Compositions, methods and kits for delivery of polyribonucleotides

Abstract

To provide methods and compositions for delivery of a polyribonucleotide.SOLUTION: In some cases, the methods and compositions provided herein are suitable for in vivo delivery of polyribonucleotides. In certain aspects, also disclosed herein are pharmaceutical compositions for delivery of polyribonucleotide having biological effects. The present invention described herein includes compositions, pharmaceutical compositions and methods for delivery of polyribonucleotides. In certain embodiments, the compositions and pharmaceutical compositions include ethanol and the polyribonucleotides. In other embodiments, the compositions and pharmaceutical compositions include alcohol and the polyribonucleotides. In another embodiment, the compositions and pharmaceutical compositions include a cell-penetrating agent and the polyribonucleotides. The methods comprise applying these compositions and pharmaceutical compositions to a surface area of a subject.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application is a continuation of U.S. Provisional Patent Application No. 62 / 812,763, filed March 1, 2019. This application claims priority to and the benefit of US Pat. No. 6,399,433, the entire contents of which are incorporated herein by reference. Be absorbed. [Background technology]

[0002] Polyribonucleotides play an important role in biological processes such as gene expression, gene regulation, and cellular signaling. It is an important biomolecule for biological activity. Summary of the Invention [Means for solving the problem]

[0003] The invention described herein provides compositions, pharmaceutical compositions, and the like for the delivery of polyribonucleotides. In certain embodiments, the compositions and pharmaceutical compositions include ethanol and In other embodiments, the compositions and pharmaceutical compositions include alcohols and polyribonucleotides. In another embodiment, the compositions and pharmaceutical compositions comprise cells, The compositions and pharmaceutical compositions include a permeabilizing agent and a polyribonucleotide. This includes applying the coating to a surface area of

[0004] The invention described herein includes compositions that do not include any carrier and are polyribonucleotides. The composition comprises a nucleotide and a diluent. The composition may be applied to the surface area following application of a disinfectant to the surface area. .

[0005] In some embodiments, the pharmaceutical composition comprises a mixture of polyribonucleotides and ethanol. ethanol comprises at least about 0.3% v / v to about 75% v / v of the mixture. In some embodiments, ethanol is at least about 0.3% v / v to about 70% v / v of the mixture. %v / v, at least about 0.3%v / v to about 60%v / v, at least about 0.3%v / v ~ about 50% v / v, at least about 0.3% v / v~ about 40% v / v, at least about 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v, at least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v, at least In both cases, about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v In some embodiments, ethanol comprises at least about 0.5% of the mixture. v / v to about 75% v / v, at least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, at least about 10% v / v to about 75% v / v, at least about 1 5% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v, at least About 30% v / v to about 75% v / v, at least about 40% v / v to about 75% v / v, at least About 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or accounts for at least about 70% v / v to about 75% v / v.

[0006] In some embodiments, the pharmaceutical composition comprises a mixture of polyribonucleotides and alcohol. The alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture. In some embodiments, the alcohol comprises at least about 0.3% v / v to about 70% v / v of the mixture. %v / v, at least about 0.3%v / v to about 60%v / v, at least about 0.3%v / v ~ about 50% v / v, at least about 0.3% v / v~ about 40% v / v, at least about 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v, at least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v, at least In both cases, about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v In some embodiments, the alcohol comprises at least about 0.5% of the mixture. v / v to about 75% v / v, at least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, at least about 10% v / v to about 75% v / v, at least about 1 5% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v, at least About 30% v / v to about 75% v / v, at least about 40% v / v to about 75% v / v, at least About 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or In some embodiments, the arsenic phosphate ... Coal is a mixture of methanol, ethanol, isopropanol, butanol, pentanol, and cetanol. Alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzene Alcohol, specially denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol Alcohol, menthol, polyethylene glycol (PEG-400), ethoxylated fatty acids and hydroxyethyl cellulose.

[0007] In some aspects, the pharmaceutical composition comprises a mixture of a polyribonucleotide and a cell penetrating agent. and the cell permeation agent comprises at least about 0.3% v / v to about 75% v / v of the mixture. In some embodiments, the cell permeability agent comprises at least about 0.3% v / v to about 70% v / v of the mixture. %v / v, at least about 0.3%v / v to about 60%v / v, at least about 0.3%v / v ~ about 50% v / v, at least about 0.3% v / v~ about 40% v / v, at least about 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v, at least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v, at least In both cases, about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v In some embodiments, the cell permeation agent comprises at least about 0.5% of the mixture. v / v to about 75% v / v, at least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, at least about 10% v / v to about 75% v / v, at least about 1 5% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v, at least About 30% v / v to about 75% v / v, at least about 40% v / v to about 75% v / v, at least About 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or In some embodiments, the cells comprise at least about 70% v / v to about 75% v / v. The permeabilizing agent is an alcohol. In some embodiments, the alcohol is methanol, ethanol, or the like. Alcohol, isopropanol, butanol, pentanol, cetyl alcohol, ethylene Glycol, propylene glycol, denatured alcohol, benzyl alcohol, special denatured alcohol Alcohol, glycol, stearyl alcohol, cetearyl alcohol, menthol, poly Polyethylene glycol (PEG)-400, ethoxylated fatty acids, and hydroxyethyl ceramides. The compound is selected from the group consisting of cellulose.

[0008] In some embodiments, the polyribonucleotide encodes a protein. In some embodiments, the protein is a therapeutic protein. The protein is a wound healing protein. In some embodiments, the wound healing protein In some embodiments, the growth factor is EGF, PDGF, TG In some embodiments, the pharmaceutical composition is a liquid, gel, low-dose, or VEGF. In some embodiments, the composition may be a polysaccharide, a paste, a cream, a foam, or a sticky substance. The ribonucleotide is a linear polyribonucleotide. In some embodiments, the polyribonucleotide is an mRNA. In some embodiments, the polyribonucleic acid sequence is a polyribonucleic acid sequence that lacks a cap or a polyA tail. In some embodiments, the polyribonucleotide is non-immunogenic. In some embodiments, the polyribonucleotide is a cyclic polyribonucleotide. In some embodiments, the polyribonucleotide comprises modified ribonucleotides. In some embodiments, the pharmaceutical composition has a pH of about 7. In some embodiments, the pharmaceutical composition has a viscosity that is about the same as water. The composition is substantially free of hydrophobic or lipophilic groups. In some embodiments, the pharmaceutical composition is substantially free of hydrocarbons. In some embodiments, the pharmaceutical composition is substantially free of fatty acids, lipids, and / or fatty acids. Substantially free of lipids, liposomes, cholesterol, or any combination thereof. In some embodiments, the cell permeation agent is soluble in a polar solvent. The cell permeabilizing agent is insoluble in polar solvents.

[0009] In some aspects, the therapeutic composition comprises a polyribonucleotide and a cell penetrating agent. The cell permeation agent is configured for local administration. In some embodiments, the therapeutic composition comprises and an alcohol, the alcohol being configured for topical administration. .

[0010] In some aspects, the therapeutic composition comprises a polyribonucleotide and an alcohol; The polyribonucleotide comprises a payload or a sequence encoding a payload and The loading has a biological effect on the cells. In some embodiments, the therapeutic composition comprises: The polyribonucleotide comprises a payload or a cell penetrating agent. The payload comprises a sequence encoding a payload, the payload having a biological effect on a cell. do.

[0011] In some aspects, the therapeutic composition comprises a polyribonucleotide and an alcohol; The polyribonucleotide is present in an amount effective to have a biological effect on a cell or tissue. and the alcohol is present in an amount effective to have a biological effect on the cell or tissue. In some aspects, the therapeutic composition comprises a polyribonucleotide and a cell permeation agent. The polyribonucleotide comprises a nucleic acid sequence that is effective to have a biological effect on a cell or tissue. and the cell permeation agent is present in an amount effective to have a biological effect on a cell or tissue. exists in quantity.

[0012] In some aspects, the method of treating a wound includes treating the wound or tissue surrounding the wound with a polyribonucleotide. contacting the nucleotide with a composition comprising a mixture of nucleotides and ethanol; comprises at least about 0.3% v / v to about 75% v / v of the mixture. The method of treating a wound comprises treating the wound or tissue surrounding the wound with a polyribonucleotide and an alpha-ribonucleotide. the alcohol being at least one of the components of the mixture, In some embodiments, the composition comprises about 0.3% v / v to about 75% v / v. The method includes treating the wound or tissue surrounding the wound with a mixture of polyribonucleotides and a cell permeation agent. wherein the cell permeation agent comprises at least about 0.3% v / v of the mixture. v~Approximately 75% v / v.

[0013] In some aspects, the therapeutic composition comprises a polyribonucleotide, alcohol, and a topical In some embodiments, the therapeutic composition comprises a delivery vehicle, and the topical delivery vehicle comprises a stabilizing agent. The article includes a polyribonucleotide, a cell penetrating agent, and a local delivery vehicle. In some embodiments, the stabilizer comprises glucose (4.5 g / L). include.

[0014] In some embodiments, the suppository or other lipid-based formulation contains polyribonucleotides and alcohol. In some embodiments, the suppository or other lipid-based formulation comprises a polyribonucleotide and Includes a cell permeabilizing agent.

[0015] In some aspects, the inhalable composition comprises a polyribonucleotide, an alcohol, and In some embodiments, the inhalable composition comprises a mixture of polyribonucleic acid and a propellant. The mixture includes a mixture of a medicament, a cell permeabilizing agent, and a propellant.

[0016] In some embodiments, the therapeutic composition is loaded with polyribonucleotides and alcohol. In some embodiments, the therapeutic composition comprises a biodegradable scaffold. The present invention includes a biodegradable scaffold loaded with a cellular permeation agent and a cell permeation agent.

[0017] In some embodiments, the cell permeation agent comprises an alcohol. Alcohols include methanol, ethanol, isopropanol, butanol, and pentane. Alcohol, cetyl alcohol, ethylene glycol, propylene glycol, denatured alcohol, Benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol, cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG)-400, Ethoxylated In some embodiments, the hydroxyethyl cellulose is selected from the group consisting of fatty acids and hydroxyethyl cellulose. In one embodiment, the alcohol is ethanol.

[0018] In some embodiments, the method of delivering a polyribonucleotide to a subject comprises: a) administering to a subject a bactericide; b) applying the polyribonucleotide and dilute polyribonucleotides free of any carrier to the surface area of ​​the object; In some embodiments, the disinfectant is a composition that is applied to the surface area. , alcohol, UV light, laser light, or heat.

[0019] In some embodiments, the method of delivering a polyribonucleotide to a subject comprises the steps of: a) administering an alcohol b) applying to a surface area of ​​the subject a polyribonucleotide and and a diluent.

[0020] In some embodiments, the method of delivering polyribonucleotides to epithelial cells comprises any of the following: A composition comprising a diluent free of ribonucleotides and unmodified polyribonucleotides is administered to epithelial cells. This includes applying

[0021] In some embodiments, the method of delivering a polyribonucleotide to a subject comprises topically applying a composition comprising a mixture of octyldodecyl and ethanol to a surface area of ​​a subject; ethanol comprises at least about 0.3% v / v to about 75% v / v of the mixture. In some aspects, the method of delivering a polyribonucleotide to a subject comprises administering the polyribonucleoside The method includes topically applying a composition comprising a mixture of tincture and alcohol to a surface area of ​​a subject. In general, the alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture. In some embodiments, the method of delivering a polyribonucleotide to a subject comprises: topically applying to a surface area of ​​a subject a composition comprising a mixture of an octide and a cell permeation agent; and the cell permeation agent comprises at least about 0.3% v / v to about 75% v / v of the mixture. In some embodiments, the composition delivers polyribonucleotides to dermal or epithelial tissue of a subject. In some embodiments, the composition delivers polyribonucleotides to the dermis or dermis of a subject. Provides iontophoretic delivery to epithelial tissues.

[0022] In some aspects, the method of delivering polyribonucleotides to a cell or tissue comprises administering to the cell or tissue comprising contacting the tissue with a mixture comprising a polyribonucleotide and an alcohol; The alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture. In one embodiment, the method of delivering polyribonucleotides to a cell or tissue comprises administering to the cell or tissue contacting the cell with a mixture comprising a polyribonucleotide and a cell permeation agent; The agent comprises at least about 0.3% v / v to about 75% v / v of the mixture.

[0023] In some aspects, the method of delivering a therapeutic composition to a cell or tissue comprises administering to the cell or tissue contacting the cell with a therapeutic composition comprising a polyribonucleotide and alcohol; In some embodiments, the alcohol is configured for local administration. The method for delivering a cell or tissue comprises administering to the cell or tissue a polyribonucleotide and a cell permeation agent. The therapeutic composition includes contacting the cell permeation agent with the cell permeation agent configured for local administration.

[0024] In some embodiments, the method of in vivo delivery of polyribonucleotides comprises The method includes applying a mixture containing an octylamine and an alcohol to a surface area of ​​the subject. In one embodiment, the method for in vivo delivery of polyribonucleotides comprises the steps of: The method includes applying a mixture including a cell permeation agent to a surface area of ​​the subject.

[0025] In some embodiments, the method of localized delivery of polyribonucleotides comprises In some embodiments, the method includes applying a mixture containing the alcohol and the solvent to a surface area of ​​the subject. In one embodiment, the method for localized delivery of polyribonucleotides comprises the steps of: The method includes applying a mixture containing the agent to a surface area of ​​the subject.

[0026] In some aspects, the method of delivering a therapeutic polyribonucleotide to a subject comprises administering the therapeutic polyribonucleotide to a subject. A mixture containing ribonucleotides and alcohol is applied to epithelial surfaces, endothelial surfaces, exposed tissues, In some embodiments, the therapeutic polyribonucleic acid (PPNA) is administered topically to a wound, such as a wound bed, or an open wound. A method for delivering a nucleotide to a subject includes a therapeutic polyribonucleotide and a cell permeation agent. The mixture is applied topically to an epithelial surface, an endothelial surface, exposed tissue, or an open wound. include.

[0027] In some embodiments, the method of treatment comprises administering a mixture comprising polyribonucleotides and alcohol. In some embodiments, the method further comprises applying the product to a surface area of ​​a subject having a pathology or disease. The method of treatment includes administering a mixture comprising a polyribonucleotide and a cell permeation agent to treat a pathology or disease. In some embodiments, the cell permeation agent comprises applying to a surface area of ​​a subject having In some embodiments, the alcohol is methanol, ethanol, Isopropanol, butanol, pentanol, cetyl alcohol, ethylene glycol , propylene glycol, denatured alcohol, benzyl alcohol, special denatured alcohol, Glycol, stearyl alcohol, cetearyl alcohol, menthol, polyethylene glycol (PEG)-400, ethoxylated fatty acids, and hydroxyethyl cellulose. In some embodiments, the alcohol comprises ethanol. In some embodiments, the ethanol, alcohol, or cell permeation agent is at least one of the mixture. Both are about 0.3% v / v to about 70% v / v, and at least about 0.3% v / v to about 60% v / v , at least about 0.3% v / v to about 50% v / v, at least about 0.3% v / v to about 40 %v / v, at least about 30%v / v to about 20%v / v, at least about 0.3%v / v About 15% v / v, at least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v, at least about 0.3% v / v to about 1% v / v, or at least about In some embodiments, ethanol ... The alcohol or cell permeabilizing agent comprises at least about 0.5% v / v to about 75% v / v of the mixture; At least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, At least about 10% v / v to about 75% v / v, at least about 15% v / v to about 75% v / v v, at least about 20% v / v to about 75% v / v, at least about 30% v / v to about 75% v / v v / v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 7 5% v / v, at least about 60% v / v to about 75% v / v, or at least about 70% v / v In some embodiments, the method further comprises: In some embodiments, the method further comprises mixing the povidone with a cell permeabilizing agent or alcohol. The polyribonucleotides are present in solid form prior to mixing. The ribonucleotides are lyophilized prior to mixing. The nucleotide is present in liquid form prior to mixing. The leutide is dissolved in a solvent prior to mixing. The octide comprises a payload or a sequence encoding a payload, and the payload is delivered to a cell. or have a biological effect on tissue. The peptide is present in an amount effective to have a biological effect on the cell, and the cell permeation agent is an amount effective to have a biological effect on the cell. The compound is present in an amount effective to have a biological effect on a cell or tissue. In some embodiments, the polyribonucleotide encodes a protein. In some embodiments, the protein is a therapeutic protein. In some embodiments, the wound healing protein is a growth factor. In some embodiments, the growth factor is EGF, PDGF, TGFβ, or VEGF. In some embodiments, the composition is a liquid, gel, lotion, paste, cream, or the like. In some embodiments, the polyribonucleotide is a linear In some embodiments, the polyribonucleotide is a In some embodiments, the polyribonucleotide is a capped or polyA In some embodiments, the polyribonucleotide is immunogenic. In some embodiments, the polyribonucleotide is non-immunogenic. In some embodiments, the polyribonucleotide is a cyclic polyribonucleotide. In some embodiments, the polyribonucleotide comprises modified ribonucleotides. In some embodiments, the composition has a pH of about 7. In some embodiments, the composition has a pH about the same as water. In some embodiments, the composition has a viscosity that is substantially In some embodiments, the composition is substantially free of hydrocarbons. In some embodiments, the composition is substantially free of cationic liposomes. In embodiments, the composition comprises a fatty acid, a lipid, a liposome, cholesterol, or any combination thereof. In some embodiments, the cell permeation agent is soluble in a polar solvent. In some embodiments, the cell permeation agent is insoluble in polar solvents. In some embodiments, the composition further comprises a pharma- ceutically acceptable excipient. In some embodiments, delivery is systemic. In some embodiments, delivery is local. In embodiments, the surface area is the skin, the oral cavity, the nasal cavity, the ear cavity, the gastrointestinal tract, the respiratory tract, the vagina, the cervix, The surface area is selected from the group consisting of intrauterine, urinary tract, and ocular surface areas. In the case of the gastrointestinal tract, respiratory tract, vagina, cervix, intrauterine, urinary tract, and eye, delivery may be by non-invasive procedures. In some embodiments, the epithelial lining of such surface areas is The applying comprises placing a drop of the mixture directly onto the surface area. In some embodiments, Application involves wiping the surface area with a patch, gel, or film in which the mixture is embedded. In some embodiments, applying comprises spraying the mixture onto the surface area. In some embodiments, the applying comprises administering the mixture to a subject by aerosolization. In some embodiments, the administering comprises administering the mixture to a subject via a suppository. In some embodiments, administration is via oral ingestion of a capsule containing the mixture. administering the mixture to the subject, the capsule being configured to release the mixture inside the gastrointestinal tract of the subject. In some embodiments, the cells comprise epithelial cells. , cyclic polyribonucleotides are at least 5%, at least 10%, At least 15%, at least 20%, at least 30%, at least 40%, at least At least 50%, at least 60%, at least 70%, at least 80%, at least 90% , at least 100%, at least 150%, at least 2 times, at least 3 times, less At least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least At least 9 times, at least 10 times, at least 20 times, at least 50 times, or at least 100-fold higher translation efficiency. In some embodiments, the circular polyribonucleotide is In some embodiments, the polynucleotide has a translation efficiency at least 5-fold higher than its linear counterpart. Ribonucleotides have short-term biological effects.

[0028] In some embodiments, the polyribonucleotides have a long-term biological effect. In some embodiments, the concentration of polyribonucleotides in the mixture is at least about 50 ng / mL, at least about 100 ng / mL, at least about 500 ng / mL, at least at least about 1 μg / mL, at least about 2 μg / mL, at least about 3 μg / mL, at least about 4 μg / mL, at least about 5 μg / mL, at least about 10 μg / mL, at least About 20 μg / mL, at least about 50 μg / mL, at least about 100 μg / mL, at least about 200 μg / mL, at least about 500 μg / mL, at least about 1 mg / mL , at least about 2 mg / mL, at least about 5 mg / mL, at least about 10 mg / mL , at least about 20 mg / mL, at least about 50 mg / mL, or at least about 100 mg / mL.

[0029] The present invention also provides kits that include the pharmaceutical compositions described herein. In an aspect, the kit comprises an application tool and a pharmaceutical composition of any one of the preceding embodiments. The application tool is configured to apply the pharmaceutical composition to a surface area of ​​a subject.

[0030] In some embodiments, the kit comprises a first application tool, a second application tool, a fungicide, and The composition includes a polyribonucleotide without any carrier and a diluent, The disinfectant application tool is configured to apply the disinfectant to the surface area of ​​the target, and a second application tool The disinfectant is configured to apply the composition to a surface area of ​​a subject. The microbial agent is alcohol, UV light, laser light, or heat. Alcohols include methanol, ethanol, isopropanol, butanol, pentanol, Cetyl alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzoyl Diethyl alcohol, specially denatured alcohol, glycol, stearyl alcohol, cetearyl Alcohol, menthol, polyethylene glycol (PEG)-400, ethoxylated fat In some embodiments, the cellulose acetate layer is selected from the group consisting of cellulose acetate, cellulose acetate ester, and hydroxyethyl cellulose. In some embodiments, the first application tool is a wipe. In some embodiments, the wipe contains a disinfectant. In some embodiments, the first application tool applies UV light or laser light. In some embodiments, the first application tool is a device that applies heat. It is.

[0031] In some embodiments, the kit includes an application tool and a polyribonucleotide and cell permeabilization kit. The application tool is configured to apply the mixture to a surface area of ​​a target. In some embodiments, the application tool or the second application tool is a pipette. In some embodiments, the application tool or the second application tool comprises a substrate. In some embodiments, the substrate is a natural or synthetic fiber. It is made.

[0032] In certain embodiments, the kit comprises a suppository. In some embodiments, the application tool includes a patch. Or the second application tool comprises a sprayer. In some embodiments, the application tool or The second application tool comprises a nebulizer. In some embodiments, the application tool or The second application tool is configured to release the mixture into the gastrointestinal tract of the subject. In some embodiments, the application tool or the second application tool controls the mixture. In some embodiments, the surface region is configured to release the , the surface areas of the oral cavity, nasal cavity, gastrointestinal tract, and respiratory tract, and any combination thereof. It is selected.

[0033] In another aspect, a kit comprises a composition described herein and an alcohol wipe. In another aspect, the kit comprises a composition as described herein and a method for application to a surface area of ​​a subject. The vial contains alcohol for the purpose of

[0034] definition The present invention will be described with reference to specific embodiments and to certain drawings, but the present invention The present invention is not limited thereto, but only by the scope of the claims. Unless paragraphs are specified, they are to be understood in their general meaning.

[0035] As used herein, the term "polynucleotide" refers to one or more nucleic acid subunits. or a molecule containing nucleotides, interchangeably referred to as "nucleic acid" or "oligonucleotide" The polynucleotides may be used for the following: adenosine (A), cytosine (C), guanine ( nucleotides selected from the group consisting of thymine (T) and uracil (U), or variants thereof; Nucleotides may include nucleosides and at least 1, 2, 3, 4, 5, It may contain 6, 7, 8, 9, 10 or more phosphate (PO3) groups. It consists of a nucleobase, a pentose sugar (either ribose or deoxyribose), and one or more ribosomal A ribonucleotide is a nucleotide in which the sugar is ribose. Ribonucleotides or ribonucleic acid, or RNA, are polymerized through phosphodiester bonds. Deoxyribonucleotides can refer to polymers that contain multiple ribonucleotides. It is a nucleotide in which the sugar is deoxyribose.

[0036] Polydeoxyribonucleotides or deoxyribonucleic acid, or DNA, are phosphodiesterases. It means a polymer containing multiple deoxyribonucleotides polymerized through nucleotide bonds. The nucleotide may be a nucleoside monophosphate or a nucleoside polyphosphate. The peptide includes a detectable tag, such as a luminescent tag or a marker (e.g., a fluorophore). , deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), Deoxyguanosine triphosphate (dGTP), uridine triphosphate (dUTP) and deoxy Thymidine triphosphate (dTTP), dNTPs, e.g., deoxyribonucleic acid It refers to deoxyribonucleoside polyphosphates such as deoxyribonucleoside triphosphates (dNTPs). A nucleotide may include any subunit that can be incorporated into a growing nucleic acid strand. Such a subunit can be A, C, G, T, or U, or one or more complementary A, C, , G, T, or U, or purine (i.e., A or G, or variants thereof) ) or any other complementary to a pyrimidine (i.e., C, T, or U, or a variant thereof). In some instances, the polynucleotide may be a deoxyribonucleic acid subunit. DNA, ribonucleic acid (RNA), or derivatives or variants thereof. In this case, the polynucleotide may be, for example, a short interfering RNA (siRNA). ), microRNA (miRNA), plasmid DNA (pDNA), short hairpin RNA A (shRNA), small nuclear RNA (snRNA), messenger RNA (mRNA ), precursor mRNA (pre-mRNA), and antisense RNA (asRNA). Nucleotide sequence and any of its structures, such as single-stranded, double-stranded, triple-stranded, helical, hairpin, etc. In some cases, the polynucleotide molecule is circular. Polynucleotides can be of various lengths. A nucleic acid molecule is at least 10 bases long. 20 bases, 30 bases, 40 bases, 50 bases, 100 bases, 200 bases, 300 bases, 40 0 bases, 500 bases, 1 kilobase (kb), 2kb, 3kb, 4kb, 5kb, 10kb Polynucleotides may be isolated from cells or tissues and may have a length of up to 50 kb or more. As embodied herein, a polynucleotide sequence can be isolated and purified. manufactured DNA / RNA molecules, synthetic DNA / RNA molecules, and synthetic DNA / RNA analogues may include.

[0037] Polynucleotides, such as polyribonucleotides or polydeoxyribonucleotides The present invention relates to a method for the preparation of nucleic acids that include non-standard nucleotides, non-naturally occurring nucleotides, nucleotide analogs, and / or modified nucleotides. Modified nucleotides may include one or more nucleotide variants, including nucleotides such as are diaminopurine, 5-fluorouracil, 5-bromouracil, and 5-chlorouracil. , 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-( (carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thio Uridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D -Galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylglucose inosine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylaminoguanine, Chiruguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methyl Guanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil Sil, beta-D-mannosylqueuosine, 5'-methoxycarboxymethyluracil , 5-Methoxyuracil, 2-Methylthio-D46-Isopentenyladenine, Uracil -5-oxyacetic acid (v), wybutoxocin, pseudouracil, queosine, 2-thiamine Ocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5 -Methyluracil, Uracil-5-oxyacetic acid methyl ester, Uracil-5-oxyacetic acid Acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxy propyl)uracil, (acp3)w, 2,6-diaminopurine, etc. In some cases, the nucleotide may include, but is not limited to, a modification to the triphosphate moiety. Non-limiting examples of such modifications include: For example, longer phosphate chains (e.g., 4, 5, 6, 7, 8, 9, 10 or more phosphate moieties) phosphate chains) and modifications with thiol moieties (e.g., alpha-thiotriphosphate and beta-thiotriphosphate). Nucleic acid molecules also include base moieties (e.g., usually complementary One or more atoms available to form hydrogen bonds with a suitable nucleotide and / or , one or more atoms that cannot form a hydrogen bond with a complementary nucleotide), sugar moiety or phosphate The nucleic acid molecule may also be modified at the backbone by N-hydroxysuccinimide esters (NHS Aminoallyl-dUTP (aa-dU) allows for the covalent attachment of amine-reactive moieties such as TP) and aminohexylacrylamide-dCTP (aha-dCTP) Modification groups may be included. Standard DNA base pairs or R Alternatives to NA base pairs offer higher density in bits per cubic mm, higher security ( Resistant to accidental or deliberate synthesis of natural toxins), light-programmed polymerase This may provide easier discrimination in enzymes or reduced secondary structure. Such alternative base pairs compatible with native and mutant polymerases for synthesis are Betz K, Malyshev DA, incorporated herein by reference for this purpose. , Lavergne T, Welte W, Diederichs K, Dwyer T J, Ordoukhanian P, Romesberg FE, Marx A. Nat .Chem.Biol.2012 Jul;8(7):612-4.

[0038] Polyribonucleotides can exist in either linear or circular form. When used, the terms "linear RNA" or "linear polyribonucleotide" are used interchangeably. It is used to mean a polyribonucleotide having free 5' and 3' ends. In some embodiments, the linear RNA has a free 5' or 3' end. In this state, the linear RNA has a non-covalently linked 5' or 3' end. As used herein, the term "circRNA" or "circular polyribonucleotide" or "circular "RNA" is used interchangeably and refers to a polymer that forms a ring structure through covalent or non-covalent bonds. In some cases, a cyclic polyribonucleotide refers to The typical free 5' and 3' ends of the corresponding linear polyribonucleotides are covalently or or non-covalently or non-nucleic acid linkers (e.g., non-nucleic acid polymers or proteins). In some cases, the present invention has continuous loops that are joined together via The circular polyribonucleotides provided herein are linked together via covalent or non-covalent bonds. Two or more linear polyribonucleic acids that are linked together to form a continuous loop structure. Without being bound by theory, it is believed that multiple nucleotides of RNA can be formed. A segment is finally circularized when only one 5' and one 3' free end remain. The DNAs are annealed to produce "threads" of RNA that can be ligated to their 5' and from the 3' free end.

[0039] As used herein, a "polypeptide" refers to a molecule that is most often linked by peptide bonds. It means a polymer of amino acid residues (natural or non-natural) linked together. As used, the term refers to a protein, polypeptide, or polypeptide of any size, structure, or function. Polypeptides include gene products, naturally occurring polypeptides, synthetic synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide may be a single molecule or a dimer. They may also be multi-molecular complexes such as single chain or antibody complexes. or may comprise a multi-chain polypeptide such as insulin, and may be associated or The most common disulfide bonds are found in multi-chain polypeptides. The term polypeptide refers to a polypeptide in which one or more amino acid residues are not part of a corresponding naturally occurring The invention may also be applied to amino acid polymers that are artificial chemical analogues of the amino acids involved.

[0040] As used herein, the term "mixture" refers to a material made of two or more different substances that are mixed together. In some cases, the mixtures described herein refer to materials that are made up of two or more The mixture may be a homogenous mixture of the above different substances, e.g., the mixture may be any given mixture of A sample may have the same proportions of its components (e.g., two or more substances) throughout the sample. In some cases, a mixture as provided herein may comprise two or more different substances. It may be a heterogeneous mixture of substances, e.g., the components of the mixture (e.g., two or more substances) The proportion of may vary throughout the mixture. In some cases, the mixture comprises A liquid solution, e.g., the mixture is in the liquid phase. A solution may be considered to include a liquid solvent and a solute. Mixing a solute in a liquid solvent In some cases, a liquid solution may be a liquid solution in a liquid. Liquids (e.g., liquid solutes dissolved in a liquid solvent), solutions of solids in liquids (e.g., a solution of a gas in a liquid (e.g., a solid solute dissolved in a liquid solvent) or In some cases, more than one solvent and / or more than one solute is present. In some cases, the mixture may be a colloid, a liquid suspension, or an emulsion. In some cases, the mixture is a solid mixture, e.g., the mixture is It is present in the solid phase.

[0041] As used herein, the term "cell permeation agent" refers to an agent that, when contacted with a cell, penetrates into the cell. In some cases, a cell permeation agent refers to an agent that promotes cell migration. Direct electrostatic interactions with negatively charged phospholipids of the membrane or with membrane proteins or phospholipids through transient pore formation by inducing conformational changes in the plasma bilayer. In some cases, cell penetrating agents promote direct penetration of endocytosis. For example, under certain circumstances, cell penetration agents can be used to Cells can be stimulated to undergo the process of endocytosis, which results in The membrane can fold inwardly within the cell. In certain embodiments, the cell penetrating agent is Helps form transient structures that transport across cell membranes. Without the need for a cell permeation agent, the cell permeation agent as provided herein increases the permeability of the cell membrane. or increased internalization of the molecule into the cell, resulting in Delivery into cells can be achieved when cells are simultaneously contacted with a cell permeation agent, as well as when the cell is not contacted with a cell permeation agent. This may be more efficient compared to the same delivery of

[0042] As used herein, the term "payload" refers to a polysaccharide as disclosed herein. It refers to any molecule delivered by ribonucleotides. The payload may be a nucleic acid, a protein, a chemical, a ribonucleoprotein, or any combination thereof. In some cases, the payload is a polynucleotide as disclosed herein. In some cases, a payload is a nucleic acid sequence that is directly contained within a polynucleotide. Loading can be achieved by, for example, complementary hybridization or protein-nucleic acid interactions. via a polyribonucleotide as disclosed herein or In certain cases, the payload is contained within a polyribonucleotide. A protein encoded by a nucleic acid sequence that is attached to, bound to, or associated with the protein. In some cases, a "bond" refers to a covalent or non-covalent bond between two molecules. In some cases, the interaction between the payload and the polyribonucleic acid When used in the context of interactions between octides, "association" refers to the interaction between a payload and a It means that it is indirectly linked to a polyribonucleotide via one or more other molecules. In some cases, the binding or association may be transient. In this case, the payload may be responsive to, for example, the pH conditions of the environment or the presence or absence of a stimulus or binding partner. Depending on the type of protein, it may be bound to or associated with polyribonucleotides under certain conditions. , but not under other conditions.

[0043] The term "biological effect on a cell" refers to a change, e.g., a morphological change on or in a cell. It means any effect on a cell that can result in a biological or functional change. For example, The biological effect on a cell may be acceleration or deceleration of cell proliferation, survival, apoptosis, or Cell necrosis, gene transcription and mRNA translation, and the functionality of specific differentiated cells (e.g. For example, activation of immune cells, excitation or inhibition of neurons, and release of hormones from hormone-secreting cells. These include, but are not limited to, cellular mechanisms such as cellular proliferation, secretion of phospholipase A, or phagocytic activity by macrophages. Changes in intracellular signaling that affect the function of the cell or the efficiency of entry of foreign molecules into the cell. This may include a change in the rate of cell proliferation, for example an increase or decrease in cell permeability to foreign molecules. The biological effect on the cell may include, but is not limited to, a disease caused by a disease that affects the subject. This may result in the amelioration of the above symptoms, or the treatment or eradication of the disease in the subject.

[0044] The term "biological effect on a tissue" refers to a change, e.g., a morphological change on or in a tissue. It means any effect on a tissue that can cause a biological or functional change. For example, The biological effects on tissues include acceleration or deceleration of cell proliferation in the tissue, tissue survival, apoptosis of cells or necrosis of tissues, gene transcription and mRNA translation of cells in tissues, as well as affecting cellular functions, including but not limited to the functionality of specific differentiated tissues. Changes in signal transduction within tissues that affect tissue function or the combination of foreign molecules Changes in the efficiency of transport into tissues, e.g., increased tissue permeability to foreign molecules or The biological effect on the tissue may include, but is not limited to, a reduction in the amount of tissue that the subject is afflicted with. or resulting in the amelioration of one or more symptoms of a disease in a subject. possible.

[0045] The term "alcohol" refers to any compound having a hydroxyl functional group (-OH) attached to a carbon. Alcohol as discussed herein refers to a monohydric alcohol, These may include polyhydric alcohols, unsaturated aliphatic alcohols, and alicyclic alcohols. In some cases, alcohol may refer to ethanol. In some cases, the alcohol is methanol, ethanol, isopropanol, Butanol, pentanol, cetyl alcohol, ethylene glycol, propylene glycol Alcohol, denatured alcohol, benzyl alcohol, special denatured alcohol, glycol, stearyl alcohol Alcohol, Cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG )-400, ethoxylated fatty acids, and hydroxyethyl cellulose, Not limited to.

[0046] As used herein, the term "surface area" of a subject's body refers to the area of ​​the subject's body that is exposed to the external environment. "exposed" means any area of ​​a subject that is exposed or has the potential to be exposed; For example, surface areas of a mammalian body, e.g., a human body, include the skin, the oral cavity, the nasal cavity, the ear cavity, These may include the gastrointestinal tract, respiratory tract, vagina, cervix, intrauterine, urinary tract, and surface areas of the eye. In some cases, the surface area of ​​the subject's body is often an outer layer on which epithelial cells are lined. For example, skin can refer to one type of surface region as discussed herein. It may be composed of the epidermis and the dermis, the former forming the outermost layer of the skin and often The endothelial cells may contain organized collections of epithelial cells among other cell types.

[0047] As used herein, the term "localized delivery" refers to delivery by non-invasive means, such as to the intestinal tract and other The present invention relates to delivery of a substance to the skin or epithelial layer accessible through the gastrointestinal (GI) epithelium or vaginal epithelium of the Local delivery of a pharmaceutical composition may have a local pharmacodynamic effect on the subject. For example, a locally delivered pharmaceutical composition may be administered to a subject in the body (e.g., In some other embodiments, the compound has a pharmacodynamic effect at or near a specific portion of the skin. The local delivery of pharmaceutical compositions as discussed herein may be accomplished by any of a variety of delivery modalities (e.g., specific Although the term is used to refer only to topical application to a surface area, pharmaceutical compositions may also be used for topical or systemic applications. For example, the pharmaceutical composition may have a pharmacodynamic effect, such as a localized effect at or near the site of administration. The drug may remain locally or enter the circulatory system (e.g., blood or lymphatic system) of the subject's body. Preferably, the pharmaceutical composition is delivered to the body via a route other than the circulatory system. It can be delivered to remote parts of the body that are otherwise inaccessible.

[0048] As used herein, the term "systemic delivery" or "systemic administration" refers to the administration of a pharmaceutical composition or other Systemic administration refers to a route of administration of a substance into the circulatory system (e.g., blood or lymphatic system). administration, parenteral administration, intranasal administration, sublingual administration, rectal administration, transdermal administration, or any combination thereof. As used herein, the term "non-systemic delivery" or "non-systemic administration" refers to a pharmaceutical It may refer to any other route of administration that is not systemic delivery of a composition or other substance, e.g. The delivered material does not enter the circulatory system (eg, blood and lymphatic system) of the subject's body.

[0049] As used herein, the term "expressed sequence" refers to a sequence that is used to express a product, e.g., a peptide or polypeptide. A nucleic acid sequence encoding a peptide or polypeptide, or a regulatory nucleic acid. An exemplary expression sequence for loading may include multiple nucleotide triplets, each of which may include , which can code for an amino acid, and are called "codons."

[0050] As used herein, the term "modified ribonucleotide" refers to a ribonucleotide that has a modified sugar, nucleobase, or nucleotide. It means a nucleotide having at least one modification to the internucleotide bond.

[0051] As used herein, the term "substantially resistant" refers to a resistance to at least 50% of a standard. , 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% , 97%, 98% or 99% resistance.

[0052] As used herein, the term "immunogenic" refers to the potential to induce an immune response against a substance. In some cases, an immune response refers to the ability of an organism's immune system or a certain type of immune system to The term "non-immunogenic" refers to immune cells that can be induced when exposed to an immunogenic substance. In some cases, the term may refer to the absence or lack of an immune response above a detectable threshold to a specific antigen. In this case, an immune response is the reaction of an organism's immune system, or certain types of immune cells, to a non-immunogenic substance. In some cases, the non-immune The immunogenic polyribonucleotides, when measured by an immunogenicity assay, are For example, using an immunogenicity assay, the circular polyribonucleic acid does not induce an immune response greater than 100 μg / ml. When measuring antibodies raised against nucleotides, non-immune Epidemic polyribonucleotides can elicit the production of antibodies at levels below a predefined threshold The predefined threshold may be, for example, a maximum of 1.5-fold, 2-fold, or more of the antibody produced by the reference control. The level may be 2-fold, 3-fold, 4-fold, or 5-fold.

[0053] As used herein, the term "complex" refers to at least two molecules that have affinity for each other. It refers to an association between moieties (eg, chemicals or biochemicals).

[0054] "Polypeptide" and "protein" are used interchangeably and are used to refer to any bond that is linked by a covalent bond (e.g., amino acid). The term "amino acid" refers to a polymer of two or more amino acids linked together by bond (a bond). The polypeptide as described herein is intended to mean a full-length protein (e.g., a fully processed protein). proteins) and shorter amino acid sequences (e.g., fragments of naturally occurring proteins or synthetic A polypeptide may contain naturally occurring amino acids (e.g., natural Commonly found in naturally synthesized peptides and have the one-letter abbreviations A, R, N, C, and D. 2 known by Q, E, G, H, I, L, K, M, F, P, S, T, W, Y and V 0 amino acids) and non-naturally occurring amino acids (e.g., synthetic amino acids, Natural and synthetic peptides containing amino acid analogs, modified amino acids, and amino acid mimetics (an amino acid that is not one of the 20 amino acids commonly found in .

[0055] As used herein, the term "carrier" refers to a covalently attached cyclic polyribonucleotide. The composition ( Compounds and compositions that promote the transport or delivery of cyclic polyribonucleotides (e.g., cyclic polyribonucleotides) into cells. Carriers refer to any substance, reagent, or molecule. Non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-type materials), nanoparticles (e.g. Nanoparticles encapsulating or covalently attached to circular polyribonucleotides, vesosomes, fusosomes, ex vivo differentiated reticulocytes, exosomes, protein carriers (e.g., proteins covalently bound to a circular polyribonucleotide), or cationic A carrier (eg, a cationic lipopolymer or a transfection reagent).

[0056] As used herein, the terms "pharmacologically acceptable" and "therapeutically acceptable" mean and are used interchangeably. A "pharmaceutical acceptable" component is one that is biologically or otherwise desirable. means a component that is not an undesirable component, e.g., a component that is incorporated into a pharmaceutical formulation of the present invention or may be administered to a patient as described herein, and any significant It does not cause any undesirable biological effects or any of the other ingredients of the formulation in which it is contained. The term "therapeutically acceptable" refers to an excipient that does not interact with the When used in food, it is important to ensure that the ingredients meet the required standards of toxicity testing and manufacturing testing. or that the ingredient has been approved by the U.S. Food and Drug Administration Included in the inactive ingredients guide prepared by the Food and Drug Administration This means that...

[0057] As used herein, the term "naked delivery" or "naked RNA" refers to delivery of a nucleic acid molecule to a host cell without the aid of a carrier. and without covalent modification to moieties that aid in delivery to cells. Naked delivery formulations refer to formulations of RNA for delivery to the host cell. It does not include cationic carriers, carbohydrate carriers, nanoparticle carriers, or protein carriers. A naked delivery formulation of a cyclic polyribonucleotide is a cyclic polyribonucleotide that does not have any covalent modifications. A formulation containing a polynucleotide and no carrier.

[0058] As used herein, the term "diluent" refers to a diluent that is used in the compositions described herein (e.g., A composition containing a cyclic polyribonucleotide may be diluted or dissolved in an inert solvent. A diluent refers to a medium that contains a solvent. A diluent refers to an RNA solubilizing agent, a buffer, an isotonicity agent, or a mixture thereof. The diluent may be a liquid diluent or a solid diluent. Examples include water or other solvents, solubilizers and emulsifiers, such as ethyl alcohol, isopropyl alcohol, Propyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate , propylene glycol, 1,3-butylene glycol, dimethylformamide, oil (especially Cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil. oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol and Solid diluents include fatty acid esters of sorbitan, and 1,3-butanediol. Non-limiting examples include calcium carbonate, sodium carbonate, calcium phosphate, dibasic calcium carbonate, Calcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactate sucrose, cellulose, crystalline cellulose, kaolin, mannitol, sorbitol , inositol, sodium chloride, dry starch, corn starch, or powdered sugar Some examples include:

[0059] As used herein, the term "bactericide" refers to a bacteriostatic, bacteriocidal, and / or active Any agent that effectively kills, inactivates, or prevents the growth of microorganisms. The germicide that kills microorganisms may be an antibacterial agent and / or an antiseptic. In form, germicides are liquids such as alcohol, iodine, or hydrogen peroxide. In some embodiments, the germicidal agent is UV light or laser light. The sterilizing agent is heat, delivered electrically or by other means (eg, steam, contact).

[0060] Incorporation by Reference All publications, patents, and patent applications mentioned herein are hereby incorporated by reference in their entirety. , patents, or patent applications are specifically and individually indicated to be incorporated by reference. It is hereby incorporated by reference to the same extent.

[0061] The following detailed description of the embodiments of the present invention is better understood when read in conjunction with the accompanying drawings. It will be understood that, for purposes of illustrating the invention, the embodiments illustrated herein are shown in the drawings. However, the present invention does not depend on the precise arrangement and construction of the embodiment shown in the drawings. It should be understood that the present invention is not limited to the above embodiment. [Brief description of the drawings]

[0062] [Figure 1] Exemplary linear and circular RNAs, both of which were delivered topically to the skin of mouse ears, and their RNA levels in ear tissue were examined over a period ranging from 6 hours to 3 days after delivery. [Diagram 2]Figures 2A and 2B are plots summarizing qPCR results from mouse ear punches 6 hours, 1 day, 3 days, or 12 days after localized delivery of linear or circular RNA with the aid of Boost (ethanol). Figure 2A shows results from a qPCR assay using primers for detection of both linear and circular RNA. Figure 2B shows results from a qPCR assay using primers for detection of circular RNA but not linear RNA. [Diagram 3] Figures 3A and 3B are plots summarizing qPCR results from mouse ear punches 6 hours, 1 day, 3 days, or 12 days after localized delivery of linear or circular RNA with the aid of both Boost (ethanol) and TransIT mRNA Reagent (Mirus Bio, LLC), a cationic, non-liposomal polymeric lipid transfer agent. Figure 3A shows results from a qPCR assay using primers for detection of both linear and circular RNA. Figure 3B shows results from a qPCR assay using primers for detection of circular RNA but not linear RNA. [Figure 4] Protein expression from RNA administered locally using DMSO gel (RNA) or DMSO gel alone (vehicle) is shown. [Diagram 5] 1 shows protein expression from topically administered RNA formulated in Johnson & Johnson Baby Lotion (RNA) or Johnson & Johnson Baby Lotion alone (vehicle). [Figure 6] Protein expression from RNA administered locally with ethanol (RNA) or ethanol alone (vehicle) is shown. [Figure 7] Fluorescence images (B / W) show that local administration of circRNA-Cy5 results in RNA delivery to tissues. [Figure 8] Quantification of fluorescent images shows that local administration of circRNA-Cy5 results in RNA delivery to tissues. [Figure 9] Fluorescence images (B / W) show that local administration of mRNA-Cy5 results in RNA delivery to tissues. [Figure 10] Quantification of fluorescent images shows that local administration of mRNA-Cy5 results in RNA delivery to tissues. [Figure 11] 1 shows that topical administration of mRNA results in RNA delivery to tissues on days 1 and 4 after administration when the tissues are wiped with an ethanol wipe prior to application. [Figure 12] 1 shows that topical administration of mRNA results in RNA delivery to tissues on days 1 and 4 after administration when the tissues are wiped with an isopropyl alcohol wipe prior to application. [Figure 13] 1 shows that topical administration of circular RNA results in RNA delivery to tissues on days 1 and 4 after administration when the tissues are wiped with an ethanol wipe prior to application. [Figure 14] 1 shows that local administration of circular RNA mixed with 10% ethanol results in RNA delivery to tissues on days 1 and 4 after administration. [Figure 15] 1 shows that local administration of circular RNA mixed with 10% isopropyl alcohol results in RNA delivery to tissues on days 1 and 4 after administration. [Figure 16] 1 shows that topical administration of circular RNA results in RNA delivery to tissues on days 1 and 4 after administration when the tissues are wiped with an isopropyl alcohol wipe prior to application. [Figure 17] We show that topical administration of linear mRNA mixed with PBS, PBS and 10% ethanol, or PBS and 10% isopropyl alcohol results in RNA delivery to tissues on the 1st day after administration, and that topical administration of linear mRNA mixed with PBS and 10% ethanol or PBS and 10% isopropyl alcohol results in RNA delivery to tissues on the 4th day after administration. [Figure 18] We show that topical administration of circRNA results in functional protein expression in tissues when the tissue is wiped with an ethanol wipe prior to application. [Figure 19] We show that local administration of circRNA results in RNA delivery to tissues when circRNA is administered with 10% ethanol. [Figure 20] We show that local administration of circRNA results in RNA delivery to tissues when circRNA is administered with 10% isopropyl alcohol. [Figure 21] 1 shows that topical administration of mRNA results in RNA delivery to tissues when the skin is wiped with an ethanol wipe prior to application. [Figure 22] 1 shows that local administration of mRNA results in RNA delivery to tissues when the mRNA is administered with PBS alone. [Diagram 23] We show that local administration of mRNA results in RNA delivery to tissues when the mRNA is administered with 10% isopropyl alcohol. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0063] The present disclosure generally relates to pharmaceutical compositions, preparations, and delivery of polyribonucleotides and their applications. Polyribonucleotides include linear polyribonucleotides, circular polyribonucleotides, and the like. leotide (circRNA), or a combination thereof.

[0064] In some aspects, the present disclosure provides a composition for delivering polyribonucleotides to a cell. In some cases, the compositions and methods provided herein include In some embodiments, the polyribonucleotides are delivered into cells ex vivo or in vivo. In some embodiments, the compositions and methods provided herein include a method for administering a polyribonucleic acid (PNA) fragment to a cell of a subject. In some cases, the compositions provided herein are particularly useful for the local delivery of and methods for administering polyribonucleic acid to a subject for therapeutic applications, such as prevention or treatment of a disease. Deliver the chid.

[0065] The compositions disclosed herein contain polyribonucleotides and alcohol, such as ethanol. The methods disclosed herein may include a mixture of polyribonucleotides and ethanol. The polyribonucleotides can be delivered in a composition containing a mixture of alcohols such as alcohol. In some aspects, the present disclosure provides methods for the preparation of polyribonucleotides and The present invention provides a kit that includes an alcohol (e.g., ethanol) for intracellular delivery of a leucine. In some embodiments, the kit includes a disinfectant. The sample was washed with polyribonucleotides and alcohol wipes (e.g., ethanol wipes, isoprene wipes, etc.). Includes Ropil Wipes.

[0066] The compositions disclosed herein include a mixture of polyribonucleotides and a cell permeation agent. The methods disclosed herein include a mixture of polyribonucleotides and a cell permeation agent. In some embodiments, the method may include delivering the polyribonucleotide in a composition comprising: The present disclosure relates to polyribonucleotides and methods for delivering polyribonucleotides into cells. Kits are provided that include a cell permeation agent. In some embodiments, the kits include a bactericidal agent. .

[0067] The compositions disclosed herein comprise polyribonucleotides and dilute polyribonucleotides free of any carrier. The composition may be a composition comprising a diluent. The composition may be used in a method of delivery to an epithelial cell. obtain.

[0068] In some embodiments, the compositions, therapeutic compositions, or pharmaceutical compositions described herein The agent is administered directly to a surface area (e.g., a topical surface area). The compositions, therapeutic compositions, or pharmaceutical compositions described herein may be used after application of a fungicide. is applied to the surface area of ​​the target.

[0069] The compositions, methods, and kits provided herein include methods for delivering polyribonucleotides into cells. Polyribonucleotides can provide a simple and effective solution for delivery. can be delivered into cells more efficiently in the presence of a cell-penetrating agent than in the absence of the cell-penetrating agent. In some cases, the cell permeation agents described herein are capable of inhibiting the cell permeation in the absence of a cell permeation agent. at least about 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 15 0%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 80 0%, 900%, 1000%, 2000%, 5000%, 8000%, 10,000%, It is possible to increase the efficiency of polynucleotide delivery by 20,000% or 50,000%. can.

[0070] Compositions for polyribonucleotide delivery In some aspects, the present disclosure provides compositions or pharmaceutical compositions for delivering polyribonucleotides. The pharmaceutical composition is provided for delivering polyribonucleotides to cells. The composition or pharmaceutical composition may contain alcohol (e.g., ethanol) for cell permeabilization. The cell permeation agent may be used to enhance delivery of the polyribonucleotide into cells. Polyribonucleotides can exist in either a linear or circular form.

[0071] In some cases, the compositions or pharmaceutical compositions provided herein are useful for therapeutic applications. For example, polyribonucleotides are preferred because they have a therapeutic effect when the composition is administered to a subject. In some embodiments, the polyribonucleoside is a therapeutic polyribonucleotide having the desired therapeutic effect. Tid encodes a protein that promotes wound healing.

[0072] In certain aspects, the present disclosure provides therapeutic compositions and compositions described herein, therapeutic In some embodiments, the present invention provides a method for administering a composition or pharmaceutical composition. The compositions, therapeutic compositions, or pharmaceutical compositions described herein may be administered to a surface area (e.g., a topical surface area). In some embodiments, the compositions, therapeutic agents, and methods described herein are administered directly to the tumor. The therapeutic, or pharmaceutical, composition is applied to the surface area of ​​the subject following application of the germicide.

[0073] The cell penetration agent is configured to enhance delivery of the polyribonucleotide into a cell. In some cases, the compositions provided herein are suitable for therapeutic applications, e.g. The polyribonucleotide is a therapeutic polypeptide that has a therapeutic effect when the composition is administered to a subject. In an aspect, the present disclosure relates to therapeutic compositions and The present invention provides a method for administering a therapeutic composition comprising the steps of: The compound may be present in any form.

[0074] The compositions or pharmaceutical compositions as described herein may be used for wound treatment. For example, a method for treating a wound may include treating the wound, or tissue surrounding the wound, with any of the methods described herein. In some embodiments, the method may include contacting the subject with a composition or pharmaceutical composition as described above. The polyribonucleotide of the composition or pharmaceutical composition is selected from EGF, PDGF, TGFβ, or contains sequences encoding growth factors such as VEGF.

[0075] alcohol Alcohols as described herein can be used to facilitate intracellular delivery of polyribonucleotides. Alcohol can be used for the delivery of polyribonucleotides into cells. , may be in a mixture with polyribonucleotides as described herein. The product may contain at least about 0.3% v / v to about 75% v / v alcohol. In some embodiments, the mixture is applied to a surface area of ​​a subject. In some embodiments, the mixture is a pharmaceutical composition.

[0076] The alcohol can be any alcohol that contains one or more hydroxyl functional groups. In some cases, the alcohol may be a monohydric alcohol, a polyhydric alcohol, or an unsaturated aliphatic alcohol. The alcohol may be, but is not limited to, a methyl alcohol or an alicyclic alcohol. Alcohol, ethanol, isopropanol, butanol, pentanol, cetyl alcohol Alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzyl alcohol , special denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol, methyl ntol, polyethylene glycol (PEG)-400, ethoxylated fatty acids, or hydrochloric acid. In certain embodiments, the composition may include one or more of the following: alcohol, ethyl cellulose ... is ethanol.

[0077] In other cases, the compositions, pharmaceutical compositions, and methods provided herein are intended to be used in the treatment of alcohol. The present invention is not limited to the use of any other agent that enhances the delivery of polyribonucleotides into cells. In some cases, the alcohol is ethanol. The compositions, pharmaceutical compositions, and methods enhance intracellular delivery of polyribonucleotides. Does not have or use any other medications. In some cases, alcohol is In some cases, the alcohol is not a cell permeation agent.

[0078] The compositions disclosed herein include a mixture of alcohol and polyribonucleotides. In some cases, the polyribonucleotide is premixed with alcohol. In some cases, the polyribonucleotide is present in a mixture. In these cases, the polyribonucleotide is provided separately from the alcohol. When applied to cells, it is in contact with alcohol and induces the incorporation of polyribonucleotides into cells. Without being bound to any particular theory, the alcohols in the mixture are mixed together for delivery. The concentration of alcohol may contribute to the efficiency of delivery. The alcohol is provided in a mixture at a predetermined concentration. Cole and polyribonucleotides, initially separate, have been applied for delivery When mixed together, the alcohol is dissolved in sufficient amounts to form polyribonucleotides. to ensure that a minimum predetermined concentration is reached in the mixture.

[0079] In some cases, the alcohol is at least about 0.01% of the mixture, at least At least about 0.02%, at least about 0.03%, at least about 0.04%, at least about 0. 05%, at least about 0.06%, at least about 0.07%, at least about 0.08%, At least about 0.09%, at least about 0.1%, at least about 0.2%, at least about 0.3%, at least about 0.4%, at least about 0.5%, at least about 0.6%, at least about 0.7%, at least about 0.9%, at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 20% , at least about 30%, at least about 40%, at least about 50%, at least about 60% , at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 98% volume per volume (v / v). In this case, alcohol may be present in a maximum of about 0.01%, a maximum of about 0.02%, or a maximum of about 0.03% of the mixture. , maximum approximately 0.04%, maximum approximately 0.05%, maximum approximately 0.06%, maximum approximately 0.07%, maximum approximately 0.08%, maximum approximately 0.09%, maximum approximately 0.1%, 0.2%, 0.3%, 0.4%, 0. 5%, 0.6%, 0.7%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8% %, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 9 In some cases, the alcohol comprises about 10%, about 20%, or about 30% of the mixture. 0%, approx. 30%, approx. 40%, approx. 50%, approx. 60%, approx. 70%, approx. 80%, approx. 90%, approx. 5%, about 98%, or about 100% v / v.

[0080] In some cases, the alcohol is at least about 0.01% of the mixture, at least At least about 0.02%, at least about 0.03%, at least about 0.04%, at least about 0. 05%, at least about 0.06%, at least about 0.07%, at least about 0.08%, At least about 0.09%, at least about 0.1%, at least about 0.2%, at least about 0.3%, at least about 0.4%, at least about 0.5%, at least about 0.6%, at least about 0.7%, at least about 0.9%, at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 20% , at least about 30%, at least about 40%, at least about 50%, at least about 60% , at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 98% weight per weight (w / w). In this case, alcohol may be present in a maximum of about 0.01%, a maximum of about 0.02%, or a maximum of about 0.03% of the mixture. , maximum approximately 0.04%, maximum approximately 0.05%, maximum approximately 0.06%, maximum approximately 0.07%, maximum approximately 0.08%, maximum approximately 0.09%, maximum approximately 0.1%, 0.2%, 0.3%, 0.4%, 0. 5%, 0.6%, 0.7%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8% %, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 9 In some cases, the cell permeation agent comprises about 10%, about 20%, or about 30% of the mixture. 0%, approx. 30%, approx. 40%, approx. 50%, approx. 60%, approx. 70%, approx. 80%, approx. 90%, approx. 5%, or about 98% w / w. In some cases, the alcohol comprises It accounts for approximately 10% v / v.

[0081] In some embodiments, the alcohol comprises at least about 0.5% v / v to about 7% v / v of the mixture. 5% v / v, at least about 1% v / v to about 75% v / v, at least about 5% v / v to about 7 5% v / v, at least about 10% v / v to about 75% v / v, at least about 15% v / v About 75% v / v, at least about 20% v / v to about 75% v / v, at least about 30% v / v v to about 75% v / v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or less About 70% v / v to about 75% v / v, or any percentage v / v therebetween In some embodiments, the alcohol comprises at least about 0.3% v / v of the mixture. ~ about 70% v / v, at least about 0.3% v / v~ about 60% v / v, at least about 0.3 %v / v to about 50%v / v, at least about 0.3%v / v to about 40%v / v, at least About 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v, a little At least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v , at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to It comprises about 0.5% v / v, or any percentage v / v therebetween.

[0082] In some cases, the mixtures described herein are liquid solutions. For example, The alcohol is the liquid substance itself. In these cases, polyribonucleotides may also be dissolved in a liquid solution.

[0083] In some cases, ethanol is at least about 0.1% of the mixture, at least About 0.2%, at least about 0.3%, at least about 0.4%, at least about 0.5%, At least about 0.6%, at least about 0.7%, at least about 0.9%, at least about 1% , at least about 2%, at least about 3%, at least about 4%, at least about 5%, At least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 1 0%, at least about 20%, at least about 30%, at least about 40%, at least about 5 0%, at least about 60%, at least about 70%, at least about 80%, at least about 9 occupying 0%, at least about 95%, or at least about 98% of the volume per volume (v / v) In some cases, ethanol may be present in a mixture at up to about 0.1%, 0.2%, or 0. .3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.9%, 1%, 2%, 3%, 4% ,5%,6%,7%,8%,9%,10%,20%,30%,40%,50%,60%, In some cases, the ethanol comprises 70%, 80%, or 90% v / v. About 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about In some cases, the composition may comprise 80%, about 90%, about 95%, about 98%, or about 100% v / v. In this case, ethanol makes up about 10% v / v of the mixture.

[0084] In some embodiments, ethanol is at least about 0.5% v / v to about 7% v / v of the mixture. 5% v / v, at least about 1% v / v to about 75% v / v, at least about 5% v / v to about 7 5% v / v, at least about 10% v / v to about 75% v / v, at least about 15% v / v About 75% v / v, at least about 20% v / v to about 75% v / v, at least about 30% v / v v to about 75% v / v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or less About 70% v / v to about 75% v / v, or any percentage v / v therebetween In some embodiments, ethanol comprises at least about 0.3% v / v of the mixture. ~ about 70% v / v, at least about 0.3% v / v~ about 60% v / v, at least about 0.3 %v / v to about 50%v / v, at least about 0.3%v / v to about 40%v / v, at least About 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v, a little At least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v , at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to It comprises about 0.5% v / v, or any percentage v / v therebetween.

[0085] Cell permeabilization agents The cell penetration agents described herein enhance delivery of polyribonucleotides into cells. The cell permeation agent may include any substance. The cell permeation agent may include an organic compound or an inorganic molecule. In some cases, the cell permeation agent is an alkane, an alkene, or an arene; a halogen-substituted alkane , alkenes, and allenes; alcohols, phenols (derivatives of benzene), ethers, azobenzenes, These include, but are not limited to, aldehydes, ketones, and carboxylic acids; amines and nitriles. In some embodiments, the compound is an organic compound having one or more functional groups that are not capable of penetrating cells. In some embodiments, the cell permeation agent is soluble in the polar solvent. Polyribonucleotides can exist in either linear or circular form.

[0086] Cell permeabilization agents include organic compounds such as alcohols that have one or more hydroxyl functional groups. In some cases, the cell permeation agent may include a monohydric alcohol, a polyhydric alcohol, Alcohols such as, but not limited to, unsaturated aliphatic alcohols, and alicyclic alcohols. Cell permeabilizing agents include methanol, ethanol, isopropanol, and butanol. , Pentanol, Cetyl Alcohol, Ethylene Glycol, Propylene Glycol, Modified Alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG)-400 , ethoxylated fatty acids, or hydroxyethyl cellulose. In some embodiments, the cell permeation agent comprises ethanol.

[0087] In other cases, the compositions and methods provided herein include an alcohol-based drug as a cell permeabilization agent. The present invention is not limited to the use of any other drug that enhances the delivery of polyribonucleotides into cells. In some cases, the cell permeation agent is ethanol or and any other alcohol that can enhance the delivery of polyribonucleotides into cells. In some cases, the cell permeation agent includes ethanol and polyribonucleotides. Any other organic or inorganic molecule that can enhance delivery into a cell. In this case, the cell permeation agent is ethanol, as well as The brochure of International Publication No. 2013006825 and the brochure of International Publication No. 2016036 735, International Publication No. 2018112282A1, and International Liposomal materials such as those described in Publication No. 2012031043A1 In some cases, the cell permeation agent includes ethanol, as well as Bechara et al., Cell -penetrating peptides:20 years later,whe re do we stand?FEBS Letters 587(12):1693 -1702(2013);Langel,Cell-Penetrating Pept ides:Processes and Applications(CRC Pres s, Boca Raton FL, 2002);El-Andaloussi et a l.,Curr.Pharm.Des.11(28):3597-611(2003); Deshayes et al,Cell.Mol.Life Sci.62(16): 1839-49 (2005), U.S. Patent Application Publication No. 20130129726, U.S. US Patent Application Publication No. 20130137644 and US Patent Application Publication No. 201301 and cell-penetrating peptides or proteins such as those described in US Pat. No. 6,4219. In some cases, the ratio of ethanol to other cell permeabilizing agents is about 1:0.001, 1:0.002, 1:005, 1:008, 1:0.01, 1:0.02, 1:0.05 ,1:0.08,1:0.1,1:0.2,1:0.3,1:0.4,1:0.5,1: 0.6, 1:0.7, 1:0.8, 1:0.9, 1:1, 1:1.2, 1:1.5, 1: 1.8, 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:30, 1:40, 1:50, 1: 60, 1:70, 1:80, 1:90, 1:100, 1:120, 1:150, 1:20 0, 1:250, 1:500, or 1:1000. In some cases, The ratio of Nol to other cell permeabilizing agents is at least about 1:0.001, 1:0.002, 1:0 05, 1:008, 1:0.01, 1:0.02, 1:0.05, 1:0.08, 1:0 .1, 1:0.2, 1:0.3, 1:0.4, 1:0.5, 1:0.6, 1:0.7, 1 :0.8, 1:0.9, 1:1, 1:1.2, 1:1.5, 1:1.8, 1:2, 1:2 .5, 1:3, 1:3.5, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:1 0, 1:15, 1:20, 1:30, 1:40, 1:50, 1:60, 1:70, 1:8 0, 1:90, 1:100, 1:120, 1:150, 1:200, 1:250, or 1 :500.

[0088] The compositions disclosed herein include a mixture of a cell permeabilizing agent and a polyribonucleotide. In some cases, the polyribonucleotide is premixed with a cell permeabilizing agent. In some cases, the polyribonucleotide is present in a mixture. In these cases, the polyribonucleotide is provided separately from the cell permeation agent. When applied to cells, the compound is contacted with a cell permeabilizing agent, which induces the intracellular entry of polyribonucleotides. Without being bound to any particular theory, the cell permeability of the mixture is The concentration of the permeabilizing agent may contribute to the efficiency of delivery. The agent is provided in the mixture at a predetermined concentration. The penetrant and polyribonucleotide are initially separate but are applied for delivery When mixed together, the cell permeabilizing agent is in sufficient quantity to the polyribonucleotide. to ensure that a minimum predetermined concentration is reached in the mixture.

[0089] In some cases, the cell permeabilization agent comprises at least about 0.01% of the mixture, At least about 0.02%, at least about 0.03%, at least about 0.04%, at least about 0. 05%, at least about 0.06%, at least about 0.07%, at least about 0.08%, At least about 0.09%, at least about 0.1%, at least about 0.2%, at least about 0.3%, at least about 0.4%, at least about 0.5%, at least about 0.6%, at least about 0.7%, at least about 0.9%, at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 20% , at least about 30%, at least about 40%, at least about 50%, at least about 60% , at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 98% volume per volume (v / v). In this case, the cell permeabilizing agent may be up to about 0.01%, up to about 0.02%, or up to about 0.03% of the mixture. , maximum approximately 0.04%, maximum approximately 0.05%, maximum approximately 0.06%, maximum approximately 0.07%, maximum approximately 0.08%, maximum approximately 0.09%, maximum approximately 0.1%, 0.2%, 0.3%, 0.4%, 0. 5%, 0.6%, 0.7%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8% %, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 9 In some cases, the cell permeabilizing agent comprises about 10%, about 20%, or about 30% of the mixture. 0%, approx. 30%, approx. 40%, approx. 50%, approx. 60%, approx. 70%, approx. 80%, approx. 90%, approx. 5%, about 98%, or about 100% v / v.

[0090] In some cases, the cell permeabilization agent comprises at least about 0.01% of the mixture, At least about 0.02%, at least about 0.03%, at least about 0.04%, at least about 0. 05%, at least about 0.06%, at least about 0.07%, at least about 0.08%, At least about 0.09%, at least about 0.1%, at least about 0.2%, at least about 0.3%, at least about 0.4%, at least about 0.5%, at least about 0.6%, at least about 0.7%, at least about 0.9%, at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 20% , at least about 30%, at least about 40%, at least about 50%, at least about 60% , at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 98% weight per weight (w / w). In this case, the cell permeabilizing agent may be up to about 0.01%, up to about 0.02%, or up to about 0.03% of the mixture. , maximum approximately 0.04%, maximum approximately 0.05%, maximum approximately 0.06%, maximum approximately 0.07%, maximum approximately 0.08%, maximum approximately 0.09%, maximum approximately 0.1%, 0.2%, 0.3%, 0.4%, 0. 5%, 0.6%, 0.7%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8% %, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 9 In some cases, the cell permeation agent comprises about 10%, about 20%, or about 30% of the mixture. 0%, approx. 30%, approx. 40%, approx. 50%, approx. 60%, approx. 70%, approx. 80%, approx. 90%, approx. 5%, or about 98% w / w. In some cases, the cell permeation agent comprises It accounts for approximately 10% v / v.

[0091] In some cases, the mixtures described herein are liquid solutions. For example, The cell permeation agent may be a liquid substance itself. Alternatively, the cell permeation agent may be a solid, liquid, or gas. The polyribonucleic acid is a substance that is dissolved in a liquid carrier, for example, water. The nucleotides may also be dissolved in a liquid solution.

[0092] In some cases, ethanol is at least about 0.1% of the mixture, at least About 0.2%, at least about 0.3%, at least about 0.4%, at least about 0.5%, At least about 0.6%, at least about 0.7%, at least about 0.9%, at least about 1% , at least about 2%, at least about 3%, at least about 4%, at least about 5%, At least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 1 0%, at least about 20%, at least about 30%, at least about 40%, at least about 5 0%, at least about 60%, at least about 70%, at least about 80%, at least about 9 occupying 0%, at least about 95%, or at least about 98% of the volume per volume (v / v) In some cases, ethanol may be present in a mixture at up to about 0.1%, 0.2%, or 0. .3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.9%, 1%, 2%, 3%, 4% ,5%,6%,7%,8%,9%,10%,20%,30%,40%,50%,60%, In some cases, the ethanol comprises 70%, 80%, or 90% v / v. About 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about In some cases, the composition may comprise 80%, about 90%, about 95%, about 98%, or about 100% v / v. In this case, ethanol makes up about 10% v / v of the mixture.

[0093] Polyribonucleotides Aspects of the present disclosure include the administration of polyribonucleotides to cells, either ex vivo or in vivo. The present invention relates to compositions and methods for delivering polyribonucleotides into the body. It can be either a nucleotide or a cyclic polyribonucleotide. In this regard, the polyribonucleotide may have a specific function for the cell or subject to which the polyribonucleotide is administered. An aspect of the present disclosure is that the composition, when delivered intracellularly in a subject, (e.g., by direct administration) or delivered intracellularly to be administered to a subject. (e.g., cell transplantation or cell injection), The polyribonucleotide as described herein is preferably a ribonucleotide having a structure similar to that described herein. In pharmaceutical compositions, the pharmaceutical compositions may be mixed with alcohol (e.g., ethanol). The polyribonucleotide as described above is mixed with a diluent in a composition that does not contain any carrier. It can be done.

[0094] The polyribonucleotide may comprise a sequence for an expression product. Ribonucleotides are used in nucleic acids (e.g., RNA, DNA, and RNA-DNA hybrids), Small molecules (e.g., drugs), aptamers, polypeptides, proteins, lipids, phospholipids (e.g., For example, PI(4,5)P2), carbohydrates, antibodies, viruses, virus particles, membranes, multicomponent complexes other entities such as bodies, cells, other cellular parts, any fragments thereof, and any combinations thereof (e.g. Expression of sequences derived from polyribonucleotides And / or binding of polyribonucleotides to targets can have a variety of biological effects. In some cases, polyribonucleotides can inhibit cellular functions, e.g., transiently or chronically. In certain embodiments, the cellular function is modulated for a period of at least about 1 hour to about 30 days. or at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days Adjustments lasting for days, 30 days, 60 days, or more, or any time in between. In certain embodiments, the cell function is stably altered, for example, for about 30 minutes to about 7 days. Less than or equal to 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 24 hours, 36 hours, 48 ​​hours 10 days, 60 hours, 72 hours, 4 days, 5 days, 6 days, 7 days or less, or any time therebetween The modifications are transient, such as short-lasting adjustments.

[0095] The polyribonucleotide may be at least about 20 nucleotides, at least about 30 nucleotides. tide, at least about 40 nucleotides, at least about 50 nucleotides, at least about 7 5 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, At least about 300 nucleotides, at least about 400 nucleotides, at least about 50 0 nucleotides, or at least about 1,000 nucleotides. In the present invention, polyribonucleotides are used to express sequences derived from polyribonucleotides. It is of sufficient size to accommodate a binding site for a ribosome that In this case, polyribonucleotides inhibit the translation of target mRNA, degrade target mRNA, , regulating splicing of target RNAs, and promoting binding between target receptors and their ligands. To demonstrate the regulatory function of polyribonucleotides such as The maximum size of a linear or circular polyribonucleotide is sufficient for the The size of the nucleic acid molecule produces linear or circular polyribonucleotides and / or circular polyribonucleotides. It will be appreciated that the size of the octides may be within the technical constraints of using the octides. In some cases, the maximum length of the linear or circular polyribonucleotides provided herein is Size may be limited by the ability to package and deliver RNA to a target. In some cases, the size of a polyribonucleotide may be insufficient to encode a useful polypeptide. and therefore, less than about 20,000 nucleotides, about 15,000 nucleotides. Less than 0 nucleotides, less than about 10,000 nucleotides, less than about 7,500 nucleotides or less than about 5,000 nucleotides, less than about 4,000 nucleotides, less than about 3,000 nucleotides Less than about 5 nucleotides, less than about 2,000 nucleotides, less than about 1,000 nucleotides, less than about 400 nucleotides, less than about 300 nucleotides, less than about 20 Lengths of less than 0 nucleotides, less than about 100 nucleotides, can be useful.

[0096] The polyribonucleotides provided herein are intended to be identical to a reference sequence, in particular a parent polyribonucleotide. Substitutions, insertions and / or additions, deletions, and covalent modifications, etc., may be present as compared to the For example, a polyribonucleotide may have one or more post-transcriptional modifications, such as These include capping, cleavage, polyadenylation, splicing, polyA sequences, methylation, and adenylation. Sylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and thiols Polyribonucleotides contain pyridine- 4-one ribonucleosides, 5-aza-uridine, 2-thio-5-aza-uridine, 2 -Thio-pseudouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydro 3-Methyluridine, 5-Carboxymethyl-uridine, 1-Carboxyuridine Dimethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine Lysine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl- Urinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl Thiol-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine Lysine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, di Hydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine Lysine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-prop and 4-methoxy-2-thio-pseudouridine. In some cases, the mRNA may include at least one nucleoside that is 5-Aza-cytidine, ploidy isocytidine, 3-methyl-cytidine, N4-acetylcytidine Cytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine , 1-methyl-ploid isocytidine, pyrrolo-cytidine, pyrrolo-ploid isocytidine 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-ploid isocytidine Cytidine, 4-thio-1-methyl-ploid isocytidine, 4-thio-1-methyl-1-de Aza-ploid isocytidine, 1-methyl-1-deaza-ploid isocytidine, zebra Phosphorus, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine 2-Methoxy-cytidine, 2-Methoxy-5-methyl-cytidine 4-Methoxy-1-methyl-isocytidine, 4-Methoxy-1-methyl-isocytidine, and 4-Methoxy-1-methyl-isocytidine It contains at least one nucleoside selected from the group consisting of isocytidine. In this case, the mRNA is -adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-de Aza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza -8-Aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine , N6-isopentenyl adenosine, N6-(cis-hydroxyisopentenyl)adenosine Adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N 6-Glycinylcarbamoyl adenosine, N6-Threonylcarbamoyl adenosine, 2 -Methylthio-N6-threonylcarbamoyl adenosine, N6,N6-dimethyladenosine adenine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine In some cases, the compound includes at least one nucleoside selected from the group consisting of: , mRNA is inosine, 1-methyl-inosine, wyosine, wybutosine, 7-dea aza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio -7-Deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl -Guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy -Guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethyl Guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl N2-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dithio At least one nucleoside selected from the group consisting of methyl-6-thio-guanosine In some embodiments, the polyribonucleotide lacks a cap. In some embodiments, the polyribonucleotide lacks a polyA tail. In some embodiments, the polyribonucleotide is non-immunogenic. The nucleotides are immunogenic.

[0097] Polyribonucleotides are composed of sugars, nucleobases, or internucleoside linkages (e.g., linked together). any of the above for the phosphate / phosphodiester bond / phosphodiester backbone Useful modifications may include: one or more atoms of the pyrimidine nucleobase are optionally substituted. optionally substituted amino, optionally substituted thiol, optionally substituted alkyl( methyl or ethyl), or halo (e.g., chloro or fluoro). In certain embodiments, the modification (e.g., one or more modifications) may be: The modifications occur in both the sugar and the internucleoside linkages. ), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), Modification of ribonucleic acid (RNA) to locked nucleic acid (LNA) or its hybrids. Further modifications are described herein.

[0098] Different sugar modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures ) may be present at various sites in the polyribonucleotides provided herein. The present invention relates to a method for the preparation of polyribonucleotides comprising the steps of: It should be recognized that the ribonucleotide may be located at any site in the polyribonucleotide such that Polyribonucleotides are composed of approximately 1% to approximately 100% modified nucleotides (total nucleotides). With respect to nucleotide content, or the number of one or more types of nucleotides, e.g., A, G, U, or for any one or more of C) or any percentage in between (e.g., 1% to 2 0%, 1%~25%, 1%~50%, 1%~60%, 1%~70%, 1%~80%, 1% ~90%, 1%~95%, 10%~20%, 10%~25%, 10%~50%, 10%~ 60%, 10%~70%, 10%~80%, 10%~90%, 10%~95%, 10%~ 100%, 20%~25%, 20%~50%, 20%~60%, 20%~70%, 20% ~80%, 20%~90%, 20%~95%, 20%~100%, 50%~60%, 50 %~70%, 50%~80%, 50%~90%, 50%~95%, 50%~100%, 7 0%~80%, 70%~90%, 70%~95%, 70%~100%, 80%~90%, 80%~95%, 80%~100%, 90%~95%, 90%~100%, and 95%~ 100%).

[0099] In some cases, the concentration of polyribonucleotides in the mixture is at least about 0. 0.1 ng / mL, at least about 0.2 ng / mL, at least about 0.5 ng / mL, at least at least about 1 ng / mL, at least about 5 ng / mL, at least about 10 ng / mL, at least about 20 ng / mL, at least about 50 ng / mL, at least about 100 ng / mL , at least about 200 ng / mL, at least about 500 ng / mL, at least about 1 μg / mL, at least about 2 μg / mL, at least about 3 μg / mL, at least about 4 μg / mL mL, at least about 5 μg / mL, at least about 10 μg / mL, at least about 20 μg / mL, at least about 30 μg / mL, at least about 40 μg / mL, at least about 50 μg / mL, at least about 100 μg / mL, at least about 200 μg / mL, at least At least about 300 μg / mL, at least about 400 μg / mL, at least about 500 μg / mL , at least about 1 mg / mL, at least about 2 mg / mL, at least about 5 mg / mL, At least about 10 mg / mL, at least about 20 mg / mL, at least about 50 mg / m In some cases, the polysaccharide in the mixture is at least about 100 mg / mL. The concentration of ribonucleotides is up to about 0.1ng / mL, up to about 0.2ng / mL, up to Approximately 0.5ng / mL, maximum approximately 1ng / mL, maximum approximately 5ng / mL, maximum approximately 10ng / mL , maximum approximately 20ng / mL, maximum approximately 50ng / mL, maximum approximately 100ng / mL, maximum approximately 20 0ng / mL, maximum approximately 500ng / mL, maximum approximately 1μg / mL, maximum approximately 2μg / mL, maximum Largest approximately 3μg / mL, maximum approximately 4μg / mL, maximum approximately 5μg / mL, maximum approximately 10μg / mL, Maximum approximately 20μg / mL, maximum approximately 30μg / mL, maximum approximately 40μg / mL, maximum approximately 50μg / mL, maximum approximately 100μg / mL, maximum approximately 200μg / mL, maximum approximately 300μg / mL, Maximum of approximately 400μg / mL, maximum of approximately 500μg / mL, maximum of approximately 1mg / mL, maximum of approximately 2mg / mL, maximum approximately 5 mg / mL, maximum approximately 10 mg / mL, maximum approximately 20 mg / mL, maximum approximately 5 0 mg / mL, or up to about 100 mg / mL.

[0100] In some cases, the concentration of polyribonucleotide in the mixture is about 0.1 ng / mL, approx. 0.2ng / mL, approx. 0.5ng / mL, approx. 1ng / mL, approx. 5ng / mL, approx. 10ng / mL, approx. 20ng / mL, approx. 50ng / mL, approx. 100ng / mL, approx. 200 ng / mL, approximately 500ng / mL, approximately 1μg / mL, approximately 2μg / mL, approximately 3μg / mL, Approximately 4μg / mL, approximately 5μg / mL, approximately 10μg / mL, approximately 20μg / mL, approximately 30μg / mL, approx. 40μg / mL, approx. 50μg / mL, approx. 100μg / mL, approx. 200μg / mL , approx. 300μg / mL, approx. 400μg / mL, approx. 500μg / mL, approx. 1mg / mL, approx. 2mg / mL, approx. 5mg / mL, approx. 10mg / mL, approx. 20mg / mL, approx. 50mg / m L, or about 100 mg / mL.

[0101] The composition may include a polyribonucleotide and an alcohol (eg, ethanol). In certain particular embodiments, the composition comprises a linear polyribonucleotide and an alcohol. In certain particular embodiments, the composition comprises a circular polyribonucleotide (circR Due to their circular structure, circRNAs are similar to their linear counterparts. Compared to RNA, improved stability, increased half-life, reduced immunogenicity, and / or functionality ( For example, the improved functionality described herein.

[0102] The composition may include a polyribonucleotide and a cell permeation agent. In one embodiment, the composition comprises a linear polyribonucleotide and a cell penetrating agent. In an embodiment, the composition comprises a circular polyribonucleotide (circRNA) and a cell penetrating agent. Due to their circular structure, circRNAs are more stable than their linear counterparts. improved activity, increased half-life, reduced immunogenicity, and / or functionality (e.g., as described herein) The improved functionality will be

[0103] In some cases, the circular polyribonucleotides provided herein are linear. At least one of the corresponding linear expression sequences or linear circular polyribonucleotides In some cases, the circular polyribonucleotide has a half-life of In some cases, the half-life is about 5 %, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or In some cases, the circular polyribonucleotide is at least For about 1 hour to about 30 days, or for at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, Time, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19th day, 20th day, 21st day, 22nd day, 23rd day, 24th day, 25th day, 26th day, 27 days, 28 days, 29 days, 30 days, 60 days, or more, or any period therebetween In certain embodiments, the circular polyribonucleotide has a half-life or persistence in cells of any length of time. The nucleotide may be incubated for about 10 minutes to about 7 days or less, or for about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, or less. hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 1 4 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 2 2 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days, 6 days , 7 days or less, or any time therebetween.

[0104] Payload and Biological Effects In some cases, the polyribonucleotide is administered during or after delivery to a cell or subject. It contains at least one payload that subsequently has a biological effect on a cell or subject. The irodo may be one or more sequences encoded in a polyribonucleotide. These are expressed and target molecules (e.g., proteins, nucleic acids, small molecules, or ribozymes). ) or to a target entity such as a target cell. Polyribonucleotides can be linear or circular. The biological effect on a cell can be in the form of a change, e.g., on the cell or The enzymes that induce morphological or functional changes in cells are known to induce various molecules and For example, the biological effect on a cell may include an accelerated cell proliferation or slowing down, survival, apoptosis, or necrosis of cells, gene transcription and mRNA translation, and The functionality of certain differentiated cells (e.g., activation of immune cells, excitation or inhibition of neurons) hormone secretion from hormone-secreting cells, or phagocytic activity by macrophages) changes in internal cell signaling that affect cellular function, including but not limited to or a change in the efficiency of entry of a foreign molecule into a cell, e.g., cell permeability to a foreign molecule. The biological effect on the subject may include, but is not limited to, an increase or decrease in the The present invention also provides a method for detecting various changes to the physiology of a subject, for example, changes to any one or more tissues or organs. The biological effect on the subject may include structural or functional changes to the ECG, blood glucose, One or more of the following can be measured from the subject: blood pressure, temperature, blood count, HbCO, and MetHb. The biological effect may also be a change in the physiological parameters of the subject. The present invention also includes the amelioration of one or more symptoms of a disease in a subject, or the treatment or eradication of a disease in a subject. The biological effect may also include wound healing.

[0105] Expression sequence In some cases, the polyribonucleotide as described herein is The peptide comprises at least one expressible sequence encoding a peptide or polypeptide. Proteins, small peptides, peptidomimetics (e.g., peptoids), amino acids, and amino acids. Peptides may include, but are not limited to, amino acid analogs. Peptides may be linear or branched. The peptides may have a molecular weight of less than about 500,000 grams per mole and a molecular weight of less than about 100,000 grams per mole. Molecular weight less than about 200,000 grams, molecular weight less than about 100,000 grams per mole, Molecular weight less than about 50,000 grams per mole, molecular weight less than about 20,000 grams per mole Less than about 10,000 grams per mole, Less than about 5,000 grams per mole Less than 2,000 grams, molecular weight per mole Less than 1,000 grams, molecular weight per mole 00 grams, molecular weight per mole of less than about 500 grams, and salts of such compounds. The peptides may have the following pharmacokinetic and pharmacokinetic forms: delivery substances, hormones, drugs, toxins, viral or microbial particles, synthetic molecules, and their agonists. Polyribonucleotides may be either linear or circular. It may be in the form:

[0106] The peptides or polypeptides expressed by the polyribonucleotides provided herein Some examples of peptides are fluorescent tags or markers, antigens, peptide therapeutics, natural bioactive peptides, and the like. synthetic or analogue peptides derived from peptides, agonist or antagonist peptides, Microbial peptides, pore-forming peptides, bicyclic peptides, targeting or cytotoxic peptides, Degradation or self-destruction peptides and degrading or self-destruction peptides (plural). The peptides provided herein may also be antigen-binding peptides, e.g., antigen-binding antibodies or single chain antibodies, nanoparticles, or the like. Nanobodies (e.g., Steeland et al. 2016. Nanobodies as therapeutics:big opportunities for sm all antibodies.Drug Discov Today:21(7):1 Such antigen-binding peptides may include antibody-like fragments such as those described herein (see, for example, US Pat. No. 6,233,311). The antibodies can bind to cytosolic, nuclear, and intraorganellar antigens.

[0107] In some cases, the polyribonucleotide is a protein, e.g., a therapeutic protein. Some examples of therapeutic proteins include proteins Protein replacement, protein supplementation, vaccination, antigens (e.g., tumor antigens, viruses, bacteria), hormones, cytokines, antibodies, immunotherapy (e.g., cancer), cell reprogramming / transdifferentiation Recombinant factors, transcription factors, chimeric antigen receptors, transposases or nucleases, immune effectors (e.g., affecting sensitivity to immune responses / signals), regulated death Effector proteins (e.g., inducers of apoptosis or necrosis), non-lytic of tumors Inhibitors (e.g., inhibitors of oncoproteins), epigenetic modifiers, epigenetics Typic enzymes, transcription factors, DNA or protein modifying enzymes, DNA intercalators, efflux pump inhibitors inhibitors, nuclear receptor activators or inhibitors, proteasome inhibitors, competitive inhibitors of enzymes toxic agents, protein synthesis effectors or inhibitors, nucleases, protein fragments or domains These include, but are not limited to, inhibitors, ligands or receptors, and their CRISPR systems or components. In some embodiments, the protein or therapeutic protein is Growth factors include EGF, PDGF, TG, and other wound healing proteins. Fβ, or VEGF.

[0108] In some embodiments, the protein or therapeutic protein is used in a method of wound healing. For example, a method of treating a wound may include treating the wound, or tissue surrounding the wound, with any of the methods described herein. The composition may include contacting the subject with a composition or pharmaceutical composition as described herein, The polyribonucleotide of the product or pharmaceutical composition is selected from the group consisting of EGF, PDGF, TGFβ, and VEGFR. It contains sequences encoding growth factors such as F.

[0109] In some cases, the polyribonucleotide may be a regulatory element, e.g., a circular polyribonucleotide. Sequences that modify the expression of expression sequences in a ribonucleotide or linear polyribonucleotide Regulatory elements include sequences located adjacent to an expression sequence that codes for an expression product. The regulatory element may be operably linked to an adjacent sequence. , the amount of product expressed compared to the amount of product expressed without the presence of the regulatory element. In addition, one regulatory element can be used to increase the number of genes that are linked in series. It is possible to increase the amount of product expressed relative to the expression sequence. A nodal element can enhance expression of one or more expression sequences. It is well known to businesses.

[0110] In some cases, the polyribonucleotide may include a translation initiation sequence, e.g., an initiation codon. In some cases, the translation initiation sequence includes a Kozak or Shine-Dalger sequence. It is an arrangement.

[0111] In some cases, the polyribonucleotide begins at a codon that is not the first initiation codon. , for example, AUG. Translation of polyribonucleotides begins with ACG, AGG, AAG , CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG In some cases, the translation may begin at an alternative translation initiation sequence, such as, but not limited to, In this case, translation is initiated by eukaryotic initiation factor 4A (eIF4A). In an embodiment, translation is initiated by the inclusion of an internal ribosome entry site (IRES) end of a polyribonucleotide. The IRES element is an RNA molecule capable of binding eukaryotic ribosomes. In some cases, the IRES element may comprise at least about 5n A sequences. t, at least about 8 nt, at least about 9 nt, at least about 10 nt, at least about 1 5 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, At least about 40 nt, at least about 50 nt, at least about 100 nt, at least about 200 nt nt, at least about 250 nt, at least about 350 nt, or at least about 500 nt In one embodiment, the IRES element is selected from viral, mammalian, and Drosophila genes. Derived from the DNA of organisms including, but not limited to, Drosophila Such viral DNA includes encephalomyocarditis virus (EMCV) cDNA and poliovirus It can be derived from picornavirus complementary DNA (cDNA), as well as viral cDNA. In one embodiment, the IRES element is derived from Drosophila (Drosophila) DNA was melanogaster stomach.

[0112] In some cases, the polyribonucleotide comprises one or more expression sequences, each of which The current sequence may or may not have a termination element. In accordance with the present invention, the polyribonucleotide comprises one or more expression sequences, the expression sequences being preferably terminated with a termination element. In some embodiments, the polyribonucleotide is a cyclic polyribonucleotide. It is a circular polyribonucleotide that lacks a termination element so that translation can continue. In some cases, the polyribonucleotide may include a terminating element at the end of one or more of the expression sequences. In some cases, one or more of the expression sequences lacks a termination element. Generally, a termination element is an in-frame nucleotide triplet that signals the end of translation. Includes let, e.g., UAA, UGA, UAG.

[0113] Polyribonucleotides can be used, for example, to modify the expression of endogenous and / or foreign genes. In some cases, the polyribonucleotide may include a regulatory nucleic acid. As a regulatory nucleic acid, it includes one or more expression sequences that encode (e.g., are complementary to) tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, s iRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, YR Examples of non-coding RNA include, but are not limited to, NA, and hnRNA. However, it is not limited to these.

[0114] In one example, the regulatory nucleic acid targets a host gene. A nucleic acid that hybridizes to the nucleic acid sequence (e.g., a miR as described elsewhere herein) NA, siRNA, mRNA, lncRNA, RNA, DNA, antisense RNA, g RNA), nucleic acid that hybridizes to foreign nucleic acid such as viral DNA or RNA, RNA nucleic acids that hybridize to nucleic acids that interfere with gene transcription, nucleic acids that interfere with RNA translation, Nucleic acids that stabilize RNA or destabilize RNA, such as through targeting for resolution. These may include, but are not limited to, nucleic acids that regulate DNA or RNA binding factors. In one embodiment, the sequence is an miRNA.

[0115] In some cases, the polyribonucleotide is a nucleic acid sequence that is a nucleic acid sequence that is a target of transcription, such as a guide RNA (gRNA). In some cases, the polyribonucleotide comprises a guide RNA. gRNAs encode gene targets or guide RNAs. gRNAs are sequences that target genome targets defined by the user. The targeting sequence consists of a "scaffold" sequence that is required to bind to the targeting sequence of approximately 20 nucleotides. gRNAs can be short synthetic RNAs that target specific DNA sequences (e.g., the primers of genes). adjacent to or within a promoter, enhancer, silencer, or repressor gRNA is one of the CRISPR systems for gene editing. For gene editing, polyribonucleotides can be inserted into a desired target DNA sequence. Each of the sequences may be designed to contain one or more corresponding guide RNA sequences; Cong et al. (2013) Sci. ence,339:819-823;Ran et al.(2013)Nature Please see Protocols, 8:2281-2308.

[0116] Polyribonucleotides may comprise all or part of an endogenous gene or gene product (e.g., mRNA). The fragment may encode a regulatory nucleic acid that is substantially complementary or completely complementary to the fragment. The nodal nucleic acid is the site of transcription of newly generated nuclear RNA transcripts of a specific gene into mRNA. Interactions with intron-exon boundaries, between exons, or adjacent sequences that prevent maturation A regulatory nucleic acid that is complementary to a particular gene can be a nucleic acid that encodes the mRNA for that gene. and can prevent its translation. The nucleic acid may be DNA, RNA, or a derivative or hybrid thereof. In this case, the regulatory nucleic acid is a protein involved in regulating the expression of an endogenous or foreign gene. It contains a protein binding site that binds to the protein.

[0117] In some cases, the cyclic polyribonucleotide as provided herein The translation efficiency can be measured using a reference, e.g., a linear counterpart, a linear expression sequence, or a linear circular polyribonucleic acid (PNAS). In some cases, the cyclic polynucleotides as provided herein are higher than the nucleotides. The ribonucleotides are at least about 5%, 10%, 15%, 20%, 25%, %, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75 %, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 20 0%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 70 %, 800%, 900%, 1000%, 2000%, 5000%, 10000%, 100 In some cases, the circular polyribonuclease has a translation efficiency of 000% or higher. Nucleotides have a translation efficiency 10% higher than that of their linear counterparts. In Escherichia coli, circular polyribonucleotides have a translation efficiency 300% higher than that of their linear counterparts. has.

[0118] In some cases, the cyclic polyribonucleotides produce a stoichiometric ratio of expression products. Rolling circle translation produces expression products continuously in substantially the same ratio. In some cases, the circular polyribonucleotide has a stoichiometric translation efficiency, As a result, the expression products are produced in substantially the same ratio. Ribonucleotides can be used to express multiple expression products, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 1 It has a stoichiometric translation efficiency of the product from 0, 11, 12 or more expressed sequences.

[0119] In some cases, when translation of a circular polyribonucleotide is initiated, a circular polyribonucleotide is produced. The ribosome bound to the ribonucleotide is a ribosome that is attached to at least one of the circular polyribonucleotides. It does not leave the circular polyribonucleotide before the translation of the round is complete. In some cases In the present invention, a circular polyribonucleotide as described herein is In some cases, during rolling circle translation, When translation of a polyribonucleotide is initiated, the linker attached to the circular polyribonucleotide The ribosomal ribosomal RNA is synthesized by merging at least two rounds of the circular polyribonucleotide. , at least 4 rounds, at least 5 rounds, at least 6 rounds, at least 7 rounds, at least 8 rounds, at least 9 rounds, at least 10 rounds, At least 11 rounds, at least 12 rounds, at least 13 rounds, at least 14 rounds, at least 15 rounds, at least 20 rounds, at least 30 rounds at least 40 rounds, at least 50 rounds, at least 60 rounds, At least 70 rounds, at least 80 rounds, at least 90 rounds, at least 100 rounds, at least 150 rounds, at least 200 rounds, at least 2 50 rounds, at least 500 rounds, at least 1000 rounds, at least 1 500 rounds, at least 2000 rounds, at least 5000 rounds, at least Even 10,000 rounds, at least 10 5 Round, or at least 10 6 Round Translation It does not leave the circular polyribonucleotide before translation is complete.

[0120] In some cases, rolling circle translation of a circular polyribonucleotide A polypeptide product translated from two or more rounds of translation of a contiguous polyribonucleotide ("contiguous"). In some cases, this results in the production of a circular polyribonucleoside ("polyribonucleoside"). Tides are also known as alternating elements (e.g., elements that cause ribosome pausing during translation). The rolling circle translation of the circular polyribonucleotide Polypeptide products produced from one or less than one round of translation of a nucleotide In some cases, this results in the production of a "distinct" expression product. Circular polyribonucleotides are synthesized by rolling circle translation of circular polyribonucleotides. At least 10%, 20%, 30%, 40%, 50% of all polypeptides produced during , at least 60%, at least 70%, at least 80%, at least 90%, at least At least 95%, at least 96%, at least 97%, at least 98%, at least 99% %, or 100% (molar / molar) of the mixture is a separate polypeptide. In some cases, the ratio of the amount of a separate product to the total polypeptide is In some cases, it is used to test the ratio of amounts A commonly used in vitro translation system includes rabbit reticulocyte lysate. The ratio of the amounts is determined for an in vivo translation system such as a eukaryotic cell or a prokaryotic cell, a cultured cell, or a cell in an organism. The test is carried out in the following order:

[0121] In some cases, the polyribonucleotide comprises an untranslated region (UTR). The UTRs of genomic regions that contain genes can be transcribed but not translated. In some cases, the UTR may be upstream of the translation initiation sequence of the expressed sequences described herein. In some cases, a UTR may be included downstream of the expression sequences described herein. In some cases, a UTR for a first expressed sequence may be a UTR for a second expressed sequence. It may be identical to, contiguous with, or overlap with another UTR. In some cases In some cases, the intron is a human intron. A full length human intron, for example ZKSCAN1.

[0122] In some cases, polyribonucleotides are embedded with adenosines and uridines. These AU-rich features are important in the circulating expression product. The conversion rate can be increased.

[0123] The introduction, removal, or modification of AU-rich elements (AREs) in the UTRs results in the synthesis of polyribonucleic acid (PNA)-derived ribonuclease (PNA). It may be useful to regulate the stability or immunogenicity of certain polyribonucleic acid analogs. When designing a polypeptide, one or more copies of an ARE may be introduced into the polyribonucleotide. In addition, copies of the ARE may regulate the translation and / or production of the expression product. , can be identified and removed, or their intracellular stability can be modulated, thus resulting in The proteins that are engineered into polyribonucleotides are then used to affect the translation and production of the proteins that cause obtain.

[0124] Any UTR from any gene may be expressed as a sequence of polyribonucleotides, each of which may be flanked by It should be understood that the following may be incorporated: TR or a fragment thereof is incorporated herein by reference in its entirety. Patent applications 61 / 775,509 and 61 / 829,372, or The UTs listed in International Patent Application No. PCT / US2014 / 021522 In addition, multiple wild-type UTRs of any known gene can be utilized. It is also within the scope of the present invention to provide artificial UTRs that are not gene variants. These UTRs or portions thereof may be selected or modified in their orientation or location. Thus, the 5' or 6' sequences may be arranged in the same orientation as in the transcript that may be The 3'UTR may be inverted, shortened, extended, or modified with one or more other 5' As used herein, the term "modified" refers to a chimera with a 3' UTR or 3' UTR. "is" refers to a UTR sequence, which means that the UTR is aligned in some way with respect to the reference sequence. For example, the 3' or 5' UTR is altered as taught above. The UTRs may be modified relative to the wild-type or native UTRs by changes in the orientation or position of the Alternatively, the inclusion of additional nucleotides, deletion of nucleotides, exchange or rearrangement of nucleotides may be used. These methods, which generate "modified" UTRs (3' or 5'), Any of the alterations include a variant UTR.

[0125] In one embodiment, double, triple, or quadruple UTRs, such as 5' or 3' UTRs, are used. As used herein, a "double" UTR refers to two copies of the same UTR in sequence. For example, the double beta-globin 3' UTRs are disclosed in U.S. Patent Application Publication No. 2010012, the contents of which are incorporated herein in their entirety. It may be used as described in the 9877 patent.

[0126] In some cases, the polyribonucleotide may include a polyA sequence. In one embodiment, the length of the polyA sequence is more than 10 nucleotides long. In the present invention, the polyA sequence is more than 15 nucleotides in length (e.g., at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1, 300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 or more nucleotides). In some cases, the polyA sequence may be from about 10 to about 3,000 nucleotides (e.g., 3 0~50, 30~100, 30~250, 30~500, 30~750, 30~1,00 0, 30~1,500, 30~2,000, 30~2,500, 50~100, 50~2 50, 50~500, 50~750, 50~1,000, 50~1,500, 50~2, 000, 50~2,500, 50~3,000, 100~500, 100~750, 10 0~1,000, 100~1,500, 100~2,000, 100~2,500, 10 0~3,000, 500~750, 500~1,000, 500~1,500, 500~ 2,000, 500~2,500, 500~3,000, 1,000~1,500, 1, 000~2,000, 1,000~2,500, 1,000~3,000, 1,500~ 2,000, 1,500~2,500, 1,500~3,000, 2,000~3,00 0, 2,000-2,500, and 2,500-3,000).

[0127] In one embodiment, the polyA sequence is designed relative to the overall polyribonucleotide length. The design may include the length of the coding region, specific features or regions (such as the first region or adjacent regions), The length of the polyribonucleotide may be based on the length of the final product expressed from the polyribonucleotide. In this context, a polyA sequence may be a cyclic polyribonucleotide or a Lengths 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer than the feature The polyA sequence may also be part of the polyribonucleotide to which it belongs. In this context, the polyA sequence may be designed to be either the full length of the construct or a portion of the construct. The total length of the construct was 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 190, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310 In addition, the circular polyribonucleotide for polyA binding protein may be 80 or 90% or more. Engineered binding sites and conjugation of nucleotides can enhance expression.

[0128] In one embodiment, the polyribonucleotide is designed to contain poly-AG quartets. G-quartets are formed by G-rich sequences in both DNA and RNA. In one embodiment, the nucleotide sequence may be a cyclic hydrogen-bonded sequence of four guanine nucleotides that In some cases, a G quartet is incorporated at the end of the polyA sequence. Although AG quartets are seen using the 120 nucleotide polyA sequence alone, This results in at least 75% equivalent protein production.

[0129] In some cases, the polyribonucleotide may contain polyA or may lack polyA. or a modified polyA to modulate one or more characteristics of the polyribonucleotide. In some cases, polyribonucleic acid lacking polyA or having a modified polyA may be used. The nucleotides are designed to improve one or more functional characteristics, e.g., immunogenicity, half-life, expression efficiency, etc. To raise.

[0130] scaffold In some cases, the polyribonucleotides provided herein comprise one or more In one embodiment, the polyribonucleotide binds to a DNA target and a protein target. In another embodiment, the polyribonucleic acid cleavage molecule binds both to a target and mediates, for example, transcription. Otides bring together protein complexes and, for example, mediate signal transduction. In embodiments, the polyribonucleotide binds to two or more different targets, such as proteins. Polyribonucleotides are directly transported to the cytoplasm. It can exist in either a linear or cyclic form.

[0131] In some embodiments, polyribonucleotides include DNA, RNA, and proteins. and thereby modulating a cellular process (e.g., a protein In some embodiments, the synthetic polyribonucleotides are and at least one moiety, e.g., a selected DNA, RNA, or protein binding moiety. Contains a binding site for interaction, thereby competing for binding with endogenous counterparts .

[0132] In one embodiment, the synthetic polyribonucleotide binds and / or binds to the miRNA. In another embodiment, the synthetic polyribonucleotide binds to and / or captures a protein. In one embodiment, the synthetic polyribonucleotide binds to mRNA. In one embodiment, the synthetic polyribonucleotide is a ribosome-specific polyribonucleotide. In another embodiment, the synthetic polyribonucleotide binds to and / or captures In another embodiment, the synthetic polyribonucleotide is Ribonucleotides can be encoded by long non-coding RNA (lncRNA) or any other non-coding RNA. A, e.g., miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA , bind to and / or capture long non-coding RNA, shRNA. In addition to the capture site, the polyribonucleotide may be used to bind and / or capture RNA and and / or may contain degradation elements that result in degradation of the protein.

[0133] In one embodiment, the polyribonucleotide comprises a lncRNA or a sequence of a lncRNA. For example, the polyribonucleotide may be a naturally occurring non-circular lncRNA or a fragment thereof. In one embodiment, the lncRNA or the sequence of the lncRNA comprises a spacer sequence. It may be circularized, with or without a sequence, to form a synthetic circular polyribonucleotide.

[0134] In one embodiment, the polyribonucleotide has ribozyme activity. The polyribonucleotide acts as a ribozyme and binds to a pathogenic or endogenous RNA, D In one embodiment, the polyribonucleotide is an enzyme that cleaves a nucleic acid, a small molecule, or a protein. In one embodiment, the synthetic polyribonucleotide has RNA (e.g., viral In another embodiment, the nucleic acid sequence specifically recognizes and cleaves a polyribonucleic acid (PNA). In another embodiment, the polyribonucleic acid cleavage enzyme specifically recognizes and cleaves a protein. Otides specifically recognize and degrade small molecules.

[0135] In one embodiment, the polyribonucleotide is a disrupted, self-cleaving, or cleavable polyribonucleotide. In one embodiment, polyribonucleotides are used to prepare RNA, e.g. , miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, long non-coding RNA In one embodiment, the vector can deliver a synthetic polyribonucleic acid (PSA) or shRNA. Otides are characterized by (1) self-cleavable elements (e.g., hammerhead splicing elements) (2) a cleavage recruitment site (e.g., ADAR); and (3) a degradable linker (glyceryl linker). role), (4) a chemical linker, and / or (5) spacer sequences. In another embodiment, the synthetic polyribonucleotide is made from: (1) an autologous (2) a self-cleavable element (e.g., a hammerhead splicing element); (3) a degradable linker (glycerol); and (4) a cleavable mobilization site (e.g., ADAR). (5) a spacer sequence, and / or (6) a chemical linker, do.

[0136] In one embodiment, the polyribonucleotide is a transcription / replication competent polyribonucleotide. The polyribonucleotide can encode any type of RNA. The synthetic polyribonucleotide comprises an antisense miRNA and a transcriptional element. In one embodiment, following transcription, a linear functional miRNA is synthesized from a circular polyribonucleotide. It is generated from

[0137] In one embodiment, the polyribonucleotide is in combination with a translation element and has the above attributes. Contains one or more of the following:

[0138] The polyribonucleotide may contain at least one binding site for a binding moiety of a target. Targets include nucleic acids (e.g., RNA, DNA, RNA-DNA hybrids), small Molecules (e.g., drugs), aptamers, polypeptides, proteins, lipids, carbohydrates, antibodies , a virus, a virus particle, a membrane, a multicomponent complex, a cell, another cellular part, or any fragment thereof, and any combination thereof. ksson et al., (2002) Nat Biotech 20:473-77 ;Gullberg et al.,(2004)PNAS,101:8420-24 For example, the target may be single-stranded RNA, double-stranded RNA, single-stranded DNA, double-stranded DNA, DNA or RNA containing one or more double-stranded regions and one or more single-stranded regions; RNA-DNA hybrids, small molecules, aptamers, polypeptides, proteins, lipids, Carbohydrates, antibodies, antibody fragments, mixtures of antibodies, virus particles, membranes, multicomponent complexes, cells, cells The polypeptide may be a cellular portion, any fragment thereof, or any combination thereof.

[0139] In some embodiments, the target is a polypeptide, a protein, or any fragment thereof. For example, the target may be a purified polypeptide, an isolated polypeptide, a fusion tagged polypeptide, or a combination thereof. A polypeptide bound to or attached to the membrane of a cell or a virus or virion. Cross-linked polypeptides, cytoplasmic proteins, intracellular proteins, extracellular proteins, Kinases, phosphatases, aromatases, helicases, proteases, oxidoreductases catalyses, reductases, transferases, hydrolases, lyases, isomerases, Glycosylases, extracellular matrix proteins, ligases, ion transporters, Channels, pores, apoptotic proteins, cell adhesion proteins, pathogenic proteins, abnormalities expressed proteins, transcription factors, transcription regulators, translation proteins, chaperones, secreted proteins Proteins, ligands, hormones, cytokines, chemokines, nuclear proteins, receptors, Transmembrane receptors, signal transducers, antibodies, membrane proteins, integral membrane proteins , peripheral membrane proteins, cell wall proteins, globular proteins, fibrous proteins, glycoproteins Proteins, lipoproteins, chromosomal proteins, any fragments thereof, or any combination thereof. In some embodiments, the target is a heterologous polypeptide. In this study, the target is overexpressed in cells using molecular techniques such as transfection. In some embodiments, the target is a recombinant polypeptide. For example, the target may be a bacterial (e.g., E. coli), yeast, mammalian, or Proteins present in samples generated from insect cells (e.g., proteins overexpressed by the organism) In some embodiments, the target is a polypeptide having a mutation, insertion, deletion, or polymorphism. In some embodiments, the target is a peptide that is capable of immunizing an organism or inducing antibody production. An antigen, such as a polypeptide, that is used to elicit an immune response in an organism, such as a be.

[0140] In some embodiments, the target is an antibody. An antibody binds to a specific spatial and Antibodies can be monoclonal, polyclonal, or recombinant. The antibody may be an antibody, and may be prepared by techniques such as immunization of a host and collection of serum (polyclonal). The cells can be cultured by techniques well known in the art or by preparing and isolating continuous hybrid cell lines. By recovering secreted proteins (monoclonal) or specific binding of natural antibodies A nucleotide sequence encoding at least the amino acid sequence required for It can be prepared by cloning and expressing an induced version. The present antibody is composed of at least two heavy (H) chains interconnected by disulfide bonds. Each heavy chain can be a protein comprising two heavy (L) chains and two light (L) chains. H ) and The heavy chain constant region may comprise three domains: H1 , C H2 and C H3 Each light chain may comprise a light chain variable region (V L ) and a light chain constant region. The common region consists of one domain, C L It can be composed of V H and V L The area is further The complementarity determining region is inserted with a more conserved region called the framework region (FR). Each V can be divided into hypervariable regions called CDRs. H and V L The following order is used: The amino-terminus of the amino acid sequence may include three CDRs and four FRs, arranged from the amino terminus to the carboxy terminus: 1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The constant region of an antibody is Binding of immunoglobulins to host tissues or to various cells of the immune system (e.g., effector cells ) and the first component of the classical complement system (C1q). Any isotype (e.g., IgG, IgE, IgM, IgD, IgA, and IgY); class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2); Antibodies may be of any of the subclasses or modified versions thereof. An antibody fragment may comprise a phosphodiesterase or a fragment thereof. An antibody fragment may comprise a phosphodiesterase or a fragment thereof. In addition, the term may refer to one or more fragments of an antibody that retains the immunoglobulin or Aggregates, polymers, and conjugates of these fragments also exhibit binding affinity for specific molecules. Examples of antibody fragments include Fab fragments, V L , V H , C L Reach C H1 Monovalent fragment consisting of domains; F(ab)2 fragment, disulfide bond in hinge region A bivalent fragment comprising two Fab fragments linked by V H and C H1 Consists of a domain Fd fragment; V of a single arm of an antibodyL and V H Fv fragment consisting of domains; V H domain A single domain antibody (dAb) fragment (Ward et al., (1989) Na ture 341:544-46); and V L and V H The regions are paired to form monovalent molecules. The isolated CDRs and single chain fragments (scFv) forming It is known; see, e.g., Bird et al., (1988) Science 242:4 23-26; and Huston et al., (1988) PNAS 85:5879 Thus, antibody fragments include Fab, F(ab)2, Includes scFv, Fv, dAb, etc. Two domains V L and V H are caused by separate genes Although they can be encoded by a single protein chain, they can be made into a single protein chain by artificial Such single chain antibodies can be linked using recombinant methods by peptide linkers. These antibody fragments can be prepared by conventional techniques known to those skilled in the art. The fragments can be screened for utility in the same manner as intact antibodies. Antibodies may be human, humanized, chimeric, isolated, canine, feline, donkey, , or sheep, or any plant, animal, or mammal.

[0141] In some embodiments, the target is a ribonucleotide, such as DNA or RNA (e.g., mRNA). Nucleotides and / or deoxyribonucleotides (adenine, guanine, thymine, or DNA is the polymeric form of the amino acid sequence of cytosine. It includes the double-stranded DNA found in viruses, plasmids, and chromosomes. In embodiments, the polynucleotide target is a single-stranded, double-stranded, small interfering RNA (siRNA). A), messenger RNA (mRNA), transfer RNA (tRNA), chromosome , genes, non-coding genomic sequences, genomic DNA (e.g., fragmented genomic DNA), Purified, isolated, and hybridized polynucleotides Nucleotides, Transcription factor binding sites, Mitochondrial DNA, Ribosomal RNA, Eukaryotes Polynucleotides, prokaryotic polynucleotides, synthetic polynucleotides, combined polynucleotides Nucleotides, recombinant polynucleotides, polynucleotides containing nucleic acid analogs, methyl a methylated polynucleotide, a demethylated polynucleotide, any fragment thereof, or any In some embodiments, the target is a recombinant polynucleotide. In some embodiments, the target is a heterologous polynucleotide. For example, the target is a heterologous polynucleotide. For example, polyclonal antibodies produced from E. coli, yeast, mammalian, or insect cells. A polynucleotide (e.g., a polynucleotide heterologous to the organism) may be used. In embodiments, the target is a polynucleotide that has a mutation, insertion, deletion, or polymorphism.

[0142] In some embodiments, the target is an aptamer. Aptamers are molecules that bind to a target molecule, such as a protein. The present invention relates to an isolated nucleic acid molecule that binds with high specificity and affinity to a binding moiety of the present invention. An aptamer is a molecule that provides chemical contacts to specifically bind to its given target. Aptamers are nucleic acid-based molecules that are three-dimensional structures that are held in a conformational state. However, there are fundamental differences between aptamers and other nucleic acid molecules such as genes and mRNA. In the latter, the nucleic acid structure encodes information through its linear base sequence and thus This sequence is important for the function of information storage. In contrast, Aptamer function is entirely dependent on conserved linear base sequences (non-coding sequences). Rather, aptamers are dependent on specific secondary / tertiary / quaternary structures. Any coding potential is purely coincidental and may not affect the binding of the aptamer to its cognate target. Aptamers also bind to certain proteins. These latter sequences are derived from the genomes of living organisms. naturally occurring sequences embedded within the genome and are essential for transcription, translation, and It binds to specialized subgroups of proteins involved in cellular and biological transport (e.g., nucleic acid-binding proteins). Aptamers, on the other hand, are short, isolated, non-naturally occurring nucleic acid molecules. Although aptamers that bind to the binding protein can be identified, in most cases such aptamers are The peptides have little or no sequence identity to sequences recognized by natural nucleic acid binding proteins. More importantly, aptamers can bind to virtually any protein. Most of the proteins (including but not limited to nucleic acid binding proteins) and small molecules, carbohydrates, peptides, etc. It can bind to almost any partner of interest. For most partners, the protein Even if it does have such a sequence, there is no naturally occurring nucleic acid sequence to which it binds. For their partners, e.g., nucleic acid binding proteins, such sequences are The binding affinity of naturally used aptamers is relatively low compared to tight-binding aptamers. Aptamers can be distinct from aptamers. Aptamers specifically bind to a selected partner and It is possible to modulate the activity or binding interaction of a partner, e.g., through binding, A tamers can block the ability of the partner to function. Functional properties are intrinsic to the aptamer. Typical aptamers are 6-35 kDa size (20-100 nucleotides) and in the micromolar to subnanomolar range binds to its partner with an affinity of 0.1 to 0.2 and is capable of discriminating against closely related targets (For example, aptamers selectively bind to related proteins from the same gene family. Aptamers are characterized by interactions between molecules that bind to each other through hydrogen bonds, electrostatic complementarity, hydrophobic contacts, and steric exclusion. Commonly occurring molecular interactions can be used to bind to specific partners. Aptamers have the advantages of high specificity and affinity, low immunogenicity, biological efficacy, and superior drug discovery. It has several desirable characteristics for use as a therapeutic and diagnostic agent, including kinetic properties. Aptamers are synthesized by hybridization of covalently linked complementary polynucleotides. The present invention may include molecular stem and loop structures (e.g., hairpin loop structures) formed from The stem contains the hybridized polynucleotide and the loop contains two complementary This is the region to which the polynucleotide is covalently attached.

[0143] In some embodiments, the target is a small molecule. For example, the small molecule may be a macrocycle, an inhibitor, or a In some embodiments, the small molecule may be a toxic agent, drug, or chemical. In some embodiments, the small molecule contains 10 or fewer hydrogen bonds. In some embodiments, the small molecule has a molecular weight of 500 daltons or less. In some embodiments, the small molecule has a molecular weight of about 180 to 500 daltons. In some embodiments, the small molecule has an octanol / water partition coefficient lo of 5 or less. In some embodiments, the small molecule has a partition coefficient l of -0.4 to 5.6. og P. In some embodiments, the small molecule has a molar refractive index of 40 to 130. In some embodiments, small molecules contain about 20 to 70 atoms. In one embodiment, the small molecule is 140 angstroms or less. 2 It has the following polar surface area:

[0144] In some embodiments, the target is a cell. For example, the target may be an intact cell, a compound Cells treated with an agent (e.g., a drug), fixed cells, lysed cells, or any of the above. In some embodiments, the target is a single cell. In some embodiments, the target is a plurality of cells.

[0145] In some embodiments, a single target or multiple (e.g., two or more) targets are In one embodiment, the single target has 2, 3, 4, 5, 6, 7, 8, 9 In one embodiment, the two or more targets may have 10 or more binding moieties. The antibodies are present in a sample, such as a mixture or library, and the sample comprises two or more binding moieties. In some embodiments, the single target or multiple targets comprise multiple different binding moieties. For example, a plurality may be at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 3 0, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1,000, 2, 000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000 , 15,000, 16,000, 17,000, 18,000, 19,000, 20,0 The polypeptide may comprise 0, 25,000, or 30,000 binding moieties.

[0146] A target may include multiple binding moieties, including at least two different binding moieties. For example, The binding portion is at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 9 0, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1, 000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000, 15,000, 16,000, 17,000, 18,000, 19,00 0, 20,000, 21,000, 22,000, 23,000, 24,000, or 2 It may contain a plurality of binding moieties, including up to 5,000 different binding moieties.

[0147] In some cases, the polyribonucleotide contains one binding site. In the case of, the polynucleotide comprises at least two binding sites. Ribonucleotides are 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 , 15, 16, 17, 18, 19, 20 or more binding sites. In certain embodiments, the polyribonucleotides described herein are capable of binding to one or more targets. Each target is a molecular scaffold that binds to the above binding moieties. RNA, DNA, RNA-DNA hybrids), small molecules (e.g., drugs), aptamers, mers, polypeptides, proteins, lipids, carbohydrates, antibodies, viruses, virus particles, membranes , a multicomponent complex, a cell, a cell part, any fragment thereof, and any combination thereof. In some embodiments, the one or more binding sites are of the same target. In some embodiments, the one or more binding moieties are different. In some embodiments, the circRNA binds to one or more binding moieties of a target. Acts as a scaffold for one or more binding moieties of one or more targets. In this study, polyribonucleotides specifically bind to one or more binding moieties of one or more targets. In some embodiments, the method described herein regulates cellular processes by The resulting polyribonucleotide contains binding sites for one or more specific targets of interest. In some embodiments, the polyribonucleotide comprises multiple linkers for each binding moiety of interest. For example, a polyribonucleotide may be a DNA or RNA For example, the polyribonucleotide For example, a polyribonucleotide may be a rRNA. A contains a binding site for a target. For example, a polyribonucleotide can contain a binding site for a tRNA target. For example, polyribonucleotides contain binding sites for genomic DNA targets. Includes rank.

[0148] In some cases, polyribonucleotides are the binding moiety for single-stranded DNA. In some cases, the polyribonucleotide contains a binding site for a double-stranded DNA. In some cases, the polyribonucleic acid The nucleotide comprises a binding site for a binding moiety on an antibody. The ribonucleotide contains a binding site for the binding moiety to the viral particle. In some cases, the polyribonucleotide may be a binding site for a binding moiety for a small molecule. In some cases, the polyribonucleotide comprises a binding site in or on a cell. In some cases, the polyribonucleotide contains a binding site for an RNA molecule. -DNA hybrid binding moiety. Thus, the polyribonucleotide is a binding moiety for a methylated polynucleotide. In some cases, the polyribonucleotide comprises an unmethylated polyribonucleotide. In some cases, the polyribonucleic acid molecule comprises a binding site for a binding moiety for a nucleotide. The nucleotide comprises a binding site for a binding moiety for an aptamer. In the present invention, the polyribonucleotide comprises a binding site for a binding moiety for a polypeptide. In some cases, polyribonucleotides can be used to refer to polypeptides, proteins, proteins, and proteins. Protein fragments, tagged proteins, antibodies, antibody fragments, small molecules, viral particles (e.g., A virus particle that contains a transmembrane protein) or a binding site for a binding moiety to a cell. include.

[0149] In some cases, the linking moiety includes at least two amide bonds. In some cases, the linking moiety does not include a phosphodiester bond. Thus, the binding moiety is not DNA or RNA.

[0150] The polyribonucleotides provided herein are intended to provide a single binding moiety for the complex. The polyribonucleotides provided herein can form complexes. The polyribonucleic acid sequences provided herein may contain one or more binding sites for a target that is to be synthesized. The ribonucleotide can form a complex between the polyribonucleotide and the target. In some embodiments, the polyribonucleotide forms a complex with a single target. In some cases, circRNAs form complexes with two or more targets. In some embodiments, the polyribonucleotide forms a complex with three or more targets. In some embodiments, two or more polyribonucleotides form a complex with a single target. In some embodiments, the two or more polyribonucleotides are complexed with two or more targets. In some embodiments, the first circRNA is a first circRNA of the first target. The binding moiety of the target forms a complex with a second, different binding moiety of a second target. In the form, the first polyribonucleotide forms a complex with a first binding portion of a first target. The second polyribonucleotide then forms a complex with a second binding moiety of a second target.

[0151] In some embodiments, the polyribonucleotide comprises one or more antibody-polypeptide complexes. Complex, Polypeptide-Polypeptide Complex, Polypeptide-DNA Complex, Polypeptide -RNA complex, polypeptide-aptamer complex, virus particle-antibody complex, virus virus particle-polypeptide complex, virus particle-DNA complex, virus particle-RNA complex a virus particle-aptamer complex, a cell-antibody complex, a cell-polypeptide complex, Cell-DNA complex, cell-RNA complex, cell-aptamer complex, small molecule-polypeptide complex tide complexes, small molecule-DNA complexes, small molecule-aptamer complexes, small molecule-cell complexes, Conjugation for one or more binding moieties to small molecule-virus particle complexes, and combinations thereof It may include a site.

[0152] In some cases, the binding moiety is on a polypeptide, protein, or fragment thereof. In some embodiments, the binding moiety is a polypeptide, protein, or fragment thereof. For example, a binding moiety may be an isolated isolated, cellular, purified, or recombinant polypeptides. For example, a binding moiety may be a domain, fragment, epitope, region, or portion of a peptide. , a domain, fragment, epitope, region, or portion of an antibody or fragment thereof. For example, A binding moiety may include a domain, fragment, epitope, region, or portion of a transcription factor. Binding moieties include domains, fragments, epitopes, regions, or portions of a receptor. For example, The binding moiety includes a domain, fragment, epitope, region, or portion of a transmembrane receptor. The moiety may be an isolated polypeptide, a purified polypeptide, and / or a recombinant polypeptide. The present invention may be directed to or include a domain, fragment, epitope, region, or portion of a peptide. The binding moieties are capable of binding to domains, fragments, epitopes, or fragments of a mixture of analytes (e.g., lysates). The binding moiety may be on or include a group, region, or portion. For example, The fragments are domains, fragments, epitopes, and fragments derived from multiple cells or single cell lysates. On or including a region or portion.

[0153] In some cases, the binding moiety is a domain, fragment, epitope, region, or fragment of a small molecule. For example, the binding moiety may be on or comprise a domain, fragment, or moiety of a drug. For example, a binding moiety may be a compound that is located on or includes an epitope, region, or portion of a compound. On or comprising a domain, fragment, epitope, region, or portion of a substance. For example, a binding moiety may be a domain, fragment, epitope, region, or portion of an organic compound. In some cases, the binding moiety comprises or is a molecule of 900 daltons or less. A domain, fragment, epitope, region, or portion of a small molecule having a In some cases, the binding moiety has a molecular weight of 500 daltons or greater. On or comprising a domain, fragment, epitope, region, or portion of a small molecule. The binding moieties may be, for example, libraries of compounds generated via combinatorial means. , naturally occurring or synthetic molecules, including, for example, diversity combinatorial libraries. Combinatorial libraries and their derivatives may also be used. Methods for synthesis and screening are known in the art and the disclosures cited herein are incorporated by reference. Nos. 5,741,713 and 5,734, which are incorporated herein by reference. Specification No. ,018; Specification No. 5,731,423; Specification No. 5,721,099 ; Specification No. 5,708,153; Specification No. 5,698,673; Specification No. 5,688 ,997 specification; 5,688,696 specification; 5,684,711 specification ; Specification No. 5,641,862; Specification No. 5,639,603; Specification No. 5,593 ,853 specification; 5,574,656 specification; 5,571,698 specification ; Specification No. 5,565,324; Specification No. 5,549,974; No. 5,545 ,568 specification; 5,541,061 specification; 5,525,735 specification ; Specification No. 5,463,564; Specification No. 5,440,016; No. 5,438 ,119; and 5,223,409.

[0154] A binding moiety may be a domain, fragment, epitope, or fragment of a specific binding pair member (e.g., a ligand). The binding moiety may be on or include a tope, region, or moiety. A monoepitope or polyepitope domain, fragment, epitope, region, or The binding moiety may be antigenic or haptenic. The binding moieties may be a single molecule or may bind to at least one common epitope or determinant site. may be on domains, fragments, epitopes, regions, or portions of multiple molecules that share The binding moiety may be or may comprise a cell (e.g., a bacterial cell, a plant cell, or an animal cell). ) or on any domain, fragment, epitope, region, or portion of The binding moiety may be present in a natural environment (e.g., tissue), in cultured cells, or in a microorganism (e.g., cells). bacteria, fungi, protozoa, or viruses) or lysed cells. The binding moiety can be modified (e.g., chemically) to include dyes (e.g., fluorescent dyes), phosphate groups, A polypeptide modifying moiety such as a carbohydrate group or a polynucleotide modifying moiety such as a methyl group One or more additional binding sites can be provided, such as, but not limited to, .

[0155] In some cases, the binding moiety is a domain of a molecule found in a sample derived from a host. on or comprising any fragment, fragment, epitope, region, or portion of the host. Samples may be collected from body fluids (e.g., urine, blood, plasma, serum, saliva, semen, feces, sputum, cerebrospinal fluid, tears, mucus, etc.) The sample may be tested directly or may be modified to more easily detect bound moieties. A sample may be prepared to collect a quantity of material from an organism or the remains of an organism. The sample may be natural, recombinant, synthetic, or non-naturally occurring. The moieties may be naturally or recombinantly expressed from cells, cell lysates or cell cultures. in culture medium, from in vitro translated samples, or from samples (e.g., cell lysates) The immunoprecipitation of

[0156] In some cases, the target binding portion is expressed in a cell-free system or in vitro. For example, the binding moiety of the target is in a cell extract. The portion is in a cell extract along with a DNA template and reagents for transcription and translation. Exemplary sources of cell extracts that may be used include wheat germ, Escherichia coli (E scherichia coli), rabbit reticulocytes, hyperthermophiles, hybridomas, Xenopus oocytes, insect cells, and mammalian cells (e.g., Human cells that express the target polypeptide (e.g., the target polypeptide on an array). Exemplary cell-free methods that can be used to generate protein in situ hybridization (e.g., to generate peptides) include Turay (PISA), Multiple Spotting Technology (MIST), Self-organizing mRNA Translation Translated by: Nucleic Acid Programmable Protein Array (NAPPA), Nanowell NAPPA, DN A array to protein array (DAPA), membrane-free DAPA; Nanowell copy and μIP-microintaglio printing, and pMAC-tan Protein microarray copy (Kilb et al., Eng. Life Sci. 2 014,14,352-364).

[0157] In some cases, the target binding moiety is derived in situ from the DNA template (e.g. In some cases, multiple binding moieties are synthesized on a solid substrate in an array. are synthesized in situ in a single reaction or in parallel from multiple corresponding DNA templates Exemplary methods for in situ target polypeptide expression include those described by Steven s,Structure 8(9):R177-R185(2000);Katzen et al.,Trends Biotechnol.23(3):150-6.(20 05);He et al.,Curr.Opin.Biotechnol.19(1) :4-9.(2008);Ramachandran et al.,Science 305(5680):86-90.(2004);He et al.,Nucleic Acids Res.29(15):E73-3(2001);Angenendt et al.,Mol.Cell Proteomics 5(9):1658-66( 2006);Tao et al, Nat Biotechnol 24(10):12 53-4(2006);Angenendt et al.,Anal.Chem.76 (7):1844-9(2004);Kinpara et al., J.Bioche m.136(2):149-54(2004);Takulapalli et al. ,J.Proteome Res.11(8):4382-91(2012);He e t al., Nat. Methods 5(2):175-7(2008);Chat erjee and J. LaBaer,Curr Opin Biotech 17( 4):334-336(2006);He and Wang,Biomol Eng 24(4):375-80(2007); and He and Taussig, J. Im munol.Methods 274(1-2):265-70(2003) The following are listed:

[0158] In some cases, the binding portion of the nucleic acid target is at least 6 nucleotides, e.g. For example, at least 8, 9, 10, 12, 15, 20, 25, 30, 40, 50, or 10 In some cases, the binding portion of the protein target comprises a stretch of 0 nucleotides. In some cases, the protein target The binding moiety comprises a non-contiguous stretch of nucleotides. The target binding moiety may include nucleotide deletions, additions, exchanges, or truncations in the nucleic acid sequence. , including the site of mutation or functional mutation.

[0159] In some cases, the binding portion of the protein target is at least six amino acids, For example, at least 8, 9, 10, 12, 15, 20, 25, 30, 40, 50, or 1 In some cases, the binding portion of the protein target comprises a stretch of 00 amino acids. , a contiguous stretch of amino acids. In some cases, the binding site of a protein target The sequence may include a non-contiguous stretch of amino acids. The binding moiety may include amino acid deletions, additions, exchanges, or truncations in the polypeptide sequence. , including the site of mutation or functional mutation.

[0160] In some embodiments, the binding moiety is a domain, fragment, epitope of a membrane-associated protein. Exemplary membrane-associated proteins include those that are located on or include a portion, region, or portion of the membrane-associated protein. , GPCRs (e.g., adrenergic receptors, angiotensin receptors, cholecystokinin receptors, Receptor, Muscarinic acetylcholine receptor, Neurotensin receptor, Galanin receptor , dopamine receptors, opioid receptors, erotonin receptors, soma tostatin receptors, etc.), ion channels (e.g., nicotinic acetylcholine receptors, Sodium channels, potassium channels, etc.), receptor tyrosine kinases, receptor serine / Threonine kinases, receptor guanylate cyclases, growth factor and hormone receptors (e.g. For example, epidermal growth factor (EGF) receptors are included, but are not limited to these. The binding moiety may also be a domain, fragment, or mutant or engineered variant of a membrane-associated protein. , epitope, region, or portion thereof. For example, Several single or multiple point mutations in R conserve function and are involved in disease (e.g., St adel et al.,(1997)Trends in Pharmacology cal Review 18:430-37).

[0161] In some embodiments, the polyribonucleotide comprises a nucleic acid sequence for binding to other intracellular molecules. Other binding motifs may be included. Illustrative examples are listed in Table 1.

[0162] [Table 1]

[0163] In some embodiments, the polyribonucleotides described herein are intended to be useful in cellular processes. Capture targets that regulate the process, such as DNA, RNA, proteins, and other cellular components. A polyribonucleotide that has a binding site for a target of interest is ligated to an endogenous binding partner. In some embodiments, the polyribonucleotides described herein can compete with the binding of the target to the polypeptide. The nucleotides capture the miRNA. In some embodiments, the polyribonucleotide described herein captures the mRNA. The described polyribonucleotides capture proteins. In some embodiments, The polyribonucleotides described herein capture ribosomes. In some embodiments, the polyribonucleotides described herein may be synthesized by combining other polyribonucleotides. In some embodiments, the polyribonucleotides described herein are non- Code RNA, lncRNA, miRNA, tRNA, rRNA, snoRNA, ncR In some embodiments, the method captures the NA, siRNA, or shRNA described herein. The polyribonucleotides carried on the substrate are bound to the captured targets, e.g. Contains degradative elements that degrade the associated DNA, RNA, proteins, or other cellular components. Non-limiting examples of capture applications of polyribonucleotides such as circRNAs are listed in Table 2. It is mentioned.

[0164] [Table 2]

[0165] In some embodiments, methods of using the polyribonucleotides described herein Any of the above can be combined with a translation element. The polyribonucleotides described herein are capable of translating RNA into protein. For example, protein expression is determined by the sequence-specific RNA-binding motif, sequence-specific DNA-binding motif, and Polyribonucleic acid containing chief, protein-specific binding motifs, and regulatory RNA motifs Regulatory RNA motifs regulate RNA transcription and protein expression. can be started.

[0166] Encryptogen As described herein, polyribonucleotides reduce cellular innate immune responses. Polyribonucleotides may contain encryptogens that allow or prevent the formation of ribonucleotides. It can be in either a linear or cyclic form. The cyclic polyribonucleotides provided have a potent inhibitory effect on the response elicited by the reference compound, compared to the response elicited by the reference compound. This results in a reduced immune response from the host. For example, cyclic polyribonucleotides can be used to Compared to a linear polynucleotide or a linear polynucleotide containing an encryptogen A corresponding linear polyribonucleic acid molecule lacking the encryptogen results in a reduced immune response. In some embodiments, the polyribonucleic acid The polypeptides are less immunogenic than their counterparts lacking the cryptogen.

[0167] In some embodiments, the polyribonucleotide is In some embodiments, the polyribonucleotide is expressed in a mammalian cell, For example, it is capable of replicating in human cells.

[0168] In some embodiments, the polyribonucleotide comprises a sequence or an expression product.

[0169] In some embodiments, the polyribonucleotide comprising the encryptogen is In some embodiments, the half-life of the polysaccharide is at least as long as that of its counterpart lacking the saccharide. Ribonucleotides have increased half-lives over their counterparts. The half-life is approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 4 In some embodiments, the polyribonucleic acid is increased by 5%, 50%, or more. The dose is at least about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days 26 days, 27 days, 28 days, 29 days, 30 days, 60 days or more or any time in between. The polyribonucleotide may be incubated for about 10 minutes to about 7 days, or for about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 1 3 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 2 1 hour, 22 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days 5 days, 6 days, 7 days or less, or any time in between. do.

[0170] In some embodiments, the polyribonucleotide comprising the encryptogen inhibits cellular function. In certain embodiments, the cellular function is at least In either case, the time is about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, or 2 4 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days , 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days , 19th day, 20th day, 21st day, 22nd day, 23rd day, 24th day, 25th day, 26th day , 27 days, 28 days, 29 days, 30 days, 60 days, or more, or any period therebetween The alteration is stable, such as a modulation that lasts for any period of time. In certain embodiments, the cellular function is For example, about 30 minutes to about 7 days or less, or about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days, 6 days, 7 days The modification may be transient, such as a modulation lasting for less than or any period of time therebetween.

[0171] In some embodiments, the polyribonucleotide comprising the encryptogen comprises at least At least about 20 base pairs, at least about 30 base pairs, at least about 40 base pairs, at least about 50 base pairs, at least about 75 base pairs, at least about 100 base pairs, at least about 200 base pairs at least about 300 base pairs, at least about 400 base pairs, at least about 500 base pairs In some embodiments, the length of the encryptogen is at least about 1,000 base pairs. Polyribonucleotides containing ribonucleotides have sufficient fragment length to accommodate binding sites for ribosomes. Those skilled in the art can determine the maximum size of the polyribonucleotide containing the encryptogen. Size determines the degree of freedom in producing and / or using polyribonucleotides It will be appreciated that the dimensions may be within the technical constraints of the present invention.

[0172] In some embodiments, the cyclic polyribonucleotide comprising the encryptogen is a linear polyribonucleotide. The half-life of the linear expression sequence or linear circular polyribonucleotide is slightly different from that of its linear counterpart, e.g. In some embodiments, the circular polyribonucleotide is a linear polyribonucleotide. In some embodiments, the half-life is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or In some embodiments, the circular polyribonucleotide is at least In either case, the time is about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, or 2 4 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days , 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days , 19th day, 20th day, 21st day, 22nd day, 23rd day, 24th day, 25th day, 26th day , 27 days, 28 days, 29 days, 30 days, 60 days, or more, or any period therebetween In certain embodiments, the cyclic polysaccharide has a half-life or persistence in cells of any length of time. The polynucleotide may be used for about 10 minutes to about 7 days or less, or for about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days, 6 days The compound has a half-life or persistence in cells of 10 to 20 minutes, 7 days or less, or any time therebetween.

[0173] In some embodiments, the cyclic polyribonucleotide comprising the encryptogen is In certain embodiments, the cellular function is modulated, for example, transiently or long term. At least about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, or 18 hours , 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days days, 27 days, 28 days, 29 days, 30 days, 60 days or more or In certain embodiments, the cellular function is stably altered, such as a modulation that lasts for any period of time between For example, about 30 minutes to about 7 days or less, or about 1 hour, 2 hours, 3 hours, 4 hours, or 5 hours , 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days, 6 days, 7 The modification may be transient, such as a modulation lasting for days or less, or any time therebetween.

[0174] In some embodiments, the cyclic polyribonucleotide comprising the encryptogen comprises at least at least about 20 base pairs, at least about 30 base pairs, at least about 40 base pairs, at least about 50 base pairs, at least about 75 base pairs, at least about 100 base pairs, at least about 200 base pairs, at least about 300 base pairs, at least about 400 base pairs, at least about 500 base pairs In some embodiments, the circular polyribonucleotide has at least about 1,000 base pairs. The polynucleotide is of sufficient size to accommodate a binding site for a ribosome. Those skilled in the art will appreciate that the maximum size of a circular polyribonucleotide is Within the technical constraints of producing and / or using circular polyribonucleotides Without being bound by theory, it can be appreciated that the RNA The multiple segments are maximally cleaved when only one 5' and one 3' free end remain. DNA that is annealed to produce a "thread" of RNA that can eventually be circularized, and In some embodiments, the cyclic nucleotides may be generated from the 5' and 3' free ends of the cyclic nucleotides. The maximum size of a polyribonucleotide is the capacity to package and deliver RNA to a target. In some embodiments, the size of the circular polyribonucleotide may be limited by a force. is long enough to code for a useful polypeptide, and therefore is approximately 20,000 Less than 0 base pairs, less than about 15,000 base pairs, less than about 10,000 base pairs, about 7,500 base pairs less than about 5,000 base pairs, less than about 4,000 base pairs, or less than about 3,000 base pairs less than about 2,000 base pairs, less than about 1,000 base pairs, less than about 500 base pairs, less than about 40 The length is less than 0 base pairs, less than about 300 base pairs, less than about 200 base pairs, or less than about 100 base pairs. Could be useful.

[0175] Cleavage sequence In some embodiments, the polyribonucleotide comprises at least one cleavage sequence. Polyribonucleotides can exist in either linear or circular form. In embodiments, the cleavage sequence is adjacent to the expression sequence. The nucleotide may be a disrupted polyribonucleotide, a cleavable polyribonucleotide, or a self-cleavable polyribonucleotide. In some embodiments, the nucleic acid sequence includes a cleavage sequence, such as in a truncated polyribonucleotide. The polyribonucleotide may contain two or more cleavage sequences, resulting in multiple production of polyribonucleotides. to products such as miRNA, linear RNA, smaller circular polyribonucleotides, etc. Brings about separation.

[0176] In some embodiments, the cleavage sequence comprises a ribozyme RNA sequence. NA enzymes, also called catalytic RNAs (derived from ribonucleic acid enzymes), are enzymes that catalyze chemical reactions. Many natural ribozymes are RNA molecules that have one of their own phosphodiester bonds. catalyzes either the hydrolysis of one bond in RNA or the hydrolysis of bonds in other RNA. has also been found to catalyze the aminotransferase activity of ribosomal. Catalytic RNAs can be "evolved" by in vitro methods. Similarly, ribozymes and their reaction products can regulate gene expression. In some embodiments, the catalytic RNA or ribozyme is a molecule that is separated from the bulk volume of the ribozyme. Larger non-coding RNAs exist in many copies within cells due to chemical conversion of In some embodiments, the aptamer and the ribozyme can both be located within It can be encoded in the same non-coding RNA.

[0177] Destruction Array In some embodiments, the polyribonucleotides described herein are disrupted polyribonucleotides. a polyribonucleotide, a cleavable polyribonucleotide, or a self-cleaving polyribonucleotide Polyribonucleotides can exist in either linear or circular form. Polynucleotides include, for example, RNA, lncRNA, lincRNA, miRNA, tRNA, Cellular components containing NA, rRNA, snoRNA, ncRNA, siRNA, or shRNA In some embodiments, the polyribonucleotide can be delivered in a dose of 100 mg / kg or more. (ii) a self-cleavable element; (iii) a cleavage recruitment site; (iv) a degradable linker; (v) a chemical linker; and / or (v) a spacer sequence. In some embodiments, the polyribonucleotide comprises: (i) a self-cleavable element; (ii) a cleavage recruitment site (e.g., ADAR); (iii) a degradable linker (e.g., glyceryl (iv) a chemical linker; and / or (v) a spacer sequence. Non-limiting examples of self-cleavable elements include siRNAs that are , splicing element, hairpin, Hepatitis Delta Virus (HDV), Vark ud satellite (VS), and glmS ribozyme. Non-limiting examples of unregulated applications of polyribonucleotides are listed in Table 3.

[0178] [Table 3]

[0179] Riboswitches In some cases, the polyribonucleotide contains one or more riboswitches. Polyribonucleotides can exist in either linear or circular form.

[0180] Riboswitches are usually small fragments of polyribonucleotides that can directly bind to target molecules. It is believed that the binding of its target affects RNA translation, the stability and activity of the expressed product. Tucker BJ, Breaker RR (2005), Cur r Opin Struct Biol 15(3):342-8). A polyribonucleotide containing a switch can regulate its own activity depending on the presence or absence of its target molecule. In some cases, riboswitches are directly involved in regulating the function of a separate molecule. Thus, in the broader context of the present invention, Any aptamer contained in a non-coding nucleic acid can be used to capture molecules from a bulk volume. Downstream transmission of events via "(ribo)switch" activity can be particularly advantageous.

[0181] In some cases, riboswitches can regulate transcription termination, inhibition of translation initiation, and mRNA self-regulation. These include, but are not limited to, truncations and alterations of splicing pathways in eukaryotes. Riboswitches can have an effect on gene expression. The riboswitch is then exposed to conditions that activate, deactivate or block the riboswitch. Inhibition of gene expression by binding or removal of a trigger molecule, such as by altering expression Expression can have a function in regulating, for example, the termination of transcription or the binding of ribosomes to RNA. As a result of blocking of binding, the binding of the trigger molecule or its analogue is altered. Depending on the nature of the switch, it may reduce or prevent expression of the RNA molecule or inhibit the expression of the RNA molecule. Riboswitches can promote or increase the expression of a gene. , as described herein.

[0182] In some cases, the riboswitch inhibits the transcription of adenosylcobalamin (vitamin B 12 of Cobalamin binds to coenzyme form to regulate the biosynthesis and transport of cobalamin and similar metabolites. Baramin riboswitch (B 12 - element).

[0183] In some cases, riboswitches bind cyclic di-GMP to regulate the transcription of various genes. There are two structurally unrelated classes of cyclic di-GMP riboswitches that regulate (cyclic di-GMP-I and cyclic di-GMP-II).

[0184] In some cases, the riboswitch binds to flavin mononucleotide (FMN). Together, these FMN riboswitches (RFN-elements) regulate riboflavin biosynthesis and transport. (It is also a

[0185] In some cases, the riboswitch detects when sufficient concentrations of glucosamine-6-phosphate are present. The glmS riboswitch self-cleaves when present.

[0186] In some cases, the riboswitch binds to glutamine and reacts with glutamine and nitrogen. They are glutamine riboswitches that regulate genes involved in glutamine metabolism. Such riboswitches can be divided into two classes: They are structurally related: the glnA RNA motif and the downstream peptide motif.

[0187] In some cases, the riboswitch binds glycine and encodes the glycine metabolic gene It is a glycine riboswitch that regulates two adjacent It is the only known naturally occurring RNA that contains an aptamer domain and exhibits cooperative binding.

[0188] In some cases, riboswitches bind lysines and regulate lysine biosynthesis, catabolism, and and lysine riboswitches (also L-boxes) that regulate transport.

[0189] In some cases, the riboswitch binds to and mediates the synthesis of prequeusine. or the PreQ1 riboswitch that regulates the transport of this precursor to queuosine. There are two completely different classes of PreGI riboswitches: PreQ1 and PreQ2. The PreQ1-I riboswitch and the PreQ1-II riboswitch. The binding domain is unusually small for a naturally occurring riboswitch. Streptococcus and Lactococcus The PreGI-II riboswitches found only in certain species in It has structure and is larger.

[0190] In some cases, riboswitches bind purines and regulate purine metabolism and transport. The different forms of purine riboswitches regulate the transcription of guanine (G -box) or adenine. The specificity for both was determined by covalent binding to a single pyrimidine in the riboswitch at position Y74. In the guanine riboswitch, this residue is , cytosine (i.e., C74), and in adenine residues, it is always uracil (i.e., U74). The same type of purine riboswitch binds deoxyguanosine. It binds, but with a more significant difference than the single nucleotide mutation.

[0191] In some cases, the riboswitch binds S-adenosylhomocysteine This substitute is produced when S-adenosylmethionine is used in the methylation reaction. It is a SAH riboswitch that regulates genes involved in metabolic product recycling.

[0192] In some cases, the riboswitch binds to S-adenosylmethionine (SAM). In combination, it is the SAM riboswitch that regulates the biosynthesis and transport of methionine and SAM. Three different SAM riboswitches are known: SAM-I (originally called the S-box) SAM-II and S M K-box riboswitch. SAM-I is a single Although SAM-II is common in α-, β-, and a few γ-proteobacteria, Only found in S M The K-box riboswitch is a These three variants of the riboswitch are found only in the order Illales. The fourth variant, SAM-IV, has a different In the context of a scaffold that is similar to that of SAM-I, It looks like it.

[0193] In some cases, the riboswitches bind to both SAM and SAH with similar affinity. These are SAM-SAH riboswitches that bind methionine adenosyltransferase. These S Only binding to AM was proposed to be physiologically relevant.

[0194] In some cases, the riboswitch binds tetrahydrofolate and regulates the synthesis and transport of It is a tetrahydrofolate riboswitch that regulates gene delivery.

[0195] In some cases, the riboswitch is a theophylline-binding riboswitch or a thymine-binding riboswitch. It is a pyrophosphate-binding riboswitch.

[0196] In some cases, the riboswitch is a T. theta gene that senses glucosamine-6-phosphate. The glmS catalytic riboswitch from T. tengcongensis (Klein and Ferre-D'Amare 2006).

[0197] In some cases, the riboswitch binds thiamine pyrophosphate (TPP) , the TPP riboswitch that regulates thiamine biosynthesis and transport, and transport of similar metabolites (also THI-box). It is the only It is the first riboswitch.

[0198] In some cases, the riboswitch binds to a molybdenum cofactor and mediates this cofactor. Genes involved in the biosynthesis and transport of factors, and genes that use them or their derivatives as cofactors The Moco riboswitch regulates the enzyme used by the

[0199] In some cases, the riboswitch is a transcription factor that regulates transcription in Vibrio vulnificus. vulnificus adenine deaminase-encoding gene in the 5'UTR The adenine-sensing add-A riboswitch is found in

[0200] Aptazymes In some cases, the polyribonucleotide comprises an aptazyme. The system uses an aptamer domain as an allosteric control element and controls catalytic RNA. A switch for conditional expression that is linked to a region of A. Ptazymes are active in cell type-specific translation. Ptazyme is a transcription factor that regulates the transcription of proteins in a cell-state specific manner, for example in virus-infected cells or in cells infected with viruses. Polyribonucleotides are active in the presence of nucleic acids or viral proteins. It can exist in either a linear or cyclic form.

[0201] Ribozymes (derived from ribonucleic acid enzymes, also called RNA enzymes or catalytic RNAs) are Ribozymes are RNA molecules that catalyze chemical reactions. Many natural ribozymes bind to their own phosphodiesterases. It catalyzes either the hydrolysis of one of the ester bonds or the hydrolysis of the bonds in the other RNA. They also can catalyze the aminotransferase activity of the ribosome. More recently, it has been shown that catalytic RNAs can be "evolved" by in vitro methods. [1. Agresti JJ, Kelly BT, Jaschke A,Griffiths AD:Selection of ribozymes hat catalyst multiple-turnover Diels-Ald er cycloadditions by using in vitro comp artmentalization.Proc Natl Acad Sci USA 2005,102:16170-16175;2.Sooter LJ,Riedel T, Davidson EA, Levy M, Cox JC, Ellington AD:Toward automated nucleic acid enzym e selection.Biological Chemistry 2001,38 2(9):1327-1334.]. Winkler et al. ahvi A, Roth A, Collins JA, Breaker RR:Co ntrol of gene expression by a natural me tabolite-responsive ribozyme.Nature 2004 428:281-286], as well as the riboswitch activity discussed above, It has been shown that the ribozymes and their reaction products can regulate gene expression. Ribozymes exist in many copies within cells for chemical conversion of molecules from bulk volume. In particular, it is advantageous to place a catalytic RNA or a ribozyme within a larger non-coding RNA. In addition, it is possible to code for both an aptamer and a ribozyme in the same non-coding RNA. It may be particularly advantageous to do so.

[0202] Some non-limiting examples of ribozymes include hammerhead ribozymes, VL ribozymes, and the like. Examples of ribozymes include ribozymes, leadzymes, and hairpin ribozymes.

[0203] In some cases, the aptazyme cleaves the RNA sequence and binds the ligand / module. Ribozymes that can be regulated as a result of binding to a regulator. Ribozymes can also be They may also be self-cleaving ribozymes. Therefore, they have the same characteristics as ribozymes and aptamers. Aptazymes combine the potential of their activity in trans, The fact that they act catalytically to inactivate expression, and their own or heterologous transcripts It surpasses conventional aptamers due to the fact that inactivation due to cleavage of Provides benefits.

[0204] In some cases, the aptazyme is a polyribonucleotide, e.g., a linear or is included in the untranslated region of the circular polyribonucleotide and is a non-coding region of the ligand / modulator. In the presence of a ligand, the transgene is inactive, allowing expression of the transgene. It can be blocked (or downregulated). Downregulated in response to the presence of a specific modulator. The controlled aptazymes may be used in a control system to regulate the expression of the aptazymes in response to a modulator. It should be noted that upregulation of gene expression is desirable.

[0205] Aptazymes also enable the development of a system for the autoregulation of polyribonucleotide expression. For example, cyclic polyribonucleotides, which are rate-limiting enzymes in the synthesis of certain small molecules, can be synthesized using the The protein product of the molecule is selected to have increased catalytic activity in the presence of the molecule. The enzyme has been modified to contain tazymes, thereby providing an autoregulatory feedback loop for its synthesis. Alternatively, aptazyme activity may result in a loop derived from a circular polyribonucleotide. The cellular macromolecules may be selected to be sensitive to the accumulation of a protein product of interest, or any other cellular macromolecule. do.

[0206] In some cases, the polyribonucleotide may include an aptamer sequence. Some non-limiting examples include RNA aptamers binding lysozyme, with high specificity and affinity. RNA aptamer containing 2' fluoropyrimidine nucleotides that binds to thrombin at Toggle-25t, a transactivating response element of the human immunodeficiency virus (HIV TAR) binding RNATat, RNA aptamer binding hemin, RNA aptamer binding Interferon-γ, RNA aptamer-bound vascular endothelial growth factor (VEGF), RNA aptamer Aptamer binding prostate specific antigen (PSA), RNA aptamer binding dopamine, and non-classical One example is an RNA aptamer that binds to the target cancer gene, heat shock factor 1 (HSF1).

[0207] Other Reagents In some cases, the composition or pharmaceutical composition comprises an alcohol or a cell permeation agent and a polysaccharide. In addition to the oligonucleotide, the composition or pharmaceutical composition may further comprise a reagent. In addition to ribonucleotides, one or more peptides, nucleic acids (e.g., DNA), proteins a protein (e.g., an antibody or fragment thereof), an APC, a virus, a small molecule compound, a prodrug, or In some cases, the composition may contain one or more active agents, such as a therapeutic agent, including combinations thereof. In this case, the composition or pharmaceutical composition containing one or more active agents, e.g., therapeutic agents, can be, for example, For example, excipients, diluents, and agents that facilitate processing of one or more active agents into an administrable formulation. The composition may be formulated using one or more physiologically acceptable carriers, including / or auxiliary agents. Ribonucleotides can exist in either linear or cyclic form.

[0208] In some cases, the compositions or pharmaceutical compositions described herein further comprise a therapeutic and / or other suitable excipients, carriers, diluents, adjuvants, other auxiliary media, buffers, stabilizers, The composition or pharmaceutical composition may further comprise salt concentration, osmolality, pH Suitable physical or chemical properties, such as, but not limited to, hydrophobicity / hydrophilicity, and solubility, may be considered. Other agents that maintain the chemical properties of the composition may be included. For example, the composition may contain stabilizers, e.g., suitable In some embodiments, the polysaccharide may include glucose at a concentration of, for example, about 4.5 g / L. Ribonucleotides are non-immunogenic. In some embodiments, polyribonucleotides The composition or pharmaceutical composition further comprises an immunogen of the polyribonucleotide. The composition may include suitable adjuvants or other agents which may enhance or inhibit the activity of the antibody.

[0209] Non-limiting examples of therapeutically acceptable carriers include starch, glucose, lactose. , sucrose, gelatin, saline, acacia gum, keratin, urea, malt, rice flour, hu Powder, Silica Gel, Sodium Stearate, Glycerol Monostearate, Talc, Salt Sodium chloride, dried skim milk, glycerol, propylene, glycol, humectants (e.g. urea), glycols (e.g., propylene glycol), fatty acids (e.g., oleyl acid), surfactants (e.g., isopropyl myristate and sodium lauryl sulfate) , pyrrolidone, glycerol monolaurate, sulfoxides, terpenes (e.g., menthol, alcohol), amines, amides, alkanes, alkanols, water, calcium carbonate, calcium phosphate Ums, various sugars, starches, cellulose derivatives, gelatin, polyethylene glycols, etc. and water. If necessary, the carrier may also contain a small amount of a wetting agent or emulsion. The composition may contain a pH adjusting agent or a pH buffer.

[0210] stability The polyribonucleotides provided herein are stable after delivery to a cell or tissue. and can exert a biological effect on the cells or tissues to which the polyribonucleotides are delivered. Polyribonucleotides can be linear or In some embodiments, the polyribonucleotide may be in any form. , a linear polyribonucleotide that exerts a short-term biological effect, e.g., at least one hour 10 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, or any time in between. In some embodiments, the polyribonucleotide is a ring structure. It is a polyribonucleotide with a long-term biological effect, e.g., for at least 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days For a biological effect lasting for days, 14 days, or more, or any time in between. In some embodiments, the polyribonucleotide is used after degradation, e.g., exonuclease. In some embodiments, the polyribonucleoside is substantially resistant to nucleases. In some embodiments, the polyribonucleotide is resistant to autolysis. lacks an enzyme cleavage site, e.g., a Dicer cleavage site.

[0211] In some embodiments, the polyribonucleotides remain in the cell during cell division. In some embodiments, the polyribonucleotides remain in daughter cells after mitosis. In some embodiments, the polyribonucleotide is replicated within the cell and passed to daughter cells. In some embodiments, the polyribonucleotide is an autologous polyribonucleotide. In some embodiments, the replication element comprises: A linear polyribonucleotide complementary to the circular polyribonucleotide of In some embodiments, the linear complementary The polyribonucleotides are synthesized in the cells into complementary circular polyribonucleotides. In some embodiments, the complementary polyribonucleotide may further comprise to another circular polyribonucleotide having the same or similar nucleotide sequence as the starting circular polyribonucleotide. An example of an autonomous replicating element is the HDV complex. Domains (Beeharry et al, Virol, 2014, 450-451: 165-173). In some embodiments, The cells express at least one polyribonucleotide at least 25%, 50%, 60%, They pass it to daughter cells with 70%, 80%, 85%, 90%, 95%, or 99% efficiency. In one embodiment, the cells undergoing meiosis contain at least two polyribonucleotides. 5%, 50%, 60%, 70%, 80%, 85%, 90%, 95% or 99% efficient In some embodiments, cells undergoing meiosis pass polyribonucleic acid (PNA) to daughter cells. Give the leotide to your daughter.

[0212] Compositions and Delivery Routes The compositions or pharmaceutical compositions provided herein are based in part on the intended route of administration of the composition. In certain aspects of the disclosure, the compositions or pharmaceutical compositions provided herein may be formulated according to the methods described herein. The pharmaceutical composition may be administered locally at or near a particular site in a subject. The composition may be as described in the document and may further include a pharma- ceutically acceptable excipient. For example, viscous liquids, solutions, suspensions, gels, jellies, creams, lotions, ointments Direct topical application of tablets, suppositories, foams, or aerosol sprays may be used for topical administration. In some embodiments, the compositions are formulated for systemic administration. Pharmaceutically suitable vehicles for such formulations include, for example, lower aliphatic alcohols, polyglycerides, and the like. Lithium (e.g., glycerol or polyethylene glycol), esters of fatty acids, oils , fats, silicones, etc. Such formulations may also optionally contain preservatives (e.g. p-hydroxybenzoic acid esters) and / or antioxidants (e.g., ascorbic acid and tocopherol). Polyribonucleotides may be either linear or cyclic. It may be in the form:

[0213] The composition or pharmaceutical composition may comprise an alcohol (e.g., ethanol) and a polyribonucleic acid The composition or pharmaceutical composition may include a cell permeation agent and a polyribonucleotide. The composition or pharmaceutical composition may include a diluent and a polyribonucleotide. The product or pharmaceutical composition does not include any carrier.

[0214] The compositions or pharmaceutical compositions provided herein can be used to treat skin, nails, oral cavity, nasal cavity, ear cavity, vagina, For direct administration onto surface areas of a subject, such as the cervix, intrauterine, urinary tract, and surface areas of the eye. It can be formulated for this purpose.

[0215] The compositions or pharmaceutical compositions described herein may be formulated as a suspension, syrup, or elixir. In some cases, the aqueous solution may be prepared as is. The lyophilized preparations may be packaged for administration in a sterile solution or lyophilized; the lyophilized preparations may be reconstituted with a sterile solution prior to administration. The composition may be delivered as a solution or as a suspension. Generally, a gel (e.g. DMSO gels), jellies, creams, lotions (e.g., Johnson & Schneider, Formulations such as Johnson & Johnson lotion, suppositories and ointments are available that contain one or more active agents. can result in areas with more extensive exposure, while solutions, e.g. formulations can provide more rapid short-term exposure.

[0216] The compositions or pharmaceutical compositions described herein may have a pH of about 7. In embodiments, the composition or pharmaceutical composition has about the same viscosity as water. The article may be substantially free of hydrophobic or lipophilic groups. The pharmaceutical composition is substantially free of hydrocarbons. The composition or pharmaceutical composition is substantially free of fatty acids, lipids, It may be substantially free of liposomes, cholesterol, or any combination thereof.

[0217] In some embodiments, delivery of polyribonucleotides as described herein The method includes applying a composition comprising a mixture of polyribonucleotides and ethanol to a surface area of ​​a subject. wherein ethanol is at least about 0.3% v / v of the mixture. In some embodiments, the polysaccharide comprises at least one of the polysaccharides as described herein. The method of delivery of ribonucleotides includes a mixture of polyribonucleotides and alcohol. The method includes topically applying the composition to a surface area of ​​a subject, the alcohol being at least one component of the mixture. In some embodiments, the components described herein comprise from about 0.3% v / v to about 75% v / v. The method of delivery of polyribonucleotides as described comprises the steps of: The method includes topically applying to a surface area of ​​a subject a composition comprising a mixture of cell permeabilizing agents. The filter comprises at least about 0.3% v / v to about 75% v / v of the mixture. In embodiments, the ethanol, alcohol, or cell permeation agent comprises at least about 0.3% of the mixture. %v / v to about 70%v / v, at least about 0.3%v / v to about 60%v / v, at least About 0.3% v / v to about 50% v / v, at least about 0.3% v / v to about 40% v / v, a little At least about 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v v, at least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5 % v / v, at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v, or any percentage v / v therebetween. In some embodiments, the ethanol, alcohol, or cell permeation agent is at least one of the mixture. At least about 0.5% v / v to about 75% v / v, at least about 1% v / v to about 75% v / v, At least about 5% v / v to about 75% v / v, at least about 10% v / v to about 75% v / v, At least about 15% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v , at least about 30% v / v to about 75% v / v, at least about 40% v / v to about 75% v / v / v, at least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75 % v / v, or at least about 70% v / v to about 75% v / v, or any value therebetween. of v / v.

[0218] In many cases, the compositions or pharmaceutical compositions as described herein comprise polyribonucleic acid. In some embodiments, the polyribonucleic acid nucleotide is delivered to the dermis or epithelium of the subject. The oxidase is delivered without iontophoresis.

[0219] Transdermal Administration Formulations for topical administration may be in liquid, semisolid dosage forms (e.g., pastes, creams, lotions, etc.). The formulation may be in the form of a cream, powder, ointment or gel, patch, film, or spray. In some cases, the topical composition can be applied to the affected area of ​​the skin of a subject in need thereof. The formulation may be a cream or gel that is administered intradermally or intradermally (e.g., for transdermal or dermal administration). The release may be, but is not limited to, controlled release, delayed release, extended release, or sustained release. This can be accomplished in different forms. Topical pharmaceutical compositions can be administered multiple times a day, once a day, or as needed. Polyribonucleotides can be in either linear or circular form. It can exist in a variety of forms.

[0220] In some cases, the composition or pharmaceutical composition is formulated for direct application onto an area of ​​skin. The compositions or medicaments provided herein are formulated for administration via the skin or dermis (e.g., transdermal or dermal administration). The composition may include a dermatologically acceptable diluent. Such diluents are suitable for use on the skin, nails, Any dermatological agent that is compatible with mucous membranes, tissues, and / or hair and meets these requirements. Such diluents can be readily selected by one of ordinary skill in the art. When formulating an ointment, one or more drugs may be added to an oleaginous hydrocarbon base, an anhydrous absorption base, or a water-in-oil type. The compositions may be formulated in an absorption base of the oil-in-water type, a water-removable base and / or a water-soluble base.

[0221] Ointments and creams may, for example, be aqueous or non-aqueous with the addition of suitable thickening and / or gelling agents. The lotion may be formulated with an aqueous or oily base. Generally, they will also contain one or more emulsifying agents, stabilizing agents, dispersing agents, suspending agents, thickening agents, or coloring agents. The construction and use of transdermal patches for the delivery of pharmaceutical agents is known in the art. Such patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents. It is possible.

[0222] Lubricants that can be used to form the compositions and dosage forms include calcium stearate, stearate, and the like. Magnesium tearate, mineral oil, light mineral oil, glycerin, sorbitol, mannitol, poly Ethylene glycol, other glycols, stearic acid, sodium lauryl sulfate, talc , hydrogenated vegetable oils (e.g., peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, tomato oil, Corn oil, and soybean oil), zinc stearate, ethyl oleate, ethyl laurate Additional lubricants may include ethyl laureate, agar, or mixtures thereof. Examples of the aerosol include syloid silica gel, solidified aerosol of synthetic silica, or mixtures thereof. The lubricant is optionally present in an amount of less than about 1 weight percent of the composition. may be added.

[0223] The compositions or pharmaceutical compositions provided herein may be in the form of an aqueous solution, a water-alcoholic solution, or an oil-based solution. solutions, lotions or serum dispersions, aqueous, anhydrous or oily gels, dispersions of a fatty phase in an aqueous phase Emulsions obtained by (O / W or oil-in-water type) or vice versa (W / O or water-in-oil type), Microemulsions or microcapsules, ionic and / or non-ionic microparticles The polyribonucleic acid may be in any form suitable for topical administration, including, for example, a lipid vesicle dispersion. The amounts of the various components of the compositions provided herein other than the octides and other active ingredients may vary. These compositions can be used for the face, hands, body and / or young people. Protective, therapeutic or care creams, milks, lotions, etc. for mucous membranes or for purifying the skin. The composition may also comprise a soap or cleansing bar. The composition may consist of a solid preparation comprising:

[0224] The compositions or pharmaceutical compositions provided herein for local / topical administration include quaternary ammonium salts. um compounds, organic mercury, p-hydroxybenzoates, aromatic alcohols, chlorobutanol The composition may contain one or more antimicrobial preservatives such as ethanol.

[0225] Inhalation (e.g., nasal or oral inhalation) The compositions or pharmaceutical compositions described herein are formulated for administration via the nasal passages of a subject. Suitable formulations for nasal administration where the carrier is a solid include, for example, a powder that is held close to the nose. It may be administered in a nasal manner by rapid inhalation through the nasal passages from a small container, e.g. The formulation may include a coarse powder having a particle size ranging from about 10 to about 500 microns. The formulation may be administered by nasal drops or by aerosol administration using a nebulizer. Polyribonucleotides may be in the form of a linear or oily solution of polyribonucleotides. It may exist in either a cyclic or cyclic form.

[0226] The compositions or pharmaceutical compositions provided herein can be formulated as aerosol formulations. The aerosol formulation may be, for example, an aerosol solution, a suspension, or a dry powder. The sol may be administered through the respiratory system or nasal passages. For example, the composition may be administered in a suitable carrier, e.g. For example, it may be suspended or dissolved in a pharma- ceutically acceptable propellant and administered intranasally. They may also be administered directly to the lungs using a mist or inhalant. For example, one or more active agents may be administered Aerosol formulations containing the same can be used as a nebulizer or spray, for example for administration as a nasal spray or inhalant. It is dissolved, suspended, or emulsified in a mixture of a solvent and a propellant. The formulation may include any acceptable propellant under pressure, such as a pharma- ceutically acceptable propellant.

[0227] Aerosol formulations for nasal administration are designed to be administered to the nasal passages in drops or spray. The nasal solutions may be aqueous solutions prepared by the above method. They are isotonic and have a pH of about 5.5 to about 6. It may be similar to nasal secretions in that it may be slightly buffered to maintain a pH of .5. In some cases, pH values ​​outside this range may be used.

[0228] Aerosol formulations for inhalation have the following properties when administered via the nasal or oral respiratory route: One or more active agents are administered to the respiratory system of the subject, e.g., the airways, e.g., the nasal passages, mouth, pharynx, larynx, It may be designed to be delivered along the trachea, primary bronchi, and lungs. Inhalation solutions may be, for example, Inhalants or insufflations containing finely divided or liquid compositions are administered by nebulizer. Delivery to the respiratory system as a medicinal aerosol of a solution or suspension of a drug or drug combination in a mist Propellants can be halocarbon compounds, e.g., fluorocarbons. Fluorocarbons, such as fluorochlorohydrocarbons, hydrochlorofluorocarbons, and hydro It may be a liquefied gas including chlorocarbons, as well as hydrocarbons and hydrocarbon ethers.

[0229] Aerosol formulations may also contain other ingredients, such as surfactants or other ingredients such as oils and detergents. These ingredients may be used to stabilize the formulation and / or lubricate the valve components. It can function like this.

[0230] The aerosol formulation may be packaged under pressure and may be a solution, suspension, emulsion, powder, and semi-solid preparations may be formulated as aerosols. Sol formulations may be in (substantially) pure propellant or as a mixture of propellant and solvent. The solvent may include a solution of the active agent, such as a liquid solution of the active agent. The solvent may dissolve and / or spray one or more active agents. Solvents may be used to retard evaporation of the agent. Solvents may include, for example, water and glycols. Any combination of suitable solvents may be combined with preservatives, antioxidants, and / or other aerosol components. Optionally, a combination may be used.

[0231] The aerosol formulation may be a dispersion or a suspension. A suspension aerosol formulation may contain one or more The above active agents may include suspensions of, for example, polyribonucleotides, and dispersants. For example, sorbitan trioleate, oleyl alcohol, oleic acid, lecithin, and corn oil. The suspension aerosol formulation may also contain lubricants, preservatives, antioxidants, The aerosol may include a dispersing agent, a dispersing agent, and / or other aerosol components.

[0232] The aerosol formulation may also be formulated as an emulsion. The formulation may comprise, for example, a surfactant, water, and a propellant, and an active agent or combination of active agents. The surfactant may be nonionic, anionic, or An example of an aerosol formulation of an emulsion is, for example, a surfactant Another example of an aerosol formulation of an emulsion is, for example, a vegetable oil, Glyceryl monostearate, and propane.

[0233] Oral route In some cases, the compositions or pharmaceutical compositions provided herein are suitable for oral administration. In some cases, the composition or pharmaceutical composition may be formulated to contain a cell permeation agent and a polyclonal antibody. A scaffold comprising a mixture of ribonucleotides (e.g., a pill, dragee, capsule, lozenge, Hard candy, liquid, gel, syrup, slurry, powder, suspension, elixir, In some cases, the scaffold may include a mixture anywhere along the gastrointestinal tract. In other cases, the scaffold is configured to release at a specific location in the gastrointestinal tract, e.g. configured to release the mixture at one or more of the following locations: the pharynx, the esophagus, the stomach, the intestinal tract, or the colon. Different release profiles can be used, such as controlled release, delayed release, extended release, or sustained release. This can be achieved with different scaffolds for oral administration, including but not limited to polyribonucleotides. Nucleotides can exist in either a linear or cyclic form.

[0234] For oral administration, the compositions or pharmaceutical compositions provided herein may be administered in admixture with any of the compositions known in the art. The compositions are readily formulated by combining with pharma- ceutically acceptable diluents known in the art. Such diluents allow the active agent to be administered orally by the patient to be treated. For chewable tablets, pills, sugar-coated tablets, capsules, lozenges, hard candies, liquids, gels, etc. Formulated as tablets, including tablets, syrups, slurries, powders, suspensions, elixirs, wafers, etc. Such formulations can be formulated into pharma- ceuticals containing a solid diluent or filler. Acceptable diluents may include sterile aqueous media and various non-toxic organic solvents. Solid diluents are Diluents, flavourings, solubilisers, lubricants, suspending agents, binders, preservatives, tablet disintegrating agents or encapsulating agents. The agent may be one or more substances that can act as a binder.

[0235] Liquid mixtures for oral use may be prepared by dissolving the mixture in a suspending agent (e.g., methylcellulose), a moistening agent, or a humectant. agents (e.g., lecithin, lysolecithin, and / or long chain fatty alcohols), and colorants The composition may be prepared in a capsule that may contain pharma- ceutically acceptable excipients such as preservatives, flavorings, etc. The oil or non-aqueous solvent may be formulated, for example, due to the presence of large lipophilic moieties. It may be necessary to put the active agent into solution. Alternatively, it may be possible to form an emulsion, suspension, or other can be used.

[0236] Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin. , and soft seals made of gelatin and plasticizers such as glycerol or sorbitol. Push-fit capsules are made of a variety of materials, including fillers such as lactose, Binders such as starch, and / or lubricants such as talc or magnesium stearate, and optionally in admixture with a stabilizer, a cell permeabilizing agent and a polyribonucleotide. Soft capsules may contain a mixture of fatty oils, liquid paraffin, or liquid polyethylene glycol. In addition, stabilizers may be added. All formulations may be in dosages suitable for administration.

[0237] When formulating a compound for oral administration, a gastroretentive formulation is utilized to remove the It may be desirable to enhance the absorption of these drugs. Formulations that are retained in the stomach for several hours may be useful for enhancing cell permeability. The mixture of the permeabilizer and polyribonucleotide is slowly released, and the sustained release agent that may be used herein is Formulations that are retained in the stomach for several hours can be obtained by using alcohol and polysaccharides. The mixture of ribonucleotides is slowly released to provide sustained release that can be used herein. Using swelling, floating and bioadhesive technologies, the surface area of ​​the gastrointestinal tract can be This allows for maximum application of the mixture to the

[0238] Eye drops The compositions or pharmaceutical compositions provided herein may be administered ocularly, e.g. The composition may be delivered in an eye drop or ointment. By contacting cells in the retina, for example, with a mixture of a cell permeabilizing agent and a polyribonucleotide, Topical application of the composition to the eye can induce cell proliferation in the eye, such as the retina, by the alcohol. The mixture can be contacted with a mixture of alcohol (e.g., ethanol) and polyribonucleotides. Polyribonucleotides can exist in either linear or circular form.

[0239] The eye drops contain the cell permeabilizing agent and the polyribonucleotide alone when the mixture is in the liquid phase itself. Eye drops can be prepared by mixing the mixture with alcohol (e.g. For example, it can be prepared by a mixture of ethanol and polyribonucleotides alone. The eye drops are prepared by mixing the cell permeabilizing agent and polyribonucleic acid in a sterile aqueous solution such as saline or a buffer solution. By dissolving a solid mixture of leutidine or a powder to be dissolved prior to use. Alternatively, eye drops may be prepared by combining the compositions. In a sterile aqueous solution such as a solution of alcohol (e.g., ethanol) and polyribonucleotides or a powder composition which is to be dissolved prior to use. Other vehicles may be prepared by combining the above-mentioned Balanced salt solutions, physiological saline, water-soluble polyethers such as polyethylene glycol, poly polyvinyls such as polyvinyl alcohol and povidone, methylcellulose and hydroxypropyl cellulose derivatives such as propyl methylcellulose, petroleum derivatives such as mineral oil and white petrolatum Animal fats such as lanolin, and acrylic polymers such as carboxypolymethylene gel. -, vegetable fats such as peanut oil, polysaccharides such as dextran, and hyaluronic acid The glycosaminoglycans are selected from, but not limited to, sodium If necessary, additives commonly used in eye drops may be added. Additives include ionizing agents (e.g., sodium chloride, etc.), buffer solutions (e.g., boric acid, , disodium hydrogen phosphate, sodium dihydrogen phosphate, etc.), preservatives (e.g., benzoyl chloride, Zarconium chloride, benzethonium chloride, chlorobutanol, etc.), thickeners (e.g., lactate sugars such as maltose, mannitol, and maltose; for example, hyaluronic acid or sodium hyaluronate; their salts, such as sodium hyaluronate and potassium hyaluronate; mucous membranes, such as chondroitin sulfate; Polysaccharides; e.g., sodium polyacrylate, carboxyvinyl polymers, crosslinked polyacrylates phosphate, polyvinyl alcohol, polyvinylpyrrolidone, methylcellulose, hydroxy Propylmethylcellulose, Hydroxyethylcellulose, Carboxymethylcellulose , hydroxypropylcellulose, or other agents known to those skilled in the art.

[0240] Other Administration In some cases, the compositions or pharmaceutical compositions described herein are administered as a suppository. For rectal administration, suitable dosage forms for the composition include: These include suppositories (emulsion or suspension type) and rectal gelatin capsules (solution or suspension). In an exemplary suppository formulation, the compositions provided herein contain cocoa butter, Such as esterified fatty acids, glycerinated gelatin, and polyethylene glycol. The suppository may be combined with a suitable pharma- ceutically acceptable suppository base, such as any of a variety of water-soluble or dispersible bases. Various additives, enhancers, or surfactants may be incorporated. For example, triglycerides. Mixture of fatty acid glycerides, Witepsol S55 (Dynamite Nobe (registered trademark of BASF Chemical Co., Germany) or low melting point fatty acids such as cocoa butter. The wax may be melted first and the mixture homogenized, for example by stirring. The molten homogenous mixture is then poured into convenient sized molds, allowed to cool, and then dispersed. Polyribonucleotides can be in either a linear or circular form. It can exist in.

[0241] In some cases, the compositions or pharmaceutical compositions described herein are suitable for mucosal administration. It is formulated for this purpose.

[0242] In some cases, the compositions or pharmaceutical compositions described herein are intended for vaginal administration. In some cases, they are formulated as vaginal suppositories, tampons, creams, gels, or pastes. The spray, foam, or aerosol may contain the materials or compositions described herein.

[0243] In some cases, the composition or pharmaceutical composition is formulated for administration to an epithelial cell. The composition or pharmaceutical composition may not include any carrier and may be any of the compositions described herein. In some embodiments, the diluent and polyribonucleotide are as described above. The composition or pharmaceutical composition is adapted for delivery of polyribonucleotides directly to epithelial cells. It is used.

[0244] Pretreatment The composition or pharmaceutical composition as described herein may be used in combination with the application of a disinfectant to the surface ( For example, pretreatment of the surface with a disinfectant for delivery of polyribonucleotides. The surface may be a surface region of a subject. The surface region of a subject may be a region of a cell, such as an epithelial cell. Contains cells.

[0245] Bactericides are bacteriocidal, bacteriostatic, and / or actively kill or inactivate microorganisms. The agent may be any agent that kills or prevents the growth of microorganisms. The germicide is alcohol, iodine, or hydrogen peroxide. The germicide is UV light or laser light. In some embodiments, the sterilizing agent can be applied electrically or by vapor or contact, etc. The heat delivered is via other means such as by

[0246] The germicide may be applied to the surface area of ​​interest by a variety of non-invasive methods. The germicide may be applied by a wipe or swab that contains the germicide. The fungicide is applied as a spray. A variety of devices can be used to apply the fungicide. For example, devices that generate UV light or laser light can be used. In an embodiment, a device that generates heat may be used.

[0247] The composition or pharmaceutical composition applied to the surface area after pretreatment does not contain any carrier. The polyribonucleotide may be directly It may be a linear polyribonucleotide or a cyclic polyribonucleotide.

[0248] Preservatives The compositions or pharmaceutical compositions provided herein may contain material for a single dose. and may contain material for multiple administrations (e.g., "multi-dose" kits). The leutide may be in either linear or cyclic form. One or more preservatives may be included, such as thiomersal or 2-phenoxyethanol. Preservatives may be used to prevent microbial contamination during use. Suitable preservatives include salts. Benzalkonium chloride, thimerosal, chlorobutanol, methylparaben, propylparaben Ben, Phenylethyl Alcohol, Disodium EDTA, Sorbic Acid, Onamer M, or other drugs known to those skilled in the art. Such preservatives may be utilized at levels of 0.004% to 0.02%. In the composition, the preservative, e.g., benzalkonium chloride, is present in an amount of 0.001 by weight. % to less than 0.01%, for example, 0.001% to 0.008%, preferably about 0.005 It can be used at the % level.

[0249] Polyribonucleotides can be susceptible to RNases, which can be abundant in the surrounding environment. The compositions provided herein inhibit RNase activity, thereby inhibiting polyribonuclease activity. In some cases, the composition or pharmaceutical composition may include a reagent that prevents degradation of the otide. Alternatively or additionally, any RNase inhibitor known to one of skill in the art may be used. The polyribonucleotides in the compositions described herein may also include a cell permeation agent and / or a pharma- ceutically acceptable Any diluents or carriers, vehicles, excipients, or other reagents used in the preparation of the product must be prepared in an RNase-free environment. The composition may be formulated in an RNase-free environment.

[0250] In some cases, the compositions provided herein may be sterile. The composition may be formulated as a sterile solution or suspension in a suitable vehicle as known in the art. The composition may be sterilized by conventional known sterilization techniques, for example, the composition may be sterilized by conventional sterilization techniques. It may be sterile filtered.

[0251] salt In some cases, the compositions or pharmaceutical compositions provided herein comprise one or more To control osmolality, physiological salts, such as sodium salts, are provided herein. Other salts may be included in the compositions. In some cases, the composition may include sodium chloride, and / or magnesium chloride. The composition may be formulated with one or more pharma- ceutically acceptable salts. Acceptable salts include, for example, sodium, potassium, calcium, magnesium ions, etc. Such salts may include those of inorganic ions. , methanesulfonic acid, p-toluenesulfonic acid, acetic acid, fumaric acid, succinic acid, lactic acid, mannose Salts with inorganic or organic acids such as glyceryl, glyceryl, malic, citric, tartaric, or maleic acid. Polyribonucleotides can exist in either linear or circular form.

[0252] Buffer / pH The compositions or pharmaceutical compositions provided herein may be prepared using a buffer such as Tris buffer; borate buffer; amber buffer; acid buffer; histidine buffer (e.g., with aluminum hydroxide adjuvant); or The composition may include one or more buffers, such as a citrate buffer. In some cases, the buffer is , in the range of 5 to 20 mM.

[0253] The compositions or pharmaceutical compositions provided herein have an average pH of between about 5.0 and about 8.5, about 6.0 and about It may have a pH between about 8.0, between about 6.5 and about 7.5, or between about 7.0 and about 7.8. The composition or pharmaceutical composition may have a pH of about 7. The polyribonucleotide may be linear or can exist in either cyclic form.

[0254] Detergents / Surfactants The compositions or pharmaceutical compositions provided herein may be administered in one or more dosage forms depending on the intended route of administration. It may also contain detergents and / or surfactants, for example polyoxyethylene sorbitan estherate. Terephthalate surfactants (commonly referred to as "Tweens"), such as Polysorbate 20 and polysorbate 80; linear EO / PO block copolymers, etc. Ethylene oxide (EO), propylene oxide (PO) sold under the trademarks , and / or copolymers of butylene oxide (BO); Octoxynol, which may have a variable number of tandiyl groups, e.g., Octoxynol-9 (T riton X100, or t-octylphenoxypolyethoxyethanol; (Octylphenoxypolyethoxyethanol) Tylphenoxy)polyethoxyethanol (IGEPAL CA-630 / NP-40) ; phospholipids such as phosphatidylcholine (lecithin); Tergitol(TM) NP series Nonylphenol ethoxylates such as Leeds; Triethylene glycol monolauryl ethoxylates Lauryl, cetyl, stearyl and oleyl alcohols such as ethyl ether (Brij 30) Polyoxyethylene fatty ethers derived from (known as Brij surfactants); and sorbitan trioleate (Span 85) and sorbitan monolaurate. Sorbitan esters (commonly known as "SPAN"), Octoxynol (Octoxy Xynol-9 (Triton X-100) or t-octylphenoxypolyethoxy ethanol), cetyltrimethylammonium bromide ("CTAB"), or deoxy Sodium cholate. One or more detergents and / or surfactants are present only in trace amounts. In some cases, the composition has less than 1 mg / ml of octoxynol-10. and polysorbate 80. Non-ionic surfactants may be used herein. Surfactants can be classified by their "HLB" (hydrophilic / lipophilic balance). In some cases, the surfactant has at least 10, at least 15, and / or or has an HLB of at least 16. Polyribonucleotides may be either linear or cyclic. It may exist in any form.

[0255] Effective Delivery The compositions, pharmaceutical compositions, methods, and kits provided herein include those comprising polyribonucleic acid This provides an easily operable and effective solution for intracellular delivery of In some cases, delivery of polyribonucleotides into cells is therapeutic. In some cases, the efficiency of delivery is greater than that of delivery without alcohol, as described herein. In some cases, the concentration of the alcohol may be relatively high in the presence of the alcohol described in The delivery efficiency is greater in the presence of a cell-penetrating agent as described herein compared to delivery without the cell-penetrating agent. In some cases, the delivery efficiency can be relatively high without pretreatment. Pretreatment using a disinfectant (e.g., alcohol) as described herein compared to delivery Polyribonucleotides can be in either linear or circular form. It can exist in a variety of forms.

[0256] In some cases, the efficiency of delivery is determined by the amount of total polyribonucleotide that is contacted with the cells. It is expressed as the ratio of the amount of polyribonucleotide delivered into the cell to the amount of polyribonucleotide delivered into the cell. In some cases, the efficiency of delivery is determined by the amount of total polyribonucleotide (e.g., For example, polyribonucleotides are delivered into skin cells when applied directly to a skin area. The amount of polyribonucleotide delivered to the cell is expressed as the ratio of the amount of polyribonucleotide delivered to the cell (the amount of polyribonucleotide delivered to the cell). The delivery efficiency of the methods provided herein is at least about 0.5%, 1%, 1.5%, 2%, 3%, %, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% In some cases, the delivery efficiency of the methods provided herein may be about 0. .5%, 1%, 1.5%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, It can be 80%, 85%, 90%, 95%, or 100%.

[0257] In some cases, the pharmaceutical effect of the compositions and methods provided herein is It is measured in terms of the biological effect observed in a subsequent subject. For example, The amount of polyribonucleotides present in the cells (e.g., blood samples or tissue biopsies) is measured. In other cases, the expression product may be a component of the composition that is to be expressed in the subject. When the recombinant protein comprises an expression sequence encoding a protein that is capable of being expressed by the recombinant protein, the recombinant protein is capable of being expressed by the recombinant protein. It can be used as an indicator of delivery efficiency.

[0258] The compositions and methods provided herein provide a method for producing circular, as compared to linear, polyribonucleotides. The delivery of circular polyribonucleotides to cells may be particularly effective. The amount of ribonucleotide was determined by comparing the amount of the linear polyribonucleotide and the cell permeation agent in the mixture. The amount of linear polyribonucleotide contacted with the cells should be at least 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.2, 2.4, 2.5, 2.6, 2.8, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0, 7.0, 8.0, 9.0, or 10.0 times higher. In some cases, the cyclic The amount of polyribonucleotide is determined by the amount of the mixture containing the linear polyribonucleotide and the cell permeation agent. at least 1.1 times higher than the amount of linear polyribonucleotide contacted with the cells .

[0259] When administered in vivo, the polyribonucleotides can be synthesized in accordance with the methods provided herein. Thus, the compound can be delivered into any type of cell that is in close proximity to the surface area of ​​the subject, depending on the route of administration. For example, polyribonucleotides can be delivered to subcutaneous, intracavity, or ductal sites by the methods provided herein. to epithelial cells located on the surface of (e.g., the mouth, nasal cavity, pharynx, GI tract, airways, or vagina) Non-limiting types of epithelial cells include simple squamous epithelium, simple cuboidal epithelium, simple columnar epithelium, and These include stratified columnar epithelium, pseudostratified squamous epithelium, stratified cuboidal epithelium, stratified columnar epithelium, and transitional epithelium. Polyribonucleotides can be produced by the methods provided herein in keratinocytes, melanocytic cells, and the like. Kell cells, melanocytes, Langerhans cells, fibroblasts, macrophages, and adipose The present invention relates to a method for delivering a cellular marker to a surface area, including, but not limited to, cells of any type, for example, cells under the skin. Polyribonucleotides can be delivered to the epidermis, basal layer, and / or epidermis by the methods provided herein. It may be delivered to any part of the tissue beneath the skin, such as the tunica, dermis, and subcutaneous tissue.

[0260] For example, polyribonucleotides may enter the blood vessels and / or blood adjacent to the site of administration. For example, polyribonucleotides can be delivered into epithelial cells in the capillary walls beneath the skin. In some cases, the delivery is systemic, e.g., polyribonucleotides are The antibodies are delivered to the inside of blood vessels and transferred to blood cells such as red blood cells, white blood cells, and platelets. In these cases, polyribonucleotides are distributed to any part of the body. Polyribonucleotides can be delivered into circulating cells that can circulate in the body, but this is not the same as systemic delivery of polyribonucleotides. It can be recognized as such.

[0261] The compositions, pharmaceutical compositions, methods, and kits provided herein include those comprising polyribonucleic acid For example, polyribonucleotides and alcohols (e.g. , ethanol) may be formulated for extended, controlled, delayed, or sustained release. As a result, a specific therapeutic effect can be achieved or the polyribonucleotide can be delivered to the subject. For example, polyribonucleotides and alcohols can be delivered to desired locations for extended periods of time, e.g. For example, at least about 2 hours, 4 hours, 6 hours, 8 hours, 10 hours, 15 hours, 20 hours, 24 hours, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days 10 days, 11 days, 12 days, 13 days, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 2 months A patch that is to be adhered to a subject's skin area for a period of one month, three months, four months, or more. In some cases, the polyribonucleotides and and alcohol, for example, are delivered over an extended period of time as long as the patch remains adhered to the skin area. In other embodiments, the polyribonucleotide and cell permeation agent are administered in a long-term, controlled release manner. The compositions may be formulated for delayed release, or sustained release, so that a particular therapeutic effect is achieved. Alternatively, polyribonucleotides can be delivered to a desired location in a subject. The ribonucleotides and cell permeation agents may be incubated for an extended period of time, e.g., at least about 2 hours, 4 hours, 6 hours, hours, 8 hours, 10 hours, 15 hours, 20 hours, 24 hours, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 1 3 days, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 2 months, 3 months, 4 months, or more In some cases, the composition may be formulated in the form of a patch that is to be adhered to an area of ​​the skin of the subject. In this case, the polyribonucleotide and cell permeation agent in the patch may be, for example, As long as it remains adhered to the area it will be delivered over an extended period of time.

[0262] In some cases, the compositions, pharmaceutical compositions, methods and kits are delivered intracellularly. The present invention provides polyribonucleotides that can be used in a wide range of applications and have long-term biological effects. Some polyribonucleotides have little or no susceptibility to RNases. Or they may have a very long half-life inside the cells in which they are used. The ribonucleotides may be administered for an extended period of time, e.g., at least about 24 hours, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days 13 days, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 2 months, 3 months, 4 months, 5 months Months, 6 months, 7 months, 8 months, 9 months, 10 months, 1 year, 2 years, 3 years , or more, may be present and potentially active. Polyribonucleotides can be synthesized for approximately 24 hours, 36 hours, 2 days, 3 days, 4 days, 5 days, or 6 days. days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 Weeks, 3 weeks, 4 weeks, 5 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, Half-lives of 7 months, 8 months, 9 months, 10 months, 1 year, 2 years, or 3 years In certain cases, for example, polyribonucleotides may have long life. or in cells that have a life span capable of generating progeny cells (e.g., stem cells or other progenitor cells). When administered for gene editing purposes in mammals, the biological effects of polyribonucleotides are cellular or extends over the subject's lifespan.

[0263] Kits and Application Tools Depending on the different intended routes of administration, the compositions provided herein can be administered in different ways. and / or in some cases, administering the composition to a subject via a desired route. The kits may be packaged in different kits that include one or more application tools configured to As discussed above, the compositions provided herein can be administered topically (e.g., They can be administered through different routes, including via the skin, suppository, mucous membrane, and vaginal route, inhalation, and oral ingestion. In an aspect, the present disclosure relates to a method for the preparation of a polyribonucleotide and a cell. A kit for administering a composition comprising a permeation agent is provided. A kit for administering a composition comprising a polynucleotide and an alcohol is provided. The present disclosure provides a kit for administering a composition comprising a polyribonucleotide and ethanol. In an embodiment, the present disclosure provides a method for the preparation of a cellular component comprising the steps of: Kit for administration of a composition comprising a polyribonucleotide and a diluent without any carrier Polyribonucleotides can exist in either linear or circular form.

[0264] The kit may be configured for direct topical administration, e.g., for application directly to the skin. In some cases, the kit comprises a composition as provided herein. The substrate or scaffold allows for direct application of the composition onto the skin surface of a subject. The adhesive may be in the form of a patch, wipe, Q-tip, or any other form that applies adhesive to the substrate or foot. The field may be made of disposable or biodegradable materials. The material may be a fibrous layer, e.g., made of a non-elastomeric material and having at least one directional stretchability. The fiber layer may be, for example, cotton, eucalyptus, or biocellulose. The fiber layer may be made of paper, nonwoven fabric, woven fabric, or the like. The fiber layer is hydrophilic. The fibrous layer may be made of hydrophilic raw materials and may have liquid retaining properties. It may be made of hydrophilic fibers obtained from raw materials or fibers formed therefrom. In this case, the kit includes the liquid compositions provided herein and a method for transferring the liquid compositions. The transfer tool may be a straw, ear brush, or transfer It can be something as simple as a peptide. Transition tools can also be used to scale, trigger, and alarm systems. The system may be designed with additional features such as a microprocessor, a microprocessor-based microprocessor, or an automated dispensing system.

[0265] The kits may be configured for inhaled administration of the compositions provided herein. In some cases, the kit comprises an inhaler and the composition. In some cases, the inhaler comprises and a nebulizer configured to convert a liquid composition into an aerosol. In liquid form, or in solid form ready to be dissolved in a solvent for aerosolization and inhalation Non-limiting examples of nebulizers include breath-activated or Powered nebulizers, handheld inhaler devices, jet nebulizers, vibrating mesh nebulizers No. 6,393,945, each of which is incorporated herein by reference in its entirety. Publication No. 2004 / 071368, U.S. Patent Application Publication No. 2004 / 0011 As described in US Pat. No. 358 and US Pat. No. 2004 / 0035413 Nebulizers may include a compressed air source. In this method, the nebulizer pushes the drug through micron or submicron sized holes. The liquid drug is converted into an aerosol by heating or by applying ultrasound. In some cases, the inhaler is a dry powder aerosol that converts a solid composition into an aerosol. Dry powder aerosolization devices are active or passive dry powder aerosolization devices. Exemplary dry powder inhalers include, but are not limited to, Nos. 4,069,819 and 4,069,820, which are incorporated herein by reference. No. 4,995,385, U.S. Pat. No. 3,991,761, U.S. Pat. Including those as described in US Pat. No. 991,761.

[0266] The kits may be configured for oral administration of the compositions provided herein. Oral Administration For example, compositions for oral ingestion may be in the form of chewable tablets, pills, dragees, capsules, lozenges, ham, etc. candy, liquid, gel, syrup, slurry, powder, suspension, elixir, It can be formulated in various forms, such as tablets, including those containing .

[0267] The kits provided herein may further include a bottle, box, case, or other container that contains the formulated composition. The disclosed containers may also include application tools, such as a container, a capsule, or a dispenser. In some cases, the dispenser may include a dispenser for dispensing the compositions described herein. A method for dispensing liquid or solid formulations, for example by using a transfer pipette, into the skin. The liquid can be instilled into the eye for topical or intraocular delivery. The dispenser is used to dispense capsules that may be required to be kept sterile prior to application. Sterility, humidity, and / or temperature may be utilized as described herein, as appropriate. In some cases, the inhaler may be maintained in a caged container. a container for storing the composition in its liquid, solid, or aerosol form as appropriate. In certain embodiments, the container and the application tool may be provided separately.

[0268] The kits provided herein include a first application tool, a second application tool, a fungicide, and It is possible to include compositions comprising polyribonucleotides and diluents without any carrier. The first application tool is configured to apply a germicide to a surface area of ​​a target, and the second application tool is configured to apply a germicide to a surface area of ​​a target. The application tool is configured to apply the composition to a surface area of ​​a subject. The radiation can be iodine, hydrogen peroxide, UV light, laser light, or heat. In the liquid state, alcohol is methanol, ethanol, isopropanol, butanol, pentanol, etc. Alcohol, cetyl alcohol, ethylene glycol, propylene glycol, modified alcohol alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol, Cetearyl alcohol, menthol, polyethylene glycol (PEG-400), ethoxylated The first application is selected from the group consisting of hydroxylated fatty acids, and hydroxyethyl cellulose. The tool may be a wipe or swab, the wipe or swab including a sterilizing agent; or The first application tool is a device that applies UV light or laser light, or applies heat. The second application tool may be a pipette. In an embodiment, the second application tool includes a substrate, in which the mixture is embedded. In some embodiments, the substrate is made of natural or synthetic fibers. The second application tool includes a patch, a spray, or a nebulizer. The roller is configured to release the mixture in a controlled manner. , the surface areas of the skin, the oral cavity, the nasal cavity, the gastrointestinal tract, and the respiratory tract, and any combination thereof. may be selected from:

[0269] How to generate In some cases, the polyribonucleic acid in the compositions or pharmaceutical compositions provided herein The nucleotides are not naturally occurring and can be prepared by recombinant DNA techniques (methods described in detail below; e.g. For example, in vitro using DNA plasmids) or produced using chemical synthesis. Polyribonucleotides include deoxyribonucleic acid sequences that can be synthesized in either a linear or circular form. It may exist in any form.

[0270] The DNA molecule used to generate the RNA loop is a natural nucleic acid sequence that occurs in nature. DNA sequences, modified versions thereof, or synthetic polypeptides not normally found in nature (e.g. It is understood that the present invention may include a DNA sequence encoding a chimeric molecule or a fusion protein. DNA molecules are subject to site-directed mutagenesis, a chemical treatment of nucleic acid molecules that induces mutations. DNA synthesis, restriction enzyme digestion of nucleic acid fragments, ligation of nucleic acid fragments, polymerase chain reaction (PC R) Amplification and / or mutagenesis of selected regions of nucleic acid sequences, using oligonucleotide mixtures Ligation of mixed populations of synthetic and "constructed" mixtures of nucleic acid molecules, and combinations thereof Various techniques, including but not limited to classical mutagenesis techniques and recombinant DNA techniques, It can be modified using techniques.

[0271] Polyribonucleotides can be synthesized by any method, including but not limited to chemical synthesis and enzymatic synthesis. In some cases, linear polyribonucleic acid may be prepared according to available techniques. The nucleic acid may be synthesized from ribonucleotides or transcribed from a DNA construct. Transcription from the DNA construct can be performed in cells using techniques available to those of skill in the art. This can occur intracellularly or in vitro.

[0272] In some cases, the linear initial construct or linear mRNA is The polyribonucleotides may be circularized to produce the circular polyribonucleotides described herein, or may be conjugated to produce the circular polyribonucleotides described herein. The mechanism of cyclization or concatemerization can be chemical, enzymatic, splint laminating, or the like. methods such as, but not limited to, igation, or ribozyme catalyzed methods. The newly formed 5'- / 3'-bonds can occur via intramolecular or intermolecular bonds. It may be the same.

[0273] Methods for making the circular polyribonucleotides described herein are described, for example, in Khud et al. Yakov & Fields,Artificial DNA:Methods an d Applications,CRC Press(2002);Zhao,Synt hetic Biology:Tools and Applications,(Fi rst Edition), Academic Press(2013); and Egli & Herdewijn,Chemistry and Biology of Ar tificial Nucleic Acids,(First Edition),W Described in iley-VCH (2012).

[0274] Various methods for synthesizing circular polyribonucleotides have also been described in the art. (For example, U.S. Pat. No. 6,210,931, U.S. Pat. No. 5,773,244, U.S. Patent No. 5,766,903, U.S. Patent No. 5,712,128, U.S. Patent No. No. 426180, U.S. Patent Application Publication No. 20100137407, International Publication Brochure No. 1992001813 and Brochure No. WO 2010084371 (see, for example, US Pat. No. 6,393,311; the contents of each of which are incorporated herein by reference in their entireties).

[0275] All references and publications cited herein are hereby incorporated by reference. do.

[0276] Embodiment In some aspects, the compositions of the present disclosure comprise a mixture of polyribonucleotides and a cell penetrating agent. and the cell permeation agent comprises at least about 0.3% v / v of the mixture.

[0277] In some aspects, the therapeutic compositions of the present disclosure comprise a polyribonucleotide and a cell permeation agent. wherein the cell penetrating agent is configured for local administration.

[0278] In some aspects, the therapeutic compositions of the present disclosure comprise a polyribonucleotide and a cell permeation agent. wherein the polyribonucleotide comprises a payload or a sequence encoding a payload; And the payload has a biological effect on the cell.

[0279] In some aspects, the therapeutic compositions of the present disclosure comprise a polyribonucleotide and a cell permeation agent. wherein the polyribonucleotide is effective to have a biological effect on a cell or tissue. and the cell permeation agent is present in an amount effective to have a biological effect on a cell or tissue. exists in a certain amount.

[0280] In some aspects, the therapeutic compositions of the present disclosure comprise a polyribonucleotide, a cell penetrating agent, and a topical delivery vehicle, the topical delivery vehicle comprising a stabilizer. The stabilizer includes glucose (4.5 g / L).

[0281] In some aspects, the suppositories or other lipid-based formulations of the present disclosure contain polyribonucleotides and Includes a cell permeabilizing agent.

[0282] In some aspects, the inhalable compositions of the present disclosure comprise polyribonucleotides, cell penetrating The mixture includes a spray agent and a propellant.

[0283] In some aspects, the therapeutic compositions of the present disclosure comprise a polyribonucleotide and a cell permeation agent. The present invention relates to a biodegradable scaffold loaded with

[0284] In some aspects, the method of delivering polyribonucleotides to a cell or tissue comprises administering to the cell or tissue contacting the tissue with a mixture comprising a polyribonucleotide and a cell permeabilization agent; The cell permeabilization agent comprises at least about 0.3% v / v of the mixture.

[0285] In some aspects, the method of delivering a therapeutic composition to a cell or tissue comprises administering to the cell or tissue contacting the cells with a therapeutic composition comprising a polyribonucleotide and a cell permeation agent; The cell permeation agent is configured for local administration. In some embodiments, the cell permeation agent is In some embodiments, the alcohol includes methanol, ethanol, isopropyl alcohol, isopropanol, butanol, pentanol, cetyl alcohol, ethylene glycol, Propylene glycol, denatured alcohol, benzyl alcohol, special denatured alcohol, Recall, stearyl alcohol, cetearyl alcohol, menthol, polyethylene glycol Made from PEG-400, ethoxylated fatty acids, and hydroxyethyl cellulose In some embodiments, the alcohol comprises ethanol. In some embodiments, the cell permeation agent comprises at least about 10%, at least about 20%, or %, at least about 30%, at least about 40%, at least about 50%, at least about 60 %, at least about 70%, at least about 80%, at least about 90%, at least about 95% %, at least about 98%, or about 100% v / v. The cell permeabilization agent comprises about 100% v / v of the mixture. In some embodiments, the method further comprises: In some embodiments, the method further comprises mixing the polyribonucleotide with a cell permeation agent. In some embodiments, the polyribonucleotide is present in a solid form prior to mixing. The polyribonucleotides are lyophilized prior to mixing. The polyribonucleotides are present in liquid form prior to mixing. The nucleotides are dissolved in a solvent prior to mixing. The nucleotide comprises a payload or a sequence encoding a payload, and the payload comprises In some embodiments, the polyribonucleic acid has a biological effect on a cell or tissue. The otide is present in an amount effective to have a biological effect on the cell, and the cell permeation agent is The compound is present in an amount effective to have a biological effect on a cell or tissue.

[0286] In some embodiments, the method of in vivo delivery of polyribonucleotides comprises The method includes applying a mixture comprising an octide and a cell permeation agent to a surface area of ​​the subject.

[0287] In some embodiments, the method of localized delivery of polyribonucleotides comprises The method includes applying a mixture comprising the dye and a cell permeation agent to a surface area of ​​the subject.

[0288] In some aspects, the method of delivering a therapeutic polyribonucleotide to a subject comprises administering the therapeutic polyribonucleotide to a subject. A mixture containing a ribonucleotide and a cell permeabilizing agent is applied to an epithelial surface, an endothelial surface, or an exposed tissue. , or topically on an open wound.

[0289] In some aspects, the method of treatment comprises administering to the subject a mixture comprising a polyribonucleotide and a cell permeation agent. In some embodiments, the method further comprises applying the product to a surface area of ​​a subject having a pathology or disease. In some embodiments, the cell permeation agent comprises an alcohol. Alcohol, ethanol, isopropanol, butanol, pentanol, cetyl alcohol , ethylene glycol, propylene glycol, denatured alcohol, benzyl alcohol, Specially denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol, menthyl alcohol tol, polyethylene glycol (PEG)-400, ethoxylated fatty acids, and hydroxypropyl In some embodiments, the alcohol is selected from the group consisting of diethyl cellulose. In some embodiments, the delivery is systemic. In some embodiments, the delivery is localized. at least about 1%, at least about 5%, at least about 10%, at least about 20%, At least about 30%, at least about 40%, at least about 50%, at least about 60%, At least about 70%, at least about 80%, at least about 90%, at least about 95%, In some embodiments, the cell permeability agent comprises about 98% or about 100% v / v. In some embodiments, the surface area is skin, oral cavity, , nasal cavity, ear cavity, gastrointestinal tract, respiratory tract, vagina, cervix, uterine tract, urinary tract, and surface area of ​​the eye. In some embodiments, the application comprises applying a droplet of the mixture directly to the surface area. In some embodiments, applying includes placing the surface area in a In some embodiments, the application includes wiping with a patch, gel, or film. In some embodiments, applying the mixture includes spraying the mixture onto the surface area. In some embodiments, administering the mixture to a subject by aerosolization. to the subject via a suppository. In some embodiments, the application comprises administering the mixture to the subject via a suppository. administering to the subject via oral ingestion of a capsule containing the mixture, the capsule comprising: The mixture is configured to be released into the gastrointestinal tract of the subject. In some embodiments, the cells comprise epithelial cells. In some embodiments, the cells comprise blood cells. In an embodiment, the polyribonucleotide comprises a linear polyribonucleotide. In embodiments, the polyribonucleotide comprises a cyclic polyribonucleotide. In embodiments, the cyclic polyribonucleotides have at least 5% less cyclic nucleotides than their linear counterparts. At least 10%, at least 15%, at least 20%, at least 30%, at least 40% %, at least 50%, at least 60%, at least 70%, at least 80%, at least at least 90%, at least 100%, at least 150%, at least twice as much, at least 3x, at least 4x, at least 5x, at least 6x, at least 7x, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, or In some embodiments, the circular polyribonucleic acid has a translation efficiency of at least 100 times. The leutide has a translation efficiency at least 5-fold higher than that of the linear form. In some embodiments, the polyribonucleotide has a short-term biological effect. The polyribonucleotide is a linear polyribonucleotide. In some embodiments, the polyribonucleotides have long-lasting biological effects. The polyribonucleotide is a cyclic polyribonucleotide. In some embodiments, The concentration of the polyribonucleotide in the mixture is at least about 50 ng / mL, at least about 100 ng / mL, at least about 500 ng / mL, at least about 1 μg / mL, at least about 2 μg / mL, at least about 3 μg / mL, at least about 4 μg / mL, at least at least about 5 μg / mL, at least about 10 μg / mL, at least about 20 μg / mL, About 50 μg / mL, at least about 100 μg / mL, at least about 200 μg / mL , at least about 500 μg / mL, at least about 1 mg / mL, at least about 2 mg / m L, at least about 5 mg / mL, at least about 10 mg / mL, at least about 20 mg / mL mL, at least about 50 mg / mL, or at least about 100 mg / mL.

[0290] In some aspects, the kits of the present disclosure include application tools and polyribonucleotides and A mixture including a cell permeation agent, and an application tool for applying the mixture to a surface area of ​​a subject. In some embodiments, the application tool comprises a pipette. In some embodiments, the application tool includes a substrate in which the mixture is embedded. In embodiments, the substrate is made of natural or man-made fibers. In some embodiments, the application tool comprises a patch. In embodiments, the application tool includes a sprayer. In some embodiments, the application tool comprises a blister. In some embodiments, the application tool comprises a capsule configured to release The surface area is configured to release the mixture in a controlled manner. The areas include the surface areas of the skin, oral cavity, nasal cavity, gastrointestinal tract, and respiratory tract, and any combination thereof. The compound is selected from the group consisting of:

[0291] Numbered embodiments [1] A pharmaceutical composition comprising a mixture of polyribonucleotide and ethanol, A pharmaceutical composition in which ethanol constitutes at least about 0.3% v / v to about 75% v / v of the mixture. .

[0292] [2] Ethanol should be at least about 0.3% v / v to about 70% v / v of the mixture, or at least At least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v v, at least about 0.3% v / v to about 40% v / v, at least about 30% v / v to about 20 %v / v, at least about 0.3%v / v to about 15%v / v, at least about 0.3%v / v ~ about 10% v / v, at least about 0.3% v / v~ about 5% v / v, at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v; The pharmaceutical composition of paragraph [1].

[0293] [3] Ethanol should be at least about 0.5% v / v to about 75% v / v of the mixture, or at least At least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, at least At least about 10% v / v to about 75% v / v, at least about 15% v / v to about 75% v / v, At least about 20% v / v to about 75% v / v, at least about 30% v / v to about 75% v / v v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75% v / v v / v, at least about 60% v / v to about 75% v / v, or at least about 70% v / v The pharmaceutical composition of paragraph [1], wherein the pharmaceutical composition accounts for about 75% v / v.

[0294] [4] A pharmaceutical composition comprising a mixture of polyribonucleotides and alcohol, A pharmaceutical composition in which the alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture. .

[0295] [5] The alcohol should be at least about 0.3% v / v to about 70% v / v of the mixture, or at least At least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v v, at least about 0.3% v / v to about 40% v / v, at least about 30% v / v to about 20 %v / v, at least about 0.3%v / v to about 15%v / v, at least about 0.3%v / v ~ about 10% v / v, at least about 0.3% v / v~ about 5% v / v, at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v; The pharmaceutical composition of paragraph [4].

[0296] [6] Alcohol should be at least about 0.5% v / v to about 75% v / v of the mixture, or at least At least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, at least At least about 10% v / v to about 75% v / v, at least about 15% v / v to about 75% v / v, At least about 20% v / v to about 75% v / v, at least about 30% v / v to about 75% v / v v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75% v / v v / v, at least about 60% v / v to about 75% v / v, or at least about 70% v / v The pharmaceutical composition of paragraph [4], wherein the pharmaceutical composition accounts for about 75% v / v.

[0297] [7] Alcohol is methanol, ethanol, isopropanol, butanol, pentane, Alcohol, cetyl alcohol, ethylene glycol, propylene glycol, modified alcohol Cole, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl alcohol, Menthol, Polyethylene glycol (PEG)-400, E Paragraph [4], ]~[6] A pharmaceutical composition according to any one of the above.

[0298] [8] A pharmaceutical composition comprising a mixture of a polyribonucleotide and a cell penetrating agent, A pharmaceutical composition in which the cell permeabilizing agent comprises at least about 0.3% v / v to about 75% v / v of the mixture. .

[0299] [9] The cell permeabilizing agent is at least about 0.3% v / v to about 70% v / v of the mixture, at least At least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v v, at least about 0.3% v / v to about 40% v / v, at least about 30% v / v to about 20 %v / v, at least about 0.3%v / v to about 15%v / v, at least about 0.3%v / v ~ about 10% v / v, at least about 0.3% v / v~ about 5% v / v, at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v; The pharmaceutical composition of paragraph [8].

[0300]

[10] The cell permeabilizing agent comprises at least about 0.5% v / v to about 75% v / v of the mixture, At least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, At least about 10% v / v to about 75% v / v, at least about 15% v / v to about 75% v / v , at least about 20% v / v to about 75% v / v, at least about 30% v / v to about 75% v / v / v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75 % v / v, at least about 60% v / v to about 75% v / v, or at least about 70% v / v The pharmaceutical composition of paragraph [8], wherein the pharmaceutical composition accounts for about 75% v / v.

[0301]

[11] Any one of paragraphs [8] to

[10] , wherein the cell permeation agent is an alcohol. Pharmaceutical compositions.

[0302]

[12] Alcohols include methanol, ethanol, isopropanol, butanol, Pentanol, cetyl alcohol, ethylene glycol, propylene glycol, modified alkanol Alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG-400), The pharmaceutical composition of paragraph

[0011] , wherein the fatty acid is selected from the group consisting of ethoxylated fatty acids and hydroxyethyl cellulose.

[0303]

[13] Polyribonucleotides encode proteins, paragraphs [1] to

[12] 13. The pharmaceutical composition of claim 12,

[0304]

[14] The pharmaceutical composition of paragraph

[13] , wherein the protein is a therapeutic protein.

[0305]

[15] The pharmaceutical composition according to paragraph

[13] or

[14] , wherein the protein is a wound-healing protein. Pharmaceutical composition.

[0306]

[16] The pharmaceutical composition of paragraph

[15] , wherein the wound-healing protein is a growth factor.

[0307]

[17] The pharmaceutical composition of paragraph

[0016] , wherein the growth factor is EGF, PDGF, TGFβ, or VEGF.

[0308]

[18] The pharmaceutical composition is in the form of a liquid, gel, lotion, paste, cream, foam, or viscosity. The pharmaceutical composition of any one of paragraphs [1] to

[17] , wherein the pharmaceutical composition is an adhesive.

[0309]

[19] Paragraph [1], in which the polyribonucleotide is a linear polyribonucleotide. ~

[18] Any one of the pharmaceutical compositions.

[0310]

[20] Any of paragraphs [1] to

[19] , wherein the polyribonucleotide is mRNA. or a pharmaceutical composition.

[0311]

[21] The polyribonucleotide lacks a cap or a polyA tail,

[20] Any one of the pharmaceutical compositions.

[0312]

[22] Paragraphs [1] to [3], wherein the polyribonucleotide is a cyclic polyribonucleotide.

[18] Any one of the pharmaceutical compositions.

[0313]

[23] The pharmaceutical composition of any one of paragraphs [1] to

[0022] , wherein the polyribonucleotide comprises a modified ribonucleotide.

[0314]

[24] Any one of paragraphs [1] to

[23] , wherein the pharmaceutical composition has a pH of about 7. A pharmaceutical composition comprising:

[0315]

[25] The pharmaceutical composition according to paragraphs [1] to

[24] , wherein the pharmaceutical composition has a viscosity approximately the same as that of water. Any one of the pharmaceutical compositions.

[0316]

[26] The pharmaceutical composition of any one of paragraphs [1] to

[0025] , wherein the pharmaceutical composition is substantially free of hydrophobic or lipophilic groups.

[0317]

[27] Any of paragraphs [1] to

[26] , wherein the pharmaceutical composition is substantially free of hydrocarbons. Any one of the pharmaceutical compositions.

[0318]

[28] The pharmaceutical composition of any one of paragraphs [1] to

[0027] , wherein the pharmaceutical composition is substantially free of cationic liposomes.

[0319]

[29] The pharmaceutical composition comprises a fatty acid, a lipid, a liposome, cholesterol, or any of them. The pharmaceutical composition of any one of paragraphs [1] to

[28] , which is substantially free of the combination of

[0320]

[30] Any of paragraphs [4] to

[29] , wherein the cell permeabilizing agent is soluble in a polar solvent. One pharmaceutical composition.

[0321]

[31] Any of paragraphs [4] to

[30] , wherein the cell permeabilizing agent is insoluble in a polar solvent. One pharmaceutical composition.

[0322]

[32] A therapeutic composition comprising a polyribonucleotide and an alcohol, The therapeutic composition is configured for topical administration.

[0323]

[33] A therapeutic composition comprising a polyribonucleotide and alcohol, The polynucleotide comprises a payload or a sequence encoding a payload, and A therapeutic composition that has a biological effect on cells.

[0324]

[34] A therapeutic composition comprising a polyribonucleotide and alcohol, the polynucleotide is present in an amount effective to have a biological effect on a cell or tissue; and the alcohol is present in an amount effective to have a biological effect on the cell or tissue. Therapeutic composition.

[0325]

[35] A therapeutic composition comprising a polyribonucleotide, alcohol, and a topical delivery vehicle. 13. A therapeutic composition comprising a topical delivery vehicle comprising a stabilizing agent.

[0326]

[36] Suppositories or other lipid-based formulations containing polyribonucleotides and alcohol.

[0327]

[37] An inhalable drug containing a mixture of polyribonucleotides, alcohol, and a propellant. composition.

[0328]

[38] A therapeutic agent containing a biodegradable scaffold loaded with polyribonucleotides and alcohol was developed. therapeutic composition.

[0329]

[39] A therapeutic composition comprising a polyribonucleotide and a cell permeation agent, Therapeutic compositions in which the agent is adapted for topical administration.

[0330]

[40] A therapeutic composition comprising a polyribonucleotide and a cell penetrating agent, The polynucleotide comprises a payload or a sequence encoding a payload, and A therapeutic composition that has a biological effect on cells.

[0331]

[41] A therapeutic composition comprising a polyribonucleotide and a cell penetrating agent, the polynucleotide is present in an amount effective to have a biological effect on a cell or tissue; and the alcohol is present in an amount effective to have a biological effect on the cell or tissue. Therapeutic composition.

[0332]

[42] A therapeutic composition comprising a polyribonucleotide, a cell penetrating agent, and a local delivery vehicle. 13. A therapeutic composition comprising a topical delivery vehicle comprising a stabilizing agent.

[0333]

[43] A suppository or other lipid-based formulation comprising a polyribonucleotide and a cell-penetrating agent.

[0334]

[44] An inhalable composition comprising a mixture of polyribonucleotides, a cell-penetrating agent, and a propellant. composition.

[0335]

[45] A therapeutic approach was developed that included a biodegradable scaffold loaded with polyribonucleotides and a cell-penetrating agent. therapeutic composition.

[0336]

[46] The therapeutic composition of paragraph

[35] or paragraph

[0042] , wherein the stabilizer comprises glucose (4.5 g / L).

[0337]

[47] Any one of paragraphs

[39] to

[38] , wherein the cell permeation agent comprises an alcohol. Therapeutic compositions, suppositories, other lipid-based formulations, or inhalable compositions.

[0338]

[48] ​​Alcohols include methanol, ethanol, isopropanol, butanol, Pentanol, cetyl alcohol, ethylene glycol, propylene glycol, modified alkanol Alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG-400), The therapeutic composition, suppository, or other lipid-based formulation according to any one of paragraphs

[0032] to

[38] or

[47] , wherein the lipid-based formulation is selected from the group consisting of ethoxylated fatty acids and hydroxyethyl cellulose; Or an inhalable composition.

[0339]

[49] The therapeutic composition, suppository, etc. according to paragraph

[48] , wherein the alcohol is ethanol. A lipid-based formulation, or an inhalable composition.

[0340]

[50] A method for delivering a polyribonucleotide to a subject, comprising: a) applying a disinfectant to a surface area of ​​interest; b) applying to the surface region a composition comprising polyribonucleotides and a diluent without any carrier; The method includes applying.

[0341]

[51] Paragraph

[50] , where the disinfectant is alcohol, UV light, laser light, or heat. How to.

[0342]

[52] A method for delivering a polyribonucleotide to a subject, comprising: a) applying alcohol to a surface area of ​​a subject; b) applying a composition comprising polyribonucleotides and a diluent without any carrier to the surface; The method includes:

[0343]

[53] A method for delivering polyribonucleotides to epithelial cells, comprising the steps of: A composition comprising a diluent free of modified polyribonucleotides is applied to the epithelial cells. The method includes using

[0344]

[54] A method for delivering a polyribonucleotide to a subject, comprising: The method includes topically applying a composition comprising a mixture of alcohol and ethanol to a surface area of ​​a subject. , wherein ethanol comprises at least about 0.3% v / v to about 75% v / v of the mixture.

[0345]

[55] A method for delivering a polyribonucleotide to a subject, comprising: The method includes topically applying a composition comprising a mixture of alcohol and ethanol to a surface area of ​​a subject. , wherein the alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture.

[0346]

[56] A method for delivering a polyribonucleotide to a subject, comprising: The method includes topically applying to a surface area of ​​a subject a composition comprising a mixture of an agonist and a cell permeation agent. , wherein the cell permeabilization agent comprises at least about 0.3% v / v to about 75% v / v of the mixture.

[0347]

[57] The composition delivers polyribonucleotides to dermal or epithelial tissue of a subject. Drop one of the following methods:

[53] ~

[56]

[0348]

[58] The composition comprises a polyribonucleotide delivered by iontophoresis to a dermal or epidermal tissue of a subject. 2. The method of service under paragraph

[58] above, without accompanying the document.

[0349]

[59] A method for delivering polyribonucleotides to cells or tissues, comprising: contacting the tissue with a mixture comprising polyribonucleotides and an alcohol; The permeabilizing agent or alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture. How to do it.

[0350]

[60] A method for delivering a therapeutic composition to a cell or tissue, comprising: contacting the cell with a therapeutic composition comprising a ribonucleotide and an alcohol; The method wherein the opiate or alcohol is configured for topical administration.

[0351]

[61] A method for in vivo delivery of polyribonucleotides, comprising: applying a mixture comprising an alcohol and a surface area of ​​the subject.

[0352]

[62] A method for delivering a polyribonucleotide to a subject, comprising: applying a mixture comprising an alcohol and a surface area of ​​the subject.

[0353]

[63] A method for delivering a therapeutic polyribonucleotide to a subject, comprising: A mixture containing polynucleotides and alcohol is applied to epithelial surfaces, endothelial surfaces, exposed tissue, or The method comprises topically contacting the composition with an open wound.

[0354]

[64] A method of treatment comprising administering a mixture containing polyribonucleotides and alcohol. , applying to a surface area of ​​a subject having a pathology or disease.

[0355]

[65] A method for delivering polyribonucleotides to cells or tissues, comprising: contacting the tissue with a mixture comprising a polyribonucleotide and a cell permeabilizing agent; The permeabilizing agent or alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture. How to do it.

[0356]

[66] A method for delivering a therapeutic composition to a cell or tissue, comprising: contacting the cell with a therapeutic composition comprising a ribonucleotide and a cell permeation agent; The method wherein the opiate or alcohol is configured for topical administration.

[0357]

[67] A method for in vivo delivery of polyribonucleotides, comprising: The method includes applying a mixture comprising a dye and a cell permeation agent to a surface area of ​​a subject.

[0358]

[68] A method for delivering a polyribonucleotide to a subject, comprising: The method includes applying a mixture comprising a dye and a cell permeation agent to a surface area of ​​a subject.

[0359]

[69] A method for delivering a therapeutic polyribonucleotide to a subject, comprising: A mixture comprising a polynucleotide and a cell permeabilizing agent is applied to an epithelial surface, an endothelial surface, an exposed tissue, or The method comprises topically contacting the composition with an open wound.

[0360]

[70] A method of treatment comprising administering a mixture comprising a polyribonucleotide and a cell penetrating agent. , applying to a surface area of ​​a subject having a pathology or disease.

[0361]

[71] A method for treating a wound, comprising: treating the wound or tissue surrounding the wound with a polyribonucleic acid. The method includes contacting the composition with a mixture of leutidine and ethanol, the ethanol comprising: making up at least about 0.3% v / v to about 75% v / v of the mixture.

[0362]

[72] A method for treating a wound, comprising: treating the wound or tissue surrounding the wound with a polyribonucleic acid. The method includes contacting the composition with a mixture of leutidine and ethanol, wherein the alcohol is making up at least about 0.3% v / v to about 75% v / v of the mixture.

[0363]

[73] A method for treating a wound, comprising: treating the wound or tissue surrounding the wound with a polyribonucleic acid. the cell permeabilizing agent comprises contacting the cell with a composition comprising a mixture of leutidine and ethanol; making up at least about 0.3% v / v to about 75% v / v of the mixture.

[0364]

[74] The method according to paragraphs

[65] to

[70] or

[73] , wherein the cell permeation agent comprises an alcohol. Either one of the methods.

[0365]

[75] Alcohols include methanol, ethanol, isopropanol, butanol, Pentanol, cetyl alcohol, ethylene glycol, propylene glycol, modified alkanol Alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG-400), The method according to any one of paragraphs

[0051] to

[65] or

[74] , wherein the compound is selected from the group consisting of ethoxylated fatty acids and hydroxyethyl cellulose.

[0366]

[76] Alcohol includes ethanol, paragraphs

[51] to

[65] ,

[74] or is the method of

[75] .

[0367]

[77] Ethanol, alcohol, or a cell permeabilizing agent is at least about 0.3% of the mixture. %v / v to about 70%v / v, at least about 0.3%v / v to about 60%v / v, at least About 0.3% v / v to about 50% v / v, at least about 0.3% v / v to about 40% v / v, a little At least about 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v v, at least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5 % v / v, at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v Any one of paragraphs

[59] to

[76] , wherein the v / v is about 0.5% v / v.

[0368]

[78] Ethanol, alcohol, or a cell permeabilizing agent is at least about 0.5% of the mixture. %v / v to about 75%v / v, at least about 1%v / v to about 75%v / v, at least about 5 %v / v to about 75%v / v, at least about 10%v / v to about 75%v / v, at least about 15% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v, at least At least about 30% v / v to about 75% v / v, at least about 40% v / v to about 75% v / v, At least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or at least about 70% v / v to about 75% v / v, Either one way.

[0369]

[79] The method of any one of paragraphs

[0065] to

[78] , further comprising mixing the polyribonucleotide with a cell permeabilizing agent.

[0370]

[80] The method of any one of paragraphs

[0059] to

[64] or

[71] to

[78] , further comprising mixing the polyribonucleotide with an alcohol.

[0371]

[81] Paragraph

[79] or is the method of

[80] .

[0372]

[82] The method of paragraph 78, wherein the polyribonucleotide is lyophilized prior to mixing.

[0373]

[83] Paragraph

[79] or is the method of

[80] .

[0374]

[84] Paragraph

[79] or is the method of

[80] .

[0375]

[85] The polyribonucleotide contains a payload or a sequence encoding a payload. The method of any one of paragraphs

[50] to

[0084] , wherein the payload has a biological effect on a cell or tissue.

[0376]

[86] An amount of polyribonucleotide effective to have a biological effect on a cell. and the cell permeation agent is present in an amount effective to have a biological effect on a cell or tissue. Any one of the methods set out in paragraphs

[50] to

[85] of the Act.

[0377]

[87] Any one of the methods of paragraphs

[50] to

[0086] , wherein the polyribonucleotide encodes a protein.

[0378]

[88] The method of paragraph

[87] , wherein the protein is a therapeutic protein.

[0379]

[89] Paragraph

[87] or

[88] , in which the protein is a wound-healing protein Law.

[0380]

[90] The method of paragraph

[89] , wherein the wound-healing protein is a growth factor.

[0381]

[91] The method of paragraph

[0090] , wherein the growth factor is EGF, PDGF, TGFβ, or VEGF.

[0382]

[92] The composition is a liquid, gel, lotion, paste, cream, foam, or adhesive. any one of the methods set out in paragraphs

[50] to

[91] below.

[0383]

[93] Any one of the methods of paragraphs

[0050] to

[92] , wherein the polyribonucleotide is a linear polyribonucleotide.

[0384]

[94] Any of paragraphs

[50] to

[93] , wherein the polyribonucleotide is mRNA. One way.

[0385]

[95] Paragraph

[50] , in which the polyribonucleotide lacks a cap or a polyA tail. ~

[94] One of the following methods.

[0386]

[96] Paragraph

[50] , wherein the polyribonucleotide is a cyclic polyribonucleotide. ~

[92] Any one of the following methods.

[0387]

[97] Any one of the methods of paragraphs

[50] to

[0096] , wherein the polyribonucleotide comprises a modified ribonucleotide.

[0388]

[98] Any one of paragraphs

[50] to

[97] , wherein the composition has a pH of about 7. method.

[0389]

[99] Any of paragraphs

[50] to

[98] , wherein the composition has a viscosity that is approximately the same as that of water. Either one way.

[0390]

[0100] Any one of the methods of paragraphs

[50] to

[0099] , wherein the composition is substantially free of hydrophobic or lipophilic groups.

[0391]

[0101] Any of paragraphs

[50] to

[0100] , wherein the composition is substantially free of hydrocarbons. Either one way.

[0392]

[0102] Any one of the methods of paragraphs

[50] to

[0101] , wherein the composition is substantially free of cationic liposomes.

[0393]

[0103] The composition may be a fatty acid, a lipid, a liposome, cholesterol, or any of the above. Any one of the methods described in paragraphs

[50] to

[0102] , which does not substantially include combinations.

[0394]

[0104] Any of paragraphs

[59] to

[0103] , in which the cell permeation agent is soluble in a polar solvent. Either one way.

[0395]

[0105] Any of paragraphs

[59] to 87, wherein the cell permeation agent is insoluble in a polar solvent. One way.

[0396]

[0106] Any one of the methods of paragraphs

[50] to

[0105] , wherein the composition further contains a pharma- ceutically acceptable excipient.

[0397]

[0107] The method according to any one of paragraphs

[50] to

[0106] , wherein the delivery is systemic. .

[0398]

[0108] The method according to any one of paragraphs

[50] to

[0106] , wherein the delivery is localized. .

[0399]

[0109] Surface areas include skin, oral cavity, nasal cavity, ear cavity, gastrointestinal tract, respiratory tract, vagina, cervix, fetus The present invention relates to a method for treating a patient having a pulmonary circulation disorder, comprising administering to the patient a therapeutically effective amount of ... Either one of the methods.

[0400]

[0110] The method of any one of paragraphs

[0050] to

[58] ,

[61] ,

[62] , or

[71] to

[0109] , wherein applying comprises depositing a droplet of the mixture directly onto the surface area.

[0401]

[0111] Application may involve applying to a surface area a patch, gel, or film in which the mixture is embedded. The method of any one of paragraphs

[50] to

[58] ,

[61] ,

[62] , or

[71] to

[0109] , comprising wiping the surface with water.

[0402]

[0112] The method of any one of paragraphs

[50] to

[0058] ,

[61] ,

[62] , or

[71] to

[0109] , wherein applying comprises spraying the mixture onto the surface area.

[0403]

[0113] Any one of paragraphs

[0050] to

[58] ,

[61] ,

[62] , or

[71] to

[0109] , wherein the application includes administering the mixture to a subject by aerosolization. Law.

[0404]

[0114] The method according to paragraphs

[50] to

[51] , wherein the administering step comprises administering the mixture to a subject via a suppository. One of the following methods:

[58] ,

[61] ,

[62] , or

[71] to

[0109] .

[0405]

[0115] Administration of the mixture to a subject via oral ingestion of a capsule containing the mixture. and administering the mixture to the subject, the capsule being configured to release the mixture within the gastrointestinal tract of the subject. Paragraphs

[50] to

[58] ,

[61] ,

[62] , or

[71] to

[0109] Or one way.

[0406]

[0116] Paragraphs

[59] ,

[60] ,

[65] and

[66] , in which the cells include epithelial cells or one of the methods from

[71] to

[0115] .

[0407]

[0117] Circular polyribonucleotides are at least 5% less abundant than their linear counterparts. At least 10%, at least 15%, at least 20%, at least 30%, at least 40% %, at least 50%, at least 60%, at least 70%, at least 80%, at least at least 90%, at least 100%, at least 150%, at least twice as much, at least 3x, at least 4x, at least 5x, at least 6x, at least 7x, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, or Any one of paragraphs

[96] to

[0116] having at least 100 times higher translation efficiency. method.

[0408]

[0118] Circular polyribonucleotides have at least 5-fold higher translation than their linear counterparts. Any one of the methods described in paragraphs

[96] to

[0117] having efficiency.

[0409]

[0119] Paragraph

[50] , in which polyribonucleotides have a short-term biological effect. ~One of the following methods:

[0118]

[0410]

[0120] Paragraph

[50] , in which polyribonucleotides have long-term biological effects. ~One of the following methods:

[0119] .

[0411]

[0121] The concentration of polyribonucleotide in the mixture is at least about 50 ng / mL , at least about 100 ng / mL, at least about 500 ng / mL, at least about 1 μg / mL, at least about 2 μg / mL, at least about 3 μg / mL, at least about 4 μg / mL mL, at least about 5 μg / mL, at least about 10 μg / mL, at least about 20 μg / mL, at least about 50 μg / mL, at least about 100 μg / mL, at least about 2 00 μg / mL, at least about 500 μg / mL, at least about 1 mg / mL, at least at least about 2 mg / mL, at least about 5 mg / mL, at least about 10 mg / mL, at least at least about 20 mg / mL, at least about 50 mg / mL, or at least about 100 mg / mL Any one of the methods set forth in paragraphs

[50] to

[0120] .

[0412]

[0122] An application tool and a pharmaceutical composition according to any one of paragraphs [1] to

[31] . The kit, wherein the application tool is configured to apply the pharmaceutical composition to a surface area of ​​a subject. Kit.

[0413]

[0123] The method includes the first application tool, the second application tool, the fungicide, and any carriers. A kit comprising a composition comprising a polyribonucleotide and a diluent, the composition comprising a first application tool. a second application tool configured to apply the germicide to the surface area of ​​the target; and The kit is configured to apply the composition to a surface area of ​​a subject.

[0414]

[0124] The kit of paragraph

[0123] , wherein the disinfectant is alcohol, UV light, laser light, or heat.

[0415]

[0125] The alcohol is methanol, ethanol, isopropanol, butanol. , Pentanol, Cetyl Alcohol, Ethylene Glycol, Propylene Glycol, Modified Alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG)-400 , an ethoxylated fatty acid, and a hydroxyethyl cellulose;

[0124] Kit.

[0416]

[0126] Any of paragraphs

[0123] to

[0125] in which the first application tool is a wipe One kit.

[0417]

[0127] The kit of paragraph

[0126] , wherein the wipe contains a disinfectant.

[0418]

[0128] The first application tool is a device that applies UV light or laser light. A kit as set forth in paragraph

[0123] or

[0124] .

[0419]

[0129] Paragraph

[0123] , in which the first application tool is a device for applying heat; or

[0124] Kit.

[0420]

[0130] The method includes the steps of: wherein the application tool is configured to apply the mixture to a surface area of ​​a target. A kit that can be used.

[0421]

[0131] The kit of any one of paragraphs

[0122] to

[0130] , wherein the application tool or the second application tool includes a pipette.

[0422]

[0132] The application tool or the second application tool includes a substrate, the substrate being configured to A kit according to any one of paragraphs

[0122] to

[0130] , wherein the kit is embedded.

[0423]

[0133] A kit according to paragraph

[0132] , wherein the substrate is made of natural or artificial fibers.

[0424]

[0134] The kit of paragraph

[0132] , wherein the kit includes a suppository.

[0425]

[0135] The application tool or the second application tool includes a patch. ~One of the kits

[0134] .

[0426]

[0136] Paragraph

[0122] , wherein the application tool or the second application tool includes a sprayer. ~One of the kits

[0134] .

[0427]

[0137] The kit of any one of paragraphs

[0122] to

[0134] , wherein the application tool or the second application tool includes a nebulizer.

[0428]

[0138] The application tool or a second application tool releases the mixture into the gastrointestinal tract of the subject. Any one of paragraphs

[0122] to

[0134] , including a capsule configured to dispense kit.

[0429]

[0139] The application tool or a second application tool releases the mixture in a controlled manner. A kit according to any one of paragraphs

[0122] to

[0138] ,

[0430]

[0140] The surface area includes the skin, the oral cavity, the nasal cavity, the gastrointestinal tract, and the respiratory tract, as well as surface areas thereof. Any one of paragraphs

[0122] to

[0139] selected from the group consisting of any combination of Kit.

[0431]

[0141] A method for treating a wound, comprising treating the wound or tissue surrounding the wound with a A method comprising contacting the subject with a composition comprising any one of the following: EXAMPLES

[0432] The following examples are provided to further illustrate some embodiments of the present invention. It is not intended to limit the scope of the present invention; other procedures, methods known to those skilled in the art are also within the scope of the present invention. It is understood that the theories, theories, or techniques described herein may be used alternatively by virtue of their exemplary nature. It becomes.

[0433] Example 1: Formulation of RNA for localized delivery This example demonstrates the formulation of RNA for localized delivery.

[0434] To determine the local effects of RNA, RNA was formulated for delivery to epithelial tissue. .

[0435] As described herein, RNA is formulated with a cell permeation agent according to the following: Ta. 10 ng RNA containing EGF ORF, linear or circular 5uL 80% ethanol 35uL PBS + glucose (4.5g / L).

[0436] Example 2: Localized delivery of linear RNA This example demonstrates localized delivery of RNA.

[0437] To determine the effect of local delivery, RNA was formulated and delivered to epithelial tissue. As described, linear RNA formulated with a cell-penetrating agent was able to be locally delivered to ear tissue. Delivered.

[0438] Linear RNA samples were formulated as in Example 1 (50 μL) and applied to mouse ears. Prior to application of the samples to the ears, the ears were wiped with an isopropyl alcohol wipe. The ears were then dried by briefly exposing them to infrared lights and a fan in a sterile hood. Mice were returned to their cages under standard conditions.

[0439] At selected time points (6 h, 1 day, 3 days, or 12 days after application), ear tissue (single ear pan) was A 100-ml sample was collected for each RNA sample and stored in tissue storage reagent (e.g., (permeates tissue to stabilize and protect circular RNA in unfrozen samples).

[0440] Example 3: Localized delivery of circular RNA This example demonstrates localized delivery of RNA.

[0441] To determine the effect of local delivery, RNA was formulated and delivered to epithelial tissue. As described, RNA is formulated with a cell-penetrating agent and delivered locally to ear tissue. It was.

[0442] Circular RNA samples were formulated as in Example 1 (50 μL) and applied to both ears of mice. Prior to application of the samples to the ears, the ears were wiped with an isopropyl alcohol wipe. on the ear by briefly exposing the ear to an infrared light and a fan in a sterile hood. The mice were then returned to their cages under standard conditions.

[0443] At selected time points (6 h, 1 day, 3 days, or 12 days after application), ear tissue (single ear pan) was A quantification ratio (by qPCR) was collected for each RNA sample.

[0444] Example 4: Persistence of RNA after local delivery This example demonstrates the persistence of RNA following local delivery.

[0445] To determine the persistence of RNA, tissue samples were analyzed for delivered RNA. As described herein, ear punches were persistent at various time points following localized delivery of RNA. was analyzed.

[0446] Ear punch samples from Example 3 and unprocessed ear punch samples were collected in RNA stabilization reagent The RNA was extracted using a standard RNA tissue extraction kit (Maxwell RSC simpl y RNA) was extracted using

[0447] A volume of 200 μl of 1-thioglycerol / homogenization solution was added to each sample. The solution was homogenized by adding 20 μl of 1-thioglycerol per milliliter of homogenized solution. Alternatively, 600 μl of 1-thioglycerol was added to a 30 ml bottle. Before use, the 1-thioglycerol / homogenization solution was kept on ice or It was cooled to 2-10°C.

[0448] The tissue samples were washed with 200 μl of chilled 1-thioglycerol until no tissue fragments were visible. Homogenized in the homogenization solution using a handheld homogenizer and a sterile pestle. Each sample was homogenized for an additional 15-30 seconds for complete homogenization.

[0449] To examine the presence of RNA at different time points, samples were analyzed for RNA via q-PCR. qPCR was used to measure the presence of both linear and circular RNA in ear punches. To detect linear and circular RNA, the Nluc ORF was amplified. The primers used were: (F:AGATTTCGTTGGGGACTGGC (sequence Sequence number 7), R: CACCGCTCAGGACAATCCTT (SEQ ID NO: 8). Cyclic R To detect only NA, the primers that amplified the 5'-3' junction were not linear but circular. This allows detection of the .ALPHA.-shaped RNA construct (F:CTGGAGACGTGGAGGAG AAC (SEQ ID NO: 9), R: CCAAAAGACGGCAATATGGT (SEQ ID NO: 10 )).

[0450] Linear and circular RNA were detected 6, 24, and 72 hours after local delivery. Higher levels of circular RNA compared with linear RNA were detected in mice 3 days after injection. was detected in the ears of

[0451] As shown in this example, locally administered linear and circular RNAs was detectable in vivo.

[0452] Example 5: Protein expression of mRNA following local delivery This example describes the presence of a protein after local delivery.

[0453] To determine whether locally delivered RNA can be translated, tissue samples were cultured in Western The ear punches were analyzed for protein expression at different time points by RNA blot. Protein expression is analyzed following local delivery of A.

[0454] Briefly, ear punches were collected and stored in RNA stabilization reagent (Invitrogen). The tissue was homogenized in RIPA buffer using a microtube homogenizer (Fis Her Scientific) and the proteins were extracted. The mixture is centrifuged at 14 x g for 15 minutes.

[0455] The supernatant was removed and the pellet was washed with 2× SDS sample buffer (0.125 M Tris-H Cl, pH 6.8, 4% SDS, 30% glycerol, 5% 2-mercaptoethanol The antibody was dissolved in 0.1% bromophenol blue (0.01% bromophenol blue) at 70° C. for 15 minutes.

[0456] Commercially available standards (BioRad) are used as size markers. Electrophoresis onto polyvinylidene fluoride (PVDF) membranes (Millipore) using After transfer with , the blots were visualized using a chemiluminescence kit (Rockland). can be.

[0457] GFP protein was visualized in ear punch samples and expressed in circular and linear RNA. It is expected that detection will be possible.

[0458] Example 6: Local administration of RNA enhances RTP to tissue when ethanol is included in the RNA solution Resulting in NA delivery This example demonstrates the efficacy of ethanol in RNA synthesis via topical administration in vivo when ethanol is included in the RNA solution. The present invention demonstrates the ability to deliver RNA to cells and tissues using siRNA.

[0459] In this example, the circular RNA contains the EMCV IRES and nanoluciferase (N It was designed with an ORF encoding the ribosomal gene (Luc).

[0460] Circular RNA was generated in vitro. Unmodified linear RNA was synthesized from a DNA template. The transcribed RNA was purified using an RNA purification kit according to the manufacturer's instructions. The RNA 5' was purified using a 5' Phosphohydrolase (RppH) (New England Biolabs, M035 6) and purified again using an RNA purification column. RppH-treated linear RNA were obtained from splint DNA and T4 RNA ligase 2 (New England Biol. The circular RNA was then purified by urea-PAGE. and in a buffer (0.5 M sodium acetate, 0.1% SDS, 1 mM EDTA). The RNA was eluted, ethanol precipitated, and stored in RNA storage solution (ThermoFisher Science The cells were resuspended in 100 mM sodium citrate (Cat# AM7000). The RNA was also HPLC purified.

[0461] In this example, the linear mRNA encodes nanoluciferase (NLuc). In this example, the modified linear mRNA was designed with an ORF that The linear RNA was generated in-house by in vitro transcription. -Fully substituted with uridine and 5-methyl-C, capped with CleanCap™ AG It is looped over, contains the 5' and 3' human alpha-globin UTRs, and is polyadenylated. .

[0462] The RNA was then dissolved in PBS / glucose (4.5 g / L) and ethanol (10% v / v ) so that the total sample volume for each sample was 50 uL. The total RNA for the sample was 3.5 pmol. All reagents were brought to room temperature before mixing. The mixture is prepared immediately prior to use.

[0463] At time point = 0, a 50 μL volume of each sample was delivered to a BALB / c mouse using a pipette tip. The drug was applied topically to the ears of mice. Untreated mice served as negative controls. The material was dried by briefly exposing the ears to an infrared light and fan in a sterile hood. Mice were returned to their cages under standard conditions.

[0464] To determine the persistence of RNA in tissues, tissue samples are delivered using RT-qPCR. RNA was analyzed at various time points after administration: 6 hours, 1, 3, and 12 days after administration. A 2 mm ear punch was taken from each animal and then lysed in RNAlater solution (ThermoFish Total RNA was stored in a 50-ml tube (E. coli, Cat# AM7020, ELISA Kit ... The cells were isolated from ear punches using Trizol extraction. The aqueous phase was precipitated with isopropanol. The pellet was washed with 70% ETOH according to the manufacturer's instructions. , synthesized from total RNA, and RT-PCR was performed using primers specific for the NLuc ORF. All samples were run on cDNA templates using a Bio-rad CFX384 server. The RNA levels were then assayed in triplicate on a multicycler. and relative to the untreated negative control.

[0465] Circular and linear RNA were mixed at 6 hours and 1, 3, and 12 days after local administration. was detected in tissue samples, showing a signal greater than that of the solvent-only control (Figures 2A and 2B). .

[0466] This example demonstrates that circular and linear RNAs are It has been successfully delivered via local administration to tissues and demonstrated to persist in the tissues for extended periods of time. I testify.

[0467] Example 7: Local administration of RNA enhances RNA delivery to tissues when formulated in TransIT Bringing about This example demonstrates the in vivo effects of TransIT when formulating an RNA solution. The ability to deliver RNA to cells and tissues via local administration is demonstrated.

[0468] In this example, the circular RNA contains the EMCV IRES and nanoluciferase (N It was designed with an ORF encoding the ribosomal gene (Luc).

[0469] Circular RNA was generated in vitro. Unmodified linear RNA was synthesized from a DNA template. The transcribed RNA was purified using an RNA purification kit according to the manufact...

Claims

1. 1. A pharmaceutical composition comprising a mixture of a polyribonucleotide and a cell permeation agent, said cell permeation agent comprising 0.3% v / v to 75% v / v of said mixture, said pharmaceutical composition not comprising a carrier.

2. The pharmaceutical composition of claim 1 , wherein the cell permeation agent is soluble in a polar solvent.

3. The pharmaceutical composition of claim 1 , wherein the cell permeation agent is insoluble in a polar solvent.

4. The pharmaceutical composition of claim 1 , wherein the cell permeation agent is an alcohol.

5. 5. The pharmaceutical composition of claim 4, wherein the alcohol is selected from the group consisting of methanol, ethanol, isopropanol, butanol, pentanol, cetyl alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol, menthol, polyethylene glycol (PEG)-400, ethoxylated fatty acids, hydroxyethyl cellulose, isopropyl alcohol, dimethylaminoethanol, retinol, d-alpha-tocopherol, SD alcohol, SD alcohol 40, c12-16, lauryl alcohol, myristyl alcohol, butylene glycol, and propanediol.

6. The pharmaceutical composition of claim 1 , wherein the polyribonucleotide encodes a protein.

7. The pharmaceutical composition of claim 6 , wherein the protein is a therapeutic protein.

8. 7. The pharmaceutical composition of claim 6, wherein the protein is a wound healing protein, optionally wherein the wound healing protein is a growth factor.

9. The pharmaceutical composition of claim 8 , wherein the growth factor is EGF, PDGF, TGFβ, or VEGF.

10. The pharmaceutical composition of any one of claims 1 to 9, wherein the pharmaceutical composition is a liquid, gel, lotion, paste, cream, foam, serum, ointment, or adhesive.

11. The pharmaceutical composition according to any one of claims 1 to 9, further comprising a pharma- ceutically acceptable excipient.

12. A composition for delivering polyribonucleotides to epithelial cells, comprising a diluent and an unmodified polyribonucleotide, wherein the composition is applied to the epithelial cells, and the composition does not contain any carrier.

13. A composition for delivering polyribonucleotides to a subject, comprising a mixture of polyribonucleotides and a cell permeation agent, the composition being characterized in that it is applied topically to a surface area of ​​the subject, and the cell permeation agent comprises 0.3% v / v to 75% v / v of the mixture.

14. The composition of claim 13 , wherein the cell permeation agent is soluble in a polar solvent.

15. The composition of claim 13 , wherein the cell permeation agent is insoluble in a polar solvent.

16. The composition of claim 13 , wherein the polyribonucleotide encodes a protein.

17. The composition of claim 16 , wherein the protein is a therapeutic protein.

18. 17. The composition of claim 16, wherein the protein is a wound healing protein, optionally wherein the wound healing protein is a growth factor.

19. 19. The composition of claim 18, wherein the growth factor is EGF, PDGF, TGFβ, or VEGF.

20. The composition of any one of claims 12 to 19, wherein the composition is formulated as a liquid, gel, lotion, paste, cream, foam, serum, ointment, or adhesive.

21. A composition according to any one of claims 12 to 19, characterized in that the composition is applied by placing a drop of the composition directly on the integumentary member.

22. A composition according to any one of claims 12 to 19, characterized in that the composition is applied by wiping the integumentary member with a patch, gel or film in which the composition is embedded.

23. A composition according to any one of claims 12 to 19, characterized in that the composition is applied by spraying the composition onto the integumentary members.

Images