Anti-PTK7 immune cell cancer therapy

Abstract

To provide CAR T cells as new tumor-associated antigen targets.SOLUTION: The present invention provides an engineered T cell, comprising a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an external domain that specifically binds to PTK7, overexpressed in normal tissues such as the lungs, smooth muscle, stomach, kidneys, and bladder. The present invention also provides methods and compositions (e.g., cell compositions) for the treatment of cancer, such as PTK7+ malignant tumors.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 62 / 756,638, filed November 7, 2018, and U.S. Provisional Patent Application No. 62 / 910,586, filed October 4, 2019, the disclosures of which are incorporated by reference in their entireties herein.

[0002] Incorporation by Reference of Electronically Submitted Materials A sequence listing that is part of this disclosure is submitted as a text file concurrently with the present specification. The name of the text file containing this sequence listing is "CT111_Seqlisting.txt", the text file was created on November 7, 2019, and is 119,776 bytes in size. The subject matter of this sequence listing is incorporated herein by reference in its entirety. [Background technology]

[0003] Chimeric antigen receptor (CAR) T cell therapy uses genetically modified T cells to more specifically and efficiently target and kill cancer cells. After T cells are collected from the blood, they are engineered to contain a CAR on their surface. The CAR can be introduced into the T cells using CRISPR / Cas9 gene editing technology. When these heterologous CAR T cells are injected into a patient, the receptor enables the T cells to kill the cancer cells. Summary of the Invention [Means for solving the problem]

[0004] Several tumor-associated antigen targets have progressed into clinical trials and have been selected primarily using the logic that expression in cancer tissues should be more selective than in normal tissues to avoid toxicity (Morgan, R. Blood 2013;122(2):3392-3394). However, PTK7 does not meet this criterion, as it is clearly overexpressed in normal tissues such as lung, smooth muscle, stomach, kidney and bladder. Therefore, PTK7 has not been considered a viable CAR T cell target. Nevertheless, the data provided herein unexpectedly demonstrate that animals do indeed tolerate treatment with anti-PTK7 CAR T cells, and that these anti-PTK7 CAR T cells efficiently and selectively kill cells expressing PTK7.

[0005] Some aspects of the present disclosure provide engineered T cells comprising a nucleic acid encoding a chimeric antigen receptor (CAR), the CAR comprising an ectodomain that specifically binds to PTK7. In some embodiments, the engineered T cells further comprise a disrupted T cell receptor alpha chain constant region (TRAC) gene. For example, the TRAC gene can be disrupted by insertion of a nucleic acid encoding a CAR. In some embodiments, the engineered T cells further comprise a disrupted beta-2-microglobulin (β2M) gene.

[0006] The ectodomain of the CAR, in some embodiments, comprises an anti-PTK7 antibody. In some embodiments, the anti-PTK7 antibody is an anti-PTK7 single chain variable fragment (scFv). The anti-PTK7 scFv, in some embodiments, comprises the amino acid sequence of any one of SEQ ID NOs: 54, 68, 75, or 82. In some embodiments, the anti-PTK7 scFv comprises a VH comprising the amino acid sequence of any one of SEQ ID NOs: 55, 69, 76, or 83, and / or a VL comprising the amino acid sequence of any one of SEQ ID NOs: 56, 70, 77, or 84. In some embodiments, the anti-PTK7 scFv comprises a VH comprising the CDR amino acid sequence of SEQ ID NO: 57, SEQ ID NO: 58, and / or SEQ ID NO: 59, and / or the anti-PTK7 scFv comprises a VL sequence comprising the CDR amino acid sequence of SEQ ID NO: 60, SEQ ID NO: 61, and / or SEQ ID NO: 62. In some embodiments, the anti-PTK7 scFv comprises a VH comprising the CDR amino acid sequences of SEQ ID NO:85, SEQ ID NO:86, and / or SEQ ID NO:87, and / or the anti-PTK7 scFv comprises a VL sequence comprising the CDR amino acid sequences of SEQ ID NO:88, SEQ ID NO:89, and / or SEQ ID NO:90.

[0007] In some embodiments, the CAR comprises a CD3 zeta cytoplasmic signaling domain. In some embodiments, the CAR comprises a CD28 costimulatory domain or a 41BB costimulatory domain.

[0008] In some embodiments, the TRAC gene comprises a nucleotide sequence encoding the left homology arm (LHA) and / or the right homology arm (RHA) within any one of SEQ ID NOs: 63, 64, 71, 78, or 91, or comprises the nucleotide sequence of SEQ ID NO: 92 or 100, and / or the CAR is encoded by the nucleotide sequence of any one of SEQ ID NOs: 49, 51, 65, 72, 79, or 112. In some embodiments, the disrupted β2M gene comprises at least one nucleotide sequence selected from any one of SEQ ID NOs: 9-14.

[0009] Also provided herein, in some aspects, is an engineered T cell that comprises: (i) a disrupted TRAC gene; (ii) a disrupted β2M gene; and (iii) a nucleic acid encoding a CAR comprising an anti-PTK7 antigen-binding fragment.

[0010] Also provided herein, in some aspects, is a population of cells comprising engineered T cells, the engineered T cells comprising (i) a disrupted TRAC gene; (ii) a disrupted β2M gene; and (iii) a nucleic acid encoding a CAR comprising an anti-PTK7 antigen-binding fragment. In other aspects, provided herein is a population of cells comprising engineered T cells, the engineered T cells comprising (i) a disrupted TRAC gene, the disrupted TRAC gene comprising a nucleic acid encoding a CAR, the nucleic acid sequence being at least 90% identical to SEQ ID NO: 49, 51, 65, 72, 79, or 112, and encoding a CAR of SEQ ID NO: 50, 52, 66, 73, or 80; and (ii) a disrupted β2M gene.

[0011] Also provided herein, in some embodiments, is a population of engineered T cells (e.g., comprising a nucleic acid encoding an anti-PTK7 CAR), where at least 25% or at least 50% of the engineered T cells of the population express the CAR. For example, at least 70% of the engineered T cells of the population express the CAR.

[0012] In some embodiments, at least 25% of the engineered T cells of the population express the CAR after at least 7 days or at least 14 days of in vitro expansion.

[0013] In some embodiments, at least 50% of the engineered T cells of the population do not express detectable levels of T cell receptor (TCR) protein, e.g., at least 90% of the engineered T cells of the population may not express detectable levels of TCR protein.

[0014] In some embodiments, at least 50% of the engineered T cells of the population do not express detectable levels of β2M protein, for example, at least 70% of the engineered T cells of the population may not express detectable levels of β2M protein.

[0015] In some embodiments, the engineered T cells of the population, when co-cultured in vitro with a population of cancer cells expressing PTK7, induce cytolysis of at least 50% of the cancer cells of the population. For example, the engineered T cells of the population may induce cytolysis of at least 70%, at least 80%, or at least 90% of the cancer cells of the population. In some embodiments, the engineered T cells of the population, when co-cultured in vitro with a population of cancer cells expressing PTK7, induce cytolysis of at least 10%, at least 25%, or at least 50% of the cancer cells of the population. In some embodiments, the engineered T cells of the population, when co-cultured in vitro with a population of cancer cells, secrete IFNγ. In some embodiments, the ratio of engineered T cells to cancer cells is 1:1 to 2:1. The cancer cells can be, for example, sarcoma cells or breast cancer cells. Other cancer cells can be targeted. In some embodiments, the cancer cells can be breast cancer cells, ovarian cancer cells, small cell lung cancer cells, and / or colon cancer cells.

[0016] In some embodiments, the proliferative capacity of the engineered T cells of the population is within 10% of the proliferative capacity of the control cells. In yet other embodiments, the population of T cells does not induce toxicity in a subject when administered in vivo to the subject.

[0017] Another aspect of the disclosure provides a method comprising administering a population of engineered T cells described herein. In some embodiments, the subject's percent of body weight is within 10% of the subject's initial body weight 5-10 days after administration, the subject's initial body weight being the subject's body weight at the time of administration. In some embodiments, the subject is a human subject. In some aspects, the subject has cancer. The cancer may express, for example, PTK7. In various embodiments, the cancer is selected from the group consisting of pancreatic cancer, gastric cancer, ovarian cancer, uterine cancer, breast cancer, prostate cancer, testicular cancer, thyroid cancer, nasopharyngeal cancer, non-small cell lung (NSCLC), glioblastoma, neuronal, soft tissue sarcoma, leukemia, lymphoma, melanoma, colon cancer, colon adenocarcinoma, brain glioblastoma, hepatocellular carcinoma, hepatic cholangiocarcinoma, osteosarcoma, gastric cancer, esophageal squamous cell carcinoma, advanced stage pancreatic cancer, lung adenocarcinoma, lung squamous cell carcinoma, small cell lung carcinoma, renal carcinoma, and intrahepatic biliary tract cancer.

[0018] A further aspect of the disclosure provides a method of generating an engineered T cell comprising: (a) delivering to a T cell a vector comprising an RNA-guided nuclease, a gRNA targeting the TRAC gene, and a donor template comprising a nucleic acid encoding a CAR comprising an ectodomain that specifically binds PTK7, wherein the nucleic acid encoding the CAR is flanked by left and right homology arms to the TRAC gene; and (b) generating the engineered T cell. In some embodiments, the gRNA targeting the TRAC gene comprises the nucleotide sequence of SEQ ID NO: 18 or 19, or targets the nucleotide sequence of SEQ ID NO: 40. In a related embodiment, a method is provided wherein the nucleic acid encoding the CAR is flanked by left and right homology arms to the TRAC gene.

[0019] In some embodiments, the method further comprises delivering to the T cell a gRNA that targets the β2M gene. In some embodiments, the gRNA that targets the β2M gene comprises the nucleotide sequence of SEQ ID NO:20 or 21, or targets the nucleotide sequence of SEQ ID NO:41.

[0020] In some embodiments, the RNA-guided nuclease is a Cas9 nuclease, optionally a S. pyogenes Cas9 nuclease. In some embodiments, the ectodomain of the CAR is an anti-PTK7 antibody, optionally an anti-PTK7 single chain variable fragment (scFv).

[0021] In some embodiments, the donor template comprises the nucleotide sequence of any one of SEQ ID NOs: 63, 64, 71, 78, or 91.

[0022] In some embodiments, the CAR comprises a nucleotide sequence encoding any one of SEQ ID NOs: 50, 52, 66, 73, or 80.

[0023] In some embodiments, a method is provided for making an anti-PTK7 scFv that comprises the same heavy chain variable domain (VH) complementarity determining regions (CDRs) and the same light chain variable domain (VL) CDRs as a reference antibody, the reference antibody comprising (i) a VH set forth in SEQ ID NO: 55 and a VL set forth in SEQ ID NO: 56, (ii) a VH set forth in SEQ ID NO: 69 and a VL set forth in SEQ ID NO: 70, (iii) a VH set forth in SEQ ID NO: 76 and a VL set forth in SEQ ID NO: 77, or (iv) a VH set forth in SEQ ID NO: 83 and a VL set forth in SEQ ID NO: 84. In one embodiment, a method is provided, the anti-PTK7 scFv comprises the same VH and VL chains as the reference antibody. In yet another embodiment, the anti-PTK7 scFv comprises the amino acid sequence of any one of SEQ ID NOs: 54, 68, 75, or 82.

[0024] In one embodiment, a method of making the above is provided, wherein the CAR comprises a CD28 costimulatory domain or a 41BB costimulatory domain. In a related embodiment, the CAR further comprises a CD3ζ cytoplasmic signaling domain.

[0025] In some embodiments, a method of making as described above is provided, wherein the donor template comprises the nucleotide sequence of any one of SEQ ID NOs: 63, 64, 71, 78, or 91. In yet other embodiments, the CAR is encoded by the nucleotide sequence of any one of SEQ ID NOs: 49, 51, 65, 72, 79, or 112. [Brief description of the drawings]

[0026] [Figure 1] 1 shows PTK7 expression in normal human tissues. [Figure 2A] PTK7 expression in diseased and normal human tissues. [Figure 2B] PTK7 expression in diseased and normal human tissues. [Diagram 3] PTK7 patient prevalence by immunohistochemistry (IHC) in solid tumors is shown. [Figure 4] Binding affinity of PTK7 / CTX181 Ab in human and mouse cell lines is shown. [Figure 5A] PTK7 expression in a panel of frozen normal tissues (FDA standard) from mouse (FIG. 5A) and human (FIG. 5B) is shown. [Figure 5B] PTK7 expression in a panel of frozen normal tissues (FDA standard) from mouse (FIG. 5A) and human (FIG. 5B) is shown. [Figure 6] PTK7 expression in frozen mouse embryo developmental arrays. [Figure 7] Graphs showing high efficiency of multiple gene editing in TRAC- / β2M- / anti-PTK7 CAR+ T cells. Phenotypic editing measured by FACS (left graph) and anti-PTK7 CAR+ expression measured by immunohistochemistry are shown for four different anti-PTK7 CAR+ constructs (PTK7-4, PTK7-7, PTK7-13, and PTK7-17). [Figure 8]Includes graphs showing that PTK7 CAR T cells with a CD28 costimulatory domain (PTK7-4) were more effective than PTK7 CAR T cells with a 4-1BB costimulatory domain (PTK7-4b). [Figure 9A-B] 9A and 9B include graphs showing the cell killing effect of TRAC- / β2M- / anti-PTK7 CAR+ T cells against the adherent sarcoma cell lines A-204 (FIG. 9A) and Saos-2 (FIG. 9B) and the breast cancer cell line MCF7 (FIG. 9C). Cell ratios of 2:1 and 1:1 (CAT T cells: target cancer cells) were used. [Figure 9C] 9A and 9B include graphs showing the cell killing effect of TRAC- / β2M- / anti-PTK7 CAR+ T cells against the adherent sarcoma cell lines A-204 (FIG. 9A) and Saos-2 (FIG. 9B) and the breast cancer cell line MCF7 (FIG. 9C). Cell ratios of 2:1 and 1:1 (CAT T cells: target cancer cells) were used. [Figure 10A] The specificity of PTK7 CAR T cells on PTK7-KO Saos2 cells (Figure 10A) and A498 cells overexpressing PTK7 (Figure 10B) is shown. Figure 10C shows PTK7 cell surface expression on Saos2 cells, PTK7-KO Saos2 cells, A498 cells, and A498 cells overexpressing PTK7. [Figure 10B-C] The specificity of PTK7 CAR T cells on PTK7-KO Saos2 cells (Figure 10A) and A498 cells overexpressing PTK7 (Figure 10B) is shown. Figure 10C shows PTK7 cell surface expression on Saos2 cells, PTK7-KO Saos2 cells, A498 cells, and A498 cells overexpressing PTK7. [Figure 11A] We show that the in vitro efficacy of PTK7 CAR T cells followed the same trend as the expression pattern in the following solid tumor cell lines: breast cancer (Figure 11A), pancreatic cancer (Figure 11B) and lung (NSCLC) cancer (Figure 11C). [Figure 11B] We show that the in vitro efficacy of PTK7 CAR T cells followed the same trend as the expression pattern in the following solid tumor cell lines: breast cancer (Figure 11A), pancreatic cancer (Figure 11B) and lung (NSCLC) cancer (Figure 11C). [Figure 11C]We show that the in vitro efficacy of PTK7 CAR T cells followed the same trend as the expression pattern in the following solid tumor cell lines: breast cancer (Figure 11A), pancreatic cancer (Figure 11B) and lung (NSCLC) cancer (Figure 11C). [Figure 12] Includes a graph showing cell proliferation of TRAC- / β2M- / anti-PTK7 CAR+ T cells after gene editing compared to controls. [Figure 13A] Graphs showing persistence of multiple gene edits in T cells are included. Phenotypic edits, as measured by FACS, remained consistent from day 7 (FIG. 13A) to day 14 (FIG. 13B) post-editing. [Figure 13B] Graphs showing persistence of multiple gene edits in T cells are included. Phenotypic edits, as measured by FACS, remained consistent from day 7 (FIG. 13A) to day 14 (FIG. 13B) post-editing. [Figure 13C] Shown is the phenotypic editing of PTK7-4 CAR-T cells measured by FACS 7 days after editing, represented as a FACS plot (Figure 13C) and a graph (Figure 13D). [Figure 13D] Shown is the phenotypic editing of PTK7-4 CAR-T cells measured by FACS 7 days after editing, represented as a FACS plot (Figure 13C) and a graph (Figure 13D). [Figure 14A-B] 14A-14C) and Saos-2 cells (FIGS. 14D-14F). [Fig. 14C-D] 14A-14C) and Saos-2 cells (FIGS. 14D-14F). [Fig. 14E-F]14A-14C) and Saos-2 cells (FIGS. 14D-14F). [Figure 15] 1 shows that anti-PTK7 CAR T cells were equally effective in vitro in human and murine cell lines. [Figure 16] Includes graphs showing that mice treated with TRAC- / β2M- / anti-PTK7 CAR+ T cells experienced minimal weight loss for up to 10 days following treatment / injection. [Figure 17] 1 shows PTK7 cell surface expression levels in human cancer cell lines. [Figure 18A] Shows the efficacy of anti-PTK7-CAR T cells in various in vivo xenograft models. [Figure 18B] Shows the efficacy of anti-PTK7-CAR T cells in various in vivo xenograft models. [Figure 18C] Shows the efficacy of anti-PTK7-CAR T cells in various in vivo xenograft models. [Figure 19A] Shown are blinded extension in vivo studies to evaluate the efficacy of PTK7 CAR T cells in ovarian (Figure 19A), colon and SCLC (Figure 19B), and breast (Figure 19C) cancer types. [Fig. 19B-C] Shown are blinded extension in vivo studies to evaluate the efficacy of PTK7 CAR T cells in ovarian (Figure 19A), colon and SCLC (Figure 19B), and breast (Figure 19C) cancer types. [Figure 20] Shows the effect of PTK7 CAR T cell treatment on body weight in an Hs-766T pancreatic tumor xenograft mouse model. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0027] PTK7 cancer antigen In some embodiments, the T cells of the present disclosure are engineered with a chimeric antigen receptor (CAR) designed to target PTK7. Protein tyrosine kinase 7 (PTK7), also known as colon cancer kinase 4 (CCK4), is a receptor protein tyrosine kinase involved in non-canonical Wnt signaling and contains an extracellular domain. PTK7 lacks detectable catalytic tyrosine kinase activity, but contains signaling activity and is presumed to function in cell adhesion. Furthermore, PTK7 is believed to be a marker of tumor progression in cancer, as it is expressed in cancer cell lines (e.g., colon cancer cell lines and breast cancer cell lines).

[0028] Thus, in some embodiments, the T cells of the present disclosure are engineered to express a CAR comprising an anti-PTK7 antibody (e.g., an anti-PTK7 scFv). In some embodiments, the anti-PTK7 antibody is an anti-PTK7 scFv encoded by the sequence of any one of SEQ ID NOs: 53, 67, 74, or 81. In some embodiments, the anti-PTK7 antibody is an anti-PTK7 scFv encoded by the sequence of any one of SEQ ID NOs: 113. In some embodiments, the anti-PTK7 antibody is an anti-PTK7 scFv comprising the sequence of any one of SEQ ID NOs: 54, 68, 75, or 82. In some embodiments, the anti-PTK7 antibody is an anti-PTK7 scFv comprising a VH comprising the amino acid sequence of any one of SEQ ID NOs: 55, 69, 76, or 83. In some embodiments, the anti-PTK7 antibody is an anti-PTK7 scFv comprising a VL comprising the amino acid sequence of any one of SEQ ID NOs: 56, 70, 77, or 84. In some embodiments, the CAR comprising the anti-PTK7 antibody is encoded by any one of the sequences of SEQ ID NOs: 49, 51, 65, 72, or 79. In some embodiments, the CAR comprising the anti-PTK7 antibody is encoded by a sequence comprising a nucleic acid that is at least 90% identical to SEQ ID NOs: 49, 51, 65, 72, 79, or 112. In some embodiments, the CAR comprising the anti-PTK7 antibody is encoded by any one of the sequences of SEQ ID NOs: 112. In some embodiments, the CAR comprising the anti-PTK7 antibody comprises any one of the sequences of SEQ ID NOs: 50, 52, 66, 73, or 80. In some embodiments, the CAR comprising the anti-PTK7 antibody comprises an anti-PTK7 antibody as described in U.S. Pat. No. 9,102,738 or 9,409,995.

[0029] Multiple gene editing The engineered T cells of the present disclosure, in some embodiments, comprise multiple gene edits, for example in multiple genes. For example, the engineered T cells can comprise a disrupted T cell receptor alpha chain constant region (TRAC) gene, a disrupted beta-2-microglobulin (β2M) gene, a disrupted programmed cell death-1 (PD-1 or PDCD1) gene, a disrupted CD70 gene, or any combination of two or more of the foregoing disrupted genes. In some embodiments, the engineered T cells comprise a disrupted TRAC gene, a disrupted β2M gene, and a disrupted CD70 gene. In some embodiments, the engineered T cells comprise a disrupted TRAC gene, a disrupted β2M gene, and a disrupted PD-1 gene. In some embodiments, the engineered T cells comprise a disrupted TRAC gene, a disrupted β2M gene, a disrupted CD70 gene, and a disrupted PD-1 gene.

[0030] It should be understood that gene disruption encompasses genetic modification via gene editing (e.g., using CRISPR / Cas gene editing to insert or delete one or more nucleotides). In some embodiments, the disrupted gene is a gene that does not encode a functional protein. In some embodiments, a cell containing a disrupted gene does not express (e.g., at the cell surface) a detectable level (e.g., by antibody, e.g., by flow cytometry) of the protein encoded by the gene. A cell that does not express a detectable level of protein may be referred to as a knockout cell. For example, a cell with β2M gene editing may be considered a β2M knockout cell if β2M protein cannot be detected at the cell surface using an antibody that specifically binds to β2M protein.

[0031] Provided herein, in some embodiments, is a population of cells in which a percentage of cells have been edited (e.g., the β2M gene has been edited), resulting in a percentage of cells that do not express a particular gene and / or protein. In some embodiments, at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 85%) of the cells of the population of gene-edited cells are β2M knockout cells. In some embodiments, at least 50% of the cells (e.g., T cells) of this population do not express detectable levels of β2M protein. In some embodiments, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% of the cells of the population of gene-edited cells can be β2M knockout cells.

[0032] Methods for using CRISPR-Cas gene editing technology to create genomic deletions in cells (e.g., knock out genes in cells) are known (Bauer DE et al. Vis. Exp. 2015;95;e52118).

[0033] TRAC gene editing In some embodiments, the engineered T cells contain a disrupted TRAC gene. This disruption results in loss of function of the TCR and renders the engineered T cells non-allo-reactive and compatible with allogeneic transplants, minimizing the risk of graft-versus-host disease. In some embodiments, expression of the endogenous TRAC gene is ablated to prevent graft-versus-host reactions. In some embodiments, the disruption in TRAC gene expression is provided by knocking in a chimeric antigen receptor (CAR) into the TRAC gene (e.g., using an adeno-associated virus (AAV) vector and a donor template). In some embodiments, the disruption in TRAC gene expression is provided by a gRNA that targets the TRAC genomic region. In some embodiments, the genomic deletion in TRAC gene expression is provided by knocking in a chimeric antigen receptor (CAR) into the TRAC gene (e.g., using an AAV vector and a donor template). In some embodiments, the disruption in TRAC gene expression is provided by knocking in a gRNA that targets the TRAC genomic region and a chimeric antigen receptor (CAR) into the TRAC gene.

[0034] Non-limiting examples of modified and unmodified TRAC gRNA sequences that can be used as described herein to create genomic disruptions in the TRAC gene are listed in Table 4 (e.g., SEQ ID NOs: 18 and 19). See also International Application No. PCT / US2018 / 032334, filed May 11, 2018, which is incorporated herein by reference. Other gRNA sequences can be designed using the TRAC gene sequence located on chromosome 14 (GRCh38: chromosome 14: 22,547,506-22,552,154; Ensembl; ENSG00000277734). In some embodiments, gRNAs targeting the TRAC genomic region create indels in the TRAC gene that abolish expression of mRNA or protein.

[0035] In some embodiments, at least 50% of the engineered T cells of the population do not express detectable levels of T cell receptor (TCR) surface protein. For example, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the population may not express detectable levels of TCR surface protein. In some embodiments, 50%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 60%-90%, 60%-80%, 60%-70%, 70%-100%, 70%-90%, 70%-80%, 80%-100%, 80%-90%, or 90%-100% of the engineered T cells do not express detectable levels of TCR surface protein.

[0036] In some embodiments, a gRNA targeting the TRAC genomic region generates an indel in the TRAC gene comprising at least one nucleotide sequence selected from the sequences in Table 1 below.

[0037] [Table 1]

[0038] In some embodiments, the engineered T cells comprise a deletion in the TRAC gene compared to unmodified T cells. In some embodiments, the engineered T cells comprise a deletion of 15-30 base pairs in the TRAC gene compared to unmodified T cells. In some embodiments, the engineered T cells comprise a deletion of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs in the TRAC gene compared to unmodified T cells. In some embodiments, the engineered T cells comprise a deletion of more than 30 base pairs in the TRAC gene compared to unmodified T cells. In some embodiments, the engineered T cells comprise a deletion of 20 base pairs in the TRAC gene compared to unmodified T cells. In some embodiments, the engineered T cells comprise a deletion of SEQ ID NO: 104 (AGAGCAACAGTGCTGTGGCC) in the TRAC gene compared to unmodified T cells. In some embodiments, the engineered T cells comprise a deletion in the TRAC gene comprising SEQ ID NO: 104 (AGAGCAACAGTGCTGTGGCC) compared to unmodified T cells. In some embodiments, the engineered T cells comprise a deletion in the TRAC gene comprising SEQ ID NO: 40 compared to unmodified T cells. In some embodiments, the engineered T cells comprise a deletion in the TRAC gene comprising SEQ ID NO: 40 compared to unmodified T cells.

[0039] β2M gene editing In some embodiments, the engineered T cells contain a disrupted β2M gene. β2M is a common (invariant) component of the MHC I complex. Disruption of β2M gene expression by gene editing prevents host-versus-therapeutic allogeneic T cell responses and leads to increased persistence of allogeneic T cells. In some embodiments, endogenous β2M gene expression is removed to prevent host-versus-graft responses.

[0040] Non-limiting examples of modified and unmodified β2M gRNA sequences that can be used as described herein to create a genomic disruption in the β2M gene are listed in Table 4 (e.g., SEQ ID NOs: 20 and 21). See also International Application No. PCT / US2018 / 032334, filed May 11, 2018, which is incorporated by reference herein. Other gRNA sequences can be designed using the β2M gene sequence located on chromosome 15 (coordinates of GRCh38: Chromosome 15: 44,711,477-44,718,877; Ensembl: ENSG00000166710).

[0041] In some embodiments, gRNAs targeting the β2M genomic region result in indels in the β2M gene that disrupt mRNA or protein expression.

[0042] In some embodiments, at least 50% of the engineered T cells of the population do not express detectable levels of β2M surface protein. For example, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the engineered T cells of the population may not express detectable levels of β2M surface protein. In some embodiments, 50%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 60%-90%, 60%-80%, 60%-70%, 70%-100%, 70%-90%, 70%-80%, 80%-100%, 80%-90%, or 90%-100% of the engineered T cells of the population do not express detectable levels of β2M surface protein.

[0043] In some embodiments, the edited β2M gene comprises at least one nucleotide sequence selected from the sequences in Table 2 below.

[0044] [Table 2]

[0045] PD-1 gene editing PD-1 is an immune checkpoint molecule that is downregulated in activated T cells and plays a role in dampening or shutting off T cell responses. Disruption of PD-1 by gene editing may result in more sustained and / or stronger therapeutic T cell responses and / or reduce immune suppression in a subject. In some embodiments, the engineered T cells contain a disrupted PD-1 gene. In some embodiments, expression of the endogenous PD-1 gene is ablated to enhance the antitumor effect of the CAR T cells of the present disclosure.

[0046] Non-limiting examples of modified and unmodified PD-1 gRNA sequences that can be used as described herein to create a genomic deletion in the PD-1 gene are listed in Table 4 (e.g., SEQ ID NOs: 22 and 23). See also International Application No. PCT / US2018 / 032334, filed May 11, 2018, which is incorporated by reference herein. Other gRNA sequences can be designed using the PD-1 gene sequence located on chromosome 2 (coordinates of GRCh38: Chromosome 2: 241,849,881-241,858,908; Ensembl: ENSG00000188389).

[0047] In some embodiments, gRNAs targeting the PD-1 genomic region result in indels in the PD-1 gene that disrupt expression of PD-1 mRNA or protein.

[0048] In some embodiments, at least 50% of the engineered T cells of the population do not express detectable levels of PD-1 surface protein. For example, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the engineered T cells of the population may not express detectable levels of PD-1 surface protein. In some embodiments, 50%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 60%-90%, 60%-80%, 60%-70%, 70%-100%, 70%-90%, 70%-80%, 80%-100%, 80%-90%, or 90%-100% of the engineered T cells of the population do not express detectable levels of PD-1 surface protein.

[0049] CD70 gene editing Cluster of differentiation 70 (CD70) is a member of the tumor necrosis factor superfamily, and its expression is restricted to activated T and B lymphocytes and mature dendritic cells. CD70 has also been detected on hematological tumors and carcinomas. CD70 is involved in the survival of tumor cells and regulatory T cells through interaction with its ligand CD27. Disruption of CD70 by gene editing increases cell proliferation and reduces cell depletion. In some embodiments, engineered T cells contain a disrupted CD70 gene. In some embodiments, expression of the endogenous CD70 gene is ablated to enhance the antitumor effect of the CAR T cells of the present disclosure. In some embodiments, gRNAs targeting the CD70 genomic region result in indels at or around the CD70 gene that disrupt expression of CD70 mRNA and / or protein.

[0050] Non-limiting examples of modified and unmodified CD70 gRNA sequences that can be used as described herein to create a genomic deletion in the CD70 gene are listed in Table 4 (e.g., SEQ ID NOs:24-27). Other gRNA sequences can be designed using the CD70 gene sequence located on chromosome 19 (coordinates of GRCh38: Chromosome 19: 6,583,183-6,604,103; Ensembl: ENSG00000125726).

[0051] In some embodiments, at least 50% of the engineered T cells of the population do not express detectable levels of CD70 surface protein. For example, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the engineered T cells of the population may not express detectable levels of CD70 surface protein. In some embodiments, 50%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 60%-90%, 60%-80%, 60%-70%, 70%-100%, 70%-90%, 70%-80%, 80%-100%, 80%-90%, or 90%-100% of the engineered T cells of the population do not express detectable levels of CD70 surface protein.

[0052] cell phenotype In some embodiments, editing of one or more genes in a population of cells results in a phenotype associated with a change in cell proliferation capacity, cell depletion, cell viability, cell lysis capacity (e.g., increasing cytokine production and / or release), or any combination thereof.

[0053] In some embodiments, the engineered T cells of the present disclosure exhibit at least 20% greater cell proliferation capacity compared to control T cells. For example, the engineered T cells may exhibit at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 90% greater cell proliferation capacity compared to control T cells. In some embodiments, the engineered T cells of the present disclosure exhibit 20% to 100%, 20% to 90%, 20% to 80%, 20% to 70%, 20% to 60%, 20% to 50%, 30% to 100%, 30% to 90%, 30% to 80%, 30% to 70%, 30% to 60%, 30% to 50%, 40% to 100%, 40% to 90%, 40% to 80%, 40% to 70%, 40% to 60%, 40% to 50%, 50% to 100%, 50% to 90%, 50% to 80%, 50% to 70%, or 50% to 60% higher cell proliferation ability compared to control T cells.

[0054] In some embodiments, the engineered T cells of the disclosure exhibit at least a 20% increase in cell viability compared to control cells. For example, the engineered T cells of the disclosure may exhibit at least a 25%, at least a 30%, at least a 35%, at least a 40%, at least a 45%, at least a 50%, at least a 55%, at least a 60%, at least a 65%, at least a 70%, at least a 75%, at least a 80%, or at least a 90% increase in cell viability compared to control cells. In some embodiments, engineered T cells of the present disclosure exhibit a 20%-100%, 20%-90%, 20%-80%, 20%-70%, 20%-60%, 20%-50%, 30%-100%, 30%-90%, 30%-80%, 30%-70%, 30%-60%, 30%-50%, 40%-100%, 40%-90%, 40%-80%, 40%-70%, 40%-60%, 40%-50%, 50%-100%, 50%-90%, 50%-80%, 50%-70%, or 50%-60% increase in cell viability compared to control cells.

[0055] In some embodiments, the engineered T cells of the disclosure exhibit at least a 20% increase in cytolytic capacity (killing at least 20% more target cells) compared to control cells. For example, the engineered T cells of the disclosure may exhibit at least a 25%, at least a 30%, at least a 35%, at least a 40%, at least a 45%, at least a 50%, at least a 55%, at least a 60%, at least a 65%, at least a 70%, at least a 75%, at least a 80%, or at least a 90% increase in cytolytic capacity compared to control cells. In some embodiments, engineered T cells of the present disclosure exhibit a 20%-100%, 20%-90%, 20%-80%, 20%-70%, 20%-60%, 20%-50%, 30%-100%, 30%-90%, 30%-80%, 30%-70%, 30%-60%, 30%-50%, 40%-100%, 40%-90%, 40%-80%, 40%-70%, 40%-60%, 40%-50%, 50%-100%, 50%-90%, 50%-80%, 50%-70%, or 50%-60% increase in cytolytic capacity compared to control cells. For example, the level of a cytokine (e.g., IL-2 and / or IFN-gamma) secreted by the engineered T cells may be at least two-fold (e.g., at least three-fold, at least four-fold, or at least five-fold) higher than the level of a cytokine secreted by a control T cell.

[0056] The control T cell, in some embodiments, is an engineered T cell (e.g., a gene-edited T cell). In some embodiments, the control T cell is an engineered T cell that includes a disrupted TRAC gene, a nucleic acid encoding a CAR (e.g., an anti-PTK7 CAR) inserted into the TRAC gene, and / or a disrupted β2M gene. In some embodiments, the control T cell is an unedited T cell.

[0057] Gene editing methods Gene editing (including genome editing) is a type of genetic engineering in which nucleotides / nucleic acids are inserted, deleted, and / or replaced in a DNA sequence (e.g., in the genome of a targeted cell). Targeted gene editing allows insertion, deletion, and / or replacement at a preselected site in the genome of a targeted cell (e.g., in a targeted gene or in a targeted DNA sequence). When the sequence of an endogenous gene is edited, for example by deletion, insertion, or replacement of nucleotides / nucleic acids, the endogenous gene containing the affected sequence can be knocked out or knocked down due to the sequence modification. Thus, targeted editing can be used to disrupt endogenous gene expression. "Targeted integration" refers to a process that includes the insertion of one or more exogenous sequences, with or without deletion of the exogenous sequence at the insertion site. Targeted integration can result from targeted gene editing when a donor template containing the exogenous sequence is present.

[0058] Targeted editing can be achieved either through nuclease-independent or nuclease-dependent approaches. In nuclease-independent targeted editing approaches, homologous recombination is induced by homologous sequences adjacent to an exogenous polynucleotide that is introduced into an endogenous sequence via the host cell's enzymatic machinery. The exogenous polynucleotide can introduce deletions, insertions or substitutions of nucleotides in the endogenous sequence.

[0059] Alternatively, nuclease-dependent approaches can achieve targeted editing at relatively high frequencies through the specific introduction of double-strand breaks (DSBs) by specific rare-cutting nucleases (e.g., endonucleases). Such nuclease-dependent targeted editing also utilizes DNA repair mechanisms (e.g., non-homologous end joining (NHEJ) that occurs in response to DSBs). DNA repair by NHEJ often results in the random insertion or deletion (indel) of a small number of native nucleotides. In contrast to NHEJ-mediated repair, repair can also occur by homology-directed repair (HDR). In the presence of a donor template containing exogenous genetic material flanked by a pair of homologous arms, the exogenous genetic material can be introduced into the genome by HDR, which results in the targeted integration of the exogenous genetic material.

[0060] Available endonucleases that can introduce specific and targeted DSBs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided CRISPR-Cas9 nucleases (CRISPR / Cas9; clustered regularly interspaced short palindromic repeats associated 9). In addition, the DICE (Dual Integrase Cassette Exchange) system, which utilizes phiC31 integrase and Bxb1 integrase, can also be used for targeted integration.

[0061] ZFNs are targeted nucleases that contain a nuclease fused to a zinc finger DNA binding domain (ZFBD), which is a polypeptide domain that binds to DNA in a sequence-specific manner through one or more zinc fingers. A zinc finger is a domain of about 30 amino acids within the zinc finger binding domain whose structure is stabilized through the coordination of a zinc ion. Examples of zinc fingers include, but are not limited to, C2H2 zinc fingers, C3H zinc fingers, and C4 zinc fingers. Designed zinc finger domains are non-naturally occurring domains whose design / composition is primarily driven by rational criteria (e.g., application of substitution rules and computerized algorithms to process information in a database that stores information on existing ZFP designs and binding data). See, for example, U.S. Patent Nos. 6,140,081; 6,453,242; and 6,534,261; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536; and WO 03 / 016496. The selected zinc finger domain is a non-naturally occurring domain that is primarily derived from experimental processes such as phage display, interaction trap, or hybrid selection. ZFNs are described in more detail in U.S. Patent Nos. 7,888,121 and 7,972,854. The most recognized example of ZFN is the fusion of FokI nuclease with a zinc finger DNA binding domain.

[0062] TALENs are targeted nucleases that contain a nuclease fused to a TAL effector DNA binding domain. A "transcription activator-like effector DNA binding domain", "TAL effector DNA binding domain" or "TALE DNA binding domain" is a polypeptide domain of a TAL effector protein that is involved in binding of the TAL effector protein to DNA. TAL effector proteins are secreted during infection by plant pathogens of the genus Xanthomonas. The protein enters the nucleus of the plant cell, binds to an effector-specific DNA sequence via its DNA binding domain, and activates gene transcription at this sequence via its transcription activation domain. The specificity of the TAL effector DNA binding domain depends on an effector-variable number of imperfect 34 amino acid repeats that contain polymorphisms at selected repeat positions, called 2 amino acid residue variable regions (RVDs). TALENs are described in more detail in US Patent Publication No. 2011 / 0145940. The most recognized example of a TALEN in the art is a fusion polypeptide of FokI nuclease to a TAL effector DNA binding domain.

[0063] Further examples of targeted nucleases suitable for use as provided herein include, but are not limited to, Bxb1, phiC31, R4, PhiBT1 and Wβ / SPBc / TP901-1, whether used individually or in combination.

[0064] Other non-limiting examples of targeted nucleases include naturally occurring nucleases and recombinant nucleases, such as CRISPR / Cas9, restriction endonucleases, meganucleases homing endonucleases, and the like.

[0065] CRISPR-Cas9 gene editing The CRISPR-Cas9 system is a naturally occurring defense mechanism in prokaryotes that has been repurposed as an RNA-guided DNA targeting platform used for gene editing. The CRISPR-Cas9 system relies on the DNA nuclease Cas9 and two non-coding RNAs, crisprRNA (crRNA) and transactivating RNA (tracrRNA), to target DNA cleavage.

[0066] The crRNA typically facilitates sequence recognition and specificity of the CRISPR-Cas9 complex through Watson-Crick base pairing with a 20 nucleotide (nt) sequence in the target DNA. Alterations in the 5' 20 nt sequence in the crRNA allow targeting of the CRISPR-Cas9 complex to a specific locus. The CRISPR-Cas9 complex will only bind to DNA sequences that contain a sequence matching the first 20 nt of the crRNA, the single guide RNA (sgRNA), if the target sequence is followed by a specific short DNA motif (with the sequence NGG) called the protospacer adjacent motif (PAM).

[0067] TracrRNA hybridizes to the 3' end of crRNA to form an RNA duplex structure to which Cas9 endonuclease binds to form a catalytically active CRISPR-Cas9 complex, which can then cleave the target DNA.

[0068] When the CRISPR-Cas9 complex binds to DNA at a target site, two independent nuclease domains within the Cas9 enzyme each cleave one of the DNA strands upstream of the PAM site, leaving a double-stranded break (DSB) in which both strands of DNA terminate with base pairs (blunt ends).

[0069] After the CRISPR-Cas9 complex binds to DNA at a specific target site and a site-specific DSB is formed, the next critical step is the repair of the DSB. Cells use two major DNA repair pathways to repair DSBs: non-homologous end joining (NHEJ) and homology-directed repair (HDR).

[0070] NHEJ is a robust repair mechanism that appears to be highly active in most cell types, including non-dividing cells. NHEJ is error-prone and can often result in removal or addition of between one and several hundred nucleotides at the site of the DSB, although such modifications are typically <20 nt. The resulting insertions and deletions (indels) can disrupt coding or non-coding regions of genes. Instead, HDR uses long stretches of homologous donor DNA, provided endogenously or exogenously, to repair DSBs with high fidelity. HDR is only active in dividing cells and occurs at a relatively low frequency in most cell types. In many embodiments of the present disclosure, NHEJ is utilized as the repair operant.

[0071] In some embodiments, the Cas9 (CRISPR associated protein 9) endonuclease is derived from Streptococcus pyogenes, although other Cas9 homologs may be used. As described herein, it should be understood that wild-type Cas9 may be used, or a modified version of Cas9 may be used (e.g., an evolved version of Cas9 or a Cas9 ortholog or mutant). In some embodiments, Cas9 may be replaced with another RNA-guided endonuclease, such as Cpf1 (of a class II CRISPR / Cas system).

[0072] Guide RNA The present disclosure provides a genome-targeting nucleic acid that can induce the activity of an associated polypeptide (e.g., a site-directed polypeptide) to a specific target sequence within a target nucleic acid. The genome-targeting nucleic acid can be an RNA. The genome-targeting RNA is referred to herein as a "guide RNA" or "gRNA." The guide RNA comprises at least one spacer sequence that hybridizes to the target nucleic acid sequence of interest and the CRISPR repeat sequence. In type II systems, the gRNA also comprises a second RNA, referred to as a tracrRNA sequence. In type II guide RNAs (gRNAs), the CRISPR repeat sequence and the tracrRNA sequence hybridize to each other to form a duplex. In type V guide RNAs (gRNAs), the crRNA forms a duplex. In both systems, the duplex binds to the site-directed polypeptide, such that the guide RNA and the site-directed polypeptide form a complex. In some embodiments, the genome-targeting nucleic acid provides target specificity to the complex by its association with the site-directed polypeptide. Thus, the genome-targeting nucleic acid induces the activity of the site-directed polypeptide.

[0073] As will be appreciated by those skilled in the art, each guide RNA is designed to include a spacer sequence that is complementary to its genomic target sequence. See Jinek et al., Science, 337, 816-821 (2012) and Deltcheva et al., Nature, 471, 602-607 (2011).

[0074] In some embodiments, the genome-targeting nucleic acid is a dual molecule guide RNA. In some embodiments, the genome-targeting nucleic acid is a single molecule guide RNA.

[0075] The dual molecule guide RNA comprises two strands of RNA. The first strand comprises, from 5' to 3', an optional spacer extension sequence, a spacer sequence and a minimal CRISPR repeat sequence. The second strand comprises a minimal tracrRNA sequence (complementary to the minimal CRISPR repeat sequence), a 3'tracrRNA sequence and an optional tracrRNA extension sequence.

[0076] The single molecule guide RNA (sgRNA) in the type II system includes, from 5' to 3', an optional spacer extension sequence, a spacer sequence, a minimal CRISPR repeat sequence, a single molecule guide linker, a minimal tracrRNA sequence, a 3' tracrRNA sequence, and an optional tracrRNA extension sequence. The optional tracrRNA extension may include elements that confer additional functionality (e.g., stability) to the guide RNA. The single molecule guide linker links the minimal CRISPR repeat and the minimal tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension includes one or more hairpins.

[0077] The single molecule guide RNA (referred to as "sgRNA" or "gRNA") in the V-type system contains, from 5' to 3', minimal CRISPR repeats and a spacer sequence.

[0078] The sgRNA may comprise a spacer sequence of 20 nucleotides at the 5' end of the sgRNA sequence. The sgRNA may comprise a spacer sequence of less than 20 nucleotides at the 5' end of the sgRNA sequence. The sgRNA may comprise a spacer sequence of more than 20 nucleotides at the 5' end of the sgRNA sequence. The sgRNA may comprise a variable length spacer sequence having 17-30 nucleotides at the 5' end of the sgRNA sequence (see Table 3).

[0079] The sgRNA may not include any uracil at the 3' end of the sgRNA sequence. The sgRNA may include one or more uracils at the 3' end of the sgRNA sequence. For example, the sgRNA may include one uracil (U) at the 3' end of the sgRNA sequence. The sgRNA may include two uracils (UU) at the 3' end of the sgRNA sequence. The sgRNA may include three uracils (UUU) at the 3' end of the sgRNA sequence. The sgRNA may include four uracils (UUUU) at the 3' end of the sgRNA sequence. The sgRNA may include five uracils (UUUUU) at the 3' end of the sgRNA sequence. The sgRNA may include six uracils (UUUUUU) at the 3' end of the sgRNA sequence. The sgRNA may contain seven uracils (UUUUUUU) at the 3' end of the sgRNA sequence. The sgRNA may contain eight uracils (UUUUUUUU) at the 3' end of the sgRNA sequence.

[0080] The sgRNA may be unmodified or modified. For example, a modified sgRNA may contain one or more 2'-O-methyl phosphorothioate nucleotides.

[0081] [Table 3]

[0082] As an example, guide RNAs or other smaller RNAs used in the CRISPR / Cas / Cpf1 system can be easily synthesized by chemical means, as described below and in the art. While chemical synthesis methods continue to expand, as polynucleotides become significantly longer in length, exceeding a hundred or so nucleotides, purification of such RNAs by methods such as high performance liquid chromatography (avoiding the use of gels such as HPLC, PAGE, etc.) tends to become more difficult. One approach used to generate relatively long RNAs is to generate two or more molecules that are linked together. Much longer RNAs, such as those that code for Cas9 endonuclease or Cpf1 endonuclease, are more easily generated enzymatically. As described in the art, various types of RNA modifications (e.g., modifications that enhance stability, reduce the likelihood or extent of innate immune response, and / or enhance other attributes) can be introduced during or after chemical synthesis and / or enzymatic generation of RNA.

[0083] Spacer sequence The gRNA comprises a spacer sequence. The spacer sequence is a sequence (e.g., a sequence of 20 nucleotides) that defines a target sequence of a target nucleic acid of interest (e.g., a DNA target sequence such as a genomic target sequence). In some embodiments, the spacer sequence is 15-30 nucleotides. In some embodiments, the spacer sequence is 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the spacer sequence is 20 nucleotides.

[0084] A "target sequence" is a sequence adjacent to a PAM sequence and modified by an RNA-guided nuclease (e.g., Cas9). A "target nucleic acid" is a double-stranded molecule: one strand contains the target sequence and is called the "PAM strand" and the other complementary strand is called the "non-PAM strand". Those skilled in the art will recognize that a gRNA spacer sequence hybridizes to the reverse complement of a target sequence located in the non-PAM strand of a target nucleic acid of interest. Thus, a gRNA spacer sequence is the RNA equivalent of a target sequence. For example, if the target sequence is 5'-AGAGCAACAGTGCTGTGGCC-3' (SEQ ID NO: 104), then the gRNA spacer sequence is 5'-AGAGCAACAGUGCUGUGGCC-3' (SEQ ID NO: 105). The spacer of a gRNA interacts with a target nucleic acid of interest in a sequence-specific manner through hybridization (i.e., base pairing). Thus, the nucleotide sequence of the spacer varies depending on the target sequence of the target nucleic acid of interest.

[0085] In the CRISPR / Cas system herein, the spacer sequence is designed to hybridize to the region of the target nucleic acid located 5' of the PAM of the Cas9 enzyme used in this system. This spacer can be a perfect match to the target sequence or can have a mismatch. Each Cas9 enzyme has a specific PAM sequence that it recognizes in the target DNA. For example, S. pyogenes recognizes a PAM in the target nucleic acid that includes the sequence 5'-NRG-3' (where R includes either A or G, N is any nucleotide, and N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence).

[0086] In some embodiments, the target nucleic acid sequence comprises 20 nucleotides. In some embodiments, the target nucleic acid comprises less than 20 nucleotides. In some embodiments, the target nucleic acid comprises more than 20 nucleotides. In some embodiments, the target nucleic acid comprises at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid comprises up to 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid sequence comprises 20 bases immediately 5' to the first nucleotide of the PAM. For example, [ka] In a sequence comprising:

[0087] Non-limiting examples of gRNAs that can be used as described herein are shown in Table 4 and in PCT / US2018 / 032334, filed May 11, 2018.

[0088] [Table 4]

[0089] Chimeric antigen receptor (CAR) T cells Chimeric antigen receptor refers to an artificial immune cell receptor that is engineered to recognize and bind to antigens expressed by tumor cells. Generally, CARs are designed for T cells and are chimeras of the signaling domain of the T cell receptor (TCR) complex and the antigen recognition domain (e.g., single chain fragments of antibodies (scFv) or other antibody fragments) (Enblad et al., Human Gene Therapy. 2015; 26(8): 498-505). T cells expressing CARs are called CAR T cells. CARs have the ability to redirect the specificity and reactivity of T cells to selected targets in an MHC-unrestricted manner. MHC-unrestricted antigen recognition gives CAR-expressing T cells the ability to recognize antigens independent of antigen processing, thereby bypassing a major mechanism of tumor escape. Furthermore, when expressed in T cells, CARs do not advantageously dimerize with the alpha and beta chains of the endogenous T cell receptor (TCR).

[0090] There are four generations of CARs, each of which contains different components. First generation CARs link an antibody-derived scFv to the CD3 zeta (ζ or z) intracellular signaling domain of the T cell receptor via a hinge and transmembrane domain. Second generation CARs incorporate additional domains (e.g., CD28, 4-1BB (41BB) or ICOS) to provide a costimulatory signal. Third generation CARs contain two costimulatory domains fused to the TCR CD3ζ chain. Third generation costimulatory domains can include, for example, a combination of CD3ζ, CD27, CD28, 4-1BB, ICOS or OX40. A CAR, in some embodiments, comprises an ectodomain (e.g., CD3ζ), typically derived from a single chain variable fragment (scFv), a hinge, a transmembrane domain, and an endodomain with one (first generation), two (second generation) or three (third generation) signaling domains derived from CD3ζ and / or a costimulatory molecule (Maude et al., Blood. 2015; 125(26):4017-4023; Kakarla and Gottschalk, Cancer J. 2014; 20(2):151-155).

[0091] CARs typically differ in their functional properties. The CD3ζ signaling domain of the T cell receptor, when bound, activates and induces T cell proliferation, but can also cause anergy (lack of response by the body's defense mechanisms, resulting in direct induction of peripheral lymphocyte tolerance). Lymphocytes are considered anergic when they are unable to respond to a particular antigen. The addition of a costimulatory domain in second generation CARs improved the replicative capacity and persistence of modified T cells. Similar antitumor effects are observed in vitro with CD28 or 4-1BB CARs, but preclinical in vivo studies suggest that 4-1BB CARs may result in superior proliferation and / or persistence. Clinical trials suggest that both of these second generation CARs can induce substantial T cell proliferation in vivo, but CARs containing the 4-1BB costimulatory domain appear to persist longer. Third generation CARs combine multiple signaling domains (costimulation) that enhance potency.

[0092] In some embodiments, the chimeric antigen receptor is a first generation CAR. In other embodiments, the chimeric antigen receptor is a second generation CAR. In yet other embodiments, the chimeric antigen receptor is a third generation CAR.

[0093] A CAR, in some embodiments, comprises an extracellular (external) domain that includes an antigen binding domain (e.g., an antibody such as an scFv), a transmembrane domain, and a cytoplasmic (endo) domain.

[0094] External domains The ectodomain is the region of the CAR that is exposed to extracellular body fluids, and in some embodiments includes the antigen binding domain and optional signal peptide, spacer domain, and / or hinge domain. In some embodiments, the antigen binding domain is a single chain variable fragment (scFv) that includes the VL and VH of an immunoglobulin linked to a short linker peptide. The linker, in some embodiments, includes hydrophilic residues with stretches of glycine and serine for flexibility and stretches of glutamate and lysine for added solubility. Single chain variable fragments (scFv) are not actually fragments of antibodies, but instead are fusion proteins of the variable regions of the heavy (VH) and light (VL) chains of an immunoglobulin linked to a short linker peptide of 10 to about 25 amino acids. The linker is usually glycine-rich for flexibility and serine or threonine-rich for solubility, and can either link the N-terminus of the VH to the C-terminus of the VL or vice versa. The protein retains the specificity of the original immunoglobulin despite the removal of the constant region and the introduction of the linker. Non-limiting examples of VH and VL protein sequences that may be used to generate anti-PTK7 scFvs may include the amino acid sequences (VH) of SEQ ID NO: 55, 69, 76, or 83, and the amino acid sequences (VL) of SEQ ID NO: 56, 70, 77, or 83. In some embodiments, the scFvs of the present disclosure are humanized. In other embodiments, the scFvs are fully human. In yet other embodiments, the scFvs are chimeric (e.g., mouse and human sequences). In some embodiments, the scFvs are anti-PTK7 scFvs (specifically bind to PTK7). Non-limiting examples of anti-PTK7 scFv proteins that may be used as described herein may include the amino acid sequences of any one of SEQ ID NO: 54, 68, 75, or 82. Other scFv proteins may be used.

[0095] Signal peptides can enhance the antigen specificity of CAR binding. Signal peptides can be derived from antibodies (such as, but not limited to, CD8) and epitope tags (such as, but not limited to, GST or FLAG). Examples of signal peptides include MLLLVTSLLLCELPHPAFLLIP (SEQ ID NO: 106) and MALPVTALLLPLALLLHAARP (SEQ ID NO: 93). Other signal peptides can be used.

[0096] In some embodiments, the spacer domain or hinge domain is located between the extracellular domain (including the antigen binding domain) and the transmembrane domain of the CAR, or between the cytoplasmic domain and the transmembrane domain of the CAR. A spacer domain is any oligopeptide or polypeptide that functions to link a transmembrane domain to an extracellular domain and / or a cytoplasmic domain in a polypeptide chain. A hinge domain is any oligopeptide or polypeptide that functions to provide flexibility to a CAR or a domain thereof or to prevent steric hindrance of a CAR or a domain thereof. In some embodiments, a spacer domain or hinge domain can comprise up to 300 amino acids (e.g., 10-100 amino acids or 5-20 amino acids). In some embodiments, one or more spacer domains can be included in other regions of the CAR. In some embodiments, the hinge domain is a CD8 hinge domain. Other hinge domains can be used.

[0097] Transmembrane domain The transmembrane domain is a hydrophobic alpha helix that spans the membrane. The transmembrane domain provides stability to the CAR. In some embodiments, the transmembrane domain of the CAR provided herein is a CD8 transmembrane domain. In other embodiments, the transmembrane domain is a CD28 transmembrane domain. In yet other embodiments, the transmembrane domain is a chimera of the CD8 transmembrane domain and the CD28 transmembrane domain. Other transmembrane domains may be used as described herein. In some embodiments, the transmembrane domain is a CD8a transmembrane domain: [ka] Other transmembrane domains can be used.

[0098] Internal domains The endodomain is the functional end of the receptor. After antigen recognition, the receptor clusters and signals are transmitted to the cell. The most commonly used endodomain component is CD3-zeta, which contains three immunoreceptor tyrosine-based activation motifs (ITAMs). It transmits activation signals to T cells after antigen binding. In many cases, CD3-zeta may not provide a sufficiently competent activation signal, so costimulatory signaling is used. For example, CD28 and / or 4-1BB may be used together with CD3-zeta (CD3ζ) to transmit proliferation / survival signals. Thus, in some embodiments, the costimulatory molecule of the CAR provided herein is a CD28 costimulatory molecule. In other embodiments, the costimulatory molecule is a 4-1BB costimulatory molecule. In some embodiments, the CAR comprises CD3ζ and CD28. In other embodiments, the CAR comprises CD3-zeta and 4-1BB. In yet other embodiments, the CAR comprises CD3ζ, CD28, and 4-1BB. Table 5 lists examples of signaling molecules that can be used as described herein.

[0099] [Table 5]

[0100] antibody An antibody (used interchangeably in the multiple forms) is an immunoglobulin molecule that can specifically bind to a target, such as a carbohydrate, polynucleotide, lipid, polypeptide, etc., through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. As used herein, the term "antibody" encompasses intact (i.e., full-length) monoclonal antibodies, as well as antigen-binding fragments (e.g., Fab, Fab', F(ab')2, Fv), single-chain variable fragments (scFv), variants thereof, fusion proteins comprising antibody portions, humanized antibodies, chimeric antibodies, diabodies, linear antibodies, single-chain antibodies, single-domain antibodies (e.g., camelid VHH antibodies or llama VHH antibodies), multispecific antibodies (e.g., bispecific antibodies) and any other modified configuration of an immunoglobulin molecule that contains an antigen recognition site of the required specificity, such as glycosylation variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies.

[0101] A typical antibody molecule comprises a heavy chain variable region (VH) and a light chain variable region (VL) that are typically involved in antigen binding. These regions / residues involved in antigen binding can be identified from the amino acid sequence of the VH / VL sequence of a reference antibody (e.g., an anti-PTK7 antibody described herein) by methods known in the art. The VH and VL regions can be further subdivided into hypervariable regions, also known as "complementarity determining regions" ("CDRs"), interspersed with more conserved regions known as "framework regions" ("FRs"). Each VH and VL is typically composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The extent of the framework regions and CDRs can be precisely identified using methodologies known in the art, for example, by the Kabat definition, the Chothia definition, the AbM definition, and / or the contact definition, all of which are known in the art. As used herein, CDR may refer to a CDR defined by any method known in the art. Two antibodies with identical CDRs mean that these two antibodies have the same amino acid sequence of the CDRs determined by the same method. See, for example, Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, USDepartment of Health and Human Services, NIH Publication No. 91-3242, Chothia et al., (1989) Nature 342: 877; Chothia, C. et al. (1987) J. Mol. Biol. 196: 901-917, Al-lazikani et al. (1997) J. Mol. Biol. 273: 927-948; and Almagro, J. Mol. Recognit. 17: 132-143 (2004). See also hgmp.mrc.ac.uk and bioinf.org.uk / abs.

[0102] In some embodiments, the antibody is an scFv, such as an anti-PTK7 scFv. Antibodies include antibodies of any class, such as IgD, IgE, IgG, IgA, or IgM (or subclasses thereof), and the antibody need not be of any particular class. Depending on the antibody amino acid sequence of the constant domain of the heavy chain, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, some of which can be further divided into subclasses (isotypes), for example, IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively. The subunit structures and three-dimensional configurations of the different classes of immunoglobulins are known.

[0103] Antibodies used as described herein may be murine, rat, human, or of any other origin, including chimeric or humanized antibodies. In some instances, the antibodies include altered constant regions, such as constant regions that are immunologically inert (e.g., do not induce complement-mediated lysis or stimulate antibody-dependent cell-mediated cytotoxicity (ADCC)).

[0104] In some embodiments, the antibody of the present disclosure is a humanized antibody. Humanized antibodies refer to forms of non-human (e.g., murine) antibodies that are certain chimeric immunoglobulins, immunoglobulin chains, or antigen-binding fragments thereof that contain minimal sequence derived from the non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from the complementarity determining regions (CDRs) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity. In some cases, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences, but are included to further refine and optimize antibody performance. Generally, a humanized antibody will comprise substantially all of at least one (typically two) variable domains in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are of a human immunoglobulin consensus sequence. A humanized antibody will optimally also comprise at least a portion of an immunoglobulin constant region or domain (Fc), typically a human immunoglobulin constant region or domain (Fc). Other forms of humanized antibodies have one or more CDRs (one, two, three, four, five or six) that have been altered with respect to the original antibody, also referred to as one or more CDRs "derived from" one or more CDRs from the original antibody. Humanized antibodies may also be affinity matured.

[0105] In some embodiments, the antibody of the present disclosure is a chimeric antibody that may contain heavy and light constant regions from a human antibody. Chimeric antibody refers to an antibody that has a variable region or a portion of a variable region from a first species and a constant region from a second species. Typically, in this chimeric antibody, the variable regions of both the light and heavy chains mimic the variable regions of an antibody from one species of mammal (e.g., non-human mammals such as mouse, rabbit, and rat), while the constant portion is homologous to a sequence in an antibody from another mammal, such as a human. In some embodiments, amino acid modifications may be made in the variable and / or constant regions.

[0106] In some embodiments, the antibodies of the present disclosure specifically bind to a target antigen, such as human PTK7. An antibody that "specifically binds" (used interchangeably herein) to a target or epitope is a term well understood in the art, and methods for determining such specific binding are also well known in the art. A molecule is said to exhibit "specific binding" if it reacts or associates more frequently, more rapidly, with a longer duration, and / or with a higher affinity with a particular target antigen than with alternative targets. An antibody "specifically binds" to a target antigen if it binds with higher affinity, with higher avidity, more rapidly, and / or with a longer duration than it binds to other substrates. For example, an antibody that specifically (or preferentially) binds to a PTK7 epitope is an antibody that binds to this PTK7 epitope with higher affinity, with higher avidity, more rapidly, and / or with a longer duration than it binds to other PTK7 epitopes or non-PTK7 epitopes. This is also understood by reading this definition, for example, that an antibody that specifically binds to a first target antigen may or may not specifically or preferentially bind to a second target antigen. Thus, "specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding. Generally, but not necessarily, reference to binding means preferential binding.

[0107] In some embodiments, the equilibrium dissociation constant (K DIn some embodiments, the K between the antibody and PTK7 is 100 pM to 1 μM. D is 1 nM to 100 nM.

[0108] Functional variants of any of the exemplary antibodies disclosed herein are also within the scope of the present disclosure. A functional variant may include mutations of one or more amino acid residues in the VH and / or VL, or in one or more of the VH CDRs and / or one or more of the VL CDRs, relative to a reference antibody, but retain substantially similar binding and biological activity (e.g., substantially similar binding affinity, binding specificity, inhibitory activity, anti-tumor activity, or a combination thereof) as the reference antibody.

[0109] In some examples, the antibodies disclosed herein comprise a VH CDR1, VH CDR2 and VH CDR3 that collectively comprise no more than 10 amino acid mutations (e.g., no more than 9, 8, 7, 6, 5, 4, 3, 2, 1 or 1 amino acid mutations) compared to the VH CDR1, VH CDR2 and VH CDR3 of a reference antibody, such as antibody A (VH: SEQ ID NO: 55; VL: SEQ ID NO: 56). "Total" means that the total number of amino acid mutations in all three VH CDRs is within a predefined range. Alternatively or in addition, the antibody may comprise a VL CDR1, VL CDR2 and VL CDR3 that collectively comprise no more than 10 amino acid mutations (e.g., no more than 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid mutations) compared to the VL CDR1, VL CDR2 and VL CDR3 of the reference antibody.

[0110] In some examples, the antibodies disclosed herein may comprise VH CDR1, VH CDR2 and VH CDR3, at least one of which comprises no more than 5 amino acid mutations (e.g., no more than 4, 3, 2 or 1 amino acid mutations) like the VH CDR of the corresponding reference antibody, such as antibody A (VH: SEQ ID NO: 55; VL: SEQ ID NO: 56). In particular examples, the antibodies comprise VH CDR3 that comprises no more than 5 amino acid mutations (e.g., no more than 4, 3, 2 or 1 amino acid mutations) like the VH CDR3 of the reference antibody, such as antibody A (VH: SEQ ID NO: 55; VL: SEQ ID NO: 56). Alternatively or in addition, the antibodies may comprise VL CDR1, VL CDR2 and VL CDR3, at least one of which comprises no more than 5 amino acid mutations (e.g., no more than 4, 3, 2 or 1 amino acid mutations) like the VL CDR of the corresponding reference antibody. In particular examples, the antibody comprises a VL CDR3 that contains no more than 5 amino acid mutations (eg, no more than 4, 3, 2 or 1 amino acid mutations) as the VL CDR3 of the reference antibody.

[0111] In some cases, the mutation of the amino acid residue may be a conservative amino acid residue substitution. As used herein, "conservative amino acid substitution" refers to an amino acid substitution that does not change the relative charge or size characteristics of the protein in which the amino acid substitution is made. Variants can be prepared according to methods for modifying polypeptide sequences known to those skilled in the art, such as those found in references that summarize such methods, for example, Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, FMAusubel, et al., eds., John Wiley & Sons, Inc., New York. Conservative amino acid substitutions include substitutions made within the following groups of amino acids: (a) A → G, S; (b) R → K, H; (c) N → Q, H; (d) D → E, N; (e) C → S, A; (f) Q → N; (g) E → D, Q; (h) G → A; (i) H → N, Q; (j) I → L, V; (k) L → I, V; (l) K → R, H; (m) M → L, I, Y; (n) F → Y, M, L; (o) P → A; (p) S → T; (q) T → S; (r) W → Y, F; (s) Y → W, F; and (t) V → I, L.

[0112] In some embodiments, an antibody disclosed herein may comprise a VH CDR that is at least 80% (e.g., 85%, 90%, 95% or 98%) identical to the VH CDR of a reference antibody, such as Antibody A (VH: SEQ ID NO:55; VL: SEQ ID NO:56). Alternatively or in addition, an antibody may comprise a VL CDR that is at least 80% (e.g., 85%, 90%, 95% or 98%) identical to the VL CDR of the reference antibody. In some embodiments, an antibody may comprise a VH that is at least 80% (e.g., 85%, 90%, 95% or 98%) identical to the VH of a reference antibody, such as Antibody A (VH: SEQ ID NO:55; VL: SEQ ID NO:56) and / or a VL that is at least 80% (e.g., 85%, 90%, 95% or 98%) identical to the VL of the reference antibody.

[0113] Donor Mold A nucleic acid encoding a CAR can be delivered to a T cell that contains what is referred to herein as a donor template (also referred to as a donor polynucleotide). The donor template can contain a non-homologous sequence, such as a nucleic acid encoding a CAR, flanked by two regions of homology that allow for efficient HDR at the genomic location of interest. In some embodiments, the region of homology can contain the nucleotide sequence of SEQ ID NO: 92 or 100. In some embodiments, the non-homologous sequence is flanked by the nucleotide sequence of SEQ ID NO: 92 and the nucleotide sequence of SEQ ID NO: 100. Alternatively, the donor template may not have a region of homology to the targeted location in the DNA and can be integrated by NHEJ-dependent end joining after cleavage at the target site.

[0114] The donor template can be single-stranded and / or double-stranded DNA or RNA, and can be introduced into cells in linear or circular form. When introduced in linear form, the ends of the donor sequence can be protected (e.g., from exonuclease degradation) by methods known to those skilled in the art. For example, one or more dideoxynucleotide residues are added to the 3' end of the linear molecule, and / or self-complementary oligonucleotides are linked to one or both ends. See, for example, Chang et al., (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al., (1996) Science 272:886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, the addition of terminal amino groups and the use of modified internucleotide linkages, such as phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues.

[0115] The donor template can be introduced into a cell as part of a vector molecule that has additional sequences such as, for example, an origin of replication, a promoter, and genes encoding antibiotic resistance. Additionally, the donor template can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or delivered by a virus (e.g., adenovirus, AAV, herpes virus, retrovirus, lentivirus, and integrase-deficient lentivirus (IDLV)).

[0116] The donor template, in some embodiments, is inserted such that its expression is driven by a native promoter at the integration site (i.e., a promoter that drives expression of the endogenous gene into which the donor is inserted). However, in some embodiments, the donor template comprises an exogenous promoter and / or enhancer (e.g., a constitutive promoter, an inducible promoter, or a tissue-specific promoter). In some embodiments, the endogenous promoter is an EF1α promoter comprising the sequence of SEQ ID NO: 101. Other promoters may be used.

[0117] Furthermore, the exogenous sequence may also include transcriptional or translational regulatory sequences (eg, promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides, and / or polyadenylation signals).

[0118] In some embodiments, the donor template comprises the nucleotide sequence of any one of SEQ ID NOs: 63, 64, 71, 78, or 91.

[0119] Delivery Methods and Constructs The nucleases and / or donor templates may be delivered using vector systems, including, but not limited to, plasmid vectors, DNA minicircles, retroviral vectors, lentiviral vectors, adenoviral vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus vectors, and combinations thereof.

[0120] Conventional viral and non-viral gene transfer methods can be used to introduce the nucleic acid encoding the nuclease and the donor template in cells (e.g., T cells). Non-viral vector delivery systems include DNA plasmids, DNA minicircles, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as liposomes or poloxamers. Viral vector delivery systems include DNA and RNA viruses that have either episomal or integrated genomes after delivery to cells.

[0121] Methods of non-viral delivery of nucleic acid include electroporation, lipofection, microinjection, gene gun, virosome, liposome, immunoliposome, polycation or lipid:nucleic acid conjugate, naked DNA, naked RNA, capped RNA, artificial virion and drug-enhanced DNA uptake.Sonoporation, for example, using the Sonitron 2000 system (Rich-Mar), can also be used to deliver nucleic acid.

[0122] Adeno-associated virus delivery Donor nucleic acid encoding a CAR construct can be delivered to cells using adeno-associated virus (AAV). AAV is a small virus that can site-specifically integrate into the host genome and thus deliver a transgene such as CAR. Inverted terminal repeats (ITRs) flank the AAV genome and / or transgene of interest and act as origins of replication. Also present in the AAV genome are rep and cap proteins that, when transcribed, form a capsid to encapsulate the AAV genome and deliver it to target cells. Surface receptors on these capsids confer serotype to AAV and determine which target organs the capsid will primarily bind to, and therefore which cells AAV will most efficiently infect. There are currently 12 known serotypes of human AAV. In some embodiments, the AAV is AAV serotype 6 (AAV6).

[0123] Adeno-associated virus is one of the most frequently used viruses for gene therapy for several reasons. First, AAV does not induce immune response when administered to mammals, including humans. Second, AAV is efficiently delivered to target cells, especially when considering to select appropriate AAV serotypes. Finally, AAV has the ability to infect both dividing and non-dividing cells, since its genome can persist in host cells without integration. This trait makes AAV an ideal candidate for gene therapy.

[0124] Homologous recombination repair (HDR) The donor nucleic acid encoding the CAR is inserted into the target gene locus by homology directed repair (HDR). Both strands of DNA at the target locus are cut by the CRISPR Cas9 enzyme. HDR then occurs to repair the double-strand break (DSB) and insert the donor DNA. For this to occur correctly, the donor sequence is designed to have adjacent residues (hereinafter "homology arms") that are complementary to the sequence surrounding the DSB site of the target gene. These homology arms act as templates for DSB repair, allowing HDR to be an essentially error-free mechanism. The rate of homology directed repair (HDR) is a function of the distance between the mutation site and the cut site, so it is important to select a target site that is overlapping or nearby. The template may contain extra sequences adjacent to the homologous region or may contain sequences that differ from the genomic sequence, allowing sequence editing.

[0125] The target gene can be related to immune response in a subject, and persistently deleting at least a part of the target gene will regulate immune response.For example, to generate CAR T cell, the target gene can be TCR alpha constant region (TRAC).The destruction of TRAC leads to the loss of function of endogenous TCR.

[0126] In some embodiments, the target gene is present at a safe harbor locus.

[0127] Engineered T cells The engineered (gene-edited) CAR T cells of the present disclosure can be autologous ("autologous") or non-autologous ("non-autologous", e.g., allogeneic, autogenic, or xenogeneic). "Autologous" refers to cells from the same subject. "Allogeneic" refers to cells that are the same species as the subject, but genetically different from the cells in the subject. In some embodiments, the T cells are obtained from a mammalian subject. In some embodiments, the T cells are obtained from a human subject.

[0128] T cells can be obtained from a number of sources, including, but not limited to, peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments, T cells can be obtained from a unit of blood collected from a subject using any number of techniques known to those of skill in the art, such as centrifugal sedimentation (e.g., FICOLL™ separation).

[0129] In some embodiments, isolated populations of T cells are used. In some embodiments, after isolation of peripheral blood mononuclear cells (PBMCs), both cytotoxic and helper T lymphocytes can be sorted into naive, memory and effector T cell subpopulations, either before or after activation, expansion and / or genetic modification.

[0130] Specific subpopulations of T cells expressing one or more of the following cell surface markers: TCRab, CD3, CD4, CD8, CD27, CD28, CD38, CD45RA, CD45RO, CD62L, CD127, CD122, CD95, CD197, CCR7, KLRG1, MCH-I protein, and / or MCH-II protein may be further isolated by positive or negative selection techniques. In some embodiments, specific subpopulations of T cells expressing one or more of the markers selected from the group consisting of TCRab, CD4, and / or CD8 are further isolated by positive or negative selection techniques. In some embodiments, the engineered T cell population does not express or does not substantially express one or more of the following markers: CD70, CD57, CD244, CD160, PD-1, CTLA4, HM3, and LAG3. In some embodiments, the subpopulations of T cells may be isolated by positive or negative selection before and / or after genetic engineering.

[0131] In some embodiments, the isolated population of T cells express one or more markers, including but not limited to, CD3+, CD4+, CD8+, or combinations thereof. In some embodiments, T cells are isolated from a subject and first activated and stimulated to proliferate in vitro before undergoing gene editing.

[0132] To achieve a sufficient therapeutic dose of a T cell composition, the T cells are often subjected to one or more rounds of stimulation, activation and / or expansion. T cells may generally be activated and expanded using methods such as those described in, for example, U.S. Patent Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; and 6,867,041. In some embodiments, the T cells are activated and expanded for about 1 to about 4 days, about 1 to about 3 days, about 1 to about 2 days, about 2 to about 3 days, about 2 to about 4 days, about 3 to about 4 days, or about 1 day, about 2 days, about 3 days, or about 4 days prior to introduction of the genome editing composition into the T cells.

[0133] In some embodiments, the T cells are activated and expanded for about 4 hours, about 6 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours prior to introduction of the gene editing composition into the T cells.

[0134] In some embodiments, the T cells are activated at the same time that the genome editing composition is introduced into the T cells.

[0135] Also provided are populations of engineered T cells described herein. In some embodiments, at least 25%-100% of the engineered T cells of the population express a CAR. In some embodiments, at least 25% or at least 50% of the engineered T cells of the population express a CAR. In some embodiments, at least 70% of the engineered T cells of the population express a CAR. In some embodiments, at least 25% of the engineered T cells of the population express a CAR after in vitro expansion for at least 7 days or at least 14 days.

[0136] Treatment methods and compositions Provided herein, in some embodiments, is a method of treating cancer (e.g., solid tumors). Non-limiting examples of solid tumors that can be treated as described herein include pancreatic cancer, gastric cancer, ovarian cancer, uterine cancer, breast cancer, prostate cancer, testicular cancer, thyroid cancer, nasopharyngeal cancer, non-small cell lung (NSCLC), glioblastoma, neuronal, soft tissue sarcoma, and / or melanoma. In some embodiments, the cancer is selected from the group consisting of pancreatic cancer, gastric cancer, ovarian cancer, uterine cancer, breast cancer, prostate cancer, testicular cancer, thyroid cancer, nasopharyngeal cancer, non-small cell lung (NSCLC), glioblastoma, neuronal, soft tissue sarcoma, leukemia, lymphoma, melanoma, colon cancer, colon adenocarcinoma, brain glioblastoma, hepatocellular carcinoma, hepatic cholangiocarcinoma, osteosarcoma, gastric cancer, esophageal squamous cell carcinoma, advanced stage pancreatic cancer, lung adenocarcinoma, lung squamous cell carcinoma, small cell lung carcinoma, renal carcinoma, and intrahepatic biliary tract carcinoma. In some embodiments, the method includes delivering a CAR T cell of the present disclosure (e.g., an anti-Ptk7 CAR T cell) to a subject having cancer (e.g., a solid tumor), including pancreatic, gastric, ovarian, cervical, breast, prostate, testicular, thyroid, nasopharyngeal, non-small cell lung (NSCLC), glioblastoma, and / or melanoma. In some embodiments, the method includes delivering a CAT T cell of the present disclosure (e.g., an anti-PTK7 CAR T cell) to a subject having leukemia or lymphoma (e.g., T cell, B cell, NK cell, dendritic cell leukemia or lymphoma). Non-limiting examples of leukemia include acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), and chronic myeloid leukemia (CML).

[0137] The administering step may include placement (e.g., transplantation) of the cells (e.g., engineered T cells) into a subject by a method or route that results in at least partial localization of the introduced cells at a desired site, such as a tumor, to produce a desired effect. The engineered T cells may be administered by any suitable route that results in delivery to a desired location in the subject where at least a portion of the transplanted cells or components of the cells remain viable. The survival period of the cells after administration to the subject may be as short as a few hours (e.g., 24 hours) to days, years, or even the lifespan of the subject (i.e., long-term engraftment). For example, in some embodiments described herein, an effective amount of the engineered T cells is administered via a systemic route of administration, such as an intraperitoneal or intravenous route.

[0138] The subject can be any subject for whom diagnosis, treatment or therapy is desired. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0139] A donor is an individual who is not the subject being treated. A donor is an individual who is not the patient. In some embodiments, a donor is an individual who does not have or is not suspected of having the cancer being treated. In some embodiments, multiple donors (e.g., two or more donors) are used.

[0140] In some embodiments, the engineered T cell population administered according to the methods described herein comprises allogeneic T cells obtained from one or more donors. Allogeneic refers to cells, cell populations, or biological samples that contain cells obtained from one or more different donors of the same species that are not genetically identical to the recipient at one or more loci. For example, the engineered T cell population administered to the subject may be derived from one or more unrelated donors or one or more non-identical siblings. In some embodiments, an isogeneic cell population may be used, such as one obtained from a genetically identical donor (e.g., identical twins). In some embodiments, the cells are autologous, i.e., the engineered T cells are obtained or isolated from the subject and administered to the same subject, i.e., the donor and recipient are the same.

[0141] In some embodiments, the engineered T cell population administered according to the methods described herein does not induce toxicity in a subject, e.g., the engineered T cells do not induce toxicity in non-cancer cells, hi some embodiments, the engineered T cell population administered does not induce complement-mediated lysis or stimulate antibody-dependent cell-mediated cytotoxicity (ADCC).

[0142] An effective amount refers to the amount of a population of engineered T cells required to prevent or reduce at least one or more signs or symptoms of a medical condition (e.g., cancer), and refers to an amount of a composition sufficient to produce a desired effect (e.g., to treat a subject with a medical condition). Effective amounts also include an amount sufficient to prevent or delay the onset of a disease symptom, alter the course of a disease symptom (e.g., but not limited to, slow the progression of a disease symptom), or reverse a disease symptom. It is understood that for any given case, the appropriate effective amount can be determined by one of ordinary skill in the art using routine experimentation.

[0143] For use in the various embodiments described herein, an effective amount of cells (e.g., engineered T cells) is at least 10 2cells, at least 5 x 10 2 cells, at least 10 3 cells, at least 5 x 10 3 cells, at least 10 4 cells, at least 5 x 10 4 cells, at least 10 5 cells, at least 2 x 10 5 cells, at least 3 x 10 5 cells, at least 4 x 10 5 cells, at least 5 x 10 5 cells, at least 6 x 10 5 cells, at least 7 x 10 5 cells, at least 8 x 10 5 cells, at least 9 x 10 5 cells, at least 1 x 10 6 cells, at least 2 x 10 6 cells, at least 3 x 10 6 cells, at least 4 x 10 6 cells, at least 5 x 10 6 cells, at least 6 x 10 6 cells, at least 7 x 10 6 cells, at least 8 x 10 6 cells, at least 9 x 10 6 The present invention includes a method for the preparation of a human ovarian tumor cell, comprising administering to a subject in need thereof, a human ovarian tumor cell, or a combination thereof. The cells may be derived from one or more donors or may be obtained from an autologous source. In some examples described herein, the cells are expanded in culture prior to administration to a subject in need thereof.

[0144] The mode of administration includes injection, infusion, eye drop or oral ingestion.Injection includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intraarticular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal and intrasternal injection and infusion.In some embodiments, the route is intravenous.

[0145] In some embodiments, the engineered T cells are administered systemically, which refers to the administration of a population of cells not directly to a target site, tissue or organ, but instead such that they enter the subject's circulatory system and are thereby subject to metabolic and other similar processes.

[0146] The efficacy of a treatment, including a composition for the treatment of a medical condition, can be determined by a skilled clinician. A treatment is considered to be "effective treatment" if, by way of example, the level of a functional target of any one or all signs or symptoms is altered in a favorable manner (e.g., increased by at least 10%) or other clinically recognized symptoms or markers of a disease (e.g., cancer) are improved or alleviated. Efficacy can also be measured by the subject not getting worse (e.g., the progression of the disease is stopped or at least slowed) as assessed by the need for hospitalization or medical intervention. Methods for measuring these indicators are known to those skilled in the art and / or described herein. Treatment includes any treatment of a disease in a subject, and includes (1) inhibiting the disease, e.g., stopping or slowing the progression of a symptom; or (2) relieving the disease, e.g., causing regression of a symptom; and (3) preventing or reducing the likelihood of the onset of a symptom.

[0147] The present disclosure is illustrated by the following embodiments.

[0148] Embodiment 1. An engineered T cell comprising a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an ectodomain that specifically binds to PTK7.

[0149] Embodiment 2. The engineered T cell of embodiment 1, further comprising a disrupted T cell receptor alpha chain constant region (TRAC) gene.

[0150] Embodiment 3. The engineered T cell of embodiment 2, wherein a nucleic acid encoding a CAR is inserted into a disrupted TRAC gene.

[0151] Embodiment 4. The engineered T cell of any one of embodiments 1 to 3, further comprising a disrupted beta-2-microglobulin (β2M) gene.

[0152] Embodiment 5. The engineered T cell of any one of embodiments 1 to 4, wherein the ectodomain of the CAR comprises an anti-PTK7 antibody.

[0153] Embodiment 6 The engineered T cell of embodiment 5, wherein the anti-PTK7 antibody is an anti-PTK7 single chain variable fragment (scFv).

[0154] Embodiment 7. The engineered T cell of embodiment 6, wherein the anti-PTK7 scFv comprises the same heavy chain variable domain (VH) complementarity determining regions (CDRs) and the same light chain variable domain (VL) CDRs as a reference antibody, the reference antibody comprising (i) a VH set forth in SEQ ID NO: 55 and a VL set forth in SEQ ID NO: 56, (ii) a VH set forth in SEQ ID NO: 69 and a VL set forth in SEQ ID NO: 70, (iii) a VH set forth in SEQ ID NO: 76 and a VL set forth in SEQ ID NO: 77, or (iv) a VH set forth in SEQ ID NO: 83 and a VL set forth in SEQ ID NO: 84.

[0155] Embodiment 8. The engineered T cell of embodiment 7, wherein the anti-PTK7 scFv comprises the same VH and VL chains as the reference antibody.

[0156] Embodiment 9. The engineered T cell of embodiment 7, wherein the anti-PTK7 scFv comprises the amino acid sequence of any one of SEQ ID NOs: 54, 68, 75 or 82.

[0157] Embodiment 10. The engineered T cell of any one of embodiments 1 to 9, wherein the CAR comprises a CD28 costimulatory domain or a 41BB costimulatory domain.

[0158] Embodiment 11. The engineered T cell of embodiment 10, wherein the CAR further comprises a CD3ζ cytoplasmic signaling domain.

[0159] Embodiment 12. The engineered T cell of any one of embodiments 3 to 11, wherein the TRAC gene comprises a nucleotide sequence encoding the LHA and / or RHA within any one of SEQ ID NOs: 63, 64, 71, 78 or 91, or the nucleotide sequence of SEQ ID NO: 92 or 100, and / or the CAR is encoded by the nucleotide sequence of any one of SEQ ID NOs: 49, 51, 65, 72, 79 or 112.

[0160] Embodiment 13. The engineered T cell of any one of embodiments 4 to 12, wherein the disrupted β2M gene comprises at least one nucleotide sequence selected from any one of SEQ ID NOs: 9 to 14.

[0161] Embodiment 14. A population of engineered T cells according to any one of embodiments 1 to 13, wherein at least 25% or at least 50% of the engineered T cells of the population express a CAR.

[0162] Embodiment 15. The population of embodiment 14, wherein at least 70% of the engineered T cells of the population express a CAR.

[0163] Embodiment 16. The population of embodiment 14 or 15, wherein at least 25% of the engineered T cells of the population express the CAR after in vitro expansion for at least 7 days or at least 14 days.

[0164] Embodiment 17. A population according to any one of embodiments 14 to 16, wherein at least 50% of the engineered T cells of the population do not express detectable levels of T cell receptor (TCR) protein.

[0165] Embodiment 18. The population of embodiment 17, wherein at least 90% of the engineered T cells of the population do not express detectable levels of TCR protein.

[0166] Embodiment 19. A population according to any one of embodiments 14 to 18, wherein at least 50% of the engineered T cells of the population do not express detectable levels of β2M protein.

[0167] Embodiment 20. The population of embodiment 19, wherein at least 70% of the engineered T cells of the population do not express detectable levels of β2M protein.

[0168] Embodiment 21. The population of any one of embodiments 14-20, wherein the engineered T cells of the population, when co-cultured in vitro with a population of cancer cells expressing PTK7, induce cytolysis of at least 10%, at least 25%, or at least 50% of the cancer cells of the population.

[0169] Embodiment 22. The population of embodiment 21, wherein the engineered T cells of the population induce cytolysis of at least 70%, at least 80%, or at least 90% of the population of cancer cells when co-cultured in vitro with a population of cancer cells that express PTK7.

[0170] Embodiment 23. The population of embodiment 21 or 22, wherein the engineered T cells of the population secrete IFNγ when co-cultured in vitro with the population of cancer cells.

[0171] Embodiment 24. The population of any one of embodiments 21 to 23, wherein the ratio of engineered T cells to cancer cells is 1:1 to 2:1.

[0172] Embodiment 25. The population of any one of embodiments 21 to 24, wherein the cancer cells comprise sarcoma cells.

[0173] Embodiment 26. The population of any one of embodiments 21 to 24, wherein the cancer cells comprise breast cancer cells, ovarian cancer cells, small cell lung cancer cells and / or colon cancer cells.

[0174] Embodiment 28. The population according to any one of embodiments 14 to 27, which, when administered in vivo to a subject, does not induce toxicity in the subject.

[0175] Embodiment 29. A method comprising administering to a subject a population of engineered T cells according to any one of embodiments 14 to 28.

[0176] Embodiment 30. The method of embodiment 29, wherein the subject is a human subject.

[0177] Embodiment 31. The method of embodiment 30, wherein the subject has cancer.

[0178] Embodiment 32. The method of embodiment 31, wherein the cancer is selected from the group consisting of pancreatic cancer, gastric cancer, ovarian cancer, uterine cancer, breast cancer, prostate cancer, testicular cancer, thyroid cancer, nasopharyngeal cancer, non-small cell lung cancer (NSCLC), glioblastoma, neuronal, soft tissue sarcoma, leukemia, lymphoma, melanoma, colon cancer, colon adenocarcinoma, brain glioblastoma, hepatocellular carcinoma, hepatocholangiocarcinoma, osteosarcoma, gastric cancer, esophageal squamous cell carcinoma, advanced stage pancreatic cancer, lung adenocarcinoma, lung squamous cell carcinoma, small cell lung cancer, renal cancer and intrahepatic biliary tract cancer.

[0179] Embodiment 33 The method of embodiment 31 or 32, wherein the cancer comprises cancer cells that express PTK7.

[0180] Embodiment 34. A method of generating an engineered T cell comprising: (a) delivering to a T cell a vector comprising an RNA-guided nuclease, a gRNA targeting the TRAC gene, and a donor template comprising a nucleic acid encoding a CAR comprising an ectodomain that specifically binds to PTK7; and (b) generating an engineered T cell that has a disrupted TRAC gene and expresses the CAR.

[0181] Embodiment 35. The method of embodiment 34, wherein the gRNA targeting the TRAC gene comprises the nucleotide sequence of SEQ ID NO: 18 or 19, or targets the nucleotide sequence of SEQ ID NO: 40.

[0182] Embodiment 36 The method of embodiment 34 or 35, wherein the nucleic acid encoding the CAR is flanked by left and right homology arms to the TRAC gene.

[0183] Embodiment 37. The method of any one of embodiments 34 to 36, further comprising delivering to the T cell a gRNA targeting the β2M gene.

[0184] Embodiment 38. The method of embodiment 37, wherein the gRNA targeting the β2M gene comprises the nucleotide sequence of SEQ ID NO: 20 or 21, or targets the nucleotide sequence of SEQ ID NO: 41.

[0185] Embodiment 39. The method of any one of embodiments 34 to 38, wherein the RNA-guided nuclease is a Cas9 nuclease, optionally a S. pyogenes Cas9 nuclease.

[0186] Embodiment 40. The method of any one of embodiments 34 to 39, wherein the ectodomain of the CAR is an anti-PTK7 antibody.

[0187] Embodiment 41 The method of embodiment 40, wherein the anti-PTK7 antibody is an anti-PTK7 single chain variable fragment (scFv).

[0188] Embodiment 42. The method of embodiment 41, wherein the anti-PTK7 scFv comprises the same heavy chain variable domain (VH) complementarity determining regions (CDRs) and the same light chain variable domain (VL) CDRs as a reference antibody, the reference antibody comprising (i) a VH set forth in SEQ ID NO: 55 and a VL set forth in SEQ ID NO: 56, (ii) a VH set forth in SEQ ID NO: 69 and a VL set forth in SEQ ID NO: 70, (iii) a VH set forth in SEQ ID NO: 76 and a VL set forth in SEQ ID NO: 77, or (iv) a VH set forth in SEQ ID NO: 83 and a VL set forth in SEQ ID NO: 84.

[0189] Embodiment 43 The method of embodiment 42, wherein the anti-PTK7 scFv comprises the same VH and VL chains as the reference antibody.

[0190] Embodiment 44 The method of embodiment 42, wherein the anti-PTK7 scFv comprises the amino acid sequence of any one of SEQ ID NOs: 54, 68, 75, or 82.

[0191] Embodiment 45. The method of any one of embodiments 34 to 44, wherein the CAR comprises a CD28 costimulatory domain or a 41BB costimulatory domain.

[0192] Embodiment 46 The method of embodiment 45, wherein the CAR further comprises a CD3ζ cytoplasmic signaling domain.

[0193] Embodiment 47. The method of any one of embodiments 34 to 46, wherein the donor template comprises the nucleotide sequence of any one of SEQ ID NOs: 63, 64, 71, 78 or 91.

[0194] Embodiment 48. The method of any one of embodiments 34 to 47, wherein the CAR is encoded by a nucleotide sequence of any one of SEQ ID NOs: 49, 51, 65, 72, 79 or 112.

[0195] The present disclosure is further illustrated by the following embodiments.

[0196] Embodiment A1. An engineered T cell comprising a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an ectodomain that specifically binds to PTK7.

[0197] Embodiment A2. The engineered T cell of embodiment A1, further comprising a disrupted T cell receptor alpha chain constant region (TRAC) gene.

[0198] Embodiment A3. The engineered T cell of embodiment A1 or A2, further comprising a disrupted beta-2-microglobulin (β2M) gene.

[0199] Embodiment A4. An engineered T cell according to any one of embodiments A1 to A3, wherein the ectodomain of the CAR comprises an anti-PTK7 antibody.

[0200] Embodiment A5. The engineered T cell of embodiment A4, wherein the anti-PTK7 antibody is an anti-PTK7 single chain variable fragment (scFv).

[0201] Embodiment A6. The engineered T cell of embodiment A5, wherein the anti-PTK7 scFv comprises the same heavy chain variable domain (VH) complementarity determining regions (CDRs) and the same light chain variable domain (VL) CDRs as a reference antibody, the reference antibody comprising (i) a VH set forth in SEQ ID NO: 55 and a VL set forth in SEQ ID NO: 56, (ii) a VH set forth in SEQ ID NO: 69 and a VL set forth in SEQ ID NO: 70, (iii) a VH set forth in SEQ ID NO: 76 and a VL set forth in SEQ ID NO: 77, or (iv) a VH set forth in SEQ ID NO: 83 and a VL set forth in SEQ ID NO: 84.

[0202] Embodiment A7. The engineered T cell of embodiment A6, wherein the anti-PTK7 scFv comprises the same VH and VL chains as the reference antibody.

[0203] Embodiment A8. The engineered T cell of embodiment A6, wherein the anti-PTK7 scFv comprises the amino acid sequence of any one of SEQ ID NOs: 54, 68, 75 or 82.

[0204] Embodiment A9. An engineered T cell according to any one of embodiments A1 to A8, wherein the CAR further comprises a CD28 costimulatory domain or a 41BB costimulatory domain.

[0205] Embodiment A10. The engineered T cell of embodiment A9, wherein the CAR further comprises a CD3ζ cytoplasmic signaling domain.

[0206] Embodiment A11. An engineered T cell according to any one of embodiments A1 to A10, wherein the CAR is encoded by a nucleotide sequence comprising the nucleotide sequence of any one of SEQ ID NOs: 49, 51, 65, 72, 79 or 112, or a nucleic acid sequence that is at least 90% identical to SEQ ID NOs: 49, 51, 65, 72, 79 or 112.

[0207] Embodiment A12. The engineered T cell of any one of embodiments A1 to A11, wherein the nucleic acid encoding the CAR is inserted into the disrupted TRAC gene.

[0208] Embodiment A13. The engineered T cell of any one of embodiments A2 to A12, wherein the disrupted TRAC gene comprises a nucleotide sequence encoding an LHA and / or an RHA within any one of SEQ ID NOs: 63, 64, 71, 78 or 91, a nucleotide sequence of SEQ ID NO: 92 or 100, and / or a nucleotide sequence of any one of SEQ ID NOs: 63, 64, 71, 78 or 91.

[0209] Embodiment A14. The engineered T cell of any one of embodiments A1-A13, wherein the disrupted β2M gene comprises at least one nucleotide sequence selected from any one of SEQ ID NOs: 9-14.

[0210] Embodiment A15. An engineered T cell comprising: (i) a disrupted TRAC gene; (ii) a disrupted β2M gene; and (iii) a nucleic acid encoding a CAR comprising an anti-PTK7 antigen-binding fragment.

[0211] Embodiment A16. An engineered T cell according to embodiment A15, wherein the CAR comprises (a) an ectodomain comprising an anti-PTK7 antigen-binding fragment, (b) a CD8 transmembrane domain, and (c) an endodomain comprising a CD28 costimulatory domain and a CD3 zeta cytoplasmic signaling domain.

[0212] Embodiment A17. The engineered T cell of embodiment A15 or A16, wherein the disrupted TRAC gene comprises a nucleic acid encoding a CAR.

[0213] Embodiment A18. An engineered T cell comprising: (i) a disrupted TRAC gene, the disrupted TRAC gene comprising a nucleic acid encoding a CAR comprising (a) an ectodomain comprising an anti-PTK7 antigen-binding fragment, (b) a CD8 transmembrane domain, and (c) an endodomain comprising a CD28 costimulatory domain and a CD3 zeta cytoplasmic signaling domain; and (ii) a disrupted β2M gene.

[0214] Embodiment A19. An engineered T cell comprising: (i) a disrupted TRAC gene, the disrupted TRAC gene comprising a nucleic acid encoding a CAR comprising the amino acid sequence of any one of SEQ ID NOs: 50, 52, 66, 73, or 80; and (ii) a disrupted β2M gene.

[0215] Embodiment A20. An engineered T cell comprising: (i) a disrupted TRAC gene, wherein the disrupted TRAC gene comprises a nucleic acid encoding a CAR, wherein the nucleic acid sequence is at least 90% identical to SEQ ID NO: 49, 51, 65, 72, 79, or 112, and encodes a CAR comprising the amino acid sequence of SEQ ID NO: 50, 52, 66, 73, or 80; and (ii) a disrupted β2M gene.

[0216] Embodiment A21. The engineered T cell of any one of embodiments A1-A20, which is a human T cell.

[0217] Embodiment A22. A population of cells comprising an engineered T cell of any one of embodiments A1-A21, wherein at least 25% or at least 50% of the engineered T cells of the population express a CAR.

[0218] Embodiment A23. The population of embodiment A22, wherein at least 70% of the engineered T cells of the population express a CAR.

[0219] Embodiment A24. The population of embodiment A22, wherein at least 25% of the engineered T cells of the population express the CAR after at least 7 days or at least 14 days of in vitro expansion.

[0220] Embodiment A25. A population of any one of embodiments A22-A24, wherein at least 50% of the engineered T cells of the population do not express detectable levels of T cell receptor (TCR) protein.

[0221] Embodiment A26. The population of embodiment A25, wherein at least 90% of the engineered T cells of the population do not express detectable levels of TCR protein.

[0222] Embodiment A27. A population according to any one of embodiments A22 to A26, wherein at least 50% of the engineered T cells of the population do not express detectable levels of β2M protein.

[0223] Embodiment A28. The population of embodiment A27, wherein at least 70% of the engineered T cells of the population do not express detectable levels of β2M protein.

[0224] Embodiment A29. The population of any one of embodiments A22-A28, wherein the engineered T cells of the population, when co-cultured in vitro with a population of cancer cells expressing PTK7, induce cytolysis of at least 10%, at least 25%, or at least 50% of the cancer cells of the population.

[0225] Embodiment A30. The population of embodiment A29, wherein the engineered T cells of the population induce cytolysis of at least 70%, at least 80%, or at least 90% of the population of cancer cells when co-cultured in vitro with a population of cancer cells that express PTK7.

[0226] Embodiment A31. The population of embodiment A29 or A30, wherein the engineered T cells of the population secrete IFNγ when co-cultured in vitro with the population of cancer cells.

[0227] Embodiment A32. The population of any one of embodiments A29 to A31, wherein the ratio of engineered T cells to cancer cells is 1:1 to 2:1.

[0228] Embodiment A33. The population of any one of embodiments A29-A32, wherein the cancer cells comprise sarcoma cells.

[0229] Embodiment A34. The population of any one of embodiments A29-3A2, wherein the cancer cells comprise breast cancer cells, ovarian cancer cells, small cell lung cancer cells and / or colon cancer cells.

[0230] Embodiment A35. A population according to any one of embodiments A22-A34, which when administered to a subject in vivo does not induce toxicity in the subject.

[0231] Embodiment A36. A population of cells comprising engineered T cells, the engineered T cells comprising: (i) a disrupted TRAC gene; (ii) a disrupted β2M gene; and (iii) a nucleic acid encoding a CAR comprising an anti-PTK7 antigen-binding fragment.

[0232] Embodiment A37. A population of cells described in embodiment 36, wherein the CAR comprises (a) an external domain comprising an anti-PTK7 antigen-binding fragment, (b) a CD8 transmembrane domain, and (c) an internal domain comprising a CD28 costimulatory domain and a CD3 zeta cytoplasmic signaling domain.

[0233] Embodiment A38. The population of cells of embodiment A36 or A37, wherein the disrupted TRAC gene comprises a nucleic acid encoding a CAR.

[0234] Embodiment A39. A population of cells comprising engineered T cells, the engineered T cells comprising: (i) a disrupted TRAC gene comprising a nucleic acid encoding a CAR comprising: (a) an ectodomain comprising an anti-PTK7 antigen-binding fragment, (b) a CD8 transmembrane domain, and (c) an endodomain comprising a CD28 costimulatory domain and a CD3 zeta cytoplasmic signaling domain; and (ii) a disrupted β2M gene.

[0235] Embodiment A40. A population of cells comprising engineered T cells, the engineered T cells comprising: (i) a disrupted TRAC gene, wherein the engineered T cells comprise a nucleic acid encoding a CAR, wherein the nucleic acid sequence is at least 90% identical to SEQ ID NO: 49, 51, 65, 72, 79, or 112, and encodes a CAR of SEQ ID NO: 50, 52, 66, 73, or 80; and (ii) a disrupted β2M gene.

[0236] Embodiment A41. A method comprising administering to a subject a population of engineered T cells according to any one of embodiments A22 to A40.

[0237] Embodiment A42. The method of embodiment 41, wherein the subject is a human subject.

[0238] Embodiment A43. The method of embodiment A42, wherein the subject has cancer.

[0239] The method of embodiment A43, wherein the cancer is selected from the group consisting of pancreatic cancer, gastric cancer, ovarian cancer, uterine cancer, breast cancer, prostate cancer, testicular cancer, thyroid cancer, nasopharyngeal cancer, non-small cell lung cancer (NSCLC), glioblastoma, neuronal, soft tissue sarcoma, leukemia, lymphoma, melanoma, colon cancer, colon adenocarcinoma, brain glioblastoma, hepatocellular carcinoma, hepatocholangiocarcinoma, osteosarcoma, gastric cancer, esophageal squamous cell carcinoma, advanced stage pancreatic cancer, lung adenocarcinoma, lung squamous cell carcinoma, small cell lung carcinoma, renal carcinoma, and intrahepatic biliary tract carcinoma.

[0240] Embodiment A45. The method of embodiment A43 or A44, wherein the cancer comprises cancer cells that express PTK7.

[0241] Embodiment A46. A method of generating an engineered T cell comprising: (a) delivering to a T cell (i) an RNA-guided nuclease; (ii) a gRNA targeting the TRAC gene; and (iii) a vector comprising a donor template comprising a nucleic acid encoding a CAR comprising an ectodomain that specifically binds to PTK7; and (b) generating an engineered T cell that has a disrupted TRAC gene and expresses the CAR.

[0242] The method of embodiment A46, wherein the gRNA targeting the TRAC gene comprises the nucleotide sequence of SEQ ID NO: 18 or 19, or targets the nucleotide sequence of SEQ ID NO: 40.

[0243] The method of embodiment A46 or A47, further comprising delivering to the T cell a gRNA targeting the β2M gene.

[0244] The method of embodiment A48, wherein the gRNA targeting the β2M gene comprises the nucleotide sequence of SEQ ID NO: 20 or 21, or targets the nucleotide sequence of SEQ ID NO: 41.

[0245] The method of any one of embodiments A46 to A49, wherein the ectodomain of the CAR comprises an anti-PTK7 antibody.

[0246] The method of embodiment A50, wherein the anti-PTK7 antibody is an anti-PTK7 single chain variable fragment (scFv).

[0247] The method of embodiment A51, wherein the anti-PTK7 scFv comprises the same heavy chain variable domain (VH) complementarity determining regions (CDRs) and the same light chain variable domain (VL) CDRs as a reference antibody, the reference antibody comprising (i) a VH set forth in SEQ ID NO: 55 and a VL set forth in SEQ ID NO: 56, (ii) a VH set forth in SEQ ID NO: 69 and a VL set forth in SEQ ID NO: 70, (iii) a VH set forth in SEQ ID NO: 76 and a VL set forth in SEQ ID NO: 77, or (iv) a VH set forth in SEQ ID NO: 83 and a VL set forth in SEQ ID NO: 84.

[0248] Embodiment A53. The method of embodiment A52, wherein the anti-PTK7 scFv comprises the same VH and VL chains as the reference antibody.

[0249] The method of embodiment A52, wherein the anti-PTK7 scFv comprises the amino acid sequence of any one of SEQ ID NOs: 54, 68, 75 or 82.

[0250] The method of any one of embodiments A46 to A54, wherein the CAR further comprises a CD28 costimulatory domain or a 41BB costimulatory domain.

[0251] The method of embodiment A55, wherein the CAR further comprises a CD3 zeta cytoplasmic signaling domain.

[0252] The method of any one of embodiments A46 to A56, wherein the CAR is encoded by a nucleotide sequence comprising the nucleotide sequence of any one of SEQ ID NOs: 49, 51, 65, 72, 79 or 112, or a nucleic acid sequence that is at least 90% identical to SEQ ID NOs: 49, 51, 65, 72, 79 or 112.

[0253] Embodiment A58. The method of any one of embodiments A46 to A57, wherein the nucleic acid encoding the CAR is flanked by left and right homology arms to the TRAC gene.

[0254] The method of any one of embodiments A46 to A58, wherein the donor template comprises the nucleotide sequence of any one of SEQ ID NOs: 63, 64, 71, 78 or 91.

[0255] Embodiment A60. The method of any one of embodiments A46 to A59, wherein the RNA-guided nuclease is a Cas9 nuclease, optionally a S. pyogenes Cas9 nuclease.

[0256] Embodiment A61. An engineered T cell produced by a method according to any one of embodiments A46 to A60.

[0257] Embodiment A62. A population of cells comprising the engineered T cells of embodiment A61.

[0258] Embodiment A63. A method of treating cancer in a subject comprising administering to the subject a population of cells according to any one of embodiments A22-A40 or embodiment A62.

[0259] The method of embodiment A63, wherein the cancer is selected from the group consisting of pancreatic cancer, gastric cancer, ovarian cancer, uterine cancer, breast cancer, prostate cancer, testicular cancer, thyroid cancer, nasopharyngeal cancer, non-small cell lung cancer (NSCLC), glioblastoma, neuronal, soft tissue sarcoma, leukemia, lymphoma, melanoma, colon cancer, colon adenocarcinoma, brain glioblastoma, hepatocellular carcinoma, hepatocholangiocarcinoma, osteosarcoma, gastric cancer, esophageal squamous cell carcinoma, advanced stage pancreatic cancer, lung adenocarcinoma, lung squamous cell carcinoma, small cell lung carcinoma, renal carcinoma, and intrahepatic biliary tract carcinoma.

[0260] Embodiment A65. The method of embodiment A63 or A64, wherein the cancer comprises cancer cells that express PTK7. EXAMPLES

[0261] Example 1. PTK7 expression in normal human tissues PTK7 expression was assessed in a frozen normal human tissue panel (FDA Standard, Biochain) using a custom recombinant monoclonal biotinylated antibody (CTX181 mAb, Creative Biolabs, 1 mg / ml, SEQ ID NO: 108 and SEQ ID NO: 109) specific for the PTK7 CAR construct or a biotinylated mouse isotype control (Novus, NBP2-21948). Slides were fixed with acetone at -20°C for 10 minutes at ambient temperature, followed by manual immunohistochemical staining at ambient temperature. Blocking to minimize non-specific staining was performed in sequential steps with Peroxidased 1, Avidin and Biotin and Background Sniper (BioCare Medical, PX968M, AB972L, BS966M). Slides were stained with biotinylated CTX181 primary monoclonal antibody (1:600) for 30 min, followed by incubation with 4plus Streptavidin-HRP Label (BioCare Medical) reagent for 15 min each. Target antigens were visualized with DAB (brown) substrate chromogen (Dako, K3468). Mayer's Hematoxylin (Dako, S3309) was used to counterstain cell nuclei. Figure 1 shows that PTK7 was not widely expressed in normal human tissues.

[0262] CTX181 mAb sequence: >181_HC (SEQ ID NO: 108) [ka] >181_LC (SEQ ID NO: 109) [ka]

[0263] Example 2. PTK7 Expression in Diseased Human Tissues PTK7 expression was assessed in formalin-fixed paraffin-embedded (FFPE) diseased and normal patient tumor microarrays (Figures 2A and 2B) using mouse monoclonal anti-human PTK7 antibody, clone 4F9 (EMD Millipore, MABN721). Table 6 lists the FFPE tissue microarrays (TMA) used from US Biomax, Inc. FFPE sections were baked at 60°C for 30 min, deparaffinized and rehydrated. Antigen retrieval was performed in 1× Reveal Decloaker solution at 95°C for 40 min using a Decloaker chamber (BioCare Medical). The remaining steps were performed at ambient temperature. Blocking to minimize nonspecific staining was performed with Peroxidased 1 (BioCare Medical, PX968M) and Background Sniper (BioCare Medical, BS966M). Slides were stained with primary monoclonal anti-PTK7 antibody or mouse IgG isotype control (Novus Biologicals, LLC) for 60 min, washed, and then stained with secondary EnVision goat anti-mouse horseradish peroxidase antibody (Dako, K400111-2) for 30 min. Target antigens were visualized with DAB (brown) substrate chromogen (Dako, K3468). Cell nuclei were counterstained using Mayer's Hematoxylin (Dako, S3309). Slides were scanned with a Pannoramic MIDI II scanner (3DHistech, ThermoFisher Scientific) and scored using a semiquantitative scoring system that assesses both staining intensity (1+ to 3+, with 1+ representing low antigen expression) and the percentage of sections stained (1 to 100%). Results were tabulated to establish summary data of patient prevalence (Figure 3). PTK7 was found to be expressed in a wide range of solid tumor cancers.

[0264] [Table 6]

[0265] Example 3. Human / Mouse Cross-Reactivity of Anti-PTK7 CTX181 To assess the cross-species reactivity of the custom CTX181 antibody, the binding affinity of the antibody was evaluated in the mouse 3T3L1 fibroblast cell line and the mouse M158 breast cancer cell line and compared to the binding affinity of the antibody in the human Saos2 (osteosarcoma), A498 (renal carcinoma), and HCC70 (breast cancer) cell lines. For each cell line, a dose titration binding assay (200 nM to 0.0032 nM final CTX181 antibody) was performed using 2 × 10 6 A 100% ELISA was performed on 1000 cells. Cells were stained with CTX181 antibody for 30 min on ice, followed by washing and staining with a secondary APC fluorophore-conjugated human IgG-Fc antibody for 15 min at RT. Cells were assessed for staining on a Novocyte flow cytometer (Acea Biosciences). Figure 4 shows comparable binding affinity of CTX181 antibody on mouse and human cell lines.

[0266] Example 4. PTK7 expression in normal human and mouse tissues PTK7 expression was assessed in a frozen normal mouse tissue panel (FDA Standard, Biochain; Figure 5A and Figure 5B) and a frozen mouse embryo development array (Zyagen; Figure 6) using CTX181 specific for the PTK7 CAR construct or a biotinylated mouse isotype control (Novus, NBP2-21948). Slides were fixed with -20°C acetone for 10 min at ambient temperature, followed by manual immunohistochemical staining at ambient temperature. Blocking to minimize non-specific staining was performed in sequential steps with Peroxidased 1, Avidin and Biotin and Background Sniper (BioCare Medical, PX968M, AB972L, BS966M). Slides were stained with biotinylated CTX181 primary monoclonal antibody (1:300 for human; 1:600 ​​for mouse) for 30 min, followed by incubation with 4plus Streptavidin-HRP Label (BioCare Medical) reagent for 15 min each. Target antigens were visualized with DAB (brown) substrate chromogen (Dako, K3468). Cell nuclei were counterstained using Mayer's Hematoxylin (Dako, S3309).

[0267] Example 5. TRAC - / β2M - / Anti-PTK7 CAR + Generation of T cells This example illustrates a mouse model lacking expression of the T cell receptor (TCR) gene (TCR alpha constitutive (TRAC) region edited gene), the β2-microglobulin (β2M) gene, and lacking expression of the protein tyrosine kinase 7 (PTK7) and PTK7 + We describe the generation of allogeneic human T cells expressing cancer-targeting chimeric antigen receptors (CARs). Four unique anti-PTK7 CARs (PTK7-4, PTK7-7, PTK7-13, and PTK7-17) containing a CD28 costimulatory domain were submitted to TRAC for experimentation and evaluation. - / β2M -They were expressed separately in T cells. PTK7-4 (PTK7-4b) was also generated with a 41BB costimulatory domain instead of CD28. Table 7 lists the PTK7 CAR structure. Table 11 lists the sequences of the PTK7 CAR components. Table 12 lists the donor components.

[0268] [Table 7]

[0269] Activated primary human T cells were electroporated with Cas9:gRNA RNP complexes and adeno-associated adenoviral vectors (AAV) to generate TRAC. - / β2M - / Anti-PTK7 CAR + T cells were generated. Activated allogeneic human T cells were delivered with recombinant AAV serotype 6 (AAV6) containing one of the nucleotide sequences encoding the anti-PTK7 CAR (SEQ ID NO: 49, 51, 65, 72, 79 or 112) along with Cas9:sgRNA RNP (1 μM Cas9, 5 μM gRNA). The following sgRNAs were used: TRAC (SEQ ID NO: 28) and β2M (SEQ ID NO: 30). Unmodified versions (or other modified versions) of gRNAs may also be used (e.g., SEQ ID NO: 18 or SEQ ID NO: 20). See also Table 4.

[0270] Approximately one week after electroporation, cells were processed for flow cytometry to assess TRAC, β2M and anti-PTK7 CAR expression levels at the cell surface of the edited cell population (Figure 7). Table 8 lists the antibodies used. All anti-PTK7 CAR T cells and TRAC - / β2M - With respect to control cells, over 90% of viable cells lacked expression of TCR and over 60% lacked expression of β2M. Cells treated with a construct encoding the PTK7-4 CAR showed a significantly increased expression of the anti-PTK7 CAR. +The percentage of viable cells expressing the 4-1BB costimulatory domain was the highest (>70%). The orientation of the VH and VL sequences in the scFV appears to influence CAR expression. The PTK7-4 CAR differs from the PTK7-7 CAR in the orientation of the VH and VL chains, but PTK7-7 was expressed in only less than 50% of the viable cell population. PTK7 CAR T cells with a CD28 costimulatory domain (PTK7-4) were more effective than the 4-1BB costimulatory domain (PTK7-4b) (Figure 8).

[0271] [Table 8]

[0272] Cell killing assay. A cell killing (cytotoxicity) assay was then used to determine the TRAC - / β2M - / Anti-PTK7 CAR + The ability of T cells to induce cytolysis in adherent sarcoma cell lines expressing PTK7 (A-204 and Saos-2) and in a breast cancer cell line expressing PTK7 (MCF7) was assessed. Adherent cells were seeded at 50,000 cells per well in 96-well plates and left overnight at 37°C. The following day, T cells were added to wells containing target cells at a T cell:target cell ratio of 2:1 or 1:1. As a negative control, TRAC - / β2M -T cells were used. After about 20 hours, the T cells were removed from the culture by aspiration, and 100 μL of Cell titer-Glo (Promega) was added to each well of the plate to assess the number of remaining viable cells. The amount of light emitted from each well was then quantified using a plate reader. Anti-PTK7 CAR T cells (especially those expressing the PTK7-4, PTK7-7 and PTK7-13 constructs) showed strong cytotoxicity against the A-204 cell line (Figure 9A) and the Saos cell line (Figure 9B). Furthermore, anti-PTK7 CAR T cells expressing the PTK7-4 CAR showed the highest cytotoxic activity against the MCF7 cell line, which is known to have low expression of PTK7 mRNA compared to the sarcoma cell lines tested (Figure 9C).

[0273] The cell specificity of PTK7-4 CAR T cells was illustrated using PTK7 knockout (KO) Saos2 cells (Figure 10A) and A498 cells overexpressing PTK7 (Figure 10B). PTK7 KO Saos-2 cells were generated by electroporation of ribonucleoprotein particle (RNP) complex (1 μM Cas9 and 5 μM PTK7 gRNA (SEQ ID NO: 111; see Table 9)) according to established methods. Cells were analyzed for loss of PTK7 cell surface expression by flow cytometry using CTX181 mAb (Figure 10C) and subsequently expanded. Flow cytometry analysis showed a 88.6% reduction in protein expression, indicating high efficiency of gene editing. The in vitro efficacy of PTK7 KO Saos-2 cells was evaluated in a cytotoxicity assay compared to Saos-2 WT cells. Figure 10A shows the reduced efficacy of Saos2 PTK7 KO cells lysed by PTK7 CAR T cells, indicating that the CAR T cells were specific for target cells expressing PTK7.

[0274] [Table 9]

[0275] A498 cells overexpressing PTK7 were generated as follows: A498 renal cell carcinoma cells were plated at 60–70% confluency in MEM1α+10% FBS medium supplemented with 10 μg / ml polybrene. The next day, A498 cells were transduced with lentivirus expressing humPTK7 cDNA (LPP-A6381-Lv225-200, GeneCopoeia, Rockville, MD) based on the desired multiplicity of infection (MOI). After 24–48 h of lentiviral infection, the medium was replaced with fresh medium containing 4 μg / ml puromycin selection. Puromycin treatment was continued for 5–7 days after transduction until all of the untransduced cells were removed from the culture. Expression of the humPTK7 cDNA lentiviral construct was assessed by flow cytometry (Figure 10C) using CTX181 mAb. The in vitro efficacy of A498 cells expressing humPTK7 cDNA was evaluated in a cytotoxicity assay compared to A498 WT cells. Figure 10B shows the increased efficacy of PTK7 CAR T cells in lysing A498 cells expressing humPTK7 cDNA compared to A498 WT cells, indicating that PTK7 CAR T cells were specific for PTK7 antigen-expressing target cells.

[0276] Example 6. In vitro efficacy of PTK7 CAR T cells in solid tumor cell lines Cell killing assay. To test efficacy in additional tumor cell lines, high, medium and low PTK7 expressing cell lines from breast, pancreatic and NSCL cancers were selected from the Broad Cancer Cell Line database. A cell killing (cytotoxicity) assay was used to evaluate the efficacy of TRAC. - / β2M - / Anti-PTK7 CAR +The ability of T cells to induce cytolysis in an adherent sarcoma cell line expressing PTK7 (Saos-2), breast cancer cell lines expressing PTK7 to various degrees (HCC1395, MCF7, HCC1419), pancreatic cell lines expressing PTK7 to various degrees (Panc-1, Hs766T, Aspc1), and non-small cell lung cancer cell lines expressing PTK7 to various degrees (NCI-H1975, NCI-H520, NCI-H460). Adherent cells were seeded at 50,000 cells per well in 96-well plates and left overnight at 37°C. The following day, T cells were added to wells containing target cells at effector T cell:target cell ratios of 0.125:1, 0.25:1, 1:1, or 4:1. As a negative control, TRAC was used. - β2M - T cells were used. After about 24 hours, the T cells were removed from the culture by aspiration, and 100 μL of CellTiter-Glo (Promega) was added to each well of the plate to assess the number of viable cells remaining. The amount of light emitted from each well was then quantified using a plate reader. PTK7 protein expression was assessed by staining the target cells with CTX181 antibody for 30 minutes on ice, followed by washing and staining with a secondary APC fluorophore-conjugated human IgG-Fc antibody for 15 minutes at RT. The target cells were assessed for staining with a Novocyte flow cytometer (Acea Biosciences). Figures 11A-11C show that anti-PTK7 CAR T cells exhibited cytotoxicity against all cell lines tested, and this in vitro efficacy trended in line with the level of PTK7 expression in these tumor cell lines.

[0277] The functional activity of PTK7 CAR T cells was further evaluated using cytokine release assays for interferon gamma (IFNg) and interleukin-2 (IL2). T cells of all tested genotypes were incubated with target cells for 24 hours at the cell ratios indicated above. After 24 hours, the supernatant medium surrounding the cell samples was collected and the levels of IFNg and IL2 were measured using ELISA (RD Systems) according to the manufacturer's instructions. PTK7 CAR T cells secreted IFNg and IL2 in the presence of PTK7-expressing cancer cell lines (Saos2, HCC1395, MCF7, Panc1, Hs766T, NCI-H520 and NCI-H1975) when used at a T cell:target cell ratio of 4:1 or 1:1. Control cells (TCR - / β2M - (no AAV) and non-edited (no RNP) did not show a specific IFNg or IL2 secretion response in the presence of any of the listed cancer cell lines. Collectively, these functional assays demonstrated that anti-PTK7 CAR T cells are cytotoxic to cells expressing PTK7 and secrete IFNg and IL2 in the presence of the cells.

[0278] Example 7. Functional capacity of anti-PTK7 CAR T cells TRAC - / β2M - / Anti-PTK7-4 CAR + T cells (also referred to as PTK7-4 CAR T cells) were generated as described in Example 5. TRAC - / β2M - / Anti-CD19 CAR + T cells and TRAC - / β2M - A population of T cells was similarly generated for use as a control. After preparation of edited T cells by transfection, the proliferation capacity of all edited and non-edited T cells over a 7-day period was tested. For each genotype of T cells, 5×10 6 Of note, as shown in Figure 12, TRAC - / β2M - / Anti-PTK7-4 CAR + T cells were able to proliferate at a rate and level comparable to all control experiments. After 7 days of cell expansion, samples of each genotype for injection into mouse models were frozen in cyrostor10 and stored in liquid nitrogen. The remaining cells of each genotype continued to proliferate until day 14 post-editing. Notably, as shown in Figures 13A-13B, the percentage of viable cells with TCR, β2M and CAR gene edits remained consistent from day 7 to day 14 post-editing. Figures 13C-13D show that in subsequent experiments, 70.9% of cells expressed the PTK7-4 CAR construct, while 98% of cells had TRAC KO and 97% of cells had β2M KO. Expression of the anti-CDR19 CAR was detected using a biotinylated polyclonal anti-mouse FAB primary followed by a streptavidin-APC conjugate, and expression of the anti-PTK7 CAR was detected using an anti-PTK7 antibody-PE conjugate (Miltenyi cat#:130-091-364) (Figure 14A and Figure 14D).

[0279] The functional activity of PTK7-4 CAR T cells was verified using the adherent cytotoxicity assay described in Example 5. PTK7-4 CAR T cells (PTK7 CAR) were able to induce cytotoxicity of Saos-2 and MCF7 cells expressing PTK7 when used at a T cell:target cell ratio of 1:1 or 2:1. Control cells (TCR - / β2M - (AAV) None;TCR - / β2M - / anti-CD19 CAR (CD19 CAR); and non-edited (no RNP)) did not show specific cytotoxicity against either Saos-2 or MCF7 cells (Figures 14B and 14E).

[0280] The functional activity of PTK7-4 CAR T cells was further evaluated using a cytokine (interferon gamma / IFNγ) release assay. T cells of all tested genotypes were incubated with target cells (Saos-2 and MCF7 cells) at 1:1 and 2:1 cell ratios for 24 hours. After 24 hours, the supernatant medium surrounding the cell samples was collected and the levels of IFNγ were measured using ELISA (RD Systems) according to the manufacturer's instructions. PTK7-4 CAR T cells (PTK7 CAR) secreted IFNγ in the presence of PTK7-expressing Saos-2 and MCF7 cells when used at a T cell:target cell ratio of 1:1 or 2:1. Control cells (TCR - / β2M - (without AAV);TCR - / β2M - / Anti-CD19 CAR + (CD19 CAR); and non-edited (no RNP)) did not elicit a specific IFNγ secretion response in the presence of either Saos-2 or MCF7 cells (Figures 14C and 14F).

[0281] Collectively, these functional assays demonstrated that anti-PTK7 CAR T cells were cytotoxic to and secreted IFNγ in the presence of cells expressing PTK7.

[0282] Example 8. In vitro cytotoxicity assay A 24-hour cytotoxicity assay was performed to evaluate the in vitro efficacy of anti-PTK7 CAR T cells against mouse cells, 3T3L1 fibroblasts, and M158 breast cancer cells. Results were compared with the potency of anti-PTK7 CAR T cells to lyse human Saos2 osteosarcoma and human A498 renal cell carcinoma cell lines. Adherent cells were seeded in 96-well plates at 50,000 cells per well and left overnight at 37°C. The following day, T cells were added to wells containing target cells at effector T cell:target cell ratios of 0.125:1, 0.25:1, 1:1, or 4:1. As a negative control, TRAC was used. - / β2M -T cells were used. After about 24 hours, the T cells were removed from the culture by aspiration, and 100 μL of CellTiter-Glo (Promega) was added to each well of the plate to evaluate the number of remaining viable cells. The amount of light emitted from each well was then quantified using a plate reader. Anti-PTK7 CAR T cells showed equally good cytotoxicity against human Saos2 cell line and mouse 3T3L1 cell line (Figure 15). Conversely, human A498 cells and mouse M158 cells were not lysed in the presence of anti-PTK7 CAR T cells, because these two cell lines have low expression levels of PTK7.

[0283] Example 9. Permissiveness of anti-PTK7 CAR T cells in a mouse model NOG mice, TRAC - / β2M - / Anti-PTK7-4 CAR + The ability of NOG mice to tolerate treatment with the injection of 10 million TRAC T cells was tested. - / β2M - 100 million anti-PTK7-4 CAR T cells (generated as previously described above) and 2 additional mice received 10 million anti-CD19 CAR T cells. All CAR T cells were administered by tail vein injection.

[0284] Mice were weighed daily and monitored for distress or moribundity. Mice treated with anti-PTK7 CAR T cells showed minimal weight loss, similar to mice treated with anti-CD19 CAR T cells (Figure 16). After a 10-day period from injection, animals were sacrificed and spleen and blood samples were analyzed for the presence of human T cells (human CD45+ cells). In both spleen and blood, mice treated with anti-PTK7 CAR T had higher levels of edited CAR T cells (huCD45+ cells) compared to mice treated with anti-CD19 CAR T cells (Table 10), suggesting that anti-PTK7 CAR T cells will expand in the presence of mouse antigens.

[0285] [Table 10]

[0286] Taken together, the transient weight loss and relatively high levels of CAR T cells in anti-PTK7 CAR-treated mice suggested that the anti-PTK7 CAR recognized the antigen in mice, resulting in CAR T cell expansion. The overall lack of significant toxicity was surprising, indicating that the known on-target / off-tissue toxicities associated with targeting of PTK7 are tolerated in mice and may even be tolerated in humans.

[0287] Example 10. In vivo efficacy of anti-PTK7 CAR-T cells in a xenograft mouse model The efficacy of anti-PTK7 CAR-T cells was tested in vivo in the SKOV-3 human ovarian xenograft mouse model, the HCI-H1975 human non-small cell lung cancer xenograft mouse model, and the human pancreatic Hs766T tumor xenograft mouse model. Figure 17 shows PTK7 cell surface expression levels in human cancer cell lines using CTX181 Ab. For each xenograft model, five female (5-8 weeks old) NOG mice were administered a single IV dose (5x10 7 TRAC (cells / ml) - / β2M - Mice were administered anti-PTK7 CAR T cells (generated as previously described above). Body weight (2x1 week) and tumor volume were endpoints measured throughout the study. Mice were administered anti-PTK7 CAR T cells when tumors (cell lines injected subcutaneously in the right flank) reached 50mm. Studies were terminated when tumors reached endpoint size (1000mm for SKOV3 (ovarian) and 2000mm for NCI-H1975 (NSCLC) and Hs766T (pancreatic)) or at 90 days, whichever came first. Mice were housed and monitored under pathogen-free conditions and IACUC standards. Anti-PTK7 CAR-T cells were effective in all three xenograft models: NCI-H1975 non-small cell lung cancer xenograft model (Figure 18A), SKOV3 ovarian cancer xenograft model (Figure 18B), and Hs766T pancreatic cancer xenograft model (Figure 18C).

[0288] Example 11. In vivo efficacy of anti-PTK7 CAR-T cells in a xenograft mouse model The efficacy of anti-PTK7 CAR-T cells was tested in vivo in OV90 tumor xenograft mouse model, OVCAR3 tumor xenograft mouse model, A2780 human ovarian tumor xenograft mouse model, MCF7 tumor xenograft mouse model, HCC70 human breast tumor xenograft mouse model, HCT116 human colon tumor xenograft mouse model, and H209 human small cell lung cancer tumor xenograft mouse model. For each xenograft model, five female (5-8 weeks old) NOG mice were administered a single IV dose (5 × 10 7 TRAC (cells / ml) - / β2M - Mice were administered anti-PTK7 CAR T cells (generated as already described above) at 0.4 °C for 24 h. Body weight (2 x 1 week) and tumor volume were endpoints measured throughout this study. Mice were administered anti-PTK7 CAR T cells when tumors (cell line injected subcutaneously in the right flank) reached 50 mm. The study was terminated when tumors reached the endpoint size (2000 mm) or at 90 days (whichever came first). Mice were kept and monitored under pathogen-free conditions and IACUC standards. Figure 19A shows the efficacy of anti-PTK7 CAR T cells against an OV90 ovarian tumor xenograft model. Figure 19B shows the efficacy of anti-PTK7 CAR T cells against an HCT116 colon tumor xenograft model. Figure 19C shows that anti-PTK7 CAR T cells were particularly effective in an MCF7 tumor xenograft model. Figure 20 shows the percentage of body weight change in an Hs-766T pancreatic tumor xenograft model treated with PTK7 CAR T cells. A comparable percentage of weight change was observed in all xenograft studies measured. Potential toxicity was variable in xenograft models.

[0289] [Table 11]

[0290]

Table 12

[0291]

Table 13

[0292]

Table 14

[0293]

Table 15

[0294]

Table 16

[0295]

Table 17

[0296]

Table 18

[0297]

Table 19

[0298]

Table 20

[0299]

Table 21

[0300]

Table 22

[0301]

Table 23

[0302]

Table 24

[0303]

Table 25

[0304]

Table 26

[0305]

Table 27

[0306]

Table 28

[0307]

Table 29

[0308]

Table 30

[0309]

Table 31

[0310]

Table 32

[0311] [Table 33]

[0312] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter cited, if any, including the entire document.

[0313] The indefinite articles "a" and "an," as used in the specification and claims, unless clearly indicated to the contrary, should be understood to mean "at least one."

[0314] Similarly, unless expressly stated to the contrary, in any method claimed herein that includes multiple steps or acts, it should be understood that the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0315] In the claims and the above specification, all transitional phrases, such as "comprise," "include," "hold," "have," "contain," "involve," "hold," "comprise," and the like, are understood to be open-ended, i.e., meaning including but not limited to. Only the transitional phrases "consisting of" and "consisting essentially of" shall be closed or semi-closed transitional phrases, respectively, as defined in the United States Patent Office Manual of Patent Examining Procedures 2111.03.

[0316] The terms "about" and "substantially" preceding a numerical value mean ±10% of the recited numerical value.

[0317] Where a range of values ​​is provided, each value between the upper and lower limits of the range is specifically contemplated and described herein.

Claims

1. A population of genetically engineered T cells, the genetically engineered T cells comprising: (i) a nucleic acid encoding a chimeric antigen receptor (CAR), said CAR comprising an anti-PTK7 single chain variable fragment (scFv) having an amino acid sequence of SEQ ID NO:54; and (ii) a disrupted T cell receptor alpha chain constant region (TRAC) gene, a disrupted beta-2-microglobulin (β2M) gene, or a combination thereof The population of genetically engineered T cells comprising:

2. 2. The population of genetically engineered T cells of claim 1, wherein the CAR further comprises a CD28 costimulatory domain or a 41BB costimulatory domain.

3. 3. The population of genetically engineered T cells of claim 2, wherein the CAR further comprises a CD3 cytoplasmic signaling domain.

4. 4. The population of genetically engineered T cells of any one of claims 1 to 3, wherein the CAR comprises the amino acid sequence of SEQ ID NO:

50.

5. 5. The population of genetically engineered T cells of claim 4, wherein the CAR is encoded by the nucleotide sequence of any one of SEQ ID NOs: 49 or 112, or a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 49 or 112.

6. 5. The population of genetically engineered T cells of claim 4, wherein the CAR is encoded by the nucleotide sequence of SEQ ID NO:

49.

7. 7. The population of genetically engineered T cells of any one of claims 1 to 6, wherein the nucleic acid encoding the CAR is inserted into the disrupted TRAC gene.

8. 8. The population of genetically engineered T cells of any one of claims 1 to 7, wherein the disrupted TRAC gene comprises a nucleotide sequence encoding LAH and / or RHA within any one of SEQ ID NOs: 63, 64, 71, 78 or 91, a nucleotide sequence of SEQ ID NO: 92 or 100, and / or a nucleotide sequence of any one of SEQ ID NOs: 63, 64, 71, 78 or 91.

9. 9. The population of genetically engineered T cells of any one of claims 1 to 8, wherein the disrupted β2M gene comprises at least one nucleotide sequence selected from any one of SEQ ID NOs: 9 to 14.

10. 10. The population of genetically engineered T cells of any one of claims 1 to 9, which are human T cells.

11. (i) at least 25% or at least 50% of the engineered T cells of the population express the CAR; (ii) at least 50% or at least 70% of the engineered T cells of the population do not express detectable levels of T cell receptor (TCR) protein; and / or (iii) at least 50% of the engineered T cells of said population do not express detectable levels of β2M protein; A population of genetically engineered T cells according to any one of claims 1 to 10.

12. A method for producing a genetically engineered T cell according to any one of claims 1 to 11, comprising: (a) in a T cell, (i) an RNA-guided nuclease; and (ii) a gRNA targeting the TRAC gene, a gRNA targeting the β2 gene, or a combination thereof; (iii) a vector comprising a donor template comprising a nucleic acid encoding a CAR comprising an anti-PTK7 single-chain variable fragment (scFv) having the amino acid sequence of SEQ ID NO: 54; and and (b) generating a genetically engineered T cell that has a disrupted TRAC gene, a disrupted β2 gene, or a combination thereof, and expresses the CAR. The method includes:

13. The gRNA targeting the TRAC gene comprises the nucleotide sequence of SEQ ID NO: 18 or 19, or targets the nucleotide sequence of SEQ ID NO: 40; or 13. The method of claim 12, wherein the gRNA targeting the β2M gene comprises the nucleotide sequence of SEQ ID NO: 20 or 21, or targets the nucleotide sequence of SEQ ID NO:

41.

14. The method of any one of claims 12 to 13, wherein the donor template comprises the nucleotide sequence of any one of SEQ ID NOs: 63, 64, 71, 78 and 91.

15. The method of any one of claims 12 to 14, wherein the RNA-guided nuclease is a Cas9 nuclease.

16. 16. The method of claim 15, wherein the Cas9 nuclease is a S. pyogenes Cas9 nuclease.

17. A population of genetically engineered T cells for use in treating cancer in a subject, wherein the population of genetically engineered T cells is as defined in any one of claims 1 to 11.

18. 20. The population of engineered T cells for use according to claim 17, wherein the subject is a human subject.

19. 19. The population of genetically engineered T cells for use of claim 17 or 18, wherein the cancer is selected from the group consisting of pancreatic cancer, gastric cancer, ovarian cancer, uterine cancer, breast cancer, prostate cancer, testicular cancer, thyroid cancer, nasopharyngeal cancer, non-small cell lung (NSCLC), glioblastoma, neuronal, soft tissue sarcoma, leukemia, lymphoma, melanoma, colon cancer, colon adenocarcinoma, brain glioblastoma, hepatocellular carcinoma, hepatocholangiocarcinoma, osteosarcoma, gastric cancer, esophageal squamous cell carcinoma, advanced stage pancreatic cancer, lung adenocarcinoma, lung squamous cell carcinoma, small cell lung carcinoma, renal carcinoma and intrahepatic biliary tract carcinoma.

20. 20. The population of genetically engineered T cells for use according to any one of claims 17 to 19, wherein the cancer comprises cancer cells that express PTK7.

21. A population of genetically engineered T cells for use according to any one of claims 17 to 20, wherein the genetically engineered T cells are allogeneic to the subject.

Images