidine, typically resulting in uridine or deoxyuridine. Refers to a polypeptide or polypeptide complex. Cytidine deaminase includes enzymes of the cytidine deaminase superfamily, in particular enzymes of the APOBEC family (subgroup enzymes APOBEC1, APOBEC2, APOBEC4 and APOBEC3), activation-induced cytidine deaminase (AID or AICDA), and CMP deaminase (e.g. , Conticello et al.,Mol.Biol.Evol.22:367-77,2005, Conticello,Genome Biol.9:229,2008, Muramatsu et al.,J.Biol.Chem.274:18470-6,1999) , Carrington et al., Cells 9:1690 (2020)).

[0043] As used herein, the term "APOBEC3" refers to an APOBEC3 protein, such as an APOBEC3 protein expressed by any of the seven genes (A3A-A3H) of the human APOBEC3 locus. APOBEC3 may have DNA or RNA editing catalytic activity. The amino acid sequence of APOBEC3A has been described (UniPROT Accession ID: p31941) and is included herein as SEQ ID NO: 40. In some embodiments, the APOBEC3 protein is human APOBEC3 protein and / or wild type protein. Variants include proteins that have a sequence that differs from the wild-type APOBEC3 protein by one or more mutations (ie, substitutions, deletions, insertions), such as one or more single-point substitutions. For example, a truncated APOBEC3 sequence could be used, for example by deleting several N-terminal or C-terminal amino acids, preferably the C-terminal 1 to 4 amino acids of the APOBEC3 sequence. As used herein, the term "variant" refers to allelic variants, splicing variants, and natural or artificial variants that are homologous to the APOBEC3 reference sequence. A variant is "functional" in that it exhibits DNA editing or RNA editing catalytic activity. In some embodiments, the APOBEC3 (such as human APOBEC3A) has wild-type amino acid position 57 (as numbered by wild-type sequence). In some embodiments, the APOBEC3 (such as human APOBEC3A) has an asparagine at amino acid position 57 (as numbered according to the wild-type sequence).

[0044] As used herein, "nickase" is an enzyme that makes single-strand breaks (also known as "nicks") in double-stranded DNA, i.e., one strand of a DNA double helix is ​​cut However, the other strand is an enzyme that does not cut it. As used herein, an "RNA-guided DNA nickase" is a polypeptide or polypeptide complex that has DNA nickase activity, the DNA nickase activity is sequence-specific, and the DNA nickase activity is sequence-specific. refers to a polypeptide or polypeptide complex determined by Exemplary RNA-guided DNA nickases include Cas nickases. Cas nickases include the Csm or Cmr complex of type III CRISPR systems, their Cas10, Csm1 or Cmr2 subunits, the Cascade complex of type I CRISPR systems, their Cas3 subunit, and the Examples include nickase forms of Cas nucleases. Class 2 Cas nickases include variants in which only one of the two catalytic domains is inactivated, and those variants have RNA-guided DNA nickase activity. Class 2 Cas nickases include, for example, Cas9 (e.g. H840A variant, D10A variant or N863A variant of SpyCas9), Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g. N497A variant, R661A variant, Q695A variant, Q926A variant). ), HypaCas9 (e.g., N692A variant, M694A variant, Q695A variant, H698A variant), eSPCas9(1.0) (e.g., K810A variant, K1003A variant, R1060A variant), and eSPCas9(1.1) (e.g., K848A variant, K1003A variant, R1060A variant) and modified versions thereof. The Cpf1 protein (Zetsche et al., Cell, 163:1-13 (2015)) is homologous to Cas9 and contains a RuvC-like protein domain. The Cpf1 sequence of the Zetsche reference is incorporated by reference in its entirety. See, for example, Tables S1 and S3 of the Zetsche literature. "Cas9" includes S. pyogenes (Spy) Cas9, the Cas9 variants listed herein, and equivalents thereof. See, for example, Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015), Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0045] As used herein, the term "fusion protein" refers to a hybrid polypeptide that includes protein domains from at least two different proteins. One protein may be located at the amino-terminal (N-terminal) or carboxy-terminal (C-terminal) portion of the fusion protein, thus forming an "amino-terminal fusion protein" or a "carboxy-terminal fusion protein," respectively. Any of the proteins shown herein can be made by any method known in the art. For example, the proteins provided herein can be made by recombinant protein expression and purification, a method particularly suitable for fusion proteins containing peptide linkers. Methods for expressing and purifying recombinant proteins are well known, including those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)). and the entire contents of this document are incorporated herein by reference.

[0046] The term "linker" as used herein refers to a chemical group or molecule that connects two adjacent molecules or moieties. Typically, a linker is located between or sandwiched between two groups, molecules or other moieties and is linked to each other by a covalent bond. In some embodiments, the linker is an amino acid or multiple amino acids (e.g., a peptide or protein), such as the 16 amino acid residue "XTEN" linker or variants thereof (see, e.g., Examples and Schellenberger et al. al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 900), SGSETPGTSESA (SEQ ID NO: 901), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 902). In some embodiments, the linker is a peptide linker comprising one or more sequences selected from SEQ ID NOs: 903-971.

[0047] As used herein, the term "uracil glycosylase inhibitor" or "UGI" refers to a protein that can inhibit the base excision repair enzyme uracil DNA glycosylase (UDG).

[0048] As used herein, the "open reading frame" or "ORF" of a gene refers to a sequence consisting of a series of codons that specifies the amino acid sequence of the protein encoded by that gene. An ORF begins with a start codon (eg, ATG for DNA, or AUG for RNA) and ends with a stop codon, eg, TAA, TAG, or TGA for DNA, or UAA, UAG, or UGA for RNA.

[0049] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to an RNA-guided enzyme such as a Cas nuclease, e.g., Cas clivase, Cas nickase or dCas DNA binder (e.g. Cas9). Refers to guide RNA together with a DNA binding agent. In some embodiments, the guide RNA directs an RNA-guided DNA binding agent, such as Cas9, to the target sequence, the guide RNA hybridizes to the target sequence, and the binding agent binds to the target sequence; If the binding agent is a clivase or nickase, binding can be followed by cleavage or nicking.

[0050] As used herein, a first sequence is defined as "an alignment of the first sequence and a second sequence indicates that X% or more of the total positions of the second sequence match the first sequence. sequence that has at least X% identity with a second sequence if For example, the sequence AAGA includes a sequence that is 100% identical to the sequence AAG. This is because the alignment yields 100% identity in that it matches all three positions of the second sequence. The difference between RNA and DNA (generally containing uridine in place of thymidine, or thymidine in place of uridine), and the presence of nucleoside analogs such as modified uridine, is due to the related nucleotides (thymidine, uridine or modified uridine) have the same complement (e.g. adenosine in thymidine, uridine or modified uridine). Another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as their complement. does not contribute to differences in identity or complementarity between polynucleotides. Thus, for example, the sequence 5'-AXG, where X is any modified uridine such as pseudouridine, N1-methylpseudouridine or 5-methoxyuridine, is considered 100% identical to AUG. This is because both are completely complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will understand what algorithm settings and parameter settings choices are appropriate for a given pair of sequences to be aligned. The Needleman-Wunsch algorithm interface is the default setting for sequences that are approximately similar in length and are predicted to have greater than 50% amino acid identity or greater than 75% nucleotide identity. One Needleman-Wunsch algorithm (supplied by EBI on the web server at www.ebi.ac.uk) is generally adequate.

[0051] "mRNA" is used herein to refer to a polynucleotide and includes an open reading frame that can be translated into a polypeptide (ie, can serve as a substrate for translation by ribosomes and aminoacylated tRNAs). The mRNA can include a phosphate-sugar backbone that includes a ribose residue or an analog thereof, such as a 2'-methoxyribose residue. In some embodiments, the sugars of the phosphate-sugar backbone of the mRNA consist essentially of ribose residues, 2'-methoxyribose residues, or combinations thereof.

[0052] As used herein, an "indel" refers to an insertion / deletion consisting of a substantial number of nucleotides, e.g., either inserted or deleted at a double-strand break (DSB) site in a target nucleic acid. Refers to mutation.

[0053] As used herein, "reducing or eliminating" expression of a protein in a cell refers to a partial or complete lack of expression of that protein compared to unmodified cells. In some embodiments, surface expression of a protein on a cell is measured by flow cytometry and is demonstrated by a decrease in fluorescent signal when stained with the same antibody directed against the protein. , "reduced or eliminated" compared to unmodified cells. Cells with “reduced or eliminated” surface expression of a protein compared to unmodified cells are classified as such if evidenced by flow cytometry by a fluorescent signal comparable to that of cells stained with an isotype control antibody. It may be "negative" for protein expression. "Reduction or elimination" of protein expression can be measured by other techniques known in the art, along with appropriate controls known to those of skill in the art.

[0054] As used herein, "knockdown" refers to reducing the expression of a particular gene product (e.g., protein, mRNA, or both) compared to, e.g., the expression of an unedited target sequence. refers to Knockdown of a protein can be measured by detecting the total amount of that protein in cells taken from a sample, such as a tissue, fluid, or cell population of interest. Knockdown of a protein can also be determined by measuring a surrogate, marker or activity of that protein. Methods for measuring mRNA knockdown are known, and include analyzing mRNA isolated from the relevant sample. In some embodiments, "knockdown" refers to some loss of expression of a particular gene product, e.g., a reduction in the amount of mRNA transcription by a cell or cell population (including in vivo populations such as those found in tissues). It can also refer to a decrease or a decrease in protein expression.

[0055] As used herein, "knockout" refers to the lack of expression from a particular gene or expression of a particular protein in a cell. Knockout allows expression to be reduced below the detection level of the assay. Knockout can be measured in a cell, tissue, or population of cells either by detecting the total amount of protein in the cell.

[0056] As used herein, "target sequence" or "genomic target sequence" refers to the sequence of the nucleic acid of a target gene that has complementarity with the guide sequence of the gRNA. The interaction between the target sequence and the guide sequence causes the RNA-guided DNA binding agent to bind to and potentially nick within the target sequence (depending on the activity of the binding agent). , or induced to cut.

[0057] As used herein, "treatment" refers to the administration or application of a therapeutic agent for a disease or disorder in a subject, including inhibiting the disease, preventing the onset of the disease, or treating the disease. including alleviating one or more of the symptoms of the disease, curing the disease, or preventing one or more of the symptoms of the disease (including recurrence of the symptoms).

[0058] Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. Although the invention has been described in conjunction with illustrated embodiments, it will be understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included in the invention as defined by the appended claims and included embodiments. good.

[0059] Before describing the teachings of the present invention in detail, it is to be understood that this disclosure is not limited to certain compositions or process steps, as these may vary. As used in this specification and the appended claims, the singular forms "a," "an," and "the" refer to plural references unless the context clearly dictates otherwise. Please note that things are included. Thus, for example, reference to a "conjugate" includes a plurality of conjugates, reference to a "cell" includes a plurality of cells, and so on.

[0060] A numeric range includes the numbers that define the range. Measured values ​​and measurable values ​​are to be understood as approximations taking into account significant figures and errors associated with measurements. Also, "comprise", "comprises", "comprising", "contain", "contains", "containing", "include" , "includes" and "including" are not intended to be limiting. It is to be understood that both the general and detailed descriptions above are exemplary and illustrative only and not limiting on the teachings of the invention.

[0061] Unless specifically indicated herein, embodiments herein that are referred to as ``comprising'' various components do not refer to ``consisting'' of the indicated components. , or ``consisting essentially of'' those components, and embodiments herein that are said to ``consist of'' various constituents refer to those constituents as indicated. are also contemplated as ``comprising'' or ``consisting essentially of'' various components, and embodiments herein that are described as ``consisting essentially of'' various constituents are , is also contemplated as ``consisting of'' or ``comprising'' its indicated constituents (this interchangeability does not apply where these terms are used in the claims). . The term "or" is used in an inclusive sense, ie, used interchangeably with "and / or", unless the context clearly indicates otherwise.

[0062] The section headings used herein are for organizational purposes only and should not be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference conflicts with any term defined herein or any other explicit content herein, the present specification will control. Although the teachings of the invention have been described in conjunction with various embodiments, they are not intended to be limited to those embodiments. On the contrary, the teachings of the present invention encompass various alternatives, modifications, and equivalents, as will be apparent to those skilled in the art.

[0063] II. Genetically modified cells A. Manipulated cell composition The present disclosure provides engineered cell compositions in which surface expression of MHC class II is reduced or eliminated compared to unmodified cells. In some embodiments, the engineered cell composition comprises a genetic modification to the CIITA gene. In some embodiments, the engineered cells are allogeneic cells. In some embodiments, engineered cells with reduced MHC class II expression are useful in adoptive cell transfer therapy. In some embodiments, the engineered cells include additional genetic modifications in their genomes to yield desirable cells for allogeneic transplantation purposes.

[0064] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: Contains at least one nucleotide of a splice site within genomic coordinates chr16:10877360-10923242. Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: Contains at least one nucleotide of a splice site within genomic coordinates chr16:10902171-10923242. In some embodiments, the genetic modification comprises modification of at least one nucleotide of a splice acceptor site. In some embodiments, the genetic modification comprises modification of at least one nucleotide of the splice acceptor site, where the one nucleotide is an adenine (A). In some embodiments, the genetic modification comprises modification of at least one nucleotide of the splice acceptor site, where the one nucleotide is guanine (G). In some embodiments, the genetic modification comprises modification of at least one nucleotide of the splice donor site. In some embodiments, the genetic modification comprises modification of at least one nucleotide of the splice donor site, one nucleotide being guanine (G). In some embodiments, the genetic modification comprises modification of at least one nucleotide of the splice donor site, one nucleotide being thymine (T). In some embodiments, the genetic modification comprises modification of splice site boundary nucleotides.

[0065] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: Contains at least 5 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the modification at the genomic coordinates chr16:10902171-10923242 at least 6, 7, 8, 9 or 10 contiguous nucleotides within.

[0066] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: Contains at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10902171-10923242.

[0067] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: Contains at least one nucleotide of a splice site within genomic coordinates chr16:10903873-chr:10923242.

[0068] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: Contains at least one nucleotide of a splice site within genomic coordinates chr:16:10906485-chr:10923242.

[0069] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: Contains at least one nucleotide of a splice site within genomic coordinates chr16:10908130-chr:10923242.

[0070] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification comprising: chr16:10908132-10908152; chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:1091 8511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16: 10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, chr16:10922478-10922498, chr16:10895747 -10895767, chr16:10916348-10916368, chr16:10910186-10910206, chr16:10906481- 10906501, chr16:10909007-10909027, chr16:10895410-10895430 and chr16:10908130-10908150 at a splice site within the genomic coordinates.

[0071] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated compared to unmodified cells include a genetic modification in the CIITA gene, the genetic modification being chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:1090 3873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, chr16: 10916450-10916470, chr16:10923222-10923242, chr16:10916449-10916469 and chr16:10923214-10923234 at a splice site. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated compared to unmodified cells include a genetic modification in the CIITA gene, the genetic modification being chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:1090 3873-10903893, chr16:10909172-10909192, chr16:10922153-10922173 and chr16: Contains at least one nucleotide of a splice site within genomic coordinates selected from 10916450-10916470.

[0072] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification comprising: chr16:10908132-10908152; chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:1091 8511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16: At least one splice site within the genomic coordinates selected from 10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026 and chr16:10922478-10922498. Contains one nucleotide.

[0073] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification comprising: chr16:10908132-10908152; Contains at least one nucleotide of a splice site within genomic coordinates selected from chr16:10908131-10908151, chr16:10916456-10916476 and chr16:10918504-10918524.

[0074] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10908132- Contains at least one nucleotide of the splice site within 10908152. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10908131- Contains at least one nucleotide of the splice site within 10908151. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10916456- Contains at least one nucleotide of the splice site within 10916476. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10918504- Contains at least one nucleotide of the splice site within 10918524.

[0075] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated compared to unmodified cells include a genetic modification in the CIITA gene, the genetic modification being chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:1090 3873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16: 10916362-10916382, chr16:10916450-10916470, chr16:10922153-10922173, chr16:10923222-10923242, chr16:10910176-10910196, chr16:10895742 -10895762, chr16:10916449-10916469, chr16:10923214-10923234, chr16:10906492- 10906512 and chr16:10906487-10906507. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10918504- 10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505 , chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, At least one nucleotide of a splice site within chr16:10916362-10916382, chr16:10916450-10916470 and chr16:10922153-10922173.

[0076] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated compared to unmodified cells include a genetic modification in the CIITA gene, the genetic modification being chr16:10918504-10918524, Contains at least one nucleotide of a splice site within genomic coordinates selected from chr16:10923218-10923238 and chr16:10923219-10923239.

[0077] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10918504- Contains at least one nucleotide of the splice site within 10918524. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10923218- Contains at least one nucleotide of the splice site within 10923238. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated compared to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10923219- Contains at least one nucleotide of the splice site within 10923239.

[0078] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification being chr16:10895410-10895430, chr16:10898649-10898669, chr16:10898658-10898678, chr16:10902171-10902191, chr16:10902173-10902193, chr16:10902174-10902194, chr16:1090 2179-10902199, chr16:10902183-10902203, chr16:10902184-10902204, chr16: 10902644-10902664, chr16:10902779-10902799, chr16:10902788-10902808, chr16:10902789-10902809, chr16:10902790-10902810, chr16:10902795 -10902815, chr16:10902799-10902819, chr16:10903708-10903728, chr16:10903713- 10903733, chr16:10903718-10903738, chr16:10903721-10903741, chr16:10903723-10903743, chr16:10903724-10903744, chr16:10903873-10903893 , chr16:10903878-10903898, chr16:10903905-10903925, chr16:10903906-10903926, chr16:10904736-10904756, chr16:10904790-10904810, chr16:10904811-10904831, chr16:10906481-10906501, chr16:10906485-10906505, chr16:1090 6486-10906506, chr16:10906487-10906507, chr16:10906492-10906512, chr16: 10908127-10908147, chr16:10908130-10908150, chr16:10908131-10908151, chr16:10908132-10908152, chr16:10908137-10908157, chr16:10908138 -10908158, chr16:10908139-10908159, chr16:10909006-10909026, chr16:10909007- 10909027, chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022-10909042, chr16:10909172-10909192, chr16:10910165-10910185 , chr16:10910176-10910196, chr16:10910186-10910206, chr16:10915547-10915567, chr16:10915551-10915571, chr16:10915552-10915572, chr16:10915567-10915587, chr16:10916348-10916368, chr16:10916359-10916379, chr16:1091 6362-10916382, chr16:10916449-10916469, chr16:10916450-10916470, chr16: 10916455-10916475, chr16:10916456-10916476, chr16:10918423-10918443, chr16:10918504-10918524, chr16:10918511-10918531, chr16:10918512 -10918532, chr16:10918539-10918559, chr16:10922153-10922173, chr16:10922478- 10922498, chr16:10922487-10922507, chr16:10922499-10922519, chr16:10923205-10923225, chr16:10923214-10923234, chr16:10923218-10923238 , chr16:10923219-10923239, chr16:10923220-10923240, chr16:10923221-10923241 and Contains indels, C to T substitutions or A to G substitutions within genomic coordinates selected from chr16:10923222-10923242. In some embodiments, the genetic modification comprises at least 5 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9 or 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within their genomic coordinates.

[0079] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification comprising: chr16:10908132-10908152; chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:1091 8511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16: 10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, chr16:10922478-10922498, chr16:10895747 -10895767, chr16:10916348-10916368, chr16:10910186-10910206, chr16:10906481- 10906501, chr16:10909007-10909027, chr16:10895410-10895430 and chr16:10908130-10908150, including indels, C to T substitutions or A to G substitutions. In some embodiments, the genetic modification comprises at least 5 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9 or 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within their genomic coordinates.

[0080] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification being chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:1090 3873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, chr16: 10916450-10916470, chr16:10923222-10923242, chr16:10916449-10916469 and chr16:10923214-10923234, including indels, C to T substitutions or A to G substitutions. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification being chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:1090 3873-10903893, chr16:10909172-10909192, chr16:10922153-10922173 and chr16: Contains indels, C to T substitutions or A to G substitutions within genomic coordinates selected from 10916450-10916470. In some embodiments, the genetic modification comprises at least 5 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9 or 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within their genomic coordinates.

[0081] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification comprising: chr16:10908132-10908152; chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:1091 8511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16: Indels in genomic coordinates selected from 10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026 and chr16:10922478-10922498, C to T or from A to G include. In some embodiments, the genetic modification comprises at least 5 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9 or 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within their genomic coordinates.

[0082] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification comprising: chr16:10908132-10908152; Contains indels, C to T substitutions or A to G substitutions within genomic coordinates selected from chr16:10908131-10908151, chr16:10916456-10916476 and chr16:10918504-10918524.

[0083] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10908132- Indels within 10908152, including C to T substitutions or A to G substitutions. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10908131- Indels within 10908151, including C to T substitutions or A to G substitutions. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10916456- Indels within 10916476, including C to T substitutions or A to G substitutions. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10918504- Indels within 10918524, including C to T substitutions or A to G substitutions. In some embodiments, the genetic modification comprises at least 5 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9 or 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within their genomic coordinates.

[0084] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification being chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:1090 3873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16: 10916362-10916382, chr16:10916450-10916470, chr16:10922153-10922173, chr16:10923222-10923242, chr16:10910176-10910196, chr16:10895742 -10895762, chr16:10916449-10916469, chr16:10923214-10923234, chr16:10906492- Contains indels, C to T substitutions or A to G substitutions within genomic coordinates selected from 10906512 and chr16:10906487-10906507. In some embodiments, the genetic modification comprises at least 5 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9 or 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within their genomic coordinates.

[0085] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated compared to unmodified cells include a genetic modification in the CIITA gene, the genetic modification being chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:1090 3873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16: 10916362-10916382, chr16:10916450-10916470 and chr16:10922153-10922173, including indels, C to T substitutions or A to G substitutions within the selected genomic coordinates. In some embodiments, the genetic modification comprises at least 5 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9 or 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within their genomic coordinates.

[0086] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated compared to unmodified cells include a genetic modification in the CIITA gene, the genetic modification being chr16:10918504-10918524, Contains indels, C to T substitutions or A to G substitutions within genomic coordinates selected from chr16:10923218-10923238 and chr16:10923219-10923239.

[0087] In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10918504- Indels within 10918524, including C to T substitutions or A to G substitutions. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10923218- Indels within 10923238, including C to T substitutions or A to G substitutions. In some embodiments, the engineered cells in which surface expression of MHC class II is reduced or eliminated compared to unmodified cells include a genetic modification in the CIITA gene, the genetic modification at the genomic coordinates chr16:10923219- Indels within 10923239, including C to T substitutions or A to G substitutions. In some embodiments, the genetic modification comprises at least 5 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9 or 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within their genomic coordinates.

[0088] In some embodiments, chr16:10895410-10895430, chr16:10898649-10898669, chr16:10898658-10898678, chr16:10902171-10902191, chr16:10902173-10902193, chr 16:10902174-10902194, chr16:10902179-10902199, chr16 :10902183-10902203, chr16:10902184-10902204, chr16:10902644-10902664, chr16:10902779-10902799, chr16:10902788-10902808, chr16:10902789 -10902809, chr16:10902790-10902810, chr16:10902795-10902815, chr16:10902799 -10902819, chr16:10903708-10903728, chr16:10903713-10903733, chr16:10903718-10903738, chr16:10903721-10903741, chr16:10903723-10903743 , chr16:10903724-10903744, chr16:10903873-10903893, chr16:10903878-10903898 , chr16:10903905-10903925, chr16:10903906-10903926, chr16:10904736-10904756, chr16:10904790-10904810, chr16:10904811-10904831, chr16:10 906481-10906501, chr16:10906485-10906505, chr16:10906486-10906506, chr16 :10906487-10906507, chr16:10906492-10906512, chr16:10908127-10908147, chr16:10908130-10908150, chr16:10908131-10908151, chr16:10908132 -10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr16:10908139 -10908159, chr16:10909006-10909026, chr16:10909007-10909027, chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022-10909042 , chr16:10909172-10909192, chr16:10910165-10910185, chr16:10910176-10910196 , chr16:10910186-10910206, chr16:10915547-10915567, chr16:10915551-10915571, chr16:10915552-10915572, chr16:10915567-10915587, chr16:10 916348-10916368, chr16:10916359-10916379, chr16:10916362-10916382, chr16 :10916449-10916469, chr16:10916450-10916470, chr16:10916455-10916475, chr16:10916456-10916476, chr16:10918423-10918443, chr16:10918504 -10918524, chr16:10918511-10918531, chr16:10918512-10918532, chr16:10918539 -10918559, chr16:10922153-10922173, chr16:10922478-10922498, chr16:10922487-10922507, chr16:10922499-10922519, chr16:10923205-10923225 , chr16:10923214-10923234, chr16:10923218-10923238, chr16:10923219-10923239 , chr16:10923220-10923240, chr16:10923221-10923241 and chr16:10923222-10923242. Provided are engineered cells in which surface expression is reduced or eliminated. In some embodiments, chr16:10895410-10895430, chr16:10898649-10898669, chr16:10898658-10898678, chr16:10902171-10902191, chr16:10902173-10902193, chr 16:10902174-10902194, chr16:10902179-10902199, chr16 :10902183-10902203, chr16:10902184-10902204, chr16:10902644-10902664, chr16:10902779-10902799, chr16:10902788-10902808, chr16:10902789 -10902809, chr16:10902790-10902810, chr16:10902795-10902815, chr16:10902799 -10902819, chr16:10903708-10903728, chr16:10903713-10903733, chr16:10903718-10903738, chr16:10903721-10903741, chr16:10903723-10903743 , chr16:10903724-10903744, chr16:10903873-10903893, chr16:10903878-10903898 , chr16:10903905-10903925, chr16:10903906-10903926, chr16:10904736-10904756, chr16:10904790-10904810, chr16:10904811-10904831, chr16:10 906481-10906501, chr16:10906485-10906505, chr16:10906486-10906506, chr16 :10906487-10906507, chr16:10906492-10906512, chr16:10908127-10908147, chr16:10908130-10908150, chr16:10908131-10908151, chr16:10908132 -10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr16:10908139 -10908159, chr16:10909006-10909026, chr16:10909007-10909027, chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022-10909042 , chr16:10909172-10909192, chr16:10910165-10910185, chr16:10910176-10910196 , chr16:10910186-10910206, chr16:10915547-10915567, chr16:10915551-10915571, chr16:10915552-10915572, chr16:10915567-10915587, chr16:10 916348-10916368, chr16:10916359-10916379, chr16:10916362-10916382, chr16 :10916449-10916469, chr16:10916450-10916470, chr16:10916455-10916475, chr16:10916456-10916476, chr16:10918423-10918443, chr16:10918504 -10918524, chr16:10918511-10918531, chr16:10918512-10918532, chr16:10918539 -10918559, chr16:10922153-10922173, chr16:10922478-10922498, chr16:10922487-10922507, chr16:10922499-10922519, chr16:10923205-10923225 , chr16:10923214-10923234, chr16:10923218-10923238, chr16:10923219-10923239 , chr16:10923220-10923240, chr16:10923221-10923241 and chr16:10923222-10923242. Provided are engineered cells in which surface expression is reduced or eliminated. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within their genomic coordinates. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9.

[0089] In some embodiments, chr16:10903873-10903893, chr16:10903878-10903898, chr16:10903905-10903925, chr16:10903906-10903926, chr16:10904736-10904756, chr 16:10904790-10904810, chr16:10904811-10904831, chr16 :10906481-10906501, chr16:10906485-10906505, chr16:10906486-10906506, chr16:10906487-10906507, chr16:10906492-10906512, chr16:10908127 -10908147, chr16:10908130-10908150, chr16:10908131-10908151, chr16:10908132 -10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr16:10908139-10908159, chr16:10909006-10909026, chr16:10909007-10909027 , chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022-10909042 , chr16:10909172-10909192, chr16:10910165-10910185, chr16:10910176-10910196, chr16:10910186-10910206, chr16:10915547-10915567, chr16:10 915551-10915571, chr16:10915552-10915572, chr16:10915567-10915587, chr16 :10916348-10916368, chr16:10916359-10916379, chr16:10916362-10916382, chr16:10916449-10916469, chr16:10916450-10916470, chr16:10916455 -10916475, chr16:10916456-10916476, chr16:10918423-10918443, chr16:10918504 -10918524, chr16:10918511-10918531, chr16:10918512-10918532, chr16:10918539-10918559, chr16:10922153-10922173, chr16:10922478-10922498 , chr16:10922487-10922507, chr16:10922499-10922519, chr16:10923205-10923225 , chr16:10923214-10923234, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923220-10923240, chr16:10923221-10923241 and chr16:10 At least 10 contiguous nucleotides within genomic coordinates selected from 923222-10923242 engineered cells in which surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising: In some embodiments, chr16:10903873-10903893, chr16:10903878-10903898, chr16:10903905-10903925, chr16:10903906-10903926, chr16:10904736-10904756, chr 16:10904790-10904810, chr16:10904811-10904831, chr16 :10906481-10906501, chr16:10906485-10906505, chr16:10906486-10906506, chr16:10906487-10906507, chr16:10906492-10906512, chr16:10908127 -10908147, chr16:10908130-10908150, chr16:10908131-10908151, chr16:10908132 -10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr16:10908139-10908159, chr16:10909006-10909026, chr16:10909007-10909027 , chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022-10909042 , chr16:10909172-10909192, chr16:10910165-10910185, chr16:10910176-10910196, chr16:10910186-10910206, chr16:10915547-10915567, chr16:10 915551-10915571, chr16:10915552-10915572, chr16:10915567-10915587, chr16 :10916348-10916368, chr16:10916359-10916379, chr16:10916362-10916382, chr16:10916449-10916469, chr16:10916450-10916470, chr16:10916455 -10916475, chr16:10916456-10916476, chr16:10918423-10918443, chr16:10918504 -10918524, chr16:10918511-10918531, chr16:10918512-10918532, chr16:10918539-10918559, chr16:10922153-10922173, chr16:10922478-10922498 , chr16:10922487-10922507, chr16:10922499-10922519, chr16:10923205-10923225 , chr16:10923214-10923234, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923220-10923240, chr16:10923221-10923241 and chr16:10 At least 5 consecutive nucleotides within genomic coordinates selected from 923222-10923242 engineered cells in which surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising: In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within their genomic coordinates. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9.

[0090] In some embodiments, chr16:10906485-10906505, chr16:10906486-10906506, chr16:10906487-10906507, chr16:10906492-10906512, chr16:10908127-10908147, chr 16:10908130-10908150, chr16:10908131-10908151, chr16 :10908132-10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr16:10908139-10908159, chr16:10909006-10909026, chr16:10909007 -10909027, chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022 -10909042, chr16:10909172-10909192, chr16:10910165-10910185, chr16:10910176-10910196, chr16:10910186-10910206, chr16:10915547-10915567 , chr16:10915551-10915571, chr16:10915552-10915572, chr16:10915567-10915587 , chr16:10916348-10916368, chr16:10916359-10916379, chr16:10916362-10916382, chr16:10916449-10916469, chr16:10916450-10916470, chr16:10 916455-10916475, chr16:10916456-10916476, chr16:10918423-10918443, chr16 :10918504-10918524, chr16:10918511-10918531, chr16:10918512-10918532, chr16:10918539-10918559, chr16:10922153-10922173, chr16:10922478 -10922498, chr16:10922487-10922507, chr16:10922499-10922519, chr16:10923205 -10923225, chr16:10923214-10923234, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923220-10923240, chr16:10923221-10923241 and at least 10 consecutive genomic coordinates selected from chr16:10923222-10923242 The present invention provides engineered cells in which surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence containing nucleotides. In some embodiments, chr16:10906485-10906505, chr16:10906486-10906506, chr16:10906487-10906507, chr16:10906492-10906512, chr16:10908127-10908147, chr 16:10908130-10908150, chr16:10908131-10908151, chr16 :10908132-10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr16:10908139-10908159, chr16:10909006-10909026, chr16:10909007 -10909027, chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022 -10909042, chr16:10909172-10909192, chr16:10910165-10910185, chr16:10910176-10910196, chr16:10910186-10910206, chr16:10915547-10915567 , chr16:10915551-10915571, chr16:10915552-10915572, chr16:10915567-10915587 , chr16:10916348-10916368, chr16:10916359-10916379, chr16:10916362-10916382, chr16:10916449-10916469, chr16:10916450-10916470, chr16:10 916455-10916475, chr16:10916456-10916476, chr16:10918423-10918443, chr16 :10918504-10918524, chr16:10918511-10918531, chr16:10918512-10918532, chr16:10918539-10918559, chr16:10922153-10922173, chr16:10922478 -10922498, chr16:10922487-10922507, chr16:10922499-10922519, chr16:10923205 -10923225, chr16:10923214-10923234, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923220-10923240, chr16:10923221-10923241 and at least 5 consecutive within genomic coordinates selected from chr16:10923222-10923242 The present invention provides engineered cells in which surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence containing nucleotides. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within their genomic coordinates. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9.

[0091] In some embodiments, chr16:10908130-10908150, chr16:10908131-10908151, chr16:10908132-10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr 16:10908139-10908159, chr16:10909006-10909026, chr16 :10909007-10909027, chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022-10909042, chr16:10909172-10909192, chr16:10910165 -10910185, chr16:10910176-10910196, chr16:10910186-10910206, chr16:10915547 -10915567, chr16:10915551-10915571, chr16:10915552-10915572, chr16:10915567-10915587, chr16:10916348-10916368, chr16:10916359-10916379 , chr16:10916362-10916382, chr16:10916449-10916469, chr16:10916450-10916470 , chr16:10916455-10916475, chr16:10916456-10916476, chr16:10918423-10918443, chr16:10918504-10918524, chr16:10918511-10918531, chr16:10 918512-10918532, chr16:10918539-10918559, chr16:10922153-10922173, chr16 :10922478-10922498, chr16:10922487-10922507, chr16:10922499-10922519, chr16:10923205-10923225, chr16:10923214-10923234, chr16:10923218 -10923238, chr16:10923219-10923239, chr16:10923220-10923240, chr16:10923221 Manipulations in which surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence containing at least 10 contiguous nucleotides within genomic coordinates selected from -10923241 and chr16:10923222-10923242 Provide cells. In some embodiments, chr16:10908130-10908150, chr16:10908131-10908151, chr16:10908132-10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr 16:10908139-10908159, chr16:10909006-10909026, chr16 :10909007-10909027, chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022-10909042, chr16:10909172-10909192, chr16:10910165 -10910185, chr16:10910176-10910196, chr16:10910186-10910206, chr16:10915547 -10915567, chr16:10915551-10915571, chr16:10915552-10915572, chr16:10915567-10915587, chr16:10916348-10916368, chr16:10916359-10916379 , chr16:10916362-10916382, chr16:10916449-10916469, chr16:10916450-10916470 , chr16:10916455-10916475, chr16:10916456-10916476, chr16:10918423-10918443, chr16:10918504-10918524, chr16:10918511-10918531, chr16:10 918512-10918532, chr16:10918539-10918559, chr16:10922153-10922173, chr16 :10922478-10922498, chr16:10922487-10922507, chr16:10922499-10922519, chr16:10923205-10923225, chr16:10923214-10923234, chr16:10923218 -10923238, chr16:10923219-10923239, chr16:10923220-10923240, chr16:10923221 Manipulations in which surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence containing at least 5 contiguous nucleotides within genomic coordinates selected from -10923241 and chr16:10923222-10923242 Provide cells. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within their genomic coordinates. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9.

[0092] In some embodiments, chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr 16:10918512-10918532, chr16:10918511-10918531, chr16 :10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006 -10909026, chr16:10922478-10922498, chr16:10895747-10895767, chr16:10916348 -10916368, chr16:10910186-10910206, chr16:10906481-10906501, chr16:10909007-10909027, chr16:10895410-10895430 and chr16:10908130-10908150 CIITA genome containing at least 5 contiguous nucleotides within genomic coordinates selected from Gene editing systems that bind to target sequences provide engineered cells in which surface expression of MHC class II is reduced or eliminated. In some embodiments, the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within their genomic coordinates. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9.

[0093] In some embodiments, chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr 16:10916359-10916379, chr16:10903873-10903893, chr16 :10909172-10909192, chr16:10922153-10922173, chr16:10916450-10916470, chr16:10923222-10923242, chr16:10916449-10916469 and chr16:10923214 Contains at least 5 contiguous nucleotides within genomic coordinates selected from -10923234 Gene editing systems that bind to CIITA genomic target sequences provide engineered cells in which surface expression of MHC class II is reduced or eliminated. In some embodiments, chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr 16:10916359-10916379, chr16:10903873-10903893, chr16 Surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence containing at least 5 contiguous nucleotides within genomic coordinates selected from :10909172-10909192, chr16:10922153-10922173 and chr16:10916450-10916470 provides engineered cells in which the In some embodiments, the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within their genomic coordinates. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9.

[0094] In some embodiments, chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr 16:10918512-10918532, chr16:10918511-10918531, chr16 :10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006 At least 5 in genomic coordinates selected from -10909026 and chr16:10922478-10922498 engineered cells in which surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising contiguous nucleotides of the present invention. In some embodiments, the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within their genomic coordinates. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9.

[0095] In some embodiments, a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within genomic coordinates selected from chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, and chr16:10918504-10918524. Provided are engineered cells in which surface expression of MHC class II is reduced or eliminated by a gene editing system coupled to. In some embodiments, surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within genomic coordinates chr16:10908132-10908152. Provide engineered cells. In some embodiments, surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within genomic coordinates chr16:10908131-10908151. Provide engineered cells. In some embodiments, surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within genomic coordinates chr16:10916456-10916476. Provide engineered cells. In some embodiments, surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within genomic coordinates chr16:10918504-10918524. Provide engineered cells. In some embodiments, the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within their genomic coordinates. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9.

[0096] In some embodiments, chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr 16:10906485-10906505, chr16:10903873-10903893, chr16 :10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, chr16:10922153-10922173, chr16:10923222 -10923242, chr16:10910176-10910196, chr16:10895742-10895762, chr16:10916449 -10916469, chr16:10923214-10923234, chr16:10906492-10906512 and chr16:10906487-10906507. Engineered cells are provided in which surface expression of II is reduced or eliminated. In some embodiments, the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within their genomic coordinates. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase. In some embodiments, the RNA-guided DNA binding agent includes a deaminase and an RNA-guided nickase. In some embodiments, the deaminase is a deaminase APOBEC3, such as APOBEC3A (A3A).

[0097] In some embodiments, chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr 16:10906485-10906505, chr16:10903873-10903893, chr16 At least 5 consecutive nucleotides within genomic coordinates selected from :10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470 and chr16:10922153-10922173 Binds to CIITA genomic target sequences containing The present invention provides engineered cells in which surface expression of MHC class II is reduced or eliminated by a gene editing system. In some embodiments, the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within their genomic coordinates. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase. In some embodiments, the RNA-guided DNA binding agent includes a deaminase and an RNA-guided nickase. In some embodiments, the deaminase is a deaminase APOBEC3, such as APOBEC3A (A3A).

[0098] In some embodiments, a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within genomic coordinates selected from chr16:10918504-10918524, chr16:10923218-10923238, and chr16:10923219-10923239. provides engineered cells in which surface expression of MHC class II is reduced or eliminated. In some embodiments, the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within their genomic coordinates. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase. In some embodiments, the RNA-guided DNA binding agent includes a deaminase and an RNA-guided nickase. In some embodiments, the deaminase is a deaminase APOBEC3, such as APOBEC3A (A3A).

[0099] In some embodiments, surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within genomic coordinates: 10918504-10918524. Provide cells. In some embodiments, surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within genomic coordinates chr16:10923218-10923238. Provide engineered cells. In some embodiments, surface expression of MHC class II is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within genomic coordinates chr16:10923219-10923239. Provide engineered cells. In some embodiments, the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within their genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within their genomic coordinates. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase and an RNA-guided nickase. In some embodiments, the deaminase is a deaminase APOBEC3, such as APOBEC3A (A3A).

[0100] In some embodiments, for each given genomic coordinate range, the range may include ±10 nucleotides on either end of that designated coordinate. For each given genomic coordinate range, the range may include ±5 nucleotides at either end of the range. For example, if chr16:10923222-10923242 is shown, in some embodiments the genomic target sequence or genetic modification may be included in chr16:10923212-10923252.

[0101] In some embodiments, a predetermined genomic coordinate range may include target sequences on both strands of DNA (ie, the plus (+) strand and the minus (-) strand).

[0102] Genetic modifications of the CIITA gene are further described herein. In some embodiments, the genetic modification of the CIITA gene comprises any one or more of the following: insertion, deletion, substitution, or deamination of at least one nucleotide in the target sequence. Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , inactivates the splice site. Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , including insertions at the splice site nucleotides. Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , including nucleotide deletions at the splice site. Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , including nucleotide substitutions at splice sites. Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , including deamination of nucleotides at splice sites.

[0103] In some embodiments, engineered cells in which surface expression of MHC class II is reduced or eliminated compared to unmodified cells, wherein genetic modifications are made to the CIITA gene, as described herein. Provided are engineered cells comprising, the cells further having reduced or eliminated surface expression of HLA-A. In some embodiments, the engineered cell comprises a genetic modification to the HLA-A gene. In some embodiments, the engineered cell comprises a genetic modification in the HLA-A gene, is homozygous for HLA-B, and is homozygous for HLA-C. In some embodiments, the engineered cell includes a genetic modification that eliminates expression of HLA-A protein on the surface of the engineered cell.

[0104] The human engineered cells described herein may include genetic modifications to any HLA-A allele of the HLA-A gene. The HLA gene is located on chromosome 6 in a genomic region called the HLA superlocus, and hundreds of HLA-A alleles have been reported in the technical field (for example, Shiina et al., Nature 54:15- 39 (2009). Sequences of HLA-A alleles are available in the art (e.g., IPD-IMGT / HLA database to search for specific HLA-A allele sequences https: see / / www.ebi.ac.uk / ipd / imgt / hla / allele.html).

[0105] Any of the above embodiments provides an engineered cell in which surface expression of MHC class II is reduced or eliminated compared to unmodified cells, the engineered cell comprising a genetic modification in the CIITA gene, the modification comprising: contains at least one nucleotide of a splice site within the genomic coordinates chr16:10902171-10923242 and further contains genetic modifications in the HLA-A gene, the genetic modifications of the HLA-A gene are chr6:29942854-chr6:29942913 and chr6 Contains at least one nucleotide within the genomic coordinates selected from :29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29942864-chr6:29942903. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29943528-chr6:29943609. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and at least one nucleotide within the genomic coordinates selected from chr6:29944026-29944046. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and chr6:29944026-29944046, including indels, C to T substitutions or A to G substitutions within the selected genomic coordinates. In some embodiments, chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:299 43126-29943146, chr6:29943528-29943548, chr6 :29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609 and chr6:29944026-2994 Contains at least 5 contiguous nucleotides within genomic coordinates selected from 4046 A gene editing system that binds to an HLA-A genomic target sequence reduces or eliminates the expression of HLA-A in that cell. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0106] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , at least one nucleotide of a splice site within genomic coordinates chr16:10902171-10923242; Contains at least one nucleotide within genomic coordinates selected from chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29942864-chr6:29942903. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29943528-chr6:29943609. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and at least one nucleotide within the genomic coordinates selected from chr6:29944026-29944046. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and chr6:29944026-29944046, including indels, C to T substitutions or A to G substitutions within the selected genomic coordinates. In some embodiments, chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:299 43126-29943146, chr6:29943528-29943548, chr6 :29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609 and chr6:29944026-2994 Contains at least 5 contiguous nucleotides within genomic coordinates selected from 4046 A gene editing system that binds to an HLA-A genomic target sequence reduces or eliminates the expression of HLA-A in that cell. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0107] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , at least one nucleotide of a splice site within genomic coordinates chr16:10902171-10923242; Contains at least one nucleotide within genomic coordinates selected from chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29942864-chr6:29942903. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29943528-chr6:29943609. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and at least one nucleotide within the genomic coordinates selected from chr6:29944026-29944046. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and chr6:29944026-29944046, including indels, C to T substitutions or A to G substitutions within the selected genomic coordinates. In some embodiments, chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:299 43126-29943146, chr6:29943528-29943548, chr6 :29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609 and chr6:29944026-2994 Contains at least 5 contiguous nucleotides within genomic coordinates selected from 4046 A gene editing system that binds to an HLA-A genomic target sequence reduces or eliminates the expression of HLA-A in that cell. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0108] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10 918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16 :10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, chr16:10922478 -10922498, chr16:10895747-10895767, chr16:10916348-10916368, chr16:10910186 -10910206, chr16:10906481-10906501, chr16:10909007-10909027, chr16:10895410-10895430 and chr16:10908130-10908150, and the cell further , gene The genetic modification of the HLA-A gene comprises at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10 906485-10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16 :10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, chr16:10922153-10922173, chr16:10923222-10923242, chr16:10910176 -10910196, chr16:10895742-10895762, chr16:10916449-10916469, chr16:10923214 -10923234, chr16:10906492-10906512 and chr16:10906487-10906507, the cell further comprises a genetic modification in the HLA-A gene, and the cell further comprises a genetic modification in the HLA-A gene, The genetic modification of the A gene comprises at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29942864-chr6:29942903. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29943528-chr6:29943609. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and at least one nucleotide within the genomic coordinates selected from chr6:29944026-29944046. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and chr6:29944026-29944046, including indels, C to T substitutions or A to G substitutions within the selected genomic coordinates. In some embodiments, chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:299 43126-29943146, chr6:29943528-29943548, chr6 :29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609 and chr6:29944026-2994 Contains at least 5 contiguous nucleotides within genomic coordinates selected from 4046 A gene editing system that binds to an HLA-A genomic target sequence reduces or eliminates the expression of HLA-A in that cell. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0109] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10 916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16 At least one of the splice sites within the genomic coordinates selected from :10922153-10922173, chr16:10916450-10916470, chr16:10923222-10923242, chr16:10916449-10916469 and chr16:10923214-10923234. nucleotides, and the cell further contains , comprising a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10 916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16 At least one of the splice sites within the genomic coordinates selected from :10922153-10922173, chr16:10916450-10916470, chr16:10923222-10923242, chr16:10916449-10916469 and chr16:10923214-10923234. nucleotides, and the cell further contains , comprising a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29942864-chr6:29942903. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29943528-chr6:29943609. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and at least one nucleotide within the genomic coordinates selected from chr6:29944026-29944046. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and chr6:29944026-29944046, including indels, C to T substitutions or A to G substitutions within the selected genomic coordinates. In some embodiments, chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:299 43126-29943146, chr6:29943528-29943548, chr6 :29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609 and chr6:29944026-2994 Contains at least 5 contiguous nucleotides within genomic coordinates selected from 4046 A gene editing system that binds to an HLA-A genomic target sequence reduces or eliminates the expression of HLA-A in that cell. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0110] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10 916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16 :10922153-10922173 and chr16:10916450-10916470, the cell further comprises a genetic modification in an HLA-A gene; The modification includes at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10 916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16 :10922153-10922173 and chr16:10916450-10916470, the cell further comprises a genetic modification in an HLA-A gene; The modification includes at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29942864-chr6:29942903. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29943528-chr6:29943609. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and at least one nucleotide within the genomic coordinates selected from chr6:29944026-29944046. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and chr6:29944026-29944046, including indels, C to T substitutions or A to G substitutions within the selected genomic coordinates. In some embodiments, chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:299 43126-29943146, chr6:29943528-29943548, chr6 :29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609 and chr6:29944026-2994 Contains at least 5 contiguous nucleotides within genomic coordinates selected from 4046 A gene editing system that binds to an HLA-A genomic target sequence reduces or eliminates the expression of HLA-A in that cell. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0111] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524; The genetic modification of the HLA-A gene comprises at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the engineered cells comprising a genetic modification in the CIITA gene, the genetic modification being , chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, and the cell further comprises a genetic modification in the HLA-A gene. , the genetic modification of the HLA-A gene comprises at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29942864-chr6:29942903. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, the genetic modification of the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29943528-chr6:29943609. include. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and at least one nucleotide within the genomic coordinates selected from chr6:29944026-29944046. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, and the genetic modification of the HLA-A gene is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6 :29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-2994 3550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589 -29943609 and chr6:29944026-29944046, including indels, C to T substitutions or A to G substitutions within the selected genomic coordinates. In some embodiments, chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:299 43126-29943146, chr6:29943528-29943548, chr6 :29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609 and chr6:29944026-2994 Contains at least 5 contiguous nucleotides within genomic coordinates selected from 4046 A gene editing system that binds to an HLA-A genomic target sequence reduces or eliminates the expression of HLA-A in that cell. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0112] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: comprises at least one nucleotide of a splice site within genomic coordinates chr16:10902171-10923242, and the cell further has reduced or eliminated surface expression of MHC class I. In some embodiments, the engineered cell comprises a genetic modification in the β-2-microglobulin (B2M) gene. In some embodiments, the engineered cell includes a genetic modification that reduces the expression of MHC class I proteins on the surface of the engineered cell.

[0113] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: comprising at least one nucleotide of a splice site within genomic coordinates chr16:10902171-10923242, and the cell further comprises a foreign nucleic acid. In some embodiments, the exogenous nucleic acid encodes a targeting receptor expressed on the surface of the engineered cell. In some embodiments, the targeting receptor is a chimeric antigen receptor (CAR). In some embodiments, the targeting receptor is a universal CAR (UniCar). In some embodiments, the targeting receptor is a T cell receptor (TCR). In some embodiments, the targeting receptor is WT1 TCR. In some embodiments, the targeting receptor is a hybrid CAR / TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (eg, a cancer antigen recognition domain and a subunit of a TCR). In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is B cell receptor (BCR). In some embodiments, the exogenous nucleic acid encodes a polypeptide (ie, a soluble polypeptide) that is secreted by the engineered cell. In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the foreign nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the foreign nucleic acid encodes a fusion protein.

[0114] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: comprising at least one nucleotide of a splice site within genomic coordinates chr16:10902171-10923242, the cell further having reduced or eliminated surface expression of MHC class I, and the cell further comprising an exogenous nucleic acid. In some embodiments, the engineered cell comprises a genetic modification in the β-2-microglobulin (B2M) gene. In some embodiments, the engineered cell includes a genetic modification that reduces the expression of MHC class I proteins on the surface of the engineered cell. In some embodiments, the exogenous nucleic acid encodes a targeting receptor expressed on the surface of the engineered cell. In some embodiments, the targeting receptor is a chimeric antigen receptor (CAR). In some embodiments, the targeting receptor is a universal CAR (UniCar). In some embodiments, the targeting receptor is a T cell receptor (TCR). In some embodiments, the targeting receptor is WT1 TCR. In some embodiments, the targeting receptor is a hybrid CAR / TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (eg, a cancer antigen recognition domain and a subunit of a TCR). In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is B cell receptor (BCR). In some embodiments, the exogenous nucleic acid encodes a polypeptide (ie, a soluble polypeptide) that is secreted by the engineered cell. In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the foreign nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the foreign nucleic acid encodes a fusion protein.

[0115] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: comprising at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285, the cell further has reduced or eliminated surface expression of HLA-A, and the cell further comprises an exogenous nucleic acid. . In some embodiments, the engineered cell comprises a genetic modification to the HLA-A gene. In some embodiments, the engineered cell includes a genetic modification that reduces expression of HLA-A protein on the surface of the engineered cell. In some embodiments, the exogenous nucleic acid encodes a targeting receptor expressed on the surface of the engineered cell. In some embodiments, the targeting receptor is a chimeric antigen receptor (CAR). In some embodiments, the targeting receptor is a universal CAR (UniCar). In some embodiments, the targeting receptor is a T cell receptor (TCR). In some embodiments, the targeting receptor is WT1 TCR. In some embodiments, the targeting receptor is a hybrid CAR / TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (eg, a cancer antigen recognition domain and a subunit of a TCR). In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is B cell receptor (BCR). In some embodiments, the exogenous nucleic acid encodes a polypeptide (ie, a soluble polypeptide) that is secreted by the engineered cell. In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the foreign nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the foreign nucleic acid encodes a fusion protein.

[0116] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: comprising at least one nucleotide of a splice site within genomic coordinates chr16:10902171-10923242, and the cell further has reduced or eliminated endogenous TCR protein expression compared to an unmodified cell. Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: at least one nucleotide of a splice site within genomic coordinates chr16:10902171-10923242, the cell further comprises an exogenous nucleic acid, and the expression of an endogenous TCR protein is reduced or eliminated compared to an unmodified cell. has been done. Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: at least one nucleotide of a splice site within genomic coordinates chr16:10902171-10923242, the cell further has reduced or eliminated surface expression of MHC class I, and the cell further has reduced or eliminated surface expression of endogenous TCR proteins. are reduced or eliminated compared to unmodified cells.

[0117] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: comprising at least one nucleotide of a splice site within genomic coordinates chr16:10902171-10923242, the cell further comprising an exogenous nucleic acid, the cell further having reduced or eliminated surface expression of MHC class I; The cells further have reduced or eliminated expression of endogenous TCR proteins compared to unmodified cells. In some embodiments, the engineered cells have reduced or eliminated expression of TRAC protein compared to unmodified cells. In some embodiments, the engineered cells have reduced or eliminated expression of TRBC protein compared to unmodified cells. In some embodiments, the engineered cell comprises a genetic modification in the β-2-microglobulin (B2M) gene. In some embodiments, the engineered cell includes a genetic modification that reduces the expression of MHC class I proteins on the surface of the engineered cell. In some embodiments, the exogenous nucleic acid encodes a targeting receptor expressed on the surface of the engineered cell. In some embodiments, the targeting receptor is a chimeric antigen receptor (CAR). In some embodiments, the targeting receptor is a universal CAR (UniCar). In some embodiments, the targeting receptor is a T cell receptor (TCR). In some embodiments, the targeting receptor is WT1 TCR. In some embodiments, the targeting receptor is a hybrid CAR / TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (eg, a cancer antigen recognition domain and a subunit of a TCR). In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is B cell receptor (BCR). In some embodiments, the exogenous nucleic acid encodes a polypeptide (ie, a soluble polypeptide) that is secreted by the engineered cell. In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the foreign nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the foreign nucleic acid encodes a fusion protein.

[0118] Some embodiments provide engineered cells in which surface expression of MHC class II is reduced or eliminated relative to unmodified cells, the modification comprising a genetic modification in the CIITA gene, the modification comprising: comprising at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285, the cell further comprising an exogenous nucleic acid, and the cell further has reduced or eliminated surface expression of HLA-A. , the cells further have reduced or eliminated endogenous TCR protein expression compared to unmodified cells. In some embodiments, the engineered cells have reduced or eliminated expression of TRAC protein compared to unmodified cells. In some embodiments, the engineered cells have reduced or eliminated expression of TRBC protein compared to unmodified cells. In some embodiments, the engineered cell comprises a genetic modification to the HLA-A gene. In some embodiments, the engineered cell includes a genetic modification that reduces expression of HLA-A protein on the surface of the engineered cell. In some embodiments, the exogenous nucleic acid encodes a targeting receptor expressed on the surface of the engineered cell. In some embodiments, the targeting receptor is a chimeric antigen receptor (CAR). In some embodiments, the targeting receptor is a universal CAR (UniCar). In some embodiments, the targeting receptor is a T cell receptor (TCR). In some embodiments, the targeting receptor is WT1 TCR. In some embodiments, the targeting receptor is a hybrid CAR / TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (eg, a cancer antigen recognition domain and a subunit of a TCR). In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is B cell receptor (BCR). In some embodiments, the exogenous nucleic acid encodes a polypeptide (ie, a soluble polypeptide) that is secreted by the engineered cell. In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the foreign nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the foreign nucleic acid encodes a fusion protein.

[0119] The engineered cell may be any of the exemplary cell types disclosed herein. In some embodiments, the engineered cell is an immune cell. In some embodiments, the engineered cells are hematopoietic stem cells (HSCs). In some embodiments, the engineered cells are induced pluripotent stem cells (iPSCs). In some embodiments, the engineered cell is a monocyte, macrophage, mast cell, dendritic cell, or granulocyte. In some embodiments, the engineered cell is a monocyte. In some embodiments, the engineered cell is a macrophage. In some embodiments, the engineered cell is a mast cell. In some embodiments, the engineered cell is a dendritic cell.

[0120] In some embodiments, the engineered cell is a granulocyte. In some embodiments, the engineered cell is a lymphocyte. In some embodiments, the engineered cell is a T cell. In some embodiments, the engineered cells are CD4+ T cells. In some embodiments, the engineered cells are CD8+ T cells. In some embodiments, the engineered cell is a memory T cell. In some embodiments, the engineered cell is a B cell. In some embodiments, the engineered cells are plasma B cells. In some embodiments, the engineered cell is a memory B cell.

[0121] In some embodiments, the engineered cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the HLA-B allele is HLA-B*07:02, HLA-B*08:01, HLA-B*44:02, HLA-B*35:01, HLA-B* 40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02, HLA-B*44:03, HLA-B*38: 01, HLA-B*18:01, HLA-B*44:03, HLA-B*51:01, HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA-B*52:01, HLA-B*51:01, HLA-B*37:01, HLA- B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35:02, HLA-B*15:01 and HLA-B* Selected from one of the HLA-B alleles 40:02.

[0122] In some embodiments, the HLA-C allele is HLA-C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C* 03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02, HLA-C*16:01, HLA-C*12: 03, HLA-C*07:01, HLA-C*04:01, HLA-C*15:02, HLA-C*07:01, HLA-C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14:02, HLA-C*06:02, HLA- C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04:01, HLA-C*04:01 and HLA-C* Selected from one of the HLA-C alleles 02:02.

[0123] In some embodiments, the HLA-B allele is HLA-B*07:02, HLA-B*08:01, HLA-B*44:02, HLA-B*35:01, HLA-B* 40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02, HLA-B*44:03, HLA-B*38: 01, HLA-B*18:01, HLA-B*44:03, HLA-B*51:01, HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA-B*52:01, HLA-B*51:01, HLA-B*37:01, HLA- B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35:02, HLA-B*15:01 and HLA-B* 40:02, and the HLA-C alleles are HLA-C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02, HLA- C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04:01, HLA-C*15:02, HLA-C*07:01, HLA-C* 03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14: 02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04:01, One of the HLA-C alleles HLA-C*04:01 and HLA-C*02:02 is selected.

[0124] In some embodiments, the engineered cell is homozygous for HLA-B and homozygous for HLA-C, and the HLA-B allele and the HLA-C allele are HLA-B*07: 02 and HLA-C*07:02, HLA-B*08:01 and HLA-C*07:01, HLA-B*44:02 and HLA-C*05:01, HLA-B*35:01 and HLA-C*04:01, HLA-B*40:01 and HLA-C*03:04, HLA-B*57:01 and HLA-C*06:02, HLA-B*14:02 and HLA- C*08:02, HLA-B*15:01 and HLA-C*03:03, HLA-B*13:02 and HLA-C*06:02, HLA-B*44:03 and HLA-C* 16:01, HLA-B*38:01 and HLA-C*12:03, HLA-B*18:01 and HLA-C*07:01, HLA-B*44:03 and HLA-C*04: 01, HLA-B*51:01 and HLA-C*15:02, HLA-B*49:01 and HLA-C*07:01, HLA-B*15:01 and HLA-C*03:04, HLA-B*18:01 and HLA-C*12:03, HLA-B*27:05 and HLA-C*02:02, HLA-B*35:03 and HLA-C*04:01, HLA- B*18:01 and HLA-C*05:01, HLA-B*52:01 and HLA-C*12:02, HLA-B*51:01 and HLA-C*14:02, HLA-B* 37:01 and HLA-C*06:02, HLA-B*53:01 and HLA-C*04:01, HLA-B*55:01 and HLA-C*03:03, HLA-B*44: 02 and HLA-C*07:04, HLA-B*44:03 and HLA-C*07:01, HLA-B*35:02 and HLA-C*04:01, HLA-B*15:01 and HLA-C*04:01, and any one of the HLA-B allele and HLA-C allele HLA-B*40:02 and HLA-C*02:02. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C, and the HLA-B allele and the HLA-C allele are HLA-B*07:02 and HLA-C*07:02. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C, and the HLA-B allele and the HLA-C allele are HLA-B*08:01 and HLA-C*07:01. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C, and the HLA-B allele and the HLA-C allele are HLA-B*44:02 and HLA-C*05:01. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C, and the HLA-B allele and the HLA-C allele are HLA-B*35:01 and HLA-C*04:01.

[0125] In some embodiments, the present disclosure provides a pharmaceutical composition comprising any one of the engineered cells disclosed herein. In some embodiments, the pharmaceutical composition comprises a population of any one of the engineered cells disclosed herein. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that are at least 65% negative as determined by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that are at least 70% negative as determined by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that are at least 80% negative as determined by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that are at least 90% negative as determined by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that are at least 91% negative as determined by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that are at least 92% negative as determined by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that is at least 93% negative as determined by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that is at least 94% negative as determined by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that are at least 95% negative for endogenous TCR protein as determined by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that are at least 97% negative for endogenous TCR protein as determined by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that are at least 98% negative for endogenous TCR protein as determined by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that are at least 99% negative for endogenous TCR protein as determined by flow cytometry.

[0126] In some embodiments, methods are provided for administering engineered cells or pharmaceutical compositions disclosed herein to a subject in need thereof. In some embodiments, methods are provided for administering engineered cells or pharmaceutical compositions disclosed herein as ACT therapy to a subject. In some embodiments, methods are provided for administering engineered cells or pharmaceutical compositions disclosed herein as a treatment for cancer. In some embodiments, methods are provided for administering engineered cells or pharmaceutical compositions disclosed herein as a treatment for an autoimmune disease. In some embodiments, methods are provided for administering engineered cells or pharmaceutical compositions disclosed herein as a treatment for an infectious disease.

[0127] B. Methods and compositions for reducing or eliminating surface expression of MHC class II The present disclosure provides methods and compositions for reducing or eliminating surface expression of MHC class II proteins in cells compared to unmodified cells by genetically modifying the CIITA gene. The resulting genetically modified cells may also be referred to herein as engineered cells. In some embodiments, cells that have already been genetically modified (ie, engineered cells) may be the starting cells for further genetic modification using the methods or compositions provided herein. In some embodiments, the cell is an allogeneic cell. In some embodiments, cells with reduced MHC class II expression are useful in adoptive cell transfer therapy. In some embodiments, editing of the CIITA gene is combined with additional genetic modifications to result in cells desirable for allogeneic transplantation purposes.

[0128] In some embodiments, the method comprises reducing or eliminating surface expression at the cell surface of an MHC class II protein that targets a CIITA genomic target sequence comprising: i) at least one nucleotide of a splice site; or ii) a composition comprising a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to cleave a CIITA genomic target sequence that is no more than 5 nucleotides from a splice site boundary nucleotide; , with the CIITA guide targeting a genomic target comprising at least 10 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent is Cas9. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent includes a deaminase domain. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase APOBEC3A (A3A) and an RNA-guided nickase. In some embodiments, the expression of MHC class II proteins on the surface of the cells of the invention (ie, engineered cells) is thereby reduced. In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-101.

[0129] In some embodiments, the method includes producing engineered cells in which surface expression of MHC class II proteins is reduced or eliminated relative to unmodified cells, and includes: i) at least one of the splice sites; ii) a guide sequence that directs the RNA-guided DNA binding agent to cleave a CIITA genomic target sequence that is 5 or fewer nucleotides from a splice site boundary nucleotide; contacting the cell with a composition comprising a CIITA guide RNA comprising, the CIITA guide targeting a genomic target comprising at least 10 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent is Cas9. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent includes a deaminase region. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase APOBEC3A (A3A) and an RNA-guided nickase. In some embodiments, the expression of MHC class II proteins on the surface of the cells of the invention (ie, engineered cells) is thereby reduced. In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-101.

[0130] In some embodiments, the method comprises genetically modifying the cell to reduce or eliminate surface expression of an MHC class II protein, comprising: i) a CIITA genomic target sequence comprising at least one nucleotide of a splice site; or ii) a composition comprising a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to cleave a CIITA genomic target sequence that is 5 or fewer nucleotides from a splice site boundary nucleotide. the CIITA guide targets a genomic target comprising at least 10 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent is Cas9. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent includes a deaminase region. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase APOBEC3A (A3A) and an RNA-guided nickase. In some embodiments, the expression of MHC class II proteins on the surface of the cells of the invention (ie, engineered cells) is thereby reduced. In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-101.

[0131] In some embodiments, the method includes inactivating a splice site of CIITA by i) targeting a CIITA genomic target sequence comprising at least one nucleotide of the splice site, or ii) RNA guidance. contacting the cell with a composition comprising a CIITA guide RNA comprising a guide sequence that induces a type DNA binding agent to cleave a CIITA genomic target sequence that is no more than 5 nucleotides from a splice site boundary nucleotide. , whose CIITA guide targets genomic targets containing at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent is Cas9. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent includes a deaminase region. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase APOBEC3A (A3A) and an RNA-guided nickase. In some embodiments, the expression of MHC class II proteins on the surface of the cells of the invention (ie, engineered cells) is thereby reduced. In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-101.

[0132] In some embodiments, the method includes inducing a DSB or single-strand break (SSB) in CIITA, wherein i) targeting a CIITA genomic target sequence comprising at least one nucleotide of a splice site; or ii) a composition comprising a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to cleave a CIITA genomic target sequence that is 5 or fewer nucleotides from a splice site boundary nucleotide; the CIITA guide targets a genomic target comprising at least 10 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent is Cas9. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent includes a deaminase region. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase APOBEC3A (A3A) and an RNA-guided nickase. In some embodiments, the expression of MHC class II proteins on the surface of the cells of the invention (ie, engineered cells) is thereby reduced. In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-101.

[0133] In some embodiments, the method includes reducing expression of a CIITA protein in the cell, and includes delivering a composition to the cell that includes: i) a CIITA genome comprising at least one nucleotide of a splice site; or ii) a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to cleave a CIITA genomic target sequence that is no more than 5 nucleotides from a splice site boundary nucleotide. contacting the cell with a composition comprising, the CIITA guide targeting a genomic target comprising at least 10 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent is Cas9. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent includes a deaminase region. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase APOBEC3A (A3A) and an RNA-guided nickase. In some embodiments, the expression of MHC class II proteins on the surface of the cells of the invention (ie, engineered cells) is thereby reduced. In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-101.

[0134] In some embodiments, the method of reducing MHC class II protein expression on the surface of a cell comprises contacting the cell with any one or more of the CIITA guide RNAs disclosed herein. include. In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-101.

[0135] In some embodiments, i) targets a CIITA genomic target sequence that includes at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to 5 nucleotides from a splice site boundary nucleotide. Provided are compositions comprising a CIITA guide RNA comprising a guide sequence that causes cleavage of a CIITA genomic target sequence that is: targeting genomic targets containing. In some embodiments, the composition further comprises an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the composition comprises an RNA-guided DNA binding agent that is Cas9. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent includes a deaminase region. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase APOBEC3A (A3A) and an RNA-guided nickase. In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-101.

[0136] In some embodiments, the composition further comprises a uracil glycosylase inhibitor (UGI). In some embodiments, the composition comprises an RNA-guided DNA binding agent that performs a cytosine (C) to thymine (T) conversion at a CIITA genomic target sequence. In some embodiments, the composition comprises an RNA-guided DNA binding agent that performs an adenosine (A) to guanine (G) conversion at a CIITA genomic target sequence.

[0137] In some embodiments, engineered cells produced by the methods described herein are provided. In some embodiments, engineered cells produced by the methods and compositions described herein are allogeneic cells. In some embodiments, the method creates a composition comprising engineered cells that have reduced expression of MHC class II. In some embodiments, the method creates a composition comprising engineered cells that have reduced expression of CIITA protein. In some embodiments, the method produces a composition comprising engineered cells that have reduced levels of CIITA in the cell nucleus. In some embodiments, the method produces a composition comprising an engineered cell that expresses a truncated form of CIITA protein. In some embodiments, the method creates a composition comprising an engineered cell that produces undetectable CIITA protein. In some embodiments, the engineered cells have reduced expression of MHC class II, reduced CIITA protein, and / or reduced levels of CIITA in the cell nucleus compared to unmodified cells. There is. In some embodiments, the engineered cells produced by the methods disclosed herein increase CD4+ T cells as compared to unmodified cells as measured in an in vitro cell culture assay containing CD4+ T cells. inducing a reduction in the response from.

[0138] In some embodiments, engineered cells produced by the methods or compositions disclosed herein have reduced or eliminated surface expression of MHC class II proteins and have reduced or eliminated surface expression of splice acceptor sites. , provides an engineered cell comprising a genetic modification comprising at least one nucleotide modification. In some embodiments, an engineered cell produced by a method or composition disclosed herein has reduced or eliminated surface expression of an MHC class II protein and has a splice donor site of Engineered cells containing genetic modifications comprising at least one nucleotide modification are provided.

[0139] In some embodiments, engineered cells produced by the methods or compositions disclosed herein have reduced or eliminated surface expression of MHC class II proteins and have genomic coordinates chr16:10902171 -10923242 An engineered cell comprising a genetic modification comprising at least 5 contiguous nucleotides within -10923242 is provided. In some embodiments, engineered cells produced by the methods or compositions disclosed herein have reduced or eliminated surface expression of MHC class II proteins and have genomic coordinates chr16:10902171 An engineered cell comprising a genetic modification comprising at least 10 contiguous nucleotides within -10923242 is provided. In some embodiments, engineered cells produced by the methods or compositions disclosed herein have reduced or eliminated surface expression of MHC class II proteins and have genomic coordinates chr16:10902171 An engineered cell comprising a genetic modification comprising at least one C to T substitution or at least one A to G substitution within -10923242 is provided.

[0140] In some embodiments, engineered cells produced by the methods or compositions disclosed herein have reduced or eliminated surface expression of MHC class II proteins and have genomic coordinates chr16:10903873. -Chr:10923242 - provides an engineered cell comprising a genetic modification comprising at least one nucleotide of a splice site within chr:10923242. In some embodiments, engineered cells produced by the methods or compositions disclosed herein have reduced or eliminated surface expression of MHC class II proteins and have genomic coordinates chr:16 :10906485-chr:10923242 provides an engineered cell comprising a genetic modification comprising at least one nucleotide of a splice site within: In some embodiments, engineered cells produced by the methods or compositions disclosed herein have reduced or eliminated surface expression of MHC class II proteins and have genomic coordinates chr16:10908130. -Chr:10923242 - provides an engineered cell comprising a genetic modification comprising at least one nucleotide of a splice site within chr:10923242.

[0141] In some embodiments, the compositions disclosed herein further include a pharmaceutically acceptable carrier. Some embodiments provide cells produced by the compositions disclosed herein that include a pharmaceutically acceptable carrier. In some embodiments, compositions comprising cells disclosed herein are provided.

[0142] 1.CIITA guide RNA The methods and compositions provided herein disclose CIITA guide RNAs useful for reducing the expression of MHC class II proteins on the surface of cells. In some embodiments, such guide RNA directs the RNA-guided DNA binding agent to the CIITA genomic target sequence and may also be referred to herein as a "CIITA guide RNA." In some embodiments, the CIITA guide RNA directs the RNA-guided DNA binding agent to the human CIITA genomic target sequence. In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-101.

[0143] In some embodiments, the methods and compositions disclosed herein include a CIITA guide RNA comprising a guide sequence that targets a CIITA genomic target sequence comprising at least one nucleotide of a splice site; The CIITA guide RNA targets a CIITA genomic target sequence containing at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242. In some embodiments, the methods and compositions disclosed herein include a CIITA guide RNA comprising a guide sequence that targets a CIITA genomic target sequence comprising at least one nucleotide of a splice site; The CIITA guide RNA targets a CIITA genomic target sequence that includes at least one nucleotide within the genomic coordinates chr16:10903873-chr:10923242. In some embodiments, the methods and compositions disclosed herein include a CIITA guide RNA comprising a guide sequence that targets a CIITA genomic target sequence comprising at least one nucleotide of a splice site; The CIITA guide RNA targets a CIITA genomic target sequence that includes at least one nucleotide within the genomic coordinates chr:16:10906485-chr:10923242. In some embodiments, the methods and compositions disclosed herein include a CIITA guide RNA comprising a guide sequence that targets a CIITA genomic target sequence comprising at least one nucleotide of a splice site; The CIITA guide RNA targets a CIITA genomic target sequence that includes at least one nucleotide within the genomic coordinates chr16:10908130-chr:10923242.

[0144] In some embodiments, the methods and compositions disclosed herein include a CIITA guide RNA that includes a guide sequence that targets a CIITA genomic target sequence that includes at least one nucleotide of a splice acceptor site. . In some embodiments, one nucleotide of the splice acceptor site is A. In some embodiments, one nucleotide of the splice acceptor site is a G. In some embodiments, the one nucleotide is a splice site boundary nucleotide of a splice acceptor site. In some embodiments, the methods and compositions disclosed herein include a CIITA guide RNA that includes a guide sequence that targets a CIITA genomic target sequence that includes at least one nucleotide of a splice donor site. In some embodiments, one nucleotide of the splice donor site is G. In some embodiments, one nucleotide of the splice donor site is U / T. In some embodiments, the one nucleotide is a splice site boundary nucleotide of the splice donor site.

[0145] In some embodiments, the methods and compositions disclosed herein direct RNA-guided DNA binding agents to cleave the CIITA gene no more than 5 nucleotides from the splice site boundary nucleotides. a CIITA guide RNA comprising a guide sequence that targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. In some embodiments, the methods and compositions disclosed herein direct RNA-guided DNA binding agents to cleave the CIITA gene no more than 5 nucleotides from the splice site boundary nucleotides. a CIITA guide RNA that includes a guide sequence that targets a CIITA genomic target sequence that includes at least one nucleotide within the genomic coordinates chr16:10903873-chr:10923242. In some embodiments, the methods and compositions disclosed herein direct RNA-guided DNA binding agents to cleave the CIITA gene no more than 5 nucleotides from the splice site boundary nucleotides. a CIITA guide RNA that includes a guide sequence that targets a CIITA genomic target sequence that includes at least one nucleotide within genomic coordinates chr:16:10906485-chr:10923242. In some embodiments, the methods and compositions disclosed herein direct RNA-guided DNA binding agents to cleave the CIITA gene no more than 5 nucleotides from the splice site boundary nucleotides. a CIITA guide RNA that includes a guide sequence that targets a CIITA genomic target sequence that includes at least one nucleotide within the genomic coordinates chr16:10908130-chr:10923242.

[0146] In some embodiments, the methods and compositions disclosed herein direct RNA-guided DNA binding agents to perform cleavage of the CIITA gene no more than 5 nucleotides from the acceptor splice site boundary nucleotide. The CIITA guide RNA includes a guide sequence that causes the CIITA guide RNA to target a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242. In some embodiments, the methods and compositions disclosed herein direct RNA-guided DNA binding agents to cleave the CIITA gene no more than 5 nucleotides from the donor splice site border nucleotide. The CIITA guide RNA includes a guide sequence that targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within genomic coordinates chr16:10902171-10923242.

[0147] In some embodiments, the methods and compositions disclose a CIITA guide RNA that directs an RNA-guided DNA binding agent to cleave a CIITA genomic target sequence that is 5 or fewer nucleotides from a splice site boundary nucleotide. do. In embodiments where the RNA-guided DNA cleavage agent is Cas9, the cleavage or "cleavage site" is at the third base from the protospacer adjacent motif (PAM) sequence.

[0148] In some embodiments, the methods and compositions disclosed herein direct RNA-guided DNA binding agents to perform cleavage of the CIITA gene no more than 5 nucleotides from the acceptor splice site boundary nucleotide. The CIITA guide RNA contains a guide sequence that allows the cleavage site to be 3' to the acceptor splice site boundary nucleotide. In some embodiments, the methods and compositions disclosed herein direct RNA-guided DNA binding agents to perform cleavage of the CIITA gene no more than 5 nucleotides from the acceptor splice site boundary nucleotide. The CIITA guide RNA contains a guide sequence that allows cleavage to occur 5' of the acceptor splice site boundary nucleotide.

[0149] In some embodiments, the methods and compositions disclosed herein direct RNA-guided DNA binding agents to cleave the CIITA gene no more than 5 nucleotides from the donor splice site border nucleotide. Contain a CIITA guide RNA containing a guide sequence that makes the cleavage 3' of the donor splice site border nucleotide. In some embodiments, the methods and compositions disclosed herein direct RNA-guided DNA binding agents to cleave the CIITA gene no more than 5 nucleotides from the donor splice site border nucleotide. Contain a CIITA guide RNA containing a guide sequence that makes the cleavage 5' of the donor splice site boundary nucleotide.

[0150] In some embodiments, the CIITA guide includes a guide sequence that directs the RNA-guided DNA binding agent to cleave the CIITA gene no more than 4 nucleotides from the acceptor splice site boundary nucleotide. In some embodiments, the CIITA guide includes a guide sequence that directs the RNA-guided DNA binding agent to cleave the CIITA gene no more than 3 nucleotides from the acceptor splice site boundary nucleotide. In some embodiments, the CIITA guide includes a guide sequence that directs the RNA-guided DNA binding agent to cleave the CIITA gene no more than 2 nucleotides from the acceptor splice site boundary nucleotide. In some embodiments, the CIITA guide includes a guide sequence that directs the RNA-guided DNA binding agent to cleave the CIITA gene one nucleotide or less from the acceptor splice site boundary nucleotide. In some embodiments, the CIITA guide includes a guide sequence that directs the RNA-guided DNA binding agent to cleave the CIITA gene at the acceptor splice site border nucleotide.

[0151] In some embodiments, the CIITA guide includes a guide sequence that directs the RNA-guided DNA binding agent to cleave the CIITA gene no more than 4 nucleotides from the donor splice site boundary nucleotide. In some embodiments, the CIITA guide includes a guide sequence that directs the RNA-guided DNA binding agent to cleave the CIITA gene no more than 3 nucleotides from the donor splice site boundary nucleotide. In some embodiments, the CIITA guide includes a guide sequence that directs the RNA-guided DNA binding agent to cleave the CIITA gene no more than 2 nucleotides from the donor splice site boundary nucleotide. In some embodiments, the CIITA guide includes a guide sequence that directs the RNA-guided DNA binding agent to cleave the CIITA gene no more than one nucleotide from the donor splice site boundary nucleotide. In some embodiments, the CIITA guide includes a guide sequence that directs the RNA-guided DNA binding agent to cleave the CIITA gene at donor splice site boundary nucleotides.

[0152] In some embodiments, compositions are provided that include a CIITA guide RNA described herein and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.

[0153] In some embodiments, i) targets a CIITA genomic target sequence that includes at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to 5 nucleotides from a splice site boundary nucleotide. Provided are compositions comprising a CIITA single guide RNA (sgRNA) comprising a guide sequence that causes cleavage of a CIITA genomic target sequence that is: Target genomic targets containing contiguous nucleotides. In some embodiments, compositions are provided that include a CIITA sgRNA described herein and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.

[0154] In some embodiments, i) target a CIITA genomic target sequence that includes at least one nucleotide of the splice site, or ii) direct the RNA-guided DNA binding agent to 5 nucleotides from the splice site boundary nucleotide. Provided are compositions comprising a CIITA dual guide RNA (dgRNA) comprising a guide sequence that causes cleavage of a CIITA genomic target sequence that is: Target genomic targets containing contiguous nucleotides. In some embodiments, compositions are provided that include a CIITA dgRNA described herein and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.

[0155] Exemplary CIITA guide sequences are listed in Table 1 below (SEQ ID NOs: 1-101 and corresponding guide RNA sequences SEQ ID NOs: 200-300 and 301-401).

[0156] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 1-10] [Table 1-11] [Table 1-12] [Table 1-13] [Table 1-14] [Table 1-15] [Table 1-16] [Table 1-17] [Table 1-18] [Table 1-19] [Table 1-20] [Table 1-21] [Table 1-22] [Table 1-23] [Table 1-24] [Table 1-25] [Table 1-26] [Table 1-27] [Table 1-28] [Table 1-29] [Table 1-30] [Table 1-31] [Table 1-32] [Table 1-33] [Table 1-34] [Table 1-35] [Table 1-36] [Table 1-37]

[0157] The terms "mA," "mC," "mU," or "mG" are sometimes used to refer to nucleotides that are modified with 2'-O-Me.

[0158] In some embodiments, the CIITA guide RNA of the invention comprises a guide sequence selected from SEQ ID NOs: 1-101. In some embodiments, the CIITA guide RNA comprises a guide sequence that is at least 17, 18, 19 or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-101. In some embodiments, the CIITA guide RNA comprises a guide sequence that is at least 95%, 90% or 85% identical to a sequence selected from SEQ ID NOs: 1-101. In some embodiments, the CIITA guide RNA comprises a guide sequence that is at least 95% identical to a sequence selected from SEQ ID NOs: 1-101.

[0159] In some embodiments, the CIITA guide RNA comprises a guide sequence that includes at least 10 contiguous nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 1. As used herein, at least 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate means, e.g., at least 10 contiguous nucleotides within that genomic coordinate, and that genomic coordinate is defined in Table 1 10 nucleotides in the 5' direction and 10 nucleotides in the 3' direction from the range listed in . For example, the CIITA guide RNA may include 10 contiguous nucleotides within the genomic coordinates chr16:10877360-10877380 or chr16:10877350-10877390, including the border nucleotides of these ranges. In some embodiments, the CIITA guide RNA has at least 17, 18, 19, or 20 of the genomic coordinates listed in Table 1, a sequence comprising 10 contiguous nucleotides ± 10 nucleotides. Contains a guide sequence that is a series of nucleotides. In some embodiments, the CIITA guide RNA comprises 17, 18, 19, or 20 consecutive sequences comprising 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 1. a guide sequence that is at least 95%, 90%, or 85% identical to a selected sequence of nucleotides.

[0160] In some embodiments, the CIITA guide RNA comprises a guide sequence that includes at least 15 contiguous nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 1. In some embodiments, the CIITA guide RNA comprises a guide sequence that includes at least 20 contiguous nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 1.

[0161] In some embodiments, the CIITA guide RNA comprises SEQ ID NO:1. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:2. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:3. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:4. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:5. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:6. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:7. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:8. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:9. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:10. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:11. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 12. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 13. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 14. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 15. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 16. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 17. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 18. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 19. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:20. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:21. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:22. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:23. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:24. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:25. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:26. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:27. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:28. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:29. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:30. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:31. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:32. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 33. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:34. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 35. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:36. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:37. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:38. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 39. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:40. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:41. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 42. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 43. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 44. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 45. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 46. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 47. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 48. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 49. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:50. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:51. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:52. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 53. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:54. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 55. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:56. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 57. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 58. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 59. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:60. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:61. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 62. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 63. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 64. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 65. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 66. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 67. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 68. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 69. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:70. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:71. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:72. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:73. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:74. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:75. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:76. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:77. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:78. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 79. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:80. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:81. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:82. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:83. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:84. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:85. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:86. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:87. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:88. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:89. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:90. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:91. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:92. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:93. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:94. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:95. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:96. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:97. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:98. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:99. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 100. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 101.

[0162] In some embodiments, the CIITA guide RNA is SEQ ID NO: 47, SEQ ID NO: 55, SEQ ID NO: 71, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 100 and SEQ ID NO: 101.

[0163] Additional embodiments of CIITA guide RNAs are provided herein, including, for example, exemplary modifications to the guide RNA.

[0164] 2. Genetic modification for CIITA In some embodiments, the methods and compositions disclosed herein genetically modify at least one nucleotide of a splice site of a CIITA gene in a cell. Because CIITA proteins regulate the expression of MHC class II, in some embodiments, genetic modifications to CIITA can alter the production of CIITA proteins on the surface of genetically modified cells (i.e., engineered cells). reduces the expression of MHC class II proteins. Genetic modifications include a series of modifications resulting from contact with a gene editing system (eg, a series of edits resulting from Cas9 and CIITA guide RNA, or a series of edits resulting from BC22 and CIITA guide RNA).

[0165] In some embodiments, the genetic modification comprises at least one nucleotide at a splice site within genomic coordinates chr16:10902171-10923242. In some embodiments, the genetic modification comprises at least one nucleotide at a splice site within genomic coordinates chr16:10903873-chr:10923242. In some embodiments, the genetic modification comprises at least one nucleotide at a splice site within genomic coordinates chr:16:10906485-chr:10923242. In some embodiments, the genetic modification comprises at least one nucleotide at a splice site within genomic coordinates chr16:10908130-chr:10923242.

[0166] In some embodiments, the genetic modification is chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-109090 42, chr16:10918512-10918532, chr16: 10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492 -10906512, chr16:10909006-10909026, chr16:10922478-10922498, chr16:10895747- 10895767, chr16:10916348-10916368, chr16:10910186-10910206, chr16:10906481-10906501, chr16:10909007-10909027, chr16:10895410-10895430 and at least one of the splice sites within the genomic coordinates selected from chr16:10908130-10908150 Contains one nucleotide.

[0167] In some embodiments, the genetic modification is chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-109090 42, chr16:10918512-10918532, chr16: 10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492 Genomic coordinates selected from -10906512, chr16:10909006-10909026 and chr16:10922478-10922498 at least one nucleotide of a splice site within.

[0168] In some embodiments, the genetic modification comprises at least one nucleotide of a splice site within genomic coordinates selected from chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, and chr16:10918504-10918524. including. In some embodiments, the genetic modification comprises at least one nucleotide at a splice site within genomic coordinates chr16:10908132-10908152. In some embodiments, the genetic modification comprises at least one nucleotide at a splice site within genomic coordinates chr16:10908131-10908151. In some embodiments, the genetic modification comprises at least one nucleotide at a splice site within genomic coordinates chr16:10916456-10916476. In some embodiments, the genetic modification comprises at least one nucleotide at a splice site within genomic coordinates chr16:10918504-10918524.

[0169] In some embodiments, the genetic modification is chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-109065 06, chr16:10906485-10906505, chr16: 10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, chr16:10922153 -10922173, chr16:10923222-10923242, chr16:10910176-10910196, chr16:10895742- 10895762, chr16:10916449-10916469, chr16:10923214-10923234, chr16:10906492-10906512, chr16:10906487-10906507.

[0170] In some embodiments, the genetic modification is chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-109065 06, chr16:10906485-10906505, chr16: 10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470 and chr16:10922153 Contains at least one nucleotide of a splice site within the genomic coordinates selected from -10922173 .

[0171] In some embodiments, the genetic modification comprises at least one nucleotide at a splice site within genomic coordinates selected from chr16:10918504-10918524, chr16:10923218-10923238, and chr16:10923219-10923239. In some embodiments, the genetic modification comprises at least one nucleotide at a splice site within genomic coordinates chr16:10918504-10918524. In some embodiments, the genetic modification comprises at least one nucleotide at a splice site within genomic coordinates chr16:10923218-10923238. In some embodiments, the genetic modification comprises at least one nucleotide at a splice site within genomic coordinates chr16:10923219-10923239.

[0172] In some embodiments, the genetic modification comprises at least 5 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. In some embodiments, the genetic modification comprises at least 10 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10902171-10923242.

[0173] In some embodiments, the modification to CIITA comprises any one or more of the following: insertion, deletion, substitution, or deamination of at least one nucleotide in the target sequence. In some embodiments, modifications to CIITA include insertions of 1, 2, 3, 4, or 5 or more nucleotides in the target sequence. In some embodiments, modifications to CIITA include deletions of 1, 2, 3, 4, or 5 or more nucleotides in the target sequence. In another embodiment, the modification to CIITA is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or Contains insertions of 25 or more nucleotides. In another embodiment, the modification to CIITA is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or Contains deletions of 25 or more nucleotides. In some embodiments, the modification to CIITA comprises an indel, which is generally defined in the art as an insertion or deletion of less than 1000 base pairs (bp). In some embodiments, modifications to CIITA include indels that result in frameshift mutations in the target sequence. In some embodiments, the modifications to CIITA are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 in the target sequence. or contains substitutions of 25 or more nucleotides. In some embodiments, modifications to CIITA include one or more of nucleotide insertions, deletions, or substitutions due to introduction of the template nucleic acid. In some embodiments, the modification to CIITA involves insertion of a donor nucleic acid at the target sequence. In some embodiments, the modification to CIITA is not transient.

[0174] In some embodiments, at least one nucleotide at the splice site is modified. In some embodiments, at least one nucleotide of the splice acceptor site is modified. In some embodiments, at least one nucleotide of the splice donor site is modified. In some embodiments, acceptor splice site boundary nucleotides are modified. In some embodiments, donor splice site boundary nucleotides are modified. In some embodiments, one of the conserved nucleotides of the splice acceptor site is modified. In some embodiments, the conserved nucleotide A of the splice acceptor site is modified. In some embodiments, the conserved nucleotide G of the splice acceptor site is modified. In some embodiments, one of the conserved nucleotides of the splice donor site is modified. In some embodiments, the conserved nucleotide G of the splice donor site is modified. In some embodiments, the conserved nucleotide T of the splice donor site is modified.

[0175] In some embodiments, nucleotides located 5 or fewer nucleotides from the acceptor splice site boundary nucleotide are modified. In some embodiments, nucleotides located 4 or fewer nucleotides from the acceptor splice site boundary nucleotide are modified. In some embodiments, nucleotides located three or fewer nucleotides from the acceptor splice site boundary nucleotide are modified. In some embodiments, nucleotides located two or fewer nucleotides from the acceptor splice site boundary nucleotide are modified. In some embodiments, nucleotides located one nucleotide or less from the acceptor splice site boundary nucleotide are modified.

[0176] In some embodiments, nucleotides located 5 or fewer nucleotides from the border of the donor splice site are modified. In some embodiments, nucleotides located 4 or fewer nucleotides from the donor splice site boundary nucleotide are modified. In some embodiments, nucleotides located three or fewer nucleotides from the donor splice site boundary nucleotide are modified. In some embodiments, nucleotides located two or fewer nucleotides from the donor splice site boundary nucleotide are modified. In some embodiments, nucleotides located one nucleotide or less from the donor splice site boundary nucleotide are modified.

[0177] In some embodiments, the methods and compositions disclosed herein use an RNA-guided DNA binding agent (eg, a Cas enzyme) to modify the splice site of CIITA in a cell. In some embodiments, the RNA-guided DNA binding agent is Cas9. In some embodiments, the RNA-guided DNA binding agent cleaves CIITA no more than 5 nucleotides from the splice site boundary nucleotide, and the CIITA guide RNA cleaves at least 10 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. Target CIITA genomic target sequences containing nucleotides that In some embodiments, the RNA-guided DNA binding agent cleaves CIITA no more than 4 nucleotides from the splice site boundary nucleotide, and the CIITA guide RNA cleaves at least 10 consecutive nucleotides within genomic coordinates chr16:10902171-10923242. Target CIITA genomic target sequences containing nucleotides that In some embodiments, the RNA-guided DNA binding agent cleaves CIITA no more than 3 nucleotides from a splice site boundary nucleotide, and the CIITA guide RNA cleaves at least 10 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. Target CIITA genomic target sequences containing nucleotides that In some embodiments, the RNA-guided DNA binding agent cleaves CIITA no more than 2 nucleotides from the splice site boundary nucleotide, and the CIITA guide RNA cleaves at least 10 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. Target CIITA genomic target sequences containing nucleotides that In some embodiments, the RNA-guided DNA binding agent cleaves CIITA no more than one nucleotide from the splice site boundary nucleotide, and the CIITA guide RNA cleaves at least 10 consecutive nucleotides within genomic coordinates chr16:10902171-10923242. Target CIITA genomic target sequences containing nucleotides that In some embodiments, the RNA-guided DNA binding agent cleaves CIITA at a splice site boundary nucleotide, and the CIITA guide RNA comprises at least 10 contiguous nucleotides within genomic coordinates chr16:10902171-10923242. Target CIITA genomic target sequences. In some embodiments, the splice site boundary nucleotide is an acceptor splice site boundary nucleotide. In some embodiments, the splice site boundary nucleotide is a donor splice site boundary nucleotide.

[0178] In some embodiments, the genetic modification to CIITA inactivates the splice site, ie, no splicing occurs at the modified splice site. In some embodiments, the genetic modification to CIITA inactivates the splice acceptor site. In some embodiments, the genetic modification to CIITA inactivates the splice donor site.

[0179] In some embodiments, the genetic modification to the CIITA splice site removes all three nucleotides of the splice site. In some embodiments, the genetic modification removes two nucleotides at the splice site. In some embodiments, the genetic modification removes one nucleotide at the splice site. In some embodiments, genetic modification to the CIITA splice site removes one or two nucleotides of its splice acceptor site. In some embodiments, genetic modification to the CIITA splice site removes one or two nucleotides of its splice donor site. In some embodiments, at least one nucleotide of the splice site is deleted. In some embodiments, at least 2 nucleotides of the splice site are deleted. In some embodiments, acceptor splice site boundary nucleotides are deleted. In some embodiments, donor splice site boundary nucleotides are deleted.

[0180] In some embodiments, genetic modifications to CIITA utilize out-of-frame stop codons. In some embodiments, genetic modifications to CIITA result in exon skipping during splicing. In some embodiments, the genetic modification to CIITA reduces expression of CIITA protein by the cell. In some embodiments, the genetic modification to CIITA reduces CIITA in the cell nucleus. In some embodiments, modifications to the CIITA splice site reduce expression of MHC class II proteins on the surface of the cell.

[0181] In some embodiments, genetic modification to CIITA results in a truncated form of the CIITA protein. In some embodiments, the truncated form of the CIITA protein does not bind GTP. In some embodiments, the truncated form of the CIITA protein is not localized to the nucleus. In some embodiments, the CIITA protein (eg, a truncated CIITA protein) has reduced activity relative to the activity of wild-type CIITA protein with respect to modulating MHC class II expression. In some embodiments, reducing CIITA protein activity reduces MHC class II expression at the cell surface. In some embodiments, reduced CIITA protein activity results in the absence of MHC class II expression on the cell surface.

[0182] 3. Efficacy of CIITA guide RNA The efficacy of the CIITA guide RNA can be determined by evaluating the editing efficiency of the guide RNA, the level of CIITA protein and / or CIITA mRNA, and / or the level of MHC class II in target cells, among the techniques available in the art. You can find it by In some embodiments, reduction or elimination of HLA-A protein on the surface of a cell may be determined by comparison to unmodified cells (ie, "relative to unmodified cells"). An engineered cell or cell population may be compared to an unmodified cell population.

[0183] In some embodiments, the efficacy of the CIITA guide RNA is determined by measuring the level of CIITA protein in the cell. Levels of CIITA protein may be detected, for example, in cell lysates and Western blotting using anti-CIITA antibodies. In some embodiments, the potency of the CIITA guide RNA is determined by measuring the level of CIITA protein in the cell nucleus. In some embodiments, the efficacy of the CIITA guide RNA is determined by measuring the level of CIITA mRNA within the cell. Levels of CIITA mRNA may be detected, for example, by RT-PCR. In some embodiments, reduced levels of CIITA protein and / or CIITA mRNA in the target cell compared to unmodified cells indicates that the splice site CIITA guide RNA is effective.

[0184] "Unmodified cell" (or "unmodified cells") refers to a control cell (or control cells) of the same type of cell in an experiment or test, where the "unmodified" control cell is , not in contact with the CIITA guide (i.e., non-manipulated cells). Thus, an unmodified cell (or unmodified cells) may be a cell that has not been contacted with a guide RNA or a cell that has been contacted with a guide RNA that does not target CIITA.

[0185] In some embodiments, the efficacy of the CIITA guide RNA is determined by measuring the reduction or elimination of MHC class II proteins expressed by target cells. CIITA proteins function as transactivators to activate MHC class II promoters and are essential for the expression of MHC class II proteins. In some embodiments, MHC class II protein expression may be detected on the surface of target cells. In some embodiments, MHC class II protein expression is measured by flow cytometry. In some embodiments, antibodies to MHC class II proteins (eg, anti-HLA-DR,-DQ,-DP) may be used to detect expression of MHC class II proteins, eg, by flow cytometry. In some embodiments, the reduction or elimination of MHC class II proteins on the surface of the cell (or cell population) compared to unmodified cells (unmodified cell population) indicates that the CIITA guide RNA is effective. It is shown that. In some embodiments, a cell (or population of cells) contacted with a particular CIITA guide RNA and an RNA-guided DNA binding agent that is negative for MHC class II protein by flow cytometry. population) shows that CIITA guide RNA is effective.

[0186] In some embodiments, the methods and compositions disclosed herein are used to reduce or eliminate expression of MHC class II proteins in a cell population. In some embodiments, the cell population is enriched (e.g., by FACS or MACS) and is at least 65%, 70%, 80%, as measured by flow cytometry, compared to an unmodified cell population. 90%, 91%, 92%, 93% or 94% MHC class II negative. In some embodiments, the cell population is not enriched (e.g., by FACS or MACS) and is at least 65%, 70%, 80% more enriched than the unmodified cell population as measured by flow cytometry. %, 90%, 91%, 92%, 93% or 94% MHC class II negative.

[0187] In some embodiments, the cell population is at least 65% MHC class II negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 70% MHC class II negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 80% MHC class II negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 90% MHC class II negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 91% MHC class II negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 92% MHC class II negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 93% MHC class II negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 94% MHC class II negative as measured by flow cytometry as compared to the unmodified cell population.

[0188] In some embodiments, the potency of a CIITA guide RNA (i.e., the potency of that guide RNA) is determined by the distance between the cleavage site (e.g., the cleavage site created by Cas9) in the genomic target sequence and the splice site boundary nucleotide in CIITA. related to. In some embodiments, there is a correlation between distance (calculated as the number of nucleotides between the cleavage site and the splice site boundary nucleotide) and the lack of MHC class II expression. In some embodiments, the shorter the distance between the splice site boundary nucleotide and the cleavage site (eg, the cleavage site created by Cas9), the greater the reduction in MHC class II expressed by the target cell. In some embodiments, the distance between the splice site boundary nucleotides in CIITA and the cleavage site in the genomic target sequence is no more than 5 nucleotides, no more than 4 nucleotides, no more than 3 nucleotides, no more than 2 nucleotides, or no more than 1 nucleotide. In some embodiments, the cleavage site is 5' to the splice site boundary nucleotide. In some embodiments, the cleavage site is 3' to the splice site boundary nucleotide. In some embodiments, the CIITA splice site boundary is an acceptor splice site boundary nucleotide. In some embodiments, the CIITA splice site boundary is a donor splice site boundary nucleotide.

[0189] In some embodiments, effective CIITA guide RNA may be determined by measuring the response of immune cells (eg, CD4+ T cells) in vitro or in vivo to genetically modified target cells. CD4+ T cell responses can be determined (e.g., by flow cytometry, ELISA) by CD4+ T cell activation responses, e.g., CD4+ T cell proliferation, expression of activation markers, and / or production of cytokines (IL-2, may be assessed by assays that measure IL-12, IFN-γ). CD4+ T cell responses may be assessed in in vitro cell culture assays in which cells containing CD4+ T cells are co-cultured with genetically modified cells. For example, genetically modified cells may be co-cultured with, for example, PBMCs, purified CD3+ T cells, including CD4+ T cells, purified CD4+ T cells, or CD4+ T cell lines. CD4+ T cell responses elicited from genetically modified cells may be compared to responses elicited from unmodified cells. The reduced response from CD4+ T cells indicates that the CIITA guide RNA is effective.

[0190] Efficacy of CIITA guide RNA may also be assessed by cell survival after editing. In some embodiments, the cells survive at least 1 week to 6 weeks after editing. In some embodiments, the cells survive at least 1 week to 12 weeks after editing. In some embodiments, the cells survive for at least 2 weeks after editing. In some embodiments, the cells survive for at least 3 weeks after editing. In some embodiments, the cells survive for at least 4 weeks after editing. In some embodiments, the cells survive for at least 5 weeks after editing. In some embodiments, the cells survive for at least 6 weeks after editing. Viability of genetically modified cells may be determined using standard techniques, including, for example, by measuring cell death, flow cytometry, Live / Dead staining, or cell proliferation.

[0191] C. Methods and compositions for reducing or eliminating MHC class II and making additional modifications 1.MHC class I knockout In some embodiments, as disclosed herein, methods are provided for reducing or eliminating expression of MHC class II proteins at the cell surface by genetically modifying CIITA, the methods further comprising: , reducing or eliminating the expression of MHC class I proteins on the cell surface compared to unmodified cells. In one approach, MHC class I protein expression is reduced or eliminated by genetically modifying the B2M gene. In some embodiments, MHC class I protein expression is reduced or eliminated by contacting the cell with a B2M guide RNA. In another approach, the expression of the MHC class I protein HLA-A is reduced or eliminated by genetically modifying HLA-A, thereby reducing or eliminating the surface expression of HLA-A in human cells and its Human cells are homozygous for HLA-B and homozygous for HLA-C. That is, in some embodiments, HLA-A protein expression is reduced or eliminated by contacting a human cell with an HLA-A guide RNA, and the human cell is homozygous for HLA-B. Yes, and homozygous for HLA-C. In some embodiments, the resulting cells are allogeneic cells.

[0192] In some embodiments, the method includes reducing expression of an MHC class II protein on the surface of the cell, and includes genetically modifying the CIITA, the cell and the CIITA disclosed herein. The method further includes contacting the cell with a B2M guide RNA. In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent. In some embodiments, the method further comprises inducing a DSB or SSB with the B2M target sequence. In some embodiments, expression of B2M is thereby reduced by the cell. In some embodiments, MHC class I protein expression is thereby reduced by the cell.

[0193] In some embodiments, the method includes inactivating a splice site in CIITA, and includes contacting the cell with a composition comprising a CIITA guide RNA disclosed herein; The method further includes contacting the cell with a B2M guide RNA. In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent. In some embodiments, the method further comprises inducing a DSB or SSB with the B2M target sequence. In some embodiments, expression of B2M is thereby reduced by the cell. In some embodiments, MHC class I protein expression is thereby reduced by the cell.

[0194] In some embodiments, the method includes inducing a DSB or SSB with CIITA, and includes contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, The method further includes contacting the cell with a B2M guide RNA. In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent. In some embodiments, the method further comprises inducing a DSB or SSB with the B2M target sequence. In some embodiments, expression of B2M is thereby reduced by the cell. In some embodiments, MHC class I protein expression is thereby reduced by the cell.

[0195] In some embodiments, the method includes reducing expression of a CIITA protein in the cell, and includes delivering to the cell a composition comprising a CIITA guide RNA disclosed herein; The method further includes contacting the cell with a B2M guide RNA. In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent. In some embodiments, the method further comprises inducing a DSB or SSB with the B2M target sequence. In some embodiments, expression of B2M is thereby reduced by the cell. In some embodiments, MHC class I protein expression is thereby reduced by the cell.

[0196] In some embodiments, the B2M guide RNA targets the human B2M gene.

[0197] In some embodiments, the B2M guide RNA comprises SEQ ID NO: 701. In some embodiments, the B2M guide RNA comprises a guide sequence that is at least 17, 18, 19 or 20 contiguous nucleotides of SEQ ID NO: 701. In some embodiments, the B2M guide RNA comprises a guide sequence that is at least 95%, 90% or 85% identical to SEQ ID NO:701.

[0198] Additional embodiments of B2M guide RNAs are provided herein, including, for example, exemplary modifications to the guide RNAs.

[0199] In some embodiments, the efficacy of the B2M guide RNA is determined by measuring the level of B2M protein in the cells compared to unmodified cells. In some embodiments, the potency of the B2M guide RNA is determined by measuring the level of B2M protein expressed by the cell. In some embodiments, an antibody to B2M protein (eg, anti-B2M) may be used to detect the level of B2M protein, eg, by flow cytometry. In some embodiments, the potency of the B2M guide RNA is determined by measuring the level of B2M mRNA within the cell, eg, by RT-PCR. In some embodiments, the level of B2M protein or B2M mRNA is reduced or eliminated compared to the level of B2M protein in unmodified cells, indicating that the B2M guide RNA is effective. In some embodiments, a cell (or cell population) that is negative for B2M protein by flow cytometry compared to unmodified cells (or unmodified cell population) indicates that the B2M guide RNA is effective. ing. In some embodiments, the cells (or population of cells) contacted with a particular B2M guide RNA and an RNA-guided DNA binding agent are negative for MHC class I proteins by flow cytometry. ) indicates that B2M guide RNA is effective.

[0200] In some embodiments, the potency of the B2M guide RNA is determined by measuring the level of MHC class I proteins at the cell surface. In some embodiments, the level of MHC class I protein is measured by flow cytometry (eg, using antibodies to HLA-A, HLA-B, or HLA-C). In some embodiments, the cell population is at least 65% MHC I negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 70% MHC I negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 80% MHC class I negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 90% MHC I negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 95% MHC I negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 100% MHC class I negative as measured by flow cytometry as compared to the unmodified cell population.

[0201] In some embodiments, the method comprises reducing or eliminating surface expression of MHC class II proteins in the engineered cells compared to unmodified cells, and the method comprises reducing or eliminating surface expression of MHC class II proteins in the engineered cells compared to unmodified cells, contacting a composition comprising a guide RNA, the method further comprising: contacting a composition comprising a guide RNA; 42903, chr6 :29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-2994 Genomes selected from 3569, chr6:29943589-29943609 and chr6:29944026-29944046 reducing or eliminating expression of HLA-A in the cell by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within the coordinates. In some embodiments, the method comprises reducing or eliminating surface expression of MHC class II proteins in the engineered cells compared to unmodified cells, and the method comprises reducing or eliminating surface expression of MHC class II proteins in the engineered cells compared to unmodified cells, contacting a composition comprising a guide RNA, the method further comprising: contacting a composition comprising a guide RNA; 42903, chr6 :29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-2994 Genomes selected from 3569, chr6:29943589-29943609 and chr6:29944026-29944046 reducing or eliminating expression of HLA-A in the cell by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 10 contiguous nucleotides within the coordinates. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29942864-29942884. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29942868-29942888. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29942876-29942896. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29942877-29942897. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29942883-29942903. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943126-29943146. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943528-29943548. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943529-29943549. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943530-29943550. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943537-29943557. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943549-29943569. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943589-29943609. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29944026-29944046. In some embodiments, the gene editing system includes an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0202] In some embodiments, the method comprises reducing or eliminating surface expression of MHC class II proteins in the engineered cells compared to unmodified cells, and the method comprises reducing or eliminating surface expression of MHC class II proteins in the engineered cells compared to unmodified cells, The method further includes contacting the cell with an HLA-A guide RNA. In some embodiments, the HLA-A guide RNA comprises a guide sequence selected from SEQ ID NOs: 2001-2095 (the corresponding guide RNAs are SEQ ID NOs: 1811-1905 and 1906-2000) (see the table below). 2). In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0203] In some embodiments, a method of producing an engineered cell in which surface expression of MHC class II proteins is reduced or eliminated relative to an unmodified cell, the method comprising: a. contacting the cell with a CIITA guide RNA. b. Contacting the cell with HLA-A guide RNA (the HLA-A guide RNA includes a guide sequence selected from SEQ ID NOs: 1 to 117); b. c. contacting the cell with an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent, wherein the cell has surface expression of HLA-A on the cell. are reduced or eliminated compared to unmodified cells. In some embodiments, the method includes contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises S. pyogenes Cas9. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0204] Exemplary HLA-A guide RNAs are shown in Table 2 (guide sequences SEQ ID NOs: 2001-2095 (and corresponding guide RNA sequences SEQ ID NOs: 1811-1905 and 1906-2000).

[0205] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12] [Table 2-13] [Table 2-14] [Table 2-15] [Table 2-16] [Table 2-17] [Table 2-18] [Table 2-19] [Table 2-20] [Table 2-21] [Table 2-22] [Table 2-23] [Table 2-24] [Table 2-25] [Table 2-26] [Table 2-27]

[0206] In some embodiments, the efficacy of the HLA-A guide RNA is determined by measuring the level of HLA-A protein at the cell surface. In some embodiments, the level of HLA-A protein is measured by flow cytometry (eg, using antibodies to HLA-A2 and / or HLA-A3). In some embodiments, a cell population of the invention is at least 65% HLA-A negative as measured by flow cytometry as compared to an unmodified cell population. In some embodiments, the cell population is at least 70% HLA-A negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 80% HLA-A negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 90% HLA-A negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 95% HLA-A negative as measured by flow cytometry as compared to the unmodified cell population. In some embodiments, the cell population is at least 100% HLA-A negative as measured by flow cytometry as compared to the unmodified cell population.

[0207] In some embodiments, the efficacy of the B2M guide RNA or HLA-A guide enhances the response of immune cells (e.g., CD8+ T cells) in vitro or in vivo to genetically modified target cells compared to unmodified cells. It can be determined by measurement. For example, a reduced response from CD8+ T cells indicates that B2M guide RNA or HLA-A is effective. CD8+ T cell responses measure CD8+ T cell activation responses, e.g. CD8+ T cell proliferation, activation marker expression, and / or cytokine production (IL-2, IFN-γ, TNF-α) may be evaluated by assays (eg, flow cytometry, ELISA). CD8+ T cell responses may be assessed in vitro or in vivo. In some embodiments, CD8+ T cell responses may be assessed by co-culturing genetically modified cells with CD8+ T cells in vitro. In some embodiments, CD8+ T cell activity may be assessed in an in vivo model, such as a rodent model. In an in vivo model, for example, genetically modified cells may be administered together with CD8+ T cells, and survival of the genetically modified cells indicates their ability to evade lysis by CD8+ T cells. In some embodiments, the methods of the invention are performed in vivo in the presence of CD8+ T cells for more than 1 week, more than 2 weeks, more than 3 weeks, more than 4 weeks, more than 5 weeks, or more than 6 weeks, or A composition containing cells that survive for longer periods of time is created. In some embodiments, the method produces a composition comprising cells that survive in the presence of CD8+ T cells for at least 1 week to 6 weeks. In some embodiments, the method produces a composition comprising cells that survive in the presence of CD8+ T cells for at least 2-4 weeks in vivo. In some embodiments, the method produces a composition comprising cells that survive in the presence of CD8+ T cells for at least 4-6 weeks in vivo. In some embodiments, the method produces a composition comprising cells that survive in the presence of CD8+ T cells for more than 6 weeks in vivo.

[0208] In some embodiments, the method provides a composition comprising cells that have reduced or eliminated expression of MHC class II and have reduced or eliminated expression of MHC class I compared to unmodified cells. It is to be manufactured. In some embodiments, the method comprises reducing or eliminating the expression of an MHC class II protein, reducing or eliminating the expression of a CIITA protein, and / or reducing or eliminating the level of CIITA in the cell nucleus. A composition is produced that includes cells in which the expression of an MHC class I protein is eliminated and reduced. In some embodiments, the method comprises reducing or eliminating the expression of an MHC class II protein, reducing or eliminating the expression of a CIITA protein, and / or reducing or eliminating the level of CIITA in the cell nucleus. A composition is created that includes cells in which the expression of a B2M protein is reduced and eliminated. In some embodiments, the method comprises reducing or eliminating the expression of an MHC class II protein, reducing or eliminating the expression of a CIITA protein, and / or reducing or eliminating the level of CIITA in the cell nucleus. and in which the level of B2M mRNA is reduced or eliminated. In some embodiments, the cells induce a reduction or elimination of responses from CD8+ T cells.

[0209] In some embodiments, the method provides a composition comprising cells that have reduced or eliminated expression of MHC class II and have reduced or eliminated expression of HLA-A compared to unmodified cells. and the cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the method comprises reducing or eliminating the expression of an MHC class II protein, reducing or eliminating the expression of a CIITA protein, and / or reducing or eliminating the level of CIITA in the cell nucleus. A composition is produced that includes cells in which the expression of an HLA-A protein is eliminated and reduced. In some embodiments, the method comprises reducing or eliminating the expression of an MHC class II protein, reducing or eliminating the expression of a CIITA protein, and / or reducing or eliminating the level of CIITA in the cell nucleus. and / or in which expression of an HLA-A protein is eliminated or reduced. In some embodiments, the cells induce a reduction or elimination of responses from CD8+ T cells.

[0210] In some embodiments, an engineered cell is provided in which expression of MHC class II proteins and MHC class I proteins at the cell surface is reduced or eliminated, the cell comprises a genetic modification to CIITA, and the cell comprises: Includes modification in B2M. In some embodiments, the allogeneic cells induce a reduced response from CD4+ T cells and induce a reduced response from CD8+ T cells.

[0211] In some embodiments, an engineered cell is provided in which expression of MHC class II proteins and HLA-A proteins at the cell surface is reduced or eliminated, the cell comprises a genetic modification to CIITA, and the cell comprises: The cell contains a genetic modification in the HLA-A gene, and the cell is homozygous for HLA-B and homozygous for HLA-C. In some embodiments, an engineered cell is provided in which expression of MHC class II proteins and HLA-A proteins at the cell surface is reduced or eliminated, the cell comprises a genetic modification to CIITA, and the cell comprises: Contains genetic modifications to the HLA-A gene. In some embodiments, the cell is homozygous for HLA-B and HLAC. In some embodiments, the cells induce a decreased response from CD4+ T cells and induce a decreased response from CD8+ T cells.

[0212] 2.Exogenous nucleic acid In some embodiments, the present disclosure provides methods and compositions for reducing or eliminating expression of MHC class II proteins at the cell surface by genetically modifying CIITA, as disclosed herein. The methods and compositions further provide for expression of exogenous nucleic acids by the engineered cells.

[0213] a) Knock-in of NK cell inhibitor In some embodiments, the present disclosure provides methods of reducing or eliminating expression of MHC class II proteins at the cell surface by genetically modifying CIITA as disclosed herein; The method further includes expressing an exogenous nucleic acid by the cell, the exogenous nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, the NK cell inhibitor molecule is expressed on the cell surface, thereby circumventing NK cell activity (eg, cytolysis by NK cells). In some embodiments, the ability of genetically modified cells to evade lysis by NK cells makes them amenable to adoptive cell transfer therapy. In some embodiments, the cell is an allogeneic cell.

[0214] In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the cell surface, and includes genetically modifying CIITA, the cell and the method disclosed herein. The method further includes contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the surface of a cell, including modifying CIITA, and injecting the disclosed CIITA guide RNA into the cell. The method further comprises contacting the cell with a composition comprising a nucleic acid encoding an NK cell inhibitor molecule, and a B2M guide RNA (the B2M guide RNA induces expression of an MHC class I protein at the cell surface). (reducing). In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent.

[0215] In some embodiments, the method includes reducing or eliminating expression of MHC class II proteins at the cell surface, and includes a CIITA guide RNA, B2M guide RNA, NK cell inhibitor disclosed herein. Genetic modification of the cell with one or more compositions comprising a nucleic acid encoding a molecule and an RNA-guided DNA binding agent, or a nucleic acid encoding an RNA-guided DNA binding agent.

[0216] In some embodiments, the method includes inactivating a splice site of CIITA and includes contacting a cell with a composition comprising a CIITA guide RNA disclosed herein, The method further includes contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, the method includes inactivating a splice site of CIITA and includes contacting a cell with a composition comprising a CIITA guide RNA disclosed herein, The method further includes contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule and a B2M guide RNA that reduces expression of MHC class I proteins on the cell surface. In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent.

[0217] In some embodiments, the method includes inducing a DSB or SSB with CIITA, and includes contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, The method further includes contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, the method comprises inducing a DSB or SSB with CIITA, and comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein; The method further includes contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule and a B2M guide RNA that reduces expression of MHC class I proteins on the cell surface. . In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent.

[0218] In some embodiments, the method comprises reducing or eliminating expression of a CIITA protein in a cell, comprising delivering a composition comprising a CIITA guide RNA disclosed herein, and comprising: The method further includes contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, the method comprises reducing expression of a CIITA protein in a cell, the method comprises delivering a composition comprising a CIITA guide RNA disclosed herein, and the method comprises: It further includes contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule and a B2M guide RNA that reduces the expression of MHC class I proteins on the cell surface. In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent.

[0219] In some embodiments, the NK cell inhibitor molecule binds to an inhibitory receptor on a NK cell. In some embodiments, the NK cell inhibitor molecule binds to an MHC class I-specific inhibitory receptor. In some embodiments, the NK cell inhibitor molecule binds to an inhibitory receptor that is not specific for MHC class I. Examples of NK cell inhibitory receptors include KIR (human), CD94-NKG2A heterodimer (human / mouse), Ly49 (mouse), 2B4, SLAMF6, NKFP-B, TIGIT, and KIR2DL4.

[0220] In some embodiments, the NK cell inhibitor molecule binds NKG2A.

[0221] In some embodiments, the NK cell inhibitor molecule is an MHC class I molecule. In some embodiments, the NK cell inhibitor molecule is a classical MHC class I molecule. In some embodiments, the NK cell inhibitor molecule is a non-classical MHC class I molecule. In some embodiments, the NK cell inhibitor molecule is an HLA molecule. NK cell inhibitor molecules include, for example, HLA-C, HLA-E, HLA-G, Cd1, CD48, SLAMF6, Clr-b, and CD155.

[0222] In some embodiments, the NK cell inhibitor molecule is HLA-E.

[0223] In some embodiments, the NK cell inhibitor molecule is a fusion protein. In some embodiments, the NK cell inhibitor molecule is a fusion protein that includes HLA-E. In some embodiments, the NK cell inhibitor molecule comprises B2M. In some embodiments, the NK cell inhibitor molecules include HLA-E and B2M. In some embodiments, the fusion protein includes a linker. In some embodiments, the HLA-E construct is provided in a vector. In some embodiments, the vector containing the HLA-E construct is a lentiviral vector. In some embodiments, the HLA-E construct is delivered to the cell via lentiviral transfer.

[0224] In some embodiments, the NK cell inhibitor molecule inserts into the genome of the target cell. In some embodiments, the NK cell inhibitor molecule integrates into the genome of the target cell. In some embodiments, the NK cell inhibitor molecule integrates into the genome of the target cell by homologous recombination (HR). In some embodiments, the NK cell inhibitor molecule integrates into the target cell's genome by blunt-end insertion. In some embodiments, the NK cell inhibitor molecule integrates into the genome of the target cell by non-homologous end joining. In some embodiments, the NK cell inhibitor molecule integrates into a safe harbor locus in the cell's genome. In some embodiments, the NK cell inhibitor molecule integrates into one of the TRAC locus, the B2M locus, the AAVS1 locus, and / or the CIITA locus. In some embodiments, the NK cell inhibitor molecule is provided to the cell in a lipid nucleic acid assembly composition. In some embodiments, the lipid nucleic acid assembly composition is a lipid nanoparticle (LNP).

[0225] In some embodiments, the method creates engineered cells that induce a reduced response from NK cells. NK cell responses may be assessed in vitro or in vivo. In some embodiments, NK cell activity may be assessed by co-culturing genetically modified cells with NK cells in vitro. In some embodiments, NK cell activity may be assessed in an in vivo model, such as a rodent model. In an in vivo model, for example, genetically modified cells may be administered together with NK cells, and survival of the genetically modified cells indicates their ability to evade lysis by NK cells. In some embodiments, the methods of the invention are performed in vivo in the presence of NK cells for more than 1 week, more than 2 weeks, more than 3 weeks, more than 4 weeks, more than 5 weeks, or more than 6 weeks, or more. A composition containing cells that survive for more than 20 days is produced. In some embodiments, the method produces a composition comprising cells that survive in the presence of NK cells for at least 1-6 weeks in vivo. In some embodiments, the method produces a composition comprising cells that survive in the presence of NK cells for at least 2-4 weeks in vivo. In some embodiments, the method produces a composition comprising cells that survive in the presence of NK cells for at least 4-6 weeks in vivo. In some embodiments, the method produces a composition comprising cells that survive in the presence of NK cells for more than 6 weeks in vivo.

[0226] In some embodiments, the method produces a composition that includes an engineered cell that has reduced or eliminated expression of MHC class II and that includes a nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, the method creates a composition comprising engineered cells in which cell surface expression of MHC class II and expression of NK cell inhibitor molecules is reduced or eliminated. In some embodiments, the method produces a composition comprising cells that have reduced or eliminated expression of MHC class II and that induces a reduced response from NK cells. In some embodiments, the method comprises reducing or eliminating the expression of an MHC class II protein, reducing or eliminating the expression of a CIITA protein, and / or reducing or eliminating the level of CIITA in the cell nucleus. and induce a reduced response from NK cells to create a composition comprising cells in which expression of MHC class I proteins is reduced or eliminated. In some embodiments, the cells induce a reduced response from CD4+ T cells, CD8+ T cells, and / or NK cells.

[0227] In some embodiments, allogeneic cells are provided that have reduced or eliminated expression of MHC class II proteins and MHC class I proteins at the cell surface, and the cells are The cell contains a modification on CIITA, the cell contains a modification on B2M, and the cell contains a nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, the allogeneic cells induce a reduced response from CD4+ T cells, CD8+ T cells and / or NK cells.

[0228] b) Targeting receptors and other polypeptides expressed on the cell surface and secreted polypeptides In some embodiments, the present disclosure provides methods of reducing or eliminating expression of MHC class II proteins at the cell surface by genetically modifying CIITA as disclosed herein; The method further includes one or more exogenous nucleic acids (e.g., antibodies, chimeric antigen receptors (CARs), T cell receptors (TCRs), cytokines or cytokine receptors, chemokines or chemokine receptors, enzymes, fusion proteins, or other types of cell surface binding or soluble polypeptides). In some embodiments, the exogenous nucleic acid encodes a protein expressed on the cell surface. For example, in some embodiments, the exogenous nucleic acid encodes a targeting receptor (described further herein) that is expressed on the cell surface. In some embodiments, the genetically modified cells of the invention serve, for example, as a source for continuous production of polypeptides in vivo (as further described herein). can function as a "cellular factory" expressing secreted polypeptides encoded by exogenous nucleic acids. In some embodiments, the cell is an allogeneic cell.

[0229] In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the cell surface, and includes genetically modifying CIITA, the cell and the method disclosed herein. The method further includes contacting the cell with a composition comprising a CIITA guide RNA, such as a CIITA guide RNA. In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the cell surface, and includes genetically modifying CIITA, the cell and the method disclosed herein. The method further comprises contacting the cell with a composition comprising a CIITA guide RNA such as reducing or eliminating expression). In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein at the cell surface, comprising genetically modifying a splice site of a CIITA gene, the method further comprises contacting the cell with a composition comprising a CIITA guide RNA as disclosed in (eg, a secreted polypeptide), and a B2M guide RNA that reduces or eliminates expression of MHC class I proteins at the cell surface. In some embodiments, the method includes contacting the cell with two or more exogenous nucleic acids. In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent.

[0230] In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the cell surface, and includes genetically modifying CIITA, the cell and the method disclosed herein. The method further includes contacting the cell with a composition comprising a CIITA guide RNA, such as a CIITA guide RNA. In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the cell surface, and includes genetically modifying CIITA, the cell and the method disclosed herein. The method further comprises contacting the cell with a composition comprising a CIITA guide RNA such as -A protein expression is reduced or eliminated). In some embodiments, the method comprises reducing or eliminating expression of HLA-A protein at the surface of a cell, comprising genetically modifying a splice site of a CIITA gene, and comprising: the method further comprises contacting the cell with a composition comprising a CIITA guide RNA as disclosed in (eg, a secreted polypeptide), and an HLA-A guide RNA that reduces or eliminates expression of HLA-A protein at the cell surface. In some embodiments, the method includes contacting the cell with two or more exogenous nucleic acids. In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent.

[0231] In some embodiments, the method comprises reducing or eliminating expression of MHC class II proteins at the cell surface, CIITA guide RNA, B2M guide RNA, NK cells as disclosed herein. one or more exogenous nucleic acids encoding an inhibitor molecule, an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor), and an RNA-guided DNA-binding agent, or a nucleic acid encoding an RNA-guided DNA-binding agent. The composition includes genetically modifying the cell.

[0232] In some embodiments, the method includes reducing or eliminating the expression of MHC class II proteins and MHC class I proteins at the cell surface, and the method comprises reducing or eliminating expression of MHC class II proteins and MHC class I proteins at the cell surface, and includes CIITA guide RNA, B2M, as disclosed herein. a guide RNA, an exogenous nucleic acid encoding an NK cell inhibitor molecule, an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor), and an RNA-guided DNA binding agent, or a nucleic acid encoding an RNA-guided DNA binding agent. genetically modifying the cell with one or more compositions comprising.

[0233] In some embodiments, the method includes inactivating a CIITA splice site and contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein. The method further includes contacting the cell with an exogenous nucleic acid. In some embodiments, the method includes inactivating a CIITA splice site and contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein. The method further includes contacting the cell with an exogenous nucleic acid and a B2M guide that reduces expression of MHC class I proteins on the cell surface. In some embodiments, the method includes inactivating a CIITA splice site and contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein. The method further comprises combining the cell with an exogenous nucleic acid, a nucleic acid encoding an NK cell inhibitor, and a B2M guide RNA (the B2M guide RNA reduces expression of MHC class I proteins on the cell surface). Including bringing into contact. In some embodiments, the method includes inactivating a CIITA splice site and contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein. The method further includes contacting the cell with an exogenous nucleic acid and a nucleic acid encoding an NK cell inhibitor. In some embodiments, the method includes contacting the cell with two or more exogenous nucleic acids. In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent.

[0234] In some embodiments, the method includes inactivating a CIITA splice site and contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein. The method further includes contacting the cell with an exogenous nucleic acid. In some embodiments, the method includes inactivating a CIITA splice site and contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein. The method further includes contacting the cell with an exogenous nucleic acid and an HLA-A guide, the HLA-A guide reducing expression of HLA-A protein on the cell surface. In some embodiments, the method includes contacting the cell with two or more exogenous nucleic acids. In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent.

[0235] In some embodiments, the exogenous nucleic acid encodes a polypeptide that is expressed on the cell surface. In some embodiments, the exogenous nucleic acid encodes a soluble polypeptide. As used herein, "soluble" polypeptide refers to a polypeptide that is secreted by a cell. In some embodiments, the soluble polypeptide is a therapeutic polypeptide. In some embodiments, the soluble polypeptide is an antibody. In some embodiments, the soluble polypeptide is an enzyme. In some embodiments, the soluble polypeptide is a cytokine. In some embodiments, the soluble polypeptide is a chemokine. In some embodiments, the soluble polypeptide is a fusion protein.

[0236] In some embodiments, the foreign nucleic acid encodes an antibody. In some embodiments, the foreign nucleic acid encodes an antibody fragment (eg, Fab, Fab2). In some embodiments, the foreign nucleic acid encodes a full-length antibody. In some embodiments, the foreign nucleic acid encodes a single chain antibody (eg, scFv). In some embodiments, the antibody is IgG, IgM, IgD, IgA or IgE. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgG1 antibody. In some embodiments, the antibody is an IgG4 antibody. In some embodiments, the heavy chain constant region includes mutations known to reduce effector function. In some embodiments, the heavy chain constant region includes mutations known to enhance effector function. In some embodiments, the antibody is a bispecific antibody. In some embodiments, the antibody is a single domain antibody (eg, a VH domain only antibody).

[0237] In some embodiments, the foreign nucleic acid encodes a neutralizing antibody. Neutralizing antibodies neutralize the activity of the target antigen. In some embodiments, the antibody is a neutralizing antibody directed against a viral antigen. In some embodiments, the antibody neutralizes the target viral antigen and blocks the ability of the virus to infect cells. In some embodiments, a cell-based neutralization assay may be used to measure the neutralizing activity of an antibody. The specific cells and readout will depend on the target antigen of the neutralizing antibody. In cell-based neutralization assays, the half-maximal effective concentration (EC 50 ) can be measured, and EC 50 The lower the value, the stronger the neutralizing antibody.

[0238] In some embodiments, the foreign nucleic acid encodes an antibody that binds to an antigen associated with a disease or disorder (see, eg, Diseases and Disorders described in Section IV).

[0239] In some embodiments, the exogenous nucleic acid encodes a polypeptide that is expressed on the cell surface (ie, a cell surface binding protein). In some embodiments, the foreign nucleic acid encodes a targeting receptor. A "targeting receptor" is a receptor that is present on the surface of a cell, such as a T cell, and causes that cell to bind to a target site, such as a specific cell or tissue within an organism. In some embodiments, the targeting receptor is a CAR. In some embodiments, the targeting receptor is a universal CAR (UniCAR). In some embodiments, the targeting receptor is a TCR. In some embodiments, the targeting receptor is TRuC. In some embodiments, the targeting receptor is a B cell receptor (BCR) (eg, a receptor expressed on B cells). In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is a cytokine receptor.

[0240] In some embodiments, targeting receptors include chimeric antigen receptors (CARs), T-cell receptors (TCRs), and receptors for cell surface molecules that have at least a transmembrane content in their intracellular signaling domain. These include receptors that are operably linked through domains and can activate T cells when bound by an extracellular receptor moiety. In some embodiments, CAR refers to an extracellular antigen recognition domain, e.g., scFv, VHH, nanobody, operably linked to an intracellular signaling domain that, upon antigen binding, activates a T cell. . CAR is composed of four regions: an antigen recognition domain, an extracellular hinge region, a transmembrane domain, and an intracellular T cell signaling domain. Such receptors are well known in the art (see eg WO2020092057, WO2019191114, WO2019147805, WO2018208837). Universal CARs (UniCARs) that recognize various antigens (see e.g. EP2990416A1) and Reversed Universal CARs (RevCARs) that promote binding of immune cells to target cells through adapter molecules (see e.g. WO2019238722) ) is also assumed. CARs can be targeted to any antigen for which antibodies can be developed and are typically directed to molecules displayed on the surface of the targeted cells or tissues. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain) and a subunit of a TCR (e.g., TRuC). (See Baeuerle et al. Nature Communications 2087 (2019) I want to be.)

[0241] In some embodiments, the foreign nucleic acid encodes a TCR. In some embodiments, the foreign nucleic acid encodes a genetically modified TCR. In some embodiments, the exogenous nucleic acid encodes a genetically modified TCR that has specificity for a polypeptide expressed by cancer cells. In some embodiments, the foreign nucleic acid encodes a targeting receptor specific for Wilms tumor gene (WT1) antigen. In some embodiments, the foreign nucleic acid encodes a WT1-specific TCR (see, eg, WO2020 / 081613A1).

[0242] In some embodiments, the exogenous nucleic acid is inserted into the genome of the target cell. In some embodiments, the exogenous nucleic acid integrates into the genome of the target cell. In some embodiments, the exogenous nucleic acid integrates into the genome of the target cell by homologous recombination (HR). In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell by blunt-end insertion. In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell by non-homologous end joining. In some embodiments, the foreign nucleic acid integrates into a safe harbor locus in the genome of the cell. In some embodiments, the foreign nucleic acid integrates into one of the TRAC locus, the B2M locus, the AAVS1 locus, and / or the CIITA locus. In some embodiments, the exogenous nucleic acid is provided to the cell in a lipid nucleic acid assembly composition. In some embodiments, the lipid nucleic acid assembly composition is a lipid nanoparticle (LNP).

[0243] In some embodiments, the methods of the invention produce compositions that include engineered cells that have reduced or eliminated expression of MHC class II and that include exogenous nucleic acids. In some embodiments, the method includes the step of secreting and / or expressing a polypeptide encoded by an exogenous nucleic acid that has been integrated into the genome of the cell while MHC class II expression is reduced or eliminated. A composition containing cells is created. In some embodiments, the method comprises reducing or eliminating the expression of an MHC class II protein, reducing or eliminating the expression of a CIITA protein, and / or reducing or eliminating the level of CIITA in the cell nucleus. and induces a reduced response from NK cells, reduced expression of MHC class I proteins, and secretion and / or expression of polypeptides encoded by exogenous nucleic acids integrated into the genome of that cell. A composition containing engineered cells is prepared. In some embodiments, the engineered cells induce a reduction in responses from CD4+ T cells and / or CD8+ T cells.

[0244] In some embodiments, engineered cells are provided in which the expression of MHC class II proteins and MHC class I proteins at the cell surface is reduced or eliminated, the cells comprising: comprising a modification in CIITA, the cell comprising a modification in B2M, the cell comprising an exogenous nucleic acid encoding an NK cell inhibitor molecule, and the cell further encoding a polypeptide (e.g., a targeting receptor). Contains exogenous nucleic acids. In some embodiments, the engineered cells induce a reduction in responses from CD4+ T cells and / or CD8+ T cells.

[0245] In embodiments, engineered cells are provided in which the expression of MHC class II proteins and HLA-A proteins at the cell surface is reduced or eliminated, and the cells are modified with CIITA as disclosed herein. , the cell comprises a modification to the HLA-A gene, and the cell further comprises an exogenous nucleic acid encoding a polypeptide (eg, a targeting receptor). In some embodiments, the engineered cells induce a reduction in responses from CD4+ T cells and / or CD8+ T cells.

[0246] In some embodiments, the present disclosure provides methods of reducing or eliminating expression of MHC class II proteins at the cell surface by genetically modifying CIITA as disclosed herein; The method further reduces expression of one or more additional target genes (eg, TRAC, TRBC). In some embodiments, the additional genetic modification further provides an advantage when using the genetically modified cells in adoptive cell transfer applications. In some embodiments, the cell is an allogeneic cell.

[0247] In some embodiments, the methods of the invention include reducing or eliminating expression of MHC class II proteins at the cell surface, and include genetically modifying CIITA, the cells and the cells disclosed herein. contacting the cell with a composition comprising a CIITA guide RNA such as It involves contacting a guide RNA that directs the RNA-guided DNA binding agent to the target sequence, thereby reducing or eliminating expression of genes other than CIITA. In some embodiments, the method includes reducing expression of MHC class II proteins at the cell surface and includes genetically modifying CIITA, and the method includes reducing the expression of MHC class II proteins at the cell surface, the method further comprises contacting the cell with a composition comprising a CIITA guide RNA that directs the RNA-guided DNA binding agent to a target sequence located in another gene, and a B2M guide RNA. (reducing or eliminating expression of MHC class I proteins at the cell surface by B2M guide RNA). In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the cell surface, and includes genetically modifying CIITA, the cell and the method disclosed herein. the method further comprises contacting the cell with a composition comprising a CIITA guide RNA, the method further comprising directing the RNA-guided DNA binding agent to the target sequence located in the cell and another gene, thereby It involves contacting a guide RNA that reduces or eliminates expression of that other gene, and an exogenous nucleic acid encoding a polypeptide (eg, a targeting receptor).

[0248] In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the cell surface, and includes genetically modifying CIITA, the cell and the method disclosed herein. the method further comprises contacting the cell with a composition comprising a CIITA guide RNA such as Contacting a guide RNA that reduces the expression of another gene, a B2M guide RNA (B2M guide RNA reduces the expression of MHC class I proteins on the cell surface), and an exogenous nucleic acid encoding an NK cell inhibitor Including.

[0249] In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the cell surface, and includes genetically modifying CIITA, the cell and the method disclosed herein. the method further comprises contacting the cell with a composition comprising a CIITA guide RNA such as It involves contacting a guide RNA that reduces the expression of another gene and an HLA-A guide RNA (the HLA-A guide RNA reduces the expression of HLA-A protein on the cell surface).

[0250] In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the cell surface, and includes genetically modifying CIITA, the cell and the method disclosed herein. the method further comprises contacting the cell with a composition comprising a CIITA guide RNA such as encodes a guide RNA that reduces or eliminates the expression of another gene, a B2M guide RNA (B2M guide RNA reduces or eliminates the expression of MHC class I proteins at the cell surface), and a polypeptide (e.g., a targeting receptor) contact with an exogenous nucleic acid.

[0251] In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the cell surface, and includes genetically modifying CIITA, the cell and the method disclosed herein. The method further comprises contacting the cell with a composition comprising a CIITA guide RNA, such as a NK cell, and the guide RNA directing the RNA-guided DNA binding agent to a target sequence located on another gene. It involves contacting an exogenous nucleic acid encoding an inhibitor molecule and an exogenous nucleic acid encoding a polypeptide (eg, a targeting receptor).

[0252] In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the cell surface, and includes genetically modifying CIITA, the cell and the method disclosed herein. the method further comprises contacting the cell with a composition comprising a CIITA guide RNA such as a guide RNA that reduces the expression of another gene, and an HLA-A guide RNA (which reduces the expression of HLA-A protein at the cell surface), as well as a polypeptide (e.g., a targeting receptor). contacting the encoding exogenous nucleic acid.

[0253] In some embodiments, the method includes reducing or eliminating expression of an MHC class II protein at the cell surface, and includes genetically modifying CIITA, the cell and the method disclosed herein. the method further comprises contacting the cell with a composition comprising a CIITA guide RNA such as Guide RNA that reduces or eliminates the expression of additional genes, directing RNA-guided DNA binding agents to target sequences located on another gene, thereby reducing or eliminating the expression of MHC class I proteins at the cell surface comprising contacting a B2M guide RNA, an exogenous nucleic acid encoding a NK cell inhibitor molecule, and an exogenous nucleic acid encoding a polypeptide (eg, a targeting receptor). In some embodiments, the method further includes contacting the cell with an RNA-guided DNA binding agent.

[0254] In some embodiments, the method comprises reducing or eliminating expression of MHC class II proteins at the cell surface, CIITA guide RNA, B2M guide RNA, NK cells as disclosed herein. A foreign nucleic acid encoding an inhibitor molecule, a foreign nucleic acid encoding a polypeptide (e.g., a targeting receptor), directs an RNA-guided DNA binding agent to a target sequence located in another gene, thereby genetically modifying the cell with one or more compositions comprising a guide RNA that reduces or eliminates expression of the gene, and an RNA-guided DNA binding agent, or a nucleic acid encoding an RNA-guided DNA binding agent. .

[0255] In some embodiments, the method comprises reducing or eliminating expression of MHC class II proteins at the cell surface, CIITA guide RNA, HLA-A guide RNA, as disclosed herein, a foreign nucleic acid encoding a polypeptide (e.g., a targeting receptor); a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located on another gene, thereby reducing or eliminating expression of that other gene; , and genetically modifying the cell with one or more compositions comprising an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.

[0256] In some embodiments, the additional target gene is TRAC. In some embodiments, the additional target gene is TRBC.

[0257] D. Exemplary types of cells In some embodiments, the methods and compositions disclosed herein effect genetic modification of cells. In some embodiments, the cell is an allogeneic cell. In some embodiments, the cell is a human cell. In some embodiments, genetically modified cells are referred to as engineered cells. An engineered cell is a cell (or a progeny of a cell) that has undergone genetic modification by manipulation, and refers to, for example, a cell that has been brought into contact with a gene editing system and has been genetically modified by the gene editing system. The terms "engineered cell" and "genetically modified cell" are used interchangeably throughout. The engineered cell may be any of the exemplary cell types disclosed herein.

[0258] In some embodiments, the cell is an immune cell. As used herein, "immune cells" include, for example, lymphocytes (e.g., T cells, B cells, natural killer cells ("NK cells" and NKT cells or iNKT cells)), monocytes, macrophages, mast cells, Refers to cells of the immune system, including cells, dendritic cells, or granulocytes (eg, neutrophils, eosinophils, and basophils). In some embodiments, the cell is a primary immune cell. In some embodiments, the immune system cell is CD3 + T cells, CD4 + T cells and CD8 + It may be selected from T cells, regulatory T cells (Tregs), B cells, NK cells, and dendritic cells (DCs). In some embodiments, the immune cell is allogeneic.

[0259] In some embodiments, the cell is a lymphocyte. In some embodiments, the cell is an adoptive immune cell. In some embodiments, the cell is a T cell. In some embodiments, the cell is a B cell. In some embodiments, the cell is a NK cell. In some embodiments, the lymphocytes are allogeneic.

[0260] As used herein, a T cell can be defined as a cell that expresses a T cell receptor (“TCR”, or “αβ TCR” or “γδ TCR”); however, in some embodiments, The TCR of T cells may be genetically modified to reduce its expression (e.g., by genetic modification to the TRAC or TRBC genes) and thus used as a marker to identify T cells by standard flow cytometry methods. , expression of protein CD3 may be used. CD3 is a multisubunit signaling complex associated with the TCR. That is, T cells are sometimes referred to as CD3+. In some embodiments, the T cell is a cell that expresses a CD3+ marker and either a CD4+ marker or a CD8+ marker. In some embodiments, the T cell is allogeneic.

[0261] In some embodiments, the T cell expresses the glycoprotein CD8 and is therefore CD8+ by standard flow cytometry methods and may be referred to as a "cytotoxic" T cell. In some embodiments, the T cell expresses the glycoprotein CD4 and is therefore CD4+ by standard flow cytometry methods and may be referred to as a "helper" T cell. CD4+ T cells can differentiate into subsets and may be referred to as Th1 cells, Th2 cells, Th9 cells, Th17 cells, Th22 cells, T regulatory (“Treg”) cells or follicular T helper cells (“Tfh”). . Each CD4+ subset releases certain cytokines that can have either pro- or anti-inflammatory functions, or survival or protective functions. T cells may be isolated from a subject by CD4+ or CD8+ selection methods.

[0262] In some embodiments, the T cell is a memory T cell. In the body, memory T cells have already encountered antigens. Memory T cells can be located in secondary lymphoid organs (central memory T cells) or in recently infected tissues (effector memory T cells). Memory T cells may be CD8+ T cells. Memory T cells may be CD4+ T cells.

[0263] As used herein, a "central memory T cell" can be defined as a T cell that has a history of antigen exposure and may, for example, express CD62L and CD45RO. Central memory T cells may be detected as CD62L+ and CD45RO+. Central memory T cells also express CCR7 and may be detected as CCR7+ by standard flow cytometry methods.

[0264] As used herein, "early stem cell memory T cells" (or "Tscm") can be defined as T cells that express CD27 and CD45RA, and thus are be. Since Tscm does not express the CD45 isoform CD45RO, Tscm also becomes CD45RO- when stained for this isoform by standard flow cytometry methods. Therefore, CD45RO-CD27+ cells are also early stem cell memory T cells. Tscm cells further express CD62L and CCR7 and can be detected as CD62L+ and CCR7+ by standard flow cytometry methods. Early stem cell memory T cells have been shown to correlate with improved survival and therapeutic efficacy of cell therapy products.

[0265] In some embodiments, the cell is a B cell. As used herein, a "B cell" can be defined as a cell that expresses CD19 and / or CD20 and / or B cell maturation antigen ("BCMA"), so that B cells can be CD19+ and / or CD20+ and / or BCMA+ by law. B cells are further negative for CD3 and CD56 by standard flow cytometry methods. The B cell may be a plasma cell. The B cell may be a memory B cell. The B cell may be a naive B cell. The B cell may be IgM+ or have a class-switched B cell receptor (eg, IgG+ or IgA+). In some embodiments, the B cell is allogeneic.

[0266] In some embodiments, the cell is a mononuclear cell, such as from bone marrow or peripheral blood. In some embodiments, the cells are peripheral blood mononuclear cells ("PBMCs"). In some embodiments, the cells are PBMCs, such as lymphocytes or monocytes. In some embodiments, the cell is a peripheral blood lymphocyte (“PBL”). In some embodiments, the mononuclear cell is allogeneic.

[0267] Included are cells used in ACT and / or tissue regeneration therapy, such as stem cells, progenitor cells and primary cells. Examples of stem cells include pluripotent stem cells (PSCs), induced pluripotent stem cells (iPSCs), embryonic stem cells (ESCs), mesenchymal stem cells (MSCs), such as bone marrow (BM), peripheral blood (PB), placenta, umbilical cord (UC) or adipose), hematopoietic stem cells (HSC, e.g. isolated from BM or UC), neural stem cells (NSC), tissue-specific progenitor stem cells (TSPSC), and limbal stem cells ( LSC). Progenitor cells and primary cells include mononuclear cells (MNCs, e.g. isolated from BM or PB), endothelial progenitor cells (EPCs, e.g. isolated from BM, PB and UC), neural progenitor cells ( NPCs), as well as tissue-specific primary cells or cells derived therefrom (TSCs), including chondrocytes, myocytes and keratinocytes. Also included are cells for organ or tissue transplantation, such as pancreatic islet cells, cardiomyocytes, thyroid cells, thymocytes, neuron cells, skin cells and retinal cells.

[0268] In some embodiments, the cell is a human cell, such as a cell isolated from a human subject. In some embodiments, the cells are isolated from human donor PBMCs or Leukopaks. In some embodiments, the cells are obtained from a subject with a condition, disorder or disease. In some embodiments, the cells are obtained from a human donor with Epstein-Barr virus (“EBV”).

[0269] In some embodiments, the methods of the invention are performed ex vivo. As used herein, "ex vivo" refers to in vitro methods by which the cells can be transferred to a subject, eg, as ACT therapy. In some embodiments, the ex vivo method is an in vitro method involving cells or cell populations of ACT therapy.

[0270] In some embodiments, the cell is derived from a cell line. In some embodiments, the cell line is obtained from a human subject. In some embodiments, the cell line is a lymphoblastoid cell line (“LCL”). The cells may be cryopreserved and thawed. The cells do not have to be previously cryopreserved.

[0271] In some embodiments, the cells are derived from a cell bank. In some embodiments, the cells are genetically modified before being sent to a cell bank. In some embodiments, the cells are removed from the subject, genetically modified ex vivo, and sent to a cell bank. In some embodiments, the genetically modified cell population is sent to a cell bank. In some embodiments, the genetically modified immune cell population is sent to a cell bank. In some embodiments, the genetically modified immune cell population includes a first subpopulation and a second subpopulation, the first subpopulation and the second subpopulation having a common genetic modification. The population having at least one and at least one different genetic modification is sent to a cell bank.

[0272] In some embodiments, when the cell is homozygous for HLA-B, the HLA-B allele is HLA-B*07:02, HLA-B*08:01, HLA-B*44 :02, HLA-B*35:01, HLA-B*40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02 , HLA-B*44:03, HLA-B*38:01, HLA-B*18:01, HLA-B*44:03, HLA-B*51:01, HLA-B*49:01, HLA -B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA-B*52:01, HLA-B *51:01, HLA-B*37:01, HLA-B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35 :02, HLA-B*15:01, and HLA-B*40:02.

[0273] In some embodiments, when the cell is homozygous for HLA-C, the HLA-C allele is HLA-C*07:02, HLA-C*07:01, HLA-C*05 :01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02 , HLA-C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04:01, HLA-C*15:02, HLA-C*07:01, HLA -C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C *14:02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04 :01, HLA-C*04:01, and HLA-C*02:02.

[0274] In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C, and the HLA-B allele is HLA-B*07:02, HLA-B* 08:01, HLA-B*44:02, HLA-B*35:01, HLA-B*40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15: 01, HLA-B*13:02, HLA-B*44:03, HLA-B*38:01, HLA-B*18:01, HLA-B*44:03, HLA-B*51:01, HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA- B*52:01, HLA-B*51:01, HLA-B*37:01, HLA-B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B* Select one of the HLA-B alleles: 44:03, HLA-B*35:02, HLA-B*15:01, and HLA-B*40:02, and the HLA-C allele is HLA- C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C* 08:02, HLA-C*03:03, HLA-C*06:02, HLA-C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04: 01, HLA-C*15:02, HLA-C*07:01, HLA-C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14:02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA- Select from one of the following HLA-C alleles: C*07:04, HLA-C*07:01, HLA-C*04:01, HLA-C*04:01 and HLA-C*02:02 .

[0275] In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C, and the HLA-B allele and the HLA-C allele are HLA-B*07:02 and HLA-C*07:02, HLA-B*08:01 and HLA-C*07:01, HLA-B*44:02 and HLA-C*05:01, HLA-B*35:01 and HLA -C*04:01, HLA-B*40:01 and HLA-C*03:04, HLA-B*57:01 and HLA-C*06:02, HLA-B*14:02 and HLA-C *08:02, HLA-B*15:01 and HLA-C*03:03, HLA-B*13:02 and HLA-C*06:02, HLA-B*44:03 and HLA-C*16 :01, HLA-B*38:01 and HLA-C*12:03, HLA-B*18:01 and HLA-C*07:01, HLA-B*44:03 and HLA-C*04:01 , HLA-B*51:01 and HLA-C*15:02, HLA-B*49:01 and HLA-C*07:01, HLA-B*15:01 and HLA-C*03:04, HLA -B*18:01 and HLA-C*12:03, HLA-B*27:05 and HLA-C*02:02, HLA-B*35:03 and HLA-C*04:01, HLA-B *18:01 and HLA-C*05:01, HLA-B*52:01 and HLA-C*12:02, HLA-B*51:01 and HLA-C*14:02, HLA-B*37 :01 and HLA-C*06:02, HLA-B*53:01 and HLA-C*04:01, HLA-B*55:01 and HLA-C*03:03, HLA-B*44:02 and HLA-C*07:04, HLA-B*44:03 and HLA-C*07:01, HLA-B*35:02 and HLA-C*04:01, HLA-B*15:01 and HLA -C*04:01, and one of the HLA-B allele and HLA-C allele HLA-B*40:02 and HLA-C*02:02. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C, and the HLA-B allele and the HLA-C allele are HLA-B*07:02 and HLA-C*07:02. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C, and the HLA-B allele and the HLA-C allele are HLA-B*08:01 and HLA-C*07:01. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C, and the HLA-B allele and the HLA-C allele are HLA-B*44:02 and HLA-C*05:01. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C, and the HLA-B allele and the HLA-C allele are HLA-B*35:01 and HLA-C*04:01.

[0276] III. Details of gene editing system A variety of suitable gene editing systems may be used to generate the engineered cells disclosed herein, including CRISPR / Cas systems, zinc finger nuclease (ZFN) systems, and transcription activator-like effector systems. Examples include, but are not limited to, nuclease (TALEN) systems. Generally, these gene editing systems involve the use of engineered cleavage systems to induce double-strand breaks (DSBs) or nicks (eg, single-strand breaks, or SSBs) at the target DNA sequence. Cleavage or nicking can be achieved through the use of engineered ZFNs, specific nucleases such as TALENs, or using CRISPR / Cas systems with engineered guide RNAs to direct specific cleavage or nicking of the target DNA sequence. It can be carried out. Additionally, targeting nucleases have been developed based on the Argonaute system (e.g. from T. thermophilus, known as "TtAgo"; see Swarts et al (2014) Nature 507(7491):258-261). ), it also appears to have the potential to be used in gene editing and gene therapy.

[0277] In some embodiments, the gene editing system is a TALEN system. Transcription activator-like effector nucleases (TALENs) are restriction enzymes that can be engineered to cut predetermined sequences of DNA. TALENs are created by fusing a TAL effector DNA binding domain to a DNA cleavage domain (a nuclease that cuts DNA strands). Transcription activator-like effectors (TALEs) can be engineered to bind to desired DNA sequences to promote DNA cleavage at predetermined locations (see, eg, Boch, 2011, Nature Biotech). This restriction enzyme can be introduced into cells for use in in situ gene editing, a technique known as engineered nuclease-mediated gene editing. Such methods and compositions for use in gene editing are known in the art. See, for example, WO2019147805, WO2014040370, WO2018073393, the contents of which are incorporated herein in their entirety.

[0278] In some embodiments, the gene editing system is a zinc finger system. Zinc finger nucleases (ZFNs) are artificial restriction enzymes created by fusing a zinc finger DNA binding domain to a DNA cutting domain. Zinc finger domains can be engineered to target certain desired DNA sequences, directing zinc finger nucleases to unique sequences within a complex genome. Typically, a non-specific cleavage domain derived from the type II restriction endonuclease FokI is used as the cleavage domain of the ZFN. The breaks are repaired by endogenous DNA repair mechanisms, allowing the ZFNs to precisely alter the genomes of higher organisms. Such methods and compositions for use in gene editing are known in the art. See for example WO2011091324, the contents of which are incorporated herein by reference in their entirety.

[0279] In some embodiments, the gene editing system is, for example, a CRISPR / Cas system comprising a CRISPR guide RNA comprising a guide sequence and an RNA-guided DNA binding agent, as further described herein.

[0280] A.CRISPR guide RNA Provided herein are guide sequences useful for modifying target sequences using, for example, guide RNAs containing the disclosed guide sequences (e.g., CRISPR / Cas systems) in conjunction with RNA-guided DNA binding agents. It is.

[0281] Each of the guide sequences disclosed herein may further include additional nucleotides to form a crRNA, e.g., at the 3' end of the guide sequence, in the 5' to 3' direction, GUUUUAGAGCUAUGCUGUUUUG An exemplary nucleotide sequence follows (SEQ ID NO: 170). In the case of sgRNA, the guide sequence described above may further include additional nucleotides (scaffold sequence) to form the sgRNA, e.g., after the 3' end of the guide sequence, a 5' to 3' followed by an exemplary nucleotide sequence of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 171) or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 172, which does not include the terminal four U's of SEQ ID NO: 171). In some embodiments, the terminal four U's of SEQ ID NO: 171 are absent. In some embodiments, only one, two or three of the terminal four U's of SEQ ID NO: 171 are present.

[0282] In some embodiments, the sgRNA comprises any one of the guide sequences SEQ ID NOs: 1-101 and additional nucleotides to form a crRNA, such as GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGCACCGAGUCGGUGC (SEQ ID NO: 173) (5' to 3' direction). SEQ ID NO: 173 lacks 8 nucleotides compared to the sequence conserved in the wild-type guide RNA, namely GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 172).

[0283] Other exemplary scaffold nucleotide sequences are shown in Table 23. In some embodiments, an sgRNA of the invention comprises any one of the guide sequences of SEQ ID NOs: 1-101 and the additional guide scaffold sequences of Table 23 (5' to 3' direction) (as indicated). including modified scaffold arrays).

[0284] The guide RNA may further include trRNA. In each composition and method embodiment described herein, crRNA and trRNA may be associated as a single RNA (sgRNA) or present in separate RNAs (dgRNA). You can. In the case of sgRNA, the crRNA and trRNA components may be covalently linked, for example, by a phosphodiester bond or other covalent bond. In some embodiments, the crRNA and / or trRNA sequences may also be referred to as a "scaffold" or "conserved portion" of the guide RNA.

[0285] In each of the embodiments of the compositions, uses, and methods described herein, the guide RNA may include two RNA molecules as a "dual guide RNA" or "dgRNA." The dgRNA includes, for example, a first RNA molecule that includes crRNA that includes the guide sequence shown in Table 1, and a second RNA molecule that includes trRNA. The first RNA molecule and the second RNA molecule do not have to be covalently bonded, but may form an RNA complex through base pairing between the crRNA and a portion of the trRNA.

[0286] In each of the embodiments of the compositions, uses, and methods described herein, the guide RNA may include one RNA molecule as a "single guide RNA" or "sgRNA." The sgRNA may include a crRNA (or a portion thereof) containing a guide sequence shown in Table 1 covalently linked to a trRNA. The sgRNA may include 17, 18, 19 or 20 contiguous nucleotides of the guide sequence shown in Table 1. In some embodiments, the crRNA and trRNA are covalently linked via a linker. In some embodiments, the sgRNA of the invention forms a stem-loop structure through base pairing between the crRNA and a portion of the trRNA. In some embodiments, crRNA and trRNA are covalently linked through one or more bonds that are not phosphodiester bonds.

[0287] In some embodiments, the trRNA of the invention may include all or part of the trRNA sequence obtained from the natural CRISPR / Cas system. In some embodiments, the trRNA comprises a truncated or modified wild-type trRNA. The length of trRNA is determined by the CRISPR / Cas system used. In some embodiments, the trRNAs of the invention are 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 Contains or consists of 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 or more than 100 nucleotides Become. In some embodiments, the trRNAs of the invention may include certain secondary structures, such as, for example, one or more hairpin or stem-loop structures, or one or more bulge structures.

[0288] Some embodiments provide compositions that include one or more guide RNAs that include any one guide sequence in Table 1. In some embodiments, compositions are provided that include one or more guide RNAs comprising any one guide sequence in Table 1, and the 3' end of the guide sequence is followed by SEQ ID NO: 170, 171, 172 or Followed by 173 nucleotides. In some embodiments, one or more guide RNAs comprising any one guide sequence in Table 1, wherein the 3' end of the guide sequence is followed by the nucleotides of SEQ ID NO: 170, 171, 172, or 173. The subsequent guide RNA is modified according to the modification pattern of SEQ ID NO: 300.

[0289] Some embodiments provide compositions that include one or more guide RNAs that include any one guide sequence in Table 1. In one embodiment, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91% or 90% identical to any of the nucleic acids of SEQ ID NOs: 1-101. Compositions comprising one or more gRNAs are provided.

[0290] In another embodiment, compositions are provided that include at least one, such as at least two, gRNAs that include a guide sequence selected from any two or more of the guide sequences shown in Table 1. In some embodiments, the composition has at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91% with any of the guide sequences shown in Table 1. at least two gRNAs each containing a guide sequence that is % or 90% identical.

[0291] In some embodiments, guide RNA compositions of the invention are designed to recognize (eg, hybridize to) a target sequence within CIITA. For example, the CIITA target sequence may be recognized and cleaved by a supplied Cas clivase (including guide RNA). In some embodiments, an RNA-guided DNA binding agent, such as a Casclivase, may be directed to a target sequence within CIITA by a guide RNA, such that the guide sequence of the guide RNA hybridizes with the target sequence. soybean, and RNA-guided DNA binding agents such as Casclivase cleave the target sequence.

[0292] In some embodiments, the selection of one or more guide RNAs is determined based on the target sequence within CIITA. In some embodiments, a composition comprising one or more guide sequences comprises a guide sequence that is complementary to the corresponding genomic region shown in Table 1 according to the coordinates of the human reference genome hg38. The guide sequence of further embodiments may be complementary to a sequence in the immediate vicinity of the genomic coordinates within CIITA listed in any of Table 1. For example, the guide sequence of further embodiments may be complementary to a sequence comprising 10 contiguous nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 1.

[0293] Without being bound to any particular theory, modifications in particular regions of the target gene (e.g., frameshift mutations due to indels resulting from nuclease-mediated DSBs) may be more likely to occur in other regions than in other regions. The location of the DSB is an important factor in the amount or type of protein knockdown that can occur, as it may be less permissive than mutations. In some embodiments, a gRNA that is complementary or has complementarity to a target sequence within the target gene is used to direct the RNA-guided DNA binding agent to a specific location within the target gene.

[0294] In some embodiments, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90% of the target sequence present in the target gene. , 85% or 80% identical. In some embodiments, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90% of the target sequence present in the human CIITA gene. %, 85% or 80% identical.

[0295] In some embodiments, the target sequence may be complementary to the guide sequence of the guide RNA. In some embodiments, the degree of complementarity or identity between the guide sequence of the guide RNA and its corresponding target sequence is at least 80%, 85%, 90%, 95%, 96%, 97%, 98 %, 99% or 100%. In some embodiments, the target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In another embodiment, the target sequence and the guide sequence of the gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3 or 4 mismatches, and the total length of the guide sequence is 20. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1-4 mismatches, and the guide sequence is 20 nucleotides.

[0296] In some embodiments, the compositions or formulations disclosed herein contain open reading frames (ORFs) encoding RNA-guided DNA binding agents, such as Cas nucleases, as described herein. ) containing mRNA. In some embodiments, an mRNA comprising an ORF encoding an RNA-guided DNA binding agent, such as a Cas nuclease, is provided, used or administered.

[0297] B. Modification of gRNA In some embodiments, gRNA (eg, sgRNA, short sgRNA, dgRNA or crRNA) is modified. The term "modified" or "modified" in the context of the gRNAs described herein refers to, for example, (a) a terminal modification, such as a 5' end modification or a 3' end modification (5' or 3' end modification); (b) Nucleobase (or "base") modification (including base substitution or removal); (c) sugar modification (2', 3' and / or 4) (d) internucleoside linkage modifications, and (e) backbone modifications (which may include modification or replacement of phosphodiester linkages and / or ribose sugars). Contains qualifications. Modification of the nucleotide at a given position includes modification or replacement of the phosphodiester bond immediately 3' to the sugar of the nucleotide. That is, for example, a nucleic acid containing a phosphorothioate between the first sugar and the second sugar from the 5' end is considered to contain a modification at the 1st position. The term "modified gRNA" generally refers to gRNAs that have modifications to their chemical structure of one or more of base, sugar, and phosphodiester bonds or backbone moieties (including nucleotide phosphates), all of which are defined herein. This is detailed and illustrated in the book.

[0298] Further descriptions and exemplary patterns of modifications are provided in Table 1 of WO2019 / 237069, published on December 12, 2019, which is incorporated herein by reference in its entirety.

[0299] In some embodiments, the gRNAs are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 Contains modifications at 1, 15, or 16 or more YA sites. In some embodiments, the pyrimidine at the YA site comprises a modification that alters the internucleoside linkage immediately 3' of the sugar of the pyrimidine. In some embodiments, the adenine of the YA site comprises a modification that alters the internucleoside linkage immediately 3' of the sugar of that adenine. In some embodiments, the pyrimidine and adenine of the YA site include modifications, such as sugar, base, or internucleoside linkage modifications. The modification of YA can be any of the types of modifications defined herein. In some embodiments, the YA modification includes one or more of phosphorothioate, 2'-OMe or 2'-fluoro. In some embodiments, the YA modification includes a pyrimidine modification, including one or more of phosphorothioate, 2'-OMe, 2'-H, inosine, or 2'-fluoro. In some embodiments, the YA modification includes a bicyclic ribose analog (eg, LNA, BNA or ENA) within the RNA complex region that includes one or more YA sites. In some embodiments, the YA modification comprises a bicyclic ribose analog (e.g., LNA, BNA or ENA) within the region of the RNA complex that includes the YA site, and the YA modification It is on the position side.

[0300] In some embodiments, the guide sequence (or guide region) of the gRNA includes 1, 2, 3, 4, or 5 or more YA sites (“guide region YA sites”) that may include YA modifications. )including. In some embodiments, from the 5' end of the 5' end to the 5th end, 6th end, 7th end, 8th end, 9th end, or 10th end ("5th end" ” refers to the 3′ end of the guide region, ie, the fifth position toward the last 3′ nucleotide in the guide region), includes a YA modification. The modification guide region YA site includes a modification of YA.

[0301] In some embodiments, the modified guide region YA site is within 20 nucleotides, within 19 nucleotides, within 18 nucleotides, within 17 nucleotides, within 16 nucleotides, within 15 nucleotides, within 14 nucleotides of the 3' terminal nucleotide of the guide region. , within 13 nucleotides, within 12 nucleotides, within 11 nucleotides, within 10 nucleotides, or within 9 nucleotides. For example, if the modified guide region YA site is within 10 nucleotides from the 3' terminal nucleotide of the guide region, and the guide region is 20 nucleotides long, then the modified nucleotides of the modified guide region YA site are within 10 nucleotides of the 3' terminal nucleotide of the guide region. ~Positioned in one of the 20th place. In some embodiments, the modified guide region YA site is located at the 4th nucleotide, the 5th nucleotide, the 6th nucleotide, the 7th nucleotide, the 8th nucleotide, the 9th nucleotide from the 5' end of the 5' end. nucleotide, at or after the 10th or 11th nucleotide.

[0302] In some embodiments, the modified guide region YA site is other than a 5' end modification. For example, the sgRNA can include a 5' end modification, as described herein, and further includes a modified guide region YA site. Alternatively, the sgRNA can include an unmodified 5' end and a modified guide r...

Claims

[Claim 1] The invention described in the specification.

Images