Panels and methods for polynucleotide detection

Abstract

The present invention relates to a molecular system for detecting a target polynucleotide sequence in a given nucleic acid analyte, and methods for its use.

Description

[Technical field]

[0001] The present invention relates to a molecular system for detecting a target polynucleotide sequence in a given nucleic acid analyte, and methods for its use. [Background technology]

[0002] Polymerase chain reaction (PCR) is a well-known and powerful technique for amplifying DNA or RNA present in laboratory and diagnostic samples to a degree that allows reliable detection and / or quantification. However, when applied to investigate analyte samples containing low levels of such molecules, it suffers from several limitations. First, while the technique can detect as few as a single target molecule, it is prone to false positive results due to the unwanted amplification of other nucleic acid sequences present in the sample. This makes the selection of oligonucleotide primers used to initiate the reaction critical, which in turn makes the design of primers with the required level of specificity relatively complex. As a result, many PCR-based tests currently available on the market have limited specificity.

[0003] A second drawback is that the multiplexing of PCR-based methods is in practice limited to a maximum of several tens of target sequences (often not more than 10) in order to avoid primer-primer interactions, resulting in the need for a relatively narrow operating window.

[0004] Another problem is that the PCR reaction cycles in an exponential manner, making target quantification difficult. Small variations in reaction efficiency have a large effect on the amount of detectable material produced. Thus, even with appropriate controls and calibration, quantification is typically limited to within about 3-fold accuracy.

[0005] Finally, mutations in the targeted regions of interrogation by PCR amplification methods can have unwanted side effects. For example, there have been cases where FDA-approved tests had to be withdrawn because the target organisms carried mutations in the gene regions targeted by the test primers, resulting in a large number of false negatives. Conversely, when specific single nucleotide polymorphisms (SNPs) are targeted for amplification, PCR methods often show false positives when the wild-type variant is present. Avoiding this requires very careful primer design, further limiting the effectiveness of the multiplexing. This is particularly relevant when searching for panels of SNPs, a common requirement in cancer testing / screening or companion diagnostics. Summary of the Invention

[0006] The inventors have now developed an improved method based on the inventors' experience using the pyrophosphorolysis reaction used in their previous patents (WO20016590 A1, PCT / GB2020 / 053361, PCT / GB2020 / 053362, PCT / GB2020 / 053363, GB2020539.9, and GB2101176.2) that overcomes many of these limitations. In so doing, it takes advantage of the double-stranded specificity of pyrophosphorolysis, a reaction that does not proceed efficiently with single-stranded oligonucleotide substrates or double-stranded substrates containing blocking groups or nucleotide mismatches. This new method allows for more confident calling of target sequences at low concentrations. Thus, according to the present invention, there is provided a molecular system for detecting a target polynucleotide sequence in a given nucleic acid analyte, comprising a probe molecule (A0) and a hybridized splint molecule (C), a. A0 has a 3' end complementary to a target polynucleotide sequence, a loop region, and a 5' phosphate; bC hybridizes to the 5' end of A0 and provides a single-stranded 3' overhang; A molecular system is provided in which the single-stranded 3' overhang is capable of hybridizing to a region located 1 to 50 bases in the 5' direction from the 3' end of A0.

[0007] 1. A method for detecting a target polynucleotide sequence in a given nucleic acid analyte, comprising employing a molecular system comprising: i) introducing a molecular system into a sample; ii) removing complementary nucleotides that are fully hybridized to the target from the 3' end of A0 by treating A0 with an enzyme for pyrophosphorolysis to form a shortened probe A1; iii) displacing the 3' end of A1 from the target using C; iv) ligating the ends of A1 to form a circle using pre-hybridized C to form circular A2; v) detecting the presence of A2; Further provided is a method comprising:

[0008] The analytes to which the method of the invention can be applied are nucleic acids, including the target polynucleotide sequence under investigation, such as naturally occurring or synthetic DNA or RNA molecules. In one embodiment, the analyte is typically present in an aqueous solution containing the analyte and other biological material, and in one embodiment, the analyte is present together with other background nucleic acid molecules that are not of interest for the purpose of the test. In some embodiments, the analyte is present in a low amount compared to these other nucleic acid components. Preferably, for example, if the analyte is derived from a biological specimen containing cellular material, some or all of these other nucleic acids and extraneous biological material are removed using a sample preparation technique such as filtration, centrifugation, chromatography, or electrophoresis before carrying out step (i) of the method. Suitably, the analyte is derived from a biological sample taken from a mammalian subject (particularly a human patient), such as blood, plasma, sputum, urine, skin, or a biopsy. In one embodiment, the biological sample is subjected to lysis to release the analyte by destroying all cells present. In other embodiments, the analyte may already be present in a free form within the sample itself, such as cell-free DNA circulating in blood or plasma. [Brief description of the drawings]

[0009] [Figure 1]Example 1, results of the effect of the length of the annealing region between the probe and the target on the optimum temperature of the pyrophosphorolysis reaction, showing the values ​​of the difference in Cq (dCq) observed between wild type and mutant-containing samples. The pyrophosphorolysis reaction was carried out at 30-50°C. The lengths of the annealing region are summarized in Table 1. The longer the length of the annealing region between the probe and the target molecule, the higher the optimum temperature. For a complementarity of 29 base pairs (SEQ ID NO: 1 / 2), the optimum is 46-50°C, and for 22 base pairs, 30-42°C. Annealing regions that are too short may result in a decrease in dCq (SEQ ID NO: 11 / 12 and 13 / 14). At a length of 19 base pairs, no positive signal indicating the presence of the target molecule could be detected (SEQ ID NO: 15 / 16). [Diagram 2] Example 2, results of the effect of the length of the annealing region between the probe, target and splint, showing the Cq difference (dCq) values ​​observed between wild type and mutant-containing samples. A summary of the lengths tested can be found in Table 2. For probe SEQ ID NO:22 (FIG. 2A), the best performing splint sequence is SEQ ID NO:24. For probe SEQ ID NO:23 (FIG. 2B), the best performing splint sequence is SEQ ID NO:31. The closer the ligation point is located to the beginning of the probe sequence, the higher the dCq value. Compared to SEQ ID NO:22, probe SEQ ID NO:23 has a longer region of complementarity with the target, 23 base pairs compared to 17 base pairs, resulting in a higher dCq value. [Diagram 3] FIG. 1 shows the results of Example 3, showing the Cq difference (dCq) values ​​observed between wild type and mutant containing samples for two different mutant allele fractions (AF) for two different probe / sprint combinations, namely SEQ ID NO:22 / SEQ ID NO:24 and SEQ ID NO:23 / SEQ ID NO:44. Probes SEQ ID NO:22 and 23 have complementary regions of 17 and 35 bases in length with the target molecule, respectively. The higher the number of complementary bases / longer the length of the complementary region, the higher the dCq values ​​seen for AF concentrations of 0.1% and 0.5% of the target molecule. [Figure 4]Schematic of the method in action. A pre-hybridized probe sequence is introduced to the target. If the end of A0 is perfectly complementary (Figure 4a), the end is shortened. The shortened end of A1 can be displaced intramolecularly by sequence C. C forms a splint across the end of A1, allowing A1 to circularize and forming a circular product A2. If the end of A0 is not perfectly complementary to the target (Figure 4b), the probe is shortened only up to the mismatch. The end of C cannot displace the target from A1 and no circular product is formed. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] In one aspect of the invention, a molecular system for detecting a target polynucleotide sequence in a given nucleic acid analyte is provided, comprising a probe molecule (A0) and a hybridized splint molecule (C), a. A0 has a 3' end complementary to a target polynucleotide sequence, a loop region, and a 5' phosphate; bC hybridizes to the 5' end of A0 and provides a single-stranded 3' overhang; A molecular system is provided in which the single-stranded 3' overhang is capable of hybridizing to a region located 1 to 50 bases in the 5' direction from the 3' end of A0.

[0011] In some embodiments, the 5' end of A0 is resistant to exonuclease degradation. In some embodiments, A0 and C hybridize at the 5' end of A0 over a region comprising a minimum of five complementary nucleotides.

[0012] In some embodiments, the single-stranded 3' overhang of C is complementary to a region located 1-50 bases in the 5' direction from the 3' end of A0 over a region containing a minimum of 5 complementary nucleotides.

[0013] In some embodiments, the region of complementarity is a minimum of 7 nucleotides in length. In some embodiments, the 3' end of A0 is complementary to a region of a gene or chromosome within the DNA or RNA of a cancerous tumor cell.

[0014] In some embodiments, the 3' end of A0 is complementary to a region of a gene that encodes a mutation found in non-small cell lung cancer (NSCLC). In some embodiments, the 3' end of A0, or a portion of the 3' end of A0, is complementary to a gene described subsequently.

[0015] In one embodiment, a panel is provided that includes a plurality of molecular systems. In one embodiment, a panel comprising a plurality of molecular systems for detecting a plurality of target polynucleotide sequences in a given nucleic acid analyte, each of the plurality of molecular systems comprising a probe molecule (A0) and a hybridized splint molecule (C); a. each A0 has a different 3' end, loop region, and 5' phosphate complementary to one of the target polynucleotide sequences; bC hybridizes to the 5' end of A0 and provides a single-stranded 3' overhang having a variable sequence; A panel is provided in which the single-stranded 3' overhang is capable of hybridizing to a region located within a loop region of 1 to 50 bases in the 5' direction from the 3' end of A0.

[0016] In one embodiment, a method for detecting a target polynucleotide sequence in a given nucleic acid analyte is provided, comprising employing a molecular system as described above or subsequently, i) introducing a sample into a reaction mixture containing a molecular system; ii) removing complementary nucleotides that are fully hybridized to the target from the 3' end of A0 by treating A0 with an enzyme for pyrophosphorolysis to form a shortened probe A1; iii) displacing the 3' end of A1 from the target using C; iv) ligating the ends of A1 to form a circle using pre-hybridized C to form circular A2; v) detecting the presence of A2; A method is provided that includes:

[0017] In one embodiment, a method for detecting a target polynucleotide sequence in a given nucleic acid analyte employs a panel of molecular systems as described herein, comprising: i) introducing a sample into a reaction mixture comprising a panel of molecular systems; ii) removing complementary nucleotides that are fully hybridized to the target from the 3' end of A0 by treating A0 with an enzyme for pyrophosphorolysis to form a shortened probe A1; iii) displacing the 3' end of A1 from the target using C; iv) ligating the ends of A1 to form a circle using pre-hybridized C to form circular A2; v) detecting the presence of A2; A method is provided, comprising:

[0018] In some embodiments, the reaction mixture that includes the molecular system is referred to as a first reaction mixture. In some embodiments, detecting the presence of A2 is achieved by adding the product of step (iv) to a second reaction mixture, said second reaction mixture comprising a reagent that allows for the detection of A2.

[0019] In some embodiments, the reaction mixture comprising the molecular system further comprises a pyrophosphorolytic enzyme, hi some embodiments, the reaction mixture further comprises a pyrophosphate ion source.

[0020] In some embodiments, the target region of RNA present in the biological sample is reverse transcribed into DNA by reverse transcriptase prior to introduction into a reaction mixture containing a molecular system. In some embodiments, this is accomplished through the use of a reverse transcriptase and appropriate nucleotides.

[0021] In some embodiments, a target region of RNA present in a sample is transcribed into DNA concomitant with PCR-mediated amplification of the target nucleic acid present in the sample. In some embodiments, transcription of any target region of RNA present in the sample into DNA occurs in a separate step from any PCR-mediated amplification of target nucleic acid present in the sample.

[0022] In some embodiments of any of the methods described previously or subsequently, the target region of RNA present in the sample is not transcribed into DNA. In such an embodiment, A0 undergoes pyrophosphorolysis on the RNA sequence to form the partially digested strand A1, after which the method proceeds as previously or subsequently described.

[0023] In some embodiments, the target polynucleotide comprises a site of a genetic mutation, which mutation is present at a lower level in the sample compared to the wild-type sequence. In some embodiments, A2 is between 20 and 200 nucleotides in length.

[0024] In some embodiments, A2 is between 40 and 100 nucleotides in length. In some embodiments, after (iv), an exonuclease is used to digest all non-circularized nucleic acid material.

[0025] In some embodiments, A0 has a 5' end that is resistant to exonuclease degradation and uses a 5'-3' exonuclease to digest all nucleic acid molecules that are not rendered resistant to this exonuclease degradation.

[0026] In some embodiments, the exonuclease used has an activity that is at least partially dependent on the presence of a 5' phosphate group and the digestion is carried out in the presence of a kinase and a phosphate donor.

[0027] In some embodiments, step (ii) is carried out in the presence of a phosphatase or a diphosphohydrolase. In some embodiments, the pyrophosphorolysis reaction is stopped after step (ii) through the addition of pyrophosphatase.

[0028] In some embodiments, after step (iv), detection of A2 is via nucleic acid amplification. In some embodiments, step (v) comprises using one or more oligonucleotide-conjugated dyes or molecular probes.

[0029] In some embodiments, multiple molecular systems are used, each comprising an A0 selective for a different target sequence, each A0 comprising an identifying region. In some embodiments, the identified region is characterized using a molecular probe or through sequencing.

[0030] In some embodiments, the identification region is used as a priming site for nucleic acid amplification, thereby allowing the presence and identity of A2 to be determined. In some embodiments, (v) comprises the steps of: i. labeling the amplification products from A2 using one or more oligonucleotide fluorescent conjugated dyes or molecular probes; ii. measuring a fluorescent signal; iii. exposing the amplification products from A2 to a set of denaturing conditions; iv. identifying the polynucleotide target sequence in the analyte by monitoring a change in fluorescent signal during exposure to denaturing conditions; Further includes:

[0031] In some embodiments, prior to step (ii), the analyte is divided into multiple reaction volumes, each volume having a different molecular system in which a different probe oligonucleotide A0 is introduced for detecting a different target sequence, where the different probes A0 contain a common priming site for amplification, thereby allowing a single or a single set of amplification primers to be used for detection of A2.

[0032] In some embodiments, the molecular system comprises: - Ligase, - a pyrophosphorylation enzyme; - a source of ions suitable for driving the pyrophosphorolysis reaction; - With appropriate buffers A kit is provided comprising:

[0033] In some embodiments, the kit further comprises dNTPs and a polymerase. In some embodiments, prior to (i), the sample is introduced into a reaction mixture comprising one or more primers, deoxynucleotide triphosphates (dNTPs), and an amplification enzyme, and prior to step (i), nucleic acid analytes present in the sample undergo amplification. In some embodiments, the products of this amplification are then treated with a proteinase prior to (i).

[0034] In some embodiments, the sample is treated with a proteinase prior to step (i). In some embodiments, the sample is treated with a proteinase during step (i). In some embodiments, the sample is treated with a proteinase after step (i).

[0035] In some embodiments, the proteinase is heat inactivated prior to step (i). In some embodiments, the second reaction mixture comprises: - at least one single-stranded primer oligonucleotide, deoxynucleotide triphosphates (dNTPs), and an amplification enzyme; or - Reagents suitable for hybridization chain reaction (HCR), or - Reagents suitable for ligation chain reaction (LCR) wherein the pyrophosphorolytic enzyme is optionally the same enzyme that performs the amplification.

[0036] In some embodiments, the deoxynucleotide triphosphate (dNTP) is a hot-start dNTP. A hot-start deoxynucleotide triphosphate (dNTP) is a dNTP modified at the 3' end with a heat-labile protecting group. The presence of this modification blocks DNA polymerase nucleotide incorporation until the nucleotide protecting group is removed using a heat activation step.

[0037] In one embodiment, the second reaction mixture further comprises components for a hybridization chain reaction (HCR). In this embodiment, the second reaction mixture further comprises hairpin oligonucleotide 1 (HO1) and hairpin oligonucleotide 2 (HO2), each of which comprises a fluorophore and a quencher, and where the fluorophore and quencher are in contact with each other when each oligonucleotide is held in a hairpin configuration. HO1 is designed such that A2 anneals with HO1, opening the "hairpin" structure and separating the fluorophore from the quencher, where the now "open" HO1 can now anneal with HO2, opening the "hairpin" structure and separating the fluorophore from the quencher.

[0038] In this embodiment, multiple hairpin oligonucleotides are present such that the presence of one A2 can trigger a chain reaction of opening of the hairpin oligonucleotides, resulting in the production of a detectable fluorescent signal, a method known in the literature as hybridization chain reaction (HCR).

[0039] In some embodiments, the fluorophore of the fluorophore-quencher pair is selected from, but not limited to, the fluorescein family, the carboxyrhodamine family, the cyanine family, and the rhodamine family of dyes. Other dye families that can be used include, for example, polyhalofluorescein family dyes, hexachlorofluorescein family dyes, coumarin family dyes, oxazine family dyes, thiazine family dyes, squaraine family dyes, chelating lanthanide family dyes, the dye family available from Molecular Probes under the trade name Alexa Fluor J, the dye family available from ATTO-TEC (Siegen, Germany) under the trade name Atto, and the dye family available from Invitrogen (Carlsbad, Calif.) under the trade name Bodipy J. Dyes of the fluorescein family include, for example, 6-carboxyfluorescein (FAM), 2',4',1,4-tetrachlorofluorescein (TET), 2',4',5',7',1,4-hexachlorofluorescein (HEX), 2',7'-dimethoxy-4',5'-dichloro-6-carboxyrhodamine (JOE), 2'-chloro-5'-fluoro-7',8'-fused phenyl-1,4-dichloro-6-carboxyfluorescein (NED), 2'-chloro-7'-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC), 6-carboxy-X-rhodamine (ROX), and 2',4',5',7'-tetrachloro-5-carboxy-fluorescein (ZOE). Dyes of the carboxyrhodamine family include tetramethyl-6-carboxyrhodamine (TAMRA), tetrapropano-6-carboxyrhodamine (ROX), Texas Red, R110, and R6G. Dyes of the cyanine family include Cy2, Cy3, Cy3.5, Cy5, Cy5.5, and Cy7.Fluorophores are readily commercially available from, for example, Perkin-Elmer (Foster City, Calif.), Molecular Probes, Inc. (Eugene, Oreg.), and Amersham GE Healthcare (Piscataway, NJ).

[0040] In some embodiments, the quencher of the fluorophore-quencher pair can be a fluorescent quencher or a non-fluorescent quencher. Fluorescent quenchers include, but are not limited to, TAMRA, ROX, DABCYL, DABSYL, cyanine dyes including nitrothiazole blue (NTB), anthraquinone, malachite green, nitrothiazole, and nitroimidazole compounds. Exemplary non-fluorescent quenchers that dissipate the energy absorbed from the fluorophore include those available from Biosearch Technologies, Inc. (Novato, CA) under the trade name Black Hole™, those available from Epoch Biosciences (Bothell, WA) under the trade name Eclipse™ Dark, those available from Anaspec, Inc. (San Jose, CA) under the trade name Qx1J, those available from Integrated DNA Technologies (Coralville, IA) under the trade names ZEN and TAO, and those available from Integrated DNA Technologies (Coralville, IA) under the trade name Iowa Black™.

[0041] In some embodiments, the fluorophore of the fluorophore-quencher pair can be fluorescein, lucifer yellow, B-phycoerythrin, 9-acridine isothiocyanate, lucifer yellow VS, 4-acetamido-4'-isothio-cyanatostilbene-2,2'-disulfonic acid, 7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin, succinimidyl 1-pyrenebutyrate, and 4-acetamido-4'-isothiocyanatostilbene-2-,2'-disulfonic acid derivatives.

[0042] In some embodiments, the fluorophore of the fluorophore-quencher pair can be LC-Red 640, LC-Red 705, Cy5, Cy5.5, lissamine rhodamine B sulfonyl chloride, tetramethylrhodamine isothiocyanate, rhodamine x isothiocyanate, erythrosine isothiocyanate, fluorescein, diethylenetriaminepentaacetate, or other chelates of a lanthanide ion (e.g., europium or terbium).

[0043] In some embodiments, the present invention utilizes a doubly quenched fluorescently labeled oligonucleotide.The inclusion of the second internal quencher shortens the distance between the dye and the quencher, and in cooperation with the first quencher, provides greater overall dye quenching, reducing background and increasing signal detection.The second and first quenchers can be any of the quenchers previously described.

[0044] In one embodiment, the second reaction mixture comprises: - an oligonucleotide A, comprising a substrate arm, a partial catalytic core, and a sensor arm; an oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; - a substrate comprising a fluorophore-quencher pair; wherein the sensor arms of oligonucleotides A and B are complementary to the flanking regions of A2, such that in the presence of A2, oligonucleotides A and B combine to form a catalytic multicomponent nucleic acid enzyme (MNAzyme). In this embodiment, the MNAzyme forms only in the presence of A2 and cleaves a substrate that contains a fluorophore-quencher pair such that a detectable fluorescent signal is generated.

[0045] In some embodiments, the fluorophore-quencher pair can be as previously described. In some embodiments, reaction mixtures of the invention are combined such that pyrophosphorolysis, ligation, and production of a detectable fluorescent signal occur without the addition of further reagents.

[0046] In an alternative embodiment, the second reaction mixture comprises a partially double-stranded nucleic acid construct, - one strand comprises at least one RNA base, at least one fluorophore, and a region of this strand is complementary to a region of A2, this strand may be called the "substrate" strand; - the other strand comprises at least one quencher, a region of this strand being complementary to a region of A2 adjacent to the region to which the substrate strand is complementary, such that in the presence of A2 the partially double-stranded nucleic acid construct becomes substantially more double-stranded; Further included are nucleic acid constructs in which, in the process of becoming substantially more double-stranded, the substrate strand of the double-stranded nucleic acid construct is cleaved at an RNA base such that at least one quencher on the "other" strand is no longer in sufficient proximity to at least one fluorophore on the substrate strand, resulting in fluorescence.

[0047] In other words, a partially double-stranded nucleic acid construct has a larger double-stranded portion in the presence of A2. In some embodiments, the fluorophore-quencher pair can be as previously described.

[0048] In some embodiments, additional reagents, such as appropriate buffers and / or ions, are present in the second reaction mixture. In some embodiments, the reaction mixture comprises Mg 2+ It further comprises ions.

[0049] In some embodiments, the reaction mixture comprises Zn 2+ It further comprises ions. In some embodiments, the reaction mixture comprises X 2+ ion, and X is a metal. In some embodiments, the reaction mixture comprises one or more X 2+ ion, and X is a metal.

[0050] In an alternative embodiment, the second reaction mixture further comprises reagents for ligase chain reaction (LCR). In some embodiments, the second reaction mixture comprises: a. one or more ligases; b. two or more LCR probe oligonucleotides complementary to adjacent sequences on A2, where the probes are successfully annealed to A2 such that the 5' phosphate of one LCR probe is directly adjacent to the 3' OH of the other LCR probe; Includes.

[0051] In some embodiments, in the presence of A2, the two LCR probes are successfully annealed with A2 and ligated together to form one oligonucleotide molecule, which then serves as the new target for the second round of covalent ligation, resulting in the geometric amplification of the target of interest, in this case A2.The ligated product, or amplicon, is complementary to A2 and serves as the target in the next amplification cycle.Therefore, the exponential amplification of specific target DNA sequence is achieved through repeated cycles of denaturation, hybridization and ligation in the presence of excess LCR probe.This implies the presence of A2, and thus the presence of target polynucleotide sequence.

[0052] In some embodiments, in the presence of A2, the two PCR probes successfully anneal with A2 and are ligated together to form one oligonucleotide molecule, which then serves as the new target for a second round of covalent ligation, resulting in geometric amplification of the target of interest, in this case A2, which is then detected.

[0053] In some embodiments, the ligated oligonucleotide molecules are detected in real time using an intercalating dye. In some embodiments, the ligated oligonucleotide molecules are detected using gel electrophoresis.

[0054] Those skilled in the art will appreciate that there are numerous techniques that will allow for detection of ligated oligonucleotide molecules. In some embodiments, the deoxynucleotide triphosphate (dNTP) is a hot-start dNTP.

[0055] In some embodiments, the one or more ligases are thermostable. In some embodiments, the one or more ligases are naturally occurring. In another embodiment, the ligase or ligases are engineered.

[0056] In some embodiments, the one or more ligases are selected from any of the ligases previously or subsequently disclosed. In some embodiments, the one or more polymerases are thermostable.

[0057] In some embodiments, the one or more polymerases are selected from any of the polymerases previously or subsequently disclosed. In some embodiments, the one or more polymerases are naturally occurring.

[0058] In another embodiment, the polymerase or polymerases are engineered. In some embodiments, the polymerase or polymerases are the same as those used for pyrophosphorolysis.

[0059] In some embodiments, the one or more enzymes of the present invention are hot-start enzymes. In some embodiments, the enzyme or enzymes of the invention are thermostable. In an alternative embodiment, the second reaction mixture comprises: a. A splint oligonucleotide comprising a fluorophore-quencher pair that is complementary to A2; b. a double-strand-specific DNA digestive enzyme; In the presence of A2, the splint oligonucleotide is digested such that the fluorophore-quencher pair separates and the fluorescent signal, and thus the presence of A2, becomes detectable.

[0060] In some embodiments, the fluorophore-quencher pair can be as described above.In some embodiments, the double-stranded specific DNA digestion enzyme is an exonuclease.In another embodiment, the double-stranded specific DNA digestion enzyme is a polymerase with proofreading activity.In another embodiment, the reaction mixture comprises one or more mixtures of exonucleases or polymerases with proofreading activity.

[0061] In some embodiments, the double-strand-specific DNA digestive enzyme is a hot-start enzyme. In some embodiments, the double-strand-specific DNA digestive enzyme has reduced activity at the temperature at which the pyrophosphorolysis reaction of the method occurs.

[0062] In some embodiments, the double-strand-specific DNA digestive enzyme has no activity at the temperature at which the pyrophosphorolysis reaction of the method occurs. In some embodiments, the 3' end of A0 is perfectly complementary to the target polynucleotide sequence.

[0063] In some embodiments, the ligase substantially lacks single-stranded ligation activity. In some embodiments, the reaction mixture containing the partially digested chain A1 is introduced to inorganic pyrophosphatase before or during the detection step.

[0064] In chemical science, methylation refers to the addition of a methyl group to a substrate or the replacement of an atom or group with a methyl group. Methylation is a form of alkylation in which a methyl group is specifically used to replace a hydrogen atom rather than a larger carbon chain. These terms are commonly used in chemistry, biochemistry, soil science, and biological science.

[0065] In biological systems, methylation is catalyzed by enzymes. Such methylation may be involved in heavy metal modification, regulation of gene expression, regulation of protein function, and RNA metabolism. Heavy metal methylation may also occur outside of biological systems. Chemical methylation of tissue samples is also a method to reduce certain histological staining artifacts.

[0066] Aberrant DNA methylation profiles have been linked to a number of diverse and complex disease states. In oncology, hypermethylation of tumor suppressor genes in serum DNA can be used as a diagnostic marker for small cell lung cancer. Aberrant DNA methylation of cells of the immune system is found in patients with immune diseases such as diabetes, rheumatoid arthritis (RA), and systemic lupus erythematosus (SLE). Differential DNA methylation (a measure of total DNA methylation) of peripheral blood leukocytes (PBLs) at the repetitive elements ALU, LINE-1, and Satellite 2 has been found to be associated with ischemic heart disease.

[0067] DNA methylation in vertebrates typically occurs at CpG sites (cytosine-phosphate-guanine sites, i.e., where a cytosine is immediately followed by a guanine in the DNA sequence), and this methylation results in the conversion of cytosine to 5-methylcytosine. The formation of Me-CpG is catalyzed by the enzyme DNA methyltransferase. Although the majority of mammalian DNA has approximately 40% of its CpG sites methylated, there are specific regions (composed of approximately 65% ​​CG residues) known as GC-rich CpG islands, where no methylation is present. These are associated with the promoters of 56% of mammalian genes, including all ubiquitously expressed genes. 1-2% of the human genome is CpG clustered, and an inverse relationship exists between CpG methylation and transcriptional activity.

[0068] DNA methylation involves the addition of a methyl group to the 5 position of a cytosine pyrimidine ring or the 6 nitrogen of an adenine purine ring. This modification can be inherited through cell division. DNA methylation is typically removed during zygote formation and re-established through successive cell divisions during development. DNA methylation is a crucial part of normal biogenesis and cell differentiation in higher organisms. DNA methylation stably alters gene expression patterns in cells so that the cells can "remember where they've been." In other words, cells that are programmed to be islets during embryonic development will remain islets throughout the life of the organism, even if no ongoing signals tell them they need to remain islets. Furthermore, DNA methylation suppresses the expression of viral genes and other deleterious elements that have been incorporated into the host's genome over time. DNA methylation also forms the basis of the chromatin structure that allows cells to form the myriad characteristics necessary for multicellular life from a single immutable sequence of DNA. DNA methylation also plays a key role in the development of nearly all types of cancer.

[0069] Bisulfite sequencing is the use of bisulfite treatment of DNA to determine DNA methylation patterns. DNA methylation was the first epigenetic mark to be discovered and remains the most studied. It has also been linked to the repression of transcriptional activity.

[0070] Among several mRNA modifications, the N6-methyladenosine (m6A) modification is the most common type in eukaryotes and nuclear replicating viruses. m6A plays a prominent role in several cancer types, including leukemia, brain cancer, liver cancer, breast cancer, and lung cancer.

[0071] While 5-methylcytosine (5mC) is the most studied epigenetic modification, 5mC is oxidized to 5-hydroxymethylcytosine (5hmC) by the catalytic action of TET (ten-eleven translocation) enzymes. Studies have shown that the distribution of 5hmC is tissue-specific, with differences in the distribution of 5hmC in various organs and tissues. Decreased expression of 5hmC in malignant tissues has been consistently shown in a wide range of different cancers, including melanoma. By evaluating a total of 15 paired normal and carcinoma samples in human breast tissues, the study showed that the levels of 5hmC were dramatically reduced in the cancer group compared to healthy breast tissue.

[0072] Treatment of DNA with bisulfite converts cytosine residues to uracil, while 5-methylcytosine residues remain unaffected. Thus, bisulfite treatment introduces specific changes in the DNA sequence that depend on the methylation state of individual cytosine residues, giving single-nucleotide resolution information on the methylation state of the DNA segment. Various analyses can be performed on the altered sequence to extract this information. The analysis of interest is therefore attributable to discriminating between single-nucleotide polymorphisms (cytosine and thymine) resulting from bisulfite conversion. Since 5hmC is converted to 5mC upon bisulfite treatment, which is read as C when sequenced, it is not possible to distinguish between 5hmC and 5mC. As it is a composite of 5mC and 5hmC, the output from bisulfite sequencing can no longer be defined simply as DNA methylation. The development of Tet-assisted oxidative bisulfite sequencing now makes it possible to discriminate between the two modifications with single-base resolution.

[0073] 5hmC can be detected using TET-assisted bisulfite sequencing (TAB-seq). Fragmented DNA is enzymatically modified using sequential T4 phage β-glucosyltransferase (T4-BGT), followed by ten-eleven translocation (TET) dioxygenase treatment, followed by the addition of sodium bisulfite. T4-BGT glucosylates 5hmC to form beta-glucosyl-5-hydroxymethylcytosine (5ghmC), which is then oxidized to 5caC using TET. Only 5ghmC is protected from subsequent deamination by sodium bisulfite, allowing 5hmC to be distinguished from 5mC by sequencing.

[0074] Oxidative bisulfite sequencing (oxBS) provides an alternative method for distinguishing between 5mC and 5hmC. The oxidative reagent potassium perruthenate converts 5hmC to 5-formylcytosine (5fC), and subsequent sodium bisulfite treatment deaminates 5fC to uracil. 5mC remains unchanged and can therefore be identified using this method.

[0075] APOBEC-coupled epigenetic sequencing (ACE-seq) completely excludes bisulfite conversion and relies on enzymatic conversion to detect 5hmC. In this method, T4-BGT glucosylates 5hmC to 5ghmC, protecting it from deamination by apolipoprotein B mRNA editing enzyme subunit 3A (APOBEC3A). Cytosine and 5mC are deaminated by APOBEC3A and sequenced as thymine.

[0076] TET-assisted 5-methylcytosine sequencing (TAmC-seq) enriches for 5mC loci and utilizes two sequential enzymatic reactions followed by affinity pull-down. Fragmented DNA is treated with T4-BGT, which protects 5hmC by glycosylation. The enzyme mTET1 is then used to oxidize 5mC to 5hmC, and T4-BGT labels the newly formed 5hmC with a modified glucose moiety (6-N3-glucose). Click chemistry is used to introduce a biotin tag, which allows for the enrichment of 5mC-containing DNA fragments for detection and whole-genome profiling.

[0077] Methylome analysis methods are broadly divided into three groups: restriction enzyme-based, chromatin immunoprecipitation-based (ChIP), or affinity-based and bisulfite conversion (gene-based). Restriction enzyme-based methods are applied to any genome without knowing the DNA sequence, and methylation-sensitive restriction enzymes for small / large scale DNA methylation analysis by combining the use of methylation-sensitive restriction enzyme experimental techniques (RLGS, DMH, etc.) for total methylation analysis. However, large amounts of genomic DNA are required, making this method unsuitable for the analysis of samples where small amounts of DNA are recovered. On the other hand, ChIP-based methods are useful for the identification of differentially methylated regions in tumors through the precipitation of protein antigens from solution by using antibodies directed against proteins. These methods are protein-based and have been widely applied in cancer research.

[0078] Affinity enrichment is a technique often used to isolate methylated DNA from the rest of the DNA population. This is usually accomplished by antibody immunoprecipitation methods or with methyl-CpG binding domain (MBD) proteins.

[0079] Methylated DNA immunoprecipitation (MeDIP) is an antibody immunoprecipitation method that utilizes 5-methylcytidine antibodies to specifically recognize methylated cytosines. The MeDIP kit requires that the input DNA sample is single-stranded in order for the 5-methylcytidine (5-mC) antibody to bind.

[0080] Another method for enrichment of methylated DNA fragments uses recombinant methyl-binding protein MBD2b or the MBD2b / MBD3L1 complex. One advantage of the methyl-CpG binding protein enrichment strategy is that it is not necessary to denature the input DNA sample. The protein is able to recognize methylated DNA in its native double-stranded form. Another advantage is that to ensure enrichment of methylated CpG DNA, the MBD protein binds only DNA that is methylated in a CpG background, making this technique ideal for studying CpG islands.

[0081] In some embodiments, one or more nucleic acid analytes are selectively modified prior to or during step (i) of the methods of the invention. In some embodiments, before or during step (i), unmethylated cytosine bases in one or more nucleic acid analytes are chemically or enzymatically converted.

[0082] In one embodiment, unmodified cytosine bases are converted to uracil by a methyltransferase enzyme. In one embodiment, the enzyme is M.Sssl.

[0083] In one embodiment, unmodified cytosine bases are converted to uracil by a deaminase enzyme. The enzymatic methyl-seq workflow relies on the ability of APOBEC to deaminate cytosine to uracil. APOBEC also deaminates 5mC and 5hmC, making it impossible to distinguish between cytosine and its modified forms. To detect 5mC and 5hmC, the method also utilizes TET2 and oxidative enhancers, which enzymatically modify 5mC and 5hmC to forms that are not APOBEC substrates. The TET2 enzyme converts 5mC to 5caC, and the oxidative enhancer converts 5hmC to 5ghmC. Ultimately, cytosine is sequenced as thymine, and 5mC and 5hmC are sequenced as cytosine, thereby protecting the integrity of the original 5mC and 5hmC sequence information.

[0084] In one embodiment, prior to or during step (i), one or more nucleic acid analytes are introduced to an epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease. In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is McrBC.

[0085] In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is a member of the MspJI family. In one embodiment, the endonuclease is AspBHI.In one embodiment, the endonuclease is FspEI.

[0086] In one embodiment, the endonuclease is LpnPI. In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is a member of the PvuRts1I / AbaS family.

[0087] In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is a type IIM endonuclease. In one embodiment, the endonuclease is DpnI.

[0088] In one embodiment, the endonuclease is BisI. In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is a type IV endonuclease.

[0089] In one embodiment, the endonuclease is EcoKMcrBC. In one embodiment, the endonuclease is SauUSI. In one embodiment, the endonuclease is GmrSD.

[0090] In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is selected from the DpnII restriction endonuclease family. In one embodiment, the endonuclease is DpnII.

[0091] In one embodiment, the endonuclease is DpnI. In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is HpaI.

[0092] In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is HpaII. In some embodiments, one or more nucleic acid analytes are introduced to a methylation-sensitive or methylation-dependent restriction endonuclease prior to or during step (i).

[0093] In some embodiments, prior to or during step (i), one or more nucleic acid analytes are introduced to a methylation-sensitive or methylation-dependent restriction endonuclease, followed by selective amplification of target polynucleotide sequences containing the methylation state of interest through methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) of methylated DNA.

[0094] In some embodiments, the population of methylated or unmethylated nucleic acid analytes is reduced prior to or during step (i). In some embodiments, the reduction is performed using methylated DNA immunoprecipitation (MeDIP).

[0095] In some embodiments, the reduction is carried out using a methyl-binding protein, such as MBD2b or the MBD2b / MBD3L1 complex. It will be clear to those skilled in the art that the present invention can be extended to detect any epigenetic modification and is not limited to the detection of the methylation state of target polynucleotide sequence.For example, the present invention can be equally adapted to detect other epigenetic modifications, including hydroxymethylation, such as the hydroxylated form of 5mC (5-hmC).This recently recognized form of epigenetic modification is an important epigenetic marker that affects gene expression and is distinct from CpG methylation.Other epigenetic modifications, such as methyl adenosine, appear on RNA and can be detected by the method of the present invention.

[0096] In some embodiments, the method according to the invention is one in which the epigenetic modification is methylation. In further embodiments, the epigenetic modification is methylation at a CpG island or by hydroxymethylation at a CpG island.

[0097] In some embodiments, the epigenetic modification is methylation of adenines in either RNA or DNA. In some embodiments, one or more oligonucleotides of the invention are rendered resistant to pyrophosphorolysis and / or exonuclease digestion by the presence of one or more quenchers.

[0098] In some embodiments, after addition of an appropriate wash buffer, the resulting reaction mixture is mixed. In some embodiments, the resulting reaction mixture is mixed by vortexing. In some embodiments, the resulting reaction mixture is mixed by the movement of one or more magnetic beads present in the mixture.

[0099] In some embodiments, each wash step involves use of a wash buffer comprising one or more of Tris HCL pH 7.5-8.0, 5-20 mM, NaCL 0.4-2 M, EDTA 0.1-1 mM, and / or Tween 20 0-0.1%.

[0100] In some embodiments of any of the methods described previously or subsequently, one or more reaction mixtures may be combined. In some embodiments, oligonucleotide C further comprises a 3' or internal modification that protects it from 3'-5' exonuclease digestion.

[0101] In some embodiments, oligonucleotide C further comprises a 5' modification that protects it from 5'-3' exonuclease digestion. In some embodiments, oligonucleotide C further comprises a 3' mismatch to A0, or a 3' modification, which prevents extension of oligonucleotide C.

[0102] In some embodiments, the method further comprises a two-step amplification performed between steps (iv) and (v). In some embodiments, the reaction volume is divided into two or more separate volumes prior to the second amplification.

[0103] One of skill in the art will appreciate that there are a multitude of 3' modifications that can be used to prevent elongation. In some embodiments, the second reaction mixture further comprises a 5'-3' exonuclease, rendering the 5' end of A0 resistant to 5'-3' exonuclease digestion.

[0104] In some embodiments, before or during the final step, the product of the previous step is treated with pyrophosphatase. In some embodiments, before or during the final step, the product of the previous step is treated with an exonuclease.

[0105] In some embodiments, detection is accomplished using one or more oligonucleotide fluorescent conjugated dyes or molecular probes. In some embodiments, the increase in signal over time resulting from the generation of A2 amplicons is used to infer the concentration of the target sequence in the analyte.

[0106] In some embodiments, multiple molecular systems are used that include probe molecules A0, each A0 being selective for a different target sequence and containing an identification region, and further, the amplicon of A2 contains an identification region, thus inferring the target sequence present in the analyte through detection of the identification region.

[0107] In some embodiments that use multiple probes A0, multiple blocking oligonucleotides are also used. In some embodiments, detection of the identified region is performed using a molecular probe or through sequencing.

[0108] In some embodiments, the identification region is used as a priming site to allow for detection and identification of A2. In some embodiments, the final step of the method further comprises: v. labeling the product of the previous step with one or more oligonucleotide fluorescent binding dyes or molecular probes; vi. Measuring the fluorescent signal of the product; vii. exposing the product to a set of denaturing conditions; Identifying the polynucleotide target sequence in the analyte by monitoring the change in the fluorescent signal of the product during exposure to denaturing conditions.

[0109] In some embodiments, one or more nucleic acid analytes are divided into multiple reaction volumes, each volume having one or more molecular systems introduced to detect different target sequences.

[0110] In some embodiments, one or more nucleic acid analytes are divided into multiple reaction volumes, each volume having one or more molecular systems. In some embodiments, different molecular systems that include probe molecule A0 contain a common priming site, allowing a single primer or a single set of primers to be used for amplification of a region of A2.

[0111] In an alternative embodiment, the second reaction mixture further comprises one or more partially double-stranded DNA constructs, each of which contains one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are located in sufficiently close proximity to each other such that sufficient quenching of the one or more fluorophores occurs.

[0112] In some embodiments, the construct is a single strand of DNA that has a self-complementary region that folds back onto itself. In some embodiments, the construct comprises one primer of a primer pair.

[0113] In some embodiments, the second reaction mixture further comprises the other primer of the primer pair. In some embodiments, a portion of the single-stranded portion of the construct hybridizes with A2 and is extended by DNA polymerase to A2. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. This primer then extends to the construct, expelling the self-complementary region. Thus, the one or more fluorophores and the one or more dyes are sufficiently separated to detect a fluorescent signal, indicating the presence of A2 in the reaction mixture.

[0114] In such an embodiment, the construct may be known as a Sunrise Primer. In some embodiments, the construct comprises two separate strands of DNA.

[0115] In some embodiments, a portion of the single-stranded portion of the construct hybridizes with A2 and is extended by DNA polymerase to A2. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. This primer then extends to the construct in the direction of the double-stranded portion, displacing the shorter of the DNA strands, thus separating the one or more fluorophores and the one or more dyes sufficiently to detect a fluorescent signal, indicating the presence of A2 in the reaction mixture.

[0116] In such embodiments, the construct may be known as a Molecular Zipper. Those skilled in the art will appreciate that for both the sunrise primer and the molecular zipper, the fluorophore(s) and quencher(s) pairs can be located at various positions within each corresponding construct, the main feature being that each pair is located close enough to each other that in the absence of A2, i.e., when extension and strand displacement are not occurring, no fluorescent signal is emitted.

[0117] In some embodiments of any of the methods described above or subsequently, the RNA present in the sample is not transcribed into DNA. In such embodiments, A0 undergoes pyrophosphorolysis of the RNA sequence to form a partially digested strand A1, after which the method proceeds as described above or subsequently.

[0118] In some embodiments of any of the methods described above or subsequently, one or more reaction mixtures can be combined.According to the present invention, a method for detecting target polynucleotide sequence in a given nucleic acid analyte is further provided.The analyte that can be applied to various methods of the present invention can be prepared from the above-mentioned biological sample by a series of preliminary steps designed to amplify the analyte, and separate it from background genomic DNA that typically exists in significant excess.

[0119] In some embodiments, the target polynucleotide sequence in the analyte is a gene or chromosomal region in the DNA or RNA of a cancerous tumor cell, and will be characterized by the presence of one or more mutations, for example in the form of one or more single nucleotide polymorphisms (SNPs). Thus, the present invention will be useful in monitoring and / or treating disease recurrence. Patients who are declared disease-free after treatment can be monitored over time to detect disease recurrence. This needs to be done non-invasively, requiring sensitive detection of the target sequence from blood samples. Similarly, in some cancers, there are residual cancer cells that remain in the patient after treatment. Using the present invention to monitor the levels of these cells (or cell-free DNA) present in the patient's blood allows for detection of disease recurrence or failure of current treatment and the need to switch to alternative methods.

[0120] In some embodiments, detection of target polynucleotide sequences allows repeated testing of patient samples during disease treatment, allowing early detection of emerging resistance to treatment.For example, epidermal growth factor receptor (EGFR) inhibitors, such as gefitinib, erlotinib, etc., are commonly used as first-line treatment for non-small cell lung cancer (NSCLC).During treatment, tumors often develop mutations in the EGFR gene (e.g., T790M, C797S), which confer resistance to treatment.Early detection of these mutations allows patients to transition to alternative treatments.

[0121] In some embodiments, the target polynucleotide sequence in the analyte will be a gene or chromosomal region within DNA or RNA from the fetus, and will be characterized by the presence of one or more mutations, e.g., in the form of one or more single nucleotide polymorphisms (SNPs).Thus, the present invention may be used to detect mutations at very low allele fractions and at earlier stages of pregnancy than other available testing techniques.

[0122] In another embodiment, the target polynucleotide sequence may be a gene or genomic region derived from an otherwise healthy individual, but the genetic information obtained may aid in the generation of valuable companion diagnostic information to enable medical or therapeutic conclusions to be made across one or more defined groups within the human population.

[0123] In yet another embodiment, the target polynucleotide sequence may be characteristic of an infectious disease or resistance of an infectious disease to treatment with a particular therapy, for example a polynucleotide sequence characteristic of a bacterial or viral gene or chromosomal region, or a mutation therein, that confers resistance to the therapy.

[0124] In some embodiments, the target polynucleotide sequence may be characteristic of donor DNA. If a transplanted organ is rejected by a patient, DNA from the organ will be shed into the patient's bloodstream. Early detection of this DNA will allow early detection of rejection. This can be achieved using a custom panel of donor-specific markers, or by using a panel of variants known to be common in the population, some of which are present in the donor and some in the recipient. Thus, routine monitoring of organ recipients over time is possible with the claimed method.

[0125] The success of organ transplantation may depend on the overall level of cumulative injury to the organ, caused by several events in the donor. This includes age, lifestyle, ischemia / reperfusion injury (IRI), and immune response in the recipient. Studies have shown that IRI causes epigenetic changes in the donor organ. The promoter region of the C3 gene is demethylated in the kidney, which is associated with chronic nephropathy after transplantation. DNA methylation is a major contributor to a balanced immune response to the graft, as it controls the function of cells of the immune system. Thus, detection of the methylation status of specific DNA sequences can enable the identification of patients at risk for post-transplant complications.

[0126] In yet another embodiment, different versions of the method (see below) using different combinations of probes are used in parallel so that analytes can be screened simultaneously for multiple target sequences, for example, cancer sources, cancer indicators, or multiple sources of infectious diseases. In this approach, the amplification products obtained by the parallel application of the method are contacted with a detection panel consisting of one or more oligonucleotide-binding dyes or sequence-specific molecular probes such as molecular beacons, hairpin probes, etc. Thus, in another aspect of the present invention, there is provided the use of at least one probe and optionally one ligation oligonucleotide in combination with one or more chemical and biological probes selective for the target polynucleotide sequence, or in combination with the use of sequencing to identify the amplified probe region.

[0127] In some embodiments, the probe oligonucleotide A0 of the molecular system comprises a priming region and a 3' end that is complementary to the target polynucleotide sequence to be detected. This creates a first intermediate product that is at least partially double-stranded. In some embodiments, this step is carried out in the presence of an excess of the molecular system and in an aqueous medium that contains the analyte and any other nucleic acid molecules.

[0128] During step (ii), the double-stranded region of the first intermediate product is pyrophosphorolyzed in the 3'-5' direction from the 3' end of its A0 strand. As a result, the A0 strand is progressively digested to produce a partially digested strand, hereafter referred to as A1. If the probe oligonucleotide mishybridizes to a non-target sequence, the pyrophosphorolysis reaction will stop at all mismatches, preventing the subsequent steps of the method from proceeding. In another embodiment, this digestion continues until A1 lacks sufficient complementarity with the analyte or the target region therein to form a stable duplex. At this point, the various strands then separate by melting, thereby generating A1. Under typical pyrophosphorolysis conditions, this separation occurs when there are between 6 and 20 complementary nucleotides between the analyte and A0.

[0129] In another embodiment, digestion continues until A1 lacks sufficient complementarity with the analyte or a target region therein for the pyrophosphorolysis enzyme to bind or for the pyrophosphorolysis reaction to continue. This typically occurs when 6-20 complementary nucleotides remain between the analyte and the probe. In some embodiments, this occurs when 6-40 complementary nucleotides remain.

[0130] In one embodiment, digestion continues until the length of complementarity between A1 and the target is reduced to the point where it becomes energetically favorable for oligo C to displace the analyte molecule from A1. This typically occurs when the region of complementarity between A1 and the analyte molecule is of similar or shorter length than the region of complementarity between oligo C and the 3' end of A1, but can also occur when the complementarity between A1 and the analyte molecule is longer due to favoring intramolecular hybridization of oligo C.

[0131] Suitably, pyrophosphorolysis is carried out in a reaction medium at a temperature in the range of 20-90° C. in the presence of a polymerase exhibiting at least pyrophosphorolytic activity and a source of pyrophosphate ions. Further information regarding the pyrophosphorolysis reaction as applied to the digestion of polynucleotides can be found, for example, in J. Biol. Chem. 244 (1969) pp. 3019-3028, or in our previous patent applications.

[0132] In some embodiments, the pyrophosphorolysis step is driven by the presence of an excess source of polypyrophosphate, suitable sources include compounds containing three or more phosphorus atoms.

[0133] In some embodiments, the second reaction mixture includes an excess source of polypyrophosphate. In some embodiments, the pyrophosphorolysis step is driven by the presence of an excess source of modified pyrophosphate. Suitable modified pyrophosphates include those substituted with other atoms or groups in place of the bridging oxygens, or pyrophosphates (or polypyrophosphates) with substitutions or modifying groups on the other oxygens. Those skilled in the art will recognize that there are many such examples of modified pyrophosphates that would be suitable for use in the present invention. Non-limiting options include:

[0134] [ka]

[0135] In some embodiments, the second reaction mixture includes an excess source of modified polypyrophosphate. In a preferred embodiment, the pyrophosphate ion source is PNP, PCP, or Tripolyphoshoric acid (PPPi).

[0136] Further, non-limiting examples of pyrophosphate ion sources for use in the pyrophosphorolysis step (c) can be found in WO2014 / 165210 and WO00 / 49180.

[0137] In some embodiments, the source of excess modified pyrophosphate can be represented as YH, where Y has the general formula (XO)P(=B)-(ZP(=B)(OX)). n -, wherein n is an integer from 1 to 4, each Z- is independently selected from -O-, -NH-, or -CH2-, each B is independently either O or S, and the X groups are independently selected from -H, -Na, -K, an alkyl, an alkenyl, or a heterocyclic group, with the proviso that when Z and B both correspond to -O- and n is 1, then at least one X group is not H.

[0138] In some embodiments, Y has the general formula (XO)P(=B)-(ZP(=B)(OX)) n -, where n is 1, 2, 3, or 4. In another embodiment, the Y group corresponds to the general formula (XO)2P(=O)-ZP(=O)(OH)-, where one of the X groups is -H. In yet another preferred embodiment, Y corresponds to the general formula (XO)2P(=O)-ZP(=O)(OX)-, where at least one of the X groups is selected from methyl, ethyl, allyl, or dimethylallyl.

[0139] In an alternative embodiment, Y corresponds to either the general formula (HO)P(=O)-ZP(=O)(OH)-, where Z is either -NH- or -CH-, or (XO)P(=O)-ZP(=O)(OX)-, where all X groups are either -Na or -K and Z is either -NH- or -CH-.

[0140] In another embodiment, Y corresponds to the general formula (HO)P(=B)-OP(=B)(OH)-, where each B group is independently either O or S, and at least one is S.

[0141] Specific examples of preferred embodiments of Y include those of the formula (X1-O)(HO)P(=O)-ZP(=O)(O-X2), where Z is O, NH, or CH2, and (a) X1 is γ,γ-dimethylallyl and X2 is -H, or (b) X1 and X2 are both methyl, or (c) X1 and X2 are both ethyl, or (d) X1 is methyl and X2 is ethyl, or vice versa.

[0142] In some embodiments, when a molecular probe is used for detection, the probe oligonucleotide A0 component of the molecular system is configured to include an oligonucleotide identification region 5' to the region complementary to the target sequence, and the molecular probe used is designed to anneal to this identification region. In some embodiments, only the 3' region of A0 is capable of annealing to the target, i.e., all other regions lack sufficient complementarity with the analyte for a stable duplex to exist at the temperature at which the pyrophosphorolysis step is performed. Here and throughout, the term "sufficient complementarity" means that to the extent that a given region has complementarity with a given region on the analyte, the region of complementarity is more than 10 nucleotides in length.

[0143] In a further aspect of the method of the invention, an alternative embodiment is provided in which the phosphorolysis step of any previous embodiment is replaced with an exonuclease digestion step using a double-stranded specific exonuclease, which those skilled in the art will appreciate includes those that read in the 3'-5' direction, such as ExoIII, and those that read in the 5'-3' direction, such as lambda Exo, among many others.

[0144] In some embodiments of the invention, when the exonuclease digestion step utilizes a double-strand specific 5'-3' exonuclease, it is the 5' end of A0 that is complementary to the target analyte, and the common priming sequence and blocking group are located on the 3' side of the region complementary to the target. In a further embodiment, when a molecular probe is used for detection, the probe oligonucleotide A0 component of the molecular system is configured to include an oligonucleotide identification region 3' of the region complementary to the target sequence, and the molecular probe used is designed to anneal to this identification region.

[0145] In embodiments of the invention in which the exonuclease digestion step utilises a double-strand specific 5'-3' exonuclease, an exonuclease having 3' to 5' exonuclease activity can optionally be added to the second reaction mixture with the objective of leaving all material, including A0 and the partially digested strand A1, unchanged whilst digesting all other nucleic acid molecules present. Suitably, this resistance to exonuclease degradation is achieved as described elsewhere in this application.

[0146] In a preferred embodiment of the invention, the 5' end of A0 or an internal site 5' to the priming region is rendered resistant to exonuclease degradation. Thereby, and after or simultaneously with the pyrophosphorolysis step, an exonuclease with 5'-3' exonuclease activity can be optionally added to the reaction medium in order to digest all other nucleic acid molecules present while leaving all material, including A0 and the partially digested strand A1, unchanged. Suitably, this resistance to exonuclease degradation is achieved by introducing one or more blocking groups at required points within the oligonucleotide A0. In some embodiments, these blocking groups can be selected from phosphorothioate linkages and other backbone modifications commonly used in the art, C3 spacers, phosphate groups, modified bases, etc.

[0147] In some embodiments, the identification region includes or has embedded therein a barcode region with a unique sequence and is adapted to be identified indirectly using a sequence-specific molecular probe applied to the amplified components A2, or directly by sequencing these components. Examples of molecular probes that can be used include, but are not limited to, molecular beacons, TaqMan® probes, Scorpion® probes, etc.

[0148] In some embodiments, the A2 strand or a desired region thereof undergoes amplification so that multiple copies, typically millions of copies, are made. This is accomplished by priming a region of A2, followed by any amplicon derived therefrom, with a single-stranded primer oligonucleotide, provided, for example, in the form of a forward / reverse or sense / antisense pair that can anneal with a complementary region thereon. The primed strand then becomes the starting point for amplification. Amplification methods include, but are not limited to, thermocycling and isothermal methods such as polymerase chain reaction, recombinase polymerase amplification, and rolling circle amplification, which is applicable when A2 is circularized. Any of these means can easily and rapidly make multiple amplicon copies of a region of A2 and in some cases its sequence complement. The exact methods for carrying out any of these amplification methods are well known to those skilled in the art, and the exact conditions and temperature regimes to be used are readily available in the general literature to guide the reader. Specifically, in the case of polymerase chain reaction (PCR), the method generally involves extending a primer oligonucleotide in the 5'-3' direction against the A2 strand using a polymerase and a source of various single nucleoside triphosphates until a complementary strand is generated, dehybridizing the resulting double-stranded product to regenerate the A2 strand and the complementary strand, repriming the A2 strand and all of its amplicons, and then repeating these extension / dehybridization / repriming steps multiple times to accumulate the concentration of A2 amplicons to a level at which they can be reliably detected.

[0149] In some embodiments, the second reaction mixture further comprises a phosphatase or phosphohydrolase to remove the nucleoside triphosphates generated by the pyrophosphorolysis reaction by hydrolysis, thereby ensuring that the pyrophosphorolysis reaction can continue and not be competed away from the forward polymerization reaction.

[0150] In some embodiments, the product of the previous step is treated with a pyrophosphatase before or during step (v) to hydrolyze pyrophosphate ions and prevent further pyrophosphorolysis from favoring the forward polymerization reaction, In some embodiments, the product of the previous step is treated with an exonuclease before or during step (v).

[0151] In some embodiments, the enzyme that pyrophosphorolyzes A0 to form the partially digested chain A1 also amplifies A2. One of skill in the art will recognize that many such enzymes exist.

[0152] Oligonucleotide A2 is detected, and the information obtained can be used to infer whether polynucleotide target sequence is present or absent in the original analyte and / or its associated properties.For example, this can detect target sequence characteristic of cancerous tumor cells with reference to the specific SNPs that are sought.As a further example, target sequence characteristic of cancerous tumor cells can be detected with reference to the specific methylation sites that are sought.

[0153] In another embodiment, it may detect target sequences (including mutations thereof) characteristic of viral or bacterial genomes. Numerous methods for detecting amplicons or identifying regions of A2 may be used, including sequence-specific molecular probes such as oligonucleotide-binding dyes, fluorescently labeled molecular beacons or hairpin probes. Alternatively, A2 or its amplicons may be directly sequenced using one of the direct sequencing methods described or reported in the art. When using oligonucleotide-binding dyes, fluorescently labeled beacons or probes, it is convenient to detect the resulting signal using an arrangement that includes a stimulating electromagnetic radiation source (laser, LED, lamp, etc.) and a photodetector that is arranged to detect the emitted fluorescence, and generate therefrom a signal that includes a data stream that can be analyzed by a microprocessor or computer using a specifically designed algorithm.

[0154] In some embodiments, detection is accomplished using one or more oligonucleotide fluorescent binding dyes or molecular probes. In such embodiments, the increase in signal over time resulting from the generation of A2 amplicons is used to infer the concentration of the target sequence in the analyte. In some embodiments, the final step of the method further comprises the steps of: i. labeling the product of step (iv) with one or more oligonucleotide fluorescent conjugated dyes or molecular probes; ii. measuring the fluorescent signal of the product; iii. exposing the product to a set of denaturing conditions; Identifying the polynucleotide target sequence in the analyte by monitoring the change in the fluorescent signal of the product during exposure to denaturing conditions.

[0155] In another aspect of the present invention, a method for identifying a target polynucleotide sequence in a given nucleic acid analyte is provided, characterized by the steps of any of the previous embodiments of the present invention: labeling multiple copies of A2 or a region of A2 with one or more oligonucleotide fluorescent binding dyes or molecular probes. Measure the fluorescent signals of these multiple copies, and expose the multiple copies to a set of denaturing conditions. Then, by monitoring the changes in the fluorescent signals of the multiple copies during exposure to the denaturing conditions, identify the target polynucleotide sequence.

[0156] In some embodiments, denaturing conditions may be provided by varying the temperature, e.g., increasing the temperature to the point where the duplex begins to dissociate. Additionally or alternatively, denaturing conditions may be provided by varying the pH so that the conditions are acidic or alkaline, or by adding additives or agents, such as strong acids or bases, concentrated inorganic salts, or organic solvents, e.g., alcohols.

[0157] In another aspect of the invention, there is provided the use of the above-mentioned method for screening a mammalian subject, particularly a human patient, for the presence of an infectious disease, cancer, or for generating companion diagnostic information.

[0158] In a further aspect of the invention, a control probe is provided for use in the above-mentioned method. The embodiments of the invention include those in which the presence of a specific target sequence or sequences is revealed by the generation of a fluorescent signal. In such embodiments, there will necessarily be a certain level of signal generated from non-target DNA present in the sample. In a given sample, this background signal will have a later occurrence than the "true" signal, but this occurrence may vary between samples. Thus, accurate detection of the presence of low concentrations of a target sequence or sequences depends on knowledge of what signal is expected in the absence of the target sequence. While references are available for artificial samples, this is not the case for true "blind" samples from patients. A control probe (E0) is utilized to determine the expected background signal profile of each assay probe. The control probe targets a sequence not expected to be present in the sample, and the signal generated from this probe can be used to infer the expected rate of signal generation from the sample in the absence of the target sequence.

[0159] Accordingly, there is provided a method for detecting a target polynucleotide sequence in a given nucleic acid analyte, comprising the steps of: (a) either subsequently or simultaneously, repeating the steps of the method using a second detection channel, using either a separate aliquot or the same aliquot of the sample, using a single-stranded probe oligonucleotide E0 whose 3'-terminal region is at least partially mismatched with the target sequence; (b) estimating the background signal expected to be generated from a molecular system comprising A in the absence of any target analyte in the sample; (c) inferring the presence or absence of a polynucleotide target sequence in the analyte through comparison of the expected background signal inferred in (a) with the actual signal observed in the presence of the target analyte; There is provided a method according to any of the previously described methods, characterized in that

[0160] In some embodiments, the control probe (E0) and the molecular system comprising A0 are added to separate portions of the sample, while in other embodiments, E0 and the molecular system comprising A0 are added to the same portion of the sample and their respective signals are measured using different detection channels (e.g., different color dyes). The signal generated by E0 can then be used to estimate and correct for the background signal expected to be generated by the molecular system comprising A0 in the absence of the polynucleotide target sequence in the sample. For example, the correction of the background signal can include subtracting the signal observed from E0 from that observed from the molecular system comprising A0, or can be through calibration of the signal observed from the molecular system comprising A0 using a calibration curve of the relative signals generated by the molecular system comprising A0 and E0 under varying conditions.

[0161] In some embodiments, a single E0 can be used to calibrate all assay probes that may be generated. In some embodiments, a separate E0 may be used to calibrate each amplicon of the sample DNA generated in the initial amplification step. Although each amplicon may contain multiple mutations / target sequences of interest, a single E0 is sufficient to calibrate all assay probes against a single amplicon.

[0162] In further embodiments, separate E0 may be used for each target sequence.For example, if C>T mutation is targeted, E0 may be designed to target the C>G mutation at the same site, which is not known to occur in patients.The signal profile generated by E0 under various conditions may be evaluated in calibration reactions, and these data are used to infer the expected signal from the assay probe targeting the C>T mutation when the C>T mutation is not present.

[0163] The specificity of the method of the present invention can be improved by the introduction of blocking oligonucleotides. For example, blocking oligonucleotides can be introduced to hybridize with at least a portion of wild-type DNA and promote annealing only with the target polynucleotide sequence of the molecular system containing A0, but not with the wild type. Alternatively or additionally, blocking oligonucleotides can be used to improve the specificity of the polymerase chain reaction (PCR) to prevent the amplification of all wild-type sequences present. The general technique used is to design an oligonucleotide that anneals between the PCR primers and cannot be displaced or digested by the PCR polymerase. The oligonucleotide is designed to anneal with the non-target (usually healthy) sequence while being mismatched (often by a single base) with the target (mutated) sequence. This mismatch results in different melting temperatures for the two sequences, and the oligonucleotide is designed to dissociate from the target sequence while remaining annealed with the non-target sequence at the PCR extension temperature.

[0164] The blocking oligonucleotide often may have modifications to prevent its digestion by the exonuclease activity of PCR polymerase or to enhance the melting temperature difference between the target and non-target sequences.

[0165] Incorporation of locked nucleic acids (LNAs) or other melting temperature altering modifications into blocking oligonucleotides can significantly increase the difference in melting temperature of the oligonucleotide for target and non-target sequences.

[0166] Therefore, one embodiment of the present invention is provided that uses blocking oligonucleotides.In some embodiments, blocking oligonucleotides must be resistant to pyrophosphorolysis (PPL) reaction to ensure that they are not digested or displaced.This can be achieved in several different ways, for example, through mismatches at their 3' ends, or through modifications such as phosphorothioate bonds or spacers.

[0167] In one such embodiment or aspect of the invention using blocking oligonucleotides, a method for detecting a target polynucleotide sequence in a given nucleic acid analyte is characterized by annealing a single-stranded blocking oligonucleotide to at least a subset of a non-target polynucleotide sequence prior to or during the same step, where the analyte target sequence anneals to a molecular system comprising a probe oligonucleotide A0 to create a first intermediate product that is at least partially double-stranded, and the 3' end of A0 forms a double-stranded complex with the analyte target sequence.

[0168] In some embodiments, the blocking oligonucleotide is resistant to pyrophosphorolysis via a mismatch at its 3' end. In other embodiments, the blocking oligonucleotide is resistant via the presence of a 3' blocking group. In other embodiments, the blocking oligonucleotide is resistant via the presence of a spacer or other internal modification. In further embodiments, the blocking oligonucleotide contains either a modification that increases the melting temperature or a modified nucleotide base, rendering it resistant to pyrophosphorolysis.

[0169] In one aspect of the invention, a method for producing ... semiconductor device comprising the steps of: (a) introducing a blocking oligonucleotide into a first reaction mixture containing one or more nucleic acid analytes, wherein the blocking oligonucleotide anneals to at least a subset of non-target polynucleotide sequences; (b) introducing the mixture produced in (a) into a second reaction involving a molecular system, which may be as described previously or subsequently; (c) removing complementary nucleotides that are fully hybridized to the target from the 3' end of A0 by treating A0 with an enzyme for pyrophosphorolysis to form a shortened probe A1; (d) displacing the 3' end of A1 from the target using C; (e) ligating the ends of A1 to form a circle using pre-hybridized C to form circular A2; (f) detecting the presence of A2; A method is provided for detecting a polynucleotide target sequence in a predetermined nucleic acid analyte in a sample, comprising:

[0170] In some embodiments, the first reaction mixture further comprises one or more primers, deoxynucleotide triphosphates (dNTPs), and an amplification enzyme, and during step (a), nucleic acid analytes present in the sample undergo amplification, and following amplification of the nucleic acid analytes of interest and prior to (b), the sample is further treated with a proteinase.

[0171] In some embodiments, prior to step (a), the nucleic acid analytes present in the sample are amplified and following amplification of the nucleic acid analytes of interest, the sample is further treated with a proteinase. In some embodiments, the sample is treated with a proteinase prior to step (a). In some embodiments, the sample is treated with a proteinase during step (a). In some embodiments, the sample is treated with a proteinase after step (a).

[0172] In some embodiments, the method comprises the steps of: (a) detecting one or more nucleic acid analytes; i. a molecular system; ii. a blocking oligonucleotide; iii. pyrophosphorylase; iv. Ligase and a combined reaction mixture comprising: a blocking oligonucleotide annealing to at least a subset of the non-target polynucleotide sequences; a target analyte annealing to a molecular system comprising a probe oligonucleotide A0 portion of the molecular system to generate a first intermediate product that is at least partially double-stranded, the 3' end of A0 forming a double-stranded complex, A0 being pyrophosphorolyzed in the 3'-5' direction from the 3' end to generate an at least partially digested strand A1, and A1 being ligated to form A2; (b) detecting a signal derived from the product of the previous step, the product being A2 or a portion thereof, or multiple copies of A2, or multiple copies of a portion thereof, and inferring therefrom the presence or absence of the polynucleotide target sequence in the analyte; The first and second reaction mixtures are combined to contain:

[0173] In some embodiments of the method, the non-target nucleic acid analyte anneals incompletely with the blocking oligonucleotide to form an intermediate product that cannot be digested by pyrophosphorolysis to the extent necessary to melt it from the non-target molecule; the target nucleic acid analyte fully anneals to the blocking oligonucleotide to form an intermediate product that is at least partially double-stranded at the 3' end of the blocking oligonucleotide, and the blocking oligonucleotide is pyrophosphorolyzed in the 3'-5' direction to release the target nucleic acid analyte; a target nucleic acid analyte anneals to a molecular system that includes a probe oligonucleotide A0 portion of the molecular system to generate a first intermediate product that is at least partially double stranded, the 3' end of A0 forms a double stranded complex, A0 is pyrophosphorolyzed in the 3'-5' direction from the 3' end to generate an at least partially digested strand A1, A1 is ligated to form A2; A signal from the product of the previous step is detected, the product being A2 or a portion thereof, or multiple copies of A2, or multiple copies of a portion thereof, from which the presence or absence of the polynucleotide target sequence in the analyte is inferred. As such, the blocking oligonucleotides are perfectly complementary to the target nucleic acid analytes and mismatched to the non-target nucleic acid analytes.

[0174] In some embodiments, the blocking oligonucleotide contains a modification to render it resistant to exonucleolytic or pyrophosphorolytic digestion. In some embodiments, the blocking oligonucleotide contains a 3' modification to render it resistant to exonucleolytic or pyrophosphorolytic digestion.

[0175] In some embodiments, the blocking oligonucleotide contains a 5' modification to render it resistant to exonucleolytic digestion. Reference herein to a "phosphatase enzyme" refers to any enzyme, or functional fragment thereof, that has the ability to hydrolytically remove nucleoside triphosphates produced by the methods of the invention. This includes any enzyme, or functional fragment thereof, that has the ability to cleave a phosphate monoester into a phosphate ion and an alcohol.

[0176] Reference herein to a "pyrophosphatase enzyme" refers to any enzyme, or functional fragment thereof, that has the ability to catalyze the conversion of one pyrophosphate ion into two phosphate ions.

[0177] This also includes inorganic pyrophosphatases and inorganic diphosphatases. A non-limiting example is thermostable inorganic pyrophosphate (TIPP). In some embodiments, modified versions of any of the previously described embodiments are provided, in which the use of pyrophosphatase is optional.

[0178] In some embodiments of the invention, there is provided a kit for use in a method for detecting a target polynucleotide sequence in a predetermined nucleic acid analyte present in a sample, comprising: (a) a molecular system comprising a probe oligonucleotide A0 capable of forming a first intermediate product with a target polynucleotide sequence, said intermediate product being at least partially double-stranded; (b) a ligase; (c) a pyrophosphoroase capable of digesting the first intermediate product in the 3'-5' direction from the end of A0 to produce a partially digested strand A1; (d) with an appropriate buffer A kit is provided comprising:

[0179] In one embodiment, the 3' end of A0 is complementary to the target sequence. In one embodiment, the 3' end of A0 is perfectly complementary to the target sequence. In one embodiment, the kit further comprises at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of A0.

[0180] In one embodiment, the kit further comprises an amplification enzyme. In one embodiment, the kit further comprises one or more blocking oligonucleotides. In one embodiment, the kit further comprises one or more primers, one or more of the primers having a non-complementary 5' tail.

[0181] In one embodiment, one or more of the primers has a 5' phosphate. In one embodiment, one or more of the primers are 5' protected. In one embodiment, the 3' end of A0 is perfectly complementary to the target polynucleotide sequence.

[0182] In one embodiment, the ligase substantially lacks single-stranded ligation activity. In some embodiments, the kit instead comprises: - two or more ligation chain reaction (LCR) probe oligonucleotides that are complementary to adjacent sequences on A1, such that when the probes are successfully annealed, the 5' phosphate of one LCR probe is directly adjacent to the 3' OH of the other LCR probe; - one or more ligases It may further include.

[0183] In some embodiments, in the presence of A2, the two LCR probes are successfully annealed with A2 and ligated together to form one oligonucleotide molecule, which then serves as the new target for the second round of covalent ligation, resulting in the geometric amplification of the target of interest, in this case A2.The ligated product, or amplicon, is complementary to A2 and serves as the target in the next amplification cycle.Therefore, the exponential amplification of specific target DNA sequence is achieved through repeated cycles of denaturation, hybridization and ligation in the presence of excess LCR probe.This implies the presence of A2, and thus the presence of target polynucleotide sequence.

[0184] In some embodiments, in the presence of A2, the two PCR probes successfully anneal with A2 and are ligated together to form one oligonucleotide molecule, which then serves as the new target for a second round of covalent ligation, resulting in geometric amplification of the target of interest, in this case A2, which is then detected.

[0185] In some embodiments, the kit comprises: - a hairpin oligonucleotide 1 (HO1) comprising a fluorophore-quencher pair, where HO1 is complementary to A2, and when annealed with A2, the hairpin structure of HO1 opens and the fluorophore-quencher pair separates; - a hairpin oligonucleotide 2 (HO2) comprising a fluorophore-quencher pair, where HO2 is complementary to the open HO1, and when annealed with HO1, the hairpin structure of HO2 opens and the fluorophore-quencher pair separates; It may further include.

[0186] In some embodiments, the kit may further comprise multiple HO1 and HO2. In some embodiments, the kit instead comprises an oligonucleotide A comprising a substrate arm, a partial catalytic core, and a sensor arm; an oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; - a substrate containing a fluorophore-quencher pair; wherein the sensor arms of oligonucleotides A and B are complementary to the flanking regions of A2, such that in the presence of A2, oligonucleotides A and B combine to catalytically form a multicomponent nucleic acid enzyme (MNAzyme).

[0187] In some embodiments, the kit instead comprises a partially double-stranded nucleic acid construct, - one strand comprises at least one RNA base, at least one fluorophore, and a region of this strand is complementary to a region of A2, this strand may be called the "substrate" strand; - the other strand comprises at least one quencher, a region of this strand being complementary to a region of A2 adjacent to the region to which the substrate strand is complementary, such that in the presence of A2 the partially double-stranded nucleic acid construct becomes substantially more double-stranded; It may further comprise a nucleic acid construct.

[0188] In other words, a partially double-stranded nucleic acid construct has a larger double-stranded portion in the presence of A2. In some embodiments, the kit may further comprise an enzyme for removing at least one RNA base.

[0189] In some embodiments, the enzyme is uracil-DNA glycosylase (UDG) and the RNA base is uracil. In some embodiments, the kit instead comprises: - an oligonucleotide complementary to a region of A2 comprising the ligation site, comprising one or more fluorophores arranged such that their fluorescence is quenched by their proximity either to each other or to one or more fluorescent quenchers; - Double-strand specific DNA digestion enzyme wherein in the presence of A2, the labeled oligonucleotide is digested such that the fluorophores are separated from each other or from their corresponding quenchers and the fluorescent signal, and thus the presence of A2, is detectable.

[0190] In some embodiments, the double-strand-specific DNA digestive enzyme is an exonuclease. In some embodiments, the double-strand-specific DNA digestive enzyme is a polymerase with proofreading activity.

[0191] In some embodiments, the fluorophores of the kit may be selected from dyes of the fluorescein family, carboxyrhodamine family, cyanine family, rhodamine family, polyhalofluorescein family dyes, hexachlorofluorescein family dyes, coumarin family dyes, oxazine family dyes, thiazine family dyes, squaraine family dyes, and chelating lanthanide family dyes.

[0192] In some embodiments, the fluorophores of the kit may be selected from any of the commercially available dyes. In some embodiments, the quencher of the kit may be selected from those available under the trade names Black Hole™, Eclipse™ Dark, Qx1J, and Iowa Black™.

[0193] In some embodiments, the quencher of the kit may be selected from any of the commercially available quenchers. In some embodiments, the kit may further comprise one or more partially double-stranded DNA constructs, each of which contains one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are located in sufficiently close proximity to each other that sufficient quenching of the one or more fluorophores occurs.

[0194] In some embodiments, the construct is a single strand of DNA that has a self-complementary region that folds back onto itself. In some embodiments, the construct comprises one primer of a primer pair.

[0195] In some embodiments, the kit may further include the other primer of the primer pair. In some embodiments, a portion of the single-stranded portion of the construct hybridizes with A2 and is extended by DNA polymerase to A2. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. This primer then extends to the construct, expelling the self-complementary region. Thus, the one or more fluorophores and the one or more dyes are sufficiently separated to detect a fluorescent signal, indicating the presence of A2. In such an embodiment, the construct may be known as a sunrise primer.

[0196] In some embodiments, the construct comprises two separate strands of DNA. In some embodiments, a portion of the single-stranded portion of the construct hybridizes with A2 and is extended by DNA polymerase to A2. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. This primer then extends to the construct in the direction of the double-stranded portion, displacing the shorter of the DNA strands, thus separating the one or more fluorophores and the one or more dyes sufficiently to detect a fluorescent signal and indicate the presence of A2. In such an embodiment, the construct may be known as a molecular zipper.

[0197] Those skilled in the art will appreciate that for both the sunrise primer and the molecular zipper, the fluorophore(s) and quencher(s) pairs can be located at various positions within each corresponding construct, the main feature being that each pair is located close enough to each other that in the absence of A2, i.e., when extension and strand displacement are not occurring, no fluorescent signal is emitted.

[0198] In one embodiment, the kit further comprises a pyrophosphate ion source. Suitable pyrophosphate ion sources are as previously described. In some embodiments, the kit further comprises suitable positive and negative controls. In some embodiments, the kit may further comprise one or more control probes (E0) as previously described. In some embodiments, the kit may further comprise one or more control probes (E o ) and one or more blocking oligonucleotides.

[0199] In some embodiments, the 5' end of A0 may be rendered resistant to 5'-3' exonuclease digestion and the kit may further comprise a 5'-3' exonuclease. In some embodiments, C may further comprise a 3' or internal modification that protects it from 3'-5' exonuclease digestion.

[0200] In some embodiments, the kit may further comprise dNTPs, polymerase, primers, and appropriate buffers for initial amplification of target polynucleotide sequences present in a sample. In some such embodiments, at least one primer used for such initial amplification comprises a 5' or internal blocking modification, and the kit further comprises a 5'-3' exonuclease. In some such embodiments, at least one other primer comprises a 5' phosphate group.

[0201] In some embodiments, the kit may further comprise dUTP incorporating a high fidelity polymerase, dUTP, and uracil-DNA N-glycosylase (UDG). In some embodiments, the kit may further comprise a phosphatase or a phosphohydrolase. In some embodiments, the kit may further comprise a pyrophosphatase. The pyrophosphatase may be hot start.

[0202] In some embodiments, the kit may further comprise a proteinase. In some embodiments, the kit may further include one or more oligonucleotide binding dyes or molecular probes.

[0203] In some embodiments, the kit may further include a plurality of molecular systems comprising A0, each selective for a different target sequence and each comprising an identification region. In some embodiments, the kit may further comprise an enzyme for the formation of DNA from an RNA template.

[0204] In some embodiments, the enzyme is a reverse transcriptase. In some embodiments, one or more of the enzymes of the kit may be hot start. In some embodiments, one or more of the enzymes of the kit may be thermostable.

[0205] In some embodiments, the kit may further include appropriate washing and buffering reagents. In some embodiments, the amplification enzyme and the pyrophosphorylase in (e) are the same. In some embodiments, the amplifying enzyme and the pyrophosphorolytic enzyme are the same.

[0206] The kits may further include purification equipment and reagents for isolating and / or purifying portions of the polynucleotide according to the processes described herein. Suitable reagents are well known in the art and include gel filtration columns and wash buffers.

[0207] In some embodiments, the kit further comprises at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of A0, an amplification enzyme, and dNTPs. In some embodiments, the kit further comprises one or more oligonucleotide binding dyes or molecular probes.

[0208] In some embodiments, the kit further comprises a plurality of molecular systems, each comprising A0, each selective for a different target sequence, and each comprising an identification region.

[0209] In some embodiments, the kit comprises: - two or more ligation chain reaction (LCR) probe oligonucleotides that are complementary to adjacent sequences on A1, such that when the probes are successfully annealed, the 5' phosphate of one LCR probe is directly adjacent to the 3' OH of the other LCR probe; - one or more ligases Further includes:

[0210] In some embodiments, the kit further comprises one or more polymerases. In some embodiments of the kit, the one or more polymerases are the same as the pyrophosphorylase.

[0211] In some embodiments, the kit comprises: - a hairpin oligonucleotide 1 (HO1) comprising a fluorophore-quencher pair, where HO1 is complementary to A2, and when annealed with A2, the hairpin structure of HO1 opens and the fluorophore-quencher pair separates; - a hairpin oligonucleotide 2 (HO2) comprising a fluorophore-quencher pair, where HO2 is complementary to the open HO1, and when annealed with HO1, the hairpin structure of HO2 opens and the fluorophore-quencher pair separates; Further includes:

[0212] In some embodiments, the kit further comprises multiple HO1 and HO2. In some embodiments, the kit comprises: - an oligonucleotide A, comprising a substrate arm, a partial catalytic core, and a sensor arm; an oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; - a substrate comprising a fluorophore-quencher pair; wherein the sensor arms of oligonucleotides A and B are complementary to the flanking regions of A2, such that in the presence of A2, oligonucleotides A and B combine to catalytically form a multicomponent nucleic acid enzyme (MNAzyme).

[0213] In some embodiments, the kit comprises a partially double-stranded nucleic acid construct, - one strand comprises at least one RNA base, at least one fluorophore, and a region of this strand is complementary to a region of A2, this strand may be called the "substrate" strand; - the other strand comprises at least one quencher, and a region of this strand is complementary to a region of A2 adjacent to the region to which the substrate strand is complementary, such that in the presence of A2 the partially stranded nucleic acid construct becomes substantially more double stranded. , further comprising a nucleic acid construct.

[0214] In some embodiments, the kit further comprises an enzyme for removing at least one RNA base. In some embodiments of the kit, the enzyme is uracil-DNA glycosylase (UDG) and the RNA base is uracil.

[0215] In some embodiments, the kit comprises: - an oligonucleotide complementary to a region of A2 comprising the ligation site, comprising one or more fluorophores arranged such that their fluorescence is quenched by their proximity either to each other or to one or more fluorescent quenchers; - a double-strand specific DNA digestion enzyme; wherein in the presence of A2, the labeled oligonucleotide is digested such that the fluorophores are separated from each other or from their corresponding quenchers and the fluorescent signal, and thus the presence of A2, is detectable.

[0216] In some embodiments of the kit, the double-strand-specific DNA digestive enzyme is an exonuclease. In some embodiments of the kit, the double-strand-specific DNA digestive enzyme is a polymerase with proofreading activity.

[0217] In some embodiments of the kit, the fluorophore is selected from dyes of the fluorescein family, the carboxyrhodamine family, the cyanine family, the rhodamine family, the polyhalofluorescein family dyes, the hexachlorofluorescein family dyes, the coumarin family dyes, the oxazine family dyes, the thiazine family dyes, the squaraine family dyes, and the chelating lanthanide family dyes.

[0218] In some embodiments of the kit, the quencher is selected from those available under the trade names Black Hole™, Eclipse™ Dark, Qx1J, and Iowa Black™.

[0219] In some embodiments, the kit further comprises a phosphatase or a phosphohydrolase. In some embodiments, the kit further comprises a pyrophosphatase.

[0220] In some embodiments, the kit further comprises an enzyme for the formation of DNA from an RNA template. In some embodiments of the kit, the enzyme is a reverse transcriptase.

[0221] In some embodiments of the kit, the one or more enzymes are hot start. In some embodiments of the kit, the one or more enzymes are thermostable. In some embodiments, the kit may further include appropriate washing and buffering reagents.

[0222] In some embodiments, the kit further comprises an epigenetic sensitive and / or epigenetic dependent restriction enzyme, which may be as previously described. In some embodiments, the kit further comprises a methylation-sensitive and / or methylation-dependent restriction enzyme.

[0223] In some embodiments, the kit further comprises one or more methyl-CpG binding domain (MBD) proteins. In some embodiments, the kit further comprises one or more 5-methylcytidine (5-mC) antibodies.

[0224] In some embodiments, the kit further comprises one or more of the MBD2b proteins and / or one or more of the MBD2b / MBD3L1 complexes. In some embodiments, the kit further comprises reagents suitable for methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA).

[0225] In one embodiment of the present invention, 1. A device comprising at least one flow path between a first region, a second region, and a third region, wherein the first region comprises one or more wells, each well comprising: dNTPs, at least one single stranded primer oligonucleotide; An amplification enzyme for the initial amplification of DNA present in the sample; and the second region comprises one or more wells, each well comprising: A molecular system comprising a probe oligonucleotide A0 capable of forming a first intermediate product with a target polynucleotide sequence, said intermediate product being at least partially double-stranded; a pyrophosphorolytic enzyme capable of digesting the first intermediate product in the 3'-5' direction from the end of A0 to produce a partially digested strand A1; and the third region comprises one or more wells, each well comprising: dNTPs, A buffer solution; An amplifying enzyme; means for detecting a signal derived from A2 or a portion thereof, or multiple copies of A2, or multiple copies of a portion thereof; wherein the wells of the second region or the wells of the third region further comprise at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of A0.

[0226] In some embodiments, one or more wells of the first region contain one or more blocking oligonucleotides as described above or subsequently. In some embodiments, one or more wells in the second region contain one or more blocking oligonucleotides as described above or subsequently.

[0227] In some embodiments, the wells in the first region comprise: - dNTPs, - one or more single stranded primer oligonucleotides; - an amplification enzyme for the initial amplification of DNA present in the sample; wherein one or more of the primers has a non-complementary 5' tail.

[0228] In some embodiments, one or more of the primers has a 5' phosphate. In some embodiments, one or more of the primers are 5' protected. In some embodiments, the means for detecting a signal is located in one or more wells of the third region.

[0229] In some embodiments, the means for detecting a signal is located in a third region of the device. In some embodiments, the means for detecting a signal is located in an adjacent region of the device.

[0230] In some embodiments, the dNTPs in each well of the first region may be dUTP, dGTP, dATP, and dCTP, and each well may further comprise dUTP incorporating a high-fidelity polymerase and uracil-DNA N-glycosylase (UDG).

[0231] In some embodiments, the dNTPs in each well of the third region can be dUTP, dGTP, dATP, and dCTP, and each well can further comprise dUTP incorporating a high-fidelity polymerase and uracil-DNA N-glycosylase (UDG).

[0232] In some embodiments, each well of the second region may further comprise a source of pyrophosphate ions. In some embodiments, the 5' end of A0 may be rendered resistant to 5'-3' exonuclease digestion, and the wells of the second region may further comprise a 5'-3' exonuclease.

[0233] In some embodiments, the dNTPs may be hot start and each well of the second region may further comprise a phosphatase or a phosphohydrolase. In some embodiments, each well of the second region may further comprise pyrophosphatase.

[0234] In some embodiments, the pyrophosphatase may be hot start. In some embodiments, each well in the third region may further comprise one or more oligonucleotide-conjugated dyes or molecular probes.

[0235] In some embodiments, each well of the second region may contain at least one or more different molecular systems that include A0 selective for a target sequence that includes the identification region. In some embodiments, the amplification enzyme and the pyrophosphorylase in the second region can be the same.

[0236] In some embodiments, there may be a fourth region comprising one or more wells, each well may comprise a proteinase, and said fourth region may be located between the first and second regions.

[0237] In some embodiments, the wells in the second region comprise: dNTPs, A buffer solution; An amplifying enzyme; means for detecting a signal derived from A1 or a portion thereof, or multiple copies of A1, or multiple copies of a portion thereof; The second and third regions of the device may be combined to further comprise:

[0238] The wells in the second region may further contain one or more blocking oligonucleotides as described above or subsequently. In some embodiments, the means for detecting a signal is located in one or more wells of the second region.

[0239] In some embodiments, the means for detecting a signal is located in a second region of the device. In some embodiments, the means for detecting a signal is located in an adjacent region of the device.

[0240] In some embodiments, 1. A device comprising a flow path between a first region and a second region, the first region comprising one or more wells, the one or more wells comprising: A molecular system comprising a probe oligonucleotide A0 capable of forming a first intermediate product with a target polynucleotide sequence, said intermediate product being at least partially double-stranded; a pyrophosphorolytic enzyme capable of digesting the first intermediate product in the 3'-5' direction from the end of A0 to produce a partially digested strand A1; one or more ligases capable of ligating with A1 to produce oligonucleotide A2; and the second region comprises one or more wells.

[0241] The wells of the first region may further comprise one or more blocking oligonucleotides as described above or subsequently. In some embodiments, one or more wells of the first region may further comprise an ion source for driving the pyrophosphorolysis reaction forward.

[0242] In some embodiments, the ion is a pyrophosphate ion. In some embodiments, the 5' end of A0 is resistant to 5'-3' exonuclease digestion and the wells of the first region further comprise a 5'-3' exonuclease.

[0243] In some embodiments, the device may further include a third region including one or more wells connected to the first region by a flow path, the one or more wells of the third region comprising: dNTPs, a single stranded primer oligonucleotide; Amplification enzyme and Includes.

[0244] The wells in the third region may further contain one or more blocking oligonucleotides as described previously or subsequently. In some embodiments, the dNTPs of the third region can be dUTP, dGTP, dCTP, and dATP; The amplification enzyme may be a high fidelity polymerase incorporating dUTP; One or more wells in the third region may further contain uracil-DNA N-glycosylase.

[0245] In some embodiments, the device may further include a fourth region located between the first and third regions that includes one or more wells, where the one or more wells may contain a proteinase.

[0246] In some embodiments, one or more wells of the first or second region may further comprise a ligase. In some embodiments, one or more wells of the first region may contain at least one or more different molecular systems including A0, each selective for a different target sequence and each including an identification region.

[0247] In some embodiments, the wells in the second region comprise: dNTPs, A buffer solution; An amplifying enzyme; means for detecting a signal derived from A1 or a portion thereof, or multiple copies of A1, or multiple copies of a portion thereof; may include.

[0248] The wells in the second region may further contain one or more blocking oligonucleotides as described above or subsequently. Embodiments of the invention may include one or more blocking oligonucleotides located in one or more regions that include dNTPs, buffers, amplification enzymes, and the like.

[0249] In some embodiments, the means for detecting a signal is located in one or more wells of the second region. In some embodiments, the means for detecting a signal is located in a second region of the device.

[0250] In some embodiments, the means for detecting a signal is located in an adjacent region of the device. In some embodiments, one or more wells in the second region may further comprise one or more oligonucleotide-conjugated dyes or molecular probes.

[0251] In some embodiments, the amplification enzyme and the pyrophosphorylation enzyme of the device are the same. In some embodiments, the wells in the second region comprise: - two or more ligation chain reaction (LCR) probe oligonucleotides that are complementary to adjacent sequences on A1, such that when the probes are successfully annealed, the 5' phosphate of one LCR probe is directly adjacent to the 3' OH of the other LCR probe; - one or more ligases Further includes:

[0252] In some embodiments, the wells in the second region comprise: - a hairpin oligonucleotide 1 (HO1) comprising a fluorophore-quencher pair, where HO1 is complementary to A2, and when annealed with A2, the hairpin structure of HO1 opens and the fluorophore-quencher pair separates; - a hairpin oligonucleotide 2 (HO2) comprising a fluorophore-quencher pair, where HO2 is complementary to the open HO1, and when annealed with HO1, the hairpin structure of HO2 opens and the fluorophore-quencher pair separates; It may further include.

[0253] In some embodiments, the wells of the second region may further comprise a plurality of HO1 and HO2. In some embodiments, the wells in the second region comprise: - an oligonucleotide A, comprising a substrate arm, a partial catalytic core, and a sensor arm; an oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; - a substrate containing a fluorophore-quencher pair; wherein the sensor arms of oligonucleotides A and B are complementary to the flanking regions of A2, such that in the presence of A2, oligonucleotides A and B combine to catalytically form a multicomponent nucleic acid enzyme (MNAzyme).

[0254] In some embodiments, the wells of the second region comprise a partially double-stranded nucleic acid construct, - one strand comprises at least one RNA base, at least one fluorophore, and a region of this strand is complementary to a region of A2, this strand may be called the "substrate" strand; - the other strand comprises at least one quencher, and a region of this strand is complementary to a region of A2 adjacent to the region to which the substrate strand is complementary, such that in the presence of A2 the partially stranded nucleic acid construct becomes substantially more double stranded. , may comprise a nucleic acid construct.

[0255] In some embodiments, the wells of the second region may further comprise an enzyme for removing at least one RNA base. In some embodiments, the enzyme is uracil-DNA glycosylase (UDG) and the RNA base is uracil.

[0256] In some embodiments, one or more wells of the second region include: an oligonucleotide complementary to a region of A2 containing the ligation site, comprising one or more fluorophores arranged such that their fluorescence is quenched by their proximity either to each other or to one or more fluorescent quenchers; Double-strand specific DNA digestion enzyme wherein in the presence of A2, the labeled oligonucleotide is digested such that the fluorophores are separated from each other or from their corresponding quenchers and the fluorescent signal, and thus the presence of A2, is detectable.

[0257] In some embodiments, the double-strand-specific DNA digestive enzyme is an exonuclease. In some embodiments, the double-strand-specific DNA digestive enzyme is a polymerase with proofreading activity.

[0258] In some embodiments, the fluorophore is selected from dyes of the fluorescein family, the carboxyrhodamine family, the cyanine family, the rhodamine family, the polyhalofluorescein family dyes, the hexachlorofluorescein family dyes, the coumarin family dyes, the oxazine family dyes, the thiazine family dyes, the squaraine family dyes, and the chelating lanthanide family dyes.

[0259] In some embodiments, the fluorophores of the device may be selected from any of the commercially available dyes. In some embodiments, the quencher of the device is selected from those available under the trade names Black Hole™, Eclipse™ Dark, Qx1J, Iowa Black™, ZEN, and / or TAO.

[0260] In some embodiments, the quencher of the device may be selected from any of the commercially available quenchers. In some embodiments, one or more wells in the second region may further comprise one or more partially double-stranded DNA constructs, each construct containing one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are located in sufficiently close proximity to each other such that sufficient quenching of the one or more fluorophores occurs.

[0261] In some embodiments, the construct is a single strand of DNA that has a self-complementary region that folds back onto itself. In some embodiments, the construct comprises one primer of a primer pair.

[0262] In some embodiments, one or more wells in the second region may further comprise the other primer of the primer pair. In some embodiments, a portion of the single-stranded portion of the construct hybridizes to A2 and is extended to A2 by DNA polymerase. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct to display A2. This primer then extends to the construct, displacing the self-complementary region. Thus, the fluorophore or fluorophores and the dye or dyes are sufficiently separated to detect a fluorescent signal, indicating the presence of A2.

[0263] In such embodiments, the construct may be known as a sunrise primer. In some embodiments, the construct comprises two separate strands of DNA. In some embodiments, a portion of the single-stranded portion of the construct hybridizes to A2 and is extended by a DNA polymerase toward A2. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct to display A2. This primer then extends toward the construct toward the double-stranded portion, displacing the shorter of the DNA strands, such that the fluorophore(s) and dye(s) are sufficiently separated that a fluorescent signal is detected to indicate the presence of A2.

[0264] In such embodiments, the construct may be known as a molecular zipper. Those skilled in the art will appreciate that for both the sunrise primer and the molecular zipper, the fluorophore(s) and quencher(s) pairs can be located at various positions within each corresponding construct, the main feature being that each pair is located close enough to each other that in the absence of A2, i.e., when extension and strand displacement are not occurring, no fluorescent signal is emitted.

[0265] In some embodiments, one or more wells of one or more regions may further comprise pyrophosphatase. In some embodiments, one or more wells of one or more regions of the device may further comprise a phosphatase or phosphohydrolase.

[0266] In some embodiments, one or more wells in the first region of the device may further comprise an enzyme for the formation of DNA from an RNA template. In some embodiments, the enzyme is a reverse transcriptase.

[0267] In some embodiments, the enzyme or enzymes present in the device are hot start. In some embodiments, the enzyme or enzymes present in the device are thermostable.

[0268] In some embodiments, the first and second regions of the device are merged. In some embodiments of the present invention, - a device comprising at least one flow path between a first region, a second region, and a third region, the first region comprising one or more wells, each well comprising: - dNTPs, - at least one single-stranded primer oligonucleotide, - an amplification enzyme for the initial amplification of DNA present in the sample; and the second region comprises one or more wells, each well comprising: - a molecular system comprising a probe oligonucleotide A0 capable of forming a first intermediate product with a target polynucleotide sequence, said intermediate product being at least partially double-stranded; a pyrophosphorolytic enzyme capable of digesting the first intermediate product in the 3'-5' direction from the end of A0 to produce a partially digested chain A1; and the third region comprises one or more wells, each well comprising: - dNTPs, a buffer solution; - optionally an amplification enzyme; - optionally, a means for detecting a signal derived from A2 or a part thereof, or multiple copies of A2, or multiple copies of a part thereof; wherein the wells of the second region or the wells of the third region further comprise at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of A0.

[0269] In some embodiments, the wells in the second region comprise: - dNTPs, - one or more single stranded primer oligonucleotides; - an amplification enzyme for the initial amplification of DNA present in the sample; wherein one or more of the primers has a non-complementary 5' tail.

[0270] In some embodiments, one or more of the primers has a 5' phosphate. In some embodiments, one or more of the primers are 5' protected. In some embodiments, the pyrophosphatase present in the wells of the second region is transported to the wells of the third region, where the pyrophosphatase amplifies A2 in the presence of dNTPs and a suitable buffer.

[0271] In some embodiments, the means for detecting a signal is located in one or more wells of the third region. In some embodiments, the means for detecting a signal is located in a third region of the device.

[0272] In some embodiments, the means for detecting a signal is located in an adjacent region of the device. In some embodiments, the dNTPs in each well of the first region may be dUTP, dGTP, dATP, and dCTP, and each well may further comprise dUTP incorporating a high-fidelity polymerase and uracil-DNA N-glycosylase (UDG).

[0273] In some embodiments, each well of the second region may further comprise a source of pyrophosphate ions. In some embodiments, the 5' end of A0 may be rendered resistant to 5'-3' exonuclease digestion, and the wells of the second region may further comprise a 5'-3' exonuclease.

[0274] In some embodiments, each well of the second or third region may further comprise a ligase. In some embodiments, the dNTPs can be hot start.

[0275] In some embodiments, each well of the second region may further comprise a phosphatase or a phosphohydrolase. In some embodiments, each well of the second region may further comprise pyrophosphatase.

[0276] In some embodiments, the pyrophosphatase is hot start. In some embodiments, each well in the third region may further comprise one or more oligonucleotide-conjugated dyes or molecular probes.

[0277] In some embodiments, each well of the second region may contain at least one or more different A0s selective for a target sequence that includes the identification region. In some embodiments, the amplification enzyme and the pyrophosphorylase in the second region can be the same.

[0278] In some embodiments, there may be a fourth region comprising one or more wells, each well may comprise a proteinase, and said fourth region may be located between the first and second regions.

[0279] In some embodiments, the wells in the second region comprise: - dNTPs, a buffer solution; an amplifying enzyme; means for detecting a signal derived from A1 or a portion thereof, or multiple copies of A1, or multiple copies of a portion thereof; The second and third regions of the device may be combined to further comprise:

[0280] In some embodiments, the wells in the second region comprise: - optionally dNTPs, - optionally an amplification enzyme; a buffer solution; - Labeled oligonucleotide probes The second and third regions of the device may be combined to further comprise:

[0281] In some embodiments, amplification of A2 is carried out in the presence of dNTPs and a suitable buffer using pyrophosphatase present in the wells of the second region. In some embodiments, the means for detecting a signal is located in one or more wells of the second region.

[0282] In some embodiments, the means for detecting a signal is located in a second region of the device. In some embodiments, the means for detecting a signal is located in an adjacent region of the device.

[0283] In some embodiments, the first region may be in fluid communication with the sample vessel via a fluid interface. In some embodiments of the present invention, - a device comprising at least one flow path between first, second, third and fourth regions, wherein the first region comprises one or more wells, each well comprising a means for selectively modifying a nucleic acid; The second region includes one or more wells, each well comprising: - dNTPs, - at least one single-stranded primer oligonucleotide, - an amplification enzyme for the initial amplification of DNA present in the sample; and the third region comprises one or more wells, each well comprising: - a molecular system comprising a probe oligonucleotide A0 capable of forming a first intermediate product with a target polynucleotide sequence, said intermediate product being at least partially double-stranded; a pyrophosphorolytic enzyme capable of digesting the first intermediate product in the 3'-5' direction from the end of A0 to produce a partially digested chain A1; and the fourth region comprises one or more wells, each well comprising: - dNTPs, a buffer solution; - optionally an amplification enzyme; - means for detecting a signal derived from A2 or a portion thereof, or multiple copies of A2, or multiple copies of a portion thereof; wherein the wells of the third region or the wells of the fourth region further comprise at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of A0.

[0284] In some embodiments, the means for selectively modifying a nucleic acid may be a chemical agent capable of converting unmodified cytosine bases in a target polynucleotide sequence. In some embodiments, the means for selectively modifying a nucleic acid can be an enzyme capable of converting an unmodified cytosine base in a target polynucleotide sequence.

[0285] In some embodiments, the wells of the second or third region may further comprise a restriction endonuclease. In some embodiments, a region containing one or more wells may be located between the first and second regions, and each well may contain a restriction endonuclease.

[0286] In some embodiments, a restriction endonuclease may recognize a sequence in a target polynucleotide sequence that has been created by chemical or enzymatic conversion of unmodified cytosine bases. In some embodiments, sequences in a target polynucleotide sequence that can be recognized by a restriction endonuclease are removed by chemical or enzymatic conversion of unmodified cytosine bases.

[0287] In some embodiments, the restriction endonuclease can be a methylation-sensitive or methylation-dependent restriction endonuclease. In some embodiments, the wells of the second region may contain reagents for modification-specific multiple-stranded ligation-dependent probe amplification (MS-MLPA) of epigenetically modified DNA.

[0288] In some embodiments, a region containing one or more wells may be located between the first and second regions, and each well may contain reagents for PCR. In some embodiments, a region comprising one or more wells may be located between the first and second regions, and each well may contain a reagent for reducing the population of epigenetically modified or unmodified target sequences.

[0289] In some embodiments, the reagent for reducing the population of epigenetically modified or unmodified target sequences is a reagent for epigenetically modified DNA immunoprecipitation, optionally methylated DNA immunoprecipitation (MeDIP).

[0290] In some embodiments, the reagent for reducing the population of epigenetically modified or unmodified target sequences is a methyl-binding protein, such as MBD2b or the MBD2b / MBD3L1 complex.

[0291] In some embodiments, reagents for reducing the population of epigenetically modified or unmodified target sequences are located in one or more wells of the first region. In some embodiments of the device, the epigenetic modification may be methylation. In some embodiments, the epigenetic modification may be methylation at a CpG island. In some embodiments, the epigenetic modification may be hydroxymethylation at a CpG island.

[0292] In some embodiments, the wells of the second, third, or fourth region comprise: - dNTPs, - at least one single-stranded primer oligonucleotide, - Amplification enzymes may include.

[0293] In some embodiments, the dNTPs in each well may be dUTP, dGTP, dATP, and dCTP, and each well may further comprise dUTP incorporating a high fidelity polymerase and uracil-DNA N-glycosylase (UDG).

[0294] In some embodiments, each well may further comprise a source of pyrophosphate ions. In some embodiments, the 5' end of A0 may be rendered resistant to 5'-3' exonuclease digestion, and the wells of the second or third region may further comprise a 5'-3' exonuclease.

[0295] In some embodiments, each well of the third or fourth region may further comprise a ligase. In some embodiments, the dNTPs can be hot start.

[0296] In some embodiments, each well of the third region may further comprise a phosphatase or a phosphohydrolase. In some embodiments, each well of the third region may further comprise pyrophosphatase.

[0297] In some embodiments, each well of the fourth region may further comprise pyrophosphatase. In some embodiments, the pyrophosphatase is hot start.

[0298] In some embodiments, each well in the fourth region may further comprise one or more oligonucleotide-conjugated dyes or molecular probes. In some embodiments, each well of the third region may contain at least one or more different A0s selective for a target sequence that includes the identification region.

[0299] In some embodiments, the amplification enzyme in the fourth region and the pyrophosphorylase in the third region may be the same, and thus, in some embodiments, an amplification enzyme in the fourth region is not required.

[0300] In some embodiments, there may be a fifth region comprising one or more wells, each well may comprise a proteinase, and said fifth region may be located between the first and second regions.

[0301] In some embodiments, the fifth region can be located between the second and third regions. In some embodiments, the wells in the third region comprise: - dNTPs, a buffer solution; an amplifying enzyme; means for detecting a signal derived from A1 or a portion thereof, or multiple copies of A1, or multiple copies of a portion thereof; The third and fourth regions of the device may be combined to further comprise:

[0302] In some embodiments, the means for detecting a signal is located in the third region. In some embodiments, the means for detecting a signal is located within the flanking region. In some embodiments, the wells of the third or fourth region comprise: - two or more ligation chain reaction (LCR) probe oligonucleotides that are complementary to adjacent sequences on A1, such that when the probes are successfully annealed, the 5' phosphate of one LCR probe is directly adjacent to the 3' OH of the other LCR probe; - one or more ligases It may further include.

[0303] In some embodiments, the amplification enzyme and the pyrophosphorylation enzyme of the device are the same. In some embodiments, the wells in the third region comprise: - a hairpin oligonucleotide 1 (HO1) comprising a fluorophore-quencher pair, where HO1 is complementary to A2, and when annealed with A2, the hairpin structure of HO1 opens and the fluorophore-quencher pair separates; - a hairpin oligonucleotide 2 (HO2) comprising a fluorophore-quencher pair, where HO2 is complementary to the open HO1, and when annealed with HO1, the hairpin structure of HO2 opens and the fluorophore-quencher pair separates; It may further include.

[0304] In some embodiments, the wells of the third region may further comprise a plurality of HO1 and HO2. In some embodiments, the wells in the third region comprise: - an oligonucleotide A, comprising a substrate arm, a partial catalytic core, and a sensor arm; an oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; - a substrate containing a fluorophore-quencher pair; wherein the sensor arms of oligonucleotides A and B are complementary to the flanking regions of A2, such that in the presence of A2, oligonucleotides A and B combine to catalytically form a multicomponent nucleic acid enzyme (MNAzyme).

[0305] In some embodiments, the wells of the third region comprise a partially double-stranded nucleic acid construct, - one strand comprises at least one RNA base, at least one fluorophore, and a region of this strand is complementary to a region of A2, this strand may be called the "substrate" strand; - the other strand comprises at least one quencher, and a region of this strand is complementary to a region of A2 adjacent to the region to which the substrate strand is complementary, such that in the presence of A2 the partially stranded nucleic acid construct becomes substantially more double stranded. , may comprise a nucleic acid construct.

[0306] In some embodiments, the wells of the third region may further comprise an enzyme for removing at least one RNA base. In some embodiments, the enzyme is uracil-DNA glycosylase (UDG) and the RNA base is uracil.

[0307] In some embodiments, one or more wells in the third region comprise: an oligonucleotide complementary to a region of A2 containing the ligation site, comprising one or more fluorophores arranged such that their fluorescence is quenched by their proximity either to each other or to one or more fluorescent quenchers; Double-strand specific DNA digestion enzyme wherein in the presence of A2, the labeled oligonucleotide is digested such that the fluorophores are separated from each other or from their corresponding quenchers and the fluorescent signal, and thus the presence of A2, is detectable.

[0308] In some embodiments, the double-strand-specific DNA digestive enzyme is an exonuclease. In some embodiments, the double-strand-specific DNA digestive enzyme is a polymerase with proofreading activity.

[0309] In some embodiments, the fluorophore is selected from dyes of the fluorescein family, the carboxyrhodamine family, the cyanine family, the rhodamine family, the polyhalofluorescein family dyes, the hexachlorofluorescein family dyes, the coumarin family dyes, the oxazine family dyes, the thiazine family dyes, the squaraine family dyes, and the chelating lanthanide family dyes.

[0310] In some embodiments, the fluorophores of the device may be selected from any of the commercially available dyes. In some embodiments, the quencher of the device is selected from those available under the trade names Black Hole™, Eclipse™ Dark, Qx1J, Iowa Black™, ZEN, and / or TAO.

[0311] In some embodiments, the quencher of the device may be selected from any of the commercially available quenchers. In some embodiments, the wells in the third region may contain one or more partially double-stranded DNA constructs, each of which contains one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are located in sufficiently close proximity to each other such that sufficient quenching of the one or more fluorophores occurs.

[0312] In some embodiments, the construct is a single strand of DNA that has a self-complementary region that folds back onto itself. In some embodiments, the construct comprises one primer of a primer pair.

[0313] In some embodiments, the wells in the third region may further comprise the other primer of the primer pair. In some embodiments, a portion of the single-stranded portion of the construct hybridizes with A2 and is extended by DNA polymerase to A2. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. This primer then extends to the construct, expelling the self-complementary region. Thus, the one or more fluorophores and the one or more dyes are sufficiently separated to detect a fluorescent signal, indicating the presence of A2 in the reaction mixture.

[0314] In such embodiments, the construct may be known as a sunrise primer. In some embodiments, the construct comprises two separate strands of DNA. In some embodiments, a portion of the single-stranded portion of the construct hybridizes to A2 and is extended by a DNA polymerase toward A2. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct to display A2. This primer then extends toward the double-stranded portion of the construct, displacing the shorter of the DNA strands, such that the fluorophore(s) and dye(s) are sufficiently separated that a fluorescent signal can be detected to indicate the presence of A2 in the reaction mixture.

[0315] In such embodiments, the construct may be known as a molecular zipper. Those skilled in the art will appreciate that for both the sunrise primer and the molecular zipper, the fluorophore(s) and quencher(s) pairs can be located at various positions within each corresponding construct, the main feature being that each pair is located close enough to each other that in the absence of A2, i.e., when extension and strand displacement are not occurring, no fluorescent signal is emitted.

[0316] In some embodiments, one or more wells of one or more regions may further comprise pyrophosphatase. In some embodiments, one or more wells of one or more regions of the device may further comprise a phosphatase or phosphohydrolase.

[0317] In some embodiments, one or more wells in the second region of the device may further comprise an enzyme for transcription of RNA to DNA. In some embodiments, the enzyme is a reverse transcriptase.

[0318] In some embodiments, the enzyme or enzymes present in the device are hot start. In some embodiments, the enzyme or enzymes present in the device are thermostable.

[0319] In some embodiments, the second and third regions of the device are merged. In some embodiments, the third and fourth regions of the device are combined. In some embodiments, one or more fluid pathways are located between one or more wells in a region and / or between one or more regions of the device.

[0320] In some embodiments, the first region may be in fluid communication with the sample vessel via a fluid interface. In some embodiments, heating and / or cooling elements may be present in one or more areas of the device.

[0321] In some embodiments, heating and / or cooling may be applied to one or more regions of the device. In some embodiments, each region of the device may independently contain at least 100 or 200 wells.

[0322] In some embodiments, each region of the device can independently contain from about 100 to 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, or more wells. The wells can be of any shape and their locations can be arranged in any format or pattern on the substrate.

[0323] In some embodiments, the well matrix can be constructed from metal (e.g., by way of non-limiting example, gold, platinum, or nickel alloys), ceramic, glass, or other PCR-compatible polymeric materials, or composite materials. The well matrix contains a plurality of wells.

[0324] In some embodiments, the wells may be formed as blind or through holes in the well substrate. The wells may be fabricated in the well substrate by, for example, laser drilling (e.g., excimer or solid state laser), ultrasonic embossing, hot embossing lithography, electroforming in nickel molds, injection molding, and injection compression molding.

[0325] In some embodiments, the individual well volumes can range from 0.1 to 1500 nL, and in one embodiment, 0.5 to 50 nL. Each well can have a volume of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35 , 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nL.

[0326] In some embodiments, the well dimensions can have wells of any shape, for example, circular, elliptical, square, rectangular, oval, hexagonal, octagonal, pyramidal, and other shapes known to those of skill in the art.

[0327] In some embodiments, the well shape may have a cross-sectional area that varies along an axis, for example, a square hole may taper from a first size to a second size that is a small fraction of the first size.

[0328] In some embodiments, the well dimensions may be square with approximately equal diameter and depth. In some embodiments, the walls defining the well may be non-parallel. In some embodiments, the walls defining the well may converge to a point. The well dimensions may be derived from the total volumetric capacity of the well substrate.

[0329] In some embodiments, the well depth may range from 25 μm to 1000 μm. In one embodiment, the wells may have a depth of 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 μm.

[0330] In some embodiments, the well diameter may range from about 25 μm to about 500 μm, In some embodiments, the wells may have a width of 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 μm.

[0331] In some embodiments, a portion of one or more regions of the device may be modified to promote or discourage fluid adhesion. Surfaces defining the wells may be coated with a hydrophilic material (or modified to be hydrophilic), thus promoting fluid retention.

[0332] In some embodiments, a portion of one or more regions of the device may be coated with a hydrophobic material (or modified to be hydrophobic), thus preventing retention of fluid thereon. Those skilled in the art will appreciate that other surface treatments may be used to encourage drainage of excess fluid, such that fluid is preferably retained within the wells, but not on the upper surface.

[0333] In some embodiments, the wells of the well substrate may be patterned to have a simple geometric pattern of aligned rows and columns, or a diagonally or hexagonally arranged pattern, hi one embodiment, the wells of the well substrate may be patterned to have a complex geometric pattern, such as a chaotic pattern or an isogeometric design pattern.

[0334] In some embodiments, the wells may be geometrically separated from one another and / or feature a large depth-to-width ratio to help prevent cross-contamination of reagents. In some embodiments, the device may include one or more auxiliary regions that can be used to provide a process fluid, such as an oil or other chemical solution, to one or more of the regions of the device. Such auxiliary regions may be fluidly connected to one or more of the regions of the device via one or more membranes, such as metal foils or thin films, valves, and / or pressure-cleavable substrates (i.e., materials that break when subjected to a predetermined amount of pressure from fluid in the auxiliary region or adjacent portions of the flow path).

[0335] In some embodiments, the flow path of the device may include a highly tortuous section. The tortuous path between the inlet of the flow path and one or more of the regions of the device may aid in the control and handling of the fluid process. The tortuous path may help reduce the formation of gas bubbles that may interfere with the flow of oil through the flow path.

[0336] In some embodiments, the device may further include a gas permeable membrane that allows gas to exit the wells of one or more regions of the device while not allowing fluid to pass through. The gas permeable membrane may be attached to the well substrate of the device by a gas permeable adhesive. In one embodiment, the membrane is constructed from polydimethylsiloxane (PDMS) and may have a thickness in the range of 20-1000 μm. In some embodiments, the membrane may have a thickness in the range of 100-200 μm.

[0337] In some embodiments, all or a portion of the well substrate may contain a conductive metal portion (e.g., gold) to allow for heat transfer from the metal to the well. In one embodiment, the interior surface of the well may be coated with a metal to allow for heat transfer.

[0338] In some embodiments, after filling the wells of one or more regions of the device with the appropriate reagents, an isolating oil or thermally conductive liquid may be applied to the device to prevent crosstalk. In some embodiments, the wells in one or more regions of the device may be shaped to taper from a larger diameter to a smaller diameter, similar to a pyramid. Pyramid-shaped wells with gradient walls allow for the use of non-contact deposition methods of reagents (e.g., ink-jet). The pyramidal shape has also been found to aid in drying and prevent air bubbles and leaks when a gas-permeable membrane is present.

[0339] In some embodiments, the wells of one or more regions of the device may be filled by forcing the sample fluid (e.g., via pressure) along a flow path of the device. As the fluid passes through the wells of one or more regions of the device, each well fills with fluid that is primarily held within the well via surface tension. As previously described, portions of the well substrate of the device may be coated with hydrophilic / hydrophobic materials as desired to promote complete and uniform filling of the wells as the sample fluid passes through them.

[0340] In some embodiments, the wells of one or more regions of the device may be "capped" with oil after filling. This may help reduce evaporation when the well substrate is subjected to thermal cycling. In one embodiment, after oil capping, an aqueous solution may be filled into one or more regions of the device to improve thermal conductivity.

[0341] In some embodiments, a quiescent aqueous solution may be pressurized in one or more regions of the device to stop the movement of the fluid and any air bubbles. In some embodiments, oils such as mineral oils may be used for isolating the wells of one or more regions of the device and to provide thermal conductivity. However, any thermally conductive liquid may be used, such as a fluorinated liquid (e.g., 3M FC-40). References to oils in this disclosure should be understood to include alternatives that one skilled in the art would understand to be applicable.

[0342] In some embodiments, the device may further include one or more sensor assemblies. In some embodiments, the sensor assembly or assemblies may include a charge-coupled device (CCD) / complementary metal oxide semiconductor (CMOS) detector coupled with a fiber optic faceplate (FOFP). A filter may be stacked on top of the FOPF and placed against or adjacent to the well substrate. In one embodiment, a filter may be stacked (bonded) directly on top of the CCD and the FOPF placed on top of it.

[0343] In some embodiments, a hydration fluid such as distilled water may be heated within the first region or one of the auxiliary regions so that one or more regions of the device have up to 100% humidity, or at least sufficient humidity to prevent excessive evaporation during thermal cycling.

[0344] In some embodiments, after loading of the device is complete, the well substrate may be heated by an external device in thermal contact with the device to perform thermal cycling for PCR. In some embodiments, non-contact heating methods such as RFID, Curie point, induction heating, or microwave heating may be used. These and other non-contact heating methods will be familiar to those skilled in the art. During thermal cycling, the device may monitor for chemical reactions via the sensor arrangements previously described.

[0345] In some embodiments, the reagents deposited in one or more of the wells of one or more of the regions of the device are deposited in a predetermined arrangement. In some embodiments, providing a sample fluid to a flow path of the device, the device including at least one flow path between a first region, a second region, and a third region, the first, second, and third regions independently including one or more wells; filling the second region with the amplified fluid from the first region such that one or more wells of the second region are coated with the amplified fluid; draining the amplified fluid from the second region such that the one or more wells remain wetted with at least a portion of the amplified fluid; filling the third region with the fluid discharged from the second region such that one or more wells of the third region are coated with said fluid; draining the fluid from the third chamber such that the one or more wells remain wetted with at least a portion of the fluid; A method is provided that includes:

[0346] In some embodiments of the method, the flow path may be valveless. In some embodiments of the method, the evacuated second region may be filled with a hydrophobic material. In some embodiments of the method, the evacuated third region may be filled with a hydrophobic material.

[0347] In some embodiments of the method, the hydrophobic material may be provided from an oil chamber in fluid communication with the second and third regions. In some embodiments of the method, the sample fluid may be directed along a flow path in a serpentine manner.

[0348] In some embodiments, the method may further include applying heating and cooling cycles to one or more of the first, second, or third regions. According to the present invention, a. a sample containing one or more nucleic acid analytes, i. A molecular system comprising a probe molecule (A0) and a splint molecule (C) hybridized thereto, A0 has a 3' end complementary to a target polynucleotide sequence, a loop region, and a 5' phosphate; C hybridizes to the 5' end of A0 to provide a single-stranded 3' overhang; a splint molecule having a single-stranded 3' overhang capable of hybridizing to a region located 1 to 50 bases in the 5' direction from the 3' end of A0; ii. a capture oligonucleotide B0 comprising a capture portion and a region complementary to a region adjacent to a target nucleic acid sequence; iii. A solid support; into an enriched reaction mixture comprising: b. hybridizing the molecular system and B0 with a nucleic acid analyte; c. introducing the enrichment reaction mixture into a first reaction mixture containing a pyrophosphorolysis enzyme, where A0 is pyrophosphorolyzed in the 3'-5' direction from the 3' end to create an at least partially digested strand A1, and C displaces the 3' end of A1 from the target; d. introducing the partially digested strand A1 into a reaction mixture containing a ligase, where A1 undergoes ligation to form A2; e. detecting a signal derived from the product of the previous step, the product being A2 or a portion thereof, or multiple copies of A2, or multiple copies of a portion thereof, and inferring therefrom the presence or absence of the polynucleotide target sequence in the analyte; A method for detecting a polynucleotide target sequence is provided, comprising:

[0349] In some embodiments, the reaction mixture of (d) is combined with the first reaction mixture such that the ligase is present in the same reaction mixture as the pyrophosphorolytic enzyme. Those skilled in the art will understand that the previous or subsequent descriptions of the first and second reaction mixtures in the context of other embodiments may be equally applicable to the above embodiment, and that the present application includes within its scope all such variations.

[0350] The final steps of the method may be accomplished as described previously or subsequently. In some embodiments, one or more nucleic acid analytes are divided into multiple reaction volumes, each volume having one or more molecular systems comprising a probe oligonucleotide A0 and one or more capture oligonucleotides B0 introduced to detect different target sequences.

[0351] In some embodiments, B0 is attached to the solid support prior to step (b). In some embodiments, B0 is attached to the solid support during steps (b) and (c).

[0352] In some embodiments, following attachment of B0 to the solid support and hybridization of A0 and B0 with the target, the supernatant, and thus any A0 that is not hybridized to the target nucleic acid analyte, is removed from the reaction mixture.

[0353] This removal may occur prior to (c). This removal can occur prior to (d). In some embodiments, the capture oligonucleotide is complementary to a region that is within 10000, 5000, 2500, 1000, 500, 250, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, or 5 nucleotides of the target nucleic acid sequence.

[0354] In some embodiments, the capture oligonucleotide is complementary to a region that is within 100 nucleotides of the target nucleic acid sequence. In some embodiments, the capture oligonucleotide is complementary to a region that is within 50 nucleotides of the target nucleic acid sequence.

[0355] In some embodiments, the capture oligonucleotide is complementary to a region that is within 10 nucleotides of the target nucleic acid sequence. In some embodiments, oligonucleotides A0 and B0 are linked together to form a single oligonucleotide.

[0356] In some embodiments, the solid support is a polymer- and / or resin-coated solid surface. In some embodiments, the solid support is a polystyrene solid support.

[0357] In some embodiments, polystyrene (C8H8) nWhat does n mean? n is 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 10,000, 11,000, 12, 000, 12,500, 15,000, 16,000, 17,000, 17,500, 18,000, 19,000, 20,000, 25,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, or more, or where n is any integer between any of these points, or where n is within any range derivable between any two of these points.

[0358] In some embodiments, the polystyrene solid support is a particle, a microbead, a magnetic bead, a resin, or any particle comprising a polystyrene polymer. In some embodiments, the polystyrene support is modified to include one or more of the following functional groups: amine, carboxylic acid, sulfonic acid, trimethylamine, and / or epoxide.

[0359] In some embodiments, the solid support is a magnetic bead. In some embodiments, the magnetic beads are in a shape that maximizes the surface area of ​​the beads. In some embodiments, the magnetic beads are regularly shaped.

[0360] In some embodiments, the magnetic beads are irregularly shaped. In some embodiments, the magnetic beads have a diameter of less than or equal to 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, 2.5, 1, 0.5, 0.25, or 0.1 microns.

[0361] In some embodiments, the solid support is a magnetic polystyrene bead. In some embodiments, the magnetic polystyrene beads comprise iron oxide. In some embodiments, the magnetic polystyrene beads are coupled with streptavidin.

[0362] In some embodiments, the solid support is a streptavidin-coupled Dynabead (RTM). In some embodiments, the solid support is a dextran-modified surface.

[0363] In some embodiments, the dextran modified surface is a particle, a microbead, a magnetic bead, a resin, or any particle that comprises a dextran polymer. In some embodiments, the dextran polymer has an approximate molecular weight of 1,000-410,000.

[0364] In some embodiments, the dextran polymer has an approximate molecular weight of from 25,000 to about 100,000. In some embodiments, the modified dextran surface is further modified to include one or more functional groups.

[0365] In some embodiments, the dextran-modified surface is modified to include one or more of the following functional groups: amine, carboxylic acid, sulfonic acid, trimethylamine, and / or epoxide.

[0366] In some embodiments, the solid support is a magnetic bead. In some embodiments, the magnetic beads are in a shape that maximizes the surface area of ​​the beads. In some embodiments, the magnetic beads are regularly shaped.

[0367] In some embodiments, the magnetic beads are irregularly shaped. In some embodiments, the magnetic beads have a diameter of less than or equal to 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, 2.5, 1, 0.5, 0.25, or 0.1 microns.

[0368] In some embodiments, the magnetic beads are dextran magnetic beads selected from Nanomag® Dextran (ND), Nanomag® Dextran-SO3H (ND-SO3H), BioMag® Dextran Coated Charcoal, or BioMag® Plus Dextran.

[0369] In some embodiments, the solid support is polyethylene glycol (PEG) or a PEG-modified surface. In some embodiments, the polyethylene glycol (PEG) or PEG-modified surface is a particle, microbead, magnetic bead, resin, or any particle that includes PEG.

[0370] In some embodiments of the present invention, PEG, (CHO) nWhat does n mean? n is 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 10,000, 11,000, 12, 000, 12,500, 15,000, 16,000, 17,000, 17,500, 18,000, 19,000, 20,000, 25,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, or more, or where n is any integer between any of these points, or where n is within any range derivable between any two of these points.

[0371] In some embodiments, the PEG utilized is PEG-200, PEG-300, PEG-400, PEG-600, PEG-1000, PEG-1300-1600, PEG-1450, PEG-3000-3700, PEG-3500, PEG-6000, PEG-8000, or PEG-17500.

[0372] In some embodiments where the polyethylene glycol (PEG) or PEG-modified surface is a magnetic microparticle or bead, the microparticle or bead is selected from Nanomag® PEG-300 (plain) or Nanomag®-D.

[0373] In some embodiments, the solid support is polyvinylpyrrolidone (PVP) or a PVP-modified surface. In some embodiments, the PVP or PVP modified surface is a particle, microparticle, magnetic bead, resin, or any particle that includes PVP.

[0374] In some embodiments of the present invention, PVP, n-vinylpyrrolidone refers to a compound having n of 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 10, 000, 11,000, 12,000, 12,500, 15,000, 16,000, 17,000, 17,500, 18,000, 19,000, 20,000, 25,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, or more, or where n is any integer between any of these points, or where n is within any range derivable between any two of these points.

[0375] In some embodiments, the solid support is a polysaccharide or a polysaccharide-modified surface. In some embodiments, the polysaccharide or polysaccharide-modified surface is a particle, microparticle, magnetic bead, resin, or any particle that includes a polysaccharide.

[0376] In some embodiments, the polysaccharide is selected from one or more of dextran, ficoll, glycogen, gum arabic, xanthan gum, carrageenan, amylose, agar, amylopectin, xylan, and / or beta-glucan.

[0377] In some embodiments, the solid support is a chemical resin or a surface modified with a chemical resin. In some embodiments, the chemical resin or chemical resin modified surface is selected from one or more of the following resins: isocyanate, glycerol, piperidino-methyl, polyDMAP (polymer bound dimethyl 4-aminopyridine), DIPAM (diisopropylaminomethyl, aminomethyl, polystyrenealdehyde, tris(2-aminomethyl)amine, morpholino-methyl, BOBA (3-benzyloxybenzaldehyde), triphenylphosphine, or benzylthiomethyl.

[0378] In some embodiments, B0 is covalently attached to the solid support via a capture moiety of B0. In some embodiments, the capture moiety of B0 is covalently attached to the solid support via a chemically cleavable linker, such as a disulfide, allyl, or azide-masked hemiaminal ether linker.

[0379] In some embodiments, the capture moiety of B0 is covalently attached to the solid support via an amide or phosphorothioate bond. Those skilled in the art will appreciate that there are numerous techniques for covalently and non-covalently immobilizing oligonucleotides to solid supports, see, for example, "Strategies for Attaching Oligonucleotides to Solid Supports" (2014) produced by Integrated DNA Technologies (IDT®).

[0380] In some embodiments, B0 is non-covalently attached to the solid support via a capture moiety of B0. Those skilled in the art will appreciate that there are numerous techniques for covalently and non-covalently immobilizing oligonucleotides to solid supports, see, for example, "Strategies for Attaching Oligonucleotides to Solid Supports" (2014) produced by Integrated DNA Technologies (IDT®).

[0381] In some embodiments, the capture portion of B0 comprises an oligonucleotide sequence and the solid support comprises an oligonucleotide bearing a complementary sequence. In some embodiments, the length of the complementary sequence is between 10, 20, 30, 40, 50, 100, 150, and 200 bases.

[0382] In some embodiments, the length of the complementary sequence is between 10, 20, 30, 40, 50, and 100 bases. In some embodiments, the length of the complementary sequence is between 10-20, 10-30, 10-40, and 10-50 bases.

[0383] In some embodiments, the length of the complementary sequence is between 10-20, 10-30, and 10-40 bases. In some embodiments, the length of the complementary sequence is between 10-20 and 10-30 bases.

[0384] In some embodiments, the complementary sequence is 10-20 bases in length. In some embodiments, the capture moiety comprises a chemical modification to B0 that attaches B0 to the solid support via an interaction between the chemical modification and the solid support.

[0385] In some embodiments, the chemical modification is biotin and the solid support further comprises streptavidin. In some embodiments of the method, the first reaction mixture comprises a plurality of different oligonucleotides A0 and B0, and the successfully hybridized A0 oligonucleotides are simultaneously enriched.

[0386] In some embodiments, prior to step (c), A0, the target nucleic acid, and optionally B0 are released from the solid support. In some embodiments, after step (c), A1, optionally B0, and optionally the target nucleic acid are released from the solid support.

[0387] In some embodiments, during step (c), A1, optionally B0, and optionally the target nucleic acid are released from the solid support. It will be understood that references to release of A0 encompass embodiments in which A0 is converted to A1 or A2 while bound to the solid surface and then released.

[0388] In some embodiments, A0, B0, and the target nucleic acid are released from the solid support by cleavage of the chemical linker through the addition of tris(2-carboxyethyl)phosphine (TCEP) or dithiothreitol (DTT) for disulfide linkers, or palladium complexes or allyl linkers, or TCEP for azide-masked hemiaminal ether linkers.

[0389] In some embodiments, A0, B0, and the target nucleic acid are released from the solid support by removing the non-canonical base from A0 or B0 and cleaving at the resulting abasic site. In some embodiments, the non-canonical base is uracil, which is removed by uracil DNA glycosylase. In an alternative embodiment, the non-canonical base is 8-oxoguanine, which is removed by formamidopyrimidine DNA glycosylase (Fpg).

[0390] In some embodiments, the capture moieties are oligonucleotide regions and release occurs through heating of the reaction mixture. In some embodiments, the reaction mixture is heated to between 37° C. and 100° C. for 1 to 20 minutes.

[0391] In some embodiments, the reaction mixture is heated for 1 to 15 minutes. In some embodiments, the reaction mixture is heated for 1 to 10 minutes. In some embodiments, the reaction mixture is heated for 1 to 5 minutes.

[0392] In some embodiments, the reaction mixture is heated for 5 minutes. In some embodiments, the reaction mixture is heated to between 37°C and 85°C. In some embodiments, the reaction mixture is heated to between 37°C and 75°C.

[0393] In some embodiments, the reaction mixture is heated to between 37°C and 65°C. In some embodiments, the reaction mixture is heated to between 37°C and 55°C. In some embodiments, the reaction mixture is heated to between 37°C and 45°C.

[0394] One skilled in the art will appreciate that the temperature to which the reaction mixture is heated to effect release of the complementary oligonucleotide region will depend on the length of said region. In some embodiments, release is achieved through cleavage of oligonucleotide B0. This cleavage can be achieved by any of the means described previously or subsequently, or by any of the means known to one of skill in the art.

[0395] In some embodiments, B0 is chemically cleaved. In some embodiments, B0 is enzymatically cleaved. In some embodiments, B0 is cleaved by a restriction enzyme.

[0396] In some embodiments, B0 is cleaved by an epigenetic modification-sensitive or -dependent restriction enzyme. In some embodiments, B0 is cleaved by a methylation-sensitive or -dependent restriction enzyme.

[0397] In some embodiments, B0 is cleaved by a hydroxymethylation-sensitive or -dependent restriction enzyme. In some embodiments, the restriction enzyme is an endonuclease.

[0398] In some embodiments, B0 is cleaved by a flap endonuclease. In some embodiments, B0 comprises a photocleavable linker, cleavage of which releases A0, B0, and the target nucleic acid from the solid support.

[0399] In some embodiments, B0 comprises a UV-cleavable linker, cleavage of which releases A0, B0, and the target nucleic acid from the solid support. In some embodiments, the release is achieved through cleavage of A0 with a methylation-sensitive or methylation-dependent restriction enzyme. In some embodiments, the release is achieved through cleavage of A0 and the nucleic acid analyte.

[0400] In some embodiments, where A0 and B0 are regions of the same oligonucleotide C0, C0 is cleaved with a methylation-sensitive or methylation-dependent restriction enzyme and the portion comprising A0 and the nucleic acid analyte is released from the solid support.

[0401] In some embodiments, release occurs prior to pyrophosphorolysis. In some embodiments, release occurs simultaneously with pyrophosphorolysis. In some embodiments, the target nucleic acid sequence hybridized to A0 is prevented from undergoing pyrophosphorolysis prior to release from the solid support by the presence of modifications or mismatches at its 3' end. In some embodiments, cleavage occurs in the 5' direction from these modifications or mismatches, thus creating a free 3' end that allows the pyrophosphorolysis reaction to proceed.

[0402] In some embodiments, cleavage and release occurs only in the presence of methylation in the target nucleic acid sequence. In some embodiments, cleavage and release occurs only in the absence of methylation in the target nucleic acid sequence.

[0403] In some embodiments, cleavage and release occurs only in the presence of hydroxymethylation in the target nucleic acid sequence. In some embodiments, cleavage and release occurs only in the absence of hydroxymethylation in the target nucleic acid sequence.

[0404] In some embodiments, cleavage and release occurs only in the presence of an epigenetic modification in the target nucleic acid sequence. In some embodiments, cleavage and release occurs only in the absence of epigenetic modifications in the target nucleic acid sequence.

[0405] In some embodiments of the present invention, (a) a molecular system comprising a probe oligonucleotide A0 capable of forming a first intermediate product with a target polynucleotide sequence, said intermediate product being at least partially double-stranded; (b) a capture oligonucleotide B0, comprising a capture portion and a region complementary to a region adjacent to the target nucleic acid sequence; (c) a solid support; and (d) a ligase; (e) a pyrophosphorolysis enzyme capable of digesting the first intermediate product in the 3'-5' direction from the end of A0 to produce a partially digested strand A1; (f) suitable buffers and A kit is provided comprising:

[0406] It will be understood by those skilled in the art that the kit may further comprise one or more of any of the reagents, components, or constructs previously described in one or more embodiments of the methods of the present invention.

[0407] In some embodiments of the invention, a device is provided that includes at least one flow path between first, second, third, fourth, fifth, and sixth regions, each region including one or more wells.

[0408] In some embodiments, the sample is introduced into a first region. In some embodiments, there is an additional region connected by a flow path to one or more of the first, second, third, fourth, fifth, or sixth regions. In some embodiments, the additional region comprises one or more wells. In some embodiments, the one or more wells comprises a binding buffer. In some embodiments, the one or more wells comprises a wash buffer. In some embodiments, the one or more wells comprises a binding and wash buffer.

[0409] In some embodiments, one or more wells in the first region comprise: - a molecular system comprising a probe oligonucleotide A0 comprising a region complementary to a target nucleic acid sequence; - a capture oligonucleotide B0, comprising a capture portion and a region complementary to a region adjacent to the target nucleic acid sequence; - a solid support; Includes.

[0410] In some embodiments, A0 can be as previously described. In some embodiments, B0 can be as previously described. In some embodiments, the capture moiety is as previously described. In some embodiments, one or more wells of the first region contain a reagent required for the release of B0 from the solid support. In some embodiments, the device is configured such that a release agent is introduced into one or more regions from one or more separate chambers.

[0411] In some embodiments, the solid support is as previously described. In some embodiments, the solid support is the surface of one or more wells. In some embodiments, the device further comprises one or more magnets, hi some embodiments, the one or more magnets are positioned to enable the one or more magnetic beads to move from one region of the device to another.

[0412] It will be appreciated by those skilled in the art that one or more regions of one or more wells of the device may be as previously or subsequently described.Various further aspects and embodiments of the invention will be apparent to those skilled in the art in view of the present disclosure.

[0413] As used herein, "and / or" should be interpreted as a specific disclosure of each of the two specified features or components, with or without the other. For example, "A and / or B" should be interpreted as a specific disclosure of (i) A, (ii) B, and (iii) each of A and B to the same extent as if each was individually set forth herein.

[0414] Unless the context dictates otherwise, the feature descriptions and definitions set forth above are not limited to any particular aspect or embodiment of the present invention, but apply equally to all aspects and embodiments described.

[0415] Those skilled in the art will further appreciate that, although the present invention has been described by way of example with reference to certain embodiments, the invention is not limited to the disclosed embodiments, and alternative embodiments can be constructed without departing from the scope of the invention as defined in the appended claims.

[0416] As used herein, a "magnetic microparticle" is a magnetically responsive microparticle that is attracted by a magnetic field. The magnetic microparticles used in the methods of the present invention comprise a magnetic metal oxide core generally surrounded by a polymer coating that creates a surface capable of binding DNA, RNA, or PNA. The magnetic metal oxide core is preferably iron oxide, where the iron is Fe 2+ and Fe 3+The preferred Fe 2+ / Fe 3+ The ratio is preferably 2 / 1, but can vary from about 0.5 / 1 to about 4 / 1.

[0417] Those skilled in the art will understand that when the term "predict" is used, for example "predicting the presence or absence of a particular sequence," this refers to determining the presence or absence of a particular feature based on the presence or absence of A2 or copies of A2, or a region or copies of region A2 of A2.

[0418] Those of skill in the art will understand that the embodiments describing a "primer" include within their scope primers described previously or subsequently in this document. Those skilled in the art will understand that embodiments in which a "primer" is described as being located in a particular region / well of a device or present in a particular reaction mixture include within their scope embodiments in which one or more of the blocking oligonucleotides described previously or subsequently are also present in the same region / well or reaction mixture.

[0419] Those skilled in the art will understand that embodiments in which a "molecular system comprising a probe oligonucleotide A0" is described as being located within a particular region / well of a device or present in a particular reaction mixture include within their scope embodiments in which one or more of the blocking oligonucleotides described previously or subsequently are also present therein. EXAMPLES

[0420] Example 1: Effect of the length of the annealing region between the probe and the target on the optimum temperature of the pyrophosphorolysis reaction 1. Polymerase Chain Reaction Mixtures corresponding to the following were prepared: 1x Q5U buffer 400nM primer mix 1 20U / mL Q5U polymerase 10U / mL heat-labile UDG 0.4ng / uL fragmented human genomic DNA Mutant oligonucleotides at + / - 0.2 aM Total volume 50uL This mixture was then incubated using a standard thermal cycler as follows: 37℃ 10 min 98℃ 1 min 98℃ 10 seconds 58℃ 15 seconds 72℃ 15sec×50 72℃ 5 min 4℃∞ Q5 buffer Q5 buffer is available from the commercial supplier NEB. Primer Mix 1: Forward (SEQ ID NO:36): 5'-C * C * C * AACCAAGCTCTCTTGAGGATCT-3' Reverse (SEQ ID NO:37): 5'- / 5Phos / GGGACCTTACCTTATACACCGTGC-3' [In the formula, * represents a phosphorothioate bond] Mutant oligonucleotide (SEQ ID NO:38): 5'-CCCAACCAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGG C CTCCGGTGCGTTCGGCACGGTGTATAAGGTAAGGTCCC-3' Bold and underlined - mutation site 2. Proteinase K Treatment Mixtures corresponding to the following were prepared: 1 x A7 20U / mL proteinase K 40uL of mixture, 1st point Total volume 90uL The mixture was then incubated at 55°C for 5 min and at 95°C for 10 min. 1 x A7 composition Tris acetate, pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Triton-X 0.01% 3. Pyrophosphorolysis (PPL) and Ligation Mixtures corresponding to the following were prepared: 1 x BFF1 10U / mL Klenow (exo-) 100U / mL E. coli ligase 1.2U / mL apyrase 100U / mL lambda exo 0.25 mM PPi Molecular system (20 nM probe oligonucleotide / 30 nM splint oligonucleotide) 1.25uL of the mixture from the second point. Total volume 10uL The mixture was then incubated at 30-50°C for 15 min. 1 x BFF1 composition Tris acetate, pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Triton-X 0.01% Probe (SEQ ID NO:1): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCGCAGATATAGGATGTTGCCGAACGCACCGGAGGCCAGCACTTTG-3' Splint oligonucleotide (SEQ ID NO:2): 5'-TGTCAAAGCTCATCGAACATCCGGTGCGTTCGGCAT-3' Probe (SEQ ID NO:3): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCGCAGATATAGGATGTTGCGGAACGCACCGGAGGCCAGCACTTTG-3' Splint oligonucleotide (SEQ ID NO: 4): 5'-TGTCAAAGCTCATCGAACATCCGGTGCGTTCGGCAT-3' Probe (SEQ ID NO:5): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCGCAGATATAGGATGTTGCGAAACGCACCGGAGGCCAGCACTTTG-3' Splint oligonucleotide (SEQ ID NO:6): 5'-TGTCAAAGCTCATCGAACATCCGGTGCGTTCGGCAA-3' Probe (SEQ ID NO: 7): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCGCAGATATAGGATGTTGCGATACGCACCGGAGGCCAGCACTTTG-3' Splint oligonucleotide (SEQ ID NO:8): 5'-TGTCAAAGCTCATCGAACATCCGGTGCGTATCGCAT-3' Probe (SEQ ID NO: 9): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCGCAGATATAGGATGTTGCGATTCGCACCGGAGGCCAGCACTTTG-3' Splint oligonucleotide (SEQ ID NO: 10): 5'-TGTCAAAGCTCATCGAACATCCGGTGCGAATCGCAT-3' Probe (SEQ ID NO:11): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCGCAGATATAGGATGTTGCGATTGGCACCGGAGGCCAGCACTTTG-3' Splint oligonucleotide (SEQ ID NO: 12): TGTCAAAGCTCATCGAACATCCGGTGCCAATCGCAT Probe (SEQ ID NO: 13): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCGCAGATATAGGATGTTGCGATTGCCACCGGAGGCCAGCACTTTG-3' Splint oligonucleotide (SEQ ID NO: 14): 5'-TGTCAAAGCTCATCGAACATCCGGTGGCAATCGCAT-3' Probe (SEQ ID NO: 15): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCGCAGATATAGGATGTTGCGATTGCGACCGGAGGCCAGCACTTTG Splint oligonucleotide (SEQ ID NO: 16): 5'-TGTCAAAGCTCATCGAACATCCGGTCGCAATCGCAT-3' [In the formula, * represents a phosphorothioate bond, and / 5Phos / represents the 5'-terminal phosphate. 4. Detect-RCA Mixtures corresponding to the following were prepared: 2.66× Thermopol buffer (53.2 mM Tris-HCl, 26.6 mM (NH4)2SO4, 26.6 mM KCl, 5.32 mM MgSO4, 0.266% Triton® X-100, pH 8.8) 0.28uM primer mix 1 284.4U / mL BST2.0 WarmStart 14.67U / mL TIPP 1.06 mM dNTPs Syto82 dye 3uM 1.25uL of reaction mixture from point 3. Total volume 11.25uL Primer Mix 1: Forward (SEQ ID NO:17): 5'-T * C * GCAACATCCTATATCTGC-3' Reverse (SEQ ID NO:18): 5'-T* G * AGCTTTGACAATACTTGA-3' [In the formula, * represents a phosphorothioate bond] The mixture was then incubated at 50° C. for 90 minutes using a standard real-time PCR instrument. Fluorescence measurements were taken every minute and Cq values ​​were obtained using standard instrument manufacturer's software. The difference in Cq between wild type and mutant-containing samples can be seen in FIG. 1.

[0421] The lengths of the annealing region are summarized in Table 1. The longer the length of the annealing region between the probe and the target molecule, the higher the optimum temperature. For 29 base pairs (sequence number 1 / 2) complementarity, the optimum is 46-50°C, and for 22 base pairs, 30-42°C.

[0422] Annealing regions that are too short can result in a decrease in dCq (SEQ ID NOs: 11 / 12 and 13 / 14). At a length of 19 base pairs, no positive signal could be detected indicating the presence of the target molecule (SEQ ID NOs: 15 / 16).

[0423] [Table 1]

[0424] Example 2: Effect of the length of the annealing region between the probe, its target, and its splint 1. Polymerase Chain Reaction Mixtures corresponding to the following were prepared: 1x Q5U buffer 400nM primer mix 1 20U / mL Q5U polymerase 10U / mL heat-labile UDG 0.4ng / uL fragmented human genomic DNA Mutant oligonucleotides at + / - 0.2 aM Total volume 50uL This mixture was then incubated using a standard thermal cycler as follows: 37℃ 10 min (98℃ 1 min. 98℃ 10 seconds 58℃ 15 seconds 72℃ 15 seconds) x 50 72℃ 5 min 4℃∞ Q5 buffer Q5 buffer is available from the commercial supplier NEB. Primer Mix 1: Forward (SEQ ID NO:19): 5'-A * C * G * TACTGGTGAAAACACCGC-3' Reverse (SEQ ID NO:20): 5'- / 5Phos / GCCTCCTTCTGCATGGTATTCT-3' [In the formula, * represents a phosphorothioate bond] Mutant oligonucleotide (SEQ ID NO:21): 5'-ACGTACTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCTGGCCAAAC A GCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGC-3' Bold and underlined - mutation site 2. Proteinase K Treatment Mixtures corresponding to the following were prepared: 1 x A7 20U / mL proteinase K 40uL of mixture, 1st point Total volume 90uL The mixture was then incubated at 55°C for 5 min and at 95°C for 10 min. 1 x A7 composition Tris acetate, pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Triton-X 0.01% 3. Pyrophosphorolysis (PPL) and Ligation Mixtures corresponding to the following were prepared: 1 x BFF1 10U / mL Klenow (exo-) 100U / mL E. coli ligase 1.2U / mL apyrase 100U / mL lambda exo 0.25 mM PPi 20 nM probe oligonucleotide 30 nM splint oligonucleotide 1.25uL of the mixture from the second point. Total volume 10uL The mixture was then incubated at 45° C. for 15 min. 1 x BFF1 composition Tris acetate, pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Triton-X 0.01% Probe oligonucleotide (SEQ ID NO:22): 5'- / 5Phos / A*TGTTCGATGAGCTTTGACAATACTTGATCGATGCAGATATAGGATGTTGCGACGCACCCAGCTGTTTGG-3' Probe oligonucleotide (SEQ ID NO:23): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGATCGATGCAGATATAGGATGTTGCGACGCACCCAGCTGTTTGGCCAGCCCAAAATCTGTGAT-3' [In the formula, * represents a phosphorothioate bond, and / 5Phos / represents a phosphate at the 5' end. Splint oligonucleotide (SEQ ID NO: 24): 5'-TGTCAAAGCTCATCGAACATTGGGTGTCGCAACATG-3' Splint oligonucleotide (SEQ ID NO: 25): 5'-TGTCAAAGCTCATCGAACATGTCGCAACAGAAGTCGCAACATG-3' Splint oligonucleotide (SEQ ID NO: 26): 5'-TGTCAAAGCTCATCGAACATCGTCGCAACGAAGTCGCAACATG-3' Splint oligonucleotide (SEQ ID NO: 27): 5'-TGTCAAAGCTCATCGAACATGCGTCGCAAGAAGTCGCAACATG-3' Splint oligonucleotide (SEQ ID NO: 28): 5'-TGTCAAAGCTCATCGAACATTGCGTCGCAGAAGTCGCAACATG-3' Splint oligonucleotide (SEQ ID NO: 29): 5'-TGTCAAAGCTCATCGAACATGTGCGTCGCGAAGTCGCAACATG-3' Splint oligonucleotide (SEQ ID NO: 30): 5'-TGTCAAAGCTCATCGAACATGGTGCGTCGGAAGTCGCAACATG-3' Splint oligonucleotide (SEQ ID NO: 31): 5'-TGTCAAAGCTCATCGAACATGGGTGCGTCGAAGTCGCAACATG-3' Splint oligonucleotide (SEQ ID NO: 32): 5'-TGTCAAAGCTCATCGAACATTGGGTGCGTGAAGTCGCAACATG-3' Splint oligonucleotide (SEQ ID NO: 33): 5'-TGTCAAAGCTCATCGAACATCTGGGTGCGGAAGTCGCAACATG-3' Splint oligonucleotide (SEQ ID NO: 34): 5'-TGTCAAAGCTCATCGAACATGCTGGGTGCGAAGTCGCAACATG-3' 4. Detect-RCA Mixtures corresponding to the following were prepared: 2.66× Thermopol buffer (53.2 mM Tris-HCl, 26.6 mM (NH4)2SO4, 26.6 mM KCl, 5.32 mM MgSO4, 0.266% Triton® X-100, pH 8.8) 0.28uM primer mix 1 284.4U / mL BST2.0 WarmStart 14.67U / mL TIPP 1.06 mM dNTPs Syto82 dye 3uM 1.25uL of reaction mixture from point 3. Total volume 11.25uL Primer Mix 1: Forward (SEQ ID NO:17): 5'-T * C * GCAACATCCTATATCTGC-3' Reverse (SEQ ID NO:18): 5'-T * G * AGCTTTGACAATACTTGA-3' [In the formula, * represents a phosphorothioate bond] The mixture was then incubated at 50° C. for 90 min using a standard real-time PCR instrument. Fluorescence measurements were taken every minute and Cq values ​​were obtained using standard instrument manufacturer's software. The difference in Cq values ​​(dCq) observed for wild-type and mutant-containing samples can be seen in FIG. 2.

[0425] A summary of the lengths tested can be found in Table 2. For probe SEQ ID NO:22 (Figure 2A), the best performing splint sequence is SEQ ID NO:24. For probe SEQ ID NO:23 (Figure 2B), the best performing splint sequence is SEQ ID NO:31. The closer the ligation point is located to the start of the probe sequence, the higher the dCq value. Compared to SEQ ID NO:22, probe SEQ ID NO:23 has a longer region of complementarity with the target, 23 base pairs compared to 17 base pairs, resulting in a higher dCq value.

[0426] [Table 2]

[0427] Example 3: Further probe / sprint combinations 1. Polymerase Chain Reaction Mixtures corresponding to the following were prepared: 1x Q5U buffer 400nM primer mix 1 20U / mL Q5U polymerase 10U / mL heat-labile UDG 0.4ng / uL fragmented human genomic DNA Mutant oligonucleotides at + / - 0.2 aM Total volume 50uL This mixture was then incubated using a standard thermal cycler as follows: 37℃ 10 min (98℃ 1 min. 98℃ 10 seconds 58℃ 15 seconds 72℃ 15 seconds) x 50 72℃ 5 min 4℃∞ Q5 buffer Q5 buffer is available from the commercial supplier NEB. Primer Mix 1: Forward (SEQ ID NO:19): 5'-A * C * G * TACTGGTGAAAACACCGC-3' Reverse (SEQ ID NO:20): 5'- / 5Phos / GCCTCCTTCTGCATGGTATTCT-3' [In the formula, * represents a phosphorothioate bond] Mutant oligonucleotide (SEQ ID NO:21): 5'-ACGTACTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCTGGCCAAAC A GCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGC-3' Bold and underlined - mutation site 2. Proteinase K Treatment Mixtures corresponding to the following were prepared: 1 x A7 20U / mL proteinase K 40uL of mixture, 1st point Total volume 90uL The mixture was then incubated at 55°C for 5 min and at 95°C for 10 min. 1 x A7 composition Tris acetate, pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Triton-X 0.01% 3. Pyrophosphorolysis (PPL) and Ligation Mixtures corresponding to the following were prepared: 1 x BFF1 10U / mL Klenow (exo-) 100U / mL E. coli ligase 1.2U / mL apyrase 100U / mL lambda exo 0.25 mM PPi 20 nM probe oligonucleotide 30 nM splint oligonucleotide 1.25uL of the mixture from the second point. Total volume 10uL The mixture was then incubated at 45° C. for 15 min. 1 x BFF1 composition Tris acetate, pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Triton-X 0.01% Probe oligonucleotide (SEQ ID NO:22): / 5Phos / A*TGTTCGATGAGCTTTGACAATACTTGATCGATGCAGATATAGGATGTTGCGACGCACCCAGCTGTTTGG Probe oligonucleotide (SEQ ID NO:23): / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGATCGATGCAGATATAGGATGTTGCGACGCACCCAGCTG [In the formula, * represents a phosphorothioate bond] Splint oligonucleotide (SEQ ID NO:24): TTTGGCCAGCCCAAAATCTGTGAT Splint oligonucleotide (SEQ ID NO:35): TGTCAAAGCTCATCGAACATGGGTGCGGAAGTCGCT 4. Detect-RCA Mixtures corresponding to the following were prepared: 2.66× Thermopol buffer (53.2 mM Tris-HCl, 26.6 mM (NH4)2SO4, 26.6 mM KCl, 5.32 mM MgSO4, 0.266% Triton® X-100, pH 8.8) 0.28uM primer mix 1 284.4U / mL BST2.0 WarmStart 14.67U / mL TIPP 1.06 mM dNTPs Syto82 dye 3uM 1.25uL of reaction mixture from point 3. Total volume 11.25uL Primer Mix 1: Forward (SEQ ID NO:17): 5'-T * C * GCAACATCCTATATCTGC-3' Reverse (SEQ ID NO:18): 5'-T* G * AGCTTTGACAATACTTGA-3' [In the formula, * represents a phosphorothioate bond] The mixture was then incubated at 50° C. for 90 minutes using a standard real-time PCR instrument. Fluorescence measurements were taken every minute and Cq values ​​were obtained using standard instrument manufacturer's software. The difference in Cq (dCq) between wild type and mutant-containing samples can be seen in FIG. 3. Probes SEQ ID NOs: 22 and 23 have complementary regions of 17 and 35 bases length with the target molecule, respectively. The higher the number of complementary bases / longer the length of the complementary region, the higher the dCq values ​​seen for AF concentrations of 0.1% and 0.5% of the target molecule.

[0428] Example 4: Further applications of the method of the present invention Methylation frequencies of highly related methylated genes (HRMG) in human cancers

[0429] [Table 3]

[0430] Methylation of lung cancer biomarkers Lung cancer is a leading cause of cancer-related mortality for several reasons, including its late manifestation of symptoms and the low sensitivity of screening techniques such as chest radiography. DNA fragments shed from tumor cells can provide a convenient and minimally invasive access to the molecular portrait of cancer, and these DNA fragments are found in cell-free DNA (cfDNA) isolated from the blood of cancer patients. Cell-free circulating tumor DNA (ctDNA) in plasma represents a surrogate for the entire cancer genome, and ctDNA represents a low proportion of the total cfDNA, 0.05% or less, in many cancer patients, especially early in the disease. These characteristics make aberrant methylation of ctDNA a promising cancer biomarker, and recent high-throughput studies have demonstrated correspondence of changes in methylation profiles between ctDNA and DNA from paired tumor tissues. A list of methylation markers for lung cancer diagnostics and prognosis is provided below.

[0431] [Table 4]

[0432] TERT and MGMT promoter methylation and its impact on brain cancer O 6 The -methylguanine-DNA methyltransferase (MGMT) gene encodes an evolutionarily conserved and ubiquitously expressed methyltransferase involved in DNA repair. MGMT removes alkyl adducts from the O6 position of guanine to prevent DNA damage and confer a protective effect on normal cells. However, the endogenous function of MGMT also protects tumor cells from the otherwise lethal effects of chemotherapy with alkylating agents such as temozomide (TMZ). Silencing or reduced expression of MGMT through methylation of its corresponding gene promoter has been observed in 50% of grade IV gliomas, impairing DNA repair and resulting in increased chemosensitivity to agents such as TMZ. Thus, the methylation status of the MGMT promoter has potential as a biomarker of sensitivity to alkylating chemotherapy, ultimately impacting clinical practice. Although its capacity as both a predictive and prognostic biomarker has been extensively studied, currently there is no consensus on the optimal method for assessment of MGMT gene promoter methylation.

[0433] Telomere maintenance protects the integrity of chromosome ends and allows replicative immortalization, a hallmark of human cancer. The telomere reverse transcriptase (TERT) oncogene encodes the rate-limiting catalytic subunit of the telomerase holoenzyme, which is responsible for telomere maintenance and is normally expressed only in a subset of stem cells. The TERT gene is reactivated in approximately 90% of cancer cells, allowing unlimited proliferation and immortalization of these cell types. Various genetic and epigenetic mechanisms underlying TERT dysregulation have been identified, with hypermethylation of the TERT promoter region representing a unique hallmark of cancer cells. Interestingly, methylation, but not mutations, in the upstream of the transcription start site (UTSS) of the TERT gene were found to be strongly associated with increased TERT expression and poor prognosis in pediatric brain tumors. Given the prevalence of TERT promoter hypermethylation in a wide variety of cancer cell types, this epigenetic modification represents a useful prognostic biomarker. Genes that are methylated or not, such as prostate cancer genes Prostate cancer is the most frequently diagnosed non-cutaneous malignancy and the leading cause of cancer-related deaths in men in Western industrialized countries. Numerous DNA methylation changes have been observed between benign and cancerous prostate tissues, and the changes are often early and recurrent, suggesting a potential functional role. Multiple genome-wide studies have reported that several genes and gene families are recurrently hypermethylated in prostate cancer. The genes and gene families include, but are not limited to, GSTP1, MGMT, AR, ER, VHL, RB1, APC, DAPK, CD44, AOX1, APC, CDKN2A, HOXD3, PTGS2, RARB, WT1, ZNF154, C20orf103, EFS, HOXC11, LHX9, RUNX3, TBX15, BARHL2, BDNF, CCDC8, CYP27A1, DLX1, EN2, ESR1, FBLN1, FOXE3, GP5, FRSP, HHEX, HOXA3, HOXD4, HOXD8. IRX1, KIT, LBX1, LHX2, NKX2-1, NKX2-2, NKX2-5, PHOXRA, POU3F3, RHCG, SIX6, TBX3, TMEM106, VAX1, and WNT2. Methylation of pancreatic cancer markers Pancreatic ductal adenocarcinoma (PDAC) is one of the most deadly cancer types. This form of cancer is difficult to diagnose due to the lack of early diagnostic tests currently available, which means that diagnosis occurs when the disease is already advanced (more than 75% of diagnosed cases are stage III / IV disease). This has resulted in a high recorded mortality rate. Early diagnosis has proven difficult due to the lack of reliable biomarkers that can capture the early development and / or progression of PDAC. Currently, the only FDA-approved biomarker for prognostic monitoring of patients with PDAC is carbohydrate antigen 19-9 (CA19-9 or sialylated Lewis antigen). This antigen shows low sensitivity and specificity for detection of the disease. Therefore, its use is not recommended for diagnostic purposes unless used in combination with other circulating biomarkers.

[0434] Recent studies have shown that methylation analysis of cell-free DNA (cfDNA) represents a promising non-invasive approach to discover biomarkers with diagnostic potential. It may be possible to utilize cfDNA methylation for the identification of disease-specific signatures in pre-neoplastic lesions or chronic pancreatitis (CP). As CP often precedes PDAC, dynamic DNA methylation patterns of a set of defined genes may underlie disease progression. The ductal cell marker CUX2 shows increased signal in PDAC, and the ductal and acing cell marker REG1A shows gradually increasing signal in chronic pancreatitis. The biomarkers ADAMTS1 and BNC1 have been found to have high methylation frequencies in primary PDAC and pre-neoplastic pancreatic intraepithelial neoplasia (PIN) (25% and 70% for ADAMTS1 and BNC1, respectively). Combined cfDNA methylation of ADAMTS1 and BNC1 may be utilized for early diagnosis of pancreatic cancer (i.e., stages I and II). A list of potential biomarkers is provided below.

[0435] [Table 5]

[0436] KRAS detection The KRAS gene controls cell proliferation, and when it is mutated, this negative signaling is disrupted and cells can continue to proliferate, often developing into cancer. Single amino acid substitutions, particularly single nucleotide substitutions, are responsible for activating mutations associated with various cancers, namely lung adenocarcinoma, mucinous adenoma, pancreatic ductal adenocarcinoma, and colorectal cancer. KRAS mutations have been used as prognostic biomarkers, for example, in lung cancer.

[0437] Driver mutations in KRAS have been associated with up to 20% of human cancers, and targeted therapies are under development for this mutation and its associated diseases; a partial non-limiting list of such treatments can be seen in the table below.

[0438] [Table 6]

[0439] The presence of KRAS mutations has been found to reflect a very poor response to the EGFR inhibitors panitumumab (Vectibix) and cetuximab (Erbitux). Activating mutations in the gene encoding KRAS occur in 30%-50% of colorectal cancers, and studies have shown that patients whose tumors express this mutated version of the KRAS gene do not respond to panitumumab and cetuximab. Although the presence of a wild-type KRAS gene is not a guarantee that a patient will respond to these drugs, studies have shown that cetuximab has significant efficacy in metastatic colorectal cancer patients with wild-type KRAS tumors. For the EGFR antagonists erlotinib or gefitinib, lung cancer patients who are positive for KRAS mutations (wild-type EGFR) have an estimated response rate of 5% or less, compared to a 60% response rate in patients who do not harbor KRAS mutations.

[0440] Early detection of the emergence of KRAS mutations (activating or overexpressing), a frequent driver of acquired resistance to cetuximab therapy (anti-EGFR therapy) in colorectal cancer, allows modification of treatment (e.g., early initiation of mitogen-activated protein kinase kinase [MEK] inhibitors) upon delayed or reverse resistance, and it is therefore advantageous that the methods of the invention allow for rapid and inexpensive detection of KRAS status in patients.

[0441] A non-limiting list of mutations are G12D, G12A, G12C, G13D, G12V, G12S, G12R, A59T / E / G, Q61H, Q61K, Q61R / L, K117N, and A146P / T / V.

[0442] A further non-limiting list of mutations is provided in the table below.

[0443] [Table 7]

[0444] BRAF detection BRAF is a human gene that encodes a protein called B-Raf, which is involved in sending signals into cells that are involved in directing cell growth. It has been shown to be mutated in some human cancers. B-Raf is a member of the Raf kinase family of growth-signaling protein kinases and plays a role in regulating the MAP kinase / ERK signaling pathway, which among other things affects cell division.

[0445] Certain other inherited BRAF mutations cause birth defects. More than 30 mutations in the BRAF gene have been identified that have been associated with human cancers. In 90% of cases, there is a substitution of adenine for thymine at nucleotide 1799. This results in a substitution of glutamic acid (E) for valine (V) at codon 600 in the activating segment found in human cancers (referred to here as V600E). This mutation is - Colorectal cancer - Melanoma - Papillary thyroid cancer - Non-small cell lung cancer - Ameloblastoma It has been widely observed in

[0446] A non-limiting list of other mutations found are R461I, I462S, G463E, G463V, G465A, G465E, G465V, G468A, G468E, N580S, E585K, D593V, F594L, G595R, L596V, T598I, V599D, V599E, V599K, V599R, V600K, and A727V.

[0447] Drugs are being developed to treat cancers driven by BRAF mutations. Vemurafenib and dabrafenib have been approved by the FDA for the treatment of late-stage melanoma. The response rate to treatment with vemurafenib was 53% for metastatic melanoma, compared to 7-12% for the previous best chemotherapy agent, dacarbazine. ERBB2 / HER2 detection Human epidermal growth factor receptor 2 (HER2), also known as CD340 (cluster of differentiation 340), proto-oncogene Neu, Erbb2 (rodent), or ERBB2 (human), is a protein encoded by the ERBB2 gene. Amplification or overexpression of this oncogene plays an important role in the progression of invasive breast cancer. Overexpression of the ERBB2 gene is also known to occur in ovarian, gastric, lung adenocarcinoma, and invasive forms of uterine cancer, as well as in 30% of salivary duct carcinomas. Structural alterations have also been identified that cause ligand-independent firing of the receptor in the absence of overexpression.

[0448] A number of targeted therapies are approved and in development for this mutation and its associated diseases, a partial non-limiting list of such treatments can be seen in the table below.

[0449] [Table 8]

[0450] HER2 testing is routinely performed in breast cancer patients to assess prognosis, monitor response to treatment, and determine suitability for targeted therapy (such as trastuzumab). Because trastuzumab is expensive and associated with severe side effects (cardiotoxicity), it is important that only HER2+ patients are selected to receive it, and it is therefore advantageous that the method of the present invention allows for rapid and inexpensive detection of a patient's HER2 status.

[0451] In one embodiment, the methods of the invention are used to detect the presence or absence of an ERRB2 exon 20 insertion mutation. A further non-limiting list of ERBB2 mutations is provided in the table below.

[0452] [Table 9]

[0453] EML4-ALK detection EML4-ALK is an abnormal gene fusion between the echinoderm microtubule-associated protein-like 4 (EML4) gene and the anaplastic lymphoma kinase (ALK) gene. This gene fusion leads to the production of the protein EML4-ALK, which is thought to promote and maintain the malignant behavior of cancer cells. EML4-ALK-positive lung cancers are primary malignant lung tumors whose cells contain this mutation.

[0454] A number of targeted therapies are approved and in development for this mutation and its associated diseases, a partial non-limiting list of such treatments can be seen in the table below.

[0455] [Table 10]

[0456] The EML4-ALK gene fusion is responsible for approximately 5% of non-small cell lung cancers (NSCLC), with approximately 9,000 new cases in the United States and 45,000 worldwide each year. Numerous variants of EML4-ALK exist, all of which contain the essential coiled-coil domain in the N-terminal part of EML4 and in the kinase domain of ALK exon 20, which are necessary for transforming activity. Fusion of EML4 exon 13 with ALK exon 20 (variant 1: V1), fusion of EML4 exon 20 with ALK exon 20 (V2), and fusion of EML4 exon 6 with ALK exon 20 (V3) are some of the more common variants. The clinical significance of these various variants has only recently become clear.

[0457] V3 has emerged as a suitable marker for the selection of patients likely to have shorter progression-free survival (PFS) after non-tyrosine kinase inhibitor (TKI) treatments such as chemotherapy and radiotherapy. Further evidence exists that V3 is associated with shorter PFS and worse overall survival (OS) in patients receiving first- and second-generation treatment lines compared with EML4-ALK V1 and V2.

[0458] It has also been found that V3-positive patients develop resistance to the first and second treatment lines, which occurs through the development of resistance mutations and is likely driven by incomplete tumor cell suppression due to the higher IC50 of wild-type V3.Detection of unfavorable V3 can be used to select patients who require more invasive monitoring and treatment strategies.Administering third-generation lorlatinib to patients with V3 may give them longer PFS than those with V1, and therefore it is considered advantageous that the method of the present invention allows for the rapid and inexpensive detection of mutations that patients may have.

[0459] The methods of the present invention further allow for the detection of resistance mutations such as, but not limited to, G1202R, G1269A, E1210K, D1203, S1206C, L1196M, F1174C, I1171T, I1171N / S, V1180L, T1151K, and C1156Y.

[0460] For example, G1202R is a solvent-tip mutation that causes interference with drug binding and confers high levels of resistance to first and second generation ALK inhibitors. Thus, the methods of the present invention advantageously allow for the identification of patients who may carry this mutation and benefit from initiating treatment with third generation treatments rather than first or second generation treatments.

[0461] A further non-limiting list of EML4-ALK mutations is provided in the table below.

[0462] [Table 11]

[0463] EGFR detection The identification of the epidermal growth factor receptor (EGFR) as an oncogene has led to the development of targeted therapies such as gefitinib, erlotinib, afatinib, brigatinib, and icotinib for lung cancer, and cetuximab for colon cancer. However, many patients develop resistance to these treatments. The two main sources of resistance are the T790M mutation and the MET oncogene.

[0464] EGFR mutations occur in EGFR exons 18-21, and mutations in exons 18, 19, and 21 indicate suitability for treatment with EGFR-TKIs (tyrosine kinase inhibitors). Mutations in exon 20 (with the exception of a few mutations) indicate that the tumor is EGFR-TKI-resistant and not suitable for treatment with EGFR-TKIs.

[0465] The two most common EGFR mutations are a short in-frame deletion in exon 19 and a point mutation in exon 21 at nucleotide 2573 (CTG to CGG), resulting in a substitution of leucine with arginine at codon 858 (L858R). Together, these two mutations account for approximately 90% of all EGFR mutations in non-small cell lung cancer (NSCLC). Screening for these mutations in patients with NSCLC can be used to predict which patients will respond to TKIs.

[0466] Therefore, it is advantageous that the method of the present invention allows identification of patients who carry these mutations and can benefit from starting treatment with TKI.Those skilled in the art will understand that the method of the present invention allows identification of a range of EGFR mutations.A non-exhaustive list of such mutations is G719X, Ex19Del, S768I, Ex20Ins, and L861Q.

[0467] A further non-limiting list of mutations is provided in the table below.

[0468] [Table 12-1]

[0469] [Table 12-2]

[0470] ROS1 ROS1 is a receptor tyrosine kinase (encoded by the gene ROS1) with structural similarity to the anaplastic lymphoma kinase (ALK) protein, which is encoded by the c-ros oncogene.

[0471] A non-limiting list of ROS1 mutations is provided in the table below.

[0472] [Table 13]

[0473] RET proto-oncogene The RET proto-oncogene encodes a receptor tyrosine kinase for members of the glial cell line-derived neurotrophic factor (GDNF) family of extracellular signaling molecules.

[0474] A non-limiting list of RET mutations is provided in the table below.

[0475] [Table 14]

[0476] MET exon 14 MET exon 14 skipping occurs with a frequency of approximately 5% in NSCLC and is seen in both squamous and adenocarcinoma histologies.

[0477] A non-limiting list of MET mutations is provided in the table below.

[0478] [Table 15]

[0479] NTRK proto-oncogene NTRK gene fusions result in abnormal proteins called TRK fusion proteins, which can cause cancer cells to grow. NTRK gene fusions can be found in some types of cancer, including brain, head and neck, thyroid, soft tissue, lung, and colon cancers. They are also called neurotrophic tyrosine receptor kinase gene fusions.

[0480] A non-limiting list of NTRK mutations is provided in the table below.

[0481] [Table 16]

[0482] panel In one embodiment of the present invention, a panel is provided that includes a plurality of probe molecules (A0), each A0 being complementary to a target mutation. The mutation can be selected from any of the previously described or subsequently described or known mutations. Thus, those skilled in the art will understand that within the scope of the present invention are included panels that can be useful for detecting one or more mutations in any of the previously described or subsequently described or known proto-oncogenes or oncogenes.

[0483] In one embodiment, the panel comprises between 5 and 500 individual probe molecules, each complementary to a specific target mutation. In one embodiment, the panel comprises between 5 and 400 individual probe molecules, each complementary to a specific target mutation. In one embodiment, the panel comprises between 5 and 300 individual probe molecules, each complementary to a specific target mutation. In one embodiment, the panel comprises between 5 and 200 individual probe molecules, each complementary to a specific target mutation. In one embodiment, the panel comprises between 5 and 100 individual probe molecules, each complementary to a specific target mutation. In one embodiment, the panel comprises between 5 and 50 individual probe molecules, each complementary to a specific target mutation.

[0484] In one embodiment, there may be multiple probe molecules specific for the same mutation, hi one embodiment, there may be only one probe molecule specific for each mutation in the panel.

[0485] In one embodiment, a panel is provided that comprises a plurality of probe molecules, wherein one or more probes are complementary to EGFR mutations, one or more probes are complementary to KRAS mutations, one or more probes are complementary to ERBB2 / HER2 mutations, one or more probes are complementary to EML4-ALK mutations, one or more probes are complementary to ROS1 mutations, one or more probes are complementary to RET mutations, and one or more probes are complementary to MET mutations.

[0486] In one embodiment, a panel is provided that comprises a plurality of probe molecules, wherein one or more probes may be complementary to EGFR mutations, one or more probes may be complementary to KRAS mutations, one or more probes may be complementary to ERBB2 / HER2 mutations, one or more probes may be complementary to EML4-ALK mutations, one or more probes may be complementary to ROS1 mutations, one or more probes may be complementary to RET mutations, and one or more probes may be complementary to MET mutations.

[0487] In one embodiment, a panel of probes selective for one or more EGFR, KRAS, BRAF, ERBB2 / HER2, EML4-ALK, ROS1, RET, MET mutations is provided.

[0488] In one embodiment, a panel of probe molecules selective for EGFR mutations is provided. In one embodiment, a panel of probe molecules selective for KRAS mutations is provided. In one embodiment, a panel of probe molecules selective for BRAF mutations is provided.

[0489] In one embodiment, a panel of probe molecules selective for ERBB2 / HER2 mutations is provided. In one embodiment, a panel of probe molecules selective for EML4-ALK mutations is provided.

[0490] In one embodiment, a panel of probe molecules selective for ROS1 mutations is provided. In one embodiment, a panel of probe molecules selective for RET mutations is provided. In one embodiment, a panel of probe molecules selective for NTRK mutations is provided.

[0491] In one embodiment, a panel of probe molecules selective for ROS1 mutations is provided. In one embodiment, a panel of probe molecules selective for MET exon 14 mutations is provided.

[0492] In one embodiment, a panel is provided that comprises a plurality of probe molecules selective for one or more coding sequences (CDS). In one embodiment, a method is provided for detecting one or more mutations using one or more of the previously described panels.

[0493] In one embodiment, a method is provided for detecting the presence or absence of one or more mutations using one or more of the previously described panels. In one embodiment, a kit is provided that includes a panel, which may be as previously or subsequently described, in combination with one or more reagents, which may be as previously or subsequently described.

[0494] One of skill in the art will appreciate that the embodiments of the kit disclosing A0 include within their scope embodiments in which there is a panel comprising multiple A0s. Those of skill in the art will appreciate that the present disclosure further encompasses embodiments of panels that include a capture oligonucleotide B0, including embodiments in which A0 and B0 are regions of the same oligonucleotide C0.

[0495] In one embodiment, a methylation detection panel is provided. In one embodiment, a methylation detection kit is provided. Companion Diagnostics The method of the present invention can be used to detect specific genetic markers in samples that can be used to help guide the selection of appropriate treatment. These markers can be tumor-specific mutations or wild-type genomic sequences and can be detected using tissue, blood, or any other type of patient sample. The markers can be epigenetic markers. Monitoring resistance Repeated testing of patient samples during disease treatment may allow early detection of emerging resistance to therapy. One example of this application is in non-small cell lung cancer (NSCLC), where epidermal growth factor receptor (EGFR) inhibitors (e.g., gefitinib, erlotinib) are commonly used as first-line treatment. During treatment, tumors can often develop mutations in the EGFR gene (e.g., T790M, C797S), which confer resistance to the drug. Early detection of these mutations may allow patients to move to alternative treatments (e.g., Tagrisso). Epigenetic changes to the patient's DNA may indicate the emergence of resistance.

[0496] Typically, patients who are monitored for resistance development may be too sick to perform repeated tissue biopsies, which may also be expensive, invasive, and have associated risks. Although testing from blood is preferred, the mutation of interest may be present in a reasonable blood sample at very low copy number. Therefore, monitoring requires highly sensitive testing from blood samples using the method of the present invention, which is simple and cost-effective to perform so that it can be performed periodically. Monitoring for recurrence In this application, patients who are declared disease-free after treatment can be monitored over time to detect disease recurrence. This needs to be done non-invasively and requires sensitive detection of target sequences from blood samples. Using the method of the present invention provides a simple and inexpensive method that can be performed routinely. The target sequences can be common mutations known to be common in the disease of interest, or can be custom panels of targets designed for a specific patient based on detection of variants in tumor tissue before remission. Minimal Residual Disease (MRD) Monitoring In some cancers, there are residual cancer cells that remain in the patient after treatment, which is the main cause of relapse in cancer and leukemia. Monitoring and testing for MRD has several important roles: determining whether the treatment has eradicated the cancer or if traces remain, comparing the effectiveness of various treatments, monitoring the remission status of the patient and detecting the relapse of leukemia, and selecting the treatment that best meets these needs. screening Population screening for early detection of disease is a long-standing goal, especially in cancer diagnostics. The challenge is twofold: identification of a panel of markers that allows confident detection of disease with not too many false negatives, and development of a method with sufficient sensitivity and low enough price. Using the method of the present invention, a panel of mutations larger than PCR-based tests can be addressed with a much simpler workflow and lower price than sequencing-based diagnostics. Organ graft rejection If the transplanted organ is rejected by the recipient, DNA from the organ will be shed into the recipient's bloodstream. Early detection of this DNA will allow early detection of rejection. This can be achieved using a custom panel of donor-specific markers, or by using a panel of variants known to be common in the population, some of which are present in the donor and some in the recipient. Routine monitoring of organ recipients over time can be made possible by the low-cost and simple workflow of the invention disclosed herein. Non-invasive prenatal testing (NIPT) It has been known for a long time that fetal DNA exists in maternal blood, and the NIPT market is now completely saturated with companies that use sequencing to identify mutations and count the copy number of certain chromosomes to enable fetal abnormality detection.The method of the present invention disclosed herein has the ability to detect mutations at very low allele fractions, potentially enabling earlier detection of fetal DNA.Identification of common mutations in a given population will allow development of assays that target mutations that may exist in either maternal or fetal DNA, or enable detection of abnormalities at an early stage of pregnancy.

[0497] Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure. As used herein, "and / or" should be interpreted as a specific disclosure of each of the two specified features or components, with or without the other. For example, "A and / or B" should be interpreted as a specific disclosure of (i) A, (ii) B, and (iii) each of A and B to the same extent as if each was individually set forth herein.

[0498] Unless the context dictates otherwise, the feature descriptions and definitions set forth above are not limited to any particular aspect or embodiment of the present invention, but apply equally to all aspects and embodiments described.

[0499] Those skilled in the art will further appreciate that, although the present invention has been described by way of example with reference to certain embodiments, the invention is not limited to the disclosed embodiments, and alternative embodiments can be constructed without departing from the scope of the invention as defined in the appended claims.

[0500] Those skilled in the art will understand that reference to "partially digested strand A1" may refer to a single stranded oligonucleotide formed by progressive digestion of A0, in the 3'-5' direction, until the strand dissociates due to lack of complementarity when hybridized to a target analyte sequence.

[0501] Those skilled in the art will understand that reference to a "partially double-stranded" nucleic acid can refer to a nucleic acid in which one or more portions are double-stranded and one or more portions are single-stranded. Those of skill in the art will understand that reference to a "substantially double-stranded" nucleic acid can refer to a nucleic acid in which one or more portions are double-stranded and one or more fewer portions are single-stranded.

Claims

1. A panel comprising a plurality of molecular systems for detecting a plurality of target polynucleotide sequences in a given nucleic acid analyte, each of the plurality of molecular systems comprising a probe molecule (A ０ ) and a hybridized splint molecule (C), i. Each A ０ has a variable 3' end, a loop region, and a 5' phosphate that is complementary to one of the target polynucleotide sequences; ii. C is A ０ and providing a single-stranded 3' overhang having a variable sequence; The single-stranded 3' overhang is ０ The panel is capable of hybridizing to a region located within a loop region of 1 to 50 bases in the 5' direction from the 3' end of the

2. A ０ and C over a region containing a minimum of 5 or a minimum of 7 complementary nucleotides, ０ The panel of claim 1, which hybridizes at the 5' end of

3. The single-stranded 3' overhang of C extends over a region containing a minimum of 5 or a minimum of 7 complementary nucleotides. ０ The panel according to claim 1 or 2, which is complementary to a region located 1 to 50 bases in the 5' direction from the 3' end of

4. A ０ The panel of any one of the preceding claims, wherein the 3' end of A 0 is complementary to a region of a gene or chromosome within the DNA or RNA of a cancerous tumor cell, and optionally the 3' end of A 0 is complementary to a region of a gene that encodes a mutation found in non-small cell lung cancer (NSCLC).

5. A method for detecting a target polynucleotide sequence in a given nucleic acid analyte, comprising employing a panel of molecular systems according to any one of claims 1 to 4, i) introducing the sample into a reaction mixture comprising a panel of molecular systems; ii) A ０ is treated with an enzyme for pyrophosphorolysis to convert the complementary nucleotides that are perfectly hybridized with the target to A ０ from the 3' end to produce a shortened probe A １ forming a iii) Using C to A １ Displacing the target from the 3' end of iv) A １ The ends of the ligated nucleotides are then ligated to form a circle using pre-hybridized C to give a circular A ２ forming a v) A ２ detecting the presence of A method comprising:

6. 6. The method of claim 5, wherein the target polynucleotide comprises a site of a genetic mutation, the mutation being present at a lower level in the sample compared to the wild-type sequence.

7. A ２ The method of claim 5 or 6, wherein is 20 to 200, or 40 to 100 nucleotides in length.

8. A ０ has a 5' end that is resistant to exonuclease degradation, and a 5'-3' exonuclease is used to digest all nucleic acid molecules that have not been rendered resistant to said exonuclease degradation, optionally the exonuclease used has an activity that is at least partially dependent on the presence of a 5' phosphate group, and the digestion is carried out in the presence of a kinase and a phosphate donor.

9. 9. The method of claim 6, wherein step (ii) is carried out in the presence of a diphosphohydrolase.

10. 10. The method of any one of claims 6 to 9, wherein the pyrophosphorolysis reaction is stopped after step (ii) through the addition of pyrophosphatase.

11. Multiple molecular systems are used, each with selective A polypeptides for a different target sequence. ０ Each A ０ comprises an identifying region, optionally the identifying region is used as a priming site for nucleic acid amplification, thereby allowing detection and identification of A 2 , or the identifying region is characterized using a molecular probe or through sequencing, and optionally (v) comprises vi. labeling the amplification products from A2 using one or more oligonucleotide fluorescent conjugated dyes or molecular probes; vii. Measuring a fluorescent signal; viii. exposing the amplification products from A2 to a set of denaturing conditions; ix. identifying the polynucleotide target sequence in the analyte by monitoring a change in fluorescent signal during exposure to denaturing conditions; Further comprising:

11. The method according to any one of claims 6 to 10.

12. Different probe A ０ The method of claims 6 to 11, wherein said first and second amplification primers each contain a common priming site for amplification, thereby allowing the use of a single or a single set of amplification primers.

13. A molecular system according to any one of claims 1 to 4; - Ligase, a pyrophosphorylation enzyme, - a source of ions suitable for driving the pyrophosphorolysis reaction; - with appropriate buffers Kit including:

14. 14. The kit of claim 13, further comprising dNTPs and a polymerase, and optionally, primers for amplification of a region comprising a target nucleic acid sequence.

15. 15. The kit of claim 14, further comprising dUTP and UDG.

Images