Cell-permeable peptide conjugates and methods of use thereof

Abstract

Disclosed is a conjugate of an oligonucleotide and a peptide covalently attached or attached via a linker to the oligonucleotide, wherein the peptide comprises at least one cationic domain comprising at least four amino acid residues and at least one hydrophobic domain comprising at least three amino acid residues, with the proviso that the peptide comprises a total of 7-40 amino acid residues and does not comprise an artificial amino acid residue, and the oligonucleotide comprises a total of 12-40 contiguous nucleobases, wherein at least 12 contiguous nucleobases are complementary to a target sequence of the human dystrophin gene.

Description

[Technical field]

[0001] The present invention relates to peptide conjugates of antisense oligonucleotides, compositions comprising same, and methods of use thereof. [Background technology]

[0002] Nucleic acid drugs are genomic medicines that have the potential to transform human healthcare. Research suggests that such therapeutics could be applied across a broad range of disease areas, including neuromuscular diseases. Antisense oligonucleotide-based methods to modulate pre-mRNA splicing have been applied to the neuromuscular disease Duchenne muscular dystrophy (DMD), placing this monogenic disorder at the forefront of precision medicine.

[0003] However, the therapeutic development of these promising antisense therapeutics has been hindered by poor cell penetration and distribution properties, challenges that are exacerbated in DMD by the large amount of muscle tissue matrix and its distribution properties.

[0004] DMD affects 1 in 3500 newborn boys. This severe X-linked recessive disease is caused by mutations in the DMD gene, which encodes the dystrophin protein. The disorder is characterized by progressive muscle degeneration and atrophy accompanied by the emergence of respiratory failure and cardiac complications, ultimately leading to premature death. The majority of mutations underlying DMD are genomic out-of-frame deletions that induce premature truncations in the open reading frame, which results in a deficiency of the dystrophin protein.

[0005] Exon skipping therapy utilizes splice-switching antisense oligonucleotides (SSOs) to target specific regions of the DMD transcript, inducing the elimination of individual exons and restoring the abnormal reading frame, resulting in the production of an internally deleted but partially functional dystrophin protein. Despite the undoubted potential of antisense oligonucleotide exon skipping therapy for DMD, the successful application of this approach is currently limited by the relative inefficiency of targeting skeletal muscle, as well as the poor targeting of single-stranded oligonucleotides to other affected tissues, such as the heart.

[0006] In September 2016, the Food and Drug Administration (FDA) granted accelerated approval to eteplirsen, a modulator of exon 51 splicing. This was the first US FDA-approved oligonucleotide to regulate splicing, but the level of dystrophin restored was disappointing, at about 1% of normal dystrophin levels. Comparison with the allelic disorder Becker muscular dystrophy and experiments in mdx mice suggest that at least about 15% of wild-type homogeneous sarcolemmal dystrophin expression is required to protect muscles from exercise-induced damage. Summary of the Invention [Problem to be solved by the invention]

[0007] Therefore, there is a need for new antisense oligonucleotide-based therapies for devastating genetic diseases such as DMD. [Means for solving the problem]

[0008] In general, the present invention provides a conjugate of an oligonucleotide and a peptide covalently or via a linker to the oligonucleotide, or a pharma- ceutically acceptable salt thereof, wherein the oligonucleotide is complementary to a target sequence within or proximal to exon 45, exon 51, or exon 53 of the human dystrophin gene.

[0009] In one embodiment, the present invention provides a conjugate of an oligonucleotide and a peptide covalently attached to the oligonucleotide or via a linker, or a pharma- ceutically acceptable salt thereof, comprising: The peptide comprises at least one cationic domain comprising at least four amino acid residues and at least one hydrophobic domain comprising at least three amino acid residues, with the proviso that the peptide comprises a total of 7 to 40 amino acid residues and does not comprise any artificial amino acid residues; The oligonucleotide comprises a total of 12 to 40 contiguous nucleobases, with at least 12 contiguous nucleobases being complementary to a target sequence in the human dystrophin gene, or a pharma- ceutically acceptable salt thereof.

[0010] In some embodiments, the target sequence includes the exon 45 splice junction or is located within 50 nucleobases of the exon 45 splice junction.

[0011] In some embodiments, said oligonucleotide comprises at least 12 contiguous nucleobases selected from any one of the sequences in Table 1, and thymine substituted versions thereof.

[0012] In some embodiments, the oligonucleotide comprises any one of the sequences in Table 1 or a thymine substituted version thereof.

[0013] In some embodiments, the sequence in Table 1 is 5'-GCTGCCCAATGCCATCCTGGAGTTCCTGTAA-3' (SEQ ID NO: 193).

[0014] In some embodiments, the sequence in Table 1 is 5'-CAATGCCATCCTGGAGTTCCTG-3' (SEQ ID NO: 194).

[0015] In some embodiments, the target sequence comprises the splice junction of exon 51 or is located within 50 nucleobases of the splice junction of exon 51. In some embodiments, the oligonucleotide comprises at least 12 contiguous nucleobases selected from any one of the sequences in Table 2 and thymine substituted versions thereof. In some embodiments, the oligonucleotide comprises any one of the sequences in Table 3 or thymine substituted versions thereof.

[0016] In some embodiments, the sequence in Table 2 is 5'-CUCCAACAUCAAGGAAGAUGGCAUUUCUAG-3' (SEQ ID NO: 130).

[0017] In some embodiments, the sequence in Table 2 is 5'-CTCCAACATCAAGGAAGATGGCATTTCTAG-3' (SEQ ID NO:195).

[0018] In some embodiments, the target sequence comprises the splice site of exon 53 or is located within 50 nucleobases of the splice site of exon 53. In some embodiments, the target sequence comprises at least 12 contiguous nucleobases of any one of the sequences in Table 3. In some embodiments, the oligonucleotide comprises any one of the sequences in Table 3.

[0019] In some embodiments, the sequence in Table 3 is 5'-CCTCCGGTTCTGAAGGTGTTCT-3' (SEQ ID NO: 162).

[0020] In some embodiments, the sequence in Table 3 is 5'-GTTGCCTCCGGTTCTGAAGGTGTTC-3' (SEQ ID NO: 171).

[0021] In some embodiments, the splice site is an acceptor splice site, hi some embodiments, the splice site is a donor splice site.

[0022] In some embodiments, the sequence is GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 90).

[0023] In some embodiments, the peptide does not include an aminohexanoic acid (X) residue. In some embodiments, the peptide does not include a 6-aminohexanoic acid residue. In some embodiments, the peptide consists of natural amino acid residues. In some embodiments, each cationic domain has a length between 4 and 12 amino acid residues, preferably between 4 and 7 amino acid residues. In some embodiments, each cationic domain includes at least 40%, at least 45%, or at least 50% cationic amino acids. In some embodiments, each cationic domain includes a majority of cationic amino acids, preferably at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% cationic amino acids. In some embodiments, each cationic domain includes arginine, histidine, beta-alanine, hydroxyproline, and / or serine residues, preferably each cationic domain consists of arginine, histidine, beta-alanine, hydroxyproline, and / or serine residues. In some embodiments, each cationic domain is arginine-rich and / or histidine-rich, preferably each cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% arginine and / or histidine residues, hi some embodiments, the peptide comprises two cationic domains.

[0024] In some embodiments, each cationic domain comprises one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), R[Hyp]RR[Hyp]R (SEQ ID NO:19), or any combination thereof; Preferably, each cationic domain consists of one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), R[Hyp]RR[Hyp]R (SEQ ID NO:19) or any combination thereof.

[0025] In some embodiments, each hydrophobic domain has a length between 3 and 6 amino acids, preferably each hydrophobic domain has a length of 5 amino acids. In some embodiments, each hydrophobic domain comprises a majority of hydrophobic amino acid residues, preferably each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acids. In some embodiments, each hydrophobic domain comprises phenylalanine residues, leucine residues, isoleucine residues, tyrosine residues, tryptophan residues, proline residues and glutamine residues, preferably each hydrophobic domain consists of phenylalanine residues, leucine residues, isoleucine residues, tyrosine residues, tryptophan residues, proline residues and / or glutamine residues. In some embodiments, the peptide comprises one hydrophobic domain. In some embodiments, each hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26), or any combination thereof, and the or each hydrophobic domain consists of one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26), or any combination thereof.

[0026] In some embodiments, the peptide consists of two cationic domains and one hydrophobic domain, preferably the peptide consists of one hydrophobic core domain flanked by two cationic arm domains.

[0027] In some embodiments, the peptide is RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), HBHBR (SEQ ID NO:17), HBHBR (SEQ ID NO:18), HBHBR (SEQ ID NO:19), HBHBR (SEQ ID NO:20), HBHBR (SEQ ID NO:21), HBHBR (SEQ ID NO:22), HBHBR (SEQ ID NO:23), HBHBR (SEQ ID NO:24), HBHBR (SEQ ID NO:25), HBHBR (SEQ ID NO:26), HBHBR (SEQ ID NO:27), HBHBR (SEQ ID NO:28), HBHBR (SEQ ID NO:29), HBHBR (SEQ ID NO:30), HBHBR (SEQ ID NO:31), HBHBR (SEQ ID NO:32), HBHBR (SEQ ID NO:33), HBHBR (SEQ ID NO:34), HBHBR (SEQ ID NO:35), HBHBR (SEQ ID NO:36), HBHBR (SEQ ID NO:37), HBHBR (SEQ ID NO:38), HBHBR (SEQ ID NO:39), HBHBR (SEQ ID NO:40 No. 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), and R[Hyp]RR[Hyp]R (SEQ ID NO: 19), respectively.

[0028] In some embodiments, the peptide consists of one of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO: 27), RBRRBRRYQFLIRBRBR (SEQ ID NO: 31), RBRRBRRILFQYRBRBR (SEQ ID NO: 32), RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37), RBRRBRRFQILYHBHBR (SEQ ID NO: 38), RBRRBRFQILYRBHBH (SEQ ID NO: 44).

[0029] In some embodiments, the peptide has the amino acid sequence: RBRRBRFQILYBRBR (SEQ ID NO: 35). In some embodiments, the peptide has the amino acid sequence: RBRRBRRFQILYRBHBH (SEQ ID NO: 37). In some embodiments, the peptide has the amino acid sequence: RBRRBRFQILYRBHBH (SEQ ID NO: 44). In some embodiments, the peptide is attached to the remainder of the complex through its N-terminus. In some embodiments, the N-terminus of the peptide is -NH2.

[0030] In some embodiments, the peptide is attached to the remainder of the complex through its C-terminus, hi some embodiments, the peptide is acylated at its N-terminus (e.g., has an acetyl group, or an amino acid residue having an NH2- or AcNH- at the N-terminus).

[0031] Preferably, when the amino acid residue is present at the N-terminus of the peptide it contains -CONH2 in place of the -COOH that would otherwise be present.

[0032] In some embodiments, the complex has the following structure: It has [peptide]-[linker]-[oligonucleotide].

[0033] In some embodiments, the complex has the following structure: [ka] or [ka] has.

[0034] In some embodiments, the complex has the following structure: [Peptide]-[Linker]-[Peptide]-[Linker]-[Oligonucleotide] has.

[0035] In some embodiments, each linker independently has a structure according to formula (I): T1-(CR 1 R 2 ) n -T2(I) {where: T1 is a divalent group attached to the peptide and is selected from the group consisting of -NH- and carbonyl; T2 is a divalent group attached to the oligonucleotide and is selected from the group consisting of -NH- and carbonyl; n is 1, 2 or 3; Each R 1 are independently of the formula: -Y 1 -X 1 -Z 1 [where: Y 1 is either absent or of the formula: -[CR A1 R A2 ] m - where m is selected from 1, 2, 3, or 4; R A1 and R A2 are each independently selected from hydrogen, OH, or (1-2C)alkyl; X 1 is absent or is -O-, -C(O)-, -C(O)O-, -OC(O)-, -CH(OR A3 )-, -N(R A3 )-, -N(R A3 )-C(O)-, -N(R A3 )-C(O)O-, -C(O)-N(R A3 )-, -N(R A3 )C(O)N(R A3 )-, -N(R A3 )C(NR A3 )N(R A3 )-, -SO-, -S-, -SO2-, -S(O)2N(R A3 )- or -N(R A3 )SO2- (wherein each RA3 is independently selected from hydrogen or methyl; Z 1 is a further oligonucleotide or is selected from hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, where each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, and heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR A4 R A5 and (1-4C)alkoxy (wherein R A4 and R A5 are each independently substituted with one or more (e.g., 1, 2, 3, 4 or 5) substituents selected from the group consisting of hydrogen and (1-4C)alkyl). is a group represented by the formula: Each R 2 are independently of the formula: -Y 2 -X 2 -Z 2 [where: Y 2 is either absent or of the formula: -[CR B1 R B2 ] m - (wherein m is an integer selected from 1, 2, 3, or 4; R B1 and R B2 are each independently selected from hydrogen, OH, or (1-2C)alkyl; X 2 is absent or is -O-, -C(O)-, -C(O)O-, -OC(O)-, -CH(OR B3 )-, -N(R B3 )-, -N(R B3 )-C(O)-, -N(R B3 )-C(O)O-, -C(O)-N(R B3 )-, -N(R B3)C(O)N(R B3 )-, -N(R B3 )C(NR B3 )N(R B3 )-, -SO-, -S-, -SO2-, -S(O)2N(R B3 )- or -N(R B3 )SO2- (wherein each R B3 is independently selected from hydrogen or methyl; Z 2 is selected from hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, where each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR B4 R B5 and (1-4C)alkoxy (wherein R B4 and R B5 are each independently substituted with one or more (e.g., 1, 2, 3, 4 or 5) substituents selected from the group consisting of hydrogen or (1-2C)alkyl). is a group represented by the formula: however, When n=1 and T1 and T2 are different from each other, R 1 and R 2 cannot both be H; n=1, T1 and T2 are different from each other, and R 1 and R 2 If one of is H, then R 1 and R 2 The other is not methyl; n=2, each R 1 and R 2 is H, then T1 and T2 are both -C(O)- or both -NH-.

[0036] In some embodiments, T2 is -C(O)-.

[0037] In some embodiments, each R 1 are independently of the formula: -Y 1 -X 1 -Z 1 [where: Y 1 is either absent or of the formula: -[CR A1 R A2 ] m - (wherein m is 1, 2, 3, or 4; R A1 and R A2 are each hydrogen or (1-2C) alkyl; X 1 is absent or -O-, -C(O)-, -C(O)O-, -N(R A3 )-, -N(R A3 )-C(O)-, -C(O)-N(R A3 )-, -N(R A3 )C(O)N(R A3 )-, -N(R A3 )C(NR A3 )N(R A3 )- or -S-, where each R A3 are independently hydrogen or methyl; Z 1 is a further oligonucleotide or is hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, where each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, and heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR A4 R A5 and (1-4C)alkoxy (wherein R A4 and R A5each independently is hydrogen or (1-2C)alkyl);

[0038] In some embodiments, each R 1 are independently of the formula: -Y 1 -X 1 -Z 1 [where: Y 1 is either absent or of the formula: -[CR A1 R A2 ] m - (wherein m is 1, 2, 3, or 4; R A1 and R A2 are each independently hydrogen or (1-2C)alkyl; X 1 is absent or is -O-, C(O)-, -C(O)O-, -N(R A3 )-, -N(R A3 )-C(O)-, -C(O)-N(R A3 )-, -N(R A3 )C(O)N(R A3 ), -N(R A3 )C(NR A3 )N(R A3 )- or -S-, where each R A3 are independently hydrogen or methyl; Z 1 is a further oligonucleotide or a group represented by the formula: hydrogen, (1-6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl, wherein each (1-6C)alkyl, aryl, (3-6C)cycloalkyl, and heteroaryl is optionally substituted with one or more (e.g., 1, 2, 3, 4, or 5) substituents selected from the group consisting of (1-4C)alkyl, halo, and hydroxy.

[0039] In some embodiments, each R 1 are independently of the formula: -Y 1 -X 1 -Z 1 [where: Y 1 is either absent or of the formula: -[CR A1 R A2 ] m - (wherein m is 1, 2, 3, or 4; R A1 and R A2 are each independently hydrogen or (1-2C)alkyl; X 1 is absent or -C(O)-, -C(O)O-, -N(R A3 )-C(O)- or -C(O)-N(R A3 ) (where each R A3 is hydrogen or methyl); Z 1 is a further oligonucleotide or a group represented by the formula: hydrogen, (1-6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl, wherein each (1-6C)alkyl, aryl, (3-6C)cycloalkyl, and heteroaryl is optionally substituted with one or more (e.g., 1, 2, 3, 4, or 5) substituents selected from the group consisting of (1-4C)alkyl, halo, and hydroxy.

[0040] In some embodiments, each R 1 are independently of the formula: -Y 1 -X 1 -Z 1 [where Y 1 is absent, -(CH2)- or -(CH2CH2)-, X 1 is absent or -N(R A3 )-C(O)- or -C(O)-N(R A3 )-wherein each R A3 are independently hydrogen or methyl; Z 1is hydrogen or (1-2C)alkyl.

[0041] In some embodiments, each R 2 are independently of the formula: -Y 2 -Z 2 [where Y 2 is either absent or of the formula: -[CR B1 R B2 ] m - (wherein m is 1, 2, 3, or 4; R B1 and R B2 are each independently hydrogen or (1-2C)alkyl; Z 2 is hydrogen or (1-6C)alkyl.

[0042] In some embodiments, each R 2 is hydrogen.

[0043] In some embodiments, n is 2 or 3. In some embodiments, n is 1.

[0044] In some embodiments, the linker is an acid residue selected from the group consisting of glutamic acid, succinic acid, and γ-aminobutyric acid.

[0045] In some embodiments, the linker has the following structure: [ka] has.

[0046] In some embodiments, the linker has the following structure: [ka] has.

[0047] In some embodiments, the linker has the following structure: [ka] . have

[0048] In some embodiments, the linker has the following structure: [ka] has.

[0049] In some embodiments, the linker has the following structure: [ka] has.

[0050] In some embodiments, the complex has the following structure: [ka] has.

[0051] In some embodiments, the complex has the following structure: [ka] has.

[0052] In some embodiments, the complex has the following structure: [ka] has.

[0053] In some embodiments, the complex has the following structure: [ka] has.

[0054] In some embodiments, the complex has the following structure: [ka] has.

[0055] In some embodiments, the oligonucleotide is attached at its 3' end to the linker or the peptide.

[0056] In some embodiments, the oligonucleotide comprises at its 5' end the following group: [ka] Includes.

[0057] In some embodiments, the oligonucleotide comprises at its 5' end the following group: [ka] Includes.

[0058] In some embodiments, the oligonucleotide comprises a hydroxyl at its 5' end.

[0059] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'CAATGCCATCCTGGAGTTCCTG-3' (SEQ ID NO: 194) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide Ac-RBRRBRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0060] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'CAATGCCATCCTGGAGTTCCTG-3' (SEQ ID NO: 194) having its 3'-end covalently linked via a glutamic acid residue to the N-terminus of a peptide RBRRBRFQILYBRBR-NH2 (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0061] In some embodiments, the conjugate is a conjugate of the oligonucleotide 5'CAATGCCATCCTGGAGTTCCTG-3' (SEQ ID NO: 194) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide Ac-RBRRBRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof.

[0062] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'CAATGCCATCCTGGAGTTCCTG-3' (SEQ ID NO: 194) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0063] In some embodiments, the conjugate is a conjugate of the oligonucleotide 5'CAATGCCATCCTGGAGTTCCTG-3' (SEQ ID NO: 194) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof.

[0064] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'GCTGCCCAATGCCATCCTGGAGTTCCTGTAA-3' (SEQ ID NO: 193) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0065] In some embodiments, the conjugate is a conjugate of the oligonucleotide 5'GCTGCCCAATGCCATCCTGGAGTTCCTGTAA-3' (SEQ ID NO: 193) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof.

[0066] In some embodiments, it is a conjugate of the oligonucleotide 5'GCTGCCCAATGCCATCCTGGAGTTCCTGTAA-3' (SEQ ID NO: 193) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof.

[0067] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'ACATCAAGGAAGATGGCATTTCTAGTTTGG-3' (SEQ ID NO: 196) having its 3'-end covalently linked via a glutamic acid residue to the N-terminus of the peptide RBRRBRFQILYBRBR-NH2 (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0068] In some embodiments, it is a conjugate of the oligonucleotide 5'ACATCAAGGAAGATGGCATTTCTAGTTTGG-3' (SEQ ID NO: 196) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof.

[0069] In some embodiments, the conjugate is a conjugate of the oligonucleotide 5'ACATCAAGGAAGATGGCATTTCTAGTTTGG-3' (SEQ ID NO: 196) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof.

[0070] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'ACATCAAGGAAGATGGCATTTCTAGTTTGG-3' (SEQ ID NO: 196) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0071] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'CTCCAACATCAAGGAAGATGGCATTTCTAG-3' (SEQ ID NO: 195) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0072] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'CTCCAACATCAAGGAAGATGGCATTTCTAG-3' (SEQ ID NO: 195) having its 3'-end covalently linked via a glutamic acid residue to the N-terminus of the peptide RBRRBRFQILYBRBR-NH2 (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0073] In some embodiments, the conjugate is a conjugate of the oligonucleotide 5'CTCCAACATCAAGGAAGATGGCATTTCTAG-3' (SEQ ID NO: 195) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof.

[0074] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'CTCCAACATCAAGGAAGATGGCATTTCTAG-3' (SEQ ID NO: 195) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0075] In some embodiments, the conjugate is a conjugate of the oligonucleotide 5'CTCCAACATCAAGGAAGATGGCATTTCTAG-3' (SEQ ID NO: 195) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof.

[0076] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'GTTGCCTCCGGTTCTGAAGGTGTTC-3' (SEQ ID NO: 171) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0077] In some embodiments, the conjugate is a conjugate of the oligonucleotide 5'GTTGCCTCCGGTTCTGAAGGTGTTC-3' (SEQ ID NO: 171) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof.

[0078] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'-GTTGCCTCCGGTTCTGAAGGTGTTC-3' (SEQ ID NO: 171) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0079] In some embodiments, the conjugate is a conjugate of the oligonucleotide 5'GTTGCCTCCGGTTCTGAAGGTGTTC-3' (SEQ ID NO: 171) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof.

[0080] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'-GTTGCCTCCGGTTCTGAAGGTGTTC-3' (SEQ ID NO: 171) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0081] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'-CCTCCGGTTCTGAAGGTGTTCT-3' (SEQ ID NO: 162) having its 3'-end covalently linked via a glutamic acid residue to the N-terminus of the peptide RBRRBRFQILYBRBR-NH2 (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0082] In some embodiments, the conjugate is a conjugate of the oligonucleotide 5'-CCTCCGGTTCTGAAGGTGTTCT-3' (SEQ ID NO: 162) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof.

[0083] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'-CCTCCGGTTCTGAAGGTGTTCT-3' (SEQ ID NO: 162) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0084] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'-CCTCCGGTTCTGAAGGTGTTCT-3' (SEQ ID NO: 162) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0085] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'-CCTCCGGTTCTGAAGGTGTTCT-3' (SEQ ID NO: 162) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0086] In some embodiments, the conjugate is a conjugate of the oligonucleotide 5'-CCTCCGGTTCTGAAGGTGTTCT-3' (SEQ ID NO: 162) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof.

[0087] In some embodiments, the conjugate is a conjugate of the oligonucleotide 5'-CATTCAACTGTTGCCTCCGGTTCTGAAGGTG-3' (SEQ ID NO: 198) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof.

[0088] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'-CATTCAACTGTTGCCTCCGGTTCTGAAGGTG-3' (SEQ ID NO: 198) having its 3'-end covalently linked via a glutamic acid residue to the N-terminus of the peptide RBRRBRFQILYBRBR-NH2 (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0089] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'-CATTCAACTGTTGCCTCCGGTTCTGAAGGTG-3' (SEQ ID NO: 198) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0090] In some embodiments, the conjugate is a conjugate of the oligonucleotide 5'-CATTCAACTGTTGCCTCCGGTTCTGAAGGTG-3' (SEQ ID NO: 198) having its 3'-end covalently linked via a beta-alanine residue to the C-terminus of the peptide AcRBRRBRFQILYRBHBH (SEQ ID NO: 44), or a pharma- ceutically acceptable salt thereof.

[0091] In some embodiments, the conjugate is a conjugate of an oligonucleotide 5'-CATTCAACTGTTGCCTCCGGTTCTGAAGGTG-3' (SEQ ID NO: 198) having its 3'-end covalently linked via a glutamic acid residue to the C-terminus of the peptide AcRBRRBRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof, wherein if there is a free -COOH in the glutamic acid residue, it is replaced by -CONH2, or a pharma- ceutically acceptable salt thereof.

[0092] For each of the conjugates described above or elsewhere herein, or a pharma- ceutically acceptable salt thereof, in which the 3'-terminus of the oligonucleotide is covalently attached to the C-terminus or N-terminus of the peptide via a glutamic acid residue, the conjugate or a pharma- ceutically acceptable salt thereof may have the following structure: [ka] or a pharma- ceutically acceptable salt thereof.

[0093] In some embodiments, the oligonucleotide comprises at its 5' end the following group: [ka] Includes.

[0094] In another aspect, the invention provides a pharmaceutical composition comprising a conjugate described herein and a pharma- ceutically acceptable excipient.

[0095] In yet another aspect, the invention provides a method of treating a subject with DMD or BMD, comprising administering to the subject a therapeutically effective amount of a conjugate described herein or a pharmaceutical composition described herein. The invention further includes pharmaceutical compositions for use in treating a subject with DMD or BMD.

[0096] In some embodiments, the subject has DMD.

[0097] Preferably, the oligonucleotide is morpholino (more preferably, all morpholino internucleoside linkages are -P(O)(NMe2)O-).

[0098] definition References to "X" throughout refer to any form of an amino acid, for example aminohexanoic acid, such as 6-aminohexanoic acid.

[0099] References to "B" throughout refer to the amino acid beta-alanine.

[0100] References throughout to "Hyp" refer to the amino acid hydroxyproline.

[0101] References throughout to "Ac" refer to an acetyl group (CH3-C(O)-).

[0102] References throughout to other capital letters indicate the relevant genetically encoded amino acid residue according to the accepted alphabetical amino acid code.

[0103] The term "alkyl," as used herein, unless otherwise specified (e.g., (1-6C)alkyl, (1-4C)alkyl, (1-3C)alkyl, or (1-2C)alkyl), refers to a straight or branched chain hydrocarbon group containing a total of 1 to 20 carbon atoms. Non-limiting examples of alkyl include methyl, ethyl, 1-methylethyl, propyl, 1-methylbutyl, 1-ethylbutyl, and the like. References to individual alkyl groups, such as "propyl," specifically refer to the straight chain version only, and references to individual branched alkyl groups, such as "isopropyl," specifically refer to the branched chain version only.

[0104] The term "alkenyl," as used herein, unless otherwise specified (e.g., (2-6C)alkenyl, (2-4C)alkenyl, or (2-3C)alkenyl), refers to an aliphatic group having 1, 2, or 3 carbon-carbon double bonds and containing a total of 2-20 carbon atoms. Non-limiting examples of alkenyl include vinyl, allyl, homoallyl, isoprenyl, and the like. Unless otherwise specified, alkenyl may be optionally substituted with 1, 2, 3, 4, or 5 groups selected from the group consisting of carbocyclyl, aryl, heterocyclyl, heteroaryl, oxo, halogen, and hydroxyl.

[0105] The term "alkynyl," as used herein, unless otherwise specified (e.g., (2-6C)alkynyl, (2-4C)alkynyl, or (2-3C)alkynyl), refers to an aliphatic group having 1, 2, or 3 carbon-carbon triple bonds and containing a total of 2-20 carbon atoms. Non-limiting examples of alkynyl include ethynyl, propargyl, homopropargyl, but-2-yn-1-yl, 2-methyl-prop-2-yn-1-yl, and the like. Unless otherwise specified, alkynyl may be optionally substituted with 1, 2, 3, 4, or 5 groups selected from the group consisting of carbocyclyl, aryl, heterocyclyl, heteroaryl, oxo, halogen, and hydroxyl.

[0106] The term amino acid "residue" refers to a divalent group in which one N-H bond of an amino acid is replaced with a valence of one and one carboxylic acid CO bond is replaced with a valence of one. The N-H bond or the carboxylic acid CO bond may, for example, be on a side chain.

[0107] The term "arginine-rich" means that at least 40% of the cationic domains are formed by arginine residues.

[0108] The term "artificial amino acid" as used herein refers to an amino acid of non-biological origin (e.g., non-proteinogenic). For example, artificial amino acids include synthetic amino acids, modified amino acids (e.g., sugar-modified), unnatural amino acids, artificial amino acids, spacers, and non-peptide bond spacers. Synthetic amino acids may be chemically synthesized by humans. For the avoidance of doubt, aminohexanoic acid (X) is an artificial amino acid in the context of the present invention. For the avoidance of doubt, beta-alanine (B) and hydroxyproline (Hyp) exist in nature and are therefore natural amino acids, not artificial amino acids, in the context of the present invention. Artificial amino acids may include, for example, 6-aminohexanoic acid (X), tetrahydroisoquinoline-3-carboxylic acid (TIC), 1-(amino)cyclohexanecarboxylic acid (Cy), and 3-azetidine-carboxylic acid (Az), and 11-aminoundecanoic acid.

[0109] The term "aryl" as used herein refers to a carbocyclic ring system containing one, two, or three rings, at least one of which is aromatic. Unsubstituted aryl contains a total of 6 to 14 carbon atoms. The term aryl includes both monovalent and divalent species. Non-limiting examples of aryl groups include phenyl, naphthyl, indanyl, and the like. In certain embodiments, the optionally substituted aryl is an optionally substituted phenyl.

[0110] The term "bridged ring system" as used herein means a ring system in which two rings share two or more atoms (see, for example, Advanced Organic Chemistry, 4th Edition, Wiley Interscience, p. 131-133, 1992, by Jerry March). Examples of bridged heterocyclic ring systems include aza-bicyclo[2.2.1]heptane, 2-oxa-5-azabicyclo[2.2.1]heptane, aza-bicyclo[2.2.2]octane, aza-bicyclo[3.2.1]octane, quinuclidine, and the like.

[0111] The term "carbonyl" as used herein refers to a group of the following structure: -C(O)-. Non-limiting examples of carbonyl groups are those found, for example, in acetone, ethyl acetate, proteinogenic amino acids, acetamide, etc.

[0112] The term "cationic" refers to an amino acid or domain of amino acids that carries an overall positive charge at physiological pH.

[0113] The term “(m-nC)” or “(m-nC) group” used alone or as a prefix, refers to a group that has a total of m to n carbon atoms, when unsubstituted.

[0114] The term "complementary" as used herein with respect to a nucleobase sequence refers to a nucleobase sequence having a pattern of consecutive nucleobases that allows an oligonucleotide having that nucleobase sequence to hybridize with another oligonucleotide or nucleic acid under physiological conditions to form a double-stranded structure. Complementary sequences include Watson-Crick base pairs formed from natural and / or modified nucleobases. Complementary sequences can also include non-Watson-Crick base pairs, such as wobble base pairs (guanosine-uracil, hypoxanthine-uracil, hypoxanthine-adenine, hypoxanthine-cytosine) and Hoogsteen base pairs.

[0115] The term "cycloalkyl" as used herein, unless otherwise specified, refers to a saturated carbocyclic ring system containing one or two rings and a total of 3 to 10 carbon atoms. Bicyclic cycloalkyls can be arranged as fused ring systems (two bridgehead carbon atoms are directly bonded to each other), bridged ring systems (two bridgehead carbon atoms are bonded to each other via a covalent linker containing at least one carbon atom), and spiro ring systems (two rings are fused at the same carbon atom). Non-limiting examples of cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, bicyclo[2.2.1]heptyl, and the like.

[0116] Unless otherwise specified, the term "cycloalkenyl" refers to a non-aromatic, unsaturated carbocyclic ring system containing one or two rings; containing one, two or three internal ring double bonds; and containing a total of 3 to 10 carbon atoms. Two-ring cycloalkenyls can be arranged as fused ring systems (two bridgehead carbon atoms are directly bonded to each other), bridged ring systems (two bridgehead carbon atoms are bonded to each other via a covalent linker containing at least one carbon atom), and spiro ring systems (two rings are fused at the same carbon atom). Non-limiting examples of cycloalkenyls include cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, 3-cyclohexen-1-yl, cyclooctenyl, and the like.

[0117] Dystrophin is a rod-shaped cytoplasmic protein that is an integral part of a protein complex that connects the cytoskeleton of muscle fibers through the cell membrane to the surrounding extracellular matrix. Dystrophin contains multiple functional domains. For example, dystrophin contains an actin-binding domain of about 14-240 amino acids and a central rod domain of about 253-3040 amino acids. This large central domain is formed by 24 spectrin-like triple-helical elements of about 109 amino acids and has homology to α-actinin and spectrin. The repeats are typically interrupted by four proline-rich non-repetitive segments, also called hinge regions. Repeats 15 and 16 are separated by an 18 amino acid stretch that appears to be the primary site of proteolytic cleavage in dystrophin. The sequence identity between most repeats is 10-25%. One repeat contains three α-helices: 1, 2, and 3. α-helices 1 and 3 are each formed by seven helical turns, which interact as coiled coils, presumably through hydrophobic interfaces. α-helix 2 has a more complex structure, formed by segments of four and three helical turns separated by glycine or proline residues. Each repeat is encoded by two exons, usually interrupted by an intron in the first part of α-helix 2, between amino acids 47 and 48. Another intron is at a different position in the repeat, usually interspersed on helix 3. Dystrophin also contains a cysteine-rich domain at approximately 3080–3360 amino acids, which shows homology to the C-terminal domain of Dictyostelium discoideum α-actinin (i.e., 15 cysteines in 280 amino acids). The carboxy-terminal domain is at approximately amino acids 3361–3685.

[0118] The amino terminus of dystrophin binds to F-actin, and the carboxy terminus binds to the dystrophin-associated protein complex (DAPC) at the muscle cell membrane. The DAPC includes dystroglycan, sarcoglycan, integrins, and caveolin, and mutations in any of these components cause autosomal muscular dystrophies. Dystrophin deficiency destabilizes the DAPC, resulting in reduced levels of its constituent proteins and progressive fiber damage and membrane leakage. In various muscular dystrophies, including Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), muscle cells produce altered and functionally defective forms of dystrophin, primarily due to mutations in gene sequences that cause incorrect splicing, or no dystrophin at all. Predominant expression of defective dystrophin proteins or a complete lack of dystrophin or dystrophin-like proteins leads to rapid muscle degeneration as described above. In this regard, a "defective" dystrophin protein may be characterized by the form of dystrophin produced in a particular DMD or BMD subject, or the absence of detectable dystrophin, as is known in the art.

[0119] The term "exon" refers to a defined portion of a nucleic acid that codes for a protein, or a nucleic acid sequence that is represented in the mature form of an RNA molecule after any portion of a preprocessing (or precursor) RNA has been removed by splicing. The mature RNA molecule may be messenger RNA (mRNA) or a functional form of non-coding RNA such as rRNA or tRNA. The human dystrophin gene has approximately 75 exons.

[0120] The term "exon skipping" generally refers to a process by which an entire exon or a portion thereof is removed from a given pre-processed RNA such that it is not present in the mature RNA, such as the mature mRNA that is translated into a protein. Thus, the portion of the protein normally encoded by the skipped exon is not present in the expressed form of the protein, producing a normally functional but altered form of the protein. In certain embodiments, the skipped exon is an aberrant exon of the human dystrophin gene, which may contain a mutation or other alteration in its sequence that would otherwise cause aberrant splicing. In certain embodiments, the skipped exon is exon 45, exon 51, and / or exon 53 of the human dystrophin gene.

[0121] The term "halo" or "halogen" as used herein refers to fluorine, chlorine, bromine, and iodine.

[0122] The term "histidine-rich" means that at least 40% of the cationic domains are formed from histidine residues.

[0123] The terms "heteroaryl" or "heteroaromatic", as used interchangeably herein, refer to a ring system containing one, two, or three rings, at least one of which is an aromatic ring containing one to four (e.g., one, two, or three) heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur. Unsubstituted heteroaryl groups contain a total of one to nine carbon atoms. The term heteroaryl includes both monovalent and divalent species. Examples of heteroaryl groups include monocyclic and bicyclic groups containing five to twelve ring members, more commonly five to ten ring members. Heteroaryl groups are, for example, five- or six-membered monocyclic or nine- or ten-membered bicyclic rings, such as fused five- and six-membered rings, or bicyclic structures formed from two fused six-membered rings. Each ring can contain up to about four heteroatoms, typically selected from nitrogen, sulfur, and oxygen. Typically, the heteroaryl ring contains 3 or less heteroatoms, more usually 2 or less heteroatoms, for example 1 heteroatom. In some embodiments, the heteroaryl ring contains at least 1 nitrogen atom. The nitrogen atom in the heteroaryl ring is basic, as in imidazole or pyridine, or essentially non-basic, as in the case of indole or pyrrole nitrogen. Generally, the number of basic nitrogen atoms present in the heteroaryl group is at least 5 or more, including the various amino acid substituents of the ring.

[0124] Examples of heteroaryl include furyl, pyrrolyl, thienyl, oxazolyl, isoxazolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxadiazolyl, thiadiazolyl, triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1,3,5-triazenyl, benzofuranyl, indolyl, isoindolyl, benzothienyl, benzoxazolyl, benzimidazolyl, benzothiazolyl, indazolyl, purinyl, benzofurazanyl, quinolinyl, isoquinolyl, and quinolyl. These include nazolinyl, quinoxalinyl, cinnolinyl, pteridinyl, naphthyridinyl, carbazolyl, phenazinyl, benzisoquinolinyl, pyridopyrazinyl, thieno[2,3-b]furanyl, 2H-furo[3,2-b]-pyranyl, 5H-pyrazino[2,3-d]-o-oxazinyl, 1H-pyrazolo[4,3-d]-oxazolyl, 4H-imidazo[4,5-d]thiazolyl, pyrazino[2,3-d]pyridazinyl, imidazo[2,1-b]thiazolyl, and imidazo[1,2-b][1,2,4]triazinyl. "Heteroaryl" also includes partially aromatic di- or polycyclic ring systems in which at least one ring is aromatic and one or more of the other rings are non-aromatic, saturated or partially saturated, so long as at least one ring contains one or more heteroatoms selected from nitrogen, oxygen, or sulfur. Examples of partially aromatic heteroaryl groups include, for example, tetrahydroisoquinolinyl, tetrahydroquinolinyl, 2-oxo-1,2,3,4-tetrahydroquinolinyl, dihydrobenzothienyl, dihydrobenzofuranyl, 2,3-dihydro-benzo[1,4]dioxinyl, benzo[1,3]dioxolyl, 2,2-dioxo-1,3-dihydro-2-benzothienyl, 4,5,6,7-tetrahydrobenzofuranyl, indolinyl, 1,2,3,4-tetrahydro-1,8-naphthyridinyl, 1,2,3,4-tetrahydropyridido[2,3-b]pyrazinyl, and 3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazinyl.

[0125] Examples of 5-membered heteroaryl groups include, but are not limited to, pyrrolyl, furanyl, thienyl, imidazolyl, furazanyl, oxazolyl, oxadiazolyl, oxatriazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyrazolyl, triazolyl, and tetrazolyl groups.

[0126] Examples of 6-membered heteroaryl groups include, but are not limited to, pyridyl, pyrazinyl, pyridazinyl, pyrimidinyl, and triazinyl.

[0127] Bicyclic heteroaryl groups are, for example, groups selected from the following: a benzene ring fused to a 5- or 6-membered ring containing 1, 2, or 3 ring heteroatoms; a pyridine ring fused to a 5- or 6-membered ring containing 1, 2, or 3 ring heteroatoms; a pyrimidine ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a pyrrole ring fused to a 5- or 6-membered ring containing 1, 2, or 3 ring heteroatoms; a pyrazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a pyrazine ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an imidazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an oxazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an isoxazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a thiazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an isothiazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a thiophene ring fused to a 5- or 6-membered ring containing 1, 2, or 3 ring heteroatoms; a furan ring fused to a 5- or 6-membered ring containing 1, 2, or 3 ring heteroatoms; a cyclohexyl ring fused to a 5- or 6-membered aromatic heterocycle containing 1, 2, or 3 ring heteroatoms; and A cyclopentyl ring fused to a 5- or 6-membered aromatic heterocycle containing 1, 2, or 3 ring heteroatoms.

[0128] Particular examples of bicyclic heteroaryl groups containing a 6-membered ring fused to a 5-membered ring include, but are not limited to, benzofuranyl, benzothiophenyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzothiazolyl, benzisothiazolyl, isobenzofuranyl, indolyl, isoindolyl, indolizinyl, indolinyl, isoindolinyl, purinyl (e.g., adeninyl, guaninyl), indazolyl, benzodioxalyl, and pyrazolopyridinyl groups.

[0129] Particular examples of bicyclic heteroaryl groups containing two fused 6-membered rings include, but are not limited to, quinolinyl, isoquinolinyl, chromanyl, thiochromanyl, chromenyl, isochromenyl, chromanyl, isochromanyl, benzodioxanyl, quinolidinyl, benzoxazinyl, benzodiazinyl, pyridopyridinyl, quinoxalinyl, quinazolinyl, cinnolinyl, phthalazinyl, naphthyridinyl, and pteridinyl groups.

[0130] The term "heterocyclyl group" as used herein refers to a ring system containing one, two, or three rings containing at least one heteroatom selected from the group consisting of nitrogen, oxygen, and sulfur, with the proviso that the ring system does not contain an aromatic ring that also contains an inner ring heteroatom. Unsubstituted heterocyclyl groups contain a total of 2 to 9 carbon atoms. The term heterocyclyl includes both monovalent and divalent species. Examples of heterocyclyl groups include monocyclic and bicyclic groups containing from 5 to 12 ring members, more commonly from 5 to 10 ring members. Heterocyclyl groups can be, for example, a 5- or 6-membered monocyclic or a 9- or 10-membered bicyclic ring, for example, a bicyclic structure formed from fused 5- and 6-membered rings, or a bicyclic structure formed from two fused 6-membered rings. Each ring can contain up to four heteroatoms typically selected from nitrogen, sulfur, and oxygen. Non-limiting examples of heterocyclyl groups include, for example, pyrrolidine, piperazine, piperidine, azepane, 1,4-diazepane, tetrahydrofuran, tetrahydropyran, oxepane, 1,4-dioxepane, tetrahydrothiophene, tetrahydrothiopyran, indoline, benzopyrrolidine, 2,3-dihydrobenzofuran, phthalan, isochroman, and 2,3-dihydrobenzothiophene.

[0131] The term "internucleoside linkage" as used herein refers to a group or bond that forms a covalent bond between adjacent nucleosides in an oligonucleotide. An internucleoside linkage may be an unmodified internucleoside linkage or a modified internucleoside linkage. An "unmodified internucleoside linkage" is a phosphate (-OP(O)(OH)-O-) internucleoside linkage ("phosphodiester phosphate"). A "modified internucleoside linkage" is an internucleoside linkage other than a phosphodiester phosphate. Two major classes of modified internucleoside linkages are defined by the presence or absence of a phosphorus atom. Non-limiting examples of phosphorus-containing internucleoside linkages include phosphodiester linkages, phosphotriester linkages, phosphorothioate diester linkages, phosphorothioate triester linkages, morpholino internucleoside linkages, methylphosphonates, phosphoramidates, and the like. Non-limiting examples of non-phosphorus based internucleoside linkages include methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester (-OC(O)-S-), thiocarbamate (-OC(O)(NH)-S-), siloxane (-O-Si(H)2-O-), N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-), etc. Phosphorothioate linkages are phosphodiester and phosphotriester linkages in which one of the non-bridging oxygen atoms has been replaced with a sulfur atom.

[0132] In some embodiments, the internucleoside linkages have the following structure: [ka] , [wherein Z is O, S, or Se; Y is of the formula: -XLR 1 and; Each X is independently -O-, -S-, -N(-LR 1 )-, or L; Each L is independently a covalent bond or a linker (e.g., optionally substituted C 1-60 Aliphatic linker or optionally substituted C2-60 a heteroaliphatic linker; Each R 1 are each independently hydrogen, -SSR 2 ,-O-CO-R 2 ,-S-CO-R 2 , arbitrarily substituted C 1-9 a heterocyclyl group, or a hydrophobic moiety (wherein each R 2 each independently represents an optionally substituted C 1-10 Alkyl, optionally substituted C 2-10 Heteroalkyl, optionally substituted C 6-10 Aryl, optionally substituted C 6-10 Aryl C 1-6 Alkyl, optionally substituted C 1-9 Heterocyclyl group, or optionally substituted C 1-9 Heterocyclyl C 1-6 alkyl).

[0133] L is a covalent bond, R 1 When is hydrogen, Z is oxygen, and all X groups are -O-, the internucleoside group is known as a phosphodiester phosphate. L is a covalent bond, R 1 When Z is hydrogen, Z is sulfur, and all X groups are -O-, the internucleoside group is known as a phosphorothioate diester. When Z is oxygen, all X groups are -O-, (1) L is a linker, or (2) R 1 When Z is not hydrogen, the internucleoside group is known as a phosphotriester. Z is sulfur, all X groups are -O-, and (1) L is a linker, or (2) R 1 When is not hydrogen, the internucleoside group is known as a phosphorothioate triester. Non-limiting examples of phosphorothioate triester and phosphotriester linkages are described in US2017 / 0037399, the disclosure of which is incorporated herein by reference.

[0134] The term "intron" refers to a nucleic acid region (within a gene) that is not translated into protein. Introns are non-coding regions that are transcribed into a precursor mRNA (pre-mRNA) and then removed by splicing during formation of the mature RNA.

[0135] The term "morpholino" as used herein with reference to the class of oligonucleotides refers to an oligomer of at least 10 morpholino monomeric units interconnected by morpholino internucleoside linkages.

[0136] A morpholino contains a 5' group and a 3' group. For example, a morpholino may have the structure: [ka] [wherein n is an integer of at least 10 (e.g., 12 to 30) and indicates the number of groups L associated with the morpholino subunit; each B is independently a nucleobase; R 1 is the 5' group (herein R 1 is sometimes referred to as the 5' end); R 2 is the 3' group (herein R 2 is sometimes referred to as the 3' end); L is (i) a morpholino internucleoside linkage, or (ii) L is R 2 When the bond is bonded to a cyclic alkyl group, it may be a covalent bond.

[0137] The 5' group of the morpholino can be, for example, a hydroxyl group, a hydrophobic site, a phosphate, diphosphate, triphosphate, phosphorothioate, diphosphorothioate, triphosphorothioate, phosphorodithioate, diphosphorodithioate, triphosphorodithioate, phosphonate, phosphoramidate, a bond to a peptide, a bond to a peptide and linker combination, an endosomal escape moiety, a neutral organic polymer, or the following structure: [ka] or [ka] It is a group represented by the following formula:

[0138] Preferred 5' groups are hydroxyl groups and the following structures: [ka] or [ka] It is a group represented by the following formula:

[0139] A more preferred 5' group has the structure: [ka] It is a group represented by the following formula:

[0140] The 3' group of the morpholino can be, for example, a hydrogen, a hydrophobic moiety, a phosphate, a diphosphate, a triphosphate, a phosphorothioate, a diphosphorothioate, a triphosphorothioate, a phosphorodithioate, a diphosphorodithioate, a triphosphorodithioate, a phosphonate, a phosphoramidate, a bond to a peptide, a bond to a peptide and linker combination, an endosomal escape moiety, a neutral organic polymer, or the following structure: [ka] or [ka] It is a group represented by the following formula:

[0141] In a conjugate of an oligonucleotide that is a morpholino and a peptide covalently bonded or linked to the oligonucleotide, the preferred 3' group is a bond to the peptide or a bond to a peptide / linker combination.

[0142] As used herein, the term "morpholino internucleoside linkage" refers to a linker having the following structure: [ka] , [wherein Z is O or S; X 1 is a single bond, -CH2-, or -O-; X 2 is a single bond, -CH2-O-, or -O-; Y is -NR2, where each R is independently H or C 1-6 alkyl (e.g., methyl) or both R together with the nitrogen atom to which they are attached form a C2-9 heterocyclyl (e.g., an N-piperazinyl group); However, X 1 and X 2 and cannot simultaneously be a single bond.

[0143] As used herein, the term "morpholino subunit" refers to a group having the following structure: [ka] (wherein B is a nucleobase).

[0144] The term "nucleobase" as used herein refers to the nitrogen-containing heterocycle found at the 1' position of the ribofuranose / 2'-deoxyribofuranose of a nucleoside. Nucleobases may be unmodified or modified. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines, as well as synthetic and natural nucleobases such as 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl) adenine and guanine, 2-alkyl (e.g., adenine, cytos ... Examples of cytosine include 5-amino-3-methyl-1,1-diamino-2,1-diamino ...

[0145] Certain nucleobases are particularly useful for increasing the binding affinity of nucleic acids. For example, 5-substituted pyrimidines; 6-azapyrimidines; N2-, N6-, and / or O6-substituted purines. The stability of nucleic acid duplexes can be increased, for example, by using 5-methylcytosine. Non-limiting examples of nucleobases include 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza. and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size expanded bases, fluorinated bases, etc.

[0146] Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp), etc. Modified nucleobases also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deazaadenine, 7-deazaguanine, 2-aminopyridine, 2-pyridone, etc.

[0147] Additional nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808; those disclosed in The Concise Encyclopedia of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; those disclosed in Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0148] The term "nucleoside" as used herein refers to sugar-nucleobase compounds and groups known in the art, as well as modified or unmodified 2'-deoxyribofuranose-nucleobase compounds and groups known in the art. The sugar may be ribofuranose. The sugar may be modified or unmodified. An unmodified ribofuranose-nucleobase is a ribofuranose with an anomeric carbon bond to the unmodified nucleobase. Unmodified ribofuranose nucleobases are adenosine, cytidine, guanosine, uridine. Unmodified 2'-deoxyribofuranose-nucleobase compounds are 2'-deoxyadenosine, 2'-deoxycytidine, 2'-deoxyguanosine, and thymidine. Modified compounds and groups include one or more modifications selected from the group consisting of nucleobase modifications and sugar modifications described herein. A nucleobase modification is the replacement of an unmodified nucleobase with a modified nucleobase. Sugar modifications can be, for example, 2'-substituted, locked, carbocyclized, or non-locked. 2'-Substituted is the replacement of the 2'-hydroxyl of ribofuranose with 2'-fluoro, 2'-methoxy, or 2'-(2-methoxy)ethoxy.

[0149] Alternatively, the 2'-substitution may be a 2'-(ara) substitution, which corresponds to the following structure: [ka] (B is a nucleobase and R is a 2'-(ara) substituent (e.g., fluoro). The 2'-(ara) substituents can be the same as other 2'-substituents known in the art and described herein. In some embodiments, the 2'-(ara) substituent is a 2'-(ara)-F substituent (R is fluoro). The fixed modification is the incorporation of a bridge between the 4'-carbon atom and the 2'-carbon atom of the ribofuranose. Nucleosides with fixed modifications are known in the art as bridged nucleic acids, such as locked nucleic acids (LNA), ethylene-bridged nucleic acids (ENA), and cEt nucleic acids. Bridged nucleic acids are typically used as affinity-enhancing nucleosides. "Nucleoside" can also refer to a morpholino subunit.

[0150] As used herein, the term "nucleotide" refers to a nucleoside linked to an internucleoside linkage or to a nucleotide having the following structure: -X 1 -P(X 2 )(R 1 )2 [where X 1 is O, S, or NH, and X 2 is absent, =O, or =S, and each R 1 are each independently -OH, -N(R 2 )2, or -O-CH2CH2CN, where each R 2 are each independently optionally substituted alkyl, or both R 2 The groups together with the nitrogen atom to which they are attached form an optionally substituted heterocyclyl group).

[0151] The term "oligonucleotide" as used herein refers to a structure comprising 10 or more consecutive nucleosides covalently linked by internucleoside linkages; a morpholino comprising 10 or more morpholino subunits; or a peptide nucleic acid comprising 10 or more morpholino subunits. Preferably, the oligonucleotide is a morpholino.

[0152] The term "optionally substituted" refers to each of the aforementioned groups, structures, or molecules that may be substituted or unsubstituted. 1 Any CH, CH2, CH3 group or heteroatom (i.e., NH) in the group is optionally substituted" 1 It means that (any) one of the hydrogen atoms of the group is replaced by an appropriately defined group.

[0153] As used herein, the term "operably linked" may include the situation where a selected nucleotide sequence and a regulatory nucleotide sequence are covalently linked in such a way that expression of the nucleotide coding sequence is under the control of the regulatory sequence, such that the regulatory sequence is capable of effecting transcription of the nucleotide coding sequence that forms part or all of the selected nucleotide sequence, and, if appropriate, the resulting transcript can be translated into the desired peptide.

[0154] As used herein, the term "pharmacologically acceptable" means a compound, material, composition, and / or dosage form that is suitable for contact with the tissues of an individual (e.g., a human) without undue toxicity, irritation, allergic response, and other problem complications commensurate with a reasonable benefit / risk ratio.

[0155] The term "pharmaceutically acceptable salt" as used herein refers to a pharmaceutically acceptable salt of the conjugate, oligonucleotide, or peptide disclosed herein. Pharmaceutically acceptable salts of the compounds described herein may include those that are within the scope of sound medical judgment, suitable for use in contact with human and animal tissues without undue toxicity, irritation, or allergic reaction, and commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, pharmaceutically acceptable salts are described in Berge et al., J. Pharmaceutical Sciences 66:1-19, 1977 and Pharmaceutical Salts: Properties, Selection, and Use, (Eds. PH Stahl and CG Wermuth), Wiley-VCH, 2008. The salts can be prepared in situ during the final isolation and purification of the compounds described herein, or can be prepared separately by reacting the free base group with a suitable acid. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfonate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, and pamoate. These include pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, and valerate.Representative alkali or alkaline earth metal salts include, but are not limited to, sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium, amine cations, including ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like.

[0156] The term "pharmaceutical composition" as used herein refers to a composition comprising the oligonucleotides described herein, formulated with a pharma- ceutical acceptable excipient, and manufactured or sold with the approval of a government regulatory agency as part of a therapeutic regimen for the treatment of a disease in a subject.

[0157] The term "reduce" or "suppress" may generally refer to the ability of one or more compounds of the present invention to "reduce" a relevant physiological or cellular response, such as a symptom of a disease or condition described herein, as measured according to routine techniques in the diagnostic arts. The relevant physiological or cellular response (in vivo or in vitro) will be apparent to those skilled in the art and may include the alleviation of symptoms or pathology of muscular dystrophy, or the alleviation of the expression of defective forms of dystrophin, such as the altered forms of dystrophin expressed in individuals with DMD or BMD. A "reduction" in response is statistically significant as compared to the response occurring in the absence of the antisense compound or control composition and includes a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% reduction, including all integers in between.

[0158] The term "subject" as used herein refers to a human or non-human animal (e.g., a mammal) suffering from or at risk for a disease, disorder, or condition as determined by a qualified professional (e.g., a physician or nurse practitioner) with or without art-known laboratory testing of a sample from the subject. Non-limiting examples of diseases, disorders, and conditions include Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD).

[0159] The term "sugar" or "sugar moiety" includes naturally occurring sugars having a furanose ring or structures that can replace the furanose ring of a nucleoside. The sugars included in the nucleosides of the invention can be non-furanose (or 4'-substituted furanose) rings, ring systems or open systems. Such structures include simple modifications to the naturally occurring furanose ring (e.g., a six-membered ring). Alternative sugars also include those in which the furanose ring is replaced with another ring system, such as, for example, a morpholino or hexitol ring system. Non-limiting examples of useful sugar moieties that can be included in the oligonucleotides of the invention include β-D-ribose, β-D-2'-deoxyribose, substituted sugars (e.g., 2',5', and bis-substituted sugars), 4'-S-sugars (e.g., 4'-S-ribose, 4'-S-2'-deoxyribose, and 4'-S-2'-substituted ribose), bicyclic sugar moieties (e.g., bicyclic sugars derived from 2'-O-CH2-4' or 2'-O-(CH2)2-4' bridged ribose), and alternative sugars (where the ribose ring is replaced with a morpholino or hexitol ring system), etc.

[0160] As used herein, the terms "treatment" and "treatment" refer to the medical management of a subject with the intent to improve, alleviate, or stabilize a disease, disorder, or condition (e.g., DMD or BMD). This term includes active treatment (treatment to improve DMD or BMD), palliative treatment (treatment to relieve the symptoms of DMD or BMD), and supportive treatment (treatment to complement other treatments).

[0161] Throughout the description and claims of this specification, the terms "comprise" and "contain" and variations thereof mean "including but not limited to" and are not intended to (and do not) exclude other moieties, additives, ingredients, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context requires otherwise. In particular, where the indefinite article is used, it is understood that the specification contemplates the plural as well as the singular, unless the context otherwise requires.

[0162] All of the terms "complexes" also refer to solvates thereof.

[0163] The term "oligonucleotides" also refers to all salts and solvates thereof.

[0164] Unless otherwise indicated, all peptides are shown herein in the N-terminal to C-terminal direction (left to right). Unless otherwise indicated, all oligonucleotides are shown herein in the 5' to 3' direction (left to right).

[0165] It is understood that any feature, integer, property, compound, chemical moiety or group described in connection with a particular aspect, embodiment or example of the invention is also applicable to other aspects, embodiments or examples described herein, except where inconsistent therewith. All features disclosed in this specification (including the accompanying claims, abstract and drawings), and / or all steps of any method or process so disclosed, may be combined in any combination, except combinations in which at least some of such features and / or steps are mutually exclusive. [Brief description of the drawings]

[0166] [Figure 1]Figure 1 shows the in vitro exon 23 skipping efficacy of selected peptides from the DPEP1 series conjugated to antisense therapeutic PMOs at 0.25 μM, 0.5 μM and 1 μM as measured by densitometric analysis of nested RT-PCR in H2K-mdx cells (error bars: standard deviation, n≧3). [Diagram 2] Figure 1 shows the in vitro exon 23 skipping efficacy of selected peptides from the DPEP3 series conjugated to antisense therapeutic PMOs at 0.25 μM, 0.5 μM and 1 μM as measured by densitometric analysis of nested RT-PCR in H2K-mdx cells (error bars: standard deviation, n≧3). [Diagram 3] In vivo efficacy of selected peptides from the DPEP1 series conjugated to antisense therapeutic PMOs is shown in (A) tibialis anterior muscle, (B) diaphragm, and (C) cardiac muscle after a single 10 mg / kg intravenous dose in mdx mice as measured by Western blot and qRT-PCR (error bars: standard deviation, n=3). [Figure 4] In vivo efficacy of selected peptides from the DPEP3 series conjugated to antisense therapeutic PMOs is shown in (A) tibialis anterior muscle, (B) diaphragm, and (C) cardiac muscle after a single 10 mg / kg intravenous dose in mdx mice as measured by Western blot and qRT-PCR (error bars: standard deviation, n=3). [Diagram 5] Relative KIM-1 levels measured in the urine of C67BL / 6 mice 2 and 7 days after administration of a single dose of 30 mg / kg of various DPEP peptides conjugated to antisense therapeutic PMOs compared to currently available peptide carriers conjugated to the same antisense therapeutic PMOs and saline (error bars: standard deviation, n=6). [Figure 6]Relative NGAL levels measured in the urine of C67BL / 6 mice 2 and 7 days after administration of a single dose of 30 mg / kg of various DPEP peptides conjugated to antisense therapeutic PMOs compared to currently available peptide carriers conjugated to the same antisense therapeutic PMOs and saline (error bars: standard deviation, n=6). [Figure 7] Serum BUN levels measured in C67BL / 6 mice 7 days after administration of a single dose of 30 mg / kg of various DPEP peptides conjugated to antisense therapeutic PMOs compared to currently available peptide carriers conjugated to the same antisense therapeutic PMOs and saline (error bars: standard deviation, n=6). [Figure 8] Serum creatinine levels measured in C67BL / 6 mice 7 days after administration of a single dose of 30 mg / kg of various DPEP peptides conjugated to antisense therapeutic PMOs compared to currently available peptide carriers conjugated to the same antisense therapeutic PMOs and saline (error bars: standard deviation, n=6). [Figure 9] (A) Alanine transferase, (B) alkaline phosphatase and (C) aspartate aminotransferase serum levels measured in C57BL / 6 mice 7 days after administration of a single 30 mg / kg dose of various DPEP peptides conjugated to antisense therapeutic PMOs compared to currently available peptide carriers conjugated to the same antisense therapeutic PMOs and saline (error bars: standard deviation, n=6). [Figure 10] Figure 2 shows the in vivo efficacy of exon 23 skipping as assessed by qRT-PCR in (A) tibialis anterior muscle, (B) diaphragm, and (C) heart of C57BL / 6 mice following a single 30 mg / kg intravenous administration of various DPEP peptides conjugated to antisense therapeutic PMOs compared to currently available peptide carriers conjugated to the same antisense therapeutic PMOs and saline. [Figure 11]Assessment of urinary KIM-1 levels on days 2 and 7 following single dose administration of different amounts of peptide-PMO between 2.5 and 50 mg / kg to 8-10 week old C57BL6 mice (n=4-6) in comparison to currently available peptide carriers conjugated to the same antisense therapeutic PMO. KIM-1 levels were determined by ELISA and normalized to urinary creatinine levels. Data are presented as fold change relative to control KIM-1 levels in saline injected mice (n=10). [Figure 12] A comparative dose-response study of the in vivo exon skipping efficacy of peptide-PMO following single dose administration of increasing amounts between 2.5 and 50 mg / kg to 8-10 week old C57BL6 mice (n=3-6) compared to currently available peptide carriers conjugated to the same antisense therapeutic PMO. qPCR analysis of exon 23 exclusion was assessed in (A) tibialis anterior muscle, (B) diaphragm, and (C) heart at 7 days post-administration. [Figure 13] Figure 1 shows different DPEP1 / 3-[CAG]7PMO complexes correcting splicing defects of Mbnl1 transcripts in vitro in DM1 patient myoblasts (n=1-3) derived from DM1 patients carrying 2600 repeats in the DMPK gene at various concentrations. [Figure 14] Different DPEP1 / 3-[CAG]7PMO complexes correct the splicing defect of DMD transcripts in vitro in DM1 patient myoblasts derived from a DM1 patient with 2600 repeats in the DMPK gene at various concentrations (error bars: mean ± SEM, n = 1–3). [Figure 15]Relative KIM-1 levels assessed in urine of female C57BL6 mice at days 2 and 7 post-injection for different DPEP1 / 3-[CAG]7PMO conjugates, measured by ELISA using samples diluted to fall within the standard curve. Values ​​were normalized to urinary creatinine levels to account for urinary protein concentration. KIM-1 levels were similar to saline control injections compared to the fold increase induced by previous Pip-based peptide carriers (error bars: mean ± SEM, n=4-10). [Figure 16] Relative NGAL levels measured in urine of female C57BL6 mice at days 2 and 7 post-injection for different DPEP1 / 3-[CAG]7PMO conjugates, measured by ELISA using samples diluted to fall within the standard curve. Values ​​were normalized to urinary creatinine levels to account for urinary protein concentration. NGAL levels were similar to saline control injections compared to the fold increase induced by previous Pip-based peptide carriers (error bars: mean ± SEM, n = 4-10). [Figure 17] Figure 1 shows BUN levels assessed in serum of female C57BL6 mice 7 days after injection for different DPEP1 / 3-[CAG]7PMO conjugates compared to saline. BUN levels were similar to saline control injections compared to the fold increase induced by the previous Pip-based peptide carrier (error bars: mean ± SEM, n = 4-10). [Figure 18] Creatinine levels assessed in serum of female C57BL6 mice 7 days after injection for different DPEP1 / 3-[CAG]7PMO conjugates compared to saline. Creatinine levels were similar to saline control injections compared to the fold increase induced by previous Pip-based peptide carriers (error bars: mean ± SEM, n = 4-10). [Figure 19]Figure 1 shows (A) Alanine aminotransferase (ALT), (B) alkaline phosphatase (ALP), and (C) aspartate aminotransferase (AST) levels assessed in serum from female C57BL6 mice treated with a bolus IV (tail vein) injection of different DPEP1 / 3-[CAG]7PMO conjugates compared to saline at collection day 7 post-injection. ALP, ALT, and AST levels were similar to saline control injections compared to the fold increase induced by the previous Pip-based peptide carrier. [Figure 20] Graph showing relative levels of normalized urinary kidney injury marker (KIM-1) to urinary creatinine measured in urine of C57BL / 6 mice on days 2 and 7 after administration of a single dose of 30 mg / kg DPEP3.1 peptide conjugated to therapeutic antisense PMODMD via different linkers, compared to 0.9% saline control and currently available peptide carriers (R6Gly- and Pip9b2-) conjugated to the same therapeutic antisense PMODMD (error bars: standard error of the mean, n=3-10). [Figure 21] 21A-C are graphs showing the in vivo efficacy of DPEP3.1 peptides conjugated to therapeutic antisense PMODMD via different linkers in (FIG. 21A) tibialis anterior muscle, (FIG. 21B) diaphragm, and (FIG. 21C) cardiac muscle, respectively, after a single intravenous bolus administration of 30 mg / kg in C57BL / 6 mice. Efficacy was measured 7 days after administration by qPCR for exon skipping of dystrophin (exon 23). Exon skipping effects were used compared to 0.9% saline control and currently available peptide carriers (R6Gly- and Pip9b2-) conjugated to the same therapeutic antisense PMODMD. Outliers for DPEP3.1d-PMODMD suggest erroneous injections (error bars: standard error of the mean, n=3-10). [Figure 22]Graph showing relative levels of normalized urinary kidney injury marker (KIM-1) to urinary creatinine measured in urine of C57BL / 6 mice on days 2 and 7 after administration of a single dose of 10 mg / kg, 30 mg / kg, or 50 mg / kg DPEP1.9 peptide conjugated to therapeutic antisense PMODMD via different linkers, compared to 0.9% saline control and currently available peptide carriers (R6Gly- and Pip9b2-) conjugated to the same therapeutic antisense PMODMD (error bars: standard error of the mean, n=3-10). [Figure 23] 23A-C are graphs showing the in vivo efficacy of DPEP1.9 peptide conjugated to therapeutic antisense PMODMD via different linkers in (FIG. 23A) tibialis anterior muscle, (FIG. 23B) diaphragm, and (FIG. 23C) cardiac muscle after a single intravenous bolus administration of 10 mg / kg, 30 mg / kg, or 50 mg / kg in C57BL / 6 mice. Efficacy was measured 7 days after administration by qPCR for exon skipping of dystrophin (exon 23). Exon skipping efficacy was compared to 0.9% saline control and currently available peptide carriers (R6Gly- and Pip9b2-) conjugated to the same therapeutic antisense PMODMD (error bars: standard error of the mean, n=3-10). [Figure 24] FIG. 1 is a graph showing that different DPEP1 / 3-[CAG]7 complexes using various concentrations of linkers a, b, and d corrected the splicing defect of Mbnl1-dependent transcription in DM1 patient myoblasts derived from a DM1 patient carrying 2600 CTG repeats in the DMPK gene. [Diagram 25] FIG. 1 is a graph showing that different DPEP1 / 3-[CAG]7 complexes using various concentrations of linkers a, b, and d corrected the splicing defect of Mbnl1-dependent transcription in DM1 patient myoblasts derived from a DM1 patient carrying 2600 CTG repeats in the DMPK gene. [Figure 26]FIG. 1 is a graph showing that different DPEP1 / 3-[CAG]7PMO complexes using linkers a, b, and d at various concentrations correct the splicing defect of in vitro DMD transcripts in DM1 patient myoblasts derived from a DM1 patient with 2600 repeats in the DMPK gene. [Figure 27] Graph showing myoblast viability of DM1 patient myoblasts with 2600 CTG repeats transfected with different doses of DPEP1 / 3-[CAG]7 complexes using linkers a, b, and d for 48 hours. The concentration of the complexes is increased several-fold from the therapeutic level without causing cell death. [Figure 28] 1 is a graph showing cell viability of hepatocytes transfected with 40 μM of different DPEP1 / 3-[CAG]7 conjugates using linkers a, b, and d. Concentrations of the conjugates are increased several-fold from therapeutic levels without causing cell death, in contrast to the Pip6a conjugate. [Figure 29] Urinary toxicity markers from days 2 and 7 after injection of different DPEP1 / 3-[CAG]7PMO conjugates into C57BL6 female mice measured by ELISA (R&D cat# MKM100) with samples diluted to fit the standard curve. Values ​​were normalized to urinary creatinine levels to account for protein concentration in the urine (Harwell). KIM-1 levels were similar to saline control injections compared to the several-fold increase elicited by the previous Pip series peptide carriers. [Diagram 30] Urinary toxicity markers from days 2 and 7 after injection of different DPEP1 / 3-[CAG]7PMO conjugates into C57BL6 female mice measured by ELISA (R&D cat# MKM100) with samples diluted to fit the standard curve. Values ​​were normalized to urinary creatinine levels to account for protein concentration in the urine (Harwell). VKIM-1 levels were similar to saline control injections compared to the several-fold increase elicited by the previous Pip series peptide carriers. [Diagram 31]Toxicity markers assessed in plasma from C57BL6 female mice (age: 8-10 weeks, n=5 per group) injected bolus IV (tail vein) with different DPEP1 / 3-[CAG]7PMO with different linkers. Plasma collections were compared to saline at 7 days post-injection. All levels were similar to saline control injection at 7 days post-injection. [Diagram 32] Toxicity markers assessed in plasma from C57BL6 female mice (age: 8-10 weeks, n=5 per group) injected bolus IV (tail vein) with different DPEP1 / 3-[CAG]7PMO with different linkers. Plasma collections were compared to saline at 7 days post-injection. All levels were similar to saline control injection at 7 days post-injection. [Diagram 33] 1 is a plot showing the biodistribution in major skeletal, cardiac, smooth muscle and central nervous system tissues in animals treated with the complex. Major muscle tissues include the hard to reach cardiac tissue. The plot also shows that the complex is delivered across the blood-brain barrier. [Diagram 34] FIG. 1 is a plot showing the efficacy of exon 51 skipping in skeletal and cardiac muscle tissues. TA is tibialis anterior and DIAPH is diaphragm. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0167] In general, the present invention provides a conjugate of an oligonucleotide and a peptide, covalently or via a linker, to the oligonucleotide, or a pharma- ceutically acceptable salt thereof. The oligonucleotide is complementary to a target sequence in or proximal to exon 45, exon 51, or exon 53 of the human dystrophin gene. The peptide comprises at least one positively charged domain and at least one hydrophobic domain. Without being bound by theory, the peptide may act as a cell-penetrating peptide to enhance the activity of the conjugated oligonucleotide, for example, by improving intracellular delivery of the conjugated oligonucleotide. Advantageously, as described in the examples below, the conjugates disclosed herein have reduced toxicity compared to certain alternative peptide structures.

[0168] In some embodiments, the antisense oligonucleotide sequence is for inducing exon skipping of a single exon of the dystrophin gene used for treating DMD.In some embodiments, the single exon is selected from any exon involved in DMD, and can be any exon of the dystrophin gene, such as exon 45, 51 or 53.The PMO oligonucleotide of any sequence can be purchased (e.g., from Gene Tools, USA).

[0169] In some embodiments, the oligonucleotide of the conjugate is an oligonucleotide complementary to the pre-mRNA of a gene target.

[0170] In some embodiments, the oligonucleotide complementary to the pre-mRNA of gene target causes a steric blocking event that changes the pre-mRNA and leads to a changed mRNA, and thus a protein with a changed sequence.In some embodiments, the gene target is dystrophin gene.In some embodiments, the steric blocking event can be exon inclusion or exon skipping.In some embodiments, the steric blocking event is exon skipping, for example, the exon skipping of a single exon of dystrophin gene.

[0171] If necessary, lysine residues can be added to one or both ends of the oligonucleotide (such as PMO or PNA) before conjugation to the peptide to improve water solubility.

[0172] In some embodiments, the molecular weight of the oligonucleotide is less than 5,000 Da, such as less than 3,000 Da or less than 1,000 Da.

[0173] In some embodiments, the peptide is covalently attached to the oligonucleotide at the C-terminus.

[0174] In some embodiments, the peptide is covalently attached to the oligonucleotide, optionally via a linker, which may function as a spacer separating the peptide sequence from the oligonucleotide.

[0175] The linker can be selected from any suitable sequence.

[0176] In some embodiments, a linker is present between the peptide and the oligonucleotide. In some embodiments, the linker is a separate group from the peptide and the oligonucleotide. Thus, the linker may include an artificial amino acid.

[0177] In some embodiments, the conjugate comprises a peptide covalently attached to an oligonucleotide via a linker. In some embodiments, the conjugate has the following structure: [Peptide]-[Linker]-[Oligonucleotide] Includes.

[0178] In some embodiments, the conjugate has the following structure: [Peptide]-[Linker]-[Oligonucleotide] It consists of:

[0179] In some embodiments, conjugates according to the invention may use any of the peptides described herein.

[0180] Preferably, the oligonucleotide is a morpholino (more preferably a morpholino in which all morpholino internucleoside linkages are -P(O)(NMe2)O-). Typically, the phosphorus atom of the morpholinio internucleoside linkage is bonded to a nitrogen atom of the morpholino subunit.

[0181] Oligonucleotides The oligonucleotides used in the complexes disclosed herein may be complementary to a target site in the dystrophin gene. Without being bound by theory, it is believed that oligonucleotides hybridizing to a specific target region in the human dystrophin gene may induce skipping of exon 45, exon 51, or exon 53 during dystrophin pre-mRNA splicing, thereby improving Duchenne muscular dystrophy. Non-limiting examples of nucleobase sequences that can be used in the oligonucleotides of the present invention can be found in U.S. Pat. No. 9,018,368; U.S. Pat. No. 9,079,934; U.S. Pat. No. 9,447,417; U.S. Pat. No. 10,385,092; U.S. Pat. No. 10,781,450, and the like. Alternatively, the sequence is GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 90), which targets exon 23 of the mouse dystrophin gene.

[0182] The oligonucleotide comprises a nucleobase sequence complementary to the human dystrophin gene, and can induce, for example, exon skipping at exon 45. Non-limiting examples of such sequences are shown in Table 1. For example, the oligonucleotide can comprise at least 12 (e.g., 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more) consecutive nucleobases from, for example, any of the sequences listed in Table 1. In certain preferred embodiments, the oligonucleotide comprises at least 12 (e.g., 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more) consecutive nucleobases from 5'-CAAUGCCAUCCUGGAGUUCCUG-3' (SEQ ID NO: 122) or its thymine-substituted analog, 5'-CAATGCCATCCTGGAGTTCCTG-3' (SEQ ID NO: 194). In certain preferred embodiments, the oligonucleotide comprises a nucleobase sequence selected from the group consisting of 5'-CAAUGCCAUCCUGGAGUUCCUG-3' (SEQ ID NO: 122) or a thymine substituted analog thereof, and 5'-CAATGCCATCCTGGAGTTCCTG-3' (SEQ ID NO: 194).

[0183] [Table 1]

[0184] In some embodiments, one or more uracils (e.g., all uracils) in the oligonucleotide sequences shown in Table 1 are substituted with thymine. For example, the oligonucleotide sequence can be, for example, 5'-CAAUGCCAUCCUGGAGUUCCUG-3' (SEQ ID NO: 122). Alternatively, the oligonucleotide sequence can be, for example, 5'-CAATGCCATCCTGGAGTTCCTG-3' (SEQ ID NO: 194).

[0185] The oligonucleotide comprises a nucleobase sequence that is complementary to the human dystrophin gene and can induce, for example, exon skipping at exon 51. Non-limiting examples of such sequences are shown in Table 2. For example, the oligonucleotide can comprise at least 12 (e.g., 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more) consecutive nucleobases from, for example, any of the sequences listed in Table 2. In certain preferred embodiments, the oligonucleotide comprises at least 12 (e.g., 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more) consecutive nucleobases from 5'-CUCCAACAUCAAGGAAGAUGGCAUUUCUAG-3' (SEQ ID NO: 130) or a thymine-substituted analog thereof, or 5'-CTCCAACATCAAGGAAGATGGCATTTCTAG-3' (SEQ ID NO: 195). In certain preferred embodiments, the oligonucleotide comprises a nucleobase sequence selected from the group consisting of 5'-CUCCAACAUCAAGGAAGAUGGCAUUUCUAG-3' (SEQ ID NO: 130) or a thymine substituted analog thereof, and 5'-CTCCAACATCAAGGAAGATGGCATTTCTAG-3' (SEQ ID NO: 195).

[0186] [Table 2]

[0187] In some embodiments, one or more uracils (e.g., all uracils) in the oligonucleotide sequences shown in Table 2 are substituted with thymine. For example, the oligonucleotide sequence can be, for example, 5'-CUCCAACAUCAAGGAAGAUGGCAUUUCUAG-3' (SEQ ID NO: 130). Alternatively, the oligonucleotide sequence can be, for example, 5'-CTCCAACATCAAGGAAGATGGCATTTCTAG-3' (SEQ ID NO: 195).

[0188] The oligonucleotide comprises a nucleobase sequence that is complementary to the human dystrophin gene and can induce, for example, exon skipping at exon 53. Non-limiting examples of such sequences are shown in Table 3. For example, the oligonucleotide can comprise at least 12 (e.g., 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more) consecutive nucleobases from, for example, any of the sequences listed in Table 3. In certain preferred embodiments, the oligonucleotide comprises at least 12 (e.g., 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more) consecutive nucleobases from 5'-CCTCCGGTTCTGAAGGTGTTCT-3' (SEQ ID NO: 162) or 5'-GTTGCCTCCGGTTCTGAAGGTGTTC-3' (SEQ ID NO: 171). In certain preferred embodiments, the oligonucleotide comprises a nucleobase sequence selected from the group consisting of 5'-CCTCCGGTTCTGAAGGTGTTCT-3' (SEQ ID NO: 162) and 5'-GTTGCCTCCGGTTCTGAAGGTGTTC-3' (SEQ ID NO: 171).

[0189] [Table 3]

[0190] In some embodiments, one or more thymines (e.g., all thymines) in the oligonucleotide sequences shown in Table 3 are substituted with uracil. In some embodiments, one or more uracils (e.g., all uracils) in the oligonucleotide sequences shown in Table 3 are substituted with thymine.

[0191] peptide Peptides that can be used in the conjugates described herein include those disclosed in WO 2020 / 030927 and WO 2020 / 115494. Preferably, the peptides included in the conjugates described herein do not contain artificial amino acid residues.

[0192] In some embodiments, the peptide does not include an aminohexanoic acid residue. In some embodiments, the peptide does not include any form of aminohexanoic acid residue. In some embodiments, the peptide does not include a 6-aminohexanoic acid residue.

[0193] In some embodiments, the peptides include only naturally occurring amino acid residues, and thus consist of naturally occurring amino acid residues.

[0194] In some embodiments, the artificial amino acids typically used in cell-penetrating peptides, such as 6-aminohexanoic acid, are replaced with natural amino acids. In some embodiments, the artificial amino acids typically used in cell-penetrating peptides, such as 6-aminohexanoic acid, are replaced with amino acids selected from beta-alanine, serine, proline, arginine, and histidine or hydroxyproline.

[0195] In some embodiments, aminohexanoic acid is replaced with beta-alanine. In some embodiments, 6-aminohexanoic acid is replaced with beta-alanine.

[0196] In some embodiments, aminohexanoic acid is replaced with histidine. In some embodiments, 6-aminohexanoic acid is replaced with histidine.

[0197] In some embodiments, aminohexanoic acid is replaced with hydroxyproline. In some embodiments, 6-aminohexanoic acid is replaced with hydroxyproline.

[0198] In some embodiments, artificial amino acids typically used in cell penetrating peptides, such as 6-aminohexanoic acid, can be replaced with any combination of beta-alanine, serine, proline, arginine, and histidine or hydroxyproline, such as any combination of beta-alanine, histidine, and hydroxyproline.

[0199] In some embodiments, there is provided a peptide having an overall length of 40 amino acid residues or less, comprising two or more cationic domains each comprising at least four amino acid residues, and one or more hydrophobic domains each comprising at least three amino acid residues, wherein at least one cationic domain comprises histidine residues. In some embodiments, at least one cationic domain is histidine-rich.

[0200] In some embodiments, what is meant by histidine-rich is defined herein with respect to the cationic domain.

[0201] Cationic Domain The present invention relates to short cell penetrating peptides with a specific structure in which there are at least two cationic domains with a specific length.

[0202] In some embodiments, the peptide comprises up to four cationic domains, up to three cationic domains.

[0203] In some embodiments, the peptide comprises two cationic domains.

[0204] As defined above, a peptide comprises two or more cationic domains, each having a length of at least four amino acid residues.

[0205] In some embodiments, each cationic domain has a length between 4 and 12 amino acid residues, suitably between 4 and 7 amino acid residues.

[0206] In some embodiments, each cationic domain has a length of 4, 5, 6, or 7 amino acid residues.

[0207] In some embodiments, each cationic domain is of similar length, e.g., each cationic domain is the same length.

[0208] In some embodiments, each cationic domain comprises cationic amino acids and may also comprise polar and / or non-polar amino acids.

[0209] The non-polar amino acids may be selected from alanine, beta-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, phenylalanine. Suitably, the non-polar amino acids are uncharged.

[0210] The polar amino acids may be selected from serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, glutamine, hi some embodiments, the selected polar amino acids do not carry a negative charge.

[0211] The cationic amino acid may be selected from arginine, histidine, lysine, hi some embodiments, the cationic amino acid has a positive charge at physiological pH.

[0212] In some embodiments, each cationic domain does not include any anionic or negatively charged amino acid residues.

[0213] In some embodiments, each cationic domain comprises an arginine residue, a histidine residue, a beta-alanine residue, a hydroxyproline residue, and / or a serine residue.

[0214] In some embodiments, each cationic domain is comprised of arginine, histidine, beta-alanine, hydroxyproline and / or serine residues.

[0215] In some embodiments, each cationic domain comprises at least 40%, at least 45%, at least 50% cationic amino acids.

[0216] In some embodiments, each cationic domain comprises a majority of cationic amino acids, hi some embodiments, each cationic domain comprises at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% cationic amino acids.

[0217] In some embodiments, each cationic domain comprises an isoelectric point (pi) of at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, at least 12.0.

[0218] In some embodiments, each cationic domain comprises an isoelectric point (pi) of at least 10.0.

[0219] In some embodiments, each cationic domain comprises an isoelectric point (pi) between 10.0 and 13.0.

[0220] In some embodiments, each cationic domain comprises an isoelectric point (pi) between 10.4 and 12.5.

[0221] In some embodiments, the isoelectric point of the cationic domain is calculated at physiological pH by any suitable means available in the art, in some embodiments using a web-based algorithm developed by Lukasz Kozlowski, Biol Direct. 2016;11:55.DOI:10.1186 / s13062-016-0159-9 at IPC (www.isoelectric.org).

[0222] In some embodiments, each cationic domain comprises at least one cationic amino acid, e.g., between 1 and 5 cationic amino acids, hi some embodiments, each cationic domain comprises at least two cationic amino acids, e.g., between 2 and 5 cationic amino acids.

[0223] In some embodiments, each cationic domain is arginine-rich and / or histidine-rich. In some embodiments, a cationic domain may contain both histidine and arginine.

[0224] In some embodiments, each cationic domain comprises a majority of arginine and / or histidine residues.

[0225] In some embodiments, each cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% arginine and / or histidine residues.

[0226] In some embodiments, the cationic domain may comprise at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% arginine residues.

[0227] In some embodiments, the cationic domain may comprise at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% histidine residues.

[0228] In some embodiments, the cationic domain may comprise a total of between 1 and 5 histidine residues and between 1 and 5 arginine residues. In some embodiments, the cationic domain may comprise between 1 and 5 arginine residues. In some embodiments, the cationic domain may comprise between 1 and 5 histidine residues. In some embodiments, the cationic domain may comprise between 1 and 5 histidine residues. In some embodiments, the cationic domain may comprise a total of between 2 and 5 histidine residues and between 3 and 5 arginine residues. In some embodiments, the cationic domain may comprise between 3 and 5 arginine residues. In some embodiments, the cationic domain may comprise between 2 and 5 histidine residues.

[0229] In some embodiments, each cationic domain comprises one or more beta-alanine residues, hi some embodiments, each cationic domain may comprise between 2 and 5 beta-alanine residues in total, suitably 2 or 3 beta-alanine residues in total.

[0230] In some embodiments, the cationic domain may include one or more hydroxyproline or serine residues.

[0231] In some embodiments, the cationic domain may comprise between 1 and 2 hydroxyproline residues.In some embodiments, the cationic domain may comprise between 1 and 2 serine residues.

[0232] In some embodiments, all of the cationic amino acids in a given cationic domain can be histidines, or, for example, all of the cationic amino acids in a given cationic domain can be arginines.

[0233] In some embodiments, the peptide may include at least one histidine-rich cationic domain. In some embodiments, the peptide may include at least one arginine-rich cationic domain.

[0234] In some embodiments, the peptide may comprise at least one arginine-rich cationic domain and at least one histidine-rich cationic domain.

[0235] In some embodiments, the peptide comprises two arginine-rich cationic domains.

[0236] In some embodiments, the peptide comprises two histidine-rich cationic domains.

[0237] In some embodiments, the peptide comprises two arginine- and histidine-rich cationic domains.

[0238] In some embodiments, the peptide comprises one arginine-rich cationic domain and one histidine-rich cationic domain, in some embodiments, each cationic domain comprises no more than three consecutive arginine residues, e.g., no more than two consecutive arginine residues.

[0239] In some embodiments, each cationic domain does not comprise consecutive histidine residues.

[0240] In some embodiments, each cationic domain comprises arginine, histidine, and / or beta-alanine residues. In some embodiments, each cationic domain comprises a majority of arginine, histidine, and / or beta-alanine residues. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% of the amino acid residues in each cationic domain are arginine, histidine, and / or beta-alanine residues. In some embodiments, each cationic domain consists of arginine, histidine, and / or beta-alanine residues.

[0241] In some embodiments, the peptide comprises a first cationic domain comprising an arginine residue and a beta-alanine residue and a second cationic domain comprising an arginine residue and a beta-alanine residue.

[0242] In some embodiments, the peptide comprises a first cationic domain comprising an arginine residue and a beta-alanine residue, and a second cationic domain comprising a histidine residue, a beta-alanine residue, and optionally an arginine residue.

[0243] In some embodiments, the peptide comprises a first cationic domain comprising an arginine residue and a beta-alanine residue and a second cationic domain comprising a histidine residue and a beta-alanine residue.

[0244] In some embodiments, the peptide comprises a first cationic domain consisting of arginine and beta-alanine residues and a second cationic domain consisting of arginine and beta-alanine residues.

[0245] In some embodiments, the peptide comprises a first cationic domain consisting of arginine and beta-alanine residues and a second cationic domain consisting of arginine, histidine and beta-alanine residues.

[0246] In some embodiments, the peptide comprises at least two cationic domains, for example, these cationic domains form the arms of the peptide. In some embodiments, the cationic domains are located at the N-terminus and C-terminus of the peptide. In some embodiments, the cationic domains may therefore be known as cationic arm domains.

[0247] In some embodiments, the peptide comprises two cationic domains, one located at the N-terminus of the peptide and the other at the C-terminus of the peptide. In some embodiments, it is located at either end of the peptide. In some embodiments, no additional amino acids or domains are present at the N-terminus and C-terminus of the peptide, except other groups such as terminal modifications, linkers and / or oligonucleotides. For the avoidance of doubt, such other groups may be present in addition to the "peptide" described and claimed herein. In some embodiments, each cationic domain thus forms a terminus of the peptide. In some embodiments, this does not exclude the presence of additional linker groups as described herein.

[0248] In some embodiments, the peptide may comprise up to four cationic domains, hi some embodiments, the peptide comprises two cationic domains.

[0249] In some embodiments, the peptide comprises two cationic domains that are both arginine-rich.

[0250] In some embodiments, the peptide comprises one cationic domain that is arginine-rich.

[0251] In some embodiments, the peptide comprises two cationic domains that are both arginine-rich and histidine-rich.

[0252] In some embodiments, the peptide comprises one cationic domain that is arginine-rich and one cationic domain that is histidine-rich.

[0253] In some embodiments the cationic domain comprises amino acid units selected from the following: R, H, B, RR, HH, BB, RH, HR, RB, BR, HB, BH, RBR, RBB, BRR, BBR, BRB, RBH, RHB, HRB, BRH, HRR, RRH, HRH, HBB, BBH, RHR, BHB, HBH, or any combination thereof.

[0254] In some embodiments, the cationic domain may also comprise serine, proline and / or hydroxyproline residues. In some embodiments, the cationic domain may further comprise an amino acid unit selected from the following: RP, PR, RPR, RRP, PRR, PRP, Hyp;R[Hyp]R, RR[Hyp], [Hyp]RR, [Hyp]R[Hyp], [Hyp][Hyp]R, R[Hyp][Hyp], SB, BS, or any combination thereof, or any combination with the amino acid units listed above.

[0255] In some embodiments, each cationic domain comprises any one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), R[Hyp]RR[Hyp]R (SEQ ID NO:19), or any combination thereof.

[0256] In some embodiments, each cationic domain consists of any one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B, R[Hyp]H[Hyp]HB, R[Hyp]RR[Hyp]R (SEQ ID NO:19), or any combination thereof.

[0257] In some embodiments, each cationic domain consists of one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9).

[0258] In some embodiments, the cationic domains of each of the peptides may be the same or different, hi some embodiments, the cationic domains of each of the peptides are different.

[0259] Hydrophobic domain The present invention relates to short cell-penetrating peptides having a specific structure in which there is at least one hydrophobic domain having a specific length.

[0260] References herein to "hydrophobic" refer to an amino acid or domain of amino acids that has the ability to repel or immiscible with water.

[0261] In some embodiments, the peptide comprises up to 3 hydrophobic domains, up to 2 hydrophobic domains, In some embodiments, the peptide comprises 1 hydrophobic domain.

[0262] As defined above, a peptide comprises one or more hydrophobic domains, each having a length of at least three amino acid residues.

[0263] In some embodiments, each hydrophobic domain has a length of between 3 and 6 amino acids, hi some embodiments, each hydrophobic domain has a length of 5 amino acids.

[0264] In some embodiments, each hydrophobic domain can include non-polar amino acid residues, polar amino acid residues, and hydrophobic amino acid residues.

[0265] The hydrophobic amino acid residues may be selected from alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine, and tryptophan.

[0266] The non-polar amino acid residue may be selected from proline, glycine, cysteine, alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, methionine.

[0267] The polar amino acid residue may be selected from serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, glutamine.

[0268] In some embodiments, the hydrophobic domain does not include hydrophilic amino acid residues.

[0269] In some embodiments, each hydrophobic domain comprises a majority of hydrophobic amino acid residues. In some embodiments, each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acids. In some embodiments, each hydrophobic domain consists of hydrophobic amino acid residues.

[0270] In some embodiments, each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.8, at least 1.0, at least 1.1, at least 1.2, at least 1.3.

[0271] In some embodiments, each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.35, at least 0.4, at least 0.45.

[0272] In some embodiments, each hydrophobic domain comprises a hydrophobicity of at least 1.2, at least 1.25, at least 1.3, at least 1.35.

[0273] In some embodiments, each hydrophobic domain comprises a hydrophobicity between 0.4 and 1.4.

[0274] In some embodiments, each hydrophobic domain comprises a hydrophobicity between 0.45 and 0.48.

[0275] In some embodiments, each hydrophobic domain comprises a hydrophobicity between 1.27 and 1.39.

[0276] In some embodiments, hydrophobicity is as measured by White and Wimley: WC Wimley and SH White, "Experimentally determined hydrophobicity scale for proteins at membrane interfaces" Nature Struct Biol 3:842 (1996).

[0277] In some embodiments, each hydrophobic domain comprises at least 3 hydrophobic amino acid residues, at least 4 hydrophobic amino acid residues.

[0278] In some embodiments, each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and glutamine residues, hi some embodiments, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and / or glutamine residues.

[0279] In some embodiments, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine and / or glutamine residues.

[0280] In some embodiments, each hydrophobic domain consists of tryptophan and / or proline residues.

[0281] In some embodiments, the peptide comprises one hydrophobic domain. In some embodiments, the or each hydrophobic domain is located in the middle of the peptide. In some embodiments, the hydrophobic domain may therefore be known as the core hydrophobic domain. In some embodiments, the or each hydrophobic core domain is flanked on both sides by arm domains. In some embodiments, the arm domain may comprise one or more cationic domains and one or more additional hydrophobic domains.

[0282] In some embodiments, the peptide comprises two arm domains flanking a hydrophobic core domain, each arm domain comprising a cationic domain.

[0283] In some embodiments, the peptide consists of two cationic arm domains flanking a hydrophobic core domain.

[0284] In some embodiments, the or each hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26), or any combination thereof.

[0285] In some embodiments, the or each hydrophobic domain consists of one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26), or any combination thereof.

[0286] In some embodiments the or each hydrophobic domain consists of one of the following sequences: FQILY (SEQ ID NO: 21), YQFLI (SEQ ID NO: 20), ILFQY (SEQ ID NO: 22).

[0287] In some embodiments the or each hydrophobic domain consists of FQILY (SEQ ID NO:21).

[0288] In some embodiments, each hydrophobic domain within a peptide can have the same sequence or a different sequence.

[0289] The present invention relates to short cell-penetrating peptides for use in the delivery of therapeutic cargo molecules in the treatment of disease conditions.

[0290] A peptide has a sequence that is a continuous single molecule, and therefore the domains of the peptide are continuous. In some embodiments, the peptide comprises several domains that are linearly arranged between the N-terminus and the C-terminus. In some embodiments, the domains are selected from the cationic domain and the hydrophobic domain described above. In some embodiments, the peptide consists of the cationic domain and the hydrophobic domain, and the domains are as defined above.

[0291] Each domain has common sequence characteristics as described in the relevant section above, but the exact sequence of each domain is subject to variation and modification. Thus, a variety of sequences are possible for each domain. Combinations of each possible domain sequence result in a variety of peptide structures, each of which forms part of the present invention. The characteristics of the peptide structures are described below.

[0292] In some embodiments, a hydrophobic domain separates any two cationic domains, hi some embodiments, each hydrophobic domain is flanked on either side by a cationic domain.

[0293] In some embodiments, a cationic domain is not contiguous with another cationic domain.

[0294] In some embodiments, the peptide comprises one hydrophobic domain flanked by two cationic domains in the following arrangement: [cationic domain]-[hydrophobic domain]-[cationic domain].

[0295] In some embodiments, the hydrophobic domain may be known as a core domain and each cationic domain may be known as an arm domain, hi some embodiments, the hydrophobic arm domains flank the cationic core domain.

[0296] In some embodiments, the peptide consists of two cationic domains and one hydrophobic domain.

[0297] In some embodiments, the peptide consists of one hydrophobic core domain flanked by two cationic arm domains.

[0298] In some embodiments, the peptide is RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), HBHBR (SEQ ID NO:17), HBHBR (SEQ ID NO:18), HBHBR (SEQ ID NO:19), HBHBR (SEQ ID NO:20), HBHBR (SEQ ID NO:21), HBHBR (SEQ ID NO:22), HBHBR (SEQ ID NO:23), HBHBR (SEQ ID NO:24), HBHBR (SEQ ID NO:25), HBHBR (SEQ ID NO:26), HBHBR (SEQ ID NO:27), HBHBR (SEQ ID NO:28), HBHBR (SEQ ID NO:29), HBHBR (SEQ ID NO:30), HBHBR (SEQ ID NO:31), HBHBR (SEQ ID NO:32), HBHBR (SEQ ID NO:33), HBHBR (SEQ ID NO:34), HBHBR (SEQ ID NO:35), HBHBR (SEQ ID NO:36), HBHBR (SEQ ID NO:37), HBHBR (SEQ ID NO:38), HBHBR (SEQ ID NO:39), HBHBR (SEQ ID NO:40 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), and R[Hyp]RR[Hyp]R (SEQ ID NO: 19), respectively.

[0299] In some embodiments, the peptide consists of one hydrophobic core domain comprising a sequence selected from FQILY (SEQ ID NO:21), YQFLI (SEQ ID NO:20), and ILFQY (SEQ ID NO:22), flanked by two cationic arm domains comprising a sequence selected from RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9). In some embodiments, the peptide consists of one hydrophobic core domain comprising the sequence: FQILY (SEQ ID NO:21), flanked by two cationic arm domains comprising a sequence selected from RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8).

[0300] In any such embodiment, further groups may be present, such as linkers, terminal modifications and / or oligonucleotides.

[0301] In some embodiments, the peptide is N-terminally modified.

[0302] In some embodiments, the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated, hi some embodiments, the peptide is N-acetylated.

[0303] Optionally, the N-terminus of the peptide may be unmodified.

[0304] In some embodiments, the peptide is N-acetylated.

[0305] In some embodiments, the peptide is modified at the C-terminus.

[0306] In some embodiments, the peptide comprises a C-terminal modification selected from a carboxy group, a thioacid group, an aminooxy group, a hydrazino group, a thioester group, an azide group, a strained alkyne, a strained alkene, an aldehyde group, a thiol group, or a haloacetyl group.

[0307] Advantageously, the C-terminal modification provides a means for attaching the peptide to an oligonucleotide.

[0308] Thus, the C-terminal modification can include a linker, or vice versa. In some embodiments, the C-terminal modification can consist of a linker, or vice versa. Suitable linkers are described elsewhere herein.

[0309] In some embodiments, the peptide comprises a C-terminal carboxyl group.

[0310] In some embodiments, the C-terminal carboxyl group is provided by a glycine or beta-alanine residue.

[0311] In some embodiments, the C-terminal carboxyl group is provided by a beta-alanine residue. In some embodiments, the C-terminal beta-alanine residue is a linker.

[0312] In some embodiments, each cationic domain may therefore further comprise an N-terminal or C-terminal modification. In some embodiments, the C-terminal cationic domain comprises a C-terminal modification. In some embodiments, the N-terminal cationic domain comprises an N-terminal modification. In some embodiments, the C-terminal cationic domain comprises a linker group, and in some embodiments, the C-terminal cationic domain comprises a C-terminal beta-alanine. In some embodiments, the N-terminal cationic domain is N-acetylated.

[0313] The peptides of the present invention are defined as having an overall length of 40 amino acid residues or less. A peptide can therefore be considered an oligopeptide.

[0314] In some embodiments, the peptide has an overall length between 3 and 30 amino acid residues, e.g., between 5 and 25 amino acid residues, between 10 and 25 amino acid residues, between 13 and 23 amino acid residues, between 15 and 20 amino acid residues.

[0315] In some embodiments, the peptides have an overall length of at least 12 amino acid residues, at least 13 amino acid residues, at least 14 amino acid residues, at least 15 amino acid residues, at least 16 amino acid residues, at least 17 amino acid residues.

[0316] In some embodiments, the peptide is capable of penetrating cells, and thus may be considered a cell-penetrating peptide.

[0317] In some embodiments, the peptide is for attachment to an oligonucleotide. In some embodiments, the peptide is for transporting an oligonucleotide to a target cell. In some embodiments, the peptide is for delivering an oligonucleotide to a target cell. The peptide can thus be considered a carrier peptide.

[0318] In some embodiments, the peptides are capable of penetrating cells and tissues, suitably into the nucleus of cells, for example into muscle tissue.

[0319] In some embodiments, the peptide can be selected from any of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO: 27) RBRRBRRFQILYRBRR (SEQ ID NO:28) RBRRBRFQILYRRBRBR (SEQ ID NO: 29) RBRBRFQILYRBRRBRR (SEQ ID NO: 30) RBRRBRRYQFLIRBRBR (SEQ ID NO: 31) RBRRBRRILFQYRBRBR (SEQ ID NO: 32) RBRRBRFQILYRBRBR (SEQ ID NO: 33) RBRRBFQILYRBRRBR (SEQ ID NO: 34) RBRRBRFQILYBRBR (SEQ ID NO: 35) RBRRBFQILYRBRBR (SEQ ID NO: 36) RBRRBRRFQILYRBHBH (SEQ ID NO: 37) RBRRBRRFQILYHBHBR (SEQ ID NO: 38) RBRRBRRFQILYHBRBH (SEQ ID NO: 39) RBRRBRRYQFLIRBHBH (SEQ ID NO: 40) RBRRBRRILFQYRBHBH (SEQ ID NO: 41) RBRHBHRFQILYRBRBR (SEQ ID NO: 42) RBRBBHRFQILYRBHBH (SEQ ID NO: 43) RBRRBRFQILYRBHBH (SEQ ID NO: 44) RBRRBRFQILYHBHBH (SEQ ID NO: 45) RBRRBHFQILYRBHBH (SEQ ID NO: 46) HBRRBRFQILYRBHBH (SEQ ID NO: 47) RBRRBFQILYRBHBH (SEQ ID NO: 48) RBRRBRFQILYBHBH (SEQ ID NO: 49) RBRRBRYQFLIHBHBH (SEQ ID NO:50) RBRRBRILFQYHBHBH (SEQ ID NO:51) RBRRBRRFQILYHBHBH (SEQ ID NO:52)

[0320] In some embodiments, the peptide may be selected from any of the following additional sequences: RBRRBRFQILYBRBS (SEQ ID NO:53) RBRRBRFQILYBRB [Hyp] (SEQ ID NO: 54) RBRRBRFQILYBR[Hyp]R (SEQ ID NO: 55) RRBRRBRFQILYBRBR (SEQ ID NO:56) BRRBRRFQILYBRBR (SEQ ID NO:57) RBRRBRWWWBRBR (SEQ ID NO:58) RBRRBRWWPWWBRBR (SEQ ID NO:59) RBRRBRWPWWBRBR (SEQ ID NO: 60) RBRRBRWWPWBRBR (SEQ ID NO:61) RBRRBRRWWWRBRBR (SEQ ID NO:62) RBRRBRRWWPWWRBRBR (SEQ ID NO: 63) RBRRBRRWPWWRBRBR (SEQ ID NO: 64) RBRRBRRWWPWRBRBR (SEQ ID NO: 65) RBRRBRRFQILYBRBR (SEQ ID NO: 66) RBRRBRRFQILYRBR (SEQ ID NO:67) BRBRBWWPWWRBRRBR (SEQ ID NO: 68) RBRRBRRFQILYBHBH (SEQ ID NO: 69) RBRRBRRFQIYRBHBH (SEQ ID NO: 70) RBRRBRFQILYBRBH (SEQ ID NO:71) RBRRBRFQILYR[Hyp]H[Hyp]H (SEQ ID NO: 72) R[Hyp]RR[Hyp]RFQILYRBHBH (SEQ ID NO: 73) R[Hyp]RR[Hyp]RFQILYR[Hyp]H[Hyp]H (SEQ ID NO: 74) RBRRBRWWWRBHBH (SEQ ID NO: 75) RBRRBRWWPRBHBH (SEQ ID NO:76) RBRRBRPWWRBHBH (SEQ ID NO:77) RBRRBRWWPWWRBHBH (SEQ ID NO: 78) RBRRBRWWPWRBHBH (SEQ ID NO:79) RBRRBRWPWWRBHBH (SEQ ID NO: 80) RBRRBRRWWWRBHBH (SEQ ID NO: 81) RBRRBRRWWPWWRBHBH (SEQ ID NO: 82) RBRRBRRWPWWRBHBH (SEQ ID NO: 83) RBRRBRRWWPWRBHBH (SEQ ID NO: 84) RRBRRBRFQILYRBHBH (SEQ ID NO: 85) BRRBRRFQILYRBHBH (SEQ ID NO: 86) RRBRRBRFQILYBHBH (SEQ ID NO: 87) BRRBRRFQILYBHBH (SEQ ID NO: 88) RBRRBHRFQILYRBHBH (SEQ ID NO: 89) RBRRBRFQILY[Hyp]R[Hyp]R (SEQ ID NO: 101) R[Hyp]RR[Hyp]RFQILYBRBR (SEQ ID NO: 102) R[Hyp]RR[Hyp]RFQILY[Hyp]R[Hyp]R (SEQ ID NO: 103) RBRRBRWWWBRBR (SEQ ID NO: 104) RBRRBRWWPWWBRBR (SEQ ID NO: 105)

[0321] In some embodiments, the peptide can be selected from one of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO: 27) RBRRBRRYQFLIRBRBR (SEQ ID NO: 31) RBRRBRRILFQYRBRBR (SEQ ID NO: 32) RBRRBRFQILYBRBR (SEQ ID NO: 35) RBRRBRRFQILYRBHBH (SEQ ID NO: 37) RBRRBRRFQILYHBHBR (SEQ ID NO: 38) RBRRBRFQILYRBHBH (SEQ ID NO: 44)

[0322] In some embodiments, the peptide consists of the following sequence: RBRRBRFQILYBRBR (SEQ ID NO:35).

[0323] In some embodiments, the peptide consists of the sequence: RBRRBRRFQILYRBHBH (SEQ ID NO:37).

[0324] In some embodiments, the peptide consists of the following sequence: RBRRBRFQILYRBHBH (SEQ ID NO:44).

[0325] Complex In some embodiments, the complex comprises a peptide selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44). In some embodiments, the complex comprises a peptide selected from any of SEQ ID NOs: 27-52, 53-89, 101-105, and SEQ ID NOs: 27, 31, 32, 35, 37, 38, and 44. In some embodiments, the complex comprises any of the oligonucleotide sequences set forth in Table 1, Table 2, or Table 3.

[0326] In some embodiments, in either case, the peptide may further comprise an N-terminal modification as described above.

[0327] Suitable linkers include, for example, a C-terminal cysteine ​​residue capable of forming a disulfide, thioether, or thiol-maleimide bond, a C-terminal aldehyde for forming an oxime, click reaction, or morpholino bond formation with a basic amino acid on the peptide, or a carboxylic acid moiety on the peptide that covalently conjugates to an amino group to form a carboxamide bond.

[0328] In some embodiments, the linker is between 1 and 5 amino acids in length. In some embodiments, the linker can include any linker known in the art.

[0329] In some embodiments, the linker is selected from any of the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, and XB, in some embodiments, where X is 6-aminohexanoic acid.

[0330] In some embodiments, the linker can be a polymer, such as PEG.

[0331] In some embodiments, the linker is beta-alanine.

[0332] In some embodiments, the peptide is conjugated to the oligonucleotide via a carboxamide bond.

[0333] The linker of the conjugate may form part of the oligonucleotide to which the peptide is attached. Alternatively, the linker of the oligonucleotide may be directly attached to the C-terminus of the peptide. In some embodiments, such as in embodiments, a linker is not required.

[0334] Alternatively, the peptide can be chemically conjugated to the oligonucleotide. Chemical conjugation can be, for example, via a disulfide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, semicarbazide, carbazide, hydrazine, oxime, phosphate, phosphoramidate, thiophosphate, boranophosphate, iminophosphate, or thiol-maleimide bond.

[0335] If desired, a cysteine ​​can be added to the N-terminus of the oligonucleotide to allow for disulfide bond formation to the peptide, or the N-terminus can be bromoacetylated to allow for thioether conjugation to the peptide.

[0336] The peptides of the invention can likewise be covalently attached to imaging molecules to provide conjugates.

[0337] In some embodiments, the imaging molecule can be any molecule that allows visualization of the complex. In some embodiments, the imaging molecule can indicate the location of the complex. In some embodiments, the location of the complex in vitro or in vivo. In some embodiments, a method is provided for monitoring the location of a complex comprising an imaging molecule, comprising administering the complex to a subject and imaging the subject to confirm the location of the complex.

[0338] Examples of imaging molecules include detection molecules, contrast molecules, or enhancement molecules.Suitable imaging molecules can be selected from radionuclides; fluorophores; nanoparticles (e.g., nanoshells); nanocages; colorants (e.g., enzymes), radioisotopes, dyes, radio-opacifying agents, fluorescent compounds, and combinations thereof.

[0339] In some embodiments, imaging molecules can be visualized using imaging techniques, which may be cellular imaging techniques or medical imaging techniques.Suitable cellular imaging techniques include, for example, image cytometry, fluorescence microscopy, phase contrast microscopy, SEM, TEM.Suitable medical imaging techniques include, for example, X-ray, fluoroscopy, MRI, scintigraphy, SPECT, PET, CT, CAT, FNRI.

[0340] In some cases, the imaging molecule may be considered a diagnostic molecule. In some embodiments, the diagnostic molecule allows for the diagnosis of disease using the complex. In some embodiments, diagnosis of disease can be achieved by determining the location of the complex using the imaging molecule. In some embodiments, a method of diagnosing disease is provided that includes administering to a subject an effective amount of a complex that includes an imaging molecule and monitoring the location of the complex.

[0341] In some embodiments, further details such as attachment of the conjugate comprising the imaging molecule are the same as those described above for the conjugate comprising the oligonucleotide.

[0342] In some embodiments, the peptides of the present invention may be covalently attached to an oligonucleotide and an imaging molecule to provide a conjugate.

[0343] In some embodiments, the complex is capable of penetrating cells and tissues, for example, into the nucleus of a cell, for example, into muscle tissue.

[0344] Linker The conjugates described herein may include a linker that covalently links the peptides described herein to the oligonucleotides described herein. Linkers useful in the present invention are described in WO2020 / 115494, the disclosure of which is incorporated herein by reference.

[0345] The linker has a structure according to formula (I): T1-(CR 1 R 2 ) n -T2(I) {where: T1 is a divalent group attached to the peptide and is selected from the group consisting of -NH- and carbonyl; T2 is a divalent group attached to the oligonucleotide and is selected from the group consisting of -NH- and carbonyl; n is 1, 2 or 3; Each R 1 are independently of the formula: -Y 1 -X 1 -Z 1 [where: Y 1 is either absent or of the formula: -[CR A1 R A2 ] m - where m is selected from 1, 2, 3, or 4; R A1 and R A2 are each independently selected from hydrogen, OH, or (1-2C)alkyl; X 1 is absent or is -O-, -C(O)-, -C(O)O-, -OC(O)-, -CH(OR A3 )-, -N(R A3 )-, -N(R A3 )-C(O)-, -N(R A3 )-C(O)O-, -C(O)-N(R A3 )-, -N(R A3 )C(O)N(R A3 )-, -N(R A3 )C(NR A3 )N(R A3 )-, -SO-, -S-, -SO2-, -S(O)2N(R A3 )- or -N(R A3 )SO2- (wherein each R A3 is independently selected from hydrogen or methyl; Z 1 is a further oligonucleotide or is selected from hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, where each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, and heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR A4 R A5 and (1-4C)alkoxy (wherein R A4 and R A5 are each independently substituted with one or more (e.g., 1, 2, 3, 4 or 5) substituents selected from the group consisting of hydrogen and (1-4C)alkyl). is a group represented by the formula: Each R 2 are independently of the formula: -Y 2 -X2 -Z 2 [where: Y 2 is either absent or of the formula: -[CR B1 R B2 ] m - (wherein m is an integer selected from 1, 2, 3, or 4; R B1 and R B2 are each independently selected from hydrogen, OH, or (1-2C)alkyl; X 2 is absent or is -O-, -C(O)-, -C(O)O-, -OC(O)-, -CH(OR B3 )-, -N(R B3 )-, -N(R B3 )-C(O)-, -N(R B3 )-C(O)O-, -C(O)-N(R B3 )-, -N(R B3 )C(O)N(R B3 )-, -N(R B3 )C(NR B3 )N(R B3 )-, -SO-, -S-, -SO2-, -S(O)2N(R B3 )- or -N(R B3 )SO2- (wherein each R B3 is independently selected from hydrogen or methyl; Z 2 is selected from hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, where each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR B4 R B5 and (1-4C)alkoxy (wherein R B4 and R B5are each independently substituted with one or more (e.g., 1, 2, 3, 4 or 5) substituents selected from the group consisting of hydrogen or (1-2C)alkyl). is a group represented by the formula: however, When n=1 and T1 and T2 are different from each other, R 1 and R 2 cannot both be H; n=1, T1 and T2 are different from each other, and R 1 and R 2 If one of is H, then R 1 and R 2 The other is not methyl; n=2, each R 1 and R 2 is H, then T1 and T2 are both -C(O)- or both -NH-.

[0346] In some embodiments, the linker has the following structure: [ka] , [ka] , [ka] , [ka] , or [ka] has.

[0347] Pharmaceutical Compositions The complex of the present invention, or a pharma- ceutically acceptable salt thereof, can be formulated into a pharmaceutical composition.

[0348] In some embodiments, the pharmaceutical composition comprises a complex of the invention, or a pharma- ceutically acceptable salt thereof.

[0349] In some embodiments, the pharmaceutical composition may further comprise a pharma- ceutically acceptable diluent, adjuvant, or carrier.

[0350] Suitable pharma- ceutically acceptable diluents, adjuvants and carriers are well known in the art.

[0351] It is to be understood that the pharmaceutical compositions of the present disclosure may further comprise additional known therapeutic agents, drugs, modifications of compounds into prodrugs, and the like, for medical use to alleviate, ameliorate, prevent, and treat the diseases, disorders, and conditions described herein.

[0352] In some embodiments, the pharmaceutical composition is for use as a medicament, e.g., for use as a medicament in the same manner as described herein for the conjugate. All features described herein for medical treatments using the conjugate apply to the pharmaceutical composition.

[0353] Thus, in a further aspect of the present invention there is provided a pharmaceutical composition according to the fourth aspect for use as a medicament. In a further aspect there is provided a method of treating a subject for a disease condition comprising administering to the subject an effective amount of a pharmaceutical composition as disclosed herein.

[0354] Medical Use A complex containing the peptide of the present invention can be used as a medicament for treating a disease.

[0355] The medicament may be in the form of a pharmaceutical composition as defined above.

[0356] Also provided are methods of treating a patient or subject in need of treatment for a disease condition, comprising administering to the patient or subject a therapeutically effective amount of the conjugate, hi some embodiments, the medical treatment requires delivery of an oligonucleotide to a cell, e.g., to the nucleus of a cell.

[0357] The disease to be treated may include any disease in which improved penetration of the cellular and / or nuclear membrane by oligonucleotides may result in improved therapeutic outcomes.

[0358] In some embodiments, the conjugate is for use in the treatment of a disease of the neuromuscular system.

[0359] A conjugate comprising the peptide of the present invention is suitable for the treatment of Duchenne muscular dystrophy (DMD) or Butcher muscular dystrophy (BMD).

[0360] In some embodiments, the complex is for use in the treatment of a disease caused by a splicing defect. In such embodiments, the oligonucleotide can include an oligonucleotide capable of preventing or correcting the splicing defect and / or increasing the production of correctly spliced ​​mRNA molecules.

[0361] In some embodiments, the conjugate is for use in the treatment of DMD.

[0362] In some embodiments, the complex according to the second aspect is provided for use in treating DMD.In some embodiments, in such embodiments, the oligonucleotide of the complex is operable to increase the expression of dystrophin protein.In some embodiments, in such embodiments, the oligonucleotide of the complex is operable to increase the expression of functional dystrophin protein.

[0363] In some embodiments, the complex increases dystrophin expression by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%. In some embodiments, the complex increases dystrophin expression by up to 50%. In some embodiments, the complex restores dystrophin protein expression by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%. In some embodiments, the complex restores dystrophin protein expression by up to 50%.

[0364] In some embodiments, the complex restores 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% of the function of the dystrophin protein, hi some embodiments, the complex restores up to 50% of the function of the dystrophin protein.

[0365] In some embodiments, the oligonucleotides of the complex are operable to do so by causing the skipping of one or more exons during dystrophin transcription.

[0366] In some embodiments, the conjugate oligonucleotides cause skipping of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% of one or more exons of the dystrophin gene. In some embodiments, the conjugate oligonucleotides cause skipping of up to 50% of one or more exons of the dystrophin gene.

[0367] In some embodiments, the patient or subject to be treated can be any animal or human. In some embodiments, the patient or subject can be a non-human mammal. In some embodiments, the patient or subject can be male or female. In some embodiments, the subject is male.

[0368] In some embodiments, the patient or subject to be treated can be of any age. In some embodiments, the patient or subject to be treated is between 0 and 40 years old, such as between 0 and 30 years old, such as between 0 and 25 years old, such as between 0 and 20 years old.

[0369] In some embodiments, the conjugate is administered systemically to the subject, for example, by intramedullary, intrathecal, intracerebroventricular, intravitreal, enteral, parenteral, intravenous, intraarterial, intramuscular, intratumor, subcutaneous, intrabuccal, or intranasal routes.

[0370] In some embodiments, the conjugate is for intravenous administration to a subject.

[0371] In some embodiments, the conjugate is for intravenous administration by injection to a subject.

[0372] In some embodiments, the conjugates are for administration to a subject in a "therapeutically effective amount", by which is meant that the amount is sufficient to show benefit to the individual. The actual amount administered, as well as the rate and time-course of administration, will depend on the nature and severity of the disease to be treated. Decisions regarding dosage are within the responsibility of general practitioners and other physicians. Examples of techniques and protocols can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, pub. Lippincott, Williams & Wilkins. Exemplary doses can be between 0.01 mg / kg and 50 mg / kg, between 0.05 mg / kg and 40 mg / kg, between 0.1 mg / kg and 30 mg / kg, between 0.5 mg / kg and 18 mg / kg, between 1 mg / kg and 16 mg / kg, between 2 mg / kg and 15 mg / kg, between 5 mg / kg and 10 mg / kg, between 10 mg / kg and 20 mg / kg, between 12 mg / kg and 18 mg / kg, between 13 mg / kg and 17 mg / kg.

[0373] Advantageously, the dose of the complex of the invention can be, for example, an order of magnitude or order of magnitude lower than the dose required to see any effect from the oligonucleotide alone.

[0374] In some embodiments, after administration of the conjugates of the invention, one or more markers of toxicity are significantly reduced as compared to previous conjugates using currently available peptide carriers.

[0375] A suitable marker of toxicity may be a marker of nephrotoxicity.

[0376] Suitable markers of toxicity include KIM-1, NGAL, BUN, creatinine, alkaline phosphatase, alanine transferase, and aspartate aminotransferase.

[0377] In some embodiments, the levels of at least one of KIM-1, NGAL, and BUN are decreased after administration of the conjugates of the invention as compared to previous conjugates using currently available peptide carriers.

[0378] In some embodiments, the levels of each of KIM-1, NGAL, and BUN are decreased after administration of the conjugates of the invention when compared to previous conjugates using currently available peptide carriers.

[0379] In some embodiments, the levels of the or each marker are significantly reduced when compared to previous conjugates using currently available peptide carriers.

[0380] In some embodiments, the levels of the or each marker are reduced by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% after administration of the conjugates of the invention when compared to previous conjugates using currently available peptide carriers.

[0381] Advantageously, the toxicity of the peptides and resulting conjugates is significantly reduced compared to previous cell penetrating peptides and conjugates, in particular KIM-1 and NGAL-1, which are markers of toxicity, are significantly reduced by up to 120-fold compared to previous conjugates using currently available peptide carriers.

[0382] Peptide preparation The peptides of the invention can be produced by any standard protein synthesis method, for example, chemical synthesis, semi-chemical synthesis, or through the use of an expression system.

[0383] The present invention therefore also relates to nucleotide sequences comprising or consisting of DNA encoding the peptide, expression systems, for example vectors comprising said sequences together with sequences necessary for the expression and control of expression, and host cells and host organisms transformed with said expression systems.

[0384] Thus, nucleic acids encoding the peptides according to the invention are also provided.

[0385] In some embodiments, the nucleic acid can be provided in isolated or purified form.

[0386] Also provided is an expression vector comprising a nucleic acid encoding a peptide according to the invention.

[0387] In some embodiments, the vector is a plasmid.

[0388] In some embodiments, the vector comprises a control sequence, e.g., a promoter, operably linked to a nucleic acid encoding a peptide according to the invention, hi some embodiments, the expression vector is capable of expressing the peptide when transfected into a suitable cell, e.g., a mammalian, bacterial or fungal cell.

[0389] Also provided is a host cell comprising an expression vector of the invention.

[0390] The expression vector can be selected according to the host cell into which the nucleic acid of the present invention can be inserted. Such transformation of the host cell includes conventional techniques, such as those taught in Sambrook et al. [Sambrook, J., Russell, D. (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, USA]. The selection of a suitable vector is within the skill of a person skilled in the art. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses.

[0391] The produced peptide can be isolated and purified from the host cells by any suitable method, such as precipitation or chromatographic separation, for example affinity chromatography.

[0392] Suitable vectors, hosts and recombinant techniques are well known in the art.

[0393] The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples.

[0394] [Example] Example 1 1. Materials and Methods 1.1 P-PMO synthesis and preparation Wang resin (0.19 or 0.46 mmol g ) preloaded with 9-fluorenylmethoxycarbonyl (Fmoc)-protected L-amino acids, benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Fmoc^-Ala-OH. -1) were obtained from Merck (Hohenbrunn, Germany). HPLC grade acetonitrile, methanol and synthesis grade N-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthesis grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, England). PMO was purchased from Gene Tools Inc. (Philomath, USA). Chicken embryo extract and horse serum were obtained from Sera Laboratories International Ltd (West Sussex, UK). Interferon was obtained from Roche Applied Science (Penzberg, Germany). All other reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated. MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry workstation. 10 mg mL in 50% acetonitrile in water. -1 Stock solutions of α-cyano-4-hydroxycinnamic acid or sinapic acid were used as templates. Error bars are ±0.1%.

[0395] 1.2 Synthesis of P-PMO peptides for screening in H2k mdx cells a) Preparation of a library of peptide variants Peptides were purified using Wang resin preloaded with Fmoc-Ala-OH (0.19 or 0.46 mmol g -1Peptides were prepared on a 10 pmol scale using an Intavis Parallel Peptide Synthesizer or a 100 pmol scale using a CEM Liberty Blue™ Peptide Synthesizer (Buckingham, UK) by applying standard Fmoc chemistry and following the manufacturer's recommended procedures. When synthesizing using the Intavis Parallel Peptide Synthesizer, a double coupling step with a PyBOP / NMM coupling mixture was used, followed by capping with acetic anhydride after each step. When using the CEM Liberty Blue Peptide Synthesizer, single chain couplings were performed for all amino acids except for arginine, which was performed by double coupling. Couplings were performed once at 75° C. for 5 minutes at 60 watts of microwave power, except for the arginine residue, which was coupled twice each. Each deprotection reaction was performed twice at 75° C., once for 30 seconds and then for 3 minutes at 35 watts of microwave power. Upon completion of the synthesis, the resin was washed with DMF (3 × 50 mL) and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminal acetylation, the peptide resin was washed with DMF (3 × 20 mL) and DCM (3 × 20 mL). The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA):HO:triisopropylsilane (TIPS) (95%:2.5%:2.5%:3–10 mL) for 3 h at room temperature. After peptide release, excess TFA was removed by sparging with nitrogen. The crude peptide was precipitated by addition of cold diethyl ether (15–40 mL depending on the synthesis scale) and centrifugation at 3200 rpm for 5 min. The crude peptide pellet was washed three times with cold diethyl ether (3 × 15 mL) and purified by RP-HPLC using a Varian 940-LC HPLC System equipped with a 445-LC Scale-up module and a 440-LC fraction collector. A linear gradient of CH3CN in 0.1% TFA / HO was used for 15 mL min-1 The peptide was purified by semi-preparative HPLC using a RP-C18 column (10×250 mm, Phenomenex Jupiter) at a flow rate of 1000 s. Detection was performed at 220 nm and 260 nm. Fractions containing the desired peptide were combined and lyophilized to give the peptide as a white solid. Table 4: Peptides synthesized for testing in the examples with N-terminal acetylation and C-terminal beta-alanine linker. Pip9b2 and R6Gly are comparative peptides. R6Gly uses a C-terminal glycine as the linker.

[0396] [Table 4]

[0397] b) Synthesis of a library of PMO-peptide conjugates A 25-mer PMO antisense sequence of mouse dystrophin exon 23 (GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 90)) was used. The peptide was conjugated to the 3' end of the PMO by its C-terminal carboxyl group. This was achieved using 2.3 and 2 equivalents of PyBOP and HOAt in NMP, respectively, in the presence of 2.3 equivalents of DIPEA relative to peptide, and a 2.5-fold excess of peptide relative to PMO dissolved in DMSO. In a few cases, 2.3 equivalents of HBTU were used instead of PyBOP for activation of the peptide's C-terminal carboxyl group. In general, to a solution of peptide (2500 nmol) in N-methylpyrrolidone (NMP, 80 mL), PyBOP (19.2 mL of 0.3 M in NMP), HOAt in (16.7 mL of 0.3 M NMP), DIPEA (1.0 pL), and PMO (100 mL of 10 mM in DMSO) were added. The mixture was left at 40 °C for 2.5 h and the reaction was quenched by the addition of 0.1% TFA in HO (300 mL). The solution was purified by ion exchange chromatography using a modified Gilson HPLC system. A linear gradient of sodium chloride (0–1 M) in sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CHCN was used at 4 mL min -1 The PMO-peptide complexes were purified using an ion exchange column (Resource S 4mL, GE Healthcare) at a flow rate of 1000 s. Fractions containing the desired peptide were combined and lyophilized to obtain the peptide-PMO derivative as a white solid. Excess salt was removed from the peptide-PMO complexes by filtering the fractions collected after ion exchange using an Amicon® ultra-15 3K centrifugal filter device. The complexes were lyophilized and analyzed by MALDI-TOF. Before use, the complexes were dissolved in sterile water and filtered through a 0.22 pm cellulose acetate membrane. The concentration of peptide-PMO was determined by the molar absorbance at 265 nm of the complex in 0.1 N HCl solution. (See Table 5 for yields). Table 5: Yields of P-PMO complexes for cell culture analysis (Yields are based on the dry weight of lyophilized purified ppmo. The purity of P-PMO is higher than 95% as confirmed by normal phase HPLC at 220 nm and 260 nm. (a) P-PMO was synthesized using HBTU activation instead of PyBOP.

[0398] [Table 5]

[0399] 1.3 Cell culture Mouse H2k mdx myoblasts were cultured in gelatin (0.01%)-coated flasks in Dulbecco's Modified Eagle Medium (DMEM PPA Laboratories) supplemented with 20% heat-inactivated fetal bovine serum (FBS Gold, PAA Laboratories), 2% chicken embryo extract (Seralab), 1% penicillin-streptomycin-neomycin antibiotic mixture (PSN, Gibco), and 3 pg / pL g-interferon (Roche) at 33°C under 10% CO2. Cells were plated at 2 × 10 5 Cells were seeded at a density of 10 ...

[0400] 1.4 Cell transfection Cells were incubated with peptide-PMO complexes prepared as above made in serum-free Opti-MEM, 350 mL was added to each well in duplicate and incubated for 4 hours at 37° C. The transfection medium was then replaced with DMEM supplemented with 5% horse serum and 1% PSN, and cells were incubated for an additional 20 hours at 37° C. Cells were washed with PBS and 0.5 mL of TRI RNA (Sigma) isolation reagent was added to each well. Cells were frozen at −80° C. for 1 hour.

[0401] 1.5 RNA extraction and nested RT-PCR analysis Total cellular RNA was extracted using TRI reagent with an additional precipitation with ethanol. Purified RNA was quantified using Nanodrop® ND-1000 (Thermo Scientific). RNA (400 ng) was used as template for RT-PCR using OneStep RT-PCR Kit (Roche, Indianapolis, USA). For primer sequences, see Table 7. The cycling conditions for the first reverse transcription were 1 cycle of 50°C for 30 min and 94°C for 7 min, followed by 30 cycles of 94°C for 20 s, 55°C for 40 s, and 68°C for 80 s. One microliter of RT-PCR product was used as template for the second PCR step. Amplification was performed with 0.5 U of SuperTAQ for 25 cycles at 94°C for 30 s, 55°C for 1 min, and 72°C for 1 min. Products were separated by electrophoresis using a 1.5% agarose gel. Agarose gel images were taken using the Molecular Imager ChemiDoc™ XRS + Images were captured with an imaging system (BioRad, UK) and analyzed using Image Lab (V4.1). Exon skipping assay data were analyzed and plotted using Microsoft Excel and expressed as the percentage of exon 23 skipping from at least three independent experiments.

[0402] 1.6 Synthesis of PMO-peptide conjugates for testing in H2k mdx mice a) Synthesis of peptide variants Peptides were synthesized on a 100 pmol scale using a CEM Liberty Blue™ microwave Peptide Synthesizer (Buckingham, UK) and Fmoc chemistry according to the manufacturer's recommended procedures. The side chain protecting groups used were labile to trifluoroacetic acid treatment and peptides were synthesized using a 5-fold excess of Fmoc-protected amino acids (0.25 mmol) activated using PyBOP (5-fold excess) in the presence of DIPEA. N-Fmoc protecting groups were removed using piperidine (20% v / v in DMF). Couplings were performed once at 75° C. for 5 min at 60 watts of microwave power, except for the arginine residues which were each coupled twice. Each deprotection reaction was performed twice at 75° C., once for 30 s and then once for 3 min at 35 watts of microwave power. Upon completion of the synthesis, the resin was washed with DMF (3×50 mL) and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminal acetylation, the peptide resin was washed with DMF (3×20 mL) and DCM (3×20 mL). The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA):H2O:triisopropylsilane (TIPS) (95%:2.5%:2.5%, 10 mL) for 3 h at room temperature. Excess TFA was removed by sparging with nitrogen. The cleaved peptide was precipitated by the addition of ice-cold diethyl ether and centrifuged at 3000 rpm for 5 min. The crude peptide pellet was washed three times with cold diethyl ether (3×40 mL) and purified by RP-HPLC using a Varian 940-LC HPLC System equipped with a 445-LC Scale-up module and a 440-LC fraction collector. Use a linear gradient of CH3CN in 0.1% TFA / HO for 15 mL min -1 Peptides were purified by semi-preparative HPLC using a RP-C18 column (10 × 250 mm, Phenomenex Jupiter) at a flow rate of 100 s. Detection was performed at 220 nm and 260 nm.

[0403] b) Synthesis of PMO-peptide conjugates A 25-mer PMO antisense sequence of mouse dystrophin exon 23 (GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 90)) was used. The peptide was conjugated to the 3' end of the PMO by its C-terminal carboxyl group. This was achieved using 2.3 and 2 equivalents of PyBOP and HOAt in NMP, respectively, in the presence of 2.3 equivalents of DIPEA relative to peptide, and a 2.5-fold excess of peptide relative to PMO dissolved in DMSO. In a few cases, HBTU (2.3 equivalents) was used instead of PyBOP for activation of the C-terminal carboxyl group of the peptide. In general, to a solution of peptide (10 pmol) in N-methylpyrrolidone (NMP, 100 mL) was added PyBOP (76.6 mL of 0.3 M in NMP), HOAt (66.7 mL of 0.3 M NMP), DIPEA (4.0 mL), and PMO (400 mL of 10 mM in DMSO). The mixture was left for 2 h at 40 °C and the reaction was stopped by the addition of 0.1% TFA (1 mL). The reaction was run using a linear gradient of sodium chloride (0–1 M) in sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN at 6 mL min. -1 The reaction was purified using a cation exchange chromatography column (Resource S 6 mL column, GE Healthcare) at a flow rate of 100 ng / ml. Excess salt was removed from the peptide-PMO complex by filtering the fraction collected after ion exchange using an Amicon® ultra-15 3K centrifugal filter device. The complex was lyophilized and analyzed by MALDI-TOF. Prior to use, the complex was dissolved in sterile water and filtered through a 0.22 pm cellulose acetate membrane. The concentration of peptide-PMO was determined by the molar absorbance at 265 nm of the complex in 0.1 N HCl solution. The overall yield (Table 6) was 25-36% based on PMO. Table 6: Yields of P-PMO complexes synthesized on a larger scale for in vivo analysis. (Yields are based on the dry weight of lyophilized purified PPMO. The purity of PPMO is greater than 95% as confirmed by normal phase HPLC at 220 nm and 260 nm.) (a) PPMO was synthesized using HBTU activation instead of PyBOP.

[0404] [Table 6]

[0405] 1.7 In vivo assessment of dystrophin restoration by P-PMO Experiments were performed in accordance with institutional review board at the Biomedical Sciences Unit, University of Oxford under Home Office Project Licence authorisation. Mice were housed in a minimal disease facility and the environment was temperature controlled with a 12-h day / night cycle. Animals received commercial rodent chow and water ad libitum.

[0406] Experiments were performed in female 10-12 week old mdx mice. After restraining mdx mice, a single tail vein injection of 10 mg / kg P-PMO was administered. One week after injection, mice were sacrificed and the TA, heart and diaphragm muscles were removed, flash frozen in dry ice-cooled isopentane and stored at -80 °C.

[0407] 1.8 Western blot analysis To assess the duration of dystrophin repair after a single dose, one-third of the muscle (for TA and diaphragm) or 7 pm thick transverse cryosections (for heart) were dissolved in 300 ml of buffer (50 mM Tris pH 8, 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 10% SDS and protease / phosphatase inhibitors) and then centrifuged for 10 min at 13000 rpm (Heraeus, #3325B). Supernatants were collected and heated at 100°C for 3 min. Protein was quantified by the BCA method and 40 pg protein / sample was separated on NuPage 3-8% Tris acetate gels as previously described (19). Proteins were transferred to a 0.45 pm pore size PVDF membrane for 1 h at 30 V, then 1 h at 100 V and probed with monoclonal anti-dystrophin (1:200, NCL-DYS1, Novocastra) and anti-vinculin (loading control, 1:100000, hVIN-1, Sigma) antibodies as previously described (37). The secondary antibody IRDye 800CW goat anti-mouse was used at a dilution of 1:20000 (LiCOR).

[0408] Dystrophin restoration levels in P-PMO-treated mdx mice were expressed as relative levels to those in C57BL / 10 wild-type control mice, which were considered as 100%. For this, a standard curve was generated by including five series of C57BL / 10 protein dilutions in parallel with the P-PMO-treated mdx samples. The dilution series was as follows: 75%, 40%, 15%, 5% or 0% of the 40 pg total protein loaded per lane was from C57BL / 10 protein lysate, and the remainder was from untreated mdx protein lysate. These standards were aliquoted and used in each Western blot in parallel with the treated mdx samples. Quantification of dystrophin intensity was performed for all standards and treated samples using a Fluorescence Odyssey imaging system and normalized by calculating the ratio to vinculin fluorescence intensity in all samples. The standard normalized values ​​were plotted against their known dystrophin concentrations to obtain a best fit equation, which was used to interpolate the normalized values ​​for each sample of P-PMO-treated mdx mice.

[0409] 1.9 RT-qPCR analysis of Dmd exon 23 skipping in vivo Skeletal muscle and heart tissues treated with peptide-PMO were used to quantify the exclusion of exon 23 from mouse Dmd transcripts. Briefly, RNA was extracted from homogenized tissues using a Trizol-based extraction method, and cDNA was synthesized using random primers. Primers / probes were synthesized by Integrated DNA Technologies and designed to amplify a region spanning exons 23-24, representing the non-skipped product (mDMD23-24, see Table 7) or to specifically amplify transcripts lacking exon 23 using a probe spanning the boundary between exons 22 and 24 (mDMD22-24). Each transcript level was calibrated against a standard curve generated using known transcript abundance, and skipping percentages were derived by [skipped] / [skipped+non-skipped]. Table 7: Primer and probe sequences for quantification of exon 23 skipping by nested or quantitative RT-PCR.

[0410] [Table 7]

[0411] 1.10 Toxicological evaluation of peptide-PMOs Eight to ten week old female C57BL / 6 mice were administered a single dose of 30 mg / kg of peptide-PMO in 0.9% saline by bolus intravenous injection into the tail vein. On days 2 and 7 after administration, urine was collected non-invasively under chilled conditions after 20 h of housing in metabolic cages (Tecniplast, UK). Serum was collected from the jugular vein at necropsy on day 7, and tibialis anterior, diaphragm and heart tissues were also collected.

[0412] The same procedure was followed with different single dosages of peptide-PMO ranging from 2.5 mg / kg to 50 mg / kg in 0.9% saline by intravenous injection into the tail vein.

[0413] Urinary levels of KIM-1 (kidney injury molecule-1) and NGAL (neutrophil gelatinase-associated lipocalin) were quantified by ELISA after appropriate dilution of urine to fit a standard curve (KIM-1 R&D Catalogue No. MKM100, NGAL R&D Catalogue No. MLCN20). Values ​​were normalized to urinary creatinine levels quantified at the MRC Harwell Institute, Mary Lyon Centre, Oxfordshire, UK. Serum blood urea nitrogen levels were quantified at the MRC Harwell Institute, Mary Lyon Centre, Oxfordshire, UK.

[0414] All levels were quantified using an AU680 Clinical Chemistry Analyser, Beckman Coulter.

[0415] Quantitation of the efficiency of exon skipping was determined by quantitative RT-PCR of exon 23-skipped and non-skipped transcripts and expressed as the percentage of skipped transcripts relative to total (skipped and non-skipped) transcripts (see Table 7 for sequences).

[0416] 2.Results The results provided herein demonstrate a clear dose-response effect of the peptide-PMO complexes generated herein on exon skipping activity in cells (Figures 1, 2 and 12). These figures also highlight that all of the DPEP1 and DPEP3 series, i.e., the peptides of the present invention, have sufficient cell-penetrating efficacy into cells to be considered for therapeutic use.

[0417] The results provided herein further highlight the activity of the peptide-PMO complex in vivo in a suitable mouse model of the disease (Figures 3-4). Overall, these results suggest that the activity of such complexes is greatest in the tibialis anterior muscle, followed by the diaphragm, and then the heart. These figures demonstrate that the DPEP peptide complexes of the present invention have good exon skipping activity in vivo and lead to increased dystrophin protein expression in vivo. Furthermore, the DPEP complexes of the present invention compare favorably with previous cell-penetrating peptides such as the "PIP" peptide and R6Gly when the same complexes were used in both respects.

[0418] It is also demonstrated herein that the levels of KIM-1 and NGAL (which are indicators of renal toxicity) following administration of the DPEP peptide conjugate compounds are significantly lower than conjugates with the previous cell-permeable peptides. The DPEP1.9 and 3.8 conjugates showed the lowest levels of such markers (Figures 5, 6 and 11). Serum blood urea nitrogen levels (another marker of renal dysfunction) were also elevated only for the conjugates with Pip9b2, but not for the conjugates with the DPEP peptides of the present invention (Figure 7). The second major finding is that after 7 days of administration, KIM-1 and NGAL levels drop to near saline levels for all DPEP peptide conjugates, suggesting that there is also some reversal and amelioration of kidney-related toxicity. Such an effect was not seen with conjugates using the previous cell-permeable peptides. This reversal effect of toxicity is seen with the DEDP peptides of the present invention even when given at a high dose of 50 mg / kg (Figure 11). The previous cell-permeable peptides showed no reduction in toxicity after 7 days, with toxicity markers remaining much higher throughout.

[0419] Exon skipping activity remains high in TA and diaphragm at higher doses of 30 and 50 mg / kg for all DPEP peptide conjugates (Figures 10 and 12), which is supported by the lower levels of kidney damage markers, suggesting a broader therapeutic index for these compounds, as toxicity markers are many times lower.It is also noteworthy that all DPEP peptide conjugates have higher activity than known R6Gly comparators in the conjugates, while at least maintaining similar toxicity marker levels, and have similar activity to known PIP peptide comparators in the conjugates, while still having much lower toxicity marker levels.In some cases, the DPEP peptide conjugates of the present invention show not only increased activity, but also reduced toxicity markers compared to known R6Gly conjugates.

[0420] Thus, the DPEP1 and 3 peptides of the present invention provide promising cell-permeable peptides for improving efficacy and reducing toxicity of therapeutic conjugates for the treatment of neuromuscular disorders in humans.

[0421] 3. Further Examples P-PMO synthesis and preparation Wang resin (0.19 or 0.46 mmol g ) preloaded with 9-fluorenylmethoxycarbonyl (Fmoc)-protected L-amino acids, benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Fmoc^-Ala-OH. -1 ) were obtained from Merck (Hohenbrunn, Germany). 1-Hydroxy-7-azabenzotriazole (HOAt) was obtained from Sigma-Aldrich. HPLC grade acetonitrile, methanol and synthesis grade N-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthesis grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, England). PMO was purchased from Gene Tools Inc. (Philomath, USA). All other reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated. MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry workstation. 10 mg mL in 50% acetonitrile in water -1 Stock solutions of α-cyano-4-hydroxycinnamic acid or sinapic acid were used as templates. Error bars are ±0.1%.

[0422] Synthesis of P-PMO peptides for screening in cells a) Preparation of a library of peptide variants Peptides were prepared using Wang resin preloaded with Fmoc-Ala-OH (0.19 or 0.46 mmol g -1Peptides were prepared on a 10 pmol scale using an Intavis Parallel Peptide Synthesizer or a 100 pmol scale using a CEM Liberty Blue™ Peptide Synthesizer (Buckingham, UK) by applying standard Fmoc chemistry and following the manufacturer's recommended procedures. When synthesizing using the Intavis Parallel Peptide Synthesizer, a double coupling step with a PyBOP / NMM coupling mixture was used, followed by capping with acetic anhydride after each step. When using the CEM Liberty Blue Peptide Synthesizer, single chain couplings were performed for all amino acids except for arginine, which was performed by double coupling. Couplings were performed once at 75° C. for 5 minutes at 60 watts of microwave power, except for the arginine residue, which was coupled twice each. Each deprotection reaction was performed twice at 75° C., once for 30 seconds and then for 3 minutes at 35 watts of microwave power. Upon completion of the synthesis, the resin was washed with DMF (3 × 50 mL) and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminal acetylation, the peptide resin was washed with DMF (3 × 20 mL) and DCM (3 × 20 mL). The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA):HO:triisopropylsilane (TIPS) (95%:2.5%:2.5%:3–10 mL) for 3 h at room temperature. After peptide release, excess TFA was removed by sparging with nitrogen. The crude peptide was precipitated by addition of cold diethyl ether (15–40 mL depending on the synthesis scale) and centrifugation at 3200 rpm for 5 min. The crude peptide pellet was washed three times with cold diethyl ether (3 × 15 mL) and purified by RP-HPLC using a Varian 940-LC HPLC System equipped with a 445-LC Scale-up module and a 440-LC fraction collector. A linear gradient of CH3CN in 0.1% TFA / HO was used for 15 mL min-1 The peptide was purified by semi-preparative HPLC using a RP-C18 column (10×250 mm, Phenomenex Jupiter) at a flow rate of 1000 s. Detection was performed at 220 nm and 260 nm. The fractions containing the desired peptide were combined and lyophilized to give the peptide as a white solid (see Table 8 for yields). Table 8: Peptides synthesized for testing in the Examples, with N-terminal acetylation (Ac) and C-terminal β-alanine linker (B). * is a glycosylated serine residue. DPEP5.7, Pip9b2, and Pip6a are comparison peptides.

[0423] [Table 8]

[0424] 21-mer PMO antisense sequence for triplet repeat sequence A 21-mer PMO antisense sequence of the triplet repeat sequence (CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 192)), otherwise known as [CAG]7, was used. The peptide was conjugated to the 3' end of the PMO by its C-terminal carboxyl group. This was achieved using 2.5 and 2 equivalents of PyBOP and HOAt, respectively, in NMP in the presence of 2.5 equivalents of DIPEA, and a 2.5-fold excess of peptide relative to PMO dissolved in DMSO. In general, to a solution of peptide (2500 nmol) in N-methylpyrrolidone (NMP, 80 pL) was added PyBOP (19.2 mL of 0.3 M in NMP), HOAt (16.7 mL of 0.3 M NMP), DIPEA (1.0 mL), and PMO (180 pL of 10 mM in DMSO). The mixture was left at 40 °C for 2.5 h and the reaction was stopped by the addition of 0.1% TFA in HO (300 pL). The solution was purified by ion exchange chromatography using a modified Gilson HPLC system. The PMO-peptide complex was purified using an ion exchange column (Resource S 4 mL, GE Healthcare) using a linear gradient of sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN. The complex was removed from the column using a sodium chloride solution (1 M) at 4 mL min -1 or 6 mL min -1 The peptide-PMO complexes were eluted at a flow rate of either 0.1 mL / min or 100 mL / min. Fractions containing the desired compound were combined and immediately desalted. Excess salt was removed from the peptide-PMO complexes by filtering the fractions collected after ion exchange using an Amicon® ultra-15 3K centrifugal filter device. The complexes were lyophilized and analyzed by MALDI-TOF. Prior to use, the complexes were dissolved in sterile water and filtered through a 0.22 pm cellulose acetate membrane. The concentration of the peptide-PMO was determined by the molar absorbance at 265 nm of the complex in 0.1 N HCl solution. (See Table 9 for yields). Table 9: Yields of P-PMO complexes for cell culture analysis and in vivo experiments (yields are based on the dry weight of lyophilized purified P-PMO). The purity of P-PMO is greater than 95% as confirmed by normal phase HPLC at 220 nm and 260 nm.

[0425] [Table 9]

[0426] Peptide-PMO conjugate synthesis Peptides were synthesized and conjugated to PMOs as described above. The PMO sequence targeting the CUG / CTG expansion repeat (5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 192)) was purchased from Gene Tools LLC and is referred to elsewhere herein as [CAG]7PMO.

[0427] Cell culture and peptide-PMO treatment Immortalized myoblasts from healthy individuals or DM1 patients with 2600 CTG repeats were cultured in growth medium consisting of a mixture of M199:DMEM (1:4 ratio, Life technologies) supplemented with 20% FBS (Life technologies), 50 pg / ml gentamicin (Life technologies), 25 pg / ml fetuin, 0.5 ng / ml bFGF, 5 ng / ml EGF, and 0.2 pg / ml dexamethasone (Sigma-Aldrich). Myogenic differentiation was induced by switching confluent cell cultures to DMEM medium supplemented with 5 pg / ml insulin (Sigma-Aldrich) for myoblasts. For treatment, WT or DM1 cells were allowed to differentiate for 4 days. The medium was then replaced with fresh differentiation medium containing peptide-PMO complexes at 1, 2, 5, 10, 20 or 40 pM concentrations. Cells were harvested for analysis 48 hours after treatment. Two days after transfection of peptide-PMO at 40 μM into human hepatocytes or 1, 2, 5, 10, 20 or 40 pM concentrations into human myoblasts, cell viability in human hepatocytes and human myoblasts was quantified using a fluorescence-based assay (Promega).

[0428] RNA isolation, RT-PCR and qPCR analysis For mouse tissues: Muscles were disrupted with TriReagent (Sigma-Aldrich) using a Fastprep system and Lysing Matrix D tubes (MP biomedicals) before RNA extraction. For human cells: Cells were lysed in protein kinase K buffer (500 mM NaCl, 10 mM Tris-HCl, pH 7.2, 1.5 mM MgCl2, 10 mM EDTA, 2% SDS and 0.5 mg / ml protein kinase K) for 45 min at 55 °C before RNA extraction. Total RNA was isolated using TriReagent according to the manufacturer's protocol. One microgram of RNA was reverse transcribed using a total of 20 pL of M-MLV First Strand Synthesis System (Life Technologies) according to the manufacturer's instructions. One microliter of cDNA preparation was then used in semi-quantitative PCR analysis according to standard protocols (ReddyMix, Thermo Scientific). PCR amplification was performed for each gene for 25 to 35 cycles within the linear amplification range. PCR products were separated on 1.5-2% agarose gels, stained with ethidium bromide, and quantified with ImageJ software. Exon inclusion rates were quantified as the percentage of inclusion relative to the total intensity of the isoform signal. Primers are listed in Table 10 below. Table 10: Primers for PCR

[0429] [Table 10]

[0430] toxicology Toxicology assessment was performed as described in section 1.10 above.

[0431] result Treated muscle cells (myoblasts) from DM1 patients showed that DPEP1 or 3 peptide-[CAG]7 PMO complexes specifically target mutant CUGexp-DMPK transcripts and abrogate the deleterious sequestration of MBNL1 splicing factors by nuclear RNA foci and the resulting MBNL1 loss of function, which causes splicing defects and muscular dystrophy. DPEP1 / 3 peptide-[CAG]7 PMO complexes penetrate cells and induce splicing normalization with high efficacy (Figure 13). These de novo generation of so-called "ORER1 and DPEP3" peptides showed high efficacy in correcting splicing defects in vitro when complexed with CAG7 repeat antisense oligonucleotide PMO, indicating that they could be used therapeutically for the treatment of DM1.

[0432] Furthermore, preliminary toxicological evaluation of the complexes formed with DPEP1 / 3 indicates that ALP, ALT, AST, KIM-1, BUN, NGAL and creatinine levels were similar to saline control injections, in contrast to the fold increases typically induced by currently available peptide carriers from the Pip system. With this preliminary data, we have demonstrated that the complexes formed from DPEP peptide and [CAG]7PMO are as active as complexes formed with previous peptides such as Pip6a, but have a broader therapeutic window due to their lower toxicity (Figures 15-19).

[0433] Example 2 1. Materials and Methods 1.1 Materials 9-Fluorenylmethoxycarbonyl (Fmoc)-protected L-amino acid, benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium (PyBOP), Rink amide resin (0.46 mmol g -1 ), and Fmoc-β-Ala-OH preloaded Wang resin (0.19 or 0.46 mmol g -1) were obtained from Merck Millipore (Hohenbrunn, Germany). Tentagel Hydroxy-trityl resin was purchased from Rapp Polymere (Tübingen, Germany). HPLC grade acetonitrile, methanol, and synthesis grade N-methyl-2-pyrrolidone (NMP) were obtained from Fisher Scientific (Loughborough, UK). Peptide synthesis grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, England). PMO was purchased from Gene Tools Inc. (Philomas, USA). MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry (Applied Biosystems, Cheshire, UK) workstation. As matrix, 0 mg ml of α-cyano-4-hydroxycinnamic acid or sinapic acid in 50% acetonitrile in water were used. -1Stock solutions were used. Analytical and semi-preparative HPLC was performed on a Varian 940-LC HPLC System (Yarnton, UK). DMEM medium (31966047), fetal bovine serum (FBS) (10270106), antibiotic-antimycotic mixture solution (A5955), ethidium bromide (15585011), 2x ReddyMix PCR Master Mix (AB0575DCLDB), M-MLV first-strand synthesis system (28025013), and TRIzol reagent (15596026) were purchased from ThermoFisher Scientific. RealTime-Glo™ MT Cell Viability Assay (G9711), Maxwell® 16 Total RNA Purification Kit (AS1050) were purchased from Promega. Myoblasts were cultured in PromoCell's Skeletal Muscle Cell Growth Medium Kit (C-23160). Insulin (91077C) and agarose (A9539) were obtained from Sigma-Aldrich. DNA Marker -HyperLadder 50bp (BIO-33039) was obtained from BioLine Reagents. All primers were ordered through IDT. For urine collection, mice were singly housed in metabolic cages from Tecniplast (UK) and a urinary biomarker ELISA for kidney injury marker-1 (KIM-1) (MKM100) was obtained from R&D. All other reagents were obtained from Sigma-Aldrich (UK) unless otherwise indicated.

[0434] 1.2 Synthesis of peptide-PMO conjugates 1.2.1 Synthesis of peptide variants via Microwave Synthesiser Peptides were synthesized on a 100 pmole scale using a CEM Liberty Blue™ microwave Peptide Synthesizer (Buckingham, UK) and Fmoc chemistry according to the manufacturer's recommendations. Peptides with glutamic or succinic acid as linkers were synthesized on Rink amide resin to generate amides at the carboxyl termini of the peptides after TFA cleavage. Peptides with β-alanine linkers were synthesized using preloaded Wang. A complete list of peptides synthesized, along with the synthesis method and linker, is shown in Table 11. The side chain protecting groups used were labile to TFA treatment and peptides were synthesized using a 5-fold excess (0.25 mmol) of Fmoc-protected amino acids activated using PyBOP (5-fold excess) in the presence of DIPEA. Piperidine (20% v / v in DMF) was used to remove the N-Fmoc-protecting groups. Except for the arginine residue, one coupling was performed at 75°C for 5 min at a microwave power of 60 W, and each arginine residue was coupled twice. Each deprotection reaction was performed twice at 75°C (once for 30 s and then once for 3 min) at a microwave power of 35 W. After the synthesis was completed, the resin was washed with DMF (3 x 50 ml) and the N-terminus of the solid-phase-bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature for 15 min. After N-terminus acetylation, the peptide resin was washed with DMF (3 x 20 ml) and DCM (3 x 20 ml). For DPEP peptides with succinic acid at the N-terminus, N-terminus acetylation was not performed. Instead, the free N-terminus of the peptide was treated with succinic anhydride in the presence of DIPEA at room temperature for 30 min, followed by washing with DMF (3 x 20 ml). For the DPEP peptides with glutamic acid as a linker at the N-terminus, the N-terminus was acetylated as described above, but the attachment of the PMO was carried out at the side chain carboxyl group.

[0435] 1.2.2 Synthesis of peptide variants via the Intavis Multipep Synthesiser Peptides with γ-aminobutyric acid linkers were synthesized on Tentagel® Cl-trityl resin at room temperature using an Intavis Multipep Synthesiser and Fmoc chemistry according to the manufacturer's recommendations. Tentagel® Cl-trityl resin was prepared from Tentagel® hydroxy-trityl resin using acetyl chloride as recommended by the manufacturer. Briefly, resin (1 g) was washed with DMF (2×10 ml), dry DCM (3×10 ml), and dry toluene (3×10 ml) and transferred to a round-bottom flask equipped with a condenser. Sufficient toluene was added to cover the resin, and then acetyl chloride was added dropwise (1 ml g of resin). -1 , total volume 1 ml) and the mixture was heated at 60-70°C with gentle stirring for 3 hours. Upon completion, the resin was cooled to room temperature and then washed thoroughly with toluene (5 x 15 ml), DMF (5 x 15 ml) and finally dry DCM (3 x 15 ml). The resin was then loaded with Fmoc-γ-aminobutyric acid (3 eq) in DCM along with DIEA (8 eq), followed by additional DIEA (4 eq) and the reaction mixture mixed for a total of 1 hour. After 1 hour the resin was then washed with MeOH (0.8 ml g -1 ) for 15 min, followed by washing with DMF (5 × 10 ml) and DCM (5 × 15 ml). The yield and loading of the resin was determined by UV / visible spectrophotometry at 304 nm to determine Fmoc (0.41 mmol g -1 ), and the resin was used immediately.

[0436] Typically, peptides were synthesized on a 100 pmole scale using standard Fmoc amino acids with TFA-labile side chain protecting groups, and peptides were synthesized using a 5-fold excess of Fmoc-protected amino acids (0.05 mmol) activated with PyBOP (5-fold excess) in the presence of 4-methylmorpholine. Double coupling steps were used, followed by capping with acetic anhydride after each step. Piperidine (20% v / v in DMF) was used to remove the N-Fmoc protecting group. Each deprotection cycle was performed twice at room temperature (10 min each time). After completion of the synthesis, the resin was washed with DMF (3 x 50 ml) and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature for 15 min. After N-terminal acetylation, the peptide resin was washed with DMF (3 x 20 ml) and DCM (3 x 20 ml). Table 11: Synthesis methods of peptides with different linkers, resins used, and C-terminal modifications performed

[0437] [Table 11]

[0438] 1.2.3 Cleavage from solid support and purification of peptides via semi-preparative HPLC The peptides were cleaved from the solid support by treatment with a cleavage cocktail consisting of TFA / H2O / triisopropylsilane (TIPS) (95:2.5:2.5, 10 ml) for 3 h at room temperature. Excess TFA was removed by purging with nitrogen. The cleaved peptides were precipitated by the addition of ice-cold diethyl ether and centrifuged at 3000 rpm for 5 min. The crude peptide pellet was washed with diethyl ether (3 x 40 ml) and purified by RP-HPLC using a Varian 940-LC HPLC system equipped with a 445-LC scale-up module and a 440-LC fraction collector. The peptides were purified by semi-preparative HPLC on a RP-C18 column (10 x 250 mm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / H2O (0-99%, 0.1% TFA in CH3CN) at a flow rate of 15 ml / min in 15 min. Detection was carried out at 220 nm and 260 nm. Table 12: Sequences of peptides synthesized to test different linkers and binding positions in the examples. a are listed as their single amino acid abbreviations. b is for peptides; C-terminus = carboxyl terminus, N-terminus = amino terminus. The SEQ ID NOs refer to the sequences of the peptides without any additional N- and C-terminal modifications, e.g. linkers.

[0439] [Table 12]

[0440] 1.2.4 Synthesis of peptide-PMO conjugates The 25-mer antisense sequence for mouse dystrophin exon-23: (GGCCAAACCTCGGCTTACCTGAAAT; SEQ ID NO: 90) was used. The peptide was attached to the 3'-end of the PMO either through its C-terminal carboxyl group or N-terminal amino group, depending on the attachment position of the linker. This was achieved by using 2.3-fold and 2-fold equivalents of PyBOP and HOAt (in NMP), respectively, relative to the peptide, and a 2.5-fold excess of peptide (dissolved in DMSO) relative to the PMO, in the presence of 2.3 equivalents of DIPEA. In general, to a solution of peptide (10 mmol) in N-methylpyrrolidone (NMP, 100 mL), PyBOP (76.6 mL of 0.3 M NMP solution), HOAt (66.7 mL of 0.3 M NMP solution), DIPEA (4.0 mL), and PMO (4 pmoles, 400 pL of 10 mM DMSO solution) were added. The mixture was left at 40°C for 2 hours and the reaction was stopped by adding H2O (1 ml). The reaction mixture was purified on a cation exchange chromatography column (Resource S 6 H ml column, GE Healthcare) using a linear gradient of sodium chloride (0-1 M) in sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN at a flow rate of 6 ml / min. Removal of excess salt from the peptide-PMO (P-PMO) was performed through an Amicon® Ultra-15 3K centrifugal filter device on the fractions collected after ion exchange. The complex was lyophilized and analyzed by MALDI-TOF. The complex was dissolved in sterile water and purified through a 0.22 pm cellulose acetate filter before use. The concentration of P-PMO was determined by molar absorptivity measurement of the complex at 265 nm in 0.1 M HCl solution. The overall yield (Table 13) was 26-64% based on P-PMO. Table 13: Yields of large scale synthesized P-PMO conjugates for in vivo analysis (yields are calculated via UV / visible spectroscopy and based on the extinction coefficients of the PMOs). The purity for the P-PMOs is 95% or higher as confirmed by normal phase HPLC at 220 nm and 260 nm. PMOs used for conjugation to peptides ahas the following sequence: 5'-GGCCAAACCTCGGCTTACCTGAAAT-3' (SEQ ID NO: 90). b The bond position is shown here in bold italics. The part in parentheses is the linker.

[0441] [Table 13]

[0442] The following comparative conjugates were synthesized / obtained and the same PMO was attached to a peptide using comparative linkers: Table 14: Comparative peptides

[0443] [Table 14]

[0444] 1.3 Quantification and reconstitution of P-PMO P-PMO was dissolved in RNase-free water. An aliquot from this solution was diluted 100-fold in 0.1 M HCl and measured via UV / Visible spectroscopy at 265 nm. The concentration was calculated according to the Beer-Lambert law:

number

[0445] Prior to use, the P-PMO was thawed to room temperature (if previously frozen), vortexed briefly, and then incubated for 30 minutes at 37° C. An aliquot of the P-PMO was then sonicated for 5 minutes in a sonication bath. Finally, the P-PMO was vortexed briefly and pulse spun.

[0446] Injection solutions were prepared by combining P-PMO diluted in RNase-free water with 9% saline at the desired concentration (final concentration: 0.9% saline).

[0447] 1.4 Evaluation of in vivo P-PMO treatment 1.4.1 Systemic administration of P-PMO All experiments were performed at the Biomedical Sciences Unit, University of Oxford, under the Home Office Project Licence (UK), in accordance with the Animals (Scientific Procedures) Act 1986 and clinical trial ethics review. Mice were housed in a specialized pathogen-free disease facility, with a 12-h light-dark cycle and a temperature- and humidity-controlled environment. All animals had free access to commercial rodent chow and water.

[0448] Experiments were performed on female C57BL / 6 mice aged 8-10 weeks. Mice were administered 0.9% saline, 10 mg / kg, 30 mg / kg, or 50 mg / kg P-PMO via a single bolus tail vein injection. One week after administration, mice were sacrificed and the tibialis anterior muscle, diaphragm, and myocardium were harvested, flash frozen on dry ice, and stored at -80°C.

[0449] 1.4.2 Toxicological evaluation of P-PMO After intravenous administration of P-PMO (see section 1.4.1), the animals were housed in metabolic cages for 20 hours and urine was collected non-invasively under refrigerated conditions on days 2 and 7 after administration. On day 7, blood was collected from the jugular vein, fractionated, and plasma was collected. On day 7, tibialis anterior, diaphragm, and cardiac muscle were collected during dissection.

[0450] Urinary levels of kidney injury molecule-1 (KIM-1) were quantified by ELISA after appropriate dilution of urine to fit a standard curve. KIM-1 values ​​were normalized to urinary creatinine levels, which were quantified at the MRC Harwell Institute, Mary Lyon Centre (Oxfordshire, UK).

[0451] 1.4.3 qPCR analysis of P-PMO-induced exon skipping Quantification of P-PMO-induced exon skipping was performed in tibialis anterior (TA), diaphragm, and cardiac muscle 7 days after treatment. Briefly, RNA was extracted from homogenized tissues using a TRIzol-based extraction method, and randomly primed cDNA was synthesized. Primers / probes were synthesized by Integrated DNA Technologies and designed to amplify a region spanning exons 23-24 (mDMD23-24, see Table 14), indicative of a non-skipped product, or to specifically amplify the transcriptionally deleted exon 23 using a probe spanning the boundary of exons 22 and 24 (mDMD22-24). The level of each transcript was measured by skipped and non-skipped transcripts and expressed as a percentage of skipped transcripts relative to total transcripts (skipped and non-skipped) (see Table 15 for sequences). Table 15: Primer and probe sequences for quantification of mouse dystrophin (exon 23) exon skipping by qPCR.

[0452] [Table 15]

[0453] 2. Other Examples Synthesis of peptide-PMO conjugates Peptides were synthesized and conjugated to PMOs as previously described. A PMO sequence targeting an expanded CUG repeat: (5-CAGCAGCAGCAGCAGCAGCAG-3': SEQ ID NO: 192) was purchased from Gene Tools LLC and used to generate further conjugates.

[0454] Cell culture and peptide-PMO treatment Immortalized myoblasts from healthy individuals or DM1 patients with 2600 CTG repeats were cultured in growth medium consisting of M199:DMEM mix (ratio 1:4; Life technologies) supplemented with 20% FBS (Life technologies), gentamicin 50 pg / ml (Life technologies), fetuin 25 pg / ml, bFGF 0.5 ng / ml, EGF 5 ng / ml, and dexamethasone (Sigma-Aldrich) 0.2 pg / ml. Muscle differentiation was initiated by switching the confluent cell medium to myoblast DMEM medium supplemented with insulin (Sigma-Aldrich) 5 pg / ml. WT or DM1 cells were differentiated for 4 days. The medium was then replaced with fresh differentiation medium containing peptide-PMO at concentrations of 1, 2, 5, 10, 20, or 40 pM. After 48 h of treatment, cells were harvested for analysis. Two days after transfection of peptide-PMO at a concentration of 40 μM in human hepatocytes or at concentrations of 1, 2, 5, 10, 20, or 40 pM in human myoblasts, cell viability was quantified by a fluorescence detection assay (Promega).

[0455] RNA isolation, RT-PCR For human cells: Prior to RNA extraction, cells were lysed in Protease K buffer (NaCl 500 mM, Tris-HCl (pH 7.2) 10 mM, MgCl2 1.5 mM, EDTA 10 mM, 2% SDS, and Protease K 0.5 mg / ml) at 55°C for 45 min. Total RNA was isolated using TriReagent® according to the manufacturer's protocol. 1 μg of RNA was reverse transcribed using a total of 20 μl of M-MLV First Strand Synthesis System (Life Technologies) according to the manufacturer's instructions. 1 μl of the cDNA preparation was subsequently used in semi-quantitative PCR analysis (ReddyMix, Thermo Scientific) according to standard protocols. For each gene, PCR amplification was performed for 25-35 cycles within the linear range of amplification. PCR products were separated on 1.5-2% agarose gels, stained with ethidium bromide, and quantified with ImageJ software. Exon inclusion rates were quantified as a percentage of inclusion relative to the total intensity of isotype signals. To quantify mRNA expression, real-time PCR was performed according to the manufacturer's instructions. The PCR cycle consisted of a 15 minute denaturation step, followed by 50 cycles of a 94°C denaturation step for 15 seconds, 58°C annealing for 20 seconds, and 72°C extension for 20 seconds. Table 16: Primers for PCR

[0456] [Table 16]

[0457] Animal experiments and ASO injections Experiments were performed at the University of Oxford in accordance with UK legislation. Intravenous injections in HSA-LR C57BL / 6 mice were performed by single or repeated dosing via the tail vein. Doses of 30, 12.5, 7.5 and 5mg / kg of peptide-PMO-CAG7 were diluted in 0.9% saline and administered in a volume of 5-6pL / g body weight. KIM-1 levels in C57BL6 female mice were measured by ELISA (R&D cat# MKM100) with samples diluted to fit within the standard curve. Values ​​were normalized to urinary creatinine levels to account for urinary protein concentrations (Harwell). Table 17: Recovery time of C57BL6 mice following injection of DPEP-based [CAG]7PMO conjugates is shorter than following injection of conjugates formed using conventional peptides such as Pip6a.

[0458] [Table 17]

[0459] Example 3 Using the techniques and methods described in Examples 1 and 2 above, any of the following conjugates can be prepared: [ka] , [ka] , [ka] , [ka] , [ka] , [ka] ,

change

change

change

change

change

change

change

change

change

change

change

change

change

change

[0460] Where: (B) is a beta-alanine residue, (Ab) is a γ-aminobutyric acid residue; (E) is a glutamic acid residue, except that if --COOH is present in the glutamic acid residue, it is replaced with --CONH2.

[0461] In the above conjugate, the oligonucleotide may be morpholino in which all morpholino internucleoside linkages are -P(O)(NMe2)O- and which has a group at the 5' end shown in the structure below. [ka] .

[0462] Example 4. Studies in non-human primates Complex 1 containing morpholino oligonucleotide as shown below: [ka] wherein the 5' group is [ka] and the linker (E) is [ka] ) was reconstituted to 25 mg / mL in 0.9% sterile saline.

[0463] NHP single-infusion dose-response study The efficacy of exon skipping of complex 1 was tested in non-human primates (NHPs). Specifically, treatment-naïve cynomolgus monkeys aged 2–4 years were administered the complexes by a single intravenous slow bolus injection (1–2 min) at 20 mg / kg, 40 mg / kg, or 60 mg / kg (n = 1 male, n = 1 female per group).

[0464] Animals were sacrificed 1 week after dosing, and at scheduled necropsy, tissue aliquots were taken for exon skipping analysis and tissue bioanalysis.

[0465] Tissue Bioanalysis The biodistribution of Complex 1 was evaluated by an AEX-HPLC assay with fluorescence detection, which allows sensitive and specific detection of Complex 1 from NHP tissue samples. The assay is based on the specific hybridization of a 30-mer complementary RNA probe with Atto425 dye attached at both ends. The RNA and parent compound duplexes gave specific signals in the subsequent analysis by AEX-HPLC coupled to a fluorescence detector. Quantification was based on an external calibration curve generated from a standard dilution series of NHP tissues. A linear calibration curve (weighted 1 / X) from 50 ng / g to 5,000.0 ng / g was calculated. The biodistribution results are shown in Figure 33.

[0466] RT-PCR analysis The level of exon 51 skipping was determined by RT-PCR. Skeletal, cardiac, and smooth muscle tissues were homogenized using a bead-based homogenization method. RNA was extracted using a Maxwell RSC 48 instrument (Promega) and the simply RNA Tissue Kit (Promega) according to the manufacturer's recommendations. RNA concentration and purity were measured using a ClarioStar (BMG LabTech). Quantified RNA was reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific (4368813)) under the thermal cycling conditions shown in Table 18. Table 18: Reverse transcription thermal cycling conditions

[0467] [Table 18]

[0468] Nested PCR was performed as two consecutive PCR reactions. The first PCR was performed using reverse transcribed cDNA template. The second PCR was performed using the product obtained from the first PCR. All primers used in the PCR reactions are listed in Table 19, and the thermal cycling conditions are outlined in Table 20. The final PCR products were analyzed by agarose gel electrophoresis (2%). Gels were prepared using Midori Green Advance Staining Reagent (Nihon Genetics Co., Ltd.). Hyper Ladder 50 bp (Bioline, BIO-33039) and PCR products were loaded onto the agarose gel and run until an appropriate degree of band separation was achieved. Image acquisition of the resolved gel was then performed using the gel imaging system G:BOX (Syngene). Non-skipped native bands and skipped Δex 51 bands from the nested PCR gel were analyzed densitometrically using ImageJ software (Fiji). Densitometry values ​​from band quantification were used to determine nhpDMD exon 51 skipping according to the following formula: nhpDMD exon 51 skipping formula: ([peak area of ​​skipped fragment] / [peak area of ​​skipped fragment + peak area of ​​non-skipped fragment]) x 100 Table 19: Primers and primer sequences

[0469] [Table 19] Table 20: Thermal cycling conditions

[0470] [Table 20] Table 20 (continued)

[0471] [Table 21]

[0472] The effect of exon 51 skipping in non-human primates administered Complex 1 is summarized in FIG.

[0473] Other embodiments Various modifications and variations of the described invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the present invention. Other embodiments are within the claims.

Claims

1. A conjugate of an oligonucleotide and a peptide covalently or via a linker to said oligonucleotide, or a pharma- ceutically acceptable salt thereof, comprising: the peptide comprises at least one cationic domain comprising at least four amino acid residues and at least one hydrophobic domain comprising at least three amino acid residues, with the proviso that the peptide comprises a total of 7-40 amino acid residues and does not comprise any artificial amino acid residues; The oligonucleotide comprises a total of 12 to 40 contiguous nucleobases, with the proviso that at least 12 contiguous nucleobases are complementary to a target sequence in the human dystrophin gene, or a pharma- ceutically acceptable salt thereof.

2. The complex of claim 1, wherein the target sequence includes the splice site of exon 45 or is located within 50 nucleobases of the splice site of exon 45.

3. 3. The complex of claim 2, wherein the oligonucleotide comprises at least 12 contiguous nucleobases selected from any one of the sequences in Table 1 and thymine substituted versions thereof.

4. 3. The conjugate of claim 2, wherein the oligonucleotide comprises any one of the sequences in Table 1 or a thymine substituted version thereof.

5. The complex according to claim 3 or 4, characterized in that the sequence in Table 1 is 5'-GCTGCCCAATGCCATCCTGGAGTTCCTGTAA-3' (SEQ ID NO: 193).

6. The complex according to claim 3 or 4, characterized in that the sequence in Table 1 is 5'-CAATGCCATCCTGGAGTTCCTG-3' (SEQ ID NO: 194).

7. 2. The complex of claim 1, wherein the target sequence includes the splice site of exon 51 or is located within 50 nucleobases of the splice site of exon 51.

8. 8. The complex of claim 7, wherein the oligonucleotide comprises at least 12 contiguous nucleobases selected from any one of the sequences in Table 2 and thymine substituted versions thereof.

9. 8. The conjugate of claim 7, wherein the oligonucleotide comprises any one of the sequences in Table 2 or a thymine substituted version thereof.

10. The complex according to claim 8 or 9, characterized in that the sequence in Table 2 is 5'-CUCCAACAUCAAGGAAGAUGGCAUUUCUAG-3' (SEQ ID NO: 130).

11. The complex of claim 8 or 9, characterized in that the sequence in Table 2 is 5'-CTCCAACATCAAGGAAGATGGCATTTCTAG-3' (SEQ ID NO: 195).

12. The complex of claim 1, wherein the target sequence includes the splice site of exon 53 or is located within 50 nucleobases of the splice site of exon 53.

13. 13. The complex of claim 12, wherein the oligonucleotide comprises at least 12 contiguous nucleobases having any one of the sequences in Table 3.

14. The complex of claim 12, wherein the oligonucleotide comprises any one of the sequences in Table 4.

15. 15. The complex of claim 13 or 14, wherein the sequence in Table 3 is 5'-CCTCCGGTTCTGAAGGTGTTCT-3' (SEQ ID NO: 162).

16. 15. The complex of claim 13 or 14, wherein the sequence in Table 3 is 5'-GTTGCCTCCGGTTCTGAAGGTGTTC-3' (SEQ ID NO: 171).

17. 13. The complex of claim 2, 7 or 12, wherein the splice site is an acceptor splice site.

18. 13. The complex of claim 2, 7 or 12, wherein the splice site is a donor splice site.

19. The complex of claim 1, wherein the sequence is GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 90).

20. The conjugate according to any one of claims 1 to 18, characterized in that the peptide does not contain an aminohexanoic acid (X) residue, or the peptide does not contain a 6-aminohexanoic acid residue.

21. The complex according to any one of claims 1 to 18, characterized in that the peptide consists of naturally occurring amino acid residues.

22. 22. The complex according to any one of claims 1 to 21, characterized in that each cationic domain has a length between 4 and 12 amino acid residues, preferably between 4 and 7 amino acid residues.

23. The complex of any one of claims 1 to 22, wherein each cationic domain comprises at least 40%, at least 45%, or at least 50% cationic amino acids.

24. 24. The complex according to any one of claims 1 to 23, wherein each cationic domain comprises a majority of cationic amino acids, preferably at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% cationic amino acids.

25. 25. The complex according to any one of claims 1 to 24, wherein each cationic domain comprises an arginine, histidine, beta-alanine, hydroxyproline and / or serine residue, preferably each cationic domain consists of an arginine, histidine, beta-alanine, hydroxyproline and / or serine residue.

26. 26. The complex of any one of claims 1 to 25, wherein each cationic domain is arginine- and / or histidine-rich, preferably each cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% arginine and / or histidine residues.

27. The complex of any one of claims 1 to 26, characterized in that the peptide comprises two cationic domains.

28. Each cationic domain comprises one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), R[Hyp]RR[Hyp]R (SEQ ID NO:19), or any combination thereof; 28. The complex of any one of claims 1 to 27, wherein each cationic domain preferably consists of one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), R[Hyp]RR[Hyp]R (SEQ ID NO:19) or any combination thereof.

29. A complex according to any one of claims 1 to 28, characterized in that each hydrophobic domain has a length of between 3 and 6 amino acids, preferably each hydrophobic domain has a length of 5 amino acids.

30. 30. The complex of any one of claims 1 to 29, wherein each hydrophobic domain comprises a majority of hydrophobic amino acid residues, preferably wherein each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acids.

31. 31. The complex according to any one of claims 1 to 30, wherein each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline and glutamine residues, preferably each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline and / or glutamine residues.

32. The complex according to any one of claims 1 to 31, characterized in that the peptide comprises one hydrophobic domain.

33. 33. The complex according to any one of claims 1 to 32, characterized in that the or each hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW,WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26) or any combination thereof, preferably the or each hydrophobic domain consists of one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW,WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26) or any combination thereof.

34. The complex according to any one of claims 1 to 33, characterized in that the peptide consists of two cationic domains and one hydrophobic domain, preferably the peptide consists of one hydrophobic core domain flanked by two cationic arm domains.

35. The peptides are RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), 35. The complex of any one of claims 1 to 34, comprising one hydrophobic core domain comprising a sequence selected from YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW,WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), and WWPW (SEQ ID NO:26), flanked by two cationic arm domains each comprising a sequence selected from YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW,WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), and WWPW (SEQ ID NO:26).

36. 36. The complex of any one of claims 1 to 35, characterized in that the peptide consists of one of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO: 27), RBRRBRRYQFLIRBRBR (SEQ ID NO: 31), RBRRBRRILFQYRBRBR (SEQ ID NO: 32), RBRRBRRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37), RBRRBRRFQILYHBHBR (SEQ ID NO: 38), RBRRBRRFQILYRBHBH (SEQ ID NO: 44).

37. The complex according to any one of claims 1 to 18, characterized in that the peptide has the following amino acid sequence: RBRRBRRFQILYBRBR (SEQ ID NO: 35).

38. The complex according to any one of claims 1 to 18, characterized in that the peptide has the following amino acid sequence: RBRRBRRFQILYRBHBH (SEQ ID NO: 37).

39. The complex according to any one of claims 1 to 18, characterized in that the peptide has the following amino acid sequence: RBRRBRRFQILYRBHBH (SEQ ID NO: 44).

40. 40. The complex of any one of claims 1 to 39, wherein the peptide is linked to the remainder of the complex through its N-terminus.

41. The C-terminus of the peptide is -NH ２ The complex of claim 40,

42. 40. The conjugate of any one of claims 1 to 39, wherein the peptide is linked to the remainder of the conjugate through its C-terminus.

43. 43. The conjugate of claim 42, wherein the peptide is acylated at its N-terminus.

44. The complex has the following structure: [peptide]-[linker]-[oligonucleotide] The complex according to any one of claims 1 to 43, characterized in that it has

45. The complex has the following structure: 【Chemistry 1】 or 【Chemistry 2】 The complex according to any one of claims 1 to 43, characterized in that it has

46. The complex has the following structure: [peptide]-[linker]-[peptide]-[linker]-[oligonucleotide] The complex according to any one of claims 1 to 43, characterized in that it has

47. Each linker independently has a structure according to formula (I): -T １ -(CR １ R ２ ) ｎ -T ２ - (I) {where: T １ is a divalent group attached to the peptide and is selected from the group consisting of -NH- and carbonyl; T ２ is a divalent group attached to an oligonucleotide and is selected from the group consisting of -NH- and carbonyl; n is 1, 2 or 3; Each R １ are independently represented by the formula: -Y １ -X １ -Z １ [where: Y １ is absent or has the formula: -[CR Ａ１ R Ａ２ ] ｍ - (wherein m is selected from 1, 2, 3, or 4; R Ａ１ and R Ａ２ are each independently selected from hydrogen, OH, or (1-2C)alkyl; X １ is absent or is —O—, —C(O)—, —C(O)O—, —OC(O)—, —CH(OR Ａ３ ) -, -N(R Ａ３ ) -, -N(R Ａ３ )-C(O)-,-N(R Ａ３ )-C(O)O-, -C(O)-N(R Ａ３ ) -, -N(R Ａ３ ) C(O)N(R Ａ３ ) -, -N(R Ａ３ ) C(NR Ａ３ ) N (R Ａ３ )-, -SO-, -S-, -SO ２ -, -S(O) ２ N (R Ａ３ )- or -N(R Ａ３ ) S.O. ２ - (wherein each R Ａ３ are independently selected from hydrogen or methyl; Z １ is a further oligonucleotide or is selected from hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, where each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, and heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR Ａ４ R Ａ５ and (1-4C)alkoxy (wherein R Ａ４ and R Ａ５ are each independently substituted with one or more (e.g., 1, 2, 3, 4, or 5) substituents selected from the group consisting of hydrogen and (1-4C)alkyl). is a group represented by the formula: Each R ２ are independently represented by the formula: -Y ２ -X ２ -Z ２ [where: Y ２ is absent or has the formula: -[CR Ｂ１ R Ｂ２ ] ｍ - (wherein m is an integer selected from 1, 2, 3, or 4; R Ｂ１ and R Ｂ２ are each independently selected from hydrogen, OH, or (1-2C)alkyl; X ２ is absent or is —O—, —C(O)—, —C(O)O—, —OC(O)—, —CH(OR Ｂ３ ) -, -N(R Ｂ３ ) -, -N(R Ｂ３ )-C(O)-,-N(R Ｂ３ )-C(O)O-, -C(O)-N(R Ｂ３ ) -, -N(R Ｂ３ ) C(O)N(R Ｂ３ ) -, -N(R Ｂ３ ) C(NR Ｂ３ ) N (R Ｂ３ )-, -SO-, -S-, -SO ２ -, -S(O) ２ N (R Ｂ３ )- or -N(R Ｂ３ ) S.O. ２ - (wherein each R Ｂ３ are independently selected from hydrogen or methyl; Z ２ is selected from hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, wherein each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR Ｂ４ R Ｂ５ and (1-4C)alkoxy (wherein R Ｂ４ and R Ｂ５ are each independently substituted by one or more (e.g., 1, 2, 3, 4 or 5) substituents selected from the group consisting of hydrogen or (1-2C) alkyl; however, n=1, T １ and T ２ are different from each other, R １ and R ２ cannot both be H; n=1, T １ and T ２ are different from each other, and R １ and R ２ is H, then R １ and R ２ the other is not methyl; n=2, each R １ and R ２ If H, T １ and T ２ and both are -C(O)- or both are -NH-.

48. T ２ The complex of claim 47, wherein: is -C(O)-.

49. Each R １ are independently represented by the formula: -Y １ -X １ -Z １ [where: Y １ is absent or has the formula: -[CR Ａ１ R Ａ２ ] ｍ - (wherein m is 1, 2, 3 or 4; R Ａ１ and R Ａ２ are each hydrogen or (1-2C)alkyl; X １ is absent or is -O-, -C(O)-, -C(O)O-, -N(R Ａ３ ) -, -N(R Ａ３ )-C(O)-, -C(O)-N(R Ａ３ ) -, -N(R Ａ３ ) C(O)N(R Ａ３ ) -, -N(R Ａ３ ) C(NR Ａ３ ) N (R Ａ３ )- or -S-, where each R Ａ３ are independently hydrogen or methyl; Z １ is a further oligonucleotide or is hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, where each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, and heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR Ａ４ R Ａ５ and (1-4C)alkoxy (wherein R Ａ４ and R Ａ５ each independently is hydrogen or (1-2C) alkyl;

50. Each R １ are independently represented by the formula: -Y １ -X １ -Z １ [where: Y １ is absent or has the formula: -[CR Ａ１ R Ａ２ ] ｍ - where m is 1, 2, 3, or 4; R Ａ１ and R Ａ２ are each independently hydrogen or (1-2C)alkyl; X １ is absent or is -O-, -C(O)-, -C(O)O-, -N(R Ａ３ ) -, -N(R Ａ３ )-C(O)-, -C(O)-N(R Ａ３ ) -, -N(R Ａ３ ) C(O)N(R Ａ３ ), -N(R Ａ３ ) C(NR Ａ３ ) N (R Ａ３ )- or -S-, where each R Ａ３ are independently hydrogen or methyl; Z １ is a further oligonucleotide or a group represented by the formula: hydrogen, (1-6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl, wherein each (1-6C)alkyl, aryl, (3-6C)cycloalkyl, and heteroaryl is optionally substituted by one or more (e.g. 1, 2, 3, 4 or 5) substituents selected from the group consisting of (1-4C)alkyl, halo, and hydroxy.

51. Each R １ are independently represented by the formula: -Y １ -X １ -Z １ [where: Y １ is absent or has the formula: -[CR Ａ１ R Ａ２ ] ｍ - where m is 1, 2, 3, or 4; R Ａ１ and R Ａ２ are each independently hydrogen or (1-2C)alkyl; X １ is absent or is -C(O)-, -C(O)O-, -N(R Ａ３ )-C(O)- or -C(O)-N(R Ａ３ ) where each R Ａ３ is hydrogen or methyl; Z １ is a further oligonucleotide or a group represented by the formula: hydrogen, (1-6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl, wherein each (1-6C)alkyl, aryl, (3-6C)cycloalkyl, and heteroaryl is optionally substituted by one or more (e.g. 1, 2, 3, 4 or 5) substituents selected from the group consisting of (1-4C)alkyl, halo, and hydroxy.

52. Each R １ are independently represented by the formula: -Y １ -X １ -Z １ [Here, Y １ is absent or -(CH ２ )- or -(CH ２ CH ２ ) - and X １ is absent or -N(R Ａ３ )-C(O)- or -C(O)-N(R Ａ３ )--wherein each R Ａ３ are independently hydrogen or methyl; Z １ is hydrogen or (1-2C) alkyl.

53. Each R ２ are independently represented by the formula: -Y ２ -Z ２ [Here, Y ２ is absent or has the formula: -[CR Ｂ１ R Ｂ２ ] ｍ - where m is 1, 2, 3, or 4; R Ｂ１ and R Ｂ２ are each independently hydrogen or (1-2C)alkyl; Z ２ is hydrogen or (1-6C)alkyl. The complex according to any one of claims 47 to 51, wherein the group is represented by:

54. Each R ２ The complex according to any one of claims 47 to 51, wherein is hydrogen.

55. The complex according to any one of claims 47 to 54, wherein n is 2 or 3.

56. The complex according to any one of claims 47 to 54, wherein n is 1.

57. The conjugate according to any one of claims 1 to 44, characterized in that the linker is an acid residue selected from the group consisting of glutamic acid, succinic acid, and γ-aminobutyric acid.

58. The linker has the following structure: 【Chemistry 3】 The complex according to any one of claims 1 to 44, characterized in that it has

59. The linker has the following structure: 【Chemistry 4】 The complex according to any one of claims 1 to 44, characterized in that it has

60. The linker has the following structure: 【Chemistry 5】 The complex according to any one of claims 1 to 44, characterized in that it has

61. The linker has the following structure: 【Chemistry 6】 The complex according to any one of claims 1 to 44, characterized in that it has

62. The linker has the following structure: 【Chemistry 7】 The complex according to any one of claims 1 to 44, characterized in that it has

63. The complex has the following structure: 【Chemistry 8】 The complex according to any one of claims 1 to 44, characterized in that it has

64. The complex has the following structure: 【Chemistry 9】 The complex according to any one of claims 1 to 44, characterized in that it has

65. The complex has the following structure: 【Chemistry 10】 The complex according to any one of claims 1 to 44, characterized in that it has

66. The complex has the following structure: 【Chemistry 11】 The complex according to any one of claims 1 to 44, characterized in that it has

67. The complex has the following structure: 【Chemistry 12】 The complex according to any one of claims 1 to 44, characterized in that it has

68. 68. The conjugate of any one of claims 1 to 67, wherein the oligonucleotide is bound at its 3' end to the linker or the peptide.

69. The oligonucleotide has at its 5' end the following group: 【Chemistry 13】 The complex of any one of claims 1 to 68, comprising:

70. The oligonucleotide has at its 5' end the following group: 【Chemistry 14】 The complex of any one of claims 1 to 68, comprising:

71. The conjugate of any one of claims 1 to 68, wherein the oligonucleotide comprises a hydroxyl at its 5' end.

72. A conjugate of an oligonucleotide 5'-CTCCAACATCAAGGAAGATGGCATTTCTAG-3' (SEQ ID NO: 195) having its 3'-terminus covalently linked via a glutamic acid residue to the C-terminus of the peptide Ac-RBRRBRRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof, wherein the glutamic acid residue has a free -COOH, which is -CONH ２ or a pharma- ceutically acceptable salt thereof.

73. A conjugate of an oligonucleotide 5'-CATTCAACTGTTGCCTCCGGTTCTGAAGGTG-3' (SEQ ID NO: 198) having its 3'-terminus covalently linked via a glutamic acid residue to the C-terminus of the peptide Ac-RBRRBRRFQILYBRBR (SEQ ID NO: 35), or a pharma- ceutically acceptable salt thereof, wherein the glutamic acid residue has a free -COOH, which is -CONH ２ or a pharma- ceutically acceptable salt thereof.

74. The oligonucleotide has at its 5' end the following group: 【Chemistry 15】 74. The complex of claim 72 or 73, comprising:

75. The complex of any one of claims 1 to 74, wherein the oligonucleotide is a morpholino.

76. All morpholino internucleoside bonds are -P(O)(NMe ２ 76. The complex of claim 75, wherein:

77. The complex has the following structure: 【Chemistry 16】 The complex according to any one of claims 72 to 76, characterized in that it has

78. A pharmaceutical composition comprising a conjugate according to any one of claims 1 to 77 and a pharma- ceutically acceptable excipient.

79. 79. The pharmaceutical composition of claim 78 for use in treating a subject with Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD).

80. 100. A conjugate for use in the treatment of a subject having Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD), characterized in that said treatment comprises administering to the subject a therapeutically effective amount of the conjugate of any one of claims 1 to 77 or a pharmaceutical composition comprising the conjugate of any one of claims 1 to 77 and a pharma- ceutical acceptable excipient.

81. 81. The composition of claim 80, wherein the subject has Duchenne muscular dystrophy (DMD).

Images