Template-directed immunomodulation for cancer therapy

Abstract

Described herein are compositions and methods for treating cancer, comprising single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotides that are complementary to miRNAs that are highly expressed in tumor microenvironment compared to non-tumor environment. In certain aspects, the disclosure relates to a method for treating cancer, comprising administering to a subject a therapeutically effective amount of a single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in tumor or tumor microenvironment compared to non-tumor or non-tumor microenvironment.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 132,315, filed December 30, 2020, the specification of which is incorporated herein by reference in its entirety. [Background technology]

[0002] 2. Background of the Invention Cancer represents a continuing and significant threat to overall human health. Utilizing novel mechanisms to treat cancer represents a promising means of delivering therapeutic agents that meet the ongoing and urgent need for effective cancer treatment. Recent studies have shown that systemic delivery of synthetic RIG-I (retinoic acid-inducible gene I) agonists inhibits tumor growth. RIG-I senses short double-stranded RNAs with uncapped 5'-triphosphate moieties, a common motif typically found in viral RNA. RIG-I is expressed in a number of cell types, including tumor cells, and serves as a promising target for cancer therapy. It is therefore an object of the present disclosure to provide compositions and methods for selectively activating RIG-I in the tumor microenvironment to treat cancer. Therapeutic methods utilizing endogenous miRNAs as a means to activate RIG-I provide a highly promising approach to target the tumor microenvironment and treat a variety of associated cancers.

[0003] The compositions and methods of the disclosure provide methods for selectively activating RIG-I in the tumor microenvironment using single-stranded 5' uncapped triphosphate- or diphosphate-modified RNA oligonucleotides complementary to miRNAs that are highly expressed in the tumor microenvironment compared to the non-tumor environment. Summary of the Invention [Means for solving the problem]

[0004] Summary of the Invention In certain aspects, the present disclosure relates to a method for treating cancer comprising administering to a subject a therapeutically effective amount of a single-stranded 5' uncapped triphosphate- or diphosphate-modified RNA oligonucleotide, wherein said oligonucleotide is complementary to an miRNA that is highly expressed in a tumor or tumor microenvironment compared to a non-tumor or non-tumor microenvironment.

[0005] In certain aspects, the disclosure relates to a method for selectively activating RIG-I in a tumor or tumor microenvironment, comprising administering to a subject a therapeutically effective amount of a single-stranded 5' uncapped triphosphate- or diphosphate-modified RNA oligonucleotide, wherein said single-stranded 5' uncapped triphosphate- or diphosphate-modified RNA oligonucleotide comprises a sequence that is complementary to a miRNA expressed in a tumor or tumor microenvironment, and wherein RIG-I is selectively activated in said tumor or tumor microenvironment that expresses the miRNA.

[0006] In some embodiments, the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide forms a duplex with the miRNA. In some embodiments, the miRNA is an oncogenic miRNA. In some embodiments, the miRNA is a tumor associated miRNA. In some embodiments, the duplex is not cleaved by AGO2. In some embodiments, the duplex activates RIG-I. In some embodiments, RIG-I activation is at least 5%, 10%, 15% or 20% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation elicits a tumor specific immune response. In some embodiments, the tumor-specific immune response comprises type I IFN, DAMPs (danger associated molecular patterns), and / or release of tumor antigens. In some embodiments, the method induces immune memory against the tumor or the tumor microenvironment.

[0007] In some embodiments, the cancer is a solid tumor. In some embodiments, the solid tumor is selected from the group consisting of sarcoma, carcinoma, and lymphoma. In some embodiments, the cancer is selected from the group consisting of bladder cancer, blood cancer, bone cancer, brain cancer, breast cancer, colon cancer, cervical cancer, kidney cancer, esophageal cancer, liver cancer, lung cancer, thyroid cancer, skin cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, stomach cancer, uterine cancer, glioblastoma, or head and neck cancer. In some embodiments, the modified RNA oligonucleotide does not contain any other modifications.

[0008] In some embodiments, the modified RNA oligonucleotide comprises at least 2 different modified RNA oligonucleotides.In some embodiments, the modified RNA oligonucleotide comprises at least 3 different modified RNA oligonucleotides.In some embodiments, the modified RNA oligonucleotide comprises at least 4 different modified RNA oligonucleotides.In some embodiments, the modified RNA oligonucleotide comprises at least 5 different modified RNA oligonucleotides.In some embodiments, the modified RNA oligonucleotide comprises up to 40 different modified RNA oligonucleotides.

[0009] In some embodiments, the modified RNA oligonucleotide further comprises a 2'-fluoro (2'-F) ribose modification. In some embodiments, the 2'-F ribose modification is present at the 10th or 11th nucleotide from the 5' end of the modified RNA oligonucleotide. In some embodiments, the modified RNA oligonucleotide does not comprise a 2'-O-methyl (2'-OMe) ribose modification. In some embodiments, the modified RNA oligonucleotide does not comprise a N-6-methyladenosine (m6A) modification. In some embodiments, the modified RNA oligonucleotide does not comprise a pseudouridine (Ψ). In some embodiments, the modified RNA oligonucleotide does not comprise a N-1-methylpseudouridine (mΨ) modification. In some embodiments, the modified RNA oligonucleotide does not comprise a 5-methyl-cytidine (5mC) modification. In some embodiments, the modified RNA oligonucleotide does not comprise a 5-hydroxymethyl-cytidine (5hmC) modification. In some embodiments, the modified RNA oligonucleotide does not comprise a 5-methoxycytidine (5moC) modification.

[0010] In some embodiments, the modified RNA oligonucleotide comprises a sequence that is at least 19 nucleotides in length. In some embodiments, the modified RNA oligonucleotide comprises a sequence that is 15-30 nucleotides in length. In some embodiments, the modified RNA oligonucleotide comprises a sequence that is 16-27 nucleotides in length. In some embodiments, the modified RNA oligonucleotide is fully complementary to the miRNA. In some embodiments, the modified RNA oligonucleotide competes with endogenous mRNA to bind to the miRNA. In some embodiments, the duplex comprises 0-5 mismatched base pairs.

[0011] In some embodiments, the method comprises administering a modified RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO:6. In some embodiments, the nucleic acid of SEQ ID NO:6 is complementary to miR-21. In some embodiments, the cancer is selected from the group consisting of breast, ovarian, cervical, colon, lung, liver, brain, esophageal, prostate, pancreas, and thyroid cancer. In some embodiments, the method comprises administering a modified RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO:1. In some embodiments, the nucleic acid of SEQ ID NO:1 is complementary to miR-10b. In some embodiments, the cancer is non-small cell lung cancer or cervical cancer. In some embodiments, the cancer is metastatic cancer. In some embodiments, the cytosine and uracil are present at the AGO2 cleavage site. In some embodiments, the metastatic cancer is localized to the breast, lymph node, lung, bone, brain, liver, ovary, peritoneum, muscle tissue, pancreas, prostate, esophagus, colon, rectum, stomach, nasopharynx, or skin. In some embodiments, the treatment with the modified RNA oligonucleotide is a monotherapy. In some embodiments, the modified RNA oligonucleotide is administered intravenously, subcutaneously, intraarterially, intramuscularly, intraperitoneally, or locally. In some embodiments, the modified RNA oligonucleotide is administered at a dose of about 0.2 mg / kg to about 200 mg / kg. In some embodiments, the modified RNA oligonucleotide is administered at a dose of about 0.2 mg / kg to about 2.0 mg / kg. In some embodiments, the modified RNA oligonucleotide is administered at a dose of about 1.0 mg / kg to about 10.0 mg / kg.

[0012] In certain aspects, the disclosure relates to a method for treating cancer comprising administering to a subject a therapeutically effective amount of magnetic nanoparticles comprising ferric chloride, ferrous chloride, or a combination thereof; a dextran coating; and a single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide, wherein the oligonucleotide is complementary to an miRNA that is highly expressed in a tumor or tumor microenvironment compared to a non-tumor or non-tumor microenvironment. In some embodiments, the magnetic nanoparticles have a nonlinearity index ranging from about 6 to about 40. In some embodiments, the magnetic nanoparticles have a nonlinearity index ranging from about 8 to about 14. In some embodiments, the magnetic nanoparticles comprise about 0.54 g of ferric chloride and about 0.2 g of ferrous chloride. In some embodiments, the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210 and miR221.In some embodiments, the miRNA is an oncogenic miRNA.In some embodiments, the miRNA is a tumor-associated miRNA.

[0013] In some embodiments, the method further comprises administering supportive or adjunctive therapy, hi some embodiments, the adjunctive therapy comprises radiation therapy, cryotherapy, and ultrasound therapy.

[0014] In some embodiments, the method includes administering an additional therapeutic agent. In some embodiments, the additional therapeutic agent includes an miRNA. In some embodiments, the miRNA is complementary to the modified RNA oligonucleotide. In some embodiments, the additional therapeutic agent is selected from the group consisting of a targeted therapy, a chemotherapeutic agent, an immunotherapeutic agent, an immunogenic cell death inducer (ICDi), and an siRNA therapy. In some embodiments, the method further includes surgery. In some embodiments, the chemotherapeutic agent is selected from the group consisting of cyclophosphamide, mechlorethamine, chlorambucil, melphalan, daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, valrubicin, paclitaxel, docetaxel, etoposide, teniposide, tafluposide, azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, mercaptopurine, methotrexate, thioguanine, bleomycin, carboplatin, cisplatin, oxaliplatin, all-trans retinoic acid, vinblastine, vincristine, vindesine, vinorelbine, and bevacizumab. In some embodiments, the targeted therapy is trastuzumab, giotrif, proleukin, alectinib, campath, atezolizumab, avelumab, axitinib, belimumab, belinostat, bevacizumab, velcade, canakinumab, ceritinib, cetuximab, crizotinib, dabrafenib, daratumumab, dasatinib, denosumab, erotinib, erythropoie ... The immunotherapeutic agent is selected from the group consisting of tuzumab, enasidenib, erlotinib, gefitinib, ibrutinib, zydelig, imatinib, lenvatinib, midostaurin, necitumumab, niraparib, obinutuzumab, osimertinib, panitumumab, regorafenib, rituximab, ruxolitinib, sorafenib, tocilizumab, and trastuzumab. In some embodiments, the immunotherapeutic agent is an immune checkpoint inhibitor.In some embodiments, the immune checkpoint inhibitor is selected from the group consisting of pembrolizumab (Keytruda®), nivolumab (Opdivo®), atezolizumab (Tecentriq®), ipilimumab (Yervoy®), avelumab (Bavencio®) and durvalumab (Imfinzi®). In some embodiments, the adjunctive therapy induces expression of a miRNA. In some embodiments, the additional therapeutic agent induces expression of a miRNA. In some embodiments, the ICDi is selected from the group consisting of daunorubicin, docetaxel, doxorubicin, mitoxantrone, oxaliplatin, and paclitaxel. In some embodiments, the siRNA therapy targets PD-L1, CTLA-4, TGF-β, and / or VEGF. In some embodiments, the supportive or adjunctive therapy is administered prior to, concurrently with, or following administration of the modified RNA oligonucleotide.

[0015] In certain aspects, the present disclosure relates to a composition comprising a single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide that is complementary to a miRNA that is highly expressed in tumor tissue compared to non-tumor tissue. In some embodiments, the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the modified RNA oligonucleotide can form a duplex with the miRNA. In some embodiments, the duplex is not cleaved by AGO2. In some embodiments, the duplex activates RIG-I. In some embodiments, the RIG-I activation is at least 5%, 10%, 15% or 20% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation elicits a tumor-specific immune response. In some embodiments, the tumor-specific immune response comprises type I IFN, DAMPs (danger associated molecular patterns), and / or release of tumor antigens.

[0016] In some embodiments, the modified RNA oligonucleotide does not include any other modifications. In some embodiments, the modified RNA oligonucleotide further comprises a 2'-fluoro (2'-F) ribose modification. In some embodiments, the modified RNA oligonucleotide does not include a 2'-O-methyl (2'-OMe) ribose modification. In some embodiments, the modified RNA oligonucleotide does not include an N-6-methyladenosine (m6A) modification. In some embodiments, the modified RNA oligonucleotide does not include a pseudouridine (Ψ). In some embodiments, the modified RNA oligonucleotide does not include an N-1-methylpseudouridine (mΨ) modification. In some embodiments, the modified RNA oligonucleotide does not include a 5-methyl-cytidine (5mC) modification. In some embodiments, the modified RNA oligonucleotide does not include a 5-hydroxymethyl-cytidine (5hmC) modification. In some embodiments, the modified RNA oligonucleotide does not include a 5-methoxycytidine (5moC) modification. In some embodiments, the modified RNA oligonucleotide is fully complementary to the miRNA. In some embodiments, the modified RNA oligonucleotide binds to the miRNA in competition with endogenous mRNA. In some embodiments, the duplex contains 0 to 5 mismatched base pairs. In some embodiments, the modified RNA oligonucleotide comprises the nucleic acid sequence of any one of SEQ ID NOs: 1-13.

[0017] In some embodiments, the modified RNA oligonucleotide is further linked to a nanoparticle. In some embodiments, the nanoparticle is a magnetic nanoparticle. In some embodiments, the magnetic nanoparticle is coated with a polymer coating. In some embodiments, the polymer coating is dextran. In some embodiments, the magnetic nanoparticle comprises iron oxide; and a dextran coating functionalized with one or more amine groups, the number of the one or more amine groups ranging from about 5 to about 1000. In some embodiments, the iron content of the magnetic nanoparticle comprises about 50% by weight (wt) to about 100% wt iron(III) and about 0% wt to about 50% wt iron(II). In some embodiments, the magnetic nanoparticle comprises about 5 to about 150 amino groups. In some embodiments, the magnetic nanoparticle comprises one or more such modified RNA oligonucleotides.

[0018] In certain aspects, the present disclosure relates to a composition comprising a magnetic nanoparticle comprising ferric chloride, ferrous chloride, or a combination thereof; a dextran coating; and a single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a tumor or tumor microenvironment compared to a non-tumor or non-tumor microenvironment. In some embodiments, the magnetic nanoparticle has a nonlinearity index ranging from about 6 to about 40. In some embodiments, the magnetic nanoparticle has a nonlinearity index ranging from about 8 to about 14. In some embodiments, the magnetic nanoparticle comprises about 0.54 g of ferric chloride and about 0.2 g of ferrous chloride. In some embodiments, the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the miRNA is an oncogenic miRNA. In some embodiments, the miRNA is a tumor-associated miRNA.

[0019] In some embodiments, the magnetic nanoparticle comprises two or more modified RNA oligonucleotides.In some embodiments, the two or more modified RNA oligonucleotides are complementary to different miRNAs.In some embodiments, the two or more modified RNA oligonucleotides are complementary to the same miRNA.

[0020] In certain aspects, the present disclosure relates to a pharmaceutical composition comprising the modified RNA oligonucleotide or magnetic nanoparticles disclosed herein. In some embodiments, the pharmaceutical composition further comprises a delivery agent. In some embodiments, the delivery agent is selected from the group consisting of micelles, lipid nanoparticles (LNPs), spherical nucleic acids (SNAs), extracellular vesicles, synthetic vesicles, exosomes, lipidoids, liposomes, and lipoplexes. In some embodiments, the liposomes are formed from lipid bilayers. In some embodiments, the lipid bilayer comprises one or more phospholipids selected from the group consisting of phospholipids, phosphoglycerol lipids, phosphocholine lipids, and phosphoethanolamine lipids. In some embodiments, the phospholipids are PEGylated. In some embodiments, the delivery agent is a liposome or lipid nanoparticle. In some embodiments, the liposome or lipid nanoparticle further delivers an additional therapeutic agent. In some embodiments, the additional therapeutic agent is an ICDi (e.g., daunorubicin, docetaxel, doxorubicin, mitoxantrone, oxaliplatin, and paclitaxel). In some embodiments, the additional therapeutic agent is an siRNA (e.g., an siRNA targeting a gene associated with cancer). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In some embodiments, the pharmaceutical composition comprises at least one additional modified RNA oligonucleotide. In some embodiments, the modified RNA oligonucleotide is administered at a dose of about 0.2 mg / kg to about 200 mg / kg. In some embodiments, the modified RNA oligonucleotide is administered at a dose of about 0.2 mg / kg to about 2.0 mg / kg. In some embodiments, the modified RNA oligonucleotide is administered at a dose of about 1.0 mg / kg to about 10.0 mg / kg.

[0021] In some embodiments, provided herein is a single-stranded antisense RNA comprising a sequence complementary to an miRNA or mRNA with a 5' diphosphate (5'pp anti-miRNA or mRNA) or 5' triphosphate modification (5'ppp anti-miRNA or mRNA), preferably a miRNA or mRNA listed in Table 1, Table 2, or Table 3, respectively. Also provided is a RIG-I agonist comprising a 5' diphosphate (5'pp) or 5' triphosphate (5'ppp) modified RNA of at least 10 nucleotides in length that is complementary to an endogenous (preferably tumor-specific) RNA sequence. In some embodiments, the nucleic acid comprises at least one modified nucleotide. In some embodiments, the at least one modified nucleotide is a locked nucleotide.

[0022] In some embodiments, provided herein are compositions and methods comprising 5'pp or 5'ppp anti-miRNA / mRNA for eliciting an immune response against a specific RNA, e.g., an endogenous RNA sequence, for example, to treat cancer and to reduce the risk of developing cancer.

[0023] In some embodiments, the single-stranded antisense RNA is linked to a nanoparticle, said nanoparticle having a diameter of between 10 nm and 30 nm and comprising a polymer coating.

[0024] In some embodiments, the single-stranded antisense RNA is linked to a nanoparticle, the nanoparticle having a diameter of between 10 nm and 30 nm and comprising a polymer coating, hi some embodiments, the polymer coating comprises dextran.

[0025] In some embodiments, the single-stranded antisense RNA is covalently linked at the 3' end to the nanoparticle via a chemical moiety that includes a disulfide bond or a thioether bond. In some embodiments, the nanoparticle is magnetic.

[0026] Also provided herein is a pharmaceutical composition comprising the single-stranded antisense RNA described herein.Furthermore, provided herein is a method for treating cancer or reducing the risk of developing cancer in a subject.The method comprises administering a therapeutically effective amount of the single-stranded antisense RNA described herein to a subject having cancer or at risk of developing cancer.In some embodiments, the cancer is selected from the group consisting of bladder cancer, blood cancer, bone cancer, brain cancer, breast cancer, colon cancer, kidney cancer, liver cancer, lung cancer, skin cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, stomach cancer, thyroid cancer, and uterine cancer.

[0027] In some embodiments, administration results in a reduction or stabilization of tumor size in the subject's lymph nodes, or a reduction in the rate of metastatic tumor growth.In some embodiments, the single-stranded antisense RNA is administered to the subject in two or more doses.In some embodiments, the single-stranded antisense RNA is administered to the subject at least once a week.In some embodiments, the single-stranded antisense RNA is administered to the subject by intravenous, subcutaneous, intraarterial, intramuscular, or intraperitoneal administration.In some embodiments, the subject is further administered a chemotherapeutic agent.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs.Methods and materials for use in the present invention are described herein; other suitable methods and materials known in the art can also be used.Materials, methods, and examples are illustrative only and are not intended to be limiting.All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety.In case of conflict, the present specification, including definitions, will control.Other features and advantages of the present invention will be apparent from the following detailed description and drawings, and the claims. [Brief description of the drawings]

[0029] [Figure 1]FIG. 1 is a schematic diagram of the delivery of 5' triphosphorylated antisense tsRNA delivered to tumors and metastases using the nanoparticle delivery system described herein. Antisense tsRNA and tumor-specific tsRNA produce 5' ppp-dsRNA, a potent RIG-I agonist, upon hybridization. Activation of the RIG-I signaling pathway results in a type I IFN-induced immune response specific to the tumor microenvironment. This immune response is characterized by the activation of dendritic cells (DCs), natural killer cells (NKs), and macrophages. This process involves effective tumor antigen presentation by activated DCs and macrophages as well as T cell maturation, activation, and tumor cell killing. Concurrently, regulatory T cells (Tregs) are inhibited, reducing their immunosuppressive effect on the antitumor immune response. Importantly, a memory T cell subpopulation is generated that induces complete immune rejection of the tumor as foreign upon rechallenge. Together, these processes result in complete remission and resistance to cancer recurrence.

[0030] [Figure 2A-2B] Figure 2 provides summary data showing the ability of ss-ppp-miRNA-21 to induce RIG-I activation in the human RIG-I luciferase reporter cell line HEK-Lucia™ RIG-I. High expression of RIG-I in cells was confirmed using Western blot (Figure 2A). Highly significant enhancement of luciferase activity was observed in RIG-I overexpressing cells compared to null cells (Figure 2B). Dose levels of 2 μg / mL, 4 μg / mL, and 8 μg / mL of ss-ppp-miRNA-21 were evaluated in HEK-Lucia™ RIG-I. Significant RIG-I activation was observed at all three dose levels of ss-ppp-miRNA-21 tested (Figure 2C). Dose-dependent activation of caspase 3 / 7 was observed, which was more pronounced in the presence of 5'-ppp (Figure 2D). A dose-dependent decrease in tumor cell viability was also observed when the ss-ppp-miRNA-21 RIG-I agonist was used ( Fig. 2E ). [Fig. 2C-2D]Figure 2 provides summary data showing the ability of ss-ppp-miRNA-21 to induce RIG-I activation in the human RIG-I luciferase reporter cell line HEK-Lucia™ RIG-I. High expression of RIG-I in cells was confirmed using Western blot (Figure 2A). Highly significant enhancement of luciferase activity was observed in RIG-I overexpressing cells compared to null cells (Figure 2B). Dose levels of 2 μg / mL, 4 μg / mL, and 8 μg / mL of ss-ppp-miRNA-21 were evaluated in HEK-Lucia™ RIG-I. Significant RIG-I activation was observed at all three dose levels of ss-ppp-miRNA-21 tested (Figure 2C). Dose-dependent activation of caspase 3 / 7 was observed, which was more pronounced in the presence of 5'-ppp (Figure 2D). A dose-dependent decrease in tumor cell viability was also observed when the ss-ppp-miRNA-21 RIG-I agonist was used ( Fig. 2E ). [Figure 2E] Figure 2 provides summary data showing the ability of ss-ppp-miRNA-21 to induce RIG-I activation in the human RIG-I luciferase reporter cell line HEK-Lucia™ RIG-I. High expression of RIG-I in cells was confirmed using Western blot (Figure 2A). Highly significant enhancement of luciferase activity was observed in RIG-I overexpressing cells compared to null cells (Figure 2B). Dose levels of 2 μg / mL, 4 μg / mL, and 8 μg / mL of ss-ppp-miRNA-21 were evaluated in HEK-Lucia™ RIG-I. Significant RIG-I activation was observed at all three dose levels of ss-ppp-miRNA-21 tested (Figure 2C). Dose-dependent activation of caspase 3 / 7 was observed, which was more pronounced in the presence of 5'-ppp (Figure 2D). A dose-dependent decrease in tumor cell viability was also observed when the ss-ppp-miRNA-21 RIG-I agonist was used ( Fig. 2E ).

[0031] [Figure 3A]Figure 3 provides summary data showing induction of RIG-I signaling by ss-ppp-miRNA-21 agonists in HEK-Lucia™ RIG-I cells transiently transfected with increasing concentrations of synthetic mature miRNA-21 mimics. Cells were transfected with 0 ng / mL, 0.3 ng / mL, 3 ng / mL, 30 ng / mL, and 300 ng / mL concentrations of synthetic mature miRNA-21 mimics; highly significant induction of RIG-I signaling by ss-ppp-miRNA-21 agonists was observed in cells transfected with 30 and 300 ng / ml of synthetic mature miRNA-21 mimics; 5'-ppp deleted ss-miRNA-21 failed to cause detectable RIG-I activation (Figure 3A). Analysis of the dose-dependence of RIG-I activation as a function of miRNA-21 mimic concentration determined an EC50 of 83.4 ng / ml of miRNA-21 mimic using ss-ppp-miRNA-21; in contrast, the calculated EC50 using 5'-ppp deleted ss-miRNA-21 was 357.9 ng / ml (Figure 3B). Treatment of B16-F10 mouse melanoma cells with increasing concentrations of RIG-I agonists caused a dose-dependent increase in IFN-β secretion; in contrast, a commercially available ds-ppp-RNA agonist failed to stimulate IFN-β secretion (Figure 3C). Caspase 3 / 7 activation as a function of miRNA-21 mimic concentration was measured in B16-F10 murine (muring) melanoma cells; a dose-dependent increase in caspase 3 / 7 activation was observed, with the effect being significantly higher in cells treated with ss-ppp-miRNA-21 compared to 5'-ppp-deficient ss-miRNA-21 and comparable to the ds-ppp-RNA positive control (Figure 3D). Figure 3E is a Western blot showing that miR-21-transfected and ss-ppp-miRNA-21-treated cells showed a dramatic upregulation of RIG-I above the levels seen for the ds-ppp-RNA positive control oligonucleotide.FIG. 3F is a Western blot showing that increased reactivity in miR-21-transfected and ss-ppp-miRNA-21-treated cells was not associated with increased expression of p65, indicating that the increased reactivity specifically reflected target phosphorylation. [Figure 3B-3C]Figure 3 provides summary data showing induction of RIG-I signaling by ss-ppp-miRNA-21 agonists in HEK-Lucia™ RIG-I cells transiently transfected with increasing concentrations of synthetic mature miRNA-21 mimics. Cells were transfected with 0 ng / mL, 0.3 ng / mL, 3 ng / mL, 30 ng / mL, and 300 ng / mL concentrations of synthetic mature miRNA-21 mimics; highly significant induction of RIG-I signaling by ss-ppp-miRNA-21 agonists was observed in cells transfected with 30 and 300 ng / ml of synthetic mature miRNA-21 mimics; 5'-ppp deleted ss-miRNA-21 failed to cause detectable RIG-I activation (Figure 3A). Analysis of the dose-dependence of RIG-I activation as a function of miRNA-21 mimic concentration determined an EC50 of 83.4 ng / ml of miRNA-21 mimic using ss-ppp-miRNA-21; in contrast, the calculated EC50 using 5'-ppp deleted ss-miRNA-21 was 357.9 ng / ml (Figure 3B). Treatment of B16-F10 mouse melanoma cells with increasing concentrations of RIG-I agonists caused a dose-dependent increase in IFN-β secretion; in contrast, a commercially available ds-ppp-RNA agonist failed to stimulate IFN-β secretion (Figure 3C). Caspase 3 / 7 activation as a function of miRNA-21 mimic concentration was measured in B16-F10 murine (muring) melanoma cells; a dose-dependent increase in caspase 3 / 7 activation was observed, with the effect being significantly higher in cells treated with ss-ppp-miRNA-21 compared to 5'-ppp-deficient ss-miRNA-21 and comparable to the ds-ppp-RNA positive control (Figure 3D). Figure 3E is a Western blot showing that miR-21-transfected and ss-ppp-miRNA-21-treated cells showed a dramatic upregulation of RIG-I above the levels seen for the ds-ppp-RNA positive control oligonucleotide.FIG. 3F is a Western blot showing that increased reactivity in miR-21-transfected and ss-ppp-miRNA-21-treated cells was not associated with increased expression of p65, indicating that the increased reactivity specifically reflected target phosphorylation. [Figure 3D-3E]Figure 3 provides summary data showing induction of RIG-I signaling by ss-ppp-miRNA-21 agonists in HEK-Lucia™ RIG-I cells transiently transfected with increasing concentrations of synthetic mature miRNA-21 mimics. Cells were transfected with 0 ng / mL, 0.3 ng / mL, 3 ng / mL, 30 ng / mL, and 300 ng / mL concentrations of synthetic mature miRNA-21 mimics; highly significant induction of RIG-I signaling by ss-ppp-miRNA-21 agonists was observed in cells transfected with 30 and 300 ng / ml of synthetic mature miRNA-21 mimics; 5'-ppp deleted ss-miRNA-21 failed to cause detectable RIG-I activation (Figure 3A). Analysis of the dose-dependence of RIG-I activation as a function of miRNA-21 mimic concentration determined an EC50 of 83.4 ng / ml of miRNA-21 mimic using ss-ppp-miRNA-21; in contrast, the calculated EC50 using 5'-ppp deleted ss-miRNA-21 was 357.9 ng / ml (Figure 3B). Treatment of B16-F10 mouse melanoma cells with increasing concentrations of RIG-I agonists caused a dose-dependent increase in IFN-β secretion; in contrast, a commercially available ds-ppp-RNA agonist failed to stimulate IFN-β secretion (Figure 3C). Caspase 3 / 7 activation as a function of miRNA-21 mimic concentration was measured in B16-F10 murine (muring) melanoma cells; a dose-dependent increase in caspase 3 / 7 activation was observed, with the effect being significantly higher in cells treated with ss-ppp-miRNA-21 compared to 5'-ppp-deficient ss-miRNA-21 and comparable to the ds-ppp-RNA positive control (Figure 3D). Figure 3E is a Western blot showing that miR-21-transfected and ss-ppp-miRNA-21-treated cells showed a dramatic upregulation of RIG-I above the levels seen for the ds-ppp-RNA positive control oligonucleotide.FIG. 3F is a Western blot showing that increased reactivity in miR-21-transfected and ss-ppp-miRNA-21-treated cells was not associated with increased expression of p65, indicating that the increased reactivity specifically reflected target phosphorylation. [Figure 3F]Figure 3 provides summary data showing induction of RIG-I signaling by ss-ppp-miRNA-21 agonists in HEK-Lucia™ RIG-I cells transiently transfected with increasing concentrations of synthetic mature miRNA-21 mimics. Cells were transfected with 0 ng / mL, 0.3 ng / mL, 3 ng / mL, 30 ng / mL, and 300 ng / mL concentrations of synthetic mature miRNA-21 mimics; highly significant induction of RIG-I signaling by ss-ppp-miRNA-21 agonists was observed in cells transfected with 30 and 300 ng / ml of synthetic mature miRNA-21 mimics; 5'-ppp deleted ss-miRNA-21 failed to cause detectable RIG-I activation (Figure 3A). Analysis of the dose-dependence of RIG-I activation as a function of miRNA-21 mimic concentration determined an EC50 of 83.4 ng / ml of miRNA-21 mimic using ss-ppp-miRNA-21; in contrast, the calculated EC50 using 5'-ppp deleted ss-miRNA-21 was 357.9 ng / ml (Figure 3B). Treatment of B16-F10 mouse melanoma cells with increasing concentrations of RIG-I agonists caused a dose-dependent increase in IFN-β secretion; in contrast, a commercially available ds-ppp-RNA agonist failed to stimulate IFN-β secretion (Figure 3C). Caspase 3 / 7 activation as a function of miRNA-21 mimic concentration was measured in B16-F10 murine (muring) melanoma cells; a dose-dependent increase in caspase 3 / 7 activation was observed, with the effect being significantly higher in cells treated with ss-ppp-miRNA-21 compared to 5'-ppp-deficient ss-miRNA-21 and comparable to the ds-ppp-RNA positive control (Figure 3D). Figure 3E is a Western blot showing that miR-21-transfected and ss-ppp-miRNA-21-treated cells showed a dramatic upregulation of RIG-I above the levels seen for the ds-ppp-RNA positive control oligonucleotide.FIG. 3F is a Western blot showing that increased reactivity in miR-21-transfected and ss-ppp-miRNA-21-treated cells was not associated with increased expression of p65, indicating that the increased reactivity specifically reflected target phosphorylation. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0032] Detailed Description 1. Overview miRNAs in Cancer Small RNAs, such as miRNAs, exert their regulatory functions from within a ribonucleoprotein complex called RISC (RNA-induced silencing complex). The core subunits of RISC are small RNAs bound to members of the Argonaute family of proteins. Argonautes use small RNAs as guides to identify complementary target transcripts for silencing through various mechanisms. miRNAs are generally captured by the human Argonaute 2 protein (AGO2) and, while associated with AGO2, can regulate gene expression by base pairing with complementary mRNA targets. The miRNAs captured by AGO2 serve as guide RNAs to accept and hybridize with the complementary RNA target, forming a double-stranded RNA duplex. Highly complementary RNA targets have been shown to facilitate the release of the guide RNA:target RNA duplex from AGO2.

[0033] Retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) are important RNA sensors that mediate the transcriptional induction of type I interferons and other genes that collectively establish antiviral host responses (Yong HY, Luo D. 2018;9:1379). RIG-I is expressed in virtually all cell types, including tumor cells, and is a promising alternative for enhancing the efficacy of ICIs (immune checkpoint inhibitors) (Heidegger S. et al., 2019. EBioMedicine. 41:146, Poeck H., et al. 2008. Nat. Med. 14:1256). Preclinical studies have shown that systemic delivery of synthetic RIG-I agonists inhibits tumor growth by a mechanism similar to that which induces the elimination of virally infected cells (Poeck H., et al. 2008. 5'-triphosphate-siRNA: turning gene silencing and Rig-I activation against melanoma. Nat. Med. 14:1256). RIG-I engagement results in preferential tumor cell death (by intrinsic or extrinsic apoptosis and inflammasome-induced pyroptosis) and IFN-I-mediated activation of the innate and adaptive immune systems (see Figure 1 in Elion DL., et al. 2018. Oncotarget. 9:29007). RGT100, a specific RIG-I agonist, is currently in Phase I / II clinical trials for the treatment of advanced solid tumors and lymphomas (NCT03065023) (Elion DL., et al. 2018. Oncotarget. 9:29007).

[0034] Without being bound by theory, the RIG-I pathway can be selectively activated in cancer cells by in situ generation of 5'ppp-dsRNA after introduction of miRNA (5'ppp anti-miRNA) or 5'ppp RNA complementary to mRNA that is specifically expressed in these cells according to the disclosed methods and compositions (Figure 1). The same or similar selective activation of the RIG-I pathway is expected from 5'pp-dsRNA. As a result, the anti-tumor immune capacity of tumor microenvironment (TME) can be revealed by activation of RIG-I signaling pathway in conjunction with the simultaneous activation of certain tumor suppressor gene(s) simply by using single-stranded RNA.

[0035] The utility of RIG-I agonist triphosphate RNA for melanoma therapy has been recently validated (Helms MW. et al. 2019. Utility of the RIG-I Agonist Triphosphate RNA for Melanoma Therapy. Mol Cancer Ther. 2019;18(12):2343-2356). It is also noted that the similarity of triphosphate RNA (5'ppp-dsRNA) (and 5'pp), the natural ligand of RIG-I, with small interfering RNA (siRNA) has led to the development of bifunctional siRNA for simultaneous silencing of oncogenic or immunosuppressive targets as well as activation of the RIG-I signaling pathway (Poeck H., et al. 2008. Nat. Med. 14:1256, Ellermeier J. et al. 2013. 2013;73(6):1709-1720). The combined approach launches a dual-targeted attack against tumor cells and shows promising results.

[0036] MicroRNAs (miRNAs) are small non-coding RNAs that can regulate a variety of target genes. miRNAs regulate gene expression at the post-transcriptional level by base pairing with complementary sequences in messenger RNA (mRNA). This interaction results in gene silencing by cleaving the mRNA strand, destabilizing the mRNA by shortening its polyA tail, or inhibiting the translation of the mRNA into protein. miRNAs control the expression of approximately 60% of protein-coding genes and regulate cell metabolism, proliferation, differentiation, and apoptosis (Huang Z, Shi J, Gao Y, et al. HMDD v3.0: a database for experimentally supported human microRNA-disease associations. Nucleic Acids Res. 2019;47(D1):D1013-D1017).

[0037] Under normal physiological conditions, miRNAs function in a feedback mechanism by protecting important biological processes including cell proliferation, differentiation and apoptosis (Reddy, KB, Cancer Cell International, 2015, 15:38). miRNAs are expressed in various organs and cells and regulate both pro- and anti-inflammatory effects. miRNAs have emerged as key regulators of inflammatory responses in a wide range of human diseases (Tahamtan, A., et al., Front Immunol. 2018; 9: 1377).

[0038] Dysregulation of miRNA expression is associated with various disease manifestations, such as cancer. More than 50% of miRNA genes have been shown to be located in cancer-related genomic regions (Di Leva, G., et al., Annu Rev Pathol. 2014; 9():287-314). Dysregulation of miRNA has been shown to play a fundamental role in the initiation, progression and dissemination of several types of cancer. For example, miRNA dysregulation is known to be associated with chronic lymphocytic leukemia, and miR-15a and miR-16-1 have been shown to be downregulated or deleted in the majority of patients with chronic lymphocytic leukemia (Calin GA, et al., Proc Natl Acad Sci USA; 2002; pp. 15524-15529). Other miRNAs, such as miR-21, miR-26, and miR-29a, have been shown to be preferentially expressed in cancer cells and / or tumor cell microenvironments (Chakraborty, C., et al., Mol Ther Nucleic Acids. 2020 Jun 5; 20: 606-620). Thus, therapeutic approaches against endogenous miRNAs offer a highly promising approach to target the tumor microenvironment and treat various cancers associated with miRNA dysregulation.

[0039] RIG-I-mediated RNA-induced immunogenic cell death Retinoic acid-inducible gene I (RIG-I), a pattern recognition receptor, recognizes specific molecular patterns on viral RNA to induce type I interferon. RIG-I consists of two N-terminal caspase recruitment domains (CARDs), a central RNA helicase domain, and a C-terminal RNA-binding domain. The C-terminal domain (CTD) of RIG-I recognizes the 5'-ppp group of non-self RNA and undergoes a conformational change to induce IFN-β production (Lee, M., et al., Nucleic Acids Research, 2016, Vol. 44, No. 17). Structural and biochemical studies have shown that RIG-I CTD can bind to blunt-ended dsRNA containing 5'-ppp. Studies have shown that 5'-ppp dsRNA binds strongly to the RIG-I CTD and stimulates interferon production more efficiently than 5'-OH dsRNA (Pichlmair, A., et al., 2006, Science, 314, 997-1001; Vela, A., et al., 2012, J. Biol. Chem., 287, 42564-42573).

[0040] RIG-I-like receptor ligands have been used as a promising strategy for the treatment of solid malignancies including melanoma, pancreatic cancer and breast cancer in preclinical models. A striking feature of RIG-I is its ubiquitous expression and signaling outcomes, among others, IFN-I production and preferential tumor cell death, two key factors in potent T cell responses. Despite the potential success of the RIG-I approach, the immune system is powerful and incompletely understood, warranting cautious optimism and thorough examination of the caveats associated with innate immune activation, including possible on-target induction of autoimmunity, or induction of a cytokine "storm" that could pose a threat to patient safety. It is important to note that because RIG-I is expressed in many cells in the human body, the consequences of RIG-I activation are wide-ranging and can drive symptoms such as fatigue, depression and cognitive impairment.

[0041] This disclosure presents a strategy to mitigate potential side effects associated with RIG-I therapy by restricting RIG-I activation to the tumor microenvironment. Specifically, tumor-specific miRNAs are used as templates for the assembly of 5'ppp-dsRNA RIG-I agonists. To accomplish this, the method of the present invention introduces an exogenously supplied 5'ppp single-stranded oligonucleotide (e.g., RNA) that is complementary to the miRNA. The complementary miRNA (endogenous) and the single-stranded 5'ppp oligonucleotide (e.g., RNA) (exogenous) hybridize to form a 5'ppp-dsRNA that promotes release from AGO2. The released 5'ppp-dsRNA facilitates robust activation of RIG-I signaling. Through this process, RIG-I activation is restricted to cancer cells, essentially eliminating non-specific immune system activation elsewhere in the body. An additional level of specificity can be achieved by coupling the exogenous single-stranded 5'ppp oligonucleotide to a nanoparticle carrier that preferentially localizes to the tumor microenvironment. As shown in Figure 1, substitution of the 5(p)pp-anti-mRNA or -miRNA approach described herein for standard RNAi techniques to silence target miRNA or mRNA can promote RIG-I activation inducing RIG-I signaling and cell death, thereby improving treatment outcomes. In vivo, 5'(p)pp-anti-mRNA / miRNA can hybridize to and silence the target mRNA or miRNA, resulting in the formation of 5'(p)pp-ds-mRNA / -miRNA that binds to and activates RIG-I protein, resulting in RIG-I signaling and cancer cell death.

[0042] 2.Definition The terms used herein generally have their usual meaning in the art, in the context of this disclosure, and in the specific context in which each term is used.Certain terms are discussed below or elsewhere in the specification to provide practitioners with further guidance in describing the compositions and methods of the present disclosure and the methods of making and using them.The scope or meaning of any of the terms used will be clear from the specific context in which the term is used.

[0043] "About" and "approximately" generally refer to an acceptable degree of error for the quantity measured given the nature or precision of the measurement. Typically, exemplary degrees of error are within 20 percent (%), preferably within 10%, and more preferably within 5% of a given value or range of values.

[0044] Alternatively, and particularly in biological systems, the terms "about" and "approximately" may mean values ​​that are within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold of a given value. Numerical quantities given herein are approximations unless otherwise stated, meaning that the term "about" or "approximately" can be inferred when not expressly stated.

[0045] The terms "a" and "an" include plural referents unless the context in which the term is used clearly distinguishes otherwise. The terms "a" (or "an"), as well as "one or more" and "at least one" can be used interchangeably herein. Furthermore, as used herein, "and / or" should be taken as a specific disclosure of each of two or more specified features or components, with or without the other. Thus, the term "and / or" used in phrases such as "A and / or B" herein is intended to include "A and B", "A or B", "A (only)", and "B (only)". Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (only); B (only); and C (only).

[0046] The numerical ranges disclosed herein are inclusive of the numbers defining the range.

[0047] The term "nucleic acid" refers to any single- or double-stranded polynucleotide (e.g., DNA or RNA, cDNA, of semisynthetic or synthetic origin). The term "nucleic acid" includes oligonucleotides containing at least one modified nucleotide (e.g., containing a modification in the base and / or in the sugar) and / or a modification in the phosphodiester bond linking two nucleotides. In some embodiments, the nucleic acid may contain at least one modified ribose, such as 2'-fluoro (2'-F). In some embodiments, the nucleic acid may contain a 5' uncapped triphosphate or diphosphate. Non-limiting examples of nucleic acids are described herein. Further examples of nucleic acids are known in the art.

[0048] The nucleic acids disclosed herein may include non-naturally occurring oligonucleotide sequences. Such variants necessarily have less than 100% sequence identity or similarity with the starting molecule. In certain embodiments, the variants have a nucleic acid sequence with less than about 75%-100%, more preferably less than about 80%-100%, more preferably less than about 85%-100%, more preferably less than about 90%-100% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), and most preferably less than about 95%-100% amino acid sequence identity or similarity with the nucleic acid sequence of the starting (e.g., naturally occurring or wild-type) oligonucleotide, e.g., over the length of the variant molecule. In certain aspects, the oligonucleotide sequence is fully complementary to the target sequence. In other words, the duplex region formed by the oligonucleotide and its target exhibits a fully complementary sequence (i.e., does not contain any base pair mismatches or gaps), not taking into account the overhangs. In certain embodiments, the oligonucleotide and the target sequence do not contain more than 0-5 base pair mismatches in the duplex region.

[0049] The tumor-specific RNA of the present disclosure may include microRNA (miRNA) or messenger RNA (mRNA). The miRNA or mRNA of the present disclosure may include oncogenic miRNA or mRNA. Oncogenic miRNA or mRNA is a miRNA or mRNA that is thought to be involved or associated with tumor / tumors and / or cancer.

[0050] The term "diamagnetic" is used to describe a composition that has a relative magnetic permeability less than or equal to 1 and is repelled by a magnetic field.

[0051] The term "paramagnetic" is used to describe a composition that develops a magnetic moment only in the presence of an externally applied magnetic field.

[0052] The term "ferromagnetic" is used to describe a composition that is strongly susceptible to a magnetic field and can retain magnetic properties (magnetic moment) after an externally applied magnetic field is removed.

[0053] The term "nanoparticle" refers to an object having a diameter of about 2 nm to about 200 nm (e.g., 10 nm to 200 nm, 2 nm to 100 nm, 2 nm to 40 nm, 2 nm to 30 nm, 2 nm to 20 nm, 2 nm to 15 nm, 100 nm to 200 nm, and 150 nm to 200 nm). Non-limiting examples of nanoparticles include the nanoparticles described herein.

[0054] The term "magnetic nanoparticle" means a nanoparticle (as defined herein) that is magnetic (e.g., any of the nanoparticles described herein). Non-limiting examples of magnetic nanoparticles are described herein. Additional magnetic nanoparticles are known in the art.

[0055] As used herein, the term "subject" or "patient" refers to any mammal (e.g., a human or veterinary subject, such as a dog, cat, horse, cow, goat, sheep, mouse, rat, or rabbit) to which the compositions or methods of the disclosure can be administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. A subject may seek or require treatment, may request treatment, is undergoing treatment, will undergo treatment, or is under the care of a trained professional for a particular disease or condition.

[0056] As used herein, the term "tumor" refers to an abnormal mass of tissue and / or cells, including both solid masses (e.g., as in solid tumors) or fluid masses (e.g., as in blood cancers) or any cancer cells found within the tumor, in which the growth of the mass exceeds and is out of step with the growth of normal tissue. Tumors may be solid (e.g., lymphomas, sarcomas, or carcinomas) or non-solid (e.g., tumors of the blood, bone marrow, or lymph nodes, e.g., leukemias). Tumors can be defined as "benign" or "malignant" depending on the following characteristics: degree of cellular differentiation, including morphology and function, rate of growth, local invasion, and metastasis. "Benign" tumors are well differentiated, have characteristically slower growth than malignant tumors, and may remain localized at the site of origin. Furthermore, in some cases, benign tumors do not have the ability to infiltrate, invade, or metastasize to distant sites. "Malignant" tumors may be poorly differentiated (anaplastic) and have characteristically rapid growth accompanied by progressive infiltration, invasion, and destruction of surrounding tissue. In addition, malignant tumors may have the ability to metastasize to distant sites. Thus, cancer cells are cells found within abnormal masses of tissue whose growth is not coordinated with that of normal tissue.

[0057] As used herein, the term "microenvironment" means any part or region of a tissue or body that has a fixed or temporary physical or chemical difference from other regions of the tissue or body.

[0058] As used herein, the term "tumor microenvironment" refers to the environment in which a tumor resides, which is the acellular area within a tumor and the area just outside the neoplastic tissue, but does not belong to the intracellular compartment of the cancer cells themselves. It also refers to cells found within the tumor microenvironment, such as fibroblasts, endothelial cells, adipocytes, pericytes, neuroendocrine cells, or immune cells (macrophages, B cells, T cells, etc.) in the tumor microenvironment. Tumors and tumor microenvironment are closely associated and constantly interact. Tumors change their microenvironment, which can affect how tumors grow and spread. Typically, tumor microenvironments have a low pH in the range of 5.0-7.0, or in the range of 5.0-6.8, or in the range of 5.8-6.8, or in the range of 6.2-6.8. Normal physiological pH, on the other hand, is in the range of 7.2-7.8. It is also known that the tumor microenvironment has lower concentrations of glucose and other nutrients, but higher concentrations of lactate, compared to plasma. Furthermore, the tumor microenvironment can have temperatures as much as 0.3-1°C higher than normal physiological temperatures.

[0059] The term "non-tumor microenvironment" refers to the microenvironment at a site other than a tumor.

[0060] The term "metastasis" refers to the migration of cancer cells present in a primary tumor to secondary, non-adjacent tissues in a subject. Non-limiting examples of metastasis include metastasis from a primary tumor to lymph nodes (e.g., regional lymph nodes), bone tissue, lung tissue, liver tissue, and / or brain tissue. The term metastasis also includes the migration of metastatic cancer cells found in lymph nodes to secondary tissues (e.g., bone tissue, liver tissue, or brain tissue). In some non-limiting embodiments, the cancer cells present in a primary tumor are breast cancer cells, colon cancer cells, kidney cancer cells, lung cancer cells, skin cancer cells, ovarian cancer cells, pancreatic cancer cells, prostate cancer cells, rectal cancer cells, gastric cancer cells, thyroid cancer cells, or uterine cancer cells. Further aspects and examples of metastasis are known in the art or described herein.

[0061] The term "primary tumor" refers to a tumor present at the anatomical site where tumor progression began and progressed to result in a cancer mass. In some embodiments, a physician may not be able to clearly identify the site of the primary tumor in a subject.

[0062] The term "metastatic tumor" refers to a tumor in a subject that originates from tumor cells that have metastasized from a primary tumor in the subject. In some embodiments, a physician may not be able to clearly identify the site of the primary tumor in the subject.

[0063] Preferred methods and materials are described herein, although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the methods and compositions of the disclosure. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0064] 3. Endogenous tumor-specific RNA Compositions and methods for eliciting immune responses by endogenous tumor-specific RNA are described herein. In some embodiments, the present disclosure provides a method for treating cancer, comprising administering a single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to an endogenous tumor-specific RNA that is highly expressed in tumor cells compared to non-tumor cells. In some embodiments, the present disclosure provides a method for selectively activating RIG-I in tumor cells, comprising administering a single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide comprises a sequence that is complementary to an endogenous tumor-specific RNA, wherein the tumor-specific RNA is specific to tumor cells, and wherein RIG-I is selectively activated in tumor cells that highly express the tumor-specific RNA. The endogenous tumor-specific RNA of the present disclosure can be selected from miRNA or mRNA. The endogenous tumor-specific RNA of the present disclosure can further be selected from oncogenic miRNA or oncogenic mRNA. Oncogenic miRNAs or mRNAs are miRNAs or mRNAs that are thought to be involved in cancer.

[0065] miRNAs have been shown to be components in many cancers and may provide new avenues for cancer treatment. miRNAs of the disclosed methods and compositions include, but are not limited to, miR-9; miR-10b; miR-17; miR-18; miR-19b; miR-21; miR-26a; miR-29a; miR-92a; miR-106b / 93; miR-125b; miR-130a; miR-155; miR-181a; miR-200s; miR-210; miR-210-3p; miR-221; miR-222; miR-221 / 222; miR-335; miR-498; miR-504; miR-1810; miR-1908; miR-224 / 452; and miR-181 / 340. A complete list including sequences is available at OncomiRDB (Wang et al. Bioinformatics. 2014;30(15):2237-2238; mircancer.ecu.edu / browse.jsp; US20150004221A1; see also Tables 1 and 2).

[0066] One such miRNA example is miR-10b. It has been shown that upregulation of miR-10b is responsible for migration and invasion of metastatic tumor cells and the viability of these cells (Tian Y., et al., J. Biol. Chem. 2010; 285:7986-7994). Analysis of miR-10b levels in 40 human esophageal cancer samples and their paired normal adjacent tissues showed elevated expression of miR-10b in 95% (38 out of 40) of the sampled cancer tissues (Tian Y., et al., J. Biol. Chem. 2010; 285:7986-7994). There are many other miRNAs that also play a role in carcinogenesis, which are related targets; these and other miRNAs are potential new classes of targets for therapeutic inhibition (Nguyen DD, Chang S. Int J Mol Sci. 2017; 19(1):65). For example, miR-21 has been shown to be involved in various cancer cells and tissues, including but not limited to glioblastoma, breast cancer, colorectal cancer, lung cancer, pancreatic cancer, skin cancer, liver cancer, gastric cancer, cervical cancer, and thyroid cancer, as well as various lymphoid and hematopoietic cancers and neuroblastoma. miR-21 represents an example of a single miRNA that targets multiple oncogenic signaling cascades and causes global dysregulation of gene expression networks in cancer cells (Pan, X., et al., Cancer Biol. Ther. 2010; 10:1224-1232).Increased miR-21 expression was found to target various essential tumor suppressors such as phosphatase and tensin homolog (PTEN), PDCD4, RECK, and TPM1, facilitating cell proliferation, survival, metastasis, and acquisition of chemoresistance phenotype (Meng, F., et al., Gastroenterology. 2007; 133:647-658; Peralta-Zaragoza O., et al., BMC Cancer. 2016; 16:215; Zhang, X., et al., BMC Cancer. 2016;16:86; Reis ST., et al., BMC Urol. 2012;12:14; Zhu S., et al., J. Biol. Chem. 2007;282:14328-14336).

[0067] miR-155 is epigenetically regulated by BRCA1 and is overexpressed in breast, ovarian, and lung cancers. miR-155 has been investigated as a potential biomarker for B-cell cancer. Overexpression of miR-155 blocks B-cell differentiation by downregulating SHIP1 and C / EBPβ genes, leading to improved cell survival due to activation of the PI3K-Akt and MAPK pathways. In other cancers, such as glioma, overexpression of miR-155 promotes tumorigenesis progression via negative correlation with caudal homeobox 1 protein (CDX1) expression in glioma tissues.

[0068] miR-210 is a well-documented miRNA involved in various aspects of cancer development, progression and metastasis. Increased miR-210 expression was observed in bone metastatic and non-bone metastatic prostate cancer tissues. Expression was found to be elevated in bone metastatic prostate cancer tissues compared to non-bone metastatic prostate cancer tissues, and was shown to promote epithelial-mesenchymal transition and bone metastasis of prostate cancer cells by NF-κB signaling pathway (Ren D., et al., Mol Cancer. 2017; 16: 117). Other miRNAs such as miRNA-221 were found to be upregulated in breast cancer, glioma, hepatocellular carcinoma, pancreatic adenocarcinoma, melanoma, chronic lymphocytic leukemia, and papillary thyroid carcinoma (Brognara E., et al., Int J Oncol. 2012 Dec;41(6):2119-27).

[0069] In some embodiments, the present disclosure provides a method for treating cancer, comprising administering a single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to an endogenous tumor-specific RNA that is highly expressed in tumor cells compared to non-tumor cells. In some embodiments, the present disclosure provides a method for selectively activating RIG-I in tumor cells, comprising administering a single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide comprises a sequence that is complementary to an endogenous tumor-specific RNA, wherein the tumor-specific RNA is specific to tumor cells, and wherein RIG-I is selectively activated in tumor cells that highly express the tumor-specific RNA. In some embodiments, the endogenous tumor-specific RNA is an oncogenic miRNA. In some embodiments, the endogenous tumor-specific RNA is not an oncogenic miRNA.

[0070] In some embodiments, the endogenous tumor-specific RNA is a miRNA selected from the group consisting of miR-9; miR-10b; miR-17; miR-18; miR-19b; miR-21; miR-26a; miR-29a; miR-92a; miR-106b / 93; miR-125b; miR-130a; miR-155; miR-181a; miR-200s; miR-210; miR-210-3p; miR-221; miR-222; miR-221 / 222; miR-335; miR-498; miR-504; miR-1810; miR-1908; miR-224 / 452; and miR-181 / 340. In some embodiments, the endogenous tumor-specific RNA is miR-9. In some embodiments, the endogenous tumor-specific RNA is miR-10b. In some embodiments, the endogenous tumor-specific RNA is miR-17. In some embodiments, the endogenous tumor-specific RNA is miR-18. In some embodiments, the endogenous tumor-specific RNA is miR-19b. In some embodiments, the endogenous tumor-specific RNA is miR-21. In some embodiments, the endogenous tumor-specific RNA is miR-26a. In some embodiments, the endogenous tumor-specific RNA is miR-29a. In some embodiments, the endogenous tumor-specific RNA is miR-92a. In some embodiments, the endogenous tumor-specific RNA is miR-106b / 93. In some embodiments, the endogenous tumor-specific RNA is miR-125b. In some embodiments, the endogenous tumor-specific RNA is miR-130a. In some embodiments, the endogenous tumor-specific RNA is miR-155. In some embodiments, the endogenous tumor-specific RNA is miR-181a. In some embodiments, the endogenous tumor-specific RNA is miR-200s. In some embodiments, the endogenous tumor-specific RNA is miR-210. In some embodiments, the endogenous tumor-specific RNA is miR-210-3p. In some embodiments, the endogenous tumor-specific RNA is miR-221. In some embodiments, the endogenous tumor-specific RNA is miR-222. In some embodiments, the endogenous tumor-specific RNA is miR-221 / 222.In some embodiments, the endogenous tumor-specific RNA is miR-335. In some embodiments, the endogenous tumor-specific RNA is miR-498. In some embodiments, the endogenous tumor-specific RNA is miR-504. In some embodiments, the endogenous tumor-specific RNA is miR-1810. In some embodiments, the endogenous tumor-specific RNA is miR-1908. In some embodiments, the endogenous tumor-specific RNA is miR-224 / 452. In some embodiments, the endogenous tumor-specific RNA is miR-181 / 340.

[0071] In a preferred embodiment of the present disclosure, the endogenous tumor-specific RNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the endogenous tumor-specific RNA is miR10b. In some embodiments, the endogenous tumor-specific RNA is miR17. In some embodiments, the endogenous tumor-specific RNA is miR18a. In some embodiments, the endogenous tumor-specific RNA is miR18b. In some embodiments, the endogenous tumor-specific RNA is miR19b. In some embodiments, the endogenous tumor-specific RNA is miR21. In some embodiments, the endogenous tumor-specific RNA is miR26a. In some embodiments, the endogenous tumor-specific RNA is miR29a. In some embodiments, the endogenous tumor-specific RNA is miR92a-1. In some embodiments, the endogenous tumor-specific RNA is miR92a-2. In some embodiments, the endogenous tumor-specific RNA is miR155. In some embodiments, the endogenous tumor-specific RNA is miR210. In some embodiments, the endogenous tumor-specific RNA is miR22.

[0072] In some embodiments, the endogenous tumor-specific RNA highly expressed in tumor cells is selected from the group consisting of miR-9; miR-10b; miR-17; miR-18; miR-19b; miR-21; miR-26a; miR-29a; miR-92a; miR-106b / 93; miR-125b; miR-130a; miR-155; miR-181a; miR-200s; miR-210; miR-210-3p; miR-221; miR-222; miR-221 / 222; miR-335; miR-498; miR-504; miR-1810; miR-1908; miR-224 / 452; and miR-181 / 340. In some embodiments, the tumor cells are associated with bone and non-bone metastatic cancer, breast cancer, glioma, hepatocellular carcinoma, pancreatic adenocarcinoma, melanoma, chronic lymphocytic leukemia, papillary thyroid carcinoma, glioblastoma, colorectal cancer, lung cancer, renal cancer, pancreatic cancer, skin cancer, liver cancer, gastric cancer, cervical cancer, thyroid cancer, lymphatic cancer, hematopoietic cancer, neuroblastoma, acute myeloid leukemia, esophageal cancer, osteosarcoma, B-cell lymphoma, lymphocytic leukemia, ovarian cancer, oral cancer, bladder cancer, adenoid cystic carcinoma, anaplastic thyroid carcinoma, astrocytoma, meningioma, retinoblastoma.

[0073] In some embodiments, the tumor cells are associated with bone metastatic cancer. In some embodiments, the tumor cells are associated with non-bone metastatic cancer. In some embodiments, the tumor cells are associated with breast cancer. In some embodiments, the tumor cells are associated with glioma. In some embodiments, the tumor cells are associated with hepatocellular carcinoma. In some embodiments, the tumor cells are associated with pancreatic adenocarcinoma. In some embodiments, the tumor cells are associated with melanoma. In some embodiments, the tumor cells are associated with chronic lymphocytic leukemia. In some embodiments, the tumor cells are associated with papillary thyroid carcinoma. In some embodiments, the tumor cells are associated with glioblastoma. In some embodiments, the tumor cells are associated with colorectal cancer. In some embodiments, the tumor cells are associated with lung cancer. In some embodiments, the tumor cells are associated with kidney cancer. In some embodiments, the tumor cells are associated with pancreatic cancer. In some embodiments, the tumor cells are associated with skin cancer. In some embodiments, the tumor cells are associated with liver cancer. In some embodiments, the tumor cells are associated with gastric cancer. In some embodiments, the tumor cells are associated with cervical cancer. In some embodiments, the tumor cells are associated with thyroid cancer. In some embodiments, the tumor cells are associated with lymphoid cancer. In some embodiments, the tumor cells are associated with hematopoietic cancer. In some embodiments, the tumor cells are associated with neuroblastoma. In some embodiments, the tumor cells are associated with acute myeloid leukemia. In some embodiments, the tumor cells are associated with esophageal cancer. In some embodiments, the tumor cells are associated with osteosarcoma. In some embodiments, the tumor cells are associated with B-cell lymphoma. In some embodiments, the tumor cells are associated with lymphocytic leukemia. In some embodiments, the tumor cells are associated with ovarian cancer. In some embodiments, the tumor cells are associated with oral cancer. In some embodiments, the tumor cells are associated with bladder cancer. In some embodiments, the tumor cells are associated with adenoid cystic carcinoma. In some embodiments, the tumor cells are associated with anaplastic thyroid carcinoma. In some embodiments, the tumor cells are associated with astrocytoma. In some embodiments, the tumor cells are associated with meningioma. In some embodiments, the tumor cells are associated with retinoblastoma.

[0074] Many web-based tools are available for identifying microRNAs involved in human cancer. For a review, see Mar-Aguilar F, Rodriguez-Padilla C, Resendez-Perez D. Web-based tools for microRNAs involved in human cancer, Oncol Lett. 2016;11(6):3563-3570. Databases can be mined for miRNAs associated with specific types of cancer, or simultaneously for the behavior of specific miRNAs in different malignancies, and sequences of specific miRNAs can be easily retrieved from various databases. For example, miRCancer (mircancer.ecu.edu) is a database that stores records of miRNA-cancer associations collected by data mining. We analyzed the titles and abstracts of 26,414 publications (2016) and devised a rule-based approach to find complete sentences or phrases that contain the name of the miRNA and the cancer type, as well as any expression term. The results of this data mining process were then manually corroborated. miRCancer has over 3,764 miRNA-cancer association records from 2,611 publications, resulting in 236 miRNA expression profiles from 176 human cancers. miRCancer is freely accessible online, and the database can be searched by miRNA name or cancer type, or a combination of both (Xie B, Ding Q, Han H, Wu D. miRCancer: a microRNA- cancer association database constructed by text mining on literature. Bioinformatics. 2013;29(5):638-644).

[0075] As an example, by mining the database (December 16, 2020), miR-10b was found to be upregulated in 20 types of cancer, including acute myeloid leukemia, bladder cancer, colorectal cancer, endometrial cancer, esophageal cancer, esophageal squamous cell carcinoma, gastric cancer, gastric cancer, glioblastoma, glioma, hepatocellular carcinoma, lung cancer, malignant melanoma, medulloblastoma, nasopharyngeal carcinoma, non-small cell lung cancer, oral cancer, osteosarcoma, pancreatic cancer, and pancreatic ductal adenocarcinoma. Similarly, hsa-miR-101, hsa-miR-106a, hsa-miR-106b, hsa-miR-10b, hsa-miR-1207-5p, hsa-miR-1228, hsa-miR-1229, hsa-m iR-1246, hsa-miR-125a, hsa-miR-125b, hsa-miR-1307-3p, hsa-miR-135a, hsa-miR-140, hsa-miR-141, hsa-miR-150, hs a-miR-150-5p, hsa-miR-153, hsa-miR-155, hsa-miR-17, hsa-miR-17-5p, hsa-miR-181a, hsa-miR-181b, hsa-miR-181b- 3p, hsa-miR-182, hsa-miR-182-5p, hsa-miR-183, hsa-miR-183-5p, hsa-miR-18a, hsa-miR-18b, hsa-miR-191, hsa-miR- 1915-3p, hsa-miR-196a, hsa-miR-197, hsa-miR-19a, hsa-miR-19b, hsa-miR-200a, hsa-miR-200a-3p, hsa-miR-200b, hs a-miR-200c, hsa-miR-203, hsa-miR-205, hsa-miR-205-5p, hsa-miR-206, hsa-miR-20a, hsa-miR-20b, hsa-miR-21, hsa- miR-214-3p, hsa-miR-217, hsa-miR-221, hsa-miR-222, hsa-miR-223, hsa-miR-224, hsa-miR-224-5p, hsa-miR-23a, hsa -miR-23b, hsa-miR-24, hsa-miR-24-2-5p, hsa-miR-24-3p, hsa-miR-27a, hsa-miR-27b, hsa-miR-29a, hsa-miR-301a-3p,hsa-miR-3136-3p, hsa-miR-3188, hsa-miR-32, hsa-miR-330-3p, hsa-miR-346, hsa-miR-3646, hs a-miR-370, hsa-miR-372, hsa-miR-372-3p, hsa-miR-373, hsa-miR-374a, hsa-miR-376b, hsa-miR- 378, hsa-miR-423, hsa-miR-429, hsa-miR-4469, hsa-miR-449a, hsa-miR-4513, hsa-miR-4530, hsa -miR-4732-5p, hsa-miR-494, hsa-miR-495, hsa-miR-498, hsa-miR-5003-3p, hsa-miR-503, hsa-mi R-503-3p, hsa-miR-510, hsa-miR-520c, hsa-miR-520e, hsa-miR-520g, hsa-miR-526b, hsa-miR-54 4a, hsa-miR-645, hsa-miR-655, hsa-miR-660-5p, hsa-miR-665, hsa-miR-675, hsa-miR-761, hsa-m More than 100 miRNAs, including miR-10b, have been found to be associated with breast cancer, including iR-762, hsa-miR-9, hsa-miR-92a, hsa-miR-92a-3p, hsa-miR-93, hsa-miR-93-5p, hsa-miR-937, hsa-miR-944, hsa-miR-96, and hsa-miR-96-5p.

[0076] The sequence of miR-10b or any sequence of interest can be retrieved from miRbase, a microRNA database (mirbase.org / ): >hsa-miR-10b-5p MIMAT0000254 UACCCUGUAGAACCGAAUUUGUG >hsa-miR-10b-3p MIMAT0004556 ACAGAUUCGAUUCUAGGGGAAU.

[0077] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0078] [Table 2]

[0079] The methods and compositions of the present disclosure can be extended to other RNA targets, such as mRNAs that code for proteins that promote cancer development. In some embodiments, the present disclosure provides a method for treating cancer, comprising administering a single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to an endogenous tumor-specific RNA that is highly expressed in tumor cells compared to non-tumor cells. In some embodiments, the present disclosure provides a method for selectively activating RIG-I in tumor cells, comprising administering a single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide comprises a sequence that is complementary to an endogenous tumor-specific RNA, wherein the tumor-specific RNA is specific to tumor cells, and wherein RIG-I is selectively activated in tumor cells that highly express the tumor-specific RNA. In some embodiments, the endogenous tumor-specific RNA is an mRNA. In some embodiments, the endogenous tumor-specific RNA is an mRNA. In some embodiments, the endogenous tumor-specific RNA is not an mRNA.

[0080] Some mRNAs are believed to be involved in cancer. The whole or part of the antisense strand of mRNA containing polyA tail can be generated from DNA template by in vitro transcription and modified with 5'(p)pp. 5'(p)pp-anti-mRNA sequence can be optimized to contain sequence elements that increase RNA stability. Anti-mRNA can be formulated with lipid to obtain RNA-lipid nanoparticle formulation. In vivo, 5'(p)pp-anti-mRNA can hybridize with and silence target mRNA, resulting in the formation of 5'(p)pp-ds-mRNA that binds and activates RIG-I protein, resulting in RIG-I signaling and cancer cell death. For a list of exemplary mRNA transcripts, see Table 3.

[0081] [Table 3-1] [Table 3-2]

[0082] For example, survivin (also called BIRC5), a well-known cancer therapeutic target, can be targeted using this approach. Survivin, a multiregulator of cell cycle and apoptosis, is overexpressed in all human cancers but shows low expression in normal tissues. Its increased expression has been detected in 90% of primary breast cancers and correlates with poor clinical outcome. Furthermore, increased levels of survivin have been shown to be significantly associated with negative hormone receptor status. Importantly, high levels of survivin have been detected in other cancers, such as pancreatic cancer, that correlate with both cell proliferation and apoptosis, pointing to a possible ubiquitous role of this anti-apoptotic marker. Given the potential value of reducing or neutralizing survivin expression as a means to overcome chemoresistance, the process of RNA interference (RNAi) may prove valuable. Indeed, downregulation of BIRC5 by RNAi has shown promise in acute lymphoblastic leukemia, lung and cervical cancer in vitro and in breast cancer in vivo (Ghosh SK, Yigit MV, Uchida M, et al. Sequence-dependent combination therapy with doxorubicin and a survivin-specific small interfering RNA nanodrug demonstrates efficacy in models of adenocarcinoma. Int J Cancer. 2014;134(7):1758-1766). Sequence-dependent combination therapy with doxorubicin and a survivin-specific small interfering RNA nanodrug demonstrates efficacy in models of adenocarcinoma. Int J Cancer. 2014;134(7):1758-1766).

[0083] The use of the current 5(p)pp-anti-mRNA approach instead of standard siRNA technology to silence survivin may promote RIG-I signaling and cell death-inducing RIG-I activation, thereby improving treatment outcomes.

[0084] 4. Oligonucleotides and Oligonucleotide Modifications In certain embodiments, the present disclosure provides methods and compositions comprising single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides, wherein the oligonucleotides are complementary to endogenous tumor-specific RNAs that are highly expressed in tumor cells compared to non-tumor cells.In certain embodiments, the present disclosure provides methods and compositions comprising single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides, wherein the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides comprise sequences that are complementary to endogenous tumor-specific RNAs.

[0085] Exogenous RNAs containing 5' triphosphate (ppp) have been shown to induce immunogenic forms of cell death in different tumor entities (Elion, DL., et al Cancer Res. 2018 Nov 1; 78(21):6183-6195; Besch, R., et al, J Clin Investig. 2009; 119:2399-411; Duewell, P., et al., Cell Death Differ. 2014; 21:1825-37; Kuber, K., et al., Cancer Res. 2010; 70:5293-304). 5' diphosphate (5'pp) or 5' triphosphate (5'ppp) modifications may be referred to herein as 5'pp and 5'ppp anti-miRNA / mRNA, respectively. 5'-ppp-RNA has been shown to induce cytokine release and promote adaptive cellular immune responses against tumor cells, along with direct sensing of viral RNA by immune cells (Poeck, H., et al., Nat Med. 2008 Nov; 14(11):1256-63). The pattern recognition receptor RIG-I can bind to blunt-ended dsRNA containing uncapped 5'ppp or 5'pp. As disclosed herein, uncapped refers to RNA lacking a 5' cap structure consisting of 7-methylguansine triphosphate linked to the 5' end of mRNA by a 5'→5' triphosphate bond. The present disclosure provides a method for selectively activating RIG-I in tumor cells, comprising administering a single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide, wherein the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to an endogenous tumor-specific RNA. The present disclosure also provides single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides that are complementary to miRNAs that are highly expressed in tumor tissue compared to non-tumor tissue. The 5' triphosphate structures are shown below: [ka]

[0086] In a preferred embodiment, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises an uncapped 5' triphosphate.In a preferred embodiment, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises an uncapped 5' diphosphate.

[0087] In some embodiments of the methods and compositions disclosed herein, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to an miRNA. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to an endogenous miRNA. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to an oncogenic miRNA selected from the group consisting of miR-9; miR-10b; miR-17; miR-18; miR-19b; miR-21; miR-26a; miR-29a; miR-92a; miR-106b / 93; miR-125b; miR-130a; miR-155; miR-181a; miR-200s; miR-210; miR-210-3p; miR-221; miR-222; miR-221 / 222; miR-335; miR-498; miR-504; miR-1810; miR-1908; miR-224 / 452; and miR-181 / 340. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-9. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-10b. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-17. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-18. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-19b. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-21. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-26a.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-29a. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-92a. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-106b / 93. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-125b. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-130a. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-155. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-181a. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-200s. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-210. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-210-3p. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-221. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-222. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-221 / 222. In some embodiments, the single-stranded 5' uncapped triphosphate- or diphosphate-modified RNA oligonucleotide comprises a sequence that is complementary to miR-335.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-498. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-504. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-1810. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-1908. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-224 / 452. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR-181 / 340.

[0088] In a preferred embodiment of the present disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR10b. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR17. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR18a. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR18b. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR19b. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR21. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR26a. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR29a. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR92a-1. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR92a-2. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to miR155. In some embodiments, the single-stranded 5' uncapped triphosphate- or diphosphate-modified RNA oligonucleotide comprises a sequence that is complementary to miR210.In some embodiments, the single-stranded 5' uncapped triphosphate- or diphosphate-modified RNA oligonucleotide comprises a sequence that is complementary to miR22.

[0089] In some embodiments of the methods and compositions disclosed herein, a single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide forms a duplex with a miRNA. In a preferred embodiment, the duplex comprises a 5' blunt end. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide forms a duplex with a miRNA selected from the group consisting of miR-9; miR-10b; miR-17; miR-18; miR-19b; miR-21; miR-26a; miR-29a; miR-92a; miR-106b / 93; miR-125b; miR-130a; miR-155; miR-181a; miR-200s; miR-210; miR-210-3p; miR-221; miR-222; miR-221 / 222; miR-335; miR-498; miR-504; miR-1810; miR-1908; miR-224 / 452; and miR-181 / 340. In a preferred embodiment, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide forms a duplex with a miRNA selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide can form a duplex with said miRNA, and the duplex portion of the oligonucleotide is complementary to at least 10 consecutive nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 11 consecutive nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 12 consecutive nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 13 consecutive nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 14 contiguous nucleotides in the miRNA.In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 15 contiguous nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 16 contiguous nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 17 contiguous nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 18 contiguous nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 19 contiguous nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 20 contiguous nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 21 contiguous nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 22 contiguous nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 23 contiguous nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 24 contiguous nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 25 consecutive nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 26 consecutive nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 27 consecutive nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 28 consecutive nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 29 consecutive nucleotides in the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 30 consecutive nucleotides in the miRNA.In some embodiments, the duplex portion of the oligonucleotide is at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or at least 100% complementary to the miRNA. In some embodiments, the duplex portion of the oligonucleotide is at least 50% complementary to the miRNA. In some embodiments, the duplex portion of the oligonucleotide is at least 60% complementary to the miRNA. In some embodiments, the duplex portion of the oligonucleotide is at least 70% complementary to the miRNA. In some embodiments, the duplex portion of the oligonucleotide is at least 75% complementary to the miRNA. In some embodiments, the duplex portion of the oligonucleotide is at least 80% complementary to the miRNA. In some embodiments, the duplex portion of the oligonucleotide is at least 85% complementary to the miRNA. In some embodiments, the duplex portion of the oligonucleotide is at least 90% complementary to the miRNA. In some embodiments, the duplex portion of the oligonucleotide is at least 95% complementary to the miRNA. In preferred embodiments, the duplex portion of the oligonucleotide is at least 100% complementary to said miRNA. In some embodiments, the duplex portion of the oligonucleotide comprises 0-5 mismatched base pairs. In some embodiments, the duplex portion of the oligonucleotide comprises less than 5 mismatched base pairs. In some embodiments, the duplex portion of the oligonucleotide comprises less than 4 mismatched base pairs. In some embodiments, the duplex portion of the oligonucleotide comprises less than 3 mismatched base pairs. In some embodiments, the duplex portion of the oligonucleotide comprises less than 2 mismatched base pairs. In some embodiments, the duplex portion of the oligonucleotide comprises less than 1 mismatched base pair. In preferred embodiments, the duplex portion of the oligonucleotide does not comprise a mismatched base pair.

[0090] In some embodiments of the methods and compositions disclosed herein, a single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide can form a duplex with a miRNA and compete with endogenous mRNA to bind to said miRNA. In some embodiments, the duplex is not cleaved by AGO2. In some embodiments, the duplex activates RIG-I. In some embodiments, RIG-I activation is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, or 200% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 20% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 25% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 30% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 35% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 40% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 45% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 45% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 50% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 55% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 60% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide.In some embodiments, RIG-I activation is at least 65% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 70% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 75% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 80% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 85% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 90% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 95% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 100% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 110% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 120% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 130% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 140% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 150% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 200% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In a preferred embodiment, RIG-I activation elicits a tumor-specific immune response.

[0091] The oligonucleotides of the methods and compositions provided herein may include modifications. As disclosed herein, modifications may include chemical modifications, additions, deletions, substitutions, or manipulations of the nucleic acid phosphate backbone, the nucleic acid sugar, the nucleic acid base, and / or the 5' or 3' end of the oligonucleotide. Oligonucleotides, particularly those implemented in or as therapeutic agents, are generally modified on the phosphate backbone and / or ribose sugar to increase nuclease resistance and enhance affinity for target RNA. Phosphorothioate (PS) backbone modifications replace non-bridging oxygen atoms with sulfur atoms, extending the half-life of oligonucleotides in plasma from minutes to days. Enhanced protein binding has also been reported for oligonucleotides with PS modifications compared to those with phosphodiester (PO) linkages. Further improvements in nuclease stability and binding affinity of oligonucleotides to target RNA can be obtained by 2' ribose modifications such as 2'-O-methyl, 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE), 2',4'-constrained 2'-O-ethyl (cEt) and locked nucleic acid (LNA). The position of the 2' modification within the oligonucleotide sequence can further affect protein-oligonucleotide interactions. In certain embodiments, the present disclosure provides methods and compositions comprising single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides, wherein the oligonucleotides are complementary to endogenous tumor-specific RNAs that are highly expressed in tumor cells compared to non-tumor cells. In certain embodiments, the present disclosure provides methods and compositions comprising single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides, wherein the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides comprise sequences that are complementary to endogenous tumor-specific RNAs. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises other modifications. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide does not comprise any other modifications.

[0092] In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide further comprises a 2'-fluoro (2'-F) ribose modification. In some embodiments, the 2'-F ribose modification is present when the corresponding base is cytosine or uracil. In some embodiments, the 2'-F ribose modification is present at the 10th or 11th nucleotide from the 5' end of the modified RNA oligonucleotide. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide further comprises a phosphorothioate (PS) backbone modification. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide further comprises a 2'-fluoro (2'-F) ribose modification and a phosphorothioate (PS) backbone modification.

[0093] In a preferred embodiment, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide does not contain any other modifications. In a preferred embodiment, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide does not contain any other modifications selected from the group consisting of 2'-O-methyl (2'-OMe) ribose modification, N-6-methyl adenosine (m6A), pseudouridine (Ψ), N-1-methyl pseudouridine (mΨ), N-1-methyl pseudouridine (mΨ), 5-methyl-cytidine (5mC), 5-hydroxymethyl-cytidine (5hmC), or 5-methoxycytidine (5moC). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide does not contain 2'-O-methyl (2'-OMe) ribose modification. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide does not contain N-6-methyladenosine (m6A). In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide does not contain pseudouridine (Ψ). In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide does not contain N-1-methylpseudouridine (mΨ). In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide does not contain 5-methyl-cytidine (5mC). In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide does not contain 5-hydroxymethyl-cytidine (5hmC). In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide does not contain 5-methoxycytidine (5moC).

[0094] In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises one or more modifications. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises one or more modifications selected from the group consisting of phosphorothioate (PS) backbone modification, 2'-O-methyl (2'-OMe) ribose modification, N-6-methyl adenosine (m6A), pseudouridine (Ψ), N-1-methyl pseudouridine (mΨ), N-1-methyl pseudouridine (mΨ), 5-methyl-cytidine (5mC), 5-hydroxymethyl-cytidine (5hmC), or 5-methoxycytidine (5moC). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises 2'-O-methyl (2'-OMe) ribose modification. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises N-6-methyladenosine (m6A). In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises pseudouridine (Ψ). In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises N-1-methylpseudouridine (mΨ). In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises 5-methyl-cytidine (5mC). In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises 5-hydroxymethyl-cytidine (5hmC). In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises 5-methoxycytidine (5moC).

[0095] In some embodiments of the methods and compositions disclosed herein, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is at least 10 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 15 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 16 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 17 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 18 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 21 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 22 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 23 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 24 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 25 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 26 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 27 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 28 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 29 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 30 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 50 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 15-50 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 15-30 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 15-29 nucleotides in length.In some embodiments, the oligonucleotide comprises a sequence that is 15-28 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 15-27 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 15-26 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 15-25 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16-50 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16-30 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16-29 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16-28 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16-27 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16-26 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16-25 nucleotides in length.

[0096] The 5'pp and 5'ppp anti-miRNA / mRNA comprise a sequence that is complementary to at least 10 (e.g., at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23) consecutive nucleotides within the miRNA or mRNA. Exemplary miRNAs include, for example, miR-9; miR-10b; miR-21; miR-106b / 93; miR-125b; miR-130a; miR-155; miR-181a; miR-200s; miR-210-3p; miR-221 / 222; miR-335; miR-498; miR-504; miR-1810; miR-1908; miR-224 / 452; or miR-181 / 340 (see, e.g., Table 1 in Nguyen and Chang, Int J Mol Sci. 2017;19(1):65) and those listed in Tables 1 and 2 herein. Exemplary mRNAs include those listed in Table 2 herein.

[0097] In certain embodiments, the methods and compositions of the present disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the present disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the present disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 80% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 85% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13.

[0098] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO:1.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 1.

[0099] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% i% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO:2.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 2.

[0100] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO:3.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 3.

[0101] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO:4.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 4.

[0102] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO:5.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 5.

[0103] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO:6.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 6.

[0104] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO:7.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 7.

[0105] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO:8.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 8.

[0106] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO:9.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 9.

[0107] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 10.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 10.

[0108] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO:11.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 11.

[0109] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 12.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 12.

[0110] In some embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped triphosphate modified RNA oligonucleotides. In certain embodiments, the methods and compositions of the disclosure include single-stranded 5' uncapped diphosphate modified RNA oligonucleotides. In a preferred embodiment of the disclosure, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotides include a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 13.In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 13.

[0111] Antisense Oligonucleotides (ASOs) Antisense oligonucleotides (ASOs) are small-sized, single-stranded nucleic acids (typically at least 8 or 10 nt for miRNAs and up to about 30 nt or much longer for full-length mRNA antisense RNAs) that bind to their target RNA sequences in cells mediating gene silencing. ASO-based strategies target the disease source at the RNA level rather than targeting downstream processes involving proteins. Proteins are produced by decoding information stored in messenger RNAs (mRNAs). Aberrant protein production, associated with several destructive diseases and disorders, can be regulated by targeting mRNAs through the action of noncoding RNAs (ncRNAs). Among ncRNAs, microRNAs (miRNAs), transfer RNA-derived small RNAs, pseudogenes, PIWI-interacting RNAs, long ncRNAs (lncRNAs), and circular RNAs have been identified as regulators of biological functions through modulation of gene expression. Thus, antisense strategies involving targeting ncRNAs, including pre-mRNAs, mRNAs, or miRNAs, can alter the production of disease-causing proteins for therapeutic intervention.

[0112] Unlike small molecule-based protein targeting, antisense drugs exert their effects through Watson-Crick base pairing rules with target RNA sequences. This principle of Watson-Crick molecular recognition gives the antisense field more freedom in RNA-based drug design and facilitates their development. However, during ASO design, necessary modifications to optimize binding affinity, improve nuclease resistance, and allow for in vivo delivery can be considered. There have been several generations of designs with attempts to develop AMOs with high binding affinity, high specificity, and expanded functionality (Ochoa S, Milam VT. Modified Nucleic Acids: Expanding the Capabilities of Functional Oligonucleotides. Molecules. 2020;25(20):4659).

[0113] RNA nucleotides can be chemically modified at the backbone, nucleobase, ribose sugar and 2'-ribose substitution. See Figure 3 in Roberts, TC, Langer, R. & Wood, MJA Advances in oligonucleotide drug delivery. Nat Rev Drug Discov 19, 673-694 (2020).

[0114] In some ASOs (often referred to as first generation), the phosphate backbone linking the nucleotides is modified. One of the non-bridging oxygen atoms in the phosphodiester bond is replaced by a sulfur, methyl or amine group to generate phosphorothioates (PS), methyl-phosphonates, and phosphoramidates, respectively. These modifications are not equivalent and each has its own specific characteristics. PS oligonucleotides are highly representative of this first generation and are the most widely used. These chemical modifications improve stability by increasing the resistance of ASOs to nucleases, and a constant goal is to extend the half-life of ASOs. PS modifications change the half-life from minutes to days. Importantly, these modifications activate RNAseH. RNAseH is a ubiquitously expressed enzyme that cleaves the RNA strand in a DNA-RNA duplex. Thus, RNAseH can degrade the target mRNA in the ASO / mRNA complex and limit the synthesis of the encoded protein. Unfortunately, biologically active modified ASOs (PS) are highly toxic, especially due to their non-specific binding to proteins, which has led researchers to develop a new generation of ASOs that are less toxic and more specific.

[0115] Another class of ASOs (sometimes referred to as second generation ASOs) is characterized by alkyl modifications at the 2' position of the ribose. The introduction of an oxygenated group leads to the formation of 2'-O-methyl (2'-OME) and 2'-O-methoxyethyl (2'-MOE) nucleotides. These ASOs are less toxic than PS and have a slightly higher affinity for their targets. However, these modifications are not compatible with the recruitment and cleavage by RNAse H. The antisense effect of this type of ASO is probably due to steric blocking of translation. Such modifications are potentially interesting if the target RNA must not be degraded.

[0116] A further class of ASOs (sometimes referred to as third generation ASOs) is more heterogeneous, containing numerous modifications aimed at improving binding affinity, resistance to nucleases, and pharmacokinetic profiles. The most common modifications include locked nucleic acids (LNAs), corresponding to a methylene bridge connecting the 2'-oxygen and 4'-carbon of ribose; phosphorodiamidate morpholino oligomers (PMOs), in which the ribose is replaced by a morpholine moiety and the phosphodiester bond is replaced by a phosphorodiamidate bond; and peptide nucleic acids (PNAs), in which the ribose-phosphate backbone is replaced by a polyamide backbone consisting of repeating N-(2-aminothyl)glycine units to which the bases are linked (Papargyri N, Pontoppidan M, Andersen MR, Koch T, Hagedorn PH. Chemical Diversity of Locked Nucleic Acid-Modified Antisense Oligonucleotides Allows Optimization of Pharmaceutical Properties. Mol Ther Nucleic Acids. 2020;19:706-717). These last two structures are uncharged and bind to plasma proteins with lower affinity than charged ASOs, increasing their distribution and clearance in the urine. The cleared fraction represents approximately 10-30% of the administered dose and has been shown to contribute to tissue accumulation. These modifications result in high stability but do not elicit the recruitment of RNAseH. This third generation ASO forms stable hybrids with its target mRNA, thereby inhibiting its processing or translation.

[0117] The structural constraints of LNA modification imposed by the connecting bridge and that of its methylated analogues (known as "constrained ethyl": cET) have created new opportunities in chemotherapeutics. Tricyclo-DNA (tcDNA) belong to this class of structurally constrained DNA analogues with enhanced binding properties. They do not trigger RNAseH activity but show increased stability and improved cellular uptake, giving them substantial therapeutic benefits over the ASOs mentioned above.

[0118] As previously highlighted, ASOs bearing most second and third generation chemical modifications do not elicit RNAseH activity. However, RNAseH activity can be restored by inserting a series of unmodified or PS-DNA cleavage sensitive sequences between a pair of non-RNAseH sensitive sequences at the ends of the ASO. The resulting structures are known as "gapmers" (see, e.g., Quemener, Wiley Interdiscip Rev RNA. 2020;11(5):e1594).

[0119] Overall, such diversity of chemical modifications together with the structure of ASO provides considerable freedom for tailoring of therapeutic approaches according to selected targets and mechanisms of action. The recent US Food and Drug Administration (FDA) approval of several nucleic acid-based drugs has further stimulated interest in antisense research. Currently, numerous antisense drug candidates are in clinical trials for treating cardiovascular, metabolic, endocrine, neurological, neuromuscular, inflammatory, and infectious diseases.

[0120] In some embodiments, the antisense oligos contain one or more modifications in the base, 2' position, backbone / phosphate, or ribose, for example, as known in the art or described herein, so long as the modifications do not inhibit interaction with RIG-I helicase.

[0121] Anti-miRNA oligonucleotides (AMOs) As mentioned above, microRNAs control many physiological functions by tightly regulating gene expression. As they are key regulators, they are also associated with diseases. Thus, inhibition of their activity can be an effective therapeutic strategy. AMOs are ASOs that have sequences complementary to targeted endogenous miRNAs and form stable, high-affinity binding. Like ASOs, they can be synthesized with a variety of chemical features, as mentioned above. These synthetically designed molecules are used to neutralize the function of microRNAs (miRNAs) in cells for the desired response by steric blocking mechanisms as well as hybridization to miRNAs. In particular, it is essential that AMOs bind with high affinity to the miRNA "seed region," which extends 2-8 bases from the 5' end of the miRNA.

[0122] 5. Treatment method In part, the disclosure relates to a method for treating cancer, comprising administering a therapeutically effective amount of a single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide, wherein the oligonucleotide is complementary to an endogenous tumor-specific RNA (tsRNA) that is highly expressed in tumor cells compared to non-tumor cells. In some embodiments, the disclosure contemplates a method for selectively activating RIG-I in tumor cells, comprising administering a therapeutically effective amount of a single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide, wherein the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to an endogenous tumor-specific RNA (tsRNA), and RIG-I is selectively activated in tumor cells that highly express the tumor-specific RNA. In some embodiments, the RNA is an mRNA. In some embodiments, the RNA is an miRNA. In some embodiments, the miRNA is selected from the group consisting of SEQ ID NOs: 1-13.

[0123] The terms "treatment", "treating", "alleviating" and the like as used herein generally mean to obtain a desired pharmacokinetic and / or physiological effect, and may also be used to refer to improving, alleviating, and / or reducing the severity of one or more clinical complications of the condition being treated (e.g., cancer). The effect may be preventative in terms of fully or partially delaying the onset or recurrence of a disease, condition, or complication, and / or may be therapeutic in terms of a partial or complete cure of a disease or condition and / or adverse effects caused by a disease or condition. As used herein, "treatment" encompasses any treatment of a disease or condition in a mammal, particularly a human. As used herein, a therapeutic agent that "prevents" a disorder or condition refers to a compound that reduces the occurrence of a disorder or condition in a treated sample compared to an untreated control sample, or delays the onset of a disease or condition compared to an untreated control sample, in a statistical sample.

[0124] In general, treatment or prevention of a disease or condition (e.g., cancer) described in this disclosure is achieved by administering one or more 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure in an "effective amount". An effective amount of an agent refers to an amount effective at dosages and for periods of time necessary to achieve the desired therapeutic or prophylactic result. A "therapeutically effective amount" of an agent of this disclosure may vary depending on factors such as the disease state, age, sex, and weight of the individual, and the ability of the agent to elicit a desired response in the individual. A "prophylactically effective amount" refers to an amount effective at dosages and for periods of time necessary to achieve the desired prophylactic result.

[0125] In certain embodiments, the present disclosure contemplates the use of one or more 5'pp or 5'ppp ssRNA oligonucleotides in combination with one or more additional active agents or other supportive therapies to treat or prevent a disease or condition (e.g., cancer). As used herein, "in combination with," "combination of," "in conjunction with," or "conjoint" administration refers to any form of administration such that the additional active agent or supportive therapy (e.g., second, third, fourth, etc.) remains effective in the body (e.g., multiple compounds are effective in the patient simultaneously over some period of time, and may include synergistic effects of these compounds). Efficacy may not correlate with measurable concentrations of the agent in blood, serum, or plasma. For example, different therapeutic compounds can be administered in the same formulation or in separate formulations, simultaneously or sequentially, and on different schedules. Thus, subjects undergoing such treatment can benefit from the combined effects of different active agents or therapeutic agents. One or more 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure can be administered simultaneously with, before, or after one or more other additional drugs or supportive treatments, such as those disclosed herein.In general, each active drug or treatment is administered at a dose and / or time schedule determined for that particular drug.The particular combination to be used in the regimen takes into account the compatibility of the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure with the additional active drug or treatment and / or the desired effect.

[0126] The methods described herein include methods for treating cancer, comprising administering a single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to a miRNA or mRNA that is highly expressed in tumor cells compared to non-tumor cells. Without wishing to be bound by theory, the single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide forms a duplex with tumor-specific RNA, thereby eliciting a tumor-specific immune response via the RIG-I signaling pathway. Thus, methods are provided herein for treating cancer by combining RIG-I-mediated immune activation against tumor cells, optionally with inhibition of miRNA or mRNA (e.g., using 5'pp or 5'ppp ssRNA oligonucleotides that are complementary to endogenous miR21). In some embodiments, the endogenously expressed mRNA or miRNA is oncogenic. In some embodiments, the endogenously expressed mRNA or miRNA is tumor-specific. As used herein, "tumor-specific RNA" refers to an RNA (e.g., miRNA or mRNA) that is highly expressed in tumor cells compared to non-tumor cells.

[0127] In vivo, miRNAs often exert their regulatory function within the RNA-induced silencing complex (RISC). The core subunit of RISC is a miRNA bound to AGO2, a member of the Argonaute family of proteins. The miRNA within the RISC complex contains a double-stranded miRNA, where one RNA strand is the miRNA-guide that directs the complex to the target mRNA, and the other RNA strand is the passenger strand that is removed from the complex and degraded. AGO2 uses the miRNA-guide to identify complementary target transcripts for repression.

[0128] In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide forms a duplex with an endogenous tumor specific RNA. In some embodiments, the endogenous tumor specific RNA is selected from an miRNA or an mRNA. In some embodiments, the miRNA or the mRNA is oncogenic. In some embodiments, the single stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide forms a duplex with an miRNA. In some embodiments, the duplex is not cleaved by AGO2. In some embodiments, the duplex is released by AGO2. In some embodiments, the duplex comprises 0-5 mismatched base pairs.

[0129] In some embodiments, the duplex activates RIG-I. In some embodiments, RIG-I activation is at least 5%, 10%, 15% or 20% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation elicits a tumor-specific immune response. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide competes with endogenous mRNA to bind to miRNA.

[0130] The methods disclosed herein include the treatment of disorders associated with abnormal apoptosis or differentiation processes, such as cell proliferation or differentiation disorders, including both solid tumors and hematopoietic cancers. In certain embodiments, the methods are dual treatment methods that include a combination of tumor-specific immune activation and inhibition of miRNA or mRNA. The methods can also be used to reduce the risk of developing disorders associated with abnormal apoptosis or differentiation processes by inducing an immune response that targets developing cancer cells. In some embodiments, the disorder is a solid tumor, such as breast cancer, prostate cancer, pancreatic cancer, brain cancer, liver cancer, lung cancer, kidney cancer, skin cancer, or colon cancer. In general, the methods include administering a therapeutically effective amount of a treatment described herein to a subject in need of such treatment or determined to be in need of such treatment. In some embodiments, the methods include administering a therapeutically effective amount of a treatment that includes, for example, a 5'pp or 5'ppp ssRNA oligonucleotide (e.g., an RNA oligonucleotide as used herein) linked to a nanoparticle. In some embodiments, the nanoparticle is a magnetic nanoparticle.

[0131] As used in this context, "treat" means to improve at least one symptom of the disorder associated with abnormal apoptosis or differentiation process.For example, treatment can result in the reduction of tumor size or growth rate.Administering a therapeutically effective amount of the compound described herein for the treatment of a condition associated with abnormal apoptosis or differentiation process (e.g., cancer) can result in, among other things, the reduction of tumor size or the slowing of growth rate, the reduction of risk or frequency of recurrence, the delay of recurrence, the reduction of metastasis, the increase of survival rate, and / or the reduction of morbidity and mortality rate.

[0132] Examples of cell proliferation and / or differentiation disorders include cancer, e.g., carcinoma, sarcoma, metastatic disorders, or hematopoietic neoplastic disorders, e.g., leukemia. Metastatic tumors can arise from a number of primary tumor types, including, but not limited to, those of prostate, colon, lung, breast, and liver origin.

[0133] As used herein, the terms "cancer", "hyperproliferative" and "neoplastic" refer to cells capable of autonomous growth, i.e., an abnormal situation or condition characterized by rapidly proliferating cell growth. Hyperproliferative and neoplastic conditions can be classified as pathogenic, i.e., characterizing or constituting a pathology, or non-pathogenic, i.e., not associated with a pathology but a deviation from normal. The term is meant to include any type of cancerous growth or oncogenic process, metastatic tissue or malignantly transformed cells, tissues, or organs, regardless of histopathological type or stage of invasiveness. "Pathogenic hyperproliferative" cells occur in conditions characterized by malignant tumor growth. Examples of non-pathogenic hyperproliferative cells include the proliferation of cells associated with wound repair.

[0134] The term "cancer" or "neoplasm" includes malignancies of various organ systems, such as affected bladder, bone, lung, kidney, breast, thyroid, lymphatic, gastrointestinal, and genitourinary tract, as well as adenocarcinomas, including many colon, renal cell, prostate, and / or testicular cancers, non-small cell lung cancer, small intestine, and esophageal cancer. Other types of cancer include, but are not limited to, biliary tract cancer, brain cancer, breast cancer, cervical cancer, choriocarcinoma, colon cancer, endometrial cancer, esophageal cancer, gastric cancer, glioblastoma, intraepithelial neoplasia, leukemia, lymphoma, liver cancer, lung cancer, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, and kidney cancer. In certain embodiments, the cancer is selected from hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia, chronic myeloid leukemia, non-Hodgkin's lymphoma, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, renal cell carcinoma, prostate cancer, bladder cell carcinoma, breast cancer, ovarian cancer, non-small cell lung cancer, small cell lung carcinoma, hepatocellular carcinoma, basal cell carcinoma, colon cancer, cervical dysplasia, and Kaposi's sarcoma (AIDS-related and non-AIDS-related).

[0135] The term "cancer" is art-recognized and refers to malignant tumors of epithelial or endocrine tissues, including cancers of the respiratory system, gastrointestinal system, genitourinary tract, testicular, breast, prostate, endocrine system, and melanoma. In some embodiments, the disease is renal cancer or melanoma. Exemplary cancers include those forming from tissues of the cervix, lung, prostate, breast, head and neck, colon, and ovary. The term also includes carcinosarcomas, which include, for example, malignant tumors composed of carcinomatous and sarcomatous tissues. "Adenocarcinoma" refers to cancers derived from glandular tissue or in which the tumor cells form recognizable glandular structures.

[0136] The term "sarcoma" is art-recognized and refers to malignant tumors of mesenchymal derivation.

[0137] Further examples of proliferative disorders include hematopoietic neoplastic disorders.As used herein, the term "hematopoietic neoplastic disorders" includes diseases involving hyperplastic / neoplastic cells of hematopoietic origin, for example, arising from myeloid, lymphoid or erythroid lineages or their precursor cells.Preferably, the disease arises from poorly differentiated acute leukemia, for example, erythroblastic leukemia and acute megakaryoblastic leukemia. Further exemplary myeloid disorders include, but are not limited to, acute promyelocytic leukemia (APML), acute myeloid leukemia (AML) and chronic myeloid leukemia (CML) (reviewed in Vaickus, L. (1991) Crit Rev. in Oncol. / Hemotol. 11:267-97); lymphoid malignancies include, but are not limited to, acute lymphoblastic leukemia (ALL), including B-lineage ALL and T-lineage ALL, chronic lymphocytic leukemia (CLL), prolymphocytic leukemia (PLL), hairy cell leukemia (HLL), and Waldenstrom's macroglobulinemia (WM). Additional forms of malignant lymphomas include, but are not limited to, non-Hodgkin's lymphoma and its variants, peripheral T-cell lymphoma, adult T-cell leukemia / lymphoma (ATL), cutaneous T-cell lymphoma (CTCL), large granular lymphocyte leukemia (LGF), Hodgkin's disease, and Reed-Sternberg disease.

[0138] In some embodiments of any of the methods described herein, the 5'pp or 5'ppp ssRNA oligonucleotide (e.g., RNA oligonucleotides as used herein) is administered to a subject diagnosed with cancer (e.g., with primary or metastatic cancer). In some embodiments, the subject has breast cancer (e.g., metastatic breast cancer). In some non-limiting embodiments, the subject is a male or female, an adult, an adolescent, or a child. In some embodiments, the subject has one or more symptoms of cancer or metastatic cancer (e.g., metastatic cancer in lymph nodes). In some embodiments, the subject has severe or advanced stage cancer (e.g., primary or metastatic cancer). In some embodiments, the subject has a metastatic tumor present in at least one lymph node. In some embodiments, the subject has undergone lymphectomy and / or mastectomy.

[0139] RIG-I receptor-activated immune response As previously described, RIG-I is a cytoplasmic nucleic acid that senses pattern recognition receptors (PRRs) of the innate immune system. It is essential for recognizing RNA structures (such as viruses) with a 5' triphosphate signature. RIG-I activation can be programmed as an immune response against cancer. Importantly, tumor cell death by RIG-I has been shown to build immune memory, meaning that once the body's immune system is activated, the body becomes immune and rejects tumors as "foreign."

[0140] In some embodiments, the present disclosure contemplates a method for selectively activating RIG-I in tumor cells, comprising administering a therapeutically effective amount of a single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide comprises a sequence that is complementary to an endogenous tumor-specific RNA (tsRNA), and RIG-I is selectively activated in tumor cells that highly express the tumor-specific RNA. Without wishing to be bound by theory, the immune system is selectively activated in cancer cells when the single-stranded 5'-uncapped triphosphate- or diphosphate-modified RNA oligonucleotide forms a duplex with the tumor-specific RNA, thereby eliciting a tumor-specific immune response via the RIG-I signaling pathway. In some embodiments, administration of the 5'pp or 5'ppp ssRNA oligonucleotide induces an antiviral response, in particular a type I IFN response. In some embodiments, the type I IFN response is an IFN-α response. In some embodiments, RIG-I activation elicits a tumor-specific immune response (e.g., a response against tumor cells that highly express tumor-specific RNA). In some embodiments, the tumor-specific immune response includes release of type I IFN, DAMPs (danger-associated molecular patterns), and / or tumor antigens. In some embodiments, the method induces immune memory against the tumor cells.

[0141] In some embodiments, administration of 5'pp or 5'ppp ssRNA oligonucleotide induces apoptosis of tumor cells. In some embodiments, administration of 5'pp or 5'ppp ssRNA oligonucleotide (a) induces antiviral response, particularly type I IFN response, and (b) downregulates tumor-specific RNA (e.g., miRNA21) in vertebrates, particularly mammals. The present application further provides the use of at least one 5'pp or 5'ppp ssRNA oligonucleotide for the preparation of a pharmaceutical composition for inducing apoptosis of tumor cells in vertebrates, particularly mammals.

[0142] Described herein are methods and / or compositions for eliciting tumor-specific immune responses by administration of 5'pp or 5'ppp ssRNA oligonucleotides, thereby activating the body's immune system to produce a desired treatment response (e.g., for treating and / or creating anti-tumor immune memory in animals). Without wishing to be bound by theory, as shown in FIG. 1, the RIG-I pathway is selectively activated in cancer cells by the in situ generation of 5'ppp-dsRNA after introduction of 5'ppp ssRNA oligonucleotides that are complementary to miRNA or mRNA that are specifically expressed in these cells; the same or similar is expected from 5'pp-ssRNA. As a result, the anti-tumor immune capacity of tumor microenvironment (TME) can be revealed by activation of the RIG-I signaling pathway in conjunction with the simultaneous activation of certain tumor suppressor gene(s) simply by using single-stranded RNA.

[0143] 6. Pharmaceutical Compositions and Modes of Administration In any of the methods described herein, the 5'pp or 5'ppp ssRNA oligonucleotide (e.g., RNA oligonucleotides as used herein) can be administered by a medical professional (e.g., a doctor, physician assistant, nurse, or laboratory or clinic worker), by the subject (i.e., self-administration), or by a friend or family member of the subject. Administration can be performed in a clinical setting (e.g., a clinic or hospital), an assisted living facility, or a pharmacy.

[0144] In some embodiments of any of the methods described herein, the subject is administered at least one (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30) dose of a composition containing at least one (e.g., 1, 2, 3, or 4) of any of the 5'pp or 5'ppp ssRNA oligonucleotides (e.g., RNA oligonucleotides used herein) described herein. In any of the methods described herein, at least one magnetic particle or pharmaceutical composition (e.g., any of the magnetic particles or pharmaceutical compositions described herein) can be administered to the subject intravenously, intraarterially, subcutaneously, intraperitoneally, or intramuscularly. In some embodiments, at least one magnetic particle or pharmaceutical composition is administered (injected) directly into the lymph nodes of the subject.

[0145] In some embodiments of any of the methods described herein, a subject is administered at least one (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30) dose of a composition containing at least one (e.g., 1, 2, 3, or 4) of any of the 5'pp or 5'ppp ssRNA oligonucleotides (e.g., RNA oligonucleotides used herein) described herein. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 0.2 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 0.3 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 0.4 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 0.5 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 0.6 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 0.7 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 0.8 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 0.9 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 1 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 2 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 3 mg / kg to 200 mg / kg.In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 4mg / kg to 200mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 5mg / kg to 200mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 6mg / kg to 200mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 7mg / kg to 200mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 8mg / kg to 200mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 9mg / kg to 200mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 10 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 20 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 30 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 40 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 50 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 60 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 70 mg / kg to 200 mg / kg.In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 80 mg / kg to 200 mg / kg.In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 90 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 100 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 110 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 120 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 130 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 140 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 150 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 160 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 170 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 180 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered in a dose range of 190 mg / kg to 200 mg / kg.

[0146] In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 0.2 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 0.3 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 0.4 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 0.5 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 0.6 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 0.7 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 0.8 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 0.9 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 1 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 2 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 3 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 4 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 5 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 6 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the disclosure is administered at a dose of at least 7 mg / kg.In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 8 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 9 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 10 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 20 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 30 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 40 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 50 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 60 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 70 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 80 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 90 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 100 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 110 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 120 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the disclosure is administered at a dose of at least 130 mg / kg.In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 140 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 150 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 160 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 170 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 180 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 190 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered at a dose of at least 200 mg / kg.

[0147] In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered once a day. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered twice a day. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered once a week. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered twice a week. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered three times a week. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered every two weeks. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered every three weeks. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide of the present disclosure is administered every four weeks. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the present disclosure are administered monthly.

[0148] In some embodiments of any of the methods described herein, the subject is administered at least one (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30) dose of a composition containing at least one (e.g., 1, 2, 3, or 4) of any of the 5'pp or 5'ppp ssRNA oligonucleotides (e.g., RNA oligonucleotides used herein) described herein. In certain embodiments, the modified RNA oligonucleotide comprises up to 40 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 39 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 38 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 37 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 36 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 35 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 34 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 33 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 32 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 31 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 30 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 29 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 28 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 27 different modified RNA oligonucleotides.In certain embodiments, the modified RNA oligonucleotide comprises up to 26 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 25 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 24 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 23 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 22 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 21 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 20 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 19 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 18 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 17 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 16 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 15 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 14 different modified RNA oligonucleotides.In certain embodiments, the modified RNA oligonucleotide comprises up to 13 different modified RNA oligonucleotides.In certain embodiments, the modified RNA oligonucleotide comprises up to 12 different modified RNA oligonucleotides.In certain embodiments, the modified RNA oligonucleotide comprises up to 11 different modified RNA oligonucleotides.In certain embodiments, the modified RNA oligonucleotide comprises up to 10 different modified RNA oligonucleotides.In certain embodiments, the modified RNA oligonucleotide comprises up to 9 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 8 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 7 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 6 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 5 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 4 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 3 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises up to 2 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide comprises 1 modified RNA oligonucleotide.

[0149] In some embodiments of any of the methods described herein, the subject is administered at least one (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30) dose of a composition containing at least one (e.g., 1, 2, 3, or 4) of any of the 5'pp or 5'ppp ssRNA oligonucleotides (e.g., RNA oligonucleotides used herein) described herein. In any of the methods described herein, at least one magnetic particle or pharmaceutical composition (e.g., any of the magnetic particles or pharmaceutical compositions described herein) can be administered intravenously, intraarterially, subcutaneously, intraperitoneally, or intramuscularly to the subject. In some embodiments, at least one magnetic particle or pharmaceutical composition is administered (injected) directly into a lymph node of the subject. In some embodiments, the magnetic nanoparticles comprise 1 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 2 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 3 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise between 4 and up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise between 5 and up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise between 6 and up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise between 7 and up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise between 8 and up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise between 9 and up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise between 10 and up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise between 11 and up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise between 12 and up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise between 13 and up to 40 different modified RNA oligonucleotides.In some embodiments, the magnetic nanoparticles comprise 14 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 15 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 16 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 17 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 18 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 19 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 20 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 21 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 22 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 23 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 24 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 25 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 26 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 27 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 28 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 29 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 30 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 31 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 32 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 33 to up to 40 different modified RNA oligonucleotides.In some embodiments, the magnetic nanoparticles comprise 34 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 35 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 36 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 37 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 38 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise 39 to up to 40 different modified RNA oligonucleotides.

[0150] In some embodiments, the magnetic nanoparticles comprise at least 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 39 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 38 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 37 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 36 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 35 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 34 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 33 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 32 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 31 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 30 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 29 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 28 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 27 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 26 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 25 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 24 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 23 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 22 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 21 different modified RNA oligonucleotides.In some embodiments, the magnetic nanoparticles comprise at least 20 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 19 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 18 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 17 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 16 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 15 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 14 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 13 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 12 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 11 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 10 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 9 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 8 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 7 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 6 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 5 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 4 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 4 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 3 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles comprise at least 2 different modified RNA oligonucleotides.

[0151] In some embodiments, the pharmaceutical composition comprises at least one of the above 5'pp or 5'ppp ssRNA oligonucleotides and a pharma- ceutical acceptable carrier. In some embodiments, the pharmaceutical composition further comprises an agent that facilitates delivery of the oligonucleotide to cells, particularly the cytosol of cells. In some embodiments, the delivery agent is an agent described herein (e.g., micelles, lipid nanoparticles (LNPs), spherical nucleic acids (SNAs), extracellular vesicles, synthetic vesicles, exosomes, lipidoids, liposomes, and lipoplexes).

[0152] The pharmaceutical composition may further comprise other agents, such as agents that stabilize the oligonucleotide. Examples of stabilizing agents include proteins that complex with the oligonucleotide to form iRNPs, chelating agents such as EDTA, salts, and RNase inhibitors.

[0153] In certain embodiments, pharmaceutical compositions, particularly those comprising 5'pp or 5'ppp ssRNA oligonucleotides as described herein, further comprise one or more pharma- ceutical active therapeutic agents. Examples of pharma-ceutical active agents include immunostimulants, antiviral agents, antibiotics, antifungal agents, antiparasitic agents, antitumor agents, cytokines, chemokines, growth factors, antiangiogenic factors, chemotherapeutic agents, antibodies and gene silencing agents. Preferably, the pharma-ceutical active agent is selected from the group consisting of immunostimulants, antiviral agents and antitumor agents. More than one pharma-ceutical active agent may be of the same or different categories.

[0154] In certain embodiments, pharmaceutical compositions, particularly pharmaceutical compositions comprising the 5'pp or 5'ppp ssRNA oligonucleotides described herein, further comprise an antigen, an anti-viral vaccine, an anti-bacterial vaccine, and / or an anti-tumor vaccine, where the vaccine may be prophylactic and / or therapeutic.

[0155] In certain embodiments, pharmaceutical compositions, particularly those comprising the 5'pp or 5'ppp ssRNA oligonucleotides described herein, further comprise retinoid acid, IFN-α and / or IFN-β. Without being bound by any theory, retinoid acid, IFN-α and / or IFN-β can sensitize cells for IFN-α production, possibly by upregulating RIG-I expression.

[0156] The pharmaceutical composition can be formulated in any manner compatible with its therapeutic application, including the intended route of administration, delivery format and desired dosage. Those skilled in the art can formulate the optimal pharmaceutical composition according to common general knowledge in the art.

[0157] The pharmaceutical compositions may be formulated for immediate, controlled, timed, sustained, extended, or continuous release.

[0158] The pharmaceutical composition can be administered by any route known in the art, including, but not limited to, topical, enteral and parenteral, provided that it is compatible with the intended application.Topical administration includes, but is not limited to, transdermal, inhalation, intranasal, vaginal administration, enema, eye drops, and ear drops.Enteral administration includes, but is not limited to, oral, rectal administration, and administration by feeding tube.Parenteral administration includes, but is not limited to, intravenous, intraarterial, intramuscular, intracardiac, subcutaneous, intraosseous, intradermal, intrathecal, intraperitoneal, transdermal, transmucosal, and inhalation administration.The pharmaceutical composition can be used for prophylactic and / or therapeutic purposes.

[0159] One of ordinary skill in the art can readily determine the optimal dosage, frequency, timing and route of administration based on factors such as the disease or condition to be treated, the severity of the disease or condition, the age, sex and physical condition of the patient, and the presence or absence of previous treatment.

[0160] In some embodiments, the subject is administered at least one 5'pp or 5'ppp ssRNA oligonucleotide (e.g., an RNA oligonucleotide as used herein) or pharmaceutical composition (e.g., any of the 5'pp or 5'ppp ssRNA oligonucleotides or pharmaceutical compositions described herein) and at least one additional therapeutic agent. The at least one additional therapeutic agent is a chemotherapeutic agent (e.g., cyclophosphamide, mechlorethamine, chlorambucil, melphalan, daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, valrubicin, paclitaxel, docetaxel, etoposide, teniposide, tafluposide, azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, mercaptopurine, methotrexate, thioguanine, bleomycin, carboplatin, cisplatin, oxaliplatin, bortezomib, carfilzomib, salinosporamide A, all-trans retinoic acid, vinblastine, vincristine, vin desine, and vinorelbine) and / or analgesics (e.g., acetaminophen, diclofenac, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, mefenamic acid, meloxicam, nabumetone, naproxen, oxaprozin, phenylbutazone, piroxicam, sulindac, tolmetin, celecoxib, buprenorphine, butorphanol, codeine, hydrocodone, hydromorphone, levorphanol, meperidine, methadone, morphine, nalbuphine, oxycodone, oxymorphone, pentazocine, propoxyphene, and tramadol).

[0161] In some embodiments, at least one additional therapeutic agent is an immunogenic cell death inducer (ICDi) (e.g., daunorubicin, docetaxel, doxorubicin, mitoxantrone, oxaliplatin, and paclitaxel). In some embodiments, at least one additional therapeutic agent is siRNA therapy. In some embodiments, the siRNA therapy targets genes associated with cancer (e.g., PD-L1, CTLA-4, TGF-β, and / or VEGF).

[0162] In some embodiments, at least one additional therapeutic agent is a targeted therapy. Targeted therapy is the basis of what is also called precision medicine, which is a form of medicine that uses information about human genes and proteins to prevent, diagnose, and treat disease. Such therapeutic agents are sometimes called "molecularly targeted drugs" or similar names. The process of exploring them is often called "rational drug design". This concept is sometimes called "personalized medicine".

[0163] A molecularly targeted drug interacts with a specific target molecule, or a set of structurally related target molecules, in a pathway and thus modulates the end-point effect of that pathway, such as a disease-related process, and thus derives a therapeutic benefit.

[0164] Molecularly targeted agents may be small molecules or biopharmaceuticals, usually antibodies. They may be useful alone or in combination with other therapeutic agents and methods.

[0165] Targeted therapeutics may have fewer adverse side effects because they target a specific molecule or a set of related molecules and are usually designed to minimize their interaction with other molecules.Targeted cancer drugs broadly block the growth and spread of cancer by interacting with a specific molecule or a set of structurally related molecules (collectively, "molecular targets") that are involved in the growth, progression, lack of suppression or elimination, or spread of cancer.Such molecular targets may include, for example, proteins or genes that are involved in one or more cellular functions, including, but not limited to, signal transduction, gene expression modulation, induction or suppression of apoptosis, angiogenesis inhibition, or immune system modulation.

[0166] Targeted therapeutic monoclonal antibodies (mAbs) and targeted small molecules have been used as cancer treatments. They are used as monotherapy or in combination with other conventional therapeutic modalities, especially when the disease under treatment is refractory to treatment using only conventional techniques. In some embodiments, at least one additional therapeutic agent is a molecular targeted therapy. In some embodiments, the molecular targeted therapy is selected from the group consisting of trastuzumab, giotrif, proleukin, alectinib, campath, atezolizumab, avelumab, axitinib, belimumab, belinostat, bevacizumab, velcade, canakinumab, ceritinib, cetuximab, crizotinib, dabrafenib, daratumumab, dasatinib, denosumab, endothelial cell carcinoma ... The compound is selected from the group consisting of rotuzumab, enasidenib, erlotinib, gefitinib, ibrutinib, zydelig, imatinib, lenvatinib, midostaurin, necitumumab, niraparib, obinutuzumab, osimertinib, panitumumab, regorafenib, rituximab, ruxolitinib, sorafenib, tocilizumab, and trastuzumab.

[0167] In some embodiments, at least one additional therapeutic agent is an immunotherapy. As used herein, the term "immunotherapy" refers to a compound, composition, or treatment that indirectly or directly enhances, stimulates, or increases the body's immune response to cancer cells, and / or reduces the side effects of other anti-cancer treatments. Immunotherapy is therefore a treatment that directly or indirectly stimulates or enhances the immune system's response to cancer cells, and / or reduces the side effects that may be caused by other anti-cancer drugs. Immunotherapy is also referred to in the art as immunogenic therapy, biological therapy, biological response modifier therapy, and biotherapy. Examples of common immunotherapeutic agents known in the art include, but are not limited to, cytokines, cancer vaccines, monoclonal antibodies, and non-cytokine adjuvants. Alternatively, immunotherapy treatment may consist of administering a certain amount of immune cells (such as T cells, NK cells, dendritic cells, B cells, etc.) to the subject.

[0168] Immunotherapeutic agents may be non-specific, i.e., they may generally boost the immune system so that the human body is more effective at fighting the growth and / or spread of cancer cells, or they may be specific, i.e., they target the cancer cells themselves, and immunotherapeutic regimens may combine the use of non-specific and specific immunotherapeutic agents.

[0169] Non-specific immunotherapeutic agents are substances that stimulate or indirectly improve the immune system. Non-specific immunotherapeutic agents have been used alone as the primary treatment for the treatment of cancer, as well as in addition to the primary treatment, where the non-specific immunotherapeutic agent functions as an adjuvant to enhance the effectiveness of other treatments (e.g., cancer vaccines). In this latter context, non-specific immunotherapeutic agents can also function to reduce the side effects of other treatments, such as bone marrow suppression induced by certain chemotherapeutic agents. Non-specific immunotherapeutic agents can act against important immune system cells and cause secondary responses, such as increased production of cytokines and immunoglobulins. Alternatively, the agent may itself contain cytokines. Non-specific immunotherapeutic agents are generally classified as cytokines or non-cytokine adjuvants.

[0170] In some embodiments, the immunotherapy is selected from the group consisting of pembrolizumab (Keytruda®), nivolumab (Opdivo®), atezolizumab (Tecentriq®), ipilimumab (Yervoy®), avelumab (Bavencio®), and durvalumab (Imfinzi®). In some embodiments, the subject has received or is receiving anti-PD-1, anti-PD-L1, or anti-CTLA4 therapy. Alternatively, any method may further comprise administering to the subject an effective amount of anti-PD-1, anti-PD-L1, or anti-CTLA4 therapy. In some examples, the anti-PD-1, anti-PD-L1, or anti-CTLA4 therapy may include an anti-PD-1, anti-PD-L1, or anti-CTLA4 antibody, respectively. Exemplary anti-PD-1 antibodies include pembrolizumab, nivolumab, and AMP-224, or antigen-binding fragments thereof. Exemplary anti-CTLA-4 antibodies include ipilimumab and tremelimumab, or antigen-binding fragments thereof. Exemplary anti-PD-L1 antibodies include durvalumab, atezolizumab, and avelumab, or antigen-binding fragments thereof.

[0171] In some embodiments, the at least one additional therapeutic agent and the at least one 5'pp or 5'ppp ssRNA oligonucleotide (e.g., an RNA oligonucleotide as used herein) are administered in the same composition (e.g., the same pharmaceutical composition). "At least one" means that one or more 5'pp or 5'ppp ssRNA oligonucleotides of the same or different oligonucleotide(s) can be used together.

[0172] In some embodiments, the at least one additional therapeutic agent and the at least one 5'pp or 5'ppp ssRNA oligonucleotide are administered to the subject using different routes of administration (e.g., the at least one additional therapeutic agent delivered by oral administration and the at least one 5'pp or 5'ppp ssRNA oligonucleotide delivered by intravenous administration).

[0173] In any of the methods described herein, at least one 5'pp or 5'ppp ssRNA oligonucleotide or pharmaceutical composition (e.g., any of the 5'pp or 5'ppp ssRNA oligonucleotides or pharmaceutical compositions described herein) and optionally at least one additional therapeutic agent can be administered to a subject at least once a week (e.g., once a week, twice a week, three times a week, four times a week, once a day, twice a day, or three times a day). In some embodiments, at least two different 5'pp or 5'ppp ssRNA oligonucleotides are administered in the same composition (e.g., a liquid composition). In some embodiments, at least one 5'pp or 5'ppp ssRNA oligonucleotide and at least one additional therapeutic agent are administered in the same composition (e.g., a liquid composition). In some embodiments, at least one 5'pp or 5'ppp ssRNA oligonucleotide and at least one additional therapeutic agent are administered in two different compositions (e.g., a liquid composition containing at least one 5'pp or 5'ppp ssRNA oligonucleotide and a solid oral composition containing at least one additional therapeutic agent). In some embodiments, the at least one additional therapeutic agent is administered as a pill, tablet, or capsule. In some embodiments, the at least one additional therapeutic agent is administered in a sustained release oral formulation.

[0174] In some embodiments, one or more additional therapeutic agents can be administered to a subject prior to administration of at least one 5'pp or 5'ppp ssRNA oligonucleotide or pharmaceutical composition (e.g., any of the 5'pp or 5'ppp ssRNA oligonucleotides or pharmaceutical compositions described herein). In some embodiments, one or more additional therapeutic agents can be administered to a subject after administration of at least one 5'pp or 5'ppp ssRNA oligonucleotide or pharmaceutical composition (e.g., any of the magnetic particles or pharmaceutical compositions described herein). In some embodiments, one or more additional therapeutic agents and at least one 5'pp or 5'ppp ssRNA oligonucleotide or pharmaceutical composition (e.g., any of the 5'pp or 5'ppp ssRNA oligonucleotides or pharmaceutical compositions described herein) are administered to a subject such that there is an overlap in the biological activity period of the one or more additional therapeutic agents and at least one 5'pp or 5'ppp ssRNA oligonucleotide (e.g., any of the 5'pp or 5'ppp ssRNA oligonucleotides described herein) in the subject.

[0175] In some embodiments, a subject may be administered at least one 5'pp or 5'ppp ssRNA oligonucleotide or pharmaceutical composition (e.g., any of the 5'pp or 5'ppp ssRNA oligonucleotides or pharmaceutical compositions described herein) for an extended period of time (e.g., for at least 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 1 year, 2 years, 3 years, 4 years, 5 years, or 10 years). A knowledgeable medical practitioner may determine the length of treatment period using any of the methods described herein for diagnosing or tracking the effectiveness of treatment (e.g., using the methods described above and methods known in the art). As described herein, a knowledgeable medical practitioner can also vary (e.g., increase or decrease) the identity and number of 5'pp or 5'ppp ssRNA oligonucleotides (and / or one or more additional therapeutic agents) administered to a subject, and can also adjust (e.g., increase or decrease) the dosage or frequency of administration of at least one 5'pp or 5'ppp ssRNA oligonucleotide (and / or one or more additional therapeutic agents) to a subject based on an evaluation of the effectiveness of the treatment (e.g., using any of the methods described herein and known in the art). A knowledgeable medical practitioner can further determine when treatment should be discontinued (e.g., when the subject's symptoms have significantly decreased).

[0176] 7.Delivery 5'pp or 5'ppp ssRNA oligonucleotides (e.g., RNA oligonucleotides used herein) can be delivered to a host cell or subject in vivo or ex vivo using various known and suitable methods available in the art. As provided herein, delivery systems including lipoplexes, liposomes, lipid nanoparticles (LNPs), spherical nucleic acids (SNAs), nanoparticles, and other methods known in the art can be used for delivery of 5'pp or 5'ppp ssRNA oligonucleotides.

[0177] Various delivery systems (e.g., liposomes, nanoparticles) containing 5'pp or 5'ppp ssRNA oligonucleotides can be administered to an organism for delivery to cells in vivo, or to cells or cell cultures ex vivo. Administration can be by any route that is normally used to introduce a molecule into blood, fluid, or eventual contact with cells, including, but not limited to, injection, infusion, topical application, and electroporation. Suitable methods for administering such oligonucleotides are available and well known to those skilled in the art.

[0178] Oligonucleotide delivery strategies The field of oligonucleotide therapeutics has seen significant progress over the last few years. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major problem. The biological basis of oligonucleotide delivery includes the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. Current approaches to enhance delivery of oligonucleotides include molecular-scale targeting ligand-oligonucleotide conjugates, lipid and polymer-based nanoparticles, spherical nucleic acids (inorganic nanoparticles coated with nucleic acids), micelles, extracellular vesicles, synthetic vesicles, exosomes, lipidoids, antibody conjugates and small molecules that improve oligonucleotide delivery. The advantages and disadvantages of these approaches are placed in the context of the underlying fundamental biology. Some of these delivery methods are described in more detail below.

[0179] Lipoplexes, Liposomes, and Lipid Nanoparticles Formulations containing lipids are one of the most common approaches to enhance nucleic acid delivery. Mixing polyanionic nucleic acid drugs with lipids results in condensation of the nucleic acid into nanoparticles that have a more favorable surface charge and are large enough (diameter approx. 100 nm) to trigger uptake by endocytosis. Lipoplexes are the result of direct electrostatic interactions between polyanionic nucleic acids and cationic lipids and are typically a heterogeneous population of relatively unstable complexes. Lipoplex formulations must be prepared immediately prior to use and have been successfully used for localized delivery applications. In contrast, liposomes contain a lipid bilayer and the nucleic acid drug resides in an enclosed aqueous space. Liposomes are more complex (typically composed of cationic or fusogenic lipids [facilitating endosomal escape] and cholesterol PEGylated lipids), exhibit more consistent physical properties than lipoplexes, and exhibit greater stability. For example, some lipid nanoparticles (LNPs), also known as stable nucleic acid lipid particles, are liposomes that contain a defined ratio of ionizable lipids, phosphatidylcholine, cholesterol and PEG-lipid conjugates and have been used successfully in several cases. Landmark examples are the silencing of Hepatitis B virus and APOB by siRNA in preclinical animal studies and, more recently, the approval of patisiran, an siRNA delivered as an LNP formulation. Encapsulation of nucleic acid cargo provides a measure of protection from nuclease digestion in circulation and endosomes. In addition, ionizable LNPs also associate with APOE, further facilitating hepatic uptake by LDLR-mediated endocytosis. Similarly, LNPs containing lipidoid or lipid-like materials have shown robust siRNA-mediated silencing in rodents and non-human primates.

[0180] Lipid nanoparticles (LNPs) are well-known means for the delivery of nucleotide cargo and can be used for the delivery of 5'pp or 5'ppp ssRNA oligonucleotides disclosed herein. A drawback of LNPs is that their delivery is mainly limited to the liver and reticuloendothelial system, as the sinusoidal epithelium in this tissue provides a large enough space to allow the entry of these relatively large nanoparticles. However, localized delivery of LNPs has been used to successfully deliver siRNA to the CNS after intracerebroventricular injection. Conversely, the large size of nanoparticles is advantageous, as it essentially precludes renal filtration and allows the delivery of higher payloads.

[0181] In some embodiments, provided herein is a method for delivering a 5'pp or 5'ppp ssRNA oligonucleotide disclosed herein to a host cell or subject, wherein the 5'pp or 5'ppp ssRNA oligonucleotide is delivered via LNP. In some embodiments, the LNP comprises a biodegradable ionizable lipid. In some embodiments, the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate), or another ionizable lipid. See, e.g., the lipids in PCT / US2018 / 053559, WO / 2017 / 173054, WO2015 / 095340, and WO2014 / 136086, and the references provided therein. In some embodiments, the terms cationic and ionizable in the context of LNP lipids are interchangeable, e.g., ionizable lipids are cationic depending on the pH.

[0182] In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide disclosed herein is formulated in or administered via lipid nanoparticles; see, for example, WO / 2017 / 173054, the entire contents of which are incorporated herein by reference. Any of the 5'pp or 5'ppp ssRNA oligonucleotides described herein can be delivered by LNP. In some examples, the lipid component comprises a biodegradable ionizable lipid, cholesterol, DSPC, and PEG-DMG.

[0183] Spherical nucleic acid (SNA) An alternative nanoparticle-based delivery strategy is the SNA approach. SNA particles consist of a hydrophobic core nanoparticle (containing gold, silica or a variety of other materials) decorated with hydrophilic oligonucleotides (e.g., ASOs, siRNAs and immunostimulatory oligonucleotides) densely packed on the surface by thiol bonds. In contrast to other nanoparticle designs, oligonucleotides bound to SNA radiate outward from the core structure. As a result of steric hindrance, high local salt concentrations and interactions with corona proteins, the oligonucleotides are to some extent protected from nucleolytic degradation while exposed.

[0184] Nanoparticles In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotide is linked or conjugated to a nanoparticle, for example, as described in WO2013 / 016126. In some embodiments, the nanoparticle has a diameter of about 2 nm to about 200 nm (e.g., about 10 nm to about 30 nm, about 5 nm to about 25 nm, about 10 nm to about 25 nm, about 15 nm to about 25 nm, about 20 nm to about 25 nm, about 25 nm to about 50 nm, about 50 nm to about 200 nm, about 70 nm to about 200 nm, about 80 nm to about 200 nm, about 100 nm to about 200 nm, about 140 nm to about 200 nm, and about 150 nm to about 200 nm) and contains a polymer coating.

[0185] In some embodiments, the nanoparticles provided herein may be spherical or ellipsoidal, or may have an irregular shape. In some embodiments, the nanoparticles provided herein may have a diameter (between any two points on the outer surface of the nanoparticle) of about 2 nm to about 200 nm (e.g., about 10 nm to about 200 nm, about 2 nm to about 30 nm, about 5 nm to about 25 nm, about 10 nm to about 25 nm, about 15 nm to about 25 nm, about 20 nm to about 25 nm, about 50 nm to about 200 nm, about 70 nm to about 200 nm, about 80 nm to about 200 nm, about 100 nm to about 200 nm, about 140 nm to about 200 nm, and about 150 nm to about 200 nm). In some embodiments, nanoparticles having a diameter of about 2 nm to about 30 nm are localized to the lymph nodes of a subject. In some embodiments, nanoparticles having a diameter of about 40 nm to about 200 nm are localized to the liver.

[0186] In some embodiments, the nanoparticles described herein do not contain magnetic materials. In some embodiments, the nanoparticles may contain a core that contains, in part, a polymer (e.g., poly(lactic-co-glycolic acid)). Those skilled in the art will appreciate that nanoparticles can be prepared using any number of materials known in the art, including, but not limited to, gums (e.g., acacia, guar), chitosan, gelatin, sodium alginate, and albumin. Additional polymers that can be used to generate the nanoparticles described herein are known in the art. For example, polymers that can be used to generate nanoparticles include, but are not limited to, cellulosics, poly(2-hydroxyethyl methacrylate), poly(N-vinylpyrrolidone), poly(methyl methacrylate), poly(vinyl alcohol), poly(acrylic acid), polyacrylamide, poly(ethylene-co-vinyl acetate), poly(ethylene glycol), poly(methacrylic acid), polylactide (PLA), polyglycolide (PGA), poly(lactide-co-glycolide) (PLGA), polyanhydrides, polyorthoesters, polycyanoacrylates, and polycaprolactone.

[0187] Those skilled in the art will understand that the materials used in the nanoparticle composition, the methods for preparing and coating the nanoparticles, and the methods for controlling the size of the nanoparticles may vary substantially. However, these methods are well known to those skilled in the art. Important issues include the biodegradability, toxicity profile, and pharmacokinetics / pharmacodynamics of the nanoparticles. The composition and / or size of the nanoparticles are important determinants of their biological fate. For example, larger nanoparticles are typically taken up and degraded by the liver, while smaller nanoparticles (diameter less than 30 nm) typically circulate for long periods of time (sometimes blood half-lives of more than 24 hours in humans) and accumulate in the interstitium of organs with highly permeable vasculature, such as lymph nodes and tumors.

[0188] Magnetic Nanoparticles In some embodiments, the nanoparticles may be magnetic (e.g., contain a core of a magnetic material). In some embodiments, the magnetic nanoparticles include ferric chloride, ferrous chloride, or a combination thereof, and a dextran coating. In some embodiments, the magnetic nanoparticles contain a mixture of two or more different nanoparticle compositions described herein. In some embodiments, the composition contains at least one magnetic nanoparticle with tunable surface functionalization and at least one magnetic nanoparticle with tunable magnetic properties.

[0189] In some embodiments, any of the nanoparticles described herein may contain a core of a magnetic material (e.g., therapeutic magnetic nanoparticles). In some embodiments, the magnetic material or particle may contain diamagnetic, paramagnetic, superparamagnetic, or ferromagnetic materials that respond to a magnetic field. Non-limiting examples of therapeutic magnetic nanoparticles contain a core of a magnetic material that contains a metal oxide selected from the group of magnetite; ferrite (e.g., manganese, cobalt, and nickel ferrite); Fe(II) oxide, and hematite, and metal alloys thereof. The core of the magnetic material can be formed by converting a metal salt to a metal oxide using methods known in the art (e.g., Kieslich et al., Inorg. Chem. 2011). In some embodiments, the nanoparticles contain cyclodextrin gold or quantum dots. Non-limiting examples of methods that can be used to generate therapeutic magnetic nanoparticles are described in Medarova et al., Methods Mol. Biol. 555:1-13, 2009; and Medarova et al., Nature Protocols 1:429-431, 2006. Additional magnetic materials and methods for making magnetic materials are known in the art. In some embodiments of the methods described herein, the location or localization of the therapeutic magnetic nanoparticles can be imaged in a subject (e.g., imaged in a subject after administration of one or more doses of therapeutic magnetic nanoparticles).

[0190] In some embodiments, the magnetic nanoparticles can be functionalized with one or more amine groups. In some embodiments, the functionalization occurs at the surface of the magnetic nanoparticles. In some embodiments, the one or more amine groups are covalently linked to the dextran coating. In some embodiments, the one or more amine groups replace one or more hydroxyl groups of the dextran coating. In some embodiments, the number of the one or more amine groups is adjustable based on the concentration of ferric chloride, ferrous chloride, or a combination thereof. In some embodiments, the nanoparticle composition comprises about 5 to about 1000 amine groups. In some embodiments, the nanoparticle composition comprises about 5-25, 25-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750, 750-800, 800-850, 850-900, 900-950, or 950-1000 amine groups.

[0191] In some embodiments, the magnetic nanoparticles may contain a core of magnetic material (e.g., ferric chloride and / or ferrous chloride). In some embodiments, the magnetic nanoparticles include about 0.60 g to about 0.70 g of ferric chloride and about 0.3 g to about 0.5 g of ferrous chloride. In some embodiments, the magnetic nanoparticles including about 0.60 g to about 0.70 g of ferric chloride and about 0.3 g to about 0.5 g of ferrous chloride are functionalized with about 5 to 150 amine groups. In some embodiments, the magnetic nanoparticles including about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride are functionalized with about 60 to 90 amine groups. In some embodiments, the magnetic nanoparticles including about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride are functionalized with about 5 to 150 amine groups. In some embodiments, the magnetic nanoparticles comprising about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride are functionalized with about 1-150 amine groups. In some embodiments, the magnetic nanoparticles comprising about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride are functionalized with at least about 1-10 amine groups, 10-20 amine groups, about 20-30 amine groups, about 30-40 amine groups, about 40-50 amine groups, about 50-60 amine groups, about 60-70 amine groups, about 70-80 amine groups, about 80-90 amine groups, about 90-100 amine groups, about 100-110 amine groups, about 110-120 amine groups, about 120-130 amine groups, about 130-140 amine groups, or about 140-150 amine groups.

[0192] In some embodiments, the magnetic nanoparticles comprise about 1 g to about 1.4 g of ferric chloride. In some embodiments, the magnetic nanoparticles comprise about 1 g to about 1.4 g of ferric chloride are functionalized with about 246 to 500 amine groups. In some embodiments, the magnetic nanoparticles comprise about 1.2 g of ferric chloride are functionalized with about 246 to 500 amine groups. In some embodiments, the magnetic nanoparticles functionalized with about 246 to 500 amine groups do not comprise ferric chloride. In some embodiments, the magnetic nanoparticles comprise about 1.2 g of ferric chloride are functionalized with about 200 to 600 amine groups. In some embodiments, magnetic nanoparticles comprising about 1.2 g of ferric chloride are functionalized with at least about 200-250 amine groups, 250-300 amine groups, about 300-350 amine groups, about 350-400 amine groups, about 400-450 amine groups, about 450-500 amine groups, about 500-550 amine groups, about 550-600 amine groups, or more.

[0193] Thus, in some embodiments, the number of amine groups conjugated to the dextran coating can be fine-tuned by controlling the concentrations of ferric chloride and ferrous chloride used to prepare the magnetic nanoparticles.

[0194] In some embodiments, the magnetic nanoparticles include magnetic nanoparticles having a magnetic strength that is tunable based on the concentration of ferric chloride, ferrous chloride, or a combination thereof.

[0195] In some embodiments, the magnetic nanoparticles comprise about 0.1% to about 99.9% ferric ions and about 99.9% to about 0.1% ferrous ions of total iron per MNP. In some embodiments, magnetic nanoparticles comprising about 60% to about 80% ferric chloride and about 20% to about 40% ferrous chloride have stronger magnetic properties than nanoparticle compositions having a ferrous chloride amount greater than about 80%. In some embodiments, magnetic nanoparticles comprising about 70% ferric ions and about 30% ferrous ions have stronger magnetic properties than magnetic nanoparticles having a ferrous ion amount greater than about 30%.

[0196] In some embodiments, the magnetic nanoparticles have a nonlinearity index (NLI) in the range of about 6 to about 40. In some embodiments, the magnetic nanoparticles have an NLI in the range of about 6 to about 70. In some embodiments, the magnetic nanoparticles have an NLI in the range of about 8.5 to about 14.8. In some embodiments, the magnetic nanoparticles have an NLI in the range of about 8 to about 14. In some embodiments, the magnetic nanoparticles have an NLI of about 6. In some embodiments, the magnetic nanoparticles have an NLI of about 8. In some embodiments, the magnetic nanoparticles have an NLI of about 14. In some embodiments, the magnetic nanoparticles have an NLI of about 67. In some embodiments, the magnetic nanoparticles have an NLI in the range of 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, 20-30, 30-40, 40-50, 50-60, or 60-70. In some embodiments, magnetic nanoparticles comprising about 0.54 g of ferric chloride and about 0.2 g of ferrous chloride have an NLI in the range of about 8.5 to about 14.8. In some embodiments, magnetic nanoparticles comprising about 0.54 g of ferric chloride and about 0.2 g of ferrous chloride have an NLI of about 12. In some embodiments, the magnetic strength of magnetic nanoparticles can be quantified by measuring the nonlinearity index (NLI) by magnetic particle spectroscopy as described in WO2021 / 113829.

[0197] In some embodiments, the magnetic nanoparticles comprise about 80% to about 100% ferric chloride and about 20% to about 0% ferrous chloride. In some embodiments, the magnetic nanoparticles comprise about 0% to about 50% ferric chloride and about 100% to about 50% ferrous chloride have weaker magnetic properties than magnetic nanoparticles having less than about 0.4 g of ferrous chloride. In some embodiments, the magnetic nanoparticles comprise about 0.54 g of ferric chloride and about 0.4 g of ferrous chloride have weaker magnetic properties than magnetic nanoparticles having less than about 0.2 g of ferrous chloride. In some embodiments, the magnetic nanoparticles comprise about 0.54 g of ferric chloride and about 0.4 g of ferrous chloride have an NLI in the range of about 50 to about 120. In some embodiments, the magnetic nanoparticles comprise about 0.54 g of ferric chloride and about 0.4 g of ferrous chloride have an NLI of about 67.

[0198] Thus, in some embodiments, the magnetic properties (e.g., magnetic strength) of the magnetic nanoparticles can be fine-tuned by controlling the concentrations of ferric chloride and ferrous chloride used to prepare the magnetic nanoparticles.

[0199] In some embodiments, the magnetic nanoparticles have an iron concentration in the range of about 8 mM to about 217 mM. In some embodiments, the magnetic nanoparticles have an iron concentration in the range of about 8 mM to about 15 mM, about 15 mM to about 25 mM, about 25 mM to about 50 mM, 50 mM to about 60 mM, about 60 mM to about 70 mM, about 70 mM to about 80 mM, about 80 mM to about 90 mM, about 90 mM to about 100 mM, about 100 mM to about 110 mM, about 110 mM to about 120 mM, about 120 mM, about 130 mM, about 130 mM to about 140 mM, about 140 mM to about 150 mM, about 150 mM to about 160 mM, about 160 mM to about 170 mM, about 170 mM to about 180 mM, about 180 mM to about 190 mM, about 190 mM to about 200 mM, about 200 mM to about 210 mM, and about 210 mM to about 220 mM.

[0200] In some embodiments, the magnetic nanoparticles have an iron concentration in the range of about 1 mg / mL to about 25 mg / mL. In some embodiments, the magnetic nanoparticles have an iron concentration in the range of about 1 mg / mL to about 5 mg / mL, about 5 mg / mL to about 10 mg / mL, about 10 mg / mL to about 15 mg / mL, about 15 mg / mL to about 20 mg / mL, or about 20 mg / mL to about 25 mg / mL.

[0201] In some embodiments, the magnetic nanoparticles are used to deliver compositions containing at least one (e.g., one, two, three, or four) of any of the 5'pp or 5'ppp ssRNA oligonucleotides described herein (e.g., RNA oligonucleotides used herein). "At least one" means that one or more 5'pp or 5'ppp ssRNA oligonucleotides of the same or different oligonucleotide(s) can be used together. In some embodiments, the magnetic nanoparticles deliver one 5'pp or 5'ppp ssRNA oligonucleotide. In some embodiments, the magnetic nanoparticles deliver two 5'pp or 5'ppp ssRNA oligonucleotides. In some embodiments, the magnetic nanoparticles deliver three 5'pp or 5'ppp ssRNA oligonucleotides. In some embodiments, the magnetic nanoparticles deliver four 5'pp or 5'ppp ssRNA oligonucleotides. In some embodiments, the magnetic nanoparticles deliver five 5'pp or 5'ppp ssRNA oligonucleotides.

[0202] Polymer coating of nanoparticles In some embodiments, the nanoparticles described herein contain a polymer coating over the core magnetic material (e.g., over the surface of the magnetic material). The polymer material may be suitable for binding or coupling one or more biological agents (e.g., any of the nucleic acids, fluorophores, or targeting peptides described herein). One or more biological agents (e.g., nucleic acids, fluorophores, or targeting peptides) can be immobilized to the polymer coating by chemical coupling (covalent bonding).

[0203] In some embodiments, the nanoparticles are formed by a method that includes coating a core of magnetic material with a polymer that is relatively stable in water, hi some embodiments, the nanoparticles are formed by a method that includes coating the magnetic material with a polymer or absorbing the magnetic material into a thermoplastic polymer resin having reducing groups thereon. Coatings may also be applied to the magnetic material using methods described in U.S. Pat. Nos. 5,834,121, 5,395,688, 5,356,713, 5,318,797, 5,283,079, 5,232,789, 5,091,206, 4,965,007, 4,774,265, 4,770,183, 4,654,267, 4,554,088, 4,490,436, 4,336,173, and 4,421,660; and WO 10 / 111066, the disclosures of each of which are incorporated herein by reference.

[0204] Methods for the synthesis of iron oxide nanoparticles include, for example, physical and chemical methods. For example, iron oxide can be prepared by co-precipitation of Fe2+ and Fe3+ salts in aqueous solution. The resulting cores consist of magnetite (Fe3O4), maghemite (γ-Fe2O3) or a mixture of the two. The anionic salt content (chloride, nitrate, sulfate, etc.), Fe2+ and Fe3+ ratio, pH and ionic strength in the aqueous solution all play a role in controlling the size. It is important to prevent oxidation of the synthesized nanoparticles and protect their magnetic properties by carrying out the reaction in an oxygen-free environment under an inert gas such as nitrogen or argon. Coating materials can be added during the co-precipitation process to prevent aggregation of iron oxide nanoparticles into microparticles. Those skilled in the art will appreciate that any number of surface coating materials known in the art can be used to stabilize iron oxide nanoparticles, for example, synthetic and natural polymers such as polyethylene glycol (PEG), dextran, polyvinylpyrrolidone (PVP), fatty acids, polypeptides, chitosan, and / or gelatin.

[0205] For example, U.S. Patent No. 4,421,660 describes polymer-coated particles of inorganic materials that are conventionally prepared by (1) treating an inorganic solid with an acid, a combination of an acid and a base, an alcohol, or a polymer solution; (2) dispersing additional polymerizable monomers in an aqueous dispersion of the treated inorganic solids, and (3) subjecting the resulting dispersion to emulsion polymerization conditions (col. 1, lines 21-27). U.S. Patent No. 4,421,660 also discloses a method for coating inorganic nanoparticles with a polymer, comprising the steps of (1) emulsifying a hydrophobic emulsion-polymerizable monomer in an aqueous colloidal dispersion of individual particles of the inorganic solid, and (2) subjecting the resulting emulsion to emulsion polymerization conditions to form a stable, fluid aqueous colloidal dispersion of inorganic solid particles dispersed in a matrix of a water-insoluble polymer of the hydrophobic monomer (col. 1, lines 42-50).

[0206] Alternatively, polymer-coated magnetic materials that meet the starting size requirements can be obtained commercially. For example, commercially available ultra-small superparamagnetic iron oxide nanoparticles include NC100150 Injection (Nycomed Amersham, Amersham Health) and Ferumoxytol (AMAG Pharmaceuticals, Inc.).

[0207] Suitable polymers that can be used to coat the core of magnetic material include, but are not limited to, fluorinated or chlorinated polymers such as polystyrene, polyacrylamide, polyetherurethane, polysulfone, polyvinyl chloride, polyethylene, and polypropylene, polycarbonates, and polyesters. Further examples of polymers that can be used to coat the core of magnetic material include polyolefins, such as polybutadiene, polydichlorobutadiene, polyisoprene, polychloroprene, halogenated polyvinylidene, polyvinylidene carbonate, and polyfluorinated ethylene. Some copolymers containing styrene / butadiene, alpha-methylstyrene / dimethylsiloxane, or other polysiloxanes can also be used to coat the core of magnetic material (e.g., polydimethylsiloxane, polyphenylmethylsiloxane, and polytrifluoropropylmethylsiloxane). Further polymers that can be used to coat the core of magnetic material include polyacrylonitrile or acrylonitrile-containing polymers, such as polyalpha-acrylonitrile copolymers, alkyd or terpenoid resins, and polyalkylene polysulfonates. In some embodiments, the polymer coating is dextran. EXAMPLES

[0208] Having now generally described the invention, it will be more readily understood by reference to the following examples, which are included merely for the purpose of illustrating certain embodiments of the invention and are not intended to be limiting of the invention.

[0209] Example 1 Design, synthesis, and testing of RNA oligonucleotides In this example, miRNA inhibitors are designed to be fully complementary to their target miRNAs, including diphosphate (pp) triphosphate (ppp) at the 5' end for a strong agonist response, and thio-MC6-D at the 3' end for conjugation to magnetic nanoparticles (MN) for delivery. The 5'pp or 5'ppp modification is omitted for control oligos. Blunt-end double-stranded structures are generated by annealing 5'pp or 5'ppp-anti-miRNA-3'-thio-MC6-D with complementary miRNAs that can also be conjugated to MN. All custom RNA oligonucleotides are synthesized using known methods.

[0210] Synthesis and characterization of nanoconjugates The procedure is adapted from a publication (Medarova Z. et al., 2016. Controlling RNA Expression in Cancer Using Iron Oxide Nanoparticles Detectable by MRI and In Vivo Optical Imaging. Methods Mol Biol. 2016;1372:163-179) and is briefly summarized below. The disulfides on the oligonucleotides are activated by 3% Tris(2-carboxyethyl)phosphine hydrochloride (TCEP, Thermo Scientific Co., Rockford, IL), purified using ammonium acetate / ethanol precipitation, and then conjugated to nanoparticles. Aminated magnetic nanoparticles are synthesized. Nanoparticles with a size of 20+ nm are used for conjugation to oligonucleotides. The magnetic nanoparticles are sequentially conjugated to the heterobifunctional linker N-succinimidyl 3-[2-pyridyldithio]-propionate (SPDP; Thermo Scientific Co., Rockford, IL) and the activated oligonucleotide. Briefly, SPDP is dissolved in anhydrous DMSO and incubated with magnetic nanoparticles. The 3'-thioMC6 of the oligos is activated by 3% TCEP treatment in nuclease-free PBS to release the thiol. The oligonucleotides are purified using ammonium acetate / ethanol precipitation. After TCEP activation and purification, the oligonucleotides are dissolved in water and incubated with SPDP-modified magnetic nanoparticles overnight. The number of oligonucleotides per magnetic nanoparticle is determined using electrophoretic analysis.

[0211] Example 2 Protein expression and purification Full-length human RIG-I is cloned into E. coli and expressed in recombinant form with a His-SUMO tag as reported (Kwok J. et al. 2014. Expression, purification, crystallization and preliminary X-ray analysis of full-length human RIG-I. Acta Crystallogr F Struct Biol Commun. 70(Pt 2):248-251). Protein expression and purification are adapted and modified from published procedures as summarized below (Rawling DC. et al. 2020. Small-Molecule Antagonists of the RIG-I Innate Immune Receptor. ACS Chemical Biology.15(2):311-317). RIG-I expression plasmids are transformed into Rosetta II (DE3) E. coli cells (Novagen) using 150 ng / 25 uL of commercial cell stock and grown in LB medium supplemented with 50 mM potassium phosphate pH 7.4 and 1% glycerol. Expression is induced by adding isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM. Cells are grown at 16°C for 24 h before being harvested by centrifugation and resuspended in lysis buffer (20 mM phosphate pH 7.4, 500 mM NaCl, 10% glycerol, 5 mM β-mercaptoethanol (βME)) to a final volume of 50 ml and frozen at -80°C. For lysis, the frozen pellets are thawed at room temperature and then resuspended in an additional 200 ml of lysis buffer per 4 L of pellet. Cells are lysed by passage through a microfluidizer at 15,000 psi or by the method of choice, and the lysate is clarified by ultracentrifugation at 100,000×g for 30 min. Soluble lysates are incubated on 2.5 ml of Ni-NTA beads (Qiagen) and washed with lysis buffer containing an additional 40 mM imidazole before elution with Ni elution buffer (25 mM HEPES pH 8.0, 150 mM NaCl, 220 mM imidazole, 10% glycerol, 5 mM βME).The eluted protein is bound to a HiTrap Heparin HP column (GE Biosciences), washed with a buffer containing 150 mM NaCl, and stepwise eluted with 0.65 M NaCl. The SUMO tag is then removed by incubation with SUMO protease for 2 h at 4 °C. Finally, the monomeric protein is collected by passing through a HiPrep 16 / 60 Superdex 200 column (GE Biosciences) in gel filtration buffer (25 mM MOPS pH 7.4, 300 mM NaCl, 5% glycerol, 5 mM βME). Peak fractions are concentrated to 10-20 μM using centrifugal concentrators (Millipore) with a molecular weight cut-off of 50 kD.

[0212] Example 3 In vitro testing of RIG-I activation by 5'pp or 5'ppp-ds-miRNA mimics The ATP / NADH-coupled assay for ATPase activity is based on a reaction in which the regeneration of hydrolyzed ATP is coupled to the oxidation of NADH. After each cycle of ATP hydrolysis, a regeneration system consisting of phosphoenolpyruvate (PEP) and pyruvate kinase (PK) converts one molecule of PEP to pyruvate as ADP is converted back to ATP. Pyruvate is subsequently converted to lactate by lactate dehydrogenase (LDH), resulting in the oxidation of one molecule of NADH. The assay measures the rate of decline in NADH absorbance at 340 nm, which is proportional to the rate of steady-state ATP hydrolysis. The constant regeneration of ATP allows for the monitoring of the rate of ATP hydrolysis over the course of the assay. The reader in a 96-well microplate format allows for the simultaneous analysis of up to 96 samples. RIG-I is an ATP-dependent RNA helicase. Binding and activation by 5'pp or 5'ppp-ds-miRNA mimics confers ATPase activity to this protein. Enzyme assays can be conveniently used to test and / or screen for agonists or antagonists for the RIG-I receptor.

[0213] An exemplary procedure for the NADH-coupled ATPase assay is described below (Rawling DC. et al. 2020. Small-Molecule Antagonists of the RIG-I Innate Immune Receptor. ACS Chemical Biology.15(2):311-317). For the NADH-coupled assay, RIG-I protein is diluted in ATPase assay buffer (25 mM MOPS pH 7.4, 150 mM KCl, 2 mM DTT) to a final concentration of 10 nM for initial compounds, then 20 nM to visualize more potent inhibitors. In this case, RIG-I is wis activated by the desired RNA oligo or control added to a final concentration of 250 nM. A coupled assay mix consisting of 1 mM NADH, 100 U / ml lactate dehydrogenase, 500 U / ml pyruvate kinase, 2.5 mM phosphoenolpyruvate is added to the sample. Samples are incubated for at least 1 h at RT. The reaction is initiated by adding a 1:1 ATP / MgCl2 mix at a final concentration of 5 mM.

[0214] RNA agonist-induced RIG-I activation is assessed by measuring type I interferons using cell-based reporter gene assays based on readily available cell lines. Increasingly, commercially available cell lines are available that have been developed for reporter gene assays that respond to IFN exposure. These cells produce soluble gene products that can be easily quantified using a multiwell plate spectrophotometer or luminometer.

[0215] InvivoGen HEK-Lucia™ RIG-I cells were generated from HEK-Lucia™ Null cells, which are HEK293-derived cells that stably express a secreted Lucia luciferase reporter gene. This reporter gene is under the control of the IFN-inducible ISG54 promoter enhanced by a multimeric IFN-stimulated response element (ISRE). HEK-Lucia™ RIG-I cells stably express high levels of human RIG-I and are robustly responsive to cytosolic double-stranded RNA with uncapped 5'-triphosphate ends, such as 3p-hpRNA and 5'pp or 5'ppp-dsRNA. HEK-Lucia™ RIG-I and HEK-Lucia™ Null cells can be used to test the role of RIG-I by monitoring IRF-induced Lucia luciferase activity. The levels of IRF-induced Lucia in cell culture supernatants can be easily monitored using QUANTI-Luc™, a Lucia luciferase detection reagent (also from InvivoGen).Transfection agents such as LyoVec™ (InvivoGen) can be used to achieve stimulation of RIG-I using naked 5'pp or 5'ppp-dsRNA or controls that need to be delivered into the cytoplasm.

[0216] Example 4 Animal models Orthotopic models feature tissue-specific tumor implantation that is easily monitored using live imaging techniques, creating a disease-relevant tumor microenvironment (TME) for better translation to the clinic. Orthotopic models involve the seeding of tumor cell lines into corresponding tissues in animal models. This strategy allows us to evaluate tumor development in a relevant environment and evaluate efficacy in preclinical tumor models that mimic the disease process in humans. With orthotopic models, disease progression is monitored by a variety of methods, including clinical signs, survival study designs, and imaging platforms with both in vivo and ex vivo capabilities. Examples of study designs are described below.

[0217] Exemplary metastatic breast cancer cell lines that can be used include MDA-MB-231-GFP, 4T1 (American Type Culture Collection (ATCC), Manassas, VA, USA) and MDA-MB-231-luc-D3H2LN (Caliper Life Sciences, Hopkinton, MA, USA). These cell lines are used as recommended by the supplier. Six-week-old female nude mice (nu / nu or NIH III nude) are orthotopically implanted with the human breast adenocarcinoma MDA-MB-231-luc-D3H2LN cell line (Caliper Life Sciences). In this model, orthotopically implanted tumors progress from localized disease to lymph node metastasis by 4 weeks after tumor inoculation. Tumor cells express luciferase and can be detected by non-invasive bioluminescence imaging for correlative analysis of tumor burden. All animal experiments were performed in accordance with institutional guidelines and approved by the Subcommittee on Research Animal Care (SRAC).

[0218] Prevention of metastasis: 6-week-old nu / nu mice are injected into the upper right mammary fat pad with 2×106 MDA-MB-231-luc-D3H2LN cells (Caliper). Animals are used in the experiment 14 days after tumor implantation.

[0219] Stopping metastasis: 6-week-old NIH III nude mice are injected into the lower left mammary fat pad with 2x106 MDA-MB-231-luc-D3H2LN cells (Caliper). Animals are used in the experiment 28 days after tumor implantation. Treatment with MN-5'pp or MN-5'ppp-anti-miR10b and MN-5'pp- or MN-5'ppp-scr-miR involves systemic administration via the tail vein at a dose of 10mg Fe / kg once a week for 4 weeks.

[0220] Example 5 Design of template-specific RIG-I agonist, ss-pppmiRNA-21 Template-specific RIG-I agonist, ss-ppp-miRNA-21, efficiently stimulates RIG-I and induces apoptosis in melanoma cells The ability of ss-ppp-miRNA-21 to induce RIG-I activation was tested in HEK-Lucia™ RIG-I, a human RIG-I luciferase reporter cell line. This commercially available cell line stably expresses high levels of human RIG-I and a secreted Lucia luciferase reporter gene. The reporter gene is under the control of an IFN-inducible ISG54 promoter enhanced by a multimeric IFN-stimulated response element (ISRE). The HEK-Lucia™ RIG-I and HEK-Lucia™ Null control cells can be used to test the role of RIG-I by monitoring IRF-induced Lucia luciferase activity. High expression of RIG-I in the cells was confirmed using Western blot (Figure 2A). The discrimination sensitivity of HEK-Lucia™ RIG-I and HEK-Lucia™ Null control cells was verified using a commercially available conventional RIG-I agonist consisting of a 5' triphosphate double-stranded RNA 19-mer (ds-ppp-RNA). A highly significant enhancement of luciferase activity was observed in RIG-I overexpressing cells compared to null cells (Figure 2B).

[0221] The ability of the template-specific RIG-I agonist ss-ppp-miRNA-21 to activate RIG-I was evaluated. HEK-Lucia™ RIG-I and HEK-Lucia™ Null control cells were treated with ss-ppp-miRNA-21 as well as single-stranded oligonucleotides identical to our RIG-I agonist except that they did not contain 5'-ppp. Significant RIG-I activation was observed at all three dose levels of ss-ppp-miRNA-21 tested (Figure 2C). Given the strict requirement for the formation of an RNA duplex for RIG-I activation, these results support a template-directed mechanism of RIG-I agonism, especially since the miR-21 complement of the single-stranded RNA oligonucleotide was not exogenously supplied. Interestingly, even in the absence of 5'-ppp, there was a moderate RIG-I activation (Figure 2C).

[0222] Once it was established that ss-ppp-miRNA-21 could induce RIG-I in HEK-Lucia reporter cells overexpressing RIG-I, Applicants performed experiments to determine whether template-specific RIG-I agonists could mediate activation of proapoptotic signaling in the B16-F10 melanoma cell line. B16-F10 melanoma cells express miR-21 and have been used to test endogenous RIG-I signaling with cell death as an endpoint (Bek et al., 2019). Caspase-3 / 7 activation was measured in B16-F10 melanoma cells treated with ss-ppp-miRNA-21 or 5'-ppp-deficient ss-miRNA-21. A dose-dependent activation of caspase-3 / 7 was observed, which was more pronounced in the presence of 5'-ppp (Figure 2D). A dose-dependent decrease in tumor cell viability was also observed when using the ss-ppp-miRNA-21 RIG-I agonist (Figure 2E). This decrease in tumor cell viability was significantly greater than that observed using the 5'-ppp-deleted ss-miRNA-21.

[0223] RIG-I agonism by ss-ppp-miRNA-21 is template dependent To further probe the template-dependence of the observed RIG-I activation using ss-ppp-miRNA-21, HEK-Lucia™ RIG-I cells were transiently transfected with increasing concentrations of synthetic mature miRNA-21 mimics. Highly significant induction of RIG-I signaling by ss-ppp-miRNA-21 agonists was observed in cells transfected with 30 and 300 ng / ml of synthetic mature miRNA-21 mimics (Figure 3A). Surprisingly, induction of RIG-I signaling by ss-ppp-miRNA-21 agonists was observed in cultures of as few as 10,000 cells. The level of activation by ss-ppp-miRNA-21 was similar to that observed for the commercially available ds-ppp-RNA positive control oligonucleotide (Figure 3A). 5'-ppp-deleted ss-miRNA-21 failed to cause detectable RIG-I activation (Figure 3A). Furthermore, analysis of the dose-dependence of RIG-I activation as a function of miRNA-21 mimic concentration determined an EC50 of 83.4 ng / ml for miRNA-21 mimics using ss-ppp-miRNA-21. In contrast, the calculated EC50 for 5'-ppp-deleted ss-miRNA-21 was 357.9 ng / ml (Figure 3B).

[0224] The ability of template-specific ss-ppp-miRNA-21 agonists to induce IFN-I responses was evaluated in B16-F10 mouse melanoma cells. Treatment with increasing concentrations of RIG-I agonists caused a dose-dependent increase in IFN-β secretion. In cells transfected with mature miR-21 mimics, the effect was amplified, suggesting template-specific enhancement of IFN-I stimulation by the agonists. In contrast, commercially available ds-ppp-RNA agonists were unable to stimulate IFN-β secretion (Figure 3C).

[0225] Caspase 3 / 7 activation as a function of miRNA-21 mimic concentration was measured to determine consistency with known mechanisms of apoptosis induction by tumor cell-intrinsic RIG-I signaling in B16-F10 cells transiently transfected with miRNA-21 mimics. Surprisingly, a dose-dependent increase in caspase 3 / 7 activation was observed, the effect of which was significantly higher in cells treated with ss-ppp-miRNA-21 compared to 5'-ppp-deleted ss-miRNA-21 and comparable to the ds-ppp-RNA positive control (Figure 3D).

[0226] In addition to RIG-I activation, we assessed the expression levels of RIG-I to determine whether there was also evidence of RIG-I upregulation in B16-F10 cells treated with ss-ppp-miRNA-21. Low levels of RIG-I were detected in B16-F10 cells. However, in cells transfected with miR-21 and treated with ss-ppp-miRNA-21, there was a dramatic upregulation of RIG-I above the levels seen with the ds-ppp-RNA positive control oligonucleotide (Figure 3E).

[0227] One of the mechanisms of immune activation by RIG-I agonism involves activation of the NF-κB signaling pathway. In our study, phosphorylation of the NF-κB subunit p65 at S536 was analyzed to measure NF-κB transactivation. Strong phospho-P65 reactivity was observed in lysates derived from B16-F10 cells treated with ss-ppp-miRNA-21, and the strong reactivity was further amplified when cells were also transfected with miR-21 mimics. The increased reactivity was not associated with increased expression of p65, indicating that the increased reactivity specifically reflected target phosphorylation (Figure 3F). This surprising finding further supports a mechanism for effective template-dependent immune stimulation by ss-ppp-miRNA-21.

[0228] Although specific embodiments of the subject matter have been discussed, the above specification is illustrative and not restrictive. Many variations will be apparent to those skilled in the art upon review of this specification and the following claims. The full scope of the invention should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.

Claims

1. A composition for treating cancer in a subject, said composition comprising a single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide, said oligonucleotide being complementary to a miRNA that is highly expressed in a tumor or tumor microenvironment compared to a non-tumor or non-tumor microenvironment.

2. The composition described in claim 1, wherein RIG-I is selectively activated in the tumor or tumor microenvironment that expresses the miRNA.

3. 3. The composition of claim 1 or 2, wherein the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221.

4. The composition described in any one of claims 1 to 3, wherein the oligonucleotide is a modified RNA oligonucleotide comprising the nucleic acid sequence of SEQ ID NO:

6.

5. 5. The composition of claim 4, wherein the cancer is selected from the group consisting of breast, ovarian, cervical, colon, lung, liver, brain, esophageal, prostate, pancreatic, and thyroid cancer.

6. The composition described in claim 1, wherein the oligonucleotide is a modified RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO:

1.

7. The composition of claim 5 or 6, wherein the cancer is non-small cell lung cancer or cervical cancer.

8. A composition for treating cancer in a subject, the composition comprising magnetic nanoparticles, the magnetic nanoparticles comprising: ferric chloride, ferrous chloride, or a combination thereof; A dextran coating; and Single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide Including, The composition, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a tumor or a tumor microenvironment compared to a non-tumor or a non-tumor microenvironment.

9. A single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide that is complementary to a miRNA that is highly expressed in tumor tissue compared to non-tumor tissue.

10. 10. The modified RNA oligonucleotide of claim 9, wherein the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221.

11. The modified RNA oligonucleotide of claim 10, capable of forming a duplex with the miRNA.

12. A modified RNA oligonucleotide according to any one of claims 9 to 11, comprising a nucleic acid sequence according to any one of SEQ ID NOs: 1 to 13.

13. 13. The modified RNA oligonucleotide of any one of claims 9 to 12, further linked to a nanoparticle.

14. The modified RNA oligonucleotide of claim 13, wherein the nanoparticle is a magnetic nanoparticle.

15. The modified RNA oligonucleotide of claim 14, wherein the magnetic nanoparticles are coated with a polymer coating.

16. The modified RNA oligonucleotide of claim 15, wherein the polymer coating is dextran.

17. 17. The modified RNA oligonucleotide of any one of claims 14 to 16, wherein the magnetic nanoparticles comprise iron oxide; and a dextran coating functionalized with one or more amine groups, the number of the one or more amine groups ranging from about 5 to about 1000.

18. ferric chloride, ferrous chloride, or a combination thereof; A dextran coating; and Single-stranded 5' uncapped triphosphate or diphosphate modified RNA oligonucleotide wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a tumor or tumor microenvironment compared to a non-tumor or non-tumor microenvironment.

19. A pharmaceutical composition comprising a modified RNA oligonucleotide according to any one of claims 9 to 17 or a magnetic nanoparticle according to claim 18.

20. The pharmaceutical composition of claim 19, further comprising a delivery agent selected from the group consisting of micelles, lipid nanoparticles (LNPs), spherical nucleic acids (SNAs), extracellular vesicles, synthetic vesicles, exosomes, lipidoids, liposomes, and lipoplexes.

Images