Method for multiple detection of plurality of target biological molecules

Abstract

To provide a method for multiple detection of a plurality of target biological molecules, more specifically a method for multiple detection of a plurality of target biological molecules defined in the introductory part of claim 1, and a communication kit defined in claim 15.SOLUTION: The present disclosure relates to a method for multiple detection of a plurality of target biological molecules that use optical encoding, each target biological molecule including at least one detection target. The method includes: (a) a step for providing one or more nano-particle types including a plurality of nano-particles, each nano-particle having coating that provides coupling affinity of the nano-particle to a type-specific detection target, and each nano-particle including a plurality of fluorophores that generate a signal unique to each nano-particle; (b) a step for providing a sample that includes a plurality of target biological molecules; (c) a step for bringing the sample into contact with the nano-particle types and thereby enabling the nano-particle to bind to the detection target of the target biological molecule; and (d) a step for optically analyzing the fluorophore signal released by the nano-particle of the nano-particle type bound to the detection target of the target biological molecule by measuring the wavelength and intensity of the released signal, and thereby detecting the presence and characteristic property of the target biological molecule.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present disclosure relates to a method for multiplexed detection of multiple target biomolecules. More specifically, the present disclosure relates to a method for multiplexed detection of multiple target biomolecules as defined in the introductory part of claim 1 and to a kit of parts as defined in claim 15. [Background technology]

[0002] Many bioanalytical techniques allow for multiplex (two or more) detection of various targets, typically using fluorescence methods. Several applications benefit from doing this, including histology, flow cytometry, basic cellular and molecular protocols, fluorescence in situ hybridization, DNA sequencing, immunoassays, and binding assays. Although it is possible to detect two or more targets simultaneously, the use of fluorophores still severely limits the ability to multiplex. For in situ hybridization applications, new technologies have emerged in particular to increase the magnitude of multiplexing capacity, focusing on barcode decoding via in situ sequencing schemes.

[0003] The use of multiple fluorophores (dyes) is limited by their physical properties: each dye has a certain spectral shape of its absorbance and emission (approximately 100 nm wide for organic dyes). For this reason, when using multiple fluorophores simultaneously, their emissions need to be well separated. This limits the amount of dyes that can be used simultaneously before their emissions overlap (spectral overlap), making it difficult to distinguish one dye from another (typically less than 5-10 dyes at the same time).

[0004] To overcome this, in situ sequencing techniques are emerging (Strell et al. (FEBS J. (2018), p. 14435 (Placing RNA in context and space-methods for spatially resolved transcriptomics)) and Lein et al. (Science (2017) 358, 64-69 (The promise of spatial transcriptomics for neuroscience in the era of molecular cell typing.)) are two relevant papers in this context). These exploit molecular DNA barcodes that each represent a unique target that needs to be decoded for successful detection (targeted methods) or, alternatively, in the case of RNA / DNA, direct sequencing of the target (non-targeted). The process of decoding is an iterative process that involves using DNA sequencing chemistry (adding and removing signals), stepping one DNA base at a time and repeating this as many times as necessary depending on the level of multiplexing desired, while maintaining the integrity and position of the sample during this iterative process, image acquisition between each iteration, and finally clarifying and aligning all the images, followed by image analysis to determine the uniqueness of each target. Therefore, this entire process takes much longer than one-step (direct) detection methods (such as traditional fluorescent in situ hybridization), typically requiring trained personnel and / or robust hardware to integrate the chemical and imaging steps, resulting in higher costs. Furthermore, the process of performing several steps iteratively makes the sequencing approach more susceptible to errors or mistakes, since a subpart of the process going wrong is enough for the entire decoding to fail completely. Thus, the sequencing process is more complex, more susceptible to errors, more expensive, and more time-consuming compared to direct approaches.

[0005] Therefore, in view of the problems with existing solutions, there is a need for improved methods for multiplexed detection of multiple target biomolecules. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Strell et al.(FEBS J.(2018), p.14435(Placing RNA in context and space-methods for spatially resolved transcriptomics)) [Non-Patent Document 2] Lein et al.(Science(2017)358,64-69(The promise of spatial transcriptomics for neuroscience in the era of molecular cell typing.) Summary of the Invention [Problem to be solved by the invention]

[0007] It is an object of the present disclosure to mitigate, alleviate or eliminate one or more of the above-mentioned deficiencies and shortcomings in the prior art, or at least to solve the above-mentioned problems. [Means for solving the problem]

[0008] According to a first aspect of the present invention, there is provided a method for multiplex detection of a plurality of target biomolecules using optical encoding, each target biomolecule having at least one detection target, the method comprising: a. providing a plurality of nanoparticle types comprising a plurality of nanoparticles, each nanoparticle having a coating that provides binding affinity of the nanoparticle for a type-specific detection target, each nanoparticle comprising a plurality of fluorophores that generate a signal that is unique to each nanoparticle type; b. providing a sample containing a plurality of target biomolecules; c. contacting the sample with a plurality of nanoparticle types, thereby allowing the nanoparticles to bind to detection targets of the target biomolecules; d. Detection of target biomolecules. Optically reading the fluorophore signal emitted by the nanoparticles of the nanoparticle type bound to the target by measuring the wavelength and intensity of the emitted signal, thereby detecting the presence and identity of the target biomolecule.

[0009] This provides a method for the simultaneous detection of a significant number (e.g., 50-100) of detection targets in situ in a one-step direct manner by tailoring the nanoparticles of each nanoparticle type to specifically and precisely incorporate fluorophores into well-defined nanoparticles, thereby optically encoding them.

[0010] As used herein, the term "plurality" refers to at least two.

[0011] As used herein, when referring to a nanoparticle comprising multiple fluorophores, this means that the nanoparticle comprises at least two different fluorophores that exhibit different emission wavelengths and / or intensities, e.g., the nanoparticles of each nanoparticle type comprise at least two, e.g., at least three, four, or five different fluorophores.

[0012] In addition, nanoparticles can protect fluorophores to prevent bleaching, which is important because the number of combinations is limited when intensity distributions overlap each other.

[0013] Furthermore, semiconductor fluorophores such as quantum dots can be utilized to achieve a wider range of combinations, either by incorporating multiple such or by combining with organic fluorophores.

[0014] The number of combinations is n m -1, n is the number of intensity levels, and m is the number of colors. In short, the number of combinations grows proportionally to the number of colors, not the number of intensity levels. With semiconductor fluorophores, it is possible to achieve both narrower emission spectra (enabling more colors in parallel before spectral overlap becomes an issue) as well as fitting more colors within the spectrum, due to the possibility of having semiconductor fluorophores with very large Stokes shifts, along with organic fluorophores.

[0015] The use of nanoparticles also allows the properties of individual fluorophores to be altered when incorporated into organized materials within the particle where the distance between fluorophores can be carefully controlled so that they can be energetically coupled and act as waveguides / antennas, such as Förster resonance energy transfer (FRET) or excitation energy transfer (EET). This allows for more flexibility in achieving a greater number of concentration levels and / or a greater number of color combinations, ultimately leading to a greater number of multiplexes.

[0016] In one embodiment, the nanoparticle type is in a suspended state, i.e., the nanoparticles of the nanoparticle type are in a suspended state.

[0017] The present invention allows a process in which nanoparticles with a certain unique identity bind to detection targets (DNA / RNA / proteins) in situ, where the size of the nanoparticles allows cell penetration and the excess is washed away while the nanoparticles are immobilized on the target. Preferably, the detection target is designed so that multiple nanoparticles can be attached in at least one optically resolvable pixel forming a cluster of nanoparticles within a spot of the detection target, so that the signal intensity is higher in this cluster compared to the signal from a single nanoparticle that may bind non-specifically to the surroundings, and a localized signal can be detected upon target binding, where the unique identity of the nanoparticles encodes the target identity. Typically, this can be done by performing target amplification before decoding, such as rolling circle amplification (RCA) or other means of localized / clonal amplification (such as hairpin chain reaction), or by designing the probes in a manner similar to traditional fluorescent probe in situ hybridization (FISH) techniques so that the probes can form localized clusters.

[0018] The present invention also allows the process of nanoparticles with certain unique properties binding to detection targets or biomolecular targets (DNA / RNA / protein) in situ, where the size of the nanoparticles allows the penetration of cells and the excess is washed away, but the nanoparticles can be immobilized on the biomolecular target. Alternatively, the biomolecular target is not within the cell, but instead immobilized in a 2D or 3D matrix of material and still be considered to be in situ. For example, the target biomolecule can be immobilized on the surface of a microscope slide, or in a 3D polymer network, or even optionally in tissue from which most of the tissue components other than the biomolecular target have been removed. Preferably, the detection target is designed so that multiple nanoparticles can be attached in at least one optically resolvable pixel forming a cluster of nanoparticles within the detection target or the spot of the target biomolecule containing the detection target, so that the signal intensity is higher in this cluster compared to the signal from a single nanoparticle that may bind non-specifically to the surroundings, and a localized signal can be detected upon target binding, where the unique identity of the nanoparticles encoding the target identity can be read / decoded in an isolated manner since multiple nanoparticles binding to one biomolecule target are of the same nanoparticle type. Thus, such a signal is spatially resolved, which means that each signal identity encoding the target identity can be read / decoded in an isolated manner with respect to the nanoparticle type without significant interference of the signal of another nanoparticle type within this spatially resolved spot or volume, meaning that the signal from the specifically bound nanoparticles from the correct nanoparticle type is strong enough to confidently decode the identity, even if there is a small interference from non-specifically bound nanoparticles from another nanoparticle type in the localized spot of the signal.Typically, this can be done by performing target amplification prior to decoding, such as rolling circle amplification (RCA) or other means of localized / clonal amplification (such as hairpin chain reaction), or by designing the probes in a manner similar to traditional fluorescent probe in situ hybridization (FISH) techniques such that the probes form spatially resolved, localized clusters, expanding the size of the original biomolecular target, thereby allowing multiple nanoparticles of the same nanoparticle type to bind to the biomolecular target. Such amplification methods are sometimes commonly referred to as clonal amplification methods.

[0019] That is, the present invention enables a process in which nanoparticles with certain unique properties bind to a detection target or biomolecular target in a sample (DNA / RNA / protein), where the nanoparticles are immobilized on the detection target and after the contacting step, excess unbound nanoparticles can be washed away from the sample.

[0020] In one embodiment, the method of the present invention can be carried out in situ or ex situ. The term in situ refers to a sample contacting the nanoparticles after immobilization on a 2D or 3D matrix of material. The term ex situ refers to a sample contacting the nanoparticles in a homogeneous solution.

[0021] As used herein, the term "2D or 3D matrix of material" refers to a solid phase made of glass or plastic such as polystyrene, polyethylene, polymethylmethacrylate, cyclic olefin copolymers, agarose, biodegradable polymers (polylactide, poly(glycolide), poly(ε-caprolactone), etc.), or combinations thereof. The solid phase may be coated with biomolecules such as proteins and / or nucleic acids to improve sample immobilization and / or surface passivation. Alternatively, the solid phase may be uncoated.

[0022] As used herein, the term "sample" refers to any sample containing a target biomolecule (e.g., multiple target biomolecules). For example, a sample may be a biological sample, such as a bodily fluid sample, a tissue sample, or a single cell. A sample may include proteins and / or nucleic acids in a homogenous solution, or may further include a mixture of biomolecules immobilized on a "2D" or "3D" matrix of material via affinity, electrostatic, covalent, or van der Waals interactions, or a combination thereof.

[0023] As used herein, the term "detection target" refers to any target in a sample to which the nanoparticles can bind.

[0024] In one embodiment, the detection target is a polynucleotide sequence. The term "polynucleotide sequence" includes any biopolymer composed of nucleotide monomers in a chain, such as DNA and / or cDNA and / or RNA and / or proteins.

[0025] Preferably, the detection target is designed so that multiple nanoparticles can be attached in at least one optically resolvable pixel forming a cluster of nanoparticles within the spot of the detection target, so that the signal intensity is higher in this cluster compared to the signal from a single nanoparticle that may bind non-specifically to the surroundings, allowing a localized signal to be detected upon target binding, where the unique identity of the nanoparticles encodes the target identity. Typically, this can be done by performing target amplification before decoding, such as rolling circle amplification (RCA), polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction (RT-PCR), loop-mediated isothermal amplification (LAMP), or other means of localized / clonal amplification (such as hairpin chain reaction), or by designing the probes in a manner similar to traditional fluorescent probe in situ hybridization (FISH) techniques so that the probes can form localized clusters. These methods may be based on the use of exonucleases, endonucleases, transposases, or CRISPR / Cas-based enzymatic activities before amplification. The amplification procedure may also involve a combination of two or more of the above techniques.

[0026] According to some embodiments, each nanoparticle type is optically encoded by (i) incorporating precisely controlled ratios of multiple fluorophores, thereby controlling the emission wavelength and intensity from the nanoparticle type, or (ii) modifying properties of the fluorophores that affect the emission intensity.

[0027] Stated another way, each nanoparticle type can be optically encoded by incorporating a predetermined amount of multiple fluorophores within and / or on the nanoparticle, thereby arriving at a nanoparticle type that exhibits at least one, e.g., at least two, three, four, or five, specific emission wavelengths and intensities.

[0028] As used herein, the term "incorporating" refers to a nanoparticle that is loaded with multiple fluorophores. That is, in one embodiment, the nanoparticles are loaded with fluorophores. The loading can be on the surface of the nanoparticle, or within the matrix of the nanoparticle itself, or within the pores of the nanoparticle, and / or the nanoparticle may encapsulate the fluorophore.

[0029] "Loaded within the matrix of the nanoparticle itself" refers to incorporating the fluorophore into the nanoparticle when the nanoparticle is synthesized, thus embedding the fluorophore within the matrix of the nanoparticle.

[0030] Encapsulating the fluorophore in the matrix of the nanoparticle can slow down the bleaching process of the fluorophore. For example, bleaching usually proceeds faster in the presence of oxygen, so slowing down the diffusion of oxygen into the particle is one way to slow down bleaching. Another aspect is that the rate of photobleaching depends on the environment, e.g., the solvent conditions. In this way, the "solvent conditions" inside the particle can be made different from the outside of the particle, for example, when encapsulating the fluorophore in a non-polar matrix, such as a polymer matrix.

[0031] Thus, the present invention enables the use of optically encoded nanoparticles synthesized by the incorporation of precisely controlled intensity levels of dyes (e.g., fluorophores), such that each combination of levels (ratios) represents a unique identity, allowing for a larger number of multiple identities compared to single colors. The number of combinations is n m -1, n is the number of intensity levels, and m is the number of colors.

[0032] As used herein, the term "ratio" includes reference to a given amount of dye / fluorophore that is incorporated into a nanoparticle.

[0033] According to some embodiments, the binding affinity of the coating is provided by a detection probe X attached to the nanoparticle via a linker. In one embodiment, the detection probe X is a nucleic acid molecule, an antigen, an antibody, or a combination thereof.

[0034] In one embodiment, the linker is absent and the probe X is directly attached to the nanoparticle surface. "Detection probe" refers to a molecule that specifically binds to a target molecule or group of target molecules, including oligonucleotides with deoxyribose and / or ribose bases, xenonucleic acids such as locked nucleic acids (LNA), glycol nucleic acids (GNA), threose nucleic acids (TNA), phosphoroamidate morpholino oligomers (PMO), peptide nucleic acids (PNA), antibodies, antibody fragments, synthetic peptides, aptamers, DARPins, or combinations thereof.

[0035] This design allows for rapid and custom modification of the nanoparticles with different targets to easily create new panels as desired by the end user.

[0036] According to some embodiments, the coating further comprises a repulsive component provided by a functional group Y attached to the nanoparticle via a linker, the functional group Y being selected from a charged group having a positive or negative charge, a zwitterionic group comprising both positive and negative charges, or a sterically repulsive functional group such as a polymeric or aliphatic chain.

[0037] In one embodiment, the functional group Y may be selected from the group consisting of thiol, disulfide, carboxylic acid, amine, ammonium cation, phosphonic acid, silane, organosilane, sulfonate, phosphine, hydroxyl, catechol, gallol, ethoxysilane, methoxysilane, silazane, chlorosilane, aldehyde, azide, alkyne, cyclooctyne (e.g., dibenzocyclooctyne (DBCO), trans-cyclooctene (TCO)), cyclononene (bicyclo[6.1.0]nonene (BCN)), tetrazine, avidin, streptavidin, neutravidin, biotin, or an avidin / biotin combination.

[0038] In another embodiment, the coating comprises sterically repulsive groups, such as polymeric or aliphatic chains, that are also equivalent to functional group Y. By the term "sterically repulsive", this refers to groups on the surface of the nanoparticles that, by steric hindrance, prevent the nanoparticles from agglomerating when in solution.

[0039] In one embodiment, the polymer can be a water-soluble polymer such as poly(ethylene glycol) / poly(ethylene oxide), poly(propylene glycol), polypeptides, polyglycerol, and polyoxazoline, and combinations thereof. The polymer is preferably of a molecular weight that allows for a coating that provides stability to the nanoparticles in solution through steric stabilization, yet still provides binding affinity of the nanoparticles to type-specific detection targets.

[0040] The polymer may be a functionalized hydrocarbon, any selected from the list consisting of polyacrylamide, poly(acrylic acid), poly(methyl methacrylate, and poly(methyl acrylate), and combinations thereof.

[0041] In another embodiment, the functional group Y is a C 18 C2~C etc. 18For example, the aliphatic chain may be selected from the group consisting of hexane, decane, pentadecane, octadecane, polyacetylene, polystyrene, and polyethylene, and combinations thereof.

[0042] In one embodiment, the polymer and / or aliphatic chain has a molecular weight of less than about 4000 Da, such as about 150-4000 Da, about 150-2000 Da, for example about 150-1000 Da.

[0043] In another embodiment, the nanoparticle coating may include a plurality of linkers having conjugate groups configured for conjugation to the detection probes X and / or functional groups Y.

[0044] The conjugate group may be selected from the list consisting of azides, isothiocyanates, isocyanates, sulfonyl chlorides, aldehydes, carbodiimides, acyl azides, anhydrides, fluorobenzenes, carbonates, NHS esters, imido esters, epoxides, fluorophenyl esters, phosphines, carboxylic acids, maleimides, haloacetyls (Br- / I-), pyridyl disulfides, thiosulfonates, vinyl sulfones, alkoxyamines, and hydrazides, and combinations thereof.

[0045] In one embodiment, the nanoparticles of step a of the method of the invention are provided in a solution. Alternatively, the nanoparticles may be provided in the form of a dry solid for dispersion in the solution prior to contacting with the sample.

[0046] Thus, a carefully tailored surface coating of the nanoparticles contains repulsive and attractive moieties (including detection probes) so that they repel each other and other surfaces, forming a stable dispersion, while being able to form specific attractive bonds with the detection target (DNA / RNA or antibody), resulting in the nanoparticles attaching and immobilizing on the detection target. Efficient attachment occurs when the repulsive forces are balanced by the attractive forces of the probes.

[0047] According to some embodiments, the linker comprises an anchor group that connects the coating to the nanoparticle and, optionally, a spacer group.

[0048] An anchor group that "tethers" the coating to the nanoparticle should be interpreted as the anchor group bonding the coating to the nanoparticle by a covalent or non-covalent bond.

[0049] According to some embodiments, one or more linkers can provide one or more detection probes X and / or functional groups Y, or multiple linkers can facilitate providing multiple detection probes and / or functional groups Y via an interconnected backbone.

[0050] This allows multiple combinations of linkers and detection probes X and / or functional groups Y to be used.

[0051] In one embodiment, the one or more fluorophores can be selected from the list provided in Table 3 herein.

[0052] According to some embodiments, the one or more fluorophores are selected from organic fluorophores selected from the list consisting of the BODIPY, Brilliant Violet, Cyanine, Alexa, Atto, fluorescin, coumarin, rhodamine, xanthene fluorophore families, and derivatives and combinations thereof.

[0053] For example, the one or more fluorophores are selected from organic fluorophores selected from the list consisting of Atto 425, Alex fluor 405, Alexa Fluor 488, fluorescein, DiO, Atto 488, Cy3, DiI, Alexa fluor 546, Atto 550, Cy5, Alexa fluor 647, Texas Red, DiD, Atto647(N), Atto 655, Cy7, Alexa fluor 680, Alexa fluor 750, Atto 680, Atto 700, BODIPY, Brilliant Violet, Cyanine, Alexa, Atto, fluorescein, coumarin, rhodamine, xanthene fluorophore families, and derivatives and combinations thereof.

[0054] According to some embodiments, the multiple fluorophores are selected from organic fluorophores selected from the list consisting of Atto 425, Cy3, Cy5, and Cy7, or combinations thereof, or inorganic fluorophores of different colors, wherein the inorganic fluorophores include or are selected from quantum dots, rods, perovskite quantum dots, or metal-ligand complexes.

[0055] The quantum dots may be semiconductor quantum dots, such as quantum dots that are alloys containing elements from groups III and V of the periodic table, or groups II and VI of the periodic table. Additionally, the quantum dots may be silicon quantum dots.

[0056] The term "rod" as used herein refers to an elongated particle having a length / width ratio not equal to one.

[0057] By using well-separated fluorophores with high photostability, high-quality incorporation of these fluorophores into nanoparticles can be achieved with minimal spectral overlap. Both factors are important for achieving a well-separated intensity distribution that acts as a unique barcode signature (i.e., optical signature) for each batch of nanoparticles (see Figures 4, 5, 6).

[0058] According to some embodiments, the multiple fluorophores are selected from a combination of different colored organic fluorophores and different colored inorganic fluorophores, where the inorganic fluorophores include quantum dots, rods, or perovskite quantum dots.

[0059] The use of nanoparticles as probes allows the possibility of combining a wider selection of fluorophores, especially for the case of semiconductor fluorophores such as quantum dots mentioned above. m This is important because in , the number of possible combinations is proportional to the number of colors used compared to the number of levels (distinguishable dye concentrations). With semiconductor fluorophores, it is possible to achieve both narrower emission spectra (enabling more colors in parallel before spectral overlap becomes an issue) as well as the ability to fit more colors within a spectrum, due to the possibility of having semiconductor fluorophores with very large Stokes shifts, along with organic fluorophores.

[0060] In one embodiment, the plurality of nanoparticles are silica nanoparticles, semiconductor nanoparticles, organic nanoparticles, inorganic nanoparticles, metallic nanoparticles, or polymeric nanoparticles, or a combination thereof.

[0061] In another embodiment, the nanoparticles have an average diameter of less than 1000 nm, such as 500 nm, or less than 300 nm, or less than 100 nm, such as between 3 and 300 nm, for example between 3 and 200 nm, 3 and 150 nm, or 3 and 100 nm.

[0062] Nanoparticle size can be measured by any method known in the art, such as transmission electron microscopy (TEM), scanning electron microscopy (SEM), size exclusion chromatography (SEC), or dynamic light scattering (DLS).

[0063] In another embodiment, the plurality of nanoparticles are porous nanoparticles, such as mesoporous nanoparticles. For example, the plurality of nanoparticles may be mesoporous silica nanoparticles.

[0064] In another embodiment, the plurality of nanoparticles are nanoparticles having a fluorophore embedded within a matrix.

[0065] According to some embodiments, the nanoparticles have at least one of the following characteristics: i. are spherical particles made of silica and / or semiconductor, organic, inorganic, metallic and / or polymeric materials; ii. have a diameter of less than 300 nm, preferably less than 200 nm, more preferably less than 100 nm, and even more preferably less than 50 nm.

[0066] Spherical silica particles are known in the art and are an alternative for use in the present invention. Polymeric and / or plastic nanoparticles can also be used.

[0067] The use of particles having a size of less than about 300 nm, preferably less than about 100 nm, ensures penetration into the cell and ensures that the method can be performed in situ: a smaller size is typically advantageous for the particles to bind to the detection target (after entering the cell).

[0068] To improve the accessibility of nanoparticles to target biomolecules in tissue samples and / or single cells, the latter can be locally permeabilized to allow the target biomolecules to locally diffuse into the 2D or 3D solid phase defined herein, where they are immobilized via physical adsorption, electrostatic, hybridization or affinity interactions. In this way, the target biomolecules are fully accessible without the tissue and / or cell matrix and spatial information can still be obtained.

[0069] According to some embodiments, prior to step c, the method of the present invention may include a step of preparing the target biomolecule for binding to the nanoparticles, e.g., binding the target biomolecule to at least one molecule including at least one detection target, and / or amplifying the detection target in situ. Optionally, in this step, the target biomolecule is prepared for subsequent amplification by binding it to at least one molecule, such as a barcoded nucleic acid, a padlock probe, or an initiator sequence.

[0070] This allows the NP probes to be used in assays where enzymatic amplification is omitted in order to generate stronger signals by binding multiple NPs to biomolecules, e.g., conventional in situ hybridization (ISH) methods where at least one, and preferably multiple, detection targets are bound to a biomolecule.

[0071] According to some embodiments, the detection target comprises a nucleic acid molecule that is amplified or facilitates the molecule being amplified using RCA or multiple hybridization events.

[0072] Thus, signal detection becomes easier and more robust by utilizing (i) higher signal intensity, (ii) the need for multiple binding events to generate the signal to avoid randomly immobilized nanoparticles, and (iii) the specificity of molecular tools such as padlocks to amplify targets and prevent non-targets from being amplified and thus detected. Similarly, other amplification methods can be achieved that utilize, for example, the binding of two or more detection targets in close proximity, allowing subsequent hybridization to generate a stronger but more specific signal.

[0073] According to some embodiments, the decoding is performed by optical decoding, such as by optical / fluorescence imaging.

[0074] Alternatively, decoding can be performed in a flow cytometry type device that can flow the sample through a narrow nozzle with dimensions comparable to the individual elements presenting the specific target biomolecule. The "individual elements" described herein can be single cells or microparticles. The microparticles can carry probes as defined herein to specifically immobilize the target molecules upon presentation to the encoded nanoparticles.

[0075] This allows high resolution spatial information to be collected at the throughput and resolution of the imaging system, allowing large areas to be scanned.

[0076] According to some embodiments, the target biomolecules are further co-labeled with small molecule dyes / probes along with the nanoparticles.

[0077] According to some embodiments, one or more molecular probes are further provided, each of which comprises a fluorophore that binds to a nucleic acid molecule, an antigen, or an antibody, providing binding affinity of the molecular probe to a specific detection target.

[0078] As used herein, the term "molecular probe" is referred to interchangeably as "detection oligo."

[0079] The fluorophore of the molecular probe can be any fluorophore, such as any of the fluorophores detailed herein.

[0080] This will further improve both robustness and multiplexing, and ensure that signal detection relies on both nanoparticle and molecular probe binding events, and non-specifically bound nanoparticles are excluded from data analysis. For example, co-localization analysis of nanoprobe and detection oligo signals can eliminate false positives from only nanoprobe and only detection oligo signals. This is useful both in situ and ex situ, both within and outside tissue. In addition, this can be further utilized to increase multiplexing capabilities by introducing fluorophores of different colors that act as molecular probes.

[0081] According to a second aspect, the invention relates to a kit of parts, which comprises, in separate containers: (i) a plurality of nanoparticle types comprising a plurality of nanoparticles, each nanoparticle comprising a plurality of fluorophores that generate a signal that is unique to each nanoparticle type; (ii) a probe buffer comprising a solution having a controlled pH, salt concentration, and additives that promote specific detection target binding of the nanoparticles; (iii) instructions for using the kit in a method according to the invention.

[0082] In one embodiment, the nanoparticles of each nanoparticle type comprise a coating configured to conjugate to one or more detection probes X and / or one or more functional groups Y.

[0083] The detection probe X and functional group Y may be any of the probes or groups detailed herein in relation to the methods of the invention.

[0084] In another embodiment, the nanoparticle coating may include a plurality of linkers having conjugate groups configured for conjugation to the detection probes X and / or functional groups Y.

[0085] In another embodiment, the nanoparticle coating may comprise a plurality of linkers having conjugate groups conjugated to the detection probes X and / or functional groups Y.

[0086] In another embodiment, each nanoparticle type has a coating that provides binding affinity of the nanoparticle for a specific detection target.

[0087] In a particular embodiment of the second aspect of the invention, the kit of parts comprises, in separate containers: (i) one or more types of nanoparticles in suspension, each nanoparticle type having a coating that provides binding affinity of the nanoparticle for a specific detection target, and each nanoparticle containing one or more fluorophores that generate a signal that is unique to each nanoparticle type; Optionally, nanoparticles of each type in suspension, each nanoparticle type having a coating without binding affinity of the nanoparticles to a specific detection target, the binding affinity being provided in a next step by a detection probe X attached to the nanoparticles via a linker, the detection probe X being selected from a nucleic acid molecule, an antigen, or an antibody; (ii) optionally, components for providing one or more nanoparticle types with binding affinity for a specific detection target, including a reaction buffer to facilitate binding of detection probe X to the linker, a wash buffer, and a suspension buffer for suspending the nanoparticles after incorporation of the binding affinity into the coating; (iii) a probe buffer comprising a solution having a controlled pH, salt concentration, and additives that promote specific detection target binding of the nanoparticles; (iv) instructions for using the kit in the method according to the first aspect of the invention.

[0088] For the avoidance of doubt, the nanoparticle type of the second aspect of the invention may comprise any of the features of the nanoparticle type of the first aspect of the invention.

[0089] In a third aspect of the invention, a nanoparticle comprising a plurality of fluorophores is provided, the nanoparticle being coated with at least one conjugation group configured for conjugation to a detection probe.

[0090] The nanoparticles may have any of the nanoparticle characteristics for any of the "nanoparticle types" disclosed herein with respect to the first and second aspects of the invention.

[0091] Among the advantages and unexpected effects of the present invention, the following can therefore also be disclosed: • One-step sequencing versus multiple steps saves experimental and imaging time. ●The fewer number of steps, the lower the costs. • The method of the present invention is less susceptible to handling errors such as sample integrity and other risks of failure during the sequencing procedure. - The present invention allows for easier data analysis since it is a set of images instead of multiple images that require alignment. The present invention can be used with simple hardware setup by regularly trained lab personnel. - The present invention does not require a fluid solution for repeated chemical / imaging steps. • The present invention can lower the barrier for adopting in situ methods in conventional laboratories lacking advanced facilities and instrumentation. - The present invention can be used in multiple applications requiring detection / identification of localized signals.

[0092] The present disclosure will become apparent from the following detailed description. The detailed description and specific examples disclose preferred embodiments of the present disclosure for illustrative purposes only. Those skilled in the art will appreciate that, from the guidance of the detailed description, changes and modifications can be made within the scope of the present disclosure. Thus, it should be understood that the disclosure disclosed herein is not limited to the specific components of the described devices or steps of the described methods, since such devices and methods may vary. It should also be understood that the terms used herein are for the purpose of describing particular aspects only, and are not intended to be limiting. It should be noted that, as used in the specification and the appended claims, the articles "a," "an," "the," and "said" are intended to mean that there is one or more elements, unless the context clearly dictates otherwise. Thus, for example, reference to "a unit" or "the unit" may include several devices, and the like. Furthermore, the words "comprising," "including," "containing," and similar terms do not exclude other elements or steps.

[0093] For the avoidance of doubt, unless otherwise specified, it is intended that the above embodiments can be combined with the embodiments of the following detailed description where reasonably plausible.

[0094] The above objects, as well as additional objects, features, and advantages of the present disclosure, will be more fully understood by reference to the following illustrative and non-limiting detailed description of exemplary embodiments of the present disclosure in connection with the accompanying drawings. [Brief description of the drawings]

[0095] [Figure 1]Illustrating the principles of the present invention, (a) shows a situation where one or more nanoparticles (NR) have binding affinity to bind to a specific detection target in a target biomolecule (rotation circle product (RCP)), and (b) shows a situation where the nanoparticles lack binding affinity to the target biomolecule (i.e., no specific detection target for the nanoparticles is present in the biomolecule). [Diagram 2] 1 shows a main scheme for the preparation of a target biomolecule of the present invention ("Target Prep IP"). [Diagram 3] FIG. 2 shows the principle of coating nanoparticles by the method of the present invention ("IP Coating Details"). [Figure 4A] The principle of optical encoding / decoding is shown with three nanoparticle types, each with a unique optical encoding based on ratiometric control of wavelength and intensity. The spheres represent the nanoparticle types with incorporated fluorophores, labeled AC inside the sphere. A coating is established on the nanoparticle surface, and binding affinity is provided by detection probe AC. Decoding is performed by measuring the wavelength and intensity emitted by the nanoparticles, and ratiometric decoding is shown for nanoparticle types A, B, and C (1:3:3), (1:0:2), and (3:3:0), respectively. [Figure 4B] The principle of optical encoding / decoding is shown with three nanoparticle types, each with a unique optical encoding based on ratiometric control of wavelength and intensity. The spheres represent the nanoparticle types with incorporated fluorophores, labeled AC inside the sphere. A coating is established on the nanoparticle surface, and binding affinity is provided by detection probe AC. Decoding is performed by measuring the wavelength and intensity emitted by the nanoparticles, and ratiometric decoding is shown for nanoparticle types A, B, and C (1:3:3), (1:0:2), and (3:3:0), respectively. [Figure 4C]The principle of optical encoding / decoding is shown with three nanoparticle types, each with a unique optical encoding based on ratiometric control of wavelength and intensity. The spheres represent the nanoparticle types with incorporated fluorophores, labeled AC inside the sphere. A coating is established on the nanoparticle surface, and binding affinity is provided by detection probe AC. Decoding is performed by measuring the wavelength and intensity emitted by the nanoparticles, and ratiometric decoding is shown for nanoparticle types A, B, and C (1:3:3), (1:0:2), and (3:3:0), respectively. [Diagram 5] Overlapping emission spectra of three wavelengths (fluorophores) and three intensity levels are shown. [Figure 6] Simulated ratiometric XY plot of intensity distribution and intensity distribution imperfections with size for a multiplexed system with n=30 populations with three wavelengths (fluorophores Cy3 / Cy5 / Cy7) and three intensity levels (relative 0-1-2). [Figure 7] 1 is a simulated 3D plot showing the average ratiometric values ​​of the population of each nanoparticle type for a 26-plex system with three wavelengths (fluorophores Cy3 / Cy5 / Cy7) and three intensity levels (relative 0-1-2). [Figure 8] We disclose the fluorescence intensities measured for batches of 11 different NP types produced with precise control over dye incorporation, demonstrating the realization of optical encoding of nanoparticles. [Figure 9] Demonstrating the specificity of the probing properties of the nanoparticle coating, (A) NPs that specifically bind to complementary detection targets on biomolecules (RCPs) and (B) NPs that do not bind non-complementary targets are disclosed. [Figure 10](A) Two-color coded NPs conjugated (i.e., co-labeled) to a biomolecule (RCP) along with a molecular probe. (B) Line profiles show the emitted signals in each channel (Cy3 and Atto 425 from NPs, and Cy7 from the molecular probe). (C) Each channel is shown for one imaged RCP. (D) XY plot of intensity distribution of decoded NP signals from several RCPs representing specific nanoparticle types. [Figure 11] The binding of NPs to amplified biomolecules (RCPs) within cells is shown, demonstrating the effect of in situ detection of biomolecules using NPs. [Figure 12] 2 shows a specific embodiment of coated silica nanoparticles. [Figure 13] 1 shows the absolute luminescence of a 7-plex system according to the present invention. [Figure 14] 1 shows an emission map of a 7-plex system according to the present invention. [Figure 15] 1 shows optical images and corresponding diagrams of coated vs. uncoated nanoparticles in solution. [Figure 16] 1 shows a batch-to-batch titration of Cy3 and Cy5 fluorophore incorporation in a 7-plex system. [Figure 17] Shown is 2-plex coding using detection oligos (molecular probes), where targets 1-7 are differentiated by code 1 (AF750) and targets 8-14 by code 2 (Atto425). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0096] definition The term "binding" to a target biomolecule, nanoparticle, and / or detection target should be construed to include the alternative of "hybridization" of nucleic acid molecules to one another.

[0097] The term "optical encoding" is to be construed as imparting a unique signal to a particle by incorporating a combination of fluorophores of multiple wavelengths and intensities. For example, a unique signal can be achieved by incorporating a predetermined amount of at least one fluorophore into and / or onto a nanoparticle, thereby arriving at a nanoparticle type that exhibits a specific emission wavelength and intensity.

[0098] For the avoidance of doubt, optical encoding may be achieved by incorporation of one or more fluorophores into the nanoparticles.

[0099] The term "nanoparticle type" should be construed as a nanoparticle having a coating that provides binding affinity to a specific detection target and a unique optical signature. Multiple (e.g., at least two) nanoparticle types can be used in accordance with the present invention, with the various types having binding affinities for different targets. Each nanoparticle type is represented by multiple nanoparticles having the same coating and optical signature.

[0100] As used herein, the term "nanoparticle" is also referred to interchangeably with the abbreviation "NP."

[0101] Certain aspects of the present disclosure will now be described in more detail. However, the present disclosure may be embodied in other forms and should not be construed as being limited to the embodiments disclosed herein. The disclosed embodiments are provided so that the scope of the disclosure will be fully conveyed to those skilled in the art.

[0102] A first aspect of the present invention provides a method for multiplex detection of a plurality of target biomolecules using optical encoding, each target biomolecule having at least one detection target, the method comprising: a. providing a plurality of nanoparticle types comprising a plurality of nanoparticles, each nanoparticle having a coating that provides binding affinity of the nanoparticle for a type-specific detection target, each nanoparticle comprising a plurality of fluorophores that generate a signal that is unique to each nanoparticle type; b. providing a sample containing a plurality of target biomolecules; c. contacting the sample with a plurality of nanoparticle types, thereby allowing the nanoparticles to bind to detection targets of the target biomolecules; d. Detection of target biomolecules. Optically reading the fluorophore signal emitted by the nanoparticles of the nanoparticle type bound to the target by measuring the wavelength and intensity of the emitted signal, thereby detecting the presence and identity of the target biomolecule.

[0103] In another aspect of the invention, a method is provided for the multiplexed detection of one or more target biomolecules in situ using optical encoding, each target biomolecule having at least one detection target, the method comprising the steps of: a. providing one or more nanoparticles in suspension, each nanoparticle having a coating that provides binding affinity of the nanoparticle for a specific detection target, each nanoparticle comprising a plurality of fluorophores that generate a signal that is unique to each nanoparticle type; b. providing one or more cells permeated by the nanoparticles, the cells comprising one or more target biomolecules; and c. Optionally, the method may include the steps of: binding the target biomolecule to the nanoparticles, e.g. preparing the target biomolecule for binding to a molecule comprising the detection target and / or amplifying the detection target in situ; d. contacting the cells with a suspension comprising the nanoparticles, thereby allowing the nanoparticles to permeate the cells and bind to the detection target of the target biomolecule; and e. optically decoding the signal emitted by the fluorophore of the nanoparticles hybridized to the detection target of the target biomolecule by measuring the wavelength and intensity of the emitted signal, thereby detecting the presence and identity of the target biomolecule.

[0104] Figure 1 shows the principle of the method. Figure 2 shows the principle for preparing targets for multiplex detection.

[0105] coating FIG. 3 shows some alternatives for the coating of the nanoparticles of the present invention.

[0106] The binding affinity of the coating may be provided by a detection probe X attached to the nanoparticle via a linker, where detection probe X is selected from a nucleic acid molecule, an antigen, or an antibody.

[0107] The coating may further comprise a repulsive component provided by a functional group Y attached to the nanoparticle via a linker, the functional group Y being selected from a charged group having a positive or negative charge, a zwitterionic group containing both positive and negative charges, or a sterically repulsive functional group such as a polymeric or aliphatic chain.

[0108] The linker may also include an anchor group A and, optionally, a spacer group S, which connects the coating to the nanoparticle.

[0109] Depending on the surface of the nanoparticle, see Table 1 for examples of anchor groups and functional groups Y. For examples of spacer groups, see Table 2. Any of these groups may be used in the context of any aspect of the invention described herein. [Table 1-1] [Table 1-2] [Table 2]

[0110] One or more linkers can facilitate one or more detection probes X and / or functional groups Y, or multiple linkers can facilitate multiple detection probes and / or functional groups Y through an interconnected backbone. For example, a polymer chain having functional groups incorporated into the monomers such that multiple anchors and functional groups for linking to detection probes are incorporated into the chain, allowing the chain to be oriented and attached to the nanoparticle surface using its anchor groups, and further modified with detection probes using linkers that form bonds with the remaining functional groups.

[0111] Fluorophores The one or more fluorophores may be selected from the alternatives provided in Table 3 and derivatives thereof. [Table 3-1] [Table 3-2] [Table 3-3]

[0112] Nanoparticles The nanoparticles may satisfy the following properties: The size of the nanoparticles must be small enough to allow them to penetrate cell membranes, ie typically with a diameter of less than 100 nm. The coating of the nanoparticles may allow specific targeting of the nanoparticles to the detection target of interest, and it may be important and / or advantageous for the coating to be such that aggregation is avoided by adjusting the repulsive forces of the coating (e.g. cationic, anionic, zwitterionic or steric repulsive forces) and / or by modifying the buffer formulation used during binding to the detection target. - The plexing capacity of the nanoparticles is important. Preferably, more than 50 and up to 100 or more different codes should be detectable. Therefore, the problems of quenching, dye stability, and level discrimination need to be solved. Carefully designing the nanoparticle structure, and optionally using the size to further incorporate both organic and inorganic dyes, and the possibility to further modify the nanoparticle matrix and structure can increase the stability of the dyes as well as increase the flexibility of the combination of different fluorophores that can work in sync to generate advanced optical coding. However, for the avoidance of doubt, plexing will be achieved so long as at least two nanoparticle types are used, for example, plexing may be achieved with at least 3, 4, 5, 6, 7, 8, 9, or 10 nanoparticle types. - Guidance on the synthesis of nanoparticles with suitable size, coating, and fluorophore content for use according to the invention can be found in the art, such as Wang et al. (Nanoletters, 2005;5:1(37-43)). The examples also provide detailed guidance on how to synthesize nanoparticles for use in the present invention.

[0113] Preparation of target biomolecules In the methods of the present invention, a target biomolecule can be prepared by attaching it to a molecule, which includes a detection target such as a barcoded padlock probe or initiator sequence for HCR or other amplification methods.

[0114] The detection target can be a nucleic acid molecule or a protein that is amplified using the methods listed in Table 4. [Table 4]

[0115] Optical Encoding and Decoding Optical encoding may be achieved by incorporating multiple fluorophores (e.g., of different wavelengths) in precisely controlled ratios (intensities) such that each combination of wavelength / intensity ratio is uniquely separable upon decoding, thereby optically encoding each nanoparticle type. Different ratios of intensities can be achieved by (i) controlling the concentration of fluorophores in the nanoparticles and / or (ii) modifying the size or optical properties of the fluorophores to control their emission intensity, thereby achieving a ratiometric readout. It is understood that fluorophores incorporated into a nanoparticle may also be encapsulated by its matrix and located on the surface of the nanoparticle.

[0116] Furthermore, each nanoparticle type is endowed with a unique binding affinity through its coating, enabling it to recognize a unique detection target.

[0117] Decoding can be done by optical decoding, such as by optical imaging of the fluorophore signals. The signal from each nanoparticle type can be identified by measuring wavelength and intensity to ratiometrically identify the optical code embedded in the nanoparticle type, as shown in FIG.

[0118] The target biomolecules can be further co-labeled with small molecule probes (containing their own fluorophores) along with the nanoparticles. This improves the robustness of the assay by introducing a control signal that indicates where specific binding occurs between the nanoparticle and the biomolecule detection target, and also introduces another dimension to the optical encoding, allowing a higher degree of multiplexing by combining the signal emitted from the nanoparticle with the signal emitted from the biomolecule. Thus, the identity of the biomolecule can be determined by extending the number of wavelengths (fluorophore signals) emitted by the nanoparticle-biomolecule complex by using optically encoded nanoparticles, for example by co-labeling with a probe containing a molecular fluorophore, along with additional encoding of the biomolecule with a non-nanoparticle probe.

[0119] Specific embodiments of the present invention Particular embodiments of the present invention are provided in the following paragraphs.

[0120] In one embodiment of the present invention, a method is provided for the multiplexed detection of one or more target biomolecules in situ using optical encoding, each target biomolecule having at least one detection target, the method comprising: a. providing one or more nanoparticle types in a suspension, each nanoparticle having a coating that provides binding affinity of the nanoparticle for a type-specific detection target, and each nanoparticle containing one or more fluorophores that generate a signal that is unique to each nanoparticle type; b. providing one or more cells permeabilized by nanoparticles, the cells comprising one or more target biomolecules; c. Optionally, preparing the target biomolecule for binding to the nanoparticles, e.g., binding the target biomolecule to at least one molecule comprising at least one detection target, and / or amplifying the detection target in situ; d. contacting the cells with a suspension containing nanoparticles, thereby allowing the nanoparticles to penetrate the cells and bind to the detection targets of the target biomolecules; e. Detection of target biomolecules. Optically reading the fluorophore signal emitted by the nanoparticles of the nanoparticle type bound to the target by measuring the wavelength and intensity of the emitted signal, thereby detecting the presence and identity of the target biomolecule.

[0121] Preferably, each nanoparticle type is optically encoded by either (i) incorporating a precisely controlled ratio of at least one fluorophore, thereby controlling the emission wavelength and intensity from the nanoparticle type, or (ii) modifying a property of a fluorophore that affects its emission intensity.

[0122] Advantageously, the binding affinity of the nanoparticle-type coating is provided by a detection probe X attached to the nanoparticle via a linker, the detection probe X being chosen from a nucleic acid molecule, an antigen or an antibody.

[0123] Advantageously, the nanoparticle coating further comprises a repulsive component provided by a functional group Y attached to the nanoparticle via a linker, the functional group Y being selected from a charged group having a positive or negative charge, a zwitterionic group which contains both positive and negative charges, or a sterically repulsive functional group such as a polymeric or aliphatic chain.

[0124] Preferably, the linker comprises at least one anchor group that connects the coating to the nanoparticle, and optionally a spacer group.

[0125] Advantageously, one or more linkers can provide one or more detection probes X and / or functional groups Y, or multiple linkers can provide multiple detection probes X and / or functional groups Y via an interconnected backbone.

[0126] Conveniently, the one or more fluorophores are selected from: (i) an organic fluorophore selected from Atto 425, Cy3, Cy5, and Cy7; (ii) inorganic fluorophores of different colors, where the inorganic fluorophores include quantum dots, rods, perovskite quantum dots, or metal-ligand complexes; and / or (iii) A combination of organic fluorophores of different colors and inorganic fluorophores of different colors, where the inorganic fluorophores include quantum dots, rods, or perovskite quantum dots.

[0127] Preferably, the nanoparticles have at least one of the following characteristics: i. It is a spherical particle made of silica and / or semiconductor, organic, inorganic, metallic and / or polymeric material; ii. It has a diameter of less than 300 nm, preferably less than 200 nm, more preferably less than 100 nm, even more preferably less than 50 nm.

[0128] Advantageously, in step c, the target biomolecule is prepared for subsequent amplification by attaching to it at least one molecule comprising a detection target, such as a barcoded nucleic acid, a padlock probe or an initiator sequence.

[0129] Conveniently, the detection target comprises a nucleic acid molecule that is amplified, or facilitates the amplified molecule, using RCA or multiple hybridization events.

[0130] Preferably, the decoding is performed by optical decoding, such as by optical imaging.

[0131] Advantageously, the method further comprises the step of providing one or more molecular probes, each of which comprises a fluorophore that binds to a nucleic acid molecule, an antigen, or an antibody, providing binding affinity of the molecular probe to a specific detection target.

[0132] In another aspect of the invention, a kit of parts is provided, comprising in separate containers: (i) one or more types of nanoparticles in suspension, each nanoparticle type having a coating that provides binding affinity of the nanoparticle for a specific detection target, and each nanoparticle containing one or more fluorophores that generate a signal that is unique to each nanoparticle type; Optionally, nanoparticles of each type in suspension, each nanoparticle type having a coating without binding affinity of the nanoparticles to a specific detection target, the binding affinity being provided in a next step by a detection probe X attached to the nanoparticles via a linker, the detection probe X being selected from a nucleic acid molecule, an antigen, or an antibody; (ii) optionally, components for providing one or more nanoparticle types with binding affinity for a specific detection target, including a reaction buffer to facilitate binding of detection probe X to the linker, a wash buffer, and a suspension buffer for suspending the nanoparticles after incorporation of the binding affinity into the coating; (iii) a probe buffer comprising a solution having a controlled pH, salt concentration, and additives that promote specific detection target binding of the nanoparticles; (iv) instructions for using the kit in a method according to any of the above paragraphs in the section entitled "Specific Embodiments of the Invention."

[0133] Those skilled in the art will understand that the present disclosure is not limited to the above-described preferred embodiments. Those skilled in the art will further understand that modifications and variations are possible within the scope of the appended claims. Furthermore, variations to the disclosed embodiments can be understood and made by those skilled in the art when practicing the claimed disclosure, from a study of the drawings, the disclosure, and the appended claims.

[0134] array SEQ ID NO:1 TTTTTTTTTTCCTCAGTAATAGTGTCTTAC SEQ ID NO:2 TTACACCCTTTCTTTGACAA GTGTATGCAGCTCCTCAGTAATAGTGTCTT TGTGCGTCTATTTAGTGGAGCC CATG GACTGTTACTGAGCTGCGTT SEQ ID NO:3 TTGTCAAAGAAAGGGTGTAAACGCAGCTCAGTAACAGTC SEQ ID NO:4 TGCGTCTATTTAGTGGAGCC SEQ ID NO:5 DBCO Oligo (SARS-COV-2) 5'-DBCO-TTTTTTTTTTTTCCTCAGTAATAGTGTCTTAC-3' SEQ ID NO:6 DBCO Oligo (HIV) 5'-DBCO-TTTTTTTTTTGCGTCTATTTAGTGGAGCC-3' SEQ ID NO:7 Synthetic target HIV 5'-CTCTCTCTCTCTATACTATATGTTTTAGTTTATATTGTTTCTTTCCCCCTGGCCTTAACCGAATTTTTT CCCATTTATCTAATTCTCCCCCGCT-3' SEQ ID NO:8 Synthetic target SARS-COV-2 [ka] SEQ ID NO:9 Padlock Probe HIV 5'-PO4-AAGGCCAGGGGGAAAG AGTAGCCGTGACTATCGACT TGCGTCTATTTAGTGGAGCC TTAAATGGGAAAAAATTCGGTT-3' SEQ ID NO:10 Padlock Probe SARS-COV-2 5'-PO4-TGTTGTAGCTTGTCACACCGGTGTATGCAGCTCCTCAGTAATAGTGTCTTACGGCATCACTGGTTACGTCTGTTGCTCGCAAACATACAACG-3' SEQ ID NO:11 AF750-Detection Oligo (SARS-COV-2) 5'-TCCTCAGTAATAGTGTCTTACTTTT-AF750-3' SEQ ID NO:12 Atto425-detection oligo 5'-Atto425-CCTCAGTAATAGTGTCTTAC-3' EXAMPLES

[0135] List of abbreviations: NP: Nanoparticles EtOH: Ethanol PBS: Phosphate-buffered saline DEPC: Treated diethylpyrocarbonate RCA: Rolling Circle Amplification RCP: rolling circle product, result of rolling circle amplification BSA: bovine serum albumin dNTP: deoxyribonucleotide triphosphate ATP: Adenosine triphosphate PEG: Polyethylene glycol SSC: Saline sodium citrate EDTA: Ethylenediaminetetraacetic acid

[0136] Example 1 - Suspension Conditions To carry out the claimed method, the suspension conditions in which the method is carried out may have the following component ingredients and characteristics:

[0137] Suspension conditions can be controlled to promote specific binding of nanoparticles to detection targets over non-specific binding to other targets or non-targets (such as other biological materials / matrices or surfaces) while maintaining the stability of the nanoparticle dispersion.

[0138] The following components play important roles in optimizing NP binding to target biomolecules: [Table 5]

[0139] In one embodiment, the following conditions were used: SSC 2X Formamide 20% PEG4000 5% pH 7~7.4

[0140] In another embodiment, the following conditions were used: SSC 1X Formamide 10% PEG4000 5% pH 7~7.4

[0141] Example 2 - Use of the method for multiplexed detection [Table 6]

[0142] In one embodiment, NP surface coating was performed by adding 100 μL of NPs (loaded with 125 mM Si, 0.62 uM Cy3) to a solution of HO (485 μL), followed by the addition of 11-azidoundecyltriethoxysilane (2.5 μL, 256 mM), mPEG5k-triethoxysilane, (10 μL, 20 mM), and finally ammonium hydroxide (2 μL, 28-30%). The temperature was increased to 75 °C and the reaction mixture was shaken. After 3 h, the reaction mixture was washed three times with HO, once with PBS, and by centrifugation. The coated NPs were stored in 100 μL of HO.

[0143] To EtOH (50 μL), the above coated NPs (30 μL) were added, followed by PBS (20 μL) and DBCO-modified nucleotide sequence S04018 (3 μL, 100 uM). The temperature was raised to 37° C. while shaking. After 19 h, the reaction mixture was washed three times with HO by centrifugation. The sequence-functionalized NPs were stored in 100 μL of HO.

[0144] In one embodiment, the RCP was prepared in solution by adding 5'-phosphorylated padlock probe S03625 (1 μL, 1 uM) to a solution of HO (71.9 μL), phi29 reaction buffer (10 μL, 10X), T4 ligase (0.4 μL, 5 U / μL), BSA (10 μL, 2 μg / μL), ATP (2.7 μL, 25 mM), followed by target sequence S03844 (4 μL, 30 nM). The temperature was raised to 37° C. for 30 minutes. From this, 20 μL (initially diluted 1:1000) was added to HO (9.2 μL), followed by BSA (4 μL, 2 μg / μL), dNTPs (2 μL, 2.5 mM), phi 29 reaction buffer (4 μL, 10X), and phi 29 polymerase (0.8 μL, 10 U / μL). The temperature was increased to 30° C. for 2 hours, followed by an increase to 65° C. for 5 minutes.

[0145] In one embodiment, NP binding to RCP was performed by first immobilizing 5 μL of RCP on a Superfrost Plus slide (Thermo Scientific) by deposition. The ongoing reaction was performed with a Secure-seal (Grace Bio-Labs, 9 mm diameter, 0.8 mm depth) attached to the slide. The hybridization mixture was prepared by adding NP (5 μL) to a solution of SSC (5 μL, 20X), formamide (10 μL), H2O (24.5 μL), PEG4000 (5 μL, 50%), followed by the addition of complementary detection oligo S03798-Cy5 (control probe). The hybridization mixture was added to the immobilized RCP and the temperature was increased to 37°C. After 1 h, the glass slides were washed four times with PBS-T (DEPC-PBS containing 0.05% Tween-20), once with 70% EtOH, once with 85% EtOH, and finally with 99.5% EtOH.

[0146] In one embodiment, RCP generation was performed in situ instead of in solution. Cells were seeded on Superfrost Plus slides (Thermo Scientific). When the cells reached the desired confluency, they were fixed with paraformaldehyde (3% (w / v)) in PBS at room temperature. After 30 min, the slides were washed twice with DEPC-PBS, once with 70% EtOH, once with 85% EtOH, and finally with 99.5% EtOH for 3 min each. The reaction was performed with a Secure-seal (Grace Bio-Labs, 9 mm diameter, 0.8 mm depth) attached to the slide. To make the RNA more readily accessible for cDNA synthesis, 0.1 M HCl was applied to the cells for 10 min at room temperature. This was followed by two washes with DEPC-PBS.

[0147] Reverse transcription was performed by adding a mixture of DEPC-HO (34.75 μL), TranscriptMe buffer (5 μL, 10X), dNTPs (1 μL, 25 mM), BSA (0.5 μL, 20 μg / μL), random decamers (2.5 μL, 100 uM), RiboLock RNase inhibitor (Fermentas) (1.25 μL, 40 U / μL) and reverse transcriptase (5 μL, 200 U / μL) to the cells and the temperature was raised to 37°C. After 18 hours, the reaction mixture was removed and formaldehyde (3% (w / v)) was added. After 30 minutes, the cells were washed twice with PBS-T.

[0148] Ligation was performed by adding a mixture of DEPC-H2O (22 μL), Ampligase buffer (20 mM Tris-HCl, pH 8.3, 25 mM KCl, 10 mM MgCl2, 0.5 mM NAD, and 0.01% Triton X-100), (5 μL, 10X), KCl (2.5 μL, 1M), formamide (10 μL), padlock probe (1 μL, 0.5 uM), BSA (0.5 μL, 20 μg / μL), Ampligase (5 μL, 5 U / μL), and RNase H (4 μL, 5 U / μL) to the cells and the temperature was increased to 37° C. for 30 min and then increased to 45° C. After 1 h, the cells were washed twice with PBS-T.

[0149] RCA was performed by adding a mixture of DEPC-HO (33 μL), Phi-29 buffer (5 μL, 10X), glycerol (5 μL, 50%), dNTPs (0.5 μL, 25 mM), BSA (0.5 μL, 20 μg / μL), Exonuclease I (1 μL, 20 U / μL), and Phi-29 polymerase (5 μL, 10 U / μL) to the cells and increasing the temperature to 37 °C. After 4 h, the cells were washed twice with PBS-T. Subsequent binding of NPs and control probes was performed as described above, as were the RCPs placed on the slides.

[0150] In one embodiment, image acquisition was performed using an Axioplan II epifluorescence microscope (Zeiss) equipped with a 100W mercury lamp, a CCD camera (C4742-95, Hamamatsu), and a computer-controlled filter wheel with excitation and emission filters for visualizing 425, DAPI, FITC, Cy3, Cy3.5, Cy5, and Cy7. Objectives of x20 (Plan-Apocromat, Zeiss), x40 (Plan-Neofluar, Zeiss), or x63 (Plan-Neofluar, Zeiss) were used to capture images.

[0151] Example 3 - Synthesis of nanoparticles material Cyanine 3 NHS ester (Cy3-NHS), Cyanine 5 NHS ester (Cy5-NHS) were purchased from Lumiprobe GmbH, Germany. Dimethyl sulfoxide (DMSO) (≥ 99.9%), tetrahydrofuran (THF (99%), (3-aminopropyl) triethoxysilane (APTES), ammonium hydroxide (NH4OH) (28% NH3 in H2O, ≥ 99.99%), tetraethyl orthosilicate (TEOS) (99.999%), 11-azidoundecyltriethoxysilane (97%), ADIBO-PEG4-acid (90%) were purchased from Sigma Aldrich, Sweden. Absolute ethanol (≥ 99.8%) was purchased from VWR, Sweden. Ultrapure MilliQ water used was from a MilliQ (IQ7010) system.

[0152] Fluorophore Stock Fluorophore stock solutions were prepared by adding 1 ml of DMSO to 1 mg of each fluorophore.

[0153] Optically Encoded Nanoparticle Libraries Encoded NPs were synthesized by adding [0, 0.8, 1.6, 3.2, 6.4] μl of either Cy3-NHS, Cy5-NHS, or Cy7-NHS to 4 μL of APTES solution, respectively, and increasing the temperature to 37° C. while stirring or shaking. APTES solution was first prepared by adding 10 μl of APTES to 990 μl of EtOH. For example, to generate a batch of nanoparticle types encoding [8, 16, 0], 0.8 μL of Cy3-NHS, 1.6 μL of Cy5-NHS, and 0 μL of Cy7-NHS were added. In this way, any combination can be made, for example using 3 colors and 5 levels, following the example above. After 10 min, 38 μl of H2O was added, followed by EtOH, and the temperature was increased to 55° C. The amount of EtOH was set to reach a final reaction volume of 1 mL after the next addition, and under vigorous stirring, 54 μl of NH4OH was added, followed by 38 μl of TEOS. After 2 h, the NPs were washed by centrifugation three times with EtOH. The NPs were then redispersed in 1 mL of EtOH and stored at 4 °C until further use.

[0154] The resulting nanoparticles had an average diameter size of 66 nm as measured by SEM and 75 nm as measured by DLS.

[0155] In one embodiment, a 7-plex encoded NP system was synthesized using the above method with codes (32:0, 32:8, 32:16, 32:32, 16:32, 8:32, 0:32).

[0156] In another embodiment, a 15-plex encoded NP system was synthesized using the above method with the following codes: (8:0:16, 16:0:16, 32:0:16, 0:8:16.8:8:16, 16:8:16, 32:8:16, 0:16:16, 8:16:16, 16:16:16, 32:16:16, 0:32:16, 8:32:16, 16:32:16, 32:32:16).

[0157] The absolute emission of the 7-plex system is shown in FIG. 13 and the corresponding emission map of the 7-plex system is shown in FIG.

[0158] Nanoparticle Coating FIG. 3 shows a general schematic diagram for coating nanoparticles.

[0159] NP surface functionalization was performed by adding 100 μL of NPs (175 mM Si) to ethanol (248.5 μL) followed by HO (226.5 μL). To this, ammonium hydroxide solution (20 μL, 2.8%, diluted 1:10 with EtOH) was added. Finally, 11-azidoundecyltriethoxysilane (10 μL, diluted 1:4 with THF) was added and the temperature was raised to 37 °C under stirring. After 18 h, the NPs were washed by centrifugation three times with THF. The N3-NPs were then redispersed in 100 μL of THF and stored at 4 °C until further use.

[0160] The above functionalized N3-NPs (50 μL) were added to HO (112.6 μL) followed by DBCO modified oligo (4 μL, 100 μM, SEQ ID NO:5). The temperature was raised to 37° C. After 1 h, ADIBO-PEG4-acid (1.1 μL, 420 mM) was added. After 2 h, the NPs were washed by centrifugation three times using EtOH. The NPs were then redispersed in 50 μL of EtOH and stored at 4° C. until further use.

[0161] In another embodiment, the above functionalized N3-NPs (50 μL) were added to HO (112.6 μL), followed by DBCO-modified oligo (4 μL, 100 μM, SEQ ID NO: 5) and ADIBO-PEG4-acid (0.3 μL, 115 mM). After 5 hours, the NPs were washed three times with EtOH by centrifugation. The NPs were then redispersed in 50 μL of EtOH and stored at 4° C. until further use.

[0162] FIG. 12 is a schematic diagram of the overall nanoparticle achieved at this step.

[0163] In another embodiment, NP surface functionalization was performed by adding 100 μL of NPs (175 mM Si) to HO (448 μL). To this was added ammonium hydroxide solution (2 μL, 28%) followed by mPEG5k-triethoxysilane (45 μL, 20 mM in HO) and N3-PEG5k-triethoxysilane (5 μL, 10 mM in HO). The temperature was increased to 75° C. while stirring or shaking. After 18 h, the NPs were washed by centrifugation three times with HO. The PEG-NPs were then redispersed in 100 μL of HO and stored at 4° C. until further use.

[0164] In another embodiment, NP surface functionalization was performed by adding 100 μL of NPs (175 mM Si) to HO (448 μL). To this was added ammonium hydroxide solution (2 μL, 28%) followed by mPEG2k-triethoxysilane (45 μL, 20 mM in HO) and N3-PEG5k-triethoxysilane (5 μL, 10 mM in HO). The temperature was increased to 75° C. while stirring or shaking. After 18 h, the NPs were washed by centrifugation three times with HO. The PEG-NPs were then redispersed in 100 μL of HO and stored at 4° C. until further use.

[0165] The functionalized PEG-NPs (30 μL) were added to HO (5 μL) followed by DBCO-modified oligo (5 μL, 100 μM, SEQ ID NO:5). The temperature was raised to 37° C. After 18 hours, the NPs were washed by centrifugation three times with HO. The NPs were then redispersed in 300 μL of HO and stored at 4° C. until use.

[0166] What was particularly surprising was that the use of PEG chains of 4000 Da or greater provided stability to the nanoparticle dispersion but did not allow the oligos to bind to the target sites, however, when short PEG4 chains were used, stability was maintained and the oligos were able to bind to the target sites.

[0167] Figure 15 shows how nanoparticles aggregate and go out of solution if they have a coating that does not require the requisite stability, whereas if the coating is adequate they remain suspended and stable in solution.

[0168] Hybridization of nanoparticles to RCP RCP stock (30 μL) was diluted [1:5] with SSC 1x buffer (Invitrogen) by adding 120 μL of SSC 1x buffer to the PCR tube containing RCP stock (200 μL). A circle was marked on a Superfrost-plus slide (25 × 75 × 2 mm, VWR) using a diamond-tip pen. Then, 4.5 μL of the diluted RCP solution was added as a drop on the marked circle and dried in a 37 °C oven for 5 min. The marked circle with dried RCP was washed by pipetting 200 μL of PBS-tween20 (0.01 M, 0.05% tween20, Invitrogen), the washing step was repeated twice, and the area around the marked circle was cleaned using a microfiber tissue.

[0169] A hybridization chamber (Grace Bio-labs, Secure-seal hybridization chamber, 8-9 mm diameter x 0.8 mm depth) was mounted over the marked circle on the superfrost-plus slide. Next, the labeling solution was prepared. 130.6 μL of H2O was added to an Eppendorf tube (1.5 mL), 45 μL of SSC buffer (4×, Invitrogen), followed by vortexing the solution at the maximum setting for 10 seconds. Next, 1.8 μL of AF750 detection oligo (1 μM, SEQ ID NO: 11) was added, followed by vortexing at the maximum setting for 10 seconds. The oligo-functionalized nanoparticle stock prepared above was sonicated for 20 seconds. The oligo-functionalized nanoparticle stock (2.5 μL) was added to an Eppendorf tube, followed by vortexing at the maximum setting for 5 seconds, sonicating for 10 seconds, and vortexing at the maximum setting for 10 seconds.

[0170] The prepared labeling solution was added to the hybridization chamber until the chamber was full (45-50 μL). An adhesive plastic cover (3M VHB) was attached to the hole of the hybridization chamber. The prepared slide was then incubated in an oven at 37 °C for 1 h. After incubation, the plastic cover was removed using tweezers, the labeling solution was removed, and the hybridization chamber was emptied. The samples were then washed using the following procedure: 50 μL of PBS-tween20 buffer was added to the hybridization chamber, and the chamber was washed by removing and adding liquid to the chamber 10 times using a pipette. The PBS-tween20 buffer was then discarded. The washing step was repeated three times.

[0171] The hybridization chamber was then removed from the superfrost-plus slide using tweezers. The slide was covered with a cardboard box and allowed to dry at room temperature for 5 minutes. Then, 7 μL of slowfade (Gold antifade mounting medium, Invitrogen) was added to the marked circle and covered with a cover slip (Menzel-Glaser 24×50 mm #1,5).

[0172] Image acquisition All fluorescence microscopy imaging was performed using a standard epifluorescence microscope (Zeiss Axio Imager.Z2) equipped with an external LED light source (Lumencor SPECTRA X light engine). The microscope setup used a light engine equipped with filter paddles (395 / 25, 438 / 29, 470 / 24, 555 / 28, 635 / 22, 730,50). Images were acquired with an sCMOS camera (2048 × 2048, 16-bit, ORCA-Flash4.0LT Plus, Hamamatsu) using objectives 20x (0.8NA, air, 420650-9901) and 5x (0.16NA, air, 420630-9900). The setup used filter cubes for wavelength separation containing quad-band Chroma 89402 (DAPI, Cy3, Cy5) and quad-band Chroma 89403 (Atto425, Texas Red, AiexaFluor750). All samples were mounted on an automated multi-slide stage (PILine, M-686K011). Nanoparticles were imaged in the Cy3 and Cy5 channels using a 100 ms exposure. Detection oligos were imaged in the AF750 channel using a 200 ms exposure. Images were acquired using a Z-stack with a height of 5 μm and a slice thickness of 0.25 μm, resulting in 21 slices. All images were taken in ambient dark microscope room conditions.

[0173] Image processing and signal interpretation A typical image and signal interpretation procedure is shown in FIG. 10. Images were analyzed using ZEN3.2 (Blue Edition) software or ImageJ. In one embodiment, orthogonal projection was performed using maximum projection from Z-stack images. In another embodiment, orthogonal projection was performed using average projection. In another embodiment, orthogonal projection was not performed, but instead signal spots were segmented in three dimensions and signals were analyzed in three-dimensional space.

[0174] Figure 10(a) shows the full channel composite orthogonal image. Figure 10(b) shows the enlarged area corresponding to the white box shown in Figure 10(a) and its individual channels (Cy3, Atto425, and Cy7, respectively). The Cy3 and Atto425 fluorescent signals come from the nanoparticles, and the Cy7 signal comes from the co-labeled detection oligo (DO). The co-localization between all these channels (NP, DO) serves as a way to ensure NP binding to biomolecules, and can therefore be used to rule out false positives. In this case, the false positives could be non-specifically bound particles or particle aggregates.

[0175] In one embodiment, to decode the identity of the nanoparticle type, the fluorescence intensity / profile was measured in each channel for spatially resolved signal spots containing clusters of nanoparticles bound to biomolecules (RCPs). The method to analyze a single spot and optically decode the identity of the nanoparticle type is performed by drawing a line profile on one spot, which is shown enlarged in FIG. 10(b). The emission wavelengths (separated by acquisition channels Cy3, Atto 425, and Cy7) and the intensity profile from each channel are shown in FIG. 10(c) from such a line profile. From these profiles, the maximum intensity value was measured for each channel and the corresponding background signal, which was averaged from the flat part at the bottom of the intensity profile. In another embodiment, the average background intensity (line profile) for each channel was averaged from the area where no signal spots were found. The emission intensity was then measured by subtracting the background intensity from the maximum intensity. By analyzing the emission intensity of each wavelength, the identity of the nanoparticle type can be decoded. For the 7-plex system described above, in which Cy3 and Cy5 are incorporated into the nanoparticles for decoding, the emission intensities from 10 spots of each nanoparticle type are plotted in FIG. 13 using the methods described above.

[0176] In another embodiment, instead of drawing a line profile on a single spot to decipher the identity of the nanoparticle type, a circle was drawn around the spot. The background signal was subtracted by measuring the maximum intensity of each channel within the circle and averaging the background signal with an equivalent spot placed in an area where no signal spot was found. In another embodiment, the background signal was averaged by using the minimum value within the circle. In another embodiment, the background signal was averaged by drawing a second circle around the first circle, removing the pixel information from the first circle, and measuring the average intensity of the remaining pixel information from the larger circle.

[0177] Emission maps from the above 7-plex system can be plotted as shown in Figure 14 if the nanoparticles contain a third emission color that can be used to reference the other two emission colors or if the absolute emission has been calibrated prior to analysis. Furthermore, the emission map can be plotted as shown in Equation 4 2 Following -1=15, which leads to a total 15-plex system (subtracting the two colors, four intensity levels, dark mode), we show additional uniqueness that can be used to generate eight additional nanoparticle signatures that can be distinguished by extrapolating the performance of the 7-plex system.

[0178] This is further supported by the titration plot shown in Figure 16, which demonstrates that the incorporation of each fluorophore can be controlled with a high degree of precision, meaning that any intensity level shown in Figure 14 can be achieved.

[0179] A 14-plex detection system with a 7-plex nanoparticle library co-labeled with 2-plex molecular probes In another embodiment, two detection oligos were used to prepare the labeling solution. 130.6 μL of H2O was added to an Eppendorf tube (1.5 mL), 45 μL of SSC buffer (4x, Invitrogen), and the solution was then vortexed at maximum setting for 10 seconds. Then, 1.8 μL of AF750 detection oligo (1 μM, SEQ ID NO: 11) and Atto425 detection oligo (1 μM, SEQ ID NO: 12) were added, and then vortexed at maximum setting for 10 seconds. The oligo-functionalized nanoparticle stock prepared above was sonicated for 20 seconds. The oligo-functionalized nanoparticle stock was added to an Eppendorf tube (7×2.5 μL), and then vortexed at maximum setting for 5 seconds, sonicated for 10 seconds, and vortexed at maximum setting for 10 seconds. The process of nanoparticle-to-RCP hybridization, image acquisition, processing, and signal decoding was then applied as described above. The results are visualized in Figures 13 and 14 for nanoparticle decoding using the same signal decoding principle as described above and shown in Figure 10, and in Figure 17 for detection oligo decoding, showing a 14-plex system established by combining a 7-plex NP library co-labeled with a 2-plex detection oligo (molecular probe) library.

[0180] In another embodiment, a 30-plex system is achieved by combining the above 15-plex NP library co-labeled with a 2-plex detection oligo (molecular probe) library.

[0181] The procedure described for oligo functionalization and subsequent hybridization to RCP used the following sequences listed in the table below. [Table 7]

[0182] The nucleic acid sequences of the DBCO oligos, synthetic targets, and padlock probes used for the procedures described in this document are listed in the table above.

Claims

1. 1. A method for multiplex detection of multiple target biomolecules using optical encoding, wherein each target biomolecule has at least one detection target; a. providing a plurality of nanoparticle types comprising a plurality of nanoparticles, each nanoparticle having a coating that provides binding affinity of said nanoparticle to a type-specific detection target, each nanoparticle comprising a plurality of fluorophores that generate a signal that is unique to each nanoparticle type; b. providing a sample containing a plurality of target biomolecules; c. contacting the sample with the plurality of nanoparticle types, thereby allowing the nanoparticles to bind to the detection targets of the target biomolecules; d) optically decoding the signals emitted by the nanoparticles of the nanoparticle type bound to the detection target of the target biomolecule by measuring the wavelength and intensity of the emitted signal to ratiometrically identify the optical code incorporated in the nanoparticle type, thereby detecting the presence and identity of the target biomolecule.

2. 2. The method of claim 1, wherein each nanoparticle type is optically encoded by (i) containing a controlled ratio of the plurality of fluorophores, thereby controlling the wavelength and intensity of the emitted signal from the nanoparticle type, or (ii) by modifying properties of the fluorophores that affect the intensity of the emitted signal.

3. 3. The method of claim 1 or 2, wherein the binding affinity of the nanoparticle-type coating is provided by a detection probe X attached to the nanoparticle via a linker, the detection probe X being selected from a nucleic acid molecule, an antigen, or an antibody.

4. 4. The method of any one of claims 1 to 3, wherein the coating of the nanoparticles further comprises a repulsive component provided by a functional group Y attached to the nanoparticles via a linker, the functional group Y being selected from a charged group having a positive or negative charge, a zwitterionic group containing both positive and negative charges, or a sterically repulsive functional group.

5. The method of claim 4 , wherein the sterically repulsive functional group is a polymer chain or an aliphatic chain.

6. The method of any one of claims 3 to 5, wherein the linker comprises at least one anchor group that connects the coating to the nanoparticle and, optionally, a spacer group.

7. 7. The method of any one of claims 3 to 6, wherein one or more linkers can provide one or more detection probes X and / or functional groups Y, or multiple linkers can provide multiple detection probes X and / or functional groups Y via an interconnected backbone.

8. said plurality of fluorophores being (i) an organic fluorophore, optionally wherein said organic fluorophore is selected from the list consisting of Atto 425, Alexa fluor 405, Alexa Fluor 488, fluorescein, DiO, Atto 488, Cy3, DiI, Alexa fluor 546, Atto 550, Cy5, Alexa fluor 647, Texas Red, DiD, Atto 647(N), Atto 655, Cy7, Alexa fluor 680, Alexa fluor 750, Atto 680, and Atto 700, and combinations thereof; (ii) an inorganic fluorophore, optionally selected from the list consisting of a quantum dot, a rod, a perovskite quantum dot, a metal-ligand complex, or a combination thereof; and / or (iii) a combination of organic and inorganic fluorophores as defined in (i) and (ii).

9. The method of any one of claims 1 to 8, wherein the plurality of nanoparticles are silica nanoparticles, semiconductor nanoparticles, organic nanoparticles, inorganic nanoparticles, metallic nanoparticles, or polymeric nanoparticles, or a combination thereof.

10. The method of any one of claims 1 to 10, wherein the plurality of nanoparticles has an average diameter of less than 300 nm.

11. The method of claim 10, wherein the plurality of nanoparticles have an average diameter of 3 to 300 nm, 3 to 200 nm, 3 to 150 nm, or 3 to 100 nm.

12. The method of any one of claims 1 to 11, wherein the plurality of nanoparticles are porous nanoparticles.

13. Prior to step c, said target biomolecules are prepared by binding them to at least one molecule comprising said type-specific detection target, followed by an amplification step, Optionally, the amplification process is selected from rolling circle amplification (RCA), polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction (RT-PCR), loop-mediated isothermal amplification (LAMP), or other means of localized / clonal amplification (such as hairpin chain reaction), or said amplification process is based on the use of exonuclease, endonuclease, transposase, or CRISPR / Cas-based enzymatic activities prior to amplification. The method according to any one of claims 1 to 12.

14. 14. The method of claim 13, wherein the molecule comprising the type-specific detection target is a barcoded nucleic acid, a padlock probe, or an initiator sequence.

15. 15. The method of any one of claims 1 to 14, wherein the type-specific detection targets comprise nucleic acid molecules that are amplified or facilitate molecules that are amplified using RCA or multiple hybridization events.

16. The method of any one of claims 1 to 15, wherein said decoding is achieved by optical decoding, such as by optical imaging.

17. 17. The method of any one of claims 1 to 16, further comprising providing one or more molecular probes, each of which comprises a fluorophore that binds to a nucleic acid molecule, an antigen, or an antibody, providing binding affinity of the molecular probe to the type-specific detection target.

18. A kit of parts, in separate containers: (i) a plurality of nanoparticle types comprising a plurality of nanoparticles, each nanoparticle comprising a plurality of fluorophores that generate a signal that is unique to each nanoparticle type; (ii) a probe buffer comprising a solution having a controlled pH, salt concentration, and additives that promote specific detection target binding of the nanoparticles; (iii) instructions for using said kit in the method according to any one of claims 1 to 17.

Images