Methods for Polynucleotide Detection

Abstract

The present invention relates to a simplified polynucleotide sequence detection method suitable for testing for the presence of multiple diagnostic markers, including those used in the identification of cancer, infectious diseases, and transplant organ rejection, which is also useful for companion diagnostic tests where a panel of markers must be identified reliably and at low cost.

Description

[Technical field]

[0001] The present invention relates to a simplified polynucleotide sequence detection method suitable for testing for the presence of multiple diagnostic markers, including those used in the identification of cancer, infectious diseases, and transplant organ rejection, which is also useful for companion diagnostic tests where a panel of markers must be identified reliably and at low cost. [Background technology]

[0002] Polymerase chain reaction (PCR) is a well-known and powerful technique for amplifying DNA or RNA present in laboratory and diagnostic samples to a degree that allows reliable detection and / or quantification. However, when applied to investigate analyte samples containing low levels of such molecules, it suffers from several limitations. First, while the technique can detect as few as a single target molecule, it is prone to false positive results due to the unwanted amplification of other nucleic acid sequences present in the sample. This makes the selection of oligonucleotide primers used to initiate the reaction critical, which in turn makes the design of primers with the required level of specificity relatively complex. As a result, many PCR-based tests currently available on the market have limited specificity.

[0003] A second drawback is that the multiplexing of PCR-based methods is in practice limited to a maximum of several tens of target sequences (often not more than 10) in order to avoid primer-primer interactions, resulting in the need for a relatively narrow operating window.

[0004] Another problem is that the PCR reaction cycles in an exponential manner, making target quantification difficult. Small variations in reaction efficiency have a large effect on the amount of detectable material produced. Thus, even with appropriate controls and calibration, quantification is typically limited to within about 3-fold accuracy.

[0005] Finally, mutations in the targeted regions of interrogation by PCR amplification methods can have unwanted side effects. For example, there have been cases where FDA-approved tests had to be withdrawn because the target organisms carried mutations in the gene regions targeted by the test primers, resulting in a large number of false negatives. Conversely, when specific single nucleotide polymorphisms (SNPs) are targeted for amplification, PCR methods often show false positives when the wild-type variant is present. Avoiding this requires very careful primer design, further limiting the effectiveness of the multiplexing. This is particularly relevant when searching for panels of SNPs, a common requirement in cancer testing / screening or companion diagnostics.

[0006] WO2020 / 016590 describes a method for detecting a target nucleic acid sequence in which a sample is contacted with a single-stranded probe, which, if complementary to the target, is digested with pyrophosphorolysis enzyme, and the digested probe is detected. The method occurs in solution and uses multiple steps of pyrophosphorolysis and ligation to detect the target sequence. The following invention is a simplified version of the assay disclosed therein, using fewer enzymes.

[0007] Ingram et al. ("PAP-LMPCR for improved, allele-specific footprinting and automated chromatin fine structure analysis", NUCLEIC ACIDS RESEARCH, Vol. 36, No. 3, Jan. 21, 2008) teach a method in which the ligation reaction is highly inefficient in the presence of a pyrophosphorolysis induction buffer. The inventors have surprisingly found an improvement to the method of WO2020 / 016590, including a combined pyrophosphorolysis and ligation step that proceeds efficiently, contrary to the teachings of Ingram et al. Summary of the Invention

[0008] The inventors have now developed an improved method based on the inventors' experience with the pyrophosphorolysis reaction used in their previous patents (WO20016590 A1, PCT / GB2020 / 053361, PCT / GB2020 / 053362, PCT / GB2020 / 053363, GB2020539.9, and GB2101176.2). The combination with blocking oligonucleotides overcomes many of these limitations. In so doing, it takes advantage of (1) the double-stranded specificity of pyrophosphorolysis, a reaction that does not proceed efficiently with single-stranded oligonucleotide substrates or double-stranded substrates containing blocking groups or nucleotide mismatches, and (2) the ability of blocking oligonucleotides to increase the specificity of the method of the invention by reducing non-specific binding. Thus, according to the invention, there is provided a method for detecting a target polynucleotide sequence in a given nucleic acid analyte, comprising: (a) introducing a blocking oligonucleotide into a first reaction mixture containing one or more nucleic acid analytes, wherein the blocking oligonucleotide anneals to at least a subset of non-target polynucleotide sequences; (b) The mixture produced in (a), i. Single-stranded probe oligonucleotide A 0 and, ii. pyrophosphorylase; iii. Ligase and wherein the target analyte is a single-stranded probe oligonucleotide A 0 to produce a first intermediate product that is at least partially double-stranded, 0 The 3' end of A forms a double-stranded complex. 0 is pyrophosphorolyzed in the 3'-5' direction from the 3' end and at least partially digested into strand A 1 Created A 1 is ligated to A 2 forming a (c) detecting a signal derived from the product of the previous step, 2or any part thereof, or multiple copies of A 2 or a portion thereof of multiple copies thereof, and inferring therefrom the presence or absence of a polynucleotide target sequence in the analyte; A method is provided, comprising:

[0009] In one aspect of the invention, there is provided a method for detecting a polynucleotide target sequence in a given nucleic acid analyte in a sample, comprising the steps of: (a) deriving one or more analytes from a biological sample by subjecting the biological sample, comprised of the analyte and optionally background genomic DNA, to PCR to generate an analyte amplified sequence, wherein one or more of the primers have a non-complementary 5' tail; (b) detecting one or more single-stranded nucleic acid analytes; i. Single-stranded probe oligonucleotide A 0 and, ii. pyrophosphorylase; iii. Ligase and wherein the analyte is a single-stranded probe oligonucleotide A 0 to produce a first intermediate product that is at least partially double-stranded, 0 The 3' end of A forms a double-stranded complex. 0 is pyrophosphorolyzed in the 3'-5' direction from the 3' end and at least partially digested into strand A 1 Created A 1 is ligated to A 2 forming a (c) detecting a signal derived from the product of the previous step, 2 or any part thereof, or multiple copies of A 2 or a portion thereof of multiple copies thereof, and inferring therefrom the presence or absence of a polynucleotide target sequence in the analyte; A method is provided, comprising:

[0010] In some embodiments, step (a) comprises deriving one or more analytes from a biological sample by subjecting a biological sample comprised of the analytes and optionally background genomic DNA to PCR to generate amplified sequences of the analytes, wherein one or more of the primers have a non-complementary 5' tail.

[0011] In some embodiments, step (a) comprises deriving one or more single-stranded analytes from the biological sample by subjecting the biological sample, comprised of the analyte and optionally background genomic DNA, to PCR to generate an amplified sequence of the analyte, wherein one or more of the primers have a non-complementary 5' tail and one of the primers is introduced in excess over the other.

[0012] In some embodiments, step (a) comprises deriving one or more single stranded analytes from a biological sample by subjecting the biological sample, comprised of the analyte and optionally background genomic DNA, to PCR to generate an amplified sequence of the analyte, where one or more of the primers have a non-complementary 5' tail and one or more of the primers are 5' protected, and treating the PCR product with a 5'-3' exonuclease.

[0013] The analytes to which the method of the present invention can be applied are nucleic acids, including the target polynucleotide sequence under investigation, such as naturally occurring or synthetic DNA or RNA molecules. In one embodiment, the analyte is typically present in an aqueous solution containing the analyte and other biological material, and in one embodiment, the analyte is present together with other background nucleic acid molecules that are not of interest for the purpose of the test. In some embodiments, the analyte is present in a low amount compared to these other nucleic acid components. Preferably, for example, if the analyte is derived from a biological specimen containing cellular material, some or all of these other nucleic acids and extraneous biological material are removed using a sample preparation technique such as filtration, centrifugation, chromatography, or electrophoresis before carrying out step (a) of the method. Suitably, the analyte is derived from a biological sample taken from a mammalian subject (particularly a human patient), such as blood, plasma, sputum, urine, skin, or biopsy. In one embodiment, the biological sample is subjected to lysis to release the analyte by destroying all cells present. In other embodiments, the analyte may already be present in a free form within the sample itself, such as cell-free DNA circulating in blood or plasma. [Brief description of the drawings]

[0014] [Figure 1] Example 1: Results of detecting EGFR exon 19 cosm12384 mutation using various concentrations of blocking oligonucleotide in initial PCR amplification. The results show that the higher the concentration of blocking oligonucleotide used, the greater the difference in Cq value between 0% and 0.1% AF. [Diagram 2] Example 2, results of introduction of a blocking oligonucleotide following initial PCR amplification prior to combined pyrophosphorolysis and ligation steps, and detection of T790M at 0.1% AF. The results show that using a blocking oligonucleotide results in a larger difference in Cq values ​​between 0% and 0.1% AF. [Diagram 3]Example 3 shows the results of using various concentrations of blocking oligonucleotides perfectly complementary to the target sequence in the method for detection of T790M in 0.1% AF. The results show that the presence of blocking oligonucleotides increases the difference in Cq values ​​between 0% and 0.1% AF, and the optimal blocking oligo concentration is about 80 nM. [Figure 4] FIG. 1 shows an illustrative example of one embodiment of the present invention in which a blocking oligonucleotide may be present during the initial PCR amplification. The blocking oligonucleotide anneals to any wild-type strand present and prevents its amplification by PCR. This allows preferential amplification of only the mutant strand. [Diagram 5] FIG. 1 shows an illustrative example of one embodiment of the present invention in which a blocking oligonucleotide is present for the combined pyrophosphorolysis and ligation steps. The blocking oligonucleotide anneals perfectly with the wild-type molecule and prevents the annealing of probe A0. The mismatch between the blocking oligonucleotide and the target mutant molecule results in a lower melting temperature, which causes the blocking oligonucleotide annealed with the mutant molecule to either melt at the high temperature used for pyrophosphorolysis or be displaced by probe A0, while the one hybridized with the wild-type molecule remains annealed. This results in a significant increase in the fraction of probes that successfully anneal with the mutant strand and therefore the fluorescent signal level detected as a result of the method. [Figure 6]FIG. 1 shows an illustrative example of one embodiment of the present invention in which a blocking oligonucleotide that is fully complementary to the target sequence present in the mutant strand but mismatched to the corresponding sequence in the wild-type strand is present for the combined pyrophosphorolysis and ligation steps. The blocking oligonucleotide will anneal incompletely with any wild-type strand present due to the presence of one or more mismatches, which prevents any pyrophosphorolysis of the blocking oligonucleotide and then mismatch annealing of any probe A0 with the wild-type strand. The blocking oligonucleotide will anneal fully with any mutant strand present and be fully pyrophosphorolyzed, allowing any probe A0 present to anneal with the mutant strand and then pyrophosphorolysis and ligation to occur. [Figure 7] 1 is a schematic diagram showing the circularization of A1 to form A2 to an analyte target sequence. A0 is progressively digested in the 3'-5' direction from the 3' end of A0 to the target to form a partially digested strand A1, shown as steps (A) and (B). This progressive digestion exposes a region of the target that is complementary to the 5' end of A0 / A1, and the 5' end of A1 then hybridizes to this region, shown in step (C). A1 is then ligated together to form the circularized A2, step (D). [Figure 8]1 shows a single-stranded probe oligonucleotide A0 anneals to a target polynucleotide sequence to create a first intermediate product that is at least partially double-stranded, with the 3' end of A0 forming a double-stranded complex with the target polynucleotide sequence. In this simplified embodiment of the invention, there are two A0 molecules and one target polynucleotide sequence to illustrate how A0 that is not annealed to the target does not participate in further steps of the method. In this illustrative example, the 3' end of A0 anneals to the target polynucleotide sequence, while the 5' end of A0 does not anneal. The 5' end of A0 includes a 5' chemical blocking group, a common priming sequence, and a barcode region. The partially double-stranded first intermediate product undergoes pyrophosphorolysis from the 3' end of A0 in the 3'-5' direction in the presence of pyrophosphorolysis enzyme to create a partially digested strand A1, an analyte, and an undigested A0 molecule that did not anneal to the target. [Figure 9] FIG. 1 shows that A1 anneals to a single-stranded trigger oligonucleotide B, and the A1 strand is extended in the 5'-3' direction relative to B to create oligonucleotide A2. In this illustrative example, trigger oligonucleotide B has a 5' chemical block. Any undigested A0 anneals to trigger oligonucleotide B, but is unable to extend in the 5'-3' direction relative to B to generate a sequence that is the target for the subsequent portion of the method. In this example, A2 is primed with at least one single-stranded primer oligonucleotide to create multiple copies of A2 or a region of A2. [Figure 10]FIG. 1 shows that A1 is annealed with splint oligonucleotide D and then circularized by ligation of its 3' and 5' ends. The now circularized A2 is primed with at least one single-stranded primer oligonucleotide to create multiple copies of A2 or a region of A2. In this illustrative example, splint oligonucleotide D cannot be extended onto A1, either due to a 3' modification (chemical in this illustration) or through a nucleotide mismatch between the 3' end of D and the corresponding region of A2. [Figure 11] 1 illustrates that the 3' region of splint oligonucleotide D anneals to the 3' region of A1, while the 5' region of splint oligonucleotide D anneals to the 5' region of ligation probe C. Thus, a second intermediate product A2 is formed, composed of A1, C, and optionally an intermediate region formed by extension of A1 in the 5'-3' direction to meet the 5' end of C. In this illustrative example, ligation probe C has a 3' chemical blocking group so that all unligated A1 can be digested using a 3'-5' exonuclease. A2 is primed with at least one single-stranded primer oligonucleotide to create multiple copies of A2 or a region of A2. [Figure 12] FIG. 1 shows detection of T790M mutation in 0.1% AF when blocking oligonucleotide (BO) is added before or during the PPL step. Results show the difference in Cq values ​​between 0% and 0.1% AF, with the presence of blocking oligo increasing the difference between 0 and 0.1% AF in both conditions. [Figure 13] Figure 1 shows detection of 0.1% AF mutations to the EGFR receptor, A) Cosm6225 and B) Cosm6218, using two different primer sets. A clear increase in fluorescence levels can be seen in both graphs when primers containing non-complementary tails were used in the initial PCR. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] In one aspect of the invention, there is provided a method for detecting a polynucleotide target sequence in a given nucleic acid analyte in a sample, comprising the steps of: (a) introducing a blocking oligonucleotide into a first reaction mixture containing one or more nucleic acid analytes, wherein the blocking oligonucleotide anneals to at least a subset of non-target polynucleotide sequences; (b) The mixture produced in (a), i. Single-stranded probe oligonucleotide A 0 and, ii. pyrophosphorylase; iii. Ligase and wherein the target analyte is a single-stranded probe oligonucleotide A 0 to produce a first intermediate product that is at least partially double-stranded, 0 The 3' end of A forms a double-stranded complex. 0 is pyrophosphorolyzed in the 3'-5' direction from the 3' end and at least partially digested into strand A 1 Created A 1 is ligated to A 2 forming a (c) detecting a signal derived from the product of the previous step, 2 or any part thereof, or multiple copies of A 2 or a portion thereof of multiple copies thereof, and inferring therefrom the presence or absence of a polynucleotide target sequence in the analyte; A method is provided, comprising:

[0016] In one aspect of the invention, there is provided a method for detecting a polynucleotide target sequence in a given nucleic acid analyte in a sample, comprising the steps of: (a) deriving one or more analytes from a biological sample by subjecting the biological sample, comprised of the analyte and optionally background genomic DNA, to PCR to generate an analyte amplified sequence, wherein one or more of the primers have a non-complementary 5' tail; (b) detecting one or more single-stranded nucleic acid analytes; i. Single-stranded probe oligonucleotide A 0 and, ii. pyrophosphorylase; iii. Ligase and wherein the analyte is a single-stranded probe oligonucleotide A 0 to produce a first intermediate product that is at least partially double-stranded, 0 The 3' end of A forms a double-stranded complex. 0 is pyrophosphorolyzed in the 3'-5' direction from the 3' end and at least partially digested into strand A 1 Created A 1 is ligated to A 2 forming a (c) detecting a signal derived from the product of the previous step, 2 or any part thereof, or multiple copies of A 2 or a portion thereof of multiple copies thereof, and inferring therefrom the presence or absence of a polynucleotide target sequence in the analyte; A method is provided, comprising:

[0017] In some embodiments, step (a) comprises deriving one or more analytes from a biological sample by subjecting a biological sample comprised of the analytes and optionally background genomic DNA to PCR to generate amplified sequences of the analytes, wherein one or more of the primers have a non-complementary 5' tail.

[0018] In some embodiments, step (a) comprises deriving one or more single-stranded analytes from the biological sample by subjecting the biological sample, comprised of the analyte and optionally background genomic DNA, to PCR to generate an amplified sequence of the analyte, wherein one or more of the primers have a non-complementary 5' tail and one of the primers is introduced in excess over the other.

[0019] In some embodiments, step (a) comprises deriving one or more single stranded analytes from a biological sample by subjecting the biological sample, comprised of the analyte and optionally background genomic DNA, to PCR to generate an amplified sequence of the analyte, where one or more of the primers have a non-complementary 5' tail and one or more of the primers are 5' protected, and treating the PCR product with a 5'-3' exonuclease.

[0020] In some embodiments, one or more of the primers that are not 5' protected may have a 5' phosphate group. In some embodiments, the first reaction mixture further comprises one or more primers, deoxynucleotide triphosphates (dNTPs), and an amplification enzyme, and during step (a), nucleic acid analytes present in the sample undergo amplification, and following amplification of the nucleic acid analytes of interest and prior to (b), the sample is further treated with a proteinase.

[0021] In some embodiments, prior to step (a), the nucleic acid analytes present in the sample are amplified and following amplification of the nucleic acid analytes of interest, the sample is further treated with a proteinase. In some embodiments, the sample is treated with a proteinase prior to step (a). In some embodiments, the sample is treated with a proteinase during step (a). In some embodiments, the sample is treated with a proteinase after step (a).

[0022] In some embodiments, the method comprises the steps of: (a) detecting one or more nucleic acid analytes; i. Single-stranded probe oligonucleotide A 0 and, ii. a blocking oligonucleotide; iii. pyrophosphorylase; iv. Ligase and a combined reaction mixture comprising: a blocking oligonucleotide that anneals to at least a subset of the non-target polynucleotide sequences; and a target analyte that is a single-stranded probe oligonucleotide A; 0 to produce a first intermediate product that is at least partially double-stranded, 0 The 3' end of A forms a double-stranded complex. 0 is pyrophosphorolyzed in the 3'-5' direction from the 3' end and at least partially digested into strand A 1 Created A 1 is ligated to A 2 forming a (b) detecting a signal derived from the product of the previous step, 2 or any part thereof, or multiple copies of A 2 or a portion thereof of multiple copies thereof, and inferring therefrom the presence or absence of a polynucleotide target sequence in the analyte; The first and second reaction mixtures are combined to contain:

[0023] In some embodiments, the reaction mixture containing the pyrophosphorolytic enzyme further comprises a source of pyrophosphate ions. In some embodiments, a target region of RNA present in a biological sample is reverse transcribed into DNA by reverse transcriptase prior to being introduced into a reaction mixture containing pyrophosphorylase.

[0024] In some embodiments, this is accomplished through the use of reverse transcriptase and appropriate nucleotides. In some embodiments, RNA present in the sample is transcribed into DNA, concomitant with any prior amplification via PCR of nucleic acids present in the sample.

[0025] In some embodiments, transcription of any RNA present in the sample into DNA occurs in a separate step from any prior amplification via PCR of nucleic acids present in the sample. In some embodiments of any of the methods described previously or subsequently, RNA present in the sample is not transcribed into DNA.

[0026] In such an embodiment, A 0 is subjected to pyrophosphorolysis of the RNA sequence to produce a partially digested strand A. 1 and the method then proceeds as previously or subsequently described.

[0027] In some embodiments of the method, the non-target nucleic acid analyte anneals incompletely with the blocking oligonucleotide to form an intermediate product that cannot be digested by pyrophosphorolysis to the extent necessary to melt it from the non-target molecule; the target nucleic acid analyte fully anneals to the blocking oligonucleotide to form an intermediate product that is at least partially double-stranded at the 3' end of the blocking oligonucleotide, and the blocking oligonucleotide is pyrophosphorolyzed in the 3'-5' direction to release the target nucleic acid analyte; The target nucleic acid analyte is a single-stranded probe oligonucleotide A 0 to produce a first intermediate product that is at least partially double-stranded, 0 The 3' end of A forms a double-stranded complex. 0 is pyrophosphorolyzed in the 3'-5' direction from the 3' end and at least partially digested into strand A 1 Created A 1 is ligated to A 2 Forming A signal derived from the product of the previous step is detected, and the product is A 2 or any part thereof, or multiple copies of A 2 or a portion thereof of multiple copies from which the presence or absence of a polynucleotide target sequence in an analyte is inferred. As such, the blocking oligonucleotides are perfectly complementary to the target nucleic acid analytes and mismatched to the non-target nucleic acid analytes.

[0028] An illustrative example of one embodiment of the present invention, where a blocking oligonucleotide may be present during the initial PCR amplification, can be seen in Figure 4. The blocking oligonucleotide anneals to any wild-type strand present and prevents its amplification by PCR. This allows for preferential amplification of only the mutant strand.

[0029] An illustrative example of one embodiment of the present invention, where a blocking oligonucleotide is present for the combined pyrophosphorolysis and ligation steps, can be seen in Figure 5. The blocking oligonucleotide anneals perfectly to the wild-type strand present, and probe A 0 The blocking oligonucleotide will anneal poorly to the existing mutant strand and melt due to the temperature used for the combined pyrophosphorolysis or will not anneal to the probe A strand. 0 This results in a significant increase in the fraction of probes that successfully anneal with the mutant strand and therefore the level of fluorescent signal detected as a result of the method.

[0030] An illustrative example of one embodiment of the present invention, in which a blocking oligonucleotide that is perfectly complementary to the target sequence present in the mutant strand but mismatched to the corresponding sequence in the wild-type strand is present for the combined pyrophosphorolysis and ligation steps, can be seen in Figure 6. The blocking oligonucleotide will anneal poorly to any wild-type strand present due to the presence of one or more mismatches, which will prevent any pyrophosphorolysis of the blocking oligonucleotide and then any probe A ligation. 0 The blocking oligonucleotide anneals perfectly to any mutant strand present, is completely pyrophosphorolyzed, and blocks any probe A present. 0anneals to the mutated strand, allowing pyrophosphorolysis and ligation to occur.

[0031] In some embodiments, the blocking oligonucleotide contains a modification to render it resistant to exonucleolytic or pyrophosphorolytic digestion. In some embodiments, the blocking oligonucleotide contains a 3' modification to render it resistant to exonucleolytic or pyrophosphorolytic digestion.

[0032] In some embodiments, the blocking oligonucleotide contains a 5' modification to render it resistant to exonucleolytic digestion. In some embodiments, the second or combined reaction mixture comprises A 0 and deoxyribonucleotide triphosphates (dNTPs).

[0033] In some embodiments, the second or combined reaction mixture further comprises an amplification / polymerase enzyme. In some embodiments, the products of the pyrophosphorolysis reaction are introduced into a third reaction mixture containing at least one single-stranded primer oligonucleotide and dNTPs prior to the detection step.

[0034] In some embodiments, the third reaction mixture further comprises an amplification / polymerase enzyme. In some embodiments, the second or combined reaction mixture, or a third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, comprises: - at least one single-stranded primer oligonucleotide, deoxynucleotide triphosphates (dNTPs), and an amplification enzyme; or - Reagents suitable for hybridization chain reaction (HCR), or - Reagents suitable for ligation chain reaction (LCR) wherein the pyrophosphorolytic enzyme is optionally the same enzyme that performs the amplification.

[0035] In some embodiments, the deoxynucleotide triphosphate (dNTP) is a hot-start dNTP. A hot-start deoxynucleotide triphosphate (dNTP) is a dNTP modified at the 3' end with a heat-labile protecting group. The presence of this modification blocks DNA polymerase nucleotide incorporation until the nucleotide protecting group is removed using a heat activation step.

[0036] In one embodiment, the second or combined reaction mixture, or the third reaction mixture into which the products of the pyrophosphorolysis step are introduced prior to the detection step, further comprises components for hybridization chain reaction (HCR).

[0037] In some embodiments, the second or combined reaction mixture, or a third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, contains ligation probe oligonucleotides C, A, B, C ... 1 and a splint oligonucleotide D complementary to the 3' end of the partially digested strand A, and a splint oligonucleotide C complementary to the 5' end of the partially digested strand B. 1 is ligated at its 3' end to the 5' end of C to form oligonucleotide A 2 Form.

[0038] In this embodiment, the reaction mixture further comprises a hairpin oligonucleotide 1 (HO1) and a hairpin oligonucleotide 2 (HO2), each of the hairpin oligonucleotides comprising a fluorophore and a quencher, and the fluorophore and quencher are in contact with each other when each oligonucleotide is held in the hairpin configuration. 2is designed to anneal with HO1, opening the "hairpin" structure and separating the fluorophore from the quencher, where the now "open" HO1 can now anneal with HO2, opening the "hairpin" structure and separating the fluorophore from the quencher.

[0039] In this embodiment, one A 2 Multiple hairpin oligonucleotides are present such that the presence of can trigger a chain reaction of opening of the hairpin oligonucleotides, resulting in the production of a detectable fluorescent signal. This method is known in the literature as hybridization chain reaction (HCR).

[0040] In some embodiments, the fluorophore of the fluorophore-quencher pair is selected from, but not limited to, the fluorescein family, the carboxyrhodamine family, the cyanine family, and the rhodamine family of dyes. Other dye families that can be used include, for example, polyhalofluorescein family dyes, hexachlorofluorescein family dyes, coumarin family dyes, oxazine family dyes, thiazine family dyes, squaraine family dyes, chelating lanthanide family dyes, the dye family available from Molecular Probes under the trade name Alexa Fluor J, the dye family available from ATTO-TEC (Siegen, Germany) under the trade name Atto, and the dye family available from Invitrogen (Carlsbad, Calif.) under the trade name Bodipy J. Dyes of the fluorescein family include, for example, 6-carboxyfluorescein (FAM), 2',4',1,4-tetrachlorofluorescein (TET), 2',4',5',7',1,4-hexachlorofluorescein (HEX), 2',7'-dimethoxy-4',5'-dichloro-6-carboxyrhodamine (JOE), 2'-chloro-5'-fluoro-7',8'-fused phenyl-1,4-dichloro-6-carboxyfluorescein (NED), 2'-chloro-7'-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC), 6-carboxy-X-rhodamine (ROX), and 2',4',5',7'-tetrachloro-5-carboxy-fluorescein (ZOE). Dyes of the carboxyrhodamine family include tetramethyl-6-carboxyrhodamine (TAMRA), tetrapropano-6-carboxyrhodamine (ROX), Texas Red, R110, and R6G. Dyes of the cyanine family include Cy2, Cy3, Cy3.5, Cy5, Cy5.5, and Cy7.Fluorophores are readily commercially available from, for example, Perkin-Elmer (Foster City, Calif.), Molecular Probes, Inc. (Eugene, Oreg.), and Amersham GE Healthcare (Piscataway, NJ).

[0041] In some embodiments, the quencher of the fluorophore-quencher pair can be a fluorescent quencher or a non-fluorescent quencher. Fluorescent quenchers include, but are not limited to, TAMRA, ROX, DABCYL, DABSYL, cyanine dyes including nitrothiazole blue (NTB), anthraquinone, malachite green, nitrothiazole, and nitroimidazole compounds. Exemplary non-fluorescent quenchers that dissipate the energy absorbed from the fluorophore include those available from Biosearch Technologies, Inc. (Novato, CA) under the trade name Black Hole™, those available from Epoch Biosciences (Bothell, WA) under the trade name Eclipse™ Dark, those available from Anaspec, Inc. (San Jose, CA) under the trade name Qx1J, those available from Integrated DNA Technologies (Coralville, IA) under the trade names ZEN and TAO, and those available from Integrated DNA Technologies (Coralville, IA) under the trade name Iowa Black™.

[0042] In some embodiments, the fluorophore of the fluorophore-quencher pair can be fluorescein, lucifer yellow, B-phycoerythrin, 9-acridine isothiocyanate, lucifer yellow VS, 4-acetamido-4'-isothio-cyanatostilbene-2,2'-disulfonic acid, 7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin, succinimidyl 1-pyrenebutyrate, and 4-acetamido-4'-isothiocyanatostilbene-2-,2'-disulfonic acid derivatives.

[0043] In some embodiments, the fluorophore of the fluorophore-quencher pair can be LC-Red 640, LC-Red 705, Cy5, Cy5.5, lissamine rhodamine B sulfonyl chloride, tetramethylrhodamine isothiocyanate, rhodamine x isothiocyanate, erythrosine isothiocyanate, fluorescein, diethylenetriaminepentaacetate, or other chelates of a lanthanide ion (e.g., europium or terbium).

[0044] In some embodiments, the present invention utilizes a doubly quenched fluorescently labeled oligonucleotide.The inclusion of the second internal quencher shortens the distance between the dye and the quencher, and in cooperation with the first quencher, provides greater overall dye quenching, reducing background and increasing signal detection.The second and first quenchers can be any of the quenchers previously described.

[0045] In an alternative embodiment, the second or combined reaction mixture, or a third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, contains ligation probe oligonucleotides C, A, B, C, C, and C, A, B ... 1 splint oligonucleotide D, which is complementary to the 3' end of strand A, and the 5' end of strand C, which is partially digested 1 is ligated at its 3' end to the 5' end of C to form oligonucleotide A 2Form.

[0046] In some embodiments, A 1 The 5' and 3' ends of the 2 Form. In some embodiments, A 1 to the ligation probe oligonucleotide C. 2 Form.

[0047] In some embodiments, A 0 to the splint oligonucleotide D. 2 Form. In some embodiments, A 1 to the target sequence. 2 In this embodiment, A is formed in the 3'-5' direction. 0 From the 3' end of 0 The progressive digestion of A 1 The target region is A 0 / A 1 In this embodiment, a ligase is used to ligate A 1 The 3' and 5' ends of the circularized oligonucleotide A are ligated to 2 This is shown, for example, in FIG. 0 / A 1 The 5' end of is complementary to the target over a region that is 5 to 50 nucleotides in length. In one embodiment, this is 5 to 25 nucleotides in length. In one embodiment, this is 5 to 20 nucleotides in length. In one embodiment, this is 5 to 15 nucleotides in length. In one embodiment, this is 5 to 12 nucleotides in length. In one embodiment, this is 5 to 10 nucleotides in length.

[0048] In some embodiments, as described above or subsequently, 1 Cyclize to A 2 Form. In some embodiments, as described above or subsequently, 2 Partially digested chain A 1 Formed from.

[0049] In one embodiment, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, comprises: - an oligonucleotide A, comprising a substrate arm, a partial catalytic core, and a sensor arm; an oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; - a substrate comprising a fluorophore-quencher pair; Further comprising: A 2 The sensor arms of oligonucleotides A and B are connected to A such that in the presence of A, A and B combine to catalytically form a multicomponent nucleic acid enzyme (MNAzyme). 2 In this embodiment, the MNAzyme is complementary to the flanking regions of A 2 A substrate containing a fluorophore-quencher pair is cleaved such that only in the presence of the fluorophore is a detectable fluorescent signal produced.

[0050] In some embodiments, the fluorophore-quencher pair can be as previously described. In some embodiments, reaction mixtures of the invention are combined such that pyrophosphorolysis, ligation, and production of a detectable fluorescent signal occur without the addition of further reagents.

[0051] In an alternative embodiment, the second or combined reaction mixture, or a third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, comprises a partially double-stranded nucleic acid construct, - one strand contains at least one RNA base, at least one fluorophore, and a region of this strand is A 2 and this strand may be referred to as the "substrate" strand, - the other strand contains at least one quencher and a region of this strand is A 2 A adjacent to the region to which the substrate strand is complementary, such that the partially double-stranded nucleic acid construct becomes substantially more double-stranded in the presence of 2 is complementary to a region of Further included are nucleic acid constructs in which, in the process of becoming substantially more double-stranded, the substrate strand of the double-stranded nucleic acid construct is cleaved at an RNA base such that at least one quencher on the "other" strand is no longer in sufficient proximity to at least one fluorophore on the substrate strand, resulting in fluorescence.

[0052] In other words, the partially double-stranded nucleic acid construct is 2 has a larger double-stranded portion in the presence of In some embodiments, the fluorophore-quencher pair can be as previously described.

[0053] In some embodiments, additional reagents such as appropriate buffers and / or ions are present in a second or combined reaction mixture, or in a third reaction mixture into which the products of the pyrophosphorolysis step are introduced prior to the detection step.

[0054] In some embodiments, the reaction mixture comprises Mg 2+ It further comprises ions. In some embodiments, the reaction mixture comprises Zn 2+ It further comprises ions. In some embodiments, the reaction mixture comprises X 2+ ion, and X is a metal.

[0055] In some embodiments, the reaction mixture comprises one or more X 2+ ion, and X is a metal. In an alternative embodiment, the second or combined reaction mixture, or the third reaction mixture into which the products of the pyrophosphorolysis step are introduced prior to the detection step, further comprises reagents for ligase chain reaction (LCR).

[0056] In some embodiments, the second or combined reaction mixture, or a third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, comprises: a. one or more ligases; bA 2 Two or more LCR probe oligonucleotides complementary to the above flanking sequences, 2 Successful annealing to the LCR probe oligonucleotides is achieved by annealing the 5' phosphate of one LCR probe directly adjacent to the 3' OH of the other LCR probe. Includes.

[0057] In some embodiments, A 2 In the presence of 2 and are successfully annealed together to form a single oligonucleotide molecule, which then serves as the new target for a second round of covalent ligation to the desired target, in this case A. 2 The ligated products, or replicative sequences, result in geometric amplification of A 2 and serves as a target in the next amplification cycle. Thus, exponential amplification of a specific target DNA sequence is achieved through repeated cycles of denaturation, hybridization, and ligation in the presence of an excess of LCR probes. 2 This implies the presence of, and thus the presence of, the target polynucleotide sequence.

[0058] In some embodiments, A 2 In the presence of 2 are successfully annealed to and ligated together to form a single oligonucleotide molecule, which then serves as the new target for a second round of covalent ligation to the desired target, in this case A. 2 This results in a geometric amplification of the signal, which is then detected.

[0059] In some embodiments, the ligated oligonucleotide molecules are detected in real time using an intercalating dye. In some embodiments, the ligated oligonucleotide molecules are detected using gel electrophoresis.

[0060] Those skilled in the art will appreciate that there are numerous techniques that will allow for detection of ligated oligonucleotide molecules. In some embodiments, the deoxynucleotide triphosphate (dNTP) is a hot-start dNTP.

[0061] In some embodiments, the one or more ligases are thermostable. In some embodiments, the one or more ligases are naturally occurring. In another embodiment, the ligase or ligases are engineered.

[0062] In some embodiments, the one or more ligases are selected from any of the ligases previously or subsequently disclosed. In some embodiments, the one or more polymerases are thermostable.

[0063] In some embodiments, the one or more polymerases are selected from any of the polymerases previously or subsequently disclosed. In some embodiments, the one or more polymerases are naturally occurring.

[0064] In another embodiment, the polymerase or polymerases are engineered. In some embodiments, the polymerase or polymerases are the same as those used for pyrophosphorolysis.

[0065] In some embodiments, the one or more enzymes of the present invention are hot-start enzymes. In some embodiments, the enzyme or enzymes of the invention are thermostable. In an alternative embodiment, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, comprises: aA 2 and a splint oligonucleotide comprising a fluorophore-quencher pair that is complementary to B. Double-strand-specific DNA digestion enzyme Including A 2 In the presence of A, the splint oligonucleotide separates the fluorophore-quencher pair, producing a fluorescent signal, hence A. 2 is digested so that the presence of is detectable.

[0066] In some embodiments, the fluorophore-quencher pair can be as described above.In some embodiments, the double-stranded specific DNA digestion enzyme is an exonuclease.In another embodiment, the double-stranded specific DNA digestion enzyme is a polymerase with proofreading activity.In another embodiment, the reaction mixture comprises one or more mixtures of exonucleases or polymerases with proofreading activity.

[0067] In some embodiments, the double-strand-specific DNA digestive enzyme is a hot-start enzyme. In some embodiments, the double-strand-specific DNA digestive enzyme has reduced activity at the temperature at which the pyrophosphorolysis reaction of the method occurs.

[0068] In some embodiments, the double-strand-specific DNA digestive enzyme has no activity at the temperature at which the pyrophosphorolysis reaction of the method occurs. In some embodiments, A 0 The 3' end of the is perfectly complementary to the target polynucleotide sequence.

[0069] In some embodiments, the ligase substantially lacks single-stranded ligation activity. In some embodiments, the partially digested chain A 1 is introduced to inorganic pyrophosphatase prior to or during the detection step.

[0070] In chemical science, methylation refers to the addition of a methyl group to a substrate or the replacement of an atom or group with a methyl group. Methylation is a form of alkylation in which a methyl group is specifically used to replace a hydrogen atom rather than a larger carbon chain. These terms are commonly used in chemistry, biochemistry, soil science, and biological science.

[0071] In biological systems, methylation is catalyzed by enzymes. Such methylation may be involved in heavy metal modification, regulation of gene expression, regulation of protein function, and RNA metabolism. Heavy metal methylation may also occur outside of biological systems. Chemical methylation of tissue samples is also a method to reduce certain histological staining artifacts.

[0072] Aberrant DNA methylation profiles have been linked to a number of diverse and complex disease states. In oncology, hypermethylation of tumor suppressor genes in serum DNA can be used as a diagnostic marker for small cell lung cancer. Aberrant DNA methylation of cells of the immune system is found in patients with immune diseases such as diabetes, rheumatoid arthritis (RA), and systemic lupus erythematosus (SLE). Differential DNA methylation (a measure of total DNA methylation) of peripheral blood leukocytes (PBLs) at the repetitive elements ALU, LINE-1, and Satellite 2 has been found to be associated with ischemic heart disease.

[0073] DNA methylation in vertebrates typically occurs at CpG sites (cytosine-phosphate-guanine sites, i.e., where a cytosine is immediately followed by a guanine in the DNA sequence), and this methylation results in the conversion of cytosine to 5-methylcytosine. The formation of Me-CpG is catalyzed by the enzyme DNA methyltransferase. Although the majority of mammalian DNA has approximately 40% of its CpG sites methylated, there are specific regions (composed of approximately 65% ​​CG residues) known as GC-rich CpG islands, where no methylation is present. These are associated with the promoters of 56% of mammalian genes, including all ubiquitously expressed genes. 1-2% of the human genome is CpG clustered, and an inverse relationship exists between CpG methylation and transcriptional activity.

[0074] DNA methylation involves the addition of a methyl group to the 5 position of a cytosine pyrimidine ring or the 6 nitrogen of an adenine purine ring. This modification can be inherited through cell division. DNA methylation is typically removed during zygote formation and re-established through successive cell divisions during development. DNA methylation is a crucial part of normal biogenesis and cell differentiation in higher organisms. DNA methylation stably alters gene expression patterns in cells so that the cells can "remember where they've been." In other words, cells that are programmed to be islets during embryonic development will remain islets throughout the life of the organism, even if no ongoing signals tell them they need to remain islets. Furthermore, DNA methylation suppresses the expression of viral genes and other deleterious elements that have been incorporated into the host's genome over time. DNA methylation also forms the basis of the chromatin structure that allows cells to form the myriad characteristics necessary for multicellular life from a single immutable sequence of DNA. DNA methylation also plays a key role in the development of nearly all types of cancer.

[0075] Bisulfite sequencing is the use of bisulfite treatment of DNA to determine DNA methylation patterns. DNA methylation was the first epigenetic mark to be discovered and remains the most studied. It has also been linked to the repression of transcriptional activity.

[0076] Among several mRNA modifications, the N6-methyladenosine (m6A) modification is the most common type in eukaryotes and nuclear replicating viruses. m6A plays a prominent role in several cancer types, including leukemia, brain cancer, liver cancer, breast cancer, and lung cancer.

[0077] While 5-methylcytosine (5mC) is the most studied epigenetic modification, 5mC is oxidized to 5-hydroxymethylcytosine (5hmC) by the catalytic action of TET (ten-eleven translocation) enzymes. Studies have shown that the distribution of 5hmC is tissue-specific, with differences in the distribution of 5hmC in various organs and tissues. Decreased expression of 5hmC in malignant tissues has been consistently shown in a wide range of different cancers, including melanoma. By evaluating a total of 15 paired normal and carcinoma samples in human breast tissues, the study showed that the levels of 5hmC were dramatically reduced in the cancer group compared to healthy breast tissue.

[0078] Treatment of DNA with bisulfite converts cytosine residues to uracil, while 5-methylcytosine residues remain unaffected. Thus, bisulfite treatment introduces specific changes in the DNA sequence that depend on the methylation state of individual cytosine residues, giving single-nucleotide resolution information on the methylation state of the DNA segment. Various analyses can be performed on the altered sequence to extract this information. The analysis of interest is therefore attributable to discriminating between single-nucleotide polymorphisms (cytosine and thymine) resulting from bisulfite conversion. Since 5hmC is converted to 5mC upon bisulfite treatment, which is read as C when sequenced, it is not possible to distinguish between 5hmC and 5mC. As it is a composite of 5mC and 5hmC, the output from bisulfite sequencing can no longer be defined simply as DNA methylation. The development of Tet-assisted oxidative bisulfite sequencing now makes it possible to discriminate between the two modifications with single-base resolution.

[0079] 5hmC can be detected using TET-assisted bisulfite sequencing (TAB-seq). Fragmented DNA is enzymatically modified using sequential T4 phage β-glucosyltransferase (T4-BGT), followed by ten-eleven translocation (TET) dioxygenase treatment, followed by the addition of sodium bisulfite. T4-BGT glucosylates 5hmC to form beta-glucosyl-5-hydroxymethylcytosine (5ghmC), which is then oxidized to 5caC using TET. Only 5ghmC is protected from subsequent deamination by sodium bisulfite, allowing 5hmC to be distinguished from 5mC by sequencing.

[0080] Oxidative bisulfite sequencing (oxBS) provides an alternative method for distinguishing between 5mC and 5hmC. The oxidative reagent potassium perruthenate converts 5hmC to 5-formylcytosine (5fC), and subsequent sodium bisulfite treatment deaminates 5fC to uracil. 5mC remains unchanged and can therefore be identified using this method.

[0081] APOBEC-coupled epigenetic sequencing (ACE-seq) completely excludes bisulfite conversion and relies on enzymatic conversion to detect 5hmC. In this method, T4-BGT glucosylates 5hmC to 5ghmC, protecting it from deamination by apolipoprotein B mRNA editing enzyme subunit 3A (APOBEC3A). Cytosine and 5mC are deaminated by APOBEC3A and sequenced as thymine.

[0082] TET-assisted 5-methylcytosine sequencing (TAmC-seq) enriches for 5mC loci and utilizes two sequential enzymatic reactions followed by affinity pull-down. Fragmented DNA is treated with T4-BGT, which protects 5hmC by glycosylation. The enzyme mTET1 is then used to oxidize 5mC to 5hmC, and T4-BGT labels the newly formed 5hmC with a modified glucose moiety (6-N3-glucose). Click chemistry is used to introduce a biotin tag, which allows for the enrichment of 5mC-containing DNA fragments for detection and whole-genome profiling.

[0083] Methylome analysis methods are broadly divided into three groups: restriction enzyme-based, chromatin immunoprecipitation-based (ChIP), or affinity-based and bisulfite conversion (gene-based). Restriction enzyme-based methods are applied to any genome without knowing the DNA sequence, and methylation-sensitive restriction enzymes for small / large scale DNA methylation analysis by combining the use of methylation-sensitive restriction enzyme experimental techniques (RLGS, DMH, etc.) for total methylation analysis. However, large amounts of genomic DNA are required, making this method unsuitable for the analysis of samples where small amounts of DNA are recovered. On the other hand, ChIP-based methods are useful for the identification of differentially methylated regions in tumors through the precipitation of protein antigens from solution by using antibodies directed against proteins. These methods are protein-based and have been widely applied in cancer research.

[0084] Affinity enrichment is a technique often used to isolate methylated DNA from the rest of the DNA population. This is usually accomplished by antibody immunoprecipitation methods or with methyl-CpG binding domain (MBD) proteins.

[0085] Methylated DNA immunoprecipitation (MeDIP) is an antibody immunoprecipitation method that utilizes 5-methylcytidine antibodies to specifically recognize methylated cytosines. The MeDIP kit requires that the input DNA sample is single-stranded in order for the 5-methylcytidine (5-mC) antibody to bind.

[0086] Another method for enrichment of methylated DNA fragments uses recombinant methyl-binding protein MBD2b or the MBD2b / MBD3L1 complex. One advantage of the methyl-CpG binding protein enrichment strategy is that it is not necessary to denature the input DNA sample. The protein is able to recognize methylated DNA in its native double-stranded form. Another advantage is that to ensure enrichment of methylated CpG DNA, the MBD protein binds only DNA that is methylated in a CpG background, making this technique ideal for studying CpG islands.

[0087] In some embodiments, one or more nucleic acid analytes are selectively modified prior to or during step (a) of the methods of the invention. In some embodiments, prior to or during step (a), unmethylated cytosine bases in one or more nucleic acid analytes are chemically or enzymatically converted.

[0088] In one embodiment, unmodified cytosine bases are converted to uracil by a methyltransferase enzyme. In one embodiment, the enzyme is M.Sssl.

[0089] In one embodiment, unmodified cytosine bases are converted to uracil by a deaminase enzyme. The enzymatic methyl-seq workflow relies on the ability of APOBEC to deaminate cytosine to uracil. APOBEC also deaminates 5mC and 5hmC, making it impossible to distinguish between cytosine and its modified forms. To detect 5mC and 5hmC, the method also utilizes TET2 and oxidative enhancers, which enzymatically modify 5mC and 5hmC to forms that are not APOBEC substrates. The TET2 enzyme converts 5mC to 5caC, and the oxidative enhancer converts 5hmC to 5ghmC. Ultimately, cytosine is sequenced as thymine, and 5mC and 5hmC are sequenced as cytosine, thereby protecting the integrity of the original 5mC and 5hmC sequence information.

[0090] In one embodiment, prior to or during step (a), one or more nucleic acid analytes are introduced to an epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease. In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is McrBC.

[0091] In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is a member of the MspJI family. In one embodiment, the endonuclease is AspBHI.In one embodiment, the endonuclease is FspEI.

[0092] In one embodiment, the endonuclease is LpnPI. In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is a member of the PvuRts1I / AbaS family.

[0093] In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is a type IIM endonuclease. In one embodiment, the endonuclease is DpnI.

[0094] In one embodiment, the endonuclease is BisI. In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is a type IV endonuclease.

[0095] In one embodiment, the endonuclease is EcoKMcrBC. In one embodiment, the endonuclease is SauUSI. In one embodiment, the endonuclease is GmrSD.

[0096] In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is selected from the DpnII restriction endonuclease family. In one embodiment, the endonuclease is DpnII.

[0097] In one embodiment, the endonuclease is DpnI. In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is HpaI.

[0098] In one embodiment, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is HpaII. In some embodiments, one or more nucleic acid analytes are introduced to a methylation-sensitive or methylation-dependent restriction endonuclease prior to or during step (a).

[0099] In some embodiments, prior to or during step (a), one or more nucleic acid analytes are introduced to a methylation-sensitive or methylation-dependent restriction endonuclease, followed by selective amplification of target polynucleotide sequences containing the methylation state of interest through methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) of methylated DNA.

[0100] In some embodiments, the population of methylated or unmethylated nucleic acid analytes is reduced prior to or during step (a). In some embodiments, the reduction is performed using methylated DNA immunoprecipitation (MeDIP).

[0101] In some embodiments, the reduction is carried out using a methyl-binding protein, such as MBD2b or the MBD2b / MBD3L1 complex. It will be clear to those skilled in the art that the present invention can be extended to detect any epigenetic modification and is not limited to the detection of the methylation state of target polynucleotide sequence.For example, the present invention can be equally adapted to detect other epigenetic modifications, including hydroxymethylation, such as the hydroxylated form of 5mC (5-hmC).This recently recognized form of epigenetic modification is an important epigenetic marker that affects gene expression and is distinct from CpG methylation.Other epigenetic modifications, such as methyl adenosine, appear on RNA and can be detected by the method of the present invention.

[0102] In some embodiments, the method according to the invention is one in which the epigenetic modification is methylation. In further embodiments, the epigenetic modification is methylation at a CpG island or by hydroxymethylation at a CpG island.

[0103] In some embodiments, the epigenetic modification is methylation of adenines in either RNA or DNA. In some embodiments, one or more oligonucleotides of the invention are rendered resistant to pyrophosphorolysis and / or exonuclease digestion by the presence of one or more quenchers.

[0104] In some embodiments, after addition of an appropriate wash buffer, the resulting reaction mixture is mixed. In some embodiments, the resulting reaction mixture is mixed by vortexing. In some embodiments, the resulting reaction mixture is mixed by the movement of one or more magnetic beads present in the mixture.

[0105] In some embodiments, each wash step involves use of a wash buffer comprising one or more of the following: Tris.HCl pH 7.5-8.0, 5-20 mM, NaCl 0.4-2 M, EDTA 0.1-1 mM, and / or Tween 20 0-0.1%.

[0106] In some embodiments of any of the methods described previously or subsequently, one or more reaction mixtures may be combined. In some embodiments, - A 1 is circularized through ligation of its 3' and 5' ends to form A 2 To produce, or - the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises a ligation probe oligonucleotide C, and a ligation probe A 1 A happens 2 Forming A 1 Ligation between the 3' end of and the 5' end of Either:

[0107] In some embodiments, A 1 The ligation of During step (b), During step (c), or During steps (b) and (c) occurs in.

[0108] In some embodiments, oligonucleotide C further comprises a 3' or internal modification that protects it from 3'-5' exonuclease digestion. In some embodiments, oligonucleotide C further comprises a 5' modification that protects it from 5'-3' exonuclease digestion.

[0109] In some embodiments, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises a splint oligonucleotide D.

[0110] In some embodiments, D is A 1 and the 5' end of oligonucleotide C or A 1 and a region complementary to either the 5' end of

[0111] In some embodiments, D is a 3′ modification or a 3′ end of D and A 1 A 1 cannot undergo extension relative to In some embodiments, the method further comprises a two-step amplification performed between steps (b) and (c). In some embodiments, the reaction volume is divided into two or more separate volumes prior to the second amplification.

[0112] One of skill in the art will appreciate that there are a multitude of 3' modifications that can be used to prevent elongation. In some embodiments, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises a 5'-3' exonuclease, 0 The 5' end of the nucleotide sequence is rendered resistant to 5'-3' exonuclease digestion.

[0113] In some embodiments, before or during the final step, the product of the previous step is treated with pyrophosphatase. In some embodiments, before or during the final step, the product of the previous step is treated with an exonuclease.

[0114] In some embodiments, detection is accomplished using one or more oligonucleotide fluorescent conjugated dyes or molecular probes. In some embodiments, A2 The increase in signal over time resulting from the generation of replicative sequences is used to infer the concentration of the target sequence in the analyte.

[0115] In some embodiments, a plurality of probes A 0 Using each A 0 are selective for different target sequences and contain an identification region, and further 2 The amplified sequence of the present invention contains an identification region, and thus, the target sequence present in the analyte can be inferred through detection of the identification region.

[0116] Multiple Probes A 0 In some embodiments in which a blocking oligonucleotide is used, multiple blocking oligonucleotides are also used. In some embodiments, detection of the identified region is performed using a molecular probe or through sequencing.

[0117] In some embodiments, the final step of the method further comprises: i. labeling the product of the previous step using one or more oligonucleotide fluorescent binding dyes or molecular probes; ii. measuring the fluorescent signal of the product; iii. exposing the product to a set of denaturing conditions; Identifying the polynucleotide target sequence in the analyte by monitoring the change in the fluorescent signal of the product during exposure to denaturing conditions.

[0118] In some embodiments, one or more nucleic acid analytes are divided into multiple reaction volumes, each volume containing one or more probe oligonucleotides A introduced to detect different target sequences. 0 has.

[0119] In some embodiments, one or more nucleic acid analytes are divided into multiple reaction volumes, each volume containing one or more probe oligonucleotides A 0 has. In some embodiments, different probes A 0 contains a common priming site and a single primer or a single set of primers is 2 This allows the amplification of a region of interest.

[0120] In an alternative embodiment, the second or combined reaction mixture, or the third reaction mixture into which the products of the pyrophosphorolysis step are introduced prior to the detection step, further comprises one or more partially double-stranded DNA constructs, each construct containing one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are located in sufficiently close proximity to each other such that sufficient quenching of the one or more fluorophores occurs.

[0121] In some embodiments, the construct is a single strand of DNA that has a self-complementary region that folds back onto itself. In some embodiments, the construct comprises one primer of a primer pair.

[0122] In some embodiments, the fourth reaction mixture further comprises the other primer of the primer pair. In some embodiments, a portion of the single stranded portion of the construct is A 2 and is converted by DNA polymerase to A 2 In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. The primer then extends to the construct, expelling the self-complementary region. Thus, the fluorophore or fluorophores and the dye or dyes are sufficiently separated to detect the fluorescent signal and detect the A in the reaction mixture. 2 The presence of is indicated.

[0123] In such an embodiment, the construct may be known as a Sunrise Primer. In some embodiments, the construct comprises two separate strands of DNA.

[0124] In some embodiments, a portion of the single stranded portion of the construct is A 2 and is converted by DNA polymerase to A 2 In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. This primer then extends toward the construct in the direction of the double-stranded portion, displacing the shorter of the DNA strands, thus separating the one or more fluorophores and the one or more dyes sufficiently to detect a fluorescent signal, and A in the reaction mixture. 2 The presence of is indicated.

[0125] In such embodiments, the construct may be known as a Molecular Zipper. Those skilled in the art will appreciate that for both sunrise primers and molecular zippers, one or more fluorophore and one or more quencher pairs can be located at various positions within each corresponding construct. The main feature is that each pair is located sufficiently close to each other that A 2 In the absence of , i.e., when no extension and strand displacement occurs, no fluorescent signal is emitted.

[0126] In some embodiments, according to any of the methods described above or subsequently, the RNA present in the sample is not transcribed into DNA. 0 is subjected to pyrophosphorolysis of the RNA sequence to produce a partially digested strand A. 1 and the method then proceeds as previously or subsequently described.

[0127] In some embodiments of any of the methods described above or subsequently, one or more reaction mixtures can be combined.According to the present invention, a method for detecting target polynucleotide sequence in a given nucleic acid analyte is further provided.The analyte that can be applied to various methods of the present invention can be prepared from the above-mentioned biological sample by a series of preliminary steps designed to amplify the analyte, and separate it from background genomic DNA that typically exists in significant excess.

[0128] In some embodiments, the target polynucleotide sequence in the analyte is a gene or chromosomal region in the DNA or RNA of a cancerous tumor cell, and will be characterized by the presence of one or more mutations, for example in the form of one or more single nucleotide polymorphisms (SNPs). Thus, the present invention will be useful in monitoring and / or treating disease recurrence. Patients who are declared disease-free after treatment can be monitored over time to detect disease recurrence. This needs to be done non-invasively, requiring sensitive detection of the target sequence from blood samples. Similarly, in some cancers, there are residual cancer cells that remain in the patient after treatment. Using the present invention to monitor the levels of these cells (or cell-free DNA) present in the patient's blood allows for detection of disease recurrence or failure of current treatment and the need to switch to alternative methods.

[0129] In some embodiments, detection of target polynucleotide sequences allows repeated testing of patient samples during disease treatment, allowing early detection of emerging resistance to treatment.For example, epidermal growth factor receptor (EGFR) inhibitors, such as gefitinib, erlotinib, etc., are commonly used as first-line treatment for non-small cell lung cancer (NSCLC).During treatment, tumors often develop mutations in the EGFR gene (e.g., T790M, C797S), which confer resistance to treatment.Early detection of these mutations allows patients to transition to alternative treatments.

[0130] In some embodiments, the target polynucleotide sequence in the analyte will be a gene or chromosomal region within DNA or RNA from the fetus, and will be characterized by the presence of one or more mutations, e.g., in the form of one or more single nucleotide polymorphisms (SNPs).Thus, the present invention may be used to detect mutations at very low allele fractions and at earlier stages of pregnancy than other available testing techniques.

[0131] In another embodiment, the target polynucleotide sequence may be a gene or genomic region derived from an otherwise healthy individual, but the genetic information obtained may aid in the generation of valuable companion diagnostic information to enable medical or therapeutic conclusions to be made across one or more defined groups within the human population.

[0132] In yet another embodiment, the target polynucleotide sequence may be characteristic of an infectious disease or resistance of an infectious disease to treatment with a particular therapy, for example a polynucleotide sequence characteristic of a bacterial or viral gene or chromosomal region, or a mutation therein, that confers resistance to the therapy.

[0133] In some embodiments, the target polynucleotide sequence may be characteristic of donor DNA. If a transplanted organ is rejected by a patient, DNA from the organ will be shed into the patient's bloodstream. Early detection of this DNA will allow early detection of rejection. This can be achieved using a custom panel of donor-specific markers, or by using a panel of variants known to be common in the population, some of which are present in the donor and some in the recipient. Thus, routine monitoring of organ recipients over time is possible with the claimed method.

[0134] The success of organ transplantation may depend on the overall level of cumulative injury to the organ, caused by several events in the donor. This includes age, lifestyle, ischemia / reperfusion injury (IRI), and immune response in the recipient. Studies have shown that IRI causes epigenetic changes in the donor organ. The promoter region of the C3 gene is demethylated in the kidney, which is associated with chronic nephropathy after transplantation. DNA methylation is a major contributor to a balanced immune response to the graft, as it controls the function of cells of the immune system. Thus, detection of the methylation status of specific DNA sequences can enable the identification of patients at risk for post-transplant complications.

[0135] In yet another embodiment, different versions of the method (see below) using different combinations of probes are used in parallel so that analytes can be screened simultaneously for multiple target sequences, for example, cancer sources, cancer indicators, or multiple sources of infectious diseases. In this approach, the amplification products obtained by the parallel application of the method are contacted with a detection panel consisting of one or more oligonucleotide-binding dyes or sequence-specific molecular probes such as molecular beacons, hairpin probes, etc. Thus, in another aspect of the present invention, there is provided the use of at least one probe and optionally one ligation oligonucleotide in combination with one or more chemical and biological probes selective for the target polynucleotide sequence, or in combination with the use of sequencing to identify the amplified probe region.

[0136] In some embodiments, the single stranded probe oligonucleotide A 0 comprises a priming region and a 3' end complementary to the target polynucleotide sequence to be detected. This creates a first intermediate product that is at least partially double-stranded. In some embodiments, this step is carried out by reacting an excess of A 0 and in an aqueous medium containing the analyte and any other nucleic acid molecules.

[0137] During step (b), the double-stranded region of the first intermediate product is 0 The 3'-5' direction of pyrophosphorolysis occurs from the 3' end of the chain. 0 The chains are progressively digested to produce partially digested chains, hereafter referred to as A 1 If the probe oligonucleotide mishybridizes to a non-target sequence, the pyrophosphorolysis reaction will stop at all mismatches, preventing the subsequent steps of the method from proceeding. In another embodiment, the digestion is 1 until it lacks sufficient complementarity with the analyte or a target region therein to form a stable duplex. At this point, the various strands then separate by melting, thereby forming an A 1 is produced in single-stranded form. Under typical pyrophosphorolysis conditions, this separation occurs between the analyte and A 0 This occurs when there are 6 to 20 complementary nucleotides between

[0138] In another embodiment, the digestion is 1 until there is insufficient complementarity with the analyte or a target region therein for the pyrophosphorolysis enzyme to bind or for the pyrophosphorolysis reaction to continue. This typically occurs when 6-20 complementary nucleotides remain between the analyte and the probe. In some embodiments, this occurs when 6-40 complementary nucleotides remain.

[0139] A 1 In another embodiment using a splint oligonucleotide D having complementarity to the 5' and 3' ends of (see below), digestion is 1 The length of complementarity between oligo D and the target is 1 This continues until the shrinkage reaches a point where it becomes energetically favorable to expel 1 The complementary region between oligo D and the analyte molecule is 1 This occurs when the length of the complementary region between the 3' end of1 Due to favorable intramolecular hybridization of oligo D, which may already be hybridized to the 5' end of A 1 It is also possible that the complementarity between the and the analyte molecule is longer than this.

[0140] A 1 In another embodiment, where ligation of A is performed using the analyte molecule as a splint (see FIG. 8), digestion is performed using A 1 A is amplified so that the 3' and 5' ends of 1 This continues until the 5' end of the nucleotide is able to hybridize to the analyte molecule, at which point they are ligated together by a ligase and digestion can no longer proceed.

[0141] Suitably, pyrophosphorolysis is carried out in a reaction medium at a temperature in the range of 20-90° C. in the presence of a polymerase exhibiting at least pyrophosphorolytic activity and a source of pyrophosphate ions. Further information regarding the pyrophosphorolysis reaction as applied to the digestion of polynucleotides can be found, for example, in J. Biol. Chem. 244 (1969) pp. 3019-3028, or in our previous patent applications.

[0142] In some embodiments, the pyrophosphorolysis step is driven by the presence of an excess source of polypyrophosphate, suitable sources include compounds containing three or more phosphorus atoms.

[0143] In some embodiments, the second reaction mixture includes an excess source of polypyrophosphate. In some embodiments, the pyrophosphorolysis step is driven by the presence of an excess source of modified pyrophosphate. Suitable modified pyrophosphates include those substituted with other atoms or groups in place of the bridging oxygens, or pyrophosphates (or polypyrophosphates) with substitutions or modifying groups on the other oxygens. Those skilled in the art will recognize that there are many such examples of modified pyrophosphates that would be suitable for use in the present invention. Non-limiting options include:

[0144] [ka]

[0145] In some embodiments, the second reaction mixture includes an excess source of modified polypyrophosphate. In a preferred embodiment, the pyrophosphate ion source is PNP, PCP, or tripolyphosphate (PPPi).

[0146] Further, non-limiting examples of pyrophosphate ion sources for use in the pyrophosphorolysis step (c) can be found in WO2014 / 165210 and WO00 / 49180.

[0147] In some embodiments, the source of excess modified pyrophosphate can be represented as YH, where Y is represented by the general formula (XO): 2 P(=B)-(ZP(=B)(OX)) n wherein n is an integer of 1 to 4, and each Z- is -O-, -NH-, or -CH 2 -, each B is independently either O or S, and the X groups are independently selected from -H, -Na, -K, an alkyl, an alkenyl, or a heterocyclic group, with the proviso that when Z and B both correspond to -O- and n is 1, then at least one X group is not H.

[0148] In some embodiments, Y is represented by the general formula (XO): 2P(=B)-(ZP(=B)(OX)) n -, wherein n is 1, 2, 3, or 4. In another embodiment, the Y group corresponds to the general formula (XO): 2 In yet another preferred embodiment, Y corresponds to P(=O)-ZP(=O)(OH)-, where one of the X groups is -H. In yet another preferred embodiment, Y corresponds to the general formula (XO): 2 It corresponds to P(=O)-ZP(=O)(OX)-, where at least one of the X groups is selected from methyl, ethyl, allyl, or dimethylallyl.

[0149] In an alternative embodiment, Y represents a group of the general formula (HO) 2 P(=O)-ZP(=O)(OH)-, where Z is -NH- or -CH 2 - or (XO) 2 P(=O)-ZP(=O)(OX)-, where all X groups are either -Na or -K, and Z is -NH- or -CH 2 - or -.

[0150] In another embodiment, Y is represented by the general formula (HO) 2 It corresponds to P(=B)-OP(=B)(OH)-, where each B group is independently either O or S, and at least one is S.

[0151] Specific examples of preferred embodiments of Y include those of the formula (X1-O)(HO)P(=O)-ZP(=O)(O-X2), where Z is O, NH, or CH 2 and (a) X1 is γ,γ-dimethylallyl and X2 is -H, or (b) X1 and X2 are both methyl, or (c) X1 and X2 are both ethyl, or (d) X1 is methyl and X2 is ethyl, or vice versa.

[0152] In some embodiments, when a molecular probe is used for detection, the probe oligonucleotide A 0is configured to include an oligonucleotide identification region 5' to the region complementary to the target sequence, and the molecular probe used is designed to anneal to this identification region. 0 Only the 3' region of the analyte is capable of annealing to the target, i.e., all other regions lack sufficient complementarity with the analyte for a stable duplex to exist at the temperature at which the pyrophosphorolysis step is performed. Here and throughout, the term "sufficient complementarity" means that to the extent that a given region has complementarity with a given region on the analyte, the region of complementarity is more than 10 nucleotides in length.

[0153] In a further aspect of the method of the invention, an alternative embodiment is provided in which the phosphorolysis step of any previous embodiment is replaced with an exonuclease digestion step using a double-stranded specific exonuclease, which those skilled in the art will appreciate includes those that read in the 3'-5' direction, such as ExoIII, and those that read in the 5'-3' direction, such as lambda Exo, among many others.

[0154] In some embodiments of the invention, when the exonuclease digestion step utilizes a double-strand specific 5'-3' exonuclease, the target analyte is complementary to A 0 and the common priming sequence and blocking group are located on the 3' side of the region complementary to the target. In a further embodiment, when a molecular probe is used for detection, the probe oligonucleotide A 0 is constructed to include an oligonucleotide identification region 3' to the region complementary to the target sequence, and the molecular probe used is designed to anneal to this identification region.

[0155] In embodiments of the invention where the exonuclease digestion step utilizes a double strand specific 5'-3' exonuclease, it digests all other nucleic acid molecules present while also digesting the A 0 and partially digested chain A 1An exonuclease having 3' to 5' exonuclease activity can optionally be added to the second or combined reaction mixture, or to a third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, with the aim of leaving all material, including the nucleotide sequence, unchanged. Suitably, this resistance to exonuclease degradation is achieved as described elsewhere in this application.

[0156] In a preferred embodiment of the present invention, A 0 The 5' end of or an internal site 5' to the priming region is conferred resistance to exonuclease degradation. This allows the A 0 and partially digested chain A 1 An exonuclease having 5'-3' exonuclease activity can be optionally added to the reaction medium in order to leave all materials, including , unchanged. Suitably, this resistance to exonuclease degradation is achieved by attaching one or more blocking groups to the oligonucleotide A. 0 This is accomplished by introducing blocking groups at required points within the nucleotide sequence. In some embodiments, these blocking groups may be selected from phosphorothioate linkages and other backbone modifications commonly used in the art, C3 spacers, phosphate groups, modified bases, and the like.

[0157] In some embodiments, the identification region comprises or has embedded therein a barcode region having a unique sequence, and is amplified by the amplified component A 2 These components are adapted to be identified indirectly using sequence-specific molecular probes applied to the target protein or directly by sequencing these components. Examples of molecular probes that can be used include, but are not limited to, molecular beacons, TaqMan® probes, Scorpion® probes, etc.

[0158] In some embodiments, A 2The strand or desired region thereof is subjected to amplification such that multiple copies, typically millions of copies, are made. 2 This is accomplished by priming a region of, and subsequently any replicative sequences derived therefrom, with a single-stranded primer oligonucleotide, provided, for example, in the form of a forward / reverse or sense / antisense pair that can anneal to a complementary region thereon. The primed strand then serves as the origin of amplification. Amplification methods include, but are not limited to, thermal cycling and isothermal methods such as polymerase chain reaction, recombinase polymerase amplification, and rolling circle amplification, which is a method of amplifying a nucleic acid by priming a region of, and subsequently any replicative sequences derived therefrom, with a single-stranded primer oligonucleotide, provided, for example, in the form of a forward / reverse or sense / antisense pair that can anneal to a complementary region thereon. The primed strand then serves as the origin of amplification. 2 is cyclized. By any of these means, A 2 This allows for the easy and rapid generation of multiple replicate sequence copies of a region of, and in some cases, the sequence complement thereof. The exact methods for carrying out any of these amplification methods are well known to those skilled in the art, and the exact conditions and temperature regimes to be used are readily available in the general literature to guide the reader. Specifically, in the case of polymerase chain reaction (PCR), the method generally comprises: 2 extending the strand in the 5'-3' direction using a polymerase and a source of various single nucleoside triphosphates until a complementary strand is generated; and dehybridizing the resulting double-stranded product to form A 2 regenerating the strand and the complementary strand; 2 The step of repriming the strand and all of its replicative sequences, and thereafter repeating these extension / dehybridization / repriming steps multiple times, 2 A to a level where the replicative sequence can be detected with confidence. 2 and accumulating a concentration of the replicative sequences.

[0159] In some embodiments, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises a ligation probe oligonucleotide C, which is capable of detecting the partially digested strand A. 1 is ligated at the 3' end of the 5' end of C, while in another embodiment, A 1 is circularized through ligation of its 3' and 5' ends, in each case with oligonucleotide A 2 is produced.

[0160] In some embodiments, A 1 The ligation of During step (b), or During step (c), or During steps (b) and (c) occurs in.

[0161] In some embodiments, A 1 is optionally extended in the 5'-3' direction prior to ligation. In some embodiments, this optional extension and ligation is performed on the target oligonucleotide, while in other embodiments, they are performed on the A 1 In some embodiments, D is annealed to A. 1 and the 5' end of oligonucleotide C or A 1 In another embodiment, D comprises a region complementary to either the 5' end of A or the 3' end of D due to a 3' end modification or a region complementary to either the 5' end of A or the 3' end of D. 1 Either through a nucleotide mismatch between the corresponding region of 1 It cannot be extended relative to

[0162] In some embodiments, the ligation probe C has a 5' region that is complementary to at least a portion of the 5' end region of the splint oligonucleotide D or to the target oligonucleotide. 2 The chain is A 1 and C, and optionally, A in the 5'-3' direction to match the 5' end of C. 1 and an intermediate region formed by extension of A. In such an embodiment, if primers are used in step (d), they are 1 At least A containing the site where ligation between and C occurred 2 In this embodiment, we use a 3'-5' exonuclease to remove all unligated A region prior to amplification and / or detection. 1 We have found it advantageous to include a 3' blocking group on the C so that the C can be digested.

[0163] In some embodiments, the second or combined reaction mixture, or a third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises a phosphatase or phosphohydrolase to remove by hydrolysis the nucleoside triphosphates generated by the pyrophosphorolysis reaction, thereby ensuring that the pyrophosphorolysis reaction can continue and not be competed away from the forward polymerization reaction.

[0164] In some embodiments, the product of the previous step is treated with a pyrophosphatase before or during step (c) to hydrolyze pyrophosphate ions and prevent further pyrophosphorolysis from favoring forward polymerization, In some embodiments, the product of the previous step is treated with an exonuclease before or during step (c).

[0165] In some embodiments, A 0 Partially digested chain A by pyrophosphorolysis of 1 The enzyme that forms A2 It will be appreciated by those of skill in the art that many such enzymes exist.

[0166] Oligonucleotide A 2 The polynucleotide target sequence is detected, and the information obtained can be used to infer whether the polynucleotide target sequence is present or absent in the original analyte and / or the properties associated therewith. For example, this can detect target sequences characteristic of cancerous tumor cells with reference to the specific SNPs being sought. As a further example, target sequences characteristic of cancerous tumor cells can be detected with reference to the specific methylation sites being sought.

[0167] In another embodiment, target sequences characteristic of viral or bacterial genomes, including mutations thereof, may be detected. 2 A number of methods for detecting the identifying region of A can be used, including, for example, sequence-specific molecular probes such as oligonucleotide-binding dyes, fluorescently labeled molecular beacons, or hairpin probes. 2 Or the direct sequencing of the amplicon sequence can be carried out by using one of the direct sequencing methods that have been used or reported in the art.When using oligonucleotide-binding dye, fluorescently labeled beacon or probe, it is convenient to use a configuration that includes a stimulating electromagnetic radiation source (laser, LED, lamp, etc.) and a photodetector that is configured to detect emitted fluorescence to detect the signal that is generated, and generate from it a signal that includes a data stream that can be analyzed by a microprocessor or computer using a specifically designed algorithm.

[0168] In some embodiments, detection is accomplished using one or more oligonucleotide fluorescent conjugated dyes or molecular probes. 2 The increase in signal over time resulting from the generation of the replica sequence is used to infer the concentration of the target sequence in the analyte. In some embodiments, the final step of the method further comprises the steps of: i. labeling the product of step (b) with one or more oligonucleotide fluorescent conjugated dyes or molecular probes; ii. measuring the fluorescent signal of the product; iii. exposing the product to a set of denaturing conditions; Identifying the polynucleotide target sequence in the analyte by monitoring the change in the fluorescent signal of the product during exposure to denaturing conditions.

[0169] In another embodiment of the invention, multiple copies of A 2 Or A 2 A method for identifying a target polynucleotide sequence in a given nucleic acid analyte is provided, characterized by the step of any previous embodiment of the present invention, wherein a region of the polynucleotide is labeled with one or more oligonucleotide fluorescent binding dyes or molecular probes. The fluorescent signals of these copies are measured, and the copies are exposed to a set of denaturing conditions. The target polynucleotide sequence is then identified by monitoring the change in the fluorescent signal of the copies during exposure to the denaturing conditions.

[0170] In some embodiments, denaturing conditions may be provided by varying the temperature, e.g., increasing the temperature to the point where the duplex begins to dissociate. Additionally or alternatively, denaturing conditions may be provided by varying the pH so that the conditions are acidic or alkaline, or by adding additives or agents, such as strong acids or bases, concentrated inorganic salts, or organic solvents, e.g., alcohols.

[0171] In another aspect of the invention, there is provided the use of the above-mentioned method for screening a mammalian subject, particularly a human patient, for the presence of an infectious disease, cancer, or for generating companion diagnostic information.

[0172] In a further aspect of the present invention, a control probe is provided for use in the above-mentioned method. The embodiments of the present invention include those in which the presence of a specific target sequence or sequences is revealed by the generation of a fluorescent signal. In such embodiments, there will inevitably be a certain level of signal generated from non-target DNA present in the sample. In a given sample, this background signal will have a later occurrence than the "true" signal, but this occurrence may vary between samples. Thus, accurate detection of the presence of low concentrations of a target sequence or sequences depends on knowledge of what signal is expected in the absence of the target sequence. While references are available for artificial samples, this is not the case for true "blind" samples from patients. The control probe (E 0 ) are utilized to determine the expected background signal profile of each assay probe. A control probe targets a sequence not expected to be present in the sample, and the signal generated from this probe can be used to infer the expected rate of signal generation from the sample in the absence of the target sequence.

[0173] Accordingly, there is provided a method for detecting a target polynucleotide sequence in a given nucleic acid analyte, comprising the steps of: a. Either subsequently or simultaneously, a second single-stranded probe oligonucleotide E whose 3' terminal region is at least partially mismatched with the target sequence. 0 repeating the steps of the method using a second detection channel using either a separate aliquot of the sample or the same aliquot using b. In the absence of any target analyte in the sample, 0 estimating the background signal expected to be generated from c. Inferring the presence or absence of a polynucleotide target sequence in the analyte through comparison of the expected background signal inferred in (a) with the actual signal observed in the presence of the target analyte; and There is provided a method according to any of the previously described methods, characterized in that

[0174] In some embodiments, a control probe (E 0 ) and A 0 and are added to separate portions of the sample, while in another embodiment, E 0 and A 0 and are added to the same portion of the sample and their respective signals are measured using different detection channels (e.g., different colored dyes). 0 The signal generated by the A is utilized to detect A in the absence of a polynucleotide target sequence in a sample. 0 For example, the background signal may be corrected by estimating the background signal expected to be generated by E 0 The signal observed from A 0 or, under varying conditions, A 0 and E 0 Using a relative signal calibration curve generated by 0 This may be through calibration of the signal observed from

[0175] In some embodiments, a single E 0 can be used to calibrate all assay probes that may be generated. In some embodiments, a separate E 0 Each replicate of the sample DNA generated in the initial amplification step can be calibrated using the Eq. (a) to calibrate each replicate of the sample DNA generated in the initial amplification step. Each replicate may contain multiple mutations / target sequences of interest, but only a single Eq. (b) to calibrate each replicate of the sample DNA generated in the initial amplification step. 0 is sufficient to calibrate all assay probes to a single replicate sequence.

[0176] In a further embodiment, a separate E 0 For example, if a C>T mutation is being targeted, an E targeting a C>G mutation at the same site that is not known to occur in patients may be used for each target sequence. 0 It is possible to design E 0The signal profile generated by can be evaluated in calibration reactions and these data are used to infer the signal expected from an assay probe targeting the C>T variant in the absence of the C>T variant.

[0177] The specificity of the method of the present invention can be improved by the introduction of a blocking oligonucleotide. For example, a blocking oligonucleotide can be introduced to hybridize with at least a portion of the wild-type DNA and to 0 Blocking oligonucleotides can be used to promote annealing only with the target polynucleotide sequence of interest and not with the wild type. Alternatively or additionally, blocking oligonucleotides can be used to improve the specificity of the polymerase chain reaction (PCR) to prevent the amplification of any wild type sequences present. A common technique used is to design an oligonucleotide that anneals between the PCR primers and cannot be displaced or digested by the PCR polymerase. The oligonucleotide is designed to anneal with the non-target (usually healthy) sequence while being mismatched (often by a single base) with the target (mutated) sequence. This mismatch results in different melting temperatures for the two sequences, and the oligonucleotide is designed to dissociate from the target sequence while remaining annealed to the non-target sequence at the PCR extension temperature.

[0178] The blocking oligonucleotide often may have modifications to prevent its digestion by the exonuclease activity of the PCR polymerase or to enhance the melting temperature difference between the target and non-target sequences.

[0179] Incorporation of locked nucleic acids (LNAs) or other melting temperature altering modifications into blocking oligonucleotides can significantly increase the difference in melting temperature of the oligonucleotide for target and non-target sequences.

[0180] Therefore, one embodiment of the present invention is provided that uses blocking oligonucleotides.In some embodiments, blocking oligonucleotides must be resistant to pyrophosphorolysis (PPL) reaction to ensure that they are not digested or displaced.This can be achieved in several different ways, for example, through mismatches at their 3' ends, or through modifications such as phosphorothioate bonds or spacers.

[0181] In such an embodiment or aspect of the invention using blocking oligonucleotides, a method for detecting a target polynucleotide sequence in a given nucleic acid analyte is characterized by annealing a single-stranded blocking oligonucleotide to at least a subset of non-target polynucleotide sequences prior to or during the same step, wherein the analyte target sequence is annealed to a single-stranded probe oligonucleotide A. 0 to produce a first intermediate product that is at least partially double-stranded, 0 The 3' end of forms a double-stranded complex with the analyte target sequence.

[0182] In some embodiments, the blocking oligonucleotide is resistant to pyrophosphorolysis via a mismatch at its 3' end. In other embodiments, the blocking oligonucleotide is resistant via the presence of a 3' blocking group. In other embodiments, the blocking oligonucleotide is resistant via the presence of a spacer or other internal modification. In further embodiments, the blocking oligonucleotide contains either a modification that increases the melting temperature or a modified nucleotide base, rendering it resistant to pyrophosphorolysis.

[0183] Reference herein to a "phosphatase enzyme" refers to any enzyme, or functional fragment thereof, that has the ability to hydrolytically remove nucleoside triphosphates produced by the methods of the invention. This includes any enzyme, or functional fragment thereof, that has the ability to cleave a phosphate monoester into a phosphate ion and an alcohol.

[0184] Reference herein to a "pyrophosphatase enzyme" refers to any enzyme, or functional fragment thereof, that has the ability to catalyze the conversion of one pyrophosphate ion into two phosphate ions.

[0185] This also includes inorganic pyrophosphatases and inorganic diphosphatases. A non-limiting example is thermostable inorganic pyrophosphate (TIPP). In some embodiments, modified versions of any of the previously described embodiments are provided, in which the use of pyrophosphatase is optional.

[0186] Some embodiments of the methods of the present invention can be seen in Figures 8-11. In FIG. 8, single-stranded probe oligonucleotide A 0 anneals to a target polynucleotide sequence to produce a first intermediate product that is at least partially double-stranded; 0 In this simplified embodiment of the invention, the 3' end of A that is not annealed to the target polynucleotide sequence forms a double-stranded complex with the target polynucleotide sequence. 0 To illustrate how does not participate in further steps of the method, two A 0 In this illustrative example, there is a molecule and one target polynucleotide sequence. 0 The 3' end of A anneals to the target polynucleotide sequence. 0 The 5' end of A does not anneal. 0 The 5' end of the comprises a 5' chemical blocking group, a common priming sequence, and a barcode region.

[0187] The first intermediate product, which is partially double-stranded, is transformed in the presence of pyrophosphorylase to A in the 3'-5' direction. 0 The 3' end of the strand is pyrophosphorolytically digested to form the partially digested strand A. 1 , analyte, and undigested A that did not anneal to the target. 0 Create molecules.

[0188] In Figure 9, A 1is annealed to single-stranded trigger oligonucleotide B, and A 1 The strand is extended in the 5'-3' direction relative to B to form oligonucleotide A 2 In this illustrative example, trigger oligonucleotide B has a 5' chemical block. 0 anneals to trigger oligonucleotide B, but cannot extend in the 5'-3' direction relative to B to produce a sequence that is a target for the subsequent portion of the method. 2 is primed with at least one single-stranded primer oligonucleotide to generate multiple copies of A 2 Or A 2 An area of ​​is created.

[0189] In Figure 10, A 1 is annealed with splint oligonucleotide D and then circularized by ligation of its 3' and 5' ends. 2 is primed with at least one single-stranded primer oligonucleotide to generate multiple copies of A 2 Or A 2 In this illustrative example, the splint oligonucleotide D is modified by a 3' modification (chemical in this example) or by a region of the 3' end of D and A. 2 Either through a nucleotide mismatch between the corresponding region of 1 It cannot be extended relative to

[0190] In FIG. 11, the 3′ region of splint oligonucleotide D is A 1 The 5' region of splint oligonucleotide D anneals to the 5' region of ligation probe C, while the 5' region of splint oligonucleotide D anneals to the 5' region of ligation probe C. 1 and C, and optionally, A in the 5'-3' direction to match the 5' end of C. 1 and an intermediate region formed by the elongation of 2In this illustrative example, a 3'-5' exonuclease is used to remove all unligated A 1 Ligation probe C has a 3' chemical blocking group so that the ligation probe can be digested.

[0191] A 2 is primed with at least one single-stranded primer oligonucleotide to generate multiple copies of A 2 Or A 2 An area of ​​is created. In some embodiments of the invention, there is provided a kit for use in a method for detecting a target polynucleotide sequence in a predetermined nucleic acid analyte present in a sample, the method comprising: (a) a blocking oligonucleotide as described above or below; (b) a single-stranded probe oligonucleotide A capable of forming a first intermediate product with a target polynucleotide sequence; 0 wherein the intermediate product is at least partially double-stranded, single-stranded probe oligonucleotide A 0 and, (c) a ligase; (d) The first intermediate product is A 0 from the end of the 3'-5' direction to obtain partially digested strand A. 1 and a pyrophosphorylase enzyme capable of producing (e) a suitable buffer and A kit is provided comprising:

[0192] In one embodiment, A 0 The 3' end of the is complementary to the target sequence. In one embodiment, A 0 The 3' end of the is perfectly complementary to the target sequence. In one embodiment, the kit comprises: 0 The nucleic acid sequence includes at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of the nucleic acid sequence.

[0193] In one embodiment, the kit further comprises an amplification enzyme. In one embodiment, the kit further comprises one or more primers, one or more of the primers having a non-complementary 5' tail.

[0194] In one embodiment, one or more of the primers has a 5' phosphate. In one embodiment, one or more of the primers are 5' protected. In one embodiment, A 0 The 3' end of the is perfectly complementary to the target polynucleotide sequence.

[0195] In one embodiment, the ligase substantially lacks single-stranded ligation activity. In some embodiments, the kit includes a single-stranded probe oligonucleotide A capable of forming a first intermediate product with a target polynucleotide sequence. 0 wherein the intermediate product is at least partially double-stranded, single-stranded probe oligonucleotide A 0 and, (a) a blocking oligonucleotide as described above or below; (b) a ligase; (c) The first intermediate product is A 0 from the end of the 3'-5' direction to obtain partially digested strand A. 1 and a pyrophosphorylase enzyme capable of producing (d) a suitable buffer and Includes.

[0196] In some embodiments, the kit instead comprises: - A 1 two or more ligation chain reaction (LCR) probe oligonucleotides that are complementary to the above flanking sequences, where successful annealing of the probes results in the 5' phosphate of one LCR probe being directly adjacent to the 3' OH of the other LCR probe; - one or more ligases It may further include.

[0197] In some embodiments, A 2 In the presence of 2 and are successfully annealed together to form a single oligonucleotide molecule, which then serves as the new target for a second round of covalent ligation to the desired target, in this case A. 2 The ligated products, or replicative sequences, result in geometric amplification of A 2 and serves as a target in the next amplification cycle. Thus, exponential amplification of a specific target DNA sequence is achieved through repeated cycles of denaturation, hybridization, and ligation in the presence of an excess of LCR probes. 2 This implies the presence of, and thus the presence of, the target polynucleotide sequence.

[0198] In some embodiments, A 2 In the presence of 2 are successfully annealed to and ligated together to form a single oligonucleotide molecule, which then serves as the new target for a second round of covalent ligation to the desired target, in this case A. 2 This results in a geometric amplification of the signal, which is then detected.

[0199] In some embodiments, the kit instead includes: - a ligation probe oligonucleotide C; - Splint Oligonucleotide D A may further include 1 and C are ligated together to form A 2 C has a 5' phosphate, the 3' end of the splint oligonucleotide D is complementary to the 5' end of C, and the 5' end of D is complementary to A, so that 1 is complementary to the 3' end of

[0200] In some embodiments, the kit comprises: - a hairpin oligonucleotide 1 (HO1) comprising a fluorophore-quencher pair, wherein HO1 is A 2 is complementary to A 2 When annealed with, the hairpin structure of HO1 opens and the fluorophore-quencher pair separates. - a hairpin oligonucleotide 2 (HO2) comprising a fluorophore-quencher pair, where HO2 is complementary to the open HO1, and when annealed with HO1, the hairpin structure of HO2 opens and the fluorophore-quencher pair separates; It may further include.

[0201] In some embodiments, the kit may further comprise multiple HO1 and HO2. In some embodiments, the kit instead comprises an oligonucleotide A comprising a substrate arm, a partial catalytic core, and a sensor arm; an oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; - a substrate containing a fluorophore-quencher pair; A may further include 2 The sensor arms of oligonucleotides A and B are connected to A such that in the presence of A, A and B combine to catalytically form a multicomponent nucleic acid enzyme (MNAzyme). 2 The flanking regions of the ribosomal region are complementary to each other.

[0202] In some embodiments, the kit instead comprises a partially double-stranded nucleic acid construct, - one strand contains at least one RNA base, at least one fluorophore, and a region of this strand is A 2 and this strand may be referred to as the "substrate" strand, - the other strand contains at least one quencher and a region of this strand is A 2 A adjacent to the region to which the substrate strand is complementary, such that the partially double-stranded nucleic acid construct becomes substantially more double-stranded in the presence of 2 is complementary to a region of , may further comprise a nucleic acid construct.

[0203] In other words, the partially double-stranded nucleic acid construct is 2 has a larger double-stranded portion in the presence of In some embodiments, the kit may further comprise an enzyme for removing at least one RNA base.

[0204] In some embodiments, the enzyme is uracil-DNA glycosylase (UDG) and the RNA base is uracil. In some embodiments, the kit instead comprises: - A, which comprises a ligation site, comprising one or more fluorophores arranged such that their fluorescence is quenched by their proximity either to each other or to one or more fluorescent quenchers; 2 and an oligonucleotide complementary to a region of - Double-strand specific DNA digestion enzyme A may further include 2 In the presence of A, the labeled oligonucleotides are separated from each other or from their corresponding quenchers, resulting in a fluorescent signal and thus A. 2 is digested such that the presence of is detectable.

[0205] In some embodiments, the double-strand-specific DNA digestive enzyme is an exonuclease. In some embodiments, the double-strand-specific DNA digestive enzyme is a polymerase with proofreading activity.

[0206] In some embodiments, the fluorophores of the kit may be selected from dyes of the fluorescein family, carboxyrhodamine family, cyanine family, rhodamine family, polyhalofluorescein family dyes, hexachlorofluorescein family dyes, coumarin family dyes, oxazine family dyes, thiazine family dyes, squaraine family dyes, and chelating lanthanide family dyes.

[0207] In some embodiments, the fluorophores of the kit may be selected from any of the commercially available dyes. In some embodiments, the quencher of the kit may be selected from those available under the trade names Black Hole™, Eclipse™ Dark, Qx1J, and Iowa Black™.

[0208] In some embodiments, the quencher of the kit may be selected from any of the commercially available quenchers. In some embodiments, the kit may further comprise one or more partially double-stranded DNA constructs, each of which contains one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are located in sufficiently close proximity to each other that sufficient quenching of the one or more fluorophores occurs.

[0209] In some embodiments, the construct is a single strand of DNA that has a self-complementary region that folds back onto itself. In some embodiments, the construct comprises one primer of a primer pair.

[0210] In some embodiments, the kit may further include the other primer of the primer pair. In some embodiments, a portion of the single stranded portion of the construct is A 2 and is converted by DNA polymerase to A 2 In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. The primer then extends to the construct, expelling the self-complementary region. Thus, the one or more fluorophores and the one or more dyes are sufficiently separated to detect a fluorescent signal, and A 2 The presence of is indicated.

[0211] In such embodiments, the construct may be known as a sunrise primer. In some embodiments, the construct comprises two separate strands of DNA. In some embodiments, a portion of the single stranded portion of the construct is A 2 and is converted by DNA polymerase to A 2 In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. This primer then extends toward the construct in the direction of the double-stranded portion, displacing the shorter of the DNA strands, so that the one or more fluorophores and the one or more dyes are sufficiently separated to detect a fluorescent signal, and A 2 The presence of is indicated.

[0212] In such embodiments, the construct may be known as a molecular zipper. Those skilled in the art will appreciate that for both sunrise primers and molecular zippers, one or more fluorophore and one or more quencher pairs can be located at various positions within each corresponding construct. The main feature is that each pair is located sufficiently close to each other that A 2 In the absence of , i.e., when no extension and strand displacement occurs, no fluorescent signal is emitted.

[0213] In one embodiment, the kit further comprises a pyrophosphate ion source. Suitable pyrophosphate ion sources are as previously described. In some embodiments, the kit further comprises suitable positive and negative controls.

[0214] In some embodiments, the kit includes one or more control probes (E 0 ). In some embodiments, the kit includes one or more control probes (E o ) and one or more blocking oligonucleotides.

[0215] In some embodiments, A 0 The 5' end of may be rendered resistant to 5'-3' exonuclease digestion and the kit may further comprise a 5'-3' exonuclease.

[0216] In some embodiments, the kit may further comprise a ligation probe oligonucleotide C. In some embodiments, the kit may further comprise a splint oligonucleotide D.

[0217] In some embodiments, the kit may include both C and D. Ligation probe C may further comprise a 3' or internal modification that protects it from 3'-5' exonuclease digestion.

[0218] D is A 1 and the 5' end of oligonucleotide C or A 1 and a region complementary to either of the 5' ends of In some embodiments, D is a 3′ modification or a 3′ end of D and A 1 or through a mismatch between the corresponding region of A and C 1 In some cases, the extension to the original length may not be possible.

[0219] In some embodiments, the kit may further comprise dNTPs, a polymerase, and appropriate buffers for the initial amplification of target polynucleotide sequences present in a sample. In some embodiments, the kit may further comprise dUTP incorporating a high fidelity polymerase, dUTP, and uracil-DNA N-glycosylase (UDG).

[0220] In some embodiments, the kit may further comprise a phosphatase or a phosphohydrolase. In some embodiments, the kit may further comprise a pyrophosphatase. The pyrophosphatase may be hot start.

[0221] In some embodiments, the kit may further comprise a proteinase. In some embodiments, the kit may further include one or more oligonucleotide binding dyes or molecular probes.

[0222] In some embodiments, the kit comprises a plurality of A's, each of which is selective for a different target sequence and each of which comprises an identification region. 0 It may further include. In some embodiments, the kit may further comprise an enzyme for the formation of DNA from an RNA template.

[0223] In some embodiments, the enzyme is a reverse transcriptase. In some embodiments, one or more of the enzymes of the kit may be hot start. In some embodiments, one or more of the enzymes of the kit may be thermostable.

[0224] In some embodiments, the kit may further include appropriate washing and buffering reagents. In some embodiments, the amplifying enzyme and the pyrophosphorolytic enzyme are the same. In some embodiments, the amplifying enzyme and the pyrophosphorolytic enzyme are the same.

[0225] The kits may further include purification equipment and reagents for isolating and / or purifying portions of the polynucleotide according to the processes described herein. Suitable reagents are well known in the art and include gel filtration columns and wash buffers.

[0226] In some embodiments, the kit further comprises an epigenetic sensitive and / or epigenetic dependent restriction enzyme, which may be as previously described. In some embodiments, the kit further comprises a methylation-sensitive and / or methylation-dependent restriction enzyme.

[0227] In some embodiments, the kit further comprises one or more methyl-CpG binding domain (MBD) proteins. In some embodiments, the kit further comprises one or more 5-methylcytidine (5-mC) antibodies.

[0228] In some embodiments, the kit further comprises one or more of the MBD2b proteins and / or one or more of the MBD2b / MBD3L1 complexes. In some embodiments, the kit further comprises reagents suitable for methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA).

[0229] In one embodiment of the present invention, 1. A device comprising at least one flow path between a first region, a second region, and a third region, wherein the first region comprises one or more wells, each well comprising: dNTPs, at least one single stranded primer oligonucleotide; An amplification enzyme for the initial amplification of DNA present in the sample; and the second region comprises one or more wells, each well comprising: a single-stranded probe oligonucleotide A capable of forming a first intermediate product with a target polynucleotide sequence; 0 wherein the intermediate product is at least partially double-stranded, single-stranded probe oligonucleotide A 0 and, The first intermediate product is A 0 from the end of the 3'-5' direction to obtain partially digested strand A. 1 and pyrophosphorylase, which can produce and the third region comprises one or more wells, each well comprising: dNTPs, A buffer solution; An amplifying enzyme; A 2or any part thereof, or multiple copies of A 2 or a means for detecting a signal from a portion thereof in multiple copies. and the well of the second region or the well of the third region comprises A 0 and further comprising at least one single stranded primer oligonucleotide that is substantially complementary to a portion of.

[0230] In some embodiments, one or more wells of the first region contain one or more blocking oligonucleotides as described above or subsequently. In some embodiments, one or more wells in the second region contain one or more blocking oligonucleotides as described above or subsequently.

[0231] In some embodiments, the wells in the first region comprise: - dNTPs, - one or more single stranded primer oligonucleotides; - an amplification enzyme for the initial amplification of DNA present in the sample; wherein one or more of the primers has a non-complementary 5' tail.

[0232] In some embodiments, one or more of the primers has a 5' phosphate. In some embodiments, one or more of the primers are 5' protected. In some embodiments, the means for detecting a signal is located in one or more wells of the third region.

[0233] In some embodiments, the means for detecting a signal is located in a third region of the device. In some embodiments, the means for detecting a signal is located in an adjacent region of the device.

[0234] In some embodiments, the dNTPs in each well of the first region may be dUTP, dGTP, dATP, and dCTP, and each well may further comprise dUTP incorporating a high-fidelity polymerase and uracil-DNA N-glycosylase (UDG).

[0235] In some embodiments, the dNTPs in each well of the third region can be dUTP, dGTP, dATP, and dCTP, and each well can further comprise dUTP incorporating a high-fidelity polymerase and uracil-DNA N-glycosylase (UDG).

[0236] In some embodiments, each well of the second region may further comprise a source of pyrophosphate ions. In some embodiments, A 0 The 5' ends of the wells may be rendered resistant to 5'-3' exonuclease digestion and the wells of the second region may further comprise a 5'-3' exonuclease.

[0237] In some embodiments, each well of the second or third region may further comprise a ligase and a ligation probe oligonucleotide C or a splint oligonucleotide D.

[0238] Ligation probe C may contain a 3' or internal modification that protects it from 3'-5' exonuclease digestion. Splint oligonucleotide D is A 1 and the 5' end of oligonucleotide C or A 1 or a region complementary to either the 5' end of

[0239] D is a 3'-modified nucleotide, or the 3' end of D is a nucleotide with A 1 or through a mismatch between the corresponding region of A and C 1 In some cases, the extension to the original length may not be possible.

[0240] In some embodiments, the dNTPs may be hot start and each well of the second region may further comprise a phosphatase or a phosphohydrolase. In some embodiments, each well of the second region may further comprise pyrophosphatase.

[0241] In some embodiments, the pyrophosphatase may be hot start. In some embodiments, each well in the third region may further comprise one or more oligonucleotide-conjugated dyes or molecular probes.

[0242] In some embodiments, each well in the second region contains at least one or more different A selective for a target sequence that includes the identification region. 0 may include. In some embodiments, the amplification enzyme and the pyrophosphorylase in the second region can be the same.

[0243] In some embodiments, there may be a fourth region comprising one or more wells, each well may comprise a proteinase, and said fourth region may be located between the first and second regions.

[0244] In some embodiments, the wells in the second region comprise: dNTPs, A buffer solution; An amplifying enzyme; A 1 or any part thereof, or multiple copies of A 1 or a means for detecting a signal from a portion thereof in multiple copies. The second and third regions of the device may be combined to further comprise:

[0245] The wells in the second region may further contain one or more blocking oligonucleotides as described above or subsequently. In some embodiments, the means for detecting a signal is located in one or more wells of the second region.

[0246] In some embodiments, the means for detecting a signal is located in a second region of the device. In some embodiments, the means for detecting a signal is located in an adjacent region of the device.

[0247] In some embodiments, 1. A device comprising a flow path between a first region and a second region, the first region comprising one or more wells, the one or more wells comprising: a single-stranded probe oligonucleotide A capable of forming a first intermediate product with a target polynucleotide sequence; 0 wherein the intermediate product is at least partially double-stranded, single-stranded probe oligonucleotide A 0 and, The first intermediate product is A 0 from the end of the 3'-5' direction to obtain partially digested strand A. 1 and a pyrophosphorylase enzyme capable of producing A 1 and ligated to oligonucleotide A 2 and one or more ligases capable of producing and the second region comprises one or more wells.

[0248] The wells of the first region may further comprise one or more blocking oligonucleotides as described above or subsequently. In some embodiments, one or more wells of the first region may further comprise an ion source for driving the pyrophosphorolysis reaction forward.

[0249] In some embodiments, the ion is a pyrophosphate ion. In some embodiments, A 0 is resistant to 5'-3' exonuclease digestion, and the wells in the first region further comprise a 5'-3' exonuclease.

[0250] In some embodiments, the device may further include a third region including one or more wells connected to the first region by a flow path, the one or more wells of the third region comprising: dNTPs, a single stranded primer oligonucleotide; Amplification enzyme and Includes.

[0251] The wells in the third region may further contain one or more blocking oligonucleotides as described previously or subsequently. In some embodiments, the dNTPs of the third region can be dUTP, dGTP, dCTP, and dATP; The amplification enzyme may be a high fidelity polymerase incorporating dUTP; One or more wells in the third region may further contain uracil-DNA N-glycosylase.

[0252] In some embodiments, the device may further include a fourth region located between the first and third regions that includes one or more wells, where the one or more wells may contain a proteinase.

[0253] In some embodiments, one or more wells in the first or second region contain a ligase and A 0 and a ligation probe oligonucleotide C which is complementary to a region of

[0254] In some embodiments, one or more wells in the first or second region contain a ligase and A 0 and a splint oligonucleotide D which is complementary to a region of In some embodiments, one or more wells of the first or second region may further comprise a ligase, a splint oligonucleotide D, and a ligation probe oligonucleotide C.

[0255] In some embodiments, the ligation probe oligonucleotide C may contain a 3' or internal modification that protects it from 3'-5' exonuclease digestion. In some embodiments, D is A 1 and the 5' end of oligonucleotide C or A 1 or a region complementary to either the 5' end of

[0256] In some embodiments, D is a 3′ modification or a 3′ end of D and A 1 or through a mismatch between the corresponding region of A and C 1 In some cases, the extension to the original length may not be possible.

[0257] In some embodiments, one or more wells in the first region contain at least one or more different A wells, each selective for a different target sequence and each containing an identification region. 0 may include.

[0258] In some embodiments, the wells in the second region comprise: dNTPs, A buffer solution; An amplifying enzyme; A 1 or any part thereof, or multiple copies of A 1 or a means for detecting a signal from a portion thereof in multiple copies. may include.

[0259] The wells in the second region may further contain one or more blocking oligonucleotides as described above or subsequently. Embodiments of the invention may include one or more blocking oligonucleotides located in one or more regions that include dNTPs, buffers, amplification enzymes, and the like.

[0260] In some embodiments, the means for detecting a signal is located in one or more wells of the second region. In some embodiments, the means for detecting a signal is located in a second region of the device.

[0261] In some embodiments, the means for detecting a signal is located in an adjacent region of the device. In some embodiments, one or more wells in the second region may further comprise one or more oligonucleotide-conjugated dyes or molecular probes.

[0262] In some embodiments, the amplification enzyme and the pyrophosphorylation enzyme of the device are the same. In some embodiments, the wells in the second region comprise: - A 1 two or more ligation chain reaction (LCR) probe oligonucleotides that are complementary to the above flanking sequences, where successful annealing of the probes results in the 5' phosphate of one LCR probe being directly adjacent to the 3' OH of the other LCR probe; - one or more ligases Further includes:

[0263] In some embodiments, the wells in the second region comprise: - a ligation probe oligonucleotide C; - Splint Oligonucleotide D A 1 and C are ligated together to form oligonucleotide A 2 C has a 5' phosphate, the 3' end of the splint oligonucleotide D is complementary to the 5' end of C, and the 5' end of D is complementary to A, so that 1 is complementary to the 3' end of

[0264] In some embodiments, the wells in the second region comprise: - a hairpin oligonucleotide 1 (HO1) comprising a fluorophore-quencher pair, wherein HO1 is A 2 is complementary to A 2When annealed with, the hairpin structure of HO1 opens and the fluorophore-quencher pair separates. - a hairpin oligonucleotide 2 (HO2) comprising a fluorophore-quencher pair, where HO2 is complementary to the open HO1, and when annealed with HO1, the hairpin structure of HO2 opens and the fluorophore-quencher pair separates; It may further include.

[0265] In some embodiments, the wells of the second region may further comprise a plurality of HO1 and HO2. In some embodiments, the wells in the second region comprise: - an oligonucleotide A, comprising a substrate arm, a partial catalytic core, and a sensor arm; an oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; - a substrate containing a fluorophore-quencher pair; A may further include 2 The sensor arms of oligonucleotides A and B are connected to A such that in the presence of A, A and B combine to catalytically form a multicomponent nucleic acid enzyme (MNAzyme). 2 The flanking regions of the ribosomal region are complementary to each other.

[0266] In some embodiments, the wells of the second region comprise a partially double-stranded nucleic acid construct, - one strand contains at least one RNA base, at least one fluorophore, and a region of this strand is A 2 and this strand may be referred to as the "substrate" strand, - the other strand contains at least one quencher and a region of this strand is A 2 A adjacent to the region to which the substrate strand is complementary, such that the partially stranded nucleic acid construct becomes substantially more double stranded in the presence of 2 is complementary to a region of , may comprise a nucleic acid construct.

[0267] In some embodiments, the wells of the second region may further comprise an enzyme for removing at least one RNA base. In some embodiments, the enzyme is uracil-DNA glycosylase (UDG) and the RNA base is uracil.

[0268] In some embodiments, one or more wells of the second region include: A ligation site that includes one or more fluorophores arranged such that their fluorescence is quenched by their proximity either to each other or to one or more fluorescent quenchers. 2 and an oligonucleotide complementary to a region of Double-strand specific DNA digestion enzyme A may further include 2 In the presence of A, the labeled oligonucleotides are separated from each other or from their corresponding quenchers, resulting in a fluorescent signal and thus A. 2 is digested such that the presence of is detectable.

[0269] In some embodiments, the double-strand-specific DNA digestive enzyme is an exonuclease. In some embodiments, the double-strand-specific DNA digestive enzyme is a polymerase with proofreading activity.

[0270] In some embodiments, the fluorophore is selected from dyes of the fluorescein family, the carboxyrhodamine family, the cyanine family, the rhodamine family, the polyhalofluorescein family dyes, the hexachlorofluorescein family dyes, the coumarin family dyes, the oxazine family dyes, the thiazine family dyes, the squaraine family dyes, and the chelating lanthanide family dyes.

[0271] In some embodiments, the fluorophores of the device may be selected from any of the commercially available dyes. In some embodiments, the quencher of the device is selected from those available under the trade names Black Hole™, Eclipse™ Dark, Qx1J, Iowa Black™, ZEN, and / or TAO.

[0272] In some embodiments, the quencher of the device may be selected from any of the commercially available quenchers. In some embodiments, one or more wells in the second region may further comprise one or more partially double-stranded DNA constructs, each construct containing one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are located in sufficiently close proximity to each other such that sufficient quenching of the one or more fluorophores occurs.

[0273] In some embodiments, the construct is a single strand of DNA that has a self-complementary region that folds back onto itself. In some embodiments, the construct comprises one primer of a primer pair.

[0274] In some embodiments, one or more wells in the second region may further comprise the other primer of the primer pair. In some embodiments, a portion of the single stranded portion of the construct is A 2 and is converted by DNA polymerase to A 2 In some embodiments, the other primer of the primer pair then hybridizes to the extended construct to form A 2 The primer is then extended over the construct, displacing the self-complementary region, thus separating the fluorophore(s) and dye(s) sufficiently to detect a fluorescent signal, and A 2 The presence of is indicated.

[0275] In such embodiments, the construct may be known as a sunrise primer. In some embodiments, the construct comprises two separate strands of DNA. In some embodiments, a portion of the single stranded portion of the construct is A 2 and is converted by DNA polymerase to A 2 In some embodiments, the other primer of the primer pair then hybridizes to the extended construct to form A 2 The primer is then extended toward the double-stranded portion of the construct, displacing the shorter of the DNA strands, so that the fluorophore or fluorophores and the dye or dyes are sufficiently separated to detect a fluorescent signal, and A 2 The presence of is indicated.

[0276] In such embodiments, the construct may be known as a molecular zipper. Those skilled in the art will appreciate that for both sunrise primers and molecular zippers, one or more fluorophore and one or more quencher pairs can be located at various positions within each corresponding construct. The main feature is that each pair is located sufficiently close to each other that A 2 In the absence of , i.e., when no extension and strand displacement occurs, no fluorescent signal is emitted.

[0277] In some embodiments, one or more wells of one or more regions may further comprise pyrophosphatase. In some embodiments, one or more wells of one or more regions of the device may further comprise a phosphatase or phosphohydrolase.

[0278] In some embodiments, one or more wells in the first region of the device may further comprise an enzyme for the formation of DNA from an RNA template. In some embodiments, the enzyme is a reverse transcriptase.

[0279] In some embodiments, the enzyme or enzymes present in the device are hot start. In some embodiments, the enzyme or enzymes present in the device are thermostable.

[0280] In some embodiments, the first and second regions of the device are merged. In some embodiments of the present invention, - a device comprising at least one flow path between a first region, a second region, and a third region, the first region comprising one or more wells, each well comprising: - dNTPs, - at least one single-stranded primer oligonucleotide, - an amplification enzyme for the initial amplification of DNA present in the sample; and the second region comprises one or more wells, each well comprising: - a single-stranded probe oligonucleotide A capable of forming a first intermediate product with a target polynucleotide sequence; 0 wherein the intermediate product is at least partially double-stranded, single-stranded probe oligonucleotide A 0 and, - The first intermediate product is A 0 from the end of the 3'-5' direction to obtain partially digested strand A. 1 and pyrophosphorylase, which can produce and the third region comprises one or more wells, each well comprising: - dNTPs, a buffer solution; - optionally an amplification enzyme; - Optionally, A 2 or any part thereof, or multiple copies of A 2 or a means for detecting a signal from a portion thereof in multiple copies. and the well of the second region or the well of the third region comprises A 0 and further comprising at least one single stranded primer oligonucleotide that is substantially complementary to a portion of.

[0281] In some embodiments, the wells in the second region comprise: - dNTPs, - one or more single stranded primer oligonucleotides; - an amplification enzyme for the initial amplification of DNA present in the sample; wherein one or more of the primers has a non-complementary 5' tail.

[0282] In some embodiments, one or more of the primers has a 5' phosphate. In some embodiments, one or more of the primers are 5' protected. In some embodiments, the pyrophosphatase present in the wells of the second region is transported to the wells of the third region, where the pyrophosphatase reacts with A in the presence of dNTPs and a suitable buffer. 2 Amplification is performed.

[0283] In some embodiments, the means for detecting a signal is located in one or more wells of the third region. In some embodiments, the means for detecting a signal is located in a third region of the device.

[0284] In some embodiments, the means for detecting a signal is located in an adjacent region of the device. In some embodiments, the dNTPs in each well of the first region may be dUTP, dGTP, dATP, and dCTP, and each well may further comprise dUTP incorporating a high-fidelity polymerase and uracil-DNA N-glycosylase (UDG).

[0285] In some embodiments, each well of the second region may further comprise a source of pyrophosphate ions. In some embodiments, A 0The 5' ends of the wells may be rendered resistant to 5'-3' exonuclease digestion and the wells of the second region may further comprise a 5'-3' exonuclease.

[0286] In some embodiments, each well of the second or third region may further comprise a ligase. In some embodiments, each well of the second or third region may further comprise a ligase and a ligation probe oligonucleotide C or a splint oligonucleotide D.

[0287] Ligation probe C may contain a 3' or internal modification that protects it from 3'-5' exonuclease digestion. Splint oligonucleotide D is A 1 and the 5' end of oligonucleotide C or A 1 or a region complementary to either the 5' end of

[0288] D is a 3'-modified nucleotide, or the 3' end of D is a nucleotide with A 1 or through a mismatch between the corresponding region of A and C 1 In some cases, the extension to the original length may not be possible.

[0289] In some embodiments, the dNTPs can be hot start. In some embodiments, each well of the second region may further comprise a phosphatase or a phosphohydrolase.

[0290] In some embodiments, each well of the second region may further comprise pyrophosphatase. In some embodiments, the pyrophosphatase is hot start.

[0291] In some embodiments, each well in the third region may further comprise one or more oligonucleotide-conjugated dyes or molecular probes. In some embodiments, each well in the second region contains at least one or more different A selective for a target sequence that includes the identification region. 0 may include.

[0292] In some embodiments, the amplification enzyme and the pyrophosphorylase in the second region can be the same. In some embodiments, there may be a fourth region comprising one or more wells, each well may comprise a proteinase, and said fourth region may be located between the first and second regions.

[0293] In some embodiments, the wells in the second region comprise: - dNTPs, a buffer solution; an amplifying enzyme; A 1 or any part thereof, or multiple copies of A 1 or a means for detecting a signal from a portion thereof in multiple copies. The second and third regions of the device may be combined to further comprise:

[0294] In some embodiments, the wells in the second region comprise: - optionally dNTPs, - optionally an amplification enzyme; a buffer solution; - Labeled oligonucleotide probes The second and third regions of the device may be combined to further comprise:

[0295] In some embodiments, pyrophosphorylation enzymes present in the wells of the second region are used to generate A in the presence of dNTPs and a suitable buffer. 2 Amplification is performed. In some embodiments, the means for detecting a signal is located in one or more wells of the second region.

[0296] In some embodiments, the means for detecting a signal is located in a second region of the device. In some embodiments, the means for detecting a signal is located in an adjacent region of the device.

[0297] In some embodiments, the first region may be in fluid communication with the sample vessel via a fluid interface. In some embodiments of the present invention, - a device comprising at least one flow path between first, second, third and fourth regions, wherein the first region comprises one or more wells, each well comprising a means for selectively modifying a nucleic acid; The second region includes one or more wells, each well comprising: - dNTPs, - at least one single-stranded primer oligonucleotide, - an amplification enzyme for the initial amplification of DNA present in the sample; and the third region comprises one or more wells, each well comprising: - a single-stranded probe oligonucleotide A capable of forming a first intermediate product with a target polynucleotide sequence; 0 wherein the intermediate product is at least partially double-stranded, single-stranded probe oligonucleotide A 0 and, - The first intermediate product is A 0 from the end of the 3'-5' direction to obtain partially digested strand A. 1 and pyrophosphorylase, which can produce and the fourth region comprises one or more wells, each well comprising: - dNTPs, a buffer solution; - optionally an amplification enzyme; - A 2 or any part thereof, or multiple copies of A 2 or a means for detecting a signal from a portion thereof in multiple copies. and the well of the third region or the well of the fourth region comprises A 0and further comprising at least one single stranded primer oligonucleotide that is substantially complementary to a portion of.

[0298] In some embodiments, the means for selectively modifying a nucleic acid may be a chemical agent capable of converting unmodified cytosine bases in a target polynucleotide sequence. In some embodiments, the means for selectively modifying a nucleic acid can be an enzyme capable of converting an unmodified cytosine base in a target polynucleotide sequence.

[0299] In some embodiments, the wells of the second or third region may further comprise a restriction endonuclease. In some embodiments, a region containing one or more wells may be located between the first and second regions, and each well may contain a restriction endonuclease.

[0300] In some embodiments, a restriction endonuclease may recognize a sequence in a target polynucleotide sequence that has been created by chemical or enzymatic conversion of unmodified cytosine bases. In some embodiments, sequences in a target polynucleotide sequence that can be recognized by a restriction endonuclease are removed by chemical or enzymatic conversion of unmodified cytosine bases.

[0301] In some embodiments, the restriction endonuclease can be a methylation-sensitive or methylation-dependent restriction endonuclease. In some embodiments, the wells of the second region may contain reagents for modification-specific multiple-stranded ligation-dependent probe amplification (MS-MLPA) of epigenetically modified DNA.

[0302] In some embodiments, a region containing one or more wells may be located between the first and second regions, and each well may contain reagents for PCR. In some embodiments, a region comprising one or more wells may be located between the first and second regions, and each well may contain a reagent for reducing the population of epigenetically modified or unmodified target sequences.

[0303] In some embodiments, the reagent for reducing the population of epigenetically modified or unmodified target sequences is a reagent for epigenetically modified DNA immunoprecipitation, optionally methylated DNA immunoprecipitation (MeDIP).

[0304] In some embodiments, the reagent for reducing the population of epigenetically modified or unmodified target sequences is a methyl-binding protein, such as MBD2b or the MBD2b / MBD3L1 complex.

[0305] In some embodiments, reagents for reducing the population of epigenetically modified or unmodified target sequences are located in one or more wells of the first region. In some embodiments of the device, the epigenetic modification may be methylation. In some embodiments, the epigenetic modification may be methylation at a CpG island. In some embodiments, the epigenetic modification may be hydroxymethylation at a CpG island.

[0306] In some embodiments, the wells of the second, third, or fourth region comprise: - dNTPs, - at least one single-stranded primer oligonucleotide, - Amplification enzymes may include.

[0307] In some embodiments, the dNTPs in each well may be dUTP, dGTP, dATP, and dCTP, and each well may further comprise dUTP incorporating a high fidelity polymerase and uracil-DNA N-glycosylase (UDG).

[0308] In some embodiments, each well may further comprise a source of pyrophosphate ions. In some embodiments, A0 The 5' ends of the wells may be rendered resistant to 5'-3' exonuclease digestion and the wells of the second or third region may further comprise a 5'-3' exonuclease.

[0309] In some embodiments, each well of the third or fourth region may further comprise a ligase. In some embodiments, each well of the third or fourth region may further comprise a ligase and a ligation probe oligonucleotide C or a splint oligonucleotide D.

[0310] Ligation probe C may contain a 3' or internal modification that protects it from 3'-5' exonuclease digestion. Splint oligonucleotide D is A 1 and the 5' end of oligonucleotide C or A 1 or a region complementary to either the 5' end of

[0311] D is a 3'-modified nucleotide, or the 3' end of D is a nucleotide with A 1 or through a mismatch between the corresponding region of A and C 1 In some cases, the extension to the original length may not be possible.

[0312] In some embodiments, the dNTPs can be hot start. In some embodiments, each well of the third region may further comprise a phosphatase or a phosphohydrolase.

[0313] In some embodiments, each well of the third region may further comprise pyrophosphatase. In some embodiments, each well of the fourth region may further comprise pyrophosphatase.

[0314] In some embodiments, the pyrophosphatase is hot start. In some embodiments, each well in the fourth region may further comprise one or more oligonucleotide-conjugated dyes or molecular probes.

[0315] In some embodiments, each well in the third region contains at least one or more different A selective for a target sequence that includes the identification region. 0 may include. In some embodiments, the amplification enzyme in the fourth region and the pyrophosphorylase in the third region may be the same, and thus, in some embodiments, an amplification enzyme in the fourth region is not required.

[0316] In some embodiments, there may be a fifth region comprising one or more wells, each well may comprise a proteinase, and said fifth region may be located between the first and second regions.

[0317] In some embodiments, the fifth region can be located between the second and third regions. In some embodiments, the wells in the third region comprise: - dNTPs, a buffer solution; an amplifying enzyme; A 1 or any part thereof, or multiple copies of A 1 or a means for detecting a signal from a portion thereof in multiple copies. The third and fourth regions of the device may be combined to further comprise:

[0318] In some embodiments, the means for detecting a signal is located in the third region. In some embodiments, the means for detecting a signal is located within the flanking region. In some embodiments, the wells of the third or fourth region comprise: - A 1two or more ligation chain reaction (LCR) probe oligonucleotides that are complementary to the above flanking sequences, where successful annealing of the probes results in the 5' phosphate of one LCR probe being directly adjacent to the 3' OH of the other LCR probe; - one or more ligases It may further include.

[0319] In some embodiments, the amplification enzyme and the pyrophosphorylation enzyme of the device are the same. In some embodiments, the wells in the third region comprise: - a ligation probe oligonucleotide C; - Splint Oligonucleotide D A 1 and C are ligated to oligonucleotide A 2 C has a 5' phosphate, the 3' end of the splint oligonucleotide D is complementary to the 5' end of C, and the 5' end of D is complementary to A, so that 1 is complementary to the 3' end of

[0320] In some embodiments, the wells in the third region comprise: - a hairpin oligonucleotide 1 (HO1) comprising a fluorophore-quencher pair, wherein HO1 is A 2 is complementary to A 2 When annealed with, the hairpin structure of HO1 opens and the fluorophore-quencher pair separates. - a hairpin oligonucleotide 2 (HO2) comprising a fluorophore-quencher pair, where HO2 is complementary to the open HO1, and when annealed with HO1, the hairpin structure of HO2 opens and the fluorophore-quencher pair separates; It may further include.

[0321] In some embodiments, the wells of the third region may further comprise a plurality of HO1 and HO2. In some embodiments, the wells in the third region comprise: - an oligonucleotide A, comprising a substrate arm, a partial catalytic core, and a sensor arm; an oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; - a substrate containing a fluorophore-quencher pair; A may further include 2 The sensor arms of oligonucleotides A and B are connected to A such that in the presence of A, A and B combine to catalytically form a multicomponent nucleic acid enzyme (MNAzyme). 2 The flanking regions of the ribosomal region are complementary to each other.

[0322] In some embodiments, the wells of the third region comprise a partially double-stranded nucleic acid construct, - one strand contains at least one RNA base, at least one fluorophore, and a region of this strand is A 2 and this strand may be referred to as the "substrate" strand, - the other strand contains at least one quencher and a region of this strand is A 2 A adjacent to the region to which the substrate strand is complementary, such that the partially stranded nucleic acid construct becomes substantially more double stranded in the presence of 2 is complementary to a region of , may comprise a nucleic acid construct.

[0323] In some embodiments, the wells of the third region may further comprise an enzyme for removing at least one RNA base. In some embodiments, the enzyme is uracil-DNA glycosylase (UDG) and the RNA base is uracil.

[0324] In some embodiments, one or more wells in the third region comprise: A ligation site that includes one or more fluorophores arranged such that their fluorescence is quenched by their proximity either to each other or to one or more fluorescent quenchers.2 and an oligonucleotide complementary to a region of Double-strand specific DNA digestion enzyme A may further include 2 In the presence of A, the labeled oligonucleotides are separated from each other or from their corresponding quenchers, resulting in a fluorescent signal and thus A. 2 is digested such that the presence of is detectable.

[0325] In some embodiments, the double-strand-specific DNA digestive enzyme is an exonuclease. In some embodiments, the double-strand-specific DNA digestive enzyme is a polymerase with proofreading activity.

[0326] In some embodiments, the fluorophore is selected from dyes of the fluorescein family, the carboxyrhodamine family, the cyanine family, the rhodamine family, the polyhalofluorescein family dyes, the hexachlorofluorescein family dyes, the coumarin family dyes, the oxazine family dyes, the thiazine family dyes, the squaraine family dyes, and the chelating lanthanide family dyes.

[0327] In some embodiments, the fluorophores of the device may be selected from any of the commercially available dyes. In some embodiments, the quencher of the device is selected from those available under the trade names Black Hole™, Eclipse™ Dark, Qx1J, Iowa Black™, ZEN, and / or TAO.

[0328] In some embodiments, the quencher of the device may be selected from any of the commercially available quenchers. In some embodiments, the wells in the third region may contain one or more partially double-stranded DNA constructs, each of which contains one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are located in sufficiently close proximity to each other such that sufficient quenching of the one or more fluorophores occurs.

[0329] In some embodiments, the construct is a single strand of DNA that has a self-complementary region that folds back onto itself. In some embodiments, the construct comprises one primer of a primer pair.

[0330] In some embodiments, the wells in the third region may further comprise the other primer of the primer pair. In some embodiments, a portion of the single stranded portion of the construct is A 2 and is converted by DNA polymerase to A 2 In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. The primer then extends to the construct, expelling the self-complementary region. Thus, the fluorophore or fluorophores and the dye or dyes are sufficiently separated to detect the fluorescent signal and detect the A in the reaction mixture. 2 The presence of is indicated.

[0331] In such embodiments, the construct may be known as a sunrise primer. In some embodiments, the construct comprises two separate strands of DNA. In some embodiments, a portion of the single stranded portion of the construct is A 2 and is converted by DNA polymerase to A 2 In some embodiments, the other primer of the primer pair then hybridizes to the extended construct to form A 2The primer then extends toward the double-stranded portion of the construct, displacing the shorter of the DNA strands, thus separating the fluorophore(s) and dye(s) sufficiently to detect a fluorescent signal, and the A in the reaction mixture. 2 The presence of is indicated.

[0332] In such embodiments, the construct may be known as a molecular zipper. Those skilled in the art will appreciate that for both sunrise primers and molecular zippers, one or more fluorophore and one or more quencher pairs can be located at various positions within each corresponding construct. The main feature is that each pair is located sufficiently close to each other that A 2 In the absence of , i.e., when no extension and strand displacement occurs, no fluorescent signal is emitted.

[0333] In some embodiments, one or more wells of one or more regions may further comprise pyrophosphatase. In some embodiments, one or more wells of one or more regions of the device may further comprise a phosphatase or phosphohydrolase.

[0334] In some embodiments, one or more wells in the second region of the device may further comprise an enzyme for transcription of RNA to DNA. In some embodiments, the enzyme is a reverse transcriptase.

[0335] In some embodiments, the enzyme or enzymes present in the device are hot start. In some embodiments, the enzyme or enzymes present in the device are thermostable.

[0336] In some embodiments, the second and third regions of the device are merged. In some embodiments, the third and fourth regions of the device are combined. In some embodiments, one or more fluid pathways are located between one or more wells in a region and / or between one or more regions of the device.

[0337] In some embodiments, the first region may be in fluid communication with the sample vessel via a fluid interface. In some embodiments, heating and / or cooling elements may be present in one or more areas of the device.

[0338] In some embodiments, heating and / or cooling may be applied to one or more regions of the device. In some embodiments, each region of the device may independently contain at least 100 or 200 wells.

[0339] In some embodiments, each region of the device can independently contain from about 100 to 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, or more wells. The wells can be of any shape and their locations can be arranged in any format or pattern on the substrate.

[0340] In some embodiments, the well matrix can be constructed from metal (e.g., by way of non-limiting example, gold, platinum, or nickel alloys), ceramic, glass, or other PCR-compatible polymeric materials, or composite materials. The well matrix contains a plurality of wells.

[0341] In some embodiments, the wells may be formed as blind or through holes in the well substrate. The wells may be fabricated in the well substrate by, for example, laser drilling (e.g., excimer or solid state laser), ultrasonic embossing, hot embossing lithography, electroforming in nickel molds, injection molding, and injection compression molding.

[0342] In some embodiments, the individual well volumes can range from 0.1 to 1500 nL, and in one embodiment, 0.5 to 50 nL. Each well can have a volume of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35 , 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nL.

[0343] In some embodiments, the well dimensions can have wells of any shape, for example, circular, elliptical, square, rectangular, oval, hexagonal, octagonal, pyramidal, and other shapes known to those of skill in the art.

[0344] In some embodiments, the well shape may have a cross-sectional area that varies along an axis, for example, a square hole may taper from a first size to a second size that is a small fraction of the first size.

[0345] In some embodiments, the well dimensions may be square with approximately equal diameter and depth. In some embodiments, the walls defining the well may be non-parallel. In some embodiments, the walls defining the well may converge to a point. The well dimensions may be derived from the total volumetric capacity of the well substrate.

[0346] In some embodiments, the well depth may range from 25 μm to 1000 μm. In one embodiment, the wells may have a depth of 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 μm.

[0347] In some embodiments, the well diameter may range from about 25 μm to about 500 μm. In some embodiments, the wells may have a width of 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 μm.

[0348] In some embodiments, a portion of one or more regions of the device may be modified to promote or discourage fluid adhesion. Surfaces defining the wells may be coated with a hydrophilic material (or modified to be hydrophilic), thus promoting fluid retention.

[0349] In some embodiments, a portion of one or more regions of the device may be coated with a hydrophobic material (or modified to be hydrophobic), thus preventing retention of fluid thereon. Those skilled in the art will appreciate that other surface treatments may be used to encourage drainage of excess fluid, such that fluid is preferably retained within the wells, but not on the upper surface.

[0350] In some embodiments, the wells of the well substrate may be patterned to have a simple geometric pattern of aligned rows and columns, or a diagonally or hexagonally arranged pattern, hi one embodiment, the wells of the well substrate may be patterned to have a complex geometric pattern, such as a chaotic pattern or an isogeometric design pattern.

[0351] In some embodiments, the wells may be geometrically separated from one another and / or feature a large depth-to-width ratio to help prevent cross-contamination of reagents. In some embodiments, the device may include one or more auxiliary regions that can be used to provide a process fluid, such as an oil or other chemical solution, to one or more of the regions of the device. Such auxiliary regions may be fluidly connected to one or more of the regions of the device via one or more membranes, such as metal foils or thin films, valves, and / or pressure-cleavable substrates (i.e., materials that break when subjected to a predetermined amount of pressure from fluid in the auxiliary region or adjacent portions of the flow path).

[0352] In some embodiments, the flow path of the device may include a highly tortuous section. The tortuous path between the inlet of the flow path and one or more of the regions of the device may aid in the control and handling of the fluid process. The tortuous path may help reduce the formation of gas bubbles that may interfere with the flow of oil through the flow path.

[0353] In some embodiments, the device may further include a gas permeable membrane that allows gas to exit the wells of one or more regions of the device while not allowing fluid to pass through. The gas permeable membrane may be attached to the well substrate of the device by a gas permeable adhesive. In one embodiment, the membrane is constructed from polydimethylsiloxane (PDMS) and may have a thickness in the range of 20-1000 μm. In some embodiments, the membrane may have a thickness in the range of 100-200 μm.

[0354] In some embodiments, all or a portion of the well substrate may contain a conductive metal portion (e.g., gold) to allow for heat transfer from the metal to the well. In one embodiment, the interior surface of the well may be coated with a metal to allow for heat transfer.

[0355] In some embodiments, after filling the wells of one or more regions of the device with the appropriate reagents, an isolating oil or thermally conductive liquid may be applied to the device to prevent crosstalk. In some embodiments, the wells in one or more regions of the device may be shaped to taper from a larger diameter to a smaller diameter, similar to a pyramid. Pyramid-shaped wells with gradient walls allow for the use of non-contact deposition methods of reagents (e.g., ink-jet). The pyramidal shape has also been found to aid in drying and prevent air bubbles and leaks when a gas-permeable membrane is present.

[0356] In some embodiments, the wells of one or more regions of the device may be filled by forcing the sample fluid (e.g., via pressure) along a flow path of the device. As the fluid passes through the wells of one or more regions of the device, each well fills with fluid that is primarily held within the well via surface tension. As previously described, portions of the well substrate of the device may be coated with hydrophilic / hydrophobic materials as desired to promote complete and uniform filling of the wells as the sample fluid passes through them.

[0357] In some embodiments, the wells of one or more regions of the device may be "capped" with oil after filling. This may help reduce evaporation when the well substrate is subjected to thermal cycling. In one embodiment, after oil capping, an aqueous solution may be filled into one or more regions of the device to improve thermal conductivity.

[0358] In some embodiments, a quiescent aqueous solution may be pressurized in one or more regions of the device to stop the movement of the fluid and any air bubbles. In some embodiments, oils such as mineral oils may be used for isolating the wells of one or more regions of the device and to provide thermal conductivity. However, any thermally conductive liquid may be used, such as a fluorinated liquid (e.g., 3M FC-40). References to oils in this disclosure should be understood to include alternatives that one skilled in the art would understand to be applicable.

[0359] In some embodiments, the device may further include one or more sensor assemblies. In some embodiments, the sensor assembly or assemblies may include a charge-coupled device (CCD) / complementary metal oxide semiconductor (CMOS) detector coupled with a fiber optic faceplate (FOFP). A filter may be stacked on top of the FOPF and placed against or adjacent to the well substrate. In one embodiment, a filter may be stacked (bonded) directly on top of the CCD and the FOPF placed on top of it.

[0360] In some embodiments, a hydration fluid such as distilled water may be heated within the first region or one of the auxiliary regions so that one or more regions of the device have up to 100% humidity, or at least sufficient humidity to prevent excessive evaporation during thermal cycling.

[0361] In some embodiments, after loading of the device is complete, the well substrate may be heated by an external device in thermal contact with the device to perform thermal cycling for PCR. In some embodiments, non-contact heating methods such as RFID, Curie point, induction heating, or microwave heating may be used. These and other non-contact heating methods will be familiar to those skilled in the art. During thermal cycling, the device may monitor for chemical reactions via the sensor arrangements previously described.

[0362] In some embodiments, the reagents deposited in one or more of the wells of one or more of the regions of the device are deposited in a predetermined arrangement. In some embodiments, providing a sample fluid to a flow path of the device, the device including at least one flow path between a first region, a second region, and a third region, the first, second, and third regions independently including one or more wells; filling the second region with the amplified fluid from the first region such that one or more wells of the second region are coated with the amplified fluid; draining the amplified fluid from the second region such that the one or more wells remain wetted with at least a portion of the amplified fluid; filling the third region with the fluid discharged from the second region such that one or more wells of the third region are coated with said fluid; draining the fluid from the third chamber such that the one or more wells remain wetted with at least a portion of the fluid; A method is provided that includes:

[0363] In some embodiments of the method, the flow path may be valveless. In some embodiments of the method, the evacuated second region may be filled with a hydrophobic material. In some embodiments of the method, the evacuated third region may be filled with a hydrophobic material.

[0364] In some embodiments of the method, the hydrophobic material may be provided from an oil chamber in fluid communication with the second and third regions. In some embodiments of the method, the sample fluid may be directed along a flow path in a serpentine manner.

[0365] In some embodiments, the method may further include applying heating and cooling cycles to one or more of the first, second, or third regions. Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure.

[0366] As used herein, "and / or" should be interpreted as a specific disclosure of each of the two specified features or components, with or without the other. For example, "A and / or B" should be interpreted as a specific disclosure of (i) A, (ii) B, and (iii) each of A and B to the same extent as if each was individually set forth herein.

[0367] Unless the context dictates otherwise, the feature descriptions and definitions set forth above are not limited to any particular aspect or embodiment of the present invention, but apply equally to all aspects and embodiments described.

[0368] Those skilled in the art will further appreciate that, although the present invention has been described by way of example with reference to certain embodiments, the invention is not limited to the disclosed embodiments, and alternative embodiments can be constructed without departing from the scope of the invention as defined in the appended claims.

[0369] As used herein, a "magnetic microparticle" is a magnetically responsive microparticle that is attracted by a magnetic field. The magnetic microparticles used in the methods of the present invention comprise a magnetic metal oxide core generally surrounded by a polymer coating that creates a surface capable of binding DNA, RNA, or PNA. The magnetic metal oxide core is preferably iron oxide, where the iron is Fe 2+ and Fe 3+ The preferred Fe 2+ / Fe 3+ The ratio is preferably 2 / 1, but can vary from about 0.5 / 1 to about 4 / 1.

[0370] Those skilled in the art will appreciate that when the term "predict" is used, e.g., "predict the presence or absence of a particular sequence," this is understood to mean 2 Or A 2 A copy of, or 2 or area A 2 It will be understood that this refers to determining the presence or absence of a particular feature based on the presence or absence of a copy of a gene.

[0371] Those of skill in the art will understand that the embodiments describing a "primer" include within their scope primers described previously or subsequently in this document. Those skilled in the art will understand that embodiments in which a "primer" is described as being located in a particular region / well of a device or present in a particular reaction mixture include within their scope embodiments in which one or more of the blocking oligonucleotides described previously or subsequently are also present in the same region / well or reaction mixture.

[0372] Those skilled in the art will recognize that "single-stranded probe oligonucleotide A 0 It will be understood that embodiments in which " is described as being located within a particular region / well of a device or present in a particular reaction mixture include within their scope embodiments in which one or more of the blocking oligonucleotides described previously or subsequently are also present therein. EXAMPLES

[0373] Example 1: Detection of EGFR exon 19 cosm12384 mutations In this example, various concentrations of blocking oligonucleotides were utilized in the initial PCR amplification. PCR amplification Mixtures corresponding to the following were prepared: 1x Q5U buffer 200nM primer mix 1 20U / mL Q5U polymerase 10U / mL heat-labile UDG 0.4ng / uL fragmented human genomic DNA Mutant oligonucleotides at + / - 0.2 aM 0-300 nM blocking oligonucleotide Total volume 50uL Q5 buffer Q5 buffer is available from the commercial supplier NEB.

[0374] Primer Mix 1: FWD (SEQ ID NO:1): 5'-C*C*C*AACCAAGCTCTCTTGAGGATCTTG-3' REV (SEQ ID NO:2): 5'- / 5Phos / GGGACCTTACCTTATACACCGTGCCG-3' FWD (SEQ ID NO:3): 5'-G*C*C*TCCCTCGCGCCATCAGAAGGTGAGAAAGTTAAAATTCCCGTC-3' REV (SEQ ID NO: 4): 5'- / 5Phos / GCCTTGCCAGCCCGCTCAGACAGCAAAGCAGAAACTCACATCG-3' FWD (SEQ ID NO:5): 5'-G*C*C*TCCCTCGCGCCATCAGCATCTGCCTCACCTCCACCG-3' REV (SEQ ID NO:6): 5'- / 5Phos / GCCTTGCCAGCCCGCTCAGATATTGTCTTTGTGTTCCCGGAC-3' FWD (SEQ ID NO: 7): 5'-G*A*A*GCCACACTGACGTGCCTCTC-3' REV (SEQ ID NO:8): 5'- / 5Phos / AGGCAGATGCCCAGCAGGCGGCA-3' FWD (SEQ ID NO: 9): 5'-A*C*G*TACTGGTGAAAACACCGCAG-3' REV (SEQ ID NO:10): 5'- / 5Phos / GCCTCCTTCTGCATGGTATTCTTT-3' FWD (SEQ ID NO:11): 5'-G*C*C*TCCCTCGCGCCATCAGAATGACTGAATATAAACTTGTGGTAGTTGGAG-3' REV (SEQ ID NO:12): 5'- / 5Phos / GCCTTGCCAGCCCGCTCAGGAATTAGCTGTATCGTCAAGGCACTCTTG-3' FWD (SEQ ID NO: 13): 5'-C*T*G*GTCCCTCATTGCACTGTACTCC-3' REV (SEQ ID NO:14): 5'- / 5Phos / AGAAACCTGTCTCTTGGATATTCTCGACAC-3' FWD (SEQ ID NO: 15): 5'- / 5Phos / GCCTCCCTCGCGCCATCAGCCACAAAATGGATCCAGACAACTGTTCAAA-3' REV (SEQ ID NO:16): 5'-G*C*C*TTGCCAGCCCGCTCAGTCTTCATGAAGACCTCACAGTAAAAATAGGTGA-3' FWD (SEQ ID NO: 17): 5'- / 5Phos / CCCCCAGCCCTCTGACGTCC-3' REV (SEQ ID NO:18): 5'-A*T*C*TTCTGCTGCCGTCGCTTGA-3' FWD (SEQ ID NO: 19): 5'-T*A*C*CCTTGTCCCCAGGAAGCATA-3' REV (SEQ ID NO:20): 5'- / 5Phos / ATGCCCAGAAGGCGGGAGACAT-3' Mutant oligonucleotide (SEQ ID NO:21): 5'-CTGTCATAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGTTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTC-3' Blocking oligonucleotide (SEQ ID NO:22): 5'- / 5Phos / CTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGG / 3InvdT / -3' [ * represents a phosphorothioate bond, / 5Phos / represents a 5'-terminal phosphate, and / 3InvdT / represents a 3'-terminal inverted dT. The mixture was then incubated: 37℃ 1 min 55℃ 10 minutes 98℃ 1 min (98℃ 10 seconds 63℃ 15 seconds 72℃ 15 seconds) x 50 72℃ 5 min 4℃∞ b. Proteinase K treatment Mixtures corresponding to the following were prepared: 0.44x Proteinase K Buffer 20U / mL proteinase K 40uL of mixture, point a Total volume 90uL Composition of 1x Proteinase K Buffer Tris acetate, pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Tween-20 0.1% The mixture was then incubated at 55°C for 5 min and at 95°C for 10 min.

[0375] C. Pyrophosphorolysis (PPL) and ligation Mixtures corresponding to the following were prepared: 1 x BFF6 20U / mL Klenow (exo-) 100U / mL E. coli ligase 2U / mL apyrase 100U / mL Lambda Exo 0.5 mM PPi 20 nM probe oligonucleotide 30 nM splint oligonucleotide 2.2uL of mixture from point b. Total volume 10uL 1 x BFF6 composition Tris acetate, pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Tween-20 0.1% Probe (SEQ ID NO:23): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGATCGATGCAGATATAGGATGTTGCGAGCTTTCGGAACCTTGATA-3' Splint oligonucleotide (SEQ ID NO:24): 5'-TGTCAAAGCTCATCGAACATTTCCGAAAGCCATCGG-3' [ * represents a phosphorothioate bond, and / 5Phos / represents the 5'-terminal phosphate. The mixture was then incubated at 45° C. for 30 min.

[0376] d.Detect-RCA Mixtures corresponding to the following were prepared: 2.66x isothermal buffer (53.2 mM Tris-HCl, 26.6 mM (NH 4 ) 2 SO 4 , 133 mM KCl, 5.32 mM MgSO 4 , 0.266% Tween-20, pH 8.8) 0.28uM primer mix 2 284.4U / mL BST2.0 WarmStart 14.67U / mL TIPP 1.06 mM dNTPs Syto82 dye 3uM 1.2 uL of reaction mixture from point c. Total volume 11.2uL Primer Mix 2: Forward (SEQ ID NO:25): 5'-T * C * GCAACATCCTATATCTGC-3' Reverse (SEQ ID NO:26): 5'-T * G * AGCTTTGACAATACTTGA-3' [ * represents a phosphorothioate bond] The mixture was then incubated at 60° C. for 90 min. Fluorescence measurements were taken every minute. The results are shown in FIG. 1. The results show that the higher the concentration of blocking oligonucleotide, the greater the difference in Cq values ​​between 0% and 0.1% AF.

[0377] Example 2: Introduction of a blocking oligonucleotide following initial PCR amplification prior to a combined pyrophosphorolysis and ligation step, and detection of T790M in 0.1% AF. PCR amplification Mixtures corresponding to the following were prepared: 1x Q5U buffer 200 nM of primer mix 1 (same as in Example 1, SEQ ID NOs: 1 to 20) 20U / mL Q5U polymerase 10U / mL heat-labile UDG 0.4ng / uL fragmented human genomic DNA Mutant oligonucleotides at + / - 0.2 aM Total volume 50uL The mixture was then incubated: 37℃ 1 min 55℃ 10 minutes 98℃ 1 min (98℃ 10 seconds 63℃ 15 seconds 72℃ 15 seconds) x 50 72℃ 5 min 4℃∞ Q5 buffer Q5 buffer is available from the commercial supplier NEB.

[0378] Mutant oligonucleotide (SEQ ID NO:27): 5'-CATCTGCCTCACCTCCACcgTgcagcTcaTcaTgcagcTcaTgcccTTcggcTgccTccTggacTaTgTCCGGGAACACAAAGACAATAT-3' [ * represents a phosphorothioate bond, and / 5Phos / represents the 5'-terminal phosphate. b. Proteinase K treatment Mixtures corresponding to the following were prepared: 0.44x Proteinase K Buffer 20U / mL proteinase K 40uL of mixture, point a Total volume 90uL The mixture was then incubated at 55°C for 5 min and at 95°C for 10 min.

[0379] Composition of 1x Proteinase K Buffer Tris acetate, pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Tween-20 0.1% c. Annealing of blocking oligos 2.2uL of mixture, point b 30 nM blocking oligonucleotide Total volume 5uL The mixture was then incubated at 95°C for 5 min and cooled to 4°C.

[0380] Blocking oligonucleotide (SEQ ID NO:28): 5'-A * TGAGCTGCGTGATGAG * G * A * A-3' [ * represents a phosphorothioate bond] d. Pyrophosphorolysis (PPL) and ligation Mixtures corresponding to the following were prepared: 1 x BFF6 20U / mL Klenow (exo-) 100U / mL E. coli ligase 2U / mL apyrase 100U / mL Lambda Exo 0.5 mM PPi 10 nM probe oligonucleotide 15 nM splint oligonucleotide 5uL of mixture from point c. Total volume 10uL The mixture was then incubated at 45° C. for 30 min.

[0381] 1 x BFF6 composition Tris acetate, pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Tween-20 0.1% Probe (SEQ ID NO:29): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGAGCACGGCAGATATAGGATGTTGCGAAGGGCATGAGCTGCATGATG-3' Splint oligonucleotide (SEQ ID NO:30): 5'-CAAAGCTCATCGAACATATGCCCTTCGCAACT / 3InvdT / -3' [ * represents a phosphorothioate bond, / 5Phos / represents a 5'-terminal phosphate, and / 3InvdT / represents a 3'-terminal inverted dT. e.Detection-RCA Mixtures corresponding to the following were prepared: 2.66x isothermal buffer (53.2 mM Tris-HCl, 26.6 mM (NH 4 ) 2 SO 4 , 133 mM KCl, 5.32 mM MgSO 4 , 0.266% Tween-20, pH 8.8) 0.28 uM Primer Mix 2 (same as in Example 1, SEQ ID NOs: 25 and 26) 284.4U / mL BST2.0 WarmStart 14.67U / mL TIPP 1.06 mM dNTPs Syto82 dye 3uM 1.2 uL of reaction mixture from point d. Total volume 11.2uL The mixture was then incubated at 60° C. for 90 min. Fluorescence measurements were taken every minute. The results can be seen in FIG. 2. When blocking oligonucleotides are present, the difference in Cq values ​​between 0% and 0.1% AF increases.

[0382] Example 3: Use of various concentrations of blocking oligonucleotides perfectly complementary to the target sequence in a method for the detection of T790M in 0.1% AF PCR amplification Mixtures corresponding to the following were prepared: 1x Q5U buffer 200 nM of primer mix 1 (same as in Example 1, SEQ ID NOs: 1 to 20) 20U / mL Q5U polymerase 10U / mL heat-labile UDG 0.4ng / uL fragmented human genomic DNA + / - 0.2 aM Mutant Oligonucleotide (same as in Example 2, SEQ ID NO: 27) Total volume 50uL The mixture was then incubated: 37℃ 1 min 55℃ 10 minutes 98℃ 1 min (98℃ 10 seconds 63℃ 15 seconds 72℃ 15 seconds) x 50 72℃ 5 min 4℃∞ Q5 buffer Q5 buffer is available from the commercial supplier NEB.

[0383] b. Proteinase K treatment Mixtures corresponding to the following were prepared: 0.44x Proteinase K Buffer 20U / mL proteinase K 40uL of mixture, point a Total volume 90uL The mixture was then incubated at 55°C for 5 min and at 95°C for 10 min.

[0384] Composition of 1x Proteinase K Buffer Tris acetate, pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Tween-20 0.1% c. Annealing of blocking oligos 2.2uL of mixture, point b 0-120 nM blocking oligonucleotide Total volume 5uL The mixture was then incubated at 95°C for 5 min and cooled to 4°C.

[0385] Blocking oligonucleotide (SEQ ID NO:31): 5'-A * GCCGAAGAGCATGAGCTGCATGATG-3' [ * represents a phosphorothioate bond] d. Pyrophosphorolysis (PPL) and ligation Mixtures corresponding to the following were prepared: 1 x BFF6 20U / mL Klenow (exo-) 100U / mL E. coli ligase 2U / mL apyrase 100U / mL Lambda Exo 0.5 mM PPi 10 nM of probe oligonucleotide (same as in Example 2, SEQ ID NO: 29) 15 nM splint oligonucleotide (same as in Example 2, SEQ ID NO: 30) 5uL of mixture from point c. Total volume 10uL The mixture was then incubated at 45° C. for 30 min.

[0386] 1 x BFF6 composition Tris acetate, pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Tween-20 0.1% e.Detection-RCA Mixtures corresponding to the following were prepared: 2.66x isothermal buffer (53.2 mM Tris-HCl, 26.6 mM (NH 4 ) 2 SO 4 , 133 mM KCl, 5.32 mM MgSO 4 , 0.266% Tween-20, pH 8.8) 0.28 uM Primer Mix 2 (same as in Example 1, SEQ ID NOs: 25 and 26) 284.4U / mL BST2.0 WarmStart 14.67U / mL TIPP 1.06 mM dNTPs Syto82 dye 3uM 1.2 uL of reaction mixture from point d. Total volume 11.2uL The mixture was then incubated at 60° C. for 90 minutes. Fluorescence measurements were taken every minute. The results can be seen in FIG. 3. The results show that the presence of blocking oligonucleotides increases the difference in Cq values ​​between 0% and 0.1% AF.

[0387] Example 4: PCR A PCR mixture was prepared corresponding to the following: 400 nM of primer mix 1 or primer mix 2 20U / mL Q5U polymerase 10U / mL heat-labile UDG 0.4ng / uL fragmented human genomic DNA + / - 0.2 aM Mutant Oligonucleotide 1 + / - 0.2aM Mutant Oligonucleotide 2 Total volume: 50uL Primer Mix 1: FWD (SEQ ID NO:32): 5'-A*A*G*TTAAAATTCCCGTCGCTA-3' REV (SEQ ID NO:33): 5'- / 5Phos / AGCAAAGCAGAAACTCACATCG-3' Primer Mix 2: FWD (SEQ ID NO:34): 5'-G*C*C*TCCCTCGCGCCATCAGAAGTTAAAATTCCCGTCGCTA-3' REV (SEQ ID NO:35): 5'- / 5Phos / GCCTTGCCAGCCCGCTCAGAGCAAAGCAGAAACTCACATCG-3' Mutant oligonucleotide 1 (SEQ ID NO:36): 5'-CTGTCATAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGACATCTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTC-3' Mutant oligonucleotide 2 (SEQ ID NO:37): 5'-CTGTCATAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTC-3' [ * represents a phosphorothioate bond, and / 5Phos / represents the 5'-terminal phosphate. The mixture was then incubated as detailed below: 37℃ 1 min 55℃ 10 minutes 98℃ 1 min (98℃ 10 seconds 60℃ 15 seconds 72℃ 15 seconds) x 50 72℃ 5 min 4℃∞ b. Proteinase K treatment Mixtures corresponding to the following were prepared: 0.44x A7 buffer 20U / mL proteinase K 40uL of mixture, point a Total volume 90uL 1×A7 Tris acetate, pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Triton-X 100, 0.1% The mixture was then incubated at 55°C for 5 min and at 95°C for 10 min.

[0388] C. Pyrophosphorolysis (PPL) and ligation Mixtures corresponding to the following were prepared: 1 x BFF1 20U / mL Klenow (exo-) 100U / mL E. coli ligase 1.2U / mL apyrase 100U / mL Lambda Exo 0.25 mM PPi 20 nM of probe oligonucleotide 1 or probe oligonucleotide 2 30 nM of splint oligonucleotide 1 or splint oligonucleotide 2 1.25uL of mixture from point b. Total volume 10uL 1 x BFF1 composition Tris acetate, pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Triton-X 100, 0.1% Probe oligonucleotide 1 (SEQ ID NO:38): 5' / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGATCGATGCAGATATAGGATGTTGCGATCGGAGATGTCTTGATAG-3' Splint Oligonucleotide 1 (SEQ ID NO:39): 5'-TGTCAAAGCTCATCGAACATACATCTCCGAAATCGG-3' Probe oligonucleotide 2 (SEQ ID NO:40): 5' / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGATCGATGCAGATATAGGATGTTGCGACGGAGATGTTGCTTCCTTGA-3' Splint oligonucleotide 2 (SEQ ID NO:41): 5'-TGTCAAAGCTCATCGAACATCAACATCTCTCGCAAG-3' [ * represents a phosphorothioate bond, and / 5Phos / represents the 5'-terminal phosphate.

[0389] The mixture was then incubated at 45° C. for 15 min. d.Detect-RCA Mixtures corresponding to the following were prepared: 2.66x isothermal buffer (53.2 mM Tris-HCl, 26.6 mM (NH 4 ) 2 SO 4 , 133 mM KCl, 5.32 mM MgSO 4 , 0.266% Tween-20, pH 8.8) 0.28 uM Primer Mix 2 (same as in Example 2, SEQ ID NOs: 25 and 26) 284.4U / mL BST2.0 WarmStart 14.67U / mL TIPP 1.06 mM dNTPs Syto82 dye 3uM 1.25uL of reaction mixture from point c. Total volume 11.25uL The mixture was then incubated for 90 minutes at 60° C. Fluorescence measurements were taken every minute and the results can be seen in FIG.

[0390] Example 5: Data showing the effect of adding a blocking oligonucleotide (BO) before or during the PPL step: Mixtures corresponding to the following were prepared: 200 nM of primer mix 1 (same as in Example 1, SEQ ID NOs: 1 to 20) 20U / mL Q5U polymerase 10U / mL heat-labile UDG 0.4ng / uL fragmented human genomic DNA Mutant oligonucleotide of + / - 0.2 aM (same as in Example 1, SEQ ID NO: 21) Total volume 50uL The mixture was then incubated: 37℃ 1 min 55℃ 10 minutes 98℃ 1 min (98℃ 10 seconds 63℃ 15 seconds 72℃ 15 seconds) x 50 72℃ 5 min 4℃∞ b. Proteinase K treatment Mixtures corresponding to the following were prepared: 0.44x Proteinase K Buffer 20U / mL proteinase K 40uL of mixture, point a Total volume 90uL The mixture was then incubated at 55°C for 5 min and at 95°C for 10 min.

[0391] Composition of 1x Proteinase K Buffer Tris acetate, pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Tween-20 0.1% c. Addition of blocking oligonucleotides before the PPL step c.1. Annealing of blocking oligos 2.2uL of mixture, point b 30 nM of blocking oligonucleotide (same as in Example 3, SEQ ID NO: 31) Total volume 5uL The mixture was then incubated at 95°C for 5 min and cooled to 4°C.

[0392] c.2. Pyrophosphorolysis (PPL) and ligation Mixtures corresponding to the following were prepared: 1 x BFF6 20U / mL Klenow (exo-) 100U / mL E. coli ligase 2U / mL apyrase 100U / mL Lambda Exo 0.5 mM PPi 5 nM of each probe oligonucleotide 10 nM of each splint oligonucleotide 5uL of mixture c.1. Total volume 10uL The mixture was then incubated at 45° C. for 30 min.

[0393] 1 x BFF6 composition Tris acetate, pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Tween-20 0.1% T790M probe (SEQ ID NO: 42): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGAGCACGGCAGATATAGGATGTTGCGAAGGGCATGAGCTGCATGATG-3' T790M splint oligonucleotide (SEQ ID NO: 43): 5'-CAAAGCTCATCGAACATATGCCCTTCGCAACT / 3InvdT / -3' G719X_6239 probe (SEQ ID NO: 44): 5' / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCGCAGATATAGGATGTTGCGAAACGCACCGGAGGCCAGCACTTTG-3' G719X_6239 splint oligonucleotide (SEQ ID NO: 45): 5'-TGTCAAAGCTCATCGAACATCCGGTGCGTTCGGCAA-3' G719X_6252 probe (SEQ ID NO: 46): 5' / 5Phos / C*TGTCCAGTGAGCTTTGACAATACTTGACATGCCGAGTAATGAGAGTTTCGCAAACGCACCGGAGCTCAGCACTTTG-3' G719X_6252 splint oligonucleotide (SEQ ID NO: 47): 5'-TGTCAAAGCTCACTGGACAGCCGGTGCGTTCGGCAA-3' G719X_6253 probe (SEQ ID NO: 48): 5' / 5Phos / A*CCTGATCTGAGCTTTGACAATACTTGACATGCGAGCAATTAGGTAGTGTCGTAACGCACCGGAGCACAGCACTTTG-3' G719X_6253 splint oligonucleotide (SEQ ID NO: 49): 5'-TGTCAAAGCTCAGATCAGGTCCGGTGCGTTCGGCAA-3' [ * represents a phosphorothioate bond, / 5Phos / represents a 5'-terminal phosphate, and / 3InvdT / represents a 3'-terminal inverted dT. d. Addition of blocking oligonucleotide during the PPL step Mixtures corresponding to the following were prepared: 1 x BFF6 20U / mL Klenow (exo-) 100U / mL E. coli ligase 2U / mL apyrase 100U / mL Lambda Exo 0.5 mM PPi 5 nM of probe oligonucleotide (same as in Example 5, step c, SEQ ID NOs: 42, 44, 46, 48) 10 nM splint oligonucleotide (same as in Example 5, step c, SEQ ID NOs: 43, 45, 47, 49) 2.2 uL of mixture b. 30 nM of blocking oligonucleotide (same as in Example 3, SEQ ID NO: 31) Total volume 10uL The mixture was then incubated at 45° C. for 30 min.

[0394] 1 x BFF6 composition Tris acetate, pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Tween-20 0.1% e.Detection-RCA Mixtures corresponding to the following were prepared: 2.66× Thermopol (53.2 mM Tris-HCl, 26.6 mM (NH 4 ) 2 SO 4 , 2.66 mM KCl, 5.32 mM MgSO 4 , 0.266% Tween-20, pH 8.8) 1 x Primer Mix 2 571.4U / mL BST2.0 WarmStart 1.07 mM dNTPs 1.2uL of reaction mixture from point d or c. Total volume 11.2uL Primer mix 2 consists of: 40 μM of primer 1 (SEQ ID NO: 50): 5'-T * G * AGCTTTGACAATACTTGA-3' 10 μM primer 2 (SEQ ID NO:51): 5'- / 5Cy5 / A*CTGACCAGCTCCATGACAATCGCTGTCGCCATGATCGATCGCAACATCCTATATCTGCGC 10 μM primer 3 (SEQ ID NO: 52): 5'- / 5TEX615 / A*CTGACCAGCTCCATGACAATCGCTGTCGCCATGATCGATGCGAAACTCTCATTACTCGGC 10 μM primer 4 (SEQ ID NO: 53): 5'- / 5HEX / T*ACGACCGACTCACTCCTTACAGCAGTCCGCAGTATGCTACGACACTACCTAATTGCTCGC 10 μM primer 5 (SEQ ID NO: 54): 5'- / 5ATTO488N / T*ACGACCGACTCACTCCTTACAGCAGTCCGCAGTATGCTTCGGTGATCAGTCCTCGATG 20 μM primer 6 (SEQ ID NO: 55): 5'-TCGATCATGGCGACAGCGATTGTCATGGAGCTGGTCAGT / 3IAbRQSp / 20 μM primer 7 (SEQ ID NO: 56): 5'-AGCATACTGCGGACTGCTGTAAGGAGTGAGTCGGTCGTA / 3IABkFQ / [ * represents a phosphorothioate linkage, / 5Cy5 / represents a Cy5 dye, / 5TEX615 / A represents a Texas Red dye, / 5HEX / represents a Hex dye, / 5ATTO488N / represents an Atto488 dye, / 3IAbRQSp / represents an Iowa Black® RQ quencher, and / 3IABkFQ / represents an Iowa Black® FQ. The mixture was then incubated for 120 minutes at 58° C. Fluorescence measurements in the four reading channels were taken every minute, and the results can be seen in FIG.

[0395] Example 6: Further applications of the method of the present invention Methylation frequencies of highly related methylated genes (HRMG) in human cancers

[0396] [Table 1]

[0397] Methylation of lung cancer biomarkers Lung cancer is a leading cause of cancer-related mortality for several reasons, including its late manifestation of symptoms and the low sensitivity of screening techniques such as chest radiography. DNA fragments shed from tumor cells can provide a convenient and minimally invasive access to the molecular portrait of cancer, and these DNA fragments are found in cell-free DNA (cfDNA) isolated from the blood of cancer patients. Cell-free circulating tumor DNA (ctDNA) in plasma represents a surrogate for the entire cancer genome, and ctDNA represents a low proportion of the total cfDNA, 0.05% or less, in many cancer patients, especially early in the disease. These characteristics make aberrant methylation of ctDNA a promising cancer biomarker, and recent high-throughput studies have demonstrated correspondence of changes in methylation profiles between ctDNA and DNA from paired tumor tissues. A list of methylation markers for lung cancer diagnostics and prognosis is provided below.

[0398] [Table 2]

[0399] TERT and MGMT promoter methylation and its impact on brain cancer O 6The -methylguanine-DNA methyltransferase (MGMT) gene encodes an evolutionarily conserved and ubiquitously expressed methyltransferase involved in DNA repair. MGMT removes alkyl adducts from the O6 position of guanine to prevent DNA damage and confer a protective effect on normal cells. However, the endogenous function of MGMT also protects tumor cells from the otherwise lethal effects of chemotherapy with alkylating agents such as temozomide (TMZ). Silencing or reduced expression of MGMT through methylation of its corresponding gene promoter has been observed in 50% of grade IV gliomas, impairing DNA repair and resulting in increased chemosensitivity to agents such as TMZ. Thus, the methylation status of the MGMT promoter has potential as a biomarker of sensitivity to alkylating chemotherapy, ultimately impacting clinical practice. Although its capacity as both a predictive and prognostic biomarker has been extensively studied, currently there is no consensus on the optimal method for assessment of MGMT gene promoter methylation.

[0400] Telomere maintenance protects the integrity of chromosome ends and allows replicative immortalization, a hallmark of human cancer. The telomere reverse transcriptase (TERT) oncogene encodes the rate-limiting catalytic subunit of the telomerase holoenzyme, which is responsible for telomere maintenance and is normally expressed only in a subset of stem cells. The TERT gene is reactivated in approximately 90% of cancer cells, allowing unlimited proliferation and immortalization of these cell types. Various genetic and epigenetic mechanisms underlying TERT dysregulation have been identified, with hypermethylation of the TERT promoter region representing a unique hallmark of cancer cells. Interestingly, methylation, but not mutations, in the upstream of the transcription start site (UTSS) of the TERT gene were found to be strongly associated with increased TERT expression and poor prognosis in pediatric brain tumors. Given the prevalence of TERT promoter hypermethylation in a wide variety of cancer cell types, this epigenetic modification represents a useful prognostic biomarker. Genes that are methylated or not, such as prostate cancer genes Prostate cancer is the most frequently diagnosed non-cutaneous malignancy and the leading cause of cancer-related deaths in men in Western industrialized countries. Numerous DNA methylation changes have been observed between benign and cancerous prostate tissues, and the changes are often early and recurrent, suggesting a potential functional role. Multiple genome-wide studies have reported that several genes and gene families are recurrently hypermethylated in prostate cancer. The genes and gene families include, but are not limited to, GSTP1, MGMT, AR, ER, VHL, RB1, APC, DAPK, CD44, AOX1, APC, CDKN2A, HOXD3, PTGS2, RARB, WT1, ZNF154, C20orf103, EFS, HOXC11, LHX9, RUNX3, TBX15, BARHL2, BDNF, CCDC8, CYP27A1, DLX1, EN2, ESR1, FBLN1, FOXE3, GP5, FRSP, HHEX, HOXA3, HOXD4, HOXD8. IRX1, KIT, LBX1, LHX2, NKX2-1, NKX2-2, NKX2-5, PHOXRA, POU3F3, RHCG, SIX6, TBX3, TMEM106, VAX1, and WNT2. Methylation of pancreatic cancer markers Pancreatic ductal adenocarcinoma (PDAC) is one of the most deadly cancer types. This form of cancer is difficult to diagnose due to the lack of early diagnostic tests currently available, meaning that diagnosis occurs when the disease is already advanced (more than 75% of diagnosed cases are stage III / IV disease). This has resulted in a high recorded mortality rate. Early diagnosis has proven difficult due to the lack of reliable biomarkers that can capture the early development and / or progression of PDAC. Currently, the only FDA-approved biomarker for prognostic monitoring of patients with PDAC is carbohydrate antigen 19-9 (CA19-9 or sialylated Lewis antigen). This antigen shows low sensitivity and specificity for detection of the disease. Therefore, its use is not recommended for diagnostic purposes unless used in combination with other circulating biomarkers.

[0401] Recent studies have shown that methylation analysis of cell-free DNA (cfDNA) represents a promising non-invasive approach to discover biomarkers with diagnostic potential. It may be possible to utilize cfDNA methylation for the identification of disease-specific signatures in pre-neoplastic lesions or chronic pancreatitis (CP). As CP often precedes PDAC, dynamic DNA methylation patterns of a set of defined genes may underlie disease progression. The ductal cell marker CUX2 shows increased signal in PDAC, and the ductal and acing cell marker REG1A shows gradually increasing signal in chronic pancreatitis. The biomarkers ADAMTS1 and BNC1 have been found to have high methylation frequencies in primary PDAC and pre-neoplastic pancreatic intraepithelial neoplasia (PIN) (25% and 70% for ADAMTS1 and BNC1, respectively). Combined cfDNA methylation of ADAMTS1 and BNC1 may be utilized for early diagnosis of pancreatic cancer (i.e., stages I and II). A list of potential biomarkers is provided below.

[0402] [Table 3]

[0403] KRAS detection The KRAS gene controls cell proliferation, and when it is mutated, this negative signaling is disrupted and cells can continue to proliferate, often developing into cancer. Single amino acid substitutions, particularly single nucleotide substitutions, are responsible for activating mutations associated with various cancers, namely lung adenocarcinoma, mucinous adenoma, pancreatic ductal adenocarcinoma, and colorectal cancer. KRAS mutations have been used as prognostic biomarkers, for example, in lung cancer.

[0404] Driver mutations in KRAS have been associated with up to 20% of human cancers, and targeted therapies are under development for this mutation and its associated diseases; a partial non-limiting list of such treatments can be seen in the table below.

[0405] [Table 4]

[0406] The presence of KRAS mutations has been found to reflect a very poor response to the EGFR inhibitors panitumumab (Vectibix) and cetuximab (Erbitux). Activating mutations in the gene encoding KRAS occur in 30%-50% of colorectal cancers, and studies have shown that patients whose tumors express this mutated version of the KRAS gene do not respond to panitumumab and cetuximab. Although the presence of a wild-type KRAS gene is not a guarantee that a patient will respond to these drugs, studies have shown that cetuximab has significant efficacy in metastatic colorectal cancer patients with wild-type KRAS tumors. For the EGFR antagonists erlotinib or gefitinib, lung cancer patients who are positive for KRAS mutations (wild-type EGFR) have an estimated response rate of 5% or less, compared to a 60% response rate in patients who do not harbor KRAS mutations.

[0407] Early detection of the emergence of KRAS mutations (activating or overexpressing), a frequent driver of acquired resistance to cetuximab therapy (anti-EGFR therapy) in colorectal cancer, allows modification of treatment (e.g., early initiation of mitogen-activated protein kinase kinase [MEK] inhibitors) upon delayed or reverse resistance, and it is therefore advantageous that the methods of the invention allow for rapid and inexpensive detection of KRAS status in patients.

[0408] A non-limiting list of mutations are G12D, G12A, G12C, G13D, G12V, G12S, G12R, A59T / E / G, Q61H, Q61K, Q61R / L, K117N, and A146P / T / V.

[0409] A further non-limiting list of mutations is provided in the table below.

[0410] [Table 5]

[0411] BRAF detection BRAF is a human gene that encodes a protein called B-Raf, which is involved in sending signals into cells that are involved in directing cell growth. It has been shown to be mutated in some human cancers. B-Raf is a member of the Raf kinase family of growth-signaling protein kinases and plays a role in regulating the MAP kinase / ERK signaling pathway, which among other things affects cell division.

[0412] Certain other inherited BRAF mutations cause birth defects. More than 30 mutations in the BRAF gene have been identified that have been associated with human cancers. In 90% of cases, there is a substitution of adenine for thymine at nucleotide 1799. This results in a substitution of glutamic acid (E) for valine (V) at codon 600 in the activating segment found in human cancers (referred to here as V600E). This mutation is - Colorectal cancer - Melanoma - Papillary thyroid cancer - Non-small cell lung cancer - Ameloblastoma It has been widely observed in

[0413] A non-limiting list of other mutations found are R461I, I462S, G463E, G463V, G465A, G465E, G465V, G468A, G468E, N580S, E585K, D593V, F594L, G595R, L596V, T598I, V599D, V599E, V599K, V599R, V600K, and A727V.

[0414] Drugs are being developed to treat cancers driven by BRAF mutations. Vemurafenib and dabrafenib have been approved by the FDA for the treatment of late-stage melanoma. The response rate to treatment with vemurafenib was 53% for metastatic melanoma, compared to 7-12% for the previous best chemotherapy agent, dacarbazine. ERBB2 / HER2 detection Human epidermal growth factor receptor 2 (HER2), also known as CD340 (cluster of differentiation 340), proto-oncogene Neu, Erbb2 (rodent), or ERBB2 (human), is a protein encoded by the ERBB2 gene. Amplification or overexpression of this oncogene plays an important role in the progression of invasive breast cancer. Overexpression of the ERBB2 gene is also known to occur in ovarian, gastric, lung adenocarcinoma, and invasive forms of uterine cancer, as well as in 30% of salivary duct carcinomas. Structural alterations have also been identified that cause ligand-independent firing of the receptor in the absence of overexpression.

[0415] A number of targeted treatments are approved and in development for this mutation and its associated diseases, a non-limiting list of some of such treatments can be seen in the table below.

[0416] [Table 6]

[0417] HER2 testing is routinely performed in breast cancer patients to assess prognosis, monitor response to treatment, and determine suitability for targeted therapy (such as trastuzumab). Because trastuzumab is expensive and associated with severe side effects (cardiotoxicity), it is important that only HER2+ patients are selected to receive it, and it is therefore advantageous that the method of the present invention allows for rapid and inexpensive detection of a patient's HER2 status.

[0418] In one embodiment, the methods of the invention are used to detect the presence or absence of an ERBB2 exon 20 insertion mutation. A further non-limiting list of ERBB2 mutations is provided in the table below.

[0419] [Table 7]

[0420] EML4-ALK detection EML4-ALK is an abnormal gene fusion between the echinoderm microtubule-associated protein-like 4 (EML4) gene and the anaplastic lymphoma kinase (ALK) gene. This gene fusion leads to the production of the protein EML4-ALK, which is thought to promote and maintain the malignant behavior of cancer cells. EML4-ALK-positive lung cancers are primary malignant lung tumors whose cells contain this mutation.

[0421] A number of targeted therapies are approved and in development for this mutation and its associated diseases, a partial non-limiting list of such treatments can be seen in the table below.

[0422] [Table 8]

[0423] The EML4-ALK gene fusion is responsible for approximately 5% of non-small cell lung cancers (NSCLC), with approximately 9,000 new cases in the United States and 45,000 worldwide each year. Numerous variants of EML4-ALK exist, all of which contain the essential coiled-coil domain in the N-terminal part of EML4 and in the kinase domain of ALK exon 20, which are necessary for transforming activity. Fusion of EML4 exon 13 with ALK exon 20 (variant 1: V1), fusion of EML4 exon 20 with ALK exon 20 (V2), and fusion of EML4 exon 6 with ALK exon 20 (V3) are some of the more common variants. The clinical significance of these various variants has only recently become clear.

[0424] V3 has emerged as a suitable marker for the selection of patients likely to have shorter progression-free survival (PFS) after non-tyrosine kinase inhibitor (TKI) treatments such as chemotherapy and radiotherapy. Further evidence exists that V3 is associated with shorter PFS and worse overall survival (OS) in patients receiving first- and second-generation treatment lines compared with EML4-ALK V1 and V2.

[0425] It has also been found that V3-positive patients develop resistance to the first and second treatment lines, which occurs through the development of resistance mutations and is likely driven by incomplete tumor cell suppression due to the higher IC50 of wild-type V3.Detection of unfavorable V3 can be used to select patients who require more invasive monitoring and treatment strategies.Administering third-generation lorlatinib to patients with V3 may give them longer PFS than those with V1, and therefore it is considered advantageous that the method of the present invention allows for the rapid and inexpensive detection of mutations that patients may have.

[0426] The methods of the present invention further allow for the detection of resistance mutations such as, but not limited to, G1202R, G1269A, E1210K, D1203, S1206C, L1196M, F1174C, I1171T, I1171N / S, V1180L, T1151K, and C1156Y.

[0427] For example, G1202R is a solvent-tip mutation that causes interference with drug binding and confers high levels of resistance to first and second generation ALK inhibitors. Thus, the methods of the present invention advantageously allow for the identification of patients who may carry this mutation and benefit from initiating treatment with third generation treatments rather than first or second generation treatments.

[0428] A further non-limiting list of EML4-ALK mutations is provided in the table below.

[0429] [Table 9]

[0430] EGFR detection The identification of the epidermal growth factor receptor (EGFR) as an oncogene has led to the development of targeted therapies such as gefitinib, erlotinib, afatinib, brigatinib, and icotinib for lung cancer, and cetuximab for colon cancer. However, many patients develop resistance to these treatments. The two main sources of resistance are the T790M mutation and the MET oncogene.

[0431] EGFR mutations occur in EGFR exons 18-21, and mutations in exons 18, 19, and 21 indicate suitability for treatment with EGFR-TKIs (tyrosine kinase inhibitors). Mutations in exon 20 (with the exception of a few mutations) indicate that the tumor is EGFR-TKI-resistant and not suitable for treatment with EGFR-TKIs.

[0432] The two most common EGFR mutations are a short in-frame deletion in exon 19 and a point mutation in exon 21 at nucleotide 2573 (CTG to CGG), resulting in a substitution of leucine with arginine at codon 858 (L858R). Together, these two mutations account for approximately 90% of all EGFR mutations in non-small cell lung cancer (NSCLC). Screening for these mutations in patients with NSCLC can be used to predict which patients will respond to TKIs.

[0433] Therefore, it is advantageous that the method of the present invention allows identification of patients who carry these mutations and can benefit from starting treatment with TKI.Those skilled in the art will understand that the method of the present invention allows identification of a range of EGFR mutations.A non-exhaustive list of such mutations is G719X, Ex19Del, S768I, Ex20Ins, and L861Q.

[0434] A further non-limiting list of mutations is provided in the table below.

[0435] [Table 10-1]

[0436] [Table 10-2]

[0437] ROS1 ROS1 is a receptor tyrosine kinase (encoded by the gene ROS1) with structural similarity to the anaplastic lymphoma kinase (ALK) protein, which is encoded by the c-ros oncogene.

[0438] A non-limiting list of ROS1 mutations is provided in the table below.

[0439] [Table 11]

[0440] RET proto-oncogene The RET proto-oncogene encodes a receptor tyrosine kinase for members of the glial cell line-derived neurotrophic factor (GDNF) family of extracellular signaling molecules.

[0441] A non-limiting list of RET mutations is provided in the table below.

[0442] [Table 12]

[0443] MET exon 14 MET exon 14 skipping occurs with a frequency of approximately 5% in NSCLC and is seen in both squamous and adenocarcinoma histologies.

[0444] A non-limiting list of MET mutations is provided in the table below.

[0445] [Table 13]

[0446] NTRK proto-oncogene NTRK gene fusions result in abnormal proteins called TRK fusion proteins, which can cause cancer cells to grow. NTRK gene fusions can be found in some types of cancer, including brain, head and neck, thyroid, soft tissue, lung, and colon cancers. They are also called neurotrophic tyrosine receptor kinase gene fusions.

[0447] A non-limiting list of NTRK mutations is provided in the table below.

[0448] [Table 14]

[0449] panel In one embodiment of the present invention, each A 0 A plurality of probe molecules (A 0 ) are provided. The mutations may be selected from any of the mutations previously or subsequently described or known. Thus, one of skill in the art will appreciate that within the scope of the present invention are panels that may be useful for detecting one or more mutations in any of the previously or subsequently described or known proto-oncogenes or oncogenes.

[0450] In one embodiment, the panel comprises between 5 and 500 individual probe molecules, each complementary to a specific target mutation. In one embodiment, the panel comprises between 5 and 400 individual probe molecules, each complementary to a specific target mutation. In one embodiment, the panel comprises between 5 and 300 individual probe molecules, each complementary to a specific target mutation. In one embodiment, the panel comprises between 5 and 200 individual probe molecules, each complementary to a specific target mutation. In one embodiment, the panel comprises between 5 and 100 individual probe molecules, each complementary to a specific target mutation. In one embodiment, the panel comprises between 5 and 50 individual probe molecules, each complementary to a specific target mutation.

[0451] In one embodiment, there may be multiple probe molecules specific for the same mutation, hi one embodiment, there may be only one probe molecule specific for each mutation in the panel.

[0452] In one embodiment, a panel is provided that comprises a plurality of probe molecules, wherein one or more probes are complementary to EGFR mutations, one or more probes are complementary to KRAS mutations, one or more probes are complementary to ERBB2 / HER2 mutations, one or more probes are complementary to EML4-ALK mutations, one or more probes are complementary to ROS1 mutations, one or more probes are complementary to RET mutations, and one or more probes are complementary to MET mutations.

[0453] In one embodiment, a panel is provided that comprises a plurality of probe molecules, wherein one or more probes may be complementary to EGFR mutations, one or more probes may be complementary to KRAS mutations, one or more probes may be complementary to ERBB2 / HER2 mutations, one or more probes may be complementary to EML4-ALK mutations, one or more probes may be complementary to ROS1 mutations, one or more probes may be complementary to RET mutations, and one or more probes may be complementary to MET mutations.

[0454] In one embodiment, a panel of probes selective for one or more EGFR, KRAS, BRAF, ERBB2 / HER2, EML4-ALK, ROS1, RET, MET mutations is provided.

[0455] In one embodiment, a panel of probe molecules selective for EGFR mutations is provided. In one embodiment, a panel of probe molecules selective for KRAS mutations is provided. In one embodiment, a panel of probe molecules selective for BRAF mutations is provided.

[0456] In one embodiment, a panel of probe molecules selective for ERBB2 / HER2 mutations is provided. In one embodiment, a panel of probe molecules selective for EML4-ALK mutations is provided.

[0457] In one embodiment, a panel of probe molecules selective for ROS1 mutations is provided. In one embodiment, a panel of probe molecules selective for RET mutations is provided. In one embodiment, a panel of probe molecules selective for NTRK mutations is provided.

[0458] In one embodiment, a panel of probe molecules selective for ROS1 mutations is provided. In one embodiment, a panel of probe molecules selective for MET exon 14 mutations is provided.

[0459] In one embodiment, a panel is provided that comprises a plurality of probe molecules selective for one or more coding sequences (CDS). In one embodiment, a method is provided for detecting one or more mutations using one or more of the previously described panels.

[0460] In one embodiment, a method is provided for detecting the presence or absence of one or more mutations using one or more of the previously described panels. In one embodiment, a kit is provided that includes a panel, which may be as previously or subsequently described, in combination with one or more reagents, which may be as previously or subsequently described.

[0461] Those skilled in the art will appreciate that 0 The disclosed kit embodiment includes within its scope a plurality of A 0 It will be understood that this includes embodiments in which there is a panel comprising: Those skilled in the art will appreciate that the disclosure of this application is sufficient to provide 0 It will be understood that the present invention further includes an embodiment of a panel comprising: 0 and B. 0 The same oligonucleotide C 0 This includes embodiments in the area of

[0462] In one embodiment, a methylation detection panel is provided. In one embodiment, a methylation detection kit is provided. Companion Diagnostics The method of the present invention can be used to detect specific genetic markers in samples that can be used to help guide the selection of appropriate treatment. These markers can be tumor-specific mutations or wild-type genomic sequences and can be detected using tissue, blood, or any other type of patient sample. The markers can be epigenetic markers. Monitoring resistance Repeated testing of patient samples during disease treatment may allow early detection of emerging resistance to therapy. One example of this application is in non-small cell lung cancer (NSCLC), where epidermal growth factor receptor (EGFR) inhibitors (e.g., gefitinib, erlotinib) are commonly used as first-line treatment. During treatment, tumors can often develop mutations in the EGFR gene (e.g., T790M, C797S), which confer resistance to the drug. Early detection of these mutations may allow patients to move to alternative treatments (e.g., Tagrisso). Epigenetic changes to the patient's DNA may indicate the emergence of resistance.

[0463] Typically, patients who are monitored for resistance development may be too sick to perform repeated tissue biopsies, which may also be expensive, invasive, and have associated risks. Although testing from blood is preferred, the mutation of interest may be present in a reasonable blood sample at very low copy number. Therefore, monitoring requires highly sensitive testing from blood samples using the method of the present invention, which is simple and cost-effective to perform so that it can be performed periodically. Monitoring for recurrence In this application, patients who are declared disease-free after treatment can be monitored over time to detect disease recurrence. This needs to be done non-invasively and requires sensitive detection of target sequences from blood samples. Using the method of the present invention provides a simple and inexpensive method that can be performed routinely. The target sequences can be common mutations known to be common in the disease of interest, or can be custom panels of targets designed for a specific patient based on detection of variants in tumor tissue before remission. Minimal Residual Disease (MRD) Monitoring In some cancers, there are residual cancer cells that remain in the patient after treatment, which is the main cause of relapse in cancer and leukemia. Monitoring and testing for MRD has several important roles: determining whether the treatment has eradicated the cancer or if traces remain, comparing the effectiveness of various treatments, monitoring the remission status of the patient and detecting the relapse of leukemia, and selecting the treatment that best meets these needs. screening Population screening for early detection of disease is a long-standing goal, especially in cancer diagnostics. The challenge is twofold: identification of a panel of markers that allows confident detection of disease with not too many false negatives, and development of a method with sufficient sensitivity and low enough price. Using the method of the present invention, a panel of mutations larger than PCR-based tests can be addressed with a much simpler workflow and lower price than sequencing-based diagnostics. Organ graft rejection If the transplanted organ is rejected by the recipient, DNA from the organ will be shed into the recipient's bloodstream. Early detection of this DNA will allow early detection of rejection. This can be achieved using a custom panel of donor-specific markers, or by using a panel of variants known to be common in the population, some of which are present in the donor and some in the recipient. Routine monitoring of organ recipients over time can be made possible by the low-cost and simple workflow of the invention disclosed herein. Non-invasive prenatal testing (NIPT) It has been known for a long time that fetal DNA exists in maternal blood, and the NIPT market is now completely saturated with companies that use sequencing to identify mutations and count the copy number of certain chromosomes to enable fetal abnormality detection.The method of the present invention disclosed herein has the ability to detect mutations at very low allele fractions, potentially enabling earlier detection of fetal DNA.Identification of common mutations in a given population will allow development of assays that target mutations that may exist in either maternal or fetal DNA, or enable detection of abnormalities at an early stage of pregnancy.

[0464] Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure. As used herein, "and / or" should be interpreted as a specific disclosure of each of the two specified features or components, with or without the other. For example, "A and / or B" should be interpreted as a specific disclosure of (i) A, (ii) B, and (iii) each of A and B to the same extent as if each was individually set forth herein.

[0465] Unless the context dictates otherwise, the feature descriptions and definitions set forth above are not limited to any particular aspect or embodiment of the present invention, but apply equally to all aspects and embodiments described.

[0466] Those skilled in the art will further appreciate that, although the present invention has been described by way of example with reference to certain embodiments, the invention is not limited to the disclosed embodiments, and alternative embodiments can be constructed without departing from the scope of the invention as defined in the appended claims.

[0467] Those skilled in the art will recognize that "partially digested chain A 1 " refers to a sequence that, when hybridized to a target analyte sequence, in the 3'-5' direction, undergoes strand dissociation due to lack of complementarity. 0It will be understood that the term "single stranded oligonucleotide" may refer to a single stranded oligonucleotide formed by progressive digestion of

[0468] Those skilled in the art will understand that reference to a "partially double-stranded" nucleic acid can refer to a nucleic acid in which one or more portions are double-stranded and one or more portions are single-stranded. Those of skill in the art will understand that reference to a "substantially double-stranded" nucleic acid can refer to a nucleic acid in which one or more portions are double-stranded and one or more fewer portions are single-stranded.

Claims

1. 1. A method for detecting a target polynucleotide sequence in a predetermined nucleic acid analyte present in a sample, comprising: (a) introducing a blocking oligonucleotide into a first reaction mixture containing one or more nucleic acid analytes, wherein the blocking oligonucleotide anneals to at least a subset of non-target polynucleotide sequences; (b) removing the mixture produced in (a); i. Single-stranded probe oligonucleotide A ０ and, ii. a pyrophosphorylase enzyme; iii. Ligase and a second reaction comprising the target analyte, ０ to produce a first intermediate product that is at least partially double-stranded; ０ The 3' end of A forms a double-stranded complex. ０ is pyrophosphorolyzed in the 3'-5' direction from the 3' end to at least partially digested chain A １ Created A １ is ligated to A ２ forming a (c) detecting a signal derived from the product of the previous step, ２ or a portion thereof, or multiple copies of A ２ or a portion thereof of multiple copies thereof, and inferring therefrom the presence or absence of a polynucleotide target sequence in the analyte; A method comprising:

2. 2. The method of claim 1, comprising the steps of: deriving one or more single stranded analytes from a biological sample by subjecting the biological sample, comprised of the analyte and optionally background genomic DNA, to PCR to generate an amplified sequence of the analyte, wherein one or more of the primers have a non-complementary 5' tail, and optionally one or more of the primers are 5' protected, and treating the PCR products with a 5'-3' exonuclease.

3. 3. The method of claim 1 or 2, wherein the first reaction mixture further comprises one or more primers, deoxynucleotide triphosphates (dNTPs), and an amplification enzyme, and wherein during step (a), nucleic acid analytes present in the sample undergo amplification, and further characterized in that after amplification of the predetermined nucleic acid analytes and prior to (b), the sample is further treated with a proteinase.

4. further comprising combining the first and second reaction mixtures; (a) detecting one or more nucleic acid analytes; i. Single-stranded probe oligonucleotide A ０ and, ii. a blocking oligonucleotide; iii. pyrophosphorylase; iv. Ligase a step of introducing into a combined reaction mixture comprising: a blocking oligonucleotide that anneals to at least a subset of the non-target polynucleotide sequences; and a target analyte that is a single-stranded probe oligonucleotide A; ０ to produce a first intermediate product that is at least partially double-stranded; ０ The 3' end of A forms a double-stranded complex. ０ is pyrophosphorolyzed in the 3'-5' direction from the 3' end to at least partially digested chain A １ Created A １ is ligated to A ２ forming a (b) detecting a signal derived from the product of the previous step, ２ or a portion thereof, or multiple copies of A ２ or a portion thereof of multiple copies thereof, and inferring therefrom the presence or absence of a polynucleotide target sequence in the analyte; The method of claim 1 , comprising:

5. 5. The method of claim 1, further characterized in that the reaction mixture containing the pyrophosphorolytic enzyme further contains a source of pyrophosphate ions.

6. 6. The method of claim 1, further characterized in that the target region of RNA present in the biological sample is reverse transcribed into DNA by reverse transcriptase prior to introducing the one or more nucleic acid analytes into a reaction mixture containing pyrophosphorylase.

7. the blocking oligonucleotide is perfectly complementary to the target nucleic acid analyte and mismatched to the non-target nucleic acid analyte; incomplete annealing of non-target nucleic acid analytes with blocking oligonucleotides to form intermediate products that cannot be digested by pyrophosphorolysis to the extent necessary to melt them from the non-target molecules; fully annealing the target nucleic acid analyte with the blocking oligonucleotide to form an intermediate product that is at least partially double-stranded, and the blocking oligonucleotide is pyrophosphorolyzed in the 3'-5' direction to release the target nucleic acid analyte; The target nucleic acid analyte is a single-stranded probe oligonucleotide A ０ to produce a first intermediate product that is at least partially double-stranded; ０ The 3' end of A forms a double-stranded complex. ０ is pyrophosphorolyzed in the 3'-5' direction from the 3' end to at least partially digested chain A １ Created A １ is ligated to A ２ and forming Detecting a signal from the product of the previous step, the product being A ２ or a portion thereof, or multiple copies of A ２ or a portion thereof of multiple copies thereof, and inferring therefrom the presence or absence of a polynucleotide target sequence in the analyte. The method of claim 1, 2, 4, or 5, further characterized by:

8. The method of any one of claims 1 to 7, further characterized in that the blocking oligonucleotide comprises a 3' or 5' modification to confer resistance to digestion.

9. The second or combined reaction mixture is ０ 9. The method of claim 1, further comprising at least one single-stranded primer oligonucleotide substantially complementary to a portion of and deoxyribonucleotide triphosphates (dNTPs), and optionally, the second or combined reaction mixture further comprises an amplification enzyme.

10. The second or combined reaction mixture comprises: one or more ligases; A ２ Two or more LCR probe oligonucleotides complementary to the above flanking sequences, ２ and an LCR probe oligonucleotide in which the 5' phosphate of one LCR probe is directly adjacent to the 3' OH of the other LCR probe when annealing with Further comprising: A ２ In the presence of ２ and are successfully annealed to and ligated together to form a single oligonucleotide molecule, which then serves as the new target for a second round of covalent ligation to the desired target, in this case A ２ which is then detected. or, an oligonucleotide complementary to a region of A2 containing the ligation site, comprising one or more fluorophores positioned such that their fluorescence is quenched by their proximity either to each other or to one or more fluorescent quenchers; Double-strand specific DNA digestion enzyme in the presence of A2, the labeled oligonucleotide is digested such that the fluorophores are separated from each other or from their corresponding quenchers and the fluorescent signal, and thus the presence of A2, is detectable. The method according to any one of claims 1 to 9, further characterized in that

11. The products of the pyrophosphorolysis reaction are, prior to the detection step, one or more ligases; A ２ Two or more LCR probe oligonucleotides complementary to the above flanking sequences, ２ and an LCR probe oligonucleotide in which the 5' phosphate of one LCR probe is directly adjacent to the 3' OH of the other LCR probe when annealing with into a third reaction mixture containing A ２ In the presence of ２ and are successfully annealed to and ligated together to form a single oligonucleotide molecule, which then serves as the new target for a second round of covalent ligation to the desired target, in this case A ２ which is then detected. or, an oligonucleotide complementary to a region of A2 containing the ligation site, comprising one or more fluorophores positioned such that their fluorescence is quenched by their proximity either to each other or to one or more fluorescent quenchers; Double-strand specific DNA digestion enzyme in the presence of A2, the labeled oligonucleotide is digested such that the fluorophores are separated from each other or from their corresponding quenchers and the fluorescent signal, and thus the presence of A2, is detectable. The method according to any one of claims 1 to 9, further characterized in that

12. 12. The method according to any one of claims 1 to 11, further characterized in that before or during the detection step, the product of the previous step is treated with a pyrophosphatase or an exonuclease.

13. A ０ Partially digested chain A by pyrophosphorolysis of １ The enzyme that forms A ２ 13. The method according to claim 1, further comprising amplifying also the nucleotide sequence of the first gene.

14. Multiple probes A ０ each of which is selective for a different target sequence and each of which further comprises an identification region; ２ The method according to any one of claims 1 to 13, further characterized in that the amplified sequence of comprises this identification region, and thus the target sequence present in the analyte is inferred through detection of the identification region, and optionally, the detection of the identification region is performed using a molecular probe or through sequencing.

15. One or more nucleic acid analytes are divided into multiple reaction volumes, each volume containing one or more probe oligonucleotides A introduced to detect different target sequences. ０ and a different probe A ０ 15. The method of any one of claims 1 to 14, further characterized in that: contains a common priming site, allowing a single primer or a single set of primers to be used for amplification.

Images