Compounds and methods for reducing expression of DUX4

Abstract

Compounds, pharmaceutical compositions and methods of use are provided for reducing the amount or activity of DUX4 RNA in cells or animals, and in some cases, for reducing the amount of DUX4 protein in cells or animals. Such compounds, methods and pharmaceutical compositions are useful for improving at least one symptom or characteristic of muscular dystrophy. Such symptoms and characteristics include muscle weakness and / or muscle wasting of facial, scapular and / or humeral muscles, which may progress to trunk and / or lower limb muscles. Such muscular dystrophy includes facioscapular muscular dystrophy (FSHD).

Description

[Technical field]

[0001] Sequence Listing This application has been filed with an electronic sequence listing, which is provided in a file entitled BIOL0415WOSEQ_ST25.txt, created on January 11, 2022, and having a size of 356 KB. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0002] Compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of DUX4 RNA in cells or animals, and in some cases, for reducing the amount of DUX4 protein in cells or animals. Such compounds, methods, and pharmaceutical compositions are useful for improving at least one symptom or characteristic of muscular dystrophy or neuromuscular disorder. Such symptoms and characteristics include muscle weakness and muscle wasting of facial, scapular, and / or humeral muscles, which may progress to trunk and / or lower limb muscles.

[0003] Such muscular dystrophies include facioscapulohumeral muscular dystrophy (FSHD). [Background technology]

[0004] Facioscapular muscular dystrophy (FSHD) is a progressive skeletal muscle disorder that affects the facial, scapular, and / or humeral muscles.FSHD is characterized by a variety of clinical symptoms, including but not limited to muscle weakness and muscle wasting in the facial, scapular, and / or humeral muscles, and may progress to the muscles of the trunk and lower limbs.The disorder is caused by the abnormal expression of double homeobox 4 (DUX4) in skeletal muscle cells.

[0005] Currently, there is a lack of suitable options for treating muscular dystrophies such as FSHD. It is therefore an object herein to provide compounds, methods, and pharmaceutical compositions for treating such diseases or disorders. Summary of the Invention

[0006] Provided herein are compounds, pharmaceutical compositions and methods of use for reducing the amount or activity of DUX4 RNA, and in certain embodiments, for reducing the amount of DUX4 protein in cells or animals. In certain embodiments, the animal has a disease or disorder associated with DUX4. In certain embodiments, the animal has muscular dystrophy. In certain embodiments, the animal has neuromuscular disorder. In certain embodiments, the animal has facioscapulohumeral muscular dystrophy (FSHD). In certain embodiments, the compound useful for reducing the amount or activity of DUX4 RNA is an oligomeric compound. In certain embodiments, the compound useful for reducing the amount or activity of DUX4 RNA is a modified oligonucleotide.

[0007] Also provided is a method useful for improving at least one symptom or characteristic of disease or disorder associated with DUX4.In certain embodiments, the disease or disorder associated with DUX4 is a neuromuscular disorder.In certain embodiments, the disease or disorder associated with DUX4 is a muscular dystrophy.In certain embodiments, the muscular dystrophy is facioscapulohumeral muscular dystrophy (FSHD).In certain embodiments, the symptom or characteristic includes muscle weakness and / or muscle wasting of facial, scapular, and / or humeral muscles, which may progress to trunk and / or lower limb muscles. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0008] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless otherwise specified. Furthermore, the use of the term "including" and other forms such as "comprises" and "includes" is not limiting. Also, terms such as "element" or "component" include both elements and components that include one unit and elements and components that include two or more subunits, unless expressly stated otherwise.

[0009] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are expressly incorporated herein by reference in their entirety with respect to the portions of the documents discussed herein.

[0010] definition Unless specific definitions are given, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, patent applications, published patent applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0011] Unless otherwise stated, the following terms have the following meanings.

[0012] As used herein, "2'-deoxynucleoside" refers to a nucleoside that contains a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside that contains a 2'-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside, or a nucleoside that contains an unmodified 2'-deoxyribosyl sugar moiety, may contain a modified nucleobase or an RNA nucleobase (uracil).

[0013] As used herein, "2'-MOE" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-MOE sugar moiety" or "2'-O-methoxyethyl sugar moiety" means a sugar moiety having a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety is in the β-D configuration. "MOE" means O-methoxyethyl.

[0014] As used herein, "2'-MOE nucleoside" or "2'-O(CH2)2OCH3 nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety (or a 2'-O(CH2)2OCH3 ribosyl sugar moiety).

[0015] As used herein, "2'-OMe" refers to a 2'-OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-O-methyl sugar moiety" refers to a sugar moiety having a 2'-OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, 2'-OMe has a β-D ribosyl stereochemical configuration.

[0016] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0017] As used herein, "2'-F" refers to a 2'-fluoro group in place of the 2'-OH group of a ribosyl sugar moiety. A "2'-F sugar moiety" or "2'-fluoro ribosyl sugar moiety" refers to a sugar moiety having a 2'-F group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, 2'-F has a β-D ribosyl stereochemical configuration.

[0018] As used herein, "2'-F nucleoside" means a nucleoside that includes a 2'-F sugar moiety.

[0019] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted furanosyl sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means that the sugar moiety includes at least one 2'-substituent group other than H or OH.

[0020] As used herein, "3' target site" refers to the 3'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0021] As used herein, "5' target site" refers to the 5'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0022] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0023] As used herein, "abasic sugar moiety" refers to the sugar portion of a nucleoside that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as "abasic nucleosides."

[0024] As used herein, "administration" or "administering" means providing an agent or composition to an animal.

[0025] As used herein, "improve" in relation to treatment means an improvement in at least one symptom or characteristic compared to the same symptom or characteristic without treatment.In certain embodiments, improvement is a reduction in the severity or frequency of a symptom or characteristic, or a delay in the onset or progression of the severity or frequency of a symptom or characteristic.In certain embodiments, the symptom or characteristic is muscle weakness or wasting of the facial, scapular, and / or humeral muscles, which may progress to the muscles of the trunk and lower limbs.The progression or severity of an indicator can be determined by subjective or objective measures, which are known to those skilled in the art.

[0026] As used herein, "animal" means a human or non-human animal.

[0027] As used herein, "antisense activity" refers to any detectable and / or measurable change that can result from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of an antisense compound.

[0028] As used herein, "antisense agent" means an antisense compound and optionally one or more additional features, such as a sense compound.

[0029] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0030] As used herein, "sense compound" means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.

[0031] As used herein, "antisense oligonucleotide" refers to an oligonucleotide that comprises the oligonucleotide portion of an antisense compound that can hybridize to a target nucleic acid and has at least one antisense activity.Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0032] As used herein, "sense oligonucleotide" means an oligonucleotide that includes an oligonucleotide portion of a sense compound that is capable of hybridizing to an antisense oligonucleotide.

[0033] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0034] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that comprises two rings, where a second ring is formed via a bridge that connects two of the atoms of the first ring, thereby forming a bicyclic structure.In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety.In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety.In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl sugar moiety.

[0035] As used herein, "blunt" or "blunt-ended" in reference to an oligomeric duplex formed by two oligonucleotides means that there are no unpaired nucleotides at the ends (i.e., no overhanging nucleotides). One or both ends of a double-stranded RNAi agent may be blunt.

[0036] As used herein, "cell targeting moiety" means a conjugate group or a portion of a conjugate group that is capable of binding to a specific cell type(s).

[0037] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties similar to cerebrospinal fluid (e.g., osmolality, pH, and / or electrolytes) and is biocompatible with CSF.

[0038] As used herein, "chiral enriched population" refers to a plurality of molecules of the same molecular formula, wherein the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules that would be expected to contain the same particular stereochemical configuration at the same particular chiral center in the population if the particular chiral center were stereorandom.A chiral enriched population of molecules that have multiple chiral centers in each molecule can contain one or more stereorandom chiral centers.In certain embodiments, the molecule is a modified oligonucleotide.In certain embodiments, the molecule is an oligomeric compound that includes modified oligonucleotide.

[0039] As used herein, "cleavable moiety" means a bond or group that is cleaved under physiological conditions, eg, inside a cell, animal, or human.

[0040] As used herein, "complementary" with respect to an oligonucleotide means that when the nucleobase sequences of the oligonucleotide and another nucleic acid are aligned in opposite orientations, at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of the other nucleic acid or one or more portions thereof are capable of hydrogen bonding with each other. As used herein, "complementary nucleobases" refers to nucleobases that are capable of forming hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (C) and cytosine (D) and cytosine (E). m Examples of modified nucleobases include guanine (G) and ribozyme (R). Certain modified nucleobases that pair with natural nucleobases or other modified nucleobases are known in the art. For example, inosine can pair with adenosine, cytosine, or uracil. Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, "fully complementary" or "100% complementary" in reference to an oligonucleotide, or a portion thereof, means that an oligonucleotide, or a portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0041] As used herein, a "region of complementarity" with respect to an oligonucleotide is the stretch of nucleobases of an oligonucleotide that is complementary to a second oligonucleotide or target nucleic acid.

[0042] As used herein, "conjugate group" refers to a group of atoms directly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that joins the conjugate moiety to the oligonucleotide.

[0043] As used herein, "conjugate linker" means a single bond or a group of atoms that contains at least one bond that connects a conjugate moiety to an oligonucleotide.

[0044] As used herein, "conjugate moiety" means a group of atoms attached to an oligonucleotide via a conjugate linker.

[0045] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to one another in a sequence.

[0046] As used herein, "constrained ethyl" or "cEt" or "cEt modified sugar moiety" means a β-D ribosyl bicyclic sugar moiety in which the second ring of the bicyclic sugar is formed via a bridge joining the 4'-carbon and 2'-carbon of the β-D ribosyl sugar moiety, where the bridge has the formula 4'-CH(CH3)-O-2' and the methyl group of the bridge is in the S configuration.

[0047] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt modified sugar moiety.

[0048] As used herein, "deoxy region" refers to a region of 5-12 contiguous nucleotides in which at least 70% of the nucleosides are 2'-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from 2'-β-D-deoxynucleosides, bicyclic nucleosides, and 2'-substituted nucleosides. In certain embodiments, the deoxy region supports RNase H activity. In certain embodiments, the deoxy region is the gap or an internal region of a gapmer.

[0049] As used herein, "diluent" refers to a component of a composition that lacks pharmacological activity, but is medicamentally necessary or desirable. For example, the diluent of a composition to be injected can be a liquid, such as aCSF, PBS, or saline.

[0050] As used herein, "double strand" in relation to a region or oligonucleotide refers to the duplex formed by the complementary strands of nucleic acid (including but not limited to oligonucleotide) hybridized with each other.In certain embodiments, the two strands of a double strand region are separate molecules.In certain embodiments, the two strands are regions of the same molecule that are folded back on themselves (e.g., hairpin structure).

[0051] As used herein, "duplex" or "duplex region" refers to the structure formed by two oligonucleotides or portions thereof that are hybridized to one another.

[0052] As used herein, "gapmer" refers to a modified oligonucleotide comprising an internal region having multiple nucleosides that support RNase H cleavage and that is disposed between external regions having one or more nucleosides, the nucleosides comprising the internal region being chemically distinct from the nucleoside(s) comprising the external region. The internal region may be referred to as a "gap" and the external region may be referred to as a "wing" or "wing segment". In certain embodiments, the internal region is a deoxy region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counting from the 5' end of the internal region. Unless otherwise indicated, "gapmer" refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap comprises one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, with the remainder of the nucleosides of the gap being 2'-β-D-deoxynucleosides. As used herein, the term "MOE gapmer" refers to a gapmer having a gap comprising a 2'-β-D-deoxynucleoside and wings comprising 2'-MOE nucleosides. As used herein, the term "mixed wing gapmer" refers to a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.

[0053] As used herein, a "hot spot region" is a range of nucleobases on a target nucleic acid suitable for oligomeric agent or oligomeric compound mediated reduction of the amount or activity of the target nucleic acid.

[0054] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0055] As used herein, "internucleoside bond" refers to the covalent bond between successive nucleosides in an oligonucleotide.As used herein, "modified internucleoside bond" refers to any internucleoside bond other than phosphodiester internucleoside bond."Phosphorothioate internucleoside bond" or "PS internucleoside bond" is a modified internucleoside bond in which one of the non-bridging oxygen atoms of phosphodiester internucleoside bond is replaced with a sulfur atom.

[0056] As used herein, "inverted nucleoside" means a nucleotide having 3' to 3' and / or 5' to 5' internucleoside linkages as shown herein.

[0057] As used herein, "inverted sugar moiety" means the sugar portion of an inverted nucleoside having 3' to 3' and / or 5' to 5' internucleoside linkages or an abasic sugar portion.

[0058] As used herein, "linked nucleosides" are nucleosides that are joined in contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0059] As used herein, "linker nucleoside" refers to a nucleoside that connects an oligonucleotide to a conjugate moiety, either directly or indirectly. The linker nucleoside is located within the conjugate linker of an oligomeric compound. The linker nucleoside is not considered to be part of the oligonucleotide moiety of the oligomeric compound, even if they are contiguous with the oligonucleotide.

[0060] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first nucleic acid sequence that is not complementary to a corresponding nucleobase of a second nucleic acid sequence, or target nucleic acid, when the first and second nucleic acid sequences are aligned in opposite orientations.

[0061] As used herein, "motif" refers to a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0062] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes modifications such as substituents that do not form a bridge between two atoms of the sugar to form a second ring.

[0063] As used herein, "nucleobase" refers to unmodified nucleobase or modified nucleobase. As used herein, "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U) or guanine (G). As used herein, "modified nucleobase" is an atomic group other than unmodified A, T, C, U or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

[0064] As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0065] As used herein, "nucleoside" means a compound or fragment of a compound that includes a nucleobase and a sugar moiety, each of which, independently, is unmodified or modified.

[0066] As used herein, "modified nucleoside" refers to a nucleoside that includes a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides that lack a nucleobase. "Linked nucleosides" are nucleosides that are joined in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0067] As used herein, "oligomeric agent" refers to an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound. An oligomeric agent may be a single stranded oligomeric compound or an oligomeric duplex formed by two complementary oligomeric compounds.

[0068] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0069] The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "duplex oligomeric compound."

[0070] As used herein, "oligonucleotide" refers to a chain of linked nucleosides connected via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8-50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modification. An oligonucleotide may be paired with a second oligonucleotide complementary to the oligonucleotide, or may be unpaired. A "single-stranded oligonucleotide" is an unpaired oligonucleotide. A "double-stranded oligonucleotide" is an oligonucleotide that is paired with a second oligonucleotide.

[0071] As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modification.

[0072] As used herein, "a pharma- ceutically acceptable carrier or diluent" refers to any substance suitable for use in administration to an animal. Certain such carriers allow the pharmaceutical composition to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by an animal. In certain embodiments, the pharma- ceutical acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0073] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharma- ceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0074] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0075] As used herein, "prodrug" refers to a first form of a therapeutic agent that is converted to a second form in an animal or in a cell thereof outside the body. Typically, the conversion of the prodrug in the animal is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions. In certain embodiments, the first form of the prodrug is less active than the second form.

[0076] As used herein, "reducing or inhibiting the amount or activity" refers to a reduction or blocking of transcriptional expression or activity compared to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate a complete elimination of transcriptional expression or activity.

[0077] As used herein, "RNA" means RNA transcripts, and includes pre-mRNA and mature mRNA, unless otherwise specified.

[0078] As used herein, "RNAi agent" refers to an antisense agent that acts, at least in part, via RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may include conjugate groups and / or end groups. In certain embodiments, RNAi agents regulate the amount, activity, and / or splicing of a target nucleic acid. The term RNAi agent excludes antisense agents that act via RNase H.

[0079] As used herein, "RNase H agent" refers to an antisense agent that acts through RNase H to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. In certain embodiments, the RNase H agent is single stranded. In certain embodiments, the RNase H agent is double stranded. The RNase H agent may include a conjugate group and / or a terminal group. In certain embodiments, the RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act primarily through RISC / Ago2.

[0080] As used herein, "antisense RNase H oligonucleotide" refers to an oligonucleotide that is complementary to a target sequence and contains a region containing at least one chemical modification suitable for RNase H mediated reduction of a nucleic acid.

[0081] As used herein, "antisense RNAi oligonucleotide" refers to an oligonucleotide that is complementary to a target sequence and contains a region that contains at least one chemical modification suitable for RNAi-mediated reduction of a nucleic acid.

[0082] As used herein, "self-complementary" with respect to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

[0083] As used herein, "single-stranded" refers to a nucleic acid (including, but not limited to, an oligonucleotide) that is unpaired and not part of a duplex. Single-stranded compounds can hybridize with complementary nucleic acids to form duplexes, at which point they are no longer single-stranded.

[0084] As used herein, a "stabilized phosphate group" refers to a 5'-phosphate analog that is more metabolically stable than the 5'-phosphate naturally occurring on DNA or RNA.

[0085] As used herein, "standard in vitro assay" refers to the assay described in Examples 1, 2, or 13, and reasonable variations thereof. In certain embodiments, "standard in vitro RNase H assay" refers to an in vitro assay for using an RNase H agent, and may include the assay described in Example 1 or Example 2, and reasonable variations thereof. In certain embodiments, "standard in vitro RNAi assay" refers to an in vitro assay for using an RNAi agent, and may include the assay described in Example 13, and reasonable variations thereof.

[0086] As used herein, "standard in vivo assay" refers to the assay described in Example 6 and reasonable variations thereof.

[0087] As used herein, "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center that has a random stereochemical configuration. For example, in a population of molecules that includes stereorandom chiral centers, the number of molecules that have stereorandom chiral centers in the (S) configuration may be, but is not necessarily, the same as the number of molecules that have stereorandom chiral centers in the (R) configuration. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0088] As used herein, "subject" means a human or non-human animal. In certain embodiments, the subject is a human.

[0089] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl sugar moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H)β-D-deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0090] As used herein, "sugar surrogate" refers to a modified sugar moiety having other than a furanosyl moiety that can attach a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides, including sugar surrogates, can be incorporated at one or more positions within an oligonucleotide that is capable of hybridizing to a complementary oligomeric compound or target nucleic acid.

[0091] As used herein, "symptoms or features" refers to any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptoms are evident to the subject or a medical professional examining or testing such a subject. In certain embodiments, the features are evident by invasive diagnostic testing, including but not limited to postmortem examination. In certain embodiments, the symptoms and features include muscle weakness and wasting of the facial, scapular, and / or humeral muscles, which may progress to the muscles of the trunk and lower limbs.

[0092] As used herein, "target nucleic acid" and "target RNA" refer to the nucleic acid against which an antisense compound is designed to act. Target RNA refers to an RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0093] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0094] As used herein, "terminal group" refers to a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0095] As used herein, "treating" refers to improving a disease or condition of a subject by administering an oligomeric agent or oligomeric compound described herein.In certain embodiments, treating a subject improves symptoms compared to the same symptoms without treatment.In certain embodiments, treatment reduces the severity or frequency of symptoms, or delays the onset of symptoms, delays the progression of symptoms, or reduces the severity or frequency of symptoms.

[0096] As used herein, a "therapeutically effective amount" refers to an amount of an agent or composition that confers a therapeutic effect on an animal, e.g., a therapeutically effective amount ameliorates a symptom of a disease.

[0097] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0098] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide is at least 80% complementary to an equal length portion of DUX4 RNA, and said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0099] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 nucleobases of any of SEQ ID NOs: 20 to 172, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0100] Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, or 16 nucleobases of any of SEQ ID NOs: 173 to 1171, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0101] Embodiment 4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0102] Embodiment 5.1 comprises 2 to 50 linked nucleosides, Nucleic acid bases 2697 to 2730 of SEQ ID NO: 1; Nucleic acid bases 2756 to 2778 of SEQ ID NO: 1; Nucleic acid bases 2732 to 2760 of SEQ ID NO: 1; nucleobases 2783 to 2806 of SEQ ID NO: 1 and / or nucleobases 10 to 33 of SEQ ID NO: 2, nucleobases 2833 to 2853 of SEQ ID NO: 1 and / or nucleobases 60 to 80 of SEQ ID NO: 2, Nucleic acid bases 2953 to 2975 of SEQ ID NO: 1 and / or nucleic acid bases 180 to 202 of SEQ ID NO: 2, nucleobases 3097 to 3136 of SEQ ID NO: 1 and / or nucleobases 324 to 363 of SEQ ID NO: 2, nucleobases 3174 to 3210 of SEQ ID NO: 1 and / or nucleobases 401 to 437 of SEQ ID NO: 2, nucleobases 3361 to 3400 of SEQ ID NO: 1 and / or nucleobases 588 to 627 of SEQ ID NO: 2, nucleobases 3883 to 3926 of SEQ ID NO: 1 and / or nucleobases 1110 to 1153 of SEQ ID NO: 2, nucleobases 4007 to 4029 of SEQ ID NO: 1 and / or nucleobases 1234 to 1256 of SEQ ID NO: 2, nucleobases 4103 to 4134 of SEQ ID NO: 1 and / or nucleobases 1330 to 1361 of SEQ ID NO: 2, Nucleic acid bases 4503 to 4522 of SEQ ID NO: 1; Nucleic acid bases 4509 to 4530 of SEQ ID NO: 1; nucleobases 4667 to 4694 of SEQ ID NO: 1 and / or nucleobases 1532 to 1559 of SEQ ID NO: 2, nucleobases 4828 to 4850 of SEQ ID NO: 1 and / or nucleobases 1693 to 1710 of SEQ ID NO: 2, Nucleic acid bases 768 to 787 of SEQ ID NO: 2; nucleobases 2955 to 2984 of SEQ ID NO: 1 and / or nucleobases 182 to 211 of SEQ ID NO: 2, nucleobases 3099 to 3128 of SEQ ID NO: 1 and / or nucleobases 326 to 355 of SEQ ID NO: 2, Nucleic acid bases 3171 to 3209 of SEQ ID NO: 1 and / or nucleic acid bases 398 to 436 of SEQ ID NO: 2, or 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases complementary to nucleobases 3859 to 3888 of SEQ ID NO:1 and / or nucleobases 1086 to 1115 of SEQ ID NO:2, The oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0103] Embodiment 6.1 comprises 2 to 50 linked nucleosides, SEQ ID NOs: 24, 98, 318-320, 359-361, 398-400, 438-440, 852, and 857, SEQ ID NOs: 323, 324, 364, 404, 443, and 444; SEQ ID NOs: 73, 148, 327, 367, 407, 408, 208, and 447; SEQ ID NOs: 299, 340, 379, and 420 to 421; SEQ ID NOs: 300-301, 341-342, 380, 422, and 1002, SEQ ID NOs: 331, 332, 370, 371, 412, 413, 451, and 452; SEQ ID NOs: 326, 366, 406, 446, and 777; SEQ ID NOs: 100, 186, 321, 362, 645, 719, 791, 796, 867, 873, 943, 946, and 1019; SEQ ID NOs: 802, 880, and 1088 to 1090; SEQ ID NOs: 668, 742, 815, 893, 966, and 1040; SEQ ID NOs: 673, 747-748, 822, 898, 971, and 1045; SEQ ID NOs: 39, 678-681, 753-755, 827-829, 903-905, 976-978, 1050-1052, and 1135-1136, SEQ ID NOs: 117, 684, 758, 1056, and 1141 to 1144; SEQ ID NOs: 123, 695-697, 769-771, 843, 844, 919, 920, 992, 993, 1066, and 1067, SEQ ID NOs: 67, 141, 646-647, 720-721, 793-794, 870-871, 945, 947-948, and 1020-1021, SEQ ID NOs: 652, 726, 799, 876, 953, 1026, and 1079; SEQ ID NOs: 163, 658, 732, 883, 957, 1031, and 1105 to 1112; SEQ ID NOs: 1424 and 1425, SEQ ID NOs: 1214 and 1410, SEQ ID NOs: 1405, 1209, and 1210, and An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases of a sequence selected from SEQ ID NOs: 1197 and 1335.

[0104] Embodiment 7. The oligomeric compound of any of embodiments 1-6, wherein the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NOs: 1-4 when measured across the entire nucleobase sequence of the modified oligonucleotide.

[0105] Embodiment 8. The modified oligonucleotide is 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-25, 17-30, 17 8. The oligomeric compound according to any one of embodiments 1 to 7, comprising from 1 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

[0106] Embodiment 9. The oligomeric compound of any one of embodiments 1 to 8, wherein the modified oligonucleotide comprises at least one modified nucleoside.

[0107] Embodiment 10. The oligomeric compound of embodiment 9, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

[0108] Embodiment 11 The oligomeric compound of embodiment 10, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0109] Embodiment 12. The oligomeric compound of embodiment 11, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0110] Embodiment 13. The oligomeric compound of any of embodiments 10-12, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a non-bicyclic modified sugar moiety.

[0111] Embodiment 14 The oligomeric compound of embodiment 13, wherein said non-bicyclic modified sugar moiety is a 2'-O(CH2)2OCH3 ribosyl sugar moiety, a cEt sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety.

[0112] Embodiment 15. The oligomeric compound of any one of embodiments 10 to 14, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate.

[0113] Embodiment 16 The oligomeric compound of embodiment 15, wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA.

[0114] Embodiment 17. The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and having a sugar motif including a 3' region consisting of 1 to 6 linked 3' region nucleosides, 17. The oligomeric compound of any of embodiments 1-16, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0115] Embodiment 18. The modified oligonucleotide comprises: a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and having a sugar motif comprising a 3' region consisting of three linked 3' region nucleosides, 17. The oligomeric compound of any of embodiments 1-16, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0116] Embodiment 19. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and having a sugar motif comprising a 3' region consisting of five linked 3' region nucleosides, 17. The oligomeric compound of any of embodiments 1-16, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0117] Embodiment 20. The modified oligonucleotide comprises: a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and having a 3' region consisting of three linked 3' region nucleosides, The oligomeric compound of embodiment 17, wherein each of said 5' region nucleosides and each of said 3' region nucleosides comprises a cEt sugar moiety and each of said central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0118] Embodiment 21. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and having a 3' region consisting of five linked 3' region nucleosides, The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-O(CH2)2OCH3 ribosyl sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0119] Embodiment 22. The oligomeric compound according to any one of embodiments 1 to 21, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0120] Embodiment 23 The oligomeric compound of embodiment 22, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

[0121] Embodiment 24. The oligomeric compound according to embodiment 22 or embodiment 23, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

[0122] Embodiment 25 The oligomeric compound of embodiment 23, wherein each internucleoside linkage of said modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0123] Embodiment 26 The oligomeric compound of embodiment 22 or embodiment 24, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0124] Embodiment 27. The oligomeric compound according to any of embodiments 22 to 26, wherein the internucleoside linkage motif of the modified oligonucleotide is selected from 5'-sssssssssssssssssss-3' and 5'-sssssssssssssssss-3', wherein each "s" represents a phosphorothioate internucleoside linkage.

[0125] Embodiment 28. The oligomeric compound of any one of embodiments 1 to 27, wherein the modified oligonucleotide comprises a modified nucleobase.

[0126] Embodiment 29. The oligomeric compound of embodiment 28, wherein the modified nucleobase is 5-methylcytosine.

[0127] Embodiment 30. The oligomeric compound according to any one of embodiments 1 to 29, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 20, 18 to 22 or 18 to 20 linked nucleosides, or a pharma- ceutically acceptable salt thereof.

[0128] Embodiment 31. The oligomeric compound of embodiment 30, which is a pharma- ceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0129] Embodiment 32. The oligomeric compound according to any one of embodiments 1 to 31, wherein said modified oligonucleotide consists of 16 linked nucleosides.

[0130] Embodiment 33. The oligomeric compound according to any one of embodiments 1 to 31, wherein said modified oligonucleotide consists of 20 linked nucleosides.

[0131] Embodiment 34. The oligomeric compound of any one of embodiments 1 to 31, wherein said modified oligonucleotide consists of 23 linked nucleosides.

[0132] Embodiment 35. An oligomeric compound according to any one of embodiments 1 to 33, which activates RNase H.

[0133] Embodiment 36. An oligomeric compound according to any one of embodiments 1 to 35, which consists of the modified oligonucleotide.

[0134] Embodiment 37. An oligomeric compound according to any one of embodiments 1 to 35, comprising the modified oligonucleotide and a conjugate group.

[0135] Embodiment 38. The oligomeric compound of embodiment 37, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

[0136] Embodiment 39 The oligomeric compound of embodiment 38, wherein the conjugate moiety is a lipophilic group.

[0137] Embodiment 40. The oligomeric compound of embodiment 38, wherein the conjugate moiety is selected from C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, and C5 alkenyl.

[0138] Embodiment 41 The oligomeric compound of embodiment 38, wherein the conjugate moiety is a 6-palmitamidohexyl conjugate moiety.

[0139] Embodiment 42. The oligomeric compound of any one of embodiments 38 to 41, wherein the conjugate linker is a phosphodiester linker.

[0140] Embodiment 43. The oligomeric compound of any one of embodiments 37-42, wherein the conjugate group has the following structure:

[0141] [ka]

[0142] Embodiment 44. The oligomeric compound of any one of embodiments 38 to 43, wherein said conjugate linker consists of a single bond.

[0143] Embodiment 45. The oligomeric compound of any of embodiments 38 to 44, wherein the conjugate linker is cleavable.

[0144] Embodiment 46. The oligomeric compound of any of embodiments 38 to 45, wherein the conjugate linker comprises 1 to 3 linker nucleosides.

[0145] Embodiment 47. The oligomeric compound of any of embodiments 37-46, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0146] Embodiment 48. The oligomeric compound of any of embodiments 37-46, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0147] Embodiment 49. The oligomeric compound of any one of embodiments 1 to 48, comprising a terminal group.

[0148] Embodiment 50. The oligomeric compound of any of embodiments 1-45 or 47-49, which does not comprise a linker nucleoside.

[0149] Embodiment 51. The following chemical structure:

[0150] [ka] An oligomeric compound according to (SEQ ID NO: 248) or a pharma- ceutically acceptable salt thereof.

[0151] Embodiment 52. The oligomeric compound according to embodiment 51, which is a pharma- ceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0152] Embodiment 53. An oligomeric compound according to the following chemical structure:

[0153] [ka]

[0154] Embodiment 54. An oligomeric compound comprising a modified oligonucleotide and a conjugate group according to the following chemical designation: (6-palmitamidohexyl)-G ks G ks m C ks G ds A ds T ds G ds m C ds m C ds m C ds G ds G ds G ds T ks A ks m C k (SEQ ID NO: 248), where A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, k=cEt sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, and s=phosphorothioate internucleoside linkage.

[0155] Embodiment 55. A chirally enriched population of oligomeric compounds according to any one of embodiments 1 to 54, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0156] Embodiment 56. The chirally enriched population of embodiment 55, which is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having an (Sp) configuration.

[0157] Embodiment 57. The chirally enriched population of embodiment 55, which is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having an (Rp) configuration.

[0158] Embodiment 58. The chirally enriched population of embodiment 55, which is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0159] Embodiment 59. The chirally enriched population of embodiment 55, which is enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

[0160] Embodiment 60. The chirally enriched population of embodiment 55, which is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0161] Embodiment 61. The chirally enriched population of embodiment 55, which is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the 5' to 3' direction in the Sp configuration, the Sp configuration, and the Rp configuration.

[0162] Embodiment 62. A population of oligomeric compounds according to any of embodiments 1 to 54, wherein all of the phosphorothioate internucleoside linkages of said modified oligonucleotides are stereorandom.

[0163] Embodiment 63. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound described in any one of embodiments 1 to 54.

[0164] Embodiment 64. The oligomeric duplex of embodiment 63, wherein the second modified oligonucleotide consists of 12 to 50 linked nucleosides and the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0165] Embodiment 65. An oligomeric duplex comprising: A first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 1176 to 1241, 1308, 1310 to 1473, or 1638; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0166] Embodiment 66. An oligomeric duplex comprising: A first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 1176 to 1241, 1308, 1310 to 1473, or 1638; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1242 to 1307, 1309, 1474 to 1637, or 1639, and the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0167] Embodiment 67. An oligomeric duplex comprising: A first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide comprises any one of the nucleic acid base sequences of SEQ ID NOs: 1176 to 1241, 1308, 1310 to 1473, or 1638; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 1242 to 1307, 1309, 1474 to 1637, or 1639, and the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0168] Embodiment 68. The oligomeric duplex of any of embodiments 63-67, wherein the modified oligonucleotide of said first oligomeric compound comprises a 5'-stabilizing phosphate group.

[0169] Embodiment 69. The oligomeric duplex of embodiment 68, wherein the 5'-stabilized phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate.

[0170] Embodiment 70 The oligomeric duplex of any of embodiments 63-69, wherein at least one nucleoside of the first modified oligonucleotide comprises a modified sugar moiety.

[0171] Embodiment 71 The oligomeric duplex of embodiment 70, wherein the modified sugar moiety of the first modified oligonucleotide comprises a bicyclic sugar moiety.

[0172] Embodiment 72. The oligomeric duplex of embodiment 71, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0173] Embodiment 73 The oligomeric duplex of embodiment 70, wherein the modified sugar moiety of the first modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0174] Embodiment 74 The oligomeric duplex of embodiment 73, wherein the non-bicyclic modified sugar moiety of the first modified oligonucleotide is a 2'-OMe sugar moiety or a 2'-F sugar moiety.

[0175] Embodiment 75 The oligomeric duplex of any of embodiments 63-74, wherein at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate.

[0176] Embodiment 76 The oligomeric duplex of any of embodiments 63-75, wherein the first modified oligonucleotide comprises at least one modified internucleoside linkage.

[0177] Embodiment 77. The oligomeric duplex of embodiment 76, wherein at least one modified internucleoside linkage of said first modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0178] Embodiment 78. The oligomeric duplex of embodiment 76, wherein each internucleoside linkage of said first modified oligonucleotide is independently selected from phosphodiester and phosphorothioate internucleoside linkages.

[0179] Embodiment 79. The oligomeric duplex of any of embodiments 63-78, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

[0180] Embodiment 80 The oligomeric duplex of embodiment 79, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

[0181] Embodiment 81. The oligomeric duplex of embodiment 80, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0182] Embodiment 82 The oligomeric duplex of embodiment 79, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0183] Embodiment 83 The oligomeric duplex of embodiment 82, wherein the non-bicyclic modified sugar moiety of said second modified oligonucleotide is a 2'-OMe sugar moiety or a 2'-F sugar moiety.

[0184] Embodiment 84 The oligomeric duplex of any of embodiments 63-83, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate.

[0185] Embodiment 85. The oligomeric duplex of any of embodiments 63-84, wherein the second modified oligonucleotide comprises at least one modified internucleoside linkage.

[0186] Embodiment 86 The oligomeric duplex of embodiment 85, wherein at least one modified internucleoside linkage of said second modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0187] Embodiment 87. The oligomeric duplex of embodiment 85, wherein each internucleoside linkage of said second modified oligonucleotide is independently selected from phosphodiester and phosphorothioate internucleoside linkages.

[0188] Embodiment 88. The oligomeric duplex of any of embodiments 63-87, wherein the internucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide is ssooooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0189] Embodiment 89. The oligomeric duplex of any of embodiments 63-88, wherein the first modified oligonucleotide has a sugar motif of 5'-yfyfyfyfyfyfyfyfyfyfyy-3' and the second modified oligonucleotide has a sugar motif of 5'-fyfyfyfyfyfyfyfyfyfyf-3', wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0190] Embodiment 90. The oligomeric duplex of any of embodiments 63-89, wherein the first modified oligonucleotide and the second modified oligonucleotide each independently comprise at least one modified nucleobase.

[0191] Embodiment 91 The oligomeric duplex of embodiment 90, wherein said at least one modified nucleobase is 5-methylcytosine.

[0192] Embodiment 92. The oligomeric duplex of any of embodiments 63-91, wherein from one to four of the 3'-most nucleosides of said first modified oligonucleotide are overhanging nucleosides.

[0193] Embodiment 93 The oligomeric duplex of any of embodiments 63 to 92, wherein the first modified oligonucleotide is blunt ended at the 5' end.

[0194] Embodiment 94. The oligomeric duplex of any of embodiments 63-93, wherein the second oligomeric compound comprises a conjugate group comprising a conjugate moiety and a conjugate linker.

[0195] Embodiment 95 The oligomeric duplex of embodiment 94, wherein the conjugate linker consists of a single bond.

[0196] Embodiment 96 The oligomeric duplex of embodiment 94, wherein said conjugate linker is cleavable.

[0197] Embodiment 97. The oligomeric duplex of embodiment 94, wherein the conjugate linker comprises 1 to 3 linker nucleosides.

[0198] Embodiment 98. The oligomeric duplex of any of embodiments 94-97, wherein the conjugate group is attached to the 5' end of the second modified oligonucleotide.

[0199] Embodiment 99. The oligomeric duplex of any of embodiments 94-97, wherein the conjugate group is attached to the 3' end of the second modified oligonucleotide.

[0200] Embodiment 100. The oligomeric duplex of any of embodiments 94-97, wherein the conjugate group is attached via the 2' position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide.

[0201] Embodiment 101. The oligomeric duplex of any of embodiments 94-101, wherein the conjugate group comprises a C22 alkyl, a C20 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, a C5 alkyl, a C22 alkenyl, a C20 alkenyl, a C16 alkenyl, a C10 alkenyl, a C21 alkenyl, a C19 alkenyl, a C18 alkenyl, a C15 alkenyl, a C14 alkenyl, a C13 alkenyl, a C12 alkenyl, a C11 alkenyl, a C9 alkenyl, a C8 alkenyl, a C7 alkenyl, a C6 alkenyl, or a C5 alkenyl.

[0202] Embodiment 102. The oligomeric duplex of any of embodiments 94-101, wherein the conjugate moiety is a 6-palmitamidohexyl conjugate moiety.

[0203] Embodiment 103. The oligomeric duplex of any of embodiments 94 or 96-102, wherein the conjugate linker is a phosphodiester linker.

[0204] Embodiment 104. The oligomeric duplex of any one of embodiments 94 or 96-100, wherein the conjugate group has the following structure:

[0205] [ka]

[0206] Embodiment 105. The oligomeric duplex of any of embodiments 94-104, wherein the conjugate group comprises a cell targeting moiety.

[0207] Embodiment 106 The oligomeric duplex of any of embodiments 63-105, wherein the second modified oligonucleotide comprises a terminal group.

[0208] Embodiment 107. The oligomeric duplex of embodiment 106, wherein said terminal group is an abasic sugar moiety.

[0209] Embodiment 108. The second modified oligonucleotide is selected from the group consisting of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 1 108. The oligomeric duplex of any of embodiments 63-107, consisting of 7-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0210] Embodiment 109. The oligomeric duplex of any of embodiments 63-66 or 68-108, wherein the first modified oligonucleotide consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides.

[0211] Embodiment 110. An antisense agent comprising or consisting of an antisense compound, said antisense compound being an oligomeric compound according to any one of embodiments 1 to 54.

[0212] Embodiment 111. An antisense agent which is an oligomeric duplex according to any one of embodiments 63 to 109.

[0213] Embodiment 112. An antisense agent according to embodiment 110 or embodiment 111, i) an RNase H agent capable of reducing the amount of DUX4 nucleic acid by activating RNase H, or ii) An RNAi agent capable of reducing the amount of DUX4 nucleic acid by activating RISC / Ago2 The antisense agent,

[0214] Embodiment 113. An antisense agent according to any one of embodiments 110 to 112, comprising a conjugate group, wherein the conjugate group comprises a cell targeting moiety.

[0215] Embodiment 114. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 54, a population of oligomeric compounds according to any one of embodiments 55 to 62, an oligomeric duplex according to any one of embodiments 63 to 109, or an antisense agent according to any one of embodiments 110 to 113, and a pharma- ceutically acceptable diluent.

[0216] Embodiment 115. The pharmaceutical composition of embodiment 114, wherein the pharma- ceutically acceptable diluent is phosphate buffered saline (PBS).

[0217] Embodiment 116. The pharmaceutical composition of embodiment 115, consisting essentially of the oligomeric compound and PBS.

[0218] Embodiment 117. The pharmaceutical composition of embodiment 115, consisting essentially of the population of oligomeric compounds and PBS.

[0219] Embodiment 118. The pharmaceutical composition of embodiment 115, consisting essentially of said oligomeric duplex or said antisense agent and PBS.

[0220] Embodiment 119. A method comprising administering to a subject an oligomeric compound according to any one of embodiments 1-54, a population of oligomeric compounds according to any one of embodiments 55-62, an oligomeric duplex according to any one of embodiments 63-109, an antisense agent according to any one of embodiments 110-113, or a pharmaceutical composition according to any one of embodiments 114-118.

[0221] Embodiment 120. A method for treating a disease or disorder associated with DUX4, comprising administering a therapeutically effective amount of an oligomeric compound according to any of embodiments 1-54, a population of oligomeric compounds according to any of embodiments 55-62, an oligomeric duplex according to any of embodiments 63-109, an antisense agent according to any of embodiments 110-113, or a pharmaceutical composition according to any of embodiments 114-118 to a subject having or at risk of developing a disease or disorder associated with DUX4, thereby treating said disease or disorder associated with DUX4.

[0222] Embodiment 121. The method of embodiment 120, wherein the disease or disorder associated with DUX4 is a muscular dystrophy.

[0223] Embodiment 122. The method of embodiment 120, wherein the disease or disorder associated with DUX4 is facioscapulohumeral muscular dystrophy (FSHD).

[0224] Embodiment 123. The method of any of embodiments 120-122, wherein at least one symptom or characteristic of the disease or disorder associated with DUX4 is ameliorated.

[0225] Embodiment 124. The method of embodiment 123, wherein the symptom or characteristic is muscle weakness or wasting of the facial, scapular, and / or humeral muscles.

[0226] Embodiment 125. The method of embodiment 124, wherein administration of an oligomeric compound according to any one of embodiments 1 to 54, a population of oligomeric compounds according to any one of embodiments 55 to 62, an oligomeric duplex according to any one of embodiments 63 to 109, an antisense agent according to any one of embodiments 110 to 113, or a pharmaceutical composition according to any one of embodiments 114 to 118 reduces or delays the onset or progression of muscle weakness or muscle wasting in said subject.

[0227] Embodiment 126. The method of any of embodiments 119-125, wherein the oligomeric compound of any of embodiments 1-54, the population of oligomeric compounds of any of embodiments 55-62, the oligomeric duplex of any of embodiments 63-109, the antisense agent of any of embodiments 110-113, or the pharmaceutical composition of any of embodiments 114-118 is administered systemically.

[0228] Embodiment 127. The method of any one of embodiments 119 to 126, wherein the subject is a human.

[0229] Embodiment 128. A method for reducing expression of DUX4 in a cell, comprising contacting said cell with an oligomeric compound according to any one of embodiments 1 to 54, a population of oligomeric compounds according to any one of embodiments 55 to 62, an oligomeric duplex according to any one of embodiments 63 to 109, an antisense agent according to any one of embodiments 110 to 113, or a pharmaceutical composition according to any one of embodiments 114 to 118.

[0230] Embodiment 129. The method of embodiment 128, wherein the cell is a muscle cell.

[0231] Embodiment 130. The method of embodiment 128 or embodiment 129, wherein the cell is a human cell.

[0232] Embodiment 131. Use of an oligomeric compound according to any one of embodiments 1 to 54, a population of oligomeric compounds according to any one of embodiments 55 to 62, an oligomeric duplex according to any one of embodiments 63 to 109, an antisense agent according to any one of embodiments 110 to 113, or a pharmaceutical composition according to any one of embodiments 114 to 118 for treating a disease or disorder associated with DUX4.

[0233] Embodiment 132. Use of an oligomeric compound according to any one of embodiments 1 to 54, a population of oligomeric compounds according to any one of embodiments 55 to 62, an oligomeric duplex according to any one of embodiments 63 to 109, an antisense agent according to any one of embodiments 110 to 113, or a pharmaceutical composition according to any one of embodiments 114 to 118 in the manufacture of a medicament for treating a disease or disorder associated with DUX4.

[0234] Embodiment 133. The use according to embodiment 131 or embodiment 132, wherein the disease or disorder associated with DUX4 is FSHD.

[0235] Certain Oligomeric Agents and Compounds In certain embodiments, oligomeric agents are provided that target DUX4 nucleic acid.In certain embodiments, the DUX4 nucleic acid has the sequence shown in SEQ ID NO:1 (GENBANK Accession No. NC_000004.12, truncated from nucleotide 190171001 to 190187000), SEQ ID NO:2 (GENBANK Accession No. NM_001306068.2), SEQ ID NO:3 (GENBANK Accession No. FJ439133.1) or SEQ ID NO:4 (GENBANK Accession No. NM_001293798.2), each of which is incorporated by reference in its entirety.In certain embodiments, the oligomeric agent is a single-stranded oligomeric compound.In certain embodiments, the oligomeric agent is an oligomeric duplex.

[0236] In certain embodiments, oligomeric compounds are provided that include a modified oligonucleotide consisting of 12 to 50 linked nucleosides, the nucleobase sequence of the modified oligonucleotide being at least 80% complementary to an equal length portion of a DUX4 RNA, the modified oligonucleotide including at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the DUX4 nucleic acid has the nucleobase sequence of SEQ ID NO: 1, 2, 3, or 4.

[0237] In certain embodiments, oligomeric compounds are provided that comprise modified oligonucleotides consisting of 12 to 50 linked nucleosides and having a nucleobase sequence that contains at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 nucleobases of any of SEQ ID NOs:20-172.

[0238] In certain embodiments, oligomeric compounds are provided that comprise a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, or 16 nucleobases of any of SEQ ID NOs: 173-1171.

[0239] In certain embodiments, oligomeric compounds are provided that comprise a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence that contains at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638.

[0240] In any of the oligomeric compounds provided herein, the nucleobase sequence of the modified oligonucleotide can be at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a DUX4 nucleic acid, the DUX4 nucleic acid having the nucleobase sequence of any of SEQ ID NOs: 1-4.

[0241] In any of the oligomeric compounds provided herein, the modified oligonucleotide may be 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-5 and consisting of 0, 17-20, 17-25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0242] In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide may comprise a modified sugar moiety. In certain embodiments, the modified sugar moiety comprises a bicyclic sugar moiety, e.g., a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-. In certain embodiments, the modified sugar moiety comprises a non-bicyclic sugar moiety, e.g., a 2'-MOE sugar moiety, a cEt sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety.

[0243] In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide compound may include a sugar surrogate.

[0244] In any of the oligomeric compounds provided herein, at least one internucleoside bond of the modified oligonucleotide can comprise a modified internucleoside bond, for example, a phosphorothioate internucleoside bond.In certain embodiments, each internucleoside bond of the modified oligonucleotide can be a modified internucleoside bond, or each internucleoside bond of the modified oligonucleotide can be a phosphorothioate internucleoside bond.In certain embodiments, at least one internucleoside bond of the modified oligonucleotide can be a phosphodiester internucleoside bond.In certain embodiments, each internucleoside bond of the modified oligonucleotide can be independently selected from a phosphodiester or phosphorothioate internucleoside bond.In certain embodiments, at least 2, at least 3, at least 4, at least 5, or at least 6 internucleoside bonds of the modified oligonucleotide can be a phosphodiester internucleoside bond. In certain embodiments, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 internucleoside linkages of the modified oligonucleotide can be phosphorothioate internucleoside linkages.

[0245] In any of the oligomeric compounds provided herein, at least one nucleobase of the modified oligonucleotide may be a modified nucleobase, such as a 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

[0246] In any of the oligomeric compounds provided herein, the modified oligonucleotide can include a deoxy region consisting of 5-12 contiguous 2'-deoxynucleosides. In certain embodiments, each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 7, 8, 9, 10, or 7-10 linked nucleosides. In certain embodiments, each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety. In certain embodiments, the deoxy region is disposed at the 5' side by a 5' region consisting of 1-6 linked 5' region nucleosides and at the 3' side by a 3' region consisting of 1-6 linked 3' region nucleosides, the 3'-most nucleoside of the 5' region comprising a modified sugar moiety, and the 5'-most nucleoside of the 3' region comprising a modified sugar moiety. In certain embodiments, each nucleoside of the 3' region comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 5' region comprises a modified sugar moiety.

[0247] In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 50 linked nucleobases having a nucleobase sequence comprising a nucleobase sequence set forth in any one of SEQ ID NOs:20-172, wherein the modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and having a 3' region consisting of five linked 3' region nucleosides, Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety, where each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 15-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

[0248] In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 50 linked nucleobases, the modified oligonucleotide having a nucleobase sequence comprising a nucleobase sequence set forth in any one of SEQ ID NOs: 173-1171, wherein the modified oligonucleotide comprises: a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and having a 3' region consisting of three linked 3' region nucleosides, Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-cEt sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety, where each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 15-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0249] In certain embodiments, the oligomeric compound comprises a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate linker consists of a single bond, the conjugate linker is cleavable, the conjugate linker comprises 1-3 linker nucleosides, the conjugate linker does not comprise a linker nucleoside, the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide, or the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0250] In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for the transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, whose alkyl chains have one or more unsaturated bonds.

[0251] In certain embodiments, the conjugate group has the structure:

[0252] [ka]

[0253] Specific oligomeric duplexes Certain embodiments are directed to an oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound.

[0254] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide is at least 80% complementary to an equal length portion of the nucleobase sequence of any of SEQ ID NOs: 20 to 1171; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0255] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20 to 1171, wherein each thymine is replaced by uracil; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0256] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0257] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 16 to 50 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide comprises any of the nucleic acid base sequences of SEQ ID NOs: 20 to 1171, in which each thymine is replaced with uracil; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 16 to 50 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 16 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0258] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0259] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 1176 to 1241, 1308, 1310 to 1473, or 1638; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0260] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0261] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 1176 to 1241, 1308, 1310 to 1473, or 1638; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1242 to 1307, 1309, 1474 to 1637, or 1639, and the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0262] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0263] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleic acid base sequence of the second modified oligonucleotide comprises any of the nucleic acid base sequences of SEQ ID NOs: 1242-1307, 1309, 1474-1637, or 1639, and the nucleic acid base sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0264] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0265] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19-30 linked nucleosides, and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide and the nucleobase sequence of the second modified oligonucleotide each comprise at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleobases of any of the pairs of nucleobase sequences listed in the following SEQ ID NOs: 1176-1639, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO: listed in the pair, and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO: listed in the pair. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0266] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19-30 linked nucleosides, and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-30 linked nucleosides, the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide comprising any of the pairs of nucleobase sequences listed in the following SEQ ID NOs: 1176-1639, the nucleobase sequence of the first modified oligonucleotide comprising the nucleobase sequence of the first SEQ ID NO: listed in the pair, and the nucleobase sequence of the second modified oligonucleotide comprising the nucleobase sequence of the second SEQ ID NO: listed in the pair. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0267] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide being any of the pairs of nucleobase sequences listed in the following SEQ ID NOs: 1176-1639, the nucleobase sequence of the first modified oligonucleotide comprising the nucleobase sequence of the first SEQ ID NO: listed in the pair, and the nucleobase sequence of the second modified oligonucleotide comprising the nucleobase sequence of the second SEQ ID NO: listed in the pair. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0268] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, bicyclic sugar moieties, such as 2'-4' bridges selected from -O-CH2- and -O-CH(CH3)-, and non-bicyclic sugar moieties, such as 2'-MOE sugar moieties, 2'-F sugar moieties, 2'-OMe sugar moieties, or 2'-NMA sugar moieties. In certain embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe.

[0269] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, morpholino, peptide nucleic acid (PNA), glycol nucleic acid (GNA), and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, which may be GNA.

[0270] In any of the oligomeric duplexes described herein, at least one internucleoside bond of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified internucleoside bond. In certain embodiments, the modified internucleoside bond is a phosphorothioate internucleoside bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the first modified oligonucleotide comprises a phosphorothioate bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the second modified oligonucleotide comprises a phosphorothioate bond.

[0271] In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can comprise a phosphodiester internucleoside linkage.

[0272] In any of the oligomeric duplexes described herein, each internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can be independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0273] In any of the oligomeric duplexes described herein, the internucleoside linkage motif of the first modified oligonucleotide can be ssooooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide can be ssooooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0274] In any of the oligomeric duplexes described herein, at least one nucleobase of the first modified oligonucleotide and / or the second modified oligonucleotide can be a modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine.

[0275] In any of the oligomeric duplexes described herein, the first modified oligonucleotide may comprise a stabilizing phosphate group attached to the 5' position of the 5'-most nucleoside. In certain embodiments, the stabilizing phosphate group comprises a cyclopropylphosphonate or an (E)-vinylphosphonate.

[0276] In any of the oligomeric duplexes described herein, the first modified oligonucleotide may comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 5' end of the modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, whose alkyl chains have one or more unsaturated bonds.

[0277] In any of the oligomeric duplexes described herein, the second modified oligonucleotide may comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 5' end of the modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, whose alkyl chains have one or more unsaturated bonds.

[0278] In certain embodiments, the antisense agent comprises an antisense compound, which comprises an oligomeric compound or oligomeric duplex as described herein. In certain embodiments, the antisense agent, which may comprise an oligomeric compound or oligomeric duplex as described herein, is an RNAi agent that can reduce the amount of DUX4 nucleic acid by activating RISC / Ago2.

[0279] Certain embodiments provide an oligomeric agent comprising two or more oligomeric duplexes. In certain embodiments, the oligomeric agent comprises two or more of any of the oligomeric duplexes described herein. In certain embodiments, the oligomeric agent comprises two or more of the same oligomeric duplexes, which may be any of the oligomeric duplexes described herein. In certain embodiments, the two or more oligomeric duplexes are linked together. In certain embodiments, the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked together at their 3' ends. In certain embodiments, the two or more oligomeric duplexes are covalently linked together by a glycol linker, e.g., a tetraethylene glycol linker. Certain such compounds are described, for example, in Alterman, et al., Nature Biotech., 37:844-894, 2019.

[0280] I. Specific Oligonucleotides In certain embodiments, oligomeric compounds are provided herein that include oligonucleotides that consist of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. The modified oligonucleotides include at least one modification relative to unmodified RNA or DNA. That is, the modified oligonucleotides include at least one modified nucleoside (including modified sugar moieties and / or modified nucleobases) and / or at least one modified internucleoside linkage. Certain modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below.

[0281] A. Certain Modified Nucleosides Modified nucleosides contain a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides containing the following modified sugar moieties and / or the following modified nucleobases may be incorporated into antisense oligonucleotides:

[0282] 1. Specific sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates can contain one or more substitutions that correspond to those of other types of modified sugar moieties.

[0283] In certain embodiments, the modified sugar moiety is a non-bicyclic modified furanosyl sugar moiety that includes one or more acyclic substituents, including but not limited to, substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched.

[0284] In certain embodiments, a non-bicyclic modified sugar moiety comprises a substituent at the 2' position. Examples of suitable substituents at the 2' position of the modified sugar moiety include, but are not limited to, -F, -OCH3 ("OMe" or "O-methyl"), and -O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ) or OCH2C(=O)-N(R m )(R n ), wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 alkyl, -O(CH2)2ON(CH3)2 ("DMAOE"), 2'-O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), and 2'-substituents described in Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from among hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0285] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 It is an alkyl.

[0286] In certain embodiments, the 2'-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 ("DMAOE"), O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), and OCH2C(=O)-N(H)CH3 ("NMA").

[0287] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0288] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0289] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties can have seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional stereocenter at the 2' position relative to the 2'-deoxyfuranosyl sugar moiety. Thus, such sugar moieties can have a total of 16 isomeric configurations. 2'-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0290] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 4' position. Examples of suitable substituents at the 4' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO2015 / 106128.

[0291] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 3' position. Examples of suitable substituents at the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).

[0292] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 5' position. Examples of suitable substituents at the 5' position of the modified sugar moiety include, but are not limited to, vinyl, alkoxy (e.g., methoxy), alkyl (e.g., methyl (R or S), ethyl).

[0293] In certain embodiments, non-bicyclic modified sugar moieties include two or more non-bridging sugar substituents, such as, for example, 2'-F-5'-methyl sugar moieties, and the modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0294] In naturally occurring nucleic acids, sugars are linked to each other at 3' and 5'.In certain embodiments, oligonucleotides contain one or more nucleosides or sugar moieties linked at alternative positions, such as 2'-position, or linked back from 5' to 3'.For example, when linkage is at 2'-position, 2'-substituent may be at 3'-position instead.

[0295] Certain modified sugar moieties include a substituent that bridges two atoms of the furanosyl ring to form a second ring resulting in a bicyclic sugar moiety, hi certain embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. Examples of such 4' to 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,741,457; and Swayze et al., US 7,741,457). et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345 and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), al., US 8,278,426), 4'-C(Ra R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', where each R, R a , and R b are independently H, a protecting group, or C1-C 12 and alkyl (see, for example, Imanishi et al., US Pat. No. 7,427,672).

[0296] In certain embodiments, such 4' and 2' bridges are independently -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0297] The particle size of the solution was determined by Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443,Albaek et al.,J.Org.Chem.,2006,71,7731-7740,Singh et al.,Chem.Commun.,1998,4,455-456、Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,2,558-561;Braasch et al al.,Chem.Biol.,2001,8,1-7、Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243、Wengel et al.,US7,053,207,Imanishi et al.,US6,268,490,Imanishi et al.US6,770,748,Imanishi et al al.,USRE44,779; Wengel et al.,US6,794,499,Wengel et al.,US6,670,461;Wengel et al.,US7,034,133,Wengel et al.,US8,080,644; al.,US8,153,365、Wengel et al.,US7,572,582、Ramasamy et al.,US6,525,191,Torsten et al.,WO2004 / 106356,Wengel et al.,WO1999 / 014226、Seth et al.,WO2007 / 134181, Seth et al.,US7,547,684, Seth et al.,US7,666,854, Seth et al.,US8,088,746, Seth et al.,US7,750,131, Seth et al.,US8,030,467, Seth et al. al., US8,268,980, Seth et al., US8,546,556, Seth et al., US8,530,640, Migawa et al., US9,012,421, Seth et al., US8,501,805, Allerson et al., US2008 / 0039618, and Migawa et al. al., US2015 / 0191727. .

[0298] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in either the α-L or β-D configuration.

[0299] [ka]

[0300] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase the stability of siRNAs in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1): 439-447; Mook, OR. et al., (2007) Mal Cane Ther 6(3): 833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12): 3185-3193). In this specification, the general term bicyclic nucleosides includes both isomeric configurations. Where the positions of particular bicyclic nucleosides (eg, LNA or cEt) are specified in the exemplary embodiments herein, they are in the β-D configuration unless otherwise specified.

[0301] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2'-bridging sugars).

[0302] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, the modified sugar moiety also includes bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2' position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or 5' position.

[0303] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA:

[0304] [ka] ("F-HNA", see, e.g., Swayze et al., US8,088,904, Swayze et al., US8,440,803, Swayze et al., US8,796,437, and Swayze et al., US9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran), as well as nucleosides including the additional modified THP compound having the formula:

[0305] [ka] wherein, for each of the modified THP nucleosides above, independently Bx is a nucleobase moiety, T3 and T4 are each independently an internucleoside linking group that connects a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that connects a modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0306] In certain embodiments, modified THP nucleosides are provided in which q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided in which one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0307] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510, and Summerton et al., US 5,698,685, Summerton et al., US 5,166,315, Summerton et al., US 5,185,444, and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure:

[0308] [ka]

[0309] In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituents from the morpholino structures shown above. Such sugar surrogates are referred to herein as "modified morpholinos."

[0310] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876. In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262. Additional PNA compounds suitable for use in the oligonucleotides of the invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0311] In certain embodiments, the sugar surrogate is the "unlocked" sugar structure of a UNA (unlocked nucleic acid) nucleoside. A UNA is an unlocked acyclic nucleic acid in which one of the sugar linkages has been removed to form an unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Patent No. 8,314,227, and U.S. Patent Publication Nos. 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, the entire contents of each of which are incorporated herein by reference.

[0312] In certain embodiments, the sugar surrogate is glycerol, found in the GNA (glycol nucleic acid) nucleoside shown below:

[0313] [ka] In the formula, Bx represents any nucleic acid base.

[0314] Many other bicyclic and tricyclic sugars and sugar surrogates are known in the art and can be used in the modified nucleosides.

[0315] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain unmodified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain modified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not contain nucleobases, which are referred to as abasic nucleosides.In certain embodiments, modified oligonucleotide comprises one or more inosine nucleosides (i.e., nucleosides that contain hypoxanthine nucleobases).

[0316] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy The bases are selected from 5-N-benzoyl, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp).Modified nucleobases can also include those in which the purine or pyrimidine base is replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0317] Publications teaching the preparation of some of the above and other modified nucleobases include Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al., US5,459,255, al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al. et al., US5,587,470, Cook et al., US5,457,191, Matteucci et al., US5,763,588, Froehler et al., US5,830,653, Cook et al., US5,808,027, Cook et al., US6,166,199, and Matteucci et al., US6,005,096.

[0318] 3. Specific modified internucleoside linkages The naturally occurring internucleoside bond of RNA and DNA is a 3' to 5' phosphodiester bond. In certain embodiments, the nucleosides of a modified oligonucleotide can be linked using one or more modified internucleoside linkages. Two main classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester linkages ("P=O") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates ("P=S"), and phosphodiesters, including phosphorodithioates ("HS-P=S"). Representative phosphorus-free internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides, as compared to naturally occurring phosphodiester internucleoside linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for the preparation of phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0319] In certain embodiments, the modified internucleoside linkage is any of those described in WO / 2021 / 030778, which is incorporated herein by reference. In certain embodiments, the modified internucleoside linkage comprises the following formula:

[0320] [ka] wherein, independently for each internucleoside linkage group of the modified oligonucleotide: X is selected from O or S; R1 is selected from H, C1-C6 alkyl, and substituted C1-C6 alkyl; T is selected from SO2R2, C(=O)R3, and P(=O)R4R5, where R2 is selected from aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl substituted C1-C6 alkynyl, and a conjugate group; R3 is selected from aryl, substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group; R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, and a conjugate group; R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.

[0321] In certain embodiments, the modified internucleoside linkage comprises a mesyl phosphoramidate linking group having the following formula:

[0322] [ka]

[0323] In certain embodiments, the mesyl phosphoramidate internucleoside linkage may contain a chiral center. In certain embodiments, modified oligonucleotides containing (Rp) and / or (Sp) mesyl phosphoramidates each comprise one or more of the following formulae, where "B" represents a nucleobase:

[0324] [ka]

[0325] Representative internucleoside linkages with chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, where all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be made using a synthetic method in which the stereochemical configuration of each phosphorothioate linkage is randomly selected. Nevertheless, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific stereochemical configuration that is independently selected. In certain embodiments, the specific configuration of the specific phosphorothioate linkage is present in at least 65% of the molecules of the population. In certain embodiments, the specific arrangement of the specific phosphorothioate bond is present in at least 70% of the molecules of the population. In certain embodiments, the specific arrangement of the specific phosphorothioate bond is present in at least 80% of the molecules of the population. In certain embodiments, the specific arrangement of the specific phosphorothioate bond is present in at least 90% of the molecules of the population. In certain embodiments, the specific arrangement of the specific phosphorothioate bond is present in at least 99% of the molecules of the population. Such chiral enriched population of modified oligonucleotides can be produced using synthetic methods known in the art, for example, the methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one of the indicated phosphorothioates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising the (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase:

[0326] [ka]

[0327] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be in a specific stereochemical configuration.

[0328] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages, including siloxanes (dialkylsiloxanes), carboxylates, carboxamides, sulfides, sulfonates, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages containing a mixture of N, O, S, and CH2 moieties.

[0329] In certain embodiments, the modified oligonucleotide comprises one or more inverted nucleosides as shown below:

[0330] [ka] In the formula, each Bx independently represents any nucleobase.

[0331] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of an oligonucleotide) and therefore only one internucleoside linkage as shown above is present. In certain such embodiments, additional features (such as conjugate groups) may be attached to the inverted nucleoside. Such terminal inverted nucleosides may be attached to one or both ends of an oligonucleotide.

[0332] In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, the inverted sugar moiety is terminal (i.e., attached to the last nucleoside at one end of the oligonucleotide), and thus, there is only one internucleoside bond. In certain such embodiments, further features (such as conjugate groups) may be attached to the inverted sugar moiety. Such terminal inverted sugar moieties may be attached to one or both ends of the oligonucleotide.

[0333] In certain embodiments, the nucleic acids may be linked 2' to 5' rather than the standard 3' to 5' linkage. Such linkages are shown below.

[0334] [ka] In the formula, each Bx represents any nucleobase.

[0335] B. Specific motifs In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugar moieties. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and different modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif refers to modifications to nucleobases independent of the sequence of nucleobases).

[0336] 1. Specific glycomotifs In certain embodiments, an oligonucleotide comprises one or more types of modified sugar and / or unmodified sugar moieties arranged in defined patterns or sugar motifs along the oligonucleotide or a region thereof, optionally including, but not limited to, any of the sugar modifications discussed herein.

[0337] Uniformly modified oligonucleotides In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, where each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified nucleotide comprises the same 2' modification.

[0338] Gapmer Oligonucleotides In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two external regions, or "wings," and a central or internal region, or "gap." The three regions of the gapmer motif (the 5' wing, the gap, and the 3' wing) form a contiguous nucleoside sequence in which at least some of the sugar moieties of each nucleoside in both wings are different from at least some of the sugar moieties of the nucleosides in the gap. Specifically, the sugar moieties of at least the nucleosides of each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety that is different from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmer).

[0339] In certain embodiments, a gapmer wing comprises between 1 and 6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least five nucleosides of each wing of a gapmer comprise a modified sugar moiety.

[0340] In certain embodiments, the gapmer gap comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety.

[0341] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, a nucleoside on the gap side of each wing / gap junction comprises a 2'-β-D-deoxyribosyl sugar moiety, and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a 2'-OMe sugar moiety.

[0342] In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif, and each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2' modification.

[0343] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [number of nucleosides in the 5'-wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-wing]. Thus, a 3-10-3 gapmer would consist of each wing containing three linked nucleosides and a gap containing 10 linked nucleosides. When such a designation is followed by a specific modification, the modification is of each sugar moiety of each wing, and the gap nucleoside contains a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer would consist of a 5'-wing containing five linked 2'-MOE nucleosides, a gap containing 10 linked 2'-β-D-deoxynucleosides, and a 3'-wing containing five linked 2'-MOE nucleosides. A 3-10-3 cEt gapmer consists of a 5'-wing containing three linked cEt nucleosides, a gap containing ten linked 2'-β-D-deoxynucleosides, and a 3'-wing containing three linked cEt nucleosides. A 5-8-5 gapmer consists of a 5'-wing containing five linked nucleosides containing modified sugar moieties, a gap containing eight linked 2'-β-D-deoxynucleosides, and a 3'-wing containing five linked nucleosides containing modified sugar moieties. A 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5'- and / or 3'-wings.

[0344] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 BNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 LNA gapmer.

[0345] In certain embodiments, modified oligonucleotides have a sugar motif selected from 5'-eeeeeddddddddddeeeee-3' or 5'-kkkddddddddddkkk-3', where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt sugar moiety. In certain embodiments, modified oligonucleotides have the following sugar motif: 5'-eeeeeddddddddddeeeee-3', where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, modified oligonucleotides have the following sugar motif: 5'-kkkddddddddddkkk-3', where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety.

[0346] Antisense RNAi Oligonucleotides In certain embodiments, the sugar moiety of at least one nucleoside of the antisense RNAi oligonucleotide is a modified sugar moiety.

[0347] In certain embodiments, at least one nucleoside of the antisense RNAi oligonucleotide comprises a 2'-OMe sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least three nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least four nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least five nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least six nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least seven nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least eight nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least nine nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least ten nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least 11 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least 12 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least 13 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least 14 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least 15 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least 17 nucleosides comprise a 2'-OMe sugar moiety. In certain such embodiments, at least 18 nucleosides comprise a 2'-OMe sugar moiety. In certain such embodiments, at least 20 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least 21 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, one or two nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, 1 to 3 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, 1 to 4 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, 1 to 5 nucleosides comprise a 2'-OMe sugar moiety.In certain embodiments, 1-7 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, 1-10 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, 1-12 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, 1-13 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, 13 nucleosides comprise a 2'-OMe sugar moiety, with three of the 2'-OMe nucleosides being contiguous. In certain such embodiments, the remainder of the nucleosides are 2'-F modified.

[0348] In certain embodiments, at least one nucleoside of the antisense RNAi oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least three nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least four nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least five nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least six nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least seven nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least eight nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least nine nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least ten nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least 11 nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least 12 nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least 13 nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least 14 nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least 16 nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least 18 nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least 20 nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least 21 nucleosides comprise a 2'-F sugar moiety. In certain embodiments, one or two nucleosides comprise a 2'-F sugar moiety. In certain embodiments, one to three nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least 1-4 nucleosides comprise a 2'-F sugar moiety. In certain embodiments, 1-5 nucleosides comprise a 2'-F sugar moiety. In certain embodiments, 1-7 nucleosides comprise a 2'-F sugar moiety. In certain embodiments, 1-10 nucleosides comprise a 2'-F sugar moiety.In certain embodiments, every other nucleoside of the antisense RNAi oligonucleotide is a 2'-F nucleoside. In certain such embodiments, the remainder of the nucleosides are 2'-OMe modified.

[0349] In certain embodiments, at least one nucleoside of the antisense RNAi oligonucleotide comprises a 2'-OMe sugar moiety, and at least one nucleoside comprises a 2'-F sugar moiety.In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleosides comprise a 2'-OMe sugar moiety, and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides comprise a 2'-F sugar moiety.In certain embodiments, the antisense RNAi oligonucleotide comprises a sugar motif of fyf or yfy, where each "f" represents a 2'-F sugar moiety, and each "y" represents a 2'-OMe sugar moiety. In certain embodiments, the antisense RNAi oligonucleotides have a sugar motif of yfyfyfyfyfyfyfyfyfyyy, where each "f" represents a 2'-F sugar moiety and each "y" represents a 2'-OMe sugar moiety.

[0350] In certain embodiments, one nucleoside of the antisense RNAi oligonucleotide is UNA.In certain embodiments, one nucleoside of the antisense RNAi oligonucleotide is GNA.In certain embodiments, one to four nucleosides of the antisense RNAi oligonucleotide are DNA.In certain such embodiments, the one to four DNA nucleosides are at one or both ends of the antisense RNAi oligonucleotide.

[0351] Sense RNAi oligonucleotides In certain embodiments, the sugar moiety of at least one nucleoside of the sense RNAi oligonucleotide is a modified sugar moiety.

[0352] In certain such embodiments, at least one nucleoside of the sense RNAi oligonucleotide comprises a 2'-OMe sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least three nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least four nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least five nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least six nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least seven nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least eight nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least nine nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least ten nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least 12 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least 14 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least 15 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least 17 nucleosides comprise a 2'-OMe sugar moiety. In certain such embodiments, at least 18 nucleosides comprise a 2'-OMe sugar moiety. In certain such embodiments, at least 20 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, one or two nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, one to three nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, one to four nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, one to five nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, 1-7 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, 1-10 nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, every other nucleoside of the sense RNAi oligonucleotide is a 2'-OMe nucleoside.In certain such embodiments, the remainder of the nucleoside is a 2'-F modification.

[0353] In certain embodiments, at least one nucleoside of the sense RNAi oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least three nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least four nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least five nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least six nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least seven nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least eight nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least nine nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least ten nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least 11 nucleosides comprise a 2'-F sugar moiety. In certain embodiments, one or two nucleosides comprise a 2'-F sugar moiety. In certain embodiments, one to three nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least one to four nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least one to five nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least one to seven nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least one to ten nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least one to eleven nucleosides comprise a 2'-F sugar moiety. In certain embodiments, every other nucleoside of the sense RNAi oligonucleotide is a 2'-F nucleoside. In certain embodiments, the remainder of the nucleosides are 2'OMe modified.

[0354] In certain embodiments, at least one nucleoside of the sense RNAi oligonucleotide comprises a 2'-OMe sugar moiety, and at least one nucleoside comprises a 2'-F sugar moiety.In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides comprise a 2'-OMe sugar moiety, and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 nucleosides comprise a 2'-F sugar moiety.In certain embodiments, the sense RNAi oligonucleotide comprises a sugar motif of fyf or yfy, where each "f" represents a 2'-F sugar moiety, and each "y" represents a 2'-OMe sugar moiety. In certain embodiments, the sense RNAi oligonucleotide has a sugar motif of fyfyfyfyfyfyfyfyfyfyf, where each "f" represents a 2'-F sugar moiety and each "y" represents a 2'-OMe sugar moiety.

[0355] In certain embodiments, one nucleoside of the sense RNAi oligonucleotide is UNA.In certain embodiments, one nucleoside of the sense RNAi oligonucleotide is GNA.In certain embodiments, one to four nucleosides of the sense RNAi oligonucleotide are DNA.In certain such embodiments, the one to four DNA nucleosides are at one or both ends of the sense RNAi oligonucleotide.

[0356] 2. Specific nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or region thereof. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0357] In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases.In certain such embodiments, the block is at the 3' end of the oligonucleotide.In certain embodiments, the block is within 3 nucleosides of the 3' end of the oligonucleotide.In certain embodiments, the block is at the 5' end of the oligonucleotide.In certain embodiments, the block is within 3 nucleosides of the 5' end of the oligonucleotide.

[0358] Gapmer Oligonucleotides In certain embodiments, the oligonucleotide having a gapmer motif comprises a nucleoside that comprises a modified nucleobase. In certain such embodiments, one nucleoside that comprises a modified nucleobase is in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of such nucleoside is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0359] 3. Specific internucleoside linkage motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0360] Gapmer Oligonucleotides In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages in the gap are modified. In certain embodiments, some or all of the internucleoside linkages in both wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, where the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all phosphorothioate linkages in both wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, or Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain such internucleoside linkage motifs.

[0361] In certain embodiments, the modified oligonucleotide has the internucleoside linkage motif sssssssssssssss or sssssssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. In certain embodiments, the modified oligonucleotide has the internucleoside linkage motif ssssssssssssssss. In certain embodiments, the modified oligonucleotide has the internucleoside linkage motif ssssssssssssssssss.

[0362] In certain embodiments, modified oligonucleotides comprise an internucleoside linkage motif that comprises one or more mesyl phosphoramidate linkage groups.In certain embodiments, one or more phosphorothioate internucleoside linkages or one or more phosphodiester internucleoside linkages of the internucleoside linkage motif herein are replaced with mesyl phosphoramidate linkage groups.

[0363] Antisense RNAi Oligonucleotides In certain embodiments, at least one bond of the antisense RNAi oligonucleotide is a modified bond. In certain embodiments, the 5'-most bond (i.e., the bond that connects the first nucleoside from the 5'-end to the second nucleoside from the 5'-end) is modified. In certain embodiments, the two 5'-most bonds are modified. In certain embodiments, the first one or two bonds from the 3'-end are modified. In certain embodiments, the modified bond is a phosphorothioate bond. In certain embodiments, the remaining bonds are all unmodified phosphodiester bonds. In certain embodiments, the antisense RNAi oligonucleotide has an internucleoside linkage motif ssooooooooooooooooooooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0364] In certain embodiments, at least one bond of the antisense RNAi oligonucleotide is an inverted bond.

[0365] Sense RNAi oligonucleotides In certain embodiments, at least one bond of the sense RNAi oligonucleotide is a modified bond. In certain embodiments, the 5'-most bond (i.e., the bond that connects the first nucleoside from the 5'-end to the second nucleoside from the 5'-end) is modified. In certain embodiments, the two 5'-most bonds are modified. In certain embodiments, the first one or two bonds from the 3'-end are modified. In certain embodiments, the modified bond is a phosphorothioate bond. In certain embodiments, the remaining bonds are all unmodified phosphodiester bonds. In certain embodiments, the sense RNAi oligonucleotide has an internucleoside linkage motif ssooooooooooooooooooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0366] In certain embodiments, at least one bond of the sense RNAi oligonucleotide is an inverted bond.

[0367] C. A specific length The length of the oligonucleotide can be increased or decreased without eliminating activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested a series of oligonucleotides, 13-25 nucleobases long, for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases long containing 8 or 11 mismatched bases near the ends of the oligonucleotide were able to induce specific cleavage of the target RNA, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.

[0368] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X≦Y. For example, in certain embodiments, the oligonucleotides are 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13~16 pieces, 13~17 pieces, 13~18 pieces, 13~19 pieces, 13~20 pieces, 13~21 pieces, 13~22 pieces, 13~23 pieces, 13~24 pieces, 13~25 pieces, 13~26 pieces, 13~27 pieces, 13~28 pieces, 13~29 pieces, 13~30 pieces, 14~15 pieces, 14~16 pieces, 14~17 pieces, 14~18 pieces, 14~19 pieces, 14~20 pieces, 14~21 pieces, 14~22 pieces, 14~23 pieces, 14~24 pieces, 14~25 pieces, 14~26 pieces, 14~27 pieces, 14~28 pieces, 14~29 pieces, 14~30 pieces, 15~16 pieces, 15~17 pieces, 15~18 pieces, 15~19 pieces, 15~20 pieces, 15~21 pieces, 15~22 pieces, 15~23 pieces, 15~24 pieces, 15~25 pieces, 15~26 pieces, 15~27 pieces, 15~28 pieces, 15~29 pieces, 15~30 pieces, 16~17 pieces, 16~18 pieces, 16~19 pieces, 16~20 pieces, 16~21 pieces, 16~22 pieces, 16~23 pieces, 16~24 pieces, 16~25 pieces, 16~26 pieces, 16~27 pieces, 16~28 pieces, 16~29 pieces, 16~30 pieces, 17~18 pieces, 17~19 pieces, 17~20 pieces, 17~21 pieces, 17~22 pieces, 17~23 pieces, 17~24 pieces, 17~25 pieces, 17~26 pieces, 17~27 pieces, 17~28 pieces, 17~29 pieces,17~30 pieces, 18~19 pieces, 18~20 pieces, 18~21 pieces, 18~22 pieces, 18~23 pieces, 18~24 pieces, 18~25 pieces, 18~26 pieces, 18~27 pieces, 1 8~28 pieces, 18~29 pieces, 18~30 pieces, 19~20 pieces, 19~21 pieces, 19~22 pieces, 19~23 pieces, 19~24 pieces, 19~25 pieces, 19~26 pieces, 19 ~29 pieces, 19~28 pieces, 19~29 pieces, 19~30 pieces, 20~21 pieces, 20~22 pieces, 20~23 pieces, 20~24 pieces, 20~25 pieces, 20~26 pieces, 20~ 27 pieces, 20~28 pieces, 20~29 pieces, 20~30 pieces, 21~22 pieces, 21~23 pieces, 21~24 pieces, 21~25 pieces, 21~26 pieces, 21~27 pieces, 21~28 pieces pieces, 21~29 pieces, 21~30 pieces, 22~23 pieces, 22~24 pieces, 22~25 pieces, 22~26 pieces, 22~27 pieces, 22~28 pieces, 22~29 pieces, 22~30 pieces , 23~24 pieces, 23~25 pieces, 23~26 pieces, 23~27 pieces, 23~28 pieces, 23~29 pieces, 23~30 pieces, 24~25 pieces, 24~26 pieces, 24~27 pieces, 2 It consists of 4 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0369] In certain embodiments, the oligonucleotides (including modified oligonucleotides) consist of 16 linked nucleosides. In certain embodiments, the oligonucleotides (including modified oligonucleotides) consist of 17 linked nucleosides. In certain embodiments, the oligonucleotides (including modified oligonucleotides) consist of 18 linked nucleosides. In certain embodiments, the oligonucleotides (including modified oligonucleotides) consist of 19 linked nucleosides. In certain embodiments, the oligonucleotides (including modified oligonucleotides) consist of 20 linked nucleosides.

[0370] Gapmer Oligonucleotides In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X≦Y. For example, in certain embodiments, the gapmers are 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13- 17 pieces, 13~18 pieces, 13~19 pieces, 13~20 pieces, 13~21 pieces, 13~22 pieces, 13~23 pieces, 13~24 pieces, 13~25 pieces, 13~26 pieces, 13~27 pieces, 13~28 pieces, 13~29 pieces , 13~30 pieces, 14~15 pieces, 14~16 pieces, 14~17 pieces, 14~18 pieces, 14~19 pieces, 14~20 pieces, 14~21 pieces, 14~22 pieces, 14~23 pieces, 14~24 pieces, 14~25 pieces, 14 ~26 pieces, 14~27 pieces, 14~28 pieces, 14~29 pieces, 14~30 pieces, 15~16 pieces, 15~17 pieces, 15~18 pieces, 15~19 pieces, 15~20 pieces, 15~21 pieces, 15~22 pieces, 15~23 pieces, 15~24 pieces, 15~25 pieces, 15~26 pieces, 15~27 pieces, 15~28 pieces, 15~29 pieces, 15~30 pieces, 16~17 pieces, 16~18 pieces, 16~19 pieces, 16~20 pieces, 16~21 pieces, 1 6~22 pieces, 16~23 pieces, 16~24 pieces, 16~25 pieces, 16~26 pieces, 16~27 pieces, 16~28 pieces, 16~29 pieces, 16~30 pieces, 17~18 pieces, 17~19 pieces, 17~20 pieces, 17~2 1 piece, 17~22 pieces, 17~23 pieces, 17~24 pieces, 17~25 pieces, 17~26 pieces, 17~27 pieces, 17~28 pieces, 17~29 pieces, 17~30 pieces, 18~19 pieces, 18~20 pieces, 18~21 pieces,18~22 pieces, 18~23 pieces, 18~24 pieces, 18~25 pieces, 18~26 pieces, 18~27 pieces, 18~28 pieces, 18~29 pieces, 18~30 pieces, 19~2 0 pieces, 19~21 pieces, 19~22 pieces, 19~23 pieces, 19~24 pieces, 19~25 pieces, 19~26 pieces, 19~29 pieces, 19~28 pieces, 19~29 pieces, 19 ~30 pieces, 20~21 pieces, 20~22 pieces, 20~23 pieces, 20~24 pieces, 20~25 pieces, 20~26 pieces, 20~27 pieces, 20~28 pieces, 20~29 pieces, 20~30 pieces, 21~22 pieces, 21~23 pieces, 21~24 pieces, 21~25 pieces, 21~26 pieces, 21~27 pieces, 21~28 pieces, 21~29 pieces, 21~30 pieces pieces, 22~23 pieces, 22~24 pieces, 22~25 pieces, 22~26 pieces, 22~27 pieces, 22~28 pieces, 22~29 pieces, 22~30 pieces, 23~24 pieces, 23~ 25 pieces, 23~26 pieces, 23~27 pieces, 23~28 pieces, 23~29 pieces, 23~30 pieces, 24~25 pieces, 24~26 pieces, 24~27 pieces, 24~28 pieces, 2 It consists of 4 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0371] In certain embodiments, a gapmer consists of 16 linked nucleosides. In certain embodiments, a gapmer consists of 17 linked nucleosides. In certain embodiments, a gapmer consists of 18 linked nucleosides. In certain embodiments, a gapmer consists of 19 linked nucleosides. In certain embodiments, a gapmer consists of 20 linked nucleosides.

[0372] Antisense RNAi Oligonucleotides In certain embodiments, the antisense RNAi oligonucleotide consists of 17-30 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 17-25 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 17-23 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 17-21 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 18-30 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 20-30 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 21-30 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 23-30 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 18-25 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 20-22 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 21-23 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 23-24 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 21 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 22 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 23 linked nucleosides.

[0373] Sense RNAi oligonucleotides In certain embodiments, the sense RNAi oligonucleotide consists of 17-30 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 17-25 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 17-23 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 17-21 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 18-30 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 20-30 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 21-30 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 23-30 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 18-25 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 20-22 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 21-23 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 23-24 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 21 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 22 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 23 linked nucleosides.

[0374] D. Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, such parameters are each independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages in the wing regions of the sugar gapmer may be the same or different from each other, and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases independent of the gapmer pattern of sugar modification. Unless otherwise indicated, any modification is independent of the nucleobase sequence.

[0375] E. Specific Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all of the modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chiral enriched population. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chiral enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chiral enriched population are enriched for β-D ribosyl sugar moieties and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chiral enriched population are enriched for both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0376] F. Nucleic acid sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further represented by their nucleobase sequences.In certain embodiments, oligonucleotides have nucleobase sequences that are complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.In certain embodiments, a region or full length of an oligonucleotide has a nucleobase sequence that is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a second oligonucleotide or nucleic acid, such as a target nucleic acid.

[0377] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds consisting of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group can be attached to one or both termini and / or any internal position of the oligonucleotide. In certain embodiments, a conjugate group is attached to the 2' position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to one or both termini of an oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3' and / or 5' termini of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached near the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached near the 5' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached near the 5' terminus of an oligonucleotide.

[0378] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0379] A. Specific Conjugation Groups In certain embodiments, the oligonucleotide is covalently linked to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the linked oligonucleotide, including but not limited to the pharmacodynamic properties, pharmacokinetic properties, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.

[0380] In certain embodiments, one or more properties of the modified oligonucleotide can be optimized by conjugating one or more carbohydrate moieties to the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to the modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced with another moiety, for example, a non-carbohydrate (preferably cyclic) carrier with a carbohydrate ligand attached. The ribonucleotide subunit in which the ribose sugar of the subunit is replaced in this manner is referred to herein as a modified sugar moiety, ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbon ring system, i.e., one or more ring atoms can be heteroatoms, for example, nitrogen, oxygen, sulfur. The cyclic carrier can be a monocyclic ring system or can include two or more rings, for example, fused rings. The cyclic carrier can be a fully saturated ring system or can include one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.

[0381] In certain embodiments, the conjugate group confers new properties to the attached oligonucleotide, for example, a fluorophore or reporter group that allows for detection of the oligonucleotide. Certain conjugate groups and moieties have been described previously, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), choline acids (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterols (Oberhauser et al., Nucl. Acids, 1999, 10, 1024-1026), and the like. Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1995, 36, 3651-3654). Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid, palmityl moieties (Mishra et al., Biochim. Biophys.Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0382] In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0383] In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, whose alkyl chains have one or more unsaturated bonds.

[0384] In certain embodiments, the conjugate group is a lipid having the following structure:

[0385] [ka]

[0386] 1. Conjugate part Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), antibodies, vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0387] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbituric acid, cephalosporin, sulfa drug, antidiabetic drug, antibacterial drug or antibiotic.

[0388] 2. Conjugate Linker Conjugate moiety is linked to oligonucleotide via conjugate linker.In certain oligomeric compounds, conjugate linker is a single chemical bond (i.e., conjugate moiety is directly linked to oligonucleotide via single bond).In certain embodiments, said conjugate linker comprises a chain structure such as hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.

[0389] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0390] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0391] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety, for example, one known in the art to be useful for attaching a conjugate group to a compound such as the oligonucleotides provided herein. In general, the bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a specific site on the compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0392] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 and alkynyl, where a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0393] In certain embodiments, the conjugate linker comprises 1-10 linker nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is usually desirable for the linker nucleoside to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are usually linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0394] In the present specification, linker nucleosides are not considered to be part of an oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides, and (2) a conjugate group comprising 1-10 linker nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and not comprising a conjugate group. The total number of consecutive linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise indicated, the conjugate linker comprises 10 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker nucleosides. In certain embodiments, the conjugate linker comprises only 1 linker nucleoside.

[0395] In certain embodiments, it is desirable that the conjugate group is cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds that contain certain conjugate moieties are more likely to be taken up by certain cell types, but it is desirable that the conjugate group is cleaved to release the unconjugated or parent oligonucleotide after the oligomeric compound is taken up. Thus, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside the cell or in an intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0396] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide.In certain embodiments, the cleavable bond is one or both esters of phosphodiester.In certain embodiments, the cleavable moiety comprises phosphate or phosphodiester.In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0397] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, the cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0398] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula:

[0399] [ka] In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1; j is 1 or 0; and k is 1 or 0.

[0400] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0401] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently attached to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently attached to the branching group.

[0402] In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one receptor type on target cell.In certain embodiments, each ligand has affinity for at least one receptor type on the surface of mammalian liver cells.In certain embodiments, each ligand has affinity for hepatic asialoglycoprotein receptor (ASGP-R).In certain embodiments, each ligand is a carbohydrate.

[0403] In certain embodiments, the conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, the conjugate group has the general formula:

[0404] [ka] In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1; j is 1 or 0; and k is 1 or 0.

[0405] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0406] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently attached to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently attached to the branching group.

[0407] In certain embodiments, the cell targeting moiety targets neurons.In certain embodiments, the cell targeting moiety targets neurotransmitter receptors.In certain embodiments, the cell targeting moiety targets neurotransmitter transporters.In certain embodiments, the cell targeting moiety targets GABA transporters.See, for example, WO2011 / 131693, WO2014 / 064257.

[0408] In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for the transferrin receptor (TfR), (also referred to herein as TfR1 and CD71). In certain embodiments, the conjugate group described herein comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art, including, but not limited to, those described in WO1991 / 004753, WO2013 / 103800, WO2014 / 144060, WO2016 / 081643, WO2016 / 179257, WO2016 / 207240, WO2017 / 221883, WO2018 / 129384, WO2018 / 124121, WO2019 / 151539, WO2020 / 132584, WO2020 / 028864, US7,208,174, US9,034,329, and US10,550,188. In certain embodiments, the fragment of the anti-TfR1 antibody is a F(ab')2, Fab, Fab', Fv, or scFv.

[0409] In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the protein or peptide capable of binding TfR1 can be any known in the art, including but not limited to those described in WO2019 / 140050, WO2020 / 037150, WO2020 / 124032, and US10,138,483.

[0410] In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the aptamer capable of binding TfR1 can be any known in the art, including but not limited to those described in WO2013 / 163303, WO2019 / 033051, and WO2020 / 245198.

[0411] B. Specific End Groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include 5'-phosphonates, including but not limited to 5'-vinyl phosphonates. In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides or sugar moieties. In certain such embodiments, the 2'-linked group is an abasic sugar moiety.

[0412] III. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acid to provide at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of target nucleic acid by 25% or more in a standard in vitro assay. In certain embodiments, antisense compounds selectively act on one or more target nucleic acids. Such antisense compounds include nucleobase sequences that hybridize to one or more target nucleic acids to provide one or more desired antisense activities and do not hybridize to one or more non-target nucleic acids or do not hybridize to one or more non-target nucleic acids in such a way that they cause significant undesired antisense activity.

[0413] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, antisense compounds are described herein that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides are tolerated within the gapmer gap.

[0414] In certain antisense activity, antisense compound or part of antisense compound is incorporated into RNA-induced silencing complex (RISC), which finally leads to cleavage of target nucleic acid.For example, certain antisense compound leads to cleavage of target nucleic acid by Argonaute.The antisense compound that is incorporated into RISC is an RNAi agent.RNAi agent can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).

[0415] In certain embodiments, the hybridization of antisense compounds to target nucleic acid does not result in the recruitment of proteins that cleave the target nucleic acid.In certain embodiments, the hybridization of antisense compounds to target nucleic acid results in the change of splicing of the target nucleic acid.In certain embodiments, the hybridization of antisense compounds to target nucleic acid results in the inhibition of the binding interaction of the target nucleic acid with proteins or other nucleic acids.In certain embodiments, the hybridization of antisense compounds to target nucleic acid results in the change of translation of the target nucleic acid.

[0416] Antisense activity can be observed directly or indirectly. In certain embodiments, observing or detecting antisense activity involves observing or detecting changes in the amount of target nucleic acid or the amount of protein encoded by such target nucleic acid, changes in the ratio of splice variants of nucleic acid or protein, and / or changes in phenotype in a cell or subject.

[0417] IV. Specific Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA (including introns, exons, and untranslated regions). In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is located at least 50% within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, and intronic RNA molecules.

[0418] A. Complementarity / Mismatch and Double-Stranded Complementarity to Target Nucleic Acid In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the region of full complementarity is 6-20, 10-18, or 18-20 nucleobases in length.

[0419] It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA can reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Moreover, this oligonucleotide also showed strong antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem oligonucleotides consisting of 14 nucleobases, as well as 28 and 42 nucleobase oligonucleotides containing two or three of the tandem oligonucleotide sequences, respectively, for their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of these three 14 nucleobase oligonucleotides alone was able to inhibit translation, although to a lesser extent than the 28 or 42 nucleobase oligonucleotides.

[0420] In certain embodiments, oligonucleotide comprises one or more mismatched nucleobases with target nucleic acid.In certain embodiments, the antisense activity of target is reduced by such mismatch, but the activity of non-target is reduced more.Therefore, in certain embodiments, the selectivity of the oligonucleotide is improved.

[0421] Gapmer Oligonucleotides In certain embodiments, the mismatch is specifically located in the oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at 1, 2, 3, 4, 5, 6, 7, or 8 positions from the 5' end of the gap region. In certain embodiments, the mismatch is at 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions from the 3' end of the gap region. In certain embodiments, the mismatch is at 1, 2, 3, or 4 positions from the 5' end of the wing region. In certain embodiments, the mismatch is at 4, 3, 2, or 1 positions from the 3' end of the wing region.

[0422] Antisense RNAi Oligonucleotides In certain embodiments, antisense RNAi oligonucleotide comprises one or more mismatched nucleobases with target nucleic acid.In certain embodiments, the RNAi activity of target is reduced by such mismatch, but the activity of non-target is reduced more.Therefore, in certain embodiments, the selectivity of the antisense RNAi oligonucleotide is improved.

[0423] In certain embodiments, the antisense RNAi oligonucleotide comprises a targeting region that is complementary to the target nucleic acid.In certain embodiments, the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides.In certain embodiments, the targeting region comprises 70%, 80%, 85%, 90%, or 95% of the nucleosides of the antisense RNAi oligonucleotide.In certain embodiments, the targeting region comprises all of the nucleosides of the antisense RNAi oligonucleotide.In certain embodiments, the targeting region of the antisense RNAi oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the targeted region of the antisense RNAi oligonucleotide is 100% complementary to the target nucleic acid.

[0424] Sense RNAi oligonucleotides In certain embodiments, the RNAi agent comprises a sense RNAi oligonucleotide. In such embodiments, the sense RNAi oligonucleotide comprises a region complementary to the antisense RNAi oligonucleotide. In certain embodiments, the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides. In certain embodiments, the complementary region comprises 70%, 80%, 85%, 90%, or 95% of the nucleosides of the sense RNAi oligonucleotide. In certain embodiments, the complementary region comprises all of the nucleosides of the sense RNAi oligonucleotide. In certain embodiments, the complementary region of the sense RNAi oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the antisense RNAi oligonucleotide. In certain embodiments, the complementary region of the sense RNAi oligonucleotide is 100% complementary to the antisense RNAi oligonucleotide.

[0425] The complementary region of sense RNAi oligonucleotide hybridizes with antisense RNAi oligonucleotide to form a double-stranded region.In certain embodiments, this double-stranded region is composed of 7 hybridized pairs of nucleosides (one of each pair is on antisense RNAi oligonucleotide, and the other of each pair is on sense RNAi oligonucleotide).In certain embodiments, the double-stranded region comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 hybridized pairs.In certain embodiments, each nucleoside of antisense RNAi oligonucleotide is in the double-stranded region (i.e., the antisense RNAi oligonucleotide does not have overhanging nucleosides). In certain embodiments, the antisense RNAi oligonucleotide comprises an unpaired nucleoside (overhang nucleoside) at the 3'-end and / or 5'-end. In certain embodiments, each nucleoside of the sense RNAi oligonucleotide is in a double-stranded region (i.e., the sense RNAi oligonucleotide does not have an overhang nucleoside). In certain embodiments, the sense RNAi oligonucleotide comprises an unpaired nucleoside (overhang nucleoside) at the 3'-end and / or 5'-end. In certain embodiments, the duplex formed by the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide does not comprise an overhang at one or both ends. Such ends without overhangs are called blunt ends. In certain embodiments, the antisense RNAi oligonucleotide comprises an overhang nucleoside, and one or more of these overhang nucleosides are complementary to the target nucleic acid. In certain embodiments in which the antisense RNAi oligonucleotide has overhanging nucleosides, one or more of those overhanging nucleosides are not complementary to the target nucleic acid.

[0426] B.DUX4 In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, the target nucleic acid being DUX4. In certain embodiments, the DUX4 nucleic acid has a sequence as shown in SEQ ID NO: 1 (GENBANK Accession No. NC_000004.12, truncated from nucleotide 190171001 to 190187000) or SEQ ID NO: 2 (GENBANK Accession No. NM_001306068.2). In certain embodiments, the DUX4 nucleic acid has a sequence as shown in any of the known splice variants of DUX4, including but not limited to SEQ ID NO: 3 (GENBANK Accession No. FJ439133.1) and SEQ ID NO: 4 (GENBANK Accession No. NM_001293798.2). In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 reduces the amount of DUX4 RNA, and in certain embodiments reduces the amount of DUX4 protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.

[0427] In certain embodiments, contacting a cell with an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 reduces the amount of DUX4 RNA in the cell. In certain embodiments, contacting a cell with an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 reduces the amount of DUX4 protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is present in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell in a subject with an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 improves one or more symptoms or characteristics of a disease or disorder associated with DUX4. In certain embodiments, the disease or disorder associated with DUX4 is a neuromuscular disorder. In certain embodiments, the disease or disorder associated with DUX4 is a muscular dystrophy. In certain embodiments, the muscular dystrophy is facioscapulohumeral muscular dystrophy (FSHD).

[0428] In certain embodiments, oligomeric compounds complementary to any one of SEQ ID NOs: 1-4 are capable of reducing the in vitro amount of DUX4 RNA by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vitro assay. In certain embodiments, oligomeric compounds complementary to any one of SEQ ID NOs: 1-4 are capable of reducing the in vivo amount of DUX4 RNA by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vivo assay. In certain embodiments, oligomeric compounds complementary to any one of SEQ ID NOs: 1-4 are capable of reducing the in vitro amount of DUX4 protein by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vitro assay. In certain embodiments, oligomeric compounds complementary to any one of SEQ ID NOs: 1-4 are capable of reducing the in vivo amount of DUX4 protein by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vivo assay. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the amount of DUX4 RNA in a subject's muscle by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the amount of DUX4 protein in a subject's muscle by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0429] C. Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide that comprises a region that is complementary to a target nucleic acid, and the target nucleic acid is expressed in pharmacologically relevant tissue.In certain embodiments, the pharmacologically relevant tissue is muscle cell and muscle tissue.Such muscle tissue includes all skeletal muscles, including but not limited to upper and lower limbs, trunk, head and neck.

[0430] V. SPECIFIC METHODS AND USES Certain embodiments provided herein relate to the method of reducing or inhibiting the expression or activity of DUX4, which can be useful for treating, preventing or improving DUX4-related disease or disorder.In certain embodiments, the DUX4-related disease or disorder is a neuromuscular disorder.In certain embodiments, the DUX4-related disease or disorder is a muscular dystrophy.In certain embodiments, the muscular dystrophy is facioscapulohumeral muscular dystrophy (FSHD).

[0431] In certain embodiments, a method comprises administering to a subject an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent, each of which has a nucleobase sequence complementary to DUX4 nucleic acid.In certain embodiments, the subject has or is at risk of developing a disease or disorder associated with DUX4.In certain embodiments, the subject has a neuromuscular disorder.In certain embodiments, the subject has muscular dystrophy.In certain embodiments, the subject has facioscapulohumeral muscular dystrophy (FSHD).

[0432] In certain embodiments, the method of treating a disease or disorder associated with DUX4 comprises administering to a subject an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent, each of which has a nucleobase sequence complementary to DUX4 nucleic acid. In certain embodiments, the subject has or is at risk of developing a disease or disorder associated with DUX4. In certain embodiments, the subject has a neuromuscular disorder. In certain embodiments, the subject has a muscular dystrophy. In certain embodiments, the subject has facioscapulohumeral muscular dystrophy (FSHD). In certain embodiments, at least one symptom or characteristic of the disease or disorder associated with DUX4 is improved. In certain embodiments, the at least one symptom or characteristic is muscle weakness or muscle wasting of facial, scapular, and / or humeral muscles, which may progress to trunk and lower limb muscles. In certain embodiments, administration of the oligomeric compound, the modified oligonucleotide, the oligomeric duplex, or the antisense agent to the subject reduces or delays the onset or progression of muscle weakness or wasting in the facial, scapular, and / or humeral muscles, or further reduces or delays the onset or progression of muscle weakness or wasting in the trunk and / or lower limb muscles.

[0433] In certain embodiments, the method of reducing the expression of DUX4 nucleic acid, e.g., RNA, or the method of reducing the expression of DUX4 protein in a cell comprises contacting the cell with an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent, each of which has a nucleobase sequence complementary to DUX4 nucleic acid.In certain embodiments, the subject has or is at risk of developing a disease or disorder associated with DUX4.In certain embodiments, the subject has or is at risk of developing a neuromuscular disorder.In certain embodiments, the subject has or is at risk of developing a muscular dystrophy.In certain embodiments, the subject has or is at risk of developing facioscapulohumeral muscular dystrophy (FSHD).In certain embodiments, the cell is a muscle cell.In certain embodiments, the cell is a human cell.

[0434] In certain embodiments, the present invention provides an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent, each of which has a nucleobase sequence complementary to DUX4 nucleic acid, for use in treating disease or disorder associated with DUX4 or for use in manufacturing a medicament for treating disease or disorder associated with DUX4.In certain embodiments, the disease or disorder associated with DUX4 is a neuromuscular disorder.In certain embodiments, the disease or disorder associated with DUX4 is a muscular dystrophy.In certain embodiments, the disease or disorder associated with DUX4 is facioscapulohumeral muscular dystrophy (FSHD).

[0435] In any of the methods or uses described herein, the oligomeric compound, the modified oligonucleotide, the oligomeric duplex, or the antisense agent may be any described herein.

[0436] VI. Certain Pharmaceutical Compositions In certain embodiments, provided herein is a pharmaceutical composition comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each comprise a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0437] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and an artificial cerebrospinal fluid (aCSF). In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and the artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and the artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0438] In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of the aCSF solution is adjusted to about 7.1 to 7.3, or to about 7.2, by a suitable pH adjusting agent, for example, an acid such as hydrochloric acid and an alkali such as sodium hydroxide.

[0439] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, in certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0440] In certain embodiments, the oligomeric compounds may be mixed with pharma- ceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The composition and method for formulating a pharmaceutical composition depends on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0441] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharma- ceutically acceptable salts of the oligomeric compounds, esters of the oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof upon administration to animals, including humans. Thus, for example, the present disclosure also relates to pharma- ceutically acceptable salts of oligomeric compounds, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharma- ceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, prodrugs include one or more conjugate groups attached to the oligonucleotide, which are cleaved by endogenous nucleases in the body.

[0442] In certain embodiments, the oligomeric compound is lyophilized and isolated as sodium salt.In certain embodiments, the sodium salt of the oligomeric compound is mixed with a pharmaceutically acceptable diluent.In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF.In certain embodiments, the sodium salt of the oligomeric compound is mixed with PBS.In certain embodiments, the sodium salt of the oligomeric compound is mixed with aCSF.

[0443] Lipid moieties are used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes made of a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase distribution of drugs to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase distribution of drugs to adipose tissue. In certain embodiments, lipid moieties are selected to increase distribution of drugs to muscle tissue.

[0444] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for the preparation of certain pharmaceutical compositions, including those that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0445] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more agents of the present invention to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0446] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant Polysorbate 80™, and 65% w / v of polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems may be varied significantly without significantly altering their solubility and toxicity. Furthermore, the identity of the co-solvent components may be varied, for example, other surfactants may be substituted for Polysorbate 80™, the fraction size of polyethylene glycol may be changed, other biocompatible polymers, such as polyvinylpyrrolidone, may replace polyethylene glycol, and other sugars or polysaccharides may replace dextrose.

[0447] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are contained in unit dosage form, such as ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending agents, stabilizing agents, and / or dispersing agents. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0448] Under certain conditions, certain compounds disclosed herein function as acids. Such compounds may be depicted or described in a protonated (free acid) form or in an ionized (salt) form associated with a cation, but aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphodiester bonds of an oligonucleotide in aqueous solution exist in equilibrium between the free acid, anionic and salt forms. Unless otherwise indicated, compounds disclosed herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of forms that are all in equilibrium at multiple positions. The term "oligonucleotide" is intended to include all such forms. The structures depicted necessarily show a single form. Nevertheless, unless otherwise indicated, such drawings are intended to include the corresponding forms as well. In this specification, structures depicting the free acid of a compound followed by the term "or a pharma- ceutically acceptable salt thereof" expressly include all such forms, which may be fully or partially protonated / deprotonated / associated with a cation or combination of cations. In certain embodiments, one or more specific cations are specified. Such cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, the structure showing the free acid of the compound followed by the term "or a pharma- ceutically acceptable salt thereof" expressly includes all forms that can be fully or partially protonated / deprotonated / associated with one or more cations selected from sodium, potassium, calcium, and magnesium.

[0449] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution with sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution with potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl until the desired pH is reached.

[0450] In this specification, a certain dosage is described.The dosage can be in the form of dosage unit.For clarity, the dosage (or dosage unit) in milligrams of modified oligonucleotide or oligomeric compound refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound.As mentioned above, in aqueous solution, the free acid is in equilibrium with anion form and salt form.However, for the purpose of calculating dosage, the modified oligonucleotide or oligomeric compound is assumed to be present as solvent-free, sodium acetate-free, anhydrous, free acid.

[0451] In certain embodiments, when modified oligonucleotide or oligomeric compound is contained in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with sodium ions.However, the mass of this proton is taken into account in the weight of the dose, and the mass of sodium ions is not taken into account in the weight of the dose.Thus, for example, a dose or dose unit of 10 mg of compound number 541106 or compound number 613801 is equal to the number of fully protonated molecules that weigh 10 mg.This corresponds to 10.58 mg of solvent-free, sodium acetate-free, anhydrous sodiated compound number 541106, or 10.61 mg of solvent-free, sodium acetate-free, anhydrous sodiated compound number 613801.

[0452] In certain embodiments, when a modified oligonucleotide or oligomeric compound is contained in a solution containing sodium, potassium, calcium, and magnesium, such as aCSF, the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with sodium, potassium, calcium, and / or magnesium. However, the mass of the protons is taken into account in the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions is not taken into account in the weight of the dose.

[0453] In certain embodiments, when an oligomeric compound contains a conjugate group, the mass of the conjugate group can be included in calculating the dosage of such an oligomeric compound. If the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for purposes of calculating the dosage.

[0454] VII. Specific Hotspot Areas 1. Nucleic acid bases 2697 to 2730 of SEQ ID NO:1 In certain embodiments, nucleobases 2697-2730 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 2697-2730 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 or 3-10-3 gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "k" represents a cEt sugar moiety, and each cytosine residue is a 5-methylcytosine.

[0455] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0456] The nucleobase sequences of SEQ ID NOs: 24, 98, 318-320, 359-361, 398-400, 438-440, 852, and 857 are complementary to the interior of nucleobases 2697-2730 of SEQ ID NO:1.

[0457] Compounds 541110, 541187, 1099107-1099118, 1582921, and 1582472 are complementary within nucleobases 2697-2730 of SEQ ID NO:1.

[0458] In certain embodiments, modified oligonucleotides complementary to within nucleobases 2697-2730 of SEQ ID NO:1 achieve at least 27% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary to within nucleobases 2697-2730 of SEQ ID NO:1 achieve an average of 56% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0459] 2. Nucleic acid bases 2756 to 2778 of SEQ ID NO:1 In certain embodiments, nucleobases 2756-2778 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 2756-2778 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0460] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0461] The nucleobase sequences of SEQ ID NOs: 323, 324, 364, 404, 443, and 444 are complementary to the interior of nucleobases 2756 to 2778 of SEQ ID NO:1.

[0462] Compounds 1099128-1099133 are complementary within nucleobases 2756-2778 of SEQ ID NO:1.

[0463] In certain embodiments, modified oligonucleotides complementary to within nucleobases 2756-2778 of SEQ ID NO:1 achieve at least 25% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary to within nucleobases 2756-2778 of SEQ ID NO:1 achieve an average of 57% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0464] 3. Nucleic acid bases 4103 to 4134 of SEQ ID NO: 1 and / or nucleic acid bases 1330 to 1361 of SEQ ID NO: 2 In certain embodiments, nucleobases 4103-4134 of SEQ ID NO:1 and / or nucleobases 1330-1361 of SEQ ID NO:2 comprise hotspot regions. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 4103-4134 of SEQ ID NO:1 and / or nucleobases 1330-1361 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 or 3-10-3 gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0465] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0466] The nucleobase sequences of SEQ ID NOs: 73, 148, 327, 367, 407, 408, 208, and 447 are complementary to nucleobases 4103 to 4134 of SEQ ID NO: 1 and / or nucleobases 1330 to 1361 of SEQ ID NO:2.

[0467] Compounds 541160, 541238, 613853, and 1099147-1099151 are internally complementary to nucleobases 4103-4134 of SEQ ID NO:1 and / or nucleobases 1330-1361 of SEQ ID NO:2.

[0468] In certain embodiments, modified oligonucleotides complementary within nucleobases 4103-4134 of SEQ ID NO:1 and / or nucleobases 1330-1361 of SEQ ID NO:2 achieve at least 14% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4103-4134 of SEQ ID NO:1 and / or nucleobases 1330-1361 of SEQ ID NO:2 achieve an average of 52% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0469] 4. Nucleic acid bases 4503 to 4522 of SEQ ID NO:1 In certain embodiments, nucleobases 4503-4522 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 4503-4522 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0470] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0471] The nucleobase sequences of SEQ ID NOs: 299, 340, 379, and 420 to 421 are complementary to the interior of nucleobases 4503 to 4522 of SEQ ID NO:1.

[0472] Compounds 1098903-1098907 are complementary within nucleobases 4503-4522 of SEQ ID NO:1.

[0473] In certain embodiments, modified oligonucleotides complementary to within nucleobases 4503-4522 of SEQ ID NO:1 achieve at least 34% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary to within nucleobases 4503-4522 of SEQ ID NO:1 achieve an average of 55% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0474] 5. Nucleic acid bases 4509 to 4530 of SEQ ID NO:1 In certain embodiments, nucleobases 4509-4530 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 4509-4530 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0475] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0476] The nucleobase sequences of SEQ ID NOs: 300 to 301, 341 to 342, 380, 422, and 1002 are complementary to the interior of nucleobases 4509 to 4530 of SEQ ID NO:1.

[0477] Compounds 1098908-1098913 and 1582464 are complementary within nucleobases 4509-4530 of SEQ ID NO:1.

[0478] In certain embodiments, modified oligonucleotides complementary within nucleobases 4509-4530 of SEQ ID NO:1 achieve at least 43% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4509-4530 of SEQ ID NO:1 achieve an average of 61% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0479] 6. Nucleic acid bases 4828 to 4850 of SEQ ID NO: 1 and / or nucleic acid bases 1693 to 1710 of SEQ ID NO: 2 In certain embodiments, nucleobases 4828-4850 of SEQ ID NO:1 and / or nucleobases 1693-1710 of SEQ ID NO:2 comprise hotspot regions. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 4828-4850 of SEQ ID NO:1 and / or nucleobases 1693-1710 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0480] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0481] The nucleobase sequences of SEQ ID NOs: 331, 332, 370, 371, 412, 413, 451, and 452 are complementary to nucleobases 4828 to 4850 of SEQ ID NO:1 and / or nucleobases 1693 to 1710 of SEQ ID NO:2.

[0482] Compounds 1099177-1099184 are internally complementary to nucleobases 4828-4850 of SEQ ID NO:1 and / or nucleobases 1693-1710 of SEQ ID NO:2.

[0483] In certain embodiments, modified oligonucleotides complementary within nucleobases 4828-4850 of SEQ ID NO:1 and / or nucleobases 1693-1710 of SEQ ID NO:2 achieve at least 44% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4828-4850 of SEQ ID NO:1 and / or nucleobases 1693-1710 of SEQ ID NO:2 achieve an average of 55% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0484] 7. Nucleic acid bases 768 to 787 of SEQ ID NO:2 In certain embodiments, nucleobases 768-787 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 768-787 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0485] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0486] The nucleobase sequences of SEQ ID NOs: 326, 366, 406, 446, and 777 are complementary to the interior of nucleobases 768 to 787 of SEQ ID NO:2.

[0487] Compounds 1099138-1099141 and 1582913 are complementary within nucleobases 768-787 of SEQ ID NO:2.

[0488] In certain embodiments, modified oligonucleotides complementary to within nucleobases 768-787 of SEQ ID NO:2 achieve at least 53% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary to within nucleobases 768-787 of SEQ ID NO:2 achieve an average of 65% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0489] 8. Nucleic acid bases 2732 to 2760 of SEQ ID NO:1 In certain embodiments, nucleobases 2732-2760 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 2732-2760 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 or 3-10-3 gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "k" represents a cEt sugar moiety, and each cytosine residue is a 5-methylcytosine.

[0490] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0491] The nucleobase sequences of SEQ ID NOs: 100, 186, 321, 362, 645, 719, 791, 796, 867, 873, 943, 946, and 1019 are complementary to the interior of nucleobases 2732 to 2760 of SEQ ID NO:1.

[0492] Compounds 541189, 613830, 1099121-1099122, 1582534-1582535, 1582543, 1582548-1582549, 1582551, 1582557, 1582566, and 1582568 are complementary within nucleobases 2732-2760 of SEQ ID NO:1.

[0493] In certain embodiments, modified oligonucleotides complementary to within nucleobases 2732-2760 of SEQ ID NO:1 achieve at least 13% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary to within nucleobases 2732-2760 of SEQ ID NO:1 achieve an average of 69% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0494] 9. Nucleic acid bases 2783 to 2806 of SEQ ID NO: 1 and / or nucleic acid bases 10 to 33 of SEQ ID NO: 2 In certain embodiments, nucleobases 2783-2806 of SEQ ID NO:1 and / or nucleobases 10-33 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 2783-2806 of SEQ ID NO:1 and / or nucleobases 10-33 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0495] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0496] The nucleobase sequences of SEQ ID NOs: 802, 880, and 1088 to 1090 are complementary to nucleobases 2783 to 2806 of SEQ ID NO:1 and / or nucleobases 10 to 33 of SEQ ID NO:2.

[0497] Compounds 1582611-1582612 and 1604089-1604091 are complementary to nucleobases 2783-2806 of SEQ ID NO:1 and / or nucleobases 10-33 of SEQ ID NO:2.

[0498] In certain embodiments, modified oligonucleotides complementary within nucleobases 2783-2806 of SEQ ID NO:1 and / or nucleobases 10-33 of SEQ ID NO:2 achieve at least 71% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 2783-2806 of SEQ ID NO:1 and / or nucleobases 10-33 of SEQ ID NO:2 achieve an average of 79% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0499] 10. Nucleic acid bases 2833 to 2853 of SEQ ID NO: 1 and / or nucleic acid bases 60 to 80 of SEQ ID NO: 2 In certain embodiments, nucleobases 2833-2853 of SEQ ID NO:1 and / or nucleobases 60-80 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 2833-2853 of SEQ ID NO:1 and / or nucleobases 60-80 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0500] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0501] The nucleobase sequences of SEQ ID NOs: 668, 742, 815, 893, 966, and 1040 are complementary to nucleobases 2833 to 2853 of SEQ ID NO: 1 and / or nucleobases 60 to 80 of SEQ ID NO:2.

[0502] Compounds 1582702-1582707 are complementary to nucleobases 2833-2853 of SEQ ID NO:1 and / or nucleobases 60-80 of SEQ ID NO:2.

[0503] In certain embodiments, modified oligonucleotides complementary within nucleobases 2833-2853 of SEQ ID NO:1 and / or nucleobases 60-80 of SEQ ID NO:2 achieve at least 59% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 2833-2853 of SEQ ID NO:1 and / or nucleobases 60-80 of SEQ ID NO:2 achieve an average of 79% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0504] 11. Nucleic acid bases 2953 to 2975 of SEQ ID NO: 1 and / or nucleic acid bases 180 to 202 of SEQ ID NO: 2 In certain embodiments, nucleobases 2953-2975 of SEQ ID NO:1 and / or nucleobases 180-202 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 2953-2975 of SEQ ID NO:1 and / or nucleobases 180-202 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0505] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0506] The nucleobase sequences of SEQ ID NOs: 673, 747-748, 822, 898, 971, and 1045 are complementary to nucleobases 2953-2975 of SEQ ID NO:1 and / or nucleobases 180-202 of SEQ ID NO:2.

[0507] Compounds 1582734-1582740 are internally complementary to nucleobases 2953-2975 of SEQ ID NO:1 and / or nucleobases 180-202 of SEQ ID NO:2.

[0508] In certain embodiments, modified oligonucleotides complementary within nucleobases 2953-2975 of SEQ ID NO:1 and / or nucleobases 180-202 of SEQ ID NO:2 achieve at least 73% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 2953-2975 of SEQ ID NO:1 and / or nucleobases 180-202 of SEQ ID NO:2 achieve an average of 78% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0509] 12. Nucleic acid bases 3097 to 3136 of SEQ ID NO: 1 and / or nucleic acid bases 324 to 363 of SEQ ID NO: 2 In certain embodiments, nucleobases 3097-3136 of SEQ ID NO:1 and / or nucleobases 324-363 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 3097-3136 of SEQ ID NO:1 and / or nucleobases 324-363 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 or 3-10-3 gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0510] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0511] The nucleobase sequences of SEQ ID NOs: 39, 678 to 681, 753 to 755, 827 to 829, 903 to 905, 976 to 978, 1050 to 1052, and 1135 to 1136 are complementary to nucleobases 3097 to 3136 of SEQ ID NO: 1 and / or nucleobases 324 to 363 of SEQ ID NO: 2.

[0512] Compounds 541125, 1582765-1582783, and 1604144-1604145 are complementary within nucleobases 3097-3136 of SEQ ID NO:1 and / or nucleobases 324-363 of SEQ ID NO:2.

[0513] In certain embodiments, modified oligonucleotides complementary within nucleobases 3097-3136 of SEQ ID NO:1 and / or nucleobases 324-363 of SEQ ID NO:2 achieve at least 30% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 3097-3136 of SEQ ID NO:1 and / or nucleobases 324-363 of SEQ ID NO:2 achieve an average of 76% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0514] 13. Nucleic acid bases 3174 to 3210 of SEQ ID NO: 1 and / or nucleic acid bases 401 to 437 of SEQ ID NO: 2 In certain embodiments, nucleobases 3174-3210 of SEQ ID NO: 1 and / or nucleobases 401-437 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 3174-3210 of SEQ ID NO: 1 and / or nucleobases 401-437 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 or 3-10-3 gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0515] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0516] The nucleobase sequences of SEQ ID NOs: 117, 684, 758, 1056, and 1141 to 1144 are complementary to nucleobases 3174 to 3210 of SEQ ID NO:1 and / or nucleobases 401 to 437 of SEQ ID NO:2.

[0517] Compounds 541206, 1582800-1582802, and 1604150-1604153 are complementary to nucleobases 3174-3210 of SEQ ID NO:1 and / or nucleobases 401-437 of SEQ ID NO:2.

[0518] In certain embodiments, modified oligonucleotides complementary within nucleobases 3174-3210 of SEQ ID NO:1 and / or nucleobases 401-437 of SEQ ID NO:2 achieve at least 53% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 3174-3210 of SEQ ID NO:1 and / or nucleobases 401-437 of SEQ ID NO:2 achieve an average of 84% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0519] 14. Nucleic acid bases 3361 to 3400 of SEQ ID NO: 1 and / or nucleic acid bases 588 to 627 of SEQ ID NO: 2 In certain embodiments, nucleobases 3361-3400 of SEQ ID NO: 1 and / or nucleobases 588-627 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 3361-3400 of SEQ ID NO: 1 and / or nucleobases 588-627 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 or 3-10-3 gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0520] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0521] The nucleobase sequences of SEQ ID NOs: 123, 695 to 697, 769 to 771, 843, 844, 919, 920, 992, 993, 1066, and 1067 are complementary to nucleobases 3361 to 3400 of SEQ ID NO: 1 and / or nucleobases 588 to 627 of SEQ ID NO:2.

[0522] Compounds 541212, 1582863-1582873, and 1582875-1582877 are internally complementary to nucleobases 3361-3400 of SEQ ID NO:1 and / or nucleobases 588-627 of SEQ ID NO:2.

[0523] In certain embodiments, modified oligonucleotides complementary within nucleobases 3361-3400 of SEQ ID NO:1 and / or nucleobases 588-627 of SEQ ID NO:2 achieve at least 37% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 3361-3400 of SEQ ID NO:1 and / or nucleobases 588-627 of SEQ ID NO:2 achieve an average of 70% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0524] 15. Nucleic acid bases 3883 to 3926 of SEQ ID NO: 1 and / or nucleic acid bases 1110 to 1153 of SEQ ID NO: 2 In certain embodiments, nucleobases 3883-3926 of SEQ ID NO: 1 and / or nucleobases 1110-1153 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 3883-3926 of SEQ ID NO: 1 and / or nucleobases 1110-1153 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 or 3-10-3 gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0525] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0526] The nucleobase sequences of SEQ ID NOs: 67, 141, 646-647, 720-721, 793-794, 870-871, 945, 947-948, and 1020-1021 are complementary to nucleobases 3883-3926 of SEQ ID NO: 1 and / or nucleobases 1110-1153 of SEQ ID NO:2.

[0527] Compounds 541153, 541230, 1582550, 1582552 to 1582556, and 1582558 to 1582564 are complementary within nucleobases 3883 to 3926 of SEQ ID NO:1 and / or nucleobases 1110 to 1153 of SEQ ID NO:2.

[0528] In certain embodiments, modified oligonucleotides complementary within nucleobases 3883-3926 of SEQ ID NO:1 and / or nucleobases 1110-1153 of SEQ ID NO:2 achieve at least 27% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 3883-3926 of SEQ ID NO:1 and / or nucleobases 1110-1153 of SEQ ID NO:2 achieve an average of 71% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0529] 16. Nucleic acid bases 4007 to 4029 of SEQ ID NO: 1 and / or nucleic acid bases 1234 to 1256 of SEQ ID NO: 2 In certain embodiments, nucleobases 4007-4029 of SEQ ID NO:1 and / or nucleobases 1234-1256 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 4007-4029 of SEQ ID NO:1 and / or nucleobases 1234-1256 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0530] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0531] The nucleobase sequences of SEQ ID NOs: 652, 726, 799, 876, 953, 1026, and 1079 are complementary to nucleobases 4007 to 4029 of SEQ ID NO:1 and / or nucleobases 1234 to 1256 of SEQ ID NO:2.

[0532] Compounds 1582589-1582594 and 1604080 are internally complementary to nucleobases 4007-4029 of SEQ ID NO:1 and / or nucleobases 1234-1256 of SEQ ID NO:2.

[0533] In certain embodiments, modified oligonucleotides complementary within nucleobases 4007-4029 of SEQ ID NO:1 and / or nucleobases 1234-1256 of SEQ ID NO:2 achieve at least 65% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4007-4029 of SEQ ID NO:1 and / or nucleobases 1234-1256 of SEQ ID NO:2 achieve an average of 82% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0534] 17. Nucleic acid bases 4667 to 4694 of SEQ ID NO: 1 and / or nucleic acid bases 1532 to 1559 of SEQ ID NO: 2 In certain embodiments, nucleobases 4667-4694 of SEQ ID NO:1 and / or nucleobases 1532-1559 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is internally complementary to nucleobases 4667-4694 of SEQ ID NO:1 and / or nucleobases 1532-1559 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 or 3-10-3 gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0535] In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0536] The nucleobase sequences of SEQ ID NOs: 163, 658, 732, 883, 957, 1031, and 1105 to 1112 are complementary to nucleobases 4667 to 4694 of SEQ ID NO:1 and / or nucleobases 1532 to 1559 of SEQ ID NO:2.

[0537] Compounds 541256, 1582645-1582649, and 1604114-1604121 are internally complementary to nucleobases 4667-4694 of SEQ ID NO:1 and / or nucleobases 1532-1559 of SEQ ID NO:2.

[0538] In certain embodiments, modified oligonucleotides complementary within nucleobases 4667-4694 of SEQ ID NO:1 and / or nucleobases 1532-1559 of SEQ ID NO:2 achieve at least 63% reduction in DUX4 RNA in a standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4667-4694 of SEQ ID NO:1 and / or nucleobases 1532-1559 of SEQ ID NO:2 achieve an average of 83% reduction in DUX4 RNA in a standard in vitro RNase H assay.

[0539] 18. Nucleic acid bases 2955 to 2984 of SEQ ID NO: 1 and / or nucleic acid bases 182 to 211 of SEQ ID NO: 2 In certain embodiments, nucleobases 2955-2984 of SEQ ID NO: 1 and / or nucleobases 182-211 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) is internally complementary to nucleobases 2955-2984 of SEQ ID NO: 1 and / or nucleobases 182-211 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) is 23 nucleobases in length. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) comprises one or more sugar modifications. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) comprises one or more 2'-OMe sugar moieties, one or more 2'-F sugar moieties, or a combination thereof. In certain embodiments, the sugar motif of the modified oligonucleotide (e.g., antisense RNAi oligonucleotide) is (5' to 3'): yfyfyfyfyfyfyfyfyfyfyyy, where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0540] In certain embodiments, the nucleosides of the modified oligonucleotides (eg, antisense RNAi oligonucleotides) are linked by an internucleoside linkage selected from a phosphodiester or a phosphorothioate internucleoside linkage.

[0541] The nucleobase sequences of SEQ ID NOs:1425 and 1424 (antisense RNAi oligonucleotides) are complementary to nucleobases 2955 to 2984 of SEQ ID NO:1 and / or nucleobases 182 to 211 of SEQ ID NO:2.

[0542] Compounds 1588626 and 1588623 (RNAi agents) are internally complementary to nucleobases 2955-2984 of SEQ ID NO:1 and / or nucleobases 182-211 of SEQ ID NO:2.

[0543] In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 2955-2984 of SEQ ID NO:1 and / or nucleobases 182-211 of SEQ ID NO:2 achieve at least 87% reduction in DUX4 RNA in a standard in vitro RNAi assay. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 2955-2984 of SEQ ID NO:1 and / or nucleobases 182-211 of SEQ ID NO:2 achieve an average of 90% reduction in DUX4 RNA in a standard in vitro RNAi assay.

[0544] 19. Nucleic acid bases 3099 to 3128 of SEQ ID NO: 1 and / or nucleic acid bases 326 to 355 of SEQ ID NO: 2 In certain embodiments, nucleobases 3099-3128 of SEQ ID NO:1 and / or nucleobases 326-355 of SEQ ID NO:2 comprise hotspot regions. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) is internally complementary to nucleobases 3099-3128 of SEQ ID NO:1 and / or nucleobases 326-355 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) is 23 nucleobases in length. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) comprises one or more sugar modifications. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) comprises one or more 2'-OMe sugar moieties, one or more 2'-F sugar moieties, or a combination thereof. In certain embodiments, the sugar motif of the modified oligonucleotide (e.g., antisense RNAi oligonucleotide) is (5' to 3'): yfyfyfyfyfyfyfyfyfyfyyy, where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0545] In certain embodiments, the nucleosides of the modified oligonucleotides (eg, antisense RNAi oligonucleotides) are linked by an internucleoside linkage selected from a phosphodiester or a phosphorothioate internucleoside linkage.

[0546] The nucleobase sequences of SEQ ID NOs:1214 and 1410 (antisense RNAi oligonucleotides) are complementary to nucleobases 3099 to 3128 of SEQ ID NO:1 and / or nucleobases 326 to 355 of SEQ ID NO:2.

[0547] Compounds 1588572 and 1588569 (RNAi agents) are complementary within nucleobases 3099-3128 of SEQ ID NO:1 and / or nucleobases 326-355 of SEQ ID NO:2.

[0548] In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 3099-3128 of SEQ ID NO:1 and / or nucleobases 326-355 of SEQ ID NO:2 achieve at least 63% reduction in DUX4 RNA in a standard in vitro RNAi assay. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 3099-3128 of SEQ ID NO:1 and / or nucleobases 326-355 of SEQ ID NO:2 achieve an average of 77% reduction in DUX4 RNA in a standard in vitro RNAi assay.

[0549] 20. Nucleic acid bases 3171 to 3209 of SEQ ID NO: 1 and / or nucleic acid bases 398 to 436 of SEQ ID NO: 2 In certain embodiments, nucleobases 3171-3209 of SEQ ID NO: 1 and / or nucleobases 398-436 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) is internally complementary to nucleobases 3171-3209 of SEQ ID NO: 1 and / or nucleobases 398-436 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) is 23 nucleobases in length. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) comprises one or more sugar modifications. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) comprises one or more 2'-OMe sugar moieties, one or more 2'-F sugar moieties, or a combination thereof. In certain embodiments, the sugar motif of the modified oligonucleotide (e.g., antisense RNAi oligonucleotide) is (5' to 3'): yfyfyfyfyfyfyfyfyfyfyyy, where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0550] In certain embodiments, the nucleosides of the modified oligonucleotides (eg, antisense RNAi oligonucleotides) are linked by an internucleoside linkage selected from a phosphodiester or a phosphorothioate internucleoside linkage.

[0551] The nucleobase sequences of SEQ ID NOs:1405, 1210, and 1209 (antisense RNAi oligonucleotides) are complementary to nucleobases 3171 to 3209 of SEQ ID NO:1 and / or nucleobases 398 to 436 of SEQ ID NO:2.

[0552] Compounds 1588545, 1588542, and 1588539 (RNAi agents) are complementary within nucleobases 3171-3209 of SEQ ID NO:1 and / or nucleobases 398-436 of SEQ ID NO:2.

[0553] In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 3171-3209 of SEQ ID NO:1 and / or nucleobases 398-436 of SEQ ID NO:2 achieve at least 64% reduction in DUX4 RNA in a standard in vitro RNAi assay. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 3171-3209 of SEQ ID NO:1 and / or nucleobases 398-436 of SEQ ID NO:2 achieve an average of 83% reduction in DUX4 RNA in a standard in vitro RNAi assay.

[0554] 21. Nucleic acid bases 3859 to 3888 of SEQ ID NO: 1 and / or nucleic acid bases 1086 to 1115 of SEQ ID NO: 2 In certain embodiments, nucleobases 3859-3888 of SEQ ID NO:1 and / or nucleobases 1086-1115 of SEQ ID NO:2 comprise hotspot regions. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) is internally complementary to nucleobases 3859-3888 of SEQ ID NO:1 and / or nucleobases 1086-1115 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) is 23 nucleobases in length. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) comprises one or more sugar modifications. In certain embodiments, a modified oligonucleotide (e.g., an antisense RNAi oligonucleotide) comprises one or more 2'-OMe sugar moieties, one or more 2'-F sugar moieties, or a combination thereof. In certain embodiments, the sugar motif of the modified oligonucleotide (e.g., antisense RNAi oligonucleotide) is (5' to 3'): yfyfyfyfyfyfyfyfyfyyy, where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety. Each cytosine residue is a 5-methylcytosine.

[0555] In certain embodiments, the nucleosides of the modified oligonucleotides (eg, antisense RNAi oligonucleotides) are linked by an internucleoside linkage selected from a phosphodiester or a phosphorothioate internucleoside linkage.

[0556] The nucleobase sequences of SEQ ID NOs:1197 and 1335 (antisense RNAi oligonucleotides) are complementary to nucleobases 3859 to 3888 of SEQ ID NO:1 and / or nucleobases 1086 to 1115 of SEQ ID NO:2.

[0557] Compounds 1588286 and 1588283 (RNAi agents) are internally complementary to nucleobases 3859-3888 of SEQ ID NO:1 and / or nucleobases 1086-1115 of SEQ ID NO:2.

[0558] In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 3859-3888 of SEQ ID NO:1 and / or nucleobases 1086-1115 of SEQ ID NO:2 achieve at least 60% reduction in DUX4 RNA in a standard in vitro RNAi assay. In certain embodiments, modified oligonucleotides (e.g., antisense RNAi oligonucleotides) within nucleobases 3859-3888 of SEQ ID NO:1 and / or nucleobases 1086-1115 of SEQ ID NO:2 achieve an average of 70% reduction in DUX4 RNA in a standard in vitro RNAi assay.

[0559] Non-Limiting Disclosure and Incorporation by Reference Each of the literature and patent publications cited herein is incorporated by reference in its entirety.

[0560] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit them. Each of the references, GenBank accession numbers, ENSEMBL identification numbers, etc. listed in this application are incorporated herein by reference in their entirety.

[0561] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" where appropriate, in practice the sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily appreciate that the designation as "RNA" or "DNA" to describe modified oligonucleotides is arbitrary in certain instances. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar (2'-OH instead of one 2'-H of DNA) or as an RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids comprising any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleobases. As a further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG", whether modified or unmodified, can be used in combination with such compounds which contain RNA bases, for example, those having the sequence "AUCGAUCG", as well as those having some DNA bases and some RNA bases, for example, "AUCGATCG", as well as those having "AT m CGAUCG" m C represents a cytosine base containing a methyl group at the 5-position).

[0562] Certain compounds (e.g., modified oligonucleotides) described herein have one or more asymmetric centers, which in turn give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), as α or β in the case of sugar anomers, etc., or as (D) or (L), etc. in the case of amino acids, etc. Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the compound shown. Compounds provided herein that are depicted or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless otherwise specified. Similarly, tautomers of the compounds herein are also included, unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include the corresponding salt forms.

[0563] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds described herein that contain hydrogen atoms include 1 For each H hydrogen atom, all possible deuterium substitutions are included. Isotopic substitutions encompassed by the compounds herein include: 1 Replaces H. 2 H or 3 H, 12 Replaces C 13 C or 14 C. 14 Replaces N 15 N, 16 Replaces O. 17 O or 18 O, and 32 Replaces S. 33 S, 34 S, 35 S, or 36These include, but are not limited to, S. In certain embodiments, the substitution of non-radioactive isotopes can provide oligomeric compounds with new properties that are beneficial for use as therapeutic or research tools.In certain embodiments, the substitution of radioactive isotopes can make the compounds suitable for research or diagnostic purposes, such as imaging. EXAMPLES

[0564] The following examples are illustrative of certain embodiments of the present disclosure, but are not limiting.Furthermore, when specific embodiments are provided, the inventors intend the general application of these specific embodiments.For example, the disclosure of an oligonucleotide having a specific motif provides rational support for other oligonucleotides having the same motif or similar motif.Similarly, for example, when a specific high affinity modification is at a specific position, other high affinity modifications at the same position are also considered to be suitable, unless otherwise indicated.

[0565] Example 1: Effect of 5-10-5 MOE uniform phosphorothioate modified oligonucleotides on human DUX4 RNA in vitro after single administration Modified oligonucleotides complementary to human DUX4 nucleic acid were designed to examine the effect of a single administration of them on DUX4 RNA in vitro. These modified oligonucleotides were tested in a series of experiments with the same culture conditions.

[0566] The modified oligonucleotides in the following table are 5-10-5 MOE gapmers with uniform phosphorothioate internucleoside linkages. These gapmers are 20 nucleosides long with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and the 5' and 3' wing segments consisting of 5 2'-MOE nucleosides each. The sugar motif of these gapmers is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The internucleoside linkage motif of these gapmers is (5' to 3'): sssssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0567] "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NC_000004.12, truncated from nucleotide 190171001 to 190187000), SEQ ID NO:2 (GENBANK Accession No. NM_001306068.2), SEQ ID NO:3 (GENBANK Accession No. FJ439133.1), or any combination of these SEQ ID NOs. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0568] 54-2 cells (Resnick et al., 2019, Cell Reports 29, 1812-1820) were cultured in F10 nutrient medium (Gibco #11550) containing 20% ​​FBS, 1 μM dexamethasone, and 10 ng / mL human FGF (Promega rhFGF G5071). The cells were plated at 6,000 cells per well to 100% confluence, after which the medium was replaced with F-10 medium containing 1% horse serum, 10 μg / mL insulin, and 10 μg / mL holotransferrin to induce differentiation. Cells were differentiated for 72 hours before transfection with modified oligonucleotides. Differentiated 54-2 cells were treated with modified oligonucleotides at a concentration of 100 nM using cytofectin. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR. DUX4 RNA levels were measured with human primer-probe set RTS3502 (forward sequence CCCGGCTGACGTGCAA, designated herein as SEQ ID NO: 11; reverse sequence AGCCAGAATTTCACGGAAGAAC, designated herein as SEQ ID NO: 12; probe sequence AGCTCGCTGGCCTCTCTGTGCC, designated herein as SEQ ID NO: 13). DUX4 RNA levels were normalized to total RNA content measured with RIBOGREEN®. Reduction of DUX4 RNA is shown in the table below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (%UTC). Values ​​marked with "†" indicate that the modified oligonucleotide is complementary to the amplicon region of this primer-probe set. Additional assays may be used to measure the potency and efficacy of modified oligonucleotides complementary to amplicon regions.

[0569] The individual experimental analyses described in this Example are identified by letter IDs A through B in the column of the table labeled "Analysis ID."

[0570] [Table 1-1]

[0571] [Table 1-2]

[0572] [Table 1-3]

[0573] [Table 1-4]

[0574] [Table 2]

[0575] Example 2: Effect of 3-10-3cEt uniform phosphorothioate modified oligonucleotides on human DUX4 RNA in vitro after single administration Modified oligonucleotides complementary to human DUX4 nucleic acid were designed to examine the effect of a single administration of them on DUX4 RNA in vitro. These modified oligonucleotides were tested in a series of experiments with the same culture conditions.

[0576] The modified oligonucleotides in the following table are 3-10-3 cEt gapmers with uniform phosphorothioate internucleoside linkages. These gapmers are 16 nucleosides in length, with the central gap segment consisting of 10 2'-β-D-deoxynucleosides and the 5' and 3' wing segments consisting of 3 cEt nucleosides each. The sugar motif of these gapmers is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. The internucleoside linkage motif of these gapmers is (5' to 3'): sssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0577] "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (herein above), SEQ ID NO: 2 (herein above), SEQ ID NO: 3 (herein above), or any combination of these SEQ ID NOs. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0578] 54-2 cells plated at a density of 10,000 cells per well were differentiated as described herein above and treated with modified oligonucleotides at a concentration of 100 nM using cytofectin. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RT PCR. DUX4 RNA levels were measured by human primer-probe set RTS3502 (described herein in Example 1). DUX4 RNA levels were normalized to total RNA content measured with RIBOGREEN®. Reduction of DUX4 RNA is shown in the table below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (%UTC). Values ​​marked with "†" indicate that the modified oligonucleotide is complementary to the amplicon region of this primer-probe set. Additional assays may be used to measure the potency and efficacy of modified oligonucleotides complementary to amplicon regions.

[0579] The individual experimental analyses described in this Example are identified by letter IDs C through H in the column of the table labeled "Analysis ID."

[0580] In the table below, compound number 541114 (herein above) was used as a reference.

[0581] [Table 3-1]

[0582] [Table 3-2]

[0583] [Table 3-3]

[0584] [Table 3-4]

[0585]

Table 3-5

[0586]

Table 3-6

[0587]

Table 3-7

[0588]

Table 3-8

[0589]

Table 4-1

[0590]

Table 4-2

[0591]

Table 4-3

[0592]

Table 4-4

[0593]

Table 4-5

[0594]

Table 4-6

[0595] [Table 4-7]

[0596] [Table 4-8]

[0597] Example 3: Dose-dependent inhibition of human DUX4 in 54-2 cells by modified oligonucleotides Modified oligonucleotides selected from the above examples were tested at various doses in 54-2 cells (herein above). 54-2 cells plated at a density of 6,000 cells per well were differentiated (as herein above) and treated with various concentrations of modified oligonucleotides as specified in the table below using cytofectin. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured as above using human DUX4 primer-probe set RTS3502 (herein above). DUX4 RNA levels were normalized to total RNA content as measured by RIBOGREEN®. Reduction of DUX4 RNA is shown in the table below as percent DUX4 RNA (%UTC) relative to the amount of DUX4 RNA in untreated control cells.

[0598] The half-maximal inhibitory concentration (IC 50 ) was calculated using linear regression on a log / linear plot of the data in Excel and is also shown in the table below.

[0599] [Table 5]

[0600] Example 4: Dose-dependent inhibition of human DUX4 in 54-2 cells by modified oligonucleotides Modified oligonucleotides selected from the above examples were tested at various doses in 54-2 cells (herein above). 54-2 cells plated at a density of 10,000 cells per well were differentiated (as herein above) and treated with various concentrations of modified oligonucleotides as specified in the table below using cytofectin. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured as above using human DUX4 primer-probe set RTS3502 (herein above). DUX4 RNA levels were normalized to total RNA content measured with RIBOGREEN®. Reduction of DUX4 RNA is shown in the table below as percent DUX4 RNA (%UTC) relative to the amount of DUX4 RNA in untreated control cells. These modified oligonucleotides were tested in a series of experiments with the same culture conditions and the results per experiment are shown in separate tables below.

[0601] The half-maximal inhibitory concentration (IC 50 ) was calculated using linear regression on a log / linear plot of the data in Excel and is also shown in the table below.

[0602] [Table 6]

[0603] [Table 7]

[0604] [Table 8]

[0605] [Table 9]

[0606] Example 5: Design of modified oligonucleotides complementary to human DUX4 nucleic acid Modified oligonucleotides complementary to human DUX4 nucleic acids were designed as described in the table below.

[0607] The modified oligonucleotides in Table 10 are 3-10-3cEt gapmers conjugated to a 6-palmitamidohexyl conjugate moiety attached to the 5'-OH of the oligonucleotide via a phosphodiester linker. The structure of this conjugate group is:

[0608] [ka]

[0609] This gapmer is 16 nucleosides long, with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and the 5' and 3' wings consisting of three cEt nucleosides each. The sugar motif of this gapmer is (5' to 3'): kkkddddddddddkkk, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "k" represents a cEt sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0610] "Start site" refers to the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "End site" refers to the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. The modified oligonucleotides listed in the table below are 100% complementary to SEQ ID NO: 1 (herein above) and SEQ ID NO: 2 (herein above).

[0611] [Table 10]

[0612] Example 6: Activity of modified oligonucleotides complementary to human DUX4 in transgenic mice The activity of the modified oligonucleotides described above was tested using transgenic mice expressing human DUX4. This transgenic mouse model was developed using random integration of a linearized modified human DUX4 gene. The clone was digested with AseI and XhoI restriction sites to generate a region containing a Mck (muscle-specific) promoter-driven human DUX4 transgene with a single amino acid mutation of F67A. The gene fragment was introduced by pronuclear injection into fertilized eggs of C57BL6NJ mice to generate seven established lines. Line 9111 was used in the experiments described herein. Human DUX4 RNA expression is found in the muscles of this model.

[0613] process Each animal in a group of four transgenic mice was administered 50 mg / kg of Compound No. 941806 by subcutaneous injection twice weekly for a total of six injections. One group of four mice received PBS as a negative control.

[0614] RNA analysis Mice were sacrificed 72 hours after the final dose, RNA for RTPCR analysis was extracted from quadriceps, transversus abdominis (TA), and gastrocnemius muscles, and the amount of DUX4 RNA was measured using human primer-probe set RTS3502 (described above) herein. Results are expressed as a percent of human DUX4 RNA relative to the PBS control, normalized to mouse GAPDH (% control). Mouse GAPDH RNA was amplified using mouse prime-probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, designated herein as SEQ ID NO: 14; reverse sequence GGGTCTCGCTCCTGGAAGAT, designated herein as SEQ ID NO: 15; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, designated herein as SEQ ID NO: 16).

[0615] [Table 11]

[0616] Example 7: Effect of 3-10-3cEt modified oligonucleotides with uniform phosphorothioate internucleoside linkages on human DUX4 RNA in vitro, in a single dose Modified oligonucleotides complementary to human DUX4 nucleic acid were designed to examine the effect of a single administration of these oligonucleotides on human DUX4 RNA in vitro. These modified oligonucleotides were tested in a series of experiments with the same culture conditions.

[0617] The modified oligonucleotides in the following table are 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate internucleoside linkages. These modified oligonucleotides are 16 nucleosides in length. The sugar motif of these modified oligonucleotides is (5' to 3'): kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt modified sugar moiety. The internucleoside linkage motif of these modified oligonucleotides is (5' to 3'): ssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine. "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "Termination site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide set forth in the table below is 100% complementary to one or more of the following SEQ ID NOs: SEQ ID NO:1 (herein above), SEQ ID NO:2 (herein above), SEQ ID NO:3 (herein above). "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0618] 54-2 cells plated at a density of 10,000 cells per well were differentiated as described above and treated with modified oligonucleotides at a concentration of 200 nM using cytofectin. After a treatment period of about 24 hours, total RNA was isolated from the cells and human DUX4 RNA levels were measured by quantitative real-time RTPCR. Human DUX4 RNA levels were measured by probe set RTS40199 (forward sequence CTCTCTGTGCCCTTGTTCTT, herein designated as SEQ ID NO: 17; reverse sequence CATCCAGGAGATGTAACTCTAATCC, herein designated as SEQ ID NO: 18; probe sequence CCTTCCGACGCTGTCTAGGCAAA, herein designated as SEQ ID NO: 19). Human DUX4 RNA levels were normalized to total RNA content measured with RIBOGREEN®. Reduction of human DUX4 RNA is shown in the table below as percent DUX4 RNA (%UTC) relative to the amount of DUX4 RNA in untreated control cells. Values ​​marked with "†" indicate that the modified oligonucleotide is complementary to the amplicon region of this primer-probe set. Additional assays may be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region. "ND" in the tables below means that the value was undefined.

[0619] The individual experiments described in this Example are identified by assay identification letters in the column of the table labeled "Assay ID."

[0620] [Table 12-1]

[0621] [Table 12-2]

[0622] [Table 12-3]

[0623]

Table 12-4

[0624]

Table 12-5

[0625]

Table 12-6

[0626]

Table 12-7

[0627]

Table 12-8

[0628]

Table 12-9

[0629]

Table 12-10

[0630]

Table 12-11

[0631]

Table 12-12

[0632]

Table 12-13

[0633] [Table 12-14]

[0634] [Table 13]

[0635] The compounds in the table below have a single mismatch to SEQ ID NO:1 (herein above) at the position shown in the column labeled "Position of Mismatch on Compound (5' to 3')." Additionally, the mismatched nucleobase is marked in bold and underlined in the column labeled "Sequence (5' to 3')."

[0636] [Table 14]

[0637] Example 8: Dose-dependent inhibition of human DUX4 in 54-2 cells by modified oligonucleotides Modified oligonucleotides selected from the above examples were tested at various doses in 54-2 cells (herein above). 54-2 cells plated at a density of 20,000 cells per well were differentiated (as herein above) and treated with various concentrations of modified oligonucleotides as specified in the table below using cytofectin. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured as above using human DUX4 primer-probe set RTS40199 (herein above). DUX4 RNA levels were normalized to total RNA content as measured by RIBOGREEN®. Reduction of DUX4 RNA is shown in the table below as percent DUX4 RNA (%UTC) relative to the amount of DUX4 RNA in untreated control cells.

[0638] The half-maximal inhibitory concentration (IC 50 ) was calculated using linear regression on a log / linear plot of the data in Excel and is also shown in the table below. In the table below, "ND" means that the value was undefined.

[0639] [Table 15]

[0640] [Table 16]

[0641] [Table 17]

[0642] [Table 18]

[0643] [Table 19]

[0644] Example 9: Design of RNAi compounds targeting human DUX4 nucleic acid An RNAi compound comprising an antisense RNAi oligonucleotide complementary to a human DUX4 nucleic acid and a sense RNAi oligonucleotide complementary to the antisense RNAi oligonucleotide was designed as follows.

[0645] "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the antisense RNAi oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the human gene sequence to which the antisense RNAi oligonucleotide is complementary. Each antisense RNAi oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (herein above) and SEQ ID NO: 2 (herein above).

[0646] The antisense RNAi oligonucleotides included in the table below are 25 nucleosides in length and the sugar motif of the antisense RNAi oligonucleotides is (5' to 3'): rrrrrrrrrrrrrrrrrrrrrrrrr, where each "r" represents a ribosyl sugar moiety. The internucleoside linkage motif of these antisense RNAi oligonucleotides is (5' to 3'): oooooooooooooooooooooooooo, where each "o" represents a phosphodiester internucleoside linkage.

[0647] The sense RNAi oligonucleotides included in the table below are 25 nucleosides in length and the sugar motif of the antisense RNAi oligonucleotides is (5' to 3'): rrrrrrrrrrrrrrrrrrrrrrrrr, where each "r" represents a ribosyl sugar moiety. The internucleoside linkage motif of these antisense RNAi oligonucleotides is (5' to 3'): oooooooooooooooooooooooooo, where each "o" represents a phosphodiester internucleoside linkage.

[0648] The sense RNAi oligonucleotide is 100% complementary (5' to 3') to the antisense RNAi oligonucleotide.

[0649] [Table 20]

[0650] Example 10: Design of RNAi compounds targeting human DUX4 nucleic acid An RNAi compound comprising an antisense RNAi oligonucleotide complementary to a human DUX4 nucleic acid and a sense RNAi oligonucleotide complementary to the antisense RNAi oligonucleotide was designed as follows.

[0651] "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the antisense RNAi oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the human gene sequence to which the antisense RNAi oligonucleotide is complementary. Each antisense RNAi oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (herein above) and SEQ ID NO: 2 (herein above).

[0652] The antisense RNAi oligonucleotides included in the table below are 19 nucleosides in length and the sugar motif of the antisense RNAi oligonucleotides is (5' to 3'): rrrrrrrrrrrrrrrrrrr, where each "r" represents a ribosyl sugar moiety. The internucleoside linkage motif of these antisense RNAi oligonucleotides is (5' to 3'): oooooooooooooooooooo, where each "o" represents a phosphodiester internucleoside linkage.

[0653] The sense RNAi oligonucleotides included in the table below are 19 nucleosides in length and the sugar motif of the antisense RNAi oligonucleotides is (5' to 3'): rrrrrrrrrrrrrrrrrrr, where each "r" represents a ribosyl sugar moiety. The internucleoside linkage motif of these antisense RNAi oligonucleotides is (5' to 3'): oooooooooooooooooooo, where each "o" represents a phosphodiester internucleoside linkage.

[0654] The sense RNAi oligonucleotide is 100% complementary (5' to 3') to the antisense RNAi oligonucleotide.

[0655] [Table 21]

[0656] Example 11: Design of RNAi compounds targeting human DUX4 nucleic acid An RNAi compound comprising an antisense RNAi oligonucleotide complementary to a human DUX4 nucleic acid and a sense RNAi oligonucleotide complementary to the antisense RNAi oligonucleotide was designed as follows.

[0657] "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the antisense RNAi oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the human gene sequence to which the antisense RNAi oligonucleotide is complementary. Each antisense RNAi oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (herein above), SEQ ID NO: 2 (herein above), or both. "N / A" indicates that the antisense RNAi oligonucleotide is not 100% complementary to its particular target nucleic acid sequence.

[0658] The antisense RNAi oligonucleotides included in the following table are 23 nucleosides in length and the sugar motif of the antisense RNAi oligonucleotides (5' to 3') is yfyfyfyfyfyfyfyfyfyyy, where each "y" represents a 2'-O-methylribosyl sugar moiety and each "f" represents a 2'-fluororibosyl sugar moiety. The internucleoside linkage motif of these antisense RNAi oligonucleotides (5' to 3') is ssooooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0659] The sense RNAi oligonucleotides included in the table below are 21 nucleosides in length and the sugar motif of the antisense RNAi oligonucleotides is (5' to 3') fyfyfyfyfyfyfyfyfyf, where each "y" represents a 2'-O-methylribosyl sugar moiety and each "f" represents a 2'-fluororibosyl sugar moiety. The internucleoside linkage motif of these antisense RNAi oligonucleotides is (5' to 3') ssooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0660] Each sense RNAi oligonucleotide is complementary to the first 21 nucleosides (5' to 3') of the antisense RNAi oligonucleotide, and the last two 3'-nucleosides of the antisense RNAi oligonucleotide are unpaired overhanging nucleosides.

[0661] [Table 22-1]

[0662] [Table 22-2]

[0663] [Table 22-3]

[0664] [Table 22-4]

[0665] [Table 22-5]

[0666] "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the antisense RNAi oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the human gene sequence to which the antisense RNAi oligonucleotide is complementary. The antisense RNAi oligonucleotides listed in the table below are 100% complementary to SEQ ID NO: 4 (GENBANK Accession No. NM_001293798.2).

[0667] [Table 23]

[0668] Example 12: Design of RNAi compounds targeting human DUX4 nucleic acid An RNAi compound comprising an antisense RNAi oligonucleotide complementary to a human DUX4 nucleic acid and a sense RNAi oligonucleotide complementary to the antisense RNAi oligonucleotide was designed as follows.

[0669] "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the antisense RNAi oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the human gene sequence to which the antisense RNAi oligonucleotide is complementary. Each antisense RNAi oligonucleotide listed in the table below is complementary to SEQ ID NO:1 (herein above), SEQ ID NO:2 (herein above), or both, except that it has a single mismatch at position 1 (5' to 3') of the antisense RNAi oligonucleotide. "N / A" indicates that the modified oligonucleotide included in the table below has two or more mismatches to its particular target nucleic acid sequence.

[0670] The antisense RNAi oligonucleotides included in the following table are 23 nucleosides in length and the sugar motif of the antisense RNAi oligonucleotides (5' to 3') is yfyfyfyfyfyfyfyfyfyyy, where each "y" represents a 2'-O-methylribosyl sugar moiety and each "f" represents a 2'-fluororibosyl sugar moiety. The internucleoside linkage motif of these antisense RNAi oligonucleotides (5' to 3') is ssooooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0671] The sense RNAi oligonucleotides included in the table below are 21 nucleosides in length and the sugar motif of the antisense RNAi oligonucleotides is (5' to 3') fyfyfyfyfyfyfyfyfyf, where each "y" represents a 2'-O-methylribosyl sugar moiety and each "f" represents a 2'-fluororibosyl sugar moiety. The internucleoside linkage motif of these antisense RNAi oligonucleotides is (5' to 3') ssooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0672] Each sense RNAi oligonucleotide is complementary to the first 21 nucleosides (5' to 3') of the antisense RNAi oligonucleotide, and the last two 3'-nucleosides of the antisense RNAi oligonucleotide are unpaired overhanging nucleosides.

[0673] [Table 24-1]

[0674] [Table 24-2]

[0675]

Table 24-3

[0676]

Table 24-4

[0677]

Table 24-5

[0678]

Table 24-6

[0679]

Table 24-7

[0680]

Table 24-8

[0681]

Table 24-9

[0682]

Table 24-10

[0683]

Table 24-11

[0684] "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the antisense RNAi oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the human gene sequence to which the antisense RNAi oligonucleotide is complementary. The antisense RNAi oligonucleotides listed in the table below are complementary to SEQ ID NO: 4 (GENBANK Accession No. NM_001293798.2), except for a single mismatch at position 1 (5' to 3') of the antisense RNAi oligonucleotide.

[0685] [Table 25]

[0686] Example 13: Effect of RNAi compounds on human DUX4 RNA in vitro, single dose The RNAi compounds described herein above were tested in 54-2 cells (Resnick et al., 2019, Cell Reports 29, 1812-1820). These RNAi compounds were tested in a series of experiments with the same culture conditions.

[0687] 54-2 cells were differentiated as described above an...

Claims

1. consisting of 12 to 50 linked nucleosides, nucleobases 4503 to 4522 of SEQ ID NO: 1; nucleobases 2697 to 2730 of SEQ ID NO:1; Nucleobases 2756 to 2778 of SEQ ID NO:1, nucleobases 2732 to 2760 of SEQ ID NO:1; nucleobases 2783 to 2806 of SEQ ID NO: 1 and / or nucleobases 10 to 33 of SEQ ID NO: 2, nucleobases 2833 to 2853 of SEQ ID NO: 1 and / or nucleobases 60 to 80 of SEQ ID NO: 2, nucleobases 2953 to 2975 of SEQ ID NO: 1 and / or nucleobases 180 to 202 of SEQ ID NO: 2, nucleobases 3097 to 3136 of SEQ ID NO: 1 and / or nucleobases 324 to 363 of SEQ ID NO: 2, nucleobases 3174 to 3210 of SEQ ID NO: 1 and / or nucleobases 401 to 437 of SEQ ID NO: 2, nucleobases 3361 to 3400 of SEQ ID NO: 1 and / or nucleobases 588 to 627 of SEQ ID NO: 2, nucleobases 3883 to 3926 of SEQ ID NO: 1 and / or nucleobases 1110 to 1153 of SEQ ID NO: 2, nucleobases 4007 to 4029 of SEQ ID NO: 1 and / or nucleobases 1234 to 1256 of SEQ ID NO: 2, nucleobases 4103 to 4134 of SEQ ID NO: 1 and / or nucleobases 1330 to 1361 of SEQ ID NO: 2, nucleobases 4509 to 4530 of SEQ ID NO:1; nucleobases 4667 to 4694 of SEQ ID NO: 1 and / or nucleobases 1532 to 1559 of SEQ ID NO: 2, nucleobases 4828 to 4850 of SEQ ID NO: 1 and / or nucleobases 1693 to 1710 of SEQ ID NO: 2, nucleobases 768 to 787 of SEQ ID NO:2; nucleobases 2955 to 2984 of SEQ ID NO: 1 and / or nucleobases 182 to 211 of SEQ ID NO: 2, nucleobases 3099 to 3128 of SEQ ID NO: 1 and / or nucleobases 326 to 355 of SEQ ID NO: 2, nucleobases 3171 to 3209 of SEQ ID NO:1 and / or nucleobases 398 to 436 of SEQ ID NO:2, or Nucleobases 3859 to 3888 of SEQ ID NO:1 and / or nucleobases 1086 to 1115 of SEQ ID NO:2 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases complementary to The oligomeric compound described above, wherein said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

2. consisting of 12 to 50 linked nucleosides, SEQ ID NOs: 299, 340, 379, and 420 to 421; SEQ ID NOs: 24, 98, 318-320, 359-361, 398-400, 438-440, 852, and 857; SEQ ID NOs: 323, 324, 364, 404, 443, and 444; SEQ ID NOs: 73, 148, 327, 367, 407, 408, 208, and 447, SEQ ID NOs: 300-301, 341-342, 380, 422, and 1002; SEQ ID NOs: 331, 332, 370, 371, 412, 413, 451, and 452, SEQ ID NOs: 326, 366, 406, 446, and 777; SEQ ID NOs: 100, 186, 321, 362, 645, 719, 791, 796, 867, 873, 943, 946, and 1019, SEQ ID NOs: 802, 880, and 1088 to 1090; SEQ ID NOs: 668, 742, 815, 893, 966, and 1040; SEQ ID NOs: 673, 747-748, 822, 898, 971, and 1045; SEQ ID NOs: 39, 678-681, 753-755, 827-829, 903-905, 976-978, 1050-1052, and 1135-1136; SEQ ID NOs: 117, 684, 758, 1056, and 1141 to 1144; SEQ ID NOs: 123, 695-697, 769-771, 843, 844, 919, 920, 992, 993, 1066, and 1067, SEQ ID NOs: 67, 141, 646-647, 720-721, 793-794, 870-871, 945, 947-948, and 1020-1021; SEQ ID NOs: 652, 726, 799, 876, 953, 1026, and 1079, SEQ ID NOs: 163, 658, 732, 883, 957, 1031, and 1105 to 1112; SEQ ID NOs: 1424 and 1425, SEQ ID NOs: 1214 and 1410, SEQ ID NOs: 1405, 1209, and 1210, and SEQ ID NOs: 1197 and 1335 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases of a sequence selected from:

3. (a) the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NOs: 1-4, when measured across the entire nucleobase sequence of the modified oligonucleotide; (b) the modified oligonucleotide is 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-2 consisting of 5, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides; (c) the modified oligonucleotide comprises at least one modified nucleoside; optionally, (i) the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety; and further optionally, (ii) the modified sugar moiety comprises a bicyclic sugar moiety; and further optionally, (iii) the bicyclic sugar moiety is -O-CH ２ - and -O-CH(CH ３ )-; (d) the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety, optionally wherein the non-bicyclic modified sugar moiety is 2'-O(CH ２ ) ２ OCH ３ is a ribosyl sugar moiety, a cEt sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety; and / or (e) the modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate, optionally wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA; 3. The oligomeric compound according to claim 1 or 2.

4. (a) a modified oligonucleotide comprising: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and A 3' region consisting of 1 to 6 linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety; optionally, (i) the modified oligonucleotide comprises: a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of three linked 3' region nucleosides having each of the 5' region nucleosides and each of the 3' region nucleosides comprises a cEt sugar moiety and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety; or (ii) the modified oligonucleotide is a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides having Each of the 5' region nucleosides and each of the 3' region nucleosides are 2'-O(CH ２ ) ２ OCH ３ ribosyl sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribosyl sugar moiety; (b) the modified oligonucleotide is a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of three linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety; or (c) the modified oligonucleotide is a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety; The oligomeric compound according to any one of claims 1 to 3.

5. (a) the modified oligonucleotide comprises at least one modified internucleoside linkage; optionally, (i) each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage; (ii) at least one internucleoside linkage is a phosphorothioate internucleoside linkage; (iii) each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage; (iv) each internucleoside linkage of said modified oligonucleotide is a phosphorothioate internucleoside linkage; (v) each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage; or (vi) the internucleoside linkage motif of the modified oligonucleotide is selected from 5'-sssssssssssssssssss-3' and 5'-sssssssssssssssss-3', where each "s" represents a phosphorothioate internucleoside linkage; (b) the modified oligonucleotide comprises a modified nucleobase, optionally wherein the modified nucleobase is 5-methylcytosine; (c) the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-20, 18-22, or 18-20 linked nucleosides, or a pharma- ceutically acceptable salt thereof, optionally comprising one or more cations selected from sodium, potassium, calcium, and magnesium; (d) the modified oligonucleotide is (i) consists of 16 linked nucleosides; (ii) consists of 20 linked nucleosides; or (iii) consists of 23 linked nucleosides; (e) activating RNase H; (f) consisting of a modified oligonucleotide, or consisting of a modified oligonucleotide and a conjugate group, optionally the conjugate group comprises a conjugate moiety and a conjugate linker; (i) the conjugate moiety is (I) is a lipophilic group; (II) selected from C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, and C5 alkenyl; or (III) a 6-palmitamidohexyl conjugate moiety; (ii) the conjugate linker is a phosphodiester linker; (iii) the conjugate group has the following structure: 【Chemistry 1】 having (iv) the conjugate linker is (I) consists of a single bond; (II) is cleavable; and / or (III) containing 1 to 3 linker nucleosides; and / or (v) the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide, or the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide; and / or (g) containing an end group; The oligomeric compound according to any one of claims 1 to 4.

6. The oligomeric compound of any one of claims 1 to 5, which does not contain a linker nucleoside.

7. 7. The population of oligomeric compounds according to any one of claims 1 to 6, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

8. (A) a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, said first oligomeric compound being the oligomeric compound of any one of claims 1-6, and optionally said second modified oligonucleotide consisting of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide; (B) a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide; (C) a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1242-1307, 1309, 1474-1637, or 1639, and wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide; or (D) a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 1242-1307, 1309, 1474-1637, or 1639, and wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide; In some cases, (a) the modified oligonucleotide of said first oligomeric compound comprises a 5'-stabilized phosphate group, optionally wherein said 5'-stabilized phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate; (b) at least one nucleoside of the first modified oligonucleotide comprises a modified sugar moiety, and optionally, (i) the modified sugar moiety of the first modified oligonucleotide comprises a bicyclic sugar moiety, and optionally the bicyclic sugar moiety is -O-CH ２ - and -O-CH(CH ３ )-; or (ii) the modified sugar moiety of the first modified oligonucleotide comprises a non-bicyclic modified sugar moiety, and optionally, the non-bicyclic modified sugar moiety of the first modified oligonucleotide is a 2'-OMe sugar moiety or a 2'-F sugar moiety; (c) at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate; (d) the first modified oligonucleotide comprises at least one modified internucleoside linkage; optionally, (i) at least one modified internucleoside linkage of said first modified oligonucleotide is a phosphorothioate internucleoside linkage; or (ii) each internucleoside linkage of the first modified oligonucleotide is independently selected from phosphodiester and phosphorothioate internucleoside linkages; (e) at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety; and optionally, (i) the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety, and optionally the bicyclic sugar moiety is -O-CH ２ - and -O-CH(CH ３ )-; and / or (ii) the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety, and optionally, the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-OMe sugar moiety or a 2'-F sugar moiety; (f) at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate; (g) the second modified oligonucleotide comprises at least one modified internucleoside linkage; optionally, (i) at least one modified internucleoside linkage of said second modified oligonucleotide is a phosphorothioate internucleoside linkage; or (ii) each internucleoside linkage of said second modified oligonucleotide is independently selected from phosphodiester and phosphorothioate internucleoside linkages; (h) the internucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide is ssooooooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage; (i) the first modified oligonucleotide has a sugar motif of 5'-yfyfyfyfyfyfyfyfyfyfy-3' and the second modified oligonucleotide has a sugar motif of 5'-fyfyfyfyfyfyfyfyfyf-3' where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety; (j) the first modified oligonucleotide and the second modified oligonucleotide each independently comprise at least one modified nucleobase, optionally wherein the at least one modified nucleobase is 5-methylcytosine; (k) one to four 3'-most nucleosides of said first modified oligonucleotide are overhanging nucleosides; (l) the first modified oligonucleotide is blunt at the 5′ end; and / or (m) the second oligomeric compound comprises a conjugate group comprising a conjugate moiety and a conjugate linker; (i) optionally (I) the conjugate linker consists of a single bond; (II) the conjugate linker is cleavable; or (III) the conjugate linker comprises 1 to 3 linker nucleosides; (ii) further optionally, (I) the conjugate group is attached to the 5' end of the second modified oligonucleotide; (II) the conjugate group is attached to the 3' end of the second modified oligonucleotide; or (III) the conjugate group is attached through the 2' position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide; (iii) further optionally, (I) the conjugate group comprises a C22 alkyl, a C20 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, a C5 alkyl, a C22 alkenyl, a C20 alkenyl, a C16 alkenyl, a C10 alkenyl, a C21 alkenyl, a C19 alkenyl, a C18 alkenyl, a C15 alkenyl, a C14 alkenyl, a C13 alkenyl, a C12 alkenyl, a C11 alkenyl, a C9 alkenyl, a C8 alkenyl, a C7 alkenyl, a C6 alkenyl, or a C5 alkenyl; or (II) the conjugate moiety is a 6-palmitamidohexyl conjugate moiety; Oligomeric duplex.

9. (a) the conjugate linker is a phosphodiester linker; (b) the conjugate group has the structure: 【Chemistry 2】 and / or (c) the conjugate group comprises a cell targeting moiety; The oligomeric duplex of claim 8(m).

10. (a) the second modified oligonucleotide comprises a terminal group, optionally, the terminal group is an abasic sugar moiety; and / or (b) the second modified oligonucleotide is selected from the group consisting of 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17- consisting of 25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides; 10. The oligomeric duplex of claim 8 or 9.

11. The oligomeric duplex of any one of claims 8 to 10, wherein the first modified oligonucleotide consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides.

12. (a) comprising or consisting of an antisense compound, said antisense compound being an oligomeric compound according to any one of claims 1 to 6; or (b) an oligomeric duplex according to any one of claims 8 to 11; 1. An antisense agent comprising: Optionally, the antisense agent is (a) an RNase H agent capable of reducing the amount of DUX4 nucleic acid by activating RNase H; or (b) an RNAi agent capable of reducing the amount of DUX4 nucleic acid by activating RISC / Ago2; Further optionally, comprising a conjugate group, said conjugate group comprising a cell targeting moiety; The above antisense agent.

13. 13. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 1 to 6, a population of oligomeric compounds according to claim 7, an oligomeric duplex according to any one of claims 8 to 11, or an antisense agent according to claim 12, and a pharma- ceutically acceptable diluent, optionally comprising the pharma- ceutically acceptable diluent is phosphate buffered saline (PBS); and, optionally, (a) the pharmaceutical composition consists essentially of said oligomeric compound and PBS; (b) the pharmaceutical composition consists essentially of the population of oligomeric compounds and PBS; or (c) the pharmaceutical composition consists essentially of said oligomeric duplex or said antisense agent and PBS; The above pharmaceutical composition.

14. 14. The pharmaceutical composition according to claim 13 for treating a disease or disorder associated with DUX4, optionally comprising: (a) the disease or disorder associated with DUX4 is muscular dystrophy; (b) the disease or disorder associated with DUX4 is facioscapulohumeral muscular dystrophy (FSHD); (c) at least one symptom or feature of the DUX4 associated disease or disorder is ameliorated, and optionally the symptom or feature is muscle weakness or muscle wasting of the facial, scapular, and / or humeral muscles, and further optionally, administration of said oligomeric compound, population of oligomeric compounds, oligomeric duplex, antisense agent, or pharmaceutical composition reduces or delays the onset or progression of muscle weakness or muscle wasting in a subject; (d) the oligomeric compound, the population of oligomeric compounds, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered systemically; and / or (e) administered to a human; The above pharmaceutical composition.

Images