Formulations and methods for MHC-I restricted epitope immunization

Abstract

The present disclosure provides compositions and methods for generating an immune response or enhancing an immune response, comprising administering to a subject in need of treatment a composition comprising a liposome comprising a cobalt-chelated porphyrin such that the cobalt metal is present within the bilayer in the porphyrin macrocycle and a poly-histidine tagged MHC-I restricted tumor peptide.

Description

Statement regarding federally sponsored research

[0001] This invention was made with Government support under Grant No. R01 CA247771 awarded by the National Institutes of Health. The Government has certain rights in this invention. CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 137,036, filed January 13, 2021, the disclosure of which is incorporated herein by reference.

[0003] To kill cancer cells, CD8 + T cell receptors (TCRs) must recognize short tumor-derived peptides (8–10 amino acids) associated with major histocompatibility complex (MHC) class I (MHC-I) molecules. These short peptide epitopes are easy to produce and theoretically can be targeted by CD8 T cells to antigen (Ag)-bearing target cells. + They are attractive for cancer vaccine development because they provide a direct way to induce T cells. Unfortunately, cancer clinical trials of peptide-based vaccines have not produced convincing clinical responses, in contrast to more recent immunotherapies such as immune checkpoint blockade. Although several reasons could explain this, one challenge for peptide-based cancer vaccines is to obtain sufficient quantity and quality of Ag-specific CD8 T cells. + The main problem with cancer vaccines is their inability to potently generate T cells. Considerable efforts have been devoted to developing improved cancer peptide vaccine systems. Covalent conjugation is often used to improve their immunogenicity, and recent promising approaches have utilized conjugation to lipids (Kuai et al., Nature materials 16, 489-496(2017)), proteins (Mehta et al., Nature Biomedical Engineering, doi:10.1038 / s41551-020-0563-4(2020)), and long peptides (Lynn, et al. Nature Biotechnology, 1-13(2020)) to achieve this goal.

[0004] Another challenge in cancer vaccine development is the identification of Ag-specific CD8 antigens that can recognize target epitopes on cancer cells. + The goal of this study is to identify short peptide immunogens that induce T cell responses. Neoantigens are mutated cancer-specific epitopes, providing a rich source of potential cancer vaccine targets. However, it has proven difficult to identify immunogenic MHC-I-restricted neoantigens that result in a functional immune response. Indeed, attempts to target these with longer peptides have been hampered by the lack of evidence that long peptides can mediate MHC class II (MHC-II) binding and CD4 + (CD8 + This has led to the discovery that MHC-I requires the help of T cells (not immune cells) to be effective (Kreiter, et al. Nature 520, 692-696, doi:10.1038 / nature14426(2015)). This complicates MHC-I design, and the practical implication is that designing short peptides (whose length limits their binding to MHC class I) is an emerging practice with limited ability to rationally select target amino acid sequences. Summary of the Invention

[0005] The present disclosure provides compositions and methods for generating an anti-tumor immune response or enhancing an immune response to an MHC-I peptide using functionalized liposomes containing MHC-I peptides.

[0006] In one aspect, the present disclosure provides functional liposomes (also referred to herein as nanostructures) comprising MHC-I binding peptides (also referred to herein as MHC-I restricted peptides and MHC-I targeting peptides). Although the present disclosure refers to MHC-I, the present disclosure also includes peptides that bind to human leukocyte antigen (HLA) class 1 molecules. Thus, when MHC-I is referred to, the present disclosure includes HLA-1 restricted peptides for use in humans. MHC-I binding and / or CD8 +The peptides described herein as having demonstrated or predicted T cell stimulation are believed to have the same properties when HLA-1 expressing T cells are used. In some embodiments, the peptides bind MHC-I and express CD8 + The peptides described as being capable of stimulating T cells are thought to be presented in an MHC-I context.

[0007] For example, the liposome can include a human MHC-I binding peptide. The bilayer includes a cobalt porphyrin-phospholipid conjugate, a phospholipid not conjugated to a porphyrin, optionally a sterol, and optionally polyethylene glycol (PEG). One or more MHC-I binding peptides with a polyhistidine tag are incorporated into the bilayer such that a portion of the polyhistidine tag is present within the bilayer, and at least a portion of the MHC-I targeting peptide is exposed to the exterior of the bilayer. Instead of or in addition to the cobalt porphyrin-phospholipid conjugate, a cobalt porphyrin can be used in the liposome bilayer. The bilayer structure includes a cobalt chelating porphyrin (cobalt metal is present within the bilayer and the porphyrin macrocycle) and further has an MHC-I binding peptide molecule with a histidine tag non-covalently attached (at least a portion of the histidine tag is present within the bilayer and coordinated to the cobalt metal core). In embodiments, the cobalt porphyrin is cobalt porphyrin-phospholipid (CoPoP). The liposome may further comprise an adjuvant, which may be incorporated into the bilayer or present in the aqueous compartment, or both. For example, in embodiments, the liposome further comprises QS21 and a PHAD. CPQ refers to a liposome comprising CoPoP, a PHAD variant, and QS21. 2HPQ refers to the same liposome but lacking cobalt in the porphyrin macrocycle, and thus comprises PoP, a PHAD variant, and QS21.

[0008] In various embodiments, the present disclosure provides a liposome comprising: a) a bilayer; and b) a polyhistidine-tagged MHC-I restricted peptide, the bilayer comprising: i) a phospholipid and a porphyrin that coordinates to cobalt to form a cobalt-porphyrin, wherein at least a portion of the polyhistidine tag of the polyhistidine-tagged MHC-I restricted peptide is present in a hydrophobic portion of the bilayer, and one or more histidines of the polyhistidine tag are coordinated to the cobalt in the cobalt-porphyrin, wherein the polyhistidine tag is present in a hydrophobic portion of the bilayer and one or more histidines of the polyhistidine tag are coordinated to the cobalt in the cobalt-porphyrin, and wherein the polyhistidine tag is present in a hydrophobic portion of the bilayer. At least a portion of the histidine-tagged MHC-I restricted peptide is exposed on the outside of the liposome, which binds to MHC-I class of molecules but not to MHC-II class of molecules, the polyhistidine tag contains 2 to 6 histidine residues (preferably less than 6 histidine residues), and the MHC-I restricted peptide is a peptide of 4 to 11 amino acids in length (including all integer values ​​and ranges therebetween, e.g., 7 to 11 amino acids in length, not counting the histidines of the His-tag).

[0009] In various embodiments, the present disclosure provides a vaccine composition comprising a pharmaceutical carrier and one or more liposomes, wherein the liposome comprises a cobalt porphyrin-phospholipid conjugate, optionally a phospholipid not conjugated to a porphyrin, optionally a sterol, and optionally polyethylene glycol (PEG), and comprises one or more MHC-I targeting peptides having a polyhistidine tag, the MHC-I targeting peptides being incorporated into the bilayer such that a portion of the polyhistidine tag is present within the bilayer and at least a portion of the MHC-I targeting peptide is exposed to the exterior of the bilayer. In various embodiments, all or nearly all of the MHC-I peptides are exposed to the exterior of the liposome and all or nearly all of the polyhistidine tags are present within the bilayer. The vaccine composition may comprise a plurality of liposomes, each liposome comprising the same or different MHC-I peptide as another liposome in the composition. For example, a vaccine composition may include sets of liposomes, each liposome in a set containing a particular MHC-I peptide, with each set containing different MHC-I peptides. In one embodiment, a liposome may contain two or more MHC-I peptides, and different liposomes in the composition may contain different combinations of MHC-I peptides.

[0010] The nanostructures can be used to generate an immune response or enhance an immune response. The cancer vaccine adjuvant can be used to generate an anti-tumor response using short MHC-I restricted peptides. In one aspect, the disclosure provides a method for generating or enhancing an anti-tumor immune response. The method includes administering to a subject in need of immunization a composition comprising a liposome comprising a cobalt porphyrin-phospholipid conjugate, optionally a phospholipid not conjugated to a porphyrin, optionally a sterol, and optionally polyethylene glycol (PEG), and one or more MHC-I targeting peptides with a polyhistidine tag, the MHC-I targeting peptides being incorporated into the bilayer such that a portion of the polyhistidine tag is present in the bilayer and at least a portion of the MHC-I targeting peptide is exposed to the outside of the bilayer.

[0011] In some embodiments, the disclosure provides a method for increasing the immunogenicity of an MHC-I peptide and / or eliciting neutralizing antibodies against an MHC-I peptide by administering to a subject in need of treatment a composition comprising liposomes, where the liposomes comprise a bilayer comprising a cobalt porphyrin-phospholipid conjugate, optionally a phospholipid not conjugated to a porphyrin, optionally a sterol, and optionally polyethylene glycol (PEG), and have one or more MHC-I peptides with a polyhistidine tag incorporated into the bilayer such that a portion of the polyhistidine tag is present in the bilayer and at least a portion of the MHC-I peptide is exposed outside the bilayer. Optionally, one or more adjuvants may be incorporated into the nanostructure or may be administered separately.

[0012] In some embodiments, the present disclosure provides a method for in vivo cancer epitope screening and refinement using peptide microlibraries, the method comprising introducing one or more peptides into an animal model and subsequently detecting anti-cancer activity and / or CD8 activity caused by said one or more peptides. +and assessing T cell activity. The peptides can be further improved by repeatedly mutating residues and testing the mutated peptides for improved activity. Combinations of peptides identified by the above screens can be used as multiplexed vaccines. [Brief description of the drawings]

[0013] [Figure 1] CPQ liposomes rapidly and stably immobilize short MHC-I-restricted peptides A) Components of the CPQ adjuvant system used in this study along with a model A5 peptide. The sequence of A5 is SEQ ID NO:1. B) Binding of liposomes to the A5 peptide (with or without the his-tag) after 1 hour of incubation. C) Binding of the indicated liposomes to A5 (his-tagged) after 1 h of incubation. D) and E) show the hydrodynamic sizes of the liposomes in (B) and (C), respectively. F) Cryo-electron microscopy (cryo-electron microscopy) images of CPQ liposomes with and without A5 peptide bound. G) Binding kinetics of A5 to CPQ and 2HPQ liposomes. H) Refrigerated storage stability of CPQ liposomes and CPQ / A5 liposomes. I) Binding stability of A5 to CPQ liposomes and 2HPQ liposomes when incubated at 37°C in the presence of 40% human serum. Error bars indicate mean ± standard deviation of n=3 independent experiments. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 Analyzed by two-way ANOVA (B, G, H, I) or one-way ANOVA (C) with Bonferroni multiple comparison post-hoc test.

[0014] [Figure 2] Size and polydispersity of liposomes after A5 conjugation Liposome-peptide conjugation at various mass ratios A) Fluorescent A5 peptide was incubated with CPQ / 2HPQ liposomes for 1 h at peptide:liposome mass ratios of 1:8, 1:4, 1:2, or 1:1. The fluorescence of A5 was quenched upon binding to liposomes. B) Binding of A5 peptide to liposomes by microcentrifugation. C) Liposome size after peptide conjugation. D) Polydispersity of liposomes after peptide conjugation. Error bars indicate the mean ± standard deviation of n=3 independent experiments.

[0015] [Figure 3] A5 mixed with CPQ liposomes inhibited robust Ag-specific CD8 + Inducing T cell responses BALB / c mice were immunized (intramuscularly) on days 0 and 7 with 500 ng of A5 mixed with the indicated adjuvants. + T cell and effector memory (Tem) phenotypes were assessed by tetramer (abbreviated as tet) and surface marker staining. IFN-γ and TNF-α producing CD8 + T cells were assessed by intracellular staining of splenocytes. AH1 tetramer + CD8 + Flow cytometry gating (A) and percentage (B) of T cells TEM CD8 + T cell phenotype gating (C) and percentage (D) of T cells. IFN-γ-producing CD8 in splenocytes after peptide restimulation + T cell gating (E) and percentage (F) G) TNF-α-producing CD8 in splenocytes after antigen restimulation + Percentage of T cells H) In vitro lysis of CT26 target cells (T) by T effector cells (E) from splenocytes of CPQ / A5-vaccinated or naive mice at various E:T ratios. Error bars indicate the mean ± standard deviation from n = 7 independent experiments for B and D, n = 5 independent experiments for F and G, and n = 3 independent experiments for H. *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001 (B, D) were analyzed by one-way ANOVA, (H) by two-way ANOVA and Bonferroni multiple comparison post-hoc test, and (F, G) by two-tailed unpaired Student's t test.

[0016] [Figure 4] CPQ / A5 vaccination induces robust AH1-specific CD8 + Inducing T cells BALB / c mice were vaccinated (intramuscularly) with A5 mixed with the indicated adjuvants on days 0 and 7. Each injection contained 0.5 μg of antigen. On day 14, splenocytes were prepared from these mice and stained with antibodies. (A) Cells were first gated by SSC-FSC, then gated by CD8 positive, but IA / IE, CD4, B220 negative. AH1-specific T cells were gated by AH1 tetramer positive cells. (B) AHI-specific CD8 in the spleens of mice vaccinated with the indicated vaccines. + Percentage of T cells. ****p<0.0001, (B) analyzed by one-way ANOVA.

[0017] [Figure 5] Durable and robust protection from diverse tumor model challenges by CPQ / A5 immunization (A) Mice were immunized with the indicated vaccine doses on days 0 and 7 and blood Ag-specific CD8 + T cells were assessed by tetramer staining on days 7 and 13. In each pair of bars, prime is on the left and boost is on the right. (B) Tumor-free days after intramuscular immunization with CPQ / A5 at the indicated A5 doses on days 0 and 7 and challenge with CT26 on day 14. The study duration was 90 days. (C) Ag-specific CD8 + Correlation between T cells and tumor size. (D) AH1-specific CD8 in blood on day 13 and in spleen on day 13. + T cells (in each pair of bars, blood is on the left and spleen is on the right). (E) Tumor-free days after challenge with CT26 cells in mice immunized with 500 ng of A5 mixed with the indicated adjuvants. Percentage of mice with tumor size less than 1 cm after immunization with 500 ng of A5 mixed with CPQ liposomes or 2HPQ liposomes and challenged subcutaneously with CT26 cells (F) or CMS4 cells (G), or orthotopically with 4T07 cells (H). (I) Ag-specific CD8 in the blood of mice vaccinated with 500 ng of A5 mixed with the indicated adjuvants on days 0 and 7. + T cell kinetics. (J) Tumor growth in mice vaccinated with CPQ / A5 or 2HPQ / A5. 73 days after the final boost, mice were subcutaneously challenged with CT26 cells (indicated by arrows). Error bars indicate the mean ± standard deviation, n=5 mice per group. *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001 (B, E) One-way ANOVA; (A, D, I, J) Two-way ANOVA and Bonferroni multiple comparison post-hoc test or log-rank test (F, G, H).

[0018] [Figure 6] Effect of QS21 and antigen dose on T cell production CPQ liposomes were prepared at a mass ratio of [CoPoP:PHAD:QS21=1:1:1] or [CoPoP:PHAD:QS21=1:1:0.25], and antigens were incubated with the liposomes at a mass ratio of 1:4. BALB / c mice were injected with the CPQ / A5 vaccine on days 0 and 7, and blood was collected on day 14 for tetramer staining. CD8 in the blood of mice injected with the indicated vaccines was + AH1 tetramers in T cells + Percentage of cells. Error bars indicate the mean ± standard deviation for n=3 independent experiments. *p<0.05, analyzed by one-way ANOVA followed by Bonferroni multiple comparison post-hoc test.

[0019] [Figure 7] CPQ / A5 Safety CD-1 mice were left untreated or vaccinated with CPQ / A5 (500 ng of A5 mixed with CPQ liposomes containing 2 μg each of CoPoP, QS-21, and PHAD) on days 0 and 7. Blood and organs were harvested on day 14. (A) Body weight of naive or CPQ / A5 vaccinated CD-1 mice. (B) Embedded hematoxylin-eosin stained sections of the indicated organs. (C) Complete blood count parameters are as follows: WBC (white blood cells), NEU (neutrophils), LYM (lymphocytes), MONO (monocytes), EOS (eosinophils), BAS (basophils), RBC (red blood cell count), HGB (hemoglobin), HCT (hematocrit), MCV (mean cell volume), MCH (mean cellular hemoglobin), MCHC (mean cellular hemoglobin concentration), PLT (platelets), MPV (mean platelet volume), RDW (red blood cell distribution width). CPQ+A5 is the left bar, control (Ctrl) is the right bar. (D) Summary of serum markers: BUN (blood urea nitrogen), phosphorus, calcium, total protein, albumin, globulin, glucose, cholesterol, ALT (alanine aminotransferase), ALP (alkaline phosphatase), and total bilirubin. Values ​​represent mean ± standard deviation of n = 5 mice per group. ND: no data in normal range. No statistically significant differences were observed in any group (*P < 0.05; based on one-way ANOVA). CPQ+A5 is the left bar, control is the right bar.

[0020] [Figure 8] Therapeutic efficacy of CPQ / A5 vaccination against early stage CT26 cancer BALB / c mice were inoculated subcutaneously with CT26 cells on day 0 and then immunized with CPQ / A5 or 2HPQ / A5 (500 ng peptide) on days 5 and 12. (A) Mean tumor size in mice vaccinated with CPQ / A5, 2HPQ / A5, or untreated. Tumor size of individual mice: (B) vaccinated with CPQ / A5, (C) vaccinated with 2HPQ / A5, or (D) untreated. (E) Percentage of mice with tumor size less than 1 cm after tumor inoculation. n=5 mice per group. For the metastasis model, mice were injected intravenously with CT26 tumor cells and then immunized 2 and 9 days later. Lungs were evaluated for metastasis on day 18. As shown by the representative photograph (F), the number of lung metastatic nodules (G), and lung weight (H), metastases were present in the untreated and 2HPQ / A5 groups, but not in the CPQ / A5 group. Error bars represent the mean ± standard deviation for n=5 mice per group. **p<0.01, ***p<0.001, and ****p<0.0001 (G, H) One-way ANOVA, (A) Two-way ANOVA with Bonferroni multiple comparison post-hoc test or log-rank test (E). Asterisks in panel A indicate statistically significant differences between CPQ / A5 and control groups.

[0021] [Figure 9] Putative mechanism of CPQ / A5 immunization (A) Schematic diagram of T cell activation after immunization with CPQ. (B) Immune cell populations in draining lymph nodes harvested 2 days after immunization with the indicated vaccines. For each series of bars, the left bar is untreated, the middle bar is CP / A5, and the right bar is CPQ / A5. (C) Uptake of A5 into mouse macrophages or BMDCs after 1 hour of incubation. In each series of bars, BMDCs are on the left and macrophages are on the right. (D) Uptake of A5 peptide into macrophages in the presence of the indicated phagocytosis and endocytosis inhibitors. (E) Confocal micrographs of mouse BMDCs incubated with beads coated with CPQ or CPQ / A5-hilyte 488. d Colocalization with (MHC-I) and LAMP-1 is shown. Scale bar, 10 μm (F) A5 was conjugated to liposomes containing CoPoP or CoNTA followed by addition of serum and lysosomal extract as indicated. Error bars indicate mean ± standard deviation. n=5 for lymph node studies, n=3 independent experiments for macrophage and BMDC uptake studies, and A5 binding studies. **p<0.01, ***p<0.001, and ****p<0.0001 (D) One-way ANOVA; (B, C) two-way ANOVA with Bonferroni multiple comparison post-hoc test.

[0022] [Figure 10] Liposomes are rapidly excreted into lymph nodes BALB / c mice were intramuscularly injected with 50 μL of 320 μg / mL 2HP in the left leg, and lymph nodes were harvested from the mice 0, 1, 2, and 4 hours after vaccination and subjected to fluorescent imaging. (A) Mouse lymph node. (B) Fluorescence of lymph nodes (C) Number of fluorescent lymph nodes at the indicated time points. Error bars represent the mean ± standard deviation of n = 3 mice. *p < 0.05, analyzed by one-way ANOVA with Bonferroni multiple comparison post-hoc test.

[0023] [Figure 11] Macrophage uptake of CPQ / A5-Hilyte488 liposomes RAW264.7 macrophages were incubated with CPQ / A5, 2HPQ / A5, or A5 alone (antigen concentration 1 μg / mL) for 1 h, then washed with PBS and lysed with 0.1% Triton. (A) Percent macrophage uptake of A5-Hilyte488 was measured at the indicated time points. (B) Fluorescence images of macrophages. CPQ / A5, 2HPQ / A5, and A5 alone were incubated with macrophages for 1 h. (C) Percentage of peptide release in macrophages. Error bars indicate the mean ± standard deviation for n=3 independent experiments. *p<0.01, ***p<0.001, analyzed by two-way ANOVA with Bonferroni multiple comparison post-hoc test. Asterisks in panel A indicate statistically significant differences between the CPQ / A5 and A5 groups.

[0024] [Figure 12] PoP lipid coating on silica beads Silica beads were either uncoated or coated with 2HPQ and then subjected to fluorescence microscopy.

[0025] [Figure 13] Integrity of fluorescent A5 peptide taken up by macrophages Macrophages were incubated with CPQ / A5 for 1 or 2 hours, then lysed with lysis buffer and subjected to HPLC.

[0026] [Figure 14] The length of the ERR-tag and his-tag in A5 is H-2L d Binding of CD8 + Effect on T cell induction (A, B) In vitro H-2L between various concentrations of A5 (without his-tag or ERR-tag) and the indicated peptides. d Binding competition. (A) The sequence of six histidines is SEQ ID NO: 2. (B) The sequence of six histidines is SEQ ID NO: 2 and the sequence of five histidines is SEQ ID NO: 3. (C) Left panel; in vitro H-2L d Ec50 of the indicated peptides competing with A5 for binding. BALB / c mice were vaccinated with CPQ and the indicated peptides on days 0 and 7, after which blood was collected for AH1 tetramer staining (day 14). Right panel; CD8 in blood of mice vaccinated with CPQ and the indicated peptides. + AH1 tetramers in T cells +Percentage of cells. Error bars indicate mean ± standard deviation for n=3 independent experiments. (C) The sequence of the six histidines is SEQ ID NO:2 and the sequence of the five histidines is SEQ ID NO:3.

[0027] [Figure 15] Effect of his-tag length on A5 peptide binding and immunogenicity BALB / c mice were injected with A5 peptides with the indicated his-tag lengths and CPQ or CQ on days 0 and 7, after which blood was collected for AH1 tetramer staining (day 14). (A) Binding of peptides to CPQ liposomes and 2HPQ liposomes (B) Size of CPQ liposomes after binding. (C) CD8 in the blood of mice injected with the indicated peptides in combination with the indicated adjuvants. + AH1 tetramers in T cells + Percentage of cells. Error bars represent the mean ± standard deviation for n=3 independent experiments. *p<0.05, **p<0.01, ****p<0.0001. Analyzed by two-way ANOVA with Bonferroni multiple comparison post-hoc test.

[0028] [Figure 16] CPQ-based short peptide microlibrary screening reveals that the RragcL385P 9mer peptide is a functional vaccine epitope that inhibits CT26 and 4T1 lung metastases (A) Approach used for in vivo screening of 100 peptide microlibrary. Mice were immunized with pooled microlibrary peptides (five peptides at a time, along with A5 as an internal control). Harvested splenocytes were then restimulated with individual short peptides and IFN-γ was measured (relative to A5 restimulation) to indicate the presence of Ag-specific T cells. The sequence of the six histidines in (A) is SEQ ID NO:2. (B) Identification of immunogenic peptides. Error bars indicate data range from triplicate wells of n=2 mice per group and are expressed relative to IFN-γ produced by A5 in the same immunized group. (C) Mice were challenged intravenously with CT26 cells on day 0 and then immunized 1 and 8 days later with CPQ (1000 ng total peptide) along with RragcL385P, Em15G44R, Tmem5S71N, or combinations. Lung nodules (C) and lung weights (D) were assessed on day 18. Challenge was repeated immunization with 500 ng RragL385P and the indicated adjuvants, and lung metastases were assessed after challenge with CT26 cells (F) or 4T1 cells (H). (E) Images of lungs from various groups were acquired. Lung weights were also assessed for CT26 tumor-bearing mice (G) and 4T1 tumor-bearing mice (I). Lines indicate the mean of n=5 mice per group. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Analyzed by one-way ANOVA with Bonferroni multiple comparison post-hoc test.

[0029] [Figure 17] Cytotoxicity of splenocytes from mice vaccinated with CPQ / A5 and CPQ / RragcL385P Effector splenocytes (E) were incubated with 5000 target CT26 cells (T) for 5 hours. Specific lysis was then analyzed by non-radioactive LDH release assay according to the manufacturer's instructions. Error bars indicate the mean ± standard deviation for n=4 independent experiments.

[0030] [Figure 18] Identification of RENCA neoantigens (A) Approach used for in vivo screening of RENCA neoantigens. (B) Flowchart depicting the number of genomic mutations or mutant peptides identified at each stage of the analysis, and the number of peptides ultimately validated as immunogenic.

[0031] [Figure 19] As a preventive vaccine, 20 RENCA neoantigen candidates mixed with CPQ liposomes were targeted to CD8 + Induced T cell responses and suppressed tumor growth BALB / c mice were immunized with CPQ / peptide vaccine on days 0 and 7, and then subcutaneously inoculated with RENCA cells on day 14. Twenty-one days after tumor inoculation, spleens were harvested and splenocytes were prepared and subjected to immunohistochemistry for IFN-γ, TNF-α and T EM For cell staining, cells were stimulated individually with the injected peptides. (A) Percentage of binding of 20 predicted peptides to CPQ and 2HPQ liposomes. Size (B) and polydispersity (C) of liposomes with and without peptide bonds. For each series of bar graphs, CPQ is on the left and 2HPQ is on the right. (D) Tumor growth in CPQ / peptide and 2HPQ / peptide vaccinated mice. Tumor growth in individual mice following CPQ / peptide vaccination (E) or 2HPQ / peptide vaccination (F). (G) Splenic CD8 + T in T cells EM Percentage of cells. (H) IFN-γ-producing CD8 in the spleen + Percentage of T cells. Error bars indicate the mean ± standard deviation for n=5 independent experiments.

[0032] [Figure 20] CPQ / RENCA Peptide 2 The vaccine suppresses tumor growth in mice BALB / c mice were immunized with CPQ / peptide vaccine on days 0 and 7, and then inoculated subcutaneously with RENCA cells on day 14. (A) Tumor size in mice vaccinated with CPQ mixed with the indicated peptides (18 days after tumor inoculation). Splenocytes were prepared 18 days after tumor inoculation and cultured in vitro for 5 days, then stimulated with antigen to serve as effector cells (E) and tumor cells to serve as target cells (T). Effector cells were incubated with target cells for 5 h and then specific lysis was analyzed by a non-radioactive LDH release assay according to the manufacturer's instructions. Percent cytolysis of RENCA cells (B) and irrelevant TC-1 cells (C). Error bars represent the mean ± standard deviation for n=5 independent experiments.

[0033] [Figure 21] E6 / E7 Candidate MHC-I epitopes form immunogenic particles that suppress TC-1 tumor growth (A) Screening approach for functional MHC-I restricted epitopes by DNA sequencing of the E6 / E7 oncogene; predicting MHC-I epitopes; forming a multivalent vaccine with CPQ; and immunizing mice to assess functional immunogenicity. (B) Binding of the six identified synthetic peptides to CPQ or 2HPQ liposomes. C57BL / 6 mice were vaccinated with the multivalent vaccine on days 0 and 7, and blood was collected on day 14. Gated CD8 + Central memory phenotypes (C) and effector memory phenotypes (D) within T cell populations were assessed. (E) Epitope-specific IFN-γ-producing CD8 cells from PBMCs of mice vaccinated with the multivalent vaccine. + T cells. (F) Tumor growth in mice immunized with multivalent vaccines and then challenged with TC-1 cells. Error bars represent the mean ± standard deviation, n=3 per group for binding and size studies, n=5 per group for mouse studies. *p<0.05, ***p<0.001 ****p<0.0001, (E, F) analyzed by two-way ANOVA and Bonferroni multiple comparison post-hoc test or (B, C, D) two-tailed unpaired Student's t-test.

[0034] [Figure 22] All E6 / E7 synthetic epitopes formed particles, but E7 49-57 Only TC-1 tumor growth was suppressed (A) Schematic diagram of single peptide vaccines evaluated for functional epitope identification. Sequences in Figure 22(A) for single peptide vaccine epitopes are, from left to right, SEQ ID NO: 4 to SEQ ID NO: 9. Predicted HPV-16 for CPQ and 2HPQ liposomes Binding of E6 / E7 epitopes (B) and their size (C). Peptides were incubated with liposomes for 1 h at room temperature before measurement. Error bars indicate mean ± standard deviation (n=3). Mice were immunized with 500 ng of each peptide mixed with CPQ on days 0 and 7 and TC-1 tumor challenge was performed on day 14. Mean tumor volume (D) and percentage of mice with tumor size less than 1 cm (E). n=5 mice per group. CPQ / E7 49-57 All mice in the group were tumor free at the end of the study.

[0035] [Figure 23] E7 HHH49-57 Immunization with CPQ mixed with poly(I:C) suppresses tumor growth more potently than poly(I:C) in a therapeutic setting C57BL / 6 mice were subcutaneously inoculated with TC-1 cells on day 0, followed by different vaccines 2 days after tumor inoculation. Blood was collected on day 18 after tumor inoculation and CD8 + T cells were analyzed. (A) Tumor growth in mice vaccinated with the indicated vaccines. (B) Tumor size in mice on day 19 (C) Mouse survival (D) CD8 in blood + E7 49-57 tet + Percentage of cells Error bars indicate the mean ± standard deviation (n=5 per group). *p<0.05, **p<0.01, ****p<0.0001. (C) Analyzed by log-rank test or (D) one-way ANOVA with Bonferroni multiple comparison post-hoc test.

[0036] [Figure 24] Development of CPQ / Trp2 e-mimotopes with improved functionality compared to the native epitope (A) A two-step approach to develop mimotopes using positional microlibraries, using in vivo screening and tumor challenge to guide sequence selection. (B) C57BL / 6 mice were immunized with a peptide library carrying random amino acids at the indicated residues (days 0 and 7) and then challenged with B16-F10 cells on day 14. (C) Data show tumor volumes on day 21. Error bars indicate the mean ± standard deviation for n=3 independent experiments.

[0037] [Figure 25] T rp2 8C and Trp2 8Y, when mixed with CPQ, inhibits the natural Trp2 Compared with 8W peptide, it has a more excellent antitumor effect as a preventive vaccine Mice were immunized with Trp2 peptides carrying the indicated amino acid mutations at position 8. Data show tumor volumes at day 21 after B16-F10 challenge. Tumor growth (A), survival (B), and tumor volumes at day 23 (C) of untreated mice (Ctrl) or vaccinated with mimotopes (Trp2-8C and Trp2-8Y) or the native sequence (Trp2-8W). Error bars show the mean ± standard deviation for n=5 independent experiments. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Analyzed by log-rank test (B) or one-way ANOVA (C) and Bonferroni multiple comparison post-hoc test.

[0038] [Figure 26] Env 37-44 Position-scanning peptide libraries (as particulate immunogens) Scheme of experimental design demonstrating positional libraries as efficient immunogens. The sequences in the leftmost scheme, from top to bottom, are SEQ ID NO: 10 to SEQ ID NO: 18.

[0039] [Figure 27] Env 37-44 -Pos5 positional peptide vaccine targets Env 37-44 Binds to the tetramer and binds Env 37-44 -Induce T cells with high affinity for the Pos5 positional peptide and express Env 37-44 Enhanced affinity for peptides BALB / c mice were either naive or vaccinated with the CPQ / display peptide library on days 0 and 7, then blood was collected for tetramer staining and analysis on day 14. Splenocytes were prepared and analyzed on day 21. (A)Env 37-44 NetMHC binding percentiles of positional libraries. The dashed line indicates H-2L. d Env 37-44 The binding percentiles of the peptides are shown. (B) CD8 in blood + Env in T cell populations 37-44 tet + Percentage of cells. (C)CD8 + Percentage of effector memory T cell phenotype in the T cell population. Splenocytes were treated with 10 μg / mL Env 37-44 or Env 37-44 After stimulation with -Pos5, intracellular IFN-γ was stained and analyzed by flow cytometry. CD8 after Ag stimulation + Flow cytometry gating (D) and percentage (E) of IFN-γ producing cells in the T cell population. *p<0.05, ****p<0.0001. Analyzed by two-way ANOVA (E) and Bonferroni multiple comparison post-hoc test. Error bars indicate mean ± standard deviation for n=5 per group. For each series of bars in (E), Env (37-44) is right and Pos5 is left.

[0040] [Figure 28] AH1 positional peptide library and library mixture as particulate immunogen Scheme of a CPQ vaccine consisting of one AH1 positional library or four AH1 positional libraries. The sequences in the schematic diagram on the left are, from top to bottom, SEQ ID NO: 19 to SEQ ID NO: 28.

[0041] [Figure 29] AH1-Pos1, Pos3, Pos5, and Pos8 library vaccine immunogens were more capable of inducing AH1-specific T cells than the wild-type epitope and protected mice from tumor challenge. BALB / c mice were left untreated or vaccinated with CPQ and the indicated peptides or peptide libraries on days 0 and 7, after which blood was collected for analysis and inoculated subcutaneously with CT26 tumor cells on day 14. (A) AH1 positional library MHC-I binding percentiles; dashed line indicates H-2L dThe binding percentiles of AH1 peptide relative to IgG are shown. CD8 + AH1 in T cell populations tet + Percentage of cells (B), and T EM Percentage of cells (C) (D) Tumor-free days in mice vaccinated with CPQ and the indicated positional libraries. Error bars represent the mean ± standard deviation (n=3 per group).

[0042] [Figure 30] Identification of AH1 peptides with antitumor effects Mice were immunized with AH1 peptides with the indicated amino acid substitutions at positions 1, 3, 5, or 8 on days 0 and 7, then blood was collected for AH1 tetramer analysis, and on day 14 mice were challenged subcutaneously with CT26 cells. Tumor size in mice vaccinated with AH1 peptides having amino acid substitutions at position 1 (SEQ ID NO:20) (A), position 3 (SEQ ID NO:22) (B), position 5 (SEQ ID NO:24) (C), or position 8 (SEQ ID NO:27) (D). Data show tumor volume 28 days after CT26 challenge. Description of the Disclosure

[0043] In this application, the use of the singular includes the plural and vice versa. For example, "a" or "an" includes plural reference items unless otherwise indicated.

[0044] Where a range of values ​​is provided in this disclosure, unless expressly stated otherwise, it is to be understood that each intervening value between the upper and lower limits of that range, and all intervening ranges, are also included. The upper and lower limits of any broader range may independently be included in any smaller range encompassed within the disclosure.

[0045] The term "therapeutically effective amount" as used herein refers to an amount of an agent or composition sufficient to achieve the intended therapeutic objective in a single or multiple doses. Treatment may, but need not, lead to a complete cure. Treatment may refer to the alleviation of one or more symptoms or markers of an indication. The exact amount desired or required will vary depending on the particular compound or composition used, its form of administration, the patient's particulars, etc. An appropriate effective amount can be determined by the skilled artisan informed by this disclosure using only routine experimentation. In the sense of this disclosure, "treatment" also includes the prevention and treatment of recurrences, as well as the alleviation of acute or chronic signs, symptoms and / or dysfunctions associated with an indication. Treatment may be symptomatic, e.g., aimed at suppressing symptoms. It may be short-term, medium-term, or long-term treatment (e.g., as a maintenance therapy). Administration may be intermittent, regular, or continuous.

[0046] The terms "MHC-I restricted peptide" or "MHC-I targeting peptide" or "MHC-I binding peptide" are used interchangeably and refer to peptides that are presented on MHC-I molecules and bind to CD8 + It refers to a 4-mer to 11-mer peptide that can induce a T cell response.

[0047] Short MHC class-I restricted (MHC-I) peptides mediate antigen (Ag)-specific CD8 + Although it contains minimal biochemical information to induce cytotoxic T lymphocytes (CTL), it is almost impossible to do so without an adjuvant platform. In this disclosure, a novel cobalt porphyrin-liposome vaccine adjuvant is described that induces rapid particulation of conventional short MHC-I epitopes and results in highly functional cellular responses at nanogram doses. As further described in the Examples, to demonstrate the efficacy of the liposomes of the present invention, studies were performed in mice, where immunization with short MHC-I peptides derived from the oncogene gp70 as a model system elicited functional Ag-specific CD8 +T cells were generated that conferred rejection against multiple tumor cell lines, sustained immunity, and control of local and metastatic disease. In vivo screening of a peptide microlibrary containing 100 putative MHC-I binding cancer epitopes revealed a small number to be immunogenic. To identify relevant human peptides, one or more neo-epitopes predicted to be MHC-I binders (using tumor cells or cell lines or by tumor-specific gene sequencing) may be incorporated into the liposomes to assess their ability to generate or enhance a functional immune response (e.g., inhibit tumor growth). Similar methods can be used to identify HLA-associated peptides. Transgenic mice expressing MHC molecules may be used to identify relevant human peptides.

[0048] To address the challenge of low immunogenic target epitopes, positional microlibraries can be developed to identify "e-peptides," which are novel enhanced peptides with enhanced function compared to native epitopes. Further description is provided in the Examples.

[0049] The present disclosure provides liposomes comprising MHC-I binding peptides, such as human MHC-I restricted peptides. The peptides may be natural peptides or analogs thereof. Analogs may include modifications of natural peptides such that one or more functions of the peptide are altered. For example, natural peptides may be modified to improve binding to MHC-I or to bind to CD8. +The TCR-peptide MHC-I complex may be modified to stabilize it, or both. These modified constructs are altered peptide ligands, referred to herein as "e-mimotopes", that can induce improved functional responses compared to the native peptide. There are several examples of "e-mimotopes" in the literature, such as the A5 peptide in mice, which is derived from the AH1 epitope (amino acids 423-431) found in the gp70 glycoprotein, a tumor-associated Ag expressed in a variety of mouse cancer cell lines. However, synthetic A5 short peptides conjugated to lipids and proteins have shown limited efficacy (Goodwin et al., Vaccine 35, 2550-2557, 2017; Zhang et al., Nature Communications 11, 1187, 2020). The e-mimotope is a peptide that binds to the melanoma antigen Melan-A / MART-1 26-35 A27L, gp100 2M, NY-ESO-1 C165V, and survivin T97M (ELMLGEFLKL (SEQ ID NO: 29)) have been diverted into clinical trials for cancer vaccines.

[0050] In this disclosure, we use next-generation vaccine adjuvants to demonstrate that short conventional MHC-I-restricted synthetic peptides (without further covalent conjugation) can also address at least three challenges in peptide cancer vaccine development: (1) the ability to induce functional CD8 + (2) to potently induce T cells; (3) to enable the discovery of novel functional epitopes through peptide micro-library screening; and (4) to improve responses to established epitopes through bettertope evolution using mutant peptide libraries.

[0051] In one aspect, the disclosure provides a composition comprising a pharmaceutical carrier and one or more liposomes, the liposomes comprising a cobalt porphyrin-phospholipid conjugate, optionally a phospholipid not conjugated to a porphyrin, optionally a sterol, and optionally polyethylene glycol (PEG), and one or more MHC-I targeting peptides having a polyhistidine tag, the MHC-I targeting peptides being incorporated into the bilayer such that a portion of the polyhistidine tag is present within the bilayer and at least a portion of the MHC-I targeting peptide is exposed to the exterior of the bilayer. In various embodiments, all or nearly all of the MHC-I peptides are exposed to the exterior of the liposome and all or nearly all of the polyhistidine tags are present in the bilayer. The vaccine composition can comprise a plurality of liposomes, each of which may comprise the same or different MHC-I peptide as another liposome in the composition. For example, the vaccine composition may comprise a plurality of liposomes, each of which comprises the same one or more MHC-I binding peptides, or the vaccine composition may comprise a plurality of sets of liposomes, each liposome in the set comprising a particular one or more MHC-I peptides, each set comprising a different one or more MHC-I peptides. In various embodiments, the liposomes may comprise multiple peptides having the same or different sequences, and different liposomes in the composition may comprise different combinations of MHC-I peptides. The composition may further comprise an adjuvant, which may be incorporated into the liposomes, or may be present in the composition without being incorporated into the liposomes.

[0052] In one aspect, the disclosure provides a method for generating or enhancing an anti-tumor immune response, comprising administering to a subject in need of immunization a composition comprising a liposome comprising a cobalt porphyrin-phospholipid conjugate, optionally a phospholipid not conjugated to a porphyrin, optionally a sterol, and optionally polyethylene glycol (PEG), and one or more MHC-I targeting peptides having a polyhistidine tag, wherein the MHC-I targeting peptide is incorporated into the bilayer such that a portion of the polyhistidine tag is present in the bilayer and at least a portion of the MHC-I targeting peptide is exposed outside the bilayer.

[0053] In various embodiments, the disclosure provides methods for increasing the immunogenicity of an MHC-I peptide and / or eliciting neutralizing antibodies against an MHC-I peptide by administering to a subject in need of treatment a composition comprising liposomes, wherein the liposomes have incorporated therein a polyhistidine-tagged MHC-I peptide, the liposomes comprising a bilayer comprising a cobalt porphyrin-phospholipid conjugate, optionally a phospholipid not conjugated to a porphyrin, optionally a sterol, and optionally polyethylene glycol (PEG), wherein a portion of the polyhistidine tag is present in the bilayer, and at least a portion of the MHC-I peptide is exposed outside the bilayer. Optionally, one or more adjuvants may be incorporated into the nanostructure or may be administered separately.

[0054] In one embodiment, the present disclosure provides a tumor antigen-specific CD8 +A method of inducing a T cell response is provided, the method comprising administering to an individual in need of treatment a composition comprising a liposome, wherein a polyhistidine-tagged MHC-I binding peptide derived from a tumor antigen is incorporated into the liposome, the liposome comprising a bilayer, the bilayer comprising a cobalt porphyrin-phospholipid conjugate, optionally a phospholipid not conjugated to a porphyrin, optionally a sterol, and optionally polyethylene glycol (PEG), wherein a portion of the polyhistidine tag is present in the bilayer, and at least a portion of the MHC-I binding peptide is exposed to the exterior of the bilayer.

[0055] In one embodiment, the present disclosure provides a method of treating an individual suffering from a tumor, comprising administering to the individual a composition comprising a liposome, the liposome comprising a cobalt porphyrin-phospholipid conjugate, optionally a phospholipid not conjugated to a porphyrin, optionally a sterol, and optionally polyethylene glycol (PEG), and one or more MHC-I targeting peptides having a polyhistidine tag, the MHC-I targeting peptides being incorporated into the bilayer such that a portion of the polyhistidine tag is present in the bilayer and at least a portion of the MHC-I targeting peptide is exposed outside the bilayer. The composition may be administered once or multiple times. For example, the treating physician may adjust the dosage and frequency of administration of the composition depending on the growth of the tumor.

[0056] In some embodiments, the present disclosure provides methods for screening and improving cancer epitopes in vivo using peptide microlibraries.

[0057] In embodiments, the present disclosure provides MHC-1 binding, CD8 +Methods are provided for screening a plurality of peptides to determine T cell activation, anti-cancer activity, or a combination thereof. The plurality of peptides may comprise a peptide library. In embodiments, the library comprises two or more peptides. In embodiments, the library comprises 2-1000 peptides, inclusive, including all number ranges therebetween. In embodiments, the library comprises 2-100 peptides. A plurality of peptides (comprising 2-100 peptides) is sometimes referred to in this disclosure as a microlibrary.

[0058] The peptides screened in the library may be derived from any source or may be designer peptides. In certain embodiments, the peptides comprise or consist of amino acid sequences obtained or derived from neoantigens. In certain embodiments, the peptides are segments of neoantigens. In certain embodiments, the peptides are derivatives of segments of neoantigens. In certain embodiments, the peptides are designed based at least in part on predictions made using computer-implemented analyses, non-limiting examples of which are described herein.

[0059] In some embodiments, the peptides in the library used in the screen may be generated using a personalized medicine approach, which involves determining a polynucleotide sequence derived from an individual's cancer cells, identifying the encoded neoantigens, generating peptides based on the identified neoantigens, and testing the peptides to determine one or more anti-cancer related properties of the test peptides. Candidate peptides may be further characterized as described below. One or more peptides that demonstrate anti-cancer activity are used as prophylactic or therapeutic anti-cancer drugs in the individual from whom the sample was obtained.

[0060] In some embodiments, screening of peptides is performed as follows: one or more peptides are introduced into an animal and CD8 +The ability of the one or more peptides to stimulate a T cell response is evaluated, indicating that the one or more peptides bind to MHC-I and are candidates for use as anti-cancer agents. + Various methods for determining whether a T cell response can be stimulated are known in the art and can be adapted for use in the methods described herein, taking into account the benefits of the present disclosure. In one aspect, one or more peptides are introduced into an animal, such as a mouse model, and then cells from the animal are tested in the presence of one or more peptides introduced into the mouse. In one particular approach, a mouse model comprising a humanized immune system can be used. Mouse models comprising a humanized immune system are commercially available, for example, from "THE JACKSON LABORATORY". In some embodiments, the mouse model produces immune cells that express HLA-1 instead of MHC-I. In one embodiment, the peptide introduced into the animal model is expressed by CD8 T cells in or isolated from the spleen of the animal. +The peptides stimulated IFN-γ production by T cells, indicating that the peptides bind to MHC-1 and are candidates for use as anti-cancer vaccines. A representative overview of this process is provided in FIG. 18, which illustrates whole exome and RNA sequencing. As will be appreciated by those skilled in the art, exome sequencing involves determining the sequence of a genomic portion that includes an exon. By using this approach and by comparing the resulting exome sequence to a reference sequence, such as a non-cancer gene control sequence, mutations in exons associated with cancer can be identified. Mutations can be evaluated, for example, using computer-implemented algorithms, including, but not necessarily limited to, neural network simulation algorithms. Mutations can be any mutation that alters the protein coding sequence, including, but not limited to, mutations that result in alternative or improperly spliced ​​exons, missense mutations, nonsense mutations, frameshift mutations, insertions, deletions, such as indels. Evaluation of peptides can include ranking the peptides based on a number of criteria, including, but not limited to, the ranking of the peptides based on ... + This includes, but is not necessarily limited to, the predicted peptide ability to stimulate T cell-mediated tumor cell lysis. Further characterization of this and / or other abilities of the peptides can be performed by immunizing animals with one or more of the identified peptides to determine whether any of the peptides can stimulate an anti-cancer response in animals suffering from cancer that produces a protein that contains the epitope constituted by the immunizing peptide. As shown in Figure 18, the present disclosure includes analyzing multiple individual peptides to identify peptides that can be combined to generate a multivalent vaccine that includes, for example, multiple identified peptides.

[0061] The present disclosure further includes improving the identified peptides by modifying one or more amino acids in the identified peptides. An exemplary embodiment of this approach is shown in FIG. 24. As shown in FIG. 24, peptides can be randomized at certain positions to generate a plurality of mutant peptides that are tested for changes in anti-cancer activity. For example, the present disclosure includes generating a positional random library, screening the position randomized peptides to select a first set of peptides, and optionally further modifying the first set of selected peptides to provide a second set of peptides. The second set of peptides can be tested to identify one or more peptides that have further improved one or more anti-cancer properties compared to the first set of peptides.

[0062] The improvement in the anti-cancer properties of the one or more peptides may be compared to any suitable reference value. In some embodiments, the reference value is the anti-cancer effect induced using a control peptide. The control peptide may be a natural peptide, e.g., a wild-type amino acid sequence, or a peptide with a known anti-cancer effect compared to the peptides described herein, or a peptide identified by the methods of the present disclosure. The improved anti-cancer effect may be any anti-cancer effect. In some embodiments, the anti-cancer effect is at least one of suppression of cancer cell proliferation, reduction in tumor volume, inhibition of metastasis, inhibition of cancer recurrence, prolongation of survival, and improved response to a companion therapy (e.g., adoptive immunotherapy, chemotherapy, antibody-based therapy, CAR T therapy, or checkpoint inhibitor therapy) used with the peptide. The improvement in the anti-cancer properties of the one or more peptides may also be compared to the CD8 + This may include improved activation of T cells and / or improved affinity for MHC-I.

[0063] As noted above, the present disclosure primarily refers to the use of the described peptides with liposomes having a bilayer or monolayer, although the present disclosure and various embodiments are also applicable to monolayers. A bilayer or monolayer may be referred to herein as a "membrane."

[0064] A portion or all of the cobalt porphyrin in the liposomal monolayer or bilayer can be non-covalently bound to the polyhistidine tagged molecule (so that at least a portion of the polyhistidine tag of the tagged molecule is present in the bilayer and the tagged molecule is presented on the surface of the bilayer or exposed to the exterior of the liposome). One or more histidine residues in the polyhistidine tag are believed to coordinate to the cobalt metal in the bilayer. The imidazole group of the histidine residue of the polyhistidine tag may coordinate to the cobalt metal associated with the porphyrin in the membrane. The entire histidine tag may be present in the bilayer. The porphyrin-phospholipid conjugate with the cobalt metal conjugated thereto is referred to herein as CoPoP. Liposomes whose bilayer comprises CoPoP are referred to herein as CoPoP liposomes. CoPoP liposomes can be functionalized with histidine tagged molecules. As used herein, the term "His-tagged molecule" refers to a molecule having a histidine tail, such as an MHC-I restricted peptide. For example, a peptide having a histidine tail is a his-tagged molecule. CoPoP liposomes containing such a his-tag are referred to herein as His-tagged CoPoP liposomes or His-tagged CoPoP.

[0065] As used herein, a "phospholipid" is a lipid having a hydrophilic head group with a phosphate group linked via a glycerol backbone to a hydrophobic lipid tail. The phospholipid comprises an acyl side chain of 6 to 22 carbons, including all integer values ​​of carbon therebetween and ranges therebetween. In certain embodiments, the phospholipid conjugated to the porphyrin is l-palmitoyl-2-hydroxy-sn-glycero-3-phosphocholine. The phospholipid conjugated to the porphyrin may comprise, or consist essentially of, phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS) and / or phosphatidylinositol (PI). Examples of phospholipids include, but are not limited to, dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine (DSPC), distearoylphosphatidylethanolamine (DSPE), and the like.

[0066] In certain embodiments, the porphyrin is conjugated to a glycerol group on the phospholipid by a carbon chain linker having from 1 to 20 carbons (including all integer values ​​of carbon therebetween).

[0067] CoPoP bilayers functionalized with His-tagged MHC-I restricted peptides provide a platform for generating specific immune responses against those His-tagged peptides. His-tagged peptides are non-covalently attached (coordinated) to CoPoPs and can be prepared by an incubation step. The preparation process of CoPoPs does not require the removal of reactive moieties such as maleimides, or exogenous catalysts or non-standard amino acids (used in other types of conjugation chemistries).

[0068] The cobalt-porphyrin may be in a bilayer or monolayer of a self-assembled liposome that encloses an aqueous compartment therein. Cobalt porphyrin-phospholipid (CoPoP) behaves similarly to conventional lipids with respect to its amphiphilic nature. Thus, a monolayer or bilayer containing CoPoP may be used for coating nanoparticles by methods known to those skilled in the art. In an embodiment, the bilayer or monolayer of the present disclosure may be present on other nanoparticles, such as, for example, in the form of a coating. In an embodiment, a bilayer or monolayer containing cobalt-porphyrin (e.g., cobalt porphyrin-phospholipid) is present as a coating on gold or silica nanoparticles, or other nanoparticles with hydrophilic surfaces. In an embodiment, the coating may be in the form of a monolayer. In an embodiment, a monolayer or bilayer containing cobalt-porphyrin (e.g., cobalt porphyrin-phospholipid) is present as a coating on a hydrophobic surface, such as a carbon nanotube. In an embodiment, the monolayer may form a micelle that surrounds one or more hydrophobic molecules.

[0069] The liposomes of the present disclosure comprise the following i) and ii): i) A porphyrin that coordinates to cobalt to form a cobalt-porphyrin, where some or all of the cobalt-porphyrin may be conjugated to a phospholipid to form a cobalt porphyrin-phospholipid conjugate. ii) Optionally, a phospholipid that is not conjugated to a cobalt-porphyrin. Optionally, the liposome may further comprise one or more of the following: a sterol (e.g., cholesterol (abbreviated throughout the specification as Chol), an adjuvant (e.g., PHAD, QS-21, and the like, and combinations thereof), or an oligoether (e.g., PEG). For example, for a liposome comprising CoPoP / PoP, DOPC, Chol, PHAD, and QS-21, a typical mass ratio of [DOPC:Chol:CoPoP / PoP:PHAD:QS-21] is either [20:5:1:1:1] or [20:5:1:0.25:0.25].

[0070] The monolayer or bilayer need not include phospholipids that are not conjugated to cobalt porphyrin, in which case it will only have cobalt porphyrin-phospholipid conjugates. The cobalt porphyrin-phospholipids can comprise 1-100 mol % of the monolayer or bilayer, including 0.1 mol % values ​​and ranges therebetween. For example, the cobalt porphyrin can comprise 1-20 mol %, or 5-10 mol % of the monolayer or bilayer. When the cobalt porphyrin comprises 100% of the monolayer or bilayer, there are no phospholipids that are not conjugated to the cobalt porphyrin. The bilayer or monolayer can also include a sterol and / or polyethylene glycol. The sterol may be cholesterol.

[0071] The His-tag can carry different MHC-I restricted peptides for different applications. At least one end of the His-tag can be in close proximity to the outer surface of the liposome. In one embodiment, at least one end of the polyhistidine tag is covalently attached to the MHC-I restricted peptide. The number of histidines in the polyhistidine-tag in the monolayer or bilayer can be 1-6. For example, the number of histidines in the polyhistidine-tag can be 1, 2, 3, 4, 5 or 6. It is preferred to have less than 6 histidines, as it has been found that less than 6 histidines provide better immune response enhancement. In one embodiment, the poly-His tag can contain 2-5 histidines. In one embodiment, one end of the His-tag is free and the peptide is attached to the other end. It is believed that at least a portion of the His-tag is located within the bilayer such that it coordinates to the cobalt metal.

[0072] In one embodiment, the present disclosure provides an antigenic composition comprising a liposome carrying an MHC-I restricted peptide, such as a human MHC-I restricted peptide. The liposome may also include one or more adjuvants. Exemplary adjuvants include attenuated lipid A derivatives (e.g., monophosphoryl lipid A (MPLA)), or synthetic derivatives, such as 3-deacylated monophosphoryl lipid A, or monophosphoryl. Hexa-Acyl Lipid A, 3-desacylated. In various embodiments, the adjuvant may be monophosphoryl lipid A (MPLA), aluminum phosphate, aluminum hydroxide, alum, phosphorylated hexaacyl disaccharide (PHAD), Sigma adjuvant system (SAS), AddaVax (Invitrogen), or saponin QS21, CpG oligodeoxynucleotides (CpG ODN), or polyinosinic:polycytidylic acid (poly(I:C)). In some embodiments, the adjuvant is QS21. In some embodiments, the adjuvant is a PHAD. In some embodiments, the adjuvant is QS21 and a PHAD. QS21 and a PHAD are preferably incorporated into the same liposome in which the his-tagged MHC-I restricted peptide is incorporated. QS-21 has two hydrophilic head groups with multiple sugar residues and a hydrophobic region consisting of a triterpene group and an alkyl ester, and is also incorporated into bilayers. QS-21 can also be localized in lipid bilayers because it can irreversibly bind to cholesterol to form a complex. MPLA is a phosphasphoryl lipid and may be incorporated into liposome bilayers.

[0073] The adjuvant can be used as a 0.001 to 50% by weight solution in phosphate buffered saline, and the antigen is present in the order of micrograms to milligrams, for example about 0.0001 to about 5% by weight, for example about 0.0001 to about 1% by weight, or for example about 0.0001 to about 0.05% by weight, based on the total mass of peptide and lipid in the formulation. The antigen can be present in an amount on the order of micrograms to milligrams, or in an amount of about 0.001 to about 20% by weight, for example about 0.01 to about 10% by weight, or about 0.05 to about 5% by weight.

[0074] For example, a suitable mass ratio of [CoPoP:PHAD:QS21:peptide] may be 4:4:4:1. Without intending to be bound by any particular theory, a lower percentage of the adjuvants, PHAD and QS21, in the liposomal formulation increases the T cell response, possibly due to a too high dose of QS-21. For example, decreasing the proportion of MPLA and QS21 to a mass ratio of [CoPoP:PHAD:QS21:peptide]=4:4:1:1 at the same peptide dose increases the T cell response. A mass ratio of [CoPoP:PHAD:QS21:peptide]=4:1:1:1 is also highly immunogenic. However, in the absence of QS21 in the liposome, CD8 + There is little to no T cell response, and the absence of MPLA in the formulation also dramatically reduces the immunogenicity of the vaccine platform.

[0075] In various embodiments, the molar ratio range of CoPoP:peptide can vary from 0.5:1 to 4:1, the range of CoPoP:PHAD can vary from 1:1 to 1:0.1, and the range of CoPoP:QS21 can vary from 1:1 to 0.1:1.

[0076] The porphyrin group of the cobalt-porphyrin or cobalt-porphyrin conjugate that constitutes at least a portion of the bilayer of the liposome or other structure includes porphyrin, porphyrin derivatives, porphyrin analogs, or combinations thereof. Examples of porphyrins include hematoporphyrin, protoporphyrin, and tetraphenylporphyrin. Examples of porphyrin derivatives include, but are not limited to, pyropheophorbides (also called pyropheophorbides), bacteriochlorophylls, chlorophyll A, benzoporphyrin derivatives, tetrahydroxyphenylchlorins, purpurins, benzochlorins, naphthochlorins, verdins, rhodins, ketochlorins, azachlorins, bacteriochlorins, tolyporphyrins, and benzobacteriochlorins. Additional examples of porphyrin analogs include members of the broad porphyrin family (e.g., texaphyrins, sapphyrins, and hexaphyrins) and porphyrin isomers (e.g., porphycenes, inverted porphyrins, phthalocyanines, and naphthalocyanines). For example, cobalt-porphyrin is an important porphyrin for the synthesis of vitamin B 12 (cobalamin) or a derivative thereof.

[0077] In one embodiment, the CoPoP is a pyropheophorbide-phospholipid. The structure of the pyropheophorbide-phospholipid is shown below: [ka]

[0078] In one embodiment, the layer (monolayer or bilayer) only has CoPoP, and the layer has His-tagged presentation molecules embedded therein. In this embodiment, the only phospholipid in the layer is CoPoP (i.e., 100 mol% CoPoP). In one embodiment, the layer (monolayer or bilayer) only has CoPoP and porphyrin-conjugated phospholipid (PoP), where CoPoP has histidine chelated thereto, and said histidine has peptide or other presentation molecule attached thereto. In one embodiment, there are no other phospholipids other than CoPoP, but the layer (monolayer or bilayer) may optionally contain sterols and / or PEG-lipids.

[0079] In one embodiment, in addition to CoPoP, the bilayer may also have a phospholipid that is not conjugated to a porphyrin and therefore not coordinated to Co. Such phospholipids may be referred to herein as "additional phospholipids." In one embodiment, the only metal-PoP in the bilayer is CoPoP, with a His-tagged MHC-I restricted peptide embedded in the bilayer.

[0080] In one embodiment, the bilayer of the liposome comprises CoPoP and PoP. In addition to CoPoP and PoP, the bilayer can have additional phospholipids. The bilayer may further comprise one or more sterols. In one embodiment, the bilayer consists essentially of or consists of CoPoP, PoP, additional phospholipids, and optionally one or more sterols, and other lipids (such as gangliosides). In one embodiment, the only metal in the bilayer is Co.

[0081] In one embodiment, CoPoP is present in the nanoparticle at 0.1-10 mol %, and the remaining 99.9-90 mol % is additional lipid, where the mol percent is based on the total amount of lipid in the bilayer. For example, the combination of CoPoP can be present at 0.1-10 mol %, the sterol can be present at 0.1-50 mol %, and optionally, an attenuated lipid A derivative, such as monophosphoryl lipid A, or 3-deacylated monophosphoryl lipid A, or related analogs can be present at 0-20 mol % or 0.1-20 mol %, and the remaining is additional phospholipid. Examples of additional phospholipids include DOPC, DSPC, DMPC, or combinations thereof. If present, the sterol can be cholesterol.

[0082] In one embodiment, the combination of CoPoP and PoP may be present in the nanoparticles at 0.1-10 mol%, with the remaining 99.9-90 mol% being additional phospholipids. For example, the combination of CoPoP and PoP may be present at 0.1-10 mol%, the sterol may be present at 0-50 mol% or 0.1-50 mol%, the PEG may be present at 0-20 mol% or 0.1-20 mol%, with the remainder being additional phospholipids. The additional phospholipids may be DOPC, DSPC, DMPC, or combinations thereof. If present, the sterol may be cholesterol.

[0083] In various embodiments, in addition to the porphyrin conjugates disclosed herein, the bilayer of the liposome also includes other phospholipids. The fatty acid chains of these phospholipids can include a suitable number of carbon atoms to form a bilayer. For example, the fatty acid chains can include 12, 14, 16, 18, or 20 carbon atoms. In different embodiments, the bilayer includes phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, and / or phosphatidylinositol.

[0084] The bilayers and monolayers of the present invention may also include sterols. The sterols may be animal sterols or plant sterols. Examples of sterols include cholesterol, sitosterol, stigmasterol, cholesterol, and the like. In embodiments, cholesterol may be present at 0 mol% to 50 mol%, or 0.1 to 50 mol%. In other embodiments, cholesterol may be present at 1 to 50 mol%, 5 to 45 mol%, or 10 to 30 mol%.

[0085] In certain embodiments, the bilayer or monolayer further comprises an adjuvant, such as monophosphoryl lipid A or an attenuated lipid A derivative, such as 3-deacylated monophosphoryl lipid A.

[0086] The liposomes may be spherical or non-spherical. The size (e.g., longest linear dimension) of the liposomes may be 50-1000 nm or more. In one embodiment, the liposomes have a size (e.g., largest dimension, such as diameter) of 50-1000 nm, including all integer nm values ​​and ranges therebetween. For example, the size may be 50-200 nm or 20-1000 nm. If the liposome is not spherical, the longest dimension may be 50-1000 nm. These dimensions can be achieved while preserving the nanostructure width of the bilayer. The RBD sequence or a portion thereof can be incorporated into the bilayer. The liposomes can additionally carry cargo in the aqueous compartment. In one embodiment, the liposomes can have a size of 30 nm to 250 nm, including all integer nm values ​​and ranges therebetween. In one embodiment, the liposomes have a size of 100-175 nm. In one embodiment, at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 99%, or 100% of the liposomes in the composition have a size of 30-250 nm or 100-175 nm. The liposomes can be greater than 200 nm. In one embodiment, the liposomes are greater than 1000 nm. In one embodiment, the nanostructures are 200-1000 nm. In one embodiment, the largest dimension of the liposome is less than 200 nm while maintaining the nanostructure width of the bilayer. In one embodiment, the size of the liposomes is greater than 200 nm in some dimensions while maintaining the nanostructure width of the bilayer. In one embodiment, the size of the liposomes is greater than 1000 nm in some dimensions while maintaining the nanostructure width of the bilayer.

[0087] In one aspect, the present disclosure provides a composition comprising the liposomes or other structures of the present disclosure, or a mixture of different liposomes or other structures. The composition may also comprise a sterile, suitable carrier for administration to an individual, including a human, such as a physiological buffer, such as sucrose, dextrose, saline, a pH buffer (e.g., pH 5-9, pH 7-8, pH 7.2-7.6, such as 7.4), such as histidine, citrate, or phosphate. In one embodiment, the composition comprises at least 0.1% (w / v) CoPoP liposomes or His-tagged-CoPoP liposomes or other structures. In various embodiments, the composition comprises 0.1-100 mol % CoPoP liposomes or His-tagged CoPoP liposomes or other structures (such as bilayer-coated nanoparticles). In one embodiment, the composition comprises 0.1-99 mol % CoPoP liposomes having His-tagged presentation molecules associated therewith.

[0088] In one embodiment, the composition of the present disclosure does not include a maleimide or succinimidyl ester reactive group, hi one embodiment, the tagging molecule attached to the membrane does not have an unnatural amino acid.

[0089] The MHC-I restricted peptide with His-tag may be a peptide containing 4-11 amino acids. For example, the peptide may have 4, 5, 6, 7, 8, 9, 10 or 11 amino acids (excluding the histidine). In various embodiments, the peptide may have 5-11, 5-10, 6-11, 6-10, 7-11, 7-10, 8-11, 8-10, 9-11, 9-10 amino acids (excluding the histidine). Antigen selection is a key step for developing peptide cancer vaccines. Examples of human peptides include MelanA / MART 126-35 (EAAGIGILTV (SEQ ID NO: 30)), Melan A / MART 127-35 (AAGIGILTV (SEQ ID NO: 31)), tyrosinase 1-9 (MLLAVLYCL (SEQ ID NO: 32)), tyrosinase 368-376(YMDGTMSQV (SEQ ID NO: 33)), Gp100 457-466 (LLDGTATLRL (SEQ ID NO: 34)), survivin-2B 80-88 (AYACNTSTL (SEQ ID NO: 35)), NY-ESO-1b 157-165 (SLLMWITQC (SEQ ID NO: 36)), WT1 235-243 (mp235) (CMTWNQMNL (SEQ ID NO: 37)), gp100 209-217 (210M) (IMDQVPFSV (SEQ ID NO: 38)), gp100 280-288 (288V) (YLEPGPVTA (SEQ ID NO: 39)), E7 11-20 (YMLDLQPETT (SEQ ID NO: 40)), E7 86-93 (TLGIVCPI (SEQ ID NO: 41)) and E7 82-90 (LLMGTLGIV (SEQ ID NO: 42)). The peptides can have only naturally occurring amino acids, or a mixture of naturally occurring and non-naturally occurring amino acids, or only non-naturally occurring amino acids. Peptides for human vaccines can be commercially customized. The structures formed by the layers of the present disclosure are serum stable. For example, in vitro, the stability of his-tag binding to CoPoP bilayers is stable for 21 days at 37°C when incubated in 40% human serum. Thus, these structures can be stable under serum or concentrated or diluted serum conditions.

[0090] In some embodiments, compositions suitable for human treatment may include 0.05-1 mg of peptide (including all 0.01 mg values ​​and ranges therebetween), 0.05-4 mg of CoPoP (including all 0.01 mg values ​​and ranges therebetween), 0.01-0.5 mg of QS21 (including all 0.01 mg values ​​and ranges therebetween); and 0.01-1 mg of MPLA (including all 0.1 mg values ​​and ranges therebetween).

[0091] The present disclosure also provides methods for using the structures having a bilayer described herein. In one embodiment, the present disclosure provides a method of eliciting an immune response in a host. The immune response is mediated by CD8 + T cells may be generated. The method includes administering to an individual a composition comprising a structure having a CoPoP bilayer, the bilayer having one or more histidine-tagged MHC-I restricted peptide(s) conjugated thereto. The composition can be administered by standard routes of immunization, including subcutaneous, intradermal, intramuscular, intratumoral, or any other route. The composition can be administered in a single dose or in multiple doses, including booster shots. To monitor the immune response, T cells and cytokine production can be measured.

[0092] In one embodiment, the liposomes and compositions may be used in conjunction with other anti-cancer therapies. For example, treatment using the compositions may be augmented with checkpoint blockade, such as PD-1, PD-L1, or CTLA-4 antibodies.

[0093] In one aspect, the present disclosure provides a method for preparing a bilayer comprising CoPoP. Free-based PoP can be prepared by esterification of a monocarboxylic acid porphyrin such as pyropheophorbide-a with 2-palmitoyl-2-hydroxy-sn-glycero-3-phosphocholine (lyso-C16-PC) (Avanti #855675P) with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and 4-dimethylaminopyridine in chloroform at a molar ratio of lyso-C16-PC:Pyro:1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC):4-dimethylaminopyridine (DMAP) of 1:1:2:2, by stirring overnight at room temperature. The PoP is then purified by silica gel chromatography. CoPoPs can be produced by contacting a porphyrin-phospholipid conjugate with a molar excess (e.g., a 10-fold molar excess) of a cobalt salt (e.g., cobalt(II) acetate tetrahydrate) in a solvent (e.g., methanol) in the dark.

[0094] The following composition and method examples illustrate various aspects of the present disclosure:

[0095] A liposome comprising a) a bilayer and b) a polyhistidine-tagged MHC-I-restricted peptide, the bilayer comprising i) one or more phospholipids and ii) one or more porphyrin-phospholipid conjugates coordinated to cobalt to form a cobalt porphyrin-phospholipid conjugate, wherein at least a portion of the polyhistidine tag is present in a hydrophobic portion of the bilayer, one or more histidines of the polyhistidine tag are coordinated to cobalt in the cobalt porphyrin, at least a portion of the polyhistidine-tagged MHC-I-restricted peptide is exposed to the exterior of the liposome, the liposome binds to molecules of the MHC-I class but not to molecules of the MHC-II class, the polyhistidine tag comprises 2-6 histidine residues, and the MHC-I-restricted peptide is a peptide having a number of amino acids between 4 and 11 (the number of amino acids does not include the histidines of the His-tag).In various embodiments, the polyhistidine tag comprises 2-5 histidine residues, the MHC-I restricted peptide does not bind to MHC-II class molecules, and the liposome can further comprise one or more additional adjuvants incorporated therein, which may be QS21 or PHAD, and the one or more additional adjuvants can be MPLA (PHAD, 3D6A-PHAD, or synthetic variants such as 3D-PHAD), the one or more additional adjuvants may further comprise MPLA and QS21, the mass ratio of the MHC-I restricted peptide to QS21 may be 1:1 to 10:1, the mass ratio of the MHC-I restricted peptide to PHAD may be 1:1 to 1:10, the MHC-I restricted peptide, QS21 and PHAD may be present in a mass ratio of 1:1:1, 2:1:1, 3:1:1, 4:1:1, 5:1:1, 6:1:1, 7:1:1, 8:1:1, 9:1:1 or 10:1:1, The cobalt porphyrin may be conjugated to a phospholipid to form a cobalt porphyrin-phospholipid conjugate, which may constitute 1-25 mol % of the monolayer or bilayer, the cobalt porphyrin-phospholipid conjugate may constitute about 2% to about 8%, more specifically 3-4% (by mass) of the bilayer, the bilayer may further comprise cholesterol at about 15-20% by mass (e.g., about 17-19%), and / or the size of the liposomes may be 50 nm to 250 nm.

[0096] Generate an immune response against tumor antigens, reduce tumor growth in a subject, and / or induce CD8 expression against tumor cells in a host individual. + A method of inducing positive cells, comprising administering to an individual a composition comprising a liposome as described herein in a pharmaceutical carrier, hi some embodiments, the individual is a human or non-human animal.

[0097] The following examples are presented to illustrate the present disclosure and are not intended to be limiting in any manner. Example 1

[0098] This example describes the preparation and use of liposomes containing MHC-I restricted peptides. This example describes studies in mice in which immunization with short MHC-I peptides derived from the gp70 oncogene as a model system resulted in the induction of functional Ag-specific CD8 + It generates T cells leading to rejection of multiple tumor cell lines, durable immunity, and control of local and metastatic disease. In vivo screening of a peptide microlibrary containing 100 putative MHC-I binding cancer epitopes revealed a small number to be immunogenic. One epitope of the Rrgac gene shared by both breast and colon cancer cell lines reduced metastatic disease after immunization. To identify relevant human peptides, one or more neo-epitopes predicted to be MHC-I binders (using tumor cells or cell lines) can be incorporated into the liposomes to evaluate their ability to generate or enhance a functional immune response (e.g., inhibit tumor growth). The method was as follows: The top 20 (not the top 100) neo-epitopes predicted to be the best MHC-I binders from RENCA tumor cells were mixed with CPQ liposomes, the vaccine inhibited tumor growth, and (AYTTQREEL (SEQ ID NO: 43)) was screened as a functional neoantigen. When HPV-16 oncoproteins E6 and E7 were screened in the same way and six peptides predicted to be the best MHC-I binders were mixed with CPQ liposomes, the vaccine suppressed tumor growth and was superior to the previously identified E7 49-57 The epitopes were screened as functional epitopes.

[0099] result

[0100] Short peptides form particles when mixed with CoPoP / PHAD / QS-21 (CPQ) liposomes

[0101] As shown in FIG. 1A, CoPoP was used with the immunostimulatory adjuvant QS-21 (saponin) and PHAD (synthetic monophosphoryl lipid A (MPLA)) to form liposomes. The chemical structures of porphyrin-phospholipid (PoP, or 2HPoP because two hydrogens are present instead of cobalt), CoPoP, PHAD and QS-21 are shown in FIG. 1A. Due to the three active components in the bilayer, they are called "CPQ". The role of CoPoP is to induce particle formation of MHC-I restricted peptides. QS-21 and monophosphoryl lipid A (MPLA) are components of AS01, a liposomal adjuvant used in licensed vaccines for malaria and varicella zoster. MPLA is a Toll-like receptor 4 agonist lipid that can be incorporated into the bilayer. QS-21 has two hydrophilic head groups with multiple sugar residues, a hydrophobic region consisting of a triterpene group and an alkyl ester, which is also incorporated into the bilayer. QS-21 can also localize to lipid bilayers because it irreversibly binds to cholesterol to form a complex. It can bind to local cellular cholesterol alone and cause necrosis at the injection site. It also binds to cholesterol in the lipid bilayer of red blood cells, causing pores. To reduce hemolysis and its toxicity by QS-21, QS-21 is formulated with liposomes containing cholesterol. Throughout this study, control liposomes that are identical to CPQ except that two hydrogen atoms are replaced by cobalt in the porphyrin macrocycle are used as non-particle-forming control liposomes and are referred to as "2HPQ". Thus, a comparison of CPQ and 2HPQ adjuvants allows the impact of particle-based presentation of short peptides on immunogenicity to be tested.

[0102] The A5 peptide was found to bind only to CPQ liposomes when they contained a his-tag (Figure 1B). Immediately after mixing A5 with liposomes, approximately 80% were converted to particulate form, as assessed by microcentrifuge filtration assay. QS-21 and PHAD did not affect the binding between liposomes and peptide (Figure 1C). However, the corresponding liposomes containing porphyrin but not cobalt showed the least binding to A5. After particle formation with peptide, the size of all liposomes (CPQ, 2HPQ, CoPoP / PHAD[CP], CoPoP / QS-21[CQ], 2HPoP / PHAD[2HP]) remained around 100-150 nm based on dynamic light scattering (Figure 1D and Figure 1E). Cryo-electron microscopy revealed that CPQ liposomes, both with and without peptide conjugation, were spherical, unilamellar, and had a size close to 100 nm (Figure 1F). A5 was fluorescently labeled to test the peptide binding kinetics and serum stability of the resulting vaccine. Upon binding to liposomes, fluorescence energy transfer from the fluorophore to CPQ or 2HPQ liposomes results in energy transfer and can be measured. Within 20 min of incubation, the labeled A5 peptide fluorescence was completely quenched, reflecting rapid binding to liposomes (Figure 1G). 2HPQ did not quench the fluorescence of the A5 peptide. To maximize peptide loading efficiency, a roughly 4-fold mass ratio of CoPoP was used (Figure 2). These results are consistent with microcentrifuge filtration assays using unlabeled peptide. In refrigerated storage, CPQ with and without A5 peptide conjugation were stable for at least three months and had a size of 100-150 nm (Figure 1H). In 40% human serum, the binding of A5 to CPQ liposomes remained intact for several weeks, reflecting peptide-particle formation that is highly stable in body fluids (Figure 1I).

[0103] A5 / CPQ liposomes express robust Ag-specific CD8 + Inducing T cell responses

[0104] BALB / c mice were then immunized with 500 ng of A5 mixed with CPQ on days 0 and 7, and peripheral blood was collected on days 7 and 13. Mice immunized with CPQ mixed with A5 (CPQ / A5) showed increased CD8 + Vaccination with CoPoP liposomes (CP / A5) without QS-21 induced approximately 20% Ag-specific cells in the T cell population. + CQ / A5, which does not have a PHAD in the liposome, did not generate Ag-specific CD8 T cells compared with CPQ / A5. + These AH1 tetramer-positive CD8 + The majority of T cells (89%) were of effector memory T cell (Tem) phenotype based on differential expression of CD44 and CD62L (Figure 3C). + The overall percentage of T cells was significantly increased after CPQ / A5 vaccination (Figure 3D). We also tested whether the presentation of A5 peptide on the same particles as QS-21 and PHAD was important. For this, mice were immunized with CPQ / A5 or with a mixture of CoPoP liposomes bearing A5 (C / A5) and 2HPQ liposomes (same doses of peptide and adjuvant). Particle presentation of A5 with QS-21 and PHAD in separate liposomes still elicited Ag-specific CD8 + Although they were able to induce T cells, presenting all components on the same particle was significantly more effective.

[0105] Splenocytes were harvested for intracellular staining of interferon-γ (IFN-γ) and tumor necrosis factor alpha (TNF-α). Splenocytes harvested from naive mice or mice vaccinated with CPQ / A5 were prepared for in vitro stimulation with A5 peptide. There was robust IFN-γ production after peptide stimulation, with approximately 12% of CD8 + T cells produce IFN-γ, and approximately 4% of CD8 + T cells produced TNF-α. This was due to the strong CPQ / A5-positive CD8 T cells, as measured by cytokine production. +The results show that A5 peptide induced a T cell response (Figure 3E, 3F, and 3G). Splenocytes were stimulated with A5 peptide and cultured with IL2 for 5 days and then used as effector cells (E), and CT26 cells were pulsed with A5 peptide to serve as target cells (T). These effector T cells lysed 60% of the tumor cells in 4 hours at an effector-to-target (E:T) cell ratio of 100 (Figure 3H). Initial studies with A5 peptide included a zwitterionic charged C-terminal tripeptide containing the charged amino acid "ERR" with the aim of improving solubility (as MHC-I binding epitopes tend to be hydrophobic). However, this was later found not to be essential and was not included in A5 in later experiments. Other peptides may benefit from a solubilization approach (facilitating peptide dissolution and control of administration). The peptide sequences used for all experiments in this study are listed in Tables 1-2.

[0106] CPQ / A5 as a preventive cancer vaccine

[0107] Vaccine-induced Ag-specific CD8 + To test T cell function, BALB / c mice immunized with varying nanogram doses of CPQ / A5 were challenged with gp70-expressing CT26 cells. Seven days after the first vaccination, AH1-specific CD8 + After the booster vaccination, even 20ng of A5 (combined with 80ng CoPoP, 80ng PHAD, and 80ng QS-21) increased peripheral CD8 T cells by 5%. + T cells were Ag-specific (Figure 5A). A general dose-response was observed, with increasing CPQ / A5 doses resulting in stronger CD8 + T cell responses were induced (up to a plateau at 500 ng A5). Higher doses were associated with increased CD8 +It did not increase the percentage of Ag-specific cells among T cells, and in fact resulted in a decrease in frequency. Because the peptide-to-adjuvant ratio was fixed in all cases, the higher peptide dose also administered more QS-21, which may have led to toxicity to immune cells in the draining lymph nodes. Indeed, when 1000 ng of A5 was used for immunization with liposomes formulated to contain 1000 ng QS-21, rather than 4000 ng (used at the fixed Ag-to-adjuvant ratio), the Ag-specific CD8 + There was a significant increase in T cells (Figure 6).

[0108] At 4 days of tumor challenge, all control mice developed palpable tumors. However, after vaccination with only 20 ng of A5 peptide, 40% of immunized mice remained tumor-free for 90 days after tumor challenge (Figure 5B). Immunization with 200 or 500 ng of A5 completely rejected tumors in all mice. Mice immunized with doses above 500 ng actually had lower tumor rejection rates, but still had a mean tumor-free period of 70 and 60 days after tumor challenge, respectively. The lower protection rates were due to the expression of Ag-specific CD8 + Consistent with the T cell frequency data, Ag-specific CD8 + The higher the T cell induction, the smaller the tumor size (Figure 5C).

[0109] We next compared the immunogenicity of 500 ng of A5 peptide mixed with CPQ to that of A5 peptide mixed with other vaccine adjuvants, including 2HPQ (lacking cobalt), alum, or poly(I:C). Only mice immunized with CPQ mixed with 500 ng of A5 showed significant increases in AH1-specific CD8 + T cells (Figure 5D), which was accompanied by complete rejection of the CT26 tumor challenge (Figure 5E). In contrast, mice immunized with 500 ng of A5 mixed with other adjuvants did not produce detectable AH1-specific CD8 +They did not generate T cells and developed tumors within 4 days of challenge, thus improving immunization with the short A5 peptide.

[0110] Although gp70 is a common biomarker expressed in multiple murine cancer cell lines, the use of gp70 in cancer vaccines has typically been targeted to CT26 tumors. To assess whether CPQ / A5 could also provide protection in other models, mice immunized with CPQ / A5 and with the non-identical, non-particle forming 2HPQ / A5 control were challenged with CT26 cells (Figure 5F) and other models expressing gp70; the CMS4 murine sarcoma model (Figure 5G) and the orthotopic 4T07 breast cancer model (Figure 5H). Immunization with CPQ / A5 significantly suppressed tumor growth, and in all three cancer models, a significantly lower percentage of mice reached a tumor size of 1 cm after tumor challenge, with 60-100% of mice showing complete tumor rejection.

[0111] Next, we evaluated the durability of CPQ / A5 immunity. Mice were immunized with 500 ng of A5 mixed with CPQ or 2HPQ on days 0 and 7, and the Ag-specific CD8 + T cell responses were followed. Ag-specific CD8 + T cells increased after the initial immunization and boost, with the highest frequency observed on day 14 (Figure 5I). Mice immunized with 2HPQ / A5 showed high Ag-specific CD8 + T cells were minimal. From day 14 onwards, Ag-specific CD8 + T cell populations decline gradually, but total CD8 + Approximately 5% of the T cells persisted through day 80. On day 80, more than two months after the final booster with 500 ng of A5, mice were challenged with CT26 cancer cells. As shown in Figure 5J, at this time point, all CPQ / A5-immunized mice completely rejected the tumor challenge and showed no signs of growth for at least 40 days. All mice vaccinated with A5 mixed with cobalt-free liposomes developed rapidly growing tumors.

[0112] A safety study was performed using CD-1 mice primed on day 0 and boosted on day 7 with a functional dose of 500 ng peptide and CPQ / A5. Outbred mice were selected to more broadly represent potential toxic reactions. Mice showed normal weight gain (Figure 7A). No obvious differences in mouse heart, liver, spleen, lungs or kidneys were observed in histology (Figure 7B). Complete blood counts (Figure 7C) and serum chemistry panels (Figure 7D) revealed no significant differences between healthy and vaccinated mice.

[0113] CPQ / A5 as a therapeutic cancer vaccine

[0114] Although CPQ / A5 was shown to be potent in a preventative setting, most cancer vaccines will first be tested in patients with progressive or metastatic disease. To address this, CPQ / A5 was evaluated in mice following tumor implantation or in the setting of experimental lung metastasis. In the former setting, mice were inoculated with CT26 tumors 5 days prior to immunization. Mice were then immunized with 500 ng of A5 on day 5, the time when tumors first became measurable and began to grow rapidly (Figure 8A). Mice were boosted with 500 ng of A5 one week later, during which time tumors grew to approximately 3 mm x 3 mm (by day 12). However, within a few days after a second immunization with CPQ / A5, all tumors regressed and disappeared without evidence of regrowth for 90 days, with 100% survival (Figure 8B). Control mice or mice immunized with non-particulate 2HPQ / A5 showed rapid tumor growth and no mice survived (FIGS. 8C, 8D and 8E).

[0115] To study CPQ immunity in the metastatic setting, an experimental CT26 lung metastasis model was established by intravenous injection of tumor cells. After 2 and 9 days, mice were immunized with 500 ng of A5. 18 days after cancer cell injection, lung nodules were recorded. In untreated mice or mice that received the non-particulate 2HPQ / A5 vaccine, dozens of nodules were observed (Figure 8F). In stark contrast, no nodules were detected in any mice immunized with CPQ / A5. Control mice or mice injected with 2HPQ / A5 had an average of more than 50 lung nodules per mouse (Figure 8G). Mice immunized with CPQ / A5 had no visible evidence of disease. Lung metastases were confirmed by increased lung weights; mice that received no treatment or were injected with 2HPQ / A5 had almost double the lung weight compared to mice immunized with CPQ / A5 (Figure 8H).

[0116] Mechanical features of CPQ

[0117] We next sought to determine the immunological basis of the vaccine efficacy of CPQ / A5. After mixing with CPQ, short peptides form stable particles in serum (Figure 1), which can be transported to draining lymph nodes. A schematic is shown in Figure 9A. Immune cells are recruited to lymph nodes, where Ag-presenting cells (APCs) incorporate liposomes into phagosomes and endosomes. There, peptides are released from CPQ liposomes and are presented on expressed MHC-I molecules prior to T cell externalization and activation.

[0118] After intramuscular administration, liposomes migrated to 1-3 lymph nodes close to the injection site at 1 hour and to 3-4 lymph nodes at 4 hours (Figure 10). To investigate immune cell recruitment, draining inguinal lymph nodes were harvested and cells were analyzed by flow cytometry 48 hours after intramuscular immunization with CPQ / A5 or CP / A5 (the difference being that CPQ liposomes contain QS-21). Compared to CP / A5 vaccinated and untreated mice, lymph nodes from CPQ / A5 vaccinated mice showed higher amounts of CD11b lowDendritic cells (DCs) and CD11b - DCs were recruited (Figure 9B). MPLA and QS-21 have been shown to promote the recruitment of immune cells to the injection site. No significant increase in other immune cell types (neutrophils, eosinophils, infiltrating monocytes, myeloid DCs (mDCs) and macrophages) was observed in the draining lymph nodes.

[0119] A slight increase in certain immune cells in lymph nodes after immunization was observed in the CPQ-induced Ag-specific CD8 + This likely does not fully explain the robust enhancement of T cell responses. Peptide Ag uptake was examined in vitro using fluorescence microscopy with labeled A5 peptide. Macrophages and bone marrow derived dendritic cells (BMDCs) were incubated with CPQ / A5 or 2HPQ / A5 and uptake was assessed. When mixed with CPQ, 5% of the total A5 peptide in the incubation mixture was taken up by macrophages and 13% by BMDCs (Figure 9C). However, no Ag uptake was observed when A5 alone or 2HPQ / A5 was incubated with cells. Kinetics revealed that approximately 3% of the CPQ / A5 peptide was taken up by macrophages within 20 min, increasing to 4–5% at 1 h (Figure 11A). Fluorescence microscopy confirmed these results: A5 was taken up by macrophages only when the peptide was mixed into CPQ liposomes (Figure 11B). Interestingly, since CPQ quenches the fluorescence of the labeled A5 peptide upon binding, the strong fluorescence of the labeled A5 in the micrographs suggests that the peptide may be released from the liposomes after cellular uptake. The release of the peptide was detected intracellularly based on a fluorometric quenching assay, suggesting that the shorter the his-tag length, the greater the intracellular peptide release (Figure 11C). In the presence of cytochalasin B (a phagocytosis inhibitor) and chlorpromazine (an inhibitor of clathrin-mediated endocytosis), significantly less A5 peptide was taken up by macrophages (Figure 9D). Taken together, these data indicated that particle-based A5 was taken up by immune cells via phagocytosis and endocytosis after mixing with CPQ.

[0120] MPLA, which mimics components of the bacterial membrane, has been linked to MHC-I expression in phagosomes. After incubation with CPQ / A5 in BMDCs, H-2L d Expression of MHC-I haplotypes, which are the restriction elements of A5, was assessed. To aid in visualization of phagosomes, a protocol was developed to coat silica microbeads with CPQ or CPQ / A5 (Figure 12). Immunofluorescence microscopy was performed using antibodies (Abs) against the phagosome markers lysosomal-associated membrane protein 1 (LAMP-1) and H-2L. d As expected, BMDCs incubated with CPQ beads expressed H-2L d BMDCs incubated with CPQ / A5 showed colocalized fluorescence of both A5, H-2L, and LAMP-1. d , and LAMP-1 colocalized fluorescence was shown ( Fig. 9E ).

[0121] These data suggest that the peptide was released after cellular uptake, since the detectable fluorescent signal of A5 in macrophages and BMDCs suggests that A5 was released from the liposomes and was no longer quenched. Indeed, A5 release from CoPoP liposomes was detected when incubated with commercial lysosomal extract in vitro (Figure 9F). Almost all peptide was released from CPQ within 2 h. The peptide released from macrophage cell extracts can be detected by high performance liquid chromatography (HPLC) and is intact. As shown in Figure 13, the elution time of A5 peptide in cell lysates is the same as that of pure A5 peptide. Taken together, these data suggest that peptides bound to CPQ liposomes are preferentially taken up by APCs and released, presumably in intact form, in phagosomes and lysosomes of cells directly to MHC-I for presentation on their surface. This mechanism is compatible with the vacuolar pathway for MHC-I peptide presentation and avoids the need for peptides to be first transported through the cytoplasm. Some of these studies used the C-terminal ERR tripeptide to address potential solubility issues, but this was later found to be generally unnecessary in many cases. The presence of this charged tag was shown to be sufficient to inhibit recombinant H-2L in vitro. d The presence or absence of the charged tripeptide inhibited binding of the peptide to Ag-specific CD8 + Thus, immunization was not overly sensitive to the flanking residues of the MHC-I epitope. Further proteolytic processing of the peptide to remove a small number of residues flanking the MHC-I epitope is possible and should be investigated further. A short truncated his-tag on the N-terminus reduced the induction of Ag-specific CD8 + It should be noted that there is a higher induction of T cells (Figure 15), the reason for which may be related to an increased release of the peptide after intracellular uptake, as discussed above.

[0122] Antigen screening using CPQ

[0123] Modern genomic, proteomic, and bioinformatics approaches can rapidly identify an extensive list of coding mutations (i.e., neoantigens) in cancer cells, which have been reported for murine CT26 and 4T1 cell lines. However, it remains to be realized to determine with certainty which of these are immunogenic and capable of generating a functional response. Given the power of the CPQ system, we evaluated a low-cost peptide microlibrary to screen candidate peptides. We selected 100 predicted neoantigens based on the strongest MHC-I affinity, and also selected several neoantigens shared by both CT26 and 4T1 cell lines (Table 3).

[0124] Mice were immunized with the A5 peptide along with five library peptides at a time (all peptides were combined and mixed with CPQ). After two intramuscular injections, splenocytes were harvested and then individually restimulated with each synthetic microlibrary peptide. An overview of the screening process is shown in Figure 16A. The immunogenicity of the peptides was assessed by measuring the production of IFN-γ, as compared to the A5 peptide (strong Ag-specific CD8 + The results were determined relative to the control (which serves as an internal standard capable of inducing T cell responses).

[0125] For Ag screening, we used the same MHC-I haplotype (H-2L d , H-2D d , or H-2K d A multivalent vaccine consisting of peptides bearing the MHC-I binding domain and the internal A5 peptide was mixed with CPQ. After immunization, only about 10% of the MHC-I binding peptides induced T cells (in splenocytes) to produce IFN-γ upon peptide restimulation, none of which was as effective as A5 (Figure 16B). The most immunogenic peptide only produced about one-fourth the level of IFN-γ compared to A5. This result indicates that it is difficult to elicit immunogenic CD8 T cells from predicted MHC-I binding peptides, even when a strong adjuvant system is used. +This highlights the difficulty of identifying T cell epitopes. One caveat of these results is that we cannot rule out whether the immunodominance of A5 negatively affected the immunogenicity of other peptides in the cocktail. It is also possible to induce stronger immunogenic responses by immunizing individual single peptides at higher antigen doses, but this would reduce the throughput of in vivo peptide microlibrary screening.

[0126] The three most immunogenic 9-mer peptides (RragcL385P, Tmem5S71N, and Eml5G44R) were then evaluated in the CT26 lung metastasis model. Vaccines were prepared by mixing peptides with CPQ liposomes, followed by two immunizations with CPQ and peptides (total 1000 ng) on ​​days 1 and 8 after intravenous administration of tumor cells. Twenty days after challenge, naive mice had approximately 75 lung nodules (Figure 16C). However, mice vaccinated with CPQ / RragcL385P had only 15 lung nodules. Mice vaccinated with the other two neoantigens showed no significant difference in lung metastasis compared to naive mice. Mice vaccinated with the combination of all three neoantigens had an average of 25 lung nodules, which may be due to the presence of the RragcL385P antigen. The lung weights confirmed the suppressive effect of immunization with the RragcL385P vaccine on lung metastasis (FIG. 16D).

[0127] The antitumor effect of the short RragcL385P peptide (SPKALAHNG (SEQ ID NO: 44)) mixed with CPQ was evaluated in a therapeutic lung metastasis model. The lungs of mice inoculated with 4T1 tumor cells were harvested on day 16, and those of mice inoculated with CT26 were harvested on day 18. At a peptide immunization dose of 500 ng, the CPQ / RragcL385P vaccine significantly suppressed lung tumor growth in BALB / c mice (Figures 16E and 16F). When mice were inoculated with CT26 cells, the lungs of the control groups (CPQ alone, Alum / RragcL385P, 2HPQ / RragcL385P) had an average of 90 lung nodules, and when inoculated with CPQ / RragcL385P, the lungs had an average of 30 lung nodules (Figure 16F). The lung weights reflected the results of nodule counts (Figure 16G). When mice were inoculated with 4T1 cells, the lungs of the control groups (CPQ alone, peptide mixed with Alum or 2HPQ) had an average of 80 nodules, whereas those inoculated with CPQ / RragcL385P had an average of 40 nodules (Figure 16H); again, the lung weights mirrored the results of nodule counts (Figure 16I). However, in vitro cytotoxicity experiments revealed that spleen cells from CPQ / RragcL385P-immunized mice were not cytotoxic to CT26 cells compared to spleen cells from CPQ / A5-immunized mice (Figure 17), a result likely due to off-target effects and requiring further investigation. Thus, although the screening of MHC-I peptides was successful in identifying functional epitopes, the mechanism of action could not be confirmed as being due to tumor cell lysis, and further studies are required to determine the role of immunization with Rragc epitopes. In future studies, this screening approach may identify CD8 immunization targets capable of epitope-specific tumor cell lysis. + It seems likely that it will be possible to identify peptide epitopes that induce cytotoxic T lymphocytes (CTLs).

[0128] Screening of RENCA neoantigens using CoPoP liposomes

[0129] Whole exome sequencing of mouse kidney cancer RENCA cells and tissue cells from normal BALB / c mice was performed to identify mutations in tumor cells (Figure 18A). NetMHC was then used to predict the binding affinity of peptides to MHC-I. All of these 20 predicted peptides were then mixed with CoPoP liposomes to vaccinate healthy BALB / c mice. The immunogenicity of individual peptides was evaluated by IFN-γ production after antigen stimulation, and antitumor efficacy was evaluated by tumor challenge. 8373 mutations were identified in RENCA cells, and among these mutations, 1007 exome-encoded variants were confirmed by RNA-Seq. NetMHC was used to predict the binding affinity of predicted mutant 9 amino acid epitopes. 20 epitopes with NetMHC percentiles below 0.1 were identified (Figure 18B and Table 4).

[0130] A multivalent vaccine was prepared by first incubating all 20 peptides with CPQ and 2HPQ liposomes at room temperature for 1 h in a mass ratio of 1:4. The binding rate of the peptides was evaluated by peptide filtration assay. Approximately 80% of the peptides bound to CoPoPs by simple mixing, whereas the peptides did not bind to 2HPQ (the same liposome as CPQ but lacking cobalt) (Figure 19A). There was no significant change in the size of the liposomes before and after binding, which was around 100 nm (Figure 19B). The polydispersity index of the liposomes is less than 0.25 (Figure 19C). Mice were vaccinated with CPQ / peptide on days 0 and 7, with an injection dose of 50 ng per peptide and a total of 1 μg of peptide per mouse. Mice were then challenged subcutaneously with RENCA cells on day 14. Mice vaccinated with CPQ / peptide had a significantly smaller mean tumor size compared to 2HPQ / peptide (Figure 19D). The CPQ vaccine suppressed tumor growth in 4 / 5 mice (Figure 19E), whereas the 2HPQ vaccine did not (Figure 19F). On day 18, splenocytes were prepared from these mice, and the CPQ-vaccinated mice had significantly more effector memory CD8 T cells in the spleen compared to the 2HPQ-vaccinated mice. + In addition, when splenocytes were stimulated with individual peptides in a 96-well plate, peptide 2 and peptide 8 stimulated IFN-γ-producing CD8 T cells in the spleen (Figure 19G). + T cells, whereas the other peptides produced approximately 2% and 5% IFN-γ-producing CD8 + There was no clear increase in T cells (FIG. 19H).

[0131] To confirm which peptide was responsible for the antitumor effect of the vaccine, a single peptide was mixed with CoPoP liposomes and injected into BALB / c mice as a vaccine. These 20 vaccines were injected into 20 groups of BALB / c mice on days 0 and 7, and RENCA cells were inoculated on day 14. RENCA peptide 2 was the only peptide that inhibited tumor growth, while all other 19 peptides did not inhibit tumor growth (Figure 20A). In vitro cytolysis studies confirmed that only peptide 2 induced functional T cells that specifically targeted RENCA cells (Figure 20B), but not TC-1 cells (Figure 20C).

[0132] HPV-16 E6 / E7 CD8 by CoPoP liposomes + Screening for T cell epitopes

[0133] The E6 and E7 genes of TC-1 cells were sequenced from extracted DNA using Sanger sequencing. Six predicted H-2K subunits were in the upper percentile of MHC-I binders. b - and H-2D b -restricted epitopes were identified using a neural network simulation algorithm. These short 9-mer peptides were then chemically synthesized (with a polyhistidine sequence consisting of three residues) as shown in Table 5 and mixed with CPQ liposomes to induce particle formation. These six peptides were combined with CPQ to form one multivalent vaccine for mice, and the immunogenicity of each peptide was evaluated by interferon gamma (IFN-γ production after stimulation of harvested peripheral blood mononuclear cells [PBMCs] with individual peptides). Mice were then challenged subcutaneously with TC-1 cells to evaluate tumor protection by the vaccine (Figure 21A).

[0134] A multivalent peptide vaccine was prepared by simply mixing six peptides with CPQ liposomes at a total peptide to CoPoP mass ratio of 1:4. The dose of each peptide was 100 ng. QS-21 and MPLA were also included in the liposomes at a peptide to each adjuvant mass ratio of 1:1.6. Mixing six pooled E6 / E7 epitope candidates with CPQ liposomes at room temperature for 1 hour converted approximately 100% of the peptides into particle form as assessed by microcentrifuge filtration assay (Figure 21B). Identical 2HPQ liposomes, except lacking cobalt, showed very little peptide binding.

[0135] To determine immunogenicity, the multivalent vaccine was then inoculated (intramuscularly) into C57BL / 6 mice on days 0 and 7, peripheral blood mononuclear cells (PBMCs) were harvested, and mice were challenged with TC-1 tumor cells on day 14. By that time, mice immunized with peptides mixed with CPQ had increased CD8 + Central memory T cells (T CM )(CD44 + CD62L + (defined as CD4+ / CD5+) (Figure 21C), and CD8 + Effector memory T cells (T EM )(CD44 + CD62L - The percentage of both peptides (defined as β-cell adhesion molecules) (FIG. 21D) significantly increased in the case of 2HPQ but not in the case of QS-21, but not in the case of 2HPQ. Thus, even with the same amounts of QS-21 and MPLA, the presentation of peptides in particulate form was significantly enhanced in the memory CD8 + It appears to be important for inducing T cells.

[0136] The collected PBMCs were restimulated with candidate epitopes contained in the multivalent vaccine, and then CD8 + T cells are stimulated by intracellular IFN-γ production (Ag-specific CD8 + Three peptides (E7 49-57 , E7 71-79 , and E7 6-14) but not in the PBMCs after immunization, resulting in a higher than background percentage of IFN-γ producing cells (CD8 + When PBMCs from mice injected with non-particle-forming 2HPQ / peptide were restimulated with the peptide, IFN-γ-producing CD8 T cells were induced. + T cell induction (Figure 21E). When immunized mice were challenged subcutaneously with TC-1 cells, the multivalent CPQ / peptide vaccine group completely rejected tumor growth. In contrast, mice vaccinated with the 2HPQ / peptide formulation developed rapidly growing tumors (Figure 21F).

[0137] Next, to determine which peptide epitopes provided antitumor activity, the peptides were mixed individually with CPQ or 2HPQ liposomes (Figure 22A). Individually, all peptides bound effectively to CPQ liposomes, but not to 2HPQ liposomes lacking cobalt (Figure 22B). The size of the liposomes remained approximately 100 nm after binding to E6 and E7 peptides (Figure 22C). Mice were then vaccinated with the peptides mixed with CPQ (at a peptide dose of 500 ng) on ​​days 0 and 7. Each mouse was then challenged with TC-1 cells on day 14. Of all the synthetic short peptide epitopes evaluated, E7 HHH49-57 Only the peptide (sequence: HHH-RAHYNIVTF (SEQ ID NO: 8)) inhibited tumor growth (Figure 22D). Prolonged tumor-free survival was maintained for at least 60 days, reflecting the observation period (Figure 22E), whereas other predicted peptide epitopes showed no measurable antitumor effect.

[0138] CPQ / E7 HHH49-57Since it was effective in a prophylactic setting, we next evaluated the vaccine against established TC-1 tumors, which is also the setting in which most cancer vaccines are first clinically tested. Poly(I:C) was used as the adjuvant control. For poly(I:C), synthetic monopeptide doses ranged from 20 μg to 2 μg per mouse, while the poly(I:C) dose remained fixed at 20 μg / mouse. For the CPQ liposome adjuvant, peptide doses varied from 1 to 0.1 μg per mouse. With a fixed liposome to peptide ratio, this corresponds to CoPoP doses ranging from 4 to 0.4 μg, and 3D6A-PHAD and QS-21 doses ranging from 1.6 to 0.16 μg. The same E7 HHH49-57 Peptides were mixed with either of the adjuvants immediately before intramuscular immunization. Mice were first inoculated with TC-1 cells on day 0, then vaccinated on days 2 and 9. Under these conditions, only the CPQ adjuvant, but not the poly(I:C) adjuvant, resulted in effective tumor growth inhibition (Figure 23A). On day 19, CPQ-vaccinated mice showed no detectable tumor growth, whereas nearly all of the poly(I:C)-vaccinated mice showed detectable tumor growth, even at the highest peptide dose (20 μg) (Figure 23B). All poly(I:C)-vaccinated mice had tumors that reached an endpoint of 1 cm within 60 days, whereas all CPQ-vaccinated mice remained tumor-free, even at only 0.1 μg of E7 peptide dose, which was 200-fold lower compared to the highest peptide dose with poly(I:C) (Figure 23C). The antitumor effect was due to the Ag-specific CD8 + This was examined on day 19 after tumor inoculation, as it is expected to be related to the frequency of T cells. In CPQ-vaccinated mice, the number of Ag-specific CD8 + The percentage of T cells that were tetramer positive was increased by approximately 30% at a peptide dose of 1 μg. + )CD8 + T cells, whereas a peptide dose of 0.1 μg resulted in approximately 20% CD8 + Tet+ In stark contrast, mice vaccinated with poly(I:C) showed increased expression of Ag-specific CD8 + They had very few T cells (Figure 23D).

[0139] Using CoPoP as an enhanced mimotope screening system for Trp2 peptides, we developed an improved mimotope evolution system (schematically shown in Figure 24A). 180-188 SVYDFFVWL (SEQ ID NO: 45), mouse H-2K b and human HLA-A2 epitopes were used as model Ags. To develop e-mimotopes, first, 9 positional random libraries were obtained by inserting all 20 amino acids at a position and fixing 8 positions of the peptide with the original amino acid of the wild type peptide. Thus, the method in one embodiment involves repetitive amino acid randomization of candidate peptides. For each positional library, all 20 amino acids were present at a specific residue position. C57BL / 6 mice were then immunized with the library (1 μg total peptide library dose) on days 0 and 7. On day 14, mice were challenged with B16-F10 cells expressing Trp2 and tumor growth was monitored. Notably, one week after tumor inoculation, mice vaccinated with the Trp2 position 8 peptide library had significantly smaller tumor size compared to all microlibraries (Figure 24B). Next, 20 individual Trp2 peptide variants were synthesized (each peptide with a different amino acid at position 8). Mice were immunized individually with these peptides and CPQ. As shown in Figure 24C, after tumor challenge, mice immunized with Trp2-8C suppressed tumor growth (at day 21) compared to the wild type sequence (Trp-8W). Immunization with Trp-8Y also completely suppressed tumor growth in one mouse. Trp2-8C and Trp2-8Y were further studied to determine whether the mimotopes could suppress tumor growth compared to the wild type epitope (Trp-8W).

[0140] Mice were immunized with CPQ and 500 ng of peptide on days 0 and 7, and then inoculated with B16-F10 cells on day 14. Tumor growth was significantly delayed in mice immunized with Trp2-8Y and Trp2-8C compared to mice immunized with wild type Trp2-8W or adjuvant alone, where tumor growth in these groups was similar to untreated mice (Figure 25A). CPQ / Trp2-8C and CPQ / Trp2-8Y extended mouse survival compared to CPQ / Trp2-8W (Figure 25B). By day 23, only mice vaccinated with Trp2-8Y and Trp2-8C had tumors of 500 mm 3 The tumor sizes were less than 100 mm (Figure 25C).

[0141] Positional peptide libraries as immunogens for CPQ liposomes

[0142] Position-scanning libraries were synthesized as shown in FIG. 26. Three histidines were added to the N-terminus of all peptides and peptide libraries for particle formation with CoPoP liposomes. For each library, amino acids at specific positions were replaced with all 20 amino acids, and the remaining positions were the same as the wild-type sequence. Eight positional libraries were generated for this 8-mer peptide. The peptides were combined with CPQ to form single peptide or positional peptide library vaccines for mice. The immunogenicity of these immunogens was evaluated using the wild-type antigen Env. 37-44 The antitumor efficacy of these immunogens was assessed by subcutaneously challenging mice with CT26 cells as assessed by tetramer staining. Cross-reactivity of T cells elicited by positional peptide libraries and single peptide mimotopes to native peptides was assessed by cytokine production after in vitro antigen stimulation of splenocytes.

[0143] Env 37-44 Immunogenicity of positional peptide libraries

[0144] The binding affinity of each positional library was predicted using the NetMHC neural network algorithm. 37-44 H-2L d The binding percentile was 0.015%, which represents a very good MHC-I binder. 37-44 The individual library members of -Pos5 were generally predicted to have only slightly weaker binding compared to the native epitope (Figure 27A). 37-44 H-2L d -reactive peptide, the second residue of which is amino acid Pro of H-2L d Because this is the binding motif for H-2L, the Pos2 library members with substitutions at the second position bind H-2L several orders of magnitude less. d We then immunized the mice with an eight-positional peptide library to verify the immunogenicity of the native Env. 37-44 In all cases, the peptides were mixed with CPQ liposomes to induce particulate peptides. 37-44 Using the tetramer, Env 37-44 specific CD8 + T cells were evaluated. BALB / c mice were immunized on days 0 and 7, and blood was collected on day 14 for tetramer analysis. Of all positional libraries evaluated, CPQ / Env 37-44 -Only the Pos5 vaccine is 37-44 30% of CD8 + Although the peptide library vaccines or wild-type epitope vaccines induced T cells, no detectable Env 37-44 specific CD8 + CPQ / Env did not induce T cell proliferation (Figure 27B). 37-44 -Pos5 vaccine is a CD8 + Approximately 30% of effector-memory T cells were induced within the T cell population (Figure 27C; CD62L - CD44 +In contrast, mice vaccinated with the other positional libraries or with the wild-type peptide did not induce detectable effector memory T cells. To understand this remarkable efficacy of the mimotope library, we vaccinated mice from naive mice or mice vaccinated with CPQ / Env 23 days after tumor inoculation. 37-44 -Pos5 or CPQ / Env 37-44 Splenocytes were harvested from mice vaccinated with Pos5. Splenocytes from Pos5-vaccinated mice were CD8+ cells that produced IFN-γ after Pos5 stimulation. + Approximately 6% are T cells, and approximately 2-3% are CD8 + T cells produced IFN-γ after wild-type peptide stimulation (Fig. 27D, E). However, splenocytes from naive mice or mice vaccinated with the wild-type peptide did not express Env 37-44 Neither Env-Pos5 nor wild-type peptide stimulation showed detectable IFN-γ production. 37-44 - These CD8 + T cells stimulated with Env 37-44 It is important to note that in response to -Pos5 stimulation, the cells produced more IFN-γ. 37-44 - CD8 induced by Pos5 vaccine + T cells express Env 37-44 Binds to the tetramer and binds Env 37-44 Compared to Env 37-44 -Pos5 had a higher affinity.

[0145] AH1 positional peptide library as an immunogen for CPQ liposomal vaccines

[0146] Next, the positional library vaccine strategy was applied to a second MuLV epitope, AH1. 37-44 Unlike AH1, AH1 is a well-established tumor rejection epitope that is highly expressed on MHC-I of CT-26 cancer cells.

[15] As shown in Figure 28, a positional library was created for each amino acid position of the 9-mer AH1 sequence.

[0147] Antitumor effects of the AH1 positional peptide library

[0148] First, we predicted the MHC-I binding affinity of the AH1 library by NetMHC.

[20] H-2L of wild-type AH1 d The percentile of binding to H-2L was 0.5%, suggesting that AH1 is a good MHC-I binder, and amino acid changes at positions 2 and 9 reduced MHC-I-peptide binding, whereas amino acid changes at other positions reduced the average H-2L binding percentile. d BALB / c mice were then immunized with CPQ and the AH1 library or wild-type AH1 peptide (1 μg total peptide dose) on days 0 and 7, and blood was collected and analyzed on day 14. The wild-type AH1 peptide did not elicit detectable amounts of AH1 tet + CD8 + Although CPQ did not induce T cells, mice vaccinated with peptide libraries Pos1, Pos3, Pos5, and Pos8 showed Ag-specific CD8 + Ag-specific T cells induced over 10% of mice (Fig. 29B). These Ag-specific T cells were of effector memory T cell phenotype (Fig. 29C). Vaccines CPQ / P1, CPQ / P3, and CPQ / Pos8 protected 100% of mice from tumor challenge for at least 90 days. CPQ / Pos5 protected 2 / 3 mice from tumor challenge for at least 90 days (Fig. 29D). Only one mouse was protected by wild-type CPQ / AH1 immunization.

[0149] Identification of AH1 e-mimotope that exerts antitumor effects upon vaccination

[0150] Next, 20 individual AH1 peptide variants were synthesized (each peptide has different amino acids at positions 1, 3, 5, and 8). Mice were individually immunized with these CPQ / peptide vaccines, and the injection dose of a single peptide was 50 ng to keep constant with the screening of the first position library. As shown in Figure 30A, for position 1, about 10 peptide variants with amino acid substitutions (C, Q, H, I, L, M, F, W, Y, V) inhibited the growth of CT26 tumors. For position 3, three peptide variants with amino acid substitutions (E, H, P) inhibited CT26 tumor growth by 100% (Figure 30B). For position 5, four peptide variants with amino acid substitutions (A, C, G, T) inhibited CT26 tumor growth by 100% (Figure 30C). For position 8, four peptide variants with amino acid substitutions (N, D, Q, H) inhibited CT26 tumor growth by 100% (FIG. 30D).

[0151] conclusion

[0152] CPQ liposomes induce stable particle formation of short peptides and Ag-specific CD8+ inhibit tumor growth in multiple mouse tumor models, both in local and metastatic settings. +It was demonstrated to be highly effective for inducing T cells. Immunization was well tolerated in mice. The putative mechanism of efficacy is related to the promotion of infiltration of APCs into draining lymph nodes, enhanced delivery of short peptides to APCs, and subsequent putative release of peptides for binding to MHC-I expressed within endosomes and phagosomes. Based on this efficacy, we screened the microlibrary and identified a shared epitope, RragcL385P, that reduces metastatic lesions when vaccinated with CPQ in both CT26 and 4T1 cell lines (this epitope appears to act from an off-target effect, but further studies are required to understand the basis of this observation). Using the same method to screen neoantigens in the RENCA cell line, we found a peptide (AYTTQREEL (SEQ ID NO: 43)) as a neoantigen in the RENCA tumor cell line, which delayed tumor growth when mixed with CPQ liposomes as a vaccine. CPQ liposomes will also be used as a screening tool to screen for HPV-16 cellular oncoproteins E6 and E7. Among the peptides screened, the previously identified E7 49-57 Only the epitopes were functional. Immunization with a 100 ng dose of synthetic short peptides protected mice in a therapeutic tumor challenge when mixed with CoPoP liposomes, whereas no effect was observed even at a 200-fold higher peptide dose when Poly(I:C) adjuvant was used. We also developed a method to use CPQ to find Trp2 and AH1 e-mimotopes with improved functionality compared to the native epitopes. Furthermore, we found that the positional library itself can serve as a vaccine immunogen. The CPQ system can be used for other MHC-I epitopes as well as in embodiments dedicated to screening and discovering functional epitopes.

[0153] experiment

[0154] material

[0155] Co(II)PoP was synthesized by methods known in the art. The following other lipids were used: DOPC (Corden; Catalog Number: LP-R4-070), Ni-NTA lipid dioleoylglycero-Ni-NTA (Avanti; Catalog Number: 790404P), cholesterol (PhytoChol; Wilshire Technologies), synthetic PHAD (Avanti; Catalog Number: 699800P). QS-21 was obtained from Desert King (Cat. Number: NC0949192). The following adjuvants were obtained: Alhydrogel 2% aluminum gel (Accurate Chemical and Scientific Corporation; Catalog Number: A1090BS). Poly(I:C) (Sigma; Catalog Number: P1530). Granulocyte-macrophage colony-stimulating factor (GM-CSF) was obtained from Shenandoah Biotechnology (Cat. Number: 200-15-AF). Chlorpromazine hydrochloride was obtained from VWR (Cat. No.: TCC2481). Cytochalasin B was obtained from Acros (Cat. No.: 228090010). Lysosomes were obtained from Xeno tech (Cat. No.: H0610.L). 10x catabolic buffer was obtained from Xeno tech (Cat. No.: K5200). The following antibodies were obtained from BioLegend:APC-CD8a antibody (Cat. No. 100712), FITC-IA / IE antibody (Cat. No. 107605), FITC-B220 (Cat. No. 103206), FITC-CD4 antibody (Cat. No. 100405), PerCP / Cyanine5.5-CD44 (Cat. No. 103031), PE / Cy7-CD62L antibody (Cat. No. 104417), Pacific Blue IFN-γ (Cat. No. 505818), PE-TNFα (Cat. No. 506305), Alexa Fluor 488-Ly6C (Cat. No. 128021), PE / Cy7-CD11b (Cat. No. 101215), PE-Ly6G (Cat. No. 127607), APC / Cy7-CD11c (Cat. No. 117323), PerCP / Cyanine5.5-CD3 (Cat. No. 100217), Alex Fluor 700-IA / IE (Cat. No. 107621), Brefeldin A (BD, Cat. No. 555029), Live / Dead Fixation Dye (Invitrogen; Cat. No. L34965), Fixation / Permeabilization Kit (BD; Cat. No. 554714). Cell lysis buffer was obtained from BioVision (Cat. No. 5830). A5-HiLyte488 and E7-HiLyte488 were synthesized by Anaspec. Collagenase type I (Gibco; Catalog number: 17018-029), DNase I (Roche Diagnostics; Catalog number: 04536282001).

[0156] Vaccine preparation and characterization

[0157] Liposomes were prepared by ethanol injection and lipid extrusion as previously reported. The prepared liposomes were dialyzed against phosphate-buffered saline (PBS) at 4°C to remove ethanol and passed through a 0.2 μm sterile filter. For liposomes containing QS-21, QS-21 (1 mg / mL) was added to the liposomes overnight at 4°C (at a mass ratio of [DOPC:Chol:CoPoP / PoP:PHAD:QS-21] = [20:5:1:1:1]). The final liposome concentration was adjusted to 320 μg / mL CoPoP. The operation was performed without actually measuring the individual lipid concentrations, assuming that the input concentrations were maintained.

[0158] To prepare CPQ, CP, CQ, 2HP, and 2HPQ vaccines, liposomes and peptides were incubated at room temperature for 1 h in a 4:1 mass ratio. To prepare PQ+C / A5 vaccines, A5 peptide was incubated with CoPoP liposomes (lacking PHAD or QS-21) for 1 h, after which 2HPQ liposomes were added to the samples immediately prior to injection. For the desired Ag dose, liposomes were incubated with Ag as above and then diluted in PBS. To prepare Alhydrogel (Alum) vaccines, A5 was mixed with 2% Alum for 1 h and diluted in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer prior to injection. Each vaccine contained 500 ng of peptide and 75 μg of Alum. To prepare poly(I:C) vaccines, peptides were mixed with poly(I:C) for 1 h and then further diluted in PBS. For the A5 study, there was a 500 ng peptide and a 50 μg poly(I:C) dose, and for the TC-1 study, there was a 20 μg poly(I:C) dose.

[0159] To characterize the binding of peptides to liposomes, peptides were incubated with liposomes or PBS for 1 h at room temperature and filtered through a 100 kDa cutoff microcentrifuge filter tube (PALL; Cat. No.: 29300) to separate free peptide from liposomes. The amount of free peptide in the filtrate was measured using a Micro BCA (Thermo; Cat. No.: 23235) assay. The peptide binding rate to liposomes was calculated by comparing the liposome-bound peptide with the free peptide. The size and polydispersity index of the samples diluted 500-fold with PBS were measured using dynamic light scattering using a NanoBrook 90 plus PALS instrument.

[0160] To characterize the serum stability of the vaccine, pre-prepared A5-HiLyte488 or E7-HiLyte488 and liposome mixtures were incubated in 40% human serum or 10% FBS in PBS at 37°C. Samples were diluted in PBS for fluorescence measurements at various time points. The fluorescence of the peptide was quenched upon binding to the liposomes by energy transfer from HiLyte488 to porphyrin. The binding rate of the peptide was calculated based on the percentage of fluorescence quenching of the peptide.

[0161] For in vitro peptide release studies in lysosomes, lysosomal solutions were prepared according to the manufacturer's instructions. Briefly, 10 μL of 10x catabolic buffer was mixed with 50 μl of 1x lysosomes and 40 μl of water in a 96-well plate. Prepared CPQ / A5-HiLyte488, CoNTA / A5-HiLyte488, or PBS / A5-HiLyte488 was added to the lysosomal solution and incubated at 37°C. The fluorescence of the mixtures was measured at the indicated time points. The fluorescence of A5-HiLyte488 was read on a microplate reader (TECAN Safire) at 491 nm excitation and 527 nm emission.

[0162] Cryo-electron microscopy

[0163] To analyze the morphology of CPQ liposomes before and after A5 peptide binding, approximately 3.6 μL of each sample was applied to a perforated carbon grid and blotted manually with Vitrobot blotting paper (Standard Vitrobot Filter Paper, Φ55 / 20 mm, Grade 595). Immediately after blotting, a new drop of sample was applied to the EM grid and blotted again (3 s and blot force +1) using the standard routine with two blotting pads of a Vitrobot Mark IV (Thermo Fisher Scientific). The grid was then immediately placed in liquid ethane. The Vitrobot was set at 25 °C and 100% relative humidity. For all samples, c-flat grids (C-Flat 2 / 2-3Cu-T) that had been washed with chloroform were used and negatively glow discharged at 5 mA in air for 2 h for 15 s just before the samples were subjected to vitrification. Samples were imaged with a Tecnai F20 electron microscope operated at 200 kV using a side-entry Gatan 626 single tilt cryo-holder. Images were collected with a TVIPS XF416 CMOS camera at 50,000x magnification, producing images with a calibrated pixel size of 2.145 Å. Images were collected at a total volume of approximately 10e- / Å2 using a defocus ranging from -1.75 to -2.50 μm.

[0164] Sequencing of RNA from healthy BALB / c mice and RENCA tumor cells

[0165] Whole-exome sequencing libraries were generated using Agilent's "SureSelectXT Mouse All Exon Kit" according to the manufacturer's instructions. Paired-end sequencing was performed on the Illumina NextSeq platform, generating 75 bp reads. For RNA-Seq experiments, an Illumina Stranded TruSeq RNA library prep kit was used, followed by 75 cycles of paired-end sequencing on the NextSeq in medium output mode, generating approximately 25 million reads per sample.

[0166] To generate variant calls from whole-exome sequencing data, we first aligned raw sequence reads (in fastq format) to the GRCm38 reference assembly using BWA (version 0.7.13, with the "mem-M" option), and then merged and sorted (by genomic coordinates) individual fastq files from the same sample sequenced in multiple flow cell lanes. We then generated variant calls using the Mutect2 tool in the Genome Analysis Toolkit (GATK, version 4.0.9.0) with default parameters, using the coordinate-sorted bam files of the tumor cell lines as input for "-tumor" and the bam files of BALB / c as input for "-normal". The variants in the resulting VCF files were then filtered using the "FilterMutectCalls" tool in GATK. The curated VCF files were further normalized by splitting multiple alleles and left-justifying indels using the bcftool from the samtools suite (samtools.github.io / bcftools / bcftools). The final VCF files were used as input to the online Ensembl Variant Effect Predictor (useast.ensembl.org / Mus_musculus / Tools / VEP) tool for annotating the functional effects of variants. For RNA-seq data, raw sequencing reads from tumor cell lines and Balb / c samples were first aligned (in a two-pass approach) to the GRCm38 reference genome using STAR (version 2.6.1b_10-01). The resulting bam files are used to make variant calls using Mutect2. The vcf files were then filtered using the GATK 'VariantFiltration' tool with the parameters "-window 35 -cluster 3 -filterName FS -filter "FS > 30.0" -filterName QD-filter "QD < 2.0".To obtain the final nonsynonymous variant candidates, we filtered the exome sequencing VCF files for variants that were annotated as nonsynonymous variants and were also detected in the RNA-Seq data (minimum read depth 4). We then extracted peptide sequences around these nonsynonymous variants using a custom Perl script, and the resulting peptide sequences were used as input for binding affinity prediction using the NetMHC-I binding prediction server (cbs.dtu.dk / services / NetMHC / ).

[0167] cell research

[0168] RAW264.7 mouse macrophage cells were obtained from the American Type Culture Collection (ATCC) and cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. CT26 colon cells were obtained from ATCC and cultured in RPMI 1640 with 10% FBS and 1% penicillin / strep. The 4T07 cell line was kindly provided by Dr. Josh Gamble (Karmanos Cancer Institute, Detroit, MI) and cultured in DMEM with 10% FBS, 1x glutamine, and 1% pen / strep. CMS4-met cells were kindly provided by Dr. Abrams (Roswell Park, Buffalo, NY) and cultured in Roswell Park Memorial Institute (RPMI) 1640 medium with 10% FBS and 1% pen / strep. 4T1 cells were kindly provided by Dr. Yun Wu (University at Buffalo, Buffalo, NY) and were cultured in RPMI 1640 with 10% FBS and 1% pen / strep. RENCA cells were obtained from the American Type Culture Collection (ATCC) and were cultured in RPMI 1640 supplemented with 10% fetal bovine serum, 0.1 mM additional non-essential amino acids (NEAA), 1 mM additional sodium pyruvate, and 2 mM additional L-glutamine. TC-1 cells were obtained from Dr. Gomez-Gutierrez (University of Louisville, Kentucky) and were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% FBS and 1% penicillin / strep. B16-F10 cells were obtained from ATCC and were cultured in DMEM with 10% FBS and 1% penicillin / strep. BMDCs were obtained from the bone marrow of femurs and tibias of BALB / c mice. 710 cells / mL were cultured in 10 mL of RPMI 1640 medium containing 10% FBS, 1% pen / strep, and 20 ng / mL recombinant mouse GM-CSF. On day 3, 10 mL of medium containing GM-CSF was added to bring the final volume to 20 mL. On day 6, non-adherent cells were harvested and cultured at 5 × 10 cells / mL in RPMI 1640 medium containing 10% FBS and 1% pen / strep in 24-well plates. 5 Cells were cultured at 1000 cells / mL. For splenocyte studies, freshly isolated spleens were dissociated and filtered through a 70 μm cell strainer. The tissue was separated through the strainer using the plunger of a sterile 3 mL syringe, and the cells were washed using 5 mL of cold PBS and placed in a 50 mL tube. The cells were centrifuged at 500 x g for 5 min and the supernatant was discarded. Red blood cells were lysed with 5 mL of red blood cell lysis buffer for 5 min, after which 35 mL of PBS was added to the tube. The cells were centrifuged again and the cell pellet was collected for further use. Splenocytes were cultured in RPMI 1640 supplemented with 10% FBS, 1% pen / strep, 2 mM glutamine, 1 mM sodium pyruvate, 1x non-essential amino acid solution, and 50 μM β-mercaptoethanol. Cells were cultured in a humidified chamber at 5% CO2 / 95% air and 37°C.

[0169] For in vitro cellular uptake studies, RAW264.7 cells (2.5 x 10 per well) 5 ) and BMDCs (2.5 × 10 per well 5) were cultured overnight in 24-well plates and then treated (10 min, 30 min, or 1 h) with CPQ / A5-HiLyte488, 2HPQ / A5-HiLyte488, and PBS / A5-HiLyte488 (peptide concentration 1 μg / mL). For phagocytosis and endocytosis inhibitor studies, cells were first preincubated with cytochalasin B (10 μg / mL) or chlorpromazine (10 μg / mL) for 1 h, followed by cellular uptake studies. Cells were washed and lysed with 0.1% Triton X-100 and 10 mM dithiothreitol (DTT). Fluorescence signals were measured before and after the addition of DTT. Cellular uptake of A5-HiLyte488 was calculated by constructing an A5-HiLyte488 standard curve.

[0170] For cell lysate HPLC, 1 x 10 6 RAW 264.7 mouse macrophages were seeded in T25 cell culture flasks until confluent. CPQ / A5-HiLyte488 (peptide concentration 2 μg / mL) or PBS was added to the cell culture medium for the indicated times. Cells were washed, lysed, and centrifuged. The supernatant was collected and injected onto a reversed-phase HPLC column Agilent poroshell 120 EC-C18 (2.7 μm packing, 4.6 × 50 mm length). The mobile phase consisted of acetonitrile and 0.1% trifluoroacetic acid (TFA) in water (in this method, 5%-60% acetonitrile at 1 mL / min for 10 min). The HPLC system consisted of an Agilent Technologies 1260 Infinity and a diode array detector (G1315C DAD VL+) set at 475 nm.

[0171] Mouse studies

[0172] In vivo immunization Mouse studies were performed according to a protocol approved by the University at Buffalo IACUC. Five- to six-week-old female BALB / c mice (Charles River Laboratories, strain BALB / cAnNCrl) were immunized (intramuscularly) in the right hind leg. BALB / cJ mice (Jackson Laboratories) were used in this study only for DNA sequencing where indicated.

[0173] Tumor challenge For the preventative vaccine tumor model, mice were vaccinated on days 0 and 7 and challenged on day 14. To test long-term protection by the vaccine, mice were challenged on day 80. For the therapeutic vaccine tumor model, mice were inoculated subcutaneously with tumor cells on day 0 and then with the indicated vaccine on days 5 and 12. Tumor growth was monitored three times weekly and tumor size was calculated according to the formula: tumor volume = length x width. 2 The tumor size was calculated by the formula: tumor size / 2. Animals were euthanized when the tumor size reached 1 cm in diameter or when the animals developed ulcers. For the experimental lung metastasis tumor model, tumor cells were injected intravenously via the tail vein on day 0 and then either left untreated or treated by intramuscular injection of the indicated vaccine on days 2 and 9 for the A5 vaccine study, and on days 1 and 8 for the RragcL385P, Tmem5S71N, or EML5G44R peptide screening studies. Lungs were excised and stained with Bouin's solution (Sigma Catalog: HT10132) on day 18 for mice injected with CT26 cells and on day 16 for mice injected with 4T1 cells. Tumor nodules were counted manually and lung weights were measured.

[0174] Acute Toxicity Testing Eight-week-old female CD-1 mice were either untreated or injected intramuscularly with CPQ / A5 on days 0 and 7 (0.5 μg A5 peptide, 2 μg CoPoP, 2 μg PHAD, and 2 μg QS-21 per mouse). On day 14, anticoagulated blood and serum were collected for standard complete blood cell counts and serum panels, and 15 μL of blood was evaluated within 4 hours of blood collection for complete blood cell counts on a Heska Element HT5 Hematology Analyzer. Serum was evaluated on a Heska Element DC Chemistry Analyzer. Organs (heart, liver, spleen, lungs, kidneys) were fixed in formalin, stored in 70% ethanol, and subjected to hematoxylin and eosin (H&E) staining and imaging.

[0175] IFN-γ ELISA 2.5×10 5 Splenocytes were seeded in 96-well plates and stimulated with 10 μg / mL of antigen for 72 h. 50 μL of supernatant was collected from each well and subjected to interferon gamma ELISA (Thermofisher; Cat: BMS606TEN) according to the manufacturer's protocol.

[0176] Antibody staining

[0177] For tetramer staining, tumor Ag-specific CD8 + The proportion of T cells was analyzed. d -Restrictive AH1 (SPSYVYHQF) peptide was administered to MHC-I (H-2L d) and conjugated with PE (NIH Tetramer Core Facility). 60 μL of blood was incubated with AH1 tetramer (100x dilution) for 1 h at 4°C, then incubated with CD8a, MHC-II (IA / IE), B220, CD4, CD44, and CD62L antibodies (1000x dilution) for 30 min at 4°C. Red blood cells were lysed with cell lysis buffer for 5 min, after which the cells were centrifuged at 500×g for 5 min. Cell pellets were washed twice and subjected to flow cytometry analysis. For tetramer staining of splenocytes, 1×10 6 The cells were incubated with tetramers and antibodies under the same conditions as for blood and then washed twice for flow cytometry analysis. Flow cytometry studies were performed using BD LSRFortessa TM The experiments were performed using an X-20 cytometer. Flowjo (version 10) software was used for data analysis.

[0178] For intracellular staining, 100 µL of 1 x 10 6 Splenocytes were seeded in flat-bottom 96-well plates and stimulated with 10 μg / mL of antigen for 15-18 hours in a cell culture incubator. Brefeldin A was then added to the plates using a 1000x dilution for 5 hours. Cells were transferred to round-bottom 96-well plates, centrifuged at 1350 rpm for 3 minutes, and cell pellets were washed twice and stained with 500x live / dead cell fixation dye, 200x diluted APC anti-mouse CD8, 200x diluted FITC anti-mouse CD4, 200x diluted PE / Cy7 anti-mouse CD62L, and 200x diluted PerCP / Cy5.5 anti-mouse (25 minutes at 4°C with shaking). Cells were washed twice and fixed and permeabilized with fixation / permeabilization buffer for 20 minutes at 4°C. Cells were washed twice with Perm / Wash buffer and stained with 200x diluted Pacific Blue anti-mouse IFN-γ and 200x diluted PE anti-mouse TNF-α for 30 minutes on ice. Cells were washed twice with Perm / Wash buffer for flow cytometry.

[0179] For cell recruitment studies, CD-1 mice were left untreated or injected intramuscularly with CPQ / A5 or CP / A5. After 48 hours, mice were euthanized and lymph nodes were harvested for cell extraction. Cells were fixed with 4% and washed, then stained with a mixture of antibodies against Ly6C, CD11b, Ly6G, CD11c, CD3, IA / IE, and F4 / 80 for 1 hour on ice to identify cells.

[0180] For immunofluorescence microscopy, liposomes (containing 320 μg / mL PoP or CoPoP in addition to other components including fluorescent A5) were coated with 25 mg / mL beads (Spherotech Silica Particles, 1.5-1.9 μm; catalog: SIP-15-10) by shaking at 2000 rpm for 10 min followed by shaking at 1200 rpm for 45 min. Free liposomes (in the supernatant) were removed by centrifugation at 1200 rcf for 2 min and beads were washed twice with PBS. Glass cover slips were treated with 1% Alcian Blue for 10 min at 37°C in an incubator and then washed three times with PBS. 5 × 10 5BMDCs were seeded on Alcian Blue-treated glass coverslips for 30 min and then incubated with liposome-coated or uncoated silica beads for 3 h. Cells were washed three times with PBS and then fixed with 4% paraformaldehyde (VWR; Cat: 30525-89-4) for 20 min at 4°C. Slides were washed three times with PBS and then incubated with 5% BSA and 0.1% Triton X-100 (PBST) for 30 min at room temperature. Cells were incubated with anti-mouse H2Ld (1:500 dilution, Invitrogen, PIMA170109) overnight at 4°C, washed three times with 5% BSA (in PBST), followed by incubation with Alexa Flour 555 anti-mouse secondary antibody (1:1000 dilution, Invitrogen; Cat: A21137) for 30 min at room temperature. Slides were washed three times with PBST and stained with anti-mouse LAMP1 (1:500 dilution, Invitrogen, Cat. 50-128-11) for 30 minutes at room temperature. After incubation, slides were washed three times with PBST and then stained with Alexa Flour 647 chicken anti-rat IgG (1:1000 dilution, Invitrogen cat #A21137A21472) for 30 minutes at room temperature, then washed three times with PBST. Slides were stained with 4',6-diamidino-2-phenylindole (DAPI) in anti-fade mounting medium (Vectashield, Cat. H-1200). Images were acquired using a Zeiss LSM 710 confocal microscope.

[0181] For cytotoxic T lymphocyte (CTL) cytotoxicity assay, isolated splenocytes were cultured in cell culture medium and stimulated with mouse IL-2 (Pepro tech; Cat: 212-12; 10 IU / mL) and antigen (10 μg / mL) for 5 days and used as effector cells. 5000 CT26 cells were seeded in 96-well plates and pulsed with 10 μg / mL antigen for 1 h, after which splenocytes were added to the plates at various E:T ratios (5 h). Cytotoxicity of splenocytes against tumor cells was assessed by lactate dehydrogenase (LDH) release using the Non-Radioactive Cytotoxicity Assay Kit (Promega; Cat: G1780) according to the manufacturer's instructions.

[0182] DNA sequencing of RragcL385P in CT26 and 4T1 cells

[0183] DNA was extracted using DNeasy Blood & Tissue kit (QIAGEN, Cat. No.: 69504) and PCR-amplified using forward primer TCACTGTTCACGTCTGTCCT (SEQ ID NO: 46) and reverse primer ACTGAGTTCTGAGGTCTCT (SEQ ID NO: 7). DNA was purified using 1.5% agarose gel and DNA bands were excised and extracted using QIAquick Gel Extraction Kit (QIAGEN, Cat. No.: 28706). The quality and concentration of isolated PCR products were measured using NanoDrop One (ThermoFisher). Purified DNA was sequenced by Sanger sequencing at the DNA Sequencing Core (College of Medicine, Houston, TX). Data was analyzed by Snapgene.

[0184] statistical analysis

[0185] Data were analyzed by one-way or two-way analysis of variance (ANOVA) followed by Bonferroni post-hoc test for comparison of multiple groups, or by Student's t-test for comparison of two groups, or by log-rank test for survival comparisons (using Prism 8 (GraphPad Software)). P values ​​of less than 0.05 were considered statistically significant. Values ​​are reported as mean ± SD with sample sizes indicated.

[0186] Table 1. Peptides used in each figure. See table below for peptide identity. [Table 1]

[0187] Table 2. AH1-related peptides [Table 2]

[0188] Table 3. CT26 peptides [Table 3] TIFF2024502633000006.tif244170TIFF2024502633000007.tif242170TIFF2024502633000008.tif153170* indicates mutations common to CT26 and 4T1.

[0189] Table 4. Screened RENCA peptides [Table 4]

[0190] Table 5. Predicted MHC-I epitopes within the E6 / E7 oncogene sequenced from TC-1 cells [Table 5] *H3 stands for three histidine residues at the N-terminus. MW stands for molecular weight.

[0191] Table 6. Trp2 peptides [Table 6]

[0192] While the present invention has been described through specific embodiments, routine modifications will be apparent to those skilled in the art and such modifications are intended to be within the scope of this disclosure.

Claims

1. 1. A composition for reducing tumor growth in a subject, comprising: a) A liposome comprising the following i) and ii): i) a bilayer, one or more phospholipids, and one or more porphyrin phospholipid conjugates coordinated to cobalt to form a cobalt-porphyrin phospholipid conjugate; a bilayer comprising: ii) A polyhistidine-tagged MHC-I-restricted tumor peptide, wherein at least a portion of the amino acid sequence of the MHC-I-restricted peptide (MHC-I-binding peptide) is exposed to the outside of the liposome. and b) Pharmaceutical Carriers A composition comprising:

2. 1. A composition for generating an immune response against a tumor antigen, comprising: a) A liposome comprising the following i) and ii): i) a bilayer, one or more phospholipids, and one or more porphyrin phospholipid conjugates coordinated to cobalt to form a cobalt-porphyrin phospholipid conjugate; A bilayer comprising: ii) A polyhistidine-tagged MHC-I-restricted tumor peptide, wherein at least a portion of the amino acid sequence of the MHC-I-restricted peptide (MHC-I-binding peptide) is exposed to the outside of the liposome. and b) Pharmaceutical Carriers A composition comprising:

3. The immune response is + The composition of claim 2, which is for inducing T cells.

4. The composition according to any one of claims 1 to 3, wherein the MHC-I binding peptide is 7 to 11 amino acids in length (excluding the polyhistidine tag).

5. The composition of any one of claims 1 to 3, wherein the MHC-I binding peptide does not significantly bind to MHC-II molecules.

6. The composition according to any one of claims 1 to 3, wherein the polyhistidine tag comprises 6 to 10 histidine residues.

7. The composition of any one of claims 1 to 3, wherein the liposome further comprises one or more adjuvants incorporated therein.

8. The composition of claim 7, wherein the one or more further adjuvants are QS21 and / or MPLA.

9. The composition of claim 7, wherein the one or more further adjuvants further comprise MPLA or a synthetic variant thereof.

10. The composition of claim 9 , wherein the synthetic mutant is a PHAD, a 3D6A-PHAD, a 3D-PHAD, or any combination thereof.

11. The composition according to claim 7, wherein the mass ratio of the MHC-I restricted peptide to the adjuvant is 1:1 to 10:

1.

12. The composition of claim 11, wherein the MHC-I restricted peptide, QS21, and PHAD are present in a mass ratio of 1:1:1, 2:1:1, 3:1:1, 4:1:1, 5:1:1, 6:1:1, 7:1:1, 8:1:1, 9:1:1, or 10:1:

1.

13. The composition according to any one of claims 1 to 3, wherein the subject is a human.

14. The composition of any one of claims 1 to 3, wherein the composition is administered multiple times.

15. 1. A vaccine composition comprising: a) A liposome comprising the following i) and ii): i) a bilayer, one or more phospholipids, and one or more porphyrin phospholipid conjugates coordinated to cobalt to form a cobalt-porphyrin phospholipid conjugate; A bilayer comprising: ii) a polyhistidine-tagged amino acid sequence of an MHC-I-binding tumor peptide (MHC-I-restricted peptide), wherein at least a portion of the polyhistidine tag is present in the hydrophobic portion of the bilayer, one or more histidines of the polyhistidine tag are coordinated to the cobalt of the cobalt-porphyrin phospholipid conjugate, and at least a portion of the MHC-I-binding tumor peptide sequence is exposed to the exterior of the liposome. and b) Pharmaceutical Carriers 23. A vaccine composition comprising:

16. The vaccine composition of claim 15, wherein the polyhistidine tag comprises 2 to 6 histidine residues.

17. The vaccine composition of claim 15 , wherein the MHC-I restricted peptide does not bind to an MHC-II class molecule.

18. 16. The vaccine composition of claim 15, wherein the liposome further comprises one or more additional adjuvants incorporated therein.

19. 19. The vaccine composition of claim 18, wherein the one or more adjuvants are QS21 and / or PHAD.

20. 19. The vaccine composition of claim 18, wherein the one or more additional adjuvants further comprise MPLA or a variant thereof.

21. The vaccine composition of claim 20, wherein the MPLA mutant is PHAD, 3D6A-PHAD, or 3D-PHAD.

22. The vaccine composition according to claim 19, wherein the mass ratio of the MHC-I restricted peptide to QS21 or PHAD is 1:1 to 10:

1.

23. 20. The vaccine composition of claim 19, wherein the MHC-I restricted peptide, QS21, and PHAD are present in a mass ratio of 1:1:1, 2:1:1, 3:1:1, 4:1:1, 5:1:1, 6:1:1, 7:1:1, 8:1:1, 9:1:1, or 10:1:

1.

24. 16. The vaccine composition of claim 15, wherein the bilayer further comprises a cobalt porphyrin.

25. 25. The vaccine composition of claim 24, wherein the cobalt-porphyrin phospholipid conjugate constitutes 1 to 25 mole percent of the monolayer or bilayer.

26. 26. The vaccine composition of claim 25, wherein the cobalt-porphyrin phospholipid conjugate constitutes about 2% to about 8%, preferably 3-4%, by mass of the bilayer.

27. 16. The vaccine composition of claim 15, wherein the bilayer further comprises about 15-20% (by weight) cholesterol.

28. The vaccine composition of claim 15, wherein the liposome size is between 50 nm and 250 nm.

29. Immunizing mice with a combination of candidate neoepitope peptides; and In the mouse, CD8 + Select one or more peptides that stimulate T cells The method includes:

30. Using one or more of the selected peptides, CD8 + 30. The method of claim 29, further comprising formulating the composition for use in stimulating the T cells.

31. A method comprising: randomizing an amino acid or combination of amino acids in one or more candidate neoepitope peptides; testing peptides comprising one or more randomized amino acids; and comparing properties of one or more of the peptides to properties of the pre-randomized peptides used for randomization to identify one or more peptides having improved properties.

32. The one or more improved properties include higher affinity for MHC-1, CD8 + 32. The method of claim 31, comprising improved T cell activation, improved anti-cancer activity, or any combination thereof.

Images