Chimeric antigen receptor (CAR) NK cells and their uses

Abstract

Disclosed herein are plasmids and methods for genetically engineering NK cells using CRISPR / CAS9-based adeno-associated viral (AAV) delivery. In some aspects, disclosed herein are methods of using the engineered NK cells to treat cancer.

Description

[Technical Field]

[0001] I. Cross-reference of related applications This application claims the interests of U.S. Provisional Patent Application No. 63 / 105,722, filed on 26 October 2020, which is incorporated herein by reference in its entirety. [Background technology]

[0002] II. Background technology Human peripheral blood natural killer (NK) cells possess potent antitumor activity and have been successfully used in several clinical trials. Modifying NK cells with chimeric antigen receptors (CARs) can improve their targeting and enhance their specificity. However, genetic modification of NK cells has been challenging due to the high expression of innate viral nucleic acid sensing mechanisms. What is needed are new methods and vectors for genetically engineering NK cells. [Overview of the project]

[0003] III. Outline of the Invention Methods and compositions related to the electroporation of NK cells for delivering a CRISPR / CAS9 gene editing system to cells (e.g., NK cells) are disclosed.

[0004] In one embodiment, disclosed herein is a plasmid for use in clustered and regularly arranged short palindromic sequence repeat (CRISPR) / CRISPR-related 9 (Cas9) integration systems, the plasmid comprising: a left homologous arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide (e.g., a CAR containing scFv targeting a receptor on a target cell (e.g., CD33)), a transmembrane domain (e.g., NKG2D transmembrane domain, CD4 transmembrane domain, CD8 transmembrane domain, CD28 transmembrane domain, and / or CD3ξ transmembrane domain), a co-stimulatory domain (e.g., 2B4 domain, CD28 co-stimulatory domain, 4-1 BB co-stimulatory domain, or any combination of 2B4 domains, CD28 co-stimulatory domain, and / or 4-1 The plasmid comprises, in order, a BB costimulatory domain, a CD3ξ signaling domain, and a right homologous arm, with the left and right homologous arms each being less than 1000 bp in length (e.g., 30 bp, 300 bp, and 600 bp).

[0005] Plasmids for use in any preceding embodiment of a CRISPR / Cas9 integration system in which the left homologous arm and the right homologous arm are of the same or different lengths are also disclosed herein. In some embodiments, the homologous arms specifically hybridize to adeno-associated virus integration site 1 (AAVS1) on human chromosome 19.

[0006] In some embodiments, plasmids for use with any prior embodiment of a CRISPR / Cas9 integration system are disclosed herein, further comprising a mouse leukemia virus-derived (MND) promoter.

[0007] In one embodiment, an adeno-associated virus (AAV) vector (e.g., an AAV vector containing the AAV6 serotype) comprising a plasmid of any prior embodiment is disclosed herein. In some embodiments, the AAV plasmid further comprises a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide. In some embodiments, the vector further comprises plasmids encoding crRNA, tracer RNA (trcrRNA), and Cas endonuclease. The AAV vector may be single-stranded AAV (ssAAV) or self-complementary AAV (scAAV).

[0008] In one embodiment, modified cells (e.g., NK cells and NK T cells) containing a plasmid or AAV vector of any prior embodiment are disclosed herein.

[0009] Furthermore, the Specified Methods for treating, reducing, mitigating, inhibiting, alleviating, and / or preventing cancer and / or metastasis in a subject (e.g., acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), and / or myelodysplastic syndrome (MDS)) are disclosed herein, including administering modified cells of any prior embodiment to a subject having cancer.

[0010] In one embodiment, a method for producing chimeric antigen receptor (CAR) natural killer (NK) cells or CAR NK T cells is provided, a) obtaining an AAV vector containing a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA and a plasmid containing a transgene (e.g., a chimeric antigen receptor for a tumor antigen), wherein the transgene is adjacent to a homologous arm, and the homologous arm is 1000 bp or less in length, and b) introducing the transgene and the RNP complex into NK cells or NK T cells, wherein the transgene (e.g., a chimeric antigen receptor for a tumor antigen) is introduced into NK cells or NK T cells via adeno-associated virus (AAV) infection, the RNP complex hybridizes to a target sequence in the genomic DNA of the NK cells or NK T cells, and the DNA repair enzymes of the NK cells or NK T cells introduce the transgene into the host genome at the target sequence (e.g., by homologous repair), thereby producing CAR Methods for producing NK cells or CAR NK T cells are disclosed herein. In some embodiments, the RNP complex may be introduced into cells via electroporation. In some embodiments, the RNP complex may be introduced into cells via viral delivery (i.e., co-infection) within the same or different AAV.

[0011] In one embodiment, a method for genetically modifying cells (including, but not limited to, primary or proliferating cells, such as T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, nerve cells, epithelial cells, and / or muscle cells) is disclosed herein, comprising: a) obtaining an AAV vector comprising a ribonucleoprotein (RNP) complex containing a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA and a plasmid containing a chimeric antigen receptor (CAR) polypeptide, wherein the polynucleotide sequence is adjacent to homologous arms, and the homologous arms are less than or equal to 1000 bp in length; and b) introducing the polynucleotide sequence and the RNP complex into cells, wherein the polynucleotide sequence is introduced into cells via AAV infection of the cells, the RNP complex hybridizes to a target sequence in the cell's genomic DNA, and the cell's DNA repair enzymes insert the transgene into the host genome at the target sequence in the cell's genomic DNA, thereby producing modified cells.

[0012] In some embodiments, methods for genetically modifying cells of any prior embodiment are disclosed herein, wherein the cells (e.g., NK cells or NK T cells) are infected with AAV at a multiple of infection (MOI) of approximately 5 to 500K as disclosed herein.

[0013] Also disclosed herein is a method for genetically modifying cells of any prior embodiment, wherein primary cells are incubated for about 4 to 10 days in the presence of IL-2 and / or irradiated feeder cells, plasma membrane particles, or exosome cells prior to infection and / or electroporation. In some embodiments, a method for genetically modifying cells of any prior embodiment is further disclosed herein, comprising growing primary cells for about 4 to 10 days in the presence of irradiated feeder cells, plasma membrane particles, or exosomes prior to infection, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof. A method for genetically modifying cells of any prior embodiment is also disclosed, further comprising growing the modified cells after infection with irradiated feeder cells, plasma membrane particles, or exosomes, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof.

[0014] In some embodiments, methods are disclosed herein for treating, reducing, mitigating, inhibiting, improving, and / or preventing cancer and / or metastasis (e.g., acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), halocyte leukemia (HCL), and / or myelodysplastic syndrome (MDS)) in a subject, the method comprising administering a therapeutically effective amount of natural killer (NK) cells to the subject, the NK cells comprising a plasmid for use with a clustered and regularly arranged short palindromic sequence repeat (CRISPR) / CRISPR-associated 9 (Cas9) integration system, the plasmid comprising, in order, a left homologous arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide (e.g., a CD33-targeted CAR), and a right homologous arm, the left and right homologous arms each being less than 1000 bp in length (e.g., 600 bp).

[0015] In some embodiments, plasmids for use with clustered and regularly arranged short palindromic sequence repeats (CRISPR) / CRISPR-related 9 (Cas9) integration systems are disclosed herein, wherein the plasmid comprises a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, the polynucleotide sequence flanking one polynucleotide sequence encoding one protospacer flanking motif (PAM) and CRISPR RNA (crRNA), or flanking sequences encoding two PAMs and crRNAs. In some embodiments, the disclosed plasmids may be used in any of the following: methods for treating, reducing, mitigating, inhibiting, improving, and / or preventing cancer and / or metastasis of any prior embodiment; methods for producing CAR NK cells and / or CAR NK T cells of any prior embodiment; and / or methods for genetically modifying cells of any prior embodiment. [Brief explanation of the drawing]

[0016] IV. Brief Description of the Drawings The accompanying drawings incorporated herein and forming part thereof illustrate several embodiments, along with the description, illustrating the compositions and methods disclosed.

[0017] [Figure 1] Figures 1A-1E show the efficient CRISPR targeting of AAVS1 in mbIL-21-proliferating human primary NK cells. Figure 1A shows a schematic diagram of the steps for isolating and ex vivo-proliferating NK cells using mbIL21-K562. Figure 1B shows the relative gene expression levels of HR-related genes (Figure 1C) and NHEJ-related genes in different NK cells, with ***P<0.001 in all comparisons. Figure 1D shows ATAC-seq data demonstrating that AAVS1 has similar chromatin accessibility among freshly isolated (naive) mbIL-21-proliferating NK cells (n=2). Figure 1E shows the efficiency of Cas9 / RNP-mediated targeting of AAVS1 in NK cells. The sequences in Figure 1E include: SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, [Figure 2] Figures 2A–2C show constructs of mCherry-coding DNA for insertion into AAVS1 via HR and CRISPaint. In Figure 2A, the left panel shows Cas9 / RNP introducing a DSB into AAVS1, allowing the gene encoding the target DNA to be incorporated into NK cells via an HR with an optimal length of Has. The right panel shows a schematic diagram of the construct design for the insertion of 30–1000 bp of mCherry-coding DNA and HA at a Cas9 target site in AAVS1, which is cloned in the ssAAV6 and / or scAAV6 skeleton. In Figure 2B, the upper panel shows a schematic diagram of the mechanism of CRISPaint gene insertion via a homology-independent DNA repair pathway, and the lower panel shows a schematic diagram of the construct design for the insertion of mCherry-coding DNA, cloned in scAAV, via CRISPaint. Figure 2C shows a schematic diagram of the workflow for electroporating Cas9 / RNP and transducing 7-day-old mbIL21-proliferating IL2-stimulated NK cells transduced with AAV6 for gene delivery. [Figure 3] Figures 3A-3C demonstrate that targeting AAVS1 in proliferating CD3-negative CD56-positive NK cells does not alter the normal function of the cells. Figure 3A shows a representative flow cytometry analysis indicating the purity of CD3-negative CD56-positive NK cells isolated from a healthy donor buffy coat. Figure 3B shows a schematic diagram of the workflow for electroporating Cas9 / RNP on day 7 to proliferate human primary NK cells into AAVS1 targeting. Figure 3C shows a cytotoxicity assay of AAVS1-KO NK cells, showing no suppression of their antitumor activity against AML cell lines. [Figure 4]Figures 4A-4C demonstrate that the combination of AAV6 and Cas9 / RNP leads to the efficient generation of mCherry-expressing NK cells. Figure 4A shows representative flow cytometry of human primary NK cells expressing mCherry two days after CRISPR electroporation and AAV6 transduction (MOI=3×10⁵). Figure 4B shows the efficiency of Cas9 / RNP and AAV6-mediated mCherry expression in human primary NK cells via HR and CRISPaint (n=3). Figure 4C shows stable mCherry expression in NK cells after enrichment and proliferation using mbIL21 K562. [Figure 5] Figure 5 shows representative flow cytometry analysis of mCherry expression levels in freshly isolated NK cells electroporated with Cas9 / RNP and transduced with AAV6. [Figure 6] Figures 6A-6F show the successful generation of CD33CAR-expressing NK cells using a Cas9 / RNP and AAV6 combination. Figures 6A and 6B show schematic diagrams of anti-CD33 CAR constructs (Gen2 and Gen4v2) cloned with ssAAV possessing HA at the AAVS1 targeting site. Figure 6C shows representative flow cytometry of CD33CAR expression on NK cells 7 days after Cas9 / RNP electroporation and AAV6 transduction (MOI=3×10⁵). Figure 6D shows that the MFI of CD33CAR expression in Gen2 was significantly higher than that of Gen4v2, with **P=0.0014. Figure 6E shows that the CD33CAR expression levels on NK cells 7 and 14 days after transduction and electroporation did not show a significant decrease (n=3). Figure 6F shows that the proliferation ratio of CD33CAR-expressing NK cells on feeder cells over 14 days, starting with 3 × 10⁵ cells (n=3), was similar to that of wild-type NK cells. [Figure 7]Figures 7A and 7B show representative flow cytometry analyses of CD33CAR-Gen2 expression levels in 14 NK cells before freezing and after thawing, which showed no decrease. Figure 7A also shows that freezing and thawing did not affect the enhanced cytotoxic effect of CD33CAR-Gen2 NK cells against Kasumi-1. [Figure 8] Figures 8A-8I show that CD33CAR NK cells enhance anti-AML activity. CD33CAR NK cells degranulate significantly more than wild-type NK cells when co-cultured with Kasumi-1, ***adjusted P-value = 0.004. Figures 8A and 8B with HL60, *adjusted P-value = 0.01. Figure 8B shows that expressing CD33CAR on NK cells also enhances the anti-tumor activity of NK cells against Kasumi-1, ****adjusted P-value < 0.0001, as shown in a representative cytotoxicity assay performed at different effector:target ratios and with three donors. Figure 8C shows that this enhanced cytotoxic activity was observed only in CD33CAR-Gen2 NK cells (Figures 8E and 8F) against HL-60, *adjusted P-value = 0.01. CD33CAR-Gen2 and Gen4v2 significantly killed higher AML-10 primary cells, ****adjusted P-value < 0.0001 (Figures 8G and 8H). No improved killing was seen against K562, **adjusted P-value = 0.001. [Figure 9]Figures 9A-9D show that the integration of the transgene at the AAVS1 locus was confirmed by PCR and TLA. Figure 9A shows a schematic diagram of PCR primers designed inside and outside the CD33CAR encoding DNA and integrated into AAVS1. Figure 9B shows that the CD33CAR gene insertion at the AAVS1 locus was amplified and visualized on a 1% agarose gel only in the (conditions 1 and 2) NK cells in which it was successful. Gene insertion in human primary NK cells was also seen when primers were designed outside the transgene and used to amplify the AAVS1 locus of wild type, mCherry, or CD33CAR (condition 3, primers: forward-1200bp(2) reverse-1200bp(1)). Figure 9C shows the TLA sequence coverage of the entire human genome using primers designed to detect the integration of CD33CAR-Gen2 in day 14 cells. Figure 9D shows that the chromosomes are shown on the y-axis and the chromosomal positions are shown on the x-axis. The identified integration positions are surrounded by red. [Figure 10] Figures 10A and 10B show representative flow cytometry (Figure 10A) analysis of CD33CAR-Gen2 expression levels in NK cells transduced with 10K-300K MOI of ssAAV6 encoding CD33CAR-Gen2, indicating the success of CAR expression in NK cells isolated from three healthy donors (Figure 10B). [Figure 11] Figure 11 shows the expression levels of CD33 in different cancer cells. [Figure 12] Figure 12 shows a representative Calcein-AM release assay of NK cells against K562. [Figure 13] Figures 13A and 13B show representative flow cytometry analysis of CD33CAR expression levels 7 days (Figure 13A) and 14 days (Figure 13B) after electroporation and AAV6 transduction in human NK cells. [Figure 14]Figure 14 shows the NGS sequencing coverage across the vector (gray). Black arrows indicate primer locations. Blue arrows indicate the locations of identified vector-genome breakpoint sequences (described below). The vector map is shown below. The Y-axis is limited to 100x. High coverage is observed across regions between ITR sites, vector sequence vector: 12-4,255. Low / no coverage is observed across the vector: 0-11 and 4,256-6,864, indicating that the skeleton is not incorporated in most of this sample, although it may be present in a small subset of the sample. Coverage is also observed in ITRs, indicating that ITR-based incorporation occurred in the sample, even next to incorporation via homologous arms. Sequence variants and structural variants were called to cover the region. [Figure 15] Figure 15 shows TLA sequence coverage (gray) across vector integration loci, human chr19: 54,550,476–55,682,266. Blue arrows indicate the location of cleavage sequences. The Y-axis is limited to 20x and 100x. The coverage profile in this figure indicates that no genomic rearrangements occurred in the region of the integration site. From this data, it can be concluded that the vector is integrated into human chromosome chr19 as intended: 55,115,754–55,115,767. According to RefSeq, this is located in intron 1 of PPP1R12C. Other integration sites were observed among chr19: 55,115,155–55,116,371. According to RefSeq, this is also located in intron 1 of PPP1R12C. [Figure 16] Figure 16 shows the construct design for pAAV AAVS1(600bpHA)MND-CD33CAR(gen2)(CoOp). The construct sequence is sequence number 22. [Figure 17] Figure 17 shows the construct design for pAAV AAVS1(600bpHA)MND-CD33CAR(gen4v2)(CoOp). The construct sequence is sequence number 23. [Figure 18]Figure 18 shows the dynamic evaluation of cytotoxicity of unmodified (WT) and CD33-CAR-expressing proliferating NK cells against K562. Assays were performed using xCelligence to monitor target viability at 15-minute intervals using two E:T ratios. Cell lysis % was calculated by referencing a control well that did not contain NK cells. K562 is highly sensitive to WT proliferating NK cells, and serial killing is evident (over 50% lysis at a 0.5:1 E:T ratio), but since K562 also expresses CD33, the CD33 CAR allows for a more rapid initiation of killing at both E:T ratios and an increase in overall killing at lower E:T ratios. [Figure 19] Figure 19 shows the dynamic assessment of cytotoxicity against Kasumi. The assay was performed as shown in the previous figure. In contrast to K562, Kasumi is highly resistant to WT-proliferating NK cells, but the addition of CD33 CAR targeting to NK cells allows for a faster initiation of high levels of killing at a faster rate, increasing overall killing in both E:T ratios. [Figure 20] Figure 20 shows that co-culture of AML cells with WT-NK or CD33 CAR-NK cells induces AML cell death, as shown in the SPADE plot (colored for pRb expression indicating viable cycle cells), where green arrows indicate living AML cells and red arrows indicate dead / dying AML cells. CD33 CAR-NK cells show increased AML cell killing, and surviving AML cells show decreased CD33 surface expression and increased CD38 expression, suggesting that the combination of CD33 CAR and CD38 antibodies may be synergistic. This assay used patient-derived AML cell lines as targets. [Figure 21] Figure 21 shows the construct design of PAMgRNA mCherry. The construct sequence is sequence number 51. [Figure 22] Figure 22 shows the construct design for PAMgPAMg mCherry. The construct sequence is sequence number 50. [Modes for carrying out the invention]

[0018] V. Modes for carrying out the invention Before the compounds, compositions, articles, devices, and / or methods of the present invention are disclosed and described, it should be understood that, unless otherwise specified, they are not limited to specific synthesis methods or specific recombinant biotechnology methods, nor are they limited to specific reagents, and are therefore, of course, subject to change. It should also be understood that the terms used herein are intended solely to describe specific embodiments and are not intended to limit them.

[0019] A.Definition As used herein and in the appended claims, the singular “one” (“a,” “an,” and “the”) includes multiple references unless otherwise clearly indicated by the context. Thus, for example, a reference to “pharmaceutical carrier” includes a mixture of two or more such carriers.

[0020] In this specification, a range may be expressed as “approximately” from one particular value and / or “approximately” to another particular value. Where such a range is expressed, another embodiment includes one particular value and / or another particular value. Similarly, where a value is expressed as an approximation, it will be understood that by using the antecedent “approximately,” a particular value forms another embodiment. It will be further understood that each endpoint of a range is important both in relation to and independently of the other endpoints. There are several values ​​disclosed herein, and each value is disclosed herein as “approximately” that particular value, in addition to the value itself. For example, where the value “10” is disclosed, “approximately 10” is also disclosed. As will be well understood by those skilled in the art, where a value is disclosed as “less than or equal to that value,” it will also be understood that “greater than or equal to that value” and the possible range between that value are also disclosed. For example, where the value “10” is disclosed, “less than or equal to 10” and “greater than or equal to 10” are also disclosed. Furthermore, throughout this application, the data is provided in several different formats, and it is understood that this data also represents endpoints and starting points, as well as ranges of any combination of data points. For example, if a specific data point "10" and a specific data point 15 are disclosed, it is understood that, in addition to the range between 10 and 15, the values ​​greater than 10, 10 or greater, less than 10, 10 or less, and equal to 10, greater than 15, 15 or greater, less than 15, 15 or less, and equal to 15 are disclosed. It is also understood that each unit between two specific units is disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0021] "Administration" to a subject includes any route for introducing or delivering the drug to the subject. Administration can be carried out by any preferred route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-articular, parenteral, intra-arterial, intradermal, intraventricular, intracranial, intraperitoneal, intrafocal, intranasal, rectal, vaginal, inhalation, via implanted reservoir, and parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intrafocal, and intracranial injection or infusion techniques). As used herein, "concurrent administration," "administration in combination," "simultaneous administration," or "administered simultaneously" means that the compounds are administered at the same time or essentially immediately after each other. In the latter case, the two compounds are administered at times close enough that the observed results are indistinguishable from the results obtained if they were administered at the same time. "Systemic administration" refers to the introduction or delivery of a drug to a subject via a route that introduces or delivers the drug to a wide area of ​​the subject's body (e.g., more than 50% of the body), for example, through entry points into the circulatory or lymphatic system. In contrast, "local administration" refers to the introduction or delivery of a drug to a subject via a route that introduces or delivers the drug to the area of ​​the administration site or an area directly adjacent thereto, without introducing the drug systemically in a therapeutically significant amount. For example, a locally administered drug is readily detectable in the local vicinity of the administration site, but is undetectable or detectable in negligible amounts in distal parts of the subject's body. Administration includes self-administration and administration by another person.

[0022] "Biocompatibility" generally refers to materials and any metabolites or their breakdown products that are generally non-toxic to the recipient and do not cause serious side effects in the subject.

[0023] A "control" is an alternative subject or sample used in an experiment for comparative purposes. A control may be "positive" or "negative."

[0024] "Complementary" or "substantially complementary" refers to hybridization or base pairing, or double-strand formation, between nucleotides or nucleic acids, for example, between double strands of a double-stranded DNA molecule, or between an oligonucleotide primer and a primer binding site on a single-stranded nucleic acid. Complementary nucleotides are generally A and T / U, or C and G. Two single-stranded RNA or DNA molecules are said to be substantially complementary when the nucleotides of one strand are optimally aligned and compared, and pair with at least about 80%, usually at least about 90%–95%, more preferably about 98–100%, of the nucleotides of the other strand, with appropriate nucleotide insertions or deletions. Alternatively, substantial complementarity exists when an RNA or DNA strand hybridizes to its complement under selective hybridization conditions. Typically, selective hybridization will occur when there is at least about 65%, at least about 75%, or at least about 90% complementarity over an extension of at least 14–25 nucleotides. See Kanehisa (1984) Nucl. Acids Res. 12:203.

[0025] As used herein, the term “comprising” and its variations are synonymous with the term “including” and its variations, and are open and non-restrictive terms. While the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of” and “consisting of” may be used instead of “comprising” and “including” to provide more specific embodiments, and are disclosed herein.

[0026] "Composition" refers to any drug having beneficial biological effects. Beneficial biological effects include both therapeutic effects, e.g., treatment of disorders or other undesirable physiological conditions, and preventive effects, e.g., prevention of disorders or other undesirable physiological conditions. These terms also encompass, but are not limited to, pharmacologically acceptable active derivatives of beneficial drugs specifically referred to herein, including vectors, polynucleotides, cells, salts, esters, amides, precursors, active metabolites, isomers, fragments, analogs, etc. When the term "composition" is used, or when a particular composition is identified, it should be understood that this term includes not only the composition itself, but also pharmacologically acceptable, pharmacologically active vectors, polynucleotides, salts, esters, amides, precursors, complexes, active metabolites, isomers, fragments, analogs, etc.

[0027] A DNA sequence that "codes" a specific RNA is a DNA nucleic acid sequence that is transcribed into RNA. A DNA polynucleotide may code for RNA that is translated into a protein (mRNA) (and therefore both DNA and mRNA code for proteins), or it may code for RNA that is not translated into a protein (e.g., tRNA, rRNA, microRNA (miRNA), "non-coding" RNA (ncRNA), guide RNA, etc.).

[0028] An "expression vector" refers to a vector containing recombinant polynucleotides that include an expression regulatory sequence operably ligated to the nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression, and other elements for expression may be supplied by the host cell or in an in vitro expression system. Expression vectors include all known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating recombinant polynucleotides.

[0029] A “fragment” may include insertions, deletions, substitutions, or other selected modifications of a specific region or specific amino acid residue, whether or not it is attached to another sequence, provided that the activity of the fragment is not significantly altered or impaired compared to the unmodified peptide or protein. These modifications may provide several additional properties, such as removing or adding disulfide-bondable amino acids, extending its biological lifespan, or altering its secretory properties. In any case, the fragment must possess biologically active properties, such as regulating the transcription of a target gene.

[0030] The terms “gene” or “gene sequence” refer to a coding sequence or a regulatory sequence, or a fragment thereof. A gene may include any combination of coding sequences and regulatory sequences, or fragments thereof. Thus, “gene” as used herein may be all or part of a native gene. Polynucleotide sequences as used herein may be used interchangeably with the term “gene,” or may include any coding sequence, non-coding sequence, or regulatory sequence, fragments thereof, and combinations thereof. The terms “gene” or “gene sequence” may include, for example, a regulatory sequence upstream of a coding sequence (e.g., a ribosome binding site).

[0031] In the context of two or more nucleic acid or polypeptide sequences, the terms “identical” or “percent “identical” mean that they are the same or a specified percentage of identicality (i.e., about 60% identity, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%) when measured using the BLAST or BLAST2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection. This refers to two or more sequences or subsequences having amino acid residues or nucleotides of 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or identity in a specified region when compared and aligned for the greatest match in a comparison window or specified region (see, for example, the NCBI website). Such sequences are then said to be "substantially identical". This definition may also refer to or apply to the accolades of test sequences. The definition also includes sequences with deletions and / or additions, as well as sequences with substitutions. Preferred algorithms may take gaps, etc., as described below. Preferably, the identity exists over a region of at least about 10 amino acids or 20 nucleotides in length, or more preferably, over a region of 10 to 50 amino acids or 20 to 50 nucleotides in length. As used herein, percent (%) nucleotide sequence identity is defined as the percentage of amino acids in a candidate sequence that is identical to the nucleotides of the reference sequence after the sequence has been aligned and gaps introduced, if necessary, to achieve maximum percent sequence identity. Alignment for the purpose of determining percent sequence identity can be achieved in various ways within the scope of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2, or Megalign (DNASTAR) software.Appropriate parameters for measuring alignment, including any algorithm necessary to achieve the maximum alignment across the entire length of the sequences being compared, can be determined by known methods.

[0032] For sequence comparison, typically one sequence acts as a reference sequence, and the test sequence is compared to it. When using a sequence comparison algorithm, the test and reference sequences are input into a computer, sub-sequence coordinates are specified as needed, and sequence algorithm program parameters are specified. Preferably, default program parameters can be used, or alternative parameters can be specified. The sequence comparison algorithm then calculates the percentage sequence identity of the test sequence to the reference sequence based on the program parameters.

[0033] Examples of suitable algorithms for determining percent sequence identity and sequence similarity include the BLAST and BLAST 2.0 algorithms, described in Altschul et al. (1977) Nuc. Acids Res. 25:3389-3402 and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). This algorithm first identifies high-scoring sequence pairs (HSPs) by identifying short words of length W that, when aligned with words of the same length in the database sequence, match or satisfy a certain positive threshold score T. T is referred to as the neighbor word score threshold (Altschul et al. (1990) J. Mol. Biol. 215:403-410). These initial neighbor word hits serve as seeds to initiate a search for longer HSPs containing them. Word hits are extended in both directions along each sequence as long as they can increase the cumulative alignment score. The cumulative score for nucleotide sequences is calculated using parameters M (reward score for matching residue pairs; always > 0) and N (penalty score for mismatched residues; always < 0). For amino acid sequences, the cumulative score is calculated using a scoring matrix. The extension of word hits in each direction stops when the cumulative alignment score decreases by amount X from its maximum achieved value, or when the cumulative score becomes zero or less due to the accumulation of one or more negative scoring residue alignments, or when the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses, by default, a word length of 11 (W), expected (E) or 10, M=5, N=-4, and comparison of both strands.For amino acid sequences, the BLASTP program defaults to a word length of 3, an expected value (E) of 10, and an alignment (B) of 50, an expected value (E) of 10, M=5, N=-4, and a comparison of both strands in the BLOSUM 62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).

[0034] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, for example, Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P(N)), which provides an indicator of the probability that a match between two nucleotide or amino acid sequences occurs by chance. For example, if the minimum sum probability in a comparison of a test nucleic acid to a reference nucleic acid is less than about 0.2, more preferably less than about 0.01, then the nucleic acid is considered similar to the reference sequence.

[0035] As used herein, the terms “naturally occurring,” “unmodified,” or “wild-type” applied to nucleic acids, polypeptides, cells, or organisms refer to nucleic acids, polypeptides, cells, or organisms found in nature. For example, a polypeptide or polynucleotide sequence present in an organism (including a virus) that can be isolated from a natural source and has not been intentionally modified by humans in a laboratory is wild-type (and naturally occurring).

[0036] "Increase" can refer to any change that results in a greater quantity of symptoms, disease, composition, condition, or activity. An increase can be a statistically significant increase in any individual, median, or mean of a condition, symptom, activity, or composition. Thus, an increase can be an increase of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%, insofar as the increase is statistically significant.

[0037] "Reduction" can refer to any change that results in a smaller amount of symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene if the genetic output of the gene product containing that substance is less than the genetic output of the gene product without that substance. For example, a reduction could also be a change in the symptoms of a disorder, such that the symptoms are less severe than previously observed. A reduction can be a statistically significant reduction in any individual, median, or mean reduction of a condition, symptom, activity, or composition. Thus, a reduction can be a reduction of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%, insofar as the reduction is statistically significant.

[0038] As used herein, the term “nucleic acid” means a polymer composed of nucleotides, such as deoxyribonucleotides (DNA) or ribonucleotides (RNA). As used herein, the terms “ribonucleic acid” and “RNA” mean a polymer composed of ribonucleotides. As used herein, the terms “deoxyribonucleic acid” and “DNA” mean a polymer composed of deoxyribonucleotides.

[0039] "Optional" or "optional" means that the event or situation described later may or may not occur, and this description includes both cases in which the event or situation occurs and cases in which it does not occur.

[0040] As used herein, “operatably linked” can mean that a regulatory sequence useful for the expression of a nucleic acid coding sequence is positioned on a nucleic acid molecule at an appropriate position relative to the coding sequence so as to influence the expression of the coding sequence. This same definition sometimes applies to the positioning of coding sequences and / or transcriptional regulatory elements (e.g., promoters, enhancers, and termination elements), and / or selection markers within an expression vector. The term “operatably linked” can also mean the positioning of polypeptide segments within a single polypeptide chain, where individual polypeptide segments may be proteins, fragments thereof, linked peptides, and / or signal peptides, but are not limited to these. The term “operatably linked” can also mean the direct fusion of different individual polypeptides within a single polypeptide or fragment thereof, where there are no intervening amino acids between the different segments, and the individual polypeptides may be linked to each other via one or more intervening amino acids.

[0041] A "primer" is a subset of probes that can support certain types of enzymatic manipulation and can hybridize with a target nucleic acid so that enzymatic manipulation can occur. Primers can be made from any combination of nucleotides, nucleotide derivatives, or analogs available in the art that do not interfere with enzymatic manipulation.

[0042] A "probe" is typically a molecule capable of interacting with a target nucleic acid in a sequence-specific manner, for example, through hybridization. Nucleic acid hybridization is well understood in the art and will be discussed herein. Typically, probes can be prepared from any combination of nucleotides, nucleotide derivatives, or analogs available in the art.

[0043] A "protein-coding sequence," or a sequence encoding a specific protein or polypeptide, is a nucleic acid sequence that, under the control of appropriate regulatory sequences, is transcribed into mRNA (in the case of DNA) and translated into a polypeptide (in the case of mRNA) in vitro or in vivo. The boundaries of a coding sequence are determined by a start codon at the 5' end (N-terminus) and a translation termination nonsense codon at the 3' end (C-terminus). Codex sequences include, but are not limited to, cDNA derived from prokaryotic or eukaryotic mRNA, genomic DNA sequences derived from prokaryotic or eukaryotic DNA, and synthetic nucleic acids. The transcription termination sequence is usually located at 3' of the coding sequence.

[0044] The term "polynucleotide" refers to a single-chain or double-chain polymer composed of nucleotide monomers.

[0045] The term "polypeptide" refers to a compound consisting of a single chain of D- or L-amino acids, or a mixture of D- and L-amino acids linked by peptide bonds.

[0046] As used herein, the term “promoter” is defined as a DNA sequence that is recognized by a cellular synthetic mechanism, or recognized by an introduced synthetic mechanism, and is required to initiate the specific transcription of a polynucleotide sequence.

[0047] As used herein, the term “promoter / regulatory sequence” means a nucleic acid sequence required for the expression of a gene product operably ligated to a promoter / regulatory sequence. In some examples, this sequence may be a core promoter sequence, and in other examples, this sequence may also include enhancer sequences and other regulatory elements required for the expression of the gene product. The promoter / regulatory sequence may, for example, express the gene product in a tissue-specific manner.

[0048] A “pharmaceutically acceptable” component can mean a component that is not biological or otherwise undesirable, i.e., a component that can be incorporated into the pharmaceutical formulation of the present invention and administered to a subject as described herein without causing a significantly undesirable biological effect or interacting in an adverse manner with any other component of the formulation in which it is contained. When used in reference to administration to humans, this term generally means that the component meets the necessary standards for toxicity and manufacturing testing, or that it is included in the Inactive Ingredients Guide prepared by the U.S. Food and Drug Administration.

[0049] A “pharmaceutically acceptable carrier” (sometimes referred to as “carrier”) generally means a carrier or excipient useful in the preparation of safe and non-toxic pharmaceutical or therapeutic compositions, and includes carriers that are permitted for veterinary and / or human pharmaceutical or therapeutic use. The terms “carrier” or “pharmaceutically acceptable carrier” may include, but are not limited to, phosphate-buffered saline, water, emulsions (such as oil / water or water / oil emulsions), and / or various types of wetting agents. As used herein, the term “carrier” includes, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or material well known in the art for use in pharmaceutical formulations, and materials further described herein.

[0050] "Pharmacological activity" (or simply "activity") may refer to derivatives or analogues of a "pharmacological activity" that have the same type of pharmacological activity as the parent compound, and to approximately the same degree (e.g., salts, esters, amides, complexes, metabolites, isomers, fragments, etc.).

[0051] The “effective dose” of a drug refers to a sufficient amount of the drug to provide the desired effect. The amount of drug that is “effective” will vary from subject to subject, depending on many factors such as the subject’s age and general condition, and the specific drug(s) involved. Therefore, it is not always possible to specify a quantifiable “effective dose.” However, the appropriate “effective dose” for any subject may be determined by those skilled in the art using routine experiments. Also, as used herein, unless otherwise specified, the “effective dose” of a drug may also refer to an amount that covers both the therapeutically effective dose and the prophylactically effective dose. The “effective dose” of a drug required to achieve a therapeutic effect may vary depending on factors such as the subject’s age, sex, and weight. The administration plan may be adjusted to provide the optimal therapeutic response. For example, the daily dose may be divided into several doses, or the dose may be proportionally reduced as indicated by the urgency of the treatment situation.

[0052] "Therapeutic agent" refers to any composition having beneficial biological effects. Beneficial biological effects include both therapeutic effects, e.g., treatment of disorders or other undesirable physiological conditions, and preventive effects, e.g., prevention of disorders or other undesirable physiological conditions (e.g., cancer). These terms also encompass, but are not limited to, pharmacologically acceptable active derivatives of beneficial agents specifically referred to herein, including salts, esters, amides, precursors, active metabolites, isomers, fragments, analogs, etc. When the term "therapeutic agent" is used, and subsequently when a particular agent is specifically identified, it should be understood that this term includes the agent itself, as well as pharmaceutically acceptable pharmacologically active salts, esters, amides, precursors, complexes, active metabolites, isomers, fragments, analogs, etc.

[0053] The “therapeutic effective dose” or “therapeutic effective dose” of a composition (e.g., a composition containing a drug) refers to the amount effective in achieving a desired therapeutic outcome. In some embodiments, the desired therapeutic outcome is the control of cancer. In some embodiments, the desired therapeutic outcome is the control of metastasis. In some embodiments, the desired therapeutic outcome is a reduction in tumor size. In some embodiments, the desired therapeutic outcome is the prevention and / or treatment of recurrence. A given therapeutic effective dose of a therapeutic agent will typically vary with respect to the type and severity of the disorder or disease being treated, as well as factors such as the age, sex, and weight of the subject. The term can also refer to the amount of a therapeutic agent, or the rate of delivery of the therapeutic agent (e.g., amount over time), that is effective in promoting a desired therapeutic effect, such as pain relief. The exact desired therapeutic effect will vary according to the condition being treated, the subject's tolerance, the drug and / or drug formulation administered (e.g., the potency of the therapeutic agent, the concentration of the drug in the formulation, etc.), and various other factors understood by those skilled in the art. In some cases, the desired biological or medical response may be achieved after multiple administrations of the composition over several days, weeks, or years.

[0054] As used herein, “transgene” means exogenous genetic material (e.g., one or more polynucleotides) that is artificially provided or can be provided to a cell. The term may also be used to mean a “recombinant” polynucleotide that codes for any of the polypeptides disclosed herein that are the subject of this disclosure. The term “recombinant” means a sequence (e.g., a polynucleotide or polypeptide sequence) that is not present in the cell from which the sequence is artificially provided, or that is linked to another polynucleotide by a sequence not present in the cell from which the sequence is artificially provided. “Artificial” means non-natural development in a host cell and is understood to include manipulation by humans, machines, exogenous factors (e.g., enzymes, viruses, etc.), other non-natural manipulations, or combinations thereof. A transgene may include, but is not limited to, a gene operably linked to a promoter (e.g., an open reading frame). Once a transgene is artificially provided to a cell, the transgene may be integrated into the host cell chromosome, exist extrachromosomally, or exist in any combination thereof.

[0055] Throughout this application, various publications are referenced. The disclosures of these publications, in their entirety, are incorporated herein by reference to provide a more complete description of the state of the art relating to this application. The disclosed references are also discussed in the texts relating thereto, and the materials contained therein are incorporated herein by reference individually and specifically.

[0056] B. Methods for genetically modifying plasmids and cells Genetic modification of NK cells using viral or nonviral vectors is difficult due to robust foreign DNA and RNA sensing mechanisms, which can limit the efficiency of gene delivery methods to NK cells. To overcome this limitation, a novel method was developed for directly electroporating the Cas9 / ribonucleoprotein complex (Cas9 / RNP) into human primary NK cells. This method successfully introduces double-strand breaks (DSBs) into the NK cell genome, resulting in gene knockout and improved antitumor activity. Following this initial success in gene silencing, the development of gene insertion methods was further pursued. After Cas9 introduces a DSB, the break can be repaired using two independent innate DNA repair mechanisms: homologous recombination (HR) or non-homologous end joining (NHEJ). In the presence of a DNA template encoding the gene of interest, the exogenous gene can be incorporated into the Cas9 target site using either of these repair mechanisms.

[0057] Therefore, disclosed herein are plasmids for use in clustered and regularly arranged short palindromic sequence repeat (CRISPR) / CRISPR-related 9 (Cas9) integration systems, the plasmid comprising: a left homologous arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide (e.g., a CAR containing scFv targeting a receptor on a target cell (e.g., CD33)), a transmembrane domain (e.g., NKG2D transmembrane domain, CD4 transmembrane domain, CD8 transmembrane domain, CD28 transmembrane domain, or CD3ξ transmembrane domain), a co-stimulatory domain (e.g., a 2B4 domain, a CD28 co-stimulatory domain, a 4-1 BB co-stimulatory domain, or any combination of 2B4 domains, a CD28 co-stimulatory domain, and / or 4-1 The plasmid contains, in order, a BB costimulatory domain, a CD3ξ signaling domain, and a right homologous arm, with the left and right homologous arms each being less than 1000 bp in length (for example, approximately 30 bp, 300 bp, and 600 bp in length).

[0058] Generally, the “CRISPR system” or “CRISPR integration system” refers collectively to the transcripts and other elements involved in or instructing the activity of CRISPR-related “Cas” genes. In some embodiments, one or more elements of the CRISPR system are derived from type I, type II, or type III CRISPR systems. The CRISPR system is known in the art. See, for example, U.S. Patent No. 8,697,359, which is incorporated herein by reference in its entirety.

[0059] An endonuclease / RNP (e.g., Cas9 / RNP) consists of a three-component recombinant endonuclease protein (e.g., Cas9 endonuclease) complexed with a CRISPR locus. The endonuclease complexed with the CRISPR locus may be referred to as a CRISPR / Cas guide RNA. The CRISPR locus contains a synthetic single guide RNA (gRNA) that can hybridize to complementary repetitive RNA (crRNA) and trans-complementary repetitive RNA (tracrRNA) complexed with a target sequence. Thus, the CRISPR / Cas guide RNA hybridizes to a target sequence in the cell's genomic DNA. In some cases, a class 2 CRISPR / Cas endonuclease is a type II CRISPR / Cas endonuclease. In some cases, a class 2 CRISPR / Cas endonuclease is a Cas9 polypeptide, and the corresponding CRISPR / Cas guide RNA is a Cas9 guide RNA. Because these Cas9 / RNPs are delivered as functional complexes, they can cleave genomic targets with greater efficiency compared to approaches that rely on exogenous DNA. In addition, rapid clearance of Cas9 / RNPs from cells can reduce off-target effects such as the induction of apoptosis.

[0060] To produce an RNP complex, crRNA and tracrRNA can be mixed at concentrations of approximately 50 μM to approximately 500 μM (for example, 50 μM, 60 μM, 70 μM, 80 μM, 90 μM, 100 μM, 125 μM, 150 μM, 175 μM, 200 μM, 225 μM, 250 μM, 275 μM, 300 μM, 325 μM, 350 μM, 375 μM, 400 μM, 425 μM, 450 μM, 475 μM, or 500 μM), preferably 100 μM to approximately 300 μM, most preferably approximately 200 μM, in a ratio of 1:1, 2:1, or 1:2 at 95°C for approximately 5 minutes to form a crRNA:tracrRNA complex (i.e., guide RNA). Next, the crRNA:tracrRNA complex can be mixed with a final dilution of Cas endonuclease (e.g., Cas9) at a concentration of approximately 20 μM to 50 μM (e.g., 21 μM, 22 μM, 23 μM, 24 μM, 25 μM, 26 μM, 27 μM, 28 μM, 29 μM, 30 μM, 31 μM, 32 μM, 33 μM, 34 μM, 35 μM, 36 μM, 37 μM, 38 μM, 39 μM, 40 μM, 41 μM, 42 μM, 43 μM, 44 μM, 45 μM, 46 μM, 47 μM, 48 μM, 49 μM, or 50 μM).

[0061] When bound to a target sequence in a target cell, the CRISPR locus can modify the genome by introducing one or more base pairs of insertion or deletion, insertion of heterologous DNA fragments (e.g., donor polynucleotides), deletion of endogenous DNA fragments, inversion or translocation of endogenous DNA fragments, or a combination thereof into the target DNA. Therefore, when combined with DNA for homologous recombination using the methods disclosed herein, knockout or knock-in can be produced. This specification demonstrates that transduction of Cas9 / RNP via adeno-associated virus (AAV) is a relatively efficient method for overcoming previous limitations on genetic modification in cells (e.g., T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells).

[0062] The CRISPR / Cas9 system has recently been shown to facilitate high-level, precise genome editing using adeno-associated virus (AAV) vectors to function as donor template DNA during homologous recombination (HR). However, prior use of AAV has been limited by the immune function of NK cells and NK T cells, which are resistant to viral and bacterial vectors, as well as the induction of apoptosis in NK cells / NK T cells by such vectors. Therefore, prior to this method, CRISPR / Cas modification of NK cells or NK T cells had not been successful. Furthermore, the maximum AAV packaging capacity of approximately 4.5 kilobases limits the donor size, including homologous arms. Any transcript and any transgene larger than 100 bp must have homologous arms of at least 800 bp for each arm, and many systems are recommended to use asymmetric arms of 800 bp and 1000 bp, totaling 1800 bp. Therefore, AAV vectors cannot deliver transgenes larger than approximately 2.5 kb.In one embodiment, an AAV containing a donor construct plasmid having homologous arms of 30 bp to 1000 bp is used. A CRISPR / CAS9 nucleotide delivery system is disclosed herein, including 30bp, 50bp, 100bp, 110bp, 120bp, 130bp, 140bp, 150bp, 160bp, 170bp, 180bp, 190bp, 200bp, 210bp, 220bp, 230bp, 240bp, 250bp, 260bp, 270bp, 280bp, 290bp, 300bp, 310bp, 320bp, 330bp, 340bp, 350bp, 360bp, 370bp, 380bp, 390bp, 400bp, 410bp, 420bp, 430bp, 440bp, 450bp, 460bp, 470bp, 480bp, 490bp, 500bp, 510bp, and 520bp. , not limited to 530bp, 540bp, 550bp, 560bp, 570bp, 580bp, 590bp, 600bp, 610bp, 620bp, 630bp, 640bp, 650bp, 660bp, 670bp, 680bp, 690bp, 700bp, 710bp, 720bp, 730bp, 740bp, 750bp, 760bp, 770bp, 780bp, 790bp, 800bp, 810bp, 820bp, 830bp, 840bp, 850bp, 860bp, 870bp, 880bp, 890bp, 900bp, 910bp, 920bp, 930bp, 940bp, 950bp, 960bp, 970bp, 980bp, 990bp, or 1000bp. For example, homologous arms in homologous recombination (HR) may be symmetric 30 bp homologous arms, symmetric 300 bp homologous arms, symmetric 500 bp homologous arms, symmetric 600 bp homologous arms, symmetric 800 bp homologous arms, symmetric 1000 bp homologous arms, or asymmetric 800 bp homologous arms including an 800 bp left homologous arm (LHA) and a 1000 bp right homologous arm (RHA), or in non-homologous end joining using homology-independent target insertion (HITI) plasmids, there may be no homologous arms at all. In some examples, plasmids with or without homologous arms are disclosed in their entirety in WO2020 / 198675, which is incorporated herein by reference.In some embodiments, the plasmid comprises a clinically approved splice acceptor (SA) (SEQ ID NO: 10) and a clinically approved polyadenylated terminator (PA) (e.g., BGH polyA terminator SEQ ID NO: 11). It is understood and intended herein that homologous arms may be symmetric (equal length on each side) or asymmetric (different lengths on each side) to accommodate different transgene lengths.In other words, homologous arm lengths are LHA 30bp (SEQ ID NO: 2) and RHA 30bp (SEQ ID NO: 1), LHA 30bp and RHA 100bp, LHA 30bp and RHA 300bp (SEQ ID NO: 3), LHA 30bp and RHA 500bp (SEQ ID NO: 5), LHA 30bp and RHA 800bp (SEQ ID NO: 7), LHA 30bp and RHA 1000bp, LHA 100bp and RHA 30bp, LHA 100bp and RHA 100bp, LHA 100bp and RHA 300bp, LHA 100bp and RHA 500bp, LHA 100bp and RHA 800bp, LHA 100bp and RHA 1000bp, LHA 300bp (SEQ ID NO: 4) and RHA 30bp, LHA 300bp and RHA 100bp, LHA 300bp and RHA 300bp, LHA 300bp and RHA 500bp, LHA 300bp and RHA 800bp, LHA 300bp and RHA 1000bp, LHA 500bp (indicate number 6) and RHA 30bp, LHA 500bp and RHA 100bp, LHA 500bp and RHA 300bp, LHA 500bp and RHA 500bp, LHA 500bp and RHA 800bp, LHA 500bp and RHA 1000bp, LHA 800bp (indicate number 8) and RHA 30bp, LHA 800bp and RHA 100bp, LHA 800bp and RHA 300bp, LHA 800bp and RHA 500bp, LHA The possible combinations of left homologous arm (LHA) lengths and right homologous arm (RHA) lengths include, but are not limited to, 800bp and RHA 800bp, LHA 800bp and RHA 1000bp, LHA 1000bp and RHA 30bp, LHA 1000bp and RHA 300bp, LHA 1000bp and RHA 500bp, LHA 1000bp and RHA 800bp, and LHA 1000bp and RHA 1000bp.

[0063] Several methods exist for providing DNA templates, including both viral and nonviral methods. In nonviral approaches, single-stranded or double-stranded DNA templates are typically electroporated with Cas9 / RNP, but this is less efficient than viral transduction. For viral gene delivery, adeno-associated viruses (AAVs), including AAV6, are safely used in clinical trials and are useful as vectors for susceptible primary immune cells, including T cells.

[0064] Transcripts delivered via AAV vectors can be packaged as linear single-stranded (ss)DNA (ssAAV) with a length of approximately 4.7 kb, or as linear self-complementary (sc)DNA (scAAV). An advantage of scAAV vectors is the inclusion of a mutant reverse-end repeat (ITR), which is necessary for replication and helps bypass the rate-limiting step of second strand generation compared to ssDNA vectors. Due to the packaging capacity limitations of scAAV, HAs of 30 bp, 300 bp, 500 bp, and 800–1000 bps on the right and left sides of the Cas9 target site were designed to find the optimal HA length and provide possible HA lengths selected by researchers based on the size of the transgene (e.g., shown in Figure 2A). Furthermore, due to the packaging capacity limitations compared to ssAAV, scAAV may not be suitable for larger transgenes, such as chimeric antigen receptors (CARs) targeting CD33. Therefore, based on the size of the transgene, both ssAAV and scAAV have been designed and tested, providing a wide range of options for gene insertion in primary NK cells and / or NK T cells.

[0065] The efficiency of recombination has been shown to increase with increasing HA length. Therefore, for the ssAAV backbone, the longest possible length of the left-right homologous arms (HA) was used for either mCherry (e.g., 800 bp–1000 bp of HA) or CD33CAR-NK (e.g., 600 bp of HA). Since homologous arm design is a time-consuming procedure requiring multiple optimizations, the CRISPaint approach, a homology-independent method for gene insertion or tagging, was also investigated. In this method, the same Cas9 target site, including sequences encoding crRNA and a PAM sequence (hereinafter referred to herein as PAMg, e.g., SEQ ID NO: 9), is provided to a DNA template encoding the gene of interest. Upon introduction of the Cas9 complex, both the template and genomic DNA are simultaneously cleaved. As a result, the CRISPaint template is presented as linearized double-stranded DNA that can be incorporated via non-homologous repair mechanisms (e.g., as shown in Figure 2B). In some examples, the CRISPaint DNA template is as shown in Figures 21 and 22. Accordingly, in one embodiment, a plasmid is disclosed herein for delivering a donor transgene to a cell and incorporating the transgene (e.g., CAR) into the cell in combination with CRISPR / Cas9. Accordingly, plasmids for use in any preceding embodiment of a CRISPR / Cas9 integration system are disclosed herein, wherein the left homologous arm and the right homologous arm are of the same length or different lengths.

[0066] In some embodiments, the homologous arm specifically hybridizes to adeno-associated virus integration site 1 (AAVS1) on human chromosome 19. In some embodiments, the LHA is 600 bp long. In some embodiments, the LHA contains a sequence that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 31 or a fragment thereof. In some embodiments, the RHA is 600 bp long. In some embodiments, the RHA contains a sequence that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 32 or a fragment thereof.

[0067] The plasmids disclosed herein comprise polynucleotide sequences encoding chimeric antigen receptor (CAR) polypeptides. As used herein, “chimeric antigen receptor” or “CAR” refers to a chimeric receptor that targets a cancer antigen and brings receptor-expressing cells to cancer cells expressing the target antigen. Typically, a CAR comprises a molecule that recognizes a peptide derived from a tumor antigen presented by a major histocompatibility (MHC) molecule, or an antibody or fragment thereof expressed on the surface of a CAR cell targeting a cancer antigen (e.g., Fab', scFv, Fv, etc.). The receptor is fused via a linker to a signaling domain (e.g., CD3ζ domain for T and NKG2C, NKp44, or CD3ζ domain for NK cells or NK T cells). The tumor antigen target is a protein produced by tumor cells that trigger an immune response, particularly B cells, NK cells, NK T cells, and T cell-mediated immune responses. The choice of antigen-binding domain depends on the specific type of cancer being treated. Tumor antigens are known in the art, and include, for example, glioma-associated antigens, carcinoembryonic antigen (CEA), EGFRvIII, IL-llRa, IL-13Ra, EGFR, FAP, B7H3, Kit, CA LX, CS-1, MUC1, BCMA, bcr-abl, HER2, β-human chorionic gonadotropin, alpha-fetoprotein (AFP), ALK, CD19, CD123, cyclin Bl, lectin-reactive AFP, Fos-associated antigen 1, ADRB3, thyroglobulin, EphA2, RAGE-1, RUI, RU2, SSX2, AKAP-4, LCK, OY-TESl, PAX5, SART3, CLL-1, fucosyl GM1, GloboH, and MN-CA IX, EPCAM, EVT6-AML, TGS5, human telomerase reverse transcriptase, polysialic acid, PLAC1, RUI, RU2(AS), intestinal carboxylesterase, lewisY, sLe, LY6K, muthsp70-2, M-CSF, MYCN, RhoC, TRP-2, CYPIBI, BORIS, prostase, prostate-specific antigen (PSA), PAX3, PAP, NY-ESO-1, LAGE-la, LMP2, NCAM, p53, p53 variant, Ra variant, gplOO, prostein, OR51E2, PANX3, PSMA, PSCA, Her2 / neu, hTERT, HMWMAA, HAVCR1, VEGFR2, PDGFR-β, survivorbin and telomerase, regmine, HPV E6, E7, sperm protein 17, SSEA-4, tyrosinase, TARP, WT1, prostate cancer tumor antigen-1 (PCTA-1), ML-IAP, MAGE, MAGE-A1, MAD-CT-1, MAD-CT-2, MelanA / MART Examples include XAGE1, ELF2M, ERG (TMPRSS2 ETS fusion gene), NA17, neutrophil elastase, sarcoma translocation breakpoint, NY-BR-1, ephnnB2, CD20, CD22, CD24, CD30, CD33, CD38, CD44v6, CD97, CD171, CD179a, androgen receptor, FAP, insulin growth factor (IGF)-I, IGFII, IGF-I receptor, GD2, o-acetyl-GD2, GD3, GM3, GPRC5D, GPR20, CXORF61, folate receptor (FRa), folate receptor β, ROR1, Flt3, TAG72, TN Ag, Tie 2, TEM1, TEM7R, CLDN6, TSHR, UPK2, and mesoserine. Non-specific examples of tumor antigens include differentiation antigens, such as tyrosinase, TRP-1, TRP-2, and tumor-specific multisystem antigens, such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, and pi.5; Overexpressed embryonic antigens, e.g., CEA; Overexpressed oncogenes and mutated tumor suppressor genes, e.g., p53, Ra, HER-2 / neu; Unique tumor antigens resulting from chromosomal translocations, e.g., BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR; and viral antigens, e.g., Epstein-Barr virus antigen (EBVA) and human papillomavirus (HPV) antigens E6 and E7. Other large protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, pl85erbB2, pl80erbB-3, c-met, nm-23H1, PSA, IL13Ra2, CA19-9, CA72-4, CAM17.1, NuMa, K-ras, β-catenin, CDK4, Mum-1, p15, p16, 43-9F, 5T4, and 791T. Examples include gp72, α-fetoprotein, β-HCG, BCA225, BTAA, CA125, CA15-3\CA27.29\BCAA, CA195, CA242, CA-50, CAM43, CD68\P1, CO-029, FGF-5, G250, Ga733\EpCAM, HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCASL, SDCCAG1 6, TA-90\Mac-2 binding protein\Cyclofilm C-related protein, TAAL6, TAG72, TLP, TPS, GPC3, MUC16, LMP1, EBMA-1, BARF-1, CS1, CD319, HER1, B7H6, L1CAM, IL6, and MET.

[0068] CAR polypeptides may also comprise transmembrane domains (e.g., NKG2D transmembrane domain, CD4 transmembrane domain, CD8 transmembrane domain, CD28 transmembrane domain, and / or CD3ζ transmembrane domain) and costimulatory domains (e.g., 2B4 domain, CD28 costimulatory domain, 4-1 BB costimulatory domain, or any combination of 2B4 domain, CD28 costimulatory domain, and / or 4-1 BB costimulatory domain). For example, in some embodiments, the CAR polypeptide comprises an IgG4 hinge domain, a CD4 transmembrane domain, a CD28 costimulatory domain, a CD3 zeta polypeptide, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell, including but not limited to cancer cells expressing a target antigen (e.g., CD33). In some embodiments, the CAR polypeptide includes, but is not limited to, an IgG4 hinge domain, an NKG2D transmembrane domain, a 2B4 domain, a CD3 zeta polypeptide, and a single-chain variable fragment (scFV) that specifically binds to a receptor on the target cell, including but not limited to cancer cells expressing a target antigen (e.g., CD33). In some embodiments, the CAR polypeptide is as shown in Figure 6B. In some embodiments, the polynucleotide encoding the CAR polypeptide described herein contains at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) of the sequence identical to SEQ ID NO: 22, SEQ ID NO: 23, or a fragment thereof. In some examples, plasmid designs containing the CAR-coding polynucleotide are as shown in Figures 16 and 17.

[0069] In some embodiments, the polynucleotide encoding the scFV described herein contains at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) the same sequence as SEQ ID NO: 18 or a fragment thereof.

[0070] In some embodiments, the polynucleotide encoding the IgG4-hinge described herein contains at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) the same sequence as SEQ ID NO: 19 or a fragment thereof.

[0071] In some embodiments, the polynucleotides encoding the CD28 costimulatory domain described herein contain at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) the same sequence as SEQ ID NO: 20 or a fragment thereof.

[0072] In some embodiments, the polynucleotide encoding the CD3 zeta described herein contains at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) the same sequence as SEQ ID NO: 21, SEQ ID NO: 28, or a fragment thereof.

[0073] In some embodiments, the polynucleotides encoding the NKG2D transmembrane domain described herein contain at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) the same sequence as SEQ ID NO: 24 or a fragment thereof.

[0074] In some embodiments, the polynucleotide encoding the 2B4 domain described herein contains at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) the same sequence as SEQ ID NO: 26 or a fragment thereof.

[0075] In some embodiments, the polynucleotide encoding anti-CD33 scFV contains at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) the same sequence as SEQ ID NO: 29 or a fragment thereof.

[0076] In some embodiments, the MND promoter described herein contains at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) the same sequence as SEQ ID NO: 30 or a fragment thereof.

[0077] In some embodiments, the expression vector described herein comprises one or more linker sequences, the linker sequences comprising at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) of a sequence identical to SEQ ID NO: 25 or a fragment thereof.

[0078] Accordingly, in some embodiments, the plasmids disclosed herein comprise a polynucleotide sequence encoding a CAR polypeptide, the CAR polypeptide comprising a transmembrane domain (e.g., NKG2D transmembrane domain, CD4 transmembrane domain, CD8 transmembrane domain, CD28 transmembrane domain, or CD3ξ transmembrane domain), a co-stimulatory domain (e.g., 2B4 domain, CD28 co-stimulatory domain, 4-1 BB co-stimulatory domain, or any combination of 2B4 domain, CD28 co-stimulatory domain, and / or 4-1 BB co-stimulatory domain), CD3 zeta, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell (e.g., for cancer cells expressing CD33). In some embodiments, the CAR polypeptide specifically binds to CD33.

[0079] Plasmids that can be incorporated into the genome of transduced cells via HITI, CRISPaint, or other non-homologous end joining (NHEJ) are also disclosed herein. They thus have the advantage of being incorporated with higher efficiency. In some examples, the NHEJ plasmids are those disclosed in WO2020 / 198675, which are incorporated herein by reference in their entirety. To assist in the identification of cleavage sites for removing the transgene for integration, the plasmids target transgene integration with one or more PAMg sequences (i.e., protospacer flanking motif (PAM) and sequences encoding crRNA (i.e., gRNA)) (SEQ ID NO: 9). In some examples, for NHEJ DNA templates (e.g., CRISPaint DNA templates), single (PAMg) or double (PAMgPAMg) Cas9 target sequences are incorporated around the transgene (e.g., a polynucleotide encoding a CAR, e.g., CD33 CAR disclosed herein) but within the ITR. Therefore, Cas9 can simultaneously cleave gDNA and CRISPaint DNA templates, enabling their integration into genomic DSBs.

[0080] Accordingly, in some embodiments, plasmids for use in clustered and regularly arranged short palindromic sequence repeats (CRISPR) / CRISPR-related 9 (Cas9) integration systems are disclosed herein, wherein the plasmid comprises a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, and the polynucleotide sequence is adjacent to one polynucleotide sequence encoding one protospacer-adjacent motif (PAM) and CRISPR RNA (crRNA), or adjacent to two polynucleotide sequences encoding two PAMs and crRNAs. In some embodiments, plasmids disclosed herein are for use in clustered and regularly arranged short palindromic sequence repeats (CRISPR) / CRISPR-related 9 (Cas9) integration systems, wherein the plasmid comprises, in order, one polynucleotide sequence encoding one protospacer-adjacent motif (PAM) sequence and crRNA, one polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, and one PAM sequence and one polynucleotide sequence encoding crRNA. In some examples, plasmids are as shown in Figures 2B, 21, and 22.

[0081] In addition, despite the advantages of using single-stranded (SS) plasmids to insert larger transgenes, SS plasmids may require more time to fold within the cell and function as double-stranded DNA before integration, which increases DNA sensing mechanisms and cytotoxicity in some cells (e.g., T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells). This problem is overcome by using self-complementary (SC) (double-stranded) constructs to reduce the time of intracellular exposure to exogenous DNA.

[0082] In this specification, it is understood and intended that crispr RNA (crRNA) is used to target Cas9 nuclease activity to a target site and to cleave the donor plasmid, enabling the recombination of the donor transgene into host DNA. In some cases, crRNA is combined with tracrRNA to form guide RNA (gRNA). The disclosed plasmid uses AAV integration, targeting intron 1 of the regulatory subunit 12C (PPP1R12C) gene of protein phosphatase 1 on human chromosome 19, referred to as AAVS1, as the target site for transgene integration. This locus is a "safe harbor gene" and enables stable, long-term transgene expression in many cell types. Since disruption of PPP1R12C is not associated with any known disease, the AAVS1 locus is often considered a safe harbor for transgene targeting. Because the AAVS1 site is used as the target site, the CRSPR RNA (crRNA) must target this DNA. The guide RNA used in the plasmid disclosed herein includes GGGGCCACTAGGGACAGGAT (SEQ ID NO: 17), or any 10-nucleotide sense or antisense contiguous fragment thereof. Thus, in some examples, the sequence encoding PAM+crRNA includes SEQ ID NO: 9. While AAVS1 is used for illustrative purposes herein, it is understood and intended herein that other “safe harbor genes” may be used for equivalent results and may be substituted for AAVS1 if more appropriate considering the specific cell type or transgene being transfected. Examples of other safe harbor genes include, but are not limited to, CC chemokine receptor 5 (CCR5), the ROSA26 locus, and TRAC.

[0083] For example, the plasmid disclosed herein further comprises a mouse leukemia virus-derived (MND) promoter.

[0084] As described above, the use of AAV as a vector for delivering the disclosed CRISPR / Cas9 plasmid and any donor transgene is limited to a maximum of approximately 4.5 kb. One way to increase the acceptable size of the transgene is understood and intended herein to create additional room by replacing the Cas9 of the commonly used Streptococcus pyogenes (SpCas9) with synthetic Cas9 or Cas9 from a different bacterial source. Using Cas9 substitution can also increase target specificity, thus reducing the need to use gRNA. Therefore, for example, Cas9 may be derived from Staphylococcus aureus (SaCas9), Acidaminococcus species (AsCpf1), Lachnospiracase bacterium (LbCpf1), Neisseria meningitidis (NmCas9), Streptococcus thermophilus (StCas9), Campylobacter jejuni (CjCas9), enhanced SpCas9 (eSpCas9), SpCas9-HF1, Fokl-fused dCas9, proliferated Cas9 (xCas9), and / or catalytically inactive Cas9 (dCas9).

[0085] It is understood and intended herein that using a specific Cas9 can alter the PAM sequence used to screen targets using a Cas9 endonuclease (or substitute). When used herein, preferred PAM sequences include NGG(SpCas9 PAM), NNGRRT(SaCas9 PAM), NNNNGATT(NmCAs9 PAM), NNNNRYAC(CjCas9 PAM), NNAGAAW(St), TTTV(LbCpf1 PAM and AsCpf1 PAM); TYCV(LbCpf1 PAM variant and AsCpf1 PAM variant), where N is any nucleotide, V is A, C, or G, Y is C, or T, W is A, or T, and R is A, or G.

[0086] In one embodiment, a method for genetically modifying cells is provided herein, comprising: a) obtaining a plasmid containing a transgene (e.g., a chimeric antigen receptor for a tumor antigen) and a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA (gRNA) specific to a target DNA sequence in the cell, wherein the transgene is adjacent to a homologous arm; and b) introducing the transgene and the RNP complex into cells, wherein the transgene is introduced into the cells via infection with adeno-associated virus (AAV) and the RNP complex hybridizes to a target sequence in the cell's genomic DNA. In one embodiment, the method may further include introducing the RNP complex into cells via electroporation (for example, when modifying NK cells or NK T cells). In one embodiment, the method may further include co-infecting the target cells with a second AAV virus containing the RNP complex. In one embodiment, where the transgene is sufficiently small, the same AAV may contain both the transgene and the RNP complex. In a further embodiment, the transgene and the RNP complex may be encoded on the same plasmid.

[0087] In one embodiment, a method for genetically modifying cells (e.g., NK cells or NK T cells) by non-homologous end joining is disclosed herein, comprising: a) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA, and an AAV vector comprising a plasmid containing a transgene (e.g., a chimeric antigen receptor for a tumor antigen), wherein the transgene is adjacent to one PAM and crRNA, or adjacent to two sequences encoding two PAMs and crRNAs; and b) introducing the transgene and the RNP complex into cells, wherein the transgene is introduced into the cells via AAV infection of target cells, the ribonucleoprotein (RNP) complex hybridizes to a target sequence in the cell's genomic DNA, and the cell's DNA repair enzymes insert the transgene into the host genome at the target sequence (e.g., by non-homologous end joining), thereby producing modified cells. In one embodiment, the method may further include introducing the RNP complex into cells via electroporation (such as when modifying NK cells or NK T cells). In one embodiment, the method may further include co-infecting target cells with a second AAV virus containing the RNP complex. In one embodiment where the transgene is sufficiently small, the same AAV may contain both the transgene and the RNP complex. In a further embodiment, the transgene and the RNP complex may be encoded on the same plasmid.

[0088] In some cases, the AAV described herein may be used as a vector for delivering the prime-editing plasmids and any donor transgenes (e.g., polynucleotide-coding CARs) described herein. Prime editing is a “search-and-replace” genome editing technique that mediates targeted insertions, deletions, and combinations thereof in human cells without requiring a DSB or donor DNA template. Prime editing uses a fusion protein comprising a catalytically impaired Cas9 endonuclease, an engineered reverse transcriptase, an RNA programmable nickase, and / or prime-editing guide RNA (pegRNA) to directly copy genetic information from the elongation region on the pegRNA to a target genomic locus. Methods for designing and using prime editing are known in the art. See, for example, Anzalone, AV, Randolph, PB, Davis, J.Ret al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149-157 (2019). The entire text is incorporated herein by reference.

[0089] The methods disclosed herein are understood to be applicable to any cell type, including T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells, as well as any other cell type, and are intended herein. Human NK cells are particularly excellent targets for the plasmids disclosed and their methods of use. NK cells are a subset of peripheral blood lymphocytes defined by the expression of CD56 or CD16 and the absence of the T cell receptor (CD3). NK cells sense and kill target cells lacking major histocompatibility complex (MHC) class I molecules. NK cell activating receptors include, among others, innate cytotoxic receptors (NKp30, NKp44, and NKp46), as well as lectin-like receptors NKG2D and DNAM-1. Their ligands are expressed in stressed, transformed, or infected cells, but not in normal cells, so normal cells are resistant to NK cell killing. NK cell activation is negatively regulated via inhibitory receptors such as killer immunoglobin (Ig)-like receptors (KIRs), NKG2A / CD94, TGFβ, and leukocyte Ig-like receptor-1 (LIR-1). In one embodiment, target cells may be donor sources, e.g., allogeneic or autologous donor sources for adoptive transplantation (i.e., the final recipient of modified cells), NK cell lines (including, but not limited to, NK RPMI8866, HFWT, K562, and EBV-LCL), or primary NK cells from a primary NK cell source or a proliferating NK cell source derived from an NK cell line.

[0090] Prior to transduction of cells (e.g., T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, nerve cells, epithelial cells, and / or muscle cells), the cells can be incubated in a medium suitable for cell proliferation. It is understood and intended herein that the culture conditions may include the addition of cytokines, antibodies, and / or feeder cells. Accordingly, in one embodiment, a method for genetically modifying cells (e.g., T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, nerve cells, epithelial cells, and / or muscle cells) is disclosed herein, further comprising incubating the cells for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to transduction of the cells in a medium supporting cell proliferation, wherein the medium further comprises cytokines, antibodies, and / or feeder cells. For example, the culture medium may contain IL-2, IL-12, IL-15, IL-18, and / or IL-21. In one embodiment, the culture medium may also contain an anti-CD3 antibody. In one embodiment, the feeder cells may be purified from feeder cells that stimulate the cells. For example, NK cell-stimulated feeder cells for use in the claimed inventions disclosed herein may be irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs) or unirradiated autologous or PBMCs, RPMI8866, HFWT, K562, membrane-bound IL-15 and 41BBL, or IL-21, or any combination thereof, or EBV-LCL. In some embodiments, the feeder cells are provided in combination with a solution of IL-21, IL-15, and / or 41BBL. The feeder cells can be seeded into cell cultures in a ratio of 1:2, 1:1, or 2:1. It is understood and intended herein that the culture period may be 1 to 14 days after AAV infection (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days), preferably 3 to 7 days, and most preferably 4 to 6 days.

[0091] It is understood and intended herein that incubation conditions for primary and proliferating cells (including, but not limited to, primary and proliferating T cells, NK cells, NK T cells, or B cells) may vary. In one embodiment, culture of primary NK cells or NK T cells prior to AAV infection includes medium, cytokines (e.g., IL-2, IL-12, IL-15, IL-18, and / or IL-21), and / or anti-CD3 antibody for less than 5 days (e.g., 1, 2, 3, or 4 days). For proliferating NK cells, culture may be carried out in the presence of NK feeder cells (e.g., in a 1:1 ratio) in addition to, or instead of, cytokines (e.g., IL-2, IL-12, IL-15, IL-18, and / or IL-21) and / or anti-CD3 antibody. Culture of proliferating NK cells may be carried out for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days prior to transduction. Accordingly, in one embodiment, a method for genetically modifying cells (e.g., T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, nerve cells, osteoblasts, hepatocytes, epithelial cells, and / or muscle cells, etc.) is disclosed herein, comprising incubating primary cells in the presence of IL-2 for 4 days prior to infection with an AAV vector and / or electroporation (when the RNP complex is introduced via electroporation), or incubating proliferating cells in the presence of irradiated feeder cells for 4, 5, 6, or 7 days prior to infection with AAV and / or electroporation when the RNP complex is introduced via electroporation.

[0092] After transduction (e.g., via AAV infection or electroporation) of cells (e.g., T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, nerve cells, epithelial cells, and / or muscle cells), the modified cells can finally be grown in a culture medium containing feeder cells that stimulate the modified cells (e.g., T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, nerve cells, epithelial cells, and / or muscle cells). Thus, the modified cells retain their viability and proliferative capacity, as they can be grown after AAV infection and / or electroporation (when the RNP complex is introduced via electroporation) using irradiated feeder cells. For example, NK cell-stimulated feeder cells for use in the claimed inventions disclosed herein may be irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs) or K562 cells transfected with unirradiated autologous or PBMCs, RPMI8866, HFWT, K562, membrane-bound IL-15 and 41BBL, or IL-21, or any combination thereof, or EBV-LCL. In some embodiments, the NK cell feeder cells are provided in combination with a solution of IL-21, IL-15, and / or 41BBL. The feeder cells can be seeded into an NK cell culture in a ratio of 1:2, 1:1, or 2:1. The culture period may be 1 to 14 days after infection and / or electroporation (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days), preferably 3 to 7 days, most preferably 4 to 6 days, as intended herein. In some embodiments, the culture medium for modified NK cells may further contain cytokines such as IL-2, IL-12, IL-15, IL-18, and / or IL-21.

[0093] In one embodiment, it is understood and intended herein that one objective of the disclosed method for genetically modifying cells is to produce modified cells. Accordingly, modified T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, nerve cells, epithelial cells, and / or muscle cells produced by the method of the disclosure are disclosed herein. Accordingly, in one embodiment, disclosed herein are modified NK cells and / or NK T cells (including, but not limited to, CAR NK cells and / or CAR NK T cells) comprising either the plasmid or vector disclosed herein. For example, anti-CD33 CAR NK cells and anti-CD33 CAR NK T cells (including, but not limited to, anti-CD33 CAR NK cells and / or NK T cells) are disclosed herein, and anti-CD33 CAR comprises a CD33-targeting scFv, a transmembrane domain (e.g., NKG2D transmembrane domain, CD4 transmembrane domain, CD8 transmembrane domain, CD28 transmembrane domain, and / or CD3ζ transmembrane domain), and a co-stimulatory domain (e.g., a 2B4 domain, a CD28 co-stimulatory domain, a 4-1 BB co-stimulatory domain, or any combination of a 2B4 domain, a CD28 co-stimulatory domain, and / or a 4-1 BB co-stimulatory domain).

[0094] In one embodiment, disclosed herein is a method for producing chimeric antigen receptor (CAR) natural killer (NK) cells, comprising: a) obtaining a ribonucleoprotein (RNP) complex containing a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA, and an AAV vector containing a plasmid containing a transgene (e.g., a chimeric antigen receptor for a tumor antigen), wherein the transgene is adjacent to one PAM and crRNA, or adjacent to two PAM and crRNAs; and b) introducing the transgene and the RNP complex into cells, wherein the transgene is introduced into the target cells via infection with adeno-associated virus (AAV), the ribonucleoprotein (RNP) complex hybridizes to a target sequence in the cell's genomic DNA, and the cell's DNA repair enzymes insert the transgene into the host genome at the target sequence (e.g., by non-homologous end joining), thereby producing a modified cell. In one embodiment, the method may further include introducing the RNP complex into cells via electroporation (such as when modifying NK cells or NK T cells). In one embodiment, the method may further include co-infecting target cells with a second AAV virus containing the RNP complex. In one embodiment where the transgene is sufficiently small, the same AAV may contain both the transgene and the RNP complex. In a further embodiment, the transgene and the RNP complex may be encoded on the same plasmid.

[0095] In some embodiments, the method disclosed herein is a method for genetically modifying cells, comprising: a) obtaining an AAV vector comprising a ribonucleoprotein (RNP) complex containing a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA and a plasmid containing a chimeric antigen receptor (CAR) polypeptide, wherein the polynucleotide sequence is adjacent to homologous arms, and the homologous arms are 800 bp or less in length; and b) introducing the polynucleotide sequence and the RNP complex into cells, wherein the polynucleotide sequence is introduced into the cells via AAV infection, the RNP complex hybridizes to a target sequence in the cell's genomic DNA, and the cell's DNA repair enzymes insert the transgene into the host genome at the target sequence in the cell's genomic DNA, thereby producing modified cells. In some embodiments, the cells are NK cells.

[0096] In one embodiment, modified cells (e.g., NK cells) used in the disclosed immunotherapy method and produced by the disclosed modification method may be primary cells from a donor source (e.g., allogeneic or autologous donor source for adoptive transplantation therapy (i.e., the final recipient of modified NK cells)), a cell line (including, but not limited to, NK cell lines NK RPMI8866, HFWT, K562, and EBV-LCL), or a primary cell source or a source of proliferating cells derived from a cell line. Since primary cells can be used, it is understood and intended herein that the disclosed modifications of cells can be performed ex vivo or in vitro.

[0097] The cells used herein may be primary cells or proliferating cells. Primary cells may be incubated in the presence of IL-2 for about 4 to 10 days prior to infection with the AAV vector. In one embodiment, primary cells are proliferated in the presence of irradiated feeder cells, plasma membrane particles, or exosomes for about 4 to 10 days prior to infection. In some embodiments, the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof.

[0098] Following transduction of cells (e.g., NK cells), modified cells can be proliferated and stimulated before administration to a target. For example, a method for adoptively transplanting immune cells to a target in need is disclosed herein, in which the immune cells (e.g., natural killer (NK) cells) are proliferated in irradiated feeder cells, plasma membrane (PM) particles, or membrane-bound exosomes (EX) (mbIL-21) (PM particles and EX exosome-expressing mbIL-21 are referred herein as PM21 particles and EX21 exosomes, respectively) before administration to the target. In some embodiments, the proliferation may further include irradiated feeder cells, plasma membrane (PM) particles, or exosome-expressing membrane-bound IL-15 (mbIL-15), and / or membrane-bound 4-1BBL (mb4-1BBL). In some embodiments, it is understood and intended herein that stimulation and proliferation of modified (e.g., manipulated) cells may occur in vivo after or concurrently with the administration of modified cells to a subject. Accordingly, immunotherapeutic methods are disclosed herein that involve transplanting cells (e.g., NK cells) to a subject via the administration of PM particles having IL-21 or mbIL-21, exosomes having mbIL-21, and / or irradiated mbIL-21-expressing feeder cells, and then causing the cells to proliferate in the subject. In some embodiments, the proliferation further comprises the administration of IL-15 and / or 4-1BBL or PM particles, exosomes, and / or irradiated feeder cells expressing membrane-bound IL-15 and / or 4-1BBL.

[0099] In some embodiments, the methods disclosed herein include infecting NK cells with an AAV MOI ranging from about 1 to about 1000K MOI (e.g., about 5 to about 500K MOI). For example, the methods disclosed herein include infecting NK cells with at least an AAV MOI of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, or 500 MOI.

[0100] 1. Hybridization / Selective Hybridization The term hybridization typically refers to a sequence-driven interaction between at least two nucleic acid molecules, such as a primer or probe and a gene. A sequence-driven interaction means an interaction between two nucleotides or nucleotide analogs or derivatives that occurs in a nucleotide-specific manner. For example, G interacting with C, or A interacting with T, are sequence-driven interactions. Typically, sequence-driven interactions occur on the Watson-Crick or Hoogsteen planes of nucleotides. Hybridization of two nucleic acids is influenced by several conditions and parameters known to those skilled in the art. For example, the salt concentration, pH, and temperature of the reaction all affect whether the two nucleic acid molecules hybridize.

[0101] The parameters for selective hybridization between two nucleic acid molecules are known to those skilled in the art. For example, in some embodiments, the conditions for selective hybridization can be defined as stringent hybridization conditions. For instance, the stringency of hybridization is controlled by both the temperature and salt concentration of either or both the hybridization and washing steps. For example, hybridization conditions to achieve selective hybridization may involve hybridization in a high ionic strength solution (6X SSC or 6X SSPE) at a temperature about 12–25°C lower than Tm (the melting temperature at which half of the molecules dissociate from their hybridization partners), followed by washing at a combination of temperature and salt concentration selected such that the washing temperature is about 5–20°C lower than Tm. The temperature and salt conditions can be easily determined empirically in preliminary experiments in which a sample of reference DNA immobilized on a filter is hybridized to the target labeled nucleic acid and then washed under different stringency conditions. Hybridization temperatures are typically higher for DNA-RNA and RNA-RNA hybridization. As described above, or as known in the art, stringency can be achieved using these conditions. Preferred stringent hybridization conditions for DNA:DNA hybridization are approximately 68°C (in aqueous solution) in 6X SSC or 6X SSPE, followed by washing at 68°C. If desired, the stringency of hybridization and washing can be reduced as the desired degree of complementarity decreases, and further depending on the GC or AT richness of any region where variability is sought. If desired, the stringency of hybridization and washing can be increased as the desired degree of complementarity increases, and further depending on the GC or AT richness of any region where high complementarity is desired, all as known in the art.

[0102] Another way to define selective hybridization is by looking at the amount (percentage) of one nucleic acid bound to the other. For example, in some embodiments, selective hybridization conditions are when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the restriction nucleic acid is bound to the non-restriction nucleic acid. Typically, the non-restriction primer is, for example, 10, 100, or 1000 times in excess. This type of assay is performed when both the restriction and non-restriction primers are, for example, their k d It is 10 times, 100 times, or less than 1000 times, or only one of the nucleic acid molecules is 10 times, 100 times, or 1000 times, or one or both nucleic acid molecules are less than or equal to those k d It can be carried out under conditions exceeding those specified.

[0103] Another way to define selective hybridization is to examine the percentage of primers enzymatically manipulated under conditions required for the hybridization to facilitate the desired enzymatic manipulation. For example, in some embodiments, the conditions for selective hybridization are that at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, and 100% of the primers are enzymatically manipulated under conditions that facilitate enzymatic manipulation. When the enzyme manipulation is DNA elongation, for example, the conditions for selective hybridization are when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the primer molecules are elongated. Preferred conditions also include conditions suggested by the manufacturer or conditions shown in the art that are appropriate for the enzyme performing the manipulation.

[0104] It is understood that, similar to homology, various methods for determining the level of hybridization between two nucleic acid molecules are disclosed herein. While these methods and conditions may provide different percentages of hybridization between two nucleic acid molecules, unless otherwise specified, it will suffice to satisfy the parameters of any of the methods. For example, if 80% hybridization is required, then any hybridization occurring within the required parameters using any one of these methods will be considered as disclosed herein.

[0105] Those skilled in the art will understand that if a composition or method satisfies any one of these criteria for determining hybridization, either collectively or individually, it is one of the compositions or methods disclosed herein.

[0106] 2. Nucleic acid There are various molecules disclosed herein that are based on nucleic acids. The disclosed nucleic acids consist, for example, of nucleotides, nucleotide analogs, or nucleotide substitutes. Non-limiting examples of these and other molecules are discussed herein. For example, when a vector is expressed in a cell, it is understood that the expressed mRNA typically consists of A, C, G, and U. Similarly, for example, when an antisense molecule is introduced into a cell or cellular environment, for example, through exogenous delivery, it is understood that it is advantageous for the antisense molecule to consist of nucleotide analogs that reduce the degradation of the antisense molecule in the cellular environment.

[0107] a) Nucleotides and related molecules A nucleotide is a molecule containing a base moiety, a sugar moiety, and a phosphate moiety. Nucleotides can be linked together through their phosphate and sugar moieties to form nucleoside bonds. The base moiety of a nucleotide may be adenine-9-yl (A), cytosine-1-yl (C), guanine-9-yl (G), uracil-1-yl (U), and thymine-1-yl (T). The sugar moiety of a nucleotide is ribose or deoxyribose. The phosphate moiety of a nucleotide is pentavalent phosphate. Non-limiting examples of nucleotides would be 3'-AMP (3'-adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate). A wide variety of these types of molecules exist, available in the art and available herein.

[0108] A nucleotide analog is a nucleotide containing some kind of modification to either the base, sugar, or phosphate moiety. Modifications to nucleotides are known in the art and may include, for example, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, and 2-aminoadenine, as well as modifications to the sugar or phosphate moiety. A wide variety of these types of molecules are available in the art and are available herein.

[0109] Nucleotide substitutes are molecules that possess similar functional properties to nucleotides but do not contain a phosphate group, such as peptide nucleic acids (PNAs). Nucleotide substitutes recognize nucleic acids in a Watson-Crick or Hoogsteen manner, but are linked together through a portion other than the phosphate group. Nucleotide substitutes can adapt to a double-helix structure when interacting with a suitable target nucleic acid. A wide variety of these types of molecules are available in the art and are available herein.

[0110] Other types of molecules (complexes) can be linked to nucleotides or nucleotide analogs to enhance, for example, cellular uptake. These complexes can be chemically linked to nucleotides or nucleotide analogs. Examples of such complexes include, but are not limited to, lipid moieties, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556). A wide variety of these types of molecules are available in the art and are available herein.

[0111] A Watson-Crick interaction is at least one interaction between a nucleotide, nucleotide analog, or nucleotide substitute and the Watson-Crick plane. The Watson-Crick plane of a nucleotide, nucleotide analog, or nucleotide substitute includes the C2, N1, and C6 positions of purine nucleotides, nucleotide analogs, or nucleotide substitutes, and the C2, N3, and C4 positions of pyrimidine nucleotides, nucleotide analogs, or nucleotide substitutes.

[0112] Hoogsteen interactions are interactions that occur on the Hoogsteen surface of nucleotides or nucleotide analogs exposed to the major groove of double-stranded DNA. The Hoogsteen surface contains reactive groups (NH2 or O) at the N7 and C6 positions of purine nucleotides.

[0113] b) Array There are various sequences associated with protein molecules involved in the signaling pathways disclosed herein, such as CD33, 4-1BB, NKG2D, or 2B4, all of which are encoded by or are nucleic acids. Human analogues of these genes, as well as other analogues, and alleles of these genes, as well as splice variants and other types of variants, are available in various protein and gene databases, including Genbank. Those skilled in the art understand methods for analyzing sequence inconsistencies and differences, and for adapting compositions and methods associated with specific sequences to other associated sequences. Primers and / or probes can be designed for any given sequence that provides information disclosed herein and known in the art.

[0114] c) Primers and probes Compositions comprising primers and probes are disclosed that can interact with disclosed nucleic acids, such as CD33, as disclosed herein. In certain embodiments, primers are used to support DNA amplification reactions. Typically, primers may be extended in a sequence-specific manner. Sequence-specific primer extension includes any method by which the sequence and / or composition of nucleic acid molecules to which the primer hybridizes or separately associates induces or influences the composition or sequence of the product produced by the primer extension. Thus, sequence-specific primer extension includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription, or reverse transcription. Techniques and conditions for amplifying primers in a sequence-specific manner are preferred. In certain embodiments, primers are used in DNA amplification reactions such as PCR or direct sequencing. In certain embodiments, primers may also be extended using non-enzymatic techniques, for example, it should be understood that nucleotides or oligonucleotides used to extend primers are modified to chemically react to extend the primers in a sequence-specific manner. Typically, the disclosed primers hybridize to the disclosed nucleic acid or region of nucleic acid, or they hybridize to the complement of the nucleic acid or region of nucleic acid.

[0115] In certain embodiments, the size of the primer or probe for interacting with nucleic acids may be any size that supports the desired enzymatic manipulation of the primer, such as DNA amplification or simple hybridization of the probe or primer. Typical primers or probes include at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 7 The nucleotide lengths are 8, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides.

[0116] In other embodiments, the primer or probe is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, The nucleotide length may be 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides or less.

[0117] CD33 gene primers would typically be used to produce an amplified DNA product containing a region of the CD33 gene or the full-length gene. Generally, the size of this product can typically be precisely determined to be within 3 nucleotides, 2 nucleotides, or 1 nucleotide.

[0118] In certain embodiments, this product comprises at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, The nucleotide lengths are 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides.

[0119] In other embodiments, the product is 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86 , 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides in length or less.

[0120] 3. Delivery of the composition to cells Several compositions and methods exist that can be used to deliver nucleic acids to cells, either in vitro or in vivo. These methods and compositions can be broadly classified into two classes: virus-based delivery systems and non-virus-based delivery systems. For example, nucleic acids can be delivered via several direct delivery systems such as electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, and cosmids, or via the transfer of genetic material in cells or carriers, such as cationic liposomes. Suitable means for transfection, including viral vectors, chemical transfectants, or physico-mechanical methods such as electroporation and direct diffusion of DNA, are described, for example, by Wolff, JA, et al., Science, 247, 1465-1468, (1990) and Wolff, JANature, 352, 815-818, (1991). Such methods are well known in the art and are readily adaptable for use with the compositions and methods described herein. In certain cases, this method may be modified to function specifically with large DNA molecules. Furthermore, by using these methods and leveraging the carrier's targeting properties, specific diseases and cell populations can be targeted.

[0121] a) Nucleic acid-based delivery systems A transvector can be used to deliver a gene into a cell (e.g., a plasmid) or any nucleotide construct used as part of a general strategy for gene delivery, for example, as part of a recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)). In some examples, the plasmids described herein may be DNA templates or nucleotide constructs containing polynucleotide sequences provided herein.

[0122] As used herein, plasmids or viral vectors are agents that transport nucleic acids into cells without degradation and contain promoters that result in gene expression within the cells to which they are delivered. Viral vectors include, for example, adenoviruses, adeno-associated viruses, herpesviruses, vaccinia viruses, polioviruses, AIDS viruses, neurotrophic viruses, Sindbis, and other RNA viruses, including these viruses having an HIV skeleton. Preferably, any viral family that shares the properties of these viruses and is suitable for use as a vector. Retroviruses include mouse Maloney's leukemia virus (MMLV), and retroviruses that express desired properties of MMLV as vectors. Retroviral vectors can carry larger gene payloads, i.e., transgenes or marker genes, than other viral vectors, and for this reason, they are commonly used vectors. However, they are not useful in non-proliferating cells. Adenovirus vectors are relatively stable, easy to handle, have high titers, are delivered in aerosol formulations, and can transfect non-dividing cells. Poxvirus vectors are large, have several sites for gene insertion, are heat-stable, and can be stored at room temperature. A preferred embodiment is a viral vector engineered to suppress the immune response of a host organism induced by a viral antigen. This type of preferred vector carries a coding region for interleukin 8 or 10.

[0123] Viral vectors can have a higher transactional capacity (gene transfer capacity) than chemical or physical methods for introducing genes into cells. Typically, viral vectors contain unstructured early genes, structural late genes, RNA polymerase III transcripts, inverted end repeats necessary for replication and capsid formation, and promoters that control transcription and replication of the viral genome. When manipulated as a vector, a virus typically removes one or more of its early genes and inserts a gene or gene / promoter cassette into the viral genome in place of the removed viral DNA. This type of construct can carry up to approximately 8 kb of foreign genetic material. The required function of the removed early gene is typically supplied by a cell line manipulated to express the gene product of the early gene in trans.

[0124] (1) Adeno-associated virus vector Another type of viral vector is based on adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans. AAV-type vectors can transport approximately 4–5 kb, and wild-type AAV is known to stably insert into chromosome 19 (e.g., AAV integration site 1 (AAVS1)). Vectors containing this site-specific integration property are preferred. The AAV used may be derived from any AAV serotype, including but not limited to AAC1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and recombinant (rAAV) such as AAV-Rh74, and / or synthetic AAV (e.g., AAV-DJ, Anc80). The AAV serotype can be selected based on cell or tissue tropism. The AAV vector for use in the disclosed compositions and methods may be single-stranded (SS) or self-complementary (SC).

[0125] In other types of AAV viruses, the AAV contains a pair of inverted terminal repeats (ITRs) adjacent to at least one cassette containing a promoter that directs cell-specific expression ligated to a heterologous gene. In this context, heterologous refers to any nucleotide sequence or gene that is not native to AAV or B19 parvovirus.

[0126] Typically, the AAV and B19 coding regions are deleted to obtain a safe, cytotoxic vector. The AAV ITR, or its modification, confers infectivity and site-specific integration but not cytotoxicity, and the promoter directs cell-specific expression.

[0127] Therefore, the disclosed vector provides a DNA molecule that can be incorporated into mammalian chromosomes without substantial toxicity.

[0128] Inserted genes in viruses and retroviruses typically contain promoters and / or enhancers that help control the expression of the desired gene product. A promoter is generally a DNA sequence that functions when it is fixed relative to the transcription start site. Promoters contain core elements necessary for the fundamental interaction between RNA polymerase and transcription factors, and may also contain upstream and response elements.

[0129] It is understood and intended herein that the packaging capacity of AAVs is limited. One way to overcome the loading capacity of AAV vectors is through the use of two vectors, where the transgene is split between two plasmids, and a 3' splice donor and a 5' splice acceptor are used to ligate the two sections of the transgene into a single full-length transgene. Alternatively, the two transgenes can be constructed in substantial duplication, and homologous recombination ligates the two segments into a full-length transcript.

[0130] 4. Expression System Nucleic acids delivered to cells typically contain gene expression regulatory systems. For example, inserted genes in viruses and retroviral systems usually contain promoters and / or enhancers that help regulate the expression of the desired gene product. A promoter is generally a DNA sequence that functions when it is fixed in a position relative to the transcription start site. Promoters contain core elements necessary for the basic interaction between RNA polymerase and transcription factors, and may contain upstream and response elements.

[0131] a) Virus promoters and enhancers Preferred promoters for controlling transcription from vectors within mammalian host cells can be obtained from a variety of sources, e.g., from the genomes of viruses such as polyomas, Simian virus 40 (SV40), adenoviruses, retroviruses, hepatitis B viruses, and most preferably cytomegaloviruses, or from heterologous mammalian promoters, e.g., beta-actin promoters. Early and late promoters of SV40 virus may be conveniently obtained as SV40 restriction fragments that also contain the SV40 virus origin of replication (Fiers et al., Nature, 273:113 (1978)). The earliest promoter of human cytomegalovirus is conveniently obtained as a HindIIIE restriction fragment (Greenway, PJ et al., Gene 18:355-360 (1982)). Of course, promoters derived from host cells or related species are also useful herein.

[0132] An enhancer generally refers to a DNA sequence that functions even if it is not at a certain distance from the transcription start site and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. 78:993 (1981)) or 3' (Lusky, ML, et al., Mol. Cell Bio. 3:1108 (1983)) relative to the transcription unit. Furthermore, enhancers may be located within introns (Banerji, J. Let al., Cell 33:729 (1983)) and within the coding sequence itself (Osborne, TF, et al., Mol. Cell Bio. 4:1293 (1984)). These are typically 10–300 bp in length and function in cis. Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate transcriptional regulation. Promoters may also contain response elements that mediate transcriptional regulation. Enhancers often determine the regulation of gene expression. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, fetoprotein, and insulin), but typically, enhancers derived from eukaryotic cell viruses are used for general expression. Preferred examples include the SV40 enhancer (100–270 bp) on the late side of the origin of replication, the early promoter enhancer of cytomegalovirus, the polyoma enhancer on the late side of the origin of replication, and the adenovirus enhancer.

[0133] Promoters and / or enhancers can be specifically activated by either light or specific chemical events that trigger their function. The system can be modified with reagents such as tetracycline and dexamethasone. There are also methods to enhance gene expression in viral vectors by exposure to irradiation, such as gamma irradiation, or by alkylating chemotherapeutic agents.

[0134] In certain embodiments, the promoter and / or enhancer region can act as a constitutive promoter and / or enhancer to maximize the expression of the region of the transcription unit being transcribed. In certain constructs, the promoter and / or enhancer region is active in all eukaryotic cell types, even if it is expressed only in specific types of cells at specific times. A preferred promoter of this type is the CMV promoter (650 nucleotides). Other preferred promoters are the SV40 promoter, cytomegalovirus (full-length promoter), and the LTR of retroviral vectors.

[0135] It has been shown that all specific regulatory elements can be cloned and used to construct expression vectors that are selectively expressed in specific cell types, such as melanoma cells. The glial fibrillary acetate protein (GFAP) promoter has been used to selectively express genes in glial-derived cells.

[0136] Furthermore, expression vectors used in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans, or nucleated cells) may contain sequences necessary for transcription termination that can affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of mRNA encoding tissue factor proteins. The 3' untranslated region also includes the transcription termination site. It is preferable that the transcription unit also contains the polyadenylated region. One advantage of this region is that it increases the likelihood that the transcription unit will be processed and transported like mRNA. The identification and use of polyadenylated signals in expression constructs are well established. It is preferable that homologous polyadenylated signals are used in the transgene construct. In a particular transcription unit, the polyadenylated region is derived from the SV40 initial polyadenylated signal and consists of approximately 400 bases. It is also preferable that the transcription unit contains other standard sequences, either alone or in combination with the above sequences, that improve expression or stability from the construct.

[0137] b) Marker Viral vectors can contain nucleic acid sequences that encode marker products. These marker products are used to determine whether a gene is delivered to a cell and, upon delivery, expressed. Preferred marker genes are the E.Coli lacZ gene encoding β-galactosidase and green fluorescent protein.

[0138] In some embodiments, the marker may be a selectable marker. Examples of selectable markers suitable for mammalian cells include dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin. Once such selectable markers are successfully transferred to mammalian host cells, the transformed mammalian host cells can survive under selective pressure. There are two distinct categories of selective regimes that are widely used. The first category is based on the use of mutant cell lines that lack cellular metabolism and the ability to grow independently of supplemental medium. Two examples are CHO DHFR cells and mouse LTK cells. These cells lack the ability to grow without the addition of nutrients such as thymidine or hypoxanthine. Because these cells lack specific genes necessary for the complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in supplemental medium. An alternative to supplementing the medium is to alter their growth requirements by introducing intact DHFR or TK genes into the cells lacking the respective genes. Individual cells that were not transformed with the DHFR or TK gene would not be able to survive in a non-supplemented medium.

[0139] The second category refers to selection schemes used in any cell type and do not require the use of mutant cell lines, which are dominant selections. These schemes typically use drugs to halt the growth of host cells. Those cells with novel genes will express proteins that transmit drug resistance and will survive selection. Examples of such dominant selections use the drugs neomycin (Southern P. and Berg, P., J. Molec. Appl. Genet. 1:327 (1982)), mycophenolic acid (Mulligan, R. and Berg, P. Science 209:1422 (1980)), or hygromycin (Sugden, B. et al., Mol. Cell. Biol. 5:410-413 (1985)). Three examples use bacterial genes under the control of eukaryotic cells to transmit resistance to the appropriate drugs G418 or neomycin (Geneticin), xgpt (mycophenolic acid), or hygromycin, respectively. Other compounds include neomycin analog G418 and puramycin.

[0140] 5. Peptides a) Protein variants Protein variants and derivatives are well understood by those skilled in the art and may include amino acid sequence modifications. For example, amino acid sequence modifications typically fall into one or more of three classes: substitution, insertion, or deletion variants. Insertions include fusion of amino-terminus and / or carboxyl-terminus, as well as intrasequential insertions of single or multiple amino acid residues. Insertions are usually smaller than amino-terminus or carboxyl-terminus fusion insertions, typically consisting of, for example, 1 to 4 residues. Derivatives of immunogenic fusion proteins, such as those described in the examples, are prepared by fusion of a polypeptide large enough to confer immunogenicity to a target sequence, either by in vitro crosslinking or by recombinant cell cultures transformed with DNA encoding the fusion. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, about 2 to 6 residues or less are deleted at any single site within the protein molecule. These variants are usually prepared by site-directed mutagenesis of nucleotides in the protein-encoding DNA, thereby producing variant-encoding DNA, which is then expressed in recombinant cell cultures. Techniques for generating substitutional mutations at specific sites in DNA with known sequences, such as M13 primer mutagenesis and PCR mutagenesis, are well known. Amino acid substitutions are typically single-residue but can occur at several different locations at once; insertions are usually around 1 to 10 amino acid residues; and deletions range from approximately 1 to 30 residues. Deletions or insertions are preferably made in adjacent pairs, i.e., deletions or insertions of two residues. Substitutions, deletions, insertions, or any combination thereof can be combined to arrive at the final construct. Mutations should not cause the sequence to deviate from the reading frame and, preferably, do not generate complementary regions capable of producing secondary mRNA structures. A substitutional variant is one in which at least one residue is removed and a different residue is inserted in its place. Such substitutions are generally made according to Tables 5 and 6 below and are referred to as conservative substitutions. TIFF2023552917000002.tif147170TIFF2023552917000003.tif140170

[0141] Substantial changes in functional or immunological identity are achieved by selecting substitutions that are less conserved than those in Table 6, i.e., by selecting residues that have significantly different effects on maintaining (a) the structure of the polypeptide backbone in the substitution area as a sheet or helix, (b) the molecular charge or hydrophobicity at the target site, or (c) the bulk of the side chains. Generally, substitutions that are expected to bring about the greatest change in protein properties are those in which (a) a hydrophilic residue, e.g., ceryl or threonyl, is replaced by (or thereby) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl, or alanyl; (b) cysteine ​​or proline is replaced by (or thereby) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is replaced by (or thereby) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is replaced by (or thereby) a residue without a side chain, e.g., glycine, in which case (e) the substitution is made by increasing the number of sulfated and / or glycosylated sites.

[0142] For example, replacing one amino acid residue with another amino acid residue that is biologically and / or chemically similar is known to those skilled in the art as a conservative substitution. For example, a conservative substitution is replacing one hydrophobic residue with another hydrophobic residue, or replacing one polar residue with another polar residue. Substitutions include, for example, combinations of Gly, Ala, Val, Ile, Leu, Asp, Glu, Asn, Gln, Ser, Thr, Lys, Arg, and Phe, Tyr. Such conservatively substituted variations of each explicitly disclosed sequence are included in the mosaic polypeptides provided herein.

[0143] Substitution or deletion mutagenesis can be used to insert sites for N-glycosylation (Asn-X-Thr / Ser) or O-glycosylation (Ser or Thr). Deletion of cysteine ​​or other unstable residues may also be desirable. Deletion or substitution of potential proteolytic sites (e.g., Arg) can be achieved, for example, by deleting one of the basic residues or substituting it with a glutaminyl or histidyl residue.

[0144] Certain post-translational derivatizations are the result of the recombinant host cell's action on the expressed polypeptide. Glutaminyl and asparaginyl residues are often deamidated post-translation to their corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under weakly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of ceryl or threonyl residues, methylation of o-amino groups of lysine, arginine, and histidine side chains (TECreighton, Proteins: Structure and Molecular Properties, WH Freeman & Co., San Francisco pp 79-86

[1983] ), acetylation of N-terminal amines, and, in some cases, amidation of C-terminal carboxyls.

[0145] It should be understood that one way of defining protein variants and derivatives disclosed herein is by defining them in terms of homology / identity to a particular known sequence. These variants and other proteins disclosed herein are specifically disclosed if they have at least 70%, 75%, 80%, 85%, 90%, or 95% homology to the sequences described herein. Those skilled in the art will readily understand how to determine the homology of two proteins. For example, homology can be calculated after aligning the two sequences to the highest level of homology.

[0146] Another method for calculating homology can be performed by publicly available algorithms. Optimal alignment of sequences for comparison can be performed by the local homology algorithm of Smith and Waterman Adv.Appl.Math.2:482 (1981), the homology alignment algorithm of Needleman and Wunsch, J.MoL Biol.48:443 (1970), the similarity search method of Pearson and Lipman, Proc.Natl.Acad.Sci.USA85:2444 (1988), computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.

[0147] With respect to nucleic acids, the same type of homology can be obtained by algorithms disclosed, for example, in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, and Jaeger et al. Methods Enzymol. 183, 281-306 (1989).

[0148] It is understood that the descriptions of conserved variants and homology can be combined in any combination, for example, in embodiments where the variant has at least 70% homology to a particular sequence in which it is a conserved variant.

[0149] Since this specification discusses various proteins and protein sequences, it is understood that nucleic acids capable of encoding those protein sequences are also disclosed. This will include all degenerate sequences associated with a particular protein sequence, i.e., all nucleic acids having sequences encoding one particular protein sequence, as well as all nucleic acids including degenerate nucleic acids encoding disclosed variants and derivatives of protein sequences. Therefore, while each particular nucleic acid sequence may not be described herein, it is understood that each sequence and all sequences are actually disclosed and described herein through the disclosed protein sequences. It is also understood that while there are no amino acid sequences that show a specific DNA sequence encoding a particular protein in an organism disclosed herein, known nucleic acid sequences encoding that protein are also known, disclosed, and described herein.

[0150] It is understood that there are numerous amino acids and peptide analogs that can be incorporated into the disclosed compositions. For example, there are numerous D amino acids or amino acids having functional substituents different from those shown in Tables 5 and 6. Opposite stereoisomers of naturally occurring peptides, as well as stereoisomers of peptide analogs, are disclosed. These amino acids can be readily incorporated into polypeptide chains by loading selected amino acids onto tRNA molecules and by manipulating gene constructs to insert analog amino acids into peptide chains in a site-specific manner, for example, by utilizing amber codons.

[0151] It can produce molecules that are similar to peptides but are not linked via natural peptide bonds. For example, examples of bonds for amino acids or amino acid analogs include CH2NH--, --CH2S--, --CH2-CH2--, --CH=CH-- (cis and trans), --COCH2--, --CH(OH)CH2--, and --CHH2SO-- (these and others are referenced in Spatola, AF, *In Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins*, B. Weinstein, eds., Marcel Dekker, New York, p.267 (1983), Spatola, AF, *Vega Data* (March 1983), Vol.1, Issue 3, *Peptide Backbone Modifications* (general review), Morley, *Trends Pharm Sci* (1980) pp.463-468; Hudson, D. et al., *Int J Pept Prot Res*). 14:177-185(1979)(--CH2NH--, CH2CH2--), Spatola et al.Life Sci 38:1243-1249(1986)(--CH H2--S), Hann J.Chem.Soc Perkin Trans.I 307-314 (1982) (--CH--CH--, cis and trans), Almquist et al. al.European Appln,EP 45665 CA(1982):97:39405(1982 It can be found in (--CH(OH)CH2--), Holladay et al. Tetrahedron. Lett 24:4401-4404 (1983) (--C(OH)CH2--), and Hruby Life Sci 31:189-199 (1982) (--CH2--S--), each of which is incorporated herein by reference.A particularly preferred non-peptide bond is --CH2NH--. It is understood that peptide analogs, such as β-alanine and γ-aminobutyric acid, may have two or more atoms between the bonded atoms.

[0152] Amino acid analogs and their derivatives, as well as peptide analogs, often offer advantages such as more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., broader biological activity), and reduced antigenicity.

[0153] Because D-amino acids are not recognized by peptidases, they can be used to produce more stable peptides. More stable peptides can be produced by systematically substituting one or more amino acids in a consensus sequence with the same type of D-amino acid (e.g., D-lysine instead of L-lysine). Cysteine ​​residues can be used to cyclize or bond two or more peptides together. This can be beneficial for constraining peptides to a specific three-dimensional structure.

[0154] 6. Delivery of pharmaceutical carriers / medicines As described above, the composition may also be administered in vivo on a pharmaceutically acceptable carrier. "Pharmaceutically acceptable" means a material that is not biologically or otherwise undesirable, i.e., a material that can be administered to a subject together with nucleic acids or vectors, without causing any undesirable biological effects or interacting in a harmful manner with any other components of the pharmaceutical composition in which it comes into contact. The carrier may necessarily be selected to minimize any degradation of the active ingredient and minimize any adverse side effects in the subject, as is well known to those skilled in the art.

[0155] The composition may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, intraperitoneal injection, transdermally, extracorporeally, topically, including by intranasal administration or inhalation. As used herein, “intranasal administration” means delivery of the composition to the nose and nasal cavity through one or both nostrils, and may include delivery by a spray or droplet mechanism, or by aerosolization of nucleic acids or vectors. Inhalation of the composition can be done through the nose or mouth via delivery by spray or droplet mechanism. Delivery may also be directly delivered to any area of ​​the respiratory system (e.g., the lungs) via intubation. The exact amount of composition required will vary from subject to subject, depending on the species, age, weight, and general condition of the subject, the severity of the allergic disorder being treated, the specific nucleic acid or vector used, and the mode of administration. Therefore, it is impossible to specify an exact amount for all compositions. However, an appropriate amount can be determined by those skilled in the art using only routine experiments that give rise to the teachings herein.

[0156] Parenteral administration of compositions, when used, generally involves injection. Injectable preparations can be prepared in conventional forms, such as liquid solutions or suspensions, solid forms suitable for solutions of suspensions in liquids prior to injection, or emulsions. Recently revised parenteral administration approaches involve the use of sustained or prolonged release to maintain a constant dosage. See, for example, U.S. Patent No. 3,610,795, incorporated herein by reference.

[0157] The materials may be in solution or suspension (e.g., microparticles, liposomes, or incorporated into cells). These may target specific cell types via antibodies, receptors, or receptor ligands. The following references illustrate the use of this technology to target specific proteins in tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991), Bagshawe, KD, Br.J. Cancer, 60:275-281, (1989), Bagshawe, et al., Br.J. Cancer, 58:700-703, (1988), Senter, et al., Bioconjugate Chem., 4:3-9, (1993), Battelli, et al., Cancer Immunol.Immunother., 35:421-425, (1992), Pietersz and McKenzie, Immunolog.Reviews, 129:57-80, (1992), and Roffler, et al. al., Biochem.Pharmacol, 42:2062-2065, (1991). Vehicles, e.g., "Stealth" and other antibody-conjugated liposomes (including lipid-mediated drugs targeting colon cancer), receptor-mediated targeting of DNA via cell-specific ligands, lymphocyte-specific tumor targeting, and highly specific therapeutic retroviral targeting of mouse glioma cells in vivo. The following references illustrate the use of this technology to target specific proteins in tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989), and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)). Generally, receptors are involved in either constitutive or ligand-induced endocytosis pathways. These receptors cluster within clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through acidified endosomes where the receptors are sorted, and are then either recycled to the cell surface, stored within the cell, or degraded in lysosomes.Internal transport pathways perform a variety of functions, including nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligands, and regulation at the receptor level. Many receptors follow two or more intracellular pathways depending on cell type, receptor concentration, ligand type, ligand titer, and ligand concentration. The molecular and cellular mechanisms of receptor-mediated endocytosis have been outlined (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).

[0158] 7. Methods of treating cancer The plasmids, vectors, and modified NK cells and NK T cells disclosed herein can be used to treat, inhibit, mitigate, reduce, improve, and / or prevent any disease in which uncontrolled cell proliferation occurs, such as cancer. Cancer immunotherapy has advanced significantly in recent years, and genetically modified chimeric antigen receptor (CAR) T cells are a prime example of engineered immune cells that have been successfully deployed in cancer immunotherapy. While these cells were recently approved by the FDA for the treatment of CD19+ B cell malignancies, success so far has been limited to diseases with a small number of targetable antigens, and targeting such a limited antigen repertoire is prone to failure due to immune evasion. Furthermore, CAR T cells have been overshadowed by the use of autologous T cells due to the risk of graft-versus-host disease (GvHD) caused by allogeneic T cells. In contrast, NK cells are excellent candidates for cancer immunotherapy because they can kill tumor targets in an antigen-independent manner and do not cause graft-versus-host disease. It is understood and intended herein that the disclosed plasmids and methods can be used to generate, for example, CAR NK T cells and CAR NK cells for targeting cancer.

[0159] Accordingly, methods for treating, reducing, mitigating, inhibiting, improving, and / or preventing cancer and / or metastasis in a subject (e.g., acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), and / or myelodysplastic syndrome (MDS)) are disclosed herein, comprising administering any modified cells disclosed herein (e.g., modified NK cells and NK T cells) to a subject having cancer. For example, in certain embodiments, methods are disclosed herein for treating, reducing, mitigating, inhibiting, improving, and / or preventing cancer and / or metastasis (e.g., acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), halocyte leukemia (HCL), and / or myelodysplastic syndrome (MDS)) in a subject, the method comprising administering to the subject a therapeutically effective dose of natural killer (NK) cells or NK T cells, the NK cells or NK T cells comprising a plasmid for use in clustering with a regularly arranged short palindromic sequence repeat (CRISPR) / CRISPR-associated 9 (Cas9) integration system, the plasmid comprising, in order, a left homologous arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide (e.g., a CD33-targeted CAR), and a right homologous arm, the left and right homologous arms each being less than 1000 bp in length (e.g., 600 bp).

[0160] "Inhibit," "to inhibit," and "inhibition" mean reducing activity, response, condition, disease, or other biological parameter. This may include, but is not limited to, the complete elimination of activity, response, condition, or disease. This may include, for example, a 10% reduction of activity, response, condition, or disease compared to natural or control levels. Thus, the reduction may be 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount in between, compared to natural or control levels.

[0161] "To reduce" or other forms of the word, such as "to reduce" or "reduction," means a decrease in an event or characteristic (e.g., tumor growth). This is typically relative to some standard or expected value, in other words, it is relative, but it is understood that the standard or relative value is not necessarily required to be referenced. For example, "to reduce tumor growth" means to reduce the rate of tumor growth compared to a standard or control.

[0162] "Prevent" or other forms of the word, such as "preventing" or "prevention," means to stop a particular event or characteristic, to stabilize or slow the development or progression of a particular event or characteristic, or to minimize the likelihood of a particular event or characteristic occurring. Prevention is typically more absolute than reduction, for example, and therefore does not require comparison with a contrast. As used herein, something may be reduced but not prevented, while something that is reduced may be prevented. Similarly, something may be prevented but not reduced, while something that is prevented may be reduced. When reduction or prevention is used, it should be understood that the use of other words is also expressly disclosed unless specifically designated otherwise.

[0163] The term “treatment” refers to the medical management of a patient with the intention of curing, alleviating, stabilizing, or preventing a disease, pathological condition, or disorder. This term includes active treatment, i.e., treatment specifically directed toward improvement of a disease, pathological condition, or disorder, and also includes causal treatment, i.e., treatment directed toward the removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, i.e., treatment designed to alleviate symptoms rather than cure a disease, pathological condition, or disorder; preventive treatment, i.e., treatment directed toward minimizing, or partially or completely inhibiting, the onset of the associated disease, pathological condition, or disorder; and adjunct treatment, i.e., treatment used to supplement another specific therapy directed toward improvement of the associated disease, pathological condition, or disorder.

[0164] The term "subject" refers to any individual that is the target of administration or treatment. A subject may be a vertebrate, e.g., a mammal. In one embodiment, a subject may be a human, a non-human primate, a cattle, a horse, a pig, a dog, or a cat. A subject may also be a guinea pig, a rat, a hamster, a rabbit, a mouse, or a mole. Thus, a subject may be a human or a veterinary patient. The term "patient" refers to a subject under the treatment of a clinician, e.g., a physician.

[0165] As described above, the plasmids, vectors, and modified NK cells and NK T cells disclosed herein can be used to treat, inhibit, reduce, mitigate, and / or prevent cancer. A representative but non-limiting list of cancers that can be treated with the disclosed compositions is as follows: lymphoma, B-cell lymphoma, T-cell lymphoma, mycosis fungoides, Hodgkin's disease, acute lymphoblastic leukemia (ALL), pilaris cell leukemia (HCL), myelodysplastic syndrome (MDS), myeloid leukemia (acute myeloid leukemia (AML) and chronic myeloid leukemia (CML)), bladder cancer, brain cancer, nervous system cancer, head and neck cancer, squamous cell carcinoma of the head and neck, lung cancer such as small cell lung cancer and non-small cell lung cancer, neuroblastoma / glioblastoma, ovarian cancer, skin cancer, liver cancer, melanoma, oral, pharyngeal, laryngeal cancer, and squamous cell carcinoma of the lung, cervical cancer, cervical cancer Carcinoma, breast cancer, as well as epithelial cancer, kidney cancer, genitourinary cancer, lung cancer, esophageal cancer, head and neck cancer, colorectal cancer, hematopoietic cancer, testicular cancer, colon cancer, rectal cancer, prostate cancer, or pancreatic cancer.

[0166] As noted throughout this disclosure, the modified NK cells disclosed are ideally suited for use in immunotherapy, such as adoptive transplantation of modified (i.e., engineered) NK cells to a target requiring them. Accordingly, in one embodiment, a method for adoptive transplantation of engineered cells to a target requiring them is disclosed herein, the method comprising a) obtaining modified NK cells and b) class 2 complexed with the corresponding CRISPR / Cas guide RNA. The present invention comprises: a) obtaining an AAV vector containing a ribonucleoprotein (RNP) complex containing a CRISPR / Cas endonuclease (Cas9) and a plasmid containing a transgene (e.g., a chimeric antigen receptor for a tumor antigen), wherein the transgene is adjacent to a homologous arm, and the homologous arm is less than 1000 bp in length; c) introducing the transgene and the RNP complex into NK cells, wherein the transgene is introduced into the cells via infection with adeno-associated virus (AAV), the RNP complex hybridizes to a target sequence in the genomic DNA of the NK cells, and the DNA repair enzymes of the NK cells insert the transgene into the host genome at the target sequence in the genomic DNA of the target cells (e.g., by homologous repair), thereby creating engineered NK cells; and d) transplanting the engineered NK cells into a target. In one embodiment, the transgene may be contained on the same plasmid as the Cas9 endonuclease or encoded on a second plasmid in the same or a different AAV vector. In one embodiment, target cells may be transduced via electroporation with an RNP complex before or simultaneously with cell infection by a transgene containing AAV.

[0167] In one embodiment, the modified cells (e.g., NK cells) used in the disclosed immunotherapy method may be primary cells from a donor source (e.g., allogeneic or autologous donor source for adoptive transplantation therapy (i.e., the final recipient of the modified NK cells)), a cell line (including, but not limited to, NK cell lines NK RPMI8866, HFWT, K562, and EBV-LCL), or a primary cell source or primary cell source from a source of proliferating cells derived from a cell line. Since primary cells can be used, it is understood and intended herein that the disclosed modifications of cells can be made ex vivo or in vitro.

[0168] Plasmids comprising, in order, a left homologous arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, and a right homologous arm are also provided herein, wherein each left homologous arm is less than 1000 bp in length.

[0169] In another embodiment, disclosed herein are plasmids, AAV vectors, or modified cells disclosed herein for use as pharmaceuticals. The use of plasmids, AAV vectors, or modified cells disclosed herein for the manufacture of pharmaceuticals is also disclosed herein.

[0170] Plasmids, AAV vectors, or modified cells disclosed herein for use in the treatment of cancer are also disclosed herein. The use of plasmids, AAV vectors, or modified cells disclosed herein for the manufacture of pharmaceuticals for the treatment of cancer is also disclosed herein.

[0171] Also disclosed herein are CAR NK cells produced by using the methods for producing chimeric antigen receptor (CAR) natural killer (NK) cells or NK T cells disclosed herein for use in the treatment of cancer. The use of CAR NK cells produced by using the methods for producing chimeric antigen receptor (CAR) natural killer (NK) cells or NK T cells disclosed herein for the manufacture of pharmaceuticals for the treatment of cancer is also disclosed herein.

[0172] VI. Examples The following examples are provided to those skilled in the art to provide a complete disclosure and description of methods for preparing and evaluating the compounds, compositions, articles, devices, and / or methods claimed herein, and are intended to be purely illustrative and not to limit the disclosure. While efforts have been made to ensure accuracy with respect to numerical values ​​(e.g., quantity, temperature, etc.), some error and deviation should be taken into consideration. Unless otherwise indicated, parts are parts by weight, temperature is °C or ambient temperature, and pressure is atmospheric pressure or near thereto.

[0173] 1. Example 1: Highly efficient site-directed gene insertion into human natural killer cells using homologous recombination supplied by AAV6 and CRISPaint. Using the approach described herein, highly efficient and stable transgene-modified human primary NK cells, including two CAR-NK cells exhibiting enhanced anti-AML activity, were successfully generated.

[0174] a) Method (1) Purification and proliferation of human NK cells. NK cells were purified as described above. Briefly, NK cells were isolated from PBMCs collected from healthy individuals using the RosetteSep® human NK cell enrichment cocktail (Figure 1A). The phenotype of the purified NK cells was determined using flow cytometry as a population with over 90% CD3-negative / CD56-positive cells (Figure 3A). These cells were stimulated in a 2:1 ratio (feeder:NK) with irradiated K562 feeder cells expressing 4-1BBL and membrane-bound IL-21 (FC21) on the day of purification (Figure 1A). The stimulated cells were cultured for 7 days in serum-free AIM-V / ICSR growth medium containing 50 IU / mL of IL-2.

[0175] (2) ATAC-seq assay. Fresh, isolated (naive), FC15-, and FC21 proliferating NK cells were cryopreserved in aliquots of 100,000 live cells / vial prior to ATAC-seq processing. ATAC-seq was performed as described above. DNA libraries were sequenced using Illumina HiSeq 2500 with 50 bp paired terminal reads.

[0176] (3) Cas9 / RNP electroporation to target AAVS1 in NK cells. AAVS1 was targeted using a single gRNA (crRNA: 5'GGGGCCACTAGGGACAGGAT) (SEQ ID NO: 17) via Cas9 / RNP electroporation into the aforementioned 7-day proliferating NK cells. In short, 3 × 10 6 Proliferating NK cells were collected, washed twice with 13 ml of PBS, centrifuged at 400 g for 5 minutes, and the PBS was aspirated. The cell pellet was resuspended in 20 μl of P3 Primary Cell 4D-Nucleofector solution. 5 μl of pre-complexed Cas9 / RNP targeting AAVS1 (ALT-R® CRISPR-Cas9 crRNA, ALT-R® CRISPR-Cas9 tracrRNA, and ALT-R® SpHiFi Cas9 Nuclease V3) (Integrated DNA Technologies, Inc., Coralville, Iowa), targeted AAVS1, and 1 μl of 100 μM electroporation enhancer (ALT-R® Cas9 electroporation enhancer) were added to the cell suspension. The total volume of the CRISPR reaction (26 µl) was transferred to a 4D-Nucleofector® 16-well strip and electroporated using program EN-138 (Figure 3B). After electroporation, the cells were transferred to 2 ml of medium containing 50 IU of IL-2 in a 12-well plate and incubated at 37°C and 5% CO2 pressure. Two days after electroporation, the cells reached 2 × 10⁶ cells. 6 The cells were stimulated with feeder cells, and 8 ml of fresh medium supplemented with 50 IU was added to the cell suspension and held in a T25 flask.

[0177] (4) ICE mutation detection assay. To measure indel rates in AAVS1KO NK cells, PCR was used to amplify Cas9 / RNP target sites using forward and reverse primes as described in Table 1. The amplicons were sequenced using Sanger sequencing, and the results were analyzed using ICE.

[0178] (5) RNA-seq sample preparation and sequencing. Total RNA was purified from naive, quiescent, naive IL-21 stimulated, and day 7 FC21 proliferating NK cells using the Total RNA Purification Plus Kit (Norgen Biotek, Ontario, Canada). The obtained total RNA was quantified using a Nanodrop ND-1000 spectrophotometer, verified for purity and integrity using a Bioanalyzer-2100 device (Agilent Technologies Inc., Santa Clara, CA), and submitted for sequencing to the Genomics Score at Nationwide Children's Hospital. Libraries were prepared using the TruSeq RNA Sample Preparation Kit (Illumina Inc.) according to the manufacturer's recommended protocol. Library quality was determined via an Agilent 4200 Tapestation using the High Sensitivity D1000 ScreenTape Assay Kit and quantified by KAPA qPCR (KAPA BioSystems). Using the Illumina HiSeq4000 platform, we generated approximately 60 to 80 million paired-end 150bp sequence reads per library.

[0179] Sequence reads from each sample were aligned to the GRCh38.p9 assembly of Homo sapiens references from NCBI using splice recognition aligner STAR version 2.5.2b. Functional coverage counts were calculated using HTSeq with the GFF file included with the assembly from NCBI. Functionality was identified for RNA-Seq analysis using the default options for functional type, exon, functional identifier, and gene ID from the GFF. Quality control checks for sample preparation and alignment were performed using a custom Perl script that counted read types using the STAR mapping quality metric and read count aligned to each functional class defined by the functional table included with the assembly from NCBI.

[0180] (6) AAV6 production. The transgene cloned into the ssAAV or scAAV plasmid was packaged in the AAV6 capsid as described above.

[0181] (7) Combine Cas9 / RNP and AAV6 to generate mCherry and CAR NK cells. On day 6 of NK cell proliferation, one day before the experimental manipulation, 5 × 10 5 The culture medium was changed and resuspended at 10 cells / ml. Subsequently, the NK cells were electroporated with Cas9 / RNP targeting AAVS1 on day 7, as described above. 30 minutes after electroporation, 3 × 10⁶ cells were observed. 5 Individual living cells were collected, and 1 × 10⁶ cells were collected per 1 ml. 6 Each cell was resuspended in a medium containing 50 IU of IL2 (Novartis) in a 24-well plate at a total volume of 300 μl. For each transduction condition using ssAAV6 or scAAV6 to deliver HR or CRISPaint DNA encoding mCherry or CD33CAR, 3 x 10⁶ cells were resuspended. 5Electroporated cells were transduced at 300K MOI (10 - 500K MOI if necessary). Negative controls included non-electroporated NK cells, NK cells electroporated with Cas9 / RNP but not transduced with AAV, or NK cells transduced with AAV6 at 300K MOI without electroporation of Cas9 / RNP. On the day after electroporation and transduction, 300 ul of fresh medium containing 50 IU of IL2 was added to each well without changing the old medium. Cells were cultured for 48 hours after electroporation and then 6 restimulated with feeder cells and maintained in a 12-well plate with a total volume of 2 ml of medium containing 50 IU. After 48 hours, 8 ml of fresh medium supplemented with IL2 was added to the cells, and a total of 10 ml was retained in a T25 flask. On the 7th day after transduction, cells were restimulated with feeder cells at a 1:1 ratio and grown for an additional week, and fresh medium was added to the cells every 2 days.

[0182] (8) Flow cytometry for detection of CAR-NK cells. Seven and 14 days after electroporation, 5×10 5 NK cells were washed twice with staining buffer containing 2% FBS in PBS. Next, 2.5 ug of recombinant human siglec-3 / CD33 Fc chimera protein (CF; R&D Systems #1137-SL-050) was added to the cell suspension at a total volume of 80 ul and incubated at 4°C for 30 minutes. After washing the cells twice with staining buffer, they were stained with 2 ul of Alexa Fluor® 647 AffiniPure Goat Anti-Human IgG, Fcγ fragment specific (Jackson ImmunoResearch #109-605-098) at a 1:100 ratio in 200 ul of staining buffer and held at 4°C for 30 minutes. After staining, the cells were washed twice with staining buffer and then acquired on a MacsQuant flow cytometer. Flow cytometry data was analyzed using FlowJo software (FlowJo, LLC).

[0183] (9) Cytotoxicity assay. Cytotoxicity assays were performed for 3–4 hours using the calcein-acetoxymethyl release assay, as previously described. Cytotoxicity was evaluated against Kasumi-1, HL60, or AML10 cells at different target:effector ratios defined in Figure 8.

[0184] (10) CD107a staining. NK cells and cancer cells were co-cultured in a 10:1 ratio and supplemented with 20 µl of PE mouse anti-human CD107a antibody (BD Pharmingen®, #555801) in a total volume of 220 µl in 96-well plates. The plates were incubated in a 37°C incubator for 90 minutes. The cells were then washed once with staining buffer and collected for acquisition using a MacsQuant flow cytometer.

[0185] (11) PCR-based detection of introduced gene integration. In-out PCR was performed using two pairs of primers designed to be either inside or outside the CD33CAR construct (Figures 9A and 9B, and Table 2). Additionally, one set of primers was added to amplify the 1200 bp adjacent regions to the left and right of the Cas9 targeting and transgene integration site (Figure 9C). PCR was performed using the Platinum® Taq DNA polymerase high-fidelity kit (Thermofisher #11304011).

[0186] TLA. Whole-genome mapping of CD33CAR-Gen2 was performed using TLA technology (Cergentis BV). See Figure 9C for details.

[0187] b) Results (1) Proliferation of NK cells using FC21 provides optimal conditions for gene insertion. Enzymatic reactions regulate CRISPaint and HR. CRISPaint is a LIG4-dependent process, while other proteins such as BRCA1 and BRCA2 regulate HR. Therefore, the expression levels of these genes were analyzed 7 days after stimulation with freshly isolated NK cells or feeder cells expressing membrane-bound IL-21 (FC21) (n=4) to assess which repair pathways were more efficient in this cell type and at which proliferation stage (Figures 1A, 3A, and 3B). RNA-seq analysis showed that proliferating NK cells on day 7 had higher expression of BRCA1 and BRCA2 compared to naive NK cells. Furthermore, although there was no decrease in LIG4 levels in these cells, the level of LIG1, a DNA repair enzyme, was significantly higher in proliferating cells (Figures 1B and 1C), providing optimal conditions for either CRISPaint-mediated HR or NHEJ-directed gene insertion in proliferating NK cells on day 7.

[0188] (2) Successful targeting of genome-safe harbors for gene insertion. A genome-safe harbor (GSH) is a site within the genome that can be modified without altering the normal function of the host cell, enabling the proper expression of a transgene. For gene insertion into NK cells, we selected adeno-associated virus site 1 (AAVS1), a GSH and an exemplary locus within the phosphatase 1 regulatory subunit 12C (PPP1R12C) gene. This locus has been successfully used for directional gene insertion into several cell types. First, we evaluated the chromatin accessibility of AAVS1 in naive and proliferating NK cells (n=2) by ATAC-seq assay and found no decrease in chromatin accessibility in FC21 proliferating NK cells compared to naive NK cells (Figure 1D). Next, we targeted AAVS1 using a single gRNA via Cas9 / RNP electroporation into proliferating NK cells on day 7. After 48 hours, NK cell DNA was isolated using CRISPR editing inference (ICE) to detect insertions and deletions (indels) in CRISPR-edited NK cells, and the frequency of indels was analyzed. ICE results showed that up to 85% of CRISPR-modified NK cells had at least one indel at the AAVS1 Cas9 target site (Figure 1E). To ensure that genomic modification at this locus does not impair the ability of NK cells to target cancer cells, the cytotoxicity of AAVS1KO NK cells was evaluated against Kasumi-1, an acute myeloid leukemia (AML) cancer cell line. Using the calcein AM assay, no difference in their killing ability was observed between wild-type and CRISPR-modified NK cells (Figure 3C).

[0189] (3) Successful generation of mCherry-expressing primary human NK cells using a combination of single-stranded AAV6 and Cas9 / RNP. For HDR-mediated gene insertion, DNA encoding mCherry, containing 800 bp HA in the right-facing region of the Cas9 target site of the AAVS1 locus and 1000 bp HA in the left-facing region, was cloned into the backbone of a single-stranded AAV plasmid and packaged in an AAV6 viral capsid. The construct was designed to have a splice acceptor downstream of the transgene to improve mCherry gene transcription (Figure 2A). As described in the methods, NK cells were electroporated with Cas9 / RNP targeting AAVS1, and 30 minutes later, the cells were transduced with AAV6 at a MOI of 300K or 500K (Figure 2C). This generated 17% (300K MOI) and 19% (500K MOI) mCherry-positive NK cells, which were evaluated 48 hours after electroporation using flow cytometry. These cells were grown for an additional week using FC21, and mCherry-positive cells were enriched by FACS sorting. This enriched the population of mCherry-positive NK cells (77% mCherry-positive NK cells transduced with ssAAV6 at 300K MOI, and 86% NK cells transduced with 500K MOI). These cells were restimulated with feeder cells and grown for a further 30 days, and no decrease in mCherry expression levels was observed (Figures 4A, 4B, and 4C).

[0190] (4) Gene insertion was improved by using self-complementary AAV6 and Cas9 / RNP. As mentioned earlier, scAAV vectors can become double-stranded in a shorter timeframe compared to ssAAV after entering host cells. This may improve the efficiency of gene insertion in NK cells. To test this, we used scAAV6 and combined them with Cas9 / RNP to improve the gene insertion results of the ssAAV6 method. Due to the size limitations of packaging transgender in scAAV, several lengths of HA were designed to provide a wide range of possibilities for cloning transgenes of different sizes into the scAAV backbone. Thus, 30bp, 300bp, 500bp, and 1000bp HAs for the right HA and 30bp, 300bp, 500bp, and 800bp mCherry encoding DNA (Figure 2A) for the left HA were cloned into the scAAV backbone and packaged into AAV6 capsids. Next, ssAAV sections were transduced by electroporating NK cells grown on day 7, following the steps described above. This approach significantly increased the efficiency of generating NK cells expressing mCherry, with positive percentages reported as follows: 30 bp (19-20%), 300 bp (80-85%), 500 bp (75-85%), and 800 bp (80-89%) (Figures 4A and 4B). These cells could be proliferated for more than three weeks using feeder cells, showing no decrease in the percentage of mCherry-expressing NK cells and exhibiting stable exogenous gene expression. Due to the size limitations of scAAV, these vectors cannot be used to generate CAR NK cells, but mCherry can be considered a proof of concept for generating NK cells with the ability to produce a highly efficient and stable exogenous protein. In freshly isolated NK cells, the percentage of mCherry expression was significantly lower when the same approach of Cas9 / RNP electroporation and AAV6 transduction was used (1.13% for ss800bp AAV6, 2.9% for sc300bp AAV6, Figure 5). Based on these observations, FC21-proliferating NK cells were used.

[0191] (5) CRISPaint can be used for gene insertion in NK cells. To overcome the complexities of HA optimization observed in HDR-directed gene insertions, we tested a homology-independent gene insertion approach called CRISPaint. For the CRISPaint DNA template, the dual Cas9 target sequence of AAVS1(PAMgPAMg) was incorporated around the mCherry transgene, but incorporated within the ITR of scAAV and packaged in AAV6 (Figure 2B). The method used for electroporation and transduction of NK cells for HR-directed gene insertion was also performed here. Flow cytometry was performed two days after electroporation and transduction, and before proliferation, to assess mCherry expression in NK cells. Cells electroporated and transduced with 300K MOI scAAV6 delivering CRISPaint PAMgPAMg were found to be up to 6% mCherry-positive. These cells were further selected to grow up to 77% mCherry-expressing NK cells, which could be grown for 30 days using FC21 without any decrease in the percentage of mCherry-positive NK cells (Figures 4B and 4C). Although the efficiency of gene insertion using CRISPaint was observed to be lower compared to HR-directed gene insertion, this method remains desirable because it allows researchers to insert the target gene into a user-defined locus without the need to design homologous arms.

[0192] (6) Successful generation of primary human CD33 CAR NK cells. Two constructs (Gen2 and Gen4v2) were designed to generate CD33-targeted CAR NK cells. The CARs used here are the same scFv derived from the CD33 monoclonal antibody, followed by CD4 and CD28 as costimulatory domains. For Gen2, CD3z and NKG2D, 2B4 are included, followed by CD3z for Gen4v2 (Figures 6A and 6B). To improve the expression levels of CARs, which are higher than those of mCherry, instead of using a splice acceptor, a highly constitutively active promoter in the hematopoietic system prior to the CAR start codon, derived from mouse leukemia virus (MND), was incorporated. The DNA encoding the CD33 CAR was then cloned into the ssAAV backbone with a 600 bp HA at the AAVS1 target site, and these were packaged in the AAV6 capsid. Seven days after electroporation and transduction, CAR expression on NK cells was analyzed using flow cytometry, and up to 78% of positive CD33 CAR-expressing NK cells were detected (average 59.3% in Gen2 and 60% in Gen4v2 14 days after transduction). Higher mean fluorescence intensity (MFI) of CD33CAR-Gen2 expressed on NK cells was observed compared to Gen4v2 (Figures 6C and 6D). Next, the cells were grown and further grown on feeder cells for another week (day 14), and no significant decrease in CAR expression was observed between CAR-NK cells on day 7 and day 14 (Figure 6E). Genetic manipulation also did not have a significant effect on the proliferation of CAR-expressing cells compared to wild-type cells (Figure 6F). The freezing and thawing processes also had no negative effect on CAR expression or the enhanced cytotoxicity of CAR NK cells (Figures 7A and 7B). Next, PCR was used to confirm the incorporation of the transgene-encoding DNA at the DNA level (Figures 9A and 9B). Furthermore, targeted locus amplification (TLA) technology was used for whole-genome mapping of CD33CAR-Gen2 integration, with a sensitivity to detect more than 5% of random integrations, demonstrating that the vector was correctly integrated at the target site on chromosome 19 within a subset of the sample. There were no indications of abundant off-target integration sites.In the samples, one sequence variant and four structural variants were detected, indicating that erroneous targeting events occurred in at least a subset of the samples. In addition, random incorporation was identified in chr19 in a subset of the samples (Figure 9C). Reducing the viral concentration to 10K MOI was also shown to be usable for the production of CD33CAR-Gen2 NK cells (Figures 10A and 10B).

[0193] (7) Human primary CAR-NK cells have enhanced antitumor activity. To study the cytotoxic effects of primary human CD33CAR NK cells against CD33-expressing AML cells, a cytotoxicity assay based on Calcein AM was performed. Two different CD33-expressing AML cell lines, called Kasumi-1 and HL60 (Figure 11), were used and co-cultured with NK cells isolated from peripheral blood collected from three different healthy individuals. CD33CAR-gen2 and CD33CAR-gen4v2 NK cells were compared with wild-type or AAVS1 cells. KO Compared to NK cells, CD33CAR NK cells showed significantly higher expression levels of the NK cell degranulation marker CD107a when co-cultured with Kasumi-1 or HL60. This also resulted in significantly higher specific lysis of Kasumi-1 by either CD33CAR NK cells. Higher killing capacity of CD33CAR-Gen2 against HL60 was also observed (Figures 8A-8F). The enhanced tumor-killing specificity of CD33CAR NK cells against CD33-expressing cancer cells was demonstrated by performing a cytotoxicity assay against K562 chronic myeloid leukemia (CML), and no improvement in the killing capacity of NK cells was observed (Figures 8I and 12). Importantly, CD33CAR NK cells showed significantly higher antitumor activity against AML-10, a primary human AML derived from relapsed patients (Figures 8G and 8H, Figure 12). Overall, CD33CAR-Gen2 NK cells showed better cytotoxicity compared to CD33CAR-Gen4v2 NK cells.

[0194] c) Discussion Genetic modification in primary human NK cells has always been challenging, and what is reported herein is successful, highly efficient site-directed gene insertion into human primary NK cells using a combination of Cas9 / RNP electroporation and single-stranded or self-complementary AAV6 gene delivery via HR and homology-independent gene insertion (CRISPaint). Here, for the first time, we show how the expression levels of genes regulating the HR and NHEJ pathways in human NK cells change during proliferation in FC21, providing optimal conditions for site-directed gene insertion. It is also demonstrated that AAVS1 can host and express exogenous genes at a very efficient level, as previously shown in T cells and NK cells. Furthermore, it was shown that HAs in the range of 30–1000 bp that can be used for insertion into the AAVS1 locus in NK cells have a shortest optimal length of 300 bp when used within scAAV6. This helps researchers select the optimal HA based on the size of the exogenous DNA to be introduced into NK cells. CRISPaint gene insertion can be used to tag endogenous genes and to study the biology of proteins within NK cells.

[0195] Using a combination of Cas9 / RNP and AAV6 gene delivery, two distinct human primary CD33CAR NK cells were generated with enhanced anti-AML activity. These results also demonstrated that the genetically modified NK cells could subsequently be proliferated in FC21, enabling the production of a large number of genetically modified NK cells for cancer immunotherapy. Overall, the methods described herein can be used for several applications in immunology, cancer immunotherapy, and NK cell biology research. TLA was performed using two independent primer sets specific to the vector sequence (Table 3).

[0196] Sequence variants. The detected sequence variants are shown in Table 4. The frequency of these variants may indicate variations in the vector used. TIFF2023552917000007.tif51170

[0197] Identification of structural variants Four vector-vector breaks were identified. All fusions were located in the annotated homologous arms. Due to the heterogeneous nature of the sample, these fusions are expected to exist only within a subset of the sample. Note that three of the four fusions exhibit homology of 9–12 bp, which may indicate technical bias.

[0198] Vector: 149 (head) fused to the vector: 4116 (tail) with 9 homologous bases TIFF2023552917000008.tif36170

[0199] Vector: 149 (head) fused to the vector: 4113 (tail) with 12 homologous bases TIFF2023552917000009.tif33170

[0200] Vector: 155 (head) fused to the vector: 4163 (tail) with 9 homologous bases TIFF2023552917000010.tif34170

[0201] Vector: 158 (head) fused to the vector: 4121 (tail) with four homologous bases TIFF2023552917000011.tif34170

[0202] B. References Buenrostro,J.D.,Giresi,P.G.,Zaba,L.C.,Chang,H.Y.&Greenleaf,W.J.Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin,DNA-binding proteins and nucleosome position.Nat Methods 10,1213-1218(2013). de Vree,P.J.et al.Targeted sequencing by proximity ligation for comprehensive variant detection and local haplotyping.Nat Biotechnol 32,1019-1025(2014). Dutour,A.et al.In Vitro and In Vivo Antitumor Effect of Anti-CD33 Chimeric Receptor-Expressing EBV-CTL against CD33 Acute Myeloid Leukemia.Adv Hematol 2012,683065(2012). Foust,K.D.et al.Therapeutic AAV9-mediated suppression of mutant SOD1 slows disease progression and extends survival in models of inherited ALS.Mol Ther 21,2148-2159(2013). He,X.et al.Knock-in of large reporter genes in human cells via CRISPR / Cas9-induced homology-dependent and independent DNA repair.Nucleic Acids Res 44,e85(2016). Hsiau,T.et al.Inference of CRISPR Edits from Sanger Trace Data.bioRxiv,251082(2018). Li,K.,Wang,G.,Andersen,T.,Zhou,P.&Pu,W.T.Optimization of genome engineering approaches with the CRISPR / Cas9 system.PLoS One 9,e105779(2014). Li,Y.,Hermanson,D.L.,Moriarity,B.S.&Kaufman,D.S.Human iPSC-Derived Natural Killer Cells Engineered with Chimeric Antigen Receptors Enhance Anti-tumor Activity.Cell Stem Cell 23,181-192 e185(2018). Liu,J.,Zhou,G.,Zhang,L.&Zhao,Q.Building Potent Chimeric Antigen Receptor T Cells With CRISPR Genome Editing.Front Immunol 10,456(2019). MacLeod,D.T.et al.Integration of a CD19 CAR into the TCR Alpha Chain Locus Streamlines Production of Allogeneic Gene-Edited CAR T Cells.Mol Ther 25,949-961(2017). Mali,P.et al.RNA-guided human genome engineering via Cas9.Science 339,823-826(2013). McCarty,D.M.Self-complementary AAV vectors; advances and applications.Mol Ther 16,1648-1656(2008). Mendell,J.R.et al.Single-Dose Gene-Replacement Therapy for Spinal Muscular Atrophy.N Engl J Med 377,1713-1722(2017). Moseman,J.E.,Foltz,J.A.,Sorathia,K.,Heipertz,E.L.&Lee,D.A.Evaluation of serum-free media formulations in feeder cell-stimulated expansion of natural killer cells.Cytotherapy(2020). Naeimi Kararoudi,M.et al.CD38 deletion of human primary NK cells eliminates daratumumab-induced fratricide and boosts their effector activity.Blood(2020). Naeimi Kararoudi,M.et al.Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins.J Vis Exp(2018). Oceguera-Yanez,F.et al.Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives.Methods 101,43-55(2016). Pomeroy,E.J.et al.A Genetically Engineered Primary Human Natural Killer Cell Platform for Cancer Immunotherapy.Mol Ther 28,52-63(2020). Ran, FA et al. Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281-2308 (2013). Schmid-Burgk, JL, Honing, K., Ebert, TS & Hornung, V. CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun 7, 12338 (2016). Somanchi, SS, Senyukov, VV, Denman, CJ & Lee, DA Expansion, purification, and functional assessment of human peripheral blood NK cells.J Vis Exp(2011). Song, F. & Stieger, K. Optimizing the DNA Donor Template for Homology-Directed Repair of Double-Strand Breaks.Mol Ther Nucleic Acids 7,53-60(2017). Suzuki, K. et al.In vivo genome editing via CRISPR / Cas9 mediated homology-independent targeted integration.Nature 540,144-149(2016).

[0203] C. Array Sequence ID 1: Right-hand identical arm at 30bp gattggtgacagaaaaagccccatccttagg Sequence ID 2, 30bp left identical arm ttatctgtcccctccaccccacagtggggc Sequence ID 3: Right-sided identical arm of 300bp gattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtc SEQ ID NO: 4 300 bp left homologous arm gttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggc SEQ ID NO: 5 500 bp right homologous arm gattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtctggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccagtagccagccccgtcctggcag Sequence number 6 500 bp left homologous arm tcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggc Sequence number 7 Right homologous arm of 800 bp gattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtctggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccagtagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgagaatggtgcgtcctaggtgttcaccaggtcgtggccgcctctactccctttctctttctccatccttctttccttaaagagtccccagtgctatctgggacatattcctccgcccagagcagggtcccgcttccctaaggccctgctctgggcttctgggtttgagtccttggcaagcccaggagaggcgctcaggcttccctgtcccccttcctcgtccaccatctcatgcccctggctctcctgccccttccctacaggggttcctggctctgctcttcagactgagccccgttcccctgcatccccgttcccctgcatcccccttcccctgcatcccccagaggccccaggccacctacttggcctggaccccacgagaggccaccccagccctgtctaccaggctgccttttgggtggattctcctccaactgtggggtgactgcttgg。 Left homologous arm of SEQ ID NO: 8, 800 bp tgctttctctgacctgcattctctcccctgggcctgtgccgctttctgtctgcagcttgtggcctgggtcacctctacggctggcccagatccttccctgccgcctccttcaggttccgtcttcctccactccctcttccccttgctctctgctgtgttgctgcccaaggatgctctttccggagcacttccttctcggcgctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgggtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggc SEQ ID NO: 9, PAMg (sequence encoding PAM + crRNA) TIFF2023552917000012.tif SEQ ID NO: 10, splice acceptor atcgatcgcaggcgcaatcttcgcatttcttttttccag Array No. 11 BGH PolyA Terminator cctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattc Array No. 12 mCherry gtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaa Sequence ID 13: A 30 bp plasmid containing an integrated mCherry transgene. ttatctgtcccctccaccccacagtggggccactagggacagcgatcgggtacatcgatcgcaggcgcaatcttcgcatttcttttttccaggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaacgcggccgccctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattcgattggtgacagaaaagccccatccttagg Sequence ID 14: A 300 bp plasmid containing an integrated mCherry transgene. Sequence ID 15: A 500 bp plasmid containing an integrated mCherry transgene. Sequence ID 16: An 800 bp plasmid containing an integrated mCherry transgene. Array number 17 (crRNA) GGGGCCACTAGGGACAGGAT Array number 18 scFV: atgctgctgctggtgacctctctgctgctgtgcgagctgccacacccagccttcctgctgatcccagacatccagatgacacagagccccagctccctgagcgcctccgtgggcgacagagtgaccatcacatgtagggcctctgagagcgtggataactatggcatcagcttcatgaattggtttcagcagaagcctggcggcgccccaaagctgctgatctacgcagccagcatgcagggctccggcgtgccctctcggttctccggctctggcagcggcaccgacttcaccctgacaatctctagcctgcagccagacgatttcgccacatactattgccagcagagcaaggaggtgccctggacctttggccagggcacaaaggtggagatcaagggctccacctctggcagcggcaagcctggcagcggagagggctccacaaagggacaggtgcagctggtgcagtccggagccgaggtgaagaagccaggctcctctgtgaaggtgtcttgtaaggccagcggctataccttcacagactacaacatgcactgggtgcgccaggcaccaggacagggcctggagtggatcggctacatctatccttacaacggcggcaccggctataatcagaagtttaagtccaaggccaccatcacagccgatgagtctaccaatacagcctacatggagctgagcagcctgcggtccgaggacacagccgtgtactattgcgcccggggcagacccgctatggactattggggccagggcaccctggtgacagtgtctag Array number 19 IgG4-Hinge: gagagcaagtacggaccaccttgcccaccatgtcctgcaccagagttcctgggaggaccttccgtgttcctgtttcctccaaagccaaaggacaccctgatgatcagccggacccagaggtgacatgcgtggtggtggacgtgagccaggaggaccccgaggtgcagttc aactggtacgtggatggcgtggaggtgcacaatgccaagaccaagccaagagaggagcagtttaactccacctatagggtggtgtctgtgctgacagtgctgcaccaggactggctgaacggcaaggagtacaagtgcaaggtgtccaataagggcctgccttctcttatcg agaagaccatctctaaggcaaagggacagccaagggagccacaggtgtatacactgcccctagccaggaggagatgaccaagaaccaggtgtccctgacatgtctggtgaagggcttttacccttctgacatcgccgtggagtgggagagcaatggccagccagagaacaa ttataagaccacaccacccgtgctggactctgatggcagcttctttctgtacagccgcctgaccgtggataagtcccggtggcaggagggcaacgtgttctcctgctctgtgatgcacgaggccctgcacaatcactacacacagaagagcctgtccctgtctctgggcaag SEQ ID NO: 20 CD28: Atgttttgggtgctggtggtggtgggaggcgtgctggcctgttatccctgctggtgaccgtggccttcatcatcttttggtgcgctccaagcggagccggggcggacactctgactacatgaacatgaccccacggagacccggacctacaaggaagcactatcagccctacgcccctccacggacttcgcagcatatcgcagc 아이스 다이21 CD3z: Cgggtgaagtttagcagatccgccgatgcaccagcatatcagcagggacagaatcagctgtacaacgagctgaatctgggcaggcgcgaggagtacgacgtgctggataagaggcggggccgggaccccgagatgggaggcaagcccaggcgcaagaaccctcaggagg gcctgtataatgagctgcagaaggacaagatggccgaggcctacagcgagatcggcatgaagggagagcggagaaggggcaagggacacgatggcctgtatcagggcctgtccaccgccacaaaggacacctacgatgcactgcacatgcaggccctgccacctcggtga Sequence ID 22: CD33CAR-Gen2 cloned with the ssAAV skeleton (Figure 16): The ITR1 sequence corresponds to nucleic acid positions 1-141 of sequence number 22. The MND-CD33CAR-gen2 construct corresponds to nucleic acid positions 156-4118 of sequence number 22. The left 600bp homologous arm AAVS1 corresponds to nucleic acid positions 156-759 of sequence number 22. The MND promoter corresponds to nucleic acid positions 783-1322 of SEQ ID NO: 22. The sequence encoding CD33 CAR gen2 corresponds to nucleic acid positions 1329-3362 of sequence number 22. The sequence encoding scFV-CD33 corresponds to nucleic acid positions 1329-2128 of sequence number 22. The sequence encoding IgG-hingeCD4 corresponds to nucleic acid positions 2130-2816 in sequence number 22. The sequence encoding CD28 corresponds to nucleic acid positions 2814-3023 in sequence number 22. The sequence encoding CD3 zeta corresponds to nucleic acid positions 3024-3362 of sequence number 22. BGHPA corresponds to nucleic acid positions 3372-3518 of sequence number 22. BGH poly corresponds to nucleic acid positions 3378-3489 of SEQ ID NO: 22. The right 600bp homologous arm AAVS1 corresponds to nucleic acid positions 3519-4118 of sequence number 22. The ITR2 sequence corresponds to nucleic acid positions 4127-4267 of sequence number 22. Sequence ID 23 CD33CAR-Gen4v2 (Figure 17): The ITR1 sequence corresponds to nucleic acid positions 1-141 of SEQ ID NO: 23, the MND-CD33CAR-gen2 construct corresponds to nucleic acid positions 156-4415 of SEQ ID NO: 23, the left 600bp homologous arm AAVS1 corresponds to nucleic acid positions 156-759 of SEQ ID NO: 23, and the MND promoter corresponds to nucleic acid positions 783-1322 of SEQ ID NO: 23. The sequence encoding CD33 CAR gen2 corresponds to nucleic acid positions 1329-3659 of SEQ ID NO: 23, the sequence encoding scFV-CD33 corresponds to nucleic acid positions 1329-2129 of SEQ ID NO: 23, and the sequence encoding IgG-hingeCD4 corresponds to nucleic acid positions 2130-2816 of SEQ ID NO: 23, and NKG2D The sequence encoding TM corresponds to nucleic acid positions 2817-2909 of SEQ ID NO: 23, the sequence encoding 2B4 corresponds to nucleic acid positions 2934-3293 of SEQ ID NO: 23, the sequence encoding CD3 zeta corresponds to SEQ ID NO: 3318-3659, BGHPA corresponds to nucleic acid positions 3669-3815 of SEQ ID NO: 23, BGH poly corresponds to nucleic acid positions 3675-3786 of SEQ ID NO: 23, the right-hand 600bp homologous arm AAVS1 corresponds to nucleic acid positions 3816-4415 of SEQ ID NO: 23, and the ITR2 sequence corresponds to nucleic acid positions 4424-4564 of SEQ ID NO: 23. Sequence ID 24 NKG2D transmembrane domain: Agcaacctgttcgtggcctcctggatcgccgtgatgatcatctttcgcatcggcatggccgtggccatcttctgctgtttctttttcccatcc Sequence ID 25 Linker: Ggaggctctggaggaggctccggc Sequence ID 26 2B4: Tggcggagaaagcggaaggagaagcagagcgagacctcccctaaggagtttctgacaatctatgaggacgtgaaggatctgaagaccaggcgcaatcacgagcaggagcagaccttcccaggaggaggctctacaatctacagcatgatccagtcccagagcagcgccccaaccagccaggagccagcctatacactgtactctctgatccagcctagccggaagtctggcagccgcaagcggaaccactccccatctttcaattctaccatctatgaagtgatcggcaagagccagcctaaggcccagaacccagccagactgtccaggaaggagctggagaattttgacgtgtactct SEQ ID NO: 27, linker: Ggaggcagcggaggaggctctggc SEQ ID NO: 28, CD3z: Cgcgtgaagttcagccggtccgccgatgccccagcctataagcagggccagaaccagctgtacaacgagctgaatctgggccggagagaggagtacgacgtgctggataagaggcggggccgggaccccgagatgggaggcaagccccggagaaagaaccctcaggagggcctgtataatgagctgcagaaggacaagatggccgaggcctactccgagatcggcatgaagggagagaggcgccggggcaagggacacgatggcctgtatcagggcctgagcaccgccacaaaggacacctacgatgccctgcacatgcaggccctgcctccacggtgatga SEQ ID NO: 29, anti - CD33 ScFv. atgctgctgctggtgacctccctgctgctgtgcgagctgccacaccctgcctttctgctgatcccagacatccagatgacacagagccccagctccctgtctgccagcgtgggcgacagagtgaccatcacatgtagggcctccgagtctgtggataactatggcatcagctttatgaattggttccagcagaagccaggaggcgcccctaagctgctgatctacgcagcctccatgcagggctctggcgtgcccagccgctttagcggctccggctctggcaccgatttcaccctgacaatctctagcctgcagccagacgattttgccacatactattgccagcagtccaaggaggtgccctggaccttcggccagggcacaaaggtggagatcaagggcagcacctccggctctggcaagcctggctccggagagggctctacaaagggacaggtgcagctggtgcagagcggagccgaggtgaagaagccaggctcctctgtgaaggtgagctgtaaggcctccggctatacctttacagactacaacatgcactgggtgagacaggcaccaggacagggcctggagtggatcggctacatctatccttacaacggcggcaccggctataatcagaagttcaagagcaaggccaccatcacagccgatgagtccaccaatacagcctacatggagctgagcagcctgaggagcgaggacacagccgtgtactattgcgccagaggcaggcctgctatggactattggggccagggcaccctggtgacagtgtctagc Sequence number 30, MND promoter atcgatcacgagactagcctcgagaagcttgatatcgaattccacggggttggacgcgtcttaattaaggatccaaggtcaggaacagagaaacaggagaatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaagaacagttggaacagcagaatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaagaacagatggtccccagatgcggtcccgccctcagcagtttctagagaaccatcagatgtttccagggtgccccaaggacctgaaatgaccctgtgccttatttgaactaaccaatcagttcgcttctcgcttctgttcgcgcgcttctgctccccgagctctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgactctagaggatcgatcccccgggctgcaggaattcaagcgagaagacaagggcagaaagcacc SEQ ID NO: 31, 600 bp, LHA, AAVS1 (gen4v2 and gen2) gctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgggtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggc SEQ ID NO: 32, 600 bp, RHA, AAVS1 (gen4v2 and gen2) Gattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaa ggtttgcttacgatggagccagagaggatcctgggaggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtc tggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtg cgtcagttttacctgtgagataaggccagtagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgagaatggtgcgtcctaggtgttcaccaggtcgtggccgcctctactccctttct Sequence ID 33, gRNA sequence targeting AAVS1 GGGGCCACTAGGGACAGGAT Sequence ID 34.TTCTCCTGTGGATTCGGGTCAC Sequence ID 35.CTCTCTGGCTCCATCGTAAGCA Sequence ID 36.TCCTGGGCAAACAGCATAA Sequence ID 37.GAGCTGCAGAAGGACAAGAT Sequence ID 38.CTCTGTGTCATCTGGATGTCTG Sequence ID 39.CTTTGAGCTCTACTGGCTTCTG Sequence ID 40.TCCTGGGCAAACAGCATAA Sequence ID 41.CTTTGAGCTCTACTGGCTTCTG அக்குக்க்குத்து42.GCGAGTGAAGACGGCATG அக்குக்க்குத்து43.GTCTGTGCTAGCTCTTCCAG அக்குக்க்குக்கு44.GCGATGTCAGAAGGGTAAAA அக்குக்க்குக்கு45.GGCGGACACTCTGACTACAT sequence number 46 GGCATGGGGTTGGGTGAGGGAGGAGAGATGCCCGGAGAGGACCCAGACACGGGAGGATCCGCTCAGAGGACATCACGTGGTGCAGCGGCGCGCCGGCCGCAGAAAGGGAGTAGAGGCGGCCACGCTGGTGAACACCTAGGACGCACCATTCTCACAAAGGGAGTTTTCCACACGGACACCCCCTCCTCCACACAGCCCTGCCAGGACGGGGCTGGCTACTGGCCTTATCTC sequence number 47 GCGAGTGAAGACGGCATGGGGTTGGGTGAGGGAGGAGAGATGCCCGGAGGACCCACACGGGGAGGATCCGCTCAGAGGACATCACGTGGTGCAGCGGCGCGCCGGCCGCAGGAAGGGAGTAGAGGCGGCCACGACCTGGTGAACACCTAGGACGCACCATTCTCACAAAGGGAGTTTTCCACACGGACACCCCCCTCCTCACCAGCCCTGCCAGGACGGGCTGGCTACTGGCCTTA sequence number 48 GCGAGTGAAGACGGCATGGGGTTGGGTGAGGGAGGAGAGATGCCCGGAGGACCCACACGGGAGGATCCGCTCAGAGGACACGTGGTGCAGCGGCGCGCAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCAGAAAGGGAGTAGAGGCGGCCACGACCTGGTGAACACCTAGGACGCACCATTCTCACAAAGGGAGTTTTCCACACGGA sequence number 49 GCGAGTGAAGACGGCATGGGGTTGGGTGAGGGAGGAGAGATGCCCGGAGAGGACCCAGACACGGGGAGGATCCGCTCAGAGGACATCACGTGGTGCAGCGGCCGCAGAAAGGGAGTAGAGGCGGCCACGACCTGGTGAACACCTAGGACGCACCATTCTCACAAAGGGAGTTTTCCACACGGACACCCCCCTCCTCACCACAGCCCTGCCAGGACGGGGCTGGCTACTGGCCTT Sequence number 50 (PAMgPAMg mCherry construct, Figure 22) CCAATCCTGTCCCTAGTGGCCCCCACTAGGGACAGCGATCGGGTACATCGATCGCAGGCGCAATCTTCGCATTTCTTTTTTCCAGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAACGCGGCCGCCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCCCAATCCTGTCCCTAGTGGCCCC The first PAM sequence corresponds to nucleic acid positions 1-3 of SEQ ID NO: 50, the sequence encoding the first crRNA corresponds to nucleic acid positions 4-23 of SEQ ID NO: 50, the splice acceptor sequence corresponds to nucleic acid positions 47-85 of SEQ ID NO: 50, the mCherry codon (optimized) corresponds to nucleic acid positions 86-793 of SEQ ID NO: 50, the BGHpA sequence corresponds to nucleic acid positions 803-949 of SEQ ID NO: 50, the second PAM sequence corresponds to nucleic acid positions 950-952 of SEQ ID NO: 50, and the sequence encoding the second crRNA corresponds to nucleic acid positions 953-972 of SEQ ID NO: 50. Sequence ID 51 (PAMgRNA mCherry construct sequence, Figure 21) CCAATCCTGTCCCTAGTGGCCCCCACTAGGGACAGCGATCGGGTACATCGATCGCAGGCGCAATCTTCGCATTTCTTTTTTCCAGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAACGCGGCCGCCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTC The PAM sequence corresponds to nucleic acid positions 1 to 3 of SEQ ID NO: 51, The sequence encoding crRNA corresponds to nucleic acid positions 4-23 of sequence number 51. The splice acceptor corresponds to nucleic acid positions 47-85 of sequence number 51. The mCherry codon (optimized) corresponds to nucleic acid positions 86-793 of sequence number 51. The BGHpA sequence corresponds to nucleic acid positions 803-949 of sequence number 51. Sequence ID 52. Cccctccaccccacagtggggccactagggacaggattggtgacagaaaaagccccatccttaggc Sequence ID 53 Cccctccaccccacagtggggccactagggacag Sequence ID 54 Attggtgacagaaaaagccccatccttaggc Sequence ID 55 Cccctccaccccacagtggggccactaggga Sequence ID 56 Cccctccaccccac Sequence ID 57 Cccctccaccccacagtggggccac Sequence ID 58 gattggtgacagaaaaagccccatccttaggc

Claims

1. 1. A plasmid for use with a clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated 9 (Cas9) integration system, the plasmid comprising, in order, a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, and a right homology arm, the left and right homology arms each being between 30 bp and 1000 bp in length.

2. 2. The plasmid of claim 1, wherein the CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3ζ signaling domain, and a single chain variable fragment (scFv) that specifically binds to a receptor on a target cell, wherein the transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3ζ transmembrane domain, or a NKG2D transmembrane domain, and wherein the costimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 costimulatory domain, a 4-1 BB costimulatory domain, or any combination thereof.

3. The plasmid of claim 2 , wherein the receptor comprises CD33.

4. The plasmid of claim 3, wherein the scFV that specifically binds to CD33 comprises a sequence that is at least 90% identical to SEQ ID NO:29 or a fragment thereof.

5. 2. The plasmid of claim 1, wherein the homology arms specifically hybridize to the adeno-associated virus integration site 1 (AAVS1) of human chromosome 19.

6. 2. An adeno-associated virus (AAV) vector comprising the plasmid of claim 1.

7. The AAV vector of claim 6, wherein the AAV serotype comprises AAV6.

8. The AAV vector of claim 6, wherein the vector further comprises a plasmid encoding crRNA, a tracer RNA (trcrRNA), and a CAS endonuclease.

9. The AAV vector of claim 6, wherein the vector is a single-stranded AAV (ssAAV).

10. The AAV vector of claim 6, wherein the vector is a self-complementary AAV (scAAV).

11. 7. The AAV vector of claim 6, wherein the vector comprises a sequence at least 90% identical to SEQ ID NO:22 or SEQ ID NO:23 or a fragment thereof.

12. 10. A modified cell comprising the plasmid of claim 1 or the AAV vector of claim 6, said modified cell being a natural killer (NK) cell or an NK T cell.

13. 13. The modified cell of claim 12, wherein the NK cells or NK T cells are expanded in the presence of irradiated feeder cells, plasma membrane particles, or exosomes expressing membrane-bound IL-21, membrane-bound 4-1BBL, and / or membrane-bound IL-15, or any combination thereof.

14. 14. Use of the modified cell of claim 13 in the manufacture of a medicament for treating cancer in a subject.

15. A method for genetically modifying natural killer (NK) cells or NK T cells, comprising: a) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease complexed with a corresponding CRISPR / Cas guide RNA and an adeno-associated virus (AAV) vector comprising a plasmid comprising a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, said polynucleotide sequence being flanked by homologous arms, said homologous arms being 800 bp or less in length; and b) introducing into said NK cell or NK T cell a polynucleotide sequence encoding said CAR polypeptide and said RNP complex, wherein the polynucleotide sequence encoding the CAR polypeptide is introduced into the NK cell or NK T cell via infection of the cell with the AAV vector, the RNP complex hybridizes to a target sequence within the genomic DNA of the NK cell or NK T cell, and DNA repair enzymes of the cell insert the polynucleotide sequence encoding the CAR polypeptide into a host genome at the target sequence within the genomic DNA of the NK cell or NK T cell, thereby generating a modified NK cell or modified NK T cell.

16. 16. The method of claim 15, wherein the NK cells or NK T cells are primary cells or expanded cells, and the primary cells are incubated in the presence of IL-2 for about 4-10 days prior to infection, or the primary cells are expanded in the presence of irradiated feeder cells, plasma membrane particles, or exosomes for about 4-10 days prior to infection, and the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof.

17. 16. The method of claim 15, wherein the CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3ζ signaling domain, and a single chain variable fragment (scFv) that specifically binds to a receptor on a target cell, wherein the transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3ζ transmembrane domain, or a NKG2D transmembrane domain, and wherein the costimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 costimulatory domain, a 4-1 BB costimulatory domain, or any combination thereof.

18. The method of claim 17, wherein the receptor comprises CD33.

19. 16. The method of claim 15, wherein the homologous arms specifically hybridize to the adeno-associated virus integration site 1 (AAVS1) of human chromosome 19.

20. 1. A method of generating chimeric antigen receptor (CAR) natural killer (NK) cells or CAR NK T cells, comprising: a) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease complexed with a corresponding CRISPR / Cas guide RNA and an adeno-associated virus (AAV) vector comprising a plasmid comprising a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, wherein the polynucleotide sequence is flanked by homology arms, the homology arms being 1000 bp or less in length; and b) introducing into an NK cell or NK T cell the polynucleotide sequence encoding the CAR polypeptide and the RNP complex, wherein the polynucleotide sequence encoding the CAR polypeptide is introduced into the NK cell or NK T cell via infection of the NK cell or NK T cell with the AAV vector, the RNP complex hybridizes to a target sequence within the genomic DNA of the NK cell or NK T cell, and a DNA repair enzyme in the NK cell or NK T cell inserts the polynucleotide sequence encoding the CAR polypeptide into the host genome at the target sequence within the genomic DNA of the cell, thereby creating a CAR NK cell or CAR NK T cell.

21. 21. The method of claim 20, wherein the NK cells or NK T cells are primary or expanded NK cells or NK T cells, and the primary NK cells or NK T cells are incubated in the presence of IL-2 for about 4-10 days prior to infection, or the primary cells are expanded in the presence of irradiated feeder cells, plasma membrane particles, or exosomes for about 4-10 days prior to infection, and the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof.

22. 22. The method of claim 20 or 21, further comprising expanding the CAR NK cells or the CAR NK T cells after infection with IL-2, or irradiated feeder cells, plasma membrane particles, or exosomes, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof.

23. 21. The method of claim 20, wherein the NK cells or NK T cells are infected with the AAV vector at an MOI of about 5-500K.

24. 21. The method of claim 20, wherein the RNP complex is introduced into the NK cell or NK T cell via electroporation or transfection, and the RNP complex is encoded on the same or a different AAV that contains the polynucleotide sequence.

25. 21. The method of claim 20, wherein the CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3ζ signaling domain, and a single chain variable fragment (scFv) that specifically binds to a receptor on a target cell, wherein the transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3ζ transmembrane domain, or a NKG2D transmembrane domain, and wherein the costimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 costimulatory domain, a 4-1 BB costimulatory domain, or any combination thereof.

26. 26. The method of claim 25, wherein the receptor comprises CD33.

27. The method of any one of claims 20 to 26, wherein the homologous arms specifically hybridize to the adeno-associated virus integration site 1 (AAVS1) of human chromosome 19.

28. 21. The method of claim 20, wherein the serotype of the AAV vector comprises an AAV6 vector.

29. 21. The method of claim 20, wherein the vector is a single-stranded AAV (ssAAV) vector or a self-complementary AAV (scAAV) vector.

30. 21. The method of claim 20, wherein the vector comprises a sequence at least 90% identical to SEQ ID NO:22 or SEQ ID NO:23 or a fragment thereof.

31. A natural killer (NK) cell or NK T cell for treating cancer in a subject, the NK cell or NK T cell being a T cell comprising a plasmid for use with a clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated 9 (Cas9) integration system, said plasmid comprising, in order, a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, and a right homology arm, said left and right homology arms each being between 30 bp and 1000 bp in length, said CAR polypeptide comprising a transmembrane domain, a costimulatory domain, a CD3ζ signaling domain, and a single chain variable fragment (scFv) that specifically binds to a receptor on a target cell, said transmembrane domain of said CAR polypeptide comprising a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3ζ transmembrane domain, or a NKG2D transmembrane domain, and said costimulatory domain of said CAR polypeptide comprising a 2B4 domain, a CD28 costimulatory domain, a 4-1 BB costimulatory domain, or any combination thereof; T cells.

32. 32. The NK cell or NK T cell of claim 31 , wherein the scFv that specifically binds to CD33 comprises a sequence at least 90% identical to SEQ ID NO: 29 or a fragment thereof.

33. 32. The NK cell or NK T cell of claim 31, wherein the homologous arms specifically hybridize to the adeno-associated virus integration site 1 (AAVS1) of human chromosome 19.

34. 1. A plasmid for use with a clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated 9 (Cas9) integration system, the plasmid comprising a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, the polynucleotide sequence being flanked by one polynucleotide sequence encoding a protospacer adjacent motif (PAM) and a crispr RNA (crRNA), or by two polynucleotide sequences encoding two PAMs and a crRNA.

35. 35. The plasmid of claim 34, wherein the plasmid comprises, in order, a first polynucleotide sequence encoding a first PAM sequence and a crRNA, the polynucleotide sequence encoding the CAR polypeptide, and a second polynucleotide sequence encoding a second PAM sequence and a crRNA, wherein the CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3ζ signaling domain, and a single chain variable fragment (scFv) that specifically binds to a receptor on a target cell, wherein the transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3ζ transmembrane domain, or a NKG2D transmembrane domain, and wherein the costimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 costimulatory domain, a 4-1 BB costimulatory domain, or any combination thereof.

36. 36. The plasmid of claim 35, wherein the receptor comprises CD33.

37. 36. An adeno-associated virus (AAV) vector comprising the plasmid of claim 35.

38. 38. A modified cell comprising the plasmid of claim 34 or the AAV vector of claim 37, said modified cell being a natural killer (NK) cell or an NK T cell.

39. 39. The modified cell of claim 38, wherein the NK cells or NK T cells are expanded in the presence of irradiated feeder cells, plasma membrane particles, or exosomes expressing membrane-bound IL-21, membrane-bound 4-1BBL, and / or membrane-bound IL-15, or any combination thereof.

40. 1. A method for producing chimeric antigen receptor (CAR) natural killer (NK) cells or NK T cells, comprising: a) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease complexed with a corresponding CRISPR / Cas guide RNA and an adeno-associated virus (AAV) vector comprising a plasmid comprising a polynucleotide sequence encoding a chimeric antigen receptor (CAR), wherein the polynucleotide sequence is flanked by one polynucleotide sequence encoding a protospacer adjacent motif (PAM) and a crispr RNA (crRNA) or by two polynucleotide sequences encoding two PAMs and a crRNA; b) introducing into said NK cell or NK T cell said polynucleotide sequence encoding said CAR polypeptide and said RNP complex, wherein said plasmid is introduced into said cell via infection of a target cell with an AAV vector; and introducing said ribonucleoprotein (RNP) complex into a host genome at said target sequence, wherein said ribonucleoprotein (RNP) complex hybridizes to a target sequence within the genomic DNA of said cell and DNA repair enzymes of said cell insert said polynucleotide encoding said CAR into the host genome at said target sequence, thereby creating a CAR NK cell or a CAR NK T cell.

41. 1. A method for genetically modifying natural killer (NK) cells or NK T cells, comprising: a) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease complexed with a corresponding CRISPR / Cas guide RNA and an adeno-associated virus (AAV) vector comprising a plasmid comprising a polynucleotide sequence encoding a chimeric antigen receptor (CAR), wherein the polynucleotide sequence is flanked by one polynucleotide sequence encoding a PAM and a crRNA or by two polynucleotide sequences encoding two PAMs and a crRNA; and b) introducing into said NK cell or NK T cell said polynucleotide sequence encoding said CAR polypeptide and said RNP complex, wherein said polynucleotide sequence encoding said CAR polypeptide is introduced into said cell via infection of a target cell with an AAV vector, said ribonucleoprotein (RNP) complex hybridizes to a target sequence within the genomic DNA of said cell, and DNA repair enzymes of said cell insert said polynucleotide sequence encoding the chimeric antigen receptor (CAR) into the host genome at the target sequence, thereby creating a modified NK cell or NK T cell.

42. 42. The method of claim 40 or 41, wherein the plasmid comprises, in order, a first polynucleotide sequence encoding a first PAM sequence and a crRNA, the polynucleotide sequence encoding the CAR polypeptide, and a second polynucleotide sequence encoding a second PAM sequence and a crRNA.

43. The plasmid described in claim 36, wherein the scFV that specifically binds to CD33 comprises an amino acid sequence encoded by SEQ ID NO:29 or a fragment thereof.

44. An scFV comprising an amino acid sequence that is 90% identical to the amino acid sequence encoded by sequence number 29.

45. An scFV comprising an amino acid sequence encoded by sequence number 29.

46. The plasmid described in claim 4, wherein the scFV that specifically binds to CD33 comprises an amino acid sequence encoded by SEQ ID NO:29 or a fragment thereof.

Images