Proton pump function promoter

Abstract

To discover a plant-derived component capable of regulating skin pH and improving the skin's barrier function and to provide an effective skin pH regulator, skin barrier function improver, and lip texture improver with a clear mechanism of action, comprising the discovered component as an active ingredient.SOLUTION: As a first step, licorice is subjected to extraction with a pretreatment agent comprising liquid water, and subsequently filtered to separate the filtrate and the extraction residue. As a second step, the extraction residue from the first step is further subjected to extraction using one or more extraction agents selected from a group consisting of water, lower alcohols, and liquid polyhydric alcohols, at an extraction temperature that is at least 20°C higher than that in the first step, to produce a licorice extract. The licorice extract is contained in a proton pump function promoter according to the present invention.EFFECT: This inventive extract is applicable to cosmetics, drugs, quasi-drugs, and food products designed to improve the skin barrier function and lip texture by facilitating the maintenance of weakly acidic skin pH via the promotion of proton pump function.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to a skin pH adjuster, a skin barrier function improver, and a lip texture improver that promote the function of proton pumps in the skin. [Background technology]

[0002] One of the most important functions of the epidermis is the barrier function that constantly produces new keratinocytes through the division and subsequent differentiation of keratinocytes to protect the skin from various external stimuli. A decrease in barrier function due to various internal and external factors increases transepidermal water loss (TEWL), causing dryness, desquamation, itching, inflammation, etc. These further decrease the barrier function.

[0003] One of the barrier functions is the mild acidification of the skin, which contributes to the homeostasis of the permeability barrier and the durability of the stratum corneum (Non-Patent Document 1).It is also involved in lipid-lipid bonds in the extracellular lipid bilayer (Non-Patent Document 2) and the activity of ceramide-producing enzymes β-glucocerebrosidase and acidic sphingomyelinase (Non-Patent Document 3).

[0004] On the other hand, an increase in skin pH causes a delay in the recovery of barrier function and activation of serine proteases in the stratum corneum (Non-Patent Documents 4 and 5). Serine proteases, which have an optimal pH in the neutral to alkaline range, are proteolytic enzymes involved in the desquamation and shedding of keratinocytes, and induce skin peeling by degrading corneodesmosomes.

[0005] The decrease in skin pH, i.e., weak acidification, was thought to be due to the influence of components contained in sweat and sebum. However, in recent years, it has been discovered that the proton pump present in keratinocytes plays an important role, and that the sodium / hydrogen ion exchange transporter (Na + / H +It has been revealed that a decrease in the function of the hepatic endothelial exchanger (NHE) leads to an increase in skin pH (Non-Patent Documents 6 and 7).

[0006] As a means for improving the barrier function of the skin, the mainstream approach has been to apply compositions containing highly moisturizing substances such as collagen, elastin, hyaluronic acid, etc., but these only temporarily replenish moisture to the surface of the stratum corneum, and therefore are not sufficiently effective. Also, acidic lotions have been developed to keep the skin weakly acidic, but the effect of these is temporary and there is a problem with the durability of the effect.

[0007] To date, antipruritic topical preparations as skin pH adjusters (Patent Document 1) and skin barrier function enhancers as skin barrier function improvers (Patent Document 2) are known, but safer and more effective formulations are needed.

[0008] Lips are a part that greatly influences the impression of the face, and lively lip color and texture are required. From the outside, the skin is composed of the epidermis, dermis, and subcutaneous tissue, and although the skin of the lips is similar, it is histologically different from the skin of other parts of the body. That is, the stratum corneum of the epidermis of the lips is thin, and there are almost no sebaceous or sweat glands, so the lips are prone to dryness and are easily affected by physical, chemical, and environmental factors.

[0009] The causes of the deterioration of lip texture include the deterioration of tissue function due to aging and ultraviolet rays. Since the epidermis of the lips is thin, even slight roughness due to the delamination of keratinocytes affects local changes such as the uniformity of the visible color and brightness of the lip surface and the tactile unevenness. In addition, the texture is easily affected directly by the dermis located below, and is also greatly affected by wrinkles and sagging caused by a decrease in collagen production. Therefore, preventing and improving the deterioration of lip tissue function due to aging and ultraviolet rays is important for improving lip texture.

[0010] To date, lip compositions (Patent Document 3) and anti-aging gene expression promoters (Patent Document 4) are known as agents for improving the texture of the lips, but safer and more effective preparations are in demand.

[0011] Licorice (scientific name: Glycyrrhiza uralensis) is a perennial plant belonging to the genus Licorice in the family Fabaceae. It has been known that extracts from the underground parts of licorice (roots and stolons) have anti-inflammatory, anti-allergic, and anti-stress effects and are used as herbal medicines (Non-Patent Document 8). In recent years, research on licorice has progressed, and although licorice skin barrier function enhancers are already known (Patent Documents 5 and 6), there is a demand for the production of more effective licorice. [Prior art documents] [Patent documents]

[0012] [Patent Document 1] Hei 2-164823 [Patent Document 2] Patent Publication 2015-105269 [Patent Document 3] Patent Publication No. 2020-100592 [Patent Document 4] Patent Publication No. 2023-21890 [Patent Document 5] Patent Publication No. 2003-176218 [Patent Document 6] Patent Publication No. 2008-255051 [Non-patent literature]

[0013] [Non-Patent Document 1] Schmid-Wendtner MH et al,Skin Pharmacol.Physiol.,19,296-302(2006) [Non-Patent Document 2] Gibbs S et al, Arch. Dermatol. Res., 289, 585-595 (1997) [Non-Patent Document 3] Hachem JP et al,J.Invest.Dermatol.,130,500-510(2010) [Non-Patent Document 4] Mauro T et al, Arch. Dermatol. Res., 290, 215-222 (1998) [Non-Patent Document 5] Hachem JP et al,J.Invest.Dermatol.,125,510-520(2005) [Non-Patent Document 6] Behne MJ et al, J. Biol. Chem., 277, 47399-47406 (2002) [Non-Patent Document 7] Choi EH et al,J.Invest.Dermatol.,127,2847-2856(2007) [Non-Patent Document 8] World Encyclopedia of Useful Plants, Heibonsha, 1193 (1989) Summary of the Invention [Problem to be solved by the invention]

[0014] The problem to be solved by the present invention is to find a plant-derived component that adjusts the pH of the skin and improves the skin's barrier function, and to provide an excellent skin pH adjuster, skin barrier function improver, and lip texture improver that contain this as an active ingredient and have a clear mode of action. [Means for solving the problem]

[0015] The present inventors have conducted intensive research to solve the above problems, and as a result, have found that a licorice extract obtained by extracting licorice with a pretreatment agent consisting of liquid water in a first step, filtering the extract and separating the filtrate from an extraction residue, and further extracting the extraction residue from the first step with one or more extractants selected from the group consisting of water, lower alcohols and liquid polyhydric alcohols at a temperature at least 20° C. higher than the extraction temperature in the first step, has an excellent proton pump function promoting effect. Furthermore, the present inventors have found that a composition containing the extract has an excellent skin pH adjusting effect, skin barrier function improving effect and lip texture improving effect, and have completed the present invention.

[0016] That is, the present invention relates to a proton pump function promoter, a skin pH adjuster, a skin barrier function improver, and a lip texture improver, each of which contains a pretreated licorice extract as an active ingredient.

[0017] The present invention includes the following inventions. (1) A proton pump function promoter comprising a licorice extract obtained by, in a first step, extracting licorice with a pretreatment agent consisting of liquid water, filtering the extract and separating the filtrate from an extraction residue, and, in a second step, further extracting the extraction residue from the first step with one or more extractants selected from the group consisting of water, lower alcohols and liquid polyhydric alcohols at a temperature that is at least 20°C higher than the extraction temperature in the first step. (2) The function enhancer according to (1), characterized in that the extraction temperature in the first step is 0 to 20°C, and further, the extraction agent in the second step is water, and the extraction temperature is 70°C or more higher than the extraction temperature in the first step. (3) The function enhancer according to (1), characterized in that the extraction temperature in the first step is 0 to 20°C, and further, the extractant in the second step is an aqueous ethanol solution of 25% by weight or more or ethanol. (4) The function promoter according to any one of (1) to (3), wherein the proton pump is a sodium / hydrogen ion exchange transporter. (5) A skin pH adjuster comprising the agent described in (1). (6) A skin barrier function improving agent comprising the agent described in (1). (7) A lip texture improving agent comprising the agent described in (1). Effect of the Invention

[0018] The licorice extract of the present invention was excellent in the effect of promoting proton pump function. A proton pump function promoter containing this extract maintained the pH of the skin at a weak acidic level, and thus was excellent in the effect of improving the barrier function of the skin and the texture of the lips. [Brief description of the drawings]

[0019] [Figure 1] 13 is a graph showing the relationship between maximum wrinkle depth and surface pH on the lips of 23 female subjects in Experimental Example 3.

[0020] [Diagram 2] 1 is a graph showing the relationship between surface roughness and surface pH of the lips of 23 female subjects in Experimental Example 3. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0021] The proton pump in the present invention is present in the membrane of mammalian cells and transports hydrogen ions (H + ) is a protein that actively transports it out of the cell.

[0022] In the present invention, the promotion of proton pump function refers to the promotion of the expression of proton pump genes in keratinocytes and the promotion of their protein synthesis, and the subsequent transfer of hydrogen ions (H + ) facilitation of transportation.

[0023] The sodium / hydrogen ion exchanger in the present invention is a transporter that transports hydrogen ions (H + ) and extracellular sodium ions (Na + ) in a 1:1 exchange transporter protein, and plays an important role in regulating intracellular ion concentrations and osmotic pressure.

[0024] In the present invention, adjusting the pH of the skin refers to maintaining the pH of the skin surface at a weak acidity of 4.0 to 6.5, preferably 4.5 to 6.0.

[0025] The skin barrier function in the present invention refers to the prevention of water loss from inside the stratum corneum and protection of the skin from various external stimuli by constantly producing new keratinocytes through the division and subsequent differentiation of keratinocytes.

[0026] The texture of the lips in the present invention refers to the feeling felt from local changes such as the uniformity of the visual color and brightness of the lip surface and the tactile unevenness caused by wrinkles and sagging due to the delamination of keratinocytes in the epidermis and the decrease in collagen production in the dermis. Specifically, it can be evaluated based on the degree of wrinkles and roughness of the lips.

[0027] When NHE, a type of proton pump, functions normally in keratinocytes, sodium ions (Na + ) are taken up and hydrogen ions (H + ) are transported out of the cell. + ) contributes to making the skin slightly acidic (Non-Patent Documents 6 and 7). Therefore, the licorice extract of the present invention is useful for improving the barrier function of the skin and the texture of the lips by maintaining the skin's pH at a slightly acidic level through the action of promoting the proton pump function.

[0028] The licorice (scientific name: Glycyrrhiza uralensis) used in the present invention is a perennial plant belonging to the genus Glycyrrhiza in the family Fabaceae, and grows naturally in northeastern, central and northwestern China, or Mongolia. Also, Spanish licorice (scientific name: Glycyrrhiza glabra) grows naturally in northwestern China, the Middle East, European countries, and parts of the former Soviet Union. The licorice used in the present invention is preferably Glycyrrhiza uralensis.

[0029] The licorice used in the present invention may be any part of the plant such as flowers, fruits, seeds, leaves, stems, roots, etc., or the whole plant (whole plant), or a mixture thereof, with underground parts (roots and stolons) being particularly preferred. The plant may be used as is, or may be treated by drying, crushing, shredding, etc. In addition, the commercially available herbal medicine "licorice" based on Glycyrrhiza uralensis or Glycyrrhiza glabra may also be used.

[0030] [Step 1: Extraction with pretreatment agent] Liquid water is used as the pretreatment agent. It is also possible to use a pretreatment agent whose pH has been adjusted by adding an acid or alkali to the pretreatment agent. The amount of the pretreatment agent used is not particularly limited, and may be, for example, 5 times or more the amount of licorice (dry weight). It is preferably 10 times or more, and particularly preferably 20 times or more. The extraction temperature and extraction time with the pretreatment agent can be appropriately selected depending on the pressure during extraction, etc., but the extraction temperature is preferably 0 to 20°C, more preferably 2 to 15°C, and most preferably 5 to 10°C. The licorice used for extraction with the pretreatment agent may be used as is, but it is preferable to perform processing such as crushing and shredding in terms of pretreatment efficiency. When crushing or shredding is performed, it is preferable to pass through a sieve with a mesh size of 11.2 mm (2 mesh), more preferably through a sieve with a mesh size of 7.47 mm (3 mesh), and most preferably through a sieve with a mesh size of 5.55 mm (4 mesh). After extraction, filtration can be performed using filter paper, mesh, sieve, etc. The extracted residue recovered here is used in the next step 2.

[0031] [Step 2: Extraction with extractant] As the extractant, one or more selected from the group consisting of water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.) and liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.) are used. A mixed polar solvent of water-ethanol or ethanol is preferable. Among them, one containing 25% by weight or more of ethanol is most preferable. In addition, an extractant whose pH has been adjusted by adding an acid or alkali to the extractant can also be used. There is no particular limitation on the amount of the extractant used, and it may be 5 times or more, preferably 10 times or more, relative to the licorice (dry weight), but it is preferable that the amount is 100 times or less for convenience of operations when concentrating or isolating after extraction. In addition, the extraction time can be appropriately selected depending on the type of extractant used and the pressure during extraction, but the extraction temperature must be 20°C or more higher than the extraction temperature using the pretreatment agent. In particular, when water is used, the temperature is preferably at least 70° C. higher than the extraction temperature with the pretreatment agent, more preferably at least 80° C. higher, and most preferably at least 90° C. higher. Filtration can be carried out in the same manner as in the first step.

[0032] The residue extracted with the pretreatment agent may be dried before extraction with the extractant, or may be extracted directly without drying. In this case, the extraction solvent should be selected taking into consideration the effect of water remaining in the extraction residue. The method of extraction with the extractant is not particularly limited, and may be, for example, a stirring extraction method or a column extraction method. The licorice used in the present invention is a naturally occurring plant, and the components extracted from licorice are a mixture of many compounds with diverse structures. Therefore, it is difficult to clarify all the structures or properties of the components contained, and it is preferable to treat them as an extract.

[0033] The extract with the above extractant may be used as the extracted solution, but if necessary, it may be used after being subjected to treatment such as concentration (vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, etc., within the scope of the effects of the present invention. Furthermore, the extracted solution may be concentrated to dryness, spray-dried, freeze-dried, etc., and used as a dried product.

[0034] In addition, the extract obtained by the above-mentioned extracting agent may contain ingredients such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, and coating agents, which are used in cosmetics, quasi-drugs, pharmaceuticals, etc., within a range that does not impair the effects of the extract.

[0035] The present invention can be used in any of cosmetics, quasi-drugs, medicines, and foods, and examples of the dosage forms include lotions, creams, milky lotions, gels, aerosols, essences, packs, cleansers, bath products, foundations, dusting powders, lipsticks, ointments, poultices, tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and injectable solutions. Preferred are compositions for external use on the lips, such as lipsticks and lip packs.

[0036] In the case of external use, the content of the above extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, calculated as a solid matter. Furthermore, 0.01 to 5% by weight is most preferable. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, it is difficult to see an increase in the effect, which is uneconomical.

[0037] In the case of internal use, the dosage varies depending on age, body weight, symptoms, healing effect, administration method, treatment time, etc. In general, the daily dosage for an adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0038] In the following, in order to explain the present invention in detail, examples of production, formulation and experimental examples of the extract used in the present invention are given as examples, but the present invention is not limited thereto. The percentages in the production and formulation examples are by weight. EXAMPLES

[0039] [Example of Licorice Extract Manufacturing] The licorice extract of the present invention was produced according to Production Examples 1 to 4. Conventional licorice extract was produced according to Comparative Production Examples 1 to 4. The extraction material used was ground underground parts (roots and stolons) of licorice (scientific name: Glycyrrhiza uralensis) (passed through a sieve with a mesh size of 11.2 mm).

[0040] (Production Example 1) Preparation of hot water extract of pretreated licorice Twenty times the amount of water was added to 10 g of dried licorice root, and extraction was performed at 5°C for 24 hours (within 22 hours, the increase in the solid content of the extract stopped, and no further extraction was possible). The resulting extract was filtered through No. 5C filter paper, the residue was dried, and 10 times the amount of water was added to the resulting dried residue, and extraction was performed at 95°C for 2 hours. The resulting extract was filtered through No. 5C filter paper, and the filtrate was concentrated and freeze-dried to obtain 0.4 g of hot water extract of licorice.

[0041] (Comparative Manufacturing Example 1) Preparation of a conventional hot water extract of licorice Ten times the amount of water was added to 10 g of dried licorice roots, and extraction was carried out for 2 hours at 95° C. The resulting extract was filtered through No. 5C filter paper, and the filtrate was concentrated and freeze-dried to obtain 2.1 g of hot water extract of licorice.

[0042] (Production Example 2) Preparation of 50% ethanol extract of pretreated licorice 20 times the amount of water was added to 10 g of dried licorice root, and extraction was performed at 5°C for 24 hours (within 22 hours, the increase in the solid content of the extract stopped, and no further extraction was possible). The resulting extract was filtered through No. 5C filter paper, the residue was dried, and 10 times the amount of 50% ethanol aqueous solution was added to the resulting dried residue, which was then soaked at 25°C for 7 days to perform extraction. The resulting extract was filtered through No. 5C filter paper, and the filtrate was concentrated and freeze-dried to obtain 0.7 g of 50% ethanol extract of licorice.

[0043] (Comparative Manufacturing Example 2) Preparation of a conventional 50% ethanol extract of licorice A 10-fold volume of 50% ethanol solution was added to 10 g of dried licorice root, and the mixture was soaked at 25°C for 7 days to perform extraction. The resulting extract was filtered through No. 5C filter paper, and the filtrate was concentrated and freeze-dried to obtain 2.6 g of a 50% ethanol extract of licorice.

[0044] (Production Example 3) Preparation of ethanol extract of pretreated licorice 20 times the amount of water was added to 10 g of dried licorice underground parts, and extraction was carried out at 5°C for 24 hours (within 22 hours, the increase in the solid content concentration of the extract stopped, and no further extraction was possible). The resulting extract was filtered through No. 5C filter paper, the residue was dried, and 10 times the amount of ethanol was added to the resulting dried residue, which was then soaked at 25°C for 7 days to carry out extraction. The resulting extract was filtered through No. 5C filter paper, and the filtrate was concentrated and freeze-dried to obtain 0.4 g of ethanol extract of licorice.

[0045] (Comparative Manufacturing Example 3) Preparation of conventional ethanol extract of licorice A 10-fold amount of ethanol was added to 10 g of dried licorice root, and the mixture was soaked at 25°C for 7 days to perform extraction. The resulting extract was filtered through No. 5C filter paper, and the filtrate was concentrated and freeze-dried to obtain 0.6 g of ethanol extract of licorice.

[0046] (Production Example 4) Preparation of 80% 1,3-butylene glycol extract of pretreated licorice 20 times the amount of water was added to 10 g of dried licorice underground parts, and extraction was carried out at 5°C for 24 hours (within 22 hours, the increase in the solid content concentration of the extract stopped, and no further extraction was possible). The resulting extract was filtered through filter paper No. 5C, the residue was dried, and 10 times the amount of 80% 1,3-butylene glycol aqueous solution was added to the resulting dried residue, which was then immersed at 25°C for 7 days to carry out extraction. The resulting extract was filtered through filter paper No. 5C to obtain 45.6 g of 80% 1,3-butylene glycol extract of licorice.

[0047] (Comparative Manufacturing Example 4) Preparation of a conventional 80% 1,3-butylene glycol extract of licorice A 10-fold amount of 80% 1,3-butylene glycol aqueous solution was added to 10 g of dried licorice root, and the mixture was soaked at 25°C for 7 days to perform extraction. The resulting extract was filtered through No. 5C filter paper to obtain 89.6 g of 80% 1,3-butylene glycol extract of licorice root. EXAMPLES

[0048] [Product formulation example] According to the formulation examples shown below, lotions, creams, milky lotions, gels, packs, lip essences, lip balms, liquid lip balms, foundations, bath agents, ointments, powders, tablets, tablet confectioneries, and beverages containing the licorice extracts produced in Production Examples 1 to 4 were prepared by standard methods.

[0049] (Formulation example 1) Lotion Formula Content (%) 1. 50% ethanol extract of pretreated licorice (Production Example 2) 0.1 2.1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1 10.Fragrance (appropriate amount) 11. Remaining purified water

[0050] (Comparative Formulation Example 1) Conventional lotion A conventional lotion was prepared by replacing the pretreated 50% ethanol extract of licorice in Formulation Example 1 with a conventional 50% ethanol extract of licorice.

[0051] (Formulation example 2) Cream Formula Content (%) 1. Pretreated licorice hot water extract (Production Example 1) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-Butylene glycol 8.5 13. Remaining purified water

[0052] (Formulation Example 3) Emulsion Formula Content (%) 1. Ethanol extract of pretreated licorice (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Remaining purified water

[0053] (Formulation Example 4) Gel Formula Content (%) 1. Pretreated licorice 80% 1,3-butylene glycol extract (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1 5.Fragrance (appropriate amount) 6. 1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Remaining purified water

[0054] (Formulation Example 5) Pack Formula Content (%) 1. 50% ethanol extract of pretreated licorice (Production Example 2) 1.0 2. Pretreated licorice 80% 1,3-butylene glycol extract (Production Example 4) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5.1,3-Butylene glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Remaining purified water

[0055] (Formulation example 6) Lip essence Formula Content (%) 1. Pretreated licorice 80% 1,3-butylene glycol extract (Production Example 4) 0.3 2. Glycerin 5.0 3.1,3-Butylene glycol 5.0 4. Carboxymethylcellulose 0.5 5. Hydroxypropyl methylcellulose 0.5 6. Potassium hydroxide 0.5 7. Sorbitan Sesquioleate 0.5 8. Polyoxyethylene sorbitan monooleate (20E.O.) 1.5 9. Liquid Paraffin 5.0 10. Methyl parahydroxybenzoate 0.3 11. Phenoxyethanol 0.01 12. Remaining purified water

[0056] (Comparative Formulation Example 2) Conventional lip essence In Formulation Example 6, the 80% 1,3-butylene glycol extract of pretreated licorice was replaced with a conventional 80% 1,3-butylene glycol extract of licorice to form a conventional lip essence.

[0057] (Formulation Example 7) Lip balm Formula Content (%) 1. Pretreated licorice 80% 1,3-butylene glycol extract (Production Example 4) 0.05 2. Polyethylene wax 1.5 3. Paraffin wax 9.0 4. Microcrystalline Wax 3.0 5. Carnauba Wax 3.0 6. Dextrin palmitate 0.25 7. Liquid Paraffin 10.0 8. Polyglyceryl-2 triisostearate remaining

[0058] (Formulation example 8) Liquid lip cream Formula Content (%) 1. Pretreated licorice ethanol extract (Production Example 3) 0.1 2. Polyethylene wax 2.0 3. Microcrystalline wax 5.0 4. Carnauba wax 0.5 5. Inulin stearate 0.1 6. Dextrin myristate 0.05 7. Heavy Liquid Isoparaffin 35.0 8. Diisostearyl malate 10.0 9. Polyglyceryl-2 triisostearate remaining

[0059] (Formulation Example 9) Foundation Formula Content (%) 1. 50% ethanol extract of pretreated licorice (Production Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0 4. Polyoxyethylene cetyl ether (20E.O.) 2.0 5. Cetanol 1.0 6. Liquid Lanolin 2.0 7. Liquid Paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengala 1.0 17. Yellow iron oxide 2.0 18.Fragrance (appropriate amount) 19. Remaining purified water

[0060] (Formulation Example 10) Bath additive Formula Content (%) 1. Pretreated licorice ethanol extract (Production Example 3) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Sodium sulfate remaining

[0061] (Prescription Example 11) Ointment Formula Content (%) 1. Pretreated licorice hot water extract (Production Example 1) 5.0 2. 50% ethanol extract of pretreated licorice (Production Example 2) 1.0 3. Polyoxyethylene cetyl ether (30E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid Paraffin 5.0 6. Cetanol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene glycol 10.0 9. Remaining purified water

[0062] (Prescription Example 12) Powder Formula Content (%) 1. Pretreated licorice hot water extract (Production Example 1) 1.0 2.Dry cornstarch 39.0 3. Microcrystalline cellulose 60.0

[0063] (Formulation Example 13) Tablets Formula Content (%) 1. Pretreated licorice hot water extract (Production Example 1) 5.0 2.Dry cornstarch 25.0 3. Calcium carboxymethylcellulose 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0

[0064] (Prescription Example 14) Tablets Formula Content (%) 1. Pretreated licorice hot water extract (Production Example 1) 2.0 2. Dry cornstarch 49.8 3. Erythritol 40.0 4. Citric Acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7. Remaining purified water

[0065] (Formulation Example 15) Beverage Formula Content (%) 1. Pretreated licorice hot water extract (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Remaining purified water

[0066] Next, experimental examples will be given to explain the effects of the present invention in detail. EXAMPLES

[0067] (Experimental Example 1) Proton pump function enhancement effect in keratinocytes Keratinocyte-derived HaCaT cells were plated in a 6-well plate at 5 × 10 4The cells were seeded with 10% FBS and cultured at 37°C and 5% CO2 for 4 days. Next, the cells were cultured for 24 hours in DMEM culture medium containing samples (final concentrations of 1 and 10 μg / ml), and then total RNA was extracted. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the total RNA amount was determined by absorbance at 260 nm using a spectrophotometer (Nanodrop). The mRNA expression level was measured by real-time RT-PCR based on the total RNA extracted from the cells. For the real-time RT-PCR, High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other procedures were performed according to the prescribed method, and the expression level of NHE1 mRNA was calculated as a ratio to the expression level of β-actin mRNA, which is an internal standard. The NHE1 expression rate was calculated as the ratio of the expression level of NHE1 mRNA in the sample-added group to the expression level of NHE1 mRNA in the control (no sample added) group. The primers used to measure the expression level of each gene are as follows.

[0068] Primer set for NHE1 GCCCTGTTAATCATTCCGTC (SEQ ID NO: 1) CACATGGAAACCTATCTTCATGAG (SEQ ID NO: 2) Primer set for β-actin CACTCTTCCAGCCTTCCTTCC (SEQ ID NO: 3) GTGTTGGCGTACAGGTCTTTG (SEQ ID NO: 4)

[0069] The results of these experiments are shown in Table 1. As a result, the 50% ethanol extract of pretreated licorice (Production Example 2) and the conventional 50% ethanol extract of licorice (Comparative Production Example 2) as a comparison product increased the expression level of NHE1 mRNA, but the 50% ethanol extract of pretreated licorice (Production Example 2) was found to have a significantly higher effect than the conventional 50% ethanol extract of licorice (Comparative Production Example 2) as a comparison product. In addition, similar experiments were performed using different extraction methods, such as a pretreated hot water extract of licorice (Production Example 1) and a conventional hot water extract of licorice (Comparative Production Example 1), a pretreated ethanol extract of licorice (Production Example 3) and a conventional ethanol extract of licorice (Comparative Production Example 3), a pretreated 80% 1,3-butylene glycol extract of licorice (Production Example 4) and a conventional 80% 1,3-butylene glycol extract of licorice (Comparative Production Example 4), and the results showed that the pretreated licorice extract had a significantly higher effect than the conventional licorice extract. Therefore, compared to the conventional licorice extract, the pretreated licorice extract is superior in promoting the proton pump function, and it was suggested that the pretreated licorice extract is useful for improving the barrier function of the skin by maintaining the pH of the skin weakly acidic.

[0070] [Table 1]

[0071] (Experimental Example 2) Usage Test 1 Skin pH and TEWL were measured before and after use of Formulation Example 1 of the present invention and Comparative Formulation Example 1. Three female subjects were asked to use the lotion of Formulation Example 1 on one half of their face and Comparative Formulation Example 1 on the other half of their face for one week without knowing which was which. Before and after use, the skin pH of the cheeks was measured using a portable pH meter D-210P (manufactured by HORIBA), and the TEWL of the same area was measured using a Tewameter TM300 (manufactured by Courage+Khazaka).

[0072] The results of these experiments are shown in Table 2. As a result, compared with the lotion obtained from Comparative Formulation Example 1, the lotion obtained from Formulation Example 1 reduced the skin pH and TEWL of the cheeks. This suggests that Formulation Example 1 is superior to Comparative Formulation Example 1 in promoting the proton pump function, and is useful for improving the skin barrier function by maintaining the skin pH at a weak acidity. All subjects were able to use the product safely during the test period. There was also no problem with the deterioration of the formulation ingredients.

[0073] [Table 2]

[0074] (Experimental Example 3) Effect of pH on Lip Texture The maximum depth of wrinkles, surface roughness, and surface pH of the lips of 23 female subjects were measured. Specifically, the maximum depth of wrinkles and surface roughness of the upper lip were measured using a facial imaging device, Antera 3D (Mirabex), and the surface pH of the upper lip was measured using a compact pH meter, LAQUAtwin pH-22B (HORIBA).

[0075] The experimental results are shown in Figures 1 and 2. A positive correlation was observed between the maximum depth of wrinkles and surface roughness (Ra) and the surface pH. This suggests that the lower the surface pH of the lips, the less noticeable the wrinkles and roughness will be, and the better the texture will be. The experiment was also performed on the lower lip, and similar results were observed.

[0076] (Experimental Example 4) Usage Test 2 Three female subjects were divided into a group and asked to use the lip essence of Formulation Example 6 or Comparative Formulation Example 2 without knowing which one they were, and the texture was visually evaluated before and after use.

[0077] As a result, the lips looked fuller and shinier when using the lip essence obtained from Formulation Example 6 than when using the lip essence obtained from Comparative Formulation Example 2. All subjects were able to use the product safely during the test period. There were also no problems with deterioration of the ingredients. [Industrial Applicability]

[0078] The proton pump function promoter, skin pH adjuster, skin barrier function improver, and lip texture improver according to the present invention are characterized in that in the first step, licorice is extracted with a pretreatment agent consisting of liquid water, filtered, and separated into a filtrate and an extraction residue, and in the second step, the extraction residue from the first step is further extracted with one or more extractants selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols at an extraction temperature 20° C. or more higher than the extraction temperature in the first step, and contain licorice. These agents exert excellent effects for the purposes of each agent. Thus, it is possible to provide cosmetics, medicines, quasi-drugs, and foods that aim to improve the skin barrier function and lip texture by maintaining the skin pH at a weak acidity through the action of promoting the proton pump function.

Claims

1. A proton pump function promoter comprising a licorice extract obtained by extracting licorice with a pretreatment agent consisting of liquid water in a first step, filtering the extract and separating the filtrate from an extraction residue, and further extracting the extraction residue from the first step with one or more extractants selected from the group consisting of water, lower alcohols and liquid polyhydric alcohols at a temperature 20°C or more higher than the extraction temperature in the first step in a second step.

2. The function enhancer according to claim 1, characterized in that the extraction temperature in the first step is 0 to 20°C, and further, the extractant in the second step is water, and the extraction temperature is 70°C or more higher than the extraction temperature in the first step.

3. 2. The function enhancer according to claim 1, wherein the extraction temperature in the first step is 0 to 20° C., and the extractant in the second step is an aqueous ethanol solution of 25% by weight or more or ethanol.

4. 4. The function promoter according to any one of claims 1 to 3, wherein the proton pump is a sodium / hydrogen ion exchange transporter.

5. A skin pH adjusting agent comprising the agent according to claim 1.

6. A skin barrier function improving agent comprising the agent according to claim 1.

7. A lip texture improving agent comprising the agent according to claim 1.

Images