Immune tolerance ungulate domestic animal and production method thereof
Patent Information
- Application Number
- JP2023028756
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-02-27
- Publication Date
- 2026-02-24
AI Technical Summary
The high cost and logistical challenges of maintaining immunodeficient ungulate livestock facilities hinder the practical application of these animals in regenerative medicine due to their suitability for organ size, making it unrealistic to regularly raise them for organ transplantation.
A method involving in utero transplantation of human hematopoietic stem cells into fetal ungulates, followed by birth, to create immunotolerant ungulates capable of engrafting human-derived cells, tissues, or organs, utilizing ungulates like pigs or goats.
This method generates immunotolerant ungulates that can accept human-derived cells, tissues, or organs without rejection, addressing the facility and cost issues of traditional immunodeficient ungulate livestock.
Smart Images

Figure 00000010_0000 
Figure 00000010_0001 
Figure 00000010_0002
Abstract
Description
[Technical field]
[0001] The present disclosure relates to immune-tolerant ungulate livestock and methods for producing the same. [Background technology]
[0002] Organ transplantation is fundamentally a serious problem due to a shortage of donors. In recent years, expectations for regenerative medicine have been rising, and research into human organ regeneration is progressing. Among these, expectations are also high for attempts to create human organs in the bodies of other animals. Summary of the Invention [Problem to be solved by the invention]
[0003] There have been reports of organ regeneration of xenogeneic animals such as kidneys and lungs using immunodeficient mice, but there is a problem with the size of the organs when applying this to regenerative medicine. In terms of organ size, hoofed livestock such as pigs are suitable as hosts, but the cost of maintaining clean facilities and the problem of purifying hoofed livestock make the constant rearing of immunodeficient hoofed livestock costly and unrealistic.
[0004] An object of the present invention is to provide an immunotolerant ungulate livestock and a method for producing the same. [Means for solving the problem]
[0005] As a result of intensive research aimed at solving the above problems, the present inventors have found that immune-tolerant ungulate livestock can be produced by a method comprising the steps of intrauterine transplantation of human hematopoietic stem cells into fetal ungulate livestock and allowing the ungulate livestock to give birth after intrauterine transplantation. Based on this finding, further research has led to the completion of the present invention.
[0006] The present invention includes the following aspects. [Section 1] Immunocompromised hoofed livestock. [Section 2] Immunocompromised hoofed livestock for engraftment of human-derived cells, tissues, or organs. [Section 3] 2. An immune-tolerant hoofed livestock animal for engrafting with human hematopoietic stem cells or engrafted with human hematopoietic stem cells. [Section 4] Item 4. The immunotolerant hoofed livestock according to Item 3, wherein the human hematopoietic stem cells are derived from umbilical cord, bone marrow, peripheral blood, or iPS cells. [Section 5] Item 5. The immunotolerant ungulate livestock according to any one of Items 1 to 4, wherein the ungulate livestock is a pig or a goat. [Section 6] Item 6. The immunotolerant ungulate livestock according to any one of Items 1 to 5, wherein the ungulate livestock is a pig. [Section 7] 1. A method for producing immune-tolerant ungulate livestock, comprising: (A) in utero transplantation of human hematopoietic stem cells into fetal ungulate livestock; and (B) allowing said ungulate livestock to birth after intrauterine transfer. [Section 8] Item 8. The method according to Item 7, wherein the human hematopoietic stem cells are derived from umbilical cord, bone marrow, peripheral blood, or iPS cells. [Section 9] Item 9. The method according to item 7 or 8, wherein the hoofed livestock is a pig or a goat. [Section 10] Item 10. The method according to any one of Items 7 to 9, wherein the hoofed livestock is a pig. [Section 11] 1. A method for producing immune-tolerant hoofed livestock engrafted with human hematopoietic stem cells, comprising: (A) in utero transplantation of human hematopoietic stem cells into fetal ungulate livestock; (B) causing said ungulate livestock to give birth after intrauterine transfer; and (C) transplanting human hematopoietic stem cells into said postnatal hoofed livestock. [Section 12] A method for producing an immunotolerant ungulate livestock having a human-derived kidney, pancreas, or blood vessel engrafted therein, comprising the steps of: (A1) intrauterine transplantation of human hematopoietic stem cells derived from iPS cells into a hoofed livestock animal lacking Sall1, Pdx-1, or Flk-1 during the fetal stage on or before day 39 of gestation; (A2) A step of intrauterine transplantation of iPS cell-derived kidney progenitor cells or intermediate mesoderm cells, pancreatic progenitor cells or endoderm cells, or vascular endothelial progenitor cells or lateral plate mesoderm cells into fetal ungulates after the 40th day of gestation, and (B) A method comprising the step of birthing the ungulate after intrauterine transplantation. [Item 13] The method according to item 11 or 12, wherein the ungulate is a pig or a goat. [Item 14] The method according to any one of items 11 to 13, wherein the ungulate is a pig. [Advantages of the Invention]
[0007] According to one aspect of the present invention, an immunotolerant ungulate and a method for producing the same can be provided. [Brief Description of the Drawings]
[0008] [Figure 1] Figure 1 is a schematic diagram showing the protocol of the experiment. [Diagram 2] Figure 2a is an ultrasound image showing the administration of human hematopoietic stem cells to the liver of a fetus, and Figure 2b is a CT image showing a bone marrow puncture during the administration of human hematopoietic stem cells after birth. [Diagram 3] Figure 3 is a flow cytometry diagram showing the detection of human white blood cells in porcine peripheral blood over time after bone marrow transplantation. [Figure 4] Figure 4 is a PCR electrophoresis diagram showing the detection of human genes in porcine peripheral blood over time after bone marrow transplantation. [Modes for Carrying Out the Invention]
[0009] In this specification, "comprising" is used in a meaning that includes "consisting essentially of" and "consisting of only". In this specification, "n to m" (n < m) means n or more and m or less. In this specification, "about" means within an acceptable error range for the indicated value, for example, within a range of ±10% (preferably ±5%) for the indicated value.
[0010] 1. Immunocompromised hoofed livestock As used herein, "immune tolerance" refers to a state in which a specific immune response to a specific antigen is absent or suppressed. "Immune tolerance" is different from "immunodeficiency," which refers to a state in which a specific immune response to all antigens is absent or suppressed. The immunotolerant hoofed livestock of the present invention can, for example, receive and engraft cells, tissues, or organs derived from other animals (particularly humans) without rejection. Thus, the present invention encompasses immunotolerant hoofed livestock for engrafting cells, tissues, or organs derived from humans, and immunotolerant hoofed livestock in which cells, tissues, or organs derived from humans have been engrafted.
[0011] Examples of cells, tissues, or organs derived from other animals (particularly humans) include, but are not limited to, hematopoietic stem cells, hepatic cells, pancreatic islet cells, nervous system cells, bone marrow, blood vessels, kidneys, liver, pancreas, lungs, etc. In one embodiment, the cells, tissues, or organs derived from other animals (particularly humans) are preferably human hematopoietic stem cells. In particular, human hematopoietic stem cells are preferably derived from umbilical cord, bone marrow, peripheral blood, or iPS cells, and more preferably derived from peripheral blood or iPS cells.
[0012] Human hematopoietic stem cells derived from human iPS cells can be produced, for example, by a production method including a step of culturing human iPS cells in a serum-free medium containing a hematopoietic cytokine. Examples of hematopoietic cytokines include bone morphogenetic protein 4 (BMP4), vascular endothelial growth factor (VEGF), stem cell factor (SCF), interleukin 6 (IL6), FMS-related tyrosine kinase 3 ligand (Flt3L), and the like. Hematopoietic cytokines can be used alone or in combination of two or more. The serum-free medium may further include a growth factor. Examples of growth factors include epidermal growth factor (EGF), transforming growth factor (TGF), vascular endothelial growth factor (VEGF), and the like. Growth factors can also be used alone or in combination of two or more. The production method preferably includes a step of culturing human iPS cells in a serum-free medium containing BMP4, and a step of culturing the culture of the step in a serum-free medium containing VEGF and SCF. The above-mentioned production method may further comprise a step of separating cells by flow cytometry (purification step).
[0013] In this specification, "livestock" refers to animals (industrial animals) that are tamed and raised for industrial or other use. "Livestock" also includes animals that have been bred for experimental or domestic use. The hoofed livestock may be single or twin livestock, but multiple livestock are preferred. The hoofed livestock may be odd-toed livestock, but even-toed livestock are preferred. Examples of even-toed livestock include, but are not limited to, pigs, goats, cattle, sheep, etc. In one embodiment, the hoofed livestock is preferably a pig or goat, and more preferably a pig.
[0014] Among pigs, micropigs or microminipigs are preferred. Minipigs are not particularly limited, but examples thereof include NIBS, NIH, Gottingen, Aumini, Crown, Pitman-Moore, Hormel, Hanford, Aizu, Sinclair, Yucatan, Nebraska, and Corsica. Micropigs or microminipigs are not particularly limited, but examples thereof include Micromini Pig (trademark) manufactured by Fuji Micro Corporation.
[0015] 2. Methods for Producing Immuno-tolerant Hoofed Livestock In one embodiment, the method for producing an immunotolerant ungulate livestock preferably comprises the following steps (A) and (B): (A) in utero transplantation of human hematopoietic stem cells into fetal ungulate livestock; and (B) allowing said ungulate livestock to birth after intrauterine transfer.
[0016] 2-1. Process (A) In this specification, the term "fetal period" refers to the period after the formation of the placenta and before birth, and may also be referred to as "fetal period." Furthermore, in this specification, "ungulate livestock in the fetal period" may also be referred to simply as "fetus" or "fetus."
[0017] In one embodiment, the human hematopoietic stem cells used for intrauterine transplantation are preferably derived from umbilical cord, bone marrow, peripheral blood, or iPS cells, more preferably from peripheral blood or iPS cells.
[0018] The number of human hematopoietic stem cells used for intrauterine transplantation is not particularly limited, but may be, for example, about 1 × 10 4 cells / body or more, preferably about 5×10 4 cells / body or more, more preferably about 1×10 5 The number of human hematopoietic stem cells is, for example, about 1 × 10 8 cells / body or less, preferably about 1×10 7 cells / body or less, more preferably about 1×10 6The number of human hematopoietic stem cells is, for example, about 1 × 10 4 ~Approx. 1×10 8 cells / body, preferably about 5×10 4 ~Approx. 1×10 7 cells / body, more preferably about 1×10 5 ~Approx. 1×10 6 cells / body.
[0019] Intrauterine transplantation is preferably performed, for example, after about day 20 of pregnancy, preferably after about day 25 of pregnancy, more preferably after about day 30 of pregnancy, and even more preferably after about day 35 of pregnancy. Intrauterine transplantation is preferably performed, for example, before about day 60 of pregnancy, preferably before about day 55 of pregnancy, more preferably before day 50 of pregnancy, and even more preferably before about day 45 of pregnancy (for example, before about day 39 of pregnancy). Intrauterine transplantation is preferably performed, for example, from about day 20 to about day 60 of pregnancy, preferably from about day 25 to about day 55 of pregnancy, more preferably from about day 30 to about day 50 of pregnancy, and even more preferably from about day 35 to about day 45 of pregnancy. In one embodiment, intrauterine transplantation is preferably performed at the time when the thymus begins to form. In this specification, "day X of pregnancy" refers to the time point when X days have passed since the day of fertilization or mating, which is set as day 0, and can also be referred to as X days of age (fetal age).
[0020] In the case of twin or multiple pregnancies, all fetuses in the uterus may be transplanted, but also a subset of fetuses, for example one, two, three, four or five.
[0021] Intrauterine transplantation can be performed by a conventional method, for example, transuterine transplantation. Transuterine transplantation may be performed with or without laparotomy. Transuterine transplantation is usually performed using an injection needle or a puncture needle. The needle usually has a gauge of 15 to 27, preferably 20 to 24. Examples of transplantation sites include organs such as the heart and liver, and the abdominal cavity, but are not limited thereto.
[0022] 2-2. Process (B) In this specification, the term "giving birth" is not limited to birth with artificial assistance (e.g., Caesarean section, induced birth), but also includes natural birth. Birth is preferably full-term birth. When the ungulate is a pig, birth is preferably at about 114 days of gestation.
[0023] Whether or not a ungulate livestock produced by a method including steps (A) and (B) is immunotolerant can be confirmed, for example, by carrying out step (C) in 3-2 below and checking whether or not human hematopoietic stem cells actually engraft. Specifically, it is preferable to confirm whether or not human leukocytes are present in the peripheral blood after step (C), particularly at 12 weeks of age.
[0024] 3. Method for generating immune-tolerant hoofed livestock engrafted with human hematopoietic stem cells In one embodiment, the method for producing immune-tolerant ungulate livestock engrafted with human hematopoietic stem cells preferably comprises the following steps (A), (B), and (C): (A) in utero transplantation of human hematopoietic stem cells into fetal ungulate livestock; (B) causing said ungulate livestock to give birth after intrauterine transfer; and (C) transplanting human hematopoietic stem cells into said postnatal hoofed livestock.
[0025] 3-1. Steps (A) and (B) Steps (A) and (B) of this method correspond to steps (A) and (B) of 2 above, and similar conditions can be employed.
[0026] 3-2. Process (C) In this specification, "postnatal ungulate livestock" may be referred to simply as "newborn" or "calf." In addition, since "postnatal ungulate livestock" have acquired immune tolerance, they may also be referred to as "immune-tolerant ungulates."
[0027] The origin of the human hematopoietic stem cells in step (C) may be the same as or different from the origin of the human hematopoietic stem cells in step (A), but if the origin is different, it is preferable that the HLA type is compatible.
[0028] Examples of human hematopoietic stem cells in step (C) include those exemplified in the above 1. Transplantation can be carried out according to a conventional method, for example, a method in which the limbs of postnatal hoofed livestock are irradiated with radiation, followed by bone marrow transplantation.
[0029] The number of human hematopoietic stem cells used in bone marrow transplantation is not particularly limited, but may be, for example, about 1 × 10 4 cells / body or more, preferably about 5×10 4 cells / body or more, more preferably about 1×10 5 The number of human hematopoietic stem cells is, for example, about 1 × 10 9 cells / body or less, preferably about 1×10 8 cells / body or less, more preferably about 1×10 7 The number of human hematopoietic stem cells is, for example, about 1 × 10 4 ~Approx. 1×10 9 cells / body, preferably about 5×10 4 ~Approx. 1×10 8 cells / body, more preferably about 1×10 5 ~Approx. 1×10 7 cells / body.
[0030] Bone marrow transplantation is preferably performed, for example, about 1 week after birth, preferably about 2 weeks after birth, and more preferably about 3 weeks after birth. Bone marrow transplantation is preferably performed, for example, before about 8 weeks after birth, preferably about 6 weeks after birth, and more preferably about 5 weeks after birth. Bone marrow transplantation is preferably performed, for example, about 1 week to about 8 weeks after birth, preferably about 2 weeks to about 6 weeks after birth, and more preferably about 3 weeks to about 5 weeks after birth.
[0031] Bone marrow transplantation is usually performed using a bone marrow needle. The thickness of the bone marrow needle is not particularly limited, but is, for example, 13 to 15 gauge.
[0032] 4. Method for producing immune-tolerant hoofed livestock with human-derived kidney, pancreas, or blood vessels In one embodiment, the method for producing an immune-tolerant ungulate livestock having a human-derived kidney, pancreas, or blood vessel engrafted therein preferably comprises the following steps (A1), (A2), and (B): (A1) intrauterine transplantation of human hematopoietic stem cells derived from iPS cells into a hoofed livestock animal lacking Sall1, Pdx-1, or Flk-1 during the fetal stage on or before day 39 of gestation; (A2) transplanting iPS cell-derived kidney progenitor cells or intermediate mesoderm cells, pancreatic progenitor cells or endoderm cells, or vascular endothelial progenitor cells or lateral plate mesoderm cells into the ungulate livestock during the fetal stage on or after day 40 of gestation; and (B) allowing said ungulate livestock to birth after intrauterine transfer.
[0033] 4-1. Process (A1) Step (A1) of the method corresponds to step (A) of 2 above, except that ungulate livestock lacking Sall1, Pdx-1, or Flk-1 are used, and similar conditions can be employed. Sall1-, Pdx-1-, or Flk-1-deficient ungulate livestock can be produced, for example, by using collected eggs (eggs collected from pig ovaries derived from a slaughterhouse, or eggs collected from living organisms, etc.) to produce reconstructed fertilized eggs by somatic cell nuclear transfer or genome editing (direct introduction of a vector) into the fertilized eggs, and then transplanting the reconstructed fertilized eggs into recipients.
[0034] The somatic cell nuclear transfer can be carried out, for example, according to the following steps 1 to 5. 1. Create a primary cell line, such as a fibroblast, and introduce a plasmid that knocks out Sall1, Pdx-1, or Flk-1. 2. The collected immature oocytes are cultured for maturation. 3. The nuclei of matured oocytes are removed and cells lacking Sall1, Pdx-1, or Flk-1 are placed into the bony cavity. 4. The enucleated egg is fused and activated with a somatic cell to produce a reconstructed fertilized egg. 5. The reconstructed embryos are transferred to recipient pigs whose estrus has been synchronized.
[0035] Genome editing of the fertilized egg can be carried out, for example, according to the following steps 1 to 4. 1. The collected immature oocytes are cultured for maturation. 2. The matured eggs are inseminated and fertilized. 3. 12 to 17 hours after fertilization, a plasmid that knocks out Sall1, Pdx-1, or Flk-1 is introduced by a conventional method (eg, electroporation, lipofection, viral vector, microinjection). 4. The reconstructed embryos are transferred to recipient pigs whose estrus has been synchronized.
[0036] 4-2. Process (A2) The origin of the iPS cells in step (A2) may be the same as or different from the origin of the iPS cells in step (A1), but if the origin is different, it is preferable that the HLA type is compatible.
[0037] Kidney progenitor cells or intermediate mesoderm cells derived from iPS cells are used for intrauterine transplantation into Sall1-deficient hoofed livestock, pancreatic progenitor cells or endoderm cells derived from iPS cells are used for intrauterine transplantation into Pdx-1-deficient hoofed livestock, and vascular endothelial progenitor cells or lateral plate mesoderm cells derived from iPS cells are used for intrauterine transplantation into Flk-1-deficient hoofed livestock.
[0038] The number of each cell used for intrauterine transplantation is not particularly limited, but may be, for example, about 1 × 10 4 cells / body or more, preferably about 5×10 4 cells / body or more, more preferably about 1×10 5 The number of cells is, for example, about 1 × 10 9 cells / body or less, preferably about 1×10 8 cells / body or less, more preferably about 1×10 7The number of cells is, for example, about 1 × 10 4 ~Approx. 1×10 9 cells / body, preferably about 5×10 4 ~Approx. 1×10 8 cells / body, more preferably about 1×10 5 ~Approx. 1×10 7 cells / body.
[0039] Intrauterine transplantation may be performed after step (A1), and is preferably performed after about day 40 of pregnancy. Intrauterine transplantation may be performed, for example, before about day 60 of pregnancy, before about day 55 of pregnancy, or before day 50 of pregnancy. Intrauterine transplantation may be performed, for example, from about day 40 to about day 60 of pregnancy, from about day 40 to about day 55 of pregnancy, or from about day 40 to about day 50 of pregnancy.
[0040] 4-3.Process (B) Step (B) of this method corresponds to step (B) of 2 above, and similar conditions can be employed. EXAMPLES
[0041] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these.
[0042] [Example 1] 1. About animals This experiment was conducted with the approval of the Gifu University Animal Research Ethics Committee and the Nagoya University Hospital Institutional Review Board Ethics Committee. Microminipigs (female) were purchased from Fujimikura Co., Ltd. The animals were housed in a controlled room (4 m × 2.8 m, with space >1 m per animal) with a temperature of 24°C (range 21–27°C), humidity of 70–80%, and a 12-h light-dark cycle starting at 6:00 a.m. 2 ) and were fed the recommended amount of Herb Kodakara 74 (Nisshin Marubeni Feed Co., Ltd.) per body weight and had free access to water. Estrus was confirmed by behavioral observation, examination of the presence or absence of swelling of the vulva, and back pressure test. For artificial insemination, semen was manually collected from trained male microminipigs. The collected semen was diluted with a Modena Extender until the sperm concentration was 1 × 10 8 The sperm was diluted to 100 / mL and inseminated via intracervical injection of 15 mL of sperm via a spiral-tip catheter. Pregnancy was confirmed using handheld ultrasound. The fetuses were used for the experiment on day 43 of gestation. After birth, the pups were kept in a room under the same conditions as above and used for the experiment. The pigs were sacrificed 33 weeks after birth and the bone marrow was collected.
[0043] 2. Preparation of Human Peripheral Blood-derived CD34+ Cells Two vials of human CD34-positive cells (Lonza, 4Y-101D, Lot 3040601) derived from peripheral blood and from the same donor were purchased. For prenatal treatment, one vial was thawed in DMEM solution containing 10% FBS, centrifuged at 400g x 10 min at 18°C, and resuspended in PBS. 5 Five syringes of cells / 200 μL PBS were prepared according to the number of pig fetuses. For postnatal bone marrow transplantation, the remaining vial was thawed in 10% FBS-containing DMEM solution in the same manner as above, centrifuged at 400 g for 10 min at 18°C, and resuspended in PBS. 6 Three bottles of cells / 500 μL PBS were prepared according to the number of pigs.
[0044] 3. Intrauterine transplantation of human peripheral blood-derived CD34 positive cells into pig fetuses The experiment was carried out according to the schematic diagram shown in FIG. First, the sow on day 43 of pregnancy was sedated by intramuscular administration of 0.02 mg / kg medetomidine (Domitor™; Nippon Zenyaku Kogyo Co., Ltd.), 0.2 mg / kg midazolam (Domicam Injection 10 mg™; Astellas Pharma Inc.), and 0.15 mg / kg butorphanol (Betorfal™; Meiji Seika Kaisha, Ltd.). Under inhalation anesthesia with 2-5% isoflurane (Laboratory Animals 2015, Vol.49(1) 65-70), the lower abdomen was opened to expose the uterus. Cell transplantation into the fetal liver was performed using a 22G needle at 8 × 10 5 The experiment was performed on cells / body (Figure 2a).
[0045] 4. Caesarean section birth of pigs On the day before the 114th day, which was considered to be full-term delivery, the mother was sedated by intramuscular injection of three drugs: 0.02 mg / kg medetomidine, 0.2 mg / kg midazolam, and 0.15 mg / kg butorphanol, and then a cesarean section was performed under inhalation anesthesia with 2-5% isoflurane.
[0046] 5. Bone marrow transplantation of human peripheral blood-derived CD34+ cells into postnatal pigs Two of the pigs died during the perinatal period, and the three surviving pigs were irradiated with 10 Gy of radiation to the left upper and lower limbs using a linear accelerator at 4 weeks of age. The day after irradiation, a 13G x 5cm bone marrow needle (Jamshidi bone marrow biopsy needle, BD, DJ2013) was inserted into the femur from the left knee joint under computed tomography guidance, and after confirming that the needle tip was within the bone marrow, each pig was administered 1.2 x 10 6 cells / body (Fig. 2b).
[0047] 6. Flow Cytometry Analysis Whole blood was lysed using Lysing Buffer (BD Pharm Lyse, 555899) and fixed in a paraformaldehyde (PFA)-based buffer for 2 h. After fixation, white blood cells (WBCs) were first incubated with APC-mouse monoclonal anti-human CD45 antibody (BD Pharmingen, 555485) at 1 × 10 6 The cells were incubated with the antibody at a concentration of 1 × 10 cells / 100 μL PBS for 30 minutes at 4°C. Then, FITC-mouse monoclonal anti-pig CD45 antibody (Antigenix America Inc. APG450F) was added at 1 × 10 6WBCs were stained at a concentration of 100 μL / 100 μL PBS for 30 minutes at 4° C. To remove dead cells, Zombie Aqua or Zombie NIR was reacted with pCD45 antibody. Analysis was performed using an LSR Fortessa (BD Biosciences) or BD FACS Canto II (BD Biosciences) according to the instructions for each model. The analysis results are shown in Figure 3. As shown in Figure 3, human leukocytes were detected in all transplanted pigs (TP1 to TP3) 12 weeks after bone marrow transplantation.
[0048] 7. DNA Isolation and PCR Whole blood was lysed using Lysing Buffer (BD Pharm Lyse, 555899), and genomes were extracted from white blood cells. Extraction was performed using RecoverAll™ Total Nucleic Acid Isolation Kit for FFPE (Invitrogen, AM1975) according to the manufacturer's instructions. To confirm whether the extracted genome contained human genome, nested PCR was performed for the ARHGAP11B gene. PCR was performed using the KAPA HotStart Mouse Genotyping Kit (Sigma-Aldrich, KK7352). The sequences of the outer primer were AACCAGACGGACAGTAAGGTTTG (SEQ ID NO: 1) for the forward primer (Fw) and GGACACCCTTCACCTTAATACC (SEQ ID NO: 2) for the reverse primer (Rv), and the sequences of the inner primer were CTGGCAATAGGCGAGAAACC (SEQ ID NO: 3) for the forward primer (Fw) and GGATACGTCGATAACTCTGAGGC (SEQ ID NO: 4) for the reverse primer (Rv). The amplification conditions for the outer PCR were 95°C for 30 seconds, 68°C for 30 seconds, and 72°C for 30 seconds, with 30 cycles. The outer PCR product was purified using the FastGene Gel / PCR Extraction Kit (NIPPON Genetics Co., Ltd., FG-91302). The amplification conditions for the inner PCR were 95°C for 30 seconds, 64°C for 30 seconds, and 72°C for 30 seconds, with 35 cycles. The results of PCR are shown in Figure 4. As shown in Figure 4, 12 weeks after bone marrow transplantation, the human ARHGAP11B gene was detected in all of the transplanted pigs (TP1 to TP3). These results indicate that the pigs transplanted intrauterinely are immunotolerant and capable of engrafting human hematopoietic stem cells after postnatal transplantation.
[0049] [Example 2] After seeding the human iPS cells, the medium is changed to StemPro34 (Gibco) medium supplemented with 20 ng / mL BMP4 for 4 days, and then changed to StemPro34 medium supplemented with 40 ng / mL VEGF and 50 ng / mL SCF for approximately 6 days to obtain CD34 positive cells contained therein. Except for using the CD34 positive cells instead of human peripheral blood-derived CD34 positive cells in the intrauterine transplantation, the same procedure as in Example 1 is carried out to prepare immune-tolerant pigs, and the same human iPS cell-derived CD34 positive cells are transplanted into the bone marrow and engrafted.
[0050] [Example 3] Perform somatic cell nuclear transfer by following steps 1-5 below. 1. Create a primary cell line, such as a fibroblast, and introduce a plasmid that knocks out Sall1, Pdx-1, or Flk-1. 2. The collected immature oocytes are cultured for maturation. 3. The nuclei of matured oocytes are removed and cells lacking Sall1, Pdx-1, or Flk-1 are placed into the bony cavity. 4. The enucleated egg is fused and activated with a somatic cell to produce a reconstructed fertilized egg. 5. The reconstructed embryos are transferred to recipient pigs whose estrus has been synchronized. Thereafter, CD34-positive cells derived from human iPS cells are transplanted into the womb before day 39 of pregnancy, and renal progenitor cells or intermediate mesoderm cells, pancreatic progenitor cells or endoderm cells, or vascular endothelial progenitor cells or lateral plate mesoderm cells derived from human iPS cells are transplanted into the womb on or after day 40 of pregnancy, allowing human kidneys, pancreas, or blood vessels to take root.
[0051] [Example 4] Genome editing is performed on fertilized eggs by following steps 1 to 4 below. 1. The collected immature oocytes are cultured for maturation. 2. The matured eggs are inseminated and fertilized. 3. 12 to 17 hours after fertilization, a plasmid that knocks out Sall1, Pdx-1, or Flk-1 is introduced by a conventional method (eg, electroporation, lipofection, viral vector, microinjection). 4. The reconstructed embryos are transferred to recipient pigs whose estrus has been synchronized. Thereafter, the cells are transplanted intrauterinely in the same manner as in Example 3 to allow human kidney, pancreas, or blood vessels to take root.
Claims
1. 1. A method for producing immunotolerant ungulate livestock, comprising: (A) in utero transplantation of human hematopoietic stem cells into fetal ungulate livestock; and (B) A method comprising the step of birthing said ungulate livestock after intrauterine transfer.
2. A method for producing immunotolerant ungulate livestock engrafted with human hematopoietic stem cells, comprising: (A) a process of in utero transplantation of human hematopoietic stem cells into fetal ungulate livestock; (B) birthing the ungulate livestock after intrauterine transfer; and (C) A method comprising the step of transplanting human hematopoietic stem cells into said ungulate livestock after birth.
3. The method described in claim 1 or 2, wherein the human hematopoietic stem cells are derived from iPS cells, peripheral blood, umbilical cord, or bone marrow.
4. The method described in claim 1 or 2, wherein the intrauterine transplantation is performed on about day 35 to about day 45 of pregnancy.
5. The method according to claim 1 or 2, wherein the number of human hematopoietic stem cells used in the intrauterine transplantation is about 1×10 5 to about 1×10 6 cells / body.
6. The method according to claim 1 or 2, wherein the transplantation in step (C) is bone marrow transplantation, and the number of human hematopoietic stem cells used in the bone marrow transplantation is about 1 x 10 5 to about 1 x 10 7 cells / body.
7. The method of claim 1 or 2, wherein the ungulate livestock is a pig or a goat.
8. A method for producing immunotolerant ungulate livestock having a human-derived kidney, pancreas, or blood vessel engrafted therein, comprising the steps of: (A1) intrauterine transplantation of iPS cell-derived human hematopoietic stem cells into a livestock ungulate deficient in Sall1, Pdx-1, or Flk-1 during the fetal stage before day 39 of gestation; (A2) intrauterine transplantation of iPS cell-derived kidney progenitor cells or intermediate mesodermal cells, pancreatic progenitor cells or endodermal cells, or vascular endothelial progenitor cells or lateral plate mesodermal cells into a livestock ungulate fetus on or after day 40 of gestation; and (B) A method comprising the step of birthing said ungulate livestock after intrauterine transfer.
9. The method according to claim 8, wherein the number of cells used in the intrauterine transplantation is about 1×10 5 to about 1×10 7 cells / body.
10. 10. The method of claim 8 or 9, wherein the ungulate livestock is a pig or a goat.
11. An immunotolerant ungulate livestock produced by the method of claim 1, 2, or 8.
12. An immunotolerant hoofed livestock for engrafting cells, tissues, or organs of human origin, for engrafting human hematopoietic stem cells, or engrafted with human hematopoietic stem cells.
13. The immunotolerant ungulate livestock described in claim 12, wherein the human hematopoietic stem cells are derived from iPS cells, peripheral blood, umbilical cord, or bone marrow.
14. The immunotolerant ungulate livestock described in claim 12 or 13, wherein the ungulate livestock is a pig or a goat.