Variant strain-based coronavirus vaccines

Abstract

The present disclosure provides coronavirus mRNA vaccines, including vaccines directed against the spike protein of one or more variant strains of SARS-CoV-2, as well as methods of using the vaccines.

Description

[Technical Field]

[0001] Related Applications This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 63 / 138,228, filed January 15, 2021. This application also claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 63 / 140,920, filed January 24, 2021, U.S. Provisional Patent Application No. 63 / 161,433, filed March 15, 2021, U.S. Provisional Patent Application No. 63 / 173,979, filed April 12, 2021, and U.S. Provisional Patent Application No. 63 / 173,979, filed May 26, 2021, each of which is incorporated herein by reference in its entirety. Priority is claimed to U.S. Provisional Patent Application No. 63 / 193,547, U.S. Provisional Patent Application No. 63 / 222,925 filed July 16, 2021, U.S. Provisional Patent Application No. 63 / 241,963 filed September 8, 2021, U.S. Provisional Patent Application No. 63 / 283,905 filed November 29, 2021, and U.S. Provisional Patent Application No. 63 / 284,570 filed November 30, 2021. [Background technology]

[0002] Human coronaviruses are highly contagious, enveloped, single-stranded, positive-sense RNA viruses in the family Coronaviridae. Two subfamilies of Coronaviridae are known to cause human disease. The most important are the β-coronaviruses (betacoronaviruses). β-coronaviruses are common causes of mild to moderate upper respiratory tract infections. However, outbreaks of COVID-19, such as the infection caused by the coronavirus first identified in Wuhan, China, in December 2019, are associated with high mortality rates. This recently identified coronavirus, termed severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (originally called "2019 novel coronavirus" or "2019-nCoV"), has rapidly infected hundreds of thousands of people. The pandemic disease caused by the SARS-CoV-2 virus has been named COVID-19 (Coronavirus Disease 2019) by the World Health Organization (WHO). The first genome sequence of a SARS-CoV-2 isolate (Wuhan-Hu-1; USA-WA1 / 2020 isolate) was published by investigators from the China CDC in Beijing on January 10, 2020, at the Virology UK-based discussion forum for analysis and interpretation of viral molecular evolution and epidemiology. The sequence was then deposited in GenBank on January 12, 2020, and has Genbank accession number MN908947.1. Several SARS-CoV-2 strain variants have since been identified, some of which are more infectious than SARS-CoV-2 isolates.

[0003] At the time of the global emergency use authorization of approved SARS-CoV-2 nucleic acid-based vaccines, there are still no strategies to combat recently discovered variants and subsequent emerging SARS-CoV-2 variants of concern (VOCs). The ongoing health problems and mortality associated with coronavirus infections, particularly the SARS-CoV-2 pandemic, are of great international concern. The public health crisis caused by SARS-CoV-2 and its variants highlights the importance of rapidly developing effective and safe vaccine candidates against these viruses.

[0004] The emergence of SARS-CoV-2 variants with substitutions in the receptor-binding domain (RBD) and N-terminal domain (NTD) of the viral S protein has raised concerns among scientists and health officials. Coronavirus entry into host cells is mediated by interactions between the RBD of the viral S protein and the host angiotensin-converting enzyme 2 (ACE2). Vaccine development has focused on inducing antibody responses against this region of the SARS-CoV-2 S protein. More recently, neutralizing "supersites" in the NTD have also been identified. Significant decreases in vaccine efficacy have been correlated with amino acid substitutions in the RBD (e.g., K417N, E484K, and N501Y) and NTD (e.g., L18F, D80A, D215G, and Δ242-244) of the S protein. Some of the most recent circulating isolates containing these substitutions from the United Kingdom (B.1.1.7, alpha), South Africa (B.1.351, beta), Brazil (P.1 lineage, gamma), New York (B.1.526, iota), and California (B.1.427 / B.1.429 or CAL.20C lineage, epsilon) have demonstrated reduced neutralization from convalescent sera in pseudovirus neutralization (PsVN) assays and resistance to certain monoclonal antibodies. Notably, mutations in the NTD subdomain, specifically the neutralization supersite, are most widespread in B.1.351 lineage viruses. See McCallum, M. et al. N-terminal domain antigenic mapping reveals a site of vulnerability for SARS-CoV-2. Cell, doi:10.1016 / j.cell.2021.03.028 (2021).

[0005] Evaluation of the neutralizing capacity of sera from phase 1 participants and non-human primates (NHPs) receiving two doses of mRNA-1273 using a lentivirus PsVN assay expressing two orthogonal vesicular stomatitis viruses (VSVs) and the S variants 20E(EU1), 20A.EU2, D614G-N439K, mink cluster 5, B.1.1.7, P.1, B.1.427 / B.1.429, B.1.1.7+E484K, and B.1.351 was reported. See Wu, K. et al. Serum Neutralizing Activity Elicited by mRNA-1273 Vaccine. N Engl J Med, doi:10.1056 / NEJMc2102179 (2021). Subsequent studies have demonstrated reduced neutralization titers against the full B.1.351 variant after mRNA-1273 vaccination, but the levels are still significant and predicted to be protective. Despite this prediction of continued efficacy of mRNA-1273 against this key variant of concern, the duration of vaccine-mediated protection remains unknown.

[0006] L18F, D80A, D215G, L242-244del, R246I, K417N, E484K, N501Y, D614G, A701V, A67V, Δ69-70, T95I, G142D / Δ143-145, Δ211 / L212I, ins214EPE, G339D, S371L, S373P, S375F, N440K, G446S, S477N, T478K, E484A, Q493K, G496S, Q498R, Y50 There remains a need for the development and evaluation of additional COVID-19 vaccines against SARS-CoV-2 variants that encode the SARS-CoV-2 profusion-stabilizing S protein incorporating key mutations present in the variant, including 5H, T547K, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, L981F, and any combination thereof. Additional vaccines are needed to expand coverage against multiple circulating variants as well as the ancestral wild-type virus that is still circulating globally. Summary of the Invention

[0007] The SARS-CoV-2 vaccine, mRNA-1273 (developed by Moderna Therapeutics), has been shown to induce high virus-neutralizing titers in human participants in Phase 1 trials (Jackson et al., 2020; Anderson et al., 2020) and is highly effective in preventing symptomatic and severe COVID-19 disease (Baden et al., 2020). However, the recent emergence of SARS-CoV-2 variants in the UK (B.1.1.7 lineage, alpha) and South Africa (B.1.351 lineage, beta) has raised concerns due to their increased transmission rate and potential to evade immunity induced by natural infection or vaccination (Volz et al., 2021; Tegally et al., 2020; Wibmer et al., 2021; Wang et al., 2021; Collier et al., 2021).

[0008] The SARS-CoV-2 B.1.1.7 variant (alpha variant), first detected in southern England in September 2020, spreads rapidly and has been associated with increased transmission and higher viral loads (Rambaut et al., 2020). This variant contains 17 mutations in the viral genome. Eight mutations, including 69-70del, Y144del, N501Y, A570D, P681H, T716I, S982A, and D1118H, are located in the spike (S) protein. Two key features of this variant—the 69-70 deletion and the N501Y mutation in the S protein—have raised concerns among UK scientists and policymakers due to increased transmission and potentially increased mortality, leading to further shutdowns. The 69-70 deletion has been associated with reduced susceptibility to SARS-CoV-2 neutralization by human convalescent serum samples (Kemp et al., 2021). N501 is one of six key amino acids that interact with the ACE-2 receptor (Starr et al. 2020), and tyrosine substitution has been shown to increase binding affinity to the ACE-2 receptor (Chan et al., 2020).

[0009] The B.1.351 variant (beta variant) has emerged in South Africa over the past few months and, similar to the B.1.1.7 variant, has been reported to have increased transmission rates and higher viral loads after infection (Tegally et al., 2020). The mutations located in the S protein are more extensive than those of the B.1.1.7 variant, with changes L18F, D80A, D215G, L242-244del, R246I, K417N, E484K, N501Y, D614G, and A701V. Three of these mutations (K417N, E484K, and N501Y) are located in the RBD. B.1.351 shares key RBD mutations with variants reported in Brazil (Tegally et al., 2020; Naveca et al., 2021). Because the RBD is a primary target for neutralizing antibodies, these mutations may affect the efficacy of already approved and previously developed monoclonal antibodies, as well as polyclonal antibodies induced by vaccination, in neutralizing infection or the virus ( Greaney et al., 2021 , Wibmer et al., 2021 ).

[0010] Recent data suggest that a key mutation present in the B.1.351 variant, E484K, confers resistance to SARS-CoV-2 neutralizing antibodies, potentially limiting the therapeutic efficacy of monoclonal antibody therapy (Wang et al., 2021; Greaney et al., 2020; Weisblum et al., 2020; Liu et al., 2020; Wibmer et al., 2021). Furthermore, the E484K mutation has been shown to reduce neutralization against a panel of convalescent sera (Weisblum et al., 2020; Liu et al., 2020; Wibmer et al., 2021). From a vaccination perspective, it is clear that mRNA-1273 induces significantly higher neutralization titers against the USA-WA1 / 2020 isolate than convalescent sera (Jackson et al., 2020). A recent study using a recombinant VSV PsVN assay showed that sera from participants vaccinated with the mRNA-1273 vaccine had reduced neutralization titers against the E484K or K417N / E484K / N50Y combination (Wang et al., 2021); however, sera from mRNA-1273 clinical trial participants were not evaluated against the full constellation of S mutations found in the B.1.1.7 or B.1.351 variants.

[0011] Neutralization of sera from phase 1 clinical trial participants vaccinated with the mRNA-1273 vaccine was examined using a recombinant VSV-based SARS-CoV-2 PsVN assay using S proteins from the original USA-WA1 / 2020 isolate, the D614G variant, the B.1.1.7 and B.1.351 variants, and previously emerged variants (20E, 20A.EU2, D614G-N439K, and mink cluster 5 variants) (data discussed in the Examples). The effects of both single mutations and combinations of mutations present in the RBD region of the S protein were evaluated. In addition, orthogonal evaluation was performed in VSV and pseudotyped lentivirus neutralization assays on sera from non-human polioviruses (NHPs) receiving the mRNA-1273 vaccine at two different dose levels, as these were useful preclinical models for vaccine-induced immunogenicity and protection. The use of both of these assays provided confirmatory data on pseudovirus neutralization. Overall, this comprehensive pseudovirus neutralization analysis in humans and non-human primates receiving mRNA-1273 provides important validation needed to elucidate how vaccines may be affected by SARS-CoV-2 variants.

[0012] The present invention relates, inter alia, to vaccines containing nucleic acids encoding SARS-CoV-2 antigens that vary by at least one amino acid mutation from the SARS-CoV-2 2P spike antigen (encoded by mRNA-1273). Such vaccines, optionally referred to herein as variant vaccines, can be administered to seropositive or seronegative subjects. For example, subjects may be naive, lack antibodies reactive with SARS-CoV-2, or have pre-existing antibodies to SARS-CoV-2, such as those previously infected with SARS-CoV-2 or previously administered a dose of a vaccine (e.g., an mRNA vaccine) that induces antibodies against SARS-CoV-2. A variant vaccine can be the only vaccine containing nucleic acids encoding SARS-CoV-2 antigens that a subject receives. Alternatively, a variant vaccine can be administered in combination with other vaccines containing nucleic acids encoding SARS-CoV-2 antigens, as priming and / or boosting doses.

[0013] Thus, in some aspects, the disclosure provides methods comprising administering to a subject a vaccine comprising a nucleic acid encoding a SARS-CoV-2 spike antigen, and optionally a 2P-stabilized spike antigen of a second circulating SARS-CoV-2 virus, wherein the subject has previously been administered a first vaccine comprising a nucleic acid encoding a first SARS-CoV-2 2P-stabilized spike antigen of a first circulating SARS-CoV-2 virus, wherein each of the first and second 2P-stabilized spike antigens is administered in an amount effective to induce an immune response specific to the first antigen and the second antigen, and wherein the second circulating SARS-CoV-2 virus has a spike protein having an amino acid sequence with at least one amino acid mutation compared to the spike protein amino acid sequence of the first circulating SARS-CoV-2 virus, wherein the mutation is an amino acid substitution, deletion, or insertion.

[0014] In some aspects, the disclosure provides methods comprising administering to a subject a first vaccine comprising a nucleic acid encoding a first SARS-CoV-2 2P stabilized spike antigen; and administering to a subject a second vaccine comprising a nucleic acid encoding a second SARS-CoV-2 2P spike antigen, optionally a 2P stabilized spike antigen, wherein each of the nucleic acids encoding the first and second stabilized spike antigens is administered in an amount effective to induce an immune response specific to the respective encoded antigen, and wherein the second encoded SARS-CoV-2 spike antigen has an amino acid sequence with at least one amino acid mutation compared to the first encoded spike protein amino acid sequence, wherein the mutation is an amino acid substitution, deletion, or insertion.

[0015] In another aspect, the disclosure provides a method comprising administering to a subject a first vaccine comprising a nucleic acid encoding a first SARS-CoV-2 2P stabilized spike antigen; and administering to a subject a second vaccine comprising a nucleic acid encoding a second SARS-CoV-2 2P spike antigen, optionally a 2P stabilized spike antigen, wherein each of the nucleic acids encoding the first and second stabilized spike antigens is administered in an amount effective to induce an immune response specific for the respective encoded antigen, wherein the second encoded SARS-CoV-2 spike antigen has an amino acid sequence with at least one amino acid mutation compared to the first encoded spike protein amino acid sequence, wherein the mutation is an amino acid substitution, deletion, or insertion, and wherein the first encoded SARS-CoV-2 spike antigen is of a first circulating SARS-CoV-2 virus and the second encoded SARS-CoV-2 spike antigen is of a second circulating SARS-CoV-2 virus.

[0016] In some aspects, the disclosure provides methods comprising administering to a subject a first vaccine comprising a nucleic acid encoding a first SARS-CoV-2 2P stabilized spike antigen; and administering to a subject a second vaccine comprising a nucleic acid encoding a second SARS-CoV-2 2P spike antigen, optionally a 2P stabilized spike antigen, wherein each of the nucleic acids encoding the first and second stabilized spike antigens is administered in an amount effective to induce an immune response specific for the respective encoded antigen, wherein the second encoded SARS-CoV-2 spike antigen has an amino acid sequence with at least one amino acid mutation compared to the first encoded spike protein amino acid sequence, the mutation being an amino acid substitution, deletion, or insertion, and wherein the first encoded SARS-CoV-2 spike antigen represents a first circulating SARS-CoV-2 virus and the second encoded SARS-CoV-2 spike antigen represents a second circulating SARS-CoV-2 virus.

[0017] In some aspects, the disclosure provides methods comprising administering to a subject a first vaccine comprising a nucleic acid encoding a first SARS-CoV-2 2P stabilized spike antigen; and administering to a subject a second vaccine comprising a nucleic acid encoding a second SARS-CoV-2 2P spike antigen, optionally a 2P stabilized spike antigen, wherein each of the nucleic acids encoding the first and second stabilized spike antigens is administered in an amount effective to induce an immune response specific for its respective encoded antigen; the second encoded SARS-CoV-2 spike antigen has an amino acid sequence with at least one amino acid mutation compared to the first encoded spike protein amino acid sequence, the mutation being an amino acid substitution, deletion, or insertion; and the first encoded SARS-CoV-2 spike antigen represents a plurality of first circulating SARS-CoV-2 viruses and / or the second encoded SARS-CoV-2 spike antigen represents a second plurality of circulating SARS-CoV-2 viruses.

[0018] In some embodiments, the second circulating SARS-CoV-2 virus is an immunodominant emerging strain detected during the time period in which the first circulating SARS-CoV-2 virus was present in the population. In some embodiments, the second circulating SARS-CoV-2 virus and the first circulating SARS-CoV-2 virus are detectable in the population within at least one year. In some embodiments, the second circulating SARS-CoV-2 virus and the first circulating SARS-CoV-2 virus are detectable in the population during the same season. In some embodiments, the second circulating SARS-CoV-2 virus and the first circulating SARS-CoV-2 virus are detectable in the population during the same pandemic or endemic.

[0019] In some embodiments, the first nucleic acid encoding a SARS-CoV-2 2P stabilized spike antigen is a first nucleic acid encoding a first SARS-CoV-2 2P stabilized spike antigen.

[0020] In some embodiments, the nucleic acid is DNA or RNA. In some embodiments, the RNA is messenger RNA (mRNA). In some embodiments, the nucleic acid encoding the second SARS-CoV-2 2P stabilized spike antigen of the second circulating SARS-CoV-2 virus is the second nucleic acid and is messenger RNA (mRNA).

[0021] In some embodiments, the vaccine comprises a nucleic acid encoding a first SARS-CoV-2 spike antigen in combination with a nucleic acid encoding one or more additional spike proteins. In some embodiments, the vaccine comprises a nucleic acid encoding a first SARS-CoV-2 spike antigen in combination with one or more additional nucleic acids encoding one or more SARS-CoV-2 antigens that are not nucleic acids encoding spike proteins.

[0022] In some embodiments, the immune response is a neutralizing antibody response to SARS-CoV-2. In some embodiments, the immune response is a T cell response to SARS-CoV-2.

[0023] In some embodiments, the first encoded antigen is administered to the subject as a first vaccine consisting of one or more priming or prime immunizations, and the second encoded antigen is administered to the subject as a booster immunization.

[0024] In some embodiments, the second encoded antigen is administered to the subject as a first vaccine consisting of one or more priming or boosting immunizations, and the first encoded antigen is administered to the subject as a booster immunization.

[0025] In some embodiments, the first and second encoded antigens are administered to the subject together as a booster immunization.

[0026] In some embodiments, the first encoded antigen is administered to the subject as a primary or prime immunization and as a booster immunization to complete vaccination.

[0027] In some embodiments, the first coded antigen is administered to the subject as a primary or prime immunization and as a booster of the primary vaccination, and the second coded antigen is administered to the subject as a booster more than 3 months after the primary vaccination. In some embodiments, the first coded antigen is administered to the subject as a primary or prime immunization and as a booster of the primary vaccination, and the second coded antigen is administered to the subject as a booster more than 6 months after the primary vaccination. In some embodiments, the boost is a seasonal boost or a pandemic shift boost. In some embodiments, the boost dose is 50 μg.

[0028] In some embodiments, the first antigen is an mRNA encoding a first SARS-CoV-2 spike antigen, wherein the spike antigen has the amino acid sequence of SEQ ID NO: 20. In some embodiments, the second antigen is an mRNA encoding a second SARS-CoV-2 spike antigen, wherein the spike antigen has an amino acid sequence that has at least one amino acid mutation compared to the protein of SEQ ID NO: 20, wherein the mutation is an amino acid substitution, deletion, or insertion.

[0029] In some aspects, the disclosure provides a composition comprising: a first messenger ribonucleic acid (mRNA) encoding a first SARS-CoV-2 spike antigen of a first circulating SARS-CoV-2 virus, wherein the first SARS-CoV-2 spike antigen has an amino acid sequence of SEQ ID NO:20, or an amino acid sequence with at least one amino acid mutation compared to the protein of SEQ ID NO:20; and a second mRNA encoding a second SARS-CoV-2 spike antigen of a second circulating SARS-CoV-2 virus, wherein the second SARS-CoV-2 spike antigen has an amino acid sequence with at least one amino acid mutation compared to the protein of SEQ ID NO:20, wherein the mutation is an amino acid substitution, deletion, or insertion, and wherein the first SARS-CoV-2 spike antigen and the second SARS-CoV-2 spike antigen are different from each other.

[0030] In some embodiments, the composition further comprises a third messenger ribonucleic acid (mRNA) encoding a third SARS-CoV-2 spike antigen of a third SARS-CoV-2 virus, wherein the third SARS-CoV-2 spike antigen has an amino acid sequence having at least one amino acid mutation compared to the protein of SEQ ID NO:20, wherein the mutation is an amino acid substitution, deletion, or insertion.

[0031] In some embodiments, the composition further comprises a fourth messenger ribonucleic acid (mRNA) encoding a fourth SARS-CoV-2 spike antigen of a fourth SARS-CoV-2 virus, wherein the fourth SARS-CoV-2 spike antigen has an amino acid sequence having at least one amino acid mutation compared to the protein of SEQ ID NO:20, wherein the mutation is an amino acid substitution, deletion, or insertion.

[0032] In some embodiments, the composition further comprises a fifth messenger ribonucleic acid (mRNA) encoding a fifth SARS-CoV-2 spike antigen of a fifth SARS-CoV-2 virus, wherein the fifth SARS-CoV-2 spike antigen has an amino acid sequence having at least one amino acid mutation compared to the protein of SEQ ID NO: 20, wherein the mutation is an amino acid substitution, deletion, or insertion.

[0033] In some embodiments, the composition further comprises a sixth messenger ribonucleic acid (mRNA) encoding a sixth SARS-CoV-2 spike antigen of a sixth SARS-CoV-2 virus, wherein the sixth SARS-CoV-2 spike antigen has an amino acid sequence having at least one amino acid mutation compared to the protein of SEQ ID NO: 20, wherein the mutation is an amino acid substitution, deletion, or insertion.

[0034] In some embodiments, the first and second viral strains, and optionally the third, fourth, fifth, and sixth viral strains, have been circulating in the population for at least a portion of a year.

[0035] In some aspects, the disclosure provides a messenger ribonucleic acid (mRNA) encoding a SARS-CoV-2 2P-stabilized spike protein, wherein the 2P-stabilized spike protein has an amino acid sequence with at least one amino acid mutation compared to the protein of SEQ ID NO:20, wherein the mutation is an amino acid substitution, deletion, or insertion, and wherein the 2P-stabilized spike protein is a 2P-stabilized version of a spike protein from a second circulating SARS-CoV-2 viral strain, and wherein the first circulating SARS-CoV-2 viral strain comprises the spike protein of SEQ ID NO:36.

[0036] In some embodiments of the present disclosure, mRNAs encoding proteins having at least 90% or 95% sequence identity to any one of SEQ ID NOs: 5, 8, 11, 14, 17, 30, 33, 36, 39, and 42 are provided.

[0037] In some embodiments of the present disclosure, mRNAs having at least 90% or 95% sequence identity to the RNA of any one of SEQ ID NOs: 1, 6, 9, 12, 15, 28, 31, 34, 37, 40, 43, and 45 are provided.

[0038] In some embodiments of the present disclosure, an mRNA having at least 98% sequence identity to the RNA of any one of SEQ ID NOs: 1, 6, 9, 12, 15, 28, 31, 34, 37, 40, 43, and 45 is provided.

[0039] In some embodiments of the present disclosure, an mRNA comprising any one of SEQ ID NOs: 1, 6, 9, 12, 15, 28, 31, 34, 37, 40, 43, and 45 is provided.

[0040] In some embodiments, the mRNA comprises a chemical modification. In some embodiments, the mRNA is fully modified. In some embodiments, the chemical modification is 1-methylpseudouridine.

[0041] In some embodiments, the mRNA is in a lipid nanoparticle, and the lipid nanoparticle comprises an ionizable amino lipid, a sterol, a neutral lipid, and a polyethylene glycol (PEG)-modified lipid. In some embodiments, the lipid nanoparticle comprises 40-55 mol% ionizable amino lipid, 30-45 mol% sterol, 5-15 mol% neutral lipid, and 1-5 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises 40-50 mol% ionizable amino lipid, 35-45 mol% sterol, 10-15 mol% neutral lipid, and 2-4 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises 45 mol%, 46 mol%, 47 mol%, 48 mol%, 49 mol%, or 50 mol% ionizable amino lipid.

[0042] In some embodiments, the ionizable amino lipid has the structure of Compound 1: [ka]

[0043] In some embodiments, the sterol is cholesterol or a derivative thereof. In some embodiments, the neutral lipid is 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC). In some embodiments, the PEG-modified lipid is 1,2 dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000DMG).

[0044] In some aspects, the disclosure provides a composition comprising: a first messenger ribonucleic acid (mRNA) encoding a first SARS-CoV-2 spike antigen of a first circulating SARS-CoV-2 virus, wherein the first SARS-CoV-2 spike antigen has the amino acid sequence of SEQ ID NO:20; and a second mRNA encoding a second SARS-CoV-2 spike antigen of a second circulating SARS-CoV-2 virus, wherein the second SARS-CoV-2 spike antigen has an amino acid sequence that has at least one amino acid mutation compared to the protein of SEQ ID NO:20, wherein the mutation is an amino acid substitution, deletion, or insertion, and wherein the first SARS-CoV-2 spike antigen and the second SARS-CoV-2 spike antigen are different from each other.

[0045] In some embodiments, the first SARS-CoV-2 spike antigen has an amino acid sequence that has at least one amino acid mutation compared to the protein of SEQ ID NO: 20, wherein the mutation is an amino acid substitution, deletion, or insertion.

[0046] In some aspects, the disclosure provides methods comprising administering to a subject a vaccine comprising a first nucleic acid encoding a SARS-CoV-2 2P-stabilized spike antigen, wherein the spike antigen has an amino acid sequence having at least one amino acid mutation compared to the protein of SEQ ID NO: 20, wherein the mutation is an amino acid substitution, deletion, or insertion, and wherein the subject is seropositive for the SARS-CoV-2 antigen of SEQ ID NO: 21 or 20.

[0047] Another aspect of the present disclosure provides a method comprising administering to a subject a vaccine comprising a first nucleic acid encoding a SARS-CoV-2 2P-stabilized spike antigen, wherein the spike antigen has an amino acid sequence having at least one amino acid mutation compared to the protein of SEQ ID NO: 20, wherein the mutation is an amino acid substitution, deletion, or insertion, and wherein the subject is seronegative for the SARS-CoV-2 antigen of SEQ ID NO: 21 or 20.

[0048] In some embodiments, the subject is administered a second dose of the vaccine between two weeks and one year after the first dose of the vaccine is administered. In some embodiments, the subject is administered a second vaccine between two weeks and one year after the first dose of the vaccine is administered, wherein the second vaccine comprises a second nucleic acid encoding the SARS-CoV-2 2P stabilized spike antigen of SEQ ID NO: 20. In some embodiments, the second vaccine comprises a mixture of the first and second nucleic acids, wherein the first nucleic acid and the second nucleic acid are present in the second vaccine in a 1:1 ratio.

[0049] In some embodiments, 50 μg of a vaccine comprising a nucleic acid encoding a SARS-CoV-2 spike antigen, optionally a 2P-stabilized spike antigen of a third circulating SARS-CoV-2 virus, is administered to a subject. In some embodiments, the subject is administered an effective dose of the vaccine. In some embodiments, the effective dose is between 20 μg and 50 μg. In some embodiments, the effective dose is 20 μg. In some embodiments, the effective dose is 25 μg. In some embodiments, the effective dose is 30 μg. In some embodiments, the effective dose is 40 μg. In some embodiments, the effective dose is 50 μg.

[0050] In some embodiments, the vaccine comprises a nucleic acid encoding a SARS-CoV-2 spike antigen having at least 95% sequence identity to SEQ ID NO: 11. In some embodiments, the vaccine comprises a nucleic acid having at least 95% sequence identity to SEQ ID NO: 9. In some embodiments, the vaccine comprises a nucleic acid comprising SEQ ID NO: 9.

[0051] In some embodiments, the vaccine comprises a nucleic acid encoding a SARS-CoV-2 spike antigen having at least 95% sequence identity to SEQ ID NO: 30. In some embodiments, the vaccine comprises a nucleic acid having at least 95% sequence identity to SEQ ID NO: 28. In some embodiments, the vaccine comprises a nucleic acid comprising SEQ ID NO: 28.

[0052] In some embodiments, the vaccine comprises a nucleic acid encoding a SARS-CoV-2 spike antigen having at least 95% sequence identity to SEQ ID NO: 26. In some embodiments, the vaccine comprises a nucleic acid having at least 95% sequence identity to SEQ ID NO: 24. In some embodiments, the vaccine comprises a nucleic acid comprising SEQ ID NO: 24.

[0053] In some embodiments, the first vaccine or the second vaccine comprises (a) a nucleic acid encoding a SARS-CoV-2 spike antigen comprising two proline substitutions, and (b) a nucleic acid encoding a SARS-CoV-2 spike antigen comprising SEQ ID NO: 11. In some embodiments, the first vaccine or the second vaccine comprises (a) a nucleic acid encoding a SARS-CoV-2 spike antigen comprising two proline substitutions, and (b) a nucleic acid encoding a SARS-CoV-2 spike antigen comprising SEQ ID NO: 26. In some embodiments, the first vaccine or the second vaccine comprises (a) a nucleic acid encoding a SARS-CoV-2 spike antigen comprising two proline substitutions, and (b) a nucleic acid encoding a SARS-CoV-2 spike antigen comprising SEQ ID NO: 30.

[0054] In some embodiments, the ratio of (a) to (b) is 1:1, 1:2, 1:3, 1:4, 2:1, 3:1, or 4:1.

[0055] In some embodiments, the second vaccine comprises (a) a nucleic acid encoding a first SARS-CoV-2 2P spike antigen of a first circulating SARS-CoV-2 virus and (b) a nucleic acid encoding a second SARS-CoV-2 2P spike antigen of a second circulating SARS-CoV-2 virus, in which the ratio of (a) to (b) is 1:1, 1:2, 1:3, 1:4, 2:1, 3:1, or 4:1.

[0056] In some aspects, the present disclosure provides compositions comprising 50 μg to 250 μg of a first messenger ribonucleic acid (mRNA) comprising a first open reading frame (ORF) encoding a first SARS-CoV-2 pre-fusion stabilizing spike (S) protein, a second mRNA comprising a second ORF encoding a second SARS-CoV-2 pre-fusion stabilizing spike (S) protein, and lipid nanoparticles comprising a mixture of lipids including an ionizable amino lipid, a non-cationic lipid, a sterol, and a PEG-modified lipid.

[0057] In some embodiments, the composition comprises a total of 50 μg of mRNA. In some embodiments, the ratio of the first mRNA to the second mRNA is 1:1.

[0058] In some embodiments, the mRNA comprises a chemical modification. In some embodiments, the mRNA is fully modified. In some embodiments, the chemical modification is 1-methylpseudouridine.

[0059] In some embodiments, the mRNA further comprises a 5' cap analog, optionally a 7mG(5')ppp(5')NlmpNp cap. In some embodiments, the mRNA optionally further comprises a poly(A) tail having a length of 50 to 150 nucleotides (e.g., 100 nucleotides).

[0060] In some embodiments, the lipid nanoparticles comprise 40-55 mol% ionizable amino lipid, 30-45 mol% sterol, 5-15 mol% neutral lipid, and 1-5 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticles comprise 40-50 mol% ionizable amino lipid, 35-45 mol% sterol, 10-15 mol% neutral lipid, and 2-4 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticles comprise 45 mol%, 46 mol%, 47 mol%, 48 mol%, 49 mol%, or 50 mol% ionizable amino lipid. In some embodiments, the ionizable amino lipid has the structure of Compound 1: [ka]

[0061] In some embodiments, the sterol is cholesterol or a derivative thereof. In some embodiments, the neutral lipid is 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC). In some embodiments, the PEG-modified lipid is 1,2 dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000DMG).

[0062] In some embodiments, the composition further comprises Tris buffer, sucrose, and sodium acetate, or any combination thereof. In some embodiments, the composition further comprises 30-40 mM Tris buffer, 80-95 mg / mL sucrose, and 5-15 mM sodium acetate. In some embodiments, the composition has a pH of 6-8, optionally 7.5.

[0063] In some embodiments, the present disclosure provides methods comprising administering a composition described herein to a human subject.

[0064] In some embodiments, the composition is administered intramuscularly, optionally in the deltoid region of a human subject.

[0065] In some embodiments, the human subject has previously been administered a SARS-CoV-2 vaccine. In some embodiments, the SARS-CoV-2 vaccine comprises an mRNA vaccine. In some embodiments, the mRNA vaccine comprises an mRNA comprising an ORF encoding a SARS-CoV-2 pre-fusion stabilized S protein. In some embodiments, the SARS-CoV-2 pre-fusion stabilized S protein comprises a first SARS-CoV-2 pre-fusion stabilized S protein. In some embodiments, the human subject has previously been administered at least one dose of a SARS-CoV-2 vaccine. In some embodiments, the human subject has previously been administered two doses of a SARS-CoV-2 vaccine.

[0066] In some embodiments, the method includes administering the composition to the human subject at least 6 months after the most recent administration of a SARS-CoV-2 vaccine.

[0067] In some embodiments, the composition induces neutralizing antibody titers in human subjects. In some embodiments, the percentage of subjects with seroconversion 29 days after a single dose is at least 80%, at least 90%, at least 95%, or 100%. In some embodiments, the percentage of subjects with seroconversion 29 days after a single dose is 100%.

[0068] A further aspect of the present disclosure provides a method comprising administering to a subject a booster vaccine comprising a nucleic acid encoding a first SARS-CoV-2 antigen from a first SARS-CoV-2 virus, wherein the subject has previously received at least one priming dose of a first vaccine comprising a first nucleic acid encoding a SARS-CoV-2 antigen of the first SARS-CoV-2 virus; the booster vaccine is administered in an amount effective to induce a neutralizing immune response to a second SARS-CoV-2 virus, wherein the second SARS-CoV-2 virus comprises a second SARS-CoV-2 antigen, wherein the second SARS-CoV-2 antigen has an amino acid sequence with at least one amino acid mutation compared to the corresponding protein antigen of the first SARS-CoV-2 virus; and the booster vaccine is administered at least 6 months after the first dose of the first vaccine in a dosage of 25-100 μg, wherein the first antigen is a full-length stabilized spike protein with a 2P mutation.

[0069] In some embodiments, the booster vaccine is administered at a dosage of 50 μg.

[0070] In some embodiments, the booster vaccine is administered at least about 6 months after the second dose of the first vaccine. In some embodiments, the booster vaccine is administered 6 to 12 months after the second dose of the first vaccine. In some embodiments, the booster vaccine is administered at least about 8 months after the second dose of the first vaccine.

[0071] In some embodiments, the booster dose is a seasonal boost or a pandemic shift boost to provide a neutralizing immune response against multiple variants of concern.

[0072] In some embodiments, the first vaccine or the second vaccine comprises a nucleic acid encoding a SARS-CoV-2 spike antigen comprising two proline substitutions and a nucleic acid encoding a SARS-CoV-2 spike antigen comprising SEQ ID NO: 33.

[0073] In some embodiments, the first vaccine or the second vaccine comprises a nucleic acid encoding a SARS-CoV-2 spike antigen comprising two proline substitutions and a nucleic acid encoding a SARS-CoV-2 spike antigen comprising SEQ ID NO: 36.

[0074] In some embodiments, the first vaccine or the second vaccine comprises a nucleic acid encoding a SARS-CoV-2 spike antigen comprising two proline substitutions and a nucleic acid encoding a SARS-CoV-2 spike antigen comprising SEQ ID NO:39.

[0075] In some embodiments, the first vaccine or the second vaccine comprises a nucleic acid encoding a SARS-CoV-2 spike antigen comprising two proline substitutions and a nucleic acid encoding a SARS-CoV-2 spike antigen comprising SEQ ID NO: 42. In some embodiments, the vaccine comprises a nucleic acid having at least 95% sequence identity to SEQ ID NO: 40. In some embodiments, the vaccine comprises a nucleic acid comprising SEQ ID NO: 40. In some embodiments, the vaccine comprises a nucleic acid having at least 95% sequence identity to SEQ ID NO: 43. In some embodiments, the vaccine comprises a nucleic acid comprising SEQ ID NO: 43. In some embodiments, the vaccine comprises a nucleic acid having at least 95% sequence identity to SEQ ID NO: 45. In some embodiments, the vaccine comprises a nucleic acid comprising SEQ ID NO: 45. [Brief explanation of the drawings]

[0076] [Figure 1]Panels A-B show neutralization of SARS-CoV-2 pseudovirus by sera from immunized non-human primates (NHPs) or Phase 1 participants. Panel A shows data from sera collected 4 weeks after the boost from rhesus macaques (NHPs) immunized with 30 μg of mRNA encoding the spike protein with two proline substitutions in a prime-boost schedule. Panel B shows data from sera collected 1 week after the boost from Phase 1 participants immunized with 100 μg of mRNA encoding the spike protein with two proline substitutions in a prime-boost schedule. Neutralization was measured by a recombinant VSV-based SARS-CoV-2 pseudovirus neutralization assay incorporating the full-length spike protein of the USA-WA1 / 2020 isolate (D614) or the indicated spike variants (from left to right: D614G, A222V-D614G, S477N-D614G, N439K-D614G, and the mink cluster 5 variant). The horizontal dotted line indicates the lower limit of quantitation (LLOQ). D = D614 of the USA-WA1 / 2020 isolate; G = D614G variant. [Figure 2] A-B show neutralizing antibodies in NHPs against the original (D614), D614G, and spike variants. Rhesus macaques (NHPs) were immunized with 100 or 30 μg of mRNA encoding spike proteins with two proline substitutions using a prime-boost schedule, and serum was collected 4 weeks post-boost. Neutralization was measured by a recombinant VSV-based pseudovirus neutralization assay (A-B). The assay incorporated full-length spike proteins of the original D614 (D), D614G (G), or the indicated spike variants present in the B.1.1.7 (A) or B.1.351 (B) variants. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). D = D614 of the USA-WA1 / 2020 isolate; G = D614G variant. [Figure 3A]

[0023] Figure 1 shows the neutralization curves of NHP samples in a VSV-based pseudovirus neutralization assay. Data are shown from a 100 μg dose of mRNA encoding a spike protein with two proline substitutions. Individual animal numbers from the study are indicated above each graph. G=D614G. [Figure 3B]

[0023] Figure 1 shows the neutralization curves of NHP samples in a VSV-based pseudovirus neutralization assay. Data are shown from a 100 μg dose of mRNA encoding a spike protein with two proline substitutions. Individual animal numbers from the study are indicated above each graph. G=D614G. [Figure 3C]

[0023] Figure 1 shows the neutralization curves of NHP samples in a VSV-based pseudovirus neutralization assay. Data are shown from a 30 μg dose of mRNA encoding a spike protein with two proline substitutions. Individual animal numbers from the study are indicated above each graph. G=D614G. [Figure 4A] Figure 1 shows the results of a neutralization assay against B.1.1.7 and B.1.351 from human serum collected from individuals after administration of mRNA encoding a spike protein with two proline substitutions. Phase 1 participant serum from administration of mRNA encoding a spike protein with two proline substitutions was collected on day 36, 7 days after the booster immunization. Neutralization was measured by a recombinant VSV-based pseudovirus neutralization assay incorporating D614G (G) or the indicated spike mutation present in the B.1.1.7 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). D = D614 USA-WA1 / 2020 isolate, G = D614G variant. [Figure 4B]Figure 1 shows the results of neutralization assays against B.1.1.7 and B.1.351 from human serum collected from individuals after administration of mRNA encoding a spike protein with two proline substitutions. Phase 1 participant serum from administration of mRNA encoding a spike protein with two proline substitutions was collected on day 36, 7 days after the booster immunization. Neutralization was measured by a recombinant VSV-based pseudovirus neutralization assay incorporating the indicated spike mutations present in the D614G (G) or B.1.351 variants. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). D = D614 USA-WA1 / 2020 isolate; G = D614G variant. [Figure 4C] This figure shows the results of neutralization assays against B.1.1.7 and B.1.351 from human sera collected from individuals after administration of mRNA encoding a spike protein with two proline substitutions. Phase 1 participant sera from administration of mRNA encoding a spike protein with two proline substitutions were collected on day 36, 7 days after the booster immunization. Neutralization was measured by a recombinant VSV-based pseudovirus neutralization assay incorporating D614G (G) or the indicated spike mutation present in the B.1.1.7 variant. Results from individual participant sera are represented on each figure as dots with lines connecting the D614G and variant neutralization titers. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). D = D614 USA-WA1 / 2020 isolate; G = D614G variant. [Figure 4D]Neutralization assay results for B.1.1.7 and B.1.351 from human sera collected from individuals after administration of mRNA encoding a spike protein with two proline substitutions are shown. Phase 1 participant sera from administration of mRNA encoding a spike protein with two proline substitutions were collected on day 36, seven days after the booster immunization. Neutralization was measured using a recombinant VSV-based pseudovirus neutralization assay incorporating the D614G (G) or the indicated spike mutation present in the B.1.351 variant. Results from individual participant sera are represented on each panel as dots with lines connecting the D614G and variant neutralization titers. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). D = D614 USA-WA1 / 2020 isolate; G = D614G variant. [Figure 5A] Neutralization curves of human serum samples in a VSV-based pseudovirus neutralization assay. Serum from each clinical trial participant is represented as a separate graph. G=D614G variant. [Figure 5B] Neutralization curves of human serum samples in a VSV-based pseudovirus neutralization assay. Serum from each clinical trial participant is represented as a separate graph. G=D614G variant. [Figure 6] Neutralization titers of mouse serum samples are shown. Serum was from mice receiving 1 μg of mRNA encoding the spike protein with two proline substitutions: G=D614 variant. [Figure 7] Neutralization titers of mouse serum samples are shown. Serum was from mice administered 1 μg of mRNA encoding spike protein with the D614G mutation. G=D614 variant. [Figure 8A] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice 15 days after administration of PBS (negative control) or 10 μg of mRNA encoding the SARS-CoV-2 spike protein. Neutralization titers of serum from mice administered 10 μg of mRNA-1273, encoding a spike protein with two proline substitutions, are shown. [Figure 8B]Neutralization titers of mouse serum samples are shown. Serum was obtained from mice 15 days after administration of PBS (negative control) or 10 μg of mRNA encoding the SARS-CoV-2 spike protein. Neutralization titers of serum from mice administered 10 μg of mRNA-1273.351, encoding the spike protein of the SARS-CoV-2 B.1.351 (RSA) variant, are shown. [Figure 8C] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice 15 days after administration of PBS (negative control) or 10 μg of mRNA encoding the SARS-CoV-2 spike protein. Neutralization titers of serum from mice administered a 1:1 mixture of mRNA-1273 and mRNA-1273.351 (5 μg of each mRNA, 10 μg total mRNA) are shown. [Figure 8D] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice 15 days after administration of PBS (negative control) or 10 μg of mRNA encoding the SARS-CoV-2 spike protein. Neutralization titers of serum obtained from mice administered PBS are shown. [Figure 8E] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice 15 days after administration of PBS (negative control) or 10 μg of mRNA encoding the SARS-CoV-2 spike protein. A comparison of neutralization titers against the B.1.351 and D614G variant spike proteins is shown using serum from mice administered 10 μg of mRNA-1273. [Figure 8F] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice 15 days after administration of PBS (negative control) or 10 μg of mRNA encoding the SARS-CoV-2 spike protein. A comparison of neutralization titers against the B.1.351 and D614G variant spike proteins is shown using serum from mice administered 10 μg of mRNA-1273.351. [Figure 8G]Neutralization titers of mouse serum samples are shown. Serum was obtained from mice 15 days after administration of PBS (negative control) or 10 μg of mRNA encoding the SARS-CoV-2 spike protein. Comparison of neutralization titers against the B.1.351 and D614G variant spike proteins is shown using serum from mice administered a 1:1 mixture of mRNA-1273 and mRNA-1273.351 (5 μg of each mRNA, 10 μg total mRNA). [Figure 9] IgG titers specific for the SARS-CoV-2 spike protein with two proline substitutions are shown. Serum was obtained from mice administered PBS, 1 μg, or 10 μg of mRNA encoding the SARS-CoV-2 spike protein with two proline substitutions (mRNA-1273), the SARS-CoV-2 B.1.351 spike protein (mRNA-1273.351), or a 1:1 mixture of mRNA-1273 and mRNA-1273.351 (0.5 μg or 5 μg of each mRNA, 1 μg or 10 μg of total mRNA). [Figure 10A] This figure shows the ability of serum elicited by mice immunized with mRNA encoding the SARS-CoV-2 spike protein to bind to SARS-CoV-2 antigens. Binding to the SARS-CoV-2 spike protein with two proline substitutions is shown. Serum was obtained from mice administered PBS, 1 μg, or 10 μg of mRNA encoding the SARS-CoV-2 spike protein with two proline substitutions (mRNA-1273), the SARS-CoV-2 B.1.351 spike protein (RSA-full), the SARS-CoV-2 spike protein with two proline substitutions and the D614G mutation (WH202020_NatSP_2P_001_D614G), or a 1:1 mixture of mRNA-1273 and mRNA-1273.351 (0.5 μg or 5 μg of each mRNA, 1 μg or 10 μg of total mRNA). [Figure 10B]This figure shows the ability of serum elicited by mice immunized with mRNA encoding the SARS-CoV-2 spike protein to bind to SARS-CoV-2 antigens. Binding to the SARS-CoV-2 B.1.351 (RSA) variant spike protein with two proline substitutions is shown. Serum was obtained from mice administered PBS, 1 μg, or 10 μg of mRNA encoding the SARS-CoV-2 spike protein with two proline substitutions (mRNA-1273), the SARS-CoV-2 B.1.351 spike protein (RSA-full), the SARS-CoV-2 spike protein with two proline substitutions and the D614G mutation (WH202020_NatSP_2P_001_D614G), or a 1:1 mixture of mRNA-1273 and mRNA-1273.351 (0.5 μg or 5 μg of each mRNA, 1 μg or 10 μg of total mRNA). [Figure 10C] The ability of serum elicited by mice immunized with mRNA encoding the SARS-CoV-2 spike protein to bind to SARS-CoV-2 antigens is shown. Binding to the SARS-CoV-2 N protein is shown. Serum was obtained from mice administered PBS, 1 μg, or 10 μg of mRNA encoding the SARS-CoV-2 spike protein with two proline substitutions (mRNA-1273), the SARS-CoV-2 B.1.351 spike protein (RSA-full), the SARS-CoV-2 spike protein with two proline substitutions and the D614G mutation (WH202020_NatSP_2P_001_D614G), or a 1:1 mixture of mRNA-1273 and mRNA-1273.351 (0.5 μg or 5 μg of each mRNA, 1 μg or 10 μg of total mRNA). [Figure 10D]This figure shows the ability of serum elicited by mice immunized with mRNA encoding the SARS-CoV-2 spike protein to bind to SARS-CoV-2 antigens. Binding to the receptor-binding domain (RBD) of the SARS-CoV-2 B.1.351 (RSA) variant spike protein is shown. Serum was obtained from mice administered PBS, 1 μg, or 10 μg of mRNA encoding the SARS-CoV-2 spike protein with two proline substitutions (mRNA-1273), the SARS-CoV-2 B.1.351 spike protein (RSA-full), the SARS-CoV-2 spike protein with two proline substitutions and the D614G mutation (WH202020_NatSP_2P_001_D614G), or a 1:1 mixture of mRNA-1273 and mRNA-1273.351 (0.5 μg or 5 μg of each mRNA, 1 μg or 10 μg of total mRNA). [Figure 11] Neutralizing antibody titers in mice after one, two, or three doses of vaccination are shown. Balb / c mice were immunized with 1 or 0.1 μg of mRNA-1273 and boosted with 1 or 0.1 μg of mRNA-1273.351 on study day 213. Results from individual mouse sera are represented as dots in each figure, and the lines are the means for each group. The horizontal dotted line indicates the limit of detection (LOD). [Figure 12] Neutralizing antibody titers in mice after one, two, or three doses of vaccination are shown. BALB / c mice were immunized with 1 or 0.1 μg of mRNA-1273 (dose 1 on day 1 and dose 2 on day 22) and boosted with 1 or 0.1 μg of mRNA-1273.351 on day 213. Results from individual mouse sera (n = 5 per group) are represented as dots in each figure, and the lines are the means for each group. The horizontal dotted line indicates the LLOD of the log10 IgG titer at 1.602. [Figure 13A]Neutralizing antibody titers in humans are shown after two doses of 100 μg mRNA-1273 (dose 1 on day 1 and dose 2 on day 22) and a third dose (booster dose) of 50 μg mRNA-1273 6.2–6.7 months after day 1. Neutralization assay titers of serum obtained before administration of the booster dose are shown based on neutralization of VSV pseudoviruses expressing spike proteins with the D614G mutation (left bar), spike proteins with mutations associated with the B.1.351 variant (center bar), and spike proteins with mutations associated with the P.1 variant compared to the wild-type sequence. Geometric mean neutralizing antibody titers are indicated by the top of the bars, and 95% confidence intervals are indicated by the error bars. Day 15 / Day 1 fold increase is shown above the bars. ****=p<0.0001 by Wilcoxon matched-pairs signed-rank test. In all plots, individual participant titers are indicated by circles. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 13B] Neutralizing antibody titers in humans are shown after two doses of 100 μg mRNA-1273 (dose 1 on day 1 and dose 2 on day 22), and a third dose (booster dose) of 50 μg mRNA-1273 6.2 to 6.7 months after day 1. Neutralization assay titers of serum obtained 14 days after administration of the booster dose are shown against the same pseudovirus expressing the same spike protein tested in Figure 13A. Geometric mean neutralizing antibody titers are indicated by the top of the bars, and 95% confidence intervals are indicated by the error bars. Day 15 / Day 1 fold increase is shown above the bars. ****=p<0.0001 by Wilcoxon matched-pairs signed-rank test. In all plots, individual participant titers are indicated by circles. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 13C]Neutralizing antibody titers in humans are shown after two doses of 100 μg mRNA-1273 (dose 1 on day 1 and dose 2 on day 22) and a third dose (booster dose) of 50 μg mRNA-1273 6.2–6.7 months after day 1. Changes in neutralizing antibody titers against a VSV pseudovirus expressing the D614G spike protein are shown from day 1 (before administration of the booster dose) to day 15 (14 days after administration of the booster dose). The fold increase from day 15 to day 1 is indicated above the bars. ****=p<0.0001 by Wilcoxon matched-pairs signed-rank test. Individual participant titers are indicated by circles in all plots. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 13D] Neutralizing antibody titers in humans are shown after two doses of 100 μg mRNA-1273 (dose 1 on day 1 and dose 2 on day 22) and a third dose (booster dose) of 50 μg mRNA-1273 6.2–6.7 months after day 1. Changes in neutralizing antibody titers against a VSV pseudovirus expressing the B.1.351 spike protein are shown from day 1 (before administration of the booster dose) to day 15 (14 days after administration of the booster dose). The fold increase from day 15 to day 1 is indicated above the bars. ****=p<0.0001 by Wilcoxon matched-pairs signed-rank test. In all plots, individual participant titers are indicated by circles. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 13E] Neutralizing antibody titers in humans are shown after two doses of 100 μg mRNA-1273 (dose 1 on day 1 and dose 2 on day 22) and a third dose (booster dose) of 50 μg mRNA-1273 6.2–6.7 months after day 1. Changes in neutralizing antibody titers against a VSV pseudovirus expressing the P.1 spike protein are shown from day 1 (before administration of the booster dose) to day 15 (14 days after administration of the booster dose). The fold increase from day 15 to day 1 is indicated above the bars. ****=p<0.0001 by Wilcoxon matched-pairs signed-rank test. In all plots, individual participant titers are indicated by circles. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 14A]Neutralizing antibody titers in humans are shown after two doses of 100 μg mRNA-1273 (dose 1 on day 1 and dose 2 on day 22) and a third dose (booster dose) of 50 μg mRNA-1273.351 6.2–6.7 months after day 1. Neutralization assay titers of serum obtained before administration of the booster dose are shown based on neutralization of VSV pseudoviruses expressing spike proteins with the D614G mutation (left bar), spike proteins with mutations associated with the B.1.351 variant (center bar), and spike proteins with mutations associated with the P.1 variant compared to the wild-type sequence. Geometric mean neutralizing antibody titers are indicated by the top of the bars, and 95% confidence intervals are indicated by the error bars. Day 15 / Day 1 fold increase is shown above the bars. ****=p<0.0001 by Wilcoxon matched-pairs signed-rank test. In all plots, individual participant titers are indicated by circles. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 14B] Neutralizing antibody titers in humans are shown after two doses of 100 μg mRNA-1273 (dose 1 on day 1 and dose 2 on day 22) and a third dose (booster dose) of 50 μg mRNA-1273.351 6.2–6.7 months after day 1. Neutralization assay titers of serum obtained 14 days after administration of the booster dose are shown against the same pseudovirus expressing the same spike protein tested in Figure 14A. Geometric mean neutralizing antibody titers are indicated by the top of the bars, and 95% confidence intervals are indicated by the error bars. Day 15 / Day 1 fold increase is shown above the bars. ****=p<0.0001 by Wilcoxon matched-pairs signed-rank test. In all plots, individual participant titers are indicated by circles. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 14C]Neutralizing antibody titers in humans are shown after two doses of 100 μg mRNA-1273 (dose 1 on day 1 and dose 2 on day 22) and a third dose (booster dose) of 50 μg mRNA-1273.351 6.2–6.7 months after day 1. Changes in neutralizing antibody titers against a VSV pseudovirus expressing the D614G spike protein are shown from day 1 (before administration of the booster dose) to day 15 (14 days after administration of the booster dose). The fold increase from day 15 to day 1 is indicated above the bars. ****=p<0.0001 by Wilcoxon matched-pairs signed-rank test. In all plots, individual participant titers are indicated by circles. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 14D] Neutralizing antibody titers in humans are shown after two doses of 100 μg mRNA-1273 (dose 1 on day 1 and dose 2 on day 22) and a third dose (booster dose) of 50 μg mRNA-1273.351 6.2–6.7 months after day 1. Changes in neutralizing antibody titers against a VSV pseudovirus expressing the B.1.351 spike protein are shown from day 1 (before administration of the booster dose) to day 15 (14 days after administration of the booster dose). The fold increase from day 15 to day 1 is indicated above the bars. ****=p<0.0001 by Wilcoxon matched-pairs signed-rank test. Individual participant titers are indicated by circles in all plots. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 14E] Neutralizing antibody titers in humans are shown after two doses of 100 μg mRNA-1273 (dose 1 on day 1 and dose 2 on day 22) and a third dose (booster dose) of 50 μg mRNA-1273.351 6.2–6.7 months after day 1. Changes in neutralizing antibody titers from day 1 (before administration of the booster dose) to day 15 (14 days after administration of the booster dose) against a VSV pseudovirus expressing the P.1 spike protein (Figure 14E) are shown. The fold increase from day 15 to day 1 is indicated above the bars. ****=p<0.0001 by Wilcoxon matched-pairs signed-rank test. In all plots, individual participant titers are indicated by circles. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 15A] Neutralizing antibody titers against D614G and B.1.351 SARS-CoV-2 pseudoviruses in serum from human participants who received two doses of mRNA-1273 and were boosted with either a third dose of mRNA-1273 or mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 variant. The figure shows the reduction in neutralizing antibody titers against the B.1.351 spike protein compared to the D614G spike protein in serum obtained before administration of a booster dose containing 50 μg of mRNA-1273. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plot, the geometric mean neutralizing antibody titers shown above the bars are indicated by the top of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 15B] Neutralizing antibody titers against D614G and B.1.351 SARS-CoV-2 pseudoviruses in serum from human participants who received two doses of mRNA-1273 and were boosted with either a third dose of mRNA-1273 or mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 variant. The graph shows the reduction in neutralizing antibody titers against the B.1.351 spike protein compared to the D614G spike protein in serum obtained on day 15 of a booster dose containing 50 μg of mRNA-1273, i.e., 14 days after booster dose administration. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plot, the geometric mean neutralizing antibody titers shown above the bars are indicated by the top of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 15C]Neutralizing antibody titers against D614G and B.1.351 SARS-CoV-2 pseudoviruses in serum from human participants who received two doses of mRNA-1273 and were boosted with either a third dose of mRNA-1273 or mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 variant. The figure shows the reduction in neutralizing antibody titers against the B.1.351 spike protein compared to the D614G spike protein in serum obtained before administration of a booster dose containing 50 μg of mRNA-1273.351. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plot, the geometric mean neutralizing antibody titers shown above the bars are indicated by the top of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 15D] Neutralizing antibody titers against D614G and B.1.351 SARS-CoV-2 pseudoviruses in serum from human participants who received two doses of mRNA-1273 and were boosted with either a third dose of mRNA-1273 or mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 variant. The graph shows the reduction in neutralizing antibody titers against the B.1.351 spike protein compared to the D614G spike protein in serum obtained on day 15 of a booster dose containing 50 μg of mRNA-1273.351, i.e., 14 days after booster dose administration. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plot, the geometric mean neutralizing antibody titers shown above the bars are indicated by the top of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 15E]Neutralizing antibody titers against D614G and B.1.351 SARS-CoV-2 pseudoviruses were measured in serum from human participants who received two doses of mRNA-1273 and were boosted with either a third dose of mRNA-1273 or mRNA-1273.351, which encodes a spike protein with a mutation associated with the B.1.351 variant. Neutralizing antibody titers against a pseudovirus expressing the D614G spike protein (left of dashed line, square) and a panel of pseudoviruses expressing the D614G, B.1.351, or P.1 spike protein are shown 14 days after administration of 50 μg of mRNA-1273 (circles) or 50 μg of mRNA-1273.351 (diamonds) before the booster dose. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 16A] Figure 16C shows neutralizing antibody titers against pseudoviruses expressing variant SARS-CoV-2 spike proteins in sera from human participants who received two 100 μg doses of mRNA-1273 and, optionally, a booster dose of 50 μg of mRNA-1273, 50 μg of mRNA-1273.351 encoding the B.1.351 variant spike protein, or 50 μg of mRNA-1273.211 (a 1:1 mixture of mRNA-1273 and mRNA-1273.351) (Figure 16C). Figure 16D shows neutralizing antibody titers against pseudoviruses expressing the D614G, B.1.617.1-v1, B.1.617.1-v2, or A.VOI-V2 spike proteins. The horizontal bars represent the increase in neutralizing titers against B.1.617.1-v1 after administration of the booster dose compared to sera from subjects who received only two doses of 100 μg of mRNA-1273. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 16B]Figure 16C shows neutralizing antibody titers against pseudoviruses expressing variant SARS-CoV-2 spike proteins in serum from human participants who received two 100 μg doses of mRNA-1273 and, optionally, a booster dose of 50 μg of mRNA-1273, 50 μg of mRNA-1273.351 encoding the B.1.351 variant spike protein, or 50 μg of mRNA-1273.211 (a 1:1 mixture of mRNA-1273 and mRNA-1273.351) (Figure 16C). The relative reduction in neutralization against the B.1.617.1-v1, B.1.617.1-v2, or A.VOI-V2 spike proteins compared to the D614G spike protein is shown. The horizontal bars represent the increase in neutralizing titers against B.1.617.1-v1 after administration of the booster dose compared to sera from subjects who received only two doses of 100 μg of mRNA-1273. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 16C] Neutralizing antibody titers against pseudoviruses expressing variant SARS-CoV-2 spike proteins are shown in serum from human participants who received two doses of 100 μg of mRNA-1273 (Figures 16A-16B) and, optionally, a booster dose of 50 μg of mRNA-1273, 50 μg of mRNA-1273.351 encoding the B.1.351 variant spike protein, or 50 μg of mRNA-1273.211 (a 1:1 mixture of mRNA-1273 and mRNA-1273.351). Neutralization titers against the B.1.617.1-v1 spike protein are shown for sera from human subjects administered two doses of 100 μg of mRNA-1273 (left bar), followed by booster doses of 50 μg of mRNA-1273 (second bar), 50 μg of mRNA-1273.351 (third bar), or 50 μg of mRNA-1273.211 (fourth bar). Horizontal bars represent the increase in neutralization titers against B.1.617.1-v1 after administration of the booster dose compared to sera from subjects who received only two doses of 100 μg of mRNA-1273. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 17A]Neutralizing titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of mRNA-1273 on days 1 (priming dose) and again on day 22 (booster dose). Mice were administered 1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant, on days 213 (third dose) and 234 (fourth dose). Samples were collected on days 212 (before the third dose), 233 (before the fourth dose), and 248 (14 days after the fourth dose). Neutralizing antibody titers at each time point are shown based on neutralization of a pseudovirus containing a SARS-CoV-2 spike protein with the D614G mutation (left bar) or a mutation associated with the South African B.1.351 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 17B] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of mRNA-1273 on day 1 (priming dose) and again on day 22 (booster dose). On days 213 (third dose) and 234 (fourth dose), mice were administered 1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant. Samples were collected on days 212 (before the third dose), 233 (before the fourth dose), and 248 (14 days after the fourth dose). Figure 17A shows the kinetics of neutralization titers from day 212 to day 248 for each spike protein tested. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 17C]Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of mRNA-1273 on days 1 (priming dose) and again on day 22 (booster dose). Mice were administered 1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant, on days 213 (third dose) and 234 (fourth dose). Samples were collected on days 212 (before the third dose), 233 (before the fourth dose), and 248 (14 days after the fourth dose). The relative change in neutralization titer against the B.1.351 spike protein at each time point is shown compared to a spike protein containing only the D614G mutation. In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 17D] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of mRNA-1273 on days 1 (priming dose) and again on day 22 (booster dose). On days 213 (third dose) and 234 (fourth dose), mice were administered 1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant. Samples were collected on days 212 (before administration of the third dose), 233 (before administration of the fourth dose), and 248 (14 days after administration of the fourth dose). Reference neutralization titers against the D614G spike protein are shown for serum on day 36, two weeks after the second dose. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 18A]Neutralizing titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of mRNA-1273 on days 0.1 (priming dose) and again on day 22 (booster dose). Mice were administered 0.1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant, on days 213 (third dose) and 234 (fourth dose). Samples were collected on days 212 (before the third dose), 233 (before the fourth dose), and 248 (14 days after the fourth dose). Neutralizing antibody titers at each time point are shown based on neutralization of a pseudovirus containing a SARS-CoV-2 spike protein with the D614G mutation (left bar) or a mutation associated with the South African B.1.351 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the top of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 18B] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of mRNA-1273 on days 0.1 (priming dose) and again on day 22 (booster dose). On days 213 (third dose) and 234 (fourth dose), mice were administered 0.1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant. Samples were collected on days 212 (before the third dose), 233 (before the fourth dose), and 248 (14 days after the fourth dose). Figure 18A shows the kinetics of neutralization titers from days 212 to 248 for each spike protein tested. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 18C]Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of mRNA-1273 on days 0.1 (priming dose) and again on day 22 (booster dose). Mice were administered 0.1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant, on days 213 (third dose) and 234 (fourth dose). Samples were collected on days 212 (before the third dose), 233 (before the fourth dose), and 248 (14 days after the fourth dose). The relative change in neutralization titer against the B.1.351 spike protein at each time point compared to a spike protein containing only the D614G mutation is shown. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 18D] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of mRNA-1273 on days 0.1 (priming dose) and again on day 22 (booster dose). Mice were administered 0.1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant, on days 213 (third dose) and 234 (fourth dose). Samples were collected on days 212 (before administration of the third dose), 233 (before administration of the fourth dose), and 248 (14 days after administration of the fourth dose). Reference neutralization titers against the D614G spike protein are shown for serum on day 36, two weeks after the second dose. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 19A]Neutralizing titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of mRNA-1273 on days 1 (priming dose) and again on day 22 (booster dose). On days 58 (third dose) and 78 (fourth dose), mice were administered 1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant. Samples were collected on days 57 (before the third dose), 77 (before the fourth dose), and 92 (14 days after the fourth dose). Neutralizing antibody titers at each time point are shown based on neutralization of a pseudovirus containing a SARS-CoV-2 spike protein with the D614G mutation (left bar) or a mutation associated with the South African B.1.351 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 19B] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of mRNA-1273 on day 1 (priming dose) and again on day 22 (booster dose). On days 58 (third dose) and 78 (fourth dose), mice were administered 1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant. Samples were collected on days 57 (before the third dose), 77 (before the fourth dose), and 92 (14 days after the fourth dose). Figure 19A shows the kinetics of neutralization titers from day 57 to day 92 for each spike protein tested. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 19C]Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of mRNA-1273 on days 1 (priming dose) and again on day 22 (booster dose). On days 58 (third dose) and 78 (fourth dose), mice were administered 1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant. Samples were collected on days 57 (before the third dose), 77 (before the fourth dose), and 92 (14 days after the fourth dose). The relative change in neutralization titer against the B.1.351 spike protein at each time point compared to a spike protein containing only the D614G mutation is shown. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 20A] Neutralizing titers of mouse serum samples are shown. Serum was obtained from mice administered 0.1 μg of mRNA-1273 on days 1 (priming dose) and again on day 22 (booster dose). On days 58 (third dose) and 78 (fourth dose), mice were administered 0.1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant. Samples were collected on days 57 (before the third dose), 77 (before the fourth dose), and 92 (14 days after the fourth dose). Neutralizing antibody titers at each time point are shown based on neutralization of a pseudovirus containing a SARS-CoV-2 spike protein with the D614G mutation (left bar) or a mutation associated with the South African B.1.351 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 20B]Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 0.1 μg of mRNA-1273 on day 1 (priming dose) and again on day 22 (booster dose). On days 58 (third dose) and 78 (fourth dose), mice were administered 0.1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant. Samples were collected on days 57 (before administration of the third dose), 77 (before administration of the fourth dose), and 92 (14 days after administration of the fourth dose). Figure 20A shows the kinetics of neutralization titers from day 57 to day 92 for each spike protein tested. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 20C] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 0.1 μg of mRNA-1273 on days 1 (priming dose) and again on day 22 (booster dose). On days 58 (third dose) and 78 (fourth dose), mice were administered 0.1 μg of mRNA-1273.351, encoding a spike protein with a mutation associated with the B.1.351 SARS-CoV-2 variant. Samples were collected on days 57 (before the third dose), 77 (before the fourth dose), and 92 (14 days after the fourth dose). The relative change in neutralization titer against the B.1.351 spike protein at each time point compared to a spike protein containing only the D614G mutation is shown. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 21A]Spike protein-specific IgG and neutralization titers of mouse serum samples are shown. Serum was collected from mice administered 10, 1, or 0.1 μg of mRNA encoding stabilized 2P from wild-type spike protein (mRNA-1273), B.1.351 spike protein (mRNA-1273.351), or B.1.1.7 spike protein (mRNA-1273.117) on day 1 (priming dose) and again on day 22 (second dose). Serum was collected on day 36 (14 days after the second dose). Total IgG specific to wild-type 2P-stabilized SARS-CoV-2 spike protein, as measured by ELISA, is shown. Sera from each group of mice were tested against pseudoviruses containing one of a panel of spike proteins, including: 1) a spike protein with the D614G mutation, 2) a spike protein with a mutation associated with the B.1.351 variant, 3) a spike protein with a mutation associated with the CAL.20C variant, and 4) a spike protein with a mutation associated with the p.1 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the top of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 21B]Spike protein-specific IgG and neutralization titers of mouse serum samples are shown. Serum was collected from mice administered 10, 1, or 0.1 μg of mRNA encoding stabilized 2P from wild-type spike protein (mRNA-1273), B.1.351 spike protein (mRNA-1273.351), or B.1.1.7 spike protein (mRNA-1273.117) on day 1 (priming dose) and again on day 22 (second dose). Serum was collected on day 36 (14 days after the second dose). 1 shows the neutralization titers of serum samples on day 36 from mice administered two doses of 1 μg of mRNA-1273 against pseudoviruses containing one of a panel of spike proteins, including: 1) a spike protein with a D614G mutation, 2) a spike protein with a mutation associated with the B.1.351 variant, 3) a spike protein with a mutation associated with the P.1 variant, 4) a spike protein with a mutation associated with the B.1.1.7 variant, and 5) a spike protein with a mutation associated with the B.1.1.7 variant and an E484K mutation. Serum from each group of mice was tested against pseudoviruses containing one of a panel of spike proteins, including: 1) a spike protein with a D614G mutation, 2) a spike protein with a mutation associated with the B.1.351 variant, 3) a spike protein with a mutation associated with the CAL.20C variant, and 4) a spike protein with a mutation associated with the p.1 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the top of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 21C]Spike protein-specific IgG and neutralization titers of mouse serum samples are shown. Serum was collected from mice administered 10, 1, or 0.1 μg of mRNA encoding stabilized 2P from wild-type spike protein (mRNA-1273), B.1.351 spike protein (mRNA-1273.351), or B.1.1.7 spike protein (mRNA-1273.117) on day 1 (priming dose) and again on day 22 (second dose). Serum was collected on day 36 (14 days after the second dose). Figure 21B shows the relative reduction in serum neutralization titers against each of the viruses tested compared to baseline neutralization titers against the D614G spike protein. Sera from each group of mice were tested against pseudoviruses containing one of a panel of spike proteins, including: 1) a spike protein with the D614G mutation, 2) a spike protein with a mutation associated with the B.1.351 variant, 3) a spike protein with a mutation associated with the CAL.20C variant, and 4) a spike protein with a mutation associated with the p.1 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the top of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 21D]Spike protein-specific IgG and neutralization titers of mouse serum samples are shown. Serum was collected from mice administered 10, 1, or 0.1 μg of mRNA encoding stabilized 2P from wild-type spike protein (mRNA-1273), B.1.351 spike protein (mRNA-1273.351), or B.1.1.7 spike protein (mRNA-1273.117) on day 1 (priming dose) and again on day 22 (second dose). Serum was collected on day 36 (14 days after the second dose). Neutralization titers of serum samples from mice administered two 1 μg doses of mRNA-1273.351 on day 36 against pseudoviruses containing one of a panel of spike proteins, including: 1) a spike protein with a D614G mutation, 2) a spike protein with a mutation associated with the B.1.351 variant, 3) a spike protein with a mutation associated with the P.1 variant, and 4) a spike protein with a mutation associated with the B.1.1.7 variant and an E484K mutation. Serum from each group of mice was tested against pseudoviruses containing one of a panel of spike proteins, including: 1) a spike protein with a D614G mutation, 2) a spike protein with a mutation associated with the B.1.351 variant, 3) a spike protein with a mutation associated with the CAL.20C variant, and 4) a spike protein with a mutation associated with the p.1 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 21E]Spike protein-specific IgG and neutralization titers of mouse serum samples are shown. Serum was collected from mice administered 10, 1, or 0.1 μg of mRNA encoding stabilized 2P from wild-type spike protein (mRNA-1273), B.1.351 spike protein (mRNA-1273.351), or B.1.1.7 spike protein (mRNA-1273.117) on day 1 (priming dose) and again on day 22 (second dose). Serum was collected on day 36 (14 days after the second dose). Figure 21D shows the relative reduction in serum neutralization titers against each of the viruses tested compared to baseline neutralization titers against the D614G spike protein. Sera from each group of mice were tested against pseudoviruses containing one of a panel of spike proteins, including: 1) a spike protein with the D614G mutation, 2) a spike protein with a mutation associated with the B.1.351 variant, 3) a spike protein with a mutation associated with the CAL.20C variant, and 4) a spike protein with a mutation associated with the p.1 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the top of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 21F]Spike protein-specific IgG and neutralization titers of mouse serum samples are shown. Serum was collected from mice administered 10, 1, or 0.1 μg of mRNA encoding stabilized 2P from wild-type spike protein (mRNA-1273), B.1.351 spike protein (mRNA-1273.351), or B.1.1.7 spike protein (mRNA-1273.117) on day 1 (priming dose) and again on day 22 (second dose). Serum was collected on day 36 (14 days after the second dose). 1 shows the neutralization titers of serum samples on day 36 from mice administered two doses of 1 μg of mRNA-1273.117 against pseudoviruses containing one of a panel of spike proteins, including: 1) a spike protein with a D614G mutation, 2) a spike protein with a mutation associated with the B.1.351 variant, 3) a spike protein with a mutation associated with the P.1 variant, 4) a spike protein with a mutation associated with the B.1.1.7 variant, and 5) a spike protein with a mutation associated with the B.1.1.7 variant and an E484K mutation. Serum from each group of mice was tested against pseudoviruses containing one of a panel of spike proteins, including: 1) a spike protein with a D614G mutation, 2) a spike protein with a mutation associated with the B.1.351 variant, 3) a spike protein with a mutation associated with the CAL.20C variant, and 4) a spike protein with a mutation associated with the p.1 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the top of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 21G]Spike protein-specific IgG and neutralization titers of mouse serum samples are shown. Serum was collected from mice administered 10, 1, or 0.1 μg of mRNA encoding stabilized 2P from wild-type spike protein (mRNA-1273), B.1.351 spike protein (mRNA-1273.351), or B.1.1.7 spike protein (mRNA-1273.117) on day 1 (priming dose) and again on day 22 (second dose). Serum was collected on day 36 (14 days after the second dose). Figure 21F shows the relative reduction in serum neutralization titers against each of the viruses tested compared to baseline neutralization titers against the D614G spike protein. Sera from each group of mice were tested against pseudoviruses containing one of a panel of spike proteins, including: 1) a spike protein with the D614G mutation, 2) a spike protein with a mutation associated with the B.1.351 variant, 3) a spike protein with a mutation associated with the CAL.20C variant, and 4) a spike protein with a mutation associated with the p.1 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the top of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 21H]Spike protein-specific IgG and neutralization titers of mouse serum samples are shown. Serum was collected from mice administered 10, 1, or 0.1 μg of mRNA encoding stabilized 2P from wild-type spike protein (mRNA-1273), B.1.351 spike protein (mRNA-1273.351), or B.1.1.7 spike protein (mRNA-1273.117) on day 1 (priming dose) and again on day 22 (second dose). Serum was collected on day 36 (14 days after the second dose). Reference neutralizing antibody titers are shown for mice administered two doses of either mRNA-1273, mRNA-1273.351, or mRNA-1273.211 (0.50 μg each of a 1:1 mixture of mRNA-1273 and mRNA-1273.351) on days 1 and 22, with serum collected on day 36. Serum from each group of mice was tested against a pseudovirus containing one of a panel of spike proteins, including: 1) a spike protein with the D614G mutation, 2) a spike protein with a mutation associated with the B.1.351 variant, 3) a spike protein with a mutation associated with the CAL.20C variant, or 4) a spike protein with a mutation associated with the p.1 variant. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). In the bar plots, the geometric mean neutralizing antibody titers shown above the bars are indicated by the tops of the boxes, and the 95% confidence intervals are indicated by the error bars. [Figure 22] Graph showing elicited neutralizing antibody titers (log10) against a panel of SARS-CoV-2 variants. [Figure 23] Figures A-B show the neutralization titers of serum samples collected from human Phase 1 participants. Figure A shows the neutralization titers of human Phase 1 participant sera against D614G, B.1.617.1-v1, B.1.617.1-v2, and B.1.617.2. Figure B shows the relative reduction in serum neutralization titers against each of the viruses tested in Figure A. [Figure 24A]Neutralization titers are shown for serum samples collected two weeks after the third dose (booster) of vaccine containing mRNA-1273, mRNA-1273.351, or mRNA-1273.211. Serum samples were tested against D614G and variants B.1.351, P.1, B.1.427 / 1.429, B.1.526, A.VOI.V2, B.1.617.1, and B.1.617.2. Neutralization titers are shown. [Figure 24B] Neutralization titers for serum samples collected two weeks after the third dose (booster) of vaccine containing mRNA-1273, mRNA-1273.351, or mRNA-1273.211 were tested against D614G and variants B.1.351, P.1, B.1.427 / 1.429, B.1.526, A.VOI.V2, B.1.617.1, and B.1.617.2. The fold reduction in neutralization titers for the different variants compared to the neutralization titer for the D614G spike protein is shown. [Figure 25A] 1 shows D614 and B.1.351 neutralization data in non-human primates (NHPs) using a lentiviral pseudovirus neutralization assay. A time study of D614G is shown. [Figure 25B]

[0023] Figure 1 shows D614 and B.1.351 neutralization data in non-human primates (NHPs) using a lentiviral pseudovirus neutralization assay.

[0024] Figure 1 shows a time study of B.1.351. [Figure 25C]

[0023] Figure 1 shows D614 and B.1.351 neutralization data in non-human primates (NHPs) using a lentiviral pseudovirus neutralization assay, in which each group was analyzed for neutralizing antibody reduction. [Figure 25D]

[0023] Figure 1 shows D614 and B.1.351 neutralization data in non-human primates (NHPs) using a lentiviral pseudovirus neutralization assay. Each group was analyzed for neutralizing antibody reduction using VSV pseudovirus neutralization. [Figure 25E]

[0023] Figure 1 shows D614 and B.1.351 neutralization data in non-human primates (NHPs) using a lentiviral pseudovirus neutralization assay. Each group was analyzed for neutralizing antibody reduction using live virus neutralization. [Figure 26] A-B show results from the 2020 NHP challenge study after two doses of mRNA-1273 and challenge with USA-WA1 / 20. The graphs show the number of viral genome copies in lung samples (bronchoalveolar lavage, BAL, fluid; A) and from nasal swabs (B). [Figure 27] A-B show results from the 2021 NHP challenge study after two doses of mRNA-1273 and challenge with USA-WA1 / 20. The graphs show the number of viral RNA genome copies in lung samples (bronchoalveolar lavage, BAL, fluid; A) and from nasal swabs (B). [Figure 28] Figures A-B show results from a 2021 NHP challenge study after two doses of mRNA-1273 and challenge with D614G or B.1.351. A shows the reduction in neutralization titers between the two viruses using live virus neutralization. B shows the reduction in neutralization titers between the two viruses using mock virus neutralization. [Figure 29] A-B show results from a 2021 NHP challenge study after two doses of mRNA-1273 and challenge with D614G or B.1.351. The graphs show the number of viral RNA genome copies in lung samples (bronchoalveolar lavage, BAL, fluid; A) and from nasal swabs (B) at two time points. [Figure 30] Figures A-B show results from a 2021 NHP challenge study after two doses of mRNA-1273 and challenge with USA-WA1 / 20. The graphs show the number of viral RNA genome copies from lung samples (bronchoalveolar lavage fluid, BAL, fluid; A) and nasal swabs (B) at three different time points. [Figure 31]A-B show neutralization of recombinant SARS-CoV-2 VSV-based pseudoviruses (D614G, B.1.351, and P.1) by sera from participants 1 month and 6-8 months after the initial series (two doses of mRNA-1273). Geometric mean neutralizing antibody titers are indicated by the top of the boxes, and 95% confidence intervals are shown by brackets. Individual participant titers are indicated by circles. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). [Figure 32] Contains three graphs showing that administration of booster shots increases neutralizing antibody titers against wild-type (D614) and variants of concern (B.1.351 and P.1). Three booster immunization strategies were tested: mRNA-1273, mRNA-1273.351, and mRNA-1273.211. [Figure 33A] Neutralization titers after administration of booster shots are shown. Three different booster strategies were tested: mRNA-1273 (Figure 33A), mRNA-1273.351 (Figure 33B), and mRNA-1273.211 (Figure 33C). The variants of concern / variants of interest investigated were B.1.351, P.1, B.1.427 / B.1.429, B.1.526, A.VOI.V2, B.1.617.1, and B.1.617.2. [Figure 33B] Neutralization titers after administration of booster shots are shown. Three different booster strategies were tested: mRNA-1273 (Figure 33A), mRNA-1273.351 (Figure 33B), and mRNA-1273.211 (Figure 33C). The variants of concern / variants of interest investigated were B.1.351, P.1, B.1.427 / B.1.429, B.1.526, A.VOI.V2, B.1.617.1, and B.1.617.2. [Figure 33C]Neutralization titers after administration of booster shots are shown. Three different booster strategies were tested: mRNA-1273 (Figure 33A), mRNA-1273.351 (Figure 33B), and mRNA-1273.211 (Figure 33C). The variants of concern / variants of interest investigated were B.1.351, P.1, B.1.427 / B.1.429, B.1.526, A.VOI.V2, B.1.617.1, and B.1.617.2. [Figure 34] Cohort comparison between different booster strategies for two variants of concern: B.1.351 and P.1. D614G is shown as a control. [Figure 35] Figures A-B show neutralization of wild-type (A) and B.1.351 (B) lentivirus-based pseudoviruses by participant sera immediately before and after booster administration using clinically validated recombinant lentivirus-based SARS-CoV-2 pseudovirus assays (D614G and B.1.351). Serum was collected immediately before receiving the booster (D1) and on days 15 (D15) and 29 (D29) after booster doses of 50 μg mRNA-1273, 50 or 20 μg mRNA-1273.351, or 50 μg mRNA-1273.211. Geometric mean neutralizing antibody titers with 95% confidence intervals are shown. Individual participant titers are indicated by circles. Fold increases relative to measured titers for samples collected before the boost are shown. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). N = 20 participants per booster cohort. [Figure 36]Panels A–B show correlations between results from a clinically validated pseudoviral assay and a VSV-based pseudoviral assay used in exploratory analyses of SARS-CoV-2 variants. Neutralizing Ab titers from participant sera in a clinically validated recombinant lentivirus-based SARS-CoV-2 pseudoviral assay were correlated with those from a VSV-based SARS-CoV-2 pseudoviral assay used in exploratory analyses of SARS-CoV-2 variants (D614G (A) and B.1.351 (B)). Serum was collected immediately before receiving a booster (D1) and 2 weeks after (D15) a booster dose of 50 μg of mRNA-1273, mRNA-1273.351, or mRNA-1273.211. Individual participant titers are indicated by circles. For the wild-type assay, available Part B (D1) and Part C (D1 and D15) data points were used for correlation analyses. For the B.1.351 assay, available Part C (D1 and D15) data points were used. For correlation analysis of both assays, Spearman non-parametric analysis was performed. [Figure 37A] Figure 37 shows an exploratory analysis of neutralization of wild-type and variant VSV-based pseudoviruses by participant sera. Neutralization of recombinant VSV-based SARS-CoV-2 pseudoviruses (D614G, B.1.351, and P.1) by sera from participants 1 month after a primary series vaccination with 100 μg of mRNA-1273, i.e., immediately before the booster dose, and 2 weeks after a booster dose of 50 μg of mRNA-1273 (Figure 37A), 50 μg of mRNA-1273.351 (Figure 37B), 50 μg of mRNA-1273.211 (Figure 37C), or 20 μg of mRNA-1273.351 (Figure 37D). In each group (as shown in Figure 37C), the groups from left to right are D614G, B.1.351, and P.1. Geometric mean neutralizing antibody titers with 95% confidence intervals are shown. Individual participant titers are indicated by circles. GMT fold change relative to peak titer against wild-type D614G virus after the primary vaccination series is shown. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). N = 20 participants per booster cohort. [Figure 37B]Figure 37 shows an exploratory analysis of neutralization of wild-type and variant VSV-based pseudoviruses by participant sera. Neutralization of recombinant VSV-based SARS-CoV-2 pseudoviruses (D614G, B.1.351, and P.1) by sera from participants 1 month after a primary series vaccination with 100 μg of mRNA-1273, i.e., immediately before the booster dose, and 2 weeks after a booster dose of 50 μg of mRNA-1273 (Figure 37A), 50 μg of mRNA-1273.351 (Figure 37B), 50 μg of mRNA-1273.211 (Figure 37C), or 20 μg of mRNA-1273.351 (Figure 37D). In each group (as shown in Figure 37C), the groups from left to right are D614G, B.1.351, and P.1. Geometric mean neutralizing antibody titers with 95% confidence intervals are shown. Individual participant titers are indicated by circles. GMT fold change relative to peak titer against wild-type D614G virus after the primary vaccination series is shown. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). N = 20 participants per booster cohort. [Figure 37C] Figure 37 shows an exploratory analysis of neutralization of wild-type and variant VSV-based pseudoviruses by participant sera. Neutralization of recombinant VSV-based SARS-CoV-2 pseudoviruses (D614G, B.1.351, and P.1) by sera from participants 1 month after a primary series vaccination with 100 μg of mRNA-1273, i.e., immediately before the booster dose, and 2 weeks after a booster dose of 50 μg of mRNA-1273 (Figure 37A), 50 μg of mRNA-1273.351 (Figure 37B), 50 μg of mRNA-1273.211 (Figure 37C), or 20 μg of mRNA-1273.351 (Figure 37D). In each group (as shown in Figure 37C), the groups from left to right are D614G, B.1.351, and P.1. Geometric mean neutralizing antibody titers with 95% confidence intervals are shown. Individual participant titers are indicated by circles. GMT fold change relative to peak titer against wild-type D614G virus after the primary vaccination series is shown. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). N = 20 participants per booster cohort. [Figure 37D]Figure 37 shows an exploratory analysis of neutralization of wild-type and variant VSV-based pseudoviruses by participant sera. Neutralization of recombinant VSV-based SARS-CoV-2 pseudoviruses (D614G, B.1.351, and P.1) by sera from participants 1 month after a primary series vaccination with 100 μg of mRNA-1273, i.e., immediately before the booster dose, and 2 weeks after a booster dose of 50 μg of mRNA-1273 (Figure 37A), 50 μg of mRNA-1273.351 (Figure 37B), 50 μg of mRNA-1273.211 (Figure 37C), or 20 μg of mRNA-1273.351 (Figure 37D). In each group (as shown in Figure 37C), the groups from left to right are D614G, B.1.351, and P.1. Geometric mean neutralizing antibody titers with 95% confidence intervals are shown. Individual participant titers are indicated by circles. GMT fold change relative to peak titer against wild-type D614G virus after the primary vaccination series is shown. The horizontal dotted line indicates the lower limit of quantitation (LLOQ). N = 20 participants per booster cohort. [Figure 38A]Figure 38A shows the effect of B.1.617 on neutralization, as well as neutralization of wild-type D614G and VOC after booster immunizations relative to peak D614G titers after the primary series. Serum was collected from study participants one month after primary series vaccination with 100 μg of mRNA-1273, immediately prior to the booster dose, and two weeks after the 50 μg booster. Figure 38A shows neutralization of D614G, B.1.617.1, and B.1.617.2 from serum collected from 11 Part B individuals immediately prior to the booster. Serum collected after the primary series or two weeks after boosting with mRNA-1273 (Figure 38B), mRNA-1273.351 (Figure 38C), or mRNA-1273.211 (Figure 38D) was analyzed in the PsVN assay. GMT titers to wild-type or variant virus measured in booster study participants 2 weeks after the booster were evaluated relative to the peak titer measured to wild-type virus after primary series vaccination, and the fold change for each virus is shown. The GMT for each variant virus is listed above each graph. D57 GMT titers are indicated by the gray line. Results from individual participants are represented as points on each figure. N=20 for D614G, B.1.351, and P.1 assays. N=11 for B.1.427 / B.1.429, B.1.526, A.VOI.V2, B.1.617.1, and B.1.617.2; shaded dots indicate these participants. [Figure 38B]Figure 38A shows the effect of B.1.617 on neutralization, as well as neutralization of wild-type D614G and VOC after booster immunizations relative to peak D614G titers after the primary series. Serum was collected from study participants one month after primary series vaccination with 100 μg of mRNA-1273, immediately prior to the booster dose, and two weeks after the 50 μg booster. Figure 38A shows neutralization of D614G, B.1.617.1, and B.1.617.2 from serum collected from 11 Part B individuals immediately prior to the booster. Serum collected after the primary series or two weeks after boosting with mRNA-1273 (Figure 38B), mRNA-1273.351 (Figure 38C), or mRNA-1273.211 (Figure 38D) was analyzed in the PsVN assay. GMT titers to wild-type or variant virus measured in booster study participants 2 weeks after the booster were evaluated relative to the peak titer measured to wild-type virus after primary series vaccination, and the fold change for each virus is shown. The GMT for each variant virus is listed above each graph. D57 GMT titers are indicated by the gray line. Results from individual participants are represented as points on each figure. N=20 for D614G, B.1.351, and P.1 assays. N=11 for B.1.427 / B.1.429, B.1.526, A.VOI.V2, B.1.617.1, and B.1.617.2; shaded dots indicate these participants. [Figure 38C]Figure 38A shows the effect of B.1.617 on neutralization, as well as neutralization of wild-type D614G and VOC after booster immunizations relative to peak D614G titers after the primary series. Serum was collected from study participants one month after primary series vaccination with 100 μg of mRNA-1273, immediately prior to the booster dose, and two weeks after the 50 μg booster. Figure 38A shows neutralization of D614G, B.1.617.1, and B.1.617.2 from serum collected from 11 Part B individuals immediately prior to the booster. Serum collected after the primary series or two weeks after boosting with mRNA-1273 (Figure 38B), mRNA-1273.351 (Figure 38C), or mRNA-1273.211 (Figure 38D) was analyzed in the PsVN assay. GMT titers to wild-type or variant virus measured in booster study participants 2 weeks after the booster were evaluated relative to the peak titer measured to wild-type virus after primary series vaccination, and the fold change for each virus is shown. The GMT for each variant virus is listed above each graph. D57 GMT titers are indicated by the gray line. Results from individual participants are represented as points on each figure. N=20 for D614G, B.1.351, and P.1 assays. N=11 for B.1.427 / B.1.429, B.1.526, A.VOI.V2, B.1.617.1, and B.1.617.2; shaded dots indicate these participants. [Figure 38D]Figure 38A shows the effect of B.1.617 on neutralization, as well as neutralization of wild-type D614G and VOC after booster immunizations relative to peak D614G titers after the primary series. Serum was collected from study participants one month after primary series vaccination with 100 μg of mRNA-1273, immediately prior to the booster dose, and two weeks after the 50 μg booster. Figure 38A shows neutralization of D614G, B.1.617.1, and B.1.617.2 from serum collected from 11 Part B individuals immediately prior to the booster. Serum collected after the primary series or two weeks after boosting with mRNA-1273 (Figure 38B), mRNA-1273.351 (Figure 38C), or mRNA-1273.211 (Figure 38D) was analyzed in the PsVN assay. GMT titers to wild-type or variant virus measured in booster study participants 2 weeks after the booster were evaluated relative to the peak titer measured to wild-type virus after primary series vaccination, and the fold change for each virus is shown. The GMT for each variant virus is listed above each graph. D57 GMT titers are indicated by the gray line. Results from individual participants are represented as points on each figure. N=20 for D614G, B.1.351, and P.1 assays. N=11 for B.1.427 / B.1.429, B.1.526, A.VOI.V2, B.1.617.1, and B.1.617.2; shaded dots indicate these participants. [Figure 39]Panels A-B show post-boost GMT neutralization of wild-type D614G and VOC, relative to the COVE study GMT benchmark. Serum from study participants 2 weeks after a 50 μg boost with mRNA-1273, mRNA-1273.351, or mRNA-1273.211 was analyzed for neutralizing antibodies using a recombinant VSV-based SARS-CoV-2 pseudovirus assay. Panel A shows GMT neutralization titers against wild-type virus (D614G) or variants (B.1.351, P.1, B.1.427 / B.1.429, B.1.526, A.VOI.2, B.1.617.1, B.1.617.2). The GMT for one of the wild-type D614G virus COVE study benchmarks measured at D57 in the pivotal P301mRNA-1273 efficacy study (n=59) is indicated by a black dotted line. B shows the GMT ratio for the phase 3 GMT titer comparator measured at D57 in the pivotal P301mRNA-1273 efficacy study. GMT titers against wild-type or variant virus or variants measured in booster study participants 2 weeks after the booster were evaluated against the peak titer measured against wild-type D614G virus after the initial series vaccination. A GMT of 1 is indicated by a dotted line. N=20 for D614G, B.1.351, and P.1. N=11 for B.1.427 / B.1.429, B.1.526, A.VOI.V2, B.1.617.1, and B.1.617.2. [Figure 40] Graph showing that administration of a booster shot (mRNA-1273, 50 μg) increases neutralizing antibody titers against wild-type (D614) and variants of concern (B.1.351 (beta), P.1 (gamma), and B.1.617.2 (delta)) compared to two time points after the second dose of vaccine. [Figure 41] FIG. 1 is a graph showing neutralizing antibodies elicited by different vaccine formulations in mice before and after administration of a booster (third) vaccine formulation. [Figure 42A]FIG. 1 is a graph showing neutralizing antibodies elicited by different vaccine formulations in mice after two doses of vaccine administered on day 56 (prior to administration of a booster dose). [Figure 42B] FIG. 1 is a graph showing neutralizing antibodies elicited by different vaccine formulations in mice after two doses of vaccine administered on day 56 (prior to administration of a booster dose). [Figure 43A] FIG. 1 is a graph showing neutralizing antibodies elicited by different vaccine formulations in mice at day 77 after administration of two doses of vaccine and a booster dose. [Figure 43B] FIG. 1 is a graph showing neutralizing antibodies elicited by different vaccine formulations in mice at day 77 after administration of two doses of vaccine and a booster dose. [Figure 44A] Graph showing neutralizing antibodies elicited by different vaccine formulations in mice on day 77 after administration of two doses of vaccine and a booster dose. In each group, the three doses administered were of the same vaccine formulation (dosage and antigen-encoding mRNA). [Figure 44B] Graph showing neutralizing antibodies elicited by different vaccine formulations in mice on day 77 after administration of two doses of vaccine and a booster dose. In each group, the three doses administered were of the same vaccine formulation (dosage and antigen-encoding mRNA). DETAILED DESCRIPTION OF THE INVENTION

[0077] Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a newly emerging respiratory virus with high morbidity and mortality. SARS-CoV-2 has spread rapidly worldwide compared to SARS-CoV, which emerged in 2002, and Middle East respiratory syndrome coronavirus (MERS-CoV), which emerged in 2012. According to the World Health Organization (WHO), as of March 2021, the current COVID-19 pandemic has resulted in over 120 million confirmed cases and over 2.65 million deaths worldwide. New cases of COVID-19 infection are increasing and still growing rapidly. Therefore, it is important to develop a variety of safe and effective vaccines and drugs to prevent and treat COVID-19 and reduce its severe impact worldwide. Vaccines and drugs produced using various modalities, as well as vaccines with improved safety and efficacy, are essential. There remains a need to accelerate the advanced design and development of vaccines and therapeutics against coronavirus diseases, particularly coronavirus 2019 (COVID-19).

[0078] On January 7, 2020, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was identified as the causative agent of a novel pneumonia that emerged in Wuhan, Hubei Province, China in December 2019 (Lu H. et al. (2020) J Med Virol. Apr;92(4):401-402.). Shortly thereafter, this virus caused an outbreak in China and spread worldwide. Analysis of the genome structure of SARS-CoV-2 revealed that it belongs to the β-coronavirus (CoV) family (Chan et al. 2020 Emerg Microbes Infect.;9(1):221-236).

[0079] Subsequently, several SARS-CoV-2 variants have emerged and become dominant in specific initial geographic regions. However, some variants that rapidly become dominant in one geographic region can rapidly spread worldwide. These variants are known as variants of concern (VOCs). Since the fall of 2020, two major variants have been identified, including one from the UK (20B / 501Y.V1, VOC202012 / 01, or B.1.1.7 lineage, or alpha variant) and one from South Africa (20C / 501Y.V2, or B.1.351 lineage, or beta variant). Although the two variants emerged separately from each other, they appear to have enhanced transmissibility compared to the USA-WA1 / 2020 isolate. Furthermore, there are concerns that these variants, as well as other circulating strains and any future variants, may further mutate to evade neutralization by existing vaccines and therapeutic modalities such as antibodies. In this way, SARS-CoV-2 variants, and other emerging mutant SARS-CoV-2 strains, are of international health concern.

[0080] The threat of emerging mutant strains of the virus presents significant challenges to vaccine development. The compositions disclosed herein provide significant advances in combating emerging viral strains that pose global health concerns. Disclosed herein are vaccines and vaccination protocols with broad virus-neutralizing capabilities that reduce the threat of infection from two or more viral strains through single or multiple administrations of the same or different combinations of antigens from different strains. For example, vaccination strategies disclosed herein, in some embodiments, include a "primary series" of SARS-CoV-2 2P-stabilized spike protein antigen vaccinations followed by booster immunization(s). The primary series (also referred to herein as the initial, original, or first vaccine vaccination) involves one or more vaccine administrations (e.g., two vaccine administrations) of a SARS-CoV-2 2P-stabilized spike protein antigen from the originally identified SARS-CoV-2 strain. The primary vaccine series can be an mRNA vaccine encoding an antigen having the amino acid sequence of SEQ ID NO: 20. Subsequent booster or booster series vaccines are then administered, for example, immediately after the original vaccine or at a much later time point in the vaccination protocol (e.g., after neutralizing Ab titers have declined or after approval of a new strain vaccine).

[0081] In embodiments disclosed herein, emerging SARS-CoV-2 variant strains are used to design mRNA "boosters" as supplements to previously administered SARS-CoV-2 vaccines, including traditional boosts, seasonal boosts, and pandemic-shift boosts. As used herein, boost refers to any subsequent dose. A traditional boost is a second dose of antigen administered to a subject after a period such as 21-28 days, or even 2 weeks to 6 months. A traditional boost involves administering the same antigen representing the same viral strain to a subject to generate a robust immune response against that viral strain and, optionally, other variant strains.

[0082] During a pandemic or endemic, emerging viral strains may emerge that are less susceptible to effective neutralization by vaccines designed against the original strain. In particular, emerging SARS-CoV-2 viral strains appear to arise through radial evolution, i.e., possess a variety of distinct mutations compared to linear evolution, in which mutations accumulate as the virus evolves. In such instances, a pandemic shift booster may be used to provide immune protection against the emerging viral strain. A pandemic shift booster is a subsequent vaccine administered to a subject after a full course of a first vaccine. A full course of a first vaccine may include one or more administrations of the first vaccine. A pandemic shift booster is comprised of a vaccine containing antigens derived from a variant viral strain that emerged during a pandemic or endemic viral infection. A pandemic shift booster may be administered at any time after administration of the first vaccine. The first vaccine may be a vaccine against the original detected strain of the virus, a combination of the original and variant strain(s) of the virus, or a variant strain of the virus, as long as the pandemic shift booster includes a vaccine against a variant strain of the virus that is different from the first vaccine.

[0083] Additionally, variant strains of SARS-CoV-2 may occasionally emerge outside of a pandemic or endemic situation. These strains may emerge seasonally, for example. Such variant strains can be used to design seasonal SARS-CoV2 vaccines to be delivered as seasonal boosters. A seasonal booster is a subsequent vaccine administered to subjects after a full course of the first vaccine when a variant strain emerges, occurring outside of a pandemic or endemic situation. Viral surveillance methods are used in traditional vaccine design. However, due to the slow development time of traditional vaccines, antigen design decisions are often made far in advance, resulting in vaccines that do not match the circulating viral strains at the time of administration. During development, the virus may mutate or other strains may become more prevalent, reducing the effectiveness of traditional vaccines. Traditional vaccines cannot be adapted because they are already in production, and designing and manufacturing new vaccines would require additional time. In contrast, the mRNA vaccines described herein can overcome these challenges. Because they can be produced within a matter of weeks, they can be designed against coronaviruses circulating closer to the vaccination date. For example, seasonal or annual coronavirus vaccination programs can be developed to rapidly develop coronavirus vaccines in response to the virus strains circulating at the time of vaccination. That is, virus predictions closer to the coronavirus season or other outbreak are likely to be more accurate than predictions made months before the season or outbreak begins; therefore, the mRNA vaccines described herein are more effective because they are designed to target viruses circulating closer to the coronavirus season or scheduled vaccination. Thus, in exemplary embodiments, the vaccines disclosed herein can be designed to combat seasonal coronavirus strains and are therefore vaccines for use in the next or upcoming northern or southern hemisphere season. Based on an understanding of circulating coronaviruses at a given time, vaccines are designed to combat viruses that are predicted to circulate or be prevalent in the next or upcoming viral season.mRNA vaccines can be designed in a matter of days, with a recent vaccine developed by the applicant going from design to manufacturing in just five weeks. Data on which viruses are circulating and their prevalence can be captured and analyzed, bringing the start of vaccination programs, such as seasonal vaccinations, very close.

[0084] A key protein on the surface of coronaviruses, including SARS-CoV-2 and the variants described herein, is the spike (S) protein. A stabilized version of the spike protein has been developed with two proline mutations compared to wild-type SARS-CoV-2, which has the amino acid sequence of SEQ ID NO: 20. The 2P-stabilized spike antigen is a full-length spike protein containing 2P. The vaccination protocols described herein include a variety of vaccines of full-length 2P-stabilized spike proteins from the original SARS-CoV-2 strain and / or emerging variant SARS-CoV-2 strains, each antigen containing the 2P mutation.

[0085] Various mRNA constructs have been designed and are disclosed herein. When mRNA encoding 2P-stabilized versions of spike antigens from emerging variant strains is formulated in an appropriate delivery vehicle, it is possible to induce a strong immune response against SARS-CoV-2, thus producing an effective and potent mRNA vaccine / booster that provides the diversity essential to eradicate the original virus and subsequent strains. Intramuscular administration of mRNA encoding various spike protein antigens, particularly spike protein subunits and domain antigens, within LNPs results in delivery of the mRNA to immune tissues and cells of the immune system, where it is rapidly translated into protein antigens. Other immune cells, such as B cells and T cells, are then able to recognize and mount an immune response against the encoded proteins, ultimately generating a long-lasting protective response against coronaviruses. The drawbacks of protein vaccine development due to poor immunogenicity, insufficient presentation to the immune system, or antigen misfolding are circumvented by the use of highly effective mRNA vaccines encoding spike proteins, subunits, and their domains, as disclosed herein.

[0086] Due to the constantly evolving nature of viruses, scientists are continuously monitoring the viral sequences and strains circulating in humans. These various circulating strains can be used as boosters or individual vaccines, or additionally, to design multivalent mRNA vaccines as disclosed herein. Viral surveillance can be used to provide annual or seasonal (or other scheduled) information to select the exact viral strains to be used as the basis for mRNA vaccines. Once circulating strains are identified, vaccine compositions can be developed based on these strains, targeting two or three (or more) of the most representative viral types in circulation. This practice of adding antigens from new strains to vaccines can be repeated annually or over other time frames as necessary to maintain viral immunity in the population. As used herein, "population" or "target population" refers to a global, regional, or national population. For example, a regional population can refer to a geographically distinct population (e.g., a hemisphere, continent) or region of a country, as some new strains may be more prevalent in certain regions, continents, or countries of the world. In some embodiments, the target population is a national population (e.g., a U.S. population). The mRNA vaccines described herein, in some embodiments, encode multiple antigens from multiple circulating strains within a single lipid nanoparticle (LNP). The mRNA vaccines, in some embodiments, comprise a combination of at least two antigens, each derived from a unique strain of coronavirus.

[0087] Thus, the present disclosure provides compositions (e.g., mRNA vaccines) that induce potent neutralizing antibodies against coronavirus antigens in subjects. Such compositions can be administered to seropositive or seronegative subjects. Seropositive subjects may be naive and may not have antibodies reactive with SARS-CoV-2. Seronegative subjects may have pre-existing antibodies to SARS-CoV-2 because they may have previously been infected with SARS-CoV-2 or previously received a dose of a vaccine (e.g., an mRNA vaccine) that induces antibodies against SARS-CoV-2. In some embodiments, the composition comprises mRNA encoding at least one (e.g., one, two, or more) coronavirus antigens, such as SARS-CoV-2 antigens from different SARS-CoV-2 mutant strains (also referred to herein as variants). In some embodiments, the mRNA vaccine comprises multiple mRNAs encoding SARS-CoV-2 antigens from different variants within a single lipid nanoparticle. In some embodiments, the mRNA vaccine comprises mRNA encoding a SARS-CoV-2 antigen that contains one or more mutations from at least two different SARS-CoV-2 variants (e.g., encoding a combination of mutations and / or deletions found in the B.1.1.7 and 5021.V2 variants).

[0088] At least four groups of SARS-CoV-2 variants are currently of concern due to their increased prevalence, higher hACE2 binding affinity, or reported escape from mAbs and convalescent sera. One exemplary circulating strain of coronavirus (UK) is N501Y-UK or B.1.1.7 (alpha variant), which harbors the following mutations: ΔH69-ΔV70-ΔY144-N501Y-A570D-P681H-T716I-S982A-D1118H. This strain has been observed to spread rapidly through the community. N501Y causes increased binding affinity to hACE2, increasing the likelihood of viral uptake. ΔH69-ΔV70 has been shown to have reduced susceptibility to convalescent sera, and P681H is located directly adjacent to the furin cleavage site.

[0089] Another South African strain, N501Y-SA (B.1.351) (beta variant) with the K417N-E484K-N501Y mutation, has also shown rapid regional spread and higher viral loads in patients. E484K has been shown to reduce susceptibility to convalescent sera. Both N501Y and E484K are located in the receptor binding domain (RBD), and these mutations increase the RBD binding affinity to hACE2.

[0090] An additional strain, P.1 (B1.1.248; 20I / 501Y.V1) (gamma variant), has emerged in Japan from four travelers from Brazil. This variant contains 12 mutations in its spike protein, including N501U and E484K. Additional mutations may affect its ability to be recognized by antibodies, and it is believed to be more transmissible than the wild-type virus (USA-WA1 / 2020 isolate).

[0091] In the Brazilian state of Amazonas, an additional subclade of B.1.1.248 has emerged, raising concerns about reinfection in previously infected individuals. Two subclades of B.1.1.28 have been designated P.2 (another name for B.1.1.28.2) and P.1 (another name for B.1.1.28.1). For clarity, the variant of concern (VOC) is the subclade designated P.1 (another name for B.1.1.28.1), which caused the noted reinfection in a previously infected and recovered woman. Reinfection may be the result of limited or transient immunity induced by the initial infection or may reflect the new strain's superior ability to evade previous immune responses. This new strain contains 12 spike protein mutations, including three in the RBD (K417T, E484K, N501Y) and one new N-glycosylation site at T20N. The S protein mutations include the following 12 mutations: L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I, and V1176F (Naveca et al., SARS-CoV-2 reinfection by the new Variant of Concern (VOC) P.1 in Amazonas, Brazil, 2021). Reinfection caused moderate symptoms similar to those of the initial infection, but higher viral loads were recorded in nasopharyngeal and pharyngeal samples. Reinfection may be the result of the E484K mutation in the spike protein and its ability to promote evasion of SARS-CoV-2 neutralizing antibodies.

[0092] The B.1.429 (also known as CAL.20C or 542R.V1) strain (epsilon variant) was identified at Cedars-Sinai Medical Center in Los Angeles. The variant contains five mutations: I4205V (ORF1a), D1183Y (ORF1b), and S13I, W152C, and L452R (spike protein) (Zhang et al., medRxiv preprint, January 20, 2021). The L452R mutation is located within the RBD and has been found to be resistant to certain monoclonal antibodies against the spike protein.

[0093] In Garmisch-Partenkirchen, Germany, the new variant has been detected in 35 of the 73 new cases. The variant is currently being sequenced and at least one point mutation in the spike protein has been detected.

[0094] Two related variants, both belonging to the B.1.617.1 subclade, have emerged in India. The genome of one B.1.617.1 variant, designated v1 or B.1.617.1v1 (kappa variant), encodes a spike protein with eight substitutions: T95I, G142D, E154K, L452R, E484Q, D614G, P681R, and Q1071H. The genome of the other B.1.617.1 variant, designated v2 or B.1.617.1v2, encodes a spike protein with eight substitutions: G142D, E154K, L452R, E484Q, D614G, P681R, Q1071H, and H1101D.

[0095] Another variant belonging to the B.1.617.2 subclade has also emerged in India. The genome of the B.1.617.2 (delta) variant encodes a spike protein with 10 substitutions: T19R, G142D, E156G, F157, R158, L452R, T478K, D614G, P681R, and D950N, as well as two deletions: F157del and R158del.

[0096] In Angola, a new variant designated A.VOI.V2 with multiple spike protein mutations has been detected through genomic surveillance. The genome of the A.VOI.V2 variant encodes a spike protein with 15 mutations, including 10 substitutions and 5 amino acid deletions: D80Y, ΔY144, ΔI210, D215G, ΔR246, ΔS247, ΔY248, L249M, W258L, R346K, T478R, E484K, H655Y, P681H, and Q957H.

[0097] The variant of interest (VOI), lambda (C.37), was investigated. This variant was first recorded in Peru and is most frequently found in South America. It has a relatively high risk score, primarily due to the variable number of deletions in the N-terminal domain (NTD), possibly due to the RSYLTPGD246-253N mutation, which may increase the ability to evade neutralizing antibodies.

[0098] Another variant of interest (VOI), mu (B.1621), has been reported and was first recorded in Colombia. The variant contains an insertion in the spike protein, 146N, and several amino acid substitutions (Y144T, Y145S, R346K, E484K, N501Y, and P681H).

[0099] Two additional related variants, B.1.243 and B.1.243.1, have been found primarily in North America (Arizona). The B.1.243.1 variant has an additional spike protein mutation (V213G) as well as the E484K mutation, which may make it more resistant to neutralizing antibodies.

[0100] Omicron (B.1.1.529), a variant of concern with multiple spike protein mutations, was first detected in Botswana. Mutations observed in variants include those found in delta variants that are thought to increase transmissibility and mutations, as well as those found in beta and delta variants that are thought to promote immune evasion. In particular, the genome of the Omicron variant encodes a spike protein with the following mutations: A67V, Δ69-70, T95I, G142D / Δ143-145, Δ211 / L212I, ins214EPE, G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493K, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, and L981F.

[0101] These exemplary strains, as well as other emerging strains, are candidates for the methods and formulations disclosed herein. mRNA encoding antigens from these and other coronavirus strains has been designed for use in mRNA vaccines.

[0102] In some embodiments, the mRNA vaccines described herein can be administered as a primary or priming immunization (e.g., the first administration of a coronavirus vaccine to a subject). In some embodiments, the mRNA vaccines described herein can be administered as a booster, i.e., a dose administered after a primary or priming immunization. In some embodiments, the booster and primary or priming immunizations comprise the same mRNA or mRNAs. In other embodiments, the booster and primary or priming immunizations comprise different mRNA or mRNAs. In other embodiments, multiple mRNA vaccines encoding different antigens (each directed against a strain or strains) can be administered together or in parallel to provide a broad neutralization platform against multiple coronavirus strains. mRNA combinations have proven particularly effective in vivo and, quite surprisingly, generate strong immune responses even against variant strains that are not part of the vaccine. For example, administration of a multivalent mRNA vaccine as a booster has been shown to elicit strong and comparable neutralization titers against both variant strains of the virus that were not included in the primary or booster immunization.

[0103] The SARS-CoV-2 genome is a single-stranded, positive-stranded RNA (+ssRNA) encoding approximately 9,860 amino acids, measuring 29.8–30 kb in size (Chan et al. 2000, supra; Kim et al. 2020 Cell, May 14;181(4):914–921.e10). SARS-CoV-2 is a polycistronic mRNA with a 5' cap and a 3' poly(A) tail. The SARS-CoV-2 genome is organized into specific genes encoding structural and nonstructural proteins (NSPS). The order of structural proteins within the genome is 5'-replicase (open reading frame (ORF)1 / ab)-structural proteins [spike (S)-envelope (E)-membrane (M)-nucleocapsid (N)]-3'. The coronavirus genome contains a variable number of open reading frames encoding accessory, nonstructural, and structural proteins (Song et al. 2019 Viruses;11(1):p.59). Most antigenic peptides are located in the structural proteins (Cui et al. 2019 Nat. Rev. Microbiol.;17(3):181-192). The spike surface glycoprotein (S), small envelope protein (E), matrix protein (M), and nucleocapsid protein (N) are the four major structural proteins. The S protein contributes to cell tropism and viral entry and can induce neutralizing antibodies (NAbs) and protective immunity. Therefore, among all other structural proteins, it can be considered one of the most important targets for coronavirus vaccine development. Furthermore, amino acid sequence analysis has shown that the S protein contains conserved regions among coronaviruses, which may serve as the basis for universal vaccine development.

[0104] Compositions, e.g., vaccine compositions, of the present invention feature nucleic acids, particularly mRNAs, designed to encode an antigen of interest, e.g., an antigen derived from a betacoronavirus structural protein, particularly an antigen derived from the SARS-CoV-2 spike protein. Compositions, e.g., vaccine compositions, of the present invention do not themselves comprise an antigen, but rather comprise a nucleic acid, particularly mRNA(s), encoding an antigen or antigen sequence once delivered to a cell, tissue, or subject. Delivery of nucleic acids, particularly mRNA(s), is in turn achieved by formulating the nucleic acid in a suitable carrier or delivery vehicle (e.g., lipid nanoparticles) such that, upon administration to a cell, tissue, or subject, the nucleic acid is taken up by cells that express the protein(s) encoded by the nucleic acid, e.g., mRNA.

[0105] As used herein, an antigen is a protein capable of inducing an immune response (e.g., causing the immune system to produce antibodies against the antigen). The vaccines of the present disclosure offer unique advantages over conventional protein-based vaccination approaches, such as recombinant protein production techniques, in which protein antigens are purified or produced in vitro. The vaccines of the present disclosure feature mRNA encoding a desired antigen, which, when introduced into the body, i.e., administered in vivo to a mammalian subject (e.g., a human), causes the body's cells to express the desired antigen. To facilitate delivery of the mRNA of the present disclosure to body cells, the mRNA is encapsulated in lipid nanoparticles (LNPs). Once delivered and taken up by the body's cells, the mRNA is translated in the cytoplasm, and the protein antigen is produced by the host cell machinery. The protein antigen is presented and elicits adaptive humoral and cellular immune responses. Neutralizing antibodies are directed against the expressed protein antigen; therefore, protein antigens are considered relevant target antigens for vaccine development. As used herein, unless otherwise stated, the use of the term "antigen" encompasses immunogenic proteins and immunogenic fragments (immunogenic fragments that induce (or are capable of inducing) an immune response against (at least one) SARS-CoV-2 variant). It should be understood that the term "protein" encompasses peptides, and the term "antigen" encompasses antigenic fragments. While other molecules may be antigenic, such as bacterial polysaccharides or combinations of protein and polysaccharide structures, for the viral vaccines included herein, viral proteins, fragments of viral proteins, and engineered and / or mutated proteins derived from SARS-CoV-2 are antigens provided herein.

[0106] Many proteins have a quaternary or tertiary structure consisting of two or more or several polypeptide chains that associate into an oligomeric molecule. As used herein, the term "subunit" refers to a single protein molecule, e.g., a polypeptide or polypeptide chain resulting from the processing of a nascent protein molecule, which subunit assembles (or "coassembles") with other protein molecules (e.g., subunits or chains) to form a protein complex. Proteins may have a relatively small number of subunits and thus be described as "oligomers," or may consist of many subunits and thus be described as "multimers." The subunits of an oligomeric or multimeric protein may be identical, homologous, or completely different and dedicated to different tasks.

[0107] A protein or protein subunit may further comprise a domain. As used herein, the term "domain" refers to a distinct functional and / or structural unit within a protein. Typically, a "domain" is involved in a specific function or interaction and contributes to the overall role of the protein. Domains can exist in a variety of biological contexts. Similar domains (i.e., domains that share structural, functional, and / or sequence homology) may exist within a single protein or in separate proteins with similar or different functions. Protein domains are often conserved portions of a particular protein's tertiary structure or sequence and can function and exist independently of the rest of the protein or its subunits.

[0108] In structural and molecular biology, identical, homologous, or similar subunits or domains can help classify newly identified or novel proteins, as was done shortly after the publication of the SARS-CoV-2 viral genome sequence.

[0109] As used herein, the term "antigen" is distinct from the term "epitope," which refers to a substructure of an antigen, e.g., a polypeptide, such as 7-10 amino acids, or a carbohydrate structure, that can be recognized by an antigen-binding site but is insufficient to elicit an immune response. While the art describes protein antigens, e.g., isolated protein, polypeptide, or peptide antigens, delivered to subjects or immune cells in isolated form, designing, testing, validating, and producing protein antigens can be costly and time-consuming, especially when producing proteins on a large scale. In contrast, mRNA technology is amenable to the rapid design and testing of mRNA constructs encoding various antigens. Furthermore, rapid production of mRNA combined with formulation in an appropriate delivery vehicle (e.g., lipid nanoparticles) can proceed rapidly, allowing for the rapid production of mRNA vaccines on a large scale. Potential benefits also arise from the fact that the antigens encoded by the mRNAs of the present invention are expressed by the subject's cells, e.g., the human body, thus allowing the subject, e.g., the human body, to function as a "factory" to produce the antigen, which then elicits the desired immune response.

[0110] The compositions provided herein can include RNA or multiple RNAs encoding two or more antigens of the same or different viral strains. Also provided herein are combination vaccines that include RNA encoding one or more coronavirus antigens and one or more antigen(s) of a different organism. Thus, the vaccines of the present disclosure can be combination vaccines that target one or more antigens of the same strain / species, or one or more antigens of different strains / species, for example, antigens that induce immunity against organisms found in the same geographic area at high risk of coronavirus infection, or organisms to which an individual is likely exposed upon exposure to a coronavirus (e.g., COVID-19).

[0111] In some embodiments, the second or subsequent circulating SARS-CoV-2 virus is an immunodominant antigen from an emerging strain. The immunodominant antigen of the emerging strain is evaluated with respect to the strain from which the antigen is derived, compared to a different strain of the virus, such as the original strain or other variants thereof. The immunodominant antigen of the emerging strain induces a stronger immune response against the emerging strain than against a different strain. In some embodiments, the immunodominant antigen of the emerging strain is more infectious than a different strain of the virus, such as the original strain or other variants thereof.

[0112] Encoded coronavirus spike (S) protein antigen The envelope spike (S) proteins of known betacoronaviruses determine the host tropism and entry of the virus into host cells. Coronavirus spike (S) proteins are antigens of choice for vaccine design because they can induce neutralizing antibodies and protective immunity. The S protein is important for SARS-CoV-2 infection. The composition of the S protein is similar among betacoronaviruses, such as SARS-CoV-2, SARS-CoV, MERS-CoV, HKU1-CoV, MHV-CoV, and NL63-CoV.

[0113] As used herein, the term "spike protein" refers to a homotrimer-forming glycoprotein that protrudes from the envelope (viral surface) of viruses, including betacoronaviruses. The trimerized spike protein binds to receptors on the surface of the host cell and subsequently fuses the viral membrane with the host cell membrane, thereby facilitating virion entry into the host cell. The S protein is a large, highly glycosylated type I transmembrane fusion protein composed of 1,160 to 1,400 amino acids, depending on the virus type. Betacoronavirus spike proteins contain approximately 1,100 to 1,500 amino acids.

[0114] The SARS-CoV-2 spike (S) protein is an antigen of choice for vaccine design because it can induce neutralizing antibodies and protective immunity. The mRNAs of the present invention are designed to produce the SARS-CoV-2 spike protein (i.e., encode the spike protein such that the spike protein is expressed when the mRNA is delivered to a cell or tissue, e.g., a subject's cell or tissue), as well as its antigenic variants. Those skilled in the art will understand that while an essentially full-length or complete spike protein may be necessary for a virus, e.g., a betacoronavirus, to perform its intended function of facilitating viral entry into host cells, some amount of variation in the structure and / or sequence of the spike protein may be tolerated if an immune response is intended to be elicited primarily against the spike protein. For example, slight truncations of, e.g., one to a few, perhaps up to 5 or 10 amino acids, from the N- or C-terminus of the encoded spike protein, e.g., the encoded spike protein antigen, may be tolerated without altering the antigenic properties of the protein. Similarly, one to several, perhaps up to five or up to ten amino acids (or more) of the encoded spike protein, e.g., the encoded spike protein antigen, variations (e.g., conservative substitutions) can be tolerated without altering the antigenic properties of the protein. In some embodiments, the spike protein is a stabilized spike protein, e.g., the spike protein is stabilized by two proline substitutions (2P mutations).

[0115] In some embodiments, the spike proteins are from different viral strains. Strains are genetic variants of microorganisms (e.g., viruses). When two or more viruses infect the same natural cell, new viral strains can be created due to mutation or swapping of genetic components, for example, due to antigenic drift or antigenic shift.

[0116] Antigenic drift is a type of genetic variation in viruses caused by the accumulation of mutations in viral genes that encode viral surface proteins that recognize host antibodies. This results in new strains of virus particles that are not effectively inhibited by the antibodies that prevented infection with previous strains. This makes the altered virus more likely to spread throughout partially immune populations.

[0117] Antigenic shift is the process by which two or more different strains of a virus, or two or more different strains of a virus, combine to form a new subtype with a mixture of surface antigens from two or more original strains. The term is often applied specifically to influenza, as it is the most well-known example, but this process is known to occur with other viruses as well. Antigenic shift is a specific instance of reassortment or viral shift, which confers phenotypic change. Antigenic shift contrasts with antigenic drift, which is the natural mutation of known strains of a virus over time, which can result in loss of immunity or vaccine mismatch. Antigenic shift is often associated with large-scale rearrangement of viral surface antigens, resulting in reassortment that significantly alters the viral phenotype.

[0118] As used herein, a viral strain refers to a genetic variant or virus characterized by different isoforms of one or more surface proteins of the virus. For example, in the case of SARS-CoV-2, this refers to a different amino acid sequence in the SARS-CoV-2 spike protein, which occurs when the immune response in an individual to the new strain is less effective than the strain used to immunize or initially infect the individual. New viral strains can arise from natural mutations, or a combination of natural mutations and immune selection, resulting from a continuing immune response in immunized or previously infected individuals. New viral strains can differ by one, two, three, or more amino acid mutations in regions of the spike protein responsible for viral functions such as receptor binding or viral fusion with target cells. The spike protein from a new strain can differ from the parent strain by 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity at the amino acid level.

[0119] A natural virus strain is a recognizable variant of a given virus because it possesses some "unique phenotypic characteristics" that remain stable under natural conditions (e.g., biological, serological, and / or molecular characteristics that are stable and heritable). Such "unique phenotypic characteristics" are biological properties that differ from the reference virus to which it is compared, such as unique antigenic characteristics, host range (e.g., infecting different types of hosts), disease symptoms caused by the strain, or different types of disease caused by the strain (e.g., transmitted by different means). "Unique phenotypic characteristics" can be detected clinically (e.g., clinical symptoms detected in hosts infected with the strain) or within comparative animal experiments, allowing a researcher skilled in the field of virology to distinguish between animals infected with a reference control virus and animals suspected of being infected with a new strain without knowing which animals received which virus and without having information about the differences between the two viruses. Importantly, virus variants with simple differences in genome sequence are not separate strains if they lack a recognizably distinct viral phenotype. The degree of variation in the genomic sequence is irrelevant to the classification of a variant as a strain, as distinct phenotypes can arise from small numbers of mutations.

[0120] By way of example, in some embodiments, the mRNA encodes an antigen from at least one virus strain variant or includes mutations from at least one virus strain that is not wild-type SARS-CoV-2. In some embodiments, the vaccine includes mRNA encoding a spike protein associated with the B.1.1.7 lineage (UK) variant (20B / 501Y.V1 VOC 202012 / 01). The B.1.1.7 lineage variant has a mutation in the receptor-binding domain (RBD) of the spike protein at position 501, an N501Y mutation in which the amino acid asparagine (N) is replaced with a tyrosine (Y). Additionally, the variant has a spontaneously occurring recurrent 69 / 70 deletion, resulting in a conformational change in the spike protein, a P681H mutation near the S1 / S2 furin cleavage site, and an ORF8 stop codon (Q27 stop) caused by a mutation in ORF8. The 501.V2 (South Africa, SA) variant contains multiple mutations in the spike protein, including N501Y and E484K, but does not have a 69 / 70 deletion. The E484K mutation is considered an "escape" mutation compared to at least one form of monoclonal antibody against SARS-CoV-2 and may therefore alter the antigenicity of the virus. Other mutations discovered include the D614G mutation, which is thought to increase the speed of viral transmission, and the N543Y mutation (which emerged on mink farms in the Netherlands and Denmark). In some embodiments, the spike protein contains mutations from more than one variant (e.g., a combination of mutations found in the B.1.1.7 and 502Y.V2 variants). Table 2 below provides examples of spike protein mutations in SARS-CoV-2 variants. [Table 1]

[0121] In exemplary embodiments, the spike protein, e.g., the encoded spike protein antigen, has an amino acid sequence set forth in any one of SEQ ID NOs: 5, 8, 11, 14, 17, 23, 26, 30, 33, 36, 39, and 42. In other embodiments, the spike protein, e.g., the encoded spike protein antigen, has no more than 100, no more than 90, no more than 80, no more than 70, no more than 60, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10, or no more than 5 amino acid substitutions and / or deletions compared to (aligned with) a spike protein having an amino acid sequence set forth in any one of SEQ ID NOs: 5, 8, 11, 14, 17, 23, 26, 30, 33, 36, 39, and 42. Where slight variations occur in the encoded spike protein sequence, the variant preferably has the same activity and / or the same immunospecificity as the reference spike protein sequence, for example, as determined by an immunoassay (e.g., an enzyme-linked immunosorbent assay (ELISA assay)).

[0122] The coronavirus S protein can be divided into two key functional subunits: the N-terminal S1 subunit, which forms the globular head of the S protein, and the C-terminal S2 region, which forms the protein stalk and is directly embedded in the viral envelope. Upon interaction with a potential host cell, the S1 subunit recognizes and binds to receptors on the host cell, particularly the angiotensin-converting enzyme 2 (ACE2) receptor, while the S2 subunit, the most conserved component of the S protein, is responsible for fusing the viral envelope with the host cell membrane. (See, for example, Shang et al., PLoS Pathog. 2020 Mar;16(3):e1008392.) Each monomer of the trimeric S protein trimer contains two subunits, S1 and S2, which mediate attachment and membrane fusion, respectively. As part of the in vivo infection process, the two subunits are separated from each other by an enzymatic cleavage process. The S protein is initially cleaved by furin-mediated cleavage at the S1 / S2 site in infected cells. In vivo, a subsequent serine protease-mediated cleavage event occurs at the S2' site within S1. In SARS-CoV2, the S1 / S2 cleavage site is at amino acid 676 [ka] ~688 (SEQ ID NO:47). The S2' cleavage site is at amino acids 811-KPSKR / SFI-818 (SEQ ID NO:48).

[0123] As used herein, for example, in the context of designing a SARS-CoV-2 S protein antigen encoded by a nucleic acid, e.g., mRNA, of the invention, the term "S1 subunit" (e.g., S1 subunit antigen) refers to the N-terminal subunit of the spike protein that begins at the N-terminus of the S protein and ends at the S1 / S2 cleavage site, while the term "S2 subunit" (e.g., S2 subunit antigen) refers to the C-terminal subunit of the spike protein that begins at the S1 / S2 cleavage site and ends at the C-terminus of the spike protein. As noted above, those skilled in the art will understand that while essentially the full-length or complete spike protein S1 or S2 subunit is required for receptor binding or membrane fusion, respectively, some variation in the structure and / or sequence of S1 or S2 is permissible when seeking to primarily elicit an immune response against the spike protein subunit. For example, minor truncations, e.g., one to several, perhaps up to 4, 5, 6, 7, 8, 9, or 10 amino acids, from the N- or C-terminus of an encoded subunit, e.g., the encoded S1 or S2 protein antigen, can be tolerated without altering the antigenic properties of the protein. Similarly, variations (e.g., conservative substitutions) of one to several, perhaps up to 4, 5, 6, 7, 8, 9, or 10 amino acids (or more) in an encoded spike protein subunit, e.g., the encoded S1 or S2 protein antigen, can be tolerated without altering the antigenic properties of the protein(s). In exemplary embodiments, the spike protein, e.g., the encoded spike protein antigen, has the amino acid sequence set forth in any one of SEQ ID NOs: 5, 8, 11, 14, 17, 20, 23, 26, 29, 30, 32, 33, 36, 39, and 42.

[0124] In some embodiments, the mRNA vaccine encodes an antigen that has at least one of the following mutations compared to the USA-WA1 / 2020 isolate: E484K, D614G, K417N, N501Y, L18F, D80A, D215G, R246I, A701V, A570D, P861H, T716I, S982A, D1118H. In some embodiments, the mRNA vaccine encodes an antigen that has at least one of the following mutations compared to the SARS-CoV-2S protein of SEQ ID NO: 20 (WT 2P mutated version): E484K, D614G, K417N, N501Y, L18F, D80A, D215G, R246I, A701V, A570D, P861H, T716I, S982A, D1118H. In some embodiments, the mRNA encodes an antigen with 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or all 14 of the listed mutations. In some embodiments, the mRNA encodes an antigen with one or more deletions compared to the SARS-CoV-2S protein of SEQ ID NO: 20. Exemplary deletions include, but are not limited to, positions 69, 70, 144, and 242-244. In some embodiments, the mRNA encodes an antigen with 1, 2, 3, 4, 5, or 6 deletions. In some embodiments, the mRNA encoding the antigen has 1, 2, 3, 4, 5, or 6 deletions and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 mutations, or any combination thereof.

[0125] In some embodiments, the mRNA vaccine comprises one, two, three, four, five, or six mRNAs encoding different antigens, each antigen comprising at least one mutation and / or at least one deletion. In some embodiments, the mRNA vaccine further comprises an mRNA encoding a wild-type SARS-CoV-2 S protein antigen or an antigenic fragment thereof. The mRNA vaccine, in some embodiments, is within a lipid nanoparticle (i.e., the lipid nanoparticle comprises one, two, three, four, five, or six mRNAs encoding different antigens).

[0126] In some aspects, compositions of the present disclosure include at least a first mRNA encoding a first SARS-CoV-2 spike antigen of a first SARS-CoV-2 virus, wherein the first SARS-CoV-2 spike antigen has an amino acid sequence of SEQ ID NO:20 or an amino acid sequence having at least one amino acid mutation, deletion, or both an amino acid mutation and deletion compared to the protein of SEQ ID NO:20; and a second mRNA encoding a second SARS-CoV-2 spike antigen of a second SARS-CoV-2 virus, wherein the second SARS-CoV-2 spike antigen has an amino acid sequence having at least one amino acid mutation, deletion, or both an amino acid mutation and deletion compared to the protein of SEQ ID NO:20. In some embodiments, the first SARS-CoV-2 virus is a first circulating SARS-CoV-2 virus. In some embodiments, the second SARS-CoV-2 virus is a second circulating SARS-CoV-2 virus. In some embodiments, the first and second mRNAs are present in the composition in a ratio of 1:1, 1:2, 1:3, or 1:4. In other embodiments, the first and second mRNAs are present in the composition in a ratio of 2:1, 3:1, or 4:1. In some embodiments, the first and second mRNAs are present in the composition in a ratio of 1:1. In one embodiment, the first mRNA encodes SEQ ID NO:20 (the 2P mutated version of WT) and the second mRNA encodes SEQ ID NO:11 (mRNA-1273.351, WH2020_NatSP_2P_L18F_D80A_D215G_L242_244del_R246I_K417N_E484K_N501Y_D614G_A701V). In one embodiment, the first mRNA encodes SEQ ID NO: 20 (the 2P mutated version of WT) and the second mRNA encodes SEQ ID NO: 26 (S2P_IN_B.1.617.2, now known as the delta variant, which contains the following mutations: T19R, G142D, E156G, F157del, R158del, L452R, T478K, D614G, P681R, and D950N).In one embodiment, the first mRNA encodes SEQ ID NO:20 (a 2P-mutated version of WT), and the second mRNA encodes SEQ ID NO:30 (S2P_IN_B.1.617.2, containing the following mutations: T19R, T95I, G142D, E156G, F157del, R158del, L452R, T478K, D614G, P681R, D950N). "Circulating virus," as used herein, refers to a virus that has been circulating for 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, part of a year, 1 year, 1.5 years, 2 years, 3 years, or more.

[0127] In some embodiments, the composition further comprises a third mRNA encoding a third SARS-CoV-2 spike antigen of a third SARS-CoV-2 virus, wherein the third SARS-CoV-2 spike antigen has an amino acid sequence having at least one amino acid mutation compared to the protein sequence of SEQ ID NO:20.

[0128] In some embodiments, the composition further comprises a fourth mRNA encoding a fourth SARS-CoV-2 spike antigen of a fourth SARS-CoV-2 virus, wherein the fourth SARS-CoV-2 spike antigen has an amino acid sequence having at least one amino acid mutation compared to the protein of SEQ ID NO:20.

[0129] In some embodiments, the composition further comprises a fifth mRNA encoding a fifth SARS-CoV-2 spike antigen of a fifth SARS-CoV-2 virus, wherein the fifth SARS-CoV-2 spike antigen has an amino acid sequence having at least one amino acid mutation compared to the protein of SEQ ID NO:20.

[0130] In some embodiments, the composition further comprises a sixth mRNA encoding a sixth SARS-CoV-2 spike antigen of a sixth SARS-CoV-2 virus, wherein the sixth SARS-CoV-2 spike antigen has an amino acid sequence having at least one amino acid mutation compared to the protein of SEQ ID NO:20.

[0131] In some embodiments, the first and second antigens are antigens of the spike protein, hi some embodiments, the third, fourth, fifth, and / or sixth antigens are antigens of the spike protein.

[0132] In some embodiments, the mRNAs are present in equal amounts in the composition (e.g., a 1:1 weight / weight ratio or a 1:1 molar ratio), e.g., mRNAs encoding distinct coronavirus antigens are present in a 1:1 (1:1:1:1:1) ratio. As used herein, "weight / weight ratio," or weight / weight ratio (wt / wt ratio), or weight:weight ratio (wt:wt ratio) refers to the ratio between the weights (masses) of different components. "Molar ratio" refers to the ratio between different components (e.g., the number of mRNAs encoding each antigen). In some embodiments, the ratio is 1:1, 1:2, 1:3, 1:4, 2:1, 3:1, or 4:1. In each embodiment or aspect of the present invention, it is understood that the featured vaccine comprises mRNA encapsulated within the LNP. While it is possible to encapsulate each unique mRNA in its own LNP, mRNA vaccine technology enjoys a significant technical advantage in that it is possible to encapsulate several mRNAs in a single LNP product. In other embodiments, the vaccines are not co-formulated, but are separate vaccines that may be mixed separately prior to administration or simply administered separately.

[0133] Exemplary sequences of coronavirus antigens and RNA encoding coronavirus antigens (e.g., SARS-CoV-2 variant antigens) of the compositions of the disclosure are provided in Table 1. In some embodiments, the mRNA vaccine comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to a sequence selected from SEQ ID NOs: 1, 6, 9, 12, 15, 21, 24, 28, 31, 34, 37, 40, 43, and 45. In some embodiments, the mRNA vaccine encodes a polypeptide that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or identical to a sequence selected from SEQ ID NOs: 5, 8, 11, 14, 17, 23, 26, 30, 33, 36, 39, and 42.

[0134] nucleic acid The compositions of the present disclosure include (at least one) messenger RNA (mRNA) having an open reading frame (ORF) encoding a coronavirus antigen. In some embodiments, the mRNA further comprises a 5' UTR, a 3' UTR, a poly(A) tail, and / or a 5' cap analog.

[0135] It should also be understood that the coronavirus vaccines of the present disclosure can include any five 'untranslated regions (UTRs) and / or any three 'UTRs.' Exemplary UTR sequences include SEQ ID NOs: 2, 4, 50, and 51; however, other UTR sequences can be used or substituted for any of the UTR sequences described herein. In some embodiments, a 5'UTR of the present disclosure comprises a sequence selected from SEQ ID NO: 50 (GGGAAAUA AGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) and SEQ ID NO: 2 (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC). In some embodiments, a 3' UTR of the present disclosure comprises a sequence selected from SEQ ID NO: 51 (UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUU CUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) and SEQ ID NO: 4 (UGAUAA UAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC). UTRs can also be omitted from the RNA polynucleotides provided herein.

[0136] Nucleic acids include polymers of nucleotides (nucleotide monomers). Therefore, nucleic acids are also referred to as polynucleotides. Nucleic acids can be or include, for example, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA, LNA with β-D-ribonucleotide structure, α-LNA with α-L-ribonucleotide structure (diastereomer of LNA), 2'-amino-LNA with 2'-amino functionalization, and 2'-amino-α-LNA with 2'-amino functionalization), ethylene nucleic acid (ENA), cyclohexenyl nucleic acid (CeNA), and / or chimeras, and / or combinations thereof.

[0137] "Messenger RNA" (mRNA) refers to any RNA that encodes (at least one) protein (naturally occurring, non-naturally occurring, or modified polymer of amino acids), which can be translated to produce the encoded polypeptide in vitro, in vivo, in situ, or ex vivo. Those of skill in the art will understand that, unless otherwise specified, the nucleic acid sequences set forth in this application may list a "T" in a representative DNA sequence, but when the sequence represents mRNA, the "T" is replaced with a "U." Thus, any DNA disclosed and identified herein by a specific sequence identification number also discloses the corresponding mRNA sequence complementary to that DNA, in which each "T" in the DNA sequence is replaced with a "U."

[0138] An open reading frame (ORF) is a continuous stretch of DNA or RNA that begins with a start codon (e.g., methionine (ATG or AUG)) and ends with a stop codon (e.g., TAA, TAG, or TGA, or UAA, UAG, or UGA). ORFs typically encode proteins. The sequences disclosed herein may further include additional elements, e.g., 5' and 3' UTRs, although it will be understood that these elements, unlike ORFs, need not necessarily be present in the RNA polynucleotides of the present disclosure.

[0139] variant In some embodiments, the compositions of the present disclosure comprise RNA encoding a SARS-CoV-2 antigenic variant. An antigenic variant or other polypeptide variant refers to a molecule whose amino acid sequence differs from that of a wild-type, native, or reference sequence. An antigenic / polypeptide variant may have substitutions, deletions, and / or insertions at specific positions within the amino acid sequence compared to the native or reference sequence. Examples of SARS-CoV-2 antigenic variants are provided in Table 1. Typically, a variant has at least 50% identity to the wild-type, native, or reference sequence. In some embodiments, a variant shares at least 90% identity to the wild-type, native, or reference sequence. In some embodiments, the nucleic acid vaccines described herein encode SARS-CoV-2 variants that contain one, two, three, four, or more mutations compared to a reference sequence. In some embodiments, the nucleic acid vaccines described herein encode SARS-CoV-2 variants that contain fewer than 20, 18, 15, 12, or 10 mutations compared to a reference sequence. In some embodiments, the nucleic acid vaccines described herein encode SARS-CoV-2 variants having 1-50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 10-50, 10-40, 10-30, 10-25, 10-20, 10-15, 20-50, 20-40, 20-30, 20-25, 25-50, 25-40, 25-30, 30-50, 30-40, or 40-50 mutations (e.g., substitutions). As used herein, "mutation" refers to an amino acid substitution, insertion, or deletion. A reference sequence refers to a naturally occurring strain, e.g., a naturally occurring circulating strain of SARS-CoV-2.

[0140] Variant antigens / polypeptides encoded by the nucleic acids of the present disclosure can contain amino acid changes that confer any of a number of desirable properties, for example, improving their immunogenicity, improving their expression, and / or improving their stability or PK / PD properties in a subject. Variant antigens / polypeptides can be generated using conventional mutagenesis techniques and appropriately assayed to assess whether they possess the desired properties. Assays for determining expression levels and immunogenicity are well known in the art, and exemplary such assays are described in the Examples section. Similarly, the PK / PD properties of protein variants can be measured using art-recognized techniques, for example, by assessing antigen expression over time in vaccinated subjects and / or by confirming the durability of the induced immune response. The stability of the protein(s) encoded by the variant nucleic acids can be measured by analyzing their thermal stability or stability upon urea denaturation, or can be measured using in silico predictions. Methods for such experiments and in silico evaluations are known in the art.

[0141] In some embodiments, the composition comprises an RNA or RNA ORF that comprises the nucleotide sequence of any one of the sequences provided herein, or that comprises a nucleotide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleotide sequence of any one of the sequences provided herein.

[0142] The term "identity" refers to the relationship between two or more polypeptide (e.g., antigen) or polynucleotide (nucleic acid) sequences, as determined by comparing the sequences. Identity also refers to the degree of sequence relatedness between sequences and is determined by the number of matches between two or more strings of amino acid or nucleic acid residues. Identity measures the percent of identical matches between the smaller of two or more sequences with gap alignment (if any) addressed by a particular mathematical model or computer program (e.g., "algorithm"). The identity of related antigens or nucleic acids can be readily calculated by known methods. "Percent identity (%)" as applied to a polypeptide or polynucleotide sequence is defined as the percentage of residues (amino acid residues or nucleic acid residues) in a candidate amino acid or nucleic acid sequence that are identical to the residues in the amino acid or nucleic acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Methods and computer programs for alignment are well known in the art. It is understood that identity depends on the calculation of percent identity, but may have different values ​​depending on gaps and penalties introduced into the calculation. Generally, variants of a particular polynucleotide or polypeptide (e.g., antigen) have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, but less than 100% sequence identity to that of a particular reference polynucleotide or polypeptide, as determined by sequence alignment programs and parameters described herein and known to those of skill in the art. Such alignment tools include the BLAST suite of tools (Stephen F. Altschul, et al. (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs," Nucleic Acids Res. 25:3389-3402).Another popular local alignment technique is the Smith-Waterman algorithm (see Smith, T. F. & Waterman, M. S. (1981) "Identification of common molecular subsequences." J. Mol. Biol. 147:195-197). A general global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (see Needleman, S. B. & Wunsch, C. D. (1970) "A general method applicable to the search for similarities in the amino acid sequences of two proteins." J. Mol. Biol. 48:443-453). More recently, the Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed, which is said to generate global alignments of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm.

[0143] Thus, polynucleotides encoding peptides or polypeptides containing substitutions, insertions and / or additions, deletions, and covalent modifications compared to a reference sequence, particularly the polypeptide (antigen) sequences disclosed herein, are within the scope of this disclosure. For example, sequence tags or amino acids, such as one or more lysines, can be added to a peptide sequence (e.g., at the N- or C-terminus). Sequence tags can be used for peptide detection, purification, or localization. Lysines can be used to increase peptide solubility or enable biotinylation. Alternatively, amino acid residues located in the carboxy- and amino-terminal regions of a peptide or protein amino acid sequence can be optionally deleted to result in a truncated sequence. Certain amino acids (e.g., C- or N-terminal residues) can alternatively be deleted depending on the use of the sequence, for example, expression of the sequence as part of a larger sequence that is soluble or linked to a solid support. In some embodiments, sequences for (or encoding) signal sequences, termination sequences, transmembrane domains, linkers, multimerization domains (e.g., fold-on regions), etc. can be replaced with alternative sequences that achieve the same or similar functions. In some embodiments, cavities within the protein core may be filled, for example, by introducing larger amino acids, to improve stability. In other embodiments, buried hydrogen bond networks may be replaced with hydrophobic residues to improve stability. In still other embodiments, glycosylation sites may be removed and replaced with appropriate residues. Such sequences are readily identifiable by those skilled in the art. It should also be understood that some of the sequences provided herein contain sequence tags or terminal peptide sequences (e.g., at the N- or C-terminus) that may be deleted, for example, before use in preparing mRNA vaccines.

[0144] As will be appreciated by those skilled in the art, protein fragments, functional protein domains, and homologous proteins are also considered within the scope of coronavirus antigens of interest. For example, provided herein is any protein fragment (meaning a polypeptide sequence at least one amino acid residue shorter than the reference antigen sequence but otherwise identical) of a reference protein, provided that it is immunogenic and confers a protective immune response against coronavirus. In addition to truncated variants identical to the reference protein, in some embodiments, the antigen contains 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations relative to any of the sequences provided or referenced herein. The length of the antigen / antigen polypeptide can range from about 4, 6, or 8 amino acids to the full-length protein.

[0145] Stabilizing Element Natural eukaryotic mRNA molecules may contain stabilizing elements, including, but not limited to, untranslated regions (UTRs) at their 5'-end (5'UTR) and / or 3'-end (3'UTR), in addition to other structural features such as a 5'-cap structure or a 3'-poly(A) tail, both of which are typically transcribed from genomic DNA and are elements of the premature mRNA. Structural features characteristic of mature mRNAs, such as the 5'-cap and 3'-poly(A) tail, are usually added to the transcribed (premature) mRNA during mRNA processing.

[0146] In some embodiments, the composition comprises an RNA polynucleotide having an open reading frame encoding at least one antigen polypeptide with at least one modification, at least one 5'-terminal cap, and is formulated within a lipid nanoparticle. 5'-capping of the polynucleotide can be completed simultaneously during the in vitro transcription reaction using the following chemical RNA cap analogs to generate a 5'-guanosine cap structure according to the manufacturer's protocol: 3'-O-Me-m7G(5')ppp(5')G [ARCA cap], G(5')ppp(5')A, G(5')ppp(5')G, m7G(5')ppp(5')A, m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). 5'-capping of modified RNAs can also be completed post-transcriptionally using vaccinia virus capping enzyme to generate the "Cap 0" structure: m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). The Cap 1 structure may be generated using both vaccinia virus capping enzyme and a 2'-O-methyltransferase to generate m7G(5')ppp(5')G-2'-O-methyl. The Cap 2 structure can be generated from the Cap 1 structure by 2'-O-methylating the third 5'-nucleotide using a 2'-O-methyltransferase. The Cap 3 structure can be generated from the Cap 2 structure by 2'-O-methylating the fourth 5'-nucleotide using a 2'-O-methyltransferase. The enzymes may be derived from recombinant sources.

[0147] The 3'-poly(A) tail is typically a string of adenine nucleotides added to the 3' end of a transcribed mRNA. In some cases, it can contain approximately 400 adenine nucleotides. In some embodiments, the length of the 3'-poly(A) tail can be an essential element for the stability of an individual mRNA.

[0148] In some embodiments, the composition comprises a stabilizing element. The stabilizing element may include, for example, a histone stem loop. A 32 kDa protein, stem-loop binding protein (SLBP), has been identified. It associates with histone stem loops at the 3' end of histone messages in both the nucleus and the cytoplasm. Its expression level is regulated by the cell cycle, peaking during S phase, when histone mRNA levels also increase. This protein has been shown to be essential for efficient 3'-end processing of histone pre-mRNA by U7 snRNP. SLBP continues to associate with the stem loop after processing and then promotes translation of mature histone mRNA into histone protein in the cytoplasm. The RNA-binding domain of SLBP is conserved across metazoans and protozoans, and its binding to histone stem loops depends on the structure of the loop. The minimal binding site includes at least three nucleotides 5' and two nucleotides 3' to the stem loop.

[0149] In some embodiments, the mRNA comprises a coding region, at least one histone stem loop, and optionally a poly(A) sequence or polyadenylation signal. The poly(A) sequence or polyadenylation signal should generally improve the expression level of the encoded protein. In some embodiments, the encoded protein is not a histone protein, a reporter protein (e.g., luciferase, GFP, EGFP, β-galactosidase, EGFP), or a marker or selection protein (e.g., alpha-globin, galactokinase, and xanthine:guanine phosphoribosyltransferase (GPT)).

[0150] In some embodiments, the mRNA comprises a combination of a poly(A) sequence or a polyadenylation signal and at least one histone stem loop, which essentially represent alternative mechanisms but act synergistically to increase protein expression above levels observed with either of the individual elements. The synergistic effect of the combination of poly(A) and at least one histone stem loop is independent of the order of the elements or the length of the poly(A) sequence.

[0151] In some embodiments, the mRNA does not contain a histone downstream element (HDE). A "histone downstream element (HDE)" comprises a purine-rich polynucleotide stretch of approximately 15-20 nucleotides 3' of a naturally occurring stem-loop, which corresponds to the binding site for U7 snRNA, which is involved in processing histone pre-mRNA to mature histone mRNA. In some embodiments, the nucleic acid does not contain an intron.

[0152] The mRNA may or may not contain enhancer and / or promoter sequences, which may be modified or unmodified, activated or unactivated. In some embodiments, histone stem-loops are generally derived from histone genes and comprise two adjacent, partially or fully reverse-complementary sequences separated by a short spacer, forming the loop of the structure. The unpaired loop region typically cannot base-pair with any of the stem-loop elements. Because it is an important component of many RNA secondary structures, it is often present in RNA, but can also be present in single-stranded DNA. The stability of the stem-loop structure generally depends on the length, the number of mismatches or bulges, and the base composition of the paired region. In some embodiments, wobble base pairs (non-Watson-Crick base pairs) may occur. In some embodiments, at least one histone stem-loop sequence comprises a length of 15-45 nucleotides.

[0153] In some embodiments, the mRNA has one or more AU-rich sequences removed. These sequences (sometimes referred to as AURES) are destabilizing sequences found in the 3'UTR. AURES may be removed from the RNA vaccine. Alternatively, AURES may remain in the RNA vaccine.

[0154] signal peptide In some embodiments, the composition contains an mRNA having an ORF encoding a signal peptide fused to a coronavirus antigen. Signal peptides, which typically comprise the N-terminal 15-60 amino acids of a protein, are required for translocation across membranes along the secretory pathway and thus universally control entry of most proteins into the secretory pathway in both eukaryotes and prokaryotes. In eukaryotes, the signal peptide of a nascent precursor protein (preprotein) directs ribosomes to the rough endoplasmic reticulum (ER) membrane and initiates transmembrane transport of the growing peptide chain for processing. ER processing typically produces a mature protein in which the signal peptide is either cleaved from the precursor protein by a signal peptidase present in the host cell's ER or remains uncleaved, functioning as a membrane anchor. Signal peptides can also facilitate targeting of proteins to the cell membrane.

[0155] The signal peptide may be 15 to 60 amino acids in length, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 amino acids in length. In some embodiments, the signal peptide is 20-60, 25-60, 30-60, 35-60, 40-60, 45-60, 50-60, 55-60, 15-55, 20-55, 25-55, 30-55, 35-55, 40-55, 45-55, 50-55, 15-50, 20-50, 25-50, 30-50, 35-50, 4 and having a length of 0-50, 45-50, 15-45, 20-45, 25-45, 30-45, 35-45, 40-45, 15-40, 20-40, 25-40, 30-40, 35-40, 15-35, 20-35, 25-35, 30-35, 15-30, 20-30, 25-30, 15-25, 20-25, or 15-20 amino acids.

[0156] Signal peptides from heterologous genes (which in effect regulate the expression of genes other than coronavirus antigens) are known in the art and may be tested for desired properties and then incorporated into the nucleic acids of the present disclosure.

[0157] Scaffolding In some embodiments, the mRNA vaccines provided herein encode fusion proteins comprising coronavirus antigens or scaffold moieties linked to each other. In some embodiments, such scaffold moieties confer desirable properties to the antigens encoded by the disclosed nucleic acids. For example, scaffold proteins can improve the immunogenicity of antigens by, for example, altering the structure of the antigen, modifying the uptake and processing of the antigen, and / or causing the antigen to bind to a binding partner.

[0158] In some embodiments, the scaffold moiety is a protein that can self-assemble into highly symmetric, stable, and structurally organized protein nanoparticles with diameters of 10 to 150 nm, a size range highly suitable for optimal interaction with various cells of the immune system. In some embodiments, viral proteins or virus-like particles can be used to form stable nanoparticle structures. Examples of such viral proteins are known in the art. For example, in some embodiments, the scaffold moiety is hepatitis B surface antigen (HBsAg). HBsAg forms spherical particles with an average diameter of approximately 22 nm, lacks nucleic acid, and is therefore non-infectious (Lopez-Sagaseta, J. et al. Computational and Structural Biotechnology Journal 14 (2016) 58-68). In some embodiments, the scaffold moiety is hepatitis B core antigen (HBcAg), which self-assembles into particles with diameters of 24 to 31 nm, similar to viral cores obtained from HBV-infected human livers. The generated HBcAg self-assembles into two classes of nanoparticles of different sizes, with diameters of 300 Å and 360 Å, corresponding to 180 or 240 protomers. In some embodiments, a coronavirus antigen is fused to HBsAG or HBcAG to facilitate self-assembly of nanoparticles displaying the coronavirus antigen.

[0159] In some embodiments, bacterial protein platforms may be used. Non-limiting examples of these self-assembling proteins include ferritin, lumazine, and encapsulin.

[0160] Ferritin is a protein whose primary function is intracellular iron storage. Ferritin is composed of 24 subunits, each consisting of four alpha-helical bundles, which self-assemble into a quaternary structure with octahedral symmetry (Cho KJ et al. J Mol Biol. 2009;390:83-98). Several high-resolution structures of ferritin have been determined, confirming that Helicobacter pylori ferritin is composed of 24 identical protomers. However, in animals, ferritin light and heavy chains exist that can assemble independently or combine into particles of 24 subunits in different ratios (Granier T. et al. J Biol Inorg Chem. 2003;8:105-111; Lawson DM et al. Nature. 1991;349:541-544). Ferritin self-assembles into nanoparticles with excellent thermal and chemical stability. Therefore, ferritin nanoparticles are highly suitable for carrying and exposing antigens.

[0161] Lumazine synthase (LS) is also highly suitable as a nanoparticle platform for antigen display. LS, responsible for the penultimate catalytic step in riboflavin biosynthesis, is an enzyme present in a wide variety of organisms, including archaea, bacteria, fungi, plants, and eubacteria (Weber, S.E.Flavins and Flavoproteins. Methods and Protocols, Series: Methods in Molecular Biology. 2014). LS monomers are 150 amino acids long and consist of a beta sheet flanked by tandem alpha helices. Several different quaternary structures have been reported for LS, demonstrating its morphological versatility, ranging from a homopentamer to a symmetrical assembly of 12 pentamers that forms a capsid with a diameter of 150 Å. LS cages of over 100 subunits have even been described (Zhang, X. et al., J. Mol. Biol. 2006;362:753-770).

[0162] Encapsulin, a novel protein cage nanoparticle isolated from the thermophilic Thermotoga maritima, can also be used as a platform for displaying antigens on the surface of self-assembled nanoparticles. Encapsulin is organized from 60 copies of identical 31 kDa monomers, forming a thin, icosahedral T=1 symmetric cage structure with inner and outer diameters of 20 nm and 24 nm, respectively (Sutter M. et al. Nat Struct Mol Biol. 2008, 15:939-947). The exact function of encapsulin in T. maritima is still not clearly understood, but its crystal structure has recently been elucidated, and its function has been hypothesized as a cellular compartment encapsulating proteins such as DyP (dye-decolorizing peroxidase) and Flp (ferritin-like protein), which are involved in oxidative stress responses (Rahmanpour R. et al. FEBS J. 2013, 280:2097-2104).

[0163] In some embodiments, the RNA of the present disclosure encodes a coronavirus antigen fused to a foldon domain, which can be obtained, for example, from bacteriophage T4 fibritin (see, for example, Tao Y, et al. Structure. 1997 Jun 15;5(6):789-98).

[0164] Linkers and Cleavable Peptides In some embodiments, the mRNA of the present disclosure encodes two or more polypeptides, referred to herein as a fusion protein. In some embodiments, the mRNA further encodes a linker located between at least one or each domain of the fusion protein. The linker can be, for example, a cleavable linker or a protease-sensitive linker. In some embodiments, the linker is selected from the group consisting of an F2A linker, a P2A linker, a T2A linker, an E2A linker, and combinations thereof. This family of self-cleaving peptide linkers, referred to as 2A peptides, has been described in the art (see, e.g., Kim, J. et al. (2011) PLoS ONE 6:e18556). In some embodiments, the linker is an F2A linker. In some embodiments, the linker is a GGGS (SEQ ID NO: 49) linker. In some embodiments, the fusion protein contains three domains with an intervening linker having a domain-linker-domain-linker-domain structure.

[0165] In connection with the present disclosure, cleavable linkers known in the art can be used. Such exemplary linkers include F2A linkers, T2A linkers, P2A linkers, and E2A linkers (see, for example, WO2017 / 127750). Those skilled in the art will understand that other linkers recognized by those skilled in the art can be suitable for use in the constructs of the present disclosure (e.g., encoded by the nucleic acids of the present disclosure). Those skilled in the art will also understand that other polycistronic constructs (mRNAs that separately encode two or more antigens / polypeptides within the same molecule) can be suitable for use as provided herein.

[0166] Array Optimization In some embodiments, the ORF encoding the antigen of the present disclosure is codon-optimized. Codon optimization methods are known in the art. For example, any one or more ORFs of the sequences provided herein can be codon-optimized. In some embodiments, codon optimization can be used to match codon frequencies in the target organism and the host organism to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structure; minimize tandem repeat codons or base runs that may impair gene assembly or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove / add post-translational modification sites in the encoded protein (e.g., glycosylation sites); add, remove, or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust the translation rate to allow various domains of the protein to fold properly; or reduce or eliminate problematic secondary structures within the polynucleotide. Codon optimization tools, algorithms, and services are known in the art, and non-limiting examples include services and / or proprietary methods from GeneArt (Life Technologies), DNA2.0 (Menlo Park, CA). In some embodiments, the open reading frame (ORF) sequence is optimized using an optimization algorithm.

[0167] In some embodiments, the codon-optimized sequence shares less than 95% sequence identity with a naturally occurring or wild-type sequence ORF (e.g., a naturally occurring or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares less than 90% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares less than 85% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares less than 80% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares less than 75% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a coronavirus antigen).

[0168] In some embodiments, the codon-optimized sequence shares 65% to 85% (e.g., about 67% to about 85% or about 67% to about 80%) sequence identity to the native or wild-type sequence (e.g., a native or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares 65% to 75% or about 80% sequence identity to the native or wild-type sequence (e.g., a native or wild-type mRNA sequence encoding a coronavirus antigen).

[0169] In some embodiments, the codon-optimized sequence encodes an antigen that is the same as or more immunogenic than (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% or more immunogenic than) a coronavirus antigen encoded by a non-codon-optimized sequence.

[0170] The modified mRNA, when transfected into a mammalian host cell, has stability for 12 to 18 hours, or for more than 18 hours, for example, 24, 36, 48, 60, 72 hours, or for more than 72 hours, and is capable of being expressed by the mammalian host cell.

[0171] In some embodiments, the codon-optimized RNA may have an increased level of G / C. The G / C content of a nucleic acid molecule (e.g., mRNA) can affect the stability of the RNA. RNA with an increased amount of guanine (G) and / or cytosine (C) residues is believed to be more functionally stable than RNA containing a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides. For example, WO 02 / 098443 discloses a pharmaceutical composition containing an mRNA stabilized by sequence modifications within the coding region. Due to the degeneracy of the genetic code, the modifications are made by replacing existing codons with codons that further enhance the stability of the RNA without changing the resulting amino acid. This approach is limited to the coding region of the RNA.

[0172] Unmodified nucleotides In some embodiments, the mRNA is not chemically modified and comprises standard ribonucleotides consisting of adenosine, guanosine, cytosine, and uridine. In some embodiments, the nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those found in transcribed RNA (e.g., A, G, C, or U). In some embodiments, the nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those found in DNA (e.g., dA, dG, dC, or dT).

[0173] chemical modification Compositions of the present disclosure, in some embodiments, include RNA having an open reading frame encoding a coronavirus antigen, where the nucleic acid comprises nucleotides and / or nucleosides that can be standard (unmodified) or modified as known in the art. In some embodiments, the nucleotides and nucleosides of the present disclosure comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally occurring modified nucleotides and nucleosides or non-naturally occurring nucleotides and nucleosides. Such modifications can include art-recognized modifications in the sugar, backbone, or nucleobase moieties of the nucleotide and / or nucleoside.

[0174] In some embodiments, the naturally occurring modified nucleotides or nucleotides of the present disclosure are those generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the widely recognized MODOMICS database.

[0175] In some embodiments, the non-naturally occurring modified nucleotides or nucleosides of the present disclosure are generally known or art-recognized. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides can be found, inter alia, in published U.S. application Nos. PCT / US2012 / 058519, PCT / US2013 / 075177, PCT / US2014 / 058897, PCT / US2014 / 058891, PCT / US2014 / 070413, PCT / US2015 / 36773, PCT / US2015 / 36759, PCT / US2015 / 36771, or PCT / IB2017 / 051367, all of which are incorporated herein by reference.

[0176] Thus, the nucleic acids of the present disclosure (e.g., DNA nucleic acids and RNA nucleic acids such as mRNA nucleic acids) can include standard nucleotides and nucleosides, naturally occurring nucleotides and nucleosides, non-naturally occurring nucleotides and nucleosides, or any combination thereof.

[0177] Nucleic acids of the present disclosure (e.g., DNA nucleic acids and RNA nucleic acids such as mRNA nucleic acids) in some embodiments comprise a variety (two or more) different types of standard and / or modified nucleotides and nucleosides. In some embodiments, a particular region of a nucleic acid contains one, two, or more (optionally different) types of standard and / or modified nucleotides and nucleosides.

[0178] In some embodiments, modified RNA nucleic acids (e.g., modified mRNA nucleic acids) introduced into a cell or organism exhibit reduced degradation in the cell or organism, respectively, compared to unmodified nucleic acids comprising standard nucleotides and nucleosides.

[0179] In some embodiments, modified RNA nucleic acids (e.g., modified mRNA nucleic acids) introduced into a cell or organism may exhibit reduced immunogenicity (e.g., reduced innate response) in the cell or organism, respectively, compared to unmodified nucleic acids comprising standard nucleotides and nucleosides.

[0180] Nucleic acids (e.g., RNA nucleic acids such as mRNA nucleic acids) in some embodiments contain non-naturally occurring modified nucleotides that are introduced during or after the synthesis of the nucleic acid to achieve a desired function or property. Modifications can be in the internucleotide bond, the purine or pyrimidine base, or the sugar. Modifications can be introduced by chemical synthesis or can be introduced at the end of the chain or anywhere in the chain using a polymerase enzyme. Any region of a nucleic acid can be chemically modified.

[0181] The present disclosure provides modified nucleosides and nucleotides of nucleic acids (e.g., RNA nucleic acids such as mRNA nucleic acids). A "nucleoside" refers to a compound or derivative thereof containing a sugar molecule (e.g., pentose or ribose) combined with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as a "nucleobase"). A "nucleotide" refers to a nucleoside containing a phosphate group. Modified nucleotides can be synthesized in any useful manner, for example, chemically, enzymatically, or recombinantly, to include one or more modified or unnatural nucleosides. A nucleic acid can include a region or regions of linked nucleosides. Such regions can have a variety of backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acid would include a region of nucleotides.

[0182] Base pairing of modified nucleotides encompasses not only standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides containing non-standard or modified bases and / or modified nucleotides, where the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between a non-standard base and a standard base, or between two complementary non-standard base structures, as in the case of nucleic acids having at least one chemical modification. One example of such non-standard base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil. Any combination of base / sugar or linker can be incorporated into the polynucleotides of the present disclosure.

[0183] In some embodiments, modified nucleobases in a nucleic acid (e.g., an RNA nucleic acid such as an mRNA nucleic acid) comprise 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (ψ). In some embodiments, modified nucleobases in a nucleic acid (e.g., an RNA nucleic acid such as an mRNA nucleic acid) comprise 5-methoxymethyluridine, 5-methylthiouridine, 1-methoxymethylpseudouridine, 5-methylcytidine, and / or 5-methoxycytidine. In some embodiments, a polynucleotide comprises a combination of at least two (e.g., two, three, four, or more) of any of the foregoing modified nucleobases, including, but not limited to, chemical modifications.

[0184] In some embodiments, an mRNA of the disclosure comprises 1-methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions in the nucleic acid.

[0185] In some embodiments, an mRNA of the disclosure comprises 1-methylpseudouridine (m1ψ) substitutions at one or more or all of the uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more or all of the cytidine positions of the nucleic acid.

[0186] In some embodiments, an mRNA of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions in the nucleic acid.

[0187] In some embodiments, an mRNA of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all of the uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more or all of the cytidine positions of the nucleic acid.

[0188] In some embodiments, an mRNA of the disclosure includes a uridine at one or more or all uridine positions of the nucleic acid.

[0189] In some embodiments, mRNA is uniformly modified (e.g., completely modified, modified throughout the entire sequence) for a particular modification. For example, a nucleic acid can be uniformly modified with 1-methyl-pseudouridine, i.e., all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified by replacing any type of nucleoside residue present in the sequence with a modified residue, such as those described above.

[0190] The nucleic acids of the present disclosure may be partially or completely modified along the entire length of the molecule. For example, one or more, or all, or a given type of nucleotide (e.g., purine or pyrimidine, or one or more or all of A, G, U, C) can be uniformly modified in the nucleic acids of the present disclosure, or in a predetermined sequence region thereof (e.g., mRNA, including or excluding a poly-A tail). In some embodiments, all nucleotides X in the nucleic acids of the present disclosure (or in a sequence region thereof) are modified nucleotides, and X can be any one of nucleotides A, G, U, C, or any one of the following combinations: A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, or A+G+C.

[0191] Nucleic acids may contain from about 1% to about 100% modified nucleotides (with respect to the overall nucleotide content or with respect to any one or more types of nucleotides, i.e., A, G, U, or C) or any intervening percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90% , 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It will be understood that any remaining percentage is determined by the presence of unmodified A, G, U, or C.

[0192] The mRNA can contain from 1% to 100% modified nucleotides, or any range of percentages (e.g., at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides). For example, the nucleic acid can contain modified pyrimidines such as modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in the nucleic acid are replaced with modified uracils (e.g., 5-substituted uracils). The modified uracils can be replaced by a compound with a single unique structure, or by multiple compounds with different structures (e.g., two, three, four, or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in a nucleic acid are replaced with modified cytosines (e.g., 5-substituted cytosines). The modified cytosines can be replaced by a compound having a single unique structure, or by multiple compounds having different structures (e.g., two, three, four, or more unique structures).

[0193] Untranslated Regions (UTRs) The mRNA of the present disclosure may contain one or more regions or portions that act or function as untranslated regions. When the mRNA is designed to encode at least one antigen of interest, the nucleic acid may contain one or more of these untranslated regions (UTRs). The wild-type untranslated region of a nucleic acid is transcribed but not translated. In an mRNA, the 5' UTR begins at the transcription initiation site and continues up to, but not including, the start codon, while the 3' UTR begins immediately after the stop codon and continues to the transcription termination signal. There is increasing evidence regarding the regulatory role played by UTRs in terms of the stability and translation of nucleic acid molecules. Regulatory features of UTRs can be incorporated into the polynucleotides of the present disclosure, particularly to increase the stability of the molecule. Specific features can also be incorporated to ensure controlled downregulation of the transcript in case the transcript is misdirected to an undesired organ site. Various 5' UTR and 3' UTR sequences are known and available in the art.

[0194] The 5'UTR refers to the region of an mRNA immediately upstream (5') from the start codon (the first codon of an mRNA transcript translated by ribosomes). 5'UTRs do not encode proteins (are non-coding). Natural 5'UTRs have characteristics that play a role in translation initiation. They have signatures such as the Kozak sequence, which is commonly known to be involved in the process by which the ribosome initiates translation of many genes. The Kozak sequence has the consensus CCR(A / G)CCAUGG (SEQ ID NO: 52), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG) followed by another "G." 5'UTRs are also known to form secondary structures involved in elongation factor binding.

[0195] In some embodiments of the present disclosure, the 5' UTR is a heterologous UTR, i.e., a naturally occurring UTR associated with a different ORF. In another embodiment, the 5' UTR is a synthetic UTR, i.e., not naturally occurring. Synthetic UTRs include UTRs mutated to improve gene expression or other characteristics, as well as completely synthetic UTRs. Exemplary 5' UTRs include those derived from Xenopus or human a-globin or b-globin (8278063, 9012219), human cytochrome b-245a polypeptide, and hydroxysteroid (17b) dehydrogenase, and tobacco etch virus (US8278063, 9012219). The CMV immediate early 1 (IE1) gene (US2014 / 0206753, WO2013 / 185069), sequence GGGAUCCUACC (SEQ ID NO: 24) (WO2014 / 144196), can also be used. In another embodiment, the 5'UTR of the TOP gene is a 5'UTR of a TOP gene lacking a 5'TOP motif (oligopyrimidine tract) (e.g., WO / 2015 / 101414, WO / 2015 / 101415, WO / 2015 / 062738, WO2015 / 024667, WO2015 / 024667; a 5'UTR element from the ribosomal protein large 32 (L32) gene (WO / 2015 / 101414, WO 2015 / 101415, WO / 2015 / 062738), a 5'UTR element derived from the 5'UTR of the hydroxysteroid (17-beta) dehydrogenase 4 gene (HSD17B4) (WO2015 / 024667), or a 5'UTR element derived from the 5'UTR of ATP5A1 (WO2015 / 024667) can be used. In some embodiments, an internal ribosome entry site (IRES) is used in place of the 5'UTR.

[0196] In some embodiments, a 5'UTR of the present disclosure comprises a sequence selected from SEQ ID NO:2 and SEQ ID NO:21.

[0197] The 3'UTR is the region of an mRNA immediately downstream (3') of the stop codon (the codon in an mRNA transcript that signals the end of translation). The 3'UTR is non-coding and does not encode proteins. Native or wild-type 3'UTRs are known to contain a series of adenosines and uridines. These AU-rich signatures are particularly prevalent in genes with high turnover rates. Based on their sequence characteristics and functional properties, AU-rich elements (AREs) can be separated into three classes (Chen et al., 1995): Class I AREs contain several dispersed copies of the AUUUA motif within a U-rich region. C-Myc and MyoD contain Class I AREs. Class II AREs have two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules containing this type of ARE include GM-CSF and TNF-α. Class III AREs are less well defined. These U-rich regions do not contain the AUUUA motif. c-Jun and myogenin are two well-studied examples of this class. While most proteins that bind to AREs are known to destabilize messengers, members of the ELAV family, particularly HuR, have been reported to increase mRNA stability. HuR binds to all three classes of AREs. Engineering a HuR-specific binding site into the 3'UTR of a nucleic acid molecule results in HuR binding and, therefore, stabilization of the message in vivo.

[0198] The introduction, removal, or modification of 3'UTR AU-rich elements (AREs) may be used to modulate the stability of the nucleic acids (e.g., RNA) of the present disclosure. When engineering a particular nucleic acid, one or more copies of an ARE can be introduced to reduce the stability of the nucleic acid of the present disclosure, thereby suppressing translation and reducing production of the resulting protein. Similarly, AREs can be identified and removed or mutated to increase intracellular stability, thus increasing translation and production of the resulting protein. Transfection experiments can be performed in relevant cell lines using the nucleic acids of the present disclosure, and protein production can be assayed at various time points after transfection. For example, cells can be transfected with various ARE-engineered molecules and the relevant protein using an ELISA kit, and the protein produced can be assayed 6 hours, 12 hours, 24 hours, 48 ​​hours, and 7 days after transfection.

[0199] Those skilled in the art will understand that heterologous or synthetic 5'UTRs can be used with any desired 3'UTR sequence. For example, a heterologous 5'UTR can be used with a synthetic 3'UTR with a heterologous 3'UTR.

[0200] Non-UTR sequences can also be used as regions or subregions within nucleic acids. For example, intron sequences or portions of intron sequences can be incorporated into the regions of the nucleic acids of the present disclosure. The intron sequence integration can increase protein production and nucleic acid levels.

[0201] A combination of features can be included in the flanking regions, or can be contained among other features. For example, an ORF can be flanked by a 5' UTR, which can contain a strong Kozak translation initiation signal, and / or a 3' UTR, which can contain an oligo(dT) sequence for templated addition of a polyA tail. The 5' UTR can include a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different genes, such as the 5' UTRs described in U.S. Patent Application Publication No. 20100293625 and PCT / US2014 / 069155, which are incorporated herein by reference in their entireties.

[0202] It should be understood that any UTR from any gene can be incorporated into a region of a nucleic acid. Furthermore, multiple wild-type UTRs from any known gene may be utilized. It is also within the scope of the present disclosure to provide artificial UTRs that are not variants of the wild-type region. These UTRs or portions thereof may be positioned in the same orientation as the selected transcript, or their orientation or position may be modified. Thus, a 5' or 3' UTR may be inverted, shortened, extended, or created with one or more other 5' or 3' UTRs. As used herein, the term "modified" refers to a UTR sequence and means that the UTR has been altered in some way relative to a reference sequence. For example, a 3' or 5' UTR may be modified compared to a wild-type or native UTR by a change in orientation or position, as taught above, or by the inclusion of additional nucleotides, deletion of nucleotides, nucleotide swapping, or translocation. Any of these changes that produce a "modified" UTR (either 3' or 5') include variant UTRs.

[0203] In some embodiments, double, triple, or quadruple UTRs, such as 5'UTR or 3'UTR, can be used. As used herein, a "double" UTR is one in which two copies of the same UTR are encoded in tandem or substantially tandem. For example, the double beta-globin 3'UTR described in U.S. Patent Publication No. 2010 / 0129877, the entire contents of which are incorporated herein by reference, can be used.

[0204] It is also within the scope of the present disclosure to have patterned UTR.As used herein, " patterned UTR " refers to UTR that reflects a repeating or alternating pattern, such as ABABAB or AABBABBAABB or ABCABCABC or its variants being repeated once, twice, or three or more times.In these patterns, each letter A, B, or C represents the UTR that is different at the nucleotide level.

[0205] In some embodiments, the flanking region is selected from a family of transcripts whose proteins share common functions, structures, characteristics, or properties.For example, a polypeptide of interest may belong to a family of proteins that are expressed in a particular cell, tissue, or at a certain time during development.The UTR from any of these genes can be swapped with any other UTR from proteins of the same or different family to create a new polynucleotide.As used herein, the term "family of proteins" is used in the broadest sense and refers to a group of two or more polypeptides of interest that share at least one function, structure, characteristic, location, origin, or expression pattern.

[0206] The untranslated region may also include a translational enhancer element (TEE). By way of non-limiting example, the TEE may include those described in U.S. Patent Application Publication No. 20090226470, which is incorporated herein by reference in its entirety, and TEEs known in the art.

[0207] Non-coding sequences Aspects of the present disclosure relate to multivalent RNA compositions comprising mRNAs, e.g., 2 to 15 mRNA polynucleotides, each comprising a distinct open reading frame (ORF) encoding a coronavirus antigen polypeptide, wherein each mRNA polynucleotide comprises one or more non-coding sequences in its untranslated region (UTR) with a unique identifier sequence (non-coding sequence). In some embodiments, the non-coding sequences are unique non-coding sequences. In some embodiments, each mRNA in a multivalent vaccine composition comprises its own unique non-coding sequence. As used herein, "non-coding sequence" refers to a sequence of a biological molecule (e.g., a nucleic acid, a protein, etc.) that, when combined with that sequence, functions to identify another biological molecule. Typically, a non-coding sequence is a heterologous sequence that is incorporated into or added to the sequence of a target biological molecule and serves as a reference for identifying the target molecule of interest. In some embodiments, a non-coding sequence is a sequence of a nucleic acid (e.g., a heterologous or synthetic nucleic acid) that is incorporated into or added to the target nucleic acid and serves as a reference for identifying the target nucleic acid. In some embodiments, the non-coding sequence is of the formula (N)n. In some embodiments, n is an integer ranging from 5 to 20, 5 to 10, 10 to 20, 7 to 20, or 7 to 30. In some embodiments, n is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more. In some embodiments, each N is a nucleotide independently selected from A, G, T, U, and C, or analogs thereof. Thus, some embodiments include a nucleic acid (e.g., an mRNA) that (i) has a target sequence of interest (e.g., a coding sequence (e.g., encoding an antigenic protein or polypeptide)) and (ii) includes a unique non-coding sequence.

[0208] In some embodiments, one or more in vitro transcribed mRNAs contain one or more non-coding sequences in a non-translated region (UTR), such as the 5' UTR or 3' UTR. Including a non-coding sequence in a UTR of an mRNA prevents the non-coding sequence from being translated into a peptide. In some embodiments, the non-coding region is located in the 3' UTR of the mRNA. In some embodiments, the non-coding sequence is located upstream of the polyA tail of the mRNA. In some embodiments, the non-coding sequence is located downstream (e.g., after) the polyA tail of the mRNA. In some embodiments, the non-coding sequence is located between the last codon of the ORF of the mRNA and the first "A" in the polyA tail of the mRNA. In some embodiments, the polynucleotide non-coding sequence located in a UTR contains 1 to 10 nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides). In some embodiments, a UTR containing a polynucleotide non-coding sequence further contains one or more (e.g., 1, 2, 3, or more) RNAse cleavage sites, such as an RNase H cleavage site. In some embodiments, each different RNA of a multivalent RNA composition comprises a different (e.g., unique) non-coding sequence. In some embodiments, the RNA of a multivalent RNA composition is detected and / or purified according to the polynucleotide non-coding sequence of the RNA. In some embodiments, the mRNA non-coding sequence is used to identify the presence of mRNA or to determine the relative ratio of different mRNAs in a sample (e.g., a reaction product or drug product). In some embodiments, the mRNA non-coding sequence is detected using one or more of deep sequencing, PCR, and Sanger sequencing.Exemplary non-coding sequences include AACGUGAU, AAACAUCG, ATGCCUAA, AGUGGUCA, ACCACUGU, ACAUUGGC, CAGAUCUG, CAUCAAGU, CGCUGAUC, ACAAGCUA, CUGUAGCC, AGUACAAG, AACAACCA, AACCGAGA, AACGCUUA, AAGACGGA, AAGGUACA, ACACAGAA, ACAGCAGA, ACUCCAA, ACGCUCGA, ACGUAUCA, ACUAUGCA, AGAGUCAA, AGAUCGCA, AGCAGGAA, AGUCACUA, AUCCUGUA, AUUGAGGA, CAACCACA, GACUAGUA, CAAUGGAA, CACUUCGA, CAGCGUUA, CAUACCAA, CCAGUUCA, CCGAAGUA, ACAGUG, CGAUGU, UUAGGC, AUCACG, and UGACCA.

[0209] In some embodiments, the polyvalent RNA composition comprises: (a) combining in a single reaction vessel a first linearized DNA molecule encoding a first mRNA polynucleotide, a second linearized DNA molecule encoding a second mRNA polynucleotide, and optionally a third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth linearized DNA molecule encoding a third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth mRNA polynucleotide, wherein the first DNA molecule, the second DNA molecule, and the third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecule are obtained from different sources; (b) simultaneously transcribing in vitro a linearized first DNA molecule, a linearized second DNA molecule, and optionally a linearized third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecule to obtain a polyvalent RNA composition. The different sources may be bacterial cell cultures, which may not be co-cultured. In some embodiments, the amounts of the first, second, and third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecules present in the reaction mixture are normalized before the start of IVT.

[0210] In vitro transcription of RNA cDNA encoding the polynucleotides described herein can be transcribed using an in vitro transcription (IVT) system. In vitro transcription of RNA is known in the art and is described in International Publication No. WO 2014 / 152027, the entire contents of which are incorporated herein by reference. In some embodiments, the RNA of the present disclosure is prepared according to any one or more of the methods described in WO 2018 / 053209 and WO 2019 / 036682, each of which is incorporated herein by reference.

[0211] In some embodiments, RNA transcripts are generated using an unamplified, linearized DNA template in an in vitro transcription reaction to produce the RNA transcript. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by reverse transcription of an RNA polynucleotide, for example, but not limited to, coronavirus mRNA. In some embodiments, cells, e.g., bacterial cells, e.g., E. coli, e.g., DH-1 cells, are transfected with a plasmid DNA template. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA, which is then isolated and purified. In some embodiments, the DNA template comprises an RNA polymerase promoter, e.g., a T7 promoter located 5' and operably linked to a gene of interest.

[0212] In some embodiments, the in vitro transcription template encodes a 5' untranslated (UTR) region, contains an open reading frame, encodes a 3' UTR, and a polyA tail. The particular nucleic acid sequence composition and length of the in vitro transcription template depends on the mRNA encoded by the template.

[0213] "5' untranslated region" (UTR) refers to the region of an mRNA immediately upstream (i.e., 5') from the start codon (i.e., the first codon of the mRNA transcript translated by the ribosome) that does not encode a polypeptide. When an RNA transcript is produced, the 5' UTR may contain a promoter sequence. Such promoter sequences are known in the art. It should be understood that the vaccines of the present disclosure are free of such promoter sequences.

[0214] "3' untranslated region" (UTR) refers to the region of an mRNA immediately downstream (i.e., 3') from a stop codon (i.e., the codon of the mRNA transcript that signals translation termination) that does not encode a polypeptide.

[0215] An "open reading frame" is a contiguous stretch of DNA beginning with a start codon (eg, methionine (ATG)) and ending with a stop codon (eg, TAA, TAG, or TGA) that encodes a polypeptide.

[0216] A "poly(A) tail" is a region of an mRNA downstream, e.g., immediately downstream (i.e., 3'), of the 3' UTR that contains multiple consecutive adenosine monophosphates. A poly(A) tail can contain 10 to 300 adenosine monophosphates. For example, a poly(A) tail can contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenosine monophosphates. In some embodiments, a poly(A) tail contains 50 to 250 adenosine monophosphates. In relevant biological environments (e.g., intracellular, in vivo), the poly(A) tail functions, for example, to protect the mRNA from enzymatic degradation in the cytoplasm, assist in transcription termination, and / or transport and translation of the mRNA from the nucleus.

[0217] In some embodiments, the nucleic acid comprises 200 to 3,000 nucleotides. For example, the nucleic acid may comprise 200 to 500, 200 to 1,000, 200 to 1,500, 200 to 3,000, 500 to 1,000, 500 to 1,500, 500 to 2,000, 500 to 3,000, 1,000 to 1,500, 1,000 to 2,000, 1,000 to 3,000, 1,500 to 3,000, or 2,000 to 3,000 nucleotides.

[0218] In vitro transcription systems typically include a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor, and a polymerase.

[0219] NTPs may be produced in-house, selected from a supplier, or synthesized as described herein. NTPs may be selected from those described herein, including, but not limited to, natural and unnatural (modified) NTPs.

[0220] Any number of RNA polymerases or variants can be used in the methods of the present disclosure. The polymerase can be selected from mutant polymerases, such as, but not limited to, phage RNA polymerases, e.g., T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, and / or polymerases capable of incorporating modified nucleic acids and / or modified nucleotides, including, but not limited to, chemically modified nucleic acids and / or nucleotides. Some embodiments exclude the use of DNase.

[0221] In some embodiments, the RNA transcript is capped via enzymatic capping. In some embodiments, the RNA comprises a 5' end cap, e.g., 7mG(5')ppp(5')NlmpNp.

[0222] chemical synthesis Solid-phase chemical synthesis. The nucleic acids of the present disclosure may be produced entirely or partially using solid-phase technology. Solid-phase chemical synthesis of nucleic acids is an automated method in which molecules are immobilized on a solid support and synthesized stepwise in a reaction solution. Solid-phase synthesis is useful for site-specific introduction of chemical modifications into nucleic acid sequences.

[0223] Solution Phase Chemical Synthesis. Synthesis of the nucleic acids of the present disclosure by sequential addition of monomer building blocks can be carried out in solution phase.

[0224] Combination of synthesis methods. Each of the synthesis methods discussed above has its own advantages and limitations. Attempts have been made to combine these methods to overcome these limitations. Such combinations of methods are within the scope of the present disclosure. The use of solid-phase or liquid-phase chemical synthesis in combination with enzymatic ligation provides an efficient way to generate long-chain nucleic acids that cannot be obtained by chemical synthesis alone.

[0225] Ligation of nucleic acid regions or subregions Ligase-mediated nucleic acid assembly can also be used. DNA or RNA ligase promotes intermolecular ligation of the 5' and 3' ends of polynucleotide chains via the formation of phosphodiester bonds. Nucleic acids, such as chimeric polynucleotides and / or circular nucleic acids, can be prepared by ligating one or more regions or subregions. DNA fragments can be joined by ligase-catalyzed reactions to generate recombinant DNAs with different functions. Two oligodeoxynucleotides (one containing a 5' phosphoryl group and the other containing a free 3' hydroxyl group) serve as substrates for DNA ligase.

[0226] purification Purification of nucleic acids as described herein can include, but is not limited to, nucleic acid cleanup, quality assurance, and quality control. Cleanup can be performed by methods known in the art, such as, but not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNA™ Oligo-T Capture Probes (EXIQON® Inc, Vedbaek, Denmark), or HPLC-based purification methods, including, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). The term "purified," when used with respect to nucleic acids, such as "purified nucleic acids," refers to those that have been separated from at least one contaminant. A "contaminant" is any substance that renders one unsuitable, impure, or adulterated. Thus, purified nucleic acids (e.g., DNA and RNA) are present in a form or setting that is different from that in which they are found in nature or that they existed in prior to being subjected to a processing or purification method.

[0227] Quality assurance and / or quality control checks can be performed using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC.

[0228] In some embodiments, nucleic acids may be sequenced by methods including, but not limited to, reverse transcriptase PCR.

[0229] Quantification In some embodiments, nucleic acids of the present disclosure may be quantified in exosomes or from one or more bodily fluids, including peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, sputum-like fluid, amniotic fluid, earwax, breast milk, bronchoalveolar lavage fluid, semen, prostatic fluid, Cowper's or pre-ejaculatory fluid, sweat, feces, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menstrual fluid, pus, sebum, vomit, vaginal secretions, mucosal secretions, stool, pancreatic juice, sinus lavage fluid, bronchopulmonary aspirate, blastocyst cavity fluid, and umbilical cord blood. Alternatively, the exosomes may be obtained from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta.

[0230] Assays can be performed using construct-specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or a combination thereof, and exosomes can be isolated using immunohistochemistry, such as enzyme-linked immunosorbent assay (ELISA). Exosomes can also be isolated by size-exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunosorbent capture, affinity purification, microfluidic separation, or a combination thereof.

[0231] These methods allow researchers to monitor residual or delivered levels of nucleic acid in real time, which is possible because the nucleic acids of the present disclosure, in some embodiments, differ from endogenous forms by structural or chemical modifications.

[0232] In some embodiments, nucleic acids can be quantified using methods such as, but not limited to, ultraviolet-visible spectroscopy (UV / Vis). A non-limiting example of a UV / Vis spectrometer is the NANODROP® spectrometer (ThermoFisher, Waltham, MA). Quantified nucleic acids can be analyzed to determine whether the nucleic acids are of the appropriate size and to confirm that nucleic acid degradation has not occurred. Nucleic acid degradation can be confirmed by methods such as, but not limited to, agarose gel electrophoresis, HPLC-based purification methods, including, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE), and capillary gel electrophoresis (CGE).

[0233] Lipid nanoparticles (LNPs) In some embodiments, the mRNA of the present disclosure is formulated in a lipid nanoparticle (LNP). As used herein, "lipid nanoparticle" should be understood to refer to a single LNP or a population of LNPs. Lipid nanoparticles typically comprise an ionizable amino (cationic) lipid, a non-cationic lipid, a sterol, and a PEG lipid component, along with a nucleic acid cargo of interest. Lipid nanoparticles of the present disclosure can be produced using components, compositions, and methods generally known in the art, such as PCT / US2016 / 052352; PCT / US2016 / 068300, PCT / US2017 / 037551, PCT / US2015 / 027400, PCT / US2016 / 047406, PCT / US201600012, all of which are incorporated herein by reference in their entireties. 9, PCT / US2016 / 014280, PCT / US2016 / 014280, PCT / US2017 / 038426, PCT / US2014 / 027077, PCT / US2014 / 055394, PCT / US2016 / 52117, PCT / US2012 / 069610, PCT / US2017 / 027492, PCT / US2016 / 059575, and PCT / US2016 / 069491.

[0234] The vaccines of the present disclosure are typically formulated in lipid nanoparticles. In some embodiments, the lipid nanoparticles comprise at least one ionizable amino lipid, at least one non-cationic lipid, at least one sterol, and / or at least one polyethylene glycol (PEG)-modified lipid.

[0235] In some embodiments, the lipid nanoparticles comprise 20-60 mol% ionizable amino lipids. In some embodiments, the lipid nanoparticles comprise 20-55 mol% ionizable amino lipids. For example, the lipid nanoparticles may comprise 20-50 mol%, 20-40 mol%, 20-30 mol%, 30-60 mol%, 30-50 mol%, 30-40 mol%, 40-60 mol%, 40-50 mol%, or 50-60 mol% ionizable amino lipids. In some embodiments, the lipid nanoparticles comprise 20 mol%, 30 mol%, 40 mol%, 50 mol%, or 60 mol% ionizable amino lipids. In some embodiments, the lipid nanoparticles comprise 40 mol%, 41 mol%, 42 mol%, 43 mol%, 44 mol%, 45 mol%, 46 mol%, 47 mol%, 48 mol%, 49 mol%, 50 mol%, or 60 mol% ionizable amino lipids.

[0236] In some embodiments, the lipid nanoparticles comprise 5-25 mol% non-cationic lipids. For example, the lipid nanoparticles may comprise 5-20 mol%, 5-15 mol%, 5-10 mol%, 10-25 mol%, 10-20 mol%, 10-25 mol%, 15-25 mol%, 15-20 mol%, or 20-25 mol% non-cationic lipids. In some embodiments, the lipid nanoparticles comprise 5 mol%, 10 mol%, 15 mol%, 20 mol%, or 25 mol% non-cationic lipids.

[0237] In some embodiments, the lipid nanoparticles contain 25-55 mol% sterol. For example, the lipid nanoparticles may contain 25-50 mol%, 25-45 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 30-35 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 45-55 mol%, 45-50 mol%, or 50-55 mol% sterol. In some embodiments, the lipid nanoparticles contain 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, or 55 mol% sterol.

[0238] In some embodiments, the lipid nanoparticles comprise 0.5-15% PEG-modified lipids. For example, the lipid nanoparticles comprise 0.5-10 mol%, 0.5-5 mol%, 1-15 mol%, 1-10 mol%, 1-5 mol%, 2-15 mol%, 2-10 mol%, 2-5 mol%, 5-15 mol%, 5-10 mol%, or 10-15 mol%. In some embodiments, the lipid nanoparticles comprise 0.5 mol%, 1 mol%, 2 mol%, 3 mol%, 4 mol%, 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, 11 mol%, 12 mol%, 13 mol%, 14 mol%, or 15 mol% PEG-modified lipids.

[0239] In some embodiments, the lipid nanoparticles comprise 20-60 mol% ionizable amino lipid, 5-25 mol% non-cationic lipid, 25-55 mol% sterol, and 0.5-15 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticles comprise 40-50 mol% ionizable amino lipid, 5-15 mol% neutral lipid, 20-40 mol% cholesterol, and 0.5-3 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticles comprise 45-50 mol% ionizable amino lipid, 9-13 mol% neutral lipid, 35-45 mol% cholesterol, and 2-3 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticles comprise 48 mol% ionizable amino lipid, 11 mol% neutral lipid, 68.5 mol% cholesterol, and 2.5 mol% PEG-modified lipid.

[0240] In some embodiments, the ionizable amino lipids of the present disclosure comprise a compound of formula (I): [ka] or a salt or isomer thereof, wherein: R1 is C 5-30 Alkyl, C 5-20 selected from the group consisting of alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1-14 Alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, where Q is a carbocycle, a heterocycle, -OR, -O(CH) nN(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N( R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R8, -O(CH2) n -OR, -N(R)C(=NR9)N(R), -N(R)C(=CHR9)N(R), -OC(O)N(R), -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)R, -N(OR)C(O)OR, -N(OR)C(O)N(R), -N(OR)C(S)N(R), -N(OR)C(=NR9)N(R), -N(OR)C(=CHR9)N(R), -C(=NR9)N(R), -C(=NR9)R, -C(O)N(R)OR, and -C(R)N(R)C(O)OR; each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independently C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8, C 3-6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles and heterocycles; Each R is independently C 1-3 Alkyl, C2-3 selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 2-12 alkenyl; Each Y is independently C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0241] In some embodiments, a subset of compounds of formula (I) includes compounds where R4 is -(CH2) n Q, -(CH2) n When CHQR, -CHQR, or -CQ(R), compounds are included in which (i) Q is not -N(R) when n is 1, 2, 3, 4, or 5, or (ii) Q is not a 5-, 6-, or 7-membered heterocycloalkyl when n is 1 or 2.

[0242] In some embodiments, another subset of compounds of formula (I) includes: R1 is C 5-30 Alkyl, C 5-20 selected from the group consisting of alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1-14 Alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) nQ, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, wherein Q is selected from the group consisting of C 3-6 Carbocycles, N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n 5-14 membered heteroaryl having one or more heteroatoms selected from OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, as well as oxo (=O), OH, amino, mono- or dialkylamino, and C 1-3 and 5-14 membered heterocycloalkyl having one or more heteroatoms selected from N, O, and S substituted with one or more substituents selected from alkyl, where each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independently C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -SS-, an aryl group, and a heteroaryl group; R7 is C1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8, C 3-6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles and heterocycles; Each R is independently C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 2-12 alkenyl; Each Y is independently C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0243] In some embodiments, another subset of compounds of formula (I) includes: R1 is C 5-30 Alkyl, C 5-20 selected from the group consisting of alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1-14 Alkyl, C 2-14alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, wherein Q is selected from the group consisting of C 3~6 Carbocycle, 5-14 membered heterocycle having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n and (i) R4 is selected from -N(R)C(=NR9)N(R), -N(R)C(=CHR9)N(R), -OC(O)N(R), -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)R, -N(OR)C(O)OR, -N(OR)C(O)N(R), -N(OR)C(S)N(R), -N(OR)C(=NR9)N(R), -N(OR)C(=CHR9)N(R), -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R), wherein each n is independently selected from 1, 2, 3, 4, and 5; Q is a 5-14 membered heterocycle; and (i) R4 is selected from -(CH2) n Q (where n is 1 or 2), or (ii) R4 is -(CH2) n or (iii) when R4 is -CHQR and -CQ(R)2, Q is either a 5- to 14-membered heteroaryl or an 8- to 14-membered heterocycloalkyl; Each R5 is independently C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R6 is C 1-3Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8, C 3-6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles and heterocycles; Each R is independently C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 2-12 alkenyl; Each Y is independently C 3~6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0244] In some embodiments, another subset of compounds of formula (I) includes: R1 is C 5-30 Alkyl, C 5-20 selected from the group consisting of alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1-14 Alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, wherein Q is selected from the group consisting of C 3-6 Carbocycle, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n -OR, -N(R)C(=NR9)N(R), -N(R)C(=CHR9)N(R), -OC(O)N(R), -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)R, -N(OR)C(O)OR, -N(OR)C(O)N(R), -N(OR)C(S)N(R), -N(OR)C(=NR9)N(R), -N(OR)C(=CHR9)N(R), -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R), wherein each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independently C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8, C 3-6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles and heterocycles; Each R is independently C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 2-12 alkenyl; Each Y is independently C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0245] In some embodiments, another subset of compounds of formula (I) includes: R1 is C 5-30 Alkyl, C 5-20selected from the group consisting of alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are H, C 2-14 Alkyl, C 2-14 independently selected from the group consisting of alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is -(CH2) n Q or -(CH2) n CHQR, where Q is —N(R)2 and n is selected from 3, 4, and 5; Each R5 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R is independently C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 1-12 alkenyl; Each Y is independently C3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0246] In some embodiments, another subset of compounds of formula (I) includes: R1 is C 5-30 Alkyl, C 5-20 selected from the group consisting of alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are C 1-14 Alkyl, C 2-14 independently selected from the group consisting of alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is -(CH2) n Q, -(CH2) n -CHQR, -CHQR, and -CQ(R)2, where Q is -N(R)2 and n is selected from 1, 2, 3, 4, and 5; Each R5 is independently C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R6 is independently C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R is independently C 1-3 Alkyl, C 2-3selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 1-12 alkenyl; Each Y is independently C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0247] In some embodiments, a subset of compounds of formula (I) includes compounds of formula (IA): [ka] or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M is a bond or M'; and R is an unsubstituted C 1-3 Alkyl or -(CH2) n Q, where Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; R and R are independently selected from H, C 1-14 Alkyl, and C 2-14 alkenyl.

[0248] In some embodiments, a subset of compounds of formula (I) includes compounds of formula (II): [ka] or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; M is a bond or M′; and R is an unsubstituted C 1-3 Alkyl or -(CH2) n Q, n is 2, 3, or 4, and Q is OH, —NHC(S)N(R)2, —NHC(O)N(R)2, —N(R)C(O)R, —N(R)S(O)2R, —N(R)R8, -NHC(=NR9)N(R)2, -NHC(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M' are independently -C(O)O-, -OC(O)-, -C(O)N(R')-, R2 and R3 are independently selected from H, C ... 1-14 Alkyl and C 2-14 alkenyl.

[0249] In some embodiments, a subset of compounds of formula (I) includes compounds of formula (IIa), (IIb), (IIc), or (IIe): [ka] or a salt or isomer thereof, wherein R4 is as described herein.

[0250] In some embodiments, a subset of compounds of formula (I) includes compounds of formula (IId): [ka] or a salt or isomer thereof, wherein n is 2, 3, or 4; m, R′, R″, and R2 through R6 are as described herein. For example, each of R2 and R3 can independently be C 5-14 Alkyl and C 5-14 alkenyl.

[0251] In some embodiments, the ionizable amino lipids of the present disclosure include compounds having the following structure: [ka]

[0252] In some embodiments, the ionizable amino lipids of the present disclosure include compounds having the following structure: [ka]

[0253] In some embodiments, the non-cationic lipids of the present disclosure are 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero 1-O-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3 -phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.

[0254] In some embodiments, the PEG-modified lipids of the present disclosure include PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. In some embodiments, the PEG-modified lipid is DMG-PEG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG, and / or PEG-DPG.

[0255] In some embodiments, sterols of the present disclosure include cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and mixtures thereof.

[0256] In some embodiments, the LNPs of the present disclosure comprise an ionizable amino lipid of Compound 1, the non-cationic lipid is DSPC, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG (e.g., PEG2000-DMG).

[0257] In some embodiments, the lipid nanoparticles comprise 45-55 mole percent (mol%) of an ionizable amino lipid (e.g., Compound 1). For example, the lipid nanoparticles may comprise 45-47, 45-48, 45-49, 45-50, 45-52, 46-48, 46-49, 46-50, 46-52, 46-55, 47-48, 47-49, 47-50, 47-52, 47-55, 48-50, 48-52, 48-55, 49-50, 49-52, 49-55, or 50-55 mol% of an ionizable amino lipid (e.g., Compound 1). For example, the lipid nanoparticles may comprise 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 mol% of an ionizable amino lipid.

[0258] In some embodiments, the lipid nanoparticles comprise 5-15 mol% of a non-cationic (neutral) lipid (e.g., DSPC). For example, the lipid nanoparticles may comprise 5-6, 5-7, 5-8, 5-9, 5-10, 5-11, 5-12, 5-13, 5-14, 5-15, 6-7, 6-8, 6-9, 6-10, 6-11, 6-12, 6-13, 6-14, 6-15, 7-8, 7-9, 7-10, 7-11, 7-12, 7-13, 7-14, 7-15, 8-9, 8-10, 8-11, 8-12, 8-1 For example, the lipid nanoparticles may contain 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mol% of DSPC.

[0259] In some embodiments, the lipid nanoparticles comprise 35-40 mol% sterol (e.g., cholesterol). For example, the lipid nanoparticles may comprise 35-36, 35-37, 35-38, 35-39, 35-40, 36-37, 36-38, 36-39, 36-40, 37-38, 37-39, 37-40, 38-39, 38-40, or 39-40 mol% cholesterol. For example, the lipid nanoparticles may comprise 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, or 40 mol% cholesterol.

[0260] In some embodiments, the lipid nanoparticles contain 1-3 mol% DMG-PEG. For example, the lipid nanoparticles may contain 1-1.5, 1-2, 1-2.5, 1-3, 1.5-2, 1.5-2.5, 1.5-3, 2-2.5, 2-3, or 2.5-3 mol% DMG-PEG. For example, the lipid nanoparticles may contain 1, 1.5, 2, 2.5, or 3 mol% DMG-PEG.

[0261] In some embodiments, the lipid nanoparticles comprise 50 mol% ionizable amino lipid, 10 mol% DSPC, 38.5 mol% cholesterol, and 1.5 mol% DMG-PEG. In some embodiments, the lipid nanoparticles comprise 48 mol% ionizable amino lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% PEG2000-DMG.

[0262] In some embodiments, the LNPs of the disclosure comprise an N:P ratio of about 2:1 to about 30:1.

[0263] In some embodiments, the LNPs of the present disclosure comprise an N:P ratio of about 6:1.

[0264] In some embodiments, the LNPs of the present disclosure comprise an N:P ratio of about 3:1.

[0265] In some embodiments, the LNPs of the present disclosure comprise a weight / weight ratio of ionizable amino lipid components to RNA of about 10:1 to about 100:1.

[0266] In some embodiments, the LNPs of the present disclosure comprise a weight / weight ratio of ionizable amino lipid components to RNA of about 20:1.

[0267] In some embodiments, the LNPs of the present disclosure comprise a weight / weight ratio of ionizable amino lipid components to RNA of about 10:1.

[0268] In some embodiments, the LNPs of the present disclosure have an average diameter of about 50 nm to about 150 nm.

[0269] In some embodiments, the LNPs of the present disclosure have an average diameter of about 70 nm to about 120 nm.

[0270] Multivalent vaccines The compositions provided herein may contain RNA or multiple RNAs encoding two or more antigens of the same or different species. In some embodiments, the compositions contain RNA or multiple RNAs encoding two or more coronavirus antigens. In some embodiments, the RNA may encode 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more coronavirus antigens.

[0271] In some embodiments, two or more different mRNAs encoding antigens may be formulated in the same lipid nanoparticle.In other embodiments, two or more different RNAs encoding antigens may be formulated in separate lipid nanoparticles (each RNA is formulated in a single lipid nanoparticle).The lipid nanoparticles can then be combined and administered as a single vaccine composition (e.g., comprising multiple RNAs encoding multiple antigens), or can be administered separately.In some embodiments, when a composition comprises two different RNAs encoding antigens, the ratio of the RNAs encoding the antigens is 1:1, 1:2, 1:4, 4:1, or 2:1.

[0272] Primary or first vaccination In some embodiments, the first or primary vaccine is an mRNA vaccine encoding a 2P-stabilized spike protein. For example, the first or primary vaccine can be an mRNA encoding a spike antigen having the amino acid sequence of SEQ ID NO: 20. In other embodiments, the first vaccine can be any vaccine modality that includes a 2P-stabilized spike protein. As a non-limiting example, the first vaccine composition can be a recombinant vaccine. As used herein, "recombinant vaccine" refers to a vaccine produced by genetic engineering, a process and method for manipulating the genetic material of an organism. In most cases, recombinant vaccines contain one or more nucleic acids encoding protein antigens produced and purified in a heterologous expression system (e.g., bacteria or yeast) or purified from a large number of pathogenic organisms. After administration, the vaccinated person produces antibodies against the one or more protein antigens, thus protecting them from disease. In some embodiments, the recombinant vaccine is a vector vaccine. Viral vector vaccines contain polynucleotide sequences not derived from a virus (i.e., polynucleotides heterologous to the virus) and encode peptides, polypeptides, or proteins capable of eliciting an immune response in a host exposed to the vector. Expression of the polynucleotide results in the generation of a neutralizing antibody response and / or a cell-mediated response, e.g., a cytotoxic T cell response. Examples of viral vector vaccines include, but are not limited to, those developed by Oxford / AstraZeneca (COVID-19 Vaccine AstraZeneca), CanSino Biological Inc. / Beijing Institute of Biotechnology, Gamaleya Research Institute, Zydus Cadila, Institut Pasteur / Themis / University of Pittsburgh Center for Vaccine Research, University of Hong Kong, and Altimmune (NasoVAX). In some embodiments, the recombinant vaccine is a nucleic acid-based (e.g., DNA, mRNA) coronavirus vaccine.Exemplary DNA vaccines include those being developed by Inovio Pharmaceuticals (INO-4800), Genexine Consortium (GX-19), OncoSec and the Cancer Institute (CORVax12 and TAVO™), Karolinska Institute / Cobra Biologics, Osaka University / Anges / Takara Bio, and Takis / Applied DNA Sciences / Evvivax. Exemplary mRNA vaccines include those being developed by BioNTech / Pfizer, Imperial College London, Curevac, and Walvax Biotech / People's Liberation Army (PLA) Academy of Military Science.

[0273] Pharmaceutical preparations Provided herein are compositions (e.g., pharmaceutical compositions), methods, kits, and reagents for the prevention and / or treatment of coronaviruses, e.g., in humans and other mammals. The compositions provided herein can be used as therapeutic or prophylactic agents. They can be used in medicines to prevent and / or treat coronavirus infections.

[0274] In some embodiments, a SARS-CoV-2 vaccine containing RNA described herein can be administered to a subject (e.g., a mammalian subject, such as a human subject), and the RNA polynucleotide is translated in vivo to produce an antigenic polypeptide (antigen).

[0275] An "effective amount" of a composition (e.g., comprising RNA) is based, at least in part, on the target tissue, the type of target cell, the means of administration, the physical characteristics of the RNA (e.g., length, nucleotide composition, and / or degree of nucleoside modification), the other components of the vaccine, and other determinants such as the subject's age, weight, height, sex, and overall health. Typically, an effective amount of a composition provides an induced or boosted immune response as a function of antigen production in the subject's cells. In some embodiments, an effective amount of a composition containing an RNA polynucleotide with at least one chemical modification is more efficient than a composition containing a corresponding unmodified polynucleotide encoding the same antigen or peptide antigen. Increased antigen production may be demonstrated by increased cell transfection (percentage of cells transfected with the RNA vaccine), increased protein translation and / or expression from the polynucleotide, decreased nucleic acid degradation (e.g., as indicated by an increased duration of protein translation from the modified polynucleotide), or an altered antigen-specific immune response of the host cell.

[0276] The term "pharmaceutical composition" refers to a combination of an active agent and an inert or active carrier that makes the composition particularly suitable for in vivo or ex vivo diagnostic or therapeutic use. A "pharmaceutically acceptable carrier" is one that does not cause undesirable physiological effects after or upon administration to a subject. A carrier in a pharmaceutical composition must also be "acceptable" in the sense of being compatible with and capable of stabilizing the active ingredient. One or more solubilizing agents may be utilized as pharmaceutical carriers for delivery of the active agent. Examples of pharmaceutically acceptable carriers include, but are not limited to, biocompatible vehicles, adjuvants, additives, and diluents to achieve a usable composition in dosage form. Other examples of carriers include colloidal silicon oxide, magnesium stearate, cellulose, and sodium lauryl sulfate. Additional suitable pharmaceutical carriers and diluents, as well as pharmaceutical requirements for their use, are described in Remington's Pharmaceutical Sciences.

[0277] In some embodiments, compositions in accordance with the present disclosure (including polynucleotides and their encoded polypeptides) can be used to treat or prevent coronavirus infection. A composition can be administered prophylactically as part of an active immunization scheme, or therapeutically, to healthy individuals, or early in infection during the incubation period, or during active infection after symptom onset. In some embodiments, the amount of RNA provided to a cell, tissue, or subject can be an amount effective for immunoprophylaxis.

[0278] The composition may be administered with other prophylactic or therapeutic compounds. As a non-limiting example, the prophylactic or therapeutic compound may be an adjuvant or booster. As used herein, when referring to a prophylactic composition such as a vaccine, the term "booster" refers to an additional administration of the vaccine composition and may include a conventional booster, a seasonal booster, or a pandemic shift booster. A booster (or booster vaccine) can be administered after a previous administration of the prophylactic composition. The time between the initial administration of the prophylactic composition and the booster can be, but is not limited to, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year or more. In some embodiments, the administration time between the initial administration of the prophylactic composition and the booster is at least 6 months. In exemplary embodiments, the administration time between the initial administration of the prophylactic composition and the booster can be, but is not limited to, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, or 6 months. As described herein, the booster can contain the same or a different mRNA compared to the previously administered prophylactic composition. In some embodiments, the booster can contain a combination of the same mRNA from the previously administered prophylactic composition and at least one different mRNA. In some embodiments, the ratio of the mRNA from the previously administered prophylactic composition to the at least one different mRNA is 1:1, 1:2, 1:4, 4:1, or 2:1. In one embodiment, the ratio is 1:1. In some embodiments, the booster can contain a different mRNA compared to the previously administered prophylactic composition. In some embodiments, such a booster can contain one, two, three, four, or more mRNAs that were not present in the previously administered prophylactic composition.In some embodiments, the ratio of the two mRNA polynucleotides in the booster (neither of which was in the prophylactic composition) is 1:1, 1:2, 1:4, 4:1, or 2:1. In one embodiment, the ratio is 1:1. Booster or booster doses can be administered two or more times after the initial prophylactic (priming) dose, e.g., 2, 3, 4, 5, 6, or more times. In some embodiments, subsequent boosts are administered within several weeks, e.g., 3-4 weeks, of the first (or previous) boost. In some embodiments, a second boost is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more weeks after the first (or previous) boost. A booster, in some embodiments, is monovalent (e.g., the mRNA encodes a single antigen). In some embodiments, a booster is multivalent (e.g., the mRNA encodes two or more antigens).

[0279] In some embodiments, the booster dose is 5 μg-30 μg, 5 μg to 25 μg, 5 μg to 20 μg, 5 μg to 15 μg, 5 μg to 10 μg, 10 μg to 30 μg, 10 μg to 25 μg, 10 μg to 20 μg, 10 μg to 15 μg, 15 μg to 30 μg, 15 μg to 25 μg, 15 μg to 20 μg, 20 μg to 30 μg, 25 μg to 30 μg, or 25 μg to 300 μg. In some embodiments, the booster dose is between 10 μg and 60 μg, between 10 μg and 55 μg, between 10 μg and 50 μg, between 10 μg and 45 μg, between 10 μg and 40 μg, between 10 μg and 35 μg, between 10 μg and 30 μg, between 10 μg and 25 μg, between 10 μg and 20 μg, between 15 μg and 60 μg, between 15 μg and 55 μg, between 15 μg and 50 μg, 15μg~45μg, 15μg~40μg, 15μg~35μg, 15μg~30μg, 15μg~25μg, 15μg~20μg, 20μg~60μg, 2 0μg~55μg, 20μg~50μg, 20μg~45μg, 20μg~40μg, 20μg~35μg, 20μg~30μg, 20μg~25μg, 25 μg~60μg, 25μg~55μg, 25μg~50μg, 25μg~45μg, 25μg~40μg, 25μg~35μg, 25μg~30μg, 30μg g~60μg, 30μg~55μg, 30μg~50μg, 30μg~45μg, 30μg~40μg, 30μg~35μg, 35μg~60μg, 35μg In some embodiments, the booster dose is at least 10 μg and less than 25 μg of the composition. In some embodiments, the booster dose is at least 5 μg and less than 25 μg of the composition.For example, the booster dose is 5 μg, 10 μg, 15 μg, 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, 200 μg, 250 μg, or 300 μg. In some embodiments, the booster dose is 50 μg.

[0280] In some embodiments, the compositions may be administered intramuscularly, intranasally, or intradermally, similar to the administration of inactivated vaccines known in the art.

[0281] The compositions can be utilized in a variety of settings, depending on the prevalence of infection or the extent or level of unmet medical need. As a non-limiting example, RNA vaccines can be utilized to treat and / or prevent a variety of infectious diseases. RNA vaccines have superior properties over commercially available vaccines in that they produce much greater antibody titers, better neutralizing immunity, produce a more durable immune response, and / or provide a faster response.

[0282] Provided herein are pharmaceutical compositions comprising RNA and / or complexes, optionally in combination with one or more pharmaceutically acceptable excipients.

[0283] RNA may be formulated or administered alone or in combination with one or more other components, for example, an immunizing composition may include other components, including, but not limited to, an adjuvant.

[0284] In some embodiments, the immunizing composition does not include an adjuvant (it is adjuvant-free).

[0285] The RNA may be formulated or administered in combination with one or more pharmaceutically acceptable excipients. In some embodiments, the vaccine composition comprises at least one additional active agent (e.g., a therapeutic active agent, a prophylactic active agent, or a combination of both). The vaccine composition may be sterile, pyrogen-free, or both sterile and pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceuticals such as vaccine compositions can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety).

[0286] In some embodiments, the immunizing composition is administered to a human, human patient, or subject. For purposes of this disclosure, the phrase "active ingredient" generally refers to an RNA vaccine or a polynucleotide contained therein, such as an RNA polynucleotide (e.g., an mRNA polynucleotide) encoding an antigen.

[0287] Formulations of the vaccine compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. Generally, such preparatory methods involve bringing into association the active ingredient (e.g., mRNA polynucleotide) with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, forming, and / or packaging the product into the desired single- or multi-dose units.

[0288] The relative amounts of active ingredient, pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated, and on the route used to administer the composition. By way of example, the composition may comprise from 0.1% to 100%, e.g., 0.5 to 50%, 1 to 30%, 5 to 80%, at least 80% (w / w) active ingredient.

[0289] In some embodiments, RNA can be formulated using one or more excipients to (1) increase stability, (2) increase cell transfection, (3) allow for sustained or delayed release (e.g., from a depot formulation), (4) modify biodistribution (e.g., target specific tissues or cell types), (5) increase translation of the encoded protein in vivo, and / or (6) modify the release profile of the encoded protein (antigen) in vivo. In addition to conventional excipients such as any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersing or suspending aids, surfactants, isotonic agents, thickening or emulsifying agents, preservatives, excipients include, but are not limited to, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with RNA (e.g., for transplantation into a subject), hyaluronidase, nanoparticle mimics, and combinations thereof.

[0290] Dosage / Administration Provided herein are immunizing compositions (e.g., RNA vaccines), methods, kits, and reagents for the prevention and / or treatment of coronavirus infection in humans and other mammals. The immunizing compositions can be used as therapeutic or prophylactic agents. In some embodiments, the immunizing compositions are used to provide prophylactic protection from coronavirus infection. In some embodiments, the immunizing compositions are used to treat coronavirus infection. In some embodiments, the immunizing compositions are used to prime immune effector cells, e.g., to activate peripheral blood mononuclear cells (PBMCs) ex vivo, and then infused (or re-infused) into a subject.

[0291] The subject may be any mammal, including non-human primates and humans. Typically, the subject is a human subject.

[0292] In some embodiments, the immunizing composition (e.g., an RNA vaccine) is administered to a subject (e.g., a mammalian subject, such as a human subject) in an amount effective to induce an antigen-specific immune response. The RNA encoding the coronavirus spike protein antigen is expressed and translated in vivo to produce the antigen, which then stimulates an immune response in the subject.

[0293] Prophylactic protection from coronavirus can be achieved after administration of the immunizing composition (e.g., RNA vaccine) of the present disclosure. The immunizing composition may be administered once, twice, three times, four times, or more times, although a single administration of the vaccine (optionally followed by one booster) may be sufficient. Although less desirable, it is possible to administer the immunizing composition to infected individuals to achieve a therapeutic response. Dosage adjustments may be necessary accordingly.

[0294] Aspects of the present disclosure provide methods for eliciting an immune response in a subject against a coronavirus antigen (or multiple antigens). In some embodiments, the methods involve administering to the subject an immunization composition comprising an mRNA having an open reading frame encoding the coronavirus antigen, thereby inducing an immune response in the subject specific to the coronavirus antigen, wherein the anti-antigen antibody titer in the subject is increased after vaccination compared to the anti-antigen antibody titer in a subject vaccinated with a prophylactically effective dose of a conventional vaccine against the antigen. An "anti-antigen antibody" is a serum antibody that specifically binds to the antigen.

[0295] A prophylactically effective dose is a dose effective to prevent viral infection at a clinically acceptable level. In some embodiments, the effective dose is the dose listed on the vaccine package insert. As used herein, conventional vaccines refer to vaccines other than the mRNA vaccines of the present disclosure. For example, conventional vaccines include, but are not limited to, live microbial vaccines, inactivated microbial vaccines, subunit vaccines, protein antigen vaccines, DNA vaccines, virus-like particle (VLP) vaccines, etc. In exemplary embodiments, conventional vaccines are vaccines that have achieved regulatory approval and / or been registered with a national drug regulatory agency (e.g., the U.S. Food and Drug Administration (FDA) or the European Medicines Agency (EMA)).

[0296] In some embodiments, the anti-antigen antibody titer in the subject is increased by 1 log to 10 logs after vaccination compared to the anti-antigen antibody titer in a subject vaccinated with a prophylactically effective dose of a conventional vaccine against coronavirus or in an unvaccinated subject. In some embodiments, the anti-antigen antibody titer in the subject is increased by 1 log, 2 log, 3 log, 4 log, 5 log, or 10 log after vaccination compared to the anti-antigen antibody titer in a subject vaccinated with a prophylactically effective dose of a conventional vaccine against coronavirus or in an unvaccinated subject.

[0297] Another aspect of the present disclosure provides a method for inducing an immune response against coronavirus in a subject. The method includes administering to the subject a composition comprising mRNA including an open reading frame encoding a coronavirus antigen, thereby inducing a coronavirus-specific immune response in the subject, which immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional coronavirus vaccine at a dosage level of 2- to 100-fold higher than that of the composition.

[0298] In some embodiments, the immune response in a subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at twice the dosage level compared to the composition of the present disclosure. In some embodiments, the immune response in a subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at three times the dosage level of the composition of the present disclosure. In some embodiments, the immune response in a subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at four times, five times, ten times, fifty times, or one hundred times the dosage level of the composition of the present disclosure. In some embodiments, the immune response in a subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at 10 times to 1000 times the dosage level of the composition of the present disclosure. In some embodiments, the immune response in a subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at 100 times to 1000 times the dosage level of the composition of the present disclosure.

[0299] In other embodiments, the immune response is assessed by determining [protein] antibody titers in the subject. In other embodiments, the ability of serum or antibodies from an immunized subject to neutralize viral uptake or reduce coronavirus transformation of human B lymphocytes is tested. In other embodiments, the ability to promote strong T cell response(s) is measured using art-recognized techniques.

[0300] Another aspect of the present disclosure provides a method of eliciting an immune response against coronavirus in a subject by administering to the subject a composition comprising mRNA having an open reading frame encoding a coronavirus antigen to induce an immune response in the subject specific to the coronavirus antigen, wherein the immune response in the subject is induced 2 days to 10 weeks earlier than an immune response induced in a subject vaccinated with a prophylactically effective dose of a conventional vaccine against coronavirus. In some embodiments, the immune response in the subject is induced in a subject vaccinated with a prophylactically effective dose of a conventional vaccine at a dosage level 2-fold to 100-fold higher than that of the composition of the present disclosure.

[0301] In some embodiments, an immune response in a subject is induced 2 days, 3 days, 1 week, 2 weeks, 3 weeks, 5 weeks, or 10 weeks earlier than the immune response induced in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

[0302] Also provided herein is a method of eliciting an immune response in a subject against a coronavirus by administering to the subject mRNA having an open reading frame encoding a first antigen, wherein the RNA does not include a stabilizing element and an adjuvant is not co-formulated or co-administered with the vaccine.

[0303] The composition can be administered by any route that results in a therapeutically effective outcome. Such routes include, but are not limited to, intradermal, intramuscular, intranasal, and / or subcutaneous administration. The present disclosure provides methods that involve administering an RNA vaccine to a subject in need thereof. The exact amount required will vary from subject to subject, depending on the subject's race, age, and general condition, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. RNA is typically formulated in unit dosage form for ease of administration and uniformity of dosage. However, it will be understood that the total daily amount of RNA to be used may be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level, prophylactically effective dose level, or appropriate imaging dose level for any particular patient will depend on a variety of factors, including the disorder being treated and the severity of the disorder, the activity of the specific compound used, the specific composition used, the patient's age, weight, general health, sex, and diet, the time, route of administration, and excretion rate of the specific compound used, the duration of treatment, drugs used in combination or concomitantly with the specific compound used, and similar factors well known in the medical arts.

[0304] An effective amount (e.g., an effective dose) of the RNA provided herein can be as low as 20 μg, administered, for example, as a single dose or two 10 μg doses. In some embodiments, the effective amount (e.g., an effective dose) is 20 μg to 300 μg, 5 μg to 30 μg, 5 μg to 25 μg, 5 μg to 20 μg, 5 μg to 15 μg, 5 μg to 10 μg, 10 μg to 30 μg, 10 μg to 25 μg, 10 μg to 20 μg, 10 μg to 15 μg, 15 μg to 30 μg, 15 μg to 25 μg, 15 μg to 20 μg, 20 μg to 30 μg, 25 μg to 30 μg, or a total dose of 25 μg to 300 μg. In some embodiments, the effective dose (e.g., an effective amount) is at least 10 μg and less than 25 μg of the composition. In some embodiments, the effective dose (e.g., effective amount) is at least 5 μg and less than 25 μg of the composition. For example, the effective amount can be 5 μg, 10 μg, 15 μg, 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, 200 μg, 250 μg, or 300 μg total dose. In some embodiments, the effective amount (e.g., effective amount) is a total dose of 10 μg. In some embodiments, the effective amount is a 20 μg total dose (e.g., two 10 μg doses). In some embodiments, the effective amount is a 25 μg total dose. In some embodiments, the effective amount is a 30 μg total dose. In some embodiments, the effective amount is a 50 μg total dose. In some embodiments, the effective amount is a 60 μg total dose (e.g., two 30 μg doses). In some embodiments, the effective amount is a 75 μg total dose. In some embodiments, the effective amount is a 100 μg total dose. In some embodiments, the effective amount is a 150 μg total dose. In some embodiments, the effective amount is a 200 μg total dose. In some embodiments, the effective amount is a 250 μg total dose. In some embodiments, the effective amount is a 300 μg total dose.Any of the doses provided above may be an effective amount for a booster dose, for example, in some embodiments, the booster dose is a 50 μg total dose. In some embodiments, the composition comprises two or more mRNA polynucleotides, and the effective amount is a 20 μg total dose (e.g., 10 μg of a first mRNA and 10 μg of a second mRNA). In some embodiments, the composition comprises two or more mRNA polynucleotides, and the effective amount is a 50 μg total dose (e.g., 25 μg of a first mRNA and 25 μg of a second mRNA). In some embodiments, the composition comprises two or more mRNA polynucleotides, and the effective amount is a 100 μg total dose (e.g., 50 μg of a first mRNA and 50 μg of a second mRNA).

[0305] The RNAs described herein can be formulated in dosage forms described herein, such as for intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous) administration.

[0306] Vaccine effectiveness Some embodiments of the present disclosure provide formulations of compositions (e.g., RNA vaccines) in which the RNA is formulated in an amount effective to elicit an antigen-specific immune response (e.g., production of antibodies specific to a coronavirus antigen) in a subject. An "effective amount" is a dose of RNA effective to elicit an antigen-specific immune response. Also provided herein are methods of inducing an antigen-specific immune response in a subject.

[0307] As used herein, an immune response to a vaccine or LNP of the present disclosure refers to the development in a subject of a humoral and / or cellular immune response to the coronavirus protein(s) present in the vaccine. For purposes of this disclosure, a "humoral" immune response refers to an immune response mediated by antibody molecules, including, for example, secretory (IgA) or IgG molecules, while a "cellular" immune response refers to one mediated by T-lymphocytes (e.g., CD4+ helper and / or CD8+ T cells (e.g., CTLs) and / or other white blood cells). One important aspect of cellular immunity involves antigen-specific responses by cytolytic T cells (CTLs). CTLs have specificity for peptide antigens expressed on the cell surface and presented in association with proteins encoded by the major histocompatibility complex (MHC). CTLs help induce and promote the destruction of intracellular microorganisms or the lysis of cells infected with such microorganisms. Another aspect of cellular immunity involves antigen-specific responses by helper T cells. Helper T cells act to stimulate the function and help focus the activity of nonspecific effector cells against cells that present peptide antigens on their surface in conjunction with MHC molecules. The cellular immune response also results in the production of cytokines, chemokines, and other such molecules produced by activated T cells and / or other leukocytes, including those derived from CD4+ and CD8+ T cells.

[0308] In some embodiments, the antigen-specific immune response is characterized by measuring the anti-coronavirus antigen antibody titer produced in a subject administered a composition provided herein. Antibody titer is a measurement of the amount of antibodies in a subject, for example, antibodies specific to a particular antigen or antigen epitope. Antibody titer is typically expressed as the reciprocal of the highest dilution that produces a positive result. For example, enzyme-linked immunosorbent assay (ELISA) is a common assay for quantifying antibody titer.

[0309] A variety of serological tests can be used to measure antibodies to an encoded antigen of interest, e.g., the SAR-CoV-2 virus or a SAR-CoV-2 viral antigen, e.g., a domain thereof, of the SAR-CoV-2 spike or S protein. These tests include hemagglutination inhibition tests, complement fixation tests, fluorescent antibody tests, enzyme-linked immunosorbent assays (ELISAs), and plaque reduction neutralization tests (PRNTs). Each of these tests measures a different antibody activity. In an exemplary embodiment, a plaque reduction neutralization test, or PRNT (e.g., PRNT50 or PRNT90), is used as a serological correlate of protection. PRNTs measure the biological parameter of in vitro virus neutralization and are the most serologically virus-specific test for a particular class of viruses, correlating well with serum levels of protection from viral infection.

[0310] The basic design of the PRNT allows for virus-antibody interaction in a test tube or microtiter plate, where the mixture is plated onto virus-susceptible cells, preferably mammalian-derived cells, to measure the antibody's effect on viral infectivity. The cells are covered with a semi-solid medium that limits the spread of progeny virus. Each virus that initiates a productive infection produces a localized area of ​​infection (plaques) that can be detected by various methods. The plaques are counted and compared back to the starting virus concentration to determine the percentage reduction in total viral infectivity. In a PRNT, the serum sample to be tested is typically serially diluted before being mixed with a standardized amount of virus. Because the virus concentration is kept constant, individual plaques can be identified and counted when added to susceptible cells and overlaid with semi-solid medium. In this way, a PRNT endpoint titer can be calculated for each serum sample at any selected percent reduction in viral activity.

[0311] In functional assays aimed at assessing vaccine immunogenicity, serum sample dilution series for antibody titration should ideally begin below the "seroprotection" threshold titer. For SARS-CoV-2 neutralizing antibodies, the "seroprotection" threshold titer remains unknown, but a seropositivity threshold of 1:10 can be considered the seroprotection threshold in certain embodiments.

[0312] In some embodiments, a neutralizing immune response is an immune response that produces antibody levels that meet or exceed the seroprotective threshold.

[0313] The PRNT endpoint titer is expressed as the reciprocal of the last serum dilution that shows the desired percentage reduction in plaque counts. PRNT titers can be calculated based on a 50% or greater reduction in plaque counts (PRNT50). PRNT50 titers are preferred over titers that use a higher cutoff for vaccine sera (e.g., PRNT90), as they provide more accurate results from the linear portion of the titration curve.

[0314] There are several methods for calculating PRNT titers. The simplest and most widely used method for calculating titers is to count plaques and report the titer as the reciprocal of the last serum dilution, showing a greater than 50% reduction in the number of input plaques based on a back titration of the input plaques. More accurate results may be calculated using curve fitting methods from several serum dilutions. There are various computer analysis programs available for this (e.g., SPSS or GraphPad Prism).

[0315] In some embodiments, antibody titers are used to assess whether a subject has contracted an infectious disease or to determine whether immunization is necessary. In some embodiments, antibody titers are used to quantify the strength of an autoimmune response, to determine whether a booster immunization is necessary, to determine whether a previous vaccine was effective, and to confirm recent or past infection. According to the present disclosure, antibody titers can be used to quantify the strength of an immune response induced in a subject by a composition (e.g., an RNA vaccine).

[0316] In some embodiments, the anti-coronavirus antigen antibody titer produced in a subject is increased by at least 1 log compared to a control. For example, the anti-coronavirus antigen antibody titer produced in a subject can be increased by at least 1.5, at least 2, at least 2.5, or at least 3 logs compared to a control. In some embodiments, the anti-coronavirus antigen antibody titer produced in a subject is increased by 1, 1.5, 2, 2.5, or 3 logs compared to a control. In some embodiments, the anti-coronavirus antigen antibody titer produced in a subject is increased by 1 to 3 logs compared to a control. For example, the anti-coronavirus antigen antibody titer produced in a subject can be increased by 1 to 1.5, 1 to 2, 1 to 2.5, 1 to 3, 1.5 to 2, 1.5 to 2.5, 1.5 to 3, 2 to 2.5, 2 to 3, or 2.5 to 3 logs compared to a control.

[0317] In some embodiments, the anti-coronavirus antigen antibody titer produced in a subject is increased by at least 2-fold compared to a control. For example, the anti-coronavirus antigen antibody titer produced in a subject can be increased by at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold compared to a control. In some embodiments, the anti-coronavirus antigen antibody titer produced in a subject is increased by 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold compared to a control. In some embodiments, the anti-coronavirus antigen antibody titer produced in a subject is increased by 2-10-fold compared to a control. For example, the anti-coronavirus antigen antibody titer produced in a subject can be increased by 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8-10, 8-9, or 9-10 fold compared to a control.

[0318] In some embodiments, the antigen-specific immune response is measured as the ratio of the geometric mean titers (GMT) of serum neutralizing antibody titers to coronavirus (referred to as the geometric mean ratio (GMR)). The geometric mean titer (GMT) is the average antibody titer in a group of subjects, calculated by multiplying all the values ​​together and taking the nth root of that number, where n is the number of subjects with available data.

[0319] In some embodiments, the control is the anti-coronavirus antigen antibody titer produced in a subject who has not received the composition (e.g., an RNA vaccine). In some embodiments, the control is the anti-coronavirus antigen antibody titer produced in a subject who has received a recombinant or purified protein vaccine. Recombinant protein vaccines typically contain protein antigens produced in heterologous expression systems (e.g., bacteria or yeast) or purified from abundant pathogenic organisms.

[0320] In some embodiments, the ability of a composition (e.g., an RNA vaccine) to be effective is measured in a mouse model. For example, a composition may be administered to a mouse model, and the mouse model may be evaluated for the induction of neutralizing antibody titers. Viral challenge studies may also be used to evaluate the efficacy of a vaccine of the present disclosure. For example, a composition may be administered to a mouse model, the mouse model may be challenged with a virus, and the mouse model may be evaluated for survival and / or an immune response (e.g., a neutralizing antibody response, a T cell response (e.g., a cytokine response)).

[0321] In some embodiments, the effective amount of a composition (e.g., an RNA vaccine) is a reduced dose compared to the standard therapeutic dose of a recombinant protein vaccine. As used herein, "standard of care" refers to medical or psychological treatment guidelines, which may be general or specific. "Standard of care" refers to appropriate treatment based on scientific evidence and collaboration among medical professionals involved in the treatment of a given condition. It is the diagnostic and treatment process that a physician / clinician follows for a particular type of patient, disease, or clinical setting. As used herein, a "standard therapeutic dose" refers to a dose of a recombinant or purified protein vaccine, or a live-attenuated or inactivated vaccine, or a VLP vaccine, that a physician / clinician or other medical professional administers to a subject to treat or prevent a coronavirus infection or a related condition while following standard therapeutic guidelines for treating or preventing a coronavirus infection or a related condition.

[0322] In some embodiments, the anti-coronavirus antigen antibody titer produced in a subject administered an effective amount of the composition is equivalent to the anti-coronavirus antigen antibody titer produced in a control subject administered a standard of care dose of a recombinant or purified protein vaccine, or a live attenuated or inactivated vaccine, or a VLP vaccine.

[0323] Vaccine efficacy can be assessed using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun1;201(11):1607-10). For example, vaccine efficacy can be measured in a double-blind randomized controlled clinical trial. Vaccine efficacy can be expressed as the proportional reduction in disease incidence (AR) between the incidence rate of the unvaccinated study cohort (ARU) and the incidence rate of the vaccinated study cohort (ARV), and can be calculated from the relative risk (RR) of disease in the vaccinated group using the following formula: Efficacy = (ARU-ARV) / ARU x 100, and Efficacy = (1-RR) x 100

[0324] Similarly, vaccine efficacy can be assessed using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun1;201(11):1607-10). Vaccine efficacy assesses how a vaccine (which may already be known to have high vaccine efficacy) reduces disease in a population. This measure can assess not only the vaccine itself but also the net balance of benefits and side effects of a vaccination program under natural field conditions, rather than controlled clinical trials. Vaccine efficacy is proportional to vaccine efficacy (potency) but is also influenced by the degree of immunization of target groups within a population, as well as other non-vaccine-related factors that affect "real-world" outcomes such as hospitalizations, outpatient visits, or costs. For example, retrospective case-control analyses can be used to compare vaccination rates in a set of infected cases and appropriate controls. Vaccine efficacy can be expressed as a difference in proportions using the odds ratio (OR) of developing an infection despite vaccination. Efficacy = (1-OR) x 100

[0325] In some embodiments, the efficacy of the composition (e.g., an RNA vaccine) is at least 60% relative to unvaccinated control subjects. For example, the efficacy of the composition can be at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 95%, at least 98%, or 100% relative to unvaccinated control subjects.

[0326] Sterilizing immunity. Sterilizing immunity refers to a unique immune state that effectively prevents pathogen infection in a host. In some embodiments, an effective amount of a composition of the present disclosure is sufficient to provide sterilizing immunity in a subject for at least one year. For example, an effective amount of a composition of the present disclosure is sufficient to provide sterilizing immunity in a subject for at least two years, at least three years, at least four years, or at least five years. In some embodiments, an effective amount of a composition of the present disclosure is sufficient to provide sterilizing immunity in a subject at a dose at least 5-fold lower than a control. For example, an effective amount may be sufficient to provide sterilizing immunity in a subject at a dose at least 10-fold, 15-fold, or 20-fold lower than a control.

[0327] Detectable Antigen. In some embodiments, an effective amount of a composition of the present disclosure is sufficient to produce a detectable level of a coronavirus antigen as measured in the serum of a subject 1 to 72 hours after administration.

[0328] Titer. Antibody titer is a measure of the number of antibodies in a subject, for example, antibodies specific to a particular antigen (e.g., an anti-coronavirus antigen). Antibody titer is typically expressed as the reciprocal of the highest dilution that produces a positive result. For example, enzyme-linked immunosorbent assay (ELISA) is a common assay for quantifying antibody titer.

[0329] A neutralizing immune response is an immune response that is a neutralizing antibody response and / or an effective neutralizing T cell response. In some embodiments, a neutralizing antibody response produces antibody levels that meet or exceed the seroprotective threshold.

[0330] An effective T cell response is one that produces baseline levels of virus-activated or virus-specific T cells, including CD8+ and CD4+ T helper type 1 cells. CD8+ cytotoxic T lymphocytes typically clear intracellular viral compartments, while CD4+ T cells perform a variety of functions in the body, including helping B and other T cells and promoting memory generation and indirect or direct cytotoxic activity. In some embodiments, effective T cells comprise a higher percentage of CD8+ and / or CD4+ T cells compared to baseline levels (naive subjects). In some embodiments, these T cells are differentiated into an early-stage memory phenotype, accompanied by co-expression of CD27 and CD28.

[0331] In some embodiments, an effective amount of a composition of the present disclosure is sufficient to produce a neutralizing antibody titer of 1,000 to 10,000 produced by neutralizing antibodies to a coronavirus antigen, as measured in the serum of a subject 1 to 72 hours after administration. In some embodiments, an effective amount is sufficient to produce a neutralizing antibody titer of 1,000 to 5,000 produced by neutralizing antibodies to a coronavirus antigen, as measured in the serum of a subject 1 to 72 hours after administration. In some embodiments, an effective amount is sufficient to produce a neutralizing antibody titer of 5,000 to 10,000 produced by neutralizing antibodies to a coronavirus antigen, as measured in the serum of a subject 1 to 72 hours after administration.

[0332] In some embodiments, the neutralizing antibody titer is at least 100 NT 50 For example, the neutralizing antibody titer is at least 200, 300, 400, 500, 600, 700, 800, 900, or 1000 NT. 50 In some embodiments, the neutralizing antibody titer may be at least 10,000 NT. 50In some embodiments, the neutralizing antibody titer is at least 100 neutralizing units per milliliter (NU / mL). For example, the neutralizing antibody titer can be at least 200, 300, 400, 500, 600, 700, 800, 900, or 1000 NU / mL. In some embodiments, the neutralizing antibody titer is at least 10,000 NU / mL.

[0333] In some embodiments, the anti-coronavirus antigen antibody titer produced in a subject is increased by at least 1 log compared to a control. For example, the anti-coronavirus antigen antibody titer produced in a subject can be increased by at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 logs compared to a control.

[0334] In some embodiments, the anti-coronavirus antigen antibody titer produced in the subject is increased by at least 2-fold compared to a control, for example, the anti-coronavirus antigen antibody titer produced in the subject is increased by at least 3, 4, 5, 6, 7, 8, 9, or 10-fold compared to a control.

[0335] In some embodiments, the geometric mean, which is the nth root of the product of n numbers, is commonly used to describe proportional growth. In some embodiments, the geometric mean is used to characterize the antibody titer produced in a subject.

[0336] The control can be, for example, an unvaccinated subject, or a subject administered a live attenuated virus vaccine, an inactivated virus vaccine, or a protein subunit vaccine.

[0337] Further embodiments 1. A method comprising administering to a subject a vaccine comprising a nucleic acid encoding a SARS-CoV-2 spike antigen and optionally a 2P-stabilized spike antigen of a second circulating SARS-CoV-2 virus, wherein the subject has previously been administered a first vaccine comprising a nucleic acid encoding a first SARS-CoV-2 2P-stabilized spike antigen of a first circulating SARS-CoV-2 virus, wherein each of the first and second 2P-stabilized spike antigens is administered in an amount effective to induce an immune response specific to the first antigen and the second antigen, and wherein the second circulating SARS-CoV-2 virus has a spike protein having an amino acid sequence that has at least one amino acid mutation compared to the spike protein amino acid sequence of the first circulating SARS-CoV-2 virus, wherein the mutation is an amino acid substitution, deletion, or insertion.

[0338] 2. A method comprising administering to a subject a first vaccine comprising a nucleic acid encoding a first SARS-CoV-2 2P stabilized spike antigen; and administering to the subject a second vaccine comp...

Claims

1. A vaccine comprising messenger ribonucleic acid (mRNA) comprising an open reading frame encoding a SARS-CoV-2 S protein formulated in a lipid nanoparticle, said mRNA comprising an open reading frame comprising nucleosides consisting of N1-methyl-pseudouridine, adenosine, guanosine, and cytidine, said open reading frame encoding a full-length SARS-CoV-2 spike (S) protein, said S protein having one or more of the following amino acid mutations relative to SEQ ID NO:20: G142D, ΔN211, L212I, S373P, S375F, N440K, Q498R, Y505H, H655Y, N679K, Q954H, and N969K.

2. A vaccine comprising messenger ribonucleic acid (mRNA) comprising an open reading frame encoding a SARS-CoV-2 S protein formulated in a lipid nanoparticle, said mRNA comprising an open reading frame comprising nucleosides consisting of N1-methyl-pseudouridine, adenosine, guanosine, and cytidine, said open reading frame encoding a full-length SARS-CoV-2 spike (S) protein, said S protein having one or more of the following amino acid mutations in the N-terminal domain relative to SEQ ID NO:20: G142D, ΔN211, and L212I.

3. A vaccine comprising messenger ribonucleic acid (mRNA) comprising an open reading frame encoding a SARS-CoV-2 S protein formulated in a lipid nanoparticle, said mRNA comprising an open reading frame comprising nucleosides consisting of N1-methyl-pseudouridine, adenosine, guanosine, and cytidine, said open reading frame encoding a full-length SARS-CoV-2 spike (S) protein, said S protein having one or more of the following amino acid mutations in the receptor binding domain (RBD) relative to SEQ ID NO:20: S373P, S375F, N440K, Q498R, and Y505H.

4. The vaccine of claim 1, wherein the SARS-CoV-2 spike protein comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO:

20.

5. The vaccine described in any one of claims 1 to 4, wherein the lipid nanoparticles comprise 20 to 60 mol% ionizable amino lipid, 5 to 25 mol% neutral lipid, 25 to 55 mol% sterol, and 0.5 to 15 mol% polyethylene glycol (PEG)-modified lipid.

6. The method of claim 1, wherein the ionizable amino lipid has the formula (I): 【Chemistry 1】 or a salt thereof, R 1 is selected from the group consisting of C 5-30 alkyl, C 5-20 alkenyl, and -R"M'R'; R 2 and R 3 are independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl; R 4 is --(CH 2 ) n Q, where Q is --OR and n is selected from 1, 2, 3, 4, and 5; Each R 5 is H; Each R 6 is H; M and M' are independently selected from -C(O)O- and -OC(O)-; R 7 is H; R is H; R' is selected from the group consisting of C 1-18 alkyl and C 2-18 alkenyl; R″ is selected from the group consisting of C 3-14 alkyl and C 3-14 alkenyl; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; The vaccine of claim 5.

7. The compound of formula (I) having the formula (IId): 【Chemistry 2】 or a salt thereof, n is 2, 3, or 4; The vaccine of claim 6.

8. The compound of formula (I): 【Chemistry 3】 8. The vaccine of claim 6 or 7, comprising:

9. A vaccine described in any one of claims 5 to 8, wherein the sterol is cholesterol or a derivative thereof.

10. The vaccine described in any one of claims 5 to 9, wherein the neutral lipid is 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC).

11. The vaccine described in any one of claims 5 to 10, wherein the PEG-modified lipid is 1,2 dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000DMG).

12. A vaccine as described in any one of claims 1 to 11 for use in a method for inducing a neutralizing immune response against a SARS-CoV-2 variant in a subject, the method comprising administering the vaccine to the subject.

13. A vaccine as described in any one of claims 1 to 11 for use in a method for inducing a neutralizing immune response against multiple SARS-CoV-2 variants in a subject, the method comprising administering the vaccine to the subject.

Images