Hybrid AAV-anellovector

Abstract

The present invention relates generally to compositions for producing and administering anelovectors and uses thereof.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 147,102, filed February 8, 2021. The contents of the aforementioned application are incorporated herein by reference in their entirety. [Background technology]

[0002] There is a continuing need to develop compositions and methods for generating suitable vectors for delivering therapeutic effectors to patients. Summary of the Invention [Means for solving the problem]

[0003] The present disclosure provides compositions and methods for administering anelovectors (e.g., synthetic anelovectors) that can be used, for example, as a delivery vehicle for delivery of genetic material, for delivery of an effector, e.g., a payload, or for delivery of a therapeutic agent or therapeutic effector to a eukaryotic cell (e.g., a human cell or tissue). Generally, an anelovector comprises an Anellovirus ORF1 molecule (e.g., a capsid protein having at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 protein as described herein) and a proteinaceous exterior comprising a genetic element encapsulated within the proteinaceous exterior, wherein the genetic element is an Anellovirus ORF1 molecule. In some embodiments, the nucleic acid sequence comprises at least one nucleic acid sequence derived from a virus other than an Anellovirus (e.g., a contiguous nucleic acid sequence having a length of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, or 4000 nucleotides), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In some embodiments, the nucleic acid sequence derived from a virus other than an Anellovirus is derived from an adeno-associated virus (AAV) (e.g., as described herein). In some embodiments, the effector (e.g., payload), or sequence encoding the effector, is separate from the non-anellovirus sequence. In some embodiments, the proteinaceous exterior is capable of introducing the genetic element into a target cell (e.g., a mammalian cell, e.g., a human cell).The present disclosure further provides compositions and methods for administering anerowectors (e.g., synthetic anerowectors) as described herein, which can be used, for example, as delivery vehicles for delivery of genetic material, or for delivery of effectors (e.g., payloads), or for delivery of therapeutic agents or therapeutic effectors to eukaryotic cells (e.g., human cells or tissues).

[0004] Anellovectors and components thereof (e.g., produced using the compositions or methods described herein) that can be used in the methods for delivering an effector described herein generally include a genetic element (e.g., a genetic element that includes or encodes an effector, e.g., an exogenous or endogenous effector, e.g., a therapeutic effector) encapsulated in a proteinaceous exterior (e.g., a proteinaceous exterior comprising an Anellovirus capsid protein, e.g., an Anellovirus ORF1 molecule, e.g., an Anellovirus ORF1 protein, or a polypeptide encoded by, e.g., an Anellovirus ORF1 nucleic acid as described herein, or a polypeptide having at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto), which can introduce the genetic element into a cell (e.g., a mammalian cell, e.g., a human cell). The genetic element generally comprises at least one nucleic acid sequence (e.g. a contiguous nucleic acid sequence having a length of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500 or 4000 nucleotides) from a virus other than an Anellovirus (e.g. from an AAV, e.g. AAV1, AAV2 or AAV5), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity thereto.In some embodiments, the non-anellovirus sequence comprises a non-anellovirus origin of replication, e.g., derived from a Monodnavirus, e.g., a Shotokuvirus (e.g., a Cressdnaviricota (e.g., a redondovirus), a circovirus (e.g., a porcine circovirus, e.g., PCV-1 or PCV-2; or a beak and feather disease virus), a geminivirus (e.g., a tomato golden mosaic virus), or a nanovirus (e.g., BBTV, MDV1, SCSVF, or FBNYV)), or a parvovirus (e.g., a dependoparavirus, e.g., a bocavirus or an adeno-associated virus (AAV)). In some embodiments, the non-anelloviral origin of replication is derived from an AAV (e.g., AAV1, AAV2, or AAV5). In some embodiments, the non-anelloviral origin of replication comprises, e.g., an AAV Rep binding motif (RBM) described herein, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the non-anelloviral origin of replication comprises, e.g., an AAV terminal cleavage site (TRS), as described herein, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the non-anelloviral origin of replication is comprised in an inverted terminal repeat (ITR), e.g., an AAV ITR, e.g., as described herein.

[0005] In some embodiments, the anellovector comprises an Anellovirus ORF1 nucleic acid (e.g., an Alphatorquevirus, Betatorquevirus, or Gammatorquevirus ORF1 nucleic acid, e.g., Alphatorquevirus Clade 1, Alphatorquevirus Clade 2, Alphatorquevirus Clade 3, Alphatorquevirus Clade 4, Alphatorquevirus Clade 5, Alphatorquevirus Clade 6, Alphatorquevirus Clade 7, Alphatorquevirus Clade 8, Alphatorquevirus Clade 9, Alphatorquevirus Clade 10, Alphatorquevirus Clade 11, Alphatorquevirus Clade 12, Alphatorquevirus Clade 13, Alphatorquevirus Clade 14, Alphatorquevirus Clade 15, Alphatorquevirus Clade 16, Alphatorquevirus Clade 17, Alphatorquevirus Clade 18, Alphatorquevirus Clade 19, Alphatorquevirus Clade 20, Alphatorquevirus Clade 21, Alphatorquevirus Clade 22, Alphatorquevirus Clade 23, Alphatorquevirus Clade 24, Alphatorquevirus Clade 25, Alphatorquevirus Clade 26, Alphatorquevirus Clade 27, Alphatorquevirus Clade 28, Alphatorquevirus Clade 29, Alphatorquevirus Clade 30, Alphatorquevirus Clade 31, Alphatorquevirus Clade 32, Alphatorquevirus Clade 33, Alphatorquevirus Clade 34, Alphatorquevirus Clade 35, Alphatorquevirus Clade 36, Alphatorquevirus Clade 37, Alphatorquevirus Clade 38, Alphatorquevirus Clade 39, Alphatorquevirus Clade 40, Alphatorquevirus Clade 41, Alphatorquevirus Clade 42, Alphatorquevirus Clade 43, Alphatorquevirus Clade 44, Alphatorquevirus Clade 45, Alphatorquevirus Clade 46, Alphatorquevirus Clade and an infectious vehicle or particle comprising a proteinaceous exterior (e.g., capsid) comprising a polypeptide encoded by ORF1 of Alphatorquevirus Clade 4, Alphatorquevirus Clade 5, Alphatorquevirus Clade 6, or Alphatorquevirus Clade 7 (or a polypeptide having at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto). In embodiments, an anerowector described herein comprises a polypeptide encoded by an Anellovirus ORF1 nucleic acid, e.g., having a sequence set forth in any of Tables A1, B1, B3, C1, E1, F1, F3, or F5, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In embodiments, an anerowector described herein comprises a polypeptide having a sequence of an ORF1 protein, e.g., having a sequence set forth in any of Tables A2, B2, B4, C2, E2, F2, F4, or F6, or a polypeptide with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.In embodiments, an aneurovector described herein is an infectious vehicle or particle that includes, for example, an anellovirus capsid that encapsulates a non-aneurovirus genome. Production of an anellovirus capsid can include, for example, in vitro production or host cell expression of an anellovirus ORF1 molecule, as described herein.

[0006] In some embodiments, the genetic elements of the anerowector of the disclosure are circular and / or single-stranded DNA molecules (e.g., circular and single-stranded). In some embodiments, the genetic elements of the anerowector of the disclosure are linear and / or single-stranded DNA molecules (e.g., linear and single-stranded). In some embodiments, the genetic elements comprise a protein binding sequence that binds to the proteinaceous exterior that confines them, or a polypeptide that binds to it, which may facilitate confinement of the genetic element within the proteinaceous exterior and / or enrichment of the genetic element within the proteinaceous exterior relative to other nucleic acids. In some embodiments, the genetic elements of the anerowector are made using compositions or methods as described herein.

[0007] In some examples, anerowectors that can be used in the methods of delivering an effector described herein include a genetic element that includes or encodes an effector (e.g., a nucleic acid effector, such as a non-coding RNA, or a polypeptide effector, e.g., a protein), e.g., the effector can be expressed in a cell. In some embodiments, the effector is a therapeutic agent or therapeutic effector, e.g., as described herein. In some embodiments, the effector is an endogenous or exogenous effector, e.g., to the wild-type anellovirus or the target cell. In some embodiments, the effector is an exogenous effector to the wild-type anellovirus or the target cell. In some embodiments, the anerowector can deliver an effector into a cell by contacting the cell and introducing a genetic element encoding the effector into the cell, such that the effector is produced or expressed by the cell. In certain cases, the effector is an endogenous effector (e.g., endogenous to the target cell but supplied in increased amounts, e.g., by the aneurovector). In other cases, the effector is an exogenous effector. The effector can, in some cases, modulate a cellular function or modulate the activity or level of a target molecule in a cell. For example, the effector can reduce the level of a target protein in a cell. In another example, the aneurovector can deliver and express an effector, e.g., an exogenous protein, in vivo. An aneurovector can be used, for example, to deliver genetic material to a target cell, tissue, or subject; to deliver an effector to a target cell, tissue, or subject; to modulate a biological response, e.g., a cellular or molecular response; or to treat conditions such as diseases and disorders, e.g., by delivering an effector that can act as a modulator and / or therapeutic agent to a desired cell, tissue, or subject.

[0008] In some embodiments, the compositions and methods described herein can be used to generate, e.g., in a host cell, the genetic elements of a synthetic anaerovector to be used in the methods of administering an anaerovector described herein. A synthetic anaerovector has at least one structural difference compared to a wild-type virus (e.g., a wild-type anellovirus such as those described herein), e.g., a deletion, insertion, substitution, modification (e.g., an enzymatic modification) relative to the wild-type virus. In some embodiments, the structural difference comprises a non-anaeroviral sequence of a genetic element, e.g., as described herein. Generally, a synthetic anaerovector comprises an exogenous genetic element enclosed within a proteinaceous envelope, which contains the genetic element or an effector (e.g., an exogenous effector) encoded therein. In some embodiments, anellovectors can be used to deliver a target molecule (e.g., an endogenous effector or endogenous effector) (e.g., a polypeptide or nucleic acid effector) into a eukaryotic (e.g., human) cell. In some embodiments, anellovectors do not elicit a detectable and / or unwanted immune or inflammatory response, e.g., do not elicit more than a 1%, 5%, 10%, 15% increase in molecular markers of inflammation, e.g., TNF-α, IL-6, IL-12, IFN, and B cell responses, e.g., reactive or neutralizing antibodies; e.g., anellovectors can be substantially non-immunogenic to target cells, tissues, or subjects.

[0009] In some embodiments, the compositions and methods described herein can be used to generate an anerowector that includes (i) a genetic element comprising a promoter element and a sequence encoding an effector (e.g., an endogenous or exogenous effector), and a protein binding sequence (e.g., an exogenous protein binding sequence, e.g., a packaging signal); and (ii) a proteinaceous exterior, e.g., a genetic element of an anerowector that can be used in the methods of delivering an effector described herein; wherein the genetic element is encapsulated within the proteinaceous exterior (e.g., a capsid); and wherein the anerowector is capable of delivering the genetic element into a eukaryotic (e.g., mammalian, e.g., human) cell. In some embodiments, the genetic element is single-stranded and / or circular DNA. Alternatively, or in combination, the genetic element has one, two, three, or all of the following properties: it is circular, it is single-stranded, it integrates into the genome of a cell at a frequency of less than about 0.0001%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the genetic elements that enter the cell, and / or it integrates into the genome of the target cell at less than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 copies per genome. In some embodiments, the integration frequency is determined by quantitative gel purification assay of genomic DNA isolated from the free vector, for example, as described in Wang et al. (2004, Gene Therapy 11:711-721, incorporated herein by reference in its entirety). In some embodiments, the genetic element is encapsulated within a proteinaceous exterior. In some embodiments, the anelovector is capable of delivering genetic elements into eukaryotic cells.In some embodiments, the genetic element comprises a nucleic acid sequence (e.g., a nucleic acid sequence of 300-4000 nucleotides, e.g., 300-3500 nucleotides, 300-3000 nucleotides, 300-2500 nucleotides, 300-2000 nucleotides, 300-1500 nucleotides) having at least 75% (e.g., at least 75, 76, 77, 78, 79, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%) sequence identity to a wild-type Anellovirus sequence (e.g., a wild-type Torque Teno virus (TTV), Torque Teno mini virus (TTMV), or TTMDV sequence, e.g., a wild-type Anellovirus sequence described herein). In some embodiments, the genetic element comprises a nucleic acid sequence (e.g., a nucleic acid sequence of at least 300 nucleotides, 500 nucleotides, 1000 nucleotides, 1500 nucleotides, 2000 nucleotides, 2500 nucleotides, 3000 or more nucleotides) that has at least 75% (e.g., at least 75, 76, 77, 78, 79, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%) sequence identity to a wild-type Anellovirus sequence (e.g., a wild-type Anellovirus sequence described herein). In some embodiments, the nucleic acid sequence is codon-optimized, for example, for expression in mammalian (e.g., human) cells. In some embodiments, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in a nucleic acid sequence are codon-optimized, for example, for expression in mammalian (e.g., human) cells.

[0010] In some embodiments, the compositions and methods described herein can be used to generate genetic elements of infectious (e.g., human cell) anerowectors, vehicles, or particles that include a capsid (e.g., a capsid including an anellovirus ORF, e.g., an ORF1 polypeptide) that encapsulates a genetic element comprising a protein-binding sequence that binds to the capsid and a heterologous (to the anellovirus) sequence encoding a therapeutic effector that can be used in the methods of administering an anerowector described herein. In some embodiments, the anerowector is capable of delivering the genetic element into mammalian, e.g., human, cells. In some embodiments, the genetic element has less than about 6% identity (e.g., less than 10%, 9.5%, 9%, 8%, 7%, 6%, 5.5%, 5%, 4.5%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%) to a wild-type anellovirus genomic sequence. In some embodiments, the genetic element has no more than 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, or 6% identity to the wild-type Anellovirus genomic sequence. In some embodiments, the genetic element has at least about 2% to at least about 5.5% (e.g., 2-5%, 3%-5%, 4%-5%) identity to the wild-type Anellovirus. In some embodiments, the genetic element has more than about 2000, 3000, 4000, 4500, or 5000 nucleotides of non-viral sequence (e.g., non-Anellovirus genomic sequence). In some embodiments, the genetic element has about 2000-5000, 2500-4500, 3000-4500, 2500-4500, 3500, or more than 4000, 4500 (e.g. about 3000-4500) nucleotides of non-viral sequence (e.g. non-anelloviral genomic sequence). In some embodiments, the genetic element is single-stranded, circular DNA.Alternatively, or in combination, the genetic element has one, two or three of the following properties: it is circular, it is single stranded, it integrates into the genome of a cell at a frequency of less than about 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the genetic elements that enter the cell, it integrates into the genome of the target cell at less than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 copies per genome, or it integrates at a frequency of less than about 0.0001%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the genetic elements that enter the cell (e.g. by comparing the frequency of integration into genomic DNA to genetic element sequences from cell lysates). In some embodiments, integration frequency is determined by quantitative gel-purification assay of genomic DNA isolated from free vector, e.g., as described in Wang et al. (2004, Gene Therapy 11:711-721, incorporated herein by reference in its entirety).

[0011] In some embodiments, the anelloviruses or anellovectors administered by the methods described herein can be used as effective delivery vehicles for introducing agents, such as the effectors described herein, into target cells, e.g., target cells of a subject to be treated therapeutically or prophylactically.

[0012] In some embodiments, the compositions and methods described herein can be used to: (i) an arginine-rich region, e.g., a first region comprising a sequence of at least about 40 amino acids, at least 60%, 70%, or 80% of which are basic residues (e.g., arginine, lysine, or a combination thereof); (ii) a second region comprising a jelly-roll domain, e.g., a sequence comprising at least six β-strands; (iii) a third region comprising an N22 domain sequence described herein; (iv) a fourth region comprising the anellovirus ORF1 C-terminal domain (CTD) sequence described herein; a polypeptide (e.g., a synthetic polypeptide, e.g., an ORF1 molecule) comprising (e.g., consecutively): (v) optionally, a polypeptide having an amino acid sequence that has less than 100%, 99%, 98%, 95%, 90%, 85%, 80% sequence identity to a wild-type anellovirus ORF1 protein, e.g., as described herein. Genetic elements of an anellovector that can be used in the administration methods described herein can be made to contain a proteinaceous exterior comprising:

[0013] In one aspect, the invention features an isolated nucleic acid (e.g., a nucleic acid construct) that includes a sequence of a genetic element that includes a promoter element operably linked to a sequence encoding an effector, e.g., a payload, and an exogenous protein binding sequence. In some embodiments, the exogenous protein binding sequence includes a sequence that is at least 75% (at least 80%, 85%, 90%, 95%, 97%, 100%) identical to a 5'UTR sequence of, e.g., an Anellovirus disclosed herein. In embodiments, the genetic element is single-stranded DNA, is circular, integrates at a frequency of less than about 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the genetic elements that enter the cell, and / or integrates into the genome of the target cell at less than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 copies per genome, or integrates at a frequency of less than about 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the genetic elements that enter the cell. In some embodiments, the integration frequency is determined as described in Wang et al. (2004, Gene Therapy 11:711-721, incorporated herein by reference in its entirety). In embodiments, the effector is not derived from TTV and is not SV40-miR-S1. In embodiments, the nucleic acid molecule does not include a polynucleotide sequence of TTMV-LY2. In embodiments, the promoter element can direct expression of the effector in eukaryotic (e.g., mammalian, e.g., human) cells.

[0014] In some embodiments, the nucleic acid molecule is circular. In some embodiments, the nucleic acid molecule is linear. In some embodiments, the nucleic acid molecule described herein comprises one or more modified nucleotides (e.g., base, sugar, or backbone modifications).

[0015] In some embodiments, the nucleic acid molecule comprises a sequence encoding an ORF1 molecule (e.g., an Anellovirus ORF1 protein, e.g., as described herein). In some embodiments, the nucleic acid molecule comprises a sequence encoding an ORF2 molecule (e.g., an Anellovirus ORF2 protein, e.g., as described herein). In some embodiments, the nucleic acid molecule comprises a sequence encoding an ORF3 molecule (e.g., an Anellovirus ORF3 protein, e.g., as described herein). In one aspect, the invention features a genetic element that includes one, two, or three of the following: (i) a promoter element and a sequence encoding an effector, e.g., an exogenous or endogenous effector; (ii) at least 72 contiguous nucleic acids (e.g., at least 72, 73, 74, 75, 76, 77, 78, 79, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%) having sequence identity to a wild-type Anellovirus sequence; or at least 72 contiguous nucleic acids (e.g., at least 72, 73, 74, 75, 76, 77, 78, 79, 80, 90, 100, or 150 nucleotides) having at least 75% (e.g., at least 75, 76, 77, 78, 79, 80, 90, 100, or 150%) sequence identity to a wild-type Anellovirus sequence; or at least 72% (e.g., at least 72, 73, 74, 75, 76, 77, 78, 79, 80, 90, 100, or 150%) having sequence identity to a wild-type Anellovirus sequence. (iii) at least 100 (e.g., at least 300, 500, 1000, 1500) contiguous nucleic acids having sequence identity (at least 3, 74, 75, 76, 77, 78, 79, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%); and (iii) a protein binding sequence, e.g., an exogenous protein binding sequence, wherein the nucleic acid construct is a single-stranded nucleic acid. and the nucleic acid construct is circular and integrates at a frequency of about 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the genetic elements that enter the cell, and / or integrates into the genome of the target cell at less than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 copies per genome. In some embodiments, the genetic element encoding the effector (e.g., exogenous or endogenous effector) is codon-optimized.In some embodiments, the genetic element is circular. In some embodiments, the genetic element is linear. In some embodiments, the genetic elements described herein comprise one or more modified nucleotides (e.g., a base modification, a sugar modification, or a backbone modification). In some embodiments, the genetic element comprises a sequence encoding an ORF1 molecule (e.g., an Anellovirus ORF1 protein, e.g., as described herein). In some embodiments, the genetic element comprises a sequence encoding an ORF2 molecule (e.g., an Anellovirus ORF2 protein, e.g., as described herein). In some embodiments, the genetic element comprises a sequence encoding an ORF3 molecule (e.g., an Anellovirus ORF3 protein, e.g., as described herein).

[0016] In one aspect, the invention features a host cell that includes: (a) one or more nucleic acid molecules that include a sequence encoding one or more of an ORF1, ORF2, or ORF3 molecule (e.g., a sequence encoding an anellovirus ORF1 polypeptide described herein), e.g., the nucleic acid molecule is a plasmid, a viral nucleic acid, or is integrated into a chromosome; and (b) a genetic element that includes: (i) a promoter element operably linked to a nucleic acid sequence (e.g., a DNA sequence) encoding an effector (e.g., an exogenous effector or an endogenous effector), and (ii) a protein binding sequence that binds the ORF1 molecule of (a), wherein the genetic element of (b) does not encode one or more of an ORF1 polypeptide (e.g., an ORF1 protein), an ORF2 polypeptide (e.g., an ORF2 protein), and / or an ORF3 polypeptide (e.g., an ORF3 protein). For example, the host cell includes (a) and (b) in either cis (both portions on the same nucleic acid molecule) or trans (each portion on a different nucleic acid molecule). In embodiments, one or more nucleic acids in (a) may be circular, single-stranded DNA; in other embodiments, one or more nucleic acids in (a) may be linear DNA. In embodiments, the genetic element in (b) is circular, single-stranded DNA. In some embodiments, the host cell is a manufacturing cell line, e.g., as described herein. In some embodiments, the host cell is adherent or in suspension, or both. In some embodiments, the host cell or helper cell is grown in a microcarrier. In some embodiments, the host cell or helper cell complies with cGMP manufacturing practices. In some embodiments, the host cell or helper cell is grown in a medium suitable for promoting cell growth. In certain embodiments, once the host cell or helper cell has grown sufficiently (e.g., to a suitable cell density), the medium may be replaced with a medium suitable for production of the aneurovector by the host cell or helper cell.

[0017] In one aspect, the invention features a pharmaceutical composition including an anelovector (e.g., a synthetic anelovector), e.g., an anelovector that can be administered by the methods described herein. In embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is administered in an amount of about 100 mg / kg of the target subject. 5 ~10 14 (For example, about 10 6 ~10 13 , 10 7 ~10 12 , 10 8 ~10 11 , or 10 9 ~10 10 In some embodiments, the pharmaceutical composition comprising the preparation is stable for an acceptable period of time and temperature and / or is compatible with the desired route of administration and / or any devices required by that route of administration, e.g., needles or syringes. In some embodiments, the pharmaceutical composition is formulated for administration as a single dose or multiple doses. In some embodiments, the pharmaceutical composition is formulated at the site of administration, e.g., by a healthcare professional. In some embodiments, the pharmaceutical composition comprises a desired concentration of anellovector genomes or genome equivalents (e.g., as defined by genomes per volume).

[0018] In one aspect, the invention features a method of treating a disease or disorder in a subject, the method including administering to the subject an anelovector, e.g., a synthetic anelovector, e.g., as described herein.

[0019] In one aspect, the invention features a method of delivering an effector or payload (e.g., an endogenous effector or an exogenous effector) to a cell, tissue, or subject, the method including administering to the subject an anerowector, e.g., a synthetic anerowector as described herein, where the anerowector includes a nucleic acid encoding the effector. In some embodiments, the payload is a nucleic acid. In some embodiments, the payload is a polypeptide.

[0020] In one aspect, the invention features a method of delivering an anerowector to a cell, including contacting an anerowector, e.g., a synthetic anerowector as described herein, with a cell, e.g., a eukaryotic cell, e.g., a mammalian cell, e.g., in vivo or ex vivo.

[0021] In one aspect, the invention features a method of making an anerowector, e.g., a synthetic anerowector, that can be used in the methods of administering an anerowector described herein. The method includes: (a) providing a host cell comprising: (i) a first nucleic acid molecule comprising the nucleic acid sequence of a genetic element of an anaerovector, e.g., as described herein; and (ii) a second nucleic acid molecule encoding an anellovirus ORF1 polypeptide, or one or more of the amino acid sequences selected from ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2, e.g., as described herein, or an amino acid sequence having at least 70% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity thereto; and (b) incubating the host cell under conditions suitable for replication (e.g., rolling circle replication) of the nucleic acid sequence of the genetic element, thereby producing the genetic element; and Optionally, (c) incubating the host cell under conditions suitable for encapsulating the genetic element in a proteinaceous exterior (e.g., comprising a polypeptide encoded by the second nucleic acid molecule). Includes:

[0022] In another aspect, the invention provides a method of producing an anerowector composition, e.g., an anerowector composition that can be used in the administration methods described herein, the composition comprising: (a), (b), and (c): a) providing a host cell that contains, e.g., expresses, one or more components (e.g., all components) of an anaerovector, e.g., a synthetic anaerovector, e.g., as described herein; b) culturing the host cells under conditions suitable for producing a preparation of anaerovectors from the host cells, wherein the anaerovectors of the preparation comprise a proteinaceous exterior (e.g., comprising an anaerovector ORF1 polypeptide) encapsulating genetic elements (e.g., as described herein), thereby creating a preparation of anaerovectors; and Optionally, c) formulating the anellovector preparation, e.g., as a pharmaceutical composition suitable for administration to a subject. The method is characterized by a method including one or more (e.g., all) of:

[0023] For example, the host cell provided in this manufacturing method comprises: (a) a nucleic acid comprising a sequence encoding an anellovirus ORF1 polypeptide described herein, the nucleic acid being a plasmid, a viral nucleic acid or genome, or integrated into a helper cell chromosome; and (b) a nucleic acid construct capable of generating a genetic element (e.g., comprising a genetic element sequence and / or a genetic element region, e.g., as described herein), e.g., where the genetic element comprises (i) a promoter element operably linked to a nucleic acid sequence (e.g., a DNA sequence) encoding an effector (e.g., an exogenous effector or an endogenous effector) and (i) a protein binding sequence (e.g., a packaging sequence) that binds the polypeptide of (a), wherein the host cell comprises (a) and (b) in either cis or trans. In embodiments, the genetic element of (b) is circular, single-stranded DNA. In some embodiments, the host cell is a manufacturing cell line.

[0024] In some embodiments, at the time of production, the anerowector constructs are introduced into a host cell (e.g., by transient transfection). In some embodiments, the host cell stably expresses the anerowector constructs (e.g., where one or more nucleic acids encoding the anerowector constructs are introduced into the host cell, or a progenitor cell thereof, e.g., by stable transfection).

[0025] In one aspect, the invention features a method of producing an anerowector composition, including: a) providing a plurality of anerowectors described herein, or a preparation of anerowectors described herein; and b) formulating the anerowector or preparation thereof, e.g., as a pharmaceutical composition suitable for administration to a subject.

[0026] In one aspect, the invention features a method of generating a population of host cells, e.g., first host cells or producer cells (e.g., such as those depicted in Figure 12 of PCT / US19 / 65995), e.g., a first host cell population comprising an anaerovector, the method including introducing into the host cells a nucleic acid construct (e.g., such as those described herein) capable of producing a genetic element, and culturing the host cells under conditions suitable for production of the anaerovector. In embodiments, the method further includes introducing a helper, e.g., a helper virus, into the host cells. In embodiments, the introducing includes transfection (e.g., chemical transfection) or electroporation of the host cells with the anaerovector.

[0027] In one aspect, the invention features a method of producing an aneurovector, including providing a host cell, e.g., a first host cell or producer cell (e.g., such as that shown in Figure 12 of PCT / US19 / 65995), including an aneurovector, e.g., one described herein, and purifying the aneurovector from the host cell. In some embodiments, the method further includes, prior to the providing step, contacting the host cell with a nucleic acid construct or aneurovector, e.g., one described herein, and incubating the host cell under conditions suitable for production of the aneurovector. In embodiments, the host cell is the first host cell or producer cell described in the above method of producing a host cell. In embodiments, purifying the aneurovector from the host cell includes lysing the host cell.

[0028] In some embodiments, the method further comprises a second step of contacting the anaerovector produced by the first host cell or producer cell with a second host cell, e.g., a permissive cell (e.g., as shown in Figure 12 of PCT / US19 / 65995), e.g., a population of second host cells. In some embodiments, the method further comprises incubating the second host cell under conditions suitable for production of the anaerovector. In some embodiments, the method further comprises purifying the anaerovector from the second host cell, e.g., thereby producing an anaerovector seed population. In embodiments, at least about 2-100 times more anaerovectors are produced from the population of second host cells compared to that from the population of first host cells. In embodiments, purifying the anaerovector from the second host cell comprises lysing the second host cell. In some embodiments, the method further comprises contacting the anaerovector produced by the second host cell with a third host cell, e.g., a permissive cell (e.g., as shown in Figure 12 of PCT / US19 / 65995), e.g., a population of third host cells. In some embodiments, the method further comprises incubating the third host cell under conditions suitable for production of the anaerovector. In some embodiments, the method comprises purifying the anaerovector from the third host cell, e.g., thereby producing an anaerovector stock population. In embodiments, purifying the anaerovector from the third host cell comprises lysing the third host cell. In embodiments, at least about 2-100 times more anaerovectors are produced from the population of third host cells compared to that from the population of second host cells.

[0029] In some embodiments, the host cells are grown in a medium suitable for promoting cell growth. In certain embodiments, once the host cells or helper cells have grown sufficiently (e.g., to a suitable cell density), the medium may be replaced with a medium suitable for production of the aneurovector by the host cells or helper cells. In some embodiments, the aneurovector produced by the host cells is separated from the host cells (e.g., by lysing the host cells) before contacting with a second host cell. In some embodiments, the aneurovector produced by the host cells is contacted with a second host cell without an intervening purification step.

[0030] In one aspect, the invention features a method of making a pharmaceutical anaerovector preparation, e.g., a preparation to be used in an administration method described herein. The method includes: (a) generating the anaerovector preparation as described herein; (b) evaluating the preparation (e.g., a pharmaceutical anaerovector preparation, an anaerovector seed population, or an anaerovector stock population) for one or more pharmaceutical quality control parameters, e.g., identity, purity, titer, potency (e.g., in terms of genome equivalents per anaerovector particle), and / or nucleic acid sequences from genetic elements contained in the anaerovector; and (c) formulating the preparation for pharmaceutical use for evaluation to meet predetermined criteria, e.g., pharmaceutical specifications. In some embodiments, the step of evaluating identity includes evaluating (e.g., confirming) the sequence of a genetic element of the anaerovector, e.g., a sequence encoding an effector. In some embodiments, assessing purity involves assessing the amount of impurities, e.g., mycoplasma, endotoxin, host cell nucleic acid (e.g., host cell DNA and / or host cell RNA), animal-derived impurities (e.g., serum albumin or trypsin), replication-competent agents (RCA), e.g., replication-competent virus or unwanted anaerovector (e.g., an anaerovector other than a desired anaerovector, e.g., a synthetic anaerovector described herein), free viral capsid proteins, adventitious materials, and aggregates. In some embodiments, assessing titer involves assessing the ratio of functional and non-functional (e.g., infectious and non-infectious) anaerovectors in the preparation (e.g., by HPLC, etc.). In some embodiments, assessing potency involves assessing the level of detectable anaerovector function in the preparation (e.g., expression and / or function of an effector encoded therein or genome equivalent).

[0031] In embodiments, the formulated preparation is substantially free of pathogens, host cell contaminants, or impurities; has a predetermined level of non-infectious particles or a predetermined ratio of particles:infectious units (e.g., <300:1, <200:1, <100:1, or <50:1). In some embodiments, multiple anellovectors can be produced in a single batch. In embodiments, the levels of anellovectors produced in a batch can be assessed (e.g., individually or together).

[0032] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a first nucleic acid molecule comprising a nucleic acid construct described herein, and (ii) optionally, a second nucleic acid molecule encoding one or more amino acid sequences selected from, e.g., ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2 described herein, or an amino acid sequence having at least 70% (e.g., at least about 70, 80, 90, 95, 96, 97, 98, 99, or 100%) sequence identity thereto; The present invention features a host cell comprising:

[0033] In one aspect, the invention features a reaction mixture including an anellovector described herein and a helper virus that can be used in the administration methods described herein, where the helper virus includes a polynucleotide encoding an exogenous protein (e.g., an exogenous protein capable of binding to an exogenous protein binding sequence, and optionally, a lipid envelope), a polynucleotide encoding a replication protein (e.g., a polymerase), or any combination thereof.

[0034] In some embodiments, the anaerovector (e.g., a synthetic anaerovector) is isolated, e.g., isolated from a host cell and / or isolated from other components in a solution (e.g., a supernatant). In some embodiments, the anaerovector (e.g., a synthetic anaerovector) is purified, e.g., from a solution (e.g., a supernatant). In some embodiments, the anaerovector is concentrated in a solution relative to other components in the solution.

[0035] In some embodiments of any of the foregoing anaerovectors, compositions, or methods, providing the anaerovector comprises isolating (e.g., harvesting) the anaerovector from a composition comprising an anaerovector-producing cell, such as those described herein. In other embodiments, providing the anaerovector comprises obtaining the anaerovector or a preparation thereof, e.g., from a third party.

[0036] In embodiments the genetic element is incapable of autonomous replication and / or self-amplification, hi embodiments the genetic element is capable of replication and / or amplification in trans, for example in the presence of a helper, for example a helper virus.

[0037] Additional features of any of the anellovectors, compositions or methods described above include one or more of the embodiments listed below.

[0038] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein which equivalents are intended to be encompassed by the embodiments recited below.

[0039] Enumerated Embodiments 1. A viral particle comprising (i) an AAV origin of replication, (ii) a promoter operably linked to a sequence encoding a therapeutic RNA or polypeptide, and (iii) circular DNA comprising a sequence that binds to an anellovirus ORF1 molecule, wherein the circular DNA is encapsidated by a capsid comprising the anellovirus ORF1 molecule.

[0040] 2. A viral particle comprising (i) an AAV origin of replication and (ii) a circular DNA comprising a promoter operably linked to a sequence encoding a therapeutic RNA or polypeptide, wherein the circular DNA is encapsidated by a capsid comprising an anellovirus ORF1 molecule.

[0041] 3. a) a proteinaceous outer layer containing the anellovirus ORF1 molecule; and b) genetic elements containing non-anelloviral origins of replication; A vector comprising: Optionally, the genetic element further comprises (i) a nucleic acid sequence encoding an exogenous effector, and / or (ii) a promoter element operably linked to the nucleic acid sequence encoding the exogenous effector.

[0042] 4. The vector of embodiment 3, wherein the non-anelloviral origin of replication is derived from a DNA virus, e.g., a single-stranded DNA (ssDNA) virus, e.g., a linear ssDNA virus.

[0043] 5. The vector of embodiment 3 or 4, wherein the non-anelloviral origin of replication is derived from a Monodnavirus, such as a Shotokuvirus (e.g., a Cressdnaviricota (e.g., a redondovirus, a circovirus (e.g., a porcine circovirus, such as PCV-1 or PCV-2; or a beak and feather disease virus), a geminivirus (e.g., a tomato golden mosaic virus), or a nanovirus (e.g., BBTV, MDV1, SCSVF, or FBNYV)), or a parvovirus (e.g., a dependoparavirus, such as a bocavirus or AAV).

[0044] 6. The vector of embodiment 5, wherein the non-anelloviral origin of replication is derived from a Monodnavirus, such as a Shotokuvirus, such as a Cossaviricota, such as a Quintoviricetes, such as a Piccovirales, such as a Parvoviridae, such as a Parvovirinae, such as a Dependoparvovirus, such as an adeno-associated virus (AAV).

[0045] 7. The vector of embodiment 5, wherein the non-anelloviral origin of replication is an AAV (e.g., AAV1, AAV2, or AAV5) origin of replication.

[0046] 8. The vector of embodiment 5, wherein the non-anelloviral origin of replication is derived from a virus that replicates by rolling circle replication.

[0047] 9. The vector of embodiment 5, wherein the non-anelloviral origin of replication is derived from a virus that replicates by rolling hairpin replication.

[0048] 10. The vector of embodiment 5, wherein the non-anelloviral origin of replication is derived from a virus that infects an animal (e.g., a mammal, e.g., a human), a plant, a fungus, or a bacterium.

[0049] 11. The vector of any of the preceding embodiments, wherein the non-anelloviral origin of replication comprises an AAV Rep binding motif (RBM), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0050] 12. The vector of any of the preceding embodiments, wherein the non-anelloviral origin of replication comprises an AAV terminal cleavage site (TRS), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0051] 13. The vector of any of the preceding embodiments, wherein the non-anelloviral origin of replication comprises inverted terminal repeats (ITRs).

[0052] 14. The vector of any of the preceding embodiments, wherein the non-anellovirus origin of replication does not comprise an anellovirus origin of replication or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0053] 15. The vector of any of the preceding embodiments, wherein the non-anelloviral origin of replication does not substantially replicate (e.g., is unable to replicate) by rolling circle replication.

[0054] 16. The vector of any of the preceding embodiments, wherein the non-anellovirus origin of replication does not comprise a contiguous sequence of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides derived from an Anellovirus genome (e.g., as described herein).

[0055] 17. a protein binding sequence (e.g., 5'UTR) that specifically binds to anellovirus ORF1 molecules; and For example, the AAV origin of replication contained in the first AAV inverted terminal repeat (ITR); Optionally, a nucleic acid sequence encoding an exogenous effector (e.g., a therapeutic exogenous effector); and Optionally, a promoter element operably linked to a nucleic acid sequence encoding an exogenous effector. A genetic element comprising:

[0056] 18. a protein binding sequence (e.g., 5'UTR) that specifically binds to anellovirus ORF1 molecules; and For example, the AAV origin of replication contained in the first AAV inverted terminal repeat (ITR); Optionally, a nucleic acid sequence encoding an exogenous effector (e.g., a therapeutic exogenous effector); and Optionally, a promoter element operably linked to a nucleic acid sequence encoding an exogenous effector. A genetic element construct comprising:

[0057] 19. a) a first nucleic acid which is a genetic element or genetic element construct, comprising: For example, the AAV origin of replication contained in the first AAV inverted terminal repeat (ITR); Optionally, a nucleic acid sequence encoding an exogenous effector (e.g., a therapeutic exogenous effector); and Optionally, a promoter element operably linked to the nucleic acid sequence encoding the exogenous effector; a first nucleic acid comprising: b) a second nucleic acid encoding an anellovirus ORF1 molecule; and A system including:

[0058] 20. The system of embodiment 19, wherein the first nucleic acid further comprises a protein binding sequence that specifically binds to an anellovirus ORF1 molecule (e.g., a 5'UTR or GC-rich region of an Anellovirus).

[0059] 21. The system of embodiment 19 or 20, further comprising a nucleic acid sequence encoding an anellovirus ORF2 molecule.

[0060] 22. The system of embodiment 21, wherein the nucleic acid sequence encoding the anellovirus ORF2 molecule is located on a third nucleic acid.

[0061] 23. The system of any of embodiments 19-22, further comprising a nucleic acid sequence encoding an AAV Rep2 molecule (e.g., an AAV Rep2 polypeptide, e.g., an AAV Rep2 protein).

[0062] 24. The system of embodiment 23, wherein the nucleic acid sequence encoding the AAV REP2 molecule is located on a fourth nucleic acid.

[0063] 25. The system of any of embodiments 19-24, further comprising one or more nucleic acid sequences encoding one or more (e.g., all) of an adenoviral E2A molecule, an adenoviral E4 molecule, and an adenoviral Varn molecule.

[0064] 26. The system of embodiment 25, wherein the nucleic acid sequences encoding the adenoviral E2A molecule, the adenoviral E4 molecule, and the adenoviral VARN molecule are located on the fifth nucleic acid.

[0065] 27. The system of any of embodiments 19-26, wherein one or more (e.g., all) of the first, second, third, fourth, and fifth nucleic acids are plasmids.

[0066] 28. The system of any of embodiments 19-27, wherein the nucleic acids are mixed or in separate volumes.

[0067] 29. The system of any of embodiments 19-28, wherein the nucleic acid is in a cell, such as a human cell, such as a 293 cell or a MOLT4 cell.

[0068] 30. a) a proteinaceous outer layer containing the anellovirus ORF1 molecule; and b) a genetic element comprising the AAV origin of replication, for example contained in the first AAV inverted terminal repeat (ITR); 1. A DNase protection protein complex comprising: Optionally, the genetic element further comprises: (i) a nucleic acid sequence encoding an exogenous effector, and / or (ii) a promoter element operably linked to the nucleic acid sequence encoding the exogenous effector.

[0069] 31. the genetic element is substantially free of anellovirus sequences; the genetic element does not contain more than 100 nucleotides that are more than 50% identical to any 100 nucleotide sequence of the wild-type anellovirus genome; or The genetic element does not contain the anellovirus 5'UTR The DNase protection protein complex of embodiment 30.

[0070] 32. a) a proteinaceous outer layer containing the anellovirus ORF1 molecule; and b) genetic elements; 1. A DNase protection protein complex comprising: the genetic element is substantially free of anellovirus sequences; the genetic element does not contain more than 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides that are more than 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to any sequence of the same length in a wild-type anellovirus genome; and / or The genetic element does not contain the anellovirus 5'UTR; Optionally, the genetic element further comprises: (i) a nucleic acid sequence encoding an exogenous effector, and / or (ii) a promoter element operably linked to the nucleic acid sequence encoding the exogenous effector.

[0071] 33. The DNase protection protein complex of embodiment 32, wherein the genetic element further comprises (iii) a first ITR, e.g., a first AAV ITR.

[0072] 34. Anellovirus ORF1 molecule, and For example, a nucleic acid comprising an AAV origin of replication, contained in the first AAV inverted terminal repeat (ITR). A mixture comprising:

[0073] 35. Anellovirus ORF1 molecule, and nucleic acids (e.g., genetic elements); A mixture comprising: the nucleic acid is substantially free of anellovirus sequences, the nucleic acid does not contain more than 100 nucleotides that are more than 50% identical to any 100 nucleotide sequence of a wild-type anellovirus genome; or A mixture in which the nucleic acid does not contain an anellovirus 5'UTR.

[0074] 36. The mixture of embodiment 34 or 35, wherein the anellovirus ORF1 molecule is linked to a nucleic acid comprising the first AAV ITR.

[0075] 37. The mixture of any of embodiments 34 to 36, wherein the nucleic acid comprising the first AAV origin of replication is a genetic element, such as a genetic element according to any of the preceding embodiments.

[0076] 38. a genetic element according to any of the preceding embodiments, and Capsid protein bound to a genetic element (e.g., ORF1 molecule) A complex containing

[0077] 39. The mixture or complex of any of embodiments 34 to 38, in a cell-free system or a substantially cell-free composition.

[0078] 40. The conjugate of embodiment 38 or 39, wherein the conjugate is in a cell, such as a host cell, such as a helper cell.

[0079] 41. A cell comprising the genetic element or genetic element construct of any of the preceding embodiments.

[0080] 42. The cell of embodiment 41, which is a human cell, for example a 293 cell, an Expi293 cell, an Expi293F cell, or a MOLT-4 cell.

[0081] 43. A method for delivering an exogenous effector to a target cell (e.g., a vertebrate cell, e.g., a mammalian cell, e.g., a human cell), comprising introducing into the cell a vector of any of the preceding embodiments.

[0082] 44. A method of modulating biological activity in a subject in need thereof, comprising introducing into the subject a vector of any of the preceding embodiments.

[0083] 45. A method of treating or preventing a disease or disorder in a subject in need thereof, the method comprising introducing into the subject a vector of any of the preceding embodiments.

[0084] 46. ​​A method of vaccinating a subject in need thereof, comprising introducing into the subject a vector of any of the preceding embodiments, wherein the exogenous effector comprises an antigen derived from an infectious agent (e.g., a virus or bacterium).

[0085] 47. The method of any of embodiments 43-46, wherein the target cells are human cells, such as 293 cells, Expi293 cells, Expi293F cells, or MOLT-4 cells.

[0086] 48. The method of any of embodiments 43-46, wherein the target cell is a cell derived from an animal (e.g., an agricultural animal, such as a cow, sheep, pig, goat, horse, bison, or camel).

[0087] 49. The method of embodiment 48, wherein the animal is an avian animal (e.g., a turkey, chicken, quail, emu, or ostrich).

[0088] 50. The method of any of embodiments 43-49, wherein the target cell is in vivo or in vitro.

[0089] 51. The method of any of embodiments 43-50, wherein the vector is contacted with the cell in vitro, ex vivo, or in vivo.

[0090] 52. The vector of any of the preceding embodiments, wherein the genetic element is substantially protected from digestion by DNase I.

[0091] 53. The vector of any of the preceding embodiments, wherein when the exogenous effector is replaced with mKate, the vector is capable of delivering mKate to a plurality of target cells (e.g., MOLT4 cells) in vitro such that at least about 10%, 20%, 30%, 40%, 50%, or 60% of cells contacted with the vector have fluorescence above background levels, where background levels are levels that eliminate all but the most fluorescent 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% of cells contacted with an otherwise similar vector lacking ORF1, e.g., in a flow cytometry assay such as that of Example 5.

[0092] 54. The vector of any of the preceding embodiments, wherein when the exogenous effector is replaced with nanoluciferase, the vector is capable of delivering nanoluciferase to a plurality of target cells (e.g., Vero cells or MCF7 cells) in vitro, resulting in a population of cells contacted with the vector that exhibits luminescence that is at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, or 15 times background level, where background level is the luminescence of other similar cells not contacted with the vector, e.g., in the luminescence assay of Example 4 or 8.

[0093] 55. The vector of any of the preceding embodiments, which sediments on a CsCl gradient at a density of about 1.2-1.4 g / ml, e.g., according to Example 5.

[0094] 56. A method of producing a vector, comprising: (a) providing a host cell comprising the genetic element of any of the preceding embodiments; and (b) incubating the host cell under conditions suitable for enclosing the genetic element in a proteinaceous envelope (e.g., a proteinaceous envelope comprising an anellovirus ORF1 molecule); thereby producing a vector.

[0095] 57. A method of producing a vector, comprising: (a) providing a host cell comprising the system of any of the preceding embodiments; and (b) incubating the host cell under conditions suitable for enclosing the genetic element in a proteinaceous envelope (e.g., a proteinaceous envelope comprising an anellovirus ORF1 molecule); thereby producing a vector.

[0096] 58. The method of embodiment 56 or 57, comprising lysis of the host cell.

[0097] 59. The method of any of embodiments 56-58, comprising obtaining the vector from the supernatant of the host cell.

[0098] 60. The method of any of embodiments 56-59, wherein the host cell further comprises one or more additional nucleic acids encoding one or more (e.g., all) of an anellovirus ORF2 molecule, an AAV REP2 molecule, an adenovirus E2A molecule, an adenovirus E4 molecule, and an adenovirus VARNA molecule.

[0099] 61. A method of making a therapeutic composition comprising: (a) (i) AAV origin of replication; (ii) a promoter operably linked to a sequence encoding a therapeutic effector (e.g., a therapeutic RNA or polypeptide); (iii) optionally, a sequence encoding an anellovirus ORF1 molecule; (iv) optionally, a sequence encoding an anellovirus ORF2 molecule; (v) optionally, a sequence encoding a Rep protein (e.g., an AAV Rep protein, e.g., an AAV Rep2 protein), and (vi) optionally, a sequence encoding one or more of the following helper proteins, e.g., adenoviral helper proteins, e.g., an E2A molecule, an adenoviral E4 molecule, and / or an adenoviral VARN molecule; providing one or more host cells comprising exogenous DNA comprising: (b) culturing one or more host cells under conditions suitable for the formation of a vector (e.g., anellovector, e.g., viral particle) comprising a proteinaceous envelope (e.g., capsid) comprising a sufficient number of ORF1 molecules to encapsulate (e.g., encapsidate) a genetic element comprising a promoter operably linked to a sequence encoding a therapeutic effector; (optionally, the genetic element is circular or linear;) (c) concentrating (e.g., purifying) the vector produced in step (b) from the cell culture; thereby producing a therapeutic composition. A method comprising:

[0100] 62. (d) assessing the purified viral particles for one or more impurities selected from endotoxins, mycoplasma, host cell nucleic acids (e.g., host cell DNA and / or host cell RNA), animal-derived process impurities (e.g., serum albumin or trypsin), replication-competent particles, free viral capsid proteins, adventitious contaminating organisms, and aggregates; (e) optionally reducing or removing one or more impurities from the virus particles if detected in step (d); and (f) optionally formulating the purified viral particles for administration to a human, thereby creating a therapeutic composition. 62. The method of embodiment 61, further comprising:

[0101] 63. The method of embodiment 61 or 62, wherein the exogenous DNA of (a)(i) to (vi) is provided in a single host cell.

[0102] 64. The method of any one of embodiments 61-63, wherein the exogenous DNA of (a)(i)-(vi) is provided in a plurality of host cells.

[0103] 65. The method of any one of embodiments 61-64, wherein the exogenous DNAs of (a)(i) and (ii) are provided in one host cell and the exogenous DNAs of (a)(iii)-(vi) are provided in a second host cell.

[0104] 66. The method of any one of embodiments 61-65, wherein the exogenous DNA of (a)(i)-(ii) is not part of a host cell chromosome.

[0105] 67. The method of any one of embodiments 61-66, wherein the exogenous DNA of (a)(i)-(ii) is part of the same nucleic acid, e.g., circular DNA or linear DNA.

[0106] 68. The method of any one of embodiments 61-67, wherein the exogenous DNA of (a)(i)-(ii) is a genetic element according to any of the preceding embodiments.

[0107] 69. The method of any one of embodiments 61-68, wherein one or more of the exogenous DNAs of (a)(iii) are integrated into a host cell chromosome.

[0108] 70. The method of any one of embodiments 61-69, wherein one or more of the exogenous DNAs of any of (a)(iv)-(vi), if present, is integrated into a host cell chromosome.

[0109] 71. The method of any one of embodiments 61-70, wherein one or more of the exogenous DNAs of (a)(iii) is part of a plasmid.

[0110] 72. The method of any one of embodiments 61-71, wherein one or more of the exogenous DNAs of any of (a)(iv)-(vi), if present, is part of a plasmid.

[0111] 73. The method of any one of embodiments 61-72, wherein the host cell is a mammalian cell (e.g., a human cell, e.g., a HEK293 cell).

[0112] 74. The method of any one of embodiments 61-73, wherein the host cell is an immortalized cell.

[0113] 75. A method of making a therapeutic composition comprising: (a) (i) a genetic element comprising an AAV origin of replication and a promoter operably linked to a sequence encoding a therapeutic effector (e.g., a therapeutic RNA or polypeptide); and (ii) multiple ORF1 molecules (e.g., multiple copies of the same ORF1 molecule); To provide a solution comprising: (b) incubating the solution under conditions suitable for the formation of a vector (e.g., anellovector, e.g., a viral particle) comprising a proteinaceous envelope (e.g., capsid) that includes a sufficient number of ORF1 molecules to enclose (e.g., encapsidate) the genetic element; and (c) optionally concentrating, e.g., purifying, the vector produced in step (b) from solution; thereby producing a therapeutic composition. A method comprising:

[0114] 76. Genetic elements (iii) optionally, a sequence encoding an anellovirus ORF1 molecule; (iv) optionally, a sequence encoding an anellovirus ORF2 molecule; (v) optionally, a sequence encoding an AAV REP2 sequence. (vi) optionally, sequences encoding one or more helper proteins, e.g., adenoviral helper proteins, e.g., E2A molecules, adenoviral E4 molecules, and / or adenoviral VARN molecules; 76. The method of embodiment 75, wherein the method is made using

[0115] 77. The method of any one of embodiments 61-76, wherein the vector produced in step (b) is a vector of any of the preceding embodiments.

[0116] 78. A host cell (e.g. a vertebrate cell, e.g. a mammalian cell, e.g. a human cell) comprising a genetic element or genetic element construct of any of the preceding embodiments.

[0117] 79. The host cell of embodiment 78, further comprising an anellovirus ORF1 molecule or a nucleic acid encoding an anellovirus ORF1 molecule.

[0118] 80. The host cell of embodiment 78 or 79, further comprising one or more (e.g., all) of an anellovirus ORF2 molecule, an AAV REP2 molecule, an adenovirus E2A molecule, an adenovirus E4 molecule, and an adenovirus VARNA molecule.

[0119] 81. The host cell of any of embodiments 78-80, further comprising one or more nucleic acids encoding one or more (e.g., all) of an anellovirus ORF2 molecule, an AAV REP2 molecule, an adenovirus E2A molecule, an adenovirus E4 molecule, and an adenovirus VARN molecule.

[0120] 82. A host cell comprising the vector of any of the preceding embodiments.

[0121] 83. A method of making the host cell of any of embodiments 78-82, comprising introducing a genetic element into the cell, e.g., wherein introducing the genetic element comprises introducing a genetic element construct into the cell under conditions that allow production of the genetic element.

[0122] 84. The genetic element, genetic element construct, system, cell, method, or vector of any of the preceding embodiments, wherein the genetic element further comprises a second AAV origin of replication, e.g., comprised in a second AAV inverted terminal repeat (ITR).

[0123] 85. The genetic element, genetic element construct, system, cell, method, or vector of embodiment 84, wherein the second ITR is in a reverse orientation relative to the first ITR.

[0124] 86. The genetic element, genetic element construct, system, cell, method, or vector of embodiment 84, wherein the second ITR has the same orientation relative to the first ITR.

[0125] 87. The genetic element, genetic element construct, system, cell, method, or vector of any of embodiments 84-86, wherein the second ITR has the same sequence as the first ITR.

[0126] 88. The genetic element, genetic element construct, system, cell, method, or vector of any of embodiments 84-86, wherein the second ITR has one or more sequence differences compared to the first ITR.

[0127] 89. The genetic element, genetic element construct, system, cell, method, or vector of any of embodiments 84 to 88, wherein the nucleic acid sequence encoding the exogenous effector is located between the first and second ITRs.

[0128] 90. The genetic element, genetic element construct, system, cell, method, or vector of any of the preceding embodiments, wherein the first AAV ITR comprises the sequence of any of SEQ ID NOs: 1051-1059, or a sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0129] 91. The genetic element, genetic element construct, system, cell, method or vector of any of the preceding embodiments, wherein the genetic element is linear.

[0130] 92. The genetic element, genetic element construct, system, cell, method or vector of any of the preceding embodiments, wherein the genetic element is circular.

[0131] 93. The genetic element, genetic element construct, system, cell, method or vector of any of the preceding embodiments, wherein the genetic element construct is circular.

[0132] 94. The genetic element, genetic element construct, system, cell, method or vector of any of the preceding embodiments, wherein the genetic element construct is linear.

[0133] 95. The genetic element, genetic element construct, system, cell, method or vector of any of the preceding embodiments, wherein the genetic element has a length of about 500 to 1000, 1000 to 1500, 1500 to 2000, 2000 to 2500, 2500 to 3000, 3000 to 3500, 3500 to 4000, 4000 to 4100, 4100 to 4200, 4200 to 4300, 4300 to 4400, 4400 to 4500, 4500 to 4600, 4600 to 4700, 4700 to 4800, 4800 to 4900, 4900 to 5000, 5000 to 5500, 5500 to 6000 or 6000 to 7000 nucleotides.

[0134] 96. The genetic element, genetic element construct, system, cell, method or vector of any of the preceding embodiments, wherein the genetic element has a length of at least 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 5100, 5200, 5300, 5400, 5500 or 6000 nucleotides.

[0135] 97. The genetic element, genetic element construct, system, cell, method, or vector of any of the preceding embodiments, wherein the genetic element comprises DNA.

[0136] 98. The genetic element, genetic element construct, system, cell, method or vector of any of the preceding embodiments, wherein the genetic element consists of DNA.

[0137] 99. The genetic element, genetic element construct, system, cell, method, or vector of any of the preceding embodiments, wherein the genetic element consists of at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% DNA.

[0138] 100. The genetic element, genetic element construct, system, cell, method or vector of any of the preceding embodiments, wherein the genetic element is single-stranded DNA or double-stranded DNA.

[0139] 101. The genetic element, genetic element construct, system, cell, method or vector of any of the preceding embodiments, wherein the genetic element construct is single-stranded DNA or double-stranded DNA.

[0140] 102. The genetic element of any of the preceding embodiments, which is produced using circularized double-stranded DNA, for example, wherein the circularized DNA is produced by in vitro circularization.

[0141] 103. The genetic element, genetic element construct, system, cell, method, or vector of any of the preceding embodiments, wherein the promoter element is endogenous to the anellovirus.

[0142] 104. The genetic element, genetic element construct, system, cell, method, or vector of any of the preceding embodiments, wherein the promoter element is endogenous to the AAV.

[0143] 105. The genetic element, genetic element construct, system, cell, method, or vector of any of the preceding embodiments, wherein the promoter element is exogenous to the anellovirus.

[0144] 106. The genetic element, genetic element construct, system, cell, method, or vector of any of the preceding embodiments, wherein the promoter element is exogenous to the AAV.

[0145] 107. The genetic element construct of any of the preceding embodiments, comprising a backbone region suitable for replication of the genetic element construct, for example replication in a bacterial cell.

[0146] 108. The genetic element construct of any of the preceding embodiments, wherein the backbone region comprises one or both of an origin of replication and a selectable marker.

[0147] 109. The genetic element, genetic element construct, system, cell, method, or vector of any of the preceding embodiments, wherein the genetic element further comprises an anellovirus 5' UTR, an anellovirus GC-rich region, and an anellovirus 3' UTR, or any combination thereof.

[0148] 110. The genetic element, genetic element construct, system, cell, method, or vector of any of the preceding embodiments, wherein the genetic element further comprises an anellovirus 5'UTR of any of Tables A1, B1, B3, C1, E1, F1, F3, or F5.

[0149] 111. The genetic element, genetic element construct, system, cell, method, or vector of any of the preceding embodiments, wherein the genetic element further comprises an anellovirus GC-rich region of any of Tables A1, B1, B3, C1, E1, F1, F3, or F5.

[0150] 112. The genetic element, genetic element construct, system, cell, method, or vector of any of the preceding embodiments, wherein the genetic element further comprises an anellovirus 3'UTR of any of Tables A1, B1, B3, C1, E1, F1, F3, or F5.

[0151] 113. The genetic element, genetic element construct, system, cell, method or vector of any of the preceding embodiments, wherein the nucleic acid sequence encoding the exogenous effector is about 20-50, 50-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, or 900-1,000 nucleotides in length.

[0152] 114. The genetic element, genetic element construct, vector, mixture, complex, method or host cell of any of the preceding embodiments, wherein the effector comprises a miRNA.

[0153] 115. The genetic element, genetic element construct, vector, mixture, complex, method or host cell of any of the preceding embodiments, wherein the effector, e.g. miRNA, targets a host gene, e.g. modulates expression of the gene, e.g. increases or decreases expression of the gene.

[0154] 116. The genetic element, genetic element construct, vector, mixture, complex, method or host cell of any of the preceding embodiments, wherein the effector comprises an miRNA and reduces expression of a host gene.

[0155] 117. The genetic element, nucleic acid construct, CAVector, complex, method, or host cell of any of the preceding embodiments, wherein the effector comprises a nucleic acid sequence of about 20-200, 30-180, 40-160, 50-140, or 60-120 nucleotides in length.

[0156] 118. The genetic element, genetic element construct, vector, mixture, complex, method or host cell of any of the preceding embodiments, wherein the nucleic acid sequence encoding the effector is about 20 to 200, 30 to 180, 40 to 160, 50 to 140, or 60 to 120 nucleotides in length.

[0157] 119. The genetic element, genetic element construct, vector, mixture, complex, method or host cell of any of the preceding embodiments, wherein the sequence encoding the effector has a size of at least about 100 nucleotides.

[0158] 120. The genetic element, genetic element construct, vector, mixture, complex, method or host cell of any of the preceding embodiments, wherein the sequence encoding the effector has a size of from about 100 to about 5000 nucleotides.

[0159] 121. The genetic element, genetic element construct, vector, mixture, complex, method or host cell of any of the preceding embodiments, wherein the sequence encoding the effector has a size of about 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1500, or 1500-2000 nucleotides.

[0160] 122. The genetic element, genetic element construct, vector, mixture, complex, method, or host cell of any of the preceding embodiments, wherein the genetic element is DNA.

[0161] 123. The genetic element, genetic element construct, vector, mixture, complex, method or host cell of any of the preceding embodiments, wherein the vector is replication-deficient.

[0162] 124. (i) the genetic element is substantially free of anellovirus sequences; (ii) the genetic element does not contain more than 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 consecutive nucleotides that are more than 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any sequence of the same length in a wild-type anellovirus genome; and / or (iii) the genetic element does not contain anellovirus 5′UTR; The genetic element, genetic element construct, vector, mixture, complex, method or host cell of any of the preceding embodiments.

[0163] 125. The genetic element, genetic element construct, vector, mixture, complex, method or host cell of any of the preceding embodiments, wherein the vector is a viral particle.

[0164] 126. A pharmaceutical composition comprising the vector of any of the preceding embodiments and a pharmaceutically acceptable carrier and / or excipient.

[0165] Other features, objects, and advantages of the invention will become apparent from the description, the drawings, and from the claims.

[0166] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. [Brief explanation of the drawings]

[0167] [Figure 1] Western blots showing expression of N-terminally 3xFlag-tagged anellovirus ORF1 proteins: Top, Alphatorque virus Ring1 ORF1 (91 kda); Middle, Betatorque virus Ring2 ORF1 (79 kda); Bottom, Gammatorque virus Ring4 ORF1 (82 kda). [Figure 2]This is a series of figures showing replication of an ITR-flanked payload by a Cap-less AAV-Rep expression construct. Southern blots probed for hrGFP and pHelper are shown. Lanes 1-3 contain untransfected control DNA, and lanes 4-6 contain total DNA from cells transfected with different Rep constructs. Arrows indicate the band positions of the pHelper plasmid, pITR-hrGFP plasmid, and replicated ITR-hrGFP DNA. [Figure 3]

[0033] Figure 1 is a series of graphs showing purification of R2 anellovectors containing the nLuc transgene from a CsCl linear gradient. The vectors were quantified by qPCR for the nLuc reporter gene. (A) The vectors were produced by trans expression of both anellovirus ORF1 and ORF2 proteins and particles containing the nLuc transgene. (B) Quantification of the nLuc transgene when anellovirus ORF1 and ORF2 were not expressed in trans. [Figure 4] Figure 1 shows the transduction of non-human primate cells with the R2-nLuc anellovector. Vero cells were seeded at 1e5 cells per well in a 24-well plate. Transduction was performed via the addition of vector at an MOI of 0.4 (based on qPCR titer). Two days later, a luciferase assay was performed. [Figure 5] Figure 1 shows the transduction of human cells with the R2-nLuc anellovector. IGR-OV1 cells were seeded at 1e5 cells per well in a 24-well plate. Transduction was performed via the addition of vector at an MOI of 0.4 (based on qPCR titer). Two days later, luciferase assays were performed. [Figure 6]This is a series of figures showing the generation of anellovirus / AAV vectors and successful transduction in MOLT4 cells. The top panel shows an exemplary workflow for generating Anello / AAV hybrid vectors that vary the mKate payload in Expi-293 cells, transducing the vectors into MOLT4 cells, and subsequently performing flow cytometry analysis for mKate fluorescence. The bottom left panel shows a diagram of an Anello / AAV hybrid vector containing the ORF1 protein capsid encapsulating a genetic element containing the mKate-encoding gene flanked by inverted terminal repeats (ITRs). The bottom right panel shows the results of flow cytometry analysis of MOLT4 cells transduced with vectors generated using the indicated plasmids. [Figure 7] Figure 7A shows a series of diagrams demonstrating that engineered Ring2 anelloviral DNA replicates via the AAV Rep protein. (A) Diagram showing a Ring2 dsDNA genome incorporating the minimal region required for AAV replication, including a Rep binding motif (RBM) and terminal resolution site (TRS). (B) Southern blot showing linearized plasmid and Dpn1 digestion products from DNA samples obtained from Expi-293 cells transfected with the indicated combinations of AAV-Rep plasmid and WT Ring2 genome or Ring2 + RBM / TRS DNA (shown in Figure 7A). [Figure 8]

[0023] Figure 1 is a series of graphs showing the transduction of mammalian cell lines with anellovectors encoding human growth hormone (hGH) as a payload. (A) IGR-OV1 cells were transfected with an AAV Rep vector, a p helper vector, and one of the following: (i) a Ring2 capsid anellovector encoding hGH, (ii) a Ring9 capsid anellovector encoding hGH, (iii) an AAV2 capsid viral vector encoding hGH (positive control), or (iv) a no-capsid negative control. hGH levels were quantified by ELISA on days 0, 2, and 3. (A) Vero cells were transfected with AAV Rep vector, p helper vector, and one of the following: (i) a Ring2 capsid anerovector encoding hGH, (ii) a Ring9 capsid anerovector encoding hGH, (iii) an AAV2 capsid viral vector encoding hGH (positive control), or (iv) a no-capsid negative control. hGH levels were quantified by ELISA on days 0, 2, and 3. [Figure 9] 10 is a graph showing nanoluciferase luminescence in cell lysates from 293F cells transfected with Ring2-AAV ITR-nLuc anellovector produced either in the presence or absence of AAV Rep (+AAV Rep or −AAV Rep, respectively). [Figure 10]

[0023] Figure 6 is a series of diagrams showing schematics of exemplary genetic element constructs that can be used to generate genetic elements for anellovectors as described herein. Each schematic corresponds to the plasmid shown in Table 61 below. Black = Ring2 genomic sequence (e.g., as described herein); green = exogenous effector sequences; blue = AAV origin of replication. DETAILED DESCRIPTION OF THE INVENTION

[0168] The following detailed description of embodiments of the present invention will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the invention, there are shown in the drawings presently illustrated embodiments. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings. This patent or application document contains at least one drawing executed in color. Copies of this patent or patent application publication with the color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.

[0169] definition The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto except as defined in the claims. The terms set forth below should generally be understood in their ordinary meaning unless otherwise indicated.

[0170] When the term "comprising" is used in the present description and claims, it does not exclude other elements. For the purposes of the present invention, the term "consisting of" is considered to be a preferred embodiment of the term "comprising." Hereinafter, when a group is defined as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists only of these embodiments.

[0171] Where an indefinite or definite article is used to indicate a singular noun, e.g., "a", "an" or "the", this includes a plural of that noun, unless specifically stated otherwise.

[0172] The expression "compounds, compositions, products, etc. intended for treatment, regulation, etc." should be understood to refer, by itself, to compounds, compositions, products, etc. suitable for the stated purpose, such as treatment, regulation, etc. The expression "compounds, compositions, products, etc. intended for treatment, regulation, etc." also discloses, as an embodiment, that such compounds, compositions, products, etc. are used for treatment, regulation, etc.

[0173] The phrases "compound, composition, product, etc. for use in," "use of a compound, composition, product, etc. in the manufacture of a medicament, pharmaceutical composition, veterinary composition, diagnostic composition, etc. for," or "compound, composition, product, etc. for use as a medicament" indicate that such compound, composition, product, etc. is intended for use in a method of treatment that can be performed on the human or animal body. They are considered equivalent disclosures of embodiments and claims relating to methods of treatment, etc. Thus, if an embodiment or claim refers to "a compound for use in the treatment of a human or animal suspected of suffering from a disease," this is also considered to be a disclosure of "use of a compound in the manufacture of a medicament for the treatment of a human or animal suspected of suffering from a disease" or "a method of treatment by administering a compound to a human or animal suspected of suffering from a disease." The phrase "compound, composition, product, etc. for treatment, modulation, etc." should be understood to refer, by itself, to a compound, composition, product, etc. that is suitable for the stated purpose of treatment, modulation, etc.

[0174] Hereinafter, when an example of a term, value, number, etc. is given in parentheses, this should be understood to indicate that the example described in parentheses may constitute an embodiment. For example, when it is stated that "in embodiments, a nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 encoding a nucleotide sequence in Table 1 (e.g., nucleotides 571-2613 of the nucleic acid sequence in Table 1)," some embodiments relate to a nucleic acid molecule comprising a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 571-2613 of the nucleic acid sequence in Table 1.

[0175] The term "amplification," as used herein, refers to the duplication of a nucleic acid molecule or a portion thereof to produce one or more additional copies of the nucleic acid molecule or portion thereof (e.g., a genetic element or region of a genetic element). In some embodiments, amplification results in partial duplication of a nucleic acid sequence. In some embodiments, amplification occurs via rolling circle replication.

[0176] As used herein, the term "anellovector" refers to a vehicle comprising a genetic element, e.g., circular DNA, encapsulated within a proteinaceous exterior, e.g., a genetic element that is substantially protected from digestion by DNAse I by the proteinaceous exterior. "Synthetic anellovector," as used herein, generally refers to an anellovector that does not occur in nature, e.g., has a sequence that differs from that of a wild-type virus (e.g., a wild-type anellovirus described herein). In some embodiments, a synthetic anellovector is engineered or recombinant, e.g., comprises a genetic element that includes differences or modifications relative to a wild-type viral genome (e.g., a wild-type anellovirus genome described herein). In some embodiments, encapsulated within a proteinaceous exterior encompasses 100% coverage by the proteinaceous exterior, as well as less than 100% coverage, e.g., 95%, 90%, 85%, 80%, 70%, 60%, 50% or less coverage. For example, gaps or discontinuities (e.g., that render the proteinaceous exterior permeable to water, ions, peptides, or small molecules) may be present in the proteinaceous exterior, so long as the genetic elements are retained within the proteinaceous exterior or protected from digestion by, for example, DNAse I, prior to entry into the host cell. In some embodiments, the anaerovector is purified, e.g., it is separated from its original source, and / or is substantially free (>50%, >60%, >70%, >80%, >90%) of other components. In some embodiments, the anaerovector is capable of introducing genetic elements into target cells (e.g., via infection). In some embodiments, the anaerovector is an infectious synthetic anaerovirus viral particle.

[0177] As used herein, the term "antibody molecule" refers to a protein comprising at least one immunoglobulin variable domain sequence, e.g., an immunoglobulin chain or fragment thereof. The term "antibody molecule" encompasses full-length antibodies and antibody fragments (e.g., scFvs). In some embodiments, an antibody molecule is a multispecific antibody molecule, e.g., an antibody molecule comprises a plurality of immunoglobulin variable domain sequences, where a first immunoglobulin variable domain sequence of the plurality has binding specificity for a first epitope and a second immunoglobulin variable domain sequence of the plurality has binding specificity for a second epitope. In embodiments, a multispecific antibody molecule is a bispecific antibody molecule. Bispecific antibody molecules are generally characterized by a first immunoglobulin variable domain sequence that has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope.

[0178] As used herein, a "nucleic acid that encodes" refers to a nucleic acid sequence that encodes an amino acid sequence, a polynucleotide such as an mRNA, or a functional polynucleotide (e.g., a non-coding RNA such as an siRNA or miRNA).

[0179] As used herein, an "exogenous" substance (e.g., effector, nucleic acid (e.g., RNA), gene, payload, protein) refers to a substance that is not contained in or encoded by a corresponding wild-type virus, e.g., an Anellovirus described herein. In some embodiments, an exogenous substance is not naturally occurring, such as a protein or nucleic acid that has a sequence that is altered (e.g., by insertion, deletion, or substitution) relative to a naturally occurring protein or nucleic acid. In some embodiments, an exogenous substance is not naturally occurring in a host cell. In some embodiments, an exogenous substance is naturally occurring in a host cell but is exogenous to the virus. In some embodiments, an exogenous substance is naturally present in a host cell, but not at a desired level or at a desired time.

[0180] A "heterologous" substance or element (e.g., an effector, nucleic acid sequence, amino acid sequence), when used herein with respect to another substance or element (e.g., an effector, nucleic acid sequence, amino acid sequence), refers to a substance or element that is not naturally present together in, for example, a wild-type virus, e.g., anellovirus. In some embodiments, a heterologous nucleic acid sequence can be present in the same nucleic acid as a naturally occurring nucleic acid sequence (e.g., a sequence that is naturally present in anellovirus). In some embodiments, a heterologous substance or element is exogenous to the anellovirus that is the substrate for other (remaining) elements of the anellovector.

[0181] As used herein, the term "genetic element" refers to a nucleic acid molecule that is or can be enclosed within a proteinaceous exterior (e.g., to protect from DNAse I digestion), for example, to form an anaerovector as described herein. It is understood that the genetic element is produced as naked DNA and, optionally, further assembled into a proteinaceous exterior. It is also understood that the proteinaceous exterior does not necessarily enter the cell, as an anaerovector can insert its genetic element into a cell, whereby the genetic element resides within the cell.

[0182] As used herein, a "genetic element construct" refers to a nucleic acid construct (e.g. a plasmid, bacmid, cosmid or minicircle) that comprises at least one (e.g. two) genetic element sequences, or fragments thereof. In some embodiments, a genetic element construct comprises at least one full-length genetic element sequence. In some embodiments, a genetic element comprises a full-length genetic element sequence and a partial genetic element sequence. In some embodiments, a genetic element comprises two or more partial genetic element sequences (e.g. in 5' to 3' order, a 5' truncated genetic element sequence in tandem with a 3' truncated genetic element sequence, for example as shown in Figure 27C).

[0183] The term "genetic element region," as used herein, refers to a region of a construct that comprises the sequence of a genetic element. In some embodiments, the genetic element region comprises a sequence having sufficient identity to a wild-type anellovirus sequence or a fragment thereof (e.g., a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a wild-type anellovirus sequence or a fragment thereof) to be enclosed by a proteinaceous exterior, thereby forming an anelovvector. In embodiments, the genetic element region comprises, for example, a protein binding sequence as described herein (e.g., a 5' UTR, 3' UTR, and / or a GC-rich region described herein, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto). In some embodiments, the genetic element region is capable of undergoing rolling circle replication. In some embodiments, the genetic element region comprises a Rep protein binding site. In some embodiments, the genetic element comprises a Rep protein substitution site. In some embodiments, a construct comprising a genetic element region is not confined in a proteinaceous exterior, although the genetic element produced from the construct may be confined within a proteinaceous exterior. In some embodiments, a construct comprising a genetic element region further comprises a vector backbone.

[0184] As used herein, the term "inverted terminal repeat" ("ITR") refers to a nucleic acid sequence comprising an origin of replication suitable for replication of a surrounding nucleic acid sequence (or portion thereof) by a viral Rep molecule (e.g., a non-anellovirus Rep molecule, e.g., an AAV Rep protein) or a polypeptide having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. Generally, an ITR (or the viral sequence from which the ITR is derived) comprises a contiguous sequence of nucleotides (e.g., immediately adjacent or separated by about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides) followed by its reverse complement. A copy of the ITR may, in some instances, be included at one or both ends of a single-stranded viral genome (e.g., the genome of a non-anellovirus described herein, e.g., an AAV). The ITR sequence may be capable of forming a hairpin. The ITR may comprise a Rep binding motif (RBM) and / or a terminal resolution site (TRS), e.g., as described herein. In some examples, the ITR sequence is present in a genetic element of an anaerovector, e.g., as described herein. In some examples, the ITR present in a genetic element of an anaerovector may be located at a terminus (e.g., the 5' or 3' end) of the genetic element. In some examples, the ITR present in a genetic element of an anaerovector may not be located at a terminus (e.g., the 5' or 3' end) of the genetic element, e.g., may be flanked at its 5' and 3' ends by nucleic acid sequences (e.g., in a circular genetic element or a linear genetic element).

[0185] As used herein, the term "mutant," when used with respect to a genome (e.g., an anellovirus genome), or a fragment thereof, refers to a sequence that has at least one change relative to the corresponding wild-type anellovirus sequence. In some embodiments, a mutant genome or fragment thereof comprises at least one single nucleotide polymorphism, addition, deletion, or frameshift relative to the corresponding wild-type anellovirus sequence. In some embodiments, a mutant genome or fragment thereof comprises a deletion of at least one anellovirus ORF (e.g., one or more of ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, and / or ORF1 / 2) relative to the corresponding wild-type anellovirus sequence. In some embodiments, the mutant genome or fragment thereof comprises a deletion of an entire anellovirus ORF (e.g., all of ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, and / or ORF1 / 2) relative to the corresponding wild-type anellovirus sequence. In some embodiments, the mutant genome or fragment thereof comprises a deletion of at least one anellovirus non-coding region (e.g., one or more of the 5' UTR, 3' UTR, and / or GC-rich region) relative to the corresponding wild-type anellovirus sequence. In some embodiments, the mutant genome or fragment thereof comprises or encodes an exogenous effector.

[0186] As used herein, the term "non-anellovirus" sequence refers to a sequence derived from a virus not classified in the Anelloviridae family. A non-anellovirus sequence generally: (i) does not contain a nucleic acid sequence identical to the genome, gene, or non-coding functional element (e.g., an origin of replication) of a virus classified in the Anelloviridae family (e.g., an Alphatorque virus, a Betatorque virus, or a Gammatorque virus, as described herein); and / or does not encode one or more proteins (e.g., a capsid protein or a Rep protein) from a virus not classified in the Anelloviridae family. In some examples, the non-anellovirus sequence has 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, or 90% or less sequence identity to the genome, gene, or non-coding functional element (e.g., origin of replication) of any virus classified in the Anelloviridae family (e.g., Alphatorque virus, Betatorque virus, or Gammatorque virus, as described herein). In some embodiments, the non-anellovirus sequence is a wild-type sequence derived from a virus not classified in the Anelloviridae family. In other embodiments, the non-anellovirus sequence derived from a virus not classified in the Anelloviridae family contains one or more non-naturally occurring mutations derived from the genome of the virus. In some examples, the non-anellovirus sequence is derived from a virus that infects a non-human organism (e.g., a non-human primate, a non-human mammal, or a bird). In some examples, the non-anellovirus sequence is derived from a virus that infects humans.In some examples, the non-anellovirus sequence is derived from a virus selected from the group consisting of a Monodnavirus, e.g., a Shotokuvirus (e.g., a Cressdnaviricota (e.g., a redondovirus), a circovirus (e.g., a porcine circovirus, e.g., PCV-1 or PCV-2; or a beak and feather disease virus), a geminivirus (e.g., a tomato golden mosaic virus), or a nanovirus (e.g., BBTV, MDV1, SCSVF, or FBNYV)), and a parvovirus (e.g., a dependoparavirus, e.g., a bocavirus or AAV).

[0187] "ORF molecule" refers to a polypeptide having an activity and / or structural characteristics of an anellovirus ORF protein (e.g., anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, and / or ORF1 / 2 protein), or a functional fragment thereof. As used generally (i.e., "ORF molecule"), a polypeptide can include an activity and / or structural characteristics of any of the anellovirus ORFs described herein (e.g., anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, and / or ORF1 / 2), or a functional fragment thereof. When used with a modifier to indicate a particular open reading frame (e.g., "ORF1 molecule," "ORF2 molecule," "ORF2 / 2 molecule," "ORF2 / 3 molecule," "ORF1 / 1 molecule," or "ORF1 / 2 molecule"), it generally means that the polypeptide comprises an activity and / or structural characteristic of the corresponding anellovirus ORF protein, or a functional fragment thereof (e.g., as defined below for "ORF1 molecule"). For example, an "ORF2 molecule" comprises an activity and / or structural characteristic of an anellovirus ORF2 protein, or a functional fragment thereof.

[0188] As used herein, the term "ORF1 molecule" refers to a polypeptide having activity and / or structural characteristics of an anellovirus ORF1 protein (e.g., an anellovirus ORF1 protein described herein), or a functional fragment thereof. An ORF1 molecule, in some cases, includes one or more (e.g., 1, 2, 3, or 4) of the following: a first region comprising at least 60% basic residues (e.g., at least 60% arginine residues), a second region comprising at least about six beta strands (e.g., at least 4, 5, 6, 7, 8, 9, 10, 11, or 12 beta strands), a third region comprising the structure or activity of an anellovirus N22 domain (e.g., as described herein, e.g., an N22 domain from an anellovirus ORF1 protein described herein), and / or a fourth region comprising the structure or activity of an anellovirus C-terminal domain (CTD) (e.g., as described herein, e.g., a CTD from an anellovirus ORF1 protein described herein). In some cases, the ORF1 molecule comprises, from N-terminus to C-terminus, the first, second, third, and fourth regions. In some cases, the anelovvector comprises an ORF1 molecule comprising, from N-terminus to C-terminus, the first, second, third, and fourth regions. The ORF1 molecule may, in some cases, comprise a polypeptide encoded by an anellovirus ORF1 nucleic acid. The ORF1 molecule may, in some cases, further comprise a heterologous sequence, e.g., a hypervariable region (HVR), e.g., an HVR from an anellovirus ORF1 protein described herein. "Anellovirus ORF1 protein," as used herein, refers to an ORF1 protein encoded by an anellovirus genome (e.g., a wild-type anellovirus genome, e.g., as described herein).

[0189] As used herein, "ORF2 molecule" refers to a polypeptide having an activity and / or structural characteristics of an anellovirus ORF2 protein (e.g., an anellovirus ORF2 protein described herein), or a functional fragment thereof. As used herein, "anellovirus ORF2 protein" refers to an ORF2 protein having an amino acid sequence encoded by an ORF2 protein encoded by an anellovirus genome (e.g., a wild-type anellovirus genome described herein).

[0190] As used herein, "origin of replication" refers to a nucleic acid sequence comprising a sequence that promotes DNA replication in the presence of a Rep molecule (e.g., a viral Rep protein, e.g., as described herein, e.g., a non-anellovirus Rep protein, e.g., an AAV Rep protein). In some examples, an origin of replication located within a nucleic acid molecule (e.g., a genetic element described herein) promotes replication of the genetic element, or a portion thereof, in the presence of a Rep molecule to a greater extent than an otherwise similar nucleic acid molecule lacking an origin of replication. In some examples, the origin of replication is comprised in an inverted terminal repeat (ITR) sequence of, e.g., a non-anellovirus genome, e.g., an AAV genome, e.g., as described herein. In some examples, the origin of replication comprises one or both of a Rep binding motif (RBM) and / or a terminal resolution site (TRS), e.g., from a non-anellovirus (e.g., AAV), e.g., as described herein. In other examples, the origin of replication comprises an anellovirus origin of replication. As used herein, "AAV origin of replication" refers to a nucleic acid sequence comprising a sequence that promotes DNA replication in the presence of an AAV Rep molecule (e.g., an AAV Rep protein). In some examples, the AAV origin of replication is recognized and bound by an AAV Rep molecule (e.g., an AAV Rep protein). In some examples, the AAV origin of replication comprises a terminal resolution site (TRS) (e.g., an AAV TRS as described herein) and / or a Rep binding motif (RBM) (e.g., an AAV RBM as described herein). In some embodiments, the AAV origin of replication is located in an AAV ITR.

[0191] As used herein, the term "proteinaceous exterior" refers to exterior components that are primarily (e.g., >50%, >60%, >70%, >80%, >90%, >95%, >96%, >97%, >98%, or >99%) protein.

[0192] As used herein, the term "regulatory nucleic acid" refers to a nucleic acid sequence that modifies the expression, e.g., transcription and / or translation, of a DNA sequence that encodes an expression product. In embodiments, the expression product comprises RNA or a protein.

[0193] As used herein, the term "regulatory sequence" refers to a nucleic acid sequence that modulates the transcription of a target gene product. In some embodiments, a regulatory sequence is a promoter or an enhancer.

[0194] As used herein, the term "Rep molecule" refers to a protein, e.g., a viral protein, that promotes viral genome replication. In some embodiments, the Rep molecule is a non-anellovirus Rep protein (e.g., an AAV Rep protein), e.g., as described herein. In some embodiments, the Rep molecule is an anellovirus Rep molecule, e.g., an anellovirus ORF2 molecule, as described herein. "AAV Rep molecule," as used herein, generally refers to a protein that has the functionality of a wild-type AAV Rep protein, e.g., the ability to bind to an AAV RBM (e.g., a wild-type AAV RBM as described herein, or an RBM having an RBM consensus sequence as described herein), and induces replication of a nucleic acid molecule that includes an AAV RBM.

[0195] As used herein, the term "Rep binding motif" ("RBM") refers to a nucleic acid sequence derived from a viral genome (e.g., a non-anellovirus genome, e.g., an AAV genome), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto, which binds to a Rep molecule. Generally, an RBM has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an RBM sequence described herein (e.g., an AAV RBM sequence described herein). In some examples, an RBM is included within a genetic element, e.g., an origin of replication, of an aneurovector. In some cases, the RBM is located within about 1, 2, 3, 4, 5, 10, 15, 20, 25, or 30 nucleotides of a terminal resolution site (TRS), for example, as described herein. In some cases, the RBM is located about 13 nucleotides from the TRS. In some cases, the RBM is located 3' to the TRS. In some cases, the RBM recruits Rep molecules to the origin of replication.

[0196] As used herein, a "substantially non-pathogenic" organism, particle, or construct refers to, for example, an organism, particle (e.g., a virus or anellovector described herein), or construct thereof, that does not induce or cause an intolerable disease or pathology in a host organism, e.g., a mammal, e.g., a human. In some embodiments, administration of an anellovector to a subject may result in some reactions or side effects that are acceptable as part of standard treatment.

[0197] As used herein, "non-pathogenic" refers to an organism or component thereof that does not induce or induce an intolerable disease or pathology in a host organism, e.g., a mammal, e.g., a human.

[0198] As used herein, "substantially non-integrating" genetic elements refers to genetic elements, e.g., genetic elements within a virus or anellovector (e.g., those described herein), where less than about 0.01%, 0.05%, 0.1%, 0.5%, or 1% of the genetic elements that enter a host cell (e.g., a eukaryotic cell) or organism (e.g., a mammal, e.g., a human), are integrated into the genome. In some embodiments, the genetic elements are not detectably integrated into, for example, the genome of the host cell. In some embodiments, integration of the genetic elements into the genome can be detected using techniques described herein, e.g., nucleic acid sequencing, PCR detection, and / or nucleic acid hybridization. In some embodiments, integration frequency is determined by quantitative gel purification assay of genomic DNA isolated from the free vector, e.g., as described in Wang et al. (2004, Gene Therapy 11:711-721, incorporated herein by reference in its entirety).

[0199] As used herein, a "substantially non-immunogenic" organism, particle, or construct refers to an organism, particle (e.g., a virus or anellovector described herein, for example), or construct thereof, that does not elicit or induce an unwanted or non-targeted immune response in a host tissue or organism (e.g., a mammal, e.g., a human). In embodiments, a substantially non-immunogenic organism, particle, or construct does not generate a clinically significant immune response. In embodiments, a substantially non-immunogenic anellovector does not generate a clinically significant immune response against a protein comprising an amino acid sequence encoded by a nucleic acid sequence of an anellovirus or anellovector genetic element. In embodiments, an immune response (e.g., an unwanted or non-targeted immune response) is determined by assaying the presence or level of antibodies (e.g., neutralizing antibodies) in a subject (e.g., the presence or level of anti-anerovector antibodies, e.g., the presence or level of antibodies to an anerovector described herein), for example, according to the anti-TTV antibody detection method described in Tsuda et al. (1999; J. Virol. Methods 77:199-206; incorporated herein by reference) and / or the method for measuring anti-TTV IgG levels described in Kakkola et al. (2008; Virology 382:182-189; incorporated herein by reference). Antibodies (e.g., neutralizing antibodies) to anellovirus or anellovectors based thereon can also be detected by methods known in the art for detecting anti-viral antibodies, such as the method for detecting anti-AAV antibodies described in Calcedo et al. (2013; Front. Immunol. 4(341):1-7; incorporated herein by reference).

[0200] As used herein, a "subsequence" refers to a nucleic acid sequence or amino acid sequence contained within a larger nucleic acid sequence or amino acid sequence, respectively. In some cases, a subsequence may comprise a domain or functional fragment of the larger sequence. In some cases, a subsequence may comprise a fragment of the larger sequence that, when isolated from the larger sequence, is capable of forming a secondary and / or tertiary structure similar to the secondary and / or tertiary structure formed by the subsequence when present with the remainder of the larger sequence. In some cases, a subsequence can be replaced with another sequence (e.g., a subsequence that comprises a foreign or heterologous sequence relative to the remainder of the larger sequence, e.g., a corresponding subsequence from a different Anellovirus).

[0201] As used herein, the term "terminal cleavage site" ("TRS") refers to a nucleic acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a TRS sequence in a viral genome (e.g., an AAV TRS sequence as described herein), e.g., as described herein. In some examples, the TRS is cleaved by a Rep molecule (e.g., via the endonuclease activity of the rep molecule). In some examples, cleavage of the TRS by the Rep molecule generates a 3' hydroxyl end for replication of a nucleic acid molecule comprising the TRS. In some examples, the TRS is included in an origin of replication, e.g., within a genetic element of an anelovector. In some examples, the TRS is located within about 1, 2, 3, 4, 5, 10, 15, 20, 25, or 30 nucleotides of a Rep binding motif (RBM), e.g., as described herein. In some cases, the TRS is located about 13 nucleotides from the RBM. In some cases, the TRS is located 5' to the RBM.

[0202] As used herein, "treatment," "treating," and cognates refer to the medical management of a subject with the intent to ameliorate, improve, stabilize, prevent, or cure a disease, pathological condition, or disorder. This term includes active treatment (treatment directed at ameliorating the disease, pathological condition, or disorder), causal treatment (treatment directed at the cause of the associated disease, pathological condition, or disorder), palliative treatment (treatment designed to relieve symptoms), prophylactic treatment (treatment directed at preventing, minimizing, or partially or completely preventing the occurrence of the associated disease, pathological condition, or disorder); and supportive treatment (treatment used to complement another treatment).

[0203] The present invention generally relates to anaerovectors, e.g., synthetic anaerovectors, methods of administering anaerovectors, and uses thereof. The present disclosure provides anaerovectors, compositions comprising anaerovectors, and methods of making or using anaerovectors. Anaerovectors are generally useful, for example, as delivery vehicles for delivering therapeutic agents to eukaryotic cells. Generally, anaerovectors can contain genetic elements comprising nucleic acid sequences (e.g., encoding effectors, e.g., exogenous or endogenous effectors) encapsulated in a proteinaceous envelope. Anaerovectors may also contain one or more deletions of sequences (e.g., regions or domains described herein) compared to anellovirus sequences (e.g., as described herein). Anaerovectors can be used as substantially non-immunogenic vehicles for delivering genetic elements or effectors encoded therein (e.g., polypeptide or nucleic acid effectors, e.g., as described herein) to eukaryotic cells, for example, to treat a disease or disorder in a subject containing the cells.

[0204] table of contents I. Compositions and methods for generating anellovectors A. Components and Assembly of Anellovectors i. ORF1 molecule for assembly of anellovector ii. ORF2 molecule for assembly of the anellovector. iii. Production of protein components. B. Genetic Element Constructs i. Non-anellovirus sequences (e.g., AAV sequences) ii. Plasmids iii. Circular nucleic acid construct iv. In vitro cyclization v. Tandem constructs vi. cis / trans constructs vii. expression cassettes viii. Design and construction of genetic element constructs C. Effector D. host cell i. Introduction of genetic elements into host cells ii. Methods for providing proteins in cis or trans. iii. Helpers, e.g., non-anelloviral helpers iv. Exemplary Cell Types E.Culture conditions F. Recovery G. In Vitro Assembly Method H. Concentration and Purification II. Anaerovector A. anellovirus B.ORF1 molecule C.ORF2 molecule D. Genetic Elements, E.g., Genetic Elements Comprising Non-Anellovirus Sequences E. Protein Binding Sequence F.5'UTR region G.GC-rich region H. Effector I. Control Sequences J. Replication Proteins K. Other sequences L. Proteinaceous external III. Nucleic acid constructs IV. Composition V. How to use VI. Administration / Delivery

[0205] I. Compositions and methods for generating anellovectors The present disclosure provides, in some aspects, anerowectors and methods thereof for delivering effectors. In some embodiments, anerowectors or components thereof can be generated as described below. In some embodiments, the compositions and methods described herein can be used to generate genetic elements or genetic element constructs. In some embodiments, the compositions and methods described herein can be used to generate one or more anellovirus ORF molecules (e.g., ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2 molecules, or functional fragments or splice variants thereof). In some embodiments, the compositions and methods described herein can be used to generate a proteinaceous exterior or component thereof (e.g., an ORF1 molecule), for example, in a host cell. In some embodiments, anerowectors or components thereof can be generated using tandem constructs, for example, as described in U.S. Provisional Patent Application No. 63 / 038,483, which is incorporated herein by reference in its entirety. In some embodiments, anellovectors or components thereof can be generated using a bacmid / insect cell system, for example, as described in U.S. Provisional Patent Application No. 63 / 038,603, which is incorporated herein by reference in its entirety.

[0206] Without wishing to be bound by theory, rolling circle amplification may occur through binding of Rep protein to a Rep binding site (e.g., comprising a hairpin loop and / or origin of replication, e.g., including a 5' UTR, e.g., as described herein) located 5' to (or within the 5' region of) the genetic element region. As the Rep protein then processes through the genetic element region, synthesis of the genetic element may occur. The genetic element may then be circularized and then encapsulated within a proteinaceous exterior to form the anelovector.

[0207] Construction and assembly of anellovectors The compositions and methods herein can be used to produce anerowectors. As described herein, anerowectors generally comprise genetic elements (e.g., single-stranded, circular DNA molecules comprising a 5' UTR region as described herein) enclosed within a proteinaceous envelope (e.g., comprising a polypeptide encoded by, e.g., an anellovirus ORF1 nucleic acid, as described herein). In some embodiments, the genetic elements comprise one or more sequences encoding an anellovirus ORF (e.g., one or more of anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2). As used herein, an Anellovirus ORF or ORF molecule (e.g., Anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2) comprises a polypeptide comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a corresponding Anellovirus ORF sequence, such as those described in PCT / US2018 / 037379 or PCT / US19 / 65995 (each of which is incorporated by reference in its entirety). In embodiments, a genetic element comprises a sequence encoding Anellovirus ORF1, or a splice variant or functional fragment thereof (e.g., a jellyroll region, e.g., as described herein). In some embodiments, the proteinaceous exterior comprises a polypeptide encoded by an Anellovirus ORF1 nucleic acid (eg, an Anellovirus ORF1 molecule or a splice variant or functional fragment thereof).

[0208] In some embodiments, an anelovector is assembled by encapsulating genetic elements (e.g., as described herein) within a proteinaceous envelope (e.g., as described herein). In some embodiments, the genetic elements are encapsulated within a proteinaceous envelope in a host cell (e.g., as described herein). In some embodiments, the host cell expresses one or more polypeptides (e.g., polypeptides encoded by an anellovirus ORF1 nucleic acid, e.g., an ORF1 molecule) included in the proteinaceous envelope. For example, in some embodiments, the host cell comprises a nucleic acid sequence encoding an anellovirus ORF1 molecule, e.g., a splice variant or functional fragment of an anellovirus ORF1 polypeptide (e.g., a wild-type anellovirus ORF1 protein or polypeptide encoded by a wild-type anellovirus ORF1 nucleic acid, e.g., as described herein). In embodiments, the nucleic acid sequence encoding the Anellovirus ORF1 molecule is contained in a nucleic acid construct (e.g., a plasmid, viral vector, virus, minicircle, bacmid, or artificial chromosome) contained in a host cell. In embodiments, the nucleic acid sequence encoding the Anellovirus ORF1 molecule is integrated into the genome of the host cell.

[0209] In some embodiments, the host cell comprises a nucleic acid construct comprising a genetic element and / or a sequence of a genetic element. In some embodiments, the nucleic acid construct is selected from a plasmid, a viral nucleic acid, a minicircle, a bacmid, or an artificial chromosome. In some embodiments, the genetic element is excised from the nucleic acid construct and optionally converted from double-stranded to single-stranded form (e.g., by denaturation). In some embodiments, the genetic element is generated by a polymerase based on a template sequence in the nucleic acid construct. In some embodiments, the polymerase creates a single-stranded copy of the genetic element sequence, which can optionally be circularized to form the genetic element described herein. In other embodiments, the nucleic acid construct is a double-stranded minicircle made by in vitro circularization of the nucleic acid sequence of the genetic element. In embodiments, the in vitro circularized (IVC) minicircle is introduced into a host cell, where it is converted into a single-stranded genetic element suitable for encapsulation in a proteinaceous exosporium as described herein.

[0210] For example, ORF1 molecule for assembly of aneurovector An anelovector can be generated, for example, by encapsulating genetic elements within a proteinaceous envelope. The proteinaceous envelope of an anelovector generally comprises a polypeptide encoded by an anellovirus ORF1 nucleic acid (e.g., an anellovirus ORF1 molecule or a splice variant or functional fragment thereof, e.g., as described herein). The ORF1 molecule, in some embodiments, may comprise one or more of the following: a first region comprising an arginine-rich region, e.g., a region having at least 60% basic residues (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% basic residues; e.g., 60%-90%, 60%-80%, 70%-90%, or 70-80% basic residues); and a second region comprising a jellyroll domain, e.g., at least six β-strands (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12 β-strands). In embodiments, the proteinaceous exterior comprises one or more (e.g., 1, 2, 3, 4, or all 5) of the Anellovirus ORF1 arginine-rich region, jellyroll region, N22 domain, hypervariable region, and / or C-terminal domain. In some embodiments, the proteinaceous outer layer comprises an Anellovirus ORF1 jellyroll region (e.g., as described herein). In some embodiments, the proteinaceous outer layer comprises an Anellovirus ORF1 arginine-rich region (e.g., as described herein). In some embodiments, the proteinaceous outer layer comprises an Anellovirus ORF1 N22 domain (e.g., as described herein). In some embodiments, the proteinaceous outer layer comprises an Anellovirus hypervariable region (e.g., as described herein). In some embodiments, the proteinaceous outer layer comprises an Anellovirus ORF1 C-terminal domain (e.g., as described herein).

[0211] In some embodiments, the anelovector comprises an ORF1 molecule and / or a nucleic acid encoding the ORF1 molecule. Generally, the ORF1 molecule comprises a polypeptide having structural features and / or activity of an anellovirus ORF1 protein (e.g., an anellovirus ORF1 protein described herein), or a functional fragment thereof. In some embodiments, the ORF1 molecule comprises a truncation relative to an anellovirus ORF1 protein (e.g., an anellovirus ORF1 protein described herein). In some embodiments, the ORF1 molecule is truncated by at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, or 700 amino acids of an anellovirus ORF1 protein. In some embodiments, the ORF1 molecule comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to, for example, an Alphatorquevirus, Betatorquevirus, or Gammatorquevirus ORF1 protein, as described herein. ORF1 molecules are generally capable of binding to nucleic acid molecules such as DNA (e.g., genetic elements, e.g., as described herein). In some embodiments, the ORF1 molecule is localized to the nucleus of a cell. In certain embodiments, the ORF1 molecule is localized to the nucleolus.

[0212] Without wishing to be bound by theory, an ORF1 molecule may be capable of binding to other ORF1 molecules, for example, to form a proteinaceous exoskeleton (e.g., as described herein). Such ORF1 molecules may be described as having the ability to form an encapsid. In some embodiments, the proteinaceous exoskeleton may encapsulate a nucleic acid molecule (e.g., a genetic element as described herein, e.g., one produced using a composition or construct as described herein). In some embodiments, multiple ORF1 molecules may form multimers, e.g., thereby producing a proteinaceous exoskeleton. In some embodiments, the multimer may be a homomultimer. In other embodiments, the multimer may be a heteromultimer.

[0213] In some embodiments, a first plurality of anerowectors comprising ORF1 molecules as described herein is administered to a subject. In some embodiments, subsequently, after administration of the first plurality, a second plurality of anerowectors comprising ORF1 molecules as described herein is administered to a subject. In some embodiments, the second plurality of anerowectors comprises ORF1 molecules having the same amino acid sequence as ORF1 molecules comprised in the anerowectors in the first plurality. In some embodiments, the second plurality of anerowectors comprises ORF1 molecules having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to ORF1 molecules comprised in the anerowectors in the first plurality.

[0214] For example, ORF2 molecules for assembly of aneurovectors Producing an anerowector using the compositions or methods described herein can involve expression of an anellovirus ORF2 molecule (e.g., as described herein), or a splice variant or functional fragment thereof. In some embodiments, the anerowector comprises an ORF2 molecule, or a splice variant or functional fragment thereof, and / or a nucleic acid encoding the ORF2 molecule, or a splice variant or functional fragment thereof. In some embodiments, the anerowector does not comprise an ORF2 molecule, or a splice variant or functional fragment thereof, and / or a nucleic acid encoding the ORF2 molecule, or a splice variant or functional fragment thereof. In some embodiments, producing an anerowector involves expression of an ORF2 molecule, or a splice variant or functional fragment thereof, but the ORF2 molecule is not incorporated into the anerowector.

[0215] Protein ingredient manufacturing Protein components of an anerowector, e.g., ORF1, can be produced in a variety of ways, for example, as described herein. In some embodiments, for example, protein components of an anerowector comprising a proteinaceous exterior are produced in the same host cell that packages the genetic elements into the proteinaceous exterior, thereby producing the anerowector. In some embodiments, for example, protein components of an anerowector comprising a proteinaceous exterior are produced in a cell that does not contain the genetic elements and / or genetic element constructs (e.g., as described herein).

[0216] Baculovirus Expression System Viral expression systems, such as baculovirus expression systems, can be used to express proteins (e.g., for the production of anellovectors), for example, as described herein. Baculoviruses are rod-shaped viruses with a circular, supercoiled, double-stranded DNA genome. The baculovirus genus includes: alphabaculoviruses (nucleopolyhedroviruses (NPVs) isolated from Lepidoptera), betabaculoviruses (granuloviruses (GVs) isolated from Lepidoptera), gammabaculoviruses (NPVs isolated from Hymenoptera), and deltabaculoviruses (NPVs isolated from Diptera). GVs typically contain only one nucleocapsid per envelope, while NPVs typically contain either a single (SNPV) or multiple (MNPV) nucleocapsids per envelope. Enveloped virions are further occluded in the granule matrix in GVs and polyhedrin in NPVs. Baculoviruses typically have both lytic and occluded life cycles. In some embodiments, the lytic and occluded life cycles occur independently throughout the three phases of viral replication: early, late, and very late. In some embodiments, during the early phase, viral DNA replication occurs after viral entry into the host cell, early viral gene expression, and shutoff of the host gene expression machinery. In some embodiments, late genes encoding viral DNA replication are expressed during the late phase, viral particles are assembled, and extracellular virus (EV) is produced by the host cell. In some embodiments, during the very late phase, polyhedrin and p10 genes are expressed, occluded virus (OV) is produced by the host cell, and the host cell is lysed. Because baculoviruses infect insect species, they can be used as biological agents to produce exogenous proteins in baculovirus-permissive insect cells or larvae.Different isolates of baculoviruses, such as Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) and Bombyx mori (silkworm) nuclear polyhedrosis virus (BmNPV), can be used for exogenous protein expression. Various baculovirus expression systems are commercially available, for example, from ThermoFisher.

[0217] In some embodiments, a protein described herein (e.g., an anellovirus ORF molecule, e.g., ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2, or a functional fragment or splice variant thereof) can be expressed using a baculovirus expression vector (e.g., a bacmid) comprising one or more components described herein. For example, a baculovirus expression vector can comprise one or more (e.g., all) of a selectable marker (e.g., kanR), an origin of replication (e.g., one or both of a bacterial origin of replication and an insect cell origin of replication), a recombinase recognition site (e.g., an att site), and a promoter. In some embodiments, a baculovirus expression vector (e.g., a bacmid as described herein) can be produced by replacing the native wild-type polyhedrin gene encoding the baculovirus occlusion body with a gene encoding a protein described herein. In some embodiments, genes encoding proteins described herein are cloned into a baculovirus expression vector (e.g., a bacmid described herein) comprising a baculovirus promoter. In some embodiments, the baculovirus vector comprises one or more non-baculovirus promoters, such as a mammalian promoter or anellovirus promoter. In some embodiments, genes encoding proteins described herein are cloned into a donor vector (e.g., as described herein), which is then contacted with an empty baculovirus expression vector (e.g., an empty bacmid) such that the genes encoding proteins described herein are transferred (e.g., by homologous recombination or transposase activity) from the donor vector to the baculovirus expression vector (e.g., the bacmid). In some embodiments, the baculovirus promoter is adjacent to baculovirus DNA from a non-essential polyhedrin locus. In some embodiments, proteins described herein are under the transcriptional control of the AcNPV polyhedrin promoter very late in viral replication.In some embodiments, strong promoters suitable for use in baculovirus expression in insect cells include, but are not limited to, the baculovirus p10 promoter, polyhedrin (polh) promoter, p6.9 promoter, and capsid protein promoter. Weak promoters suitable for use in baculovirus expression in insect cells include the baculovirus ie1, ie2, ie0, et1, 39K (also known as pp31), and gp64 promoters.

[0218] In some embodiments, recombinant baculoviruses are produced by homologous recombination between a baculovirus genome (e.g., a wild-type or mutant baculovirus genome) and a transfer vector. In some embodiments, one or more genes encoding a protein described herein are cloned into the transfer vector. In some embodiments, the transfer vector further comprises a baculovirus promoter adjacent to DNA from a non-essential gene locus, e.g., the polyhedrin gene. In some embodiments, one or more genes encoding a protein described herein are inserted into the baculovirus genome by homologous recombination between the baculovirus genome and the transfer vector. In some embodiments, the baculovirus genome is linearized at one or more unique sites. In some embodiments, the linearized site is located near a target site for insertion of a gene encoding a protein described herein into the baculovirus genome. In some embodiments, a linearized baculovirus genome missing a gene, e.g., a fragment of the baculovirus genome downstream of the polyhedrin gene, can be used for homologous recombination. In some embodiments, the baculovirus genome and the transfer vector are co-transfected into insect cells. In some embodiments, a method for producing a recombinant baculovirus includes preparing a baculovirus genome for homologous recombination with a transfer vector containing genes encoding one or more proteins described herein, and co-transfecting the transfer vector and baculovirus genomic DNA into insect cells. In some embodiments, the baculovirus genome contains regions homologous to regions of the transfer vector. These homologous regions can increase the probability of recombination between the baculovirus genome and the transfer vector. In some embodiments, the homologous regions in the transfer vector are located upstream or downstream of a promoter. In some embodiments, to induce homologous recombination, the baculovirus genome and the transfer vector are mixed at a weight ratio of about 1:1 to 10:1.

[0219] In some embodiments, recombinant baculoviruses are generated by a method involving site-specific transposition with Tn7, e.g., whereby genes encoding proteins described herein are inserted into bacmid DNA and propagated, e.g., in bacteria, e.g., E. coli (e.g., DH10Bac cells). In some embodiments, genes encoding proteins described herein are cloned into a pFASTBAC® vector and transformed into competent cells, e.g., DH10BAC® competent cells, containing bacmid DNA with a mini-attTn7 target site. In some embodiments, baculovirus expression vectors, e.g., pFASTBAC® vectors, can have a promoter, e.g., a dual promoter (e.g., a polyhedrin promoter, a p10 promoter). Commercially available pFASTBAC® donor plasmids include pFASTBAC 1, pFASTBAC HT, and pFASTBAC DUAL. In some embodiments, recombinant bacmid DNA-containing colonies are identified and the bacmid DNA is isolated for transfection into insect cells.

[0220] In some embodiments, the baculoviral vector is introduced into the insect cell along with a helper nucleic acid. The introduction can be simultaneous or sequential. In some embodiments, the helper nucleic acid provides one or more baculoviral proteins, for example, to facilitate packaging of the baculoviral vector.

[0221] In some embodiments, recombinant baculoviruses produced in insect cells (e.g., by homologous recombination) are propagated and used to infect insect cells (e.g., in mid-logarithmic growth phase) for recombinant protein expression. In some embodiments, recombinant bacmid DNA produced by site-specific transposition in bacteria, e.g., E. coli, is used to transfect insect cells using a transfection agent, e.g., Cellfectin® II. Further information regarding baculovirus expression systems is discussed in U.S. Patent Application Nos. 14 / 447,341, 14 / 277,892, and 12 / 278,916, which are incorporated herein by reference.

[0222] insect cell system The proteins described herein can be expressed in insect cells infected or transfected with recombinant baculovirus or bacmid DNA, for example, as described above. In some embodiments, insect cells include Sf9 and Sf21 cells derived from the fall armyworm (Spodoptera frugiperda), and Tn-368 and High Five™ BTI-TN-5B1-4 cells (also referred to as Hi5 cells) derived from the nettle looper (Trichoplusia ni). In some embodiments, the insect cell lines Sf21 and Sf9, derived from the ovaries of the pupal fall army worm (Spodoptera frugiperda), can be used for expression of recombinant proteins using a baculovirus expression system. In some embodiments, Sf21 and Sf9 insect cells can be cultured in commercially available serum-supplemented or serum-free media. Suitable media for culturing insect cells include Grace's Supplement (TNM-FH), IPL-41, TC-100, Schneider's Drosophila, SF-900 II SFM, and EXPRESS-FIVE™ SFM. In some embodiments, several serum-free media formulations utilize a phosphate buffer system to maintain a culture pH in the range of 6.0 to 6.4 for both culture and recombinant protein production (Licari et al., "Insect cell hosts for baculovirus expression vectors contain endogenous exoglycosidase activity." Biotechnology Progress 9:146-152 (1993) and Drugmand et al., "Insect cells as factories for biomanufacturing." Biotechnology Advances 30:1140-1157 (2012)). In some embodiments, a pH of 6.0 to 6.8 may be used to culture various insect cell lines. In some embodiments, insect cells are cultured in suspension or as a monolayer at a temperature between 25°C and 30°C with aeration.Further information regarding insect cells is discussed, for example, in US Patent Application Nos. 14 / 564,512 and 14 / 775,154, each of which is incorporated herein by reference.

[0223] mammalian cell lines In some embodiments, the proteins described herein can be expressed in vitro in animal cell lines infected or transfected with a vector encoding the protein, for example, as described herein. Animal cell lines contemplated in the context of the present disclosure include immortalized porcine cell lines, such as, but not limited to, the porcine kidney epithelial cell lines PK-15 and SK, the monomyeloma cell line 3D4 / 31, and the testicular cell line ST. Other mammalian cell lines, such as CHO cells (Chinese hamster ovary), MARC-145, MDBK, RK-13, and EEL, are also included. Additionally or alternatively, certain embodiments of the methods of the present invention utilize animal cell lines that are epithelial cell lines, i.e., cell lines of cells of epithelial lineage. Suitable cell lines for expressing the proteins described herein include, but are not limited to, human or primate-derived cell lines, such as human or primate kidney cancer cell lines.

[0224] Genetic element constructs, e.g., for assembly of anesthetic vectors The genetic elements of the anaerovectors described herein may be produced from a genetic element construct comprising a genetic element region and optionally other sequences such as a vector backbone. Generally, the genetic element construct comprises an anellovirus 5'UTR (e.g., as described herein). The genetic element construct may be any nucleic acid construct suitable for delivery of the sequence of a genetic element to a host cell in which the genetic element may be encapsulated within a proteinaceous exterior. In some embodiments, the genetic element construct comprises a promoter. In some embodiments, the genetic element construct is a linear nucleic acid molecule. In some embodiments, the genetic element construct is a circular nucleic acid molecule (e.g., a plasmid, bacmid, or minicircle, e.g., as described herein). The genetic element construct may in some embodiments be double-stranded. In other embodiments, the genetic element is single-stranded. In some embodiments, the genetic element construct comprises DNA. In some embodiments, the genetic element construct comprises RNA. In some embodiments, the genetic element construct comprises one or more modified nucleotides.

[0225] In some aspects, the present disclosure provides methods for the replication and propagation (e.g., in cell culture systems) of the anerowectors described herein, which may include one or more of the following steps: (a) introducing (e.g., transfecting) the genetic element (e.g., linearized) into a cell line susceptible to anerowector infection; (b) harvesting the cells and optionally isolating cells that exhibit the presence of the genetic element; (c) culturing the cells obtained in step (b) (e.g., for at least 3 days, e.g., for at least 1 week or more) depending on the experimental conditions and gene expression; and (d) harvesting the cells of step (c), e.g., as described herein.

[0226] Non-anellovirus sequences The genetic element constructs described herein may comprise a nucleic acid sequence from a non-anellovirus genome (e.g. a sequence having a length of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, or 4000 nucleotides), or a sequence with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity thereto. Examples of viruses from which non-anellovirus sequences can be derived include, but are not limited to, a Monodnavirus, such as a Shotokuvirus (e.g., a Cressdnaviricota (e.g., a redondovirus), a circovirus (e.g., a porcine circovirus, e.g., PCV-1 or PCV-2; or a beak and feather disease virus), a geminivirus (e.g., a tomato golden mosaic virus), or a nanovirus (e.g., BBTV, MDV1, SCSVF, or FBNYV)), or a parvovirus (e.g., a dependoparavirus, e.g., a bocavirus or an adeno-associated virus (AAV)). In some examples, the genetic element construct comprises sequences from a Monodnavirus, e.g., a Shotokuvirus, e.g., a Cossaviricota, e.g., a Quintviricetes, e.g., a Piccovirales, e.g., a Parvoviridae, e.g., a Parvovirinae, e.g., a Dependoparvovirus, e.g., an AAV. In some examples, the genetic element comprises sequences from an AAV (e.g., AAV1, AAV2, or AAV5).

[0227] In some instances, the genetic element construct comprises a non-anellovirus origin of replication, for example, as described herein. The non-anellovirus origin of replication may in some instances comprise an ITR from a non-anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. The non-anellovirus origin of replication may in some instances comprise a Rep binding motif (RBM) of a non-anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In some instances, a non-anellovirus origin of replication may comprise a non-anellovirus terminal cleavage site (TRS), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto.

[0228] Plasmid In some embodiments, the genetic element construct is a plasmid. The plasmid will generally include the sequences of the genetic elements described herein as well as an origin of replication suitable for replication in a host cell (e.g., a bacterial origin of replication for replication in bacterial cells) and a selectable marker (e.g., an antibiotic resistance gene). In some embodiments, the sequences of the genetic elements can be excised from the plasmid. In some embodiments, the plasmid is capable of replication in bacterial cells. In some embodiments, the plasmid is capable of replication in mammalian cells (e.g., human cells). In some embodiments, the plasmid is at least 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, or 5000 bp in length. In some embodiments, the plasmid is less than 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10,000 bp in length. In some embodiments, the plasmid has a length of 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1500, 1500-2000, 2000-2500, 2500-3000, 3000-4000, or 4000-5000 bp. In some embodiments, the genetic element can be excised from the plasmid (e.g., by in vitro circularization) to form, for example, a minicircle, e.g., as described herein. In an embodiment, excision of the genetic element separates the genetic element sequence from the plasmid backbone (e.g., separates the genetic element from the bacterial backbone).

[0229] Small circular nucleic acid constructs In some embodiments, the genetic element construct is a circular nucleic acid construct, for example, lacking a backbone (e.g., lacking a bacterial origin of replication and / or a selectable marker). In embodiments, the genetic element is a double-stranded circular nucleic acid construct. In embodiments, the double-stranded circular nucleic acid construct is produced, for example, by in vitro circularization (IVC) as described herein. In embodiments, the double-stranded circular nucleic acid construct can be introduced into a host cell, where it can be converted into or used as a template to generate, for example, a single-stranded circular genetic element as described herein. In some embodiments, the circular nucleic acid construct does not comprise a plasmid backbone or a functional fragment thereof. In some embodiments, the circular nucleic acid construct is at least 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, or 4500 bp in length. In some embodiments, the circular nucleic acid construct is less than 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 5500, or 6000 bp in length. In some embodiments, the circular nucleic acid construct is selected from the group consisting of 2000-2100, 2100-2200, 2200-2300, 2300-2400, 2400-2500, 2500-2600, 2600-2700, 2700-2800, 2800-2900, 2900-3000, 3000-3100, 3100-3200, 3 In some embodiments, the circular nucleic acid construct is a minicircle.

[0230] In vitro cyclization In some cases, the genetic element packaged in the proteinaceous exterior is single-stranded circular DNA. Genetic elements may optionally be introduced into host cells via genetic element constructs having a form other than single-stranded circular DNA. For example, the genetic element construct may be double-stranded circular DNA. The double-stranded circular DNA can then be converted to single-stranded circular DNA in a host cell (e.g., a host cell comprising an enzyme suitable for rolling circle replication, such as an Anellovirus Rep protein, for example, Rep68 / 78, Rep60, RepA, RepB, ​​Pre, MobM, TraX, TrwC, MobO2281, MobO2282, NikB, ORF50240, NikK, TecH, OrfJ, or TraI, as described, e.g., in Wawrzyniak et al. 2017, Front. Microbiol. 8:2353, which are incorporated by reference herein for the listed enzymes). In some embodiments, double-stranded circular DNA is produced by in vitro circularization (IVC), for example, as described in Example 15.

[0231] Generally, in vitro circularized DNA constructs can be generated by digesting a genetic element construct (e.g., a plasmid containing the genetic element sequence) to be packaged to excise the genetic element sequence as a linear DNA molecule. The resulting linear DNA can then be ligated, for example, using DNA ligase, to form a double-stranded circular DNA. In some cases, the double-stranded circular DNA produced by in vitro circularization can undergo rolling circle replication, for example, as described herein. Without wishing to be bound by theory, it is believed that in vitro circularization results in a double-stranded DNA construct that can undergo rolling circle replication without further modification, thereby producing a single-stranded circular DNA of a size suitable for packaging, for example, into an anaerovector, as described herein. In some embodiments, the double-stranded DNA construct is smaller than a plasmid (e.g., a bacterial plasmid). In some embodiments, the double-stranded DNA construct is excised from a plasmid (e.g., a bacterial plasmid) and then circularized, for example, by in vitro circularization.

[0232] Tandem constructs In some embodiments, the genetic element construct comprises a first copy of a genetic element sequence (e.g., a nucleic acid sequence of a genetic element as described herein) and at least a portion of a second copy of a genetic element sequence (e.g., a nucleic acid sequence of the same genetic element, or a nucleic acid sequence of a different genetic element) arranged in tandem. Genetic element constructs having such a structure are generally referred to herein as tandem constructs. Such tandem constructs are used to produce anelovector genetic elements. The first copy of the genetic element sequence and the second copy of the genetic element sequence may in some instances be directly adjacent to each other on the genetic element construct. In other instances, the first copy of the genetic element sequence and the second copy of the genetic element sequence may be separated, for example, by a spacer sequence. In some embodiments, the second copy of the genetic element sequence, or a portion thereof, comprises, for example, an upstream replication-enhancing sequence (uRFS), for example, as described herein. In some embodiments, the second copy of the genetic element sequence, or a portion thereof, comprises, for example, a downstream replication-enhancing sequence (dRFS), for example, as described herein. In some embodiments, the uRFS and / or dRFS comprises an origin of replication (e.g., a mammalian origin of replication, an insect origin of replication, or a viral origin of replication, e.g., a non-anelloviral origin of replication described herein) or a portion thereof. In some embodiments, the uRFS and / or dRFS does not comprise an origin of replication. In some embodiments, the uRFS and / or dRFS comprises a hairpin loop (e.g., in the 5' UTR). In some embodiments, the tandem construct produces higher levels of the genetic element than other similar constructs that lack a second copy of the genetic element or a portion thereof. Without being bound by theory, the tandem constructs described herein, in some embodiments, can replicate by rolling circle replication. In some embodiments, the tandem construct is a plasmid. In some embodiments, the tandem construct is circular. In some embodiments, the tandem construct is linear. In some embodiments, the tandem construct is single-stranded. In some embodiments, the tandem construct is double-stranded. In some embodiments, the tandem construct is DNA.

[0233] A tandem construct may, in some instances, comprise a first copy of a genetic element sequence and a second copy of a genetic element sequence, or a portion thereof. It is understood that the second copy may be an identical copy of the first copy or portion thereof, or may comprise one or more sequence differences, for example, a substitution, addition, or deletion. In some instances, the second copy of the genetic element sequence or a portion thereof is located 5' to the first copy of the genetic element sequence. In some instances, the second copy of the genetic element sequence or a portion thereof is located 3' to the first copy of the genetic element sequence. In some instances, the second copy of the genetic element sequence or a portion thereof and the first copy of the genetic element sequence are adjacent to each other in the tandem construct. In some instances, the second copy of the genetic element sequence or a portion thereof and the first copy of the genetic element sequence are separated, for example, by a spacer sequence.

[0234] In some embodiments, the tandem constructs described herein can be used to produce the genetic elements of a vector (e.g., anellovector), vehicle, or particle (e.g., viral particle) that includes a capsid (e.g., a capsid comprising an anellovirus ORF, e.g., an ORF1 molecule, as described herein) encapsulating a genetic element comprising a protein-binding sequence that binds to the capsid, and a heterologous (e.g., relative to the anellovirus from which the ORF1 molecule is derived) sequence encoding a therapeutic effector. In embodiments, the vector is capable of delivering the genetic element to mammalian, e.g., human, cells. In some embodiments, the genetic element has less than about 50% identity (e.g., less than 50%, 40%, 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5.5%, 5%, 4.5%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%) to a wild-type anellovirus genomic sequence. In some embodiments, the genetic element has 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75% or 80% identity to a wild-type anellovirus genomic sequence, hi some embodiments, the genetic element has more than about 2000, 3000, 4000, 4500 or 5000 contiguous nucleotides of a non-anellovirus genomic sequence. In some embodiments, the genetic element comprises more than about 2000-5000, 2500-4500, 3000-4500, 2500-4500, 3500, or 4000, 4500 (e.g., about 3000-4500) nucleotides of non-anellovirus genomic sequence.

[0235] In some embodiments of the systems and methods herein, a vector (e.g., an anelovector) is generated by introducing into a cell a first nucleic acid molecule that is a genetic element or genetic element construct, e.g., a tandem construct, and a second nucleic acid molecule that encodes, for example, one or more additional proteins (e.g., a Rep molecule and / or a capsid protein) as described herein. In some embodiments, the first nucleic acid molecule and the second nucleic acid molecule are linked to each other (e.g., in cis, e.g., in a genetic element construct described herein). In some embodiments, the first nucleic acid molecule and the second nucleic acid molecule are separate (e.g., in trans). In some embodiments, the first nucleic acid molecule is a plasmid, cosmid, bacmid, minicircle, or artificial chromosome. In some embodiments, the second nucleic acid molecule is a plasmid, cosmid, bacmid, minicircle, or artificial chromosome. In some embodiments, the second nucleic acid molecule is integrated into the genome of the host cell.

[0236] In some embodiments, the method further comprises introducing the first nucleic acid molecule and / or the second nucleic acid molecule into a host cell. In some embodiments, the second nucleic acid molecule is introduced into the host cell before, simultaneously with, or after the first nucleic acid molecule. In other embodiments, the second nucleic acid molecule is integrated into the genome of the host cell. In some embodiments, the second nucleic acid molecule is, comprises, or is part of a helper construct, helper virus, or other helper vector, e.g., as described herein.

[0237] cis / trans constructs In some embodiments, a genetic element construct as described herein comprises one or more sequences encoding one or more anellovirus ORFs, e.g., a proteinaceous external component (e.g., a polypeptide encoded by, e.g., an anellovirus ORF1 nucleic acid as described herein). For example, a genetic element construct may comprise a nucleic acid sequence encoding an anellovirus ORF1 molecule. Such a genetic element construct may be suitable for introducing the genetic element and one or more anellovirus ORFs in cis into a host cell. In other embodiments, a genetic element construct as described herein does not comprise a sequence encoding one or more anellovirus ORFs, e.g., a proteinaceous external component (e.g., a polypeptide encoded by, e.g., an anellovirus ORF1 nucleic acid as described herein). For example, a genetic element construct may not comprise a nucleic acid sequence encoding an anellovirus ORF1 molecule. Such genetic element constructs may be suitable for introducing genetic elements into a host cell, wherein one or more anellovirus ORFs will be provided in trans (e.g., by introduction of a second nucleic acid construct encoding one or more of the anellovirus ORFs, or by an anellovirus ORF cassette integrated into the genome of the host cell). In some embodiments, an ORF1 molecule is provided in trans, e.g., as described herein. In some embodiments, an ORF2 molecule is provided in trans, e.g., as described herein. In some embodiments, both an ORF1 molecule and an ORF2 molecule are provided in trans, e.g., as described herein.

[0238] In some embodiments, the genetic element construct comprises a sequence encoding an Anellovirus ORF1 molecule, or a splice variant or functional fragment thereof (e.g., a jelly roll region, e.g., as described herein). In embodiments, the portion of the genetic element that does not comprise the sequence of the genetic element comprises a sequence encoding an Anellovirus ORF1 molecule, or a splice variant or functional fragment thereof (e.g., in a cassette comprising a promoter and a sequence encoding an Anellovirus ORF1 molecule, or a splice variant or functional fragment thereof). In further embodiments, the portion of the construct that comprises the sequence of the genetic element comprises a sequence encoding an Anellovirus ORF1 molecule, or a splice variant or functional fragment thereof (e.g., a jelly roll region, e.g., as described herein). In embodiments, the containment of such genetic elements within a proteinaceous exterior (e.g., as described herein) creates a replicative anaerovector (e.g., an anaerovector that, upon infecting a cell, allows the cell to produce additional copies of the anaerovector without introducing into the cell additional nucleic acid constructs encoding, e.g., one or more Anellovirus ORFs described herein).

[0239] In other embodiments, the genetic element does not include a sequence encoding an Anellovirus ORF1 molecule, or a splice variant or functional fragment thereof (e.g., a jellyroll region, e.g., as described herein). In embodiments, the containment of such a genetic element within a proteinaceous exterior (e.g., as described herein) creates a replication-incompetent Anellovector (e.g., an Anellovector that, upon infecting a cell, the infected cell is unable to produce additional Anellovector in the absence of, e.g., one or more additional constructs encoding, e.g., one or more Anellovirus ORFs described herein).

[0240] Expression cassette In some embodiments, the genetic element construct comprises one or more cassettes for expression of a polypeptide or non-coding RNA (e.g. miRNA or siRNA). In some embodiments, the genetic element construct comprises a cassette for expression of an effector (e.g. an exogenous or endogenous effector), such as a polypeptide or non-coding RNA described herein. In some embodiments, the genetic element construct comprises a cassette for expression of an Anellovirus protein (e.g. Anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2, or a functional fragment thereof). Expression cassettes may in some embodiments be located within the genetic element sequence. In embodiments, an expression cassette for an effector is located within the genetic element sequence. In embodiments, an expression cassette for an Anellovirus protein is located within the genetic element sequence. In other embodiments, the expression cassette is located at a position within the genetic element construct outside the sequence of the genetic element (e.g. in the backbone). In embodiments, the expression cassette for the Anellovirus protein is located at a position within the genetic element construct outside the sequence of the genetic element (eg, in the backbone).

[0241] A polypeptide expression cassette generally includes a promoter and a coding sequence encoding a polypeptide, e.g., an effector (e.g., an exogenous or endogenous effector described herein) or an Anellovirus protein (e.g., a sequence encoding Anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2, or a functional fragment thereof). Exemplary promoters that can be included in a polypeptide expression cassette (e.g., to drive expression of a polypeptide) include, but are not limited to, constitutive promoters (e.g., CMV, RSV, PGK, EF1a, or SV40), cell- or tissue-specific promoters (e.g., skeletal muscle α-actin promoter, myosin light chain 2A promoter, dystrophin promoter, muscle creatine kinase promoter, liver albumin promoter, hepatitis B virus core promoter, osteocalcin promoter, bone sialoprotein promoter, CD2 promoter, immunoglobulin heavy chain promoter, T-cell receptor α chain promoter, neuron-specific enolase (NSE) promoter, or neurofilament light chain promoter), as well as inducible promoters (e.g., zinc-inducible sheep metallothionine (MT) promoter; dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter; T7 polymerase promoter system, tetracycline-repressible system, tetracycline-inducible system, RU486-inducible system, rapamycin-inducible system), such as those described herein. In some embodiments, the expression cassette further comprises an enhancer, for example, as described herein.

[0242] Design and production of genetic element constructs A variety of methods are available for synthesizing genetic element constructs. For example, the sequence of a genetic element construct can be divided into smaller overlapping pieces (e.g., segments or individual ORFs ranging from about 100 bp to about 10 kb) that are easy to synthesize. These DNA segments are synthesized from sets of overlapping single-stranded oligonucleotides. The resulting overlapping synthons are then assembled into larger pieces of DNA, e.g., genetic element constructs. Segments or ORFs can be assembled into genetic element constructs by, for example, unique restriction sites at the 5' and 3' ends to allow in vitro recombination or ligation.

[0243] Genetic element constructs can be synthesized using design algorithms that parse construct sequences into oligo-length fragments and create favorable design conditions for synthesis that take into account the complexity of the sequence space. The oligos are then chemically synthesized on semiconductor-based high-density chips, where over 200,000 individual oligos are synthesized per chip. The oligos are assembled using assembly techniques such as BioFab® to build longer DNA segments from smaller oligos. This is done in parallel, so hundreds to thousands of synthetic DNA segments can be constructed at once.

[0244] Each genetic element construct or segment of a genetic element construct may be sequence verified. In some embodiments, high throughput sequencing of RNA or DNA may be performed using AnyDot. chips (Genovoxx, Germany), which allow for the monitoring of biological processes such as miRNA expression or allelic variability (SNP detection). Other high throughput sequencing systems include those disclosed in Venter, J., et al. Science 16 Feb. 2001; Adams, M. et al. Science 24 Mar. 2000; and MJ, Levene, et al. Science 299:682-686, January 2003; and U.S. Patent Application Publication Nos. 20030044781 and 2006 / 0078937. Generally, such systems involve sequencing a target nucleic acid molecule having multiple bases by the temporal addition of bases through a polymerization sequence measured against the molecule of nucleic acid, i.e., the activity of a nucleic acid polymerizing enzyme on a template nucleic acid molecule being sequenced is monitored in real time. In some embodiments, shotgun sequencing is performed.

[0245] Genetic element constructs can be designed so that factors for replication or packaging can be supplied in cis or trans relative to the genetic element. For example, if supplied in cis, the genetic element can include genes encoding one or more anellovirus ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, or ORF2t / 3, as described herein. In some embodiments, replication and / or packaging signals can be incorporated into the genetic element, for example, to direct amplification and / or encapsulation. In some embodiments, an effector is inserted at a specific site within the genome. In some embodiments, one or more viral ORFs are replaced with the effector.

[0246] In another example, when replication or packaging factors are supplied in trans, the genetic element can lack a gene encoding, for example, one or more of anellovirus ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, or ORF2t / 3 as described herein, and the protein may be supplied, for example, by another nucleic acid, e.g., a helper nucleic acid. In some embodiments, minimal cis signals (e.g., 5' UTR and / or GC-rich region) are present within the genetic element. In some embodiments, the genetic element does not encode replication or packaging factors (e.g., replicase and / or capsid proteins). Such factors may, in some embodiments, be supplied by one or more helper nucleic acids (e.g., helper virus nucleic acid, helper plasmid, or helper nucleic acid integrated into the host cell genome). In some embodiments, the helper nucleic acids express sufficient protein and / or RNA to direct amplification and / or packaging, but may lack their own packaging signal. In some embodiments, the genetic element and the helper nucleic acid are introduced into the host cell (e.g. simultaneously or sequentially) resulting in amplification and / or packaging of the genetic element, but not the helper nucleic acid.

[0247] In some embodiments, the genetic element construct may be designed using computer-aided design tools.

[0248] General methods for generating constructs are described, for example, in Khudyakov & Fields, Artificial DNA: Methods and Applications, CRC Press (2002); in Zhao, Synthetic Biology: Tools and Applications, (First Edition), Academic Press (2013); and Egli & Herdewijn, Chemistry and Biology of Artificial Nucleic Acids, (First Edition), Wiley-VCH (2012).

[0249] effector The compositions and methods described herein can be used, for example, to produce genetic elements of an anerowector that include a sequence encoding an effector (e.g., an exogenous effector or an endogenous effector), as described herein. The effector can be an endogenous effector or an exogenous effector in some cases. In some embodiments, the effector is a therapeutic effector. In some embodiments, the effector comprises a polypeptide (e.g., a therapeutic polypeptide or peptide, e.g., as described herein). In some embodiments, the effector comprises a non-coding RNA (e.g., miRNA, siRNA, shRNA, mRNA, lncRNA, RNA, DNA, antisense RNA, or gRNA). In some embodiments, the effector comprises a regulatory nucleic acid, e.g., as described herein.

[0250] In some embodiments, the effector coding sequence may be inserted into the genetic element, for example, in a non-coding region, e.g., in a non-coding region located 3' of the open reading frame and 5' of a GC-rich region of the genetic element, in the 5' non-coding region upstream of the TATA box, in the 5' UTR, downstream of the poly-A signal, or in the 3' non-coding region upstream of the GC-rich region. In some embodiments, the effector coding sequence may be inserted into the genetic element, for example, in a coding sequence (e.g., in a sequence encoding anellovirus ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, and / or ORF2t / 3, as described herein). In some embodiments, the effector coding sequence replaces all or part of the open reading frame. In some embodiments, the genetic element comprises a regulatory sequence (e.g., a promoter or enhancer, e.g., as described herein) operably linked to the effector coding sequence.

[0251] host cell The anaerovectors described herein can be produced, for example, in host cells. Generally, a host cell is provided that contains the anaerovector genetic elements and the anaerovector proteinaceous exterior (e.g., a polypeptide encoded by an Anellovirus ORF1 nucleic acid or an Anellovirus ORF1 molecule). The host cell is then incubated under conditions suitable for encapsulation of the genetic elements within the proteinaceous exterior (e.g., culture conditions described herein). In some embodiments, the host cell is further incubated under conditions suitable for release of the anaerovector from the host cell, e.g., into the surrounding supernatant. In some embodiments, the host cell is lysed for harvesting the anaerovector from the cell lysate. In some embodiments, the anaerovector can be introduced into a host cell line grown to high cell density. In some embodiments, the host cell is an Expi-293 cell.

[0252] Introduction of genetic elements into host cells The genetic element, or a nucleic acid construct comprising a sequence of a genetic element, may be introduced into a host cell. In some embodiments, the genetic element itself is introduced into the host cell. In some embodiments, a genetic element construct (e.g. as described herein) comprising the sequence of the genetic element is introduced into the host cell. The genetic element or genetic element construct may be introduced into the host cell, for example, using methods known in the art. For example, the genetic element or genetic element construct may be introduced into the host cell by transfection (e.g. stable transfection or transient transfection). In embodiments, the genetic element or genetic element construct is introduced into the host cell by lipofectamine transfection. In embodiments, the genetic element or genetic element construct is introduced into the host cell by calcium phosphate transfection. In some embodiments, the genetic element or genetic element construct is introduced into the host cell by electroporation. In some embodiments, the genetic element or genetic element construct is introduced into the host cell using a gene gun. In some embodiments, the genetic element or genetic element construct is introduced into the host cell by nucleofection. In some embodiments the genetic element or genetic element construct is introduced into the host cell by PEI transfection, hi some embodiments the genetic element is introduced into the host cell by contacting the host cell with an aneurovector comprising the genetic element.

[0253] In embodiments the genetic element construct is capable of replicating when introduced into a host cell. In embodiments a genetic element may be produced from the genetic element construct when introduced into a host cell. In some embodiments the genetic element is produced in the host cell by a polymerase, for example using the genetic element construct as a template.

[0254] In some embodiments, the genetic element or a vector containing the genetic element is introduced (e.g., transfected) into a cell line expressing a viral polymerase protein to achieve expression of the anaerovector. To this end, a cell line expressing the anaerovector polymerase protein may be utilized as a suitable host cell. Host cells may also be engineered to provide other viral or additional functions.

[0255] To prepare the anaerovectors disclosed herein, genetic element constructs can be used to transfect cells, providing the anaerovector proteins and functions necessary for replication and production. Alternatively, cells may be transfected with a second construct (e.g., a virus) that provides the anaerovector proteins and functions before, during, or after transfection with the genetic elements or vectors containing the genetic elements disclosed herein. In some embodiments, the second construct may be useful for complementation production of defective viral particles. The second construct (e.g., a bacmid) may have a conditional growth defect, such as host range restriction or temperature sensitivity, allowing for subsequent selection of transgenic viruses. In some embodiments, the second construct may provide one or more replication proteins utilized by the host cell to achieve expression of the anaerovector. In some embodiments, the host cell may be transfected with a vector encoding a viral protein, such as one or more replication proteins. In some embodiments, the second construct comprises an antiviral susceptibility.

[0256] The genetic elements disclosed herein or vectors containing genetic elements can optionally be replicated and produced into anaerovectors using techniques known in the art. For example, various virus culture methods are described in, e.g., U.S. Pat. No. 4,650,764; U.S. Pat. No. 5,166,057; U.S. Pat. No. 5,854,037; European Patent Publication No. EP 0 702 085 A1; U.S. Patent Application No. 09 / 152,845; PCT 97 / 12032; 96 / 34625; European Patent Publication Nos. EP-A 780 475; 99 / 02657; 98 / 53078; 98 / 02530; 99 / 15672; 98 / 13501; 97 / 06270; and EPO 78047 SA1, each of which is incorporated herein by reference in its entirety.

[0257] Methods for providing proteins in cis or trans In some embodiments (e.g., cis embodiments described herein), the genetic element construct further comprises one or more expression cassettes comprising the coding sequence for an Anellovirus ORF (e.g., Anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2, or a functional fragment thereof). In embodiments, the genetic element construct comprises an expression cassette comprising the coding sequence for an Anellovirus ORF1, or a splice variant or functional fragment thereof. Such genetic element constructs comprising expression cassettes for an effector and one or more Anellovirus ORFs may be introduced into a host cell. Host cells containing such genetic element constructs are capable of producing constructs for the genetic element and proteinaceous exterior, and constructs for encasement of the genetic element within the proteinaceous exterior, in some cases without the need for additional nucleic acid constructs or integration of expression cassettes into the host cell genome. In other words, such genetic element constructs can be used in cis anellovector production methods in host cells, for example as described herein.

[0258] In some embodiments (e.g., the trans embodiments described herein), the genetic elements do not include an expression cassette comprising the coding sequence for one or more Anellovirus ORFs (e.g., Anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2, or functional fragments thereof). In embodiments, the genetic element construct does not include an expression cassette comprising the coding sequence for Anellovirus ORF1, or a splice variant or functional fragment thereof. Such genetic element constructs comprising an expression cassette for an effector but lacking an expression cassette for one or more Anellovirus ORFs (e.g., Anellovirus ORF1 or a splice variant or functional fragment thereof) may be introduced into a host cell. Host cells containing such genetic element constructs may, in some cases, require an additional nucleic acid construct or integration of an expression cassette into the host cell genome for production of one or more components of the anaerovector (e.g., proteinaceous exterior protein). In some embodiments, host cells containing such genetic element constructs are unable to encapsulate the genetic element within the proteinaceous exterior protein in the absence of an additional nucleic acid construct encoding an Anellovirus ORF1 molecule. In other words, such genetic element constructs may be used, for example, in methods of trans-anaerovector production in host cells as described herein.

[0259] In some embodiments (e.g., cis embodiments described herein), the genetic element construct further comprises one or more expression cassettes comprising the coding sequence of one or more non-anelloviral ORFs (e.g., a non-anelloviral Rep molecule, e.g., an AAV Rep molecule, e.g., an AAV Rep protein, e.g., an AAV Rep2 protein). Such genetic element constructs comprising expression cassettes for an effector and one or more non-anelloviral ORFs can be introduced into a host cell. Host cells comprising such genetic element constructs may, in some instances, be capable of producing the genetic elements and components for the proteinaceous exterior, and for encapsulating the genetic element within the proteinaceous exterior, without the need for integration of additional nucleic acid constructs or expression cassettes into the host cell genome. In other words, such genetic element constructs may be used for cis anellovector production methods in host cells, for example, as described herein.

[0260] In some embodiments (e.g., trans embodiments described herein), the genetic element does not include an expression cassette comprising the coding sequence of one or more non-anelloviral ORFs (e.g., a non-anelloviral Rep molecule, e.g., an AAV Rep molecule, e.g., an AAV Rep protein, e.g., an AAV Rep2 protein). Such genetic element constructs comprising an expression cassette for an effector but lacking an expression cassette for one or more non-anelloviral ORFs (e.g., a non-anelloviral Rep molecule, e.g., an AAV Rep molecule, e.g., an AAV Rep protein, e.g., an AAV Rep2 protein) can be introduced into a host cell. Host cells comprising such genetic element constructs may, in some instances, require integration of additional nucleic acid constructs or expression cassettes into the host cell genome for production of one or more components of the anaerovector (e.g., for replication of the genetic element). In some embodiments, a host cell comprising such a genetic element construct is unable to replicate the genetic element in the absence of an additional nucleic acid construct encoding, for example, a non-anelloviral Rep molecule, e.g., an AAV Rep molecule, e.g., an AAV Rep protein, e.g., an AAV Rep2 protein. In other words, such genetic element constructs may be used for trans-anellovector production methods in host cells, e.g., as described herein.

[0261] Helper and non-anelloviral molecules In some embodiments, a molecule (e.g., a nucleic acid molecule or polypeptide) derived from, or based on, a non-anellovirus virus is present in a host cell. The molecule derived from, or based on, a non-anellovirus virus can, in some embodiments, contribute to the production of an aneurovector as described herein. For example, the molecule derived from, or based on, a non-anellovirus virus can include a non-anellovirus Rep molecule (e.g., an AAV Rep molecule) that promotes replication of aneurovector genetic elements that include a cognate origin of replication (e.g., an AAV origin of replication).

[0262] In some embodiments, the AAV Rep protein comprises an amino acid sequence listed in Table 60 below, or an amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the AAV Rep protein comprises the amino acid sequence of any of SEQ ID NOs: 1030-1042, or an amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0263] [Table 60-1]

[0264] [Table 60-2]

[0265] [Table 60-3]

[0266] [Table 60-4]

[0267] [Table 60-5]

[0268] [Table 60-6]

[0269] In some embodiments, molecules derived from, or based on, a non-anellovirus virus are introduced into a host cell via a helper construct. In some embodiments, the methods described herein comprise introducing a helper construct into a host cell (e.g. a host cell comprising a genetic element construct or genetic element described herein). In some embodiments, the helper construct is introduced into the host cell prior to introduction of the genetic element construct. In some embodiments, the helper construct is introduced into the host cell simultaneously with introduction of the genetic element construct. In some embodiments, the helper construct is introduced into the host cell after introduction of the genetic element construct.

[0270] In some embodiments, the helper construct comprises a sequence encoding a non-anellovirus ORF. In some embodiments, the helper construct comprises a sequence encoding a non-anellovirus Rep molecule, e.g., an AAV Rep molecule, e.g., an AAV Rep protein. In some embodiments, the helper construct comprises a sequence encoding an AAV REP2 molecule. In some embodiments, one or more helper constructs comprise a sequence encoding one or more (e.g., one, two, or all three) of an adenovirus E2A molecule, an adenovirus E4 molecule, and an adenovirus VA RNA molecule. In embodiments, the AAV Rep molecule, the adenovirus E2A molecule, the adenovirus E4 molecule, and the adenovirus VA RNA molecule are encoded on the same construct. In embodiments, the AAV Rep molecule, the adenovirus E2A molecule, the adenovirus E4 molecule, and the adenovirus VA RNA molecule are encoded on different constructs (e.g., at least two, three, or four separate constructs).

[0271] In some embodiments, the helper construct comprises a sequence encoding an anellovirus ORF (e.g., one or more of anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, and / or ORF1 / 2), or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto.

[0272] Exemplary Cell Types Exemplary host cells suitable for producing anellovectors include, without limitation, mammalian cells, such as human cells and insect cells. In some embodiments, the host cell is a human cell or cell line. In some embodiments, the cell is an immune cell or cell line, such as a T cell or cell line, a cancer cell line, a liver cell or cell line, a neuron, a glial cell, a skin cell, an epithelial cell, a mesenchymal cell, a blood cell, an endothelial cell, an eye cell, a gastrointestinal cell, a progenitor cell, a progenitor cell, a stem cell, a lung cell, a cardiac cell, or a muscle cell. In some embodiments, the host cell is an animal cell (e.g., a mouse cell, a rat cell, a rabbit cell, or a hamster cell, or an insect cell).

[0273] In some embodiments, the host cell is a lymphoid cell. In some embodiments, the host cell is a T cell or an immortalized T cell. In embodiments, the host cell is a Jurkat cell. In embodiments, the host cell is a MOLT cell (e.g., a MOLT-4 or MOLT-3 cell). In embodiments, the host cell is a MOLT-4 cell. In embodiments, the host cell is a MOLT-3 cell. In some embodiments, the host cell is an acute lymphoblastic leukemia (ALL) cell, e.g., a MOLT cell, e.g., a MOLT-4 or MOLT-3 cell. In some embodiments, the host cell is a B cell or an immortalized B cell. In some embodiments, the host cell comprises a genetic element construct (e.g., as described herein).

[0274] In some embodiments, the host cell is a MOLT cell (eg, a MOLT-4 or MOLT-3 cell).

[0275] In some embodiments, the host cell is an acute lymphoblastic leukemia (ALL) cell, for example, a MOLT cell, for example, a MOLT-4 or MOLT-3 cell.

[0276] In some embodiments, the host cells are Expi-293 cells. In some embodiments, the host cells are Expi-293F cells.

[0277] In one aspect, the disclosure provides a method of producing an anerowector comprising a genetic element encapsulated in a proteinaceous exoskeleton, the method comprising providing MOLT-4 cells comprising the anerowector genetic element and incubating the MOLT-4 cells under conditions that permit the anerowector genetic element to become encapsulated in the proteinaceous exoskeleton in the MOLT-4 cells. In some embodiments, the MOLT-4 cells further comprise one or more anelloviral proteins (e.g., anelloviral ORF1 molecule) that form part or all of the proteinaceous exoskeleton. In some embodiments, the anerowector genetic element is produced in the MOLT-4 cells, e.g., from a genetic element construct (e.g., as described herein). In some embodiments, the method further comprises introducing the anerowector genetic element construct into the MOLT-4 cells.

[0278] In one aspect, the disclosure provides a method of producing an anerowector comprising a genetic element encapsulated in a proteinaceous exoskeleton, the method comprising providing MOLT-3 cells comprising the anerowector genetic element and incubating the MOLT-3 cells under conditions that permit the anerowector genetic element to become encapsulated in the proteinaceous exoskeleton in the MOLT-3 cells. In some embodiments, the MOLT-3 cells further comprise one or more anelloviral proteins (e.g., anelloviral ORF1 molecule) that form part or all of the proteinaceous exoskeleton. In some embodiments, the anerowector genetic element is produced in the MOLT-3 cells, e.g., from a genetic element construct (e.g., as described herein). In some embodiments, the method further comprises introducing the anerowector genetic element construct into the MOLT-3 cells.

[0279] In some embodiments, the host cell is a human cell. In embodiments, the host cell is a HEK293T cell, a HEK293F cell, an A549 cell, a Jurkat cell, a Raji cell, a Chang cell, a HeLa cell, a Phoenix cell, an MRC-5 cell, an NCI-H292 cell, or a Wi38 cell. In some embodiments, the host cell is a non-human primate cell (e.g., a Vero cell, a CV-1 cell, or an LLCMK2 cell). In some embodiments, the host cell is a mouse cell (e.g., a McCoy cell). In some embodiments, the host cell is a hamster cell (e.g., a CHO cell or a BHK21 cell). In some embodiments, the host cell is a MARC-145, MDBK, RK-13, or EEL cell. In some embodiments, the host cell is an epithelial cell (e.g., an epithelial cell line).

[0280] In some embodiments, the anellovector is cultured in a continuous animal cell line (e.g., an immortalized cell line that can be serially propagated). According to one embodiment of the present invention, the cell line may include a porcine cell line. Cell lines contemplated in the context of the present invention include, but are not limited to, immortalized porcine cell lines such as the porcine kidney epithelial cell lines PK-15 and SK, the myelomonocytic cell line 3D4 / 31, and the testicular cell line ST.

[0281] Culture conditions The host cells containing the genetic elements and proteinaceous envelope construct can be incubated under conditions suitable for entrapment of the proteinaceous envelope of the genetic elements, thereby producing an anellovector. Suitable culture conditions include, for example, those described in Examples 1, 4, 5, 7, 8, 10, 11, or 15. In some embodiments, the host cells are incubated in liquid medium (e.g., Grace's Supplement-Containing Medium (TNM-FH), IPL-41, TC-100, Schneider's Drosophila Medium, SF-900 II SFM, or EXPRESS-FIVE™ SFM). In some embodiments, the host cells are incubated in adherent culture. In some embodiments, the host cells are incubated in suspension culture. In some embodiments, the host cells are incubated in tubes, bottles, microcarriers, or plastic containers. In some embodiments, the host cells are incubated in a dish or well (e.g., a well on a plate). In some embodiments, the host cells are incubated under conditions suitable for host cell growth. In some embodiments, the host cells are incubated under conditions suitable for the host cells to release the anellovector produced in the host cells into the surrounding supernatant.

[0282] Production of anerowector-containing cell cultures according to the present invention can be carried out at different scales (e.g., in flasks, roller bottles, or bioreactors). The medium used to culture the infected cells generally contains standard nutrients necessary for cell viability but may also contain additional nutrients depending on the cell type. Optionally, the medium can be protein-free and / or serum-free. Depending on the cell type, the cells can be cultured in suspension or on a substrate. In some embodiments, different media are used for the growth of the host cells and for the production of the anerowector.

[0283] collection Anellovectors produced by host cells can be harvested, for example, according to methods known in the art. For example, anellovectors released by host cells into the surrounding supernatant during culture can be harvested from the supernatant (e.g., as described in Example 4). In some embodiments, the supernatant is separated from the host cells to obtain the anellovector. In some embodiments, the host cells are lysed prior to or during harvest. In some embodiments, the anellovector is harvested from a host cell lysate (e.g., as described in Example 10). In some embodiments, the anellovector is harvested from both a host cell lysate and a supernatant. In some embodiments, purification and isolation of the anellovector is performed according to known methods for virus production, for example, as described in Rinaldi, et al., DNA Vaccines: Methods and Protocols (Methods in Molecular Biology), 3rd ed. 2014, Humana Press (incorporated herein by reference in its entirety). In some embodiments, anellovectors can be harvested and / or purified by separation of solutes based on biophysical properties, e.g., ion exchange chromatography or tangential flow filtration, prior to formulation with pharmaceutical excipients.

[0284] In vitro assembly method Anellovectors can be produced, for example, by in vitro assembly, e.g., in a cell-free suspension or in the supernatant. In some embodiments, genetic elements are contacted with ORF1 molecules in vitro, e.g., under conditions that allow assembly.

[0285] In some embodiments, baculovirus constructs are used to produce anellovirus proteins. These proteins can then be used, for example, in in vitro assembly to encapsidate genetic elements, such as genetic elements containing RNA. In some embodiments, polynucleotides encoding one or more anellovirus proteins are fused to a promoter for expression in host cells, for example, insect or animal cells. In some embodiments, the polynucleotides are cloned into a baculovirus expression system. In some embodiments, host cells, for example, insect cells, are infected with the baculovirus expression system and incubated for a period of time. In some embodiments, the infected cells are incubated for about 1, 2, 3, 4, 5, 10, 15, or 20 days. In some embodiments, the infected cells are lysed to recover the anellovirus proteins.

[0286] In some embodiments, the isolated anellovirus proteins are purified. In some embodiments, the anellovirus proteins are purified using purification techniques, including, but not limited to, chelation purification, heparin purification, gradient sedimentation purification, and / or SEC purification. In some embodiments, the purified anellovirus proteins are mixed with a genetic element to encapsidate the genetic element, e.g., an RNA-containing genetic element. In some embodiments, the genetic element is encapsidated using ORF1 protein, ORF2 protein, or modified versions thereof. In some embodiments, two nucleic acids are encapsidated. For example, the first nucleic acid can be mRNA, e.g., chemically modified mRNA, and the second nucleic acid can be DNA.

[0287] In some embodiments, DNA encoding an anellovirus (AV) ORF1 (e.g., a wild-type ORF1 protein, an ORF1 protein with mutations to improve assembly efficiency, yield, or stability, a chimeric ORF1 protein, or a fragment thereof) is expressed in an insect cell line (e.g., Sf9 and / or HighFive), an animal cell line (e.g., a chicken cell line (MDCC)), a bacterial cell (e.g., Escherichia coli (E. coli)), and / or a mammalian cell line (e.g., 293expi and / or MOLT4). In some embodiments, the DNA encoding AV ORF1 may be untagged. In some embodiments, the DNA encoding AV ORF1 may include a tag fused at the N-terminus and / or C-terminus. In some embodiments, the DNA encoding AV ORF1 may have a mutation, insertion, or deletion within the ORF1 protein to introduce a tag to aid in purification and / or identity determination, e.g., via immunostaining assays (including, but not limited to, ELISA or Western blot). In some embodiments, DNA encoding AV ORF1 can be expressed alone or in combination with any number of helper proteins, hi some embodiments, DNA encoding AV ORF1 is expressed in combination with AV ORF2 and / or ORF3 proteins.

[0288] In some embodiments, ORF1 proteins with mutations to improve assembly efficiency include, but are not limited to, ORF1 proteins with mutations introduced into the N-terminal arginine arm (ARG arm) that alter the pI of the ARG arm to allow pH-sensitive nucleic acid binding to trigger particle assembly (SEQ ID NOS: 3-5). In some embodiments, ORF1 proteins with mutations to improve stability may include mutations between the protomers that contact beta strands F and G of the canonical jelly-roll beta barrel to change the hydrophobicity of the protomer surface and improve the thermodynamic favorability of encapsidation.

[0289] In some embodiments, a chimeric ORF1 protein can include, but is not limited to, an ORF1 protein having a portion of its sequence replaced with an equivalent portion from another capsid protein, such as, for example, a Beak and Feather Disease Virus (BFDV) capsid protein or a Hepatitis E capsid protein, such as, but not limited to, the ARG arm or F and G beta strands of Ring9 ORF1 replaced with the equivalent portion from a BFDV capsid protein. In some embodiments, a chimeric ORF1 protein can also include an ORF1 protein having a portion of its sequence replaced with an equivalent portion from another AV ORF1 protein (e.g., a jellyroll fragment or C-terminal portion of Ring2 ORF1 replaced with the equivalent portion of Ring9 ORF1).

[0290] In some embodiments, the present disclosure describes a method of producing an anerowector, the method comprising: (a) providing a mixture comprising (i) a genetic element comprising RNA and (ii) an ORF1 molecule; and (b) incubating the mixture under conditions suitable to encapsulate the genetic element within a proteinaceous envelope comprising the ORF1 molecule, thereby producing an anerowector, optionally wherein the mixture is not contained within a cell. In some embodiments, the method further comprises expressing the ORF1 molecule, for example, in a host cell (e.g., an insect cell or a mammalian cell) prior to providing (a). In some embodiments, expression comprises incubating a host cell (e.g., an insect cell or a mammalian cell) containing a nucleic acid molecule (e.g., a baculovirus expression vector) encoding the ORF1 molecule under conditions suitable to produce the ORF1 molecule. In some embodiments, the method further comprises purifying the ORF1 molecule expressed by the host cell prior to providing (a). In some embodiments, the method is performed in a cell-free system. In some embodiments, the present disclosure describes methods of producing an anerowector composition, comprising: (a) providing a plurality of anerowectors or compositions according to any of the preceding embodiments; (b) optionally evaluating the plurality for one or more of contaminants described herein, optical density measurements (e.g., OD 260), particle counts (e.g., by HPLC), and infectivity (e.g., particle:infectious unit ratio determined by fluorescence and / or ELISA); and (c) formulating the plurality of anerowectors, e.g., as a pharmaceutical composition suitable for administration to a subject, e.g., if one or more of the parameters in (b) meet certain thresholds.

[0291] Concentration and Purification The harvested anaerovectors can be purified and / or concentrated, for example, to create an anaerovector preparation. In some embodiments, the harvested anaerovectors are isolated from other components or contaminants present in the harvest solution, for example, using methods known in the art for purifying viral particles (e.g., purification by precipitation, chromatography, and / or ultrafiltration). In some embodiments, the purification step includes removing one or more of serum, host cell DNA, host cell proteins, particles lacking genetic elements, and / or phenol red from the preparation. In some embodiments, the harvested anaerovectors are concentrated relative to other components or contaminants present in the harvest solution, for example, using methods known in the art to concentrate viral particles.

[0292] In some embodiments, the resulting preparation or pharmaceutical composition comprising the preparation is stable for an acceptable period of time and temperature, and / or is compatible with the desired route of administration and / or any device required by this route of administration, e.g., an injection needle or syringe.

[0293] II. Anaerovector In some aspects, the inventions described herein include compositions and methods of using and making anerowectors, anerowector formulations, and therapeutic compositions. In some embodiments, anerowectors are made using the compositions and methods as described herein. In some embodiments, anerowectors comprise one or more nucleic acids or polypeptides, or fragments or portions thereof, that comprise sequence, structure, and / or function based on an anellovirus (e.g., an anellovirus described herein) or other substantially non-pathogenic virus, e.g., a commensal virus, a commensal virus, or a native virus. In some embodiments, an Anellovirus-based anaerovector contains at least one element exogenous to the Anellovirus, e.g., an exogenous effector or a nucleic acid sequence encoding an exogenous effector, located within the genetic elements of the anaerovector, and / or a virus other than an Anellovirus (e.g., a Monodnavirus, e.g., a Shotokuvirus (e.g., a cressdnaviricota (e.g., a redondovirus), a circovirus (e.g., a porcine circovirus, The exogenous nucleic acid sequence may be derived from a circovirus (e.g., PCV-1 or PCV-2; or beak and feather disease virus), a geminivirus (e.g., tomato golden mosaic virus), or a nanovirus (e.g., BBTV, MDV1, SCSVF, or FBNYV), or a parvovirus (e.g., a dependoparavirus, such as a bocavirus or AAV).In some embodiments, an Anellovirus-based aneurovector comprises at least one element heterologous to another element derived from the Anellovirus, e.g., an effector-encoding nucleic acid sequence, e.g., a promoter element, that is heterologous to another linked nucleic acid sequence. In some embodiments, an Anellovector comprises a genetic element (e.g., circular DNA, e.g., single-stranded DNA) that comprises at least one element heterologous to the remainder of the genetic element and / or a proteinaceous exterior (e.g., an exogenous element encoding an effector, as described herein). An Anellovector can be a delivery vehicle (e.g., a substantially non-pathogenic delivery vehicle) of a payload to a host, e.g., a human. In some embodiments, an Anellovector is capable of replicating in eukaryotic cells, e.g., mammalian cells, e.g., human cells. In some embodiments, an Anellovector is substantially non-pathogenic and / or substantially non-integrative in mammalian (e.g., human) cells. In some embodiments, an Anellovector is substantially non-immunogenic in a mammal, e.g., a human. In some embodiments, the anerowector is replication-deficient. In some embodiments, the anerowector is replication-competent.

[0294] In some embodiments, the anerowector comprises a clone, or a component thereof (e.g., genetic elements including, e.g., effector-encoding sequences and / or proteinaceous exterior) as described in PCT Application No. PCT / US2018 / 037379, which is incorporated herein by reference in its entirety. In some embodiments, the anerowector comprises a clone, or a component thereof (e.g., genetic elements including, e.g., effector-encoding sequences and / or proteinaceous exterior) as described in PCT Application No. PCT / US19 / 65995, which is incorporated herein by reference in its entirety.

[0295] In one aspect, the invention includes: (i) a genetic element comprising a promoter element, a sequence encoding an effector (e.g., an endogenous effector or an exogenous effector, e.g., a payload), and a protein binding sequence (e.g., an exogenous protein binding sequence, e.g., a packaging signal), wherein the genetic element is single-stranded DNA and further has one or both of the following properties: it is circular and / or it integrates into the genome of a eukaryotic cell at a frequency of less than about 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the genetic elements that enter the cell; and (ii) an anerowector comprising a proteinaceous exterior, wherein the genetic element is encapsulated within the proteinaceous exterior; and the anerowector is capable of delivering the genetic element into a eukaryotic cell.

[0296] In some embodiments of the anerowectors described herein, genetic elements integrate at a frequency of less than about 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the genetic elements that enter a cell. In some embodiments, less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, or 5% of the genetic elements from a plurality of anerowectors administered to a subject are integrated into the genome of one or more host cells in the subject. In some embodiments, for example, as described herein, genetic elements of a population of anerowectors are integrated into the genome of host cells at a frequency lower than that of a comparable population of AAV viruses, e.g., about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more lower than that of a comparable population of AAV viruses.

[0297] In one aspect, the invention provides a genetic element comprising: (i) a promoter element, a sequence encoding an effector (e.g., an endogenous effector or an exogenous effector, e.g., a payload), and a protein binding sequence (e.g., an exogenous protein binding sequence), wherein the genetic element is a wild-type Anellovirus sequence (e.g., wild-type Torque Teno virus (TTV), Torque Teno minivirus (TTV), or a wild-type Torque Teno minivirus (TTV)). and (ii) anellovector comprising a proteinaceous exterior, wherein the genetic element is encapsulated within the proteinaceous exterior; and the anaellovector is capable of delivering the genetic element into a eukaryotic cell.

[0298] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: a) a genetic element comprising: (i) a sequence encoding a non-pathogenic foreign protein; (ii) a foreign protein binding sequence that binds the genetic element to the non-pathogenic foreign protein; and (iii) a sequence encoding an effector (e.g., an endogenous or exogenous effector); and b) a proteinaceous exterior that is associated with, e.g., encases or confines, the genetic element The anellovector comprises:

[0299] In some embodiments, anellovectors comprise sequences or expression products derived from (or with >70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% homology to) non-enveloped, circular, single-stranded DNA viruses. Animal circular single-stranded DNA viruses generally refer to a subgroup of single-stranded DNA (ssDNA) viruses with circular genomes that infect eukaryotic, non-plant hosts. Thus, animal circular ssDNA viruses are distinguishable from ssDNA viruses that infect prokaryotes (i.e., Microviridae and Inoviridae) and ssDNA viruses that infect plants (i.e., Geminiviridae and Nanoviridae). They are also distinguishable from linear ssDNA viruses that infect non-plant eukaryotic cells (i.e., Parvoviridae).

[0300] In some embodiments, the anellovector modulates a host cell function, e.g., transiently or long-term. In some embodiments, the cell function is stably altered, e.g., modulation persists for at least about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 60 days, or more, or any time in between. In some embodiments, the function of the cell is transiently altered, for example, modulation lasts for about 30 minutes to about 7 days or less, or for about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days, 6 days, 7 days or less, or any time in between.

[0301] In some embodiments, the genetic element comprises a promoter element. In embodiments, the promoter element is selected from an RNA polymerase II-dependent promoter, an RNA polymerase III-dependent promoter, a PGK promoter, a CMV promoter, an EF-1α promoter, an SV40 promoter, a CAGG promoter, or a UBC promoter, a TTV viral promoter, a tissue-specific promoter with an upstream DNA binding site for an activator protein (e.g., TetR-VP16, Gal4-VP16, dCas9-VP16), a U6 (pollIII), or a minimal CMV promoter. In embodiments, the promoter element comprises a TATA box. In embodiments, the promoter element is endogenous to, for example, a wild-type anellovirus described herein.

[0302] In some embodiments the genetic element comprises one or more of the following characteristics: single-stranded, circular, negative-stranded, and / or DNA. In embodiments the genetic element comprises an episome. In some embodiments the portion of the genetic element excluding the effector has a total size of about 2.5 to 5 kb (e.g. about 2.8 to 4 kb, about 2.8 to 3.2 kb, about 3.6 to 3.9 kb, or about 2.8 to 2.9 kb), less than about 5 kb (e.g. less than about 2.9 kb, 3.2 kb, 3.6 kb, 3.9 kb, or 4 kb), or at least 100 nucleotides (e.g. at least 1 kb).

[0303] The anaerovectors, compositions comprising anaerovectors, methods of using such anaerovectors, and the like described herein are based in part on examples that illustrate how, in some cases, different effectors, e.g., miRNAs (e.g., against IFN or miR-625), shRNAs, etc., can be combined with protein-binding sequences, e.g., DNA sequences that bind to capsid proteins such as Q99153, to produce anaerovectors (which can then be used to deliver the effectors to cells (e.g., animal cells, e.g., human cells or non-human cells such as porcine or murine cells)). In embodiments, the effectors can suppress expression of factors such as interferons. The examples also illustrate how anaerovectors can be produced, e.g., by inserting effectors into sequences derived from an anellovirus. Based on these examples, the following description considers various variations of the specific findings and combinations discussed in the examples. For example, those skilled in the art will understand from the examples that the specific miRNA is used as just one example of an effector, and that other effectors may be, for example, other regulatory nucleic acids or therapeutic peptides. Similarly, the specific capsid used in this example may be replaced by a substantially non-pathogenic protein as described later in this specification. Also, the specific anellovirus sequence described in this example may be replaced by an anellovirus sequence as described later in this specification. These considerations apply equally to protein binding sequences, regulatory sequences such as promoters, and the like. Independently, those skilled in the art will specifically consider such embodiments as closely related to this example.

[0304] In some embodiments, an anerogelovector, or a genetic element contained therein, is introduced into a cell (e.g., a human cell). In some embodiments, for example, once the anerogelovector or genetic element is introduced into a cell, an effector (e.g., an RNA, e.g., miRNA) encoded by the genetic element of the anerogelovector is expressed in the cell (e.g., a human cell). In embodiments, introduction of an anerogelovector, or a genetic element contained therein, into a cell modulates (e.g., increases or decreases) the level of a target molecule (e.g., a target nucleic acid, e.g., an RNA, or a target polypeptide) in the cell, e.g., by altering the level of expression of the target molecule by the cell. In embodiments, introduction of an anerogelovector, or a genetic element contained therein, into a cell modulates (e.g., increases or decreases) the level of interferon produced by the cell. In embodiments, introduction of an anerogelovector, or a genetic element contained therein, into a cell modulates (e.g., increases or decreases) a function of the cell. In embodiments, introduction of an anerogelovector, or a genetic element contained therein, into a cell modulates (e.g., increases or decreases) the viability of the cell. In embodiments, introduction of the anellovector, or the genetic elements contained therein, into a cell reduces the viability of the cell (e.g., a cancer cell).

[0305] In some embodiments, the anaerovectors described herein (e.g., synthetic anaerovectors) induce an antibody positivity rate of less than 70% (e.g., an antibody positivity rate of less than about 60%, 50%, 40%, 30%, 20%, or 10%). In embodiments, the antibody positivity rate is measured according to methods known in the art. In embodiments, the antibody positivity rate is measured by detecting antibodies to an anellovirus (e.g., as described herein) or an anaerovector based thereon in a biological sample, for example, according to the anti-TTV antibody detection method described in Tsuda et al. (1999; J. Virol. Methods 77:199-206; incorporated herein by reference) and / or the method for determining anti-TTV IgG seropositivity rate described in Kakkola et al. (2008; Virology 382:182-189; incorporated herein by reference). Furthermore, antibodies to anelloviruses or anellovectors based thereon can also be detected by methods known in the art for detecting anti-viral antibodies, such as the method for detecting anti-AAV antibodies described in Calcedo et al. (2013; Front. Immunol. 4(341):1-7; incorporated herein by reference).

[0306] In some embodiments, a replication-deficient, replication-impaired, or replication-incompetent genetic element does not encode all of the machinery or components required for replication of the genetic element. In some embodiments, a replication-deficient genetic element does not encode a replication factor. In some embodiments, a replication-deficient genetic element does not encode one or more ORFs (e.g., as described herein, e.g., ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, and / or ORF2t / 3). In some embodiments, the machinery or components not encoded by the genetic element are provided in trans (e.g., encoded in a helper, e.g., a helper virus or helper plasmid, or in a nucleic acid contained in the host cell, e.g., integrated into the genome of the host cell), e.g., whereby the genetic element can undergo replication in the presence of the machinery or components provided in trans.

[0307] In some embodiments, the packaging-deficient, packaging-impaired, or packageable genetic element cannot be packaged into a proteinaceous exoskeleton (e.g., where the proteinaceous exoskeleton comprises a capsid or portion thereof, including, e.g., a polypeptide encoded by an ORF1 nucleic acid described herein). In some embodiments, the packaging-deficient genetic element is packaged into a proteinaceous exoskeleton with less than 10% (e.g., less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, or 0.001%) efficiency compared to a wild-type Anellovirus (e.g., as described herein). In some embodiments, the packaging-defective genetic element is unable to be packaged into a proteinaceous exoprotein, even in the presence of factors (e.g., ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, or ORF2t / 3) that allow packaging of the genetic element of a wild-type Anellovirus (e.g., as described herein). In some embodiments, the packaging-defective genetic element is packaged into a proteinaceous exosporium with an efficiency of less than 10% (e.g., less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, or 0.001%) compared to a wild-type anellovirus (e.g., as described herein), even in the presence of factors (e.g., ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, or ORF2t / 3) that enable packaging of the genetic element of a wild-type anellovirus (e.g., as described herein).

[0308] In some embodiments, the packagable genetic element may be packaged into a proteinaceous exterior (e.g., where the proteinaceous exterior comprises a capsid or portion thereof, including, e.g., a polypeptide encoded by an ORF1 nucleic acid described herein). In some embodiments, the packagable genetic element is packaged into a proteinaceous exterior with an efficiency of at least 20% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100%, or more) compared to a wild-type Anellovirus (e.g., as described herein). In some embodiments, the packagable genetic elements can be packaged into a proteinaceous exterior in the presence of factors (e.g., ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, or ORF2t / 3) that allow packaging of the genetic elements of a wild-type Anellovirus (e.g., as described herein). In some embodiments, the packagable genetic element is packaged into a proteinaceous exosporium with an efficiency of at least 20% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% or more) compared to a wild-type anellovirus (e.g., as described herein) in the presence of factors (e.g., ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, or ORF2t / 3) that enable packaging of the genetic element of a wild-type anellovirus (e.g., as described herein).

[0309] Anellovirus In some embodiments, for example, the anaerovectors described herein comprise sequences or expression products derived from an anellovirus. In some embodiments, an anaerovector comprises one or more sequences or expression products exogenous to the anellovirus. In some embodiments, an anaerovector comprises one or more sequences or expression products endogenous to the anellovirus. In some embodiments, an anaerovector comprises one or more sequences or expression products that are heterologous to one or more other sequences or expression products in the anaerovector. Anelloviruses generally have single-stranded circular DNA genomes with negative polarity. Anelloviruses have not been associated with human disease. However, attempts to link anellovirus infection to human disease have been hampered by the high incidence of asymptomatic anellovirus viremia in control cohorts, the remarkable genomic diversity of the anellovirus family, the inability to propagate this virus in vitro, and the lack of animal models of anellovirus disease (Yzebe et al., Panminerva Med. (2002) 44:167-177; Biagini, P., Vet. Microbiol. (2004) 98:95-101).

[0310] Anelloviruses are generally thought to be transmitted by oronasal or fecal-oral, maternal-fetal, and / or uterine transmission (Gerner et al., Ped. Infect. Dis. J. (2000) 19:1074-1077). Infected individuals may occasionally have a prolonged (months to years) course of anellovirus viremia. Humans can be co-infected with two or more genogroups or lineages (Saback, et al., Scad. J. Infect. Dis. (2001) 33:121-125). It has been suggested that these genogroups can recombine in infected individuals (Rey et al., Infect. (2003) 31:226-233). Double-chain isoforms (replicative) intermediates have been found in several tissues, including the liver, peripheral blood mononuclear cells, and bone marrow (Kikuchi et al., J. Med. Virol. (2000) 61:165-170; Okamoto et al., Biochem. Biophys. Res. Commun. (2002) 270:657-662; Rodriguez-Ilnigo et al., Am. J. Pathol. (2000) 156:1227-1234).

[0311] In some embodiments, the genetic element comprises a nucleic acid sequence encoding an amino acid sequence or a functional fragment thereof, or a sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the amino acid sequences described herein, for example an Anellovirus amino acid sequence.

[0312] In some embodiments, the anellovectors described herein comprise one or more nucleic acid molecules (e.g., genetic elements described herein) that comprise a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to, for example, an anellovirus sequence described herein, or a fragment thereof.

[0313] In some embodiments, the anellovectors described herein comprise one or more nucleic acid molecules (e.g., genetic elements described herein) that contain a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an anellovirus TATA box, cap site, initiation element, transcription start site, 5'UTR conserved domain, ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, ORF2t / 3, 3 open reading frame regions, poly(A) signal, GC-rich region, or any combination thereof. In some embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein, e.g., an ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, ORF2t / 3 sequence of any of the anelloviruses described herein. In embodiments, the nucleic acid molecule comprises a sequence encoding an Anellovirus ORF1 protein (or a splice variant or functional fragment thereof), or a capsid protein comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a polypeptide encoded by an Anellovirus ORF1 nucleic acid.

[0314] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 nucleic acid sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 1 nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 2 nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 2 nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 3 nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2t / 3 nucleotide sequence of Table A1.In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5' UTR conserved domain nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table A1.

[0315] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 nucleic acid sequence of Table B1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 1 nucleotide sequence of Table B1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF1 / 2 nucleotide sequence of Table B1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 nucleotide sequence of Table B1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 2 nucleotide sequence of Table B1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 3 nucleotide sequence of Table B1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table B1.In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table B1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table B1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5' UTR conserved domain nucleotide sequence of Table B1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table B1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table B1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table B1.

[0316] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 nucleic acid sequence of Table B3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 1 nucleotide sequence of Table B3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF1 / 2 nucleotide sequence of Table B3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 nucleotide sequence of Table B3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 2 nucleotide sequence of Table B3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 3 nucleotide sequence of Table B3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table B3.In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table B3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table B3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5' UTR conserved domain nucleotide sequence of Table B3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table B3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table B3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table B3.

[0317] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 nucleic acid sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 1 nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 2 nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 2 nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 3 nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TAIP nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table C1.In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5' UTR conserved domain nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table C1.

[0318] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 nucleic acid sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 1 nucleotide sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF1 / 2 nucleotide sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 nucleotide sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 2 nucleotide sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 3 nucleotide sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table E1.In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5' UTR conserved domain nucleotide sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table E1.

[0319] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 nucleic acid sequence of Table F1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 1 nucleotide sequence of Table F1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 2 nucleotide sequence of Table F1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 nucleotide sequence of Table F1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 2 nucleotide sequence of Table F1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 3 nucleotide sequence of Table F1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table F1.In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table F1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table F1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5' UTR conserved domain nucleotide sequence of Table F1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table F1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table F1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table F1.

[0320] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 nucleic acid sequence of Table F3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 1 nucleotide sequence of Table F3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 2 nucleotide sequence of Table F3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 nucleotide sequence of Table F3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 2 nucleotide sequence of Table F3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 3 nucleotide sequence of Table F3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table F3.In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table F3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table F3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5' UTR conserved domain nucleotide sequence of Table F3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table F3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table F3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table F3.

[0321] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 nucleic acid sequence of Table F5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 1 nucleotide sequence of Table F5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 2 nucleotide sequence of Table F5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 nucleotide sequence of Table F5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 2 nucleotide sequence of Table F5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 3 nucleotide sequence of Table F5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table F5.In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table F5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table F5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5' UTR conserved domain nucleotide sequence of Table F5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table F5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table F5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table F5.

[0322] In some embodiments, the genetic element comprises a nucleotide sequence encoding an amino acid sequence or a functional fragment thereof, or a sequence having at least about 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the amino acid sequences described herein, for example an Anellovirus amino acid sequence.

[0323] In some embodiments, the anerowector described herein comprises one or more nucleic acid molecules (e.g., genetic elements described herein) that comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to, for example, an anellovirus sequence described herein, or a fragment thereof. In some embodiments, the anerowector comprises a nucleic acid sequence selected from the sequences set forth in any of Tables A1-M2, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In some embodiments, the anellovector comprises a polypeptide comprising a sequence set forth in any of the Tables, any of Tables A2-M2, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto.

[0324] In some embodiments, the anellovectors described herein comprise one or more nucleic acid molecules (e.g., genetic elements described herein) that comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more TATA boxes, initiation elements, cap sites, transcription start sites, 5' UTR conserved domains, ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, ORF2 / 3, three open reading frame regions, poly(A) signals, GC-rich regions, or any combination thereof, of any of the anelloviruses described herein (e.g., an anellovirus sequence annotated in or encoded by a sequence listed in any of Tables A-M). In some embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein, e.g., an ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, or ORF2 / 3 sequence of any of the Anelloviruses described herein (e.g., an Anellovirus sequence annotated in or encoded by a sequence listed in any of Tables A-M). In embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein that comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 or ORF2 protein (e.g., an ORF1 or ORF2 amino acid sequence set forth in any of Tables A2-M2, or an ORF1 or ORF2 amino acid sequence encoded by a nucleic acid sequence set forth in any of Tables A1-M1).In embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein comprising an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 protein (e.g., an ORF1 amino acid sequence set forth in any of Tables A2-M2 or an ORF1 amino acid sequence encoded by a nucleic acid sequence set forth in any of Tables A1-M1).

[0325] In some embodiments, an anaerovector described herein is a chimeric anaerovector, hi some embodiments, a chimeric anaerovector further comprises one or more elements, polypeptides, or nucleic acids from a virus other than an anellovirus.

[0326] In embodiments, a chimeric anellovector comprises multiple polypeptides (e.g., anellovirus ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, and / or ORF2t / 3) comprising sequences from multiple different anelloviruses (e.g., as described herein). For example, a chimeric anellovector may comprise an ORF1 molecule from one anellovirus (e.g., a Ring1 ORF1 molecule or an ORF1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto) and an ORF2 molecule from a different anellovirus (e.g., a Ring2 ORF2 molecule or an ORF2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto). In another example, a chimeric anellovector may include a first ORF1 molecule from one anellovirus (e.g., a Ring ORF1 molecule or an ORF1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto) and a second ORF1 molecule from a different anellovirus (e.g., a Ring2 ORF1 molecule or an ORF1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto).

[0327] In some embodiments, the anellovector comprises a chimeric polypeptide (e.g., anellovirus ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, and / or ORF2t / 3), e.g., comprising at least one portion from an anellovirus (e.g., as described herein) and at least one portion from a different virus (e.g., as described herein).

[0328] In some embodiments, the anaerovector comprises a chimeric polypeptide (e.g., anellovirus ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, and / or ORF2t / 3), e.g., comprising at least one portion from one anellovirus (e.g., as described herein) and at least one portion from a different anellovirus (e.g., as described herein). and at least a portion of an ORF1 molecule from a different Anellovirus (e.g., as described herein), or an ORF1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto. In embodiments, a chimeric ORF1 molecule comprises an ORF1 jellyroll domain from one Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and an ORF1 amino acid subsequence (e.g., as described herein) from a different Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.In embodiments, a chimeric ORF1 molecule comprises an ORF1 arginine-rich region from one Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and an ORF1 amino acid subsequence (e.g., as described herein) from a different Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In embodiments, a chimeric ORF1 molecule comprises an ORF1 hypervariable domain from one Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and an ORF1 amino acid subsequence (e.g., as described herein) from a different Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In embodiments, a chimeric ORF1 molecule comprises an ORF1 N22 domain from one Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and an ORF1 amino acid subsequence (e.g., as described herein) from a different Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.In embodiments, a chimeric ORF1 molecule comprises an ORF1 C-terminal domain from one Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and an ORF1 amino acid subsequence (e.g., as described herein) from a different Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0329] In embodiments, the anerowector comprises a chimeric ORF1 / 1 molecule comprising an ORF1 / 1 molecule from one anellovirus (e.g., as described herein), or at least a portion of an ORF1 / 1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and an ORF1 / 1 molecule from a different anellovirus (e.g., as described herein), or at least a portion of an ORF1 / 1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto. In embodiments, the anerowector comprises a chimeric ORF1 / 2 molecule comprising an ORF1 / 2 molecule from one anellovirus (e.g., as described herein), or at least a portion of an ORF1 / 2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and an ORF1 / 2 molecule from a different anellovirus (e.g., as described herein), or at least a portion of an ORF1 / 2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto. In embodiments, the anerowector comprises a chimeric ORF2 molecule comprising an ORF2 molecule from one anellovirus (e.g., as described herein), or at least a portion of an ORF2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and an ORF2 molecule from a different anellovirus (e.g., as described herein), or at least a portion of an ORF2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto.In embodiments, the anerowector comprises a chimeric ORF2 / 2 molecule comprising an ORF2 / 2 molecule from one anellovirus (e.g., as described herein), or at least a portion of an ORF2 / 2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and an ORF2 / 2 molecule from a different anellovirus (e.g., as described herein), or at least a portion of an ORF2 / 2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto. In embodiments, an anerowector comprises a chimeric ORF2 / 3 molecule comprising an ORF2 / 3 molecule from one anellovirus (e.g., as described herein), or at least a portion of an ORF2 / 3 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and an ORF2 / 3 molecule from a different anellovirus (e.g., as described herein), or at least a portion of an ORF2 / 3 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto. In embodiments, the anerowector comprises a chimeric ORF2T / 3 molecule comprising an ORF2T / 3 molecule from one anellovirus (e.g., as described herein), or at least a portion of an ORF2T / 3 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and an ORF2T / 3 molecule from a different anellovirus (e.g., as described herein), or at least a portion of an ORF2T / 3 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto.

[0330] Additional exemplary anellovirus genomes, sequences or subsequences contained therein that can be used in the compositions and methods described herein (e.g., to form genetic elements of anellovectors, e.g., as described herein), are described, for example, in PCT Application Nos. PCT / US2018 / 037379 and PCT / US19 / 65995, which are incorporated by reference in their entireties. In some embodiments, exemplary anellovirus sequences include those listed in any of Tables A1, A3, A5, A7, A9, A11, B1-B5, 1, 3, 5, 7, 9, 11, 13, 15, or 17 of PCT / US19 / 65995, which are incorporated by reference herein. In some embodiments, exemplary anellovirus sequences include the amino acid sequences listed in any of Tables A2, A4, A6, A8, A10, A12, C1-C5, 2, 4, 6, 8, 10, 12, 14, 16, or 18 of PCT / US19 / 65995, incorporated herein by reference. In some embodiments, exemplary anellovirus sequences include the ORF1 molecular sequences or nucleic acid sequences encoding same, e.g., listed in Tables 21, 23, 25, 27, 29, 31, 33, 35, D2, D4, D6, D8, D10, or 37A-37C of PCT / US19 / 65995, incorporated herein by reference.

[0331] [Table A1-1]

[0332] [Table A1-2]

[0333] [Table A1-3]

[0334] [Table A2-1]

[0335] Table A2-2

[0336] Table B1-1

[0337] Table B1-2

[0338] Table B1-3

[0339] Table B2

[0340]

Table B3-1

[0341]

Table B3-2

[0342]

Table B3-3

[0343] Table B4-1

[0344] Table B4-2

[0345] Table C1-1

[0346] Table C1-2

[0347] Table C2-1

[0348] Table C2-2

[0349] Table E1-1

[0350] Table E1-2

[0351] Table E1-3

[0352]

Table D2-1-1

[0353]

Table D2-1-2

[0354] Table F1-1

[0355] Table F1-2

[0356] Table F2-1

[0357] Table F2-2

[0358]

Table F3-1

[0359] Table F3-2

[0360] Table F4-1

[0361] Table F4-2

[0362]

Table F5-1

[0363]

Table F5-2

[0364]

Table F5-3

[0365] Table F6-1

[0366] [Table F6-2]

[0367] In some embodiments, an anerowector comprises a nucleic acid comprising a sequence listed in PCT Application No. PCT / US2018 / 037379, which is incorporated herein by reference in its entirety. In some embodiments, an anerowector comprises a polypeptide comprising a sequence listed in PCT Application No. PCT / US2018 / 037379, which is incorporated herein by reference in its entirety. In some embodiments, an anerowector comprises a nucleic acid comprising a sequence listed in PCT Application No. PCT / US19 / 65995, which is incorporated herein by reference in its entirety. In some embodiments, an anerowector comprises a polypeptide comprising a sequence listed in PCT Application No. PCT / US19 / 65995, which is incorporated herein by reference in its entirety.

[0368] ORF1 molecule In some embodiments, an anelovector comprises an ORF1 molecule and / or a nucleic acid sequence encoding the ORF1 molecule. Generally, the ORF1 molecule comprises a polypeptide having structural features and / or activity of an anellovirus ORF1 protein (e.g., an anellovirus ORF1 protein described herein). In some embodiments, the ORF1 molecule comprises a truncation relative to an anellovirus ORF1 protein (e.g., an anellovirus ORF1 protein described herein). The ORF1 molecule may be capable of binding to other ORF1 molecules, e.g., to form a proteinaceous exterior (e.g., as described herein), e.g., an encapsid. In some embodiments, the proteinaceous exterior can entrap a nucleic acid molecule (e.g., a genetic element described herein). In some embodiments, multiple ORF1 molecules may multimerize, e.g., to form a proteinaceous exterior. In some embodiments, the multimer may be a homomultimer. In other embodiments, the multimer may be a heteromultimer.

[0369] The ORF1 molecule, in some embodiments, may comprise one or more of the following: a first region comprising an arginine-rich region, e.g., a region having at least 60% basic residues (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% basic residues; e.g., 60%-90%, 60%-80%, 70%-90%, or 70-80% basic residues), and a second region comprising a jelly-roll domain, e.g., at least six beta strands (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12 beta strands).

[0370] Arginine-rich region The arginine-rich region has at least 70% (e.g., at least about 70, 80, 90, 95, 96, 97, 98, 99, or 100%) sequence identity to an arginine-rich region sequence described herein or a sequence of at least about 40 amino acids that contains at least 60%, 70%, or 80% basic residues (e.g., arginine, lysine, or a combination thereof).

[0371] Jellyroll Domain Jelly roll domains or regions have the following characteristics: (i) at least 30% (e.g., at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, or more) of the amino acids in the jelly-roll domain are part of one or more β-sheets; (ii) the secondary structure of the jellyroll domain comprises at least four (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12) β-strands; and / or (iii) the tertiary structure of the jelly-roll domain comprises at least two (e.g., two, three, or four) β-sheets; and / or (iv) the jelly-roll domain comprises a β-sheet:α-helix ratio of 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1; The term "antibody" refers to a polypeptide (e.g., a domain or region contained in a larger polypeptide) that comprises one or more (e.g., 1, 2, or 3) of:

[0372] In certain embodiments, the jellyroll domain comprises two beta sheets.

[0373] In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) beta sheets comprise about eight (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12) beta strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) beta sheets comprise eight beta strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) beta sheets comprise seven beta strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) beta sheets comprise six beta strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) beta sheets comprise five beta strands. In certain embodiments, one or more (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) beta sheets comprise four beta strands.

[0374] In some embodiments, the jellyroll domain comprises a first beta-sheet in an antiparallel orientation relative to a second beta-sheet. In certain embodiments, the first beta-sheet comprises about four (e.g., 3, 4, 5, or 6) beta-strands. In certain embodiments, the second beta-sheet comprises about four (e.g., 3, 4, 5, or 6) beta-strands. In embodiments, the first and second beta-sheets collectively comprise about eight (e.g., 6, 7, 8, 9, 10, 11, or 12) beta-strands.

[0375] In certain embodiments, the jelly-roll domain is a component of a capsid protein (e.g., an ORF1 molecule described herein). In certain embodiments, the jelly-roll domain has self-assembly activity. In some embodiments, a polypeptide comprising a jelly-roll domain binds to another copy of a polypeptide comprising a jelly-roll domain. In some embodiments, the jelly-roll domain of a first polypeptide binds to the jelly-roll domain of a second copy of the polypeptide.

[0376] N22 domain The ORF1 molecule may also comprise a third region comprising the structure or activity of an Anellovirus N22 domain (e.g., as described herein, e.g., an N22 domain from an Anellovirus ORF1 protein described herein), and / or a fourth region comprising the structure or activity of an Anellovirus C-terminal domain (CTD) (e.g., as described herein, e.g., a CTD from an Anellovirus ORF1 protein described herein). In some embodiments, the ORF1 molecule comprises, from N-terminus to C-terminus, the first region, the second region, the third region, and the fourth region.

[0377] Hypervariable region (HVR) The ORF1 molecule, in some embodiments, further comprises a hypervariable region (HVR), e.g., an HVR described herein, e.g., from an Anellovirus ORF1 protein. In some embodiments, the HVR is located between the second and third regions. In some embodiments, the HVR comprises at least about 55 (e.g., at least about 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, or 65) amino acids (e.g., about 45-160, 50-160, 55-160, 60-160, 45-150, 50-150, 55-150, 60-150, 45-140, 50-140, 55-140, or 60-140 amino acids).

[0378] Exemplary ORF1 Sequence Exemplary Anellovirus ORF1 amino acid sequences and exemplary ORF1 domain sequences are provided in the Tables below. In some embodiments, a polypeptide (e.g., ORF1 molecule) described herein comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more Anellovirus ORF1 subsequences, e.g., as set forth in any of Tables N-Z. In some embodiments, an anelovector described herein comprises an ORF1 molecule comprising an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more Anellovirus ORF1 subsequences, e.g., as set forth in any of Tables N-Z. In some embodiments, the anellovectors described herein comprise a nucleic acid molecule (e.g., a genetic element) encoding an ORF1 molecule comprising an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more Anellovirus ORF1 subsequences, e.g., as set forth in any of Tables N-Z.

[0379] In some embodiments, one or more Anellovirus ORF1 subsequences comprise one or more of an arginine (Arg)-rich domain, a jellyroll domain, a hypervariable region (HVR), an N22 domain, or a C-terminal domain (CTD) (e.g., as listed in any of Tables N-Z), or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In some embodiments, the ORF1 molecule comprises multiple subsequences from different Anelloviruses (e.g., any combination of ORF1 subsequences selected from the Alphatorquevirus Clades 1-7 subsequences listed in Tables N-Z). In embodiments, the ORF1 molecule comprises one or more of an Arg-rich domain, a jelly-roll domain, an N22 domain, and a CTD from one anellovirus and an HVR from another anellovirus. In embodiments, the ORF1 molecule comprises one or more of a jelly-roll domain, an HVR, an N22 domain, and a CTD from one anellovirus and an Arg-rich domain from another anellovirus. In embodiments, the ORF1 molecule comprises one or more of an Arg-rich domain, an HVR, an N22 domain, and a CTD from one anellovirus and a jelly-roll domain from another anellovirus. In embodiments, the ORF1 molecule comprises one or more of an Arg-rich domain, a jelly-roll domain, an HVR, and a CTD from one Anellovirus and an N22 domain from another Anellovirus. In embodiments, the ORF1 molecule comprises one or more of an Arg-rich domain, a jelly-roll domain, an HVR, and an N22 domain from one Anellovirus and a CTD from another Anellovirus.

[0380] Additional exemplary anelloviruses whose ORF1 molecules, or splice variants or functional fragments thereof, may be utilized in the compositions and methods described herein (e.g., to encapsulate genetic elements, e.g., to form the protein outer layer of an anellovector) are described, for example, in PCT Application Nos. PCT / US2018 / 037379 and PCT / US19 / 65995, which are incorporated by reference in their entireties.

[0381] [Table N-1]

[0382] [Table N-2]

[0383] [Table O]

[0384] [Table P]

[0385] [Table Q]

[0386] [Table D1]

[0387] [Table D2-2]

[0388] [Table R]

[0389] [Table S]

[0390] [Table D5]

[0391] [Table D6]

[0392] In some embodiments, the first region is capable of binding to a nucleic acid molecule (e.g., DNA). In some embodiments, the basic residue is selected from arginine, histidine, or lysine, or a combination thereof. In some embodiments, the first region comprises at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% arginine residues (e.g., 60%-90%, 60%-80%, 70%-90%, or 70%-80% arginine residues). In some embodiments, the first region comprises about 30-120 amino acids (e.g., about 40-120, 40-100, 40-90, 40-80, 40-70, 50-100, 50-90, 50-80, 50-70, 60-100, or 60-80 amino acids). In some embodiments, the first region comprises the structure or activity of a viral ORF1 arginine-rich region (e.g., an arginine-rich region from an anellovirus ORF1 protein described herein). In some embodiments, the first region comprises a nuclear localization signal.

[0393] In some embodiments, the second region comprises the structure or activity of a jelly-roll domain, e.g., a viral ORF1 jelly-roll domain (e.g., a jelly-roll domain from anellovirus ORF1 protein, e.g., as described herein). In some embodiments, the second region can combine with a second region of another ORF1 molecule to form a proteinaceous exterior (e.g., capsid) or portion thereof.

[0394] In some embodiments, the fourth region is exposed on the surface of a proteinaceous exterior (eg, a proteinaceous exterior comprising a multimer of ORF1 molecules, as described herein).

[0395] In some embodiments, the first region, second region, third region, fourth region, and / or HVR each comprise three or fewer (e.g., zero, one, two, or three) beta sheets.

[0396] In some embodiments, one or more of the first region, second region, third region, fourth region, and / or HVR may be replaced with a heterologous amino acid sequence (e.g., the corresponding region from a heterologous ORF1 molecule). In some embodiments, the heterologous amino acid sequence comprises a desired functional fragment, e.g., as described herein.

[0397] In some embodiments, the ORF1 molecule contains multiple conserved motifs (e.g., motifs comprising about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more amino acids) (e.g., as shown in Figure 34 of PCT / US19 / 65995). In some embodiments, the conserved motif is a conserved motif found in one or more wild-type Anellovirus clades (e.g., Alphatorquevirus, Clade 1; Alphatorquevirus, Clade 2; Alphatorquevirus, Clade 3; Alphatorquevirus, Clade 4; Alphatorquevirus, Clade 5; Alphatorquevirus, Clade 6; or Alphatorquevirus, Clade 7; Betatorquevirus; and / or Gammatorquevirus). In embodiments, the conserved motifs may each exhibit 60, 70, 80, 85, 90, 95, or 100% sequence identity to the ORF1 protein of Gammatorquevirus. or 100-1000 amino acids in length. In certain embodiments, the conserved motif comprises about 2-4% (e.g., about 1-8%, 1-6%, 1-5%, 1-4%, 2-8%, 2-6%, 2-5%, or 2-4%) of the sequence of the ORF1 molecule, each exhibiting 100% sequence identity to the corresponding motif in the ORF1 protein of a wild-type Anellovirus clade.In certain embodiments, the conserved motif comprises about 5-10% (e.g., about 1-20%, 1-10%, 5-20%, or 5-10%) of the sequence of the ORF1 molecule, each exhibiting 80% sequence identity to the corresponding motif in the ORF1 protein of a wild-type Anellovirus clade. In certain embodiments, the conserved motif comprises about 10-50% (e.g., about 10-20%, 10-30%, 10-40%, 10-50%, 20-40%, 20-50%, or 30-50%) of the sequence of the ORF1 molecule, each exhibiting 60% sequence identity to the corresponding motif in the ORF1 protein of a wild-type Anellovirus clade. In some embodiments, the conserved motif comprises one or more amino acid sequences listed in Table 19.

[0398] In some embodiments, the ORF1 molecule includes at least one difference (eg, a mutation, chemical modification, or epigenetic alteration), eg, compared to a wild-type ORF1 protein described herein.

[0399] Conserved ORF1 motif within the N22 domain In some embodiments, a polypeptide described herein (e.g., an ORF1 molecule) has the amino acid sequence YNPX 2 DXGX 2 N (SEQ ID NO: 829) (X n is a contiguous sequence of any n amino acids. For example, X n represents a contiguous sequence of any two amino acids. 2 DXGX 2 N (SEQ ID NO: 829), for example, is contained within the N22 domain of the ORF1 molecule described herein. In some embodiments, the genetic elements described herein have the amino acid sequence YNPX 2 DXGX 2 N (SEQ ID NO: 829) (X n is a contiguous sequence of any n amino acids) (e.g., a nucleic acid sequence encoding, for example, an ORF1 molecule described herein).

[0400] In some embodiments, the polypeptide (e.g., ORF1 molecule) contains, e.g., a nucleotide sequence similar to that of YNPX, e.g., in the N22 domain. 2 DXGX 2 In some embodiments, the conserved secondary structure comprises a first β strand and / or a second β strand. In some embodiments, the first β strand is about 5-6 (e.g., 3, 4, 5, 6, 7, or 8) amino acids in length. In some embodiments, the first β strand comprises a conserved secondary structure comprising a first β strand and / or a second β strand. In some embodiments, the first β strand is about 5-6 (e.g., 3, 4, 5, 6, 7, or 8) amino acids in length. In some embodiments, the first β strand is YNPX 2 DXGX 2 N (SEQ ID NO: 829) motif contains a tyrosine (Y) residue at the N-terminus. 2 DXGX 2 The N (SEQ ID NO: 829) motif comprises a random coil (e.g., about 8-9 amino acids of a random coil). In some embodiments, the second β strand is about 7-8 (e.g., 5, 6, 7, 8, 9, or 10) amino acids in length. In some embodiments, the second β strand is YNPX 2 DXGX 2 The N (SEQ ID NO: 829) motif contains an asparagine (N) residue at the C-terminus.

[0401] Exemplary YNPX 2 DXGX 2 The N (SEQ ID NO: 829) motif flanking secondary structure is described in Example 47 and Figure 48 of PCT / US19 / 65995, which are incorporated by reference in their entireties. In some embodiments, the ORF1 molecule comprises a region comprising one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all) of the secondary structure elements (e.g., beta strands) shown in Figure 48 of PCT / US19 / 65995. In some embodiments, the ORF1 molecule comprises a region comprising YNPX 2 DXGX 2The present invention also includes a region comprising one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all) of the secondary structure elements (e.g., beta strands) shown in Figure 48 of PCT / US19 / 65995, flanking an N (SEQ ID NO: 829) motif (e.g., as described herein).

[0402] Conserved secondary structure within the ORF1 jelly-roll domain In some embodiments, a polypeptide described herein (e.g., an ORF1 molecule) comprises one or more secondary structure elements contained in an Anellovirus ORF1 protein (e.g., as described herein). In some embodiments, an ORF1 molecule comprises one or more secondary structure elements contained in a jellyroll domain of an Anellovirus ORF1 protein (e.g., as described herein). Generally, the ORF1 jellyroll domain comprises a secondary structure comprising, from N- to C-terminal order, a first β strand, a second β strand, a first α helix, a third β strand, a fourth β strand, a fifth β strand, a second α helix, a sixth β strand, a seventh β strand, an eighth β strand, and a ninth β strand. In some embodiments, the ORF1 molecule comprises a secondary structure comprising, in N-terminal to C-terminal order, a first beta strand, a second beta strand, a first alpha helix, a third beta strand, a fourth beta strand, a fifth beta strand, a second alpha helix, a sixth beta strand, a seventh beta strand, an eighth beta strand, and / or a ninth beta strand.

[0403] In some embodiments, a pair of conserved secondary structure elements (i.e., β-strands and / or α-helices) are separated by an intervening amino acid sequence, e.g., comprising a random coil sequence, a β-strand, or an α-helix, or a combination thereof. The intervening amino acid sequence between the conserved secondary structure elements may comprise, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more amino acids. In some embodiments, the ORF1 molecule may further comprise one or more additional β-strands and / or α-helices (e.g., within a jelly-roll domain). In some embodiments, consecutive β-strands or consecutive α-helices may be combined. In some embodiments, the first and second β-strands are comprised within a larger β-strand. In some embodiments, the third and fourth β-strands are comprised within a larger β-strand. In some embodiments, the 4th and 5th beta strands are comprised in a larger beta chain. In some embodiments, the 6th and 7th beta strands are comprised in a larger beta chain. In some embodiments, the 7th and 8th beta strands are comprised in a larger beta chain. In some embodiments, the 8th and 9th beta strands are comprised in a larger beta chain.

[0404] In some embodiments, the first β strand is about 5-7 (e.g., 3, 4, 5, 6, 7, 8, 9, or 10) amino acids in length. In some embodiments, the second β strand is about 15-16 (e.g., 13, 14, 15, 16, 17, 18, or 19) amino acids in length. In some embodiments, the first α helix is ​​about 15-17 (e.g., 13, 14, 15, 16, 17, 18, 19, or 20) amino acids in length. In some embodiments, the third β strand is about 3-4 (e.g., 1, 2, 3, 4, 5, or 6) amino acids in length. In some embodiments, the fourth β strand is about 10-11 (e.g., 8, 9, 10, 11, 12, or 13) amino acids in length. In some embodiments, the fifth β strand is about 6-7 (e.g., 4, 5, 6, 7, 8, 9, or 10) amino acids in length. In some embodiments, the second α-helix is ​​about 8-14 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17) amino acids in length. In some embodiments, the second α-helix may be truncated into two smaller α-helices (e.g., separated by a random coil sequence). In some embodiments, each of the two smaller α-helices is about 4-6 (e.g., 2, 3, 4, 5, 6, 7, or 8) amino acids in length. In some embodiments, the sixth β-strand is about 4-5 (e.g., 2, 3, 4, 5, 6, or 7) amino acids in length. In some embodiments, the seventh β-strand is about 5-6 (e.g., 3, 4, 5, 6, 7, 8, or 9) amino acids in length. In some embodiments, the eighth β-strand is about 7-9 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, or 13) amino acids in length. In some embodiments, the ninth beta strand is about 5 to 7 (eg, 3, 4, 5, 6, 7, 8, 9, or 10) amino acids in length.

[0405] Exemplary jellyroll domain secondary structures are described in Example 47 of PCT / US19 / 65995 and herein in Figure 25. In some embodiments, an ORF1 molecule comprises a region that includes one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all) of the secondary structure elements (e.g., β-strands and / or α-helices) of any of the jellyroll domain secondary structures shown in Figure 25 herein.

[0406] Consensus ORF1 domain sequence In some embodiments, for example, an ORF1 molecule described herein comprises one or more of a jelly-roll domain, an N22 domain, and / or a C-terminal domain (CTD). In some embodiments, the jelly-roll domain comprises an amino acid sequence having a jelly-roll domain consensus sequence described herein (e.g., listed in any of Tables 37A-37C). In some embodiments, the N22 domain comprises an amino acid sequence having an N22 domain consensus sequence described herein (e.g., listed in any of Tables 37A-37C). In some embodiments, the CTD domain comprises an amino acid sequence having a CTD domain consensus sequence described herein (e.g., listed in any of Tables 37A-37C) in the format "(X a-b )" includes a contiguous series of amino acids, where the series includes at least a and at most b amino acids. In certain embodiments, all amino acids in the series are the same. In other embodiments, the series includes at least 2 (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21) different amino acids.

[0407] [Table 37A]

[0408] [Table 37B]

[0409] [Table 37C]

[0410] In some embodiments, the jellyroll domain comprises a jellyroll domain amino acid sequence listed in any of Tables 21, 23, 25, 27, 29, 31, 33, 35, D2, D4, D6, D8, D10, or 37A-37C, or an amino acid sequence having at least 70%, 75%, 80%, 8%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In some embodiments, the N22 domain comprises an N22 domain amino acid sequence listed in any of Tables 21, 23, 25, 27, 29, 31, 33, 35, D2, D4, D6, D8, D10, or 37A-37C, or an amino acid sequence having at least 70%, 75%, 80%, 8%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In some embodiments, the CTD domain comprises a CTD domain amino acid sequence listed in any of Tables 21, 23, 25, 27, 29, 31, 33, 35, D2, D4, D6, D8, D10, or 37A-37C, or an amino acid sequence having at least 70%, 75%, 80%, 8%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto.

[0411] Identification of ORF1 protein sequence In some embodiments, an Anellovirus ORF1 protein sequence, or a nucleic acid sequence encoding an ORF1 protein, can be identified from an Anellovirus genome (e.g., a putative Anellovirus genome identified by a nucleic acid sequencing technique, e.g., a deep sequencing technique). In some embodiments, the ORF1 protein sequence is identified by one or more (e.g., one, two, or all three) of the following selection criteria:

[0412] (i) Length Selection: Protein sequences (e.g., putative Anellovirus ORF1 sequences that pass the criteria set forth in (ii) or (iii) below) can be size-selected for greater than about 600 amino acid residues to identify putative Anellovirus ORF1 proteins. In some embodiments, Anellovirus ORF1 protein sequences are at least about 600, 650, 700, 750, 800, 850, 900, 950, or 1000 amino acid residues in length. In some embodiments, Alphatorquevirus ORF1 protein sequences are at least about 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 900, or 1000 amino acid residues in length. In some embodiments, the Betatorquevirus ORF1 protein sequence is at least about 650, 660, 670, 680, 690, 700, 750, 800, 900, or 1000 amino acid residues in length. In some embodiments, the Gammatorquevirus ORF1 protein sequence is at least about 650, 660, 670, 680, 690, 700, 750, 800, 900, or 1000 amino acid residues in length. In some embodiments, the nucleic acid sequence encoding the Anellovirus ORF1 protein is at least about 1800, 1900, 2000, 2100, 2200, 2300, 2400, or 2500 nucleotides in length. In some embodiments, the nucleic acid sequence encoding the Alphatorquevirus ORF1 protein sequence is at least about 2100, 2150, 2200, 2250, 2300, 2400, or 2500 nucleotides in length. In some embodiments, the nucleic acid sequence encoding the Betatorquevirus ORF1 protein sequence is at least about 1900, 1950, 2000, 2500, 2100, 2150, 2200, 2250, 2300, 2400, or 2500 or 1000 nucleotides in length.In some embodiments, the nucleic acid sequence encoding the Gammatorquevirus ORF1 protein sequence is at least about 1900, 1950, 2000, 2500, 2100, 2150, 2200, 2250, 2300, 2400, or 2500 or 1000 nucleotides in length.

[0413] (ii) Presence of an ORF1 motif: Protein sequences (e.g., putative anellovirus ORF1 sequences that pass the criteria set forth in (i) above or (iii) below) can be filtered to identify those containing the conserved ORF1 motif in the N22 domain described above. In some embodiments, a putative anellovirus ORF1 sequence comprises the sequence YNPXXDXGXXN. In some embodiments, a putative anellovirus ORF1 sequence comprises the sequence Y[NCS]PXXDX[GASKR]XX[NTSVAK].

[0414] (iii) Presence of Arginine-Rich Regions: Protein sequences (e.g., putative Anellovirus ORF1 sequences that pass the criteria set forth in (i) and / or (ii) above) can be filtered for those that contain arginine-rich regions (e.g., as described herein). In some embodiments, the putative Anellovirus ORF1 sequence comprises a contiguous sequence of at least about 30, 35, 40, 45, 50, 55, 60, 65, or 70 amino acids that contain at least 30% (e.g., at least about 20%, 25%, 30%, 35%, 40%, 45%, or 50%) arginine residues. In some embodiments, the putative Anellovirus ORF1 sequence comprises a contiguous sequence of about 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, or 65-70 amino acids that contains at least 30% (e.g., at least about 20%, 25%, 30%, 35%, 40%, 45%, or 50%) arginine residues. In some embodiments, the arginine-rich region is located at least about 30, 40, 50, 60, 70, or 80 amino acids downstream of the start codon of the putative Anellovirus ORF1 protein. In some embodiments, the arginine-rich region is located at least about 50 amino acids downstream of the start codon of the putative Anellovirus ORF1 protein.

[0415] ORF2 molecule In some embodiments, the anelovector comprises an ORF2 molecule and / or a nucleic acid encoding the ORF2 molecule. Generally, the ORF2 molecule comprises a polypeptide having structural characteristics and / or activity of an Anellovirus ORF2 protein (e.g., an Anellovirus ORF2 protein listed in any of Tables A2, A4, A6, A8, A10, A12, C1-C5, 2, 4, 6, 8, 10, 12, 14, 16, or 18 described herein), or a functional fragment thereof. In some embodiments, the ORF2 molecule comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 protein sequence set forth in any of Tables A2, A4, A6, A8, A10, A12, C1-C5, 2, 4, 6, 8, 10, 12, 14, 16, or 18.

[0416] In some embodiments, the ORF2 molecule comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to an Alphatorquevirus, Betatorquevirus, or Gammatorquevirus ORF2 protein, e.g., as described herein. In some embodiments, the ORF2 molecule (e.g., an ORF2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to an Alphatorquevirus ORF2 protein) has a length of 250 amino acids or less (e.g., about 150-200 amino acids). In some embodiments, the ORF2 molecule (e.g., an ORF2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to a Betatorquevirus ORF2 protein) has a length of about 50-150 amino acids. In some embodiments, the ORF2 molecule (e.g., an ORF2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to a Gammatorquevirus ORF2 protein) has a length of about 100-200 amino acids (e.g., about 100-150 amino acids). In some embodiments, the ORF2 molecule comprises a helix-turn-helix motif (e.g., a helix-turn-helix motif comprising two α-helices flanking a turn region). In some embodiments, the ORF2 molecule comprises the amino acid sequence of the ORF2 protein of TTV isolate TA278 or TTV isolate SANBAN. In some embodiments, the ORF2 molecule has protein phosphatase activity.In some embodiments, the ORF2 molecule comprises at least one difference (e.g., a mutation, chemical modification, or epigenetic alteration) compared to a wild-type ORF2 protein described herein (e.g., in Tables A2, A4, A6, A8, A10, A12, C1-C5, 2, 4, 6, 8, 10, 12, 14, 16, or 18).

[0417] Conserved ORF2 motif In some embodiments, the polypeptides described herein (e.g., ORF2 motifs) have the amino acid sequence [W / F]X 7 HX 3 CX 1 CX 5 H (SEQ ID NO: 949), wherein X n is a contiguous sequence of any n amino acids. 7 represents any consecutive sequence of 7 amino acids. 3 represents any consecutive sequence of 3 amino acids. 1 represents any single amino acid. 5 represents any consecutive sequence of 5 amino acids. In some embodiments, [W / F] can be either tryptophan or phenylalanine. In some embodiments, [W / F]X 7 HX 3 CX 1 CX 5 H (SEQ ID NO: 949), for example, is contained within the N22 domain of ORF2 described herein. In some embodiments, the genetic elements described herein have the amino acid sequence [W / F]X 7 HX 3 CX 1 CX 5 H (SEQ ID NO: 949) (X n is a contiguous sequence of any n amino acids (e.g., a nucleic acid sequence encoding an ORF2 molecule as described herein).

[0418] Genetic elements, e.g., genetic elements comprising non-anellovirus sequences In some embodiments, the anelovector comprises a genetic element, hi some embodiments, the genetic element comprises a nucleic acid sequence from a virus other than anellovirus (e.g., a contiguous nucleic acid sequence having a length of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, or 4000 nucleotides), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In some embodiments, the virus other than anellovirus is a Monodnavirus, e.g., a Shotokuvirus (e.g., a Cressdnaviricota (e.g., a redondovirus), a circovirus (e.g., a porcine circovirus, e.g., PCV-1 or PCV-2; or a beak and feather disease virus), a geminivirus (e.g., a tomato golden mosaic virus), or a nanovirus (e.g., BBTV, MDV1, SCSVF, or FBNYV)), or a parvovirus (e.g., a dependoparavirus, e.g., a bocavirus or AAV). In some embodiments, the virus other than anellovirus is an AAV (e.g., AAV1, AAV2, or AAV5). In some embodiments, the nucleic acid sequence derived from a virus other than anellovirus comprises a non-anellovirus origin of replication (e.g., an origin of replication derived from an AAV, e.g., AAV1, AAV2, or AAV5). In some embodiments, the non-anellovirus origin of replication comprises, e.g., an AAV Rep binding motif (RBM), as described herein, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.In some embodiments, the non-anelloviral origin of replication comprises, for example, an AAV terminal cleavage site (TRS), as described herein, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the non-anelloviral origin of replication is derived from a virus that replicates by rolling circle replication. In some embodiments, the non-anelloviral origin of replication is derived from a virus that replicates by rolling hairpin replication.

[0419] In some embodiments, the genetic element comprises one or more inverted terminal repeats (ITRs). In some embodiments, the genetic element comprises one ITR. In some embodiments, the genetic element comprises an ITR located 5' to an effector or effector-coding sequence described herein. In some embodiments, the genetic element comprises an ITR located 3' to an effector or effector-coding sequence described herein. In some embodiments, the genetic element comprises two ITRs, e.g., flanking an effector or effector-coding sequence described herein. In some embodiments, the non-anelloviral origin of replication is comprised in an ITR, e.g., an AAV ITR, e.g., as described herein.

[0420] In some embodiments, the genetic element comprises an ITR sequence from an AAV (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, or AAV6), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In embodiments, the AAV ITRs have a sequence as described in, for example, Grimm et al. (2005, J. Virol., DOI:10.1128 / JVI.80.1.426-439.2006; incorporated herein by reference in its entirety), e.g., as shown in Figure 1A of Grimm et al., supra. In embodiments, the AAV ITRs have the sequences described herein in Chiorini et al. (1999, J. Virol 73(5):4293-4298; incorporated herein by reference in its entirety).

[0421] In some embodiments the genetic element comprises a subsequence of an ITR sequence (e.g. from an AAV, e.g. as described herein), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto, hi embodiments the genetic element comprises the sequence AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCC (SEQ ID NO: 1051), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In an embodiment the genetic element comprises the sequence CGGGCGGGTGGTGGCGGCGGTTGGGGCTCGGCGCTCGCTCGCTCGCTGGGCGGGCGGGCGGT (SEQ ID NO: 1052), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity thereto.

[0422] In some embodiments, the genetic element comprises an RBM sequence (e.g., from an AAV, e.g., as described herein), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In embodiments, the genetic element comprises a sequence of (GMGY)x4 (SEQ ID NO: 1053), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In embodiments, the genetic element comprises a sequence of (GMGY)x5 (SEQ ID NO: 1054), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In an embodiment the genetic element comprises the sequence GCGCGCTCGCTCGCTC (SEQ ID NO: 1055) or a sequence with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity thereto. In an embodiment the genetic element comprises the sequence GCTCGCTCGCTCGCTG (SEQ ID NO: 1056) or a sequence with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity thereto.

[0423] In some embodiments the genetic element comprises a TRS sequence (e.g. from an AAV, e.g. as described herein), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In embodiments the genetic element comprises a sequence of XGTTGG (SEQ ID NO: 1057) (wherein X is selected from G, C, T, or A), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In embodiments the genetic element comprises a sequence of AGTTGG (SEQ ID NO: 1058), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In embodiments the genetic element comprises the sequence GGTTGG (SEQ ID NO: 1059) or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity thereto.

[0424] In some embodiments, a genetic element construct (for example as described herein) comprises a nucleic acid sequence having a structure shown in Table 61 below, or as outlined in Figure 10.

[0425] In some embodiments, a genetic element (e.g., as described herein) comprises a nucleic acid sequence having a structure shown in Table 61 below or outlined in Figure 10. In embodiments, the genetic element comprises (i) one or more (e.g., one or two) non-anellovirus (e.g., AAV) ITR sequences; (ii) sequences encoding an exogenous effector; and / or (iii) sequences (e.g., contiguous or non-contiguous sequences) derived from an anellovirus genome (or at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% thereto). , 99%, or 100% sequence identity), or a contiguous portion thereof having a length of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, or 4000 nucleotides.

[0426] In embodiments, the genetic element comprises a non-anellovirus (e.g., AAV) ITR sequence located within an anellovirus genome, or portion thereof. In one embodiment, the non-anellovirus ITR sequence is located closer to the 5' end of the anellovirus genomic sequence, or portion thereof, than to the 3' end of the anellovirus genomic sequence, or portion thereof. In one embodiment, the non-anellovirus ITR sequence is located closer to the 3' end of the anellovirus genomic sequence, or portion thereof, than to the 5' end of the anellovirus genomic sequence, or portion thereof.

[0427] In embodiments, the genetic element comprises a non-anellovirus (e.g., AAV) ITR sequence located at the 5' end of the anellovirus genomic sequence, or portion thereof. In embodiments, the genetic element comprises a non-anellovirus (e.g., AAV) ITR sequence located at the 3' end of the anellovirus genomic sequence, or portion thereof.

[0428] In embodiments, the non-anellovirus ITR sequences share the same orientation as the anellovirus genomic sequence, or portion thereof. In embodiments, the non-anellovirus ITR sequences have the opposite orientation as the anellovirus genomic sequence, or portion thereof.

[0429] In embodiments, the genetic element comprises a sequence encoding an effector (e.g., an endogenous effector or an exogenous effector). In embodiments, the sequence encoding the effect is located upstream of the non-anelloviral ITR sequence. In embodiments, the sequence encoding the effect is located downstream of the non-anelloviral ITR sequence.

[0430] In embodiments, a genetic element comprises multiple (e.g., two) non-anellovirus ITR sequences. In embodiments, the multiple non-anellovirus ITR sequences share the same sequence. In embodiments, the multiple non-anellovirus ITR sequences have different sequences. In embodiments, the multiple non-anellovirus ITR sequences share at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleic acid sequence identity. In embodiments, a genetic element comprises two non-anellovirus ITR sequences that share the same orientation. In embodiments, a genetic element comprises two non-anellovirus ITR sequences with opposite orientations. In embodiments, a genetic element comprises a sequence encoding an effector (e.g., an endogenous effector or an exogenous effector), wherein the effector-encoding sequence shares the same orientation with one or more of the non-anellovirus ITR sequences. In embodiments, the genetic element comprises a sequence encoding an effector (e.g., an endogenous effector or an exogenous effector), wherein the sequence encoding the effector is in the opposite orientation to one or more of the non-anellovirus ITR sequences.

[0431] [Table 61-1]

[0432] [Table 61-2]

[0433] [Table 61-3]

[0434] In some embodiments, the genetic element is a non-anellovillic Rep molecule, such as a Monodnavirus, for example a Shotokuvirus (e.g., Cressdnaviricota (e.g., redondovirus), a circovirus (e.g., porcine circovirus), The virus is capable of undergoing replication in the presence of a Rep protein from a circovirus, e.g., PCV-1 or PCV-2; or Beak and Feather virus), a geminivirus (e.g., Tomato Golden Mosaic virus), or a nanovirus (e.g., BBTV, MDV1, SCSVF, or FBNYV), or a parvovirus (e.g., a dependoparavirus, e.g., bocavirus or AAV), or a polypeptide having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the genetic element is capable of undergoing replication in the presence of an AAV Rep molecule, for example an AAV Rep protein (e.g. an AAV1, AAV2, or AAV5 Rep protein), or a polypeptide having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0435] In some embodiments, the genetic element is linear. In some embodiments, the genetic element is circular. In some embodiments, the genetic element is single-stranded. In some embodiments, the genetic element is double-stranded. In some embodiments, the genetic element consists of at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% DNA. In some embodiments, the genetic element is 100% DNA.

[0436] In some embodiments, the genetic element has one or more of the following characteristics: it does not substantially interact with the host cell's genome, it is an episomal nucleic acid, it is single-stranded DNA, it is circular, it is about 1-10 kb, it resides in the nucleus of the cell, it can be bound by an endogenous protein, it produces an effector such as a polypeptide or nucleic acid (e.g., RNA, iRNA, microRNA) that targets a gene, activity, or function of the host or target cell. In one embodiment, the genetic element is substantially non-interacting DNA. In some embodiments, the genetic element comprises a packaging signal, e.g., a sequence that binds to a capsid protein. In some embodiments, outside the packaging or capsid binding sequences, the genetic elements have less than 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% sequence identity to a wild-type Anellovirus nucleic acid sequence, for example, less than 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% sequence identity to an Anellovirus nucleic acid sequence described herein. In some embodiments, outside the packaging or capsid binding sequences, the genetic elements have less than 500, 450, 400, 350, 300, 250, 200, 150, or 100 contiguous nucleotides that are at least 70%, 75%, 80%, 8%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to an Anellovirus nucleic acid sequence. In certain embodiments, the genetic element is a circular single-stranded DNA comprising a promoter sequence, a sequence encoding a therapeutic effector, and a capsid-associated protein.

[0437] In some embodiments the genetic elements have a length of less than 20 kb (e.g. less than about 19 kb, 18 kb, 17 kb, 16 kb, 15 kb, 14 kb, 13 kb, 12 kb, 11 kb, 10 kb, 9 kb, 8 kb, 7 kb, 6 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb). In some embodiments the genetic elements independently or in addition have a length of more than 1000 b (e.g. at least about 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb, 1.7 kb, 1.8 kb, 1.9 kb, 2 kb, 2.1 kb, 2.2 kb, 2.3 kb, 2.4 kb, 2.5 kb, 2.6 kb, 2.7 kb). kb, 2.8 kb, 2.9 kb, 3 kb, 3.1 kb, 3.2 kb, 3.3 kb, 3.4 kb, 3.5 kb, 3.6 kb, 3.7 kb, 3.8 kb, 3.9 kb, 4 kb, 4.1 kb, 4.2 kb, 4.3 kb, 4.4 kb, 4.5 kb, 4.6 kb, 4.7 kb, 4.8 kb, 4.9 kb, 5 kb or more). In some embodiments the genetic element has a length of about 2.5 to 4.6, 2.8 to 4.0, 3.0 to 3.8, or 3.2 to 3.7 kb. In some embodiments, the genetic elements have a length of about 1.5 to 2.0, 1.5 to 2.5, 1.5 to 3.0, 1.5 to 3.5, 1.5 to 3.8, 1.5 to 3.9, 1.5 to 4.0, 1.5 to 4.5, or 1.5 to 5.0 kb. In some embodiments, the genetic elements have a length of about 2.0 to 2.5, 2.0 to 3.0, 2.0 to 3.5, 2.0 to 3.8, 2.0 to 3.9, 2.0 to 4.0, 2.0 to 4.5, or 2.0 to 5.0 kb. In some embodiments, the genetic elements have a length of about 2.5 to 3.0, 2.5 to 3.5, 2.5 to 3.8, 2.5 to 3.9, 2.5 to 4.0, 2.5 to 4.5, or 2.5 to 5.0 kb. In some embodiments, the genetic element has a length of about 3.0-5.0, 3.5-5.0, 4.0-5.0, or 4.5-5.0 kb. In some embodiments, the genetic element has a length of about 1.5-2.0, 2.0-2.5, 2.5-3.0, 3.0-3.5, 3.1-3.6, 3.2-3.7, 3.3-3.8, 3.4-3.9, 3.5-4.0, 4.0-4.5 kb, or 4.5-5.0 kb. In some embodiments, the genetic element has a length of about 3.6-3.9 kb.In some embodiments the genetic element has a length of about 2.8 to 2.9 kb, hi some embodiments the genetic element has a length of about 2.0 to 3.2 kb.

[0438] In some embodiments, the genetic elements comprise one or more of the features described herein, for example, a sequence encoding a substantially non-pathogenic protein, a protein binding sequence, one or more sequences encoding a regulatory nucleic acid, one or more regulatory sequences, one or more sequences encoding a replication protein, and other sequences.

[0439] In embodiments, the genetic element is produced from double-stranded circular DNA (e.g., produced by in vitro circularization). In embodiments, the genetic element is produced by rolling circle replication from double-stranded circular DNA. In some embodiments, the rolling circle replication occurs in a cell (e.g., a host cell, e.g., a mammalian cell, e.g., a human cell, e.g., HEK293T, A549 cell, or Jurkat cell). In embodiments, the genetic element may be exponentially amplified by rolling circle replication in the cell. In embodiments, the genetic element may be linearly amplified by rolling circle replication in the cell. In embodiments, the double-stranded circular DNA or genetic element may be produced at least 2, 4, 8, 16, 32, 64, 128, 256, 518, or 1024 times or more of the initial amount by rolling circle replication in the cell. In embodiments, the double-stranded circular DNA or genetic element has been introduced into the cell, e.g., as described herein.

[0440] In some embodiments, the double-stranded circular DNA and / or genetic elements do not comprise one or more bacterial plasmid elements (e.g., a bacterial origin of replication or a selectable marker, e.g., a bacterial resistance gene). In some embodiments, the double-stranded circular DNA and / or genetic elements do not comprise a bacterial plasmid backbone.

[0441] In some embodiments, the invention includes a genetic element comprising a nucleic acid sequence (e.g., a DNA sequence) encoding (i) a substantially non-pathogenic foreign protein, (ii) an foreign protein binding sequence that binds the genetic element to the substantially non-pathogenic foreign protein, and (iii) a regulatory nucleic acid. In such embodiments, the genetic element may comprise one or more sequences having at least about 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% nucleotide sequence identity to any one of the nucleotide sequences compared to a native viral sequence (e.g., a native Anellovirus sequence described herein).

[0442] Protein-binding sequence A strategy used by many viruses is for the viral capsid protein to recognize specific protein-binding sequences within its genome. For example, viruses with non-segmented genomes, such as yeast LA virus, have a secondary structure (stem-loop) and specific sequences at the 5' end of the genome, both of which are used for binding to the viral capsid protein. However, viruses with segmented genomes, such as Reoviridae, Orthomyxoviridae (influenza), Bunyaviruses, and Arenaviruses, require packaging of each genome segment. Some viruses use complementary regions of the segments to facilitate the virus containing each genome molecule. Other viruses have specific binding sites for each of the various segments. See, for example, Curr Opin Struct Biol. 2010 Feb;20(1):114-120; and Journal of Virology (2003), 77(24), 13036-13041.

[0443] In some embodiments, the genetic element encodes a protein binding sequence that binds to a substantially non-pathogenic protein. In some embodiments, the protein binding sequence promotes packaging of the genetic element into a proteinaceous exterior. In some embodiments, the protein binding sequence specifically binds to an arginine-rich region of the substantially non-pathogenic protein. In some embodiments, the genetic element comprises a protein binding sequence as described in Example 8 of PCT / US19 / 65995.

[0444] In some embodiments, the genetic element comprises a protein binding sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a 5'UTR conserved domain or a G...

Claims

1. A particle comprising (i) an AAV origin of replication, and (ii) a circular DNA comprising a promoter operably linked to a sequence encoding a therapeutic RNA or polypeptide, wherein the circular DNA is encapsidated by a capsid comprising an anellovirus ORF1 molecule.

2. The particle described in claim 1, wherein the circular DNA further comprises an anellovirus 5'UTR conserved domain, an anellovirus GC-rich region, and / or an anellovirus 3'UTR, or any combination thereof.

3. a) a proteinaceous exterior comprising an anellovirus ORF1 molecule; and b) a genetic element comprising a non-anelloviral origin of replication; Particles containing.

4. The particle described in claim 3, wherein the genetic element further comprises (i) a nucleic acid sequence encoding an exogenous effector, and / or (ii) a promoter element operably linked to the nucleic acid sequence encoding the exogenous effector.

5. The particle described in claim 4, wherein the exogenous effector is a therapeutic exogenous effector, and optionally, the therapeutic exogenous effector is a therapeutic RNA or polypeptide.

6. A particle described in any of claims 3 to 5, wherein the non-anellovirus replication origin is derived from a DNA virus.

7. The particle described in claim 6, wherein the DNA virus is a single-stranded DNA (ssDNA) virus and / or a linear ssDNA virus.

8. The non-anellovirus origin of replication, (a) derived from a monodnavirus; (b) is an AAV origin of replication; and / or (c) (i) an AAV Rep binding motif (RBM), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (ii) an AAV terminal cleavage site (TRS), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or (iii) Inverted terminal repeats (ITR) The particle according to any one of claims 3 to 7, comprising:

9. The genetic element comprising: (a) is linear; (b) is cyclic; (c) comprises DNA; and / or (d) is single-stranded DNA; The particle according to any one of claims 3 to 8.

10. A particle described in any of claims 4 to 9, wherein the promoter element is endogenous to anellovirus or endogenous to AAV.

11. The genetic element comprising: (a) anellovirus 5′UTR, anellovirus GC-rich region, and / or anellovirus 3′UTR, or any combination thereof; and / or (b) A second AAV origin of replication The particle according to any one of claims 3 to 10, further comprising:

12. The particle described in claim 11, wherein the second AAV replication origin is contained in a second AAV inverted terminal repeat (ITR).

13. The second ITR, (i) have the same orientation with respect to the first ITR; and / or (ii) has the same sequence as the first ITR; 13. The particle according to claim 12.

14. A particle described in any of claims 3 to 13, wherein the anellovirus ORF1 molecule comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to an alphatorque virus, betatorque virus, or gammatorque virus ORF1 protein.

15. An anellovirus 5'UTR conserved domain and / or an anellovirus GC-rich region; and For example, the AAV origin of replication contained in the first AAV inverted terminal repeat (ITR); Optionally, a nucleic acid sequence encoding an exogenous effector (e.g., a therapeutic exogenous effector); and Optionally, a promoter element operably linked to said nucleic acid sequence encoding said exogenous effector. A genetic element comprising:

16. a) a first nucleic acid which is a genetic element or a genetic element construct comprising: For example, the AAV origin of replication contained in the first AAV inverted terminal repeat (ITR); Optionally, a nucleic acid sequence encoding an exogenous effector (e.g., a therapeutic exogenous effector); and Optionally, a promoter element operably linked to the nucleic acid sequence encoding the exogenous effector; A first nucleic acid comprising: b) a second nucleic acid encoding an anellovirus ORF1 molecule; A system including:

17. A composition for use in a method of delivering an exogenous effector to a target cell (e.g. a vertebrate cell, e.g. a mammalian cell, e.g. a human cell), said composition comprising a particle according to any one of claims 1 to 14, and said method comprising introducing said particle into said cell.

18. A pharmaceutical composition for use in the treatment or prevention of a disease or disorder in a subject in need thereof, said pharmaceutical composition comprising particles according to any one of claims 1 to 14.

19. 1. A method of making a therapeutic composition comprising: (a) (i) AAV origin of replication, (ii) a promoter operably linked to a sequence encoding a therapeutic effector (e.g., a therapeutic RNA or polypeptide); (iii) a sequence encoding an anellovirus ORF1 molecule; (iv) optionally, a sequence encoding an anellovirus ORF2 molecule; (v) optionally, a sequence encoding an AAV REP2 sequence, and (vi) optionally, a sequence encoding one or more of the helper proteins, e.g., adenoviral helper proteins, e.g., an E2A molecule, an adenoviral E4 molecule, and / or an adenoviral VARN molecule; providing one or more host cells comprising exogenous DNA comprising: (b) culturing the one or more host cells under conditions suitable for the formation of particles (e.g., anaerovectors) that comprise a proteinaceous exterior (e.g., capsid) that comprises a sufficient number of ORF1 molecules to encase (e.g., encapsidate) the genetic element; and (c) purifying the particles produced in step (b) from the cell culture; thereby producing a therapeutic composition. A method comprising: