Humanized antibody against iRhom2

Abstract

The present invention relates to humanized antibodies or target-binding fragments or derivatives thereof that retain target-binding ability, which bind to human iRhom2 (FIG. 1).

Description

[Technical field]

[0001] The present application relates to a humanized antibody against iRhom2. [Background technology]

[0002] ADAM metallopeptidase domain 17 (ADAM17) (NCBI reference for human ADAM17: NP_003174), also known as TACE (tumor necrosis factor-α converting enzyme), is an enzyme that belongs to the ADAM protein family of disintegrins and metalloproteases. It is a polypeptide of 824 amino acids.

[0003] ADAM17 is understood to be involved in the processing of tumor necrosis factor alpha (TNF-α) from the cell surface and from within intracellular membranes in the trans-Golgi network. This process, also known as "shedding," involves the cleavage and release of soluble ectodomains from membrane-bound proproteins (such as pro-TNF-α) and is known to be physiologically important. ADAM17 was the first "sheddase" to be identified and is also understood to play a role in the release of membrane-anchored cytokines, cell adhesion molecules, receptors, ligands, and enzymes.

[0004] Cloning of the TNF-α gene revealed that it encodes a 26 kDa type II transmembrane propolypeptide that becomes inserted into the plasma membrane upon translocation within the endoplasmic reticulum. At the cell surface, pro-TNF-α is biologically active and can induce immune responses via juxta-crine cell-cell signaling. However, pro-TNF-α can undergo proteolytic cleavage at its Ala76-Val77 amide bond, which releases a soluble 17 kDa extracellular domain (ectodomain) from the pro-TNF-α molecule. This soluble ectodomain is the cytokine commonly known as TNF-α, and is crucial in the paracrine signaling of this molecule. This proteolytic release of soluble TNF-α is catalyzed by ADAM17.

[0005] ADAM17 also regulates the MAP kinase signaling pathway by regulating the cleavage of the EGFR ligand amphiregulin in the mammary gland. ADAM17 is important for activating several ligands for EGFR, TGFα, AREG, EREG, HB-EGF, and Epigen. In addition, ADAM17 is involved in the cleavage of L-selectin, a cell adhesion molecule.

[0006] Recently, ADAM17 has been identified as a critical mediator of resistance to radiotherapy, and it has been shown that radiotherapy activates ADAM17, leading to the cleavage of multiple survival factors, activation of growth factor pathways, and resistance to radiotherapy in non-small cell lung cancer.

[0007] ADAM17 is thought to be a crucial factor in the release of various pathogenic and non-pathogenic factors, including TNFα, and has therefore become a promising therapeutic target, leading to numerous attempts to develop ADAM17 inhibitors.

[0008] However, to date, no such inhibitors have proven clinically successful.

[0009] It is therefore an object of the present invention to provide new techniques that allow for the control, modulation, reduction or inhibition of ADAM17 activity.

[0010] It is another object of the present invention to provide new approaches that allow the treatment of inflammatory diseases.

[0011] These and other objects are solved by the features of the independent claims. The dependent claims disclose embodiments of the invention that may be preferred in particular circumstances. Similarly, the specification discloses further embodiments of the invention that may be preferred in particular circumstances. Summary of the Invention

[0012] The present invention provides humanized antibodies that specifically bind to human iRhom2. In one embodiment, these antibodies inhibit and / or reduce TACE / ADAM17 activity upon binding to human iRhom2. [Brief description of the drawings]

[0013] [Figure 1] Figure 1 shows the results of antibody affinity determination by FACS (fluorescence activated cell sorting) Scatchard analysis of genetically engineered mouse L929 cell populations expressing ectopically expressed T7-tagged full-length (FL) wild-type (WT) human iRhom2 by L929-2041-hiR2-FL-WT-T7 (SEQ ID NO: 49). These results showed that the KD values ​​for binding of humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 to L929-2041-hiR2-FL-WT-T7 cells were in the sub-nanomolar to low nanomolar range. [Figure 2a] Figure 2a shows the results of FACS analysis of genetically engineered mouse embryonic fibroblast (MEF) populations, showing that T7-tagged variants of human and mouse iRhom2 full-length wild type ectopically expressed by MEF-DKO-hiR2-FL-WT-T7 (SEQ ID NO: 49) and MEF-DKO-miR2-FL-WT-T7 (SEQ ID NO: 51) cells, respectively, are localized to the surface of these cells. Staining: grey = secondary antibody only, black = anti-T7 antibody. [Figure 2b] Figure 2b shows the results of FACS analysis to determine mouse cross-reactivity of the antibodies of the invention. Humanized antibody 16-B-03, as a representative example of the antibodies of the invention, clearly recognizes the human iRhom2 variant ectopically expressed by MEF-DKO-hiR2-FL-WT-T7, but does not recognize the mouse iRhom2 variant ectopically expressed by MEF-DKO-miR2-FL-WT-T7 cells, and therefore does not cross-react with mouse iRhom2. Staining: grey = secondary antibody only, black = antibody 16-B-03 [Figure 3a]Figure 3a shows the results of FACS analysis of engineered MEF populations, showing that T7-tagged variants of human iRhom1 full-length wild-type ectopically expressed by MEF-DKO-hiR1-FL-WT-T7 (SEQ ID NO: 50) and human iRhom2 full-length wild-type ectopically expressed by MEF-DKO-hiR2-FL-WT-T7 (SEQ ID NO: 49) are localized to the surface of these cells. Staining: grey = secondary antibody only, black = anti-T7 antibody. [Figure 3b] Figure 3b shows the results of FACS analysis to determine the specificity of the antibodies of the invention, showing that the humanized antibody 16-B-03, as a representative example of the antibodies of the invention, does not recognize the closely related human iRhom1 variant ectopically expressed by MEF-DKO-hiR1-FL-WT-T7 (SEQ ID NO: 50) cells, in contrast to the human iRhom2 variant ectopically expressed by MEF-DKO-hiR2-FL-WT-T7 (SEQ ID NO: 49) cells, and is therefore specific for human iRhom2. Staining: grey = secondary antibody only, black = antibody 16-B-03 [Figure 4a] Figure 4a shows the results of FACS analysis of engineered MEF populations and shows that a T7-tagged version of full-length wild-type rhesus iRhom1 ectopically expressed in MEF-DKO-Rhesus-iR1-FL-WT-T7 (Uniplot Identifier: F6ZPC8) cells and a T7-tagged version of full-length wild-type rhesus iRhom2 ectopically expressed in MEF-DKO-Rhesus-iR2-FL-WT-T7 (Uniplot Identifier: F6Y4X6) cells localize to the cell surface. Staining: grey = secondary antibody only, black = anti-T7 antibody. [Figure 4b]FIG. 4b shows the results of FACS analysis to determine the cross-reactivity of the antibodies of the invention to rhesus monkeys, showing that the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04, as representative examples of the antibody 16-B-03 of the invention, clearly recognize the rhesus iRhom2 variant ectopically expressed by MEF-DKO-Rhesus-iR2-FL-WT-T7, but do not bind to the rhesus iRhom1 variant ectopically expressed in MEF-DKO-Rhesus-iR1-FL-WT-T7 cells, and thus cross-react with rhesus iRhom2 but not with rhesus iRhom1. Staining: grey = secondary antibody only, black = antibody 16-B-03 [Figure 5a] Figure 5a shows FACS analysis of engineered MEF populations showing that T7-tagged versions of full-length wild-type cyno iRhom1 and cyno iRhom2 localized to the cell surface when ectopically expressed in MEF-DKO-Cyno-iR1-FL-WT-T7 (UniProt Identifier: A0A2K5TUM2) and MEF-DKO-Cyno-iR2-FL-WT-T7 (UniProt Identifier: A0A2K5TX07) cells, respectively. Staining: grey = secondary antibody only, black = anti-T7 antibody. [Figure 5b] FIG. 5b shows the results of FACS analysis to determine the cross-reactivity of the antibodies of the invention to cynomolgus monkeys, showing that the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04, as representative examples of the antibody 16-B-03 of the invention, clearly recognize the cynomolgus monkey iRhom2 variant ectopically expressed by MEF-DKO-Cyno-iR2-FL-WT-T7, but do not bind to the cynomolgus monkey iRhom1 variant ectopically expressed in MEF-DKO-Cyno-iR1-FL-WT-T7 cells, and thus cross-react with cynomolgus monkey iRhom2 but not with cynomolgus monkey iRhom1. Staining: grey = secondary antibody only, black = antibody 16-B-03 [Figure 6a]Figure 6a shows the results of FACS analysis of engineered MEF populations and shows that a T7-tagged version of full-length wild-type canine iRhom1 ectopically expressed in MEF-DKO-Dog-iR1-FL-WT-T7 (Uniprot Identifier: A0A5F4CNN3) cells and a T7-tagged version of full-length wild-type canine iRhom2 ectopically expressed in MEF-DKO-Dog-iR2-FL-WT-T7 (Uniprot Identifier: Q00M95) cells are localized to the cell surface. Staining: grey = secondary antibody only, black = anti-T7 antibody. [Figure 6b] FIG. 6b shows the results of FACS analysis to determine the cross-reactivity of the antibodies of the invention to dogs, showing that the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04, as representatives of the antibody 16-B-03 of the invention, clearly recognize the canine iRhom2 variant ectopically expressed by MEF-DKO-Dog-iR2-FL-WT-T7, but do not bind to the canine iRhom1 variant ectopically expressed in MEF-DKO-Dog-iR1-FL-WT-T7 cells, and thus cross-react with canine iRhom2 but not with canine iRhom1. Staining: grey = secondary antibody only, black = antibody 16-B-03 [Figure 7a] Figure 7a shows the results of FACS analysis of engineered MEF populations and shows that a T7-tagged version of full-length wild-type rabbit iRhom1 ectopically expressed in MEF-DKO-Rabbit-iR1-FL-WT-T7 (Uniprot Identifier: B8K128) cells and a T7-tagged version of full-length wild-type rabbit iRhom2 ectopically expressed in MEF-DKO-Rabbit-iR2-FL-WT-T7 (Uniprot Identifier: G1T7M2) cells are localized to the cell surface. Staining: grey = secondary antibody only, black = anti-T7 antibody. [Figure 7b]Figure 7b shows the results of FACS analysis to determine the cross-reactivity of the antibodies of the invention to rabbits, showing that the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04, as representatives of the antibody 16-B-03 of the invention, clearly recognize the rabbit iRhom2 variant ectopically expressed by MEF-DKO-Rabbit-iR2-FL-WT-T7, but do not bind to the rabbit iRhom1 variant ectopically expressed in MEF-DKO-Rabbit-iR1-FL-WT-T7 cells, and thus cross-react with rabbit iRhom2 but not with rabbit iRhom1. Staining: grey = secondary antibody only, black = antibody 16-B-03. [Figure 8a] Figure 8a shows the results of a TNFα release assay demonstrating that humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibit LPS-induced cleavage of TNFα in THP-1 cells. The data shows the effect of test articles on the absolute amount of TNFα released. [Figure 8b] FIG. 8b refers to the results depicted in FIG. 8a and shows the effect of the test articles on TNFα release as percent inhibition. [Figure 9a] Figure 9a shows the results of a TNFα release assay demonstrating that humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibit PMA-induced cleavage of TNFα in U937 cells. The data shows the effect of test articles on the absolute amount of TNFα released. [Figure 9b] FIG. 9b refers to the results of FIG. 9a and shows the effect of the test articles on TNFα release as percent inhibition. [Figure 10a] Figure 10a shows the results of an IL-6R release assay showing that humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibit PMA-induced IL-6R cleavage in THP-1 cells. The data shows the effect of the test article on the absolute number of released IL-6R. [Figure 10b] FIG. 10b refers to the results of FIG. 10a and shows the effect of the test article on IL-6R release as percent inhibition. [Figure 11a] Figure 11a shows the results of an IL-6R release assay demonstrating that humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibit PMA-induced IL-6R cleavage in U937 cells. The data shows the effect of test articles on the absolute number of released IL-6R. [Figure 11b] FIG. 11b refers to the results of FIG. 11a and shows the effect of the test article on IL-6R release as percent inhibition. [Figure 12a] Figure 12a shows the results of an HB-EGF release assay demonstrating that humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibit PMA-induced cleavage of HB-EGF in THP-1 cells. The data shows the effect of the test article on the absolute amount of HB-EGF released. [Figure 12b] FIG. 12b refers to the results of FIG. 12a and shows the effect of the test article on HB-EGF release as percent inhibition. [Figure 13a] Figure 13a shows the results of an HB-EGF release assay demonstrating that humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibit PMA-induced cleavage of HB-EGF in U937 cells. The data shows the effect of test article on the absolute amount of HB-EGF released. [Figure 13b] FIG. 13b refers to the results of FIG. 13a and shows the effect of the test article on HB-EGF release as percent inhibition. [Figure 14a] Figure 14a shows the results of a TGFα release assay demonstrating that humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 weakly inhibit PMA-induced TGFα cleavage in PC3 cells. The data shows the effect of test articles on the absolute amount of TGFα released. [Figure 14b] FIG. 14b refers to the results of FIG. 14a and shows the effect of the test article on TGFα release as an inhibition rate. [Figure 15] FIG. 15 shows the results of FACS analysis to determine the specificity of the antibodies of the present invention, showing that humanized antibody 42-B-02, a representative example of the antibodies of the present invention, binds to RPMI-8226 cells (left panel) and THP-1 cells (middle panel), both of which endogenously express iRhom2, but does not bind to RH-30 cells (right panel), which do not endogenously express iRhom2, and specifically recognizes endogenous human iRhom2. The antibodies analyzed were each transiently expressed in CHO cells with their respective heavy chain / kappa light chain pairs. Staining: grey = secondary antibody only, black = humanized antibody 42-B-02 [Figure 16a] Figure 16a shows the results of FACS analysis of MEF populations with single amino acid substitutions or deletions within the large extracellular loop (AA502 to AA594 of human iRhom2) engineered for epitope definition. The data show that a T7-tagged variant of human iRhom2 full-length wild type ectopically expressed in MEF-DKO-hiR2-FL-WT-T7 cells, as well as the T7-tagged human iRhom2 variant ectopically expressed in MEF-DKO-hiR2-FL-K536A-T7 cells, localize to the surface of these cells. Staining: grey = secondary antibody only, black = anti-T7 antibody. [Figure 16b]Figure 16b shows the results of a TGFα release assay (cleavage assay), which indicates that all 137 human iRhom2 variants (except for human iRhom2 variants hiR2-FL-C516A, hiR2-FL-F523A, hiR2-FL-C549A, hiR2-FL-D552A, hiR2-FL-C556A, hiR2-FL-P559A, hiR2-FL-W567A, hiR2-FL-W574A, and hiR2-FL-C577A) with single amino acid substitutions or deletions within the large extracellular loop (AA502 to AA594 in human iRhom2) are functionally active and, to varying degrees, are able to support PMA-stimulated TGFα cleavage, indicating that these variants are likely to be properly folded. [Figure 17a] Figure 17a shows the results of FACS analysis for epitope determination of the antibodies of the invention. Data from the analysis of MEF-DKO-hiR2-FL-K536A-T7 cells ectopically expressing the human iRhom2 variant hiR2-FL-K536A as an example of a full panel of 128 functional human iRhom2 variants with single amino acid substitutions or deletions within the large extracellular loop (AA502 to AA594 of human iRhom2) are shown. The data show that the substitution of the single amino acid alanine for leucine 536 in human iRhom2 strongly inhibits and thus contributes to the binding of humanized antibody 42-B-02, a representative example of an antibody of the invention. Staining: grey = secondary antibody only, black = humanized antibody 42-B-02 [Figure 17b] Figure 17b summarizes the results of FACS analysis of all antibodies of the invention against a panel of 128 engineered functional MEF populations ectopically expressing human iRhom2 variants with single amino acid substitutions or deletions within the large extracellular loop (AA502-AA594 of human iRhom2). The data revealed a related pattern of amino acid positions associated with iRhom2 binding of the antibodies of the invention. [Figure 18a]Figure 18a shows the results of a TNFα release assay, showing that all antibodies of the invention inhibit LPS-induced cleavage of TNFα in human peripheral blood mononuclear cells (PBMCs) isolated from healthy donors. The data shows the effect of the test articles on the absolute amount of TNFα released. The humanized antibodies analyzed were transiently expressed in CHO cells with their respective heavy chain / kappa light chain pairs. [Figure 18b] FIG. 18b refers to the results depicted in FIG. 18a and shows the effect of the test articles on TNFα release as percent inhibition. [Figure 19a] Figure 19a shows the results from an IL-6R release assay, showing that all antibodies of the invention block PMA-induced IL-6R cleavage in human peripheral blood mononuclear cells (PBMCs) isolated from healthy donors. The data show the effect of the test article on the absolute number of released IL-6R. The humanized antibodies analyzed were transiently expressed in CHO cells with their respective heavy chain / kappa light chain pairs. [Figure 19b] FIG. 19b refers to the results of FIG. 19a and shows the effect of the test article on IL-6R release as percent inhibition. [Figure 20a] Figure 20a shows the results from an HB-EGF release assay, demonstrating that all antibodies of the invention block PMA-induced cleavage of HB-EGF in human peripheral blood mononuclear cells (PBMCs) isolated from healthy donors. The data shows the effect of the test articles on the absolute amount of HB-EGF released. The humanized antibodies analyzed were transiently expressed in CHO cells with their respective heavy chain / kappa light chain pairs. [Figure 20b] FIG. 20b refers to the results of FIG. 20a and shows the effect of the test product on HB-EGF release as an inhibition rate. [Figure 21a]Figure 21a shows the results of an in vivo septic shock model using genetically humanized mice, in which the humanized antibody 42-B-02, as a representative example of the antibody of the present invention, inhibits LPS-induced cleavage of TNFα in genetically humanized mice. The data show the effect of the test article on the absolute amount of TNFα released. The analyzed humanized antibodies were transiently expressed in CHO cells with their respective heavy chain / kappa light chain pairs. [Figure 21b] FIG. 21b refers to the results depicted in FIG. 21a and shows the effect of test article on TNFα release as a percentage compared to buffer-treated control animals, which was set at 100%. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] (Detailed Description) According to one aspect of the present invention, a) SEQ ID NOs: 1 and 5; SEQ ID NOs: 9 and 13; SEQ ID NOs: 17 and 21; SEQ ID NOs: 25 and 29; SEQ ID NOs: 33 and 37; or SEQ ID NOs: 41 and 45 or a set of three heavy and three light chain complementarity determining regions (CDRs) comprising one of the heavy chain / light chain variable domain sequence pairs of b) SEQ ID NOs: 2, 3, 4, 6, 7 and 8; SEQ ID NOs: 10, 11, 12, 14, 15 and 16, SEQ ID NOs: 18, 19, 20, 22, 23 and 24, SEQ ID NOs: 26, 27, 28, 30, 31 and 32, SEQ ID NOs: 34, 35, 36, 38, 39 and 40, or SEQ ID NOs: 42, 43, 44, 46, 47 and 48, or a set of three heavy chain and three light chain complementarity determining regions (CDRs) selected from c) a set of heavy / light chain complementarity determining regions (CDRs) of b), with the proviso that at least one of the CDRs has up to three amino acid substitutions relative to the respective SEQ ID NO:; and / or d) a set of heavy / light chain complementarity determining regions (CDRs) of b) or c), with the proviso that at least one of the CDRs has a sequence identity of 66% or more to the respective SEQ ID NO; The CDRs are embedded in a suitable protein framework, preferably a variable domain framework, so as to be capable of binding to human iRhom2. A humanized antibody that binds to iRhom2, or a target-binding fragment or derivative thereof that retains target-binding ability, is provided.

[0015] In one embodiment, the CDRs are determined according to the Kabat, Chothia or MacCallum definitions; preferably, the CDRs are determined according to the numbering shown in Table 1.

[0016] Methods for the production and / or selection of humanized mAbs are known in the art, for example US6331415 by Genentech describes the production of chimeric antibodies, while US6548640 by the Medical Research Council describes CDR grafting technology, and US5859205 by Celltech describes the production of humanized antibodies.

[0017] A humanized antibody is an antibody whose complementarity determining regions are derived from a parent antibody taken from a species other than human and grafted onto the framework (at least the variable domains) of a human antibody, e.g., IgG1, IgG2, or IgG4. Humanized antibodies bind to the same targets as the parent antibody, but because they are grafted onto a human framework, they are less immunogenic (e.g., HAMA response). Thus, humanized antibodies are structurally distinct from the parent (e.g., murine) antibody.

[0018] In humanization, the step of grafting the CDRs onto a human framework is often followed by a step of affinity maturation to regain the affinity lost in the grafting process, which further modifies the sequence of the human antibody, including the CDRs.

[0019] In one embodiment, the CDRs are embedded in a suitable protein framework such that they are capable of inhibiting or reducing TACE / ADAM17 activity.

[0020] Inactive rhomboid family member 2 (iRhom2) is a protein encoded by the RHBDF2 gene in humans. It is a transmembrane protein of approximately 850 amino acids and has seven transmembrane domains. There are different isoforms of iRhom2. The experiments performed here have been established using the isoform defined as NCBI reference NP_078875.4. However, the teachings are transferable to other isoforms of iRhom2, as shown in the following table, but are not limited thereto: JPEG2024510415000002.jpg23170

[0021] As used herein, the term "inhibiting and / or reducing TACE / ADAM17 activity" is meant to describe the effect caused by an antibody or fragment thereof that inhibits or reduces the activity of TACE / ADAM17 as measured, for example, in a respective cleavage assay (see, for example, Figure 8 and Example 6).

[0022] ADAM metallopeptidase domain 17 (ADAM17), also known as TACE (tumor necrosis factor-α converting enzyme), is an enzyme that belongs to the ADAM protein family of disintegrins and metalloproteases. ADAM17 is understood to be involved in the processing of tumor necrosis factor α (TNF-α) from the cell surface and from within intracellular membranes of the trans-Golgi network. This process, also known as "shedding," involves the cleavage and release of soluble ectodomains from membrane-bound proproteins (such as pro-TNF-α) and is known to be physiologically important. ADAM17 was the first "sheddase" to be identified and is also understood to play a role in the release of a variety of membrane-anchored cytokines, cell adhesion molecules, receptors, ligands, and enzymes.

[0023] Cloning of the TNF-α gene revealed that TNF-α encodes a 26 kDa type II transmembrane propolypeptide that is inserted into the cell membrane during maturation. At the cell surface, proTNF-α is biologically active and can induce immune responses through juxta-crine cell-cell signaling. However, proTNF-α can undergo proteolytic cleavage at its Ala76-Val77 amide bond, which releases a soluble 17 kDa extracellular domain (ectodomain) from the proTNF-α molecule. This soluble ectodomain is the cytokine commonly known as TNF-α, which is crucial in paracrine signaling. This proteolytic release of soluble TNF-α is catalyzed by ADAM17.

[0024] Recently, ADAM17 was discovered as a critical mediator of resistance to radiotherapy, and it was shown that radiotherapy activates ADAM17, leading to the cleavage of multiple survival factors, activation of growth factor pathways, and resistance to radiotherapy.

[0025] ADAM17 also regulates the cleavage of the EGFR ligand amphiregulin in the mammary gland, thereby regulating the MAP kinase signaling pathway. Furthermore, ADAM17 is involved in the cleavage of the cell adhesion molecule L-selectin.

[0026] As used herein, the term "CDR" or "complementarity determining region" is intended to mean the non-contiguous antigen binding sites found in the variable regions of both heavy and light chain polypeptides. These particular regions are described by Kabat et al. (1977), Kabat et al. (1991), Chothia et al. (1987) and MacCallum et al. (1996), where the definitions include overlapping or subsets of amino acid residues when compared with each other. Nevertheless, application of either definition to refer to the CDRs of an antibody or grafted antibody or variants thereof is intended to be within the scope of the term as defined and used herein. The amino acid residues encompassing the CDRs defined by each of the above references are shown below in Table 1 for comparison. [Table 1]

[0027] As used herein, the term "framework" when used in reference to an antibody variable domain is intended to mean all amino acid residues in the variable domain of an antibody outside the CDR regions. Thus, although the framework of a variable domain is about 100-120 amino acids in length, it is intended to refer only to the amino acids outside the CDRs.

[0028] As used herein, the term "capable of binding to target X" refers to a binding domain that is capable of binding to 10 -4 The following K D It should be understood as meaning that the target is bound by K D is the equilibrium dissociation constant, k between an antibody or fragment and its antigen off / k on is the ratio of K Dand affinity are inversely related. D The K value is related to the antibody or fragment concentration (the amount of antibody or fragment needed for a particular experiment) and therefore D Lower values ​​(lower concentrations) indicate higher affinity for the binding domain. The following table shows typical K values ​​for monoclonal antibodies: D The range is shown. [Table 2] Preferably, the antibody or fragment has up to two amino acid substitutions, more preferably up to one amino acid substitution.

[0029] Preferably, at least one of the CDRs of the antibody or fragment has 67% or more, 68% or more, 69% or more, 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76%, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, and most preferably 100% sequence identity to the respective SEQ ID NO.

[0030] As used herein, the "percentage of sequence identity" is determined by comparing two optimally aligned biological sequences (amino acid sequences or polynucleotide sequences) over a comparison window, where the corresponding sequence portions in the comparison window may contain additions or deletions (i.e., gaps) compared to a reference sequence that does not contain additions or deletions due to optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which identical nucleic acid bases or amino acid residues occur in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity.

[0031] The term "identical" or percent "identity" refers to two or more sequences or subsequences that are the same sequence, with respect to two or more nucleic acid or polypeptide sequences. Two sequences are "substantially identical" if they have a specified percentage of the same amino acid residues or nucleotides (i.e., at least 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity over a specified region, or, if not specified, the entire reference sequence) when compared and aligned for maximum correspondence over a comparison window or specified region, using one of the sequence comparison algorithms described below, or by manual alignment and visual inspection. The present disclosure provides polypeptides that are substantially identical to the polypeptides exemplified herein. With respect to amino acid sequences, identity or substantial identity can exist over a region that is at least 5, 10, 15 or 20 amino acids in length, in some cases at least about 25, 30, 35, 40, 50, 75 or 100 amino acids in length, in some cases at least about 150, 200 or 250 amino acids in length, or over the entire length of the reference sequence. For shorter amino acid sequences, for example sequences of 20 or fewer amino acids, substantial identity exists if one or two amino acid residues are conservatively substituted in accordance with conservative substitutions as defined herein.

[0032] Preferably, at least one of the CDRs has been subject to CDR sequence modifications, including affinity maturation Reduced immunogenicity The process of increasing the affinity of a given antibody in vitro by affinity maturation. Similar to its natural counterpart, in vitro affinity maturation is based on the principle of mutation and selection. It has been successfully used to optimize antibodies, antibody fragments or other peptide molecules such as antibody mimetics. Random mutations within the CDRs are introduced using radiation, chemical mutagens or error-prone PCR. Furthermore, genetic diversity can be increased by chain shuffling. Two or three rounds of mutation and selection using display methods such as phage display usually result in antibody fragments with affinities in the low nanomolar range. For the principles, see Eylenstein et al. (2016) or US20050169925A1, the contents of which are incorporated herein by reference for purposes of enablement.

[0033] The antibody produced contains the CDR region from mouse sequence, together with the necessary framework back mutations in the V region from sequence. Therefore, when the humanized antibody is administered to a patient, the CDR itself can cause an immunogenic response. Methods for reducing the immunogenicity caused by CDR are disclosed in Harding et al. (2010) or US2014227251A1, the contents of which are incorporated herein by reference for the purpose of enablement.

[0034] According to one embodiment of the invention, the antibody or fragment comprises: a) A pair of heavy chain / light chain variable domains (HCVD / LCVD) as shown in the pair of SEQ ID NOs: 1 and 5; 9 and 13; 17 and 21; 25 and 29; 33 and 37 and / or 41 and 45 b) a pair of heavy chain / light chain variable domains (HCVD / LCVD) of a), provided that The HCVD has 80% or greater sequence identity to each SEQ ID NO: and / or LCDVD is a set of pairs of sequences that have 80% or more sequence identity to each other. c) a heavy / light chain variable domain (VD) pair of a) or b), with the proviso that at least one of the HCVD or LCVD has up to 10 amino acid substitutions relative to its respective SEQ ID NO; The antibody or fragment may bind to human iRhom2 and / or inhibit or reduce TACE / ADAM17 activity.

[0035] A "variable domain" as used in reference to an antibody or its heavy or light chain is intended to mean a portion of an antibody that confers antigen binding on the molecule and is not a constant region. The term is intended to include functional fragments thereof that maintain some of the binding functions of the entire variable region. Variable region binding fragments include functional fragments such as, for example, Fab, F(ab)2, Fv, single chain Fv (scfv), etc. Such functional fragments are well known to those skilled in the art. Thus, the use of these terms in describing functional fragments of heteromeric variable regions is intended to correspond to the definitions well known to those skilled in the art. Such terms are described, for example, in Huston et al., (1993) or Pluckthun and Skerra (1990).

[0036] Preferably, the HCVD and / or LCVD have ≧81%;≧82%;≧83%;≧84%;≧85%;≧86%;≧87%;≧88%;≧89%;≧90%;≧91%;≧92%;≧93%;≧94%;≧95%;≧96%;≧97%;≧98%;≧99%; or most preferably 100% sequence identity to their respective SEQ ID NOs.

[0037] According to one embodiment of the invention, at least one amino acid substitution is a conservative amino acid substitution.

[0038] As used herein, "conservative amino acid substitutions" have a smaller effect on antibody function than non-conservative substitutions. Although there are many ways to classify amino acids, they are often divided into six major groups based on their structure and the general chemical properties of the R groups.

[0039] In some embodiments, a "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. For example, families of amino acid residues having similar side chains have been defined in the art. These families include: Basic side chains (lysine, arginine, histidine, etc.), Acidic side chains (aspartic acid, glutamic acid, etc.), Uncharged polar side chains (glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, etc.), Non-polar side chains (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, etc.), β-branched side chains (threonine, valine, isoleucine, etc.) Aromatic side chains (tyrosine, phenylalanine, tryptophan, histidine, etc.).

[0040] Other conservative amino acid substitutions can also occur across amino acid side chain families, such as the substitution of aspartic acid for asparagine to modify the charge of the peptide. Conservative changes can also include the substitution of chemically homologous non-natural amino acids (i.e., synthetic non-natural hydrophobic amino acids for leucine, synthetic non-natural aromatic amino acids for tryptophan).

[0041] According to one embodiment of the invention, the antibody or fragment has at least one of the following: a target binding affinity for human iRhom2 of 50% or more compared to the antibody or fragment according to any one of the preceding claims, and / or The inhibitory or reducing effect of the antibody or fragment according to any one of the preceding claims on TACE / ADAM17 activity is 50% or more.

[0042] As used herein, the term "binding affinity" is intended to mean the strength of binding interaction, and thus includes both actual binding affinity and apparent binding affinity. Actual binding affinity is the ratio of the association rate to the dissociation rate. Thus, conferring or optimizing binding affinity includes modifying either or both of these components to achieve a desired level of binding affinity. Apparent affinity can include, for example, the avidity of the interaction. For example, a bivalent heteromeric variable region binding fragment can exhibit modified or optimized binding affinity due to its valency.

[0043] A suitable method to measure the affinity of a binding agent is through surface plasmon resonance (SPR). This method is based on a phenomenon that occurs when surface plasmon waves are excited at a metal / liquid interface. Light is shone on the side of the surface not in contact with the sample and reflected, and SPR causes a decrease in the reflected light intensity at a specific combination of angle and wavelength. Biomolecular binding events cause a change in the refractive index at the surface, which is detected as a change in the SPR signal. The binding event can be either a binding association or dissociation between a receptor-ligand pair. The change in refractive index can be measured essentially instantaneously, thus allowing the determination of the individual components of the affinity constant. Specifically, the association rate (k on ) and dissociation rate (k off ) to enable accurate measurement.

[0044] k on and k off Measuring k is useful because it identifies altered or optimized variable regions. For example, engineered variable regions, or heteromer-binding fragments thereof, may have a higher k compared to, for example, variable regions and heteromer-binding fragments that exhibit similar binding affinities. on It may be more effective because it has k onA molecule with a higher kA is able to specifically bind and inhibit its target at a faster rate, resulting in increased efficacy. Similarly, the molecules of the invention have a lower kA compared to molecules with similar binding affinities. off It may be more effective to show the value of k off Molecules with slower rates are more potent because, once bound, the molecule dissociates more slowly from its target. Although reference is made to the engineered and optimized variable regions of the invention, including heteromeric variable region binding fragments thereof, the above methods for measuring association and dissociation rates are applicable to essentially any antibody or fragment thereof to identify more effective binding agents for therapy or diagnosis.

[0045] Another suitable method for measuring the affinity of a binding agent through a surface is FACS / Scatchard analysis, see in particular Example 1 for a description of each.

[0046] Methods for measuring affinity, including association and dissociation rates using surface plasmon resonance, are well known to those skilled in the art and can be described, for example, in Jonsson and Malmquist, (1992) and Wu et al. (1998). Additionally, one device well known in the art for measuring binding interactions is the BIAcore 2000 instrument, available commercially through Pharmacia Biosensor (Uppsala, Sweden).

[0047] Preferably, the target binding affinity is at least 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58% or more, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68% or more, 69% or more, 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 6%, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, and most preferably 99% or more.

[0048] As used herein, quantification of the inhibitory or reducing effect on TACE / ADAM17 activity compared to a benchmark binding agent is determined using a suitable assay that measures the TNFα cleavage effect, for example, as described in Figure 8 and Example 6.

[0049] According to another aspect of the present invention, a method for detecting human iRhom2 by isoforms comprising the steps of: a) an antibody according to the above description, and / or b) An antibody selected from the group consisting of clones 16-B-03; 16-B-05; 16-B-07; 23-B-04; 42-B-02; and / or 42-B-04. Humanized antibodies that compete with

[0050] According to another aspect of the present invention, a) an antibody according to the above description, and / or b) an antibody selected from the group consisting of clones 16-B-03; 16-B-05; 16-B-07; 23-B-04; 42-B-02; and / or 42-B-04 Humanized antibodies are provided that bind to essentially the same region on human iRhom2 as, or to the same region as, iRhom2.

[0051] Clones 16-B-03; 16-B-05; 16-B-07; 23-B-04; 42-B-02; and 42-B-04 are identified in the sequence table herein.

[0052] As used herein, the term "region" is understood to mean an extracellular region, a domain, a subdomain, or a secondary structure (eg a loop), preferably an epitope.

[0053] Concerning the format or structure of such an antibody or fragment, the same preferred embodiments as above apply. In one embodiment, said antibody or fragment is a monoclonal antibody, or a target-binding fragment or a derivative thereof that retains target-binding ability, or an antibody mimetic.

[0054] As used herein, the term "compete for binding" is used in relation to one of the antibodies defined by the sequence as above, which means that the actual antibody or fragment has the same target or target epitope or domain or subdomain binding activity as the antibody or fragment defined by said sequence, and is a variant of the latter. The binding efficiency (e.g., kinetics or thermodynamics) can be the same as, or greater than, or less than the latter efficiency. For example, the equilibrium binding constant for binding to substrate can be different for the two antibodies.

[0055] Such competition for binding can be suitably measured in competitive binding assays, such as those disclosed in Finco et al. 2011, the contents of which are incorporated herein by reference, and their meaning for interpretation of the claims in Deng et al. 2018, the contents of which are incorporated herein by reference.

[0056] To test this property, suitable epitope mapping techniques are available and include, inter alia: X-ray cocrystallography and cryo-electron microscopy (cryo-EM) Array-Based Oligo-Peptide Scanning Site-directed mutagenesis mapping High-throughput shotgun mutagenesis epitope mapping Hydrogen-deuterium exchange Cross-linked mass spectrometry

[0057] These methods are disclosed and discussed, inter alia, in Banik et al. (2010), and DeLisser (1999), the contents of which are incorporated herein by reference for enabling purposes.

[0058] According to one embodiment, the antibody or fragment, when bound to human iRhom2, binds at least within a region of loop 1 thereof. Loop 1 of Rhom2 comprises amino acid residues 474-660 of SEQ ID NO: 49. In another embodiment, the antibody or fragment does not bind to the juxtamembrane domain (JMD) located N-terminal to loop 1. According to one embodiment of the invention, inhibition or reduction of TACE / ADAM17 activity is caused by the antibody or fragment interfering with iRhom2-mediated TACE / ADAM17 activation or the interaction of TACE / ADAM17 with other proteins, including substrate molecules.

[0059] According to one embodiment of the invention, the antibody or fragment, upon binding to human iRhom2, inhibits or reduces induced cleavage of TNFα.

[0060] According to one embodiment of the present invention, the antibody or fragment, upon binding to human iRhom2, inhibits or reduces induced cleavage of IL-6R.

[0061] According to one embodiment of the invention, the antibody or fragment, upon binding to human iRhom2, inhibits or reduces induced HB-EGF cleavage.

[0062] As used herein, "TNFα cleavage" refers to the process by which membrane-anchored tumor necrosis factor alpha (mTNFα / proTNFα) is released into the environment to become soluble TNFα (sTNFα or simply TNFα), a process that is specifically induced by TACE / ADAM17.

[0063] Interleukin-6 receptor (IL-6R) release or cleavage refers to the process by which soluble IL-6R is produced by proteolytic cleavage of cell surface membrane-bound IL-6R at a proteolytic site near the transmembrane domain by TACE / ADAM17.

[0064] Heparin-binding EGF-like growth factor (HB-EGF) release or cleavage refers to the cleavage process in which a soluble form of HB-EGF is generated and released from the cell surface. Heparin-binding EGF-like growth factor is an epidermal growth factor with affinity for heparin and is synthesized as a membrane-anchored mitogenic and chemotactic glycoprotein. First identified in the conditioned medium of human macrophage-like cells, HB-EGF is an 87 amino acid glycoprotein with highly regulated gene expression.

[0065] Suitable assays for measuring TNFα cleavage effects are described, for example, in Figure 8 and Example 6. Suitable assays for determining release or cleavage of IL-6R and / or HB-EGF are described, for example, in Figure 10 and Example 8 or Figure 12 and Example 10, respectively.

[0066] According to one embodiment of the invention, the human iRhom2 to which the antibody or fragment binds is a) the amino acid sequence set forth in SEQ ID NO: 49, or b) an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 49, provided that the amino acid sequence maintains iRhom2 activity; Includes.

[0067] In some embodiments, human iRhom2 comprises an amino acid sequence having ≧81%, preferably ≧82%, more preferably ≧83%, ≧84%, ≧85%, ≧86%, ≧87%, ≧88%, ≧89%, ≧90%, ≧91%, ≧92%, ≧93%, ≧94%, ≧95%, ≧96%, ≧97%, ≧98 or most preferably ≧99% sequence identity to SEQ ID NO:49.

[0068] SEQ ID NO: 49 represents the amino acid sequence of inactive rhomboid protein 2 (iRhom2) isoform 1 [Homo sapiens], accessible under NCBI reference NP_078875.4. In general, different variants and isoforms of iRhom2 exist. Similarly, there are or may be variants that contain conservative or silent amino acid substitutions that maintain full or at least substantial iRhom2 activity. These isoforms, variants and variants are encompassed within the identity ranges defined above, but functionally inactive variants and variants are excluded.

[0069] In one embodiment of the invention, the antibody or fragment is a monoclonal antibody, or a target-binding fragment or derivative thereof which retains target-binding ability, or an antibody mimetic.

[0070] According to one embodiment of the invention, the antibody or fragment is in at least one format selected from the group consisting of: IgG, scFv, Fab, or (Fab)2.

[0071] As used herein, the term "monoclonal antibody (mAb)" refers to an antibody composition having a homogeneous antibody population, i.e., a homogeneous population of whole immunoglobulins or fragments or derivatives thereof that retain target binding ability.

[0072] Particularly preferably, such antibodies are IgG antibodies, or fragments or derivatives thereof that retain target binding ability. Immunoglobulin G (IgG) is a type of antibody. IgG, which accounts for about 75% of human serum antibodies, is the most common type of antibody present in the blood. IgG molecules are made and released by plasma B cells. Each IgG has two antigen-binding sites.

[0073] IgG antibodies are large molecules with a molecular weight of about 150 kDa consisting of four peptide chains. They contain two identical class γ heavy chains of about 50 kDa and two identical light chains of about 25 kDa, and thus have a tetrameric structure. The two heavy chains are linked to each other and to the light chains, respectively, by disulfide bonds. As a result, the tetramer has two identical halves that together form a Y-shaped shape. Both ends of the fork contain identical antigen-binding sites. The Fc region of IgG has a highly conserved N-glycosylation site. The N-glycans that bind to this site are mainly complex-type core-fucosylated diantennary structures. In addition, a small amount of these N-glycans have been identified that have bisecting GlcNAc and α-2,6-linked sialic acid residues.

[0074] In humans, there are four IgG subclasses (IgG1, 2, 3, 4), named in order of their abundance in serum (IgG1 being the most abundant). As used herein, the term "fragment" refers to fragments of such antibodies that retain target binding ability. For example, CDR (Complementarity Determining Region) Hypervariable regions, Variable domain (Fv) IgG or IgM heavy chain (consisting of VH, CH1, hinge, CH2 and CH3 regions) an IgG or IgM light chain (consisting of a VL and CL domain); and / or Fab and / or F(ab)2.

[0075] The term "derivative" as used herein refers to protein constructs that are structurally distinct but still have some structural relatedness, such as scFv, Fab and / or F(ab)2, as well as dual, triple or higher specificity antibody constructs, and yet retain target binding ability, the common antibody concept, all of which are described below.

[0076] Other antibody derivatives known to those skilled in the art are diabodies, camelid antibodies, nanobodies, domain antibodies, bivalent homodimers with two chains consisting of scFvs, IgAs (two IgG structures linked by a J chain and a secretory component), shark antibodies, antibodies consisting of a New World primate framework and non-New World primate CDRs, dimerization constructs containing CH3+VL+VH, and antibody conjugates (e.g. antibodies or fragments or derivatives linked to toxins, cytokines, radioisotopes or labels). These types are well described in the literature and can be used by the skilled artisan based on the present disclosure without further inventive activity.

[0077] Methods for producing hybridoma cells are disclosed in Kohler & Milstein (1975).

[0078] Methods for the production and / or selection of fully human mAbs are known in the art. These include the use of transgenic animals immunized with the respective protein or peptide, or the use of suitable display technologies such as yeast display, phage display, B cell display or ribosome display, where antibodies from a library are screened against human iRhom2 in stationary phase.

[0079] In vitro antibody libraries are disclosed, inter alia, by MorphoSys in US6300064 and by MRC / Scripps / Stratagene in US6248516. Phage display techniques are disclosed, for example, by Dyax in US5223409. Transgenic mammalian platforms are described, for example, in EP1480515A2 by TaconicArtemis.

[0080] IgG, IgM, scFv, Fab and / or F(ab)2 are antibody formats well known to those skilled in the art. The relevant validation techniques can be obtained from the respective textbooks. As used herein, the term "Fab" refers to an IgG / IgM fragment containing the antigen-binding region, said fragment consisting of one constant and one variable domain from each of the heavy and light chains of the antibody.

[0081] As used herein, the term "F(ab)2" refers to an IgG / IgM fragment consisting of two Fab fragments bound together by disulfide bonds.

[0082] As used herein, the term "scFv" refers to a single-chain variable region fragment that is a fusion of the variable regions of the heavy and light chains of an immunoglobulin, linked by a short linker, usually serine (S) or glycine (G). This chimeric molecule retains the specificity of the original immunoglobulin despite the removal of the constant regions and the introduction of a linker peptide.

[0083] Modified antibody formats are, for example, bi- or trispecific antibody constructs, antibody-based fusion proteins, immunoconjugates, etc. These types are well described in the literature and can be used by the skilled artisan based on the present disclosure, further adding activity to the invention.

[0084] As used herein, the term "antibody mimetic" refers to organic molecules, most often proteins, that specifically bind to a target protein in the same way as antibodies, but are not structurally related to antibodies. Antibody mimetics are usually artificial peptides or proteins with a molar mass of about 3-20 kDa. The definition encompasses, among others, affibody molecules, affilins, affimas, affitins, alphabodies, anticalins, avimers, DARPins, finomers, Kunitz domain peptides, monobodies, and nanoCLAMPs. In one or more embodiments, the antibody or fragment thereof is an isolated antibody, or a target-binding fragment or derivative thereof that retains target-binding ability, or an isolated antibody mimetic.

[0085] In one or more embodiments, the antibody is an engineered or recombinant antibody, or a target-binding fragment or derivative thereof that retains target-binding ability, or an engineered or recombinant antibody mimetic.

[0086] According to one embodiment of the invention, the antibody or fragment is an antibody in at least one format selected from the group consisting of: IgG, scFv, Fab, or (Fab)2.

[0087] According to one embodiment of the invention, the antibody or fragment does not cross-react with human iRhom 1. The nucleic acid sequence of human iRhom 1 is disclosed herein as SEQ ID NO:50.

[0088] According to another aspect of the invention there is provided a nucleic acid encoding a binding agent according to any one of the preceding claims.

[0089] In one embodiment, where the binding agent is a monoclonal antibody having a heteromeric structure of at least one light chain and one heavy chain, a nucleic acid or a pair of nucleic acids encoding the heavy and light chains, respectively, of the binding agent is provided.

[0090] Such nucleic acids can also be used for pharmaceutical purposes. The nucleic acid can be an RNA molecule or an RNA derivative that contains modified nucleotides such as pseudouridine (Ψ) or N-1 methylpseudouridine (m1Ψ), for example, to provide stability and reduce immunogenicity (see, for example, US8278036 and US9428535, the contents of which are incorporated herein for purposes of enablement). In another embodiment, RNAs containing the most GC-rich codons are selected to provide stability and reduce immunogenicity (see, for example, EP1392341). The mRNAs can be delivered, for example, in suitable liposomes, and contain either specific sequences or modified uridine nucleosides to avoid immune responses and / or improve folding and translation efficiency, and sometimes contain cap modifications at the 5' and / or 3' ends to target them to specific cell types. In some embodiments, the respective RNA sequences are selected from SEQ ID NO: 100 to SEQ ID NO: 147. See the table below for which RNAs code for which antibody sequences.

[0091] The nucleic acid may also be a DNA molecule. In that case, the molecule may be a cDNA, optionally incorporated into a suitable vector, such as an attenuated non-pathogenic virus, or provided as one or more plasmids. Such a plasmid may be administered to a patient using an electroporation device, for example as disclosed in patent EP3397337B1, the contents of which are incorporated herein for enablement purposes. In some embodiments, the respective DNA sequence is selected from SEQ ID NO: 52 to SEQ ID NO: 99. See the table below for which cDNAs code for which antibody sequences.

[0092] In general, since the genetic code is degenerate, there are many nucleic acids capable of encoding such a chain. The skilled person is fully capable of determining whether a given nucleic acid meets the above criteria. On the other hand, the skilled person is perfectly capable of reverse engineering a suitable nucleic acid encoding a given amino acid sequence based on the codon usage table. For this purpose, software tools such as "reverse translate" provided by the online tool "sequence manipulation suite" (https: / / www.bioinformatics.org / sms2 / rev_trans.html) can be used. Thus, there are any number of alternative sequences of DNA or RNA that code for a protein sequence as claimed. These alternative sequences are considered to be within the scope of the present invention.

[0093] According to another aspect of the invention there is provided the use of an antibody or fragment or nucleic acid as described above (for the manufacture of a medicament) for the treatment of a human or animal subject diagnosed with, suffering from or at risk of developing an inflammatory condition, or for the prevention of such a condition.

[0094] To diagnose an inflammatory condition, patients may undergo a physical exam and a medical history may be taken. The physician may look for joint inflammation, joint stiffness, and decreased joint function. In addition, the healthcare professional may order x-rays and / or blood tests to detect inflammatory markers, such as serum hs-CRP, IL-6, TNF-α, and IL-10, erythrocyte sedimentation rate, plasma viscosity, fibrinogen, and / or ferritin, compared to healthy controls.

[0095] According to another aspect of the invention there is provided a pharmaceutical composition comprising an antibody or fragment or nucleic acid as described above, and optionally one or more pharma- ceutically acceptable excipients.

[0096] According to another aspect of the invention there is provided a combination comprising (i) an antibody or fragment or nucleic acid or a pharmaceutical composition as described above, and (ii) one or more therapeutically active compounds.

[0097] According to another aspect of the present invention, there is provided a method for treating or preventing an inflammatory condition, including a method comprising the administration to a human or animal subject of a therapeutically sufficient amount of (i) an antibody or fragment as described above, (ii) a nucleic acid as described above, (iii) a pharmaceutical composition as described above, or (iv) a combination as described above.

[0098] According to another aspect of the present invention, a) the antibody or fragment thereof, the nucleic acid thereof, the pharmaceutical composition thereof, or the combination thereof b) a device for administering the composition, composition or combination, and c) Instructions for use of the kit A therapeutic kit of parts is provided, comprising: EXAMPLES

[0099] While the present invention has been illustrated and described in detail in the drawings and the foregoing description, such illustration and description are to be considered as illustrative or exemplary and not restrictive, and the present invention is not limited to the disclosed embodiments. Other variations to the disclosed embodiments can be understood and effected by those skilled in the art in practicing the claimed invention, from a study of the drawings, the disclosure, and the appended claims. In the claims, the word "comprising" does not exclude other elements or steps, and the indefinite article "a" or "an" does not exclude a plurality. The mere fact that certain measures are recited in mutually different dependent claims does not indicate that a combination of these measures cannot be used to advantage. Any reference signs in the claims should not be construed as limiting the scope.

[0100] All amino acid sequences disclosed herein are shown from N-terminus to C-terminus; all nucleic acid sequences disclosed herein are shown 5'->3'.

[0101] General methods for antibody humanization Humanization by CDR grafting is a proven and successful technique that uses antibodies derived from mice, other xenogeneic species, or hybridomas to retain the binding and functional activity of the parent antibody while reducing potential immunogenicity. Typically, one starts with a chimeric antibody and aims to remove foreign framework regions (FR) in the variable domains that may trigger an immune response. The solution to this problem is to "graft" the complementarity determining regions (CDRs) of a mouse antibody onto a human acceptor framework.

[0102] However, because a set of supporting framework residues in the Vernier zones is critical for maintaining the conformation of the CDRs, grafting of the CDRs alone may significantly reduce or completely lose binding affinity. This problem can be solved by reintroducing mouse residues into the human framework. Such substitutions are commonly called backmutations.

[0103] Since the most important property of a therapeutic antibody is its activity, it is important that the proposed substitutions during humanization do not affect the affinity or stability of the antibody. With advances in antibody biophysical properties, CDR loop conformations, and protein modeling, a large amount of information has been collected over the past two decades on frameworks that allow for precise humanization of antibodies while maintaining binding affinity and stability.

[0104] The humanization procedure was as follows: 1) The domains and regions of the parent antibody were identified 2) Critical positions and potential post-translational modifications (PTMs) were identified In an antibody Fv, there are several key positions that constitute the VH / VL chain interface or that assume a distinct set of canonical structures defined for the five CDRs: these positions should be considered in detail before proposing substitutions. Post-translational modifications (PTMs) can cause problems during therapeutic protein development, including increased heterogeneity, reduced biological activity, decreased stability, immunogenicity, fragmentation, and aggregation. The potential impact of PTMs varies depending on their location and, in some cases, on exposure to solvent. Sequences were analyzed for the following potential PTMs: asparagine deamidation, aspartic acid isomerization, free cysteine ​​thiol groups, N-glycosylation, and oxidation of methionine and tryptophan.

[0105] 3) The optimal acceptor human germline sequence was selected for each strand based on sequence analysis and key positions. The best matching entries were identified based on alignment of the parent antibody sequences against human germline sequences. Identification of optimal human germline acceptors was based on the following ordered criteria: Sequence identity of the entire V gene (framework + CDR) Identical or interchangeable interchain interface residues Support loops in the canonical conformation of the parent CDRs 4) A 3D structural model of the parent mouse Fv region was constructed. 5) Following close inspection of the molecular model, an initial assessment was made of the feasibility of substitutions at each position. Positions were classified as “neutral” or “critical.” Single mutations to disrupt potential PTMs were also identified. 6) CDR grafting was performed by analyzing the positions that differed between the parent and acceptor sequences. All neutral position substitutions were made.

[0106] During the design of a humanized antibody, a procedure more precisely defined as germlining, involves replacing parental framework amino acids that differ from the selected acceptor with the corresponding human amino acids.

[0107] 7) Combinations of different humanized VH and VL versions were produced, purified and tested for binding and biological activity. 8) The selection of the optimal humanized heavy and light chain combinations among the different versions was performed by evaluating the following criteria: a) Transient expression levels of the humanized version (compared to the chimeric version) as human IgG1 / Kappa produced in mammalian cells (HEK 293 or preferably CHO) using tissue culture supernatants from transfected cells prior to harvest for purification by ELISA or measurement by Protein A using the Octet label-free detection system. b) Binding ability (EC50 by ELISA or FACS; or preferably Kd by Biacore or Octet) compared to a chimeric human IgG1 / Kappa version (chimeric means the combination of the VH and VL of the parent mouse fused to a human constant region). c) The biological activity of the humanized antibody in relevant in vitro cell assays was compared to that of a reference chimeric antibody. d) Cross-reactivity with related orthologous species (in vitro binding activity). e) Measurement of the biophysical properties of the humanized version compared to the chimera: SEC-HPLC profiles to measure the levels of polymeric aggregates; SDS-PAGE under non-reducing and reducing conditions, Microcal TM The Tm of Fab, CH2, and CH3 were measured by differential scanning calorimetry (DSC) analysis using a VP-capillary DSC system. Common antibody production methods

[0108] For recombinant antibody production, the target DNA sequence was designed, optimized, and synthesized. The complete sequence was subcloned into an expression vector, and transfection-grade plasmids were prepared for CHO cell expression. CHO cells were cultured in CHO TF expression medium (Xell AG, Germany) and transfected with recombinant plasmids encoding the target proteins. Cell culture supernatants harvested 11 days after transfection were used for purification. The cell culture broth was centrifuged and filtered. The filtered cell culture supernatants were loaded onto a MabSelect PrismA (Thermo Fisher, USA) affinity purification column at an appropriate flow rate. After washing and elution with appropriate buffers, the eluted fractions were pooled and buffer-exchanged into the final formulation buffer. The purified proteins were subjected to SDS-PAGE analysis to determine molecular weight and purity.

[0109] Example 1: Affinity determination of humanized antibodies of the invention In this study, affinity measurements of the humanized antibodies of the present invention, 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04, were performed by indirect FACS Scatchard analysis using L920-2041-hiR2-FL-WT-T7 cells, a mouse cell line expressing human iRhom2.

[0110] Generation of L929-2041-hiR2-FL-WT-T7 To generate a suitable cell line for comparable and reliable binding analysis of antibodies, L929 (NCTC clone 929) mouse fibroblasts (ATCC, USA) were genetically modified to knock out the mouse iRhom2 gene. The resulting L929 mouse iRhom2 knockout cell line was subsequently infected with different human iRhom2 constructs to obtain cell line derivatives stably expressing different human iRhom2 proteins, allowing binding analysis with different iRhom2 variants in the same genetic background.

[0111] Briefly, mRhbdf2.3 IVT gRNA (AAGCATGCTATCCTGCTCGC) was synthesized at Thermo Fisher Scientific GeneArt GmbH, Regensburg, Germany. One day after seeding in 24-well plates, L929 parental cells were transfected with the gRNA / GeneArt Platinium Cas9 Nucelase (ThermoFisherScientific, USA) mix using Lipofectamine CRISPRMAX Transfection Reagent (ThermoFisherScientific, USA) according to the GeneArt CRISPR Nuclease mRNA User Guide (Thermo Fisher Scientific, USA). Three days after transfection, cells were lysed and DNA was extracted for amplification of specific PCR products using the mRhbdf2.3 fwd (TCAATGAGCTCTTTATGGGGCA) / mRhbdf2.3 rev (AAGGTCTCCATCCCCTCAGGTC) 5 primer pair (Thermo Fisher Scientific, USA). For selection of positive wells, the GeneArt Genomic Cleavage Detection Kit (Thermo Fisher Scientific, USA) was applied to samples with a prominent single band of the appropriate size in an Invitrogen 2% E-Gel Size Select agarose gel (Thermo Fisher Scientific, USA). Cleavage assay PCR products were also analyzed in an Invitrogen 2% E-Gel Size Select agarose gel. The polyclonal L929 population identified using the limiting dilution method was subcloned twice using the cleavage detection kit for identification of positive subclones. Thus, the most promising positive subclone identified in the first round (designated 1029) was further subcloned in a second round to obtain the final clone (designated 2041).The monoclonal cell population derived from this subclone was named L929-2041 and was used for subsequent infection (following the procedure described in Example 3) with the human iRhom2 construct hiR2-FL-WT-T7 to generate the cell line L929-2041-hiR2-FL-WT-T7.

[0112] FACS Scatchard analysis of L929-2041-hiR2-FL-T7 Briefly, L929-2041-hiR2-FL-T7 were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide) and plated in Nunc U-bottom 96-well plates (Thermo Fisher Scientific, USA) at approximately 3x10 cells per well. 5 In cells The plates were centrifuged at 1500 rpm for 3 min at 4° C. to pellet the cells and remove the supernatant. For primary staining, the cells were suspended in 100 μl per well of either FACS buffer alone (control) or serial 2-fold dilutions (total of 22 concentrations) of the humanized antibodies of the present invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 in FACS buffer starting at 160 μg / ml and incubated on ice for 1 h. The plates were then centrifuged at 1500 rpm for 3 min at 4° C. and washed twice with 200 μl of FACS buffer per well. For secondary staining, the cells were spun down and suspended in 100 μl per well of PE-labeled goat anti-human IgG F(ab´)2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. The cell suspension was incubated on ice for 1 h protected from light. Afterwards, the plate was centrifuged at 1500 rpm at 4°C for 3 min and washed three times with 200 μl FACS buffer per well. Finally, the cells were resuspended in 150 μl FACS buffer per well and analyzed using a BD AccuriTM C6 Plus flow cytometer (Becton Dickinson, Germany). The Prism8 software (GraphPad Sowtware, USA) was applied to calculate the respective KD values ​​of each antibody of the present invention.

[0113] FIG. 1 shows representative results from this study and indicates that the K values ​​for binding of humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 to L929-2041-hiR2-FL-T7 cells are in the sub-nanomolar to low nanomolar range.

[0114] Example 2: Generation of iRhom1 / 2- / - double knockout mouse embryonic fibroblasts For various purposes, particularly the binding studies described in some of the Examples below, cell lines were required that expressed defined levels of a particular iRhom variant of interest against a background lacking endogenous iRhom1 or iRhom2 protein. To this end, mouse embryonic fibroblasts (MEFs) were established from double knockout mice (DKO) that were homozygously negative for both mouse iRhom1 and mouse iRhom2 (iRhom1 / 2- / -). This Example describes the mouse strains used to establish iRhom1 / 2- / -DKO MEFs and generate immortalized iRhom1 / 2- / -DKO MEF cell lines.

[0115] Mouse strains used to establish iRhom1 / 2- / -DKO MEFs Briefly, the Rhbdf2tm1b(KOMP)Wtsi mouse strain (C57BL / 6N-Rhbdf2tm1b(KOMP)Wtsi) on a C57BL / 6N background was obtained from the Knockout Mouse Project (KOMP) repository at the University of California, Davis, USA (Rhbdf2 is another name for iRhom2). Heterozygous male Rhbdf2tm1b mice were bred with wild-type female mice on a 129Sv / J genetic background to generate heterozygous offspring with a mixed genetic background (129Sv / J-C57BL / 6N). These heterozygous mice were bred with each other to generate male and female offspring homozygous for the deletion of the Rhbdf2 gene (Rhbdf2- / - mice, 129Sv / J-C57BL / 6N). The resulting colony of homozygous Rhbdf2 knockout mice was further expanded by mating Rhbdf male and female mice to generate sufficient numbers of mice that were viable, fertile, and showed no obvious spontaneous pathological phenotypes.

[0116] Rhbdf1 knockout mice were obtained from the European Conditional Mouse Mutagenesis Program (EUCOMM) of the International Knockout Mouse Consortium (IKMC). The generation of these animals is described in Li et al., PNAS, 2015, doi:10.1073 / pnas.1505649112. Homozygous Rhbdf1- / - mice are viable and fertile and show no obvious spontaneous pathological phenotypes.

[0117] To generate Rhbdf1 and Rhbdf2 DKO mice (Rhbdf1 / 2- / - mice), Rhbdf1- / - and Rhbdf2- / - mice were crossed to generate Rhbdf1+ / -Rhbdf2+ / - double heterozygous mice, which were crossed with Rhbdf2- / - mice to generate Rhbdf1+ / -Rhbdf2- / - animals, which were crossed with each other to generate E14.5 embryos lacking both Rhbdf genes in the expected Mendelian ratio (1 / 4 of all embryos) to generate E13.5 Rhbdf1 / 2- / - DKO MEFs (Rhbdf1 / 2- / - DKO embryos) as described below.

[0118] Generation of immortalized iRhom1 / 2- / - DKO MEF cell lines Briefly, pregnant Rhbdf1+ / -Rhbdf2- / - females were sacrificed at E13.5. The uterine horns were removed into a dish containing ice-cold PBS. The embryos were detached from the maternal tissues using fine-tipped forceps, and each embryo was removed from the placenta. Each embryo was then dissected with a sharp scalpel to remove all internal organs, including the liver, heart, lungs, and intestines. A 0.5 mm section of the tail was removed and transferred to a 1.5 ml Eppendorf tube for isolation of genomic DNA and subsequent genotyping by PCR to confirm the correct genotype of the embryos. The remaining embryonic tissue was then washed once with PBS and transferred to a tissue culture dish containing 2 mL of 0.25% trypsin / EDTA. The tissue was minced extensively with two sterile scalpels, and the trypsin / cell mixture was incubated at 37 °C for 15 min. Trypsinization was stopped by the addition of FCS-containing growth medium. To create a single cell suspension, the mixture was pipetted up and down, first five times with a 10 mL serological pipette, then five times with a 5 mL serological pipette, and finally several times with a fire-polished Pasteur pipette to further dissociate any remaining cell clusters. Cells from one embryo were then plated onto two 10 cm tissue culture plates. The next day, the medium was replaced with fresh medium, and the cells were allowed to grow until they reached 90% confluence. Finally, the cells were expanded and stocked for future use.

[0119] For immortalization of primary Rhbdf1 / 2- / - DKO MEFs, cells were transduced with a retroviral system using the pMSCV expression system (Clontech, USA). Briefly, pMSCV-Zeo-SV40 was generated as follows: the sequence encoding puromycin resistance was removed from the plasmid pMSCV-puro (Clontech, USA) and replaced with the sequence conferring zeocin resistance from the pcDNA3.1(+) Zeo vector (Thermo Fisher Scientific, USA). The retroviral packaging cell line GP2-293 (Clontech, USA) was used in combination with the envelope vector pVSV-G (Clontech, USA) and the pMSCV-Zeo-SV40 plasmid to generate retrovirus encoding the SV40 large T antigen. The virus was filtered and added to primary Rhbdf1 / 2- / - DKO MEFs plated at 50% confluence for 24 h. Transduced Rhbdf1 / 2- / - DKO MEFs were then grown in growth medium without selection pressure for 24 h and then transferred to growth medium containing 100 μg / ml Zeocin. Cells were passaged when confluent and stocked for future use after 10 passages.

[0120] Example 3: Evaluation of mouse cross-reactivity of humanized antibodies of the invention Next, immortalized iRhom1 / 2- / - DKO MEFs were reconstituted with tagged human iRhom2 to test the target recognition of the humanized antibodies of the present invention.Furthermore, to measure the cross-reactivity of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the present invention with the mouse orthologue of iRhom2, iRhom1 / 2- / - DKO MEFs were generated that stably express a tagged form of mouse iRhom2.

[0121] Generation of iRhom1 / 2- / - DKO MEFs stably expressing T7-tagged human or mouse iRhom2 Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in 6-well tissue culture plates (Greiner, Germany) in standard growth medium. 5 The cells were seeded with 1000 ng / ml of chloroquine and incubated overnight at 37°C with 5% CO2. On the second day, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. Using the calcium phosphate method, the cells were transfected with 2 μg / ml of pMSCV (Clontech, USA) empty vector, pMSCV-hiR2-FL-WT-T7 encoding human iRhom2 full-length wild-type with three consecutive copies of the C-terminus carrying a T7 epitope (MASMTGGQQMG), or pMSCV-miR2-FL-WT-T7 encoding mouse iRhom2 full-length wild-type with three consecutive copies of the C-terminus carrying a T7 epitope, and kept at 37°C with 5% CO2. After 7 hours, the cell supernatant was replaced with standard growth medium lacking chloroquine to stop the transfection, and the cells were incubated overnight at 37°C with 5% CO2 for virus production. In parallel, immortalized iRhom1 / 2- / -DKO MEFs as target cells for retroviral infection were plated at 1x10 per well in 6-well tissue culture plates (Greiner, Germany) in standard growth medium. 5The cells were seeded with 1000-kDa cells and incubated overnight at 37°C and 5% CO2. On the third day, the supernatants of Phoenix-ECO cells releasing pMSCV, pMSCV-hiR2-FL-WT-T7 or pMSCV-miR2-FL-WT-T7 ecotropic viruses were collected, filtered through a 0.45 μm CA filter, and supplemented with 4 μg / ml polybrene (Sigma-Aldrich, USA). After removing the medium from the immortalized iRhom1 / 2- / -DKO MEFs, the virus-containing supernatants were added to the target cells and the primary infection was carried out for 4 h at 37°C and 5% CO2. At the same time, the Phoenix-ECO cells were re-incubated with fresh medium, filtered after another 4 h, and used for a second infection of the respective target cell population, again in the presence of 4 μg / ml polybrene. Similarly, a third, but overnight, infection cycle was carried out. On the fourth day, the virus-containing cell supernatants were replaced with fresh standard growth medium. From day 5 onwards, cells were grown in the presence of 2mg / ml geneticin (G418, Thermo Fisher Scientific, USA) to select immortalized MEF-DKO-EV control cells stably infected with pMSCV empty vector, MEF-DKO-hiR2-FL-WT-T7 cells stably expressing human iRhom2 full-length wild-type C-terminus tagged with three consecutive copies of T7 epitopes, and MEF-DKO-miR2-FL-WT-T7 cells stably expressing mouse iRhom2 full-length wild-type C-terminus tagged with three consecutive copies of T7 epitopes. After growth, cells were stocked for future use.

[0122] FACS analysis for test system evaluation and antibody characterization Briefly, immortalized MEF-DKO-EV control cells, MEF-DKO-hiR2-FL-WT-T7 cells, and MEF-DKO-miR2-FL-WT-T7 cells were harvested with 10 mM EDTA in PBS, washed, and then resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide) and plated at approximately 3x10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5The plates were then centrifuged at 1500 rpm for 3 min at 4° C. to pellet the cells and remove the supernatant. For primary staining, the cells were resuspended in 100 μl per well with either FACS buffer alone (control), mouse monoclonal anti-T7 IgG (Merck Millipore, USA) at 3 μg / ml FACS buffer, or humanized antibodies of the present invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04, also at 3 μg / ml FACS buffer, and incubated on ice for 1 h. The plates were then centrifuged at 1500 rpm for 3 min at 4° C. and washed twice with 200 μl per well of FACS buffer. For secondary staining of the previous anti-T7 staining, cells were spun down and resuspended in 100 μl per well of PE-labeled goat anti-mouse IgG F(ab´)2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. For secondary staining of the previous with the humanized antibodies of the invention, cells were spun down and resuspended in 100 μl per well of PE-labeled goat anti-human IgG F(ab´)2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. The cell suspension was incubated for 1 h on ice, protected from light. Afterwards, the plate was centrifuged at 1500 rpm at 4°C for 3 min and washed 3 times with 200 μl of FACS buffer per well. Finally, cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD AccuriTM C6 Plus flow cytometer (Becton Dickinson, Germany).

[0123] Figures 2a and 2b show representative results from this experiment. Compared to control samples incubated with anti-mouse IgG or anti-human IgG secondary antibodies only (2a and 2b, grey), co-incubation with anti-T7 tag antibody (Figure 2a, black) revealed almost no background staining in MEF-DKO-EV control cells (Figure 2a, left). In contrast, binding analysis of anti-T7 tag antibody in both MEF-DKO-hiR2-FL-WT-T7 (Figure 2a middle) and MEF-DKO-miR2-FL-WT-T7 (Figure 2a right) cells showed a strong increase in relative fluorescence intensity, indicating that both ectopically expressed human and mouse iRhom2 variants are localized to the surface of these engineered cell populations, thus validating the antibody of the present invention as a suitable test system for characterizing the antibody. Co-incubation of these cell populations with humanized antibody 16-B-03 (Figure 2b, black), a representative example of a humanized antibody of the present invention, completely abolished background staining of MEF-DKO-EV control cells (Figure 2b, left), whereas a strong shift in relative fluorescence intensity similar to that observed with anti-T7 tag antibody in MEF-DKO-hiR2-FL-WT-T7 cells indicates strong binding of humanized antibody 16-B-03 of the present invention to human iRhom2 variants (Figure 2b, middle). In contrast, no significant binding of humanized antibody 16-B-03 of the present invention to MEF-DKO-miR2-FL-WT-T7 cells was detected (Figure 2b, right), providing evidence that mouse iRhom2 variants confirmed to be present on the cell surface with anti-T7 tag antibody (Figure 2a, right) are not recognized by humanized antibody 16-B-03 of the present invention. Similar results were obtained with the humanized antibodies 16-B-05, 16-B-07, 23-B-04, 42-B-02, and 42-B-04 of the present invention, demonstrating that none of these humanized antibodies of the present invention cross-reacts with mouse iRhom2.

[0124] Example 4: Evaluation of the binding specificity of humanized antibodies of the present invention Due to the sequence homology between human iRhom2 protein and its closely related family member human iRhom1 protein (see NCBI Reference Sequence NP_078875.4. for human iRhom2 and NCBI Reference Sequence NP_071895.3 for human iRhom1, the amino acid sequence identity of extracellular loops 1, 2, 3 and C-terminal tail of human iRhom2 to human iRhom1 is calculated to be 67.4%, 100.00%, 80.00% and 63.64%, respectively), as a next step, the binding specificity of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02, 42-B-04 of the present invention to human iRhom2 to human iRhom1 was evaluated. For this purpose, iRhom1 / 2- / -DKO MEFs stably expressing human iRhom1 tag were generated.

[0125] Generation of iRhom1 / 2- / - DKO MEFs stably expressing T7-tagged human iRhom1 Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in 6-well tissue culture plates (Greiner, Germany) in standard growth medium. 5 The cells were seeded with hiR1 cells and incubated overnight at 37°C, 5% CO2. On the second day, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. The calcium phosphate method was applied to transfect the cells with 2 μg / ml of pMSCV-hiR1-FL-WT-T7 (SEQ ID NO: 50), which encodes human iRhom1 full-length wild-type C-terminal with three consecutive copies of the T7 epitope, and the cells were kept at 37°C, 5% CO2. After 7 hours, the cell supernatant was replaced with standard growth medium lacking chloroquine to stop the transfection, and the cells were cultured overnight at 37°C, 5% CO2 for virus production. In parallel, immortalized iRhom1 / 2- / -DKO MEFs as target cells for retroviral infection were plated at 1x10 per well in 6-well tissue culture plates (Greiner, Germany) in standard growth medium. 5The cells were seeded with pMSCV-hiR1-FL-WT-T7 ecotropic virus and incubated overnight at 37°C and 5% CO2. On day 3, the supernatants of Phoenix-ECO cells that released pMSCV-hiR1-FL-WT-T7 ecotropic virus were collected, filtered through a 0.45 μm CA filter, and supplemented with 4 μg / ml polybrene (Sigma-Aldrich, USA). After removing the medium from the immortalized iRhom1 / 2- / -DKO MEFs, these supernatants were added to the target cells and the primary infection was carried out for 4 h at 37°C and 5% CO2. At the same time, Phoenix-ECO cells were re-incubated with fresh medium, filtered after another 4 h, and used for a second infection of the respective target cell population, again in the presence of 4 μg / ml polybrene. Similarly, a third, but overnight, infection cycle was carried out. On day 4, the virus-containing cell supernatant was replaced with fresh standard growth medium. Immortalized MEF-DKO-hiR1-FL-WT-T7 cells stably expressing human iRhom1 full-length wild-type C-terminus tagged with three consecutive copies of the T7 epitope were grown in the presence of 2 mg / ml geneticin (G418, Thermo Fisher Scientific, USA) from day 5 onwards. After growth, the cells were stocked for future use.

[0126] FACS analysis for test system evaluation and antibody characterization Briefly, MEF-DKO-hiR1-FL-WT-T7 cells, in addition to the immortalized MEF-DKO-EV control cells and MEF-DKO-hiR2-FL-WT-T7 cells (already described in Example 3), were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide) and plated in Nunc U-bottom 96-well plates (Thermo Fisher Scientific, USA) at approximately 3x10 per well. 5Cells were seeded in 100 μl / well. Plates were centrifuged at 1500 rpm, 4° C. for 3 min to pellet cells and remove supernatant. For primary staining, cells were resuspended in 100 μl / well of either FACS buffer alone (control), mouse monoclonal anti-T7 IgG (Merck Millipore, USA) at 3 μg / ml FACS buffer, or humanized antibodies of the present invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02, 42-B-04, also at 3 μg / ml FACS buffer, and incubated on ice for 1 h. Plates were then centrifuged at 1500 rpm, 4° C. for 3 min and washed twice with 200 μl / well of FACS buffer. For secondary staining of the previous anti-T7 staining, cells were spun down and resuspended in 100 μl per well of PE-labeled goat anti-mouse IgG F(ab´)2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. For secondary staining of the previous with the humanized antibodies of the invention, cells were spun down and resuspended in 100 μl per well of PE-labeled goat anti-human IgG F(ab´)2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. The cell suspension was incubated for 1 h on ice, protected from light. Afterwards, the plate was centrifuged at 1500 rpm at 4°C for 3 min and washed 3 times with 200 μl of FACS buffer per well. Finally, cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD AccuriTM C6 Plus flow cytometer (Becton Dickinson, Germany).

[0127] Figures 3a and 3b are representative of the results of these analyses. The strong increase in relative fluorescence intensity obtained with MEF-DKO-hiR1-FL-WT-T7 using the anti-T7 tag antibody (Figure 3a, middle), compared to the staining of MEF-DKO-EV control cells (Figure 3a, left; same as Figure 2a, left) and MEF-DKO-hiR2-FL-WT-T7 (Figure 3a, right; same as Figure 2a, middle), indicates that the human iRhom1 variants, like the human iRhom2 variants, are located on the surface of this engineered cell population, thus validating it as a suitable test system to characterize the antibodies of the invention. In this context, the binding of antibody 16-B-03 as a representative example of a humanized antibody of the invention to human iRhom2 variants expressed on MEF-DKO-hiR2-FL-WT-T7 cells (Figure 3b, right; identical to Figure 2b, middle), already shown in Example 3, was not detected as a significant binding of the humanized antibody 16-B-03 of the invention to MEF-DKO-hiR1-FL-WT-T7 cells (Figure 3b, middle), providing evidence that the human iRhom1 variants, the presence of which was confirmed on the cell surface with an anti-T7 tag antibody (Figure 3a, middle), are not recognized by the humanized antibody 16-B-03 of the invention. Similar results were obtained with the humanized antibodies 16-B-05, 16-B-07, 23-B-04, 42-B-02, 42-B-04 of the invention, showing that none of these humanized antibodies of the invention recognizes human iRhom1.

[0128] Example 5: Evaluation of cross-reactivity of the antibodies of the present invention against different species Next, to measure the cross-reactivity of the antibodies of the present invention with the respective orthologues of iRhom2, we generated iRhom1 / 2- / -DKO MEFs stably expressing tagged forms of iRhom2 from rhesus, cynomolgus, dog, or rabbit. We generated iRhom1 / 2- / -DKO MEFs stably expressing tagged forms of iRhom1 from rhesus, cynomolgus, dog, or rabbit, and confirmed the specificity of iRhom2 for iRhom1 in these species.

[0129] Generation of iRhom1 / 2- / - DKO MEFs stably expressing T7-tagged rhesus, cynomolgus, dog or rabbit iRhom2 Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in 6-well tissue culture plates (Greiner, Germany) in standard growth medium. 5 The cells were seeded and incubated overnight at 37°C, 5% CO. On the second day, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. The cells were transfected with 2 μg / ml of pMSCV (Clontech, USA) empty vector, pMSCV-rhesus-iR2-FL-WT-T7 cells encoding rhesus iRhom2 full-length wild type C-terminus tagged with three consecutive copies of the T7 epitope, pMSCV-cyno-iR2-FL-WT-T7 cells encoding cyno iRhom2 full-length wild type C-terminus tagged with three consecutive copies of the T7 epitope, pMSCV-dog-iR2-FL-WT-T7 cells encoding dog iRhom2 full-length wild type C-terminus tagged with three consecutive copies of the T7 epitope, and pMSCV-rabbit-iR2-FL-WT-T7 cells encoding rabbit iRhom2 full-length wild type C-terminus tagged with three consecutive copies of the T7 epitope, using the calcium phosphate method. o After 7 h, the transfection was stopped by replacing the cell supernatant with standard growth medium lacking chloroquine and the cells were cultured overnight at 37 °C, 5% CO for virus production. In parallel, immortalized iRhom1 / 2- / -DKO MEFs as target cells for retroviral infection were plated at 1x10 per well in 6-well tissue culture plates (Greiner, Germany) in standard growth medium. 5The cells were seeded in the immortalized iRhom1 / 2- / -DKO MEFs and incubated overnight at 37°C with 5% CO2. On day 3, the supernatants of Phoenix-ECO cells releasing pMSCV, pMSCV-rhesus-iR2-FL-WT-T7, pMSCV-cyno-iR2-FL-WT-T7, pMSCV-dog-iR2-FL-WT-T7, or pMSCV-rabbit-iR2-FL-WT-T7 ecotropic viruses were collected, filtered through a 0.45 μm CA filter, and supplemented with 4 μg / ml polybrene (Sigma-Aldrich, USA). After removing the medium from the immortalized iRhom1 / 2- / -DKO MEFs, the virus-containing supernatants were added to the target cells and primary infection was performed at 37°C with 5% CO2 for 4 h. Concurrently, Phoenix-ECO cells were reincubated with fresh medium, filtered after another 4 h, and used for a second round of infection of the respective target cell populations, again in the presence of 4 μg / ml polybrene. Similarly, a third, but overnight, infection cycle was performed. On day 4, the virus-containing cell supernatant was replaced with fresh standard growth medium. From day 5 onwards, the following cells were cultured: immortalized MEF-DKO-EV control cells stably infected with pMSCV empty vector; pMSCV-rhesus-iR2-FL-WT-T7 cells stably expressing rhesus iRhom2 full-length wild-type C-terminus tagged with three consecutive copies of the T7 epitope; pMSCV-cyno-iR2-FL-WT-T7 cells stably expressing cyno iRhom2 full-length wild-type C-terminus tagged with three consecutive copies of the T7 epitope; pMSCV-dog-iR2-FL-WT-T7 cells stably expressing dog iRhom2 full-length wild-type C-terminus tagged with three consecutive copies of the T7 epitope; and rabbit iRhom2 full-length wild-type To select pMSCV-rabbit-iR2-FL-WT-T7 cells stably expressing a C-terminal tagged with three consecutive copies of the T7 epitope, cells were grown in the presence of 2mg / ml geneticin (G418, Thermo Fisher Scientific, USA). After expansion, cells were stocked for future use. In parallel, iRhom1 / 2- / -DKO MEFs stably expressing rhesus, cynomolgus, dog, and rabbit iRhom1-tagged versions were generated in a similar manner.

[0130] FACS analysis for test system evaluation and antibody characterization Briefly, immortalized MEF-DKO-EV control, MEF-DKO-rhesus-iR2-FL-WT-T7, MEF-DKO-cyno-iR2-FL-WT-T7, MEF-DKO-dog-iR2-FL-WT-T7 and MEF-DKO-rabbit-iR2-FL-WT-T7 cells and their respective iRhom1 counterparts were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide) and plated at approximately 3x10 per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Cells were seeded at 100 μl per well. To pellet the cells and remove the supernatant, the plates were centrifuged at 1500 rpm for 3 min at 4° C. For primary staining, cells were resuspended in 100 μl per well of either FACS buffer alone (control), mouse monoclonal anti-T7 IgG (Merck Millipore, USA) at 3 μg / ml FACS buffer, or the antibody of the present invention, also at 3 μg / ml FACS buffer, and incubated on ice for 1 h. Afterwards, the plates were centrifuged at 1500 rpm for 3 min at 4° C. and washed twice with 200 μl FACS buffer per well. For secondary staining of the previous anti-T7 staining, cells were spun down and resuspended at 100 μl per well in PE-labeled goat anti-mouse IgG F(ab´)2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. For the secondary staining before with the humanized antibodies of the invention, the cells were spun down and resuspended in 100 μl per well of PE-labeled goat anti-human IgG F(ab´)2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. The cell suspension was incubated on ice for 1 h, protected from light. Afterwards, the plate was centrifuged at 1500 rpm at 4°C for 3 min and washed three times with 200 μl FACS buffer per well. Finally, the cells were resuspended in 150 μl FACS buffer per well and analyzed using a BD AccuriTM C6 Plus flow cytometer (Becton Dickinson, Germany).

[0131] Figures 4a and 4b show representative results of cross-reactivity analysis for rhesus monkeys. Compared to staining of MEF-DKO-EV control cells (Figure 4a left; same as Figure 2a left), MEF-DKO-Rhesus-iR1-FL-WT-T7 (Figure 4a middle) and MEF-DKO-Rhesus-iR2-FL-WT-T7 (Figure 4a right), the strong increase in relative fluorescence intensity obtained with MEF-DKO-Rhesus-iR1-FL-WT-T7 and MEF-DKO-Rhesus-iR2-FL-WT-T7 using anti-T7 tag antibody indicates that rhesus iRhom1 and 2 variants, as well as human iRhom1 and 2 variants, are located on the surface of this genetically engineered cell population and therefore are valid as a suitable test system for characterizing the antibodies of the present invention. Antibody 16-B-03, a representative example of the humanized antibody of the present invention, showed strong binding to rhesus iRhom2 variants expressed on MEF-DKO-Rhesus-iR2-FL-WT-T7 cells (Figure 4b right), whereas no significant binding was detected on MEF-DKO-Rhesus-iR1-FL-WT-T7 cells (Figure 4b middle). This provides evidence that rhesus iRhom2 variants are specifically recognized by the humanized antibody 16-B-03 of the present invention, whereas rhesus iRhom1 was not recognized, and its presence on the cell surface was confirmed with an anti-T7 tag antibody (Figure 4a middle). Similar results were obtained with the humanized antibodies 16-B-05, 16-B-07, 23-B-04, 42-B-02, and 42-B-04 of the present invention, demonstrating that all of these humanized antibodies of the present invention recognize rhesus iRhom2 but not rhesus iRhom1.

[0132] Figures 5a and 5b show representative results of cross-reactivity analysis for cynomolgus monkeys. The strong increase in relative fluorescence intensity obtained with MEF-DKO-Cyno-iR1-FL-WT-T7 and MEF-DKO-Cyno-iR2-FL-WT-T7 using anti-T7 tag antibodies compared to staining with MEF-DKO-EV control cells (Figure 5a left; same as Figure 2a left), MEF-DKO-Cyno-iR1-FL-WT-T7 (Figure 5a middle) and MEF-DKO-Cyno-iR2-FL-WT-T7 (Figure 5a right) indicates that cynomolgus monkey iRhom1 and 2 variants, as well as human iRhom1 and 2 variants, are located on the surface of this genetically engineered cell population and therefore are valid as a suitable test system for characterizing the antibodies of the present invention. Antibody 16-B-03, a representative example of the humanized antibody of the present invention, showed strong binding to the cynomolgus monkey iRhom2 variant expressed on MEF-DKO-Cyno-iR2-FL-WT-T7 cells (Figure 5b, right), whereas no significant binding was detected on MEF-DKO-Cyno-iR1-FL-WT-T7 cells (Figure 5b, center). This provides evidence that the cynomolgus monkey iRhom2 variant is specifically recognized by the humanized antibody 16-B-03 of the present invention, whereas cynomolgus monkey iRhom1 was not recognized, and its presence on the cell surface was confirmed with an anti-T7 tag antibody (Figure 5a, center). Similar results were obtained with the humanized antibodies 16-B-05, 16-B-07, 23-B-04, 42-B-02, and 42-B-04 of the present invention, all of which were shown to recognize cynomolgus monkey iRhom2 but not cynomolgus monkey iRhom1.

[0133] Figures 6a and 6b show representative results of cross-reactivity analysis for dogs. Compared to staining of MEF-DKO-EV control cells, MEF-DKO-Dog-iR1-FL-WT-T7 (Figure 6a middle) and MEF-DKO-Dog-iR2-FL-WT-T7 (Figure 6a right) (Figure 6a left; same as Figure 2a left), the strong increase in relative fluorescence intensity obtained with MEF-DKO-Dog-iR1-FL-WT-T7 and MEF-DKO-Dog-iR2-FL-WT-T7 using anti-T7 tag antibody indicates that, like human iRhom1 and 2 variants, canine iRhom1 and 2 variants are also located on the surface of this engineered cell population and therefore valid as a suitable test system for characterizing the antibodies of the present invention. Antibody 16-B-03, a representative example of the humanized antibody of the present invention, showed strong binding to the canine iRhom2 variant expressed on MEF-DKO-Dog-iR2-FL-WT-T7 cells (Figure 6b right), whereas no significant binding was detected on MEF-DKO-Dog-iR1-FL-WT-T7 cells (Figure 6b middle). This proves that the canine iRhom2 variant is specifically recognized by the humanized antibody 16-B-03 of the present invention. On the other hand, canine iRhom1 was not recognized, and its presence on the cell surface was confirmed with an anti-T7 tag antibody (Figure 6a middle). Similar results were obtained with the humanized antibodies 16-B-05, 16-B-07, 23-B-04, 42-B-02, and 42-B-04 of the present invention, indicating that all of these humanized antibodies of the present invention recognize canine iRhom2 but not canine iRhom1.

[0134] Figures 7a and 7b show representative results of cross-reactivity analysis for rabbit. The strong increase in relative fluorescence intensity obtained with MEF-DKO-Rabbit-iR1-FL-WT-T7 and MEF-DKO-Rabbit-iR2-FL-WT-T7 using anti-T7 tag antibody compared to staining of MEF-DKO-EV control cells (Figure 7a left; same as Figure 2a left), MEF-DKO-Rabbit-iR1-FL-WT-T7 (Figure 7a middle) and MEF-DKO-Rabbit-iR2-FL-WT-T7 (Figure 7a right) indicates that rabbit iRhom1 and 2 variants, as well as human iRhom1 and 2 variants, are located on the surface of this engineered cell population and therefore are valid as a suitable test system for characterizing the antibodies of the present invention. Antibody 16-B-03, a representative example of the humanized antibody of the present invention, showed strong binding to rabbit iRhom2 variants expressed on MEF-DKO-Rabbit-iR2-FL-WT-T7 cells (Figure 7b right), whereas no significant binding was detected on MEF-DKO-Rabbit-iR1-FL-WT-T7 cells (Figure 7b middle). This proves that rabbit iRhom2 variants are specifically recognized by humanized antibody 16-B-03 of the present invention. On the other hand, rabbit iRhom1 was not recognized, and its presence on the cell surface was confirmed with anti-T7 tag antibody (Figure 7a middle). Similar results were obtained with humanized antibodies 16-B-05, 16-B-07, 23-B-04, 42-B-02, and 42-B-04 of the present invention, indicating that all of these humanized antibodies of the present invention recognize rabbit iRhom2 but not rabbit iRhom1.

[0135] Example 6: Analysis of the inhibitory effect of the antibody of the present invention on LPS-induced TNFα cleavage in vitro In the following study, an ELISA-based TNFα release assay was performed to confirm the inhibitory effect of the humanized antibodies of the invention on LPS-induced release of endogenous TNFα from human THP-1 monocytic cells.

[0136] The ELISA-based TNFα release assay used in this example is described below.

[0137] Briefly, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with mouse anti-human TNFα capture antibody (provided as part of the DuoSet ELISA kit) at 4 μg / ml in TBS, 100 μl per well, overnight at 4° C. On day 2, the capture antibody solution was removed and MaxiSorp® plates were blocked with 300 μl per well of TBS, 1% BSA for 1-2 hours at room temperature. Meanwhile, 20,000 THP-1 (American Type Culture Collection, USA) cells in 80 μl of normal growth medium were seeded into each well of a Greiner CELLSTAR V-bottom 96-well plate (Greiner Bio-One, Germany) and pre-incubated for 30 min at 37° C., 5% CO2 in standard growth medium (20 μl per well) supplemented with 50 μM Batimastat (BB94, Abcam, UK) as a positive control (final concentration of 10 μM in the resulting 100 μl sample volume), 15 μg / ml human IgG antibody (BioLegend, USA) as an isotype control (final concentration of 3 μg / ml, sample volume of 100 μl), or 15 μg / ml humanized antibody of the present invention (final concentration of 3 μg / ml, sample volume of 100 μl). For stimulation targets, 20 μl of standard growth medium without test article was added. Afterwards, cells (except for the unstimulated control) were stimulated with LPS (Sigma-Aldrich, USA) at 300 ng / ml in growth medium to a final concentration of 50 ng / ml, 20 μl per well, for 2 h at 37 °C and 5% CO2. Afterwards, the 96-well plates were centrifuged to sediment the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plates and the plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well on a 96-head plate washer (Tecan Group, Switzerland). To avoid drying, 30 μl TBS was immediately added to each well of the MaxiSorp® plate, followed by transfer of 70 μl of cell-free supernatant per sample.Additionally, 100 μl of recombinant human TNFα protein (provided as part of the DuoSet ELISA kit) diluted to a defined concentration in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human TNFα detection antibody (provided as part of the DuoSet ELISA kit) was added per well at 50 ng / ml in TBS, and the plate was incubated for 2 h at room temperature, protected from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland, Carl Roth), and carefully removing all traces of buffer after the fourth cycle, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plate was incubated for 30 min at room temperature, again protected from direct light. After rewashing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer after the fourth cycle, 100 μl of AttoPhos substrate solution (Promega, USA) was added per well for incubation at room temperature in the dark for 1 h. Fluorescence of each well was collected at an excitation wavelength of 435 nm and an emission wavelength of 555 nm using an infinite M1000 (Tecan Group, Switzerland) microplate reader.

[0138] Figure 8 shows representative results from this experiment showing the effect of test articles on LPS-induced TNFα release from THP-1 cells in absolute numbers (Figure 8a) and percent inhibition (Figure 8b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and potently inhibited LPS-induced TNFα release, while the presence of an IgG isotype control had no significant effect on TNFα cleavage. In contrast, equivalent concentrations of humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibit LPS-induced TNFα release from THP-1 cells by 75.1%, 78.7%, 77.2%, 77.6%, 75.2% and 76.1%, respectively.

[0139] Example 7: Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced TNFα cleavage in vitro In contrast to Example 6, which examined the inhibitory effect of antibodies of the invention on LPS-induced release of endogenous TNFα from human THP-1 cells, this analysis was performed to confirm the inhibitory effect of antibodies of the invention on PMA-induced release of endogenous TNFα from human monocytic U-937 cells.

[0140] The ELISA-based TNFα release assay used in this example is described below.

[0141] Briefly, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with mouse anti-human TNFα capture antibody (provided as part of the DuoSet ELISA kit) at 4 μg / ml in TBS, 100 μl per well, overnight at 4° C. On day 2, the capture antibody solution was removed and MaxiSorp® plates were blocked with 300 μl per well of TBS, 1% BSA for 1-2 hours at room temperature. Meanwhile, 75,000 U-937 (European Collection of Authenticated Cell Cultures, UK) cells in 80 μl of normal growth medium were seeded into each well of a Greiner CELLSTAR V-bottom 96-well plate (Greiner Bio-One, Germany) and pre-incubated for 30 min at 37° C., 5% CO2 in standard growth medium (20 μl per well) supplemented with 50 μM Batimastat (BB94, Abcam, UK) as a positive control (final concentration of 10 μM in the resulting 100 μl sample volume), 50 μg / ml human IgG antibody (BioLegend, USA) as an isotype control (final concentration of 10 μg / ml, sample volume of 100 μl), or 16.66 μg / ml of the antibody of the present invention (final concentration of 3.33 μg / ml, sample volume of 100 μl). For stimulation targets, 20 μl of standard growth medium without the test article was added. Afterwards, cells (except for the unstimulated control) were stimulated with PMA (Sigma-Aldrich, USA) at 150 ng / ml in growth medium to a final concentration of 25 ng / ml with 20 μl per well for 1 h at 37 °C and 5% CO2. Afterwards, the 96-well plates were centrifuged to sediment the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plates and the plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well on a 96-head plate washer (Tecan Group, Switzerland). To avoid drying, 30 μl TBS was immediately added to each well of the MaxiSorp® plate, followed by transfer of 70 μl of cell-free supernatant per sample.Additionally, 100 μl of recombinant human TNFα protein (provided as part of the DuoSet ELISA kit) diluted to a defined concentration in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human TNFα detection antibody (provided as part of the DuoSet ELISA kit) was added per well at 50 ng / ml in TBS, and the plate was incubated for 2 h at room temperature, protected from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland, Carl Roth), and carefully removing all traces of buffer after the fourth cycle, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plate was incubated for 30 min at room temperature, again protected from direct light. After rewashing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer after the fourth cycle, 100 μl of AttoPhos substrate solution (Promega, USA) was added per well for incubation at room temperature in the dark for 1 h. Fluorescence of each well was collected at an excitation wavelength of 435 nm and an emission wavelength of 555 nm using an infinite M1000 (Tecan Group, Switzerland) microplate reader.

[0142] Figure 9 shows representative results from this experiment, showing the effect of test articles on PMA-induced release of TNFα from U-937 cells, in absolute numbers (Figure 9a) and percent inhibition (Figure 9b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and potently inhibited LPS-induced TNFα release, while the presence of an IgG isotype control had no significant effect on TNFα cleavage. In contrast, humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibit PMA-induced TNFα release from U-937 cells by 89.8%, 89.0%, 90.3%, 77.2%, 85.0% and 87.9%, respectively.

[0143] Example 8: Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced interleukin-6 receptor (IL-6R) cleavage in vitro In the following study, an ELISA-based IL-6R release assay was performed to analyze the inhibitory effect of antibodies of the invention on PMA-induced release of endogenous IL-6R from human THP-1 monocytic cells.

[0144] The ELISA-based IL-6R release assay used in this example is described below.

[0145] Briefly, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with mouse anti-human IL-6R capture antibody (provided as part of the DuoSet ELISA kit) at 100 μl per well at 2 μg / ml in TBS overnight at 4° C. On day 2, the capture antibody solution was removed and MaxiSorp® plates were blocked with 300 μl per well of TBS, 1% BSA for 1-2 hours at room temperature. Meanwhile, 40,000 THP-1 (American Type Culture Collection, USA) cells in 80 μl of normal growth medium were seeded into each well of a Greiner CELLSTAR V-bottom 96-well plate (Greiner Bio-One, Germany) and pre-incubated for 30 min at 37° C., 5% CO2 in standard growth medium (20 μl per well) supplemented with 50 μM Batimastat (BB94, Abcam, UK) as a positive control (final concentration of 10 μM in the resulting 100 μl sample volume), 15 μg / ml human IgG antibody (BioLegend, USA) as an isotype control (final concentration of 3 μg / ml, sample volume of 100 μl), or 15 μg / ml of the antibody of the present invention (final concentration of 3 μg / ml, sample volume of 100 μl). For stimulation targets, 20 μl of standard growth medium without the test article was added. Afterwards, cells (except for the unstimulated control) were stimulated with PMA (Sigma-Aldrich, USA) at 150 ng / ml in growth medium to a final concentration of 25 ng / ml with 20 μl per well for 1 h at 37 °C and 5% CO2. Afterwards, the 96-well plates were centrifuged to sediment the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plates and the plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well on a 96-head plate washer (Tecan Group, Switzerland). To avoid drying, 30 μl TBS was immediately added to each well of the MaxiSorp® plate, followed by transfer of 70 μl of cell-free supernatant per sample.Additionally, 100 μl of recombinant human IL-6R protein (provided as part of the DuoSet ELISA kit) diluted to a defined concentration in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human IL-6R detection antibody (provided as part of the DuoSet ELISA kit) was added per well at 100 ng / ml in TBS, and the plate was incubated for 2 h at room temperature, protected from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland, Carl Roth), and carefully removing all traces of buffer after the fourth cycle, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plate was incubated for 30 min at room temperature, again protected from direct light. After rewashing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer after the fourth cycle, 100 μl of AttoPhos substrate solution (Promega, USA) was added per well for incubation at room temperature in the dark for 1 h. Fluorescence of each well was collected at an excitation wavelength of 435 nm and an emission wavelength of 555 nm using an infinite M1000 (Tecan Group, Switzerland) microplate reader.

[0146] Figures 10a and 10b show representative results from this experiment showing the effect of test articles on PMA-induced release of IL-6R from THP-1 cells in absolute numbers (Figure 10a) and percent inhibition (Figure 10b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and potently inhibited PMA-induced IL-6R release, while the presence of an IgG isotype control had no significant effect on IL-6R cleavage. In contrast, equivalent concentrations of the humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibited PMA-induced IL-6R release from THP-1 cells by 75.6%, 74.0%, 75.6%, 70.1%, 68.5% and 71.6%, respectively.

[0147] Example 9: Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced interleukin-6 receptor (IL-6R) cleavage in vitro Supplementing the above-mentioned Example 8, an ELISA-based IL-6R release assay was performed to confirm the inhibitory effect of the antibodies of the present invention on PMA-induced release of endogenous IL-6R from human U-937 cells.

[0148] The ELISA-based IL-6R release assay used in this example is described below.

[0149] Briefly, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with mouse anti-human IL-6R capture antibody (provided as part of the DuoSet ELISA kit) at 100 μl per well at 2 μg / ml in TBS overnight at 4° C. On day 2, the capture antibody solution was removed and MaxiSorp® plates were blocked with 300 μl per well of TBS, 1% BSA for 1-2 hours at room temperature. Meanwhile, 75,000 U-937 (European Collection of Authenticated Cell Cultures, UK) cells in 80 μl of normal growth medium were seeded into each well of a Greiner CELLSTAR V-bottom 96-well plate (Greiner Bio-One, Germany) and pre-incubated for 30 min at 37° C., 5% CO2 in standard growth medium (20 μl per well) supplemented with 50 μM Batimastat (BB94, Abcam, UK) as a positive control (final concentration of 10 μM in the resulting 100 μl sample volume), 50 μg / ml human IgG antibody (BioLegend, USA) as an isotype control (final concentration of 10 μg / ml, sample volume of 100 μl), or 16.66 μg / ml of the antibody of the present invention (final concentration of 3.33 μg / ml, sample volume of 100 μl). For stimulation targets, 20 μl of standard growth medium without the test article was added. Afterwards, cells (except for the unstimulated control) were stimulated with PMA (Sigma-Aldrich, USA) at 150 ng / ml in growth medium to a final concentration of 25 ng / ml with 20 μl per well for 1 h at 37 °C and 5% CO2. Afterwards, the 96-well plates were centrifuged to sediment the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plates and the plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well on a 96-head plate washer (Tecan Group, Switzerland). To avoid drying, 30 μl TBS was immediately added to each well of the MaxiSorp® plate, followed by transfer of 70 μl of cell-free supernatant per sample.Additionally, 100 μl of recombinant human IL-6R protein (provided as part of the DuoSet ELISA kit) diluted to a defined concentration in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human IL-6R detection antibody (provided as part of the DuoSet ELISA kit) was added per well at 100 ng / ml in TBS, and the plate was incubated for 2 h at room temperature, protected from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland, Carl Roth), and carefully removing all traces of buffer after the fourth cycle, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plate was incubated for 30 min at room temperature, again protected from direct light. After rewashing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer after the fourth cycle, 100 μl of AttoPhos substrate solution (Promega, USA) was added per well for incubation at room temperature in the dark for 1 h. Fluorescence of each well was collected at an excitation wavelength of 435 nm and an emission wavelength of 555 nm using an infinite M1000 (Tecan Group, Switzerland) microplate reader.

[0150] Figure 11 shows representative results from this experiment, showing the effect of test articles on PMA-induced release of IL-6R from U-937 cells in absolute numbers (Figure 11a) and percent inhibition (Figure 11b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and potently inhibited PMA-induced IL-6R release, while the presence of an IgG isotype control had no significant effect on IL-6R cleavage. In contrast, humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the present invention inhibit PMA-induced IL-6R release from U-937 cells by 79.6%, 81.7%, 77.5%, 77.8%, 78.3% and 82.4%, respectively.

[0151] Example 10: Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced cleavage of heparin-binding EGF-like growth factor (HB-EGF) in vitro In the following study, an ELISA-based HB-EGF release assay was performed to analyze the inhibitory effect of antibodies of the invention on PMA-induced release of endogenous HB-EGF from human THP-1 monocytic cells.

[0152] The ELISA-based HB-EGF release assay used in this example is described below.

[0153] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with rat anti-human HB-EGF capture antibody (provided as part of the DuoSet ELISA kit) at 2 μg / ml in TBS, 100 μl per well, overnight at 4°C. 40,000 THP-1 (American Type Culture Collection, USA) cells in 80 μl of normal growth medium were seeded into each well of a Greiner CELLSTAR V-bottom 96-well plate (Greiner Bio-One, Germany) and pre-incubated for 30 min at 37° C., 5% CO2 with standard growth medium (20 μl per well) supplemented with 50 μM Batimastat (BB94, Abcam, UK) as positive control (final concentration 10 μM in the resulting 100 μl sample volume), 15 μg / ml human IgG antibody (BioLegend, USA) as isotype control (final concentration 3 μg / ml, sample volume 100 μl), or 15 μg / ml of the antibody of the present invention (final concentration 3 μg / ml, sample volume 100 μl). For stimulation, 20 μl of standard growth medium without test article was added. Afterwards, cells (except for the unstimulated control) were stimulated with PMA (Sigma-Aldrich, USA) at 150 ng / ml in growth medium to a final concentration of 25 ng / ml with 20 μl per well for 24 h at 37 °C, 5% CO2. On the second day, the capture antibody solution was removed and the MaxiSorp® plates were blocked with 300 μl TBS, 1% BSA per well for 1-2 h at room temperature. Afterwards, the 96-well plates were centrifuged to precipitate the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plates and the plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well on a 96-head plate washer (Tecan Group, Switzerland). To avoid drying, 30 μl TBS was immediately added to each well of the MaxiSorp® plate, followed by transfer of 70 μl of cell-free supernatant per sample.Additionally, 100 μl of recombinant human HB-EGF protein (provided as part of the DuoSet ELISA kit) diluted to a defined concentration in TBS was added to the plate as a standard reference. The plate was then incubated for 2 h at room temperature. After washing four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer after the fourth cycle, 100 μl of biotinylated goat anti-human HB-EGF detection antibody (provided as part of the DuoSet ELISA kit) was added per well at 50 ng / ml TBS and the plate was incubated for 2 h at room temperature, away from direct sunlight. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland, Carl Roth) and carefully removing all traces of buffer from the fourth cycle onwards, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well and the plate was incubated for 30 min at room temperature, again protected from direct light. After washing again four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer from the fourth cycle onwards, 100 μl of AttoPhos substrate solution (Promega, USA) was added per well for 1 h incubation at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0154] Figure 12 shows representative results from this experiment, showing the effect of test articles on PMA-induced release of HB-EGF from THP-1 cells in absolute numbers (Figure 12a) and percent inhibition (Figure 12b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and potently inhibited PMA-induced HB-EGF release, while the presence of a human IgG isotype control had no significant effect on HB-EGF cleavage. In contrast, equivalent concentrations of humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibited PMA-induced HB-EGF release from THP-1 cells by 80.2%, 83.0%, 80.5%, 84.4%, 81.2% and 86.2%, respectively.

[0155] Example 11: Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced HB-EGF cleavage in vitro Supplementing Example 10 above, an ELISA-based HB-EGF release assay was performed to confirm the inhibitory effect of the antibodies of the present invention on PMA-induced release of endogenous HB-EGF from human U-937 cells.

[0156] The ELISA-based HB-EGF release assay used in this example was the same as that described in Example 10, with the only difference being that U-937 (European Collection of Authenticated Cell Cultures, UK) cells (80,000 cells / well) were used instead of THP-1 (American Type Culture Collection, USA) cells.

[0157] Figure 13 shows representative results from this experiment, showing the effect of test articles on PMA-induced release of HB-EGF from U-937 cells, in absolute numbers (Figure 13a) and percent inhibition (Figure 13b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and potently inhibited PMA-induced HB-EGF release, while the presence of a human IgG isotype control had little effect on HB-EGF cleavage. In contrast, equivalent concentrations of the humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibited PMA-induced HB-EGF release from U-937 cells by 99.2%, 99.7%, 99.2%, 99.5%, 98.8% and 99.4%, respectively.

[0158] Example 12: Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced transforming growth factor α (TGFα) cleavage in vitro In the following studies, an ELISA-based TGFα release assay was performed to analyze the inhibitory effect of antibodies of the invention on PMA-induced release of endogenous TGFα from human PC3 prostate cancer cells.

[0159] The ELISA-based TGFα release assay used in this example is described below.

[0160] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with goat anti-human TGFα capture antibody (provided as part of the DuoSet ELISA kit) at 100 μl per well in 0.4 μg / ml TBS overnight at 4° C. 80,000 PC3 (European Collection of Authenticated Cell Cultures, UK) cells were seeded in 100 μl of standard growth medium into each well of an F-bottom 96-well cell culture plate (Corning, USA) and incubated overnight at 37° C., 5% CO2. On day 2, the capture antibody solution was removed and MaxiSorp® plates were blocked with 300 μl per well of TBS, 1% BSA for 1-2 hours at room temperature. Meanwhile, the cells were washed once with PBS and pre-incubated for 30 min at 37° C. and 5% CO2 in 80 μL of OptiMEM medium (20 μl per well) supplemented with 50 μM Batimastat (BB94, Abcam, UK) as a positive control (final concentration of 10 μM in the resulting 100 μl sample volume), 50 μg / ml human IgG antibody (BioLegend, USA) as an isotype control (final concentration of 10 μg / ml, sample volume of 100 μl), or 50 μg / ml of the antibody of the present invention (final concentration of 10 μg / ml, sample volume of 100 μl). For stimulation targets, 20 μl of OptiMEM medium without test article was added. Then, the cells (except for the non-stimulated control) were stimulated with PMA (Sigma-Aldrich, USA) at a final concentration of 25 ng / ml in 150 ng / ml OptiMEM at 37° C. and 5% CO2 for 2 h at 37° C. In parallel, blocking buffer was removed from the MaxiSorp® plates and the plates were washed four times with 350 μl TBS-T (Karl Roth, Germany) per well on a 96-head plate washer (Tecan Group, Switzerland). To avoid drying, 20 μl TBS was immediately added to each well of the MaxiSorp® plate before transferring 80 μl of cell-free supernatant per sample.Additionally, 100 μl of recombinant human TGFα protein (provided as part of the DuoSet ELISA kit) diluted to a defined concentration in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human TGFα detection antibody (provided as part of the DuoSet ELISA kit) was added per well at 37.5 ng / ml in TBS, and the plate was incubated for 2 h at room temperature, protected from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland, Carl Roth), and carefully removing all traces of buffer after the fourth cycle, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plate was incubated for 30 min at room temperature, again protected from direct light. After rewashing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer after the fourth cycle, 100 μl of AttoPhos substrate solution (Promega, USA) was added per well for incubation at room temperature in the dark for 1 h. Fluorescence of each well was collected at an excitation wavelength of 435 nm and an emission wavelength of 555 nm using an infinite M1000 (Tecan Group, Switzerland) microplate reader.

[0161] Figure 14 shows representative results from this experiment, showing the effect of test articles on PMA-induced release of TGFα from PC3 cells, both in absolute numbers (Figure 14a) and as percentage inhibition (Figure 14b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control, inhibiting PMA-induced TGFα release by 90.7%, while the presence of an IgG isotype control had no effect on inhibiting TGFα cleavage. In the presence of equal concentrations of humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04, PMA-induced release of TGFα from PC3 cells was inhibited by 15.9%, 23.8%, 3.3%, 21.3%, 6.4% and 19.5%, respectively, with only very modest effects on TGFα cleavage being detected.

[0162] Example 13: Evaluation of the binding specificity of the antibodies of the present invention in cell lines that endogenously express iRhom2 In this study, the humanized antibody 42-B-02 was used as a representative example of the antibody of the present invention to analyze the binding specificity in cell lines that endogenously express iRhom2. The study was carried out using RPMI-8226 cells, a human B lymphocyte cell line that endogenously expresses iRhom2 but is endogenously negative for iRhom1, THP-1 cells, a human monocytic cell line that endogenously expresses both iRhom2 and iRhom1, and RH-30 cells, a human fibroblast cell line that is endogenously negative for iRhom2 but endogenously expresses iRhom1.

[0163] Briefly, human RPMI-8226 cells (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Germany), THP-1 cells (American Type Culture Collection, USA), and RH-30 cells (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Germany) were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 2 × 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5 Cells were seeded on wells at 100 μl per well. Plates were centrifuged at 1500 rpm, 4° C. for 3 min to pellet the cells and remove the supernatant. For primary staining, cells were suspended in 100 μl per well of either FACS buffer alone (control) or 3 μg / ml of the antibody of the invention in FACS buffer and incubated on ice for 1 h. Plates were then centrifuged at 1500 rpm, 4° C. for 3 min and washed twice with 200 μl of FACS buffer per well. For secondary staining, cells were spun down and suspended in 100 μl of PE-labeled goat anti-human IgG F(ab´)2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer per well. Protected from light, the cell suspension was incubated on ice for 1 h. Plates were then centrifuged at 1500 rpm, 4° C. for 3 min and washed three times with 200 μl of FACS buffer per well. Finally, cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD AccuriTM C6 Plus flow cytometer (Becton Dickinson, Germany).

[0164] Figure 15 shows representative results of this study. Compared to the control sample incubated with secondary antibody alone (gray), when both RPMI-8226 cells and THP-1 cells, which endogenously express iRhom2, were co-incubated with humanized antibody 42-B-02, a representative example of the antibody of the present invention (left & center, black), a strong shift in relative fluorescence intensity was observed in both cell lines, demonstrating strong binding of humanized antibody 42-B-02 of the present invention to two human cell lines that are endogenously positive for iRhom2. On the other hand, no binding of humanized antibody 42-B-02, a representative example of the antibody of the present invention (right, black), was detected to RH-30 cells that do not express iRhom2, providing evidence that endogenously expressed iRhom2 is specifically recognized by humanized antibody 42-B-02 of the present invention.

[0165] Example 14: Epitope mapping of antibodies of the invention based on single amino acid substitutions or deletions in large extracellular loops Currently, there are several methods to map epitopes recognized by antibodies, including X-ray crystallography, array-based oligopeptide scanning, hydrogen-deuterium exchange, and cross-linking mass spectrometry. Genetic approaches such as site-directed mutagenesis and high-throughput shotgun mutagenesis allow epitope mapping at single amino acid resolution. However, amino acid substitutions at random positions in a protein or with unrelated amino acids run the risk of causing conformational changes or loss of function in the protein, which may result in misinterpretation as to whether the substituted amino acid contributes to the antibody epitope. An elegant and commonly accepted way to avoid such risks is to replace individual amino acids in a protein with homologous amino acids from structurally related proteins, i.e., orthologues or closely related family members. As mentioned above, both are true, since our humanized anti-human iRhom2 antibody has been shown not to cross-react with either the mouse orthologue (Example 3) or the closely related family member human iRhom1 (Example 4). Furthermore, replacement of individual amino acids in a protein with the amino acid alanine is a widely used approach for mapping epitopes.

[0166] Therefore, as an approach to identify single amino acids that contribute to the binding of the antibody of the present invention, we designed a plasmid of a set of 137 human iRhom2 variants with either mouse iRhom2-associated single amino acid substitutions, human iRhom1-associated single amino acid substitutions, or single amino acid substitutions to alanine. These 137 substitutions reflect amino acids in the large extracellular loop 1 (AA502 to AA594 in human iRhom2) that are non-identical in human iRhom2 vs. mouse iRhom2, non-identical in human iRhom2 vs. human iRhom1, or the respective amino acids in human iRhom2 are replaced with alanine. Instead of amino acids in human iRhom2, amino acids at the corresponding positions in mouse iRhom2 or human iRhom1 were introduced, or amino acids in human iRhom2 were replaced with alanine. When the corresponding amino acid was not present in mouse iRhom2 or human iRhom1, the respective amino acids in human iRhom2 were deleted to generate the following variants: hiR2-FL-Q502R-T7, hiR2-FL-N503A-T7, hiR2-FL-D504A-T7, hiR2-FL-H505R-T7, hi R2-FL-H505A-T7, hiR2-FL-S506A-T7, hiR2-FL-G507A-T7, hiR2-FL-C508A-T7, hiR2 -FL-I509V-T7, hiR2-FL-I509A-T7, hiR2-FL-Q510A-T7, hiR2-FL-T511A-T7, hiR2-F L-Q512L-T7, hiR2-FL-Q512S-T7, hiR2-FL-Q512A-T7, hiR2-FL-R513K-T7, hiR2-FL- R513E-T7, hiR2-FL-R513A-T7, hiR2-FL-K514E-T7, hiR2-FL-K514A-T7, hiR2-FL-D5 15E-T7, hiR2-FL-D515A-T7, hiR2-FL-C516A-T7, hiR2-FL-S517A-T7, hiR2-FL-E518 S-T7, hiR2-FL-E518A-T7, hiR2-FL-T519A-T7, hiR2-FL-L520A-T7, hiR2-FL-A521S- T7, hiR2-FL-T522V-T7, hiR2-FL-T522A-T7, hiR2-FL-F523W-T7, hiR2-FL-F523A-T7,hiR2-FL-V524A-T7, hiR2-FL-K525A-T7, hiR2-FL-W526A-T7, hiR2-FL-Q527P-T7, hiR2-FL-Q527A-T7, hiR2-FL-D528N-T7, hiR2-FL-D528I-T7, hiR2-FL-D528A-T7, hiR2-FL-D529H-T7, hiR2-FL-D529A-T7, hiR2-FL-T530P-T7, hiR2-FL-T530A-T7, hiR2-FL-G531S-T7, hiR2-FL-G531A-T7, hiR2-FL- P532A-T7, hiR2-FL-P533--T7, hiR2-FL-P533A-T7, hiR2-FL-M534S-T7, hiR2-FL-M534--T7, hiR2-FL-M534A-T7, hiR2-FL-D535--T7, hiR2-FL-D535A-T7, hiR2-FL-K536--T7, hiR2-FL-K536A-T7, hiR2-FL-S537E-T7, hiR2-FL-S537A-T7, hiR2-FL-D538L-T7, hiR2-FL-D538A-T7, hiR2-FL-L539A-T7, hiR2-FL-G540S-T7, hiR2-FL-G540A-T7, hiR2-FL-Q541H-T7, hiR2-FL-Q541A-T7, hiR2-FL-K542A-T7, hiR2-FL-R543Q-T7, hiR2-FL-R543A-T7, hiR2-FL-T544P-T7, hiR2-FL-T544Q-T7, hiR2-FL-T544A-T7, hiR2-FL-S545F-T7, hiR2-FL-S545A-T7, hiR2-FL-G546A-T7, hiR2-FL-A547V-T7, hiR2-FL- A547S-T7, hiR2-FL-V548A-T7, hiR2-FL-C549A-T7, hiR2-FL-H550A-T7, hiR2-FL-Q551A-T7, hiR2-FL-D552A-T7, hiR2-FL-P553A-T7, hiR2-FL-R554A-T7, hiR2-FL-T555V-T7, hiR2-FL-T555A-T7, hiR2-FL-C556A-T7, hiR2-FL-E557D-T7, hiR2-FL-E557A-T7, hiR2-FL-E558A-T7, hiR2-FL-P559A-T7,<h2 style=";text-align:left;direction:ltr">hiR2-FL-A560S-T7, hiR2-FL-S561A-T7, hiR2-FL-S562E-T7, hiR2-FL-S562A-T7, hiR2-FL-G563D-T7, hiR2-FL-G563A-T7, hiR2-FL-A564P-T7, hiR2-FL-A564S-T7, hiR2-FL-H565A-T7, hiR2-FL-I566E-T7, hiR2-FL-I566A-T7, hiR2-FL-W 567A-T7, hiR2-FL-P568A-T7, hiR2-FL-D569E-T7, hiR2-FL-D569A-T7, hiR2-FL-D570A-T7, hiR2-FL-I571A-T7, hiR2-FL-T572A-T7, hiR2-FL-K573A-T7, hiR2-FL-W574A-T7, hiR2-FL-P575A-T7, hiR2-FL-I576A-T7, hiR2-FL-C577A-T7, h iR2-FL-T578A-T7、hiR2-FL-E579K-T7、hiR2-FL-E579A-T7、hiR2-FL-Q580N-T7、hiR2-FL-Q580A-T7、hiR2-FL-A581S- T7、hiR2-FL-R582A-T7、hiR2-FL-S583G-T7、hiR2-FL-S583A-T7、hiR2-FL-N584A-T7、hiR2-FL-H585A-T7、hiR2-FL-T5 86A-T7, hiR2-FL-G587N-T7, hiR2-FL-G587A-T7, hiR2-FL-F588H-T7, hiR2-FL-F588A-T7, hiR2-FL-L589P-T7, hiR2-FL-L589A-T7, hiR2-FL-H590A-T7, hiR2-FL-M591A-T7, hiR2-FL-D592A-T7, hiR2-FL-C593A-T7, and hiR2-FL-E594V-T7.<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0167] <h2 style=";text-align:left;direction:ltr"> In this example, we describe the generation of iRhom1 / 2- / -DKO MEF populations expressing 137 single amino acid substitution or deletion variants and their characterization in terms of cell surface localization and functional activity as indicators of proper protein conformation. We then describe the binding analysis of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the present invention to the entire panel of 137 artificial MEF populations expressing human iRhom2 variants with single amino acid substitutions or deletions.

[0168] Generation of iRhom1 / 2- / - DKO MEFs stably expressing 137 T7-tagged human iRhom2 variants with single amino acid substitutions or deletions Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in 6-well tissue culture plates (Greiner, Germany) in standard growth medium. 5The cells were seeded and incubated overnight at 37°C, 5% CO2. On the second day, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. The calcium phosphate method was applied to inoculate the cells with 2 μg / ml of pMSCV-hiR2-FL-Q502R-T7, pMSCV-hiR2-FL-N503A-T7, pMSCV-hiR2-FL-D504A-T7, pMSCV-hiR2-FL-H505R-T7, pMSCV-hiR2-FL-H505A-T7, and pMSCV-hiR2-FL-S506A-T7, encoding full-length single amino acid substitutions of human iRhom2 tagged at the C-terminus with three consecutive copies of the T7 epitope (MASMTGGQQMG). , pMSCV-hiR2-FL-G507A-T7, pMSCV-hiR2-FL-C508A-T7, pMSCV-hiR2-FL-I509V-T7, pMSCV-hiR2-FL-I509A-T7, pMSCV-hiR2-FL-Q510A-T7 , pMSCV-hiR2-FL-T511A-T7, pMSCV-hiR2-FL-Q512L-T7, pMSCV-hiR2-FL-Q512S-T7, pMSCV-hiR2-FL-Q512A-T7, pMSCV-hiR2-FL-R513K-T7 , pMSCV-hiR2-FL-R513E-T7, pMSCV-hiR2-FL-R513A-T7, pMSCV-hiR2-FL-K514E-T7, pMSCV-hiR2-FL-K514A-T7, pMSCV-hiR2-FL-D515E-T7 , pMSCV-hiR2-FL-D515A-T7, pMSCV-hiR2-FL-C516A-T7, pMSCV-hiR2-FL-S517A-T7, pMSCV-hiR2-FL-E518S-T7, pMSCV-hiR2-FL-E518A-T7 , pMSCV-hiR2-FL-T519A-T7, pMSCV-hiR2-FL-L520A-T7, pMSCV-hiR2-FL-A521S-T7, pMSCV-hiR2-FL-T522V-T7, pMSCV-hiR2-FL-T522A-T7 , pMSCV-hiR2-FL-F523W-T7, pMSCV-hiR2-FL-F523A-T7, pMSCV-hiR2-FL-V524A-T7, pMSCV-hiR2-FL-K525A-T7, pMSCV-hiR2-FL-W526A-T7,pMSCV-hiR2-FL-Q527P-T7, pMSCV-hiR2-FL-Q527A-T7, pMSCV-hiR2-FL-D528N-T7, pMSCV-hiR2-FL-D528I-T7, pMSCV-hiR2-FL-D528A-T7, pMSCV-hiR2-FL-D529H-T7, pMSCV-hiR2-FL-D529A-T7, pMSCV-hiR2-FL-T530P-T7, pMSCV-hiR2-FL-T530A-T7, pMSCV-hiR2-FL-G531S-T7, pMSCV-hiR2-FL-G53 1A-T7, pMSCV-hiR2-FL-P532A-T7, pMSCV-hiR2-FL-P533--T7, pMSCV-hiR2-FL-P533A-T7, pMSCV-hiR2-FL-M534S-T7, pMSCV-hiR2-FL-M534--T7, pMSCV-hiR2-FL-M534A-T7, pMSCV-hiR2-FL-D535--T7, pMSCV-hiR2-FL-D535A-T7, pMSCV-hiR2-FL-K536--T7, pMSCV-hiR2-FL-K536A-T7, pMSCV-hiR2- FL-S537E-T7, pMSCV-hiR2-FL-S537A-T7, pMSCV-hiR2-FL-D538L-T7, pMSCV-hiR2-FL-D538A-T7, pMSCV-hiR2-FL-L539A-T7, pMSCV-hiR2-FL-G540S-T7, pMSCV-hiR2-FL-G540A-T7, pMSCV-hiR2-FL-Q541H-T7, pMSCV-hiR2-FL-Q541A-T7, pMSCV-hiR2-FL-K542A-T7, pMSCV-hiR2-FL-R543Q-T7, pMSCV -hiR2-FL-R543A-T7, pMSCV-hiR2-FL-T544P-T7, pMSCV-hiR2-FL-T544Q-T7, pMSCV-hiR2-FL-T544A-T7, pMSCV-hiR2-FL-S545F-T7, pMSCV-hiR2-FL-S545A-T7, pMSCV-hiR2-FL-G546A-T7, pMSCV-hiR2-FL-A547V-T7, pMSCV-hiR2-FL-A547S-T7, pMSCV-hiR2-FL-V548A-T7, pMSCV-hiR2-FL-C549A-T7,pMSCV-hiR2-FL-H550A-T7, pMSCV-hiR2-FL-Q551A-T7, pMSCV-hiR2-FL-D552A-T7, pMSCV-hiR2-FL-P553A-T7, pMSCV-hiR2-FL-R554A-T7, pMSCV-hiR2-FL-T555V-T7, pMSCV-hiR2-FL-T555A-T7, pMSCV-hiR2-FL-C556A-T7, pMSCV-hiR2-FL-E557D-T7, pMSCV-hiR2-FL-E557A-T7, pMSCV-hiR2-FL-E55 8A-T7, pMSCV-hiR2-FL-P559A-T7, pMSCV-hiR2-FL-A560S-T7, pMSCV-hiR2-FL-S561A-T7, pMSCV-hiR2-FL-S562E-T7, pMSCV-hiR2-FL-S562A-T7, pMSCV-hiR2-FL-G563D-T7, pMSCV-hiR2-FL-G563A-T7, pMSCV-hiR2-FL-A564P-T7, pMSCV-hiR2-FL-A564S-T7, pMSCV-hiR2-FL-H565A-T7, pMSCV-hiR2- FL-I566E-T7, pMSCV-hiR2-FL-I566A-T7, pMSCV-hiR2-FL-W567A-T7, pMSCV-hiR2-FL-P568A-T7, pMSCV-hiR2-FL-D569E-T7, pMSCV-hiR2-FL-D569A-T7, pMSCV-hiR2-FL-D570A-T7, pMSCV-hiR2-FL-I571A-T7, pMSCV-hiR2-FL-T572A-T7, pMSCV-hiR2-FL-K573A-T7, pMSCV-hiR2-FL-W574A-T7, pMSCV -hiR2-FL-P575A-T7, pMSCV-hiR2-FL-I576A-T7, pMSCV-hiR2-FL-C577A-T7, pMSCV-hiR2-FL-T578A-T7, pMSCV-hiR2-FL-E579K-T7, pMSCV-hiR2-FL-E579A-T7, pMSCV-hiR2-FL-Q580N-T7, pMSCV-hiR2-FL-Q580A-T7, pMSCV-hiR2-FL-A581S-T7, pMSCV-hiR2-FL-R582A-T7, pMSCV-hiR2-FL-S583G-T7,pMSCV-hiR2-FL-S583A-T7, pMSCV-hiR2-FL-N584A-T7, pMSCV-hiR2-FL-H585A-T7, pMSCV-hiR2-FL-T586A -T7, pMSCV-hiR2-FL-G587N-T7, pMSCV-hiR2-FL-G587A-T7, pMSCV-hiR2-FL-F588H-T7, pMSCV-hiR2-FL-F 588A-T7, pMSCV-hiR2-FL-L589P-T7, pMSCV-hiR2-FL-L589A-T7, pMSCV-hiR2-FL-H590A-T7, pMSCV-hiR2-FL-M591A-T7, pMSCV-hiR2-FL-D592A-T7, pMSCV-hiR2-FL-C593A-T7 and pMSCV-hiR2-FL-E594V-T7 in trans, After 7 h, the transfection was stopped by replacing the cell supernatant with standard growth medium lacking chloroquine and the cells were cultured overnight at 37°C with 5% CO2 for virus production. In parallel, immortalized iRhom1 / 2- / -DKO MEFs were plated at 1x10 per well in 6-well tissue culture plates (Greiner, Germany) in standard growth medium as target cells for retroviral infection. 5<h2 style=";text-align:left;direction:ltr">pMSCV-hiR2-FL-Q502R-T7、pMSCV-hiR2- FL-N503A-T7、pMSCV-hiR2-FL-D504A-T7、pMSCV-hiR2-FL-H505R-T7、pMSC V-hiR2-FL-H505A-T7、pMSCV-hiR2-FL-S506A-T7、pMSCV-hiR2-FL-G507A-T7、pMSCV-hiR2-FL-C508A-T7、pMSCV-hiR2-FL-I509V-T7、pMSCV-hiR2-FL -I509A-T7、pMSCV-hiR2-FL-Q510A-T7、pMSCV-hiR2-FL-T511A-T7、pMSCV-hiR2-FL-Q512L-T7、pMSCV-hiR2-FL-Q512S-T7" 、pMSCV-hiR2-FL-R513K-T7、pMSCV-hiR2-FL-R513E-T7、pMSCV-hiR2-FL-R513A-T7、pMSCV-hiR2-FL-K514E-T7、pMSCV-hiR2-FL-K514A-T7、pMSCV-hiR 2-FL-D515E-T7、pMSCV-hiR2-FL-D515A-T7、pMSCV-hiR2-FL-C516A-T7、pMSCV-hiR2-FL-S517A-T7、pMSCV-hiR2-FL-E518S-T7、pMSCV-hiR2-FL-E518 A-T7、pMSCV-hiR2-FL-T519A-T7、pMSCV-hiR2-FL-L520A-T7、pMSCV-hiR2-FL-A521S-T7、pMSCV-hiR2-FL-T522V-T7、pMSCV-hiR2-FL-T522A-T7、pMSC V-hiR2-FL-F523W-T7, pMSCV-hiR2-FL-F523A-T7, pMSCV-hiR2-FL-V524A-T7, pMSCV-hiR2-FL-K525A-T7, pMSCV-hiR2-FL-W526A-T7, pMSCV-hiR2-FL-Q527P-T7, pMSCV-hiR2-FL-Q527A-T7, pMSCV-hiR2-FL-D528N-T7, pMSCV-hiR2-FL-D528I-T7, pMSCV-hiR2-FL-D528A-T7, pMSCV-hiR2-FL-D529H-T7,pMSCV-hiR2-FL-D529A-T7, pMSCV-hiR2-FL-T530P-T7, pMSCV-hiR2-FL-T530A-T7, pMSCV-hiR2-FL-G531S-T7, pMSCV-hiR2-FL-G531A-T7, pMSCV-hiR2-FL-P532A-T7, pMSCV-hiR2-FL-P533--T7, pMSCV-hiR2-FL-P533A-T7, pMSCV-hiR2-FL-M534S-T7, pMSCV-hiR2-FL-M534--T7, pMSCV-hiR2-FL-M53 4A-T7, pMSCV-hiR2-FL-D535--T7, pMSCV-hiR2-FL-D535A-T7, pMSCV-hiR2-FL-K536--T7, pMSCV-hiR2-FL-K536A-T7, pMSCV-hiR2-FL-S537E-T7, pMSCV-hiR2-FL-S537A-T7, pMSCV-hiR2-FL-D538L-T7, pMSCV-hiR2-FL-D538A-T7, pMSCV-hiR2-FL-L539A-T7, pMSCV-hiR2-FL-G540S-T7, pMSCV-hiR2- FL-G540A-T7, pMSCV-hiR2-FL-Q541H-T7, pMSCV-hiR2-FL-Q541A-T7, pMSCV-hiR2-FL-K542A-T7, pMSCV-hiR2-FL-R543Q-T7, pMSCV-hiR2-FL-R543A-T7, pMSCV-hiR2-FL-T544P-T7, pMSCV-hiR2-FL-T544Q-T7, pMSCV-hiR2-FL-T544A-T7, pMSCV-hiR2-FL-S545F-T7, pMSCV-hiR2-FL-S545A-T7, pMSCV -hiR2-FL-G546A-T7, pMSCV-hiR2-FL-A547V-T7, pMSCV-hiR2-FL-A547S-T7, pMSCV-hiR2-FL-V548A-T7, pMSCV-hiR2-FL-C549A-T7, pMSCV-hiR2-FL-H550A-T7, pMSCV-hiR2-FL-Q551A-T7, pMSCV-hiR2-FL-D552A-T7, pMSCV-hiR2-FL-P553A-T7, pMSCV-hiR2-FL-R554A-T7, pMSCV-hiR2-FL-T555V-T7,pMSCV-hiR2-FL-T555A-T7, pMSCV-hiR2-FL-C556A-T7, pMSCV-hiR2-FL-E557D-T7, pMSCV-hiR2-FL-E557A-T7, pMSCV-hiR2-FL-E558A-T7, pMSCV-hiR2-FL-P559A-T7, pMSCV-hiR2-FL-A560S-T7, pMSCV-hiR2-FL-S561A-T7, pMSCV-hiR2-FL-S562E-T7, pMSCV-hiR2-FL-S562A-T7, pMSCV-hiR2-FL-G56 3D-T7, pMSCV-hiR2-FL-G563A-T7, pMSCV-hiR2-FL-A564P-T7, pMSCV-hiR2-FL-A564S-T7, pMSCV-hiR2-FL-H565A-T7, pMSCV-hiR2-FL-I566E-T7, pMSCV-hiR2-FL-I566A-T7, pMSCV-hiR2-FL-W567A-T7, pMSCV-hiR2-FL-P568A-T7, pMSCV-hiR2-FL-D569E-T7, pMSCV-hiR2-FL-D569A-T7, pMSCV-hiR2- FL-D570A-T7, pMSCV-hiR2-FL-I571A-T7, pMSCV-hiR2-FL-T572A-T7, pMSCV-hiR2-FL-K573A-T7, pMSCV-hiR2-FL-W574A-T7, pMSCV-hiR2-FL-P575A-T7, pMSCV-hiR2-FL-I576A-T7, pMSCV-hiR2-FL-C577A-T7, pMSCV-hiR2-FL-T578A-T7, pMSCV-hiR2-FL-E579K-T7, pMSCV-hiR2-FL-E579A-T7, pMSCV -hiR2-FL-Q580N-T7, pMSCV-hiR2-FL-Q580A-T7, pMSCV-hiR2-FL-A581S-T7, pMSCV-hiR2-FL-R582A-T7, pMSCV-hiR2-FL-S583G-T7, pMSCV-hiR2-FL-S583A-T7, pMSCV-hiR2-FL-N584A-T7, pMSCV-hiR2-FL-H585A-T7, pMSCV-hiR2-FL-T586A-T7, pMSCV-hiR2-FL-G587N-T7, pMSCV-hiR2-FL-G587A-T7,Supernatants of Phoenix-ECO cells releasing pMSCV-hiR2-FL-F588H-T7, pMSCV-hiR2-FL-F588A-T7, pMSCV-hiR2-FL-L589P-T7, pMSCV-hiR2-FL-L589A-T7, pMSCV-hiR2-FL-H590A-T7, pMSCV-hiR2-FL-M591A-T7, pMSCV-hiR2-FL-D592A-T7, pMSCV-hiR2-FL-C593A-T7 and pMSCV-hiR2-FL-E594V-T7 ecotropic viruses were collected, filtered through 0.45 μm CA filter and supplemented with 4 μg / ml polybrene (Sigma-Aldrich, USA). Immortalized iRhom1 / 2- / -DKO MEFs, After removing the medium from the cells, these supernatants were added to the target cells and the initial infection was carried out for 4 h at 37°C and 5% CO2. Concurrently, Phoenix-ECO cells were re-incubated with fresh medium, filtered after another 4 h, and used for a second infection of the respective target cell population, again in the presence of 4 μg / ml polybrene. Similarly, a third, but overnight, infection cycle was carried out. On the fourth day, the virus-containing cell supernatant was replaced with fresh standard growth medium. From day 5 onwards, immortalized MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR2-FL-N503A-T7, MEF-DKO-hiR2-FL-D504A-T7, MEF-DKO-hiR2-FL-H505R-T7, MEF-DKO-hiR2-FL-H505 ...R-T7, MEF-DKO-hiR2-FL-H505R-T7, MEF-DKO-hiR2-FL-H505R-T7, MEF-DKO-hiR2-FL-H505R O-hiR2-FL-S506A-T7, MEF-DKO-hiR2-FL-G507A-T7, MEF-DKO-hiR2-FL-C508A-T7, MEF-DKO-hiR2-FL-I509V-T7, MEF-D KO-hiR2-FL-I509A-T7, MEF-DKO-hiR2-FL-Q510A-T7, MEF-DKO-hiR2-FL-T511A-T7, MEF-DKO-hiR2-FL-Q512L-T7, MEF- DKO-hiR2-FL-Q512S-T7, MEF-DKO-hiR2-FL-Q512A-T7, MEF-DKO-hiR2-FL-R513K-T7, MEF-DKO-hiR2-FL-R513E-T7, MEF -DKO-hiR2-FL-R513A-T7, MEF-DKO-hiR2-FL-K514E-T7, MEF-DKO-hiR2-FL-K514A-T7, MEF-DKO-hiR2-FL-D515E-T7, ME F-DKO-hiR2-FL-D515A-T7, MEF-DKO-hiR2-FL-C516A-T7, MEF-DKO-hiR2-FL-S517A-T7, MEF-DKO-hiR2-FL-E518S-T7, M EF-DKO-hiR2-FL-E518A-T7, MEF-DKO-hiR2-FL-T519A-T7, MEF-DKO-hiR2-FL-L520A-T7, MEF-DKO-hiR2-FL-A521S-T7,MEF-DKO-hiR2-FL-T522V-T7、MEF-DKO-hiR2-FL-T522A-T7、MEF-DKO-hiR2-FL-F523W-T7、MEF-DKO-hiR2-FL-F523A-T7、MEF-DKO-hiR2-FL-V524A-T7、MEF-DKO-hiR2-FL-K525A-T7、MEF-DKO-hiR2-FL-W526A-T7、MEF-DKO-hiR2-FL-Q527P-T7、MEF-DKO-hiR2-FL-Q527A-T7、MEF-DKO-hiR2-FL-D528N-T7、MEF-DKO-hiR2-FL-D528I-T7、MEF-DKO-hiR2-FL-D528A-T7、MEF-DKO-hiR2-FL-D529H-T7、MEF-DKO-hiR2-FL-D529A-T7、MEF-DKO-hiR2-FL-T530P-T7、MEF-DKO-hiR2-FL-T530A-T7、MEF-DKO-hiR2-FL-G531S-T7、MEF-DKO-hiR2-FL-G531A-T7、MEF-DKO-hiR2-FL-P532A-T7、MEF-DKO-hiR2-FL-P533--T7、MEF-DKO-hiR2-FL-P533A-T7、MEF-DKO-hiR2-FL-M534S-T7、MEF-DKO-hiR2-FL-M534--T7、MEF-DKO-hiR2-FL-M534A-T7、MEF-DKO-hiR2-FL-D535--T7、MEF-DKO-hiR2-FL-D535A-T7、MEF-DKO-hiR2-FL-K536--T7、MEF-DKO-hiR2-FL-K536A-T7、MEF-DKO-hiR2-FL-S537E-T7、MEF-DKO-hiR2-FL-S537A-T7、MEF-DKO-hiR2-FL-D538L-T7、MEF-DKO-hiR2-FL-D538A-T7、MEF-DKO-hiR2-FL-L539A-T7、MEF-DKO-hiR2-FL-G540S-T7、MEF-DKO-hiR2-FL-G540A-T7、MEF-DKO-hiR2-FL-Q541H-T7、MEF-DKO-hiR2-FL-Q541A-T7、MEF-DKO-hiR2-FL-K542A-T7、MEF-DKO-hiR2-FL-R543Q-T7、MEF-DKO-hiR2-FL-R543A-T7、MEF-DKO-hiR2-FL-T544P-T7、MEF-DKO-hiR2-FL-T544Q-T7、MEF-DKO-hiR2-FL-T544A-T7、MEF-DKO-hiR2-FL-S545F-T7、MEF-DKO-hiR2-FL-S545A-T7、MEF-DKO-hiR2-FL-G546A-T7、MEF-DKO-hiR2-FL-A547V-T7、MEF-DKO-hiR2-FL-A547S-T7、MEF-DKO-hiR2-FL-V548A-T7、MEF-DKO-hiR2-FL-C549A-T7、MEF-DKO-hiR2-FL-H550A-T7、MEF-DKO-hiR2-FL-Q551A-T7、MEF-DKO-hiR2-FL-D552A-T7、MEF-DKO-hiR2-FL-P553A-T7、MEF-DKO-hiR2-FL-R554A-T7、MEF-DKO-hiR2-FL-T555V-T7、MEF-DKO-hiR2-FL-T555A-T7、MEF-DKO-hiR2-FL-C556A-T7、MEF-DKO-hiR2-FL-E557D-T7、MEF-DKO-hiR2-FL-E557A-T7、MEF-DKO-hiR2-FL-E558A-T7、MEF-DKO-hiR2-FL-P559A-T7、MEF-DKO-hiR2-FL-A560S-T7、MEF-DKO-hiR2-FL-S561A-T7、MEF-DKO-hiR2-FL-S562E-T7、MEF-DKO-hiR2-FL-S562A-T7、MEF-DKO-hiR2-FL-G563D-T7、MEF-DKO-hiR2-FL-G563A-T7、MEF-DKO-hiR2-FL-A564P-T7、MEF-DKO-hiR2-FL-A564S-T7、MEF-DKO-hiR2-FL-H565A-T7、MEF-DKO-hiR2-FL-I566E-T7、MEF-DKO-hiR2-FL-I566A-T7、MEF-DKO-hiR2-FL-W567A-T7、MEF-DKO-hiR2-FL-P568A-T7、MEF-DKO-hiR2-FL-D569E-T7、MEF-DKO-hiR2-FL-D569A-T7、MEF-DKO-hiR2-FL-D570A-T7、MEF-DKO-hiR2-FL-I571A-T7、MEF-DKO-hiR2-FL-T572A-T7、MEF-DKO-hiR2-FL-K573A-T7, MEF-DKO-hiR2-FL-W574A-T7, MEF-DKO-hiR2-FL-P575A-T7, MEF-DKO-hiR2-FL-I 576A-T7, MEF-DKO-hiR2-FL-C577A-T7, MEF-DKO-hiR2-FL-T578A-T7, MEF-DKO-hiR2-FL-E579K-T7, MEF-DKO-h iR2-FL-E579A-T7, MEF-DKO-hiR2-FL-Q580N-T7, MEF-DKO-hiR2-FL-Q580A-T7, MEF-DKO-hiR2-FL-A581S-T7, M EF-DKO-hiR2-FL-R582A-T7, MEF-DKO-hiR2-FL-S583G-T7, MEF-DKO-hiR2-FL-S583A-T7, MEF-DKO-hiR2-FL-N5 84A-T7, MEF-DKO-hiR2-FL-H585A-T7, MEF-DKO-hiR2-FL-T586A-T7, MEF-DKO-hiR2-FL-G587N-T7, MEF-DKO-hi R2-FL-G587A-T7, MEF-DKO-hiR2-FL-F588H-T7, MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR2-FL-L589P-T7, ME For selection of F-DKO-hiR2-FL-L589A-T7, MEF-DKO-hiR2-FL-H590A-T7, MEF-DKO-hiR2-FL-M591A-T7, MEF-DKO-hiR2-FL-D592A-T7, MEF-DKO-hiR2-FL-C593A-T7 and MEF-DKO-hiR2-FL-E594V-T7 cells, they were cultured in the presence of 2mg / ml geneticin (G418, Thermo Fisher Scientific, USA). After expansion, the cells were stocked for future use.

[0169] FACS analysis for test system validation Briefly described, immortalized MEF-DKO-hiR2-FL-WT-T7 cells and MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR2-FL-N503A-T7, MEF-DKO-hiR2-FL-D504A-T7, MEF-DKO-hiR2-FL-H505R-T7, MEF-DKO-hiR2-FL-H505A-T7, MEF-DKO-hiR2-FL-S506A-T7, MEF-DKO-hiR2-FL-G507A-T7, MEF-DKO-hiR2-FL-C508A-T7, MEF-DKO-hiR2-FL-I509V-T7, MEF-DKO-hiR2-FL-I509A-T7, MEF-DKO-hiR2-FL-Q510A-T7, MEF-DKO-hiR2-FL-T511A-T7, MEF-DKO-hiR2-FL-Q512L-T7, MEF-DKO-hiR2-FL-Q512S-T7, MEF-DKO-hiR2-FL-Q512A-T7, MEF-DKO-hiR2-FL-R513K-T7, MEF-DKO-hiR2-FL-R513E-T7, MEF-DKO-hiR2-FL-R513A-T7, MEF-DKO-hiR2-FL-K514E-T7, MEF-DKO-hiR2-FL-K514A-T7, MEF-DKO-hiR2-FL-D515E-T7, MEF-DKO-hiR2-FL-D515A-T7, MEF-DKO-hiR2-FL-C516A-T7, MEF-DKO-hiR2-FL-S517A-T7, MEF-DKO-hiR2-FL-E518S-T7, MEF-DKO-hiR2-FL-E518A-T7, MEF-DKO-hiR2-FL-T519A-T7, MEF-DKO-hiR2-FL-L520A-T7, MEF-DKO-hiR2-FL-A521S-T7, MEF-DKO-hiR2-FL-T522V-T7, MEF-DKO-hiR2-FL-T522A-T7, MEF-DKO-hiR2-FL-F523W-T7, MEF-DKO-hiR2-FL-F523A-T7, MEF-DKO-hiR2-FL-V524A-T7, MEF-DKO-hiR2-FL-K525A-T7, MEF-DKO-hiR2-FL-W526A-T7, MEF-DKO-hiR2-FL-Q527P-T7, MEF-DKO-hiR2-FL-Q527A-T7,MEF-DKO-hiR2-FL-D528N-T7、MEF-DKO-hiR2-FL-D528I-T7、MEF-DKO-hiR2-FL-D528A-T7、MEF-DKO-hiR2-FL-D529H-T7、MEF-DKO-hiR2-FL-D529A-T7、MEF-DKO-hiR2-FL-T530P-T7、MEF-DKO-hiR2-FL-T530A-T7、MEF-DKO-hiR2-FL-G531S-T7、MEF-DKO-hiR2-FL-G531A-T7、MEF-DKO-hiR2-FL-P532A-T7、MEF-DKO-hiR2-FL-P533--T7、MEF-DKO-hiR2-FL-P533A-T7、MEF-DKO-hiR2-FL-M534S-T7、MEF-DKO-hiR2-FL-M534--T7、MEF-DKO-hiR2-FL-M534A-T7、MEF-DKO-hiR2-FL-D535--T7、MEF-DKO-hiR2-FL-D535A-T7、MEF-DKO-hiR2-FL-K536--T7、MEF-DKO-hiR2-FL-K536A-T7、MEF-DKO-hiR2-FL-S537E-T7、MEF-DKO-hiR2-FL-S537A-T7、MEF-DKO-hiR2-FL-D538L-T7、MEF-DKO-hiR2-FL-D538A-T7、MEF-DKO-hiR2-FL-L539A-T7、MEF-DKO-hiR2-FL-G540S-T7、MEF-DKO-hiR2-FL-G540A-T7、MEF-DKO-hiR2-FL-Q541H-T7、MEF-DKO-hiR2-FL-Q541A-T7、MEF-DKO-hiR2-FL-K542A-T7、MEF-DKO-hiR2-FL-R543Q-T7、MEF-DKO-hiR2-FL-R543A-T7、MEF-DKO-hiR2-FL-T544P-T7、MEF-DKO-hiR2-FL-T544Q-T7、MEF-DKO-hiR2-FL-T544A-T7、MEF-DKO-hiR2-FL-S545F-T7、MEF-DKO-hiR2-FL-S545A-T7、MEF-DKO-hiR2-FL-G546A-T7、MEF-DKO-hiR2-FL-A547V-T7、MEF-DKO-hiR2-FL-A547S-T7、MEF-DKO-hiR2-FL-V548A-T7、MEF-DKO-hiR2-FL-C549A-T7、MEF-DKO-hiR2-FL-H550A-T7、MEF-DKO-hiR2-FL-Q551A-T7、MEF-DKO-hiR2-FL-D552A-T7、MEF-DKO-hiR2-FL-P553A-T7、MEF-DKO-hiR2-FL-R554A-T7、MEF-DKO-hiR2-FL-T555V-T7、MEF-DKO-hiR2-FL-T555A-T7、MEF-DKO-hiR2-FL-C556A-T7、MEF-DKO-hiR2-FL-E557D-T7、MEF-DKO-hiR2-FL-E557A-T7、MEF-DKO-hiR2-FL-E558A-T7、MEF-DKO-hiR2-FL-P559A-T7、MEF-DKO-hiR2-FL-A560S-T7、MEF-DKO-hiR2-FL-S561A-T7、MEF-DKO-hiR2-FL-S562E-T7、MEF-DKO-hiR2-FL-S562A-T7、MEF-DKO-hiR2-FL-G563D-T7、MEF-DKO-hiR2-FL-G563A-T7、MEF-DKO-hiR2-FL-A564P-T7、MEF-DKO-hiR2-FL-A564S-T7、MEF-DKO-hiR2-FL-H565A-T7、MEF-DKO-hiR2-FL-I566E-T7、MEF-DKO-hiR2-FL-I566A-T7、MEF-DKO-hiR2-FL-W567A-T7、MEF-DKO-hiR2-FL-P568A-T7、MEF-DKO-hiR2-FL-D569E-T7、MEF-DKO-hiR2-FL-D569A-T7、MEF-DKO-hiR2-FL-D570A-T7、MEF-DKO-hiR2-FL-I571A-T7、MEF-DKO-hiR2-FL-T572A-T7、MEF-DKO-hiR2-FL-K573A-T7、MEF-DKO-hiR2-FL-W574A-T7、MEF-DKO-hiR2-FL-P575A-T7、MEF-DKO-hiR2-FL-I576A-T7、MEF-DKO-hiR2-FL-C577A-T7、MEF-DKO-hiR2-FL-T578A-T7、MEF-DKO-hiR2-FL-E579K-T7、MEF-DKO-hiR2-FL-E579A-T7、MEF-DKO-hiR2-FL-Q580N-T7、MEF-DKO-hiR2-FL-Q580A-T7, MEF-DKO-hiR2-FL-A581S-T7, MEF-DKO-hiR2-FL-R582A-T7, MEF-DKO-hiR2-FL-S583G-T7, MEF-DKO-hiR2-FL-S583A -T7, MEF-DKO-hiR2-FL-N584A-T7, MEF-DKO-hiR2-FL-H585A-T7, MEF-DKO-hiR2-FL-T586A-T7, MEF-DKO-hiR2-FL-G587N-T7, MEF-DKO-hiR2-FL-G5 87A-T7, MEF-DKO-hiR2-FL-F588H-T7, MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR2-FL-L589P-T7, MEF-DKO-hiR2-FL-L589A-T7, MEF-DKO-hiR2-FL -H590A-T7, MEF-DKO-hiR2-FL-M591A-T7, MEF-DKO-hiR2-FL-D592A-T7, MEF-DKO-hiR2-FL-C593A-T7 and MEF-DKO-hiR2-FL-E594V-T7 cells at 10mM in PBS They were harvested with EDTA, washed and resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide) and plated in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA) at approximately 1x10 per well. 5Cells were seeded on 100 wells of 100x1000 cells. Plates were centrifuged at 1500 rpm, 4°C for 3 min to pellet the cells and remove the supernatant. For primary staining, cells were resuspended in 100 μl per well of FACS buffer alone (control) or 3 μg / ml mouse monoclonal anti-T7 IgG (FACS buffer, Merck Millipore, USA) and incubated on ice for 1 h. Plates were then centrifuged at 1500 rpm, 4°C for 3 min and washed twice with 200 μl FACS buffer per well. For secondary staining, cells were spun down and suspended in 100 μl per well of PE-labeled goat anti-mouse IgG F(ab´)2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 h. Plates were then centrifuged at 1500 rpm, 4°C for 3 min and washed three times with 200 μl FACS buffer per well. Finally, cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD AccuriTM C6 Plus flow cytometer (Becton Dickinson, Germany).

[0170] Figure 16a exemplarily shows a representative result of this experiment for the human iRhom2 variant hiR2-FL-K536A-T7. Binding analysis of anti-T7 tag antibody (black) and anti-mouse IgG secondary antibody (gray) in MEF-DKO-hiR2-FL-WT-T7 cells (left) and MEF-DKO-hiR2-FL-K536A-T7 cells (right) revealed a strong increase in relative fluorescence intensity. This indicates that similar to human iRhom2 wild type (left), human iRhom2 variant hiR2-FL-K536A-T7 (right) is well expressed and localized on the surface of these cells. MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR2-FL-N503A-T7, MEF-DKO-hiR2-FL-D504A-T7, MEF-DKO-hiR2-FL -H505R-T7, MEF-DKO-hiR2-FL-H505A-T7, MEF-DKO-hiR2-FL-S506A-T7, MEF-DKO-hiR2-FL-G507A-T7, MEF-DK O-hiR2-FL-C508A-T7, MEF-DKO-hiR2-FL-I509V-T7, MEF-DKO-hiR2-FL-I509A-T7, MEF-DKO-hiR2-FL-Q510A -T7, MEF-DKO-hiR2-FL-T511A-T7, MEF-DKO-hiR2-FL-Q512L-T7, MEF-DKO-hiR2-FL-Q512S-T7, MEF-DKO-hiR2 -FL-Q512A-T7, MEF-DKO-hiR2-FL-R513K-T7, MEF-DKO-hiR2-FL-R513E-T7, MEF-DKO-hiR2-FL-R513A-T7, ME F-DKO-hiR2-FL-K514E-T7, MEF-DKO-hiR2-FL-K514A-T7, MEF-DKO-hiR2-FL-D515E-T7, MEF-DKO-hiR2-FL-D5 15A-T7, MEF-DKO-hiR2-FL-C516A-T7, MEF-DKO-hiR2-FL-S517A-T7, MEF-DKO-hiR2-FL-E518S-T7, MEF-DKO-h iR2-FL-E518A-T7, MEF-DKO-hiR2-FL-T519A-T7, MEF-DKO-hiR2-FL-L520A-T7, MEF-DKO-hiR2-FL-A521S-T7,MEF-DKO-hiR2-FL-T522V-T7、MEF-DKO-hiR2-FL-T522A-T7、MEF-DKO-hiR2-FL-F523W-T7、MEF-DKO-hiR2-FL-F523A-T7、MEF-DKO-hiR2-FL-V524A-T7、MEF-DKO-hiR2-FL-K525A-T7、MEF-DKO-hiR2-FL-W526A-T7、MEF-DKO-hiR2-FL-Q527P-T7、MEF-DKO-hiR2-FL-Q527A-T7、MEF-DKO-hiR2-FL-D528N-T7、MEF-DKO-hiR2-FL-D528I-T7、MEF-DKO-hiR2-FL-D528A-T7、MEF-DKO-hiR2-FL-D529H-T7、MEF-DKO-hiR2-FL-D529A-T7、MEF-DKO-hiR2-FL-T530P-T7、MEF-DKO-hiR2-FL-T530A-T7、MEF-DKO-hiR2-FL-G531S-T7、MEF-DKO-hiR2-FL-G531A-T7、MEF-DKO-hiR2-FL-P532A-T7、MEF-DKO-hiR2-FL-P533--T7、MEF-DKO-hiR2-FL-P533A-T7、MEF-DKO-hiR2-FL-M534S-T7、MEF-DKO-hiR2-FL-M534--T7、MEF-DKO-hiR2-FL-M534A-T7、MEF-DKO-hiR2-FL-D535--T7、MEF-DKO-hiR2-FL-D535A-T7、MEF-DKO-hiR2-FL-K536--T7、MEF-DKO-hiR2-FL-K536A-T7、MEF-DKO-hiR2-FL-S537E-T7、MEF-DKO-hiR2-FL-S537A-T7、MEF-DKO-hiR2-FL-D538L-T7、MEF-DKO-hiR2-FL-D538A-T7、MEF-DKO-hiR2-FL-L539A-T7、MEF-DKO-hiR2-FL-G540S-T7、MEF-DKO-hiR2-FL-G540A-T7、MEF-DKO-hiR2-FL-Q541H-T7、MEF-DKO-hiR2-FL-Q541A-T7、MEF-DKO-hiR2-FL-K542A-T7、MEF-DKO-hiR2-FL-R543Q-T7、MEF-DKO-hiR2-FL-R543A-T7、MEF-DKO-hiR2-FL-T544P-T7、MEF-DKO-hiR2-FL-T544Q-T7、MEF-DKO-hiR2-FL-T544A-T7、MEF-DKO-hiR2-FL-S545F-T7、MEF-DKO-hiR2-FL-S545A-T7、MEF-DKO-hiR2-FL-G546A-T7、MEF-DKO-hiR2-FL-A547V-T7、MEF-DKO-hiR2-FL-A547S-T7、MEF-DKO-hiR2-FL-V548A-T7、MEF-DKO-hiR2-FL-C549A-T7、MEF-DKO-hiR2-FL-H550A-T7、MEF-DKO-hiR2-FL-Q551A-T7、MEF-DKO-hiR2-FL-D552A-T7、MEF-DKO-hiR2-FL-P553A-T7、MEF-DKO-hiR2-FL-R554A-T7、MEF-DKO-hiR2-FL-T555V-T7、MEF-DKO-hiR2-FL-T555A-T7、MEF-DKO-hiR2-FL-C556A-T7、MEF-DKO-hiR2-FL-E557D-T7、MEF-DKO-hiR2-FL-E557A-T7、MEF-DKO-hiR2-FL-E558A-T7、MEF-DKO-hiR2-FL-P559A-T7、MEF-DKO-hiR2-FL-A560S-T7、MEF-DKO-hiR2-FL-S561A-T7、MEF-DKO-hiR2-FL-S562E-T7、MEF-DKO-hiR2-FL-S562A-T7、MEF-DKO-hiR2-FL-G563D-T7、MEF-DKO-hiR2-FL-G563A-T7、MEF-DKO-hiR2-FL-A564P-T7、MEF-DKO-hiR2-FL-A564S-T7、MEF-DKO-hiR2-FL-H565A-T7、MEF-DKO-hiR2-FL-I566E-T7、MEF-DKO-hiR2-FL-I566A-T7、MEF-DKO-hiR2-FL-W567A-T7、MEF-DKO-hiR2-FL-P568A-T7、MEF-DKO-hiR2-FL-D569E-T7、MEF-DKO-hiR2-FL-D569A-T7、MEF-DKO-hiR2-FL-D570A-T7、MEF-DKO-hiR2-FL-I571A-T7、MEF-DKO-hiR2-FL-T572A-T7、MEF-DKO-hiR2-FL-K573A-T7, MEF-DKO-hiR2-FL-W574A-T7, MEF-DKO-hiR2-FL-P575A-T7, MEF-DKO-hiR2-FL-I5 76A-T7, MEF-DKO-hiR2-FL-C577A-T7, MEF-DKO-hiR2-FL-T578A-T7, MEF-DKO-hiR2-FL-E579K-T7, MEF-DKO-hiR2 -FL-E579A-T7, MEF-DKO-hiR2-FL-Q580N-T7, MEF-DKO-hiR2-FL-Q580A-T7, MEF-DKO-hiR2-FL-A581S-T7, MEF-DK O-hiR2-FL-R582A-T7, MEF-DKO-hiR2-FL-S583G-T7, MEF-DKO-hiR2-FL-S583A-T7, MEF-DKO-hiR2-FL-N584A-T7, MEF-DKO-hiR2-FL-H585A-T7, MEF-DKO-hiR2-FL-T586A-T7, MEF-DKO-hiR2-FL-G587N-T7, MEF-DKO-hiR2-FL-G5 87A-T7, MEF-DKO-hiR2-FL-F588H-T7, MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR2-FL-L589P-T7, MEF-DKO-hiR2 Similar results were obtained for the expression and localization of human iRhom2 full-length single amino acid substitution variants expressed in MEF-DKO-hiR2-FL-L589A-T7, MEF-DKO-hiR2-FL-H590A-T7, MEF-DKO-hiR2-FL-M591A-T7, MEF-DKO-hiR2-FL-D592A-T7, MEF-DKO-hiR2-FL-C593A-T7 and MEF-DKO-hiR2-FL-E594V-T7 cells.

[0171] TGFα ELISA for test system validation To test all 137 human iRhom2 variants with single amino acid substitutions or deletions, the respective MEF-DKO cell lines stably expressing these variants, as described in the above examples, were subjected to TGFα cleavage ELISA analysis. As an indication that these variants are properly folded, the PMA-induced release of nucleofected TGFα was evaluated to prove the functionality of all variants. The cells used in this analysis are rescue variants of iRhom1 / 2- / - double knockout mouse embryonic fibroblasts (described in Example 2), rescued by single amino acid substitutions or deletions of each human iRhom2 variant, so that the stably expressed iRhom2 variant is the only iRhom protein expressed in these cells, and therefore the only iRhom contributing to the cleavage of TGFα in these cells.

[0172] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with mouse anti-human TGFα capture antibody (provided as part of the DuoSet ELISA kit) at 400ng / ml in TBS, 100μl per well, overnight at 4°C. hTGFα-FL-WT constructs were transfected into the pcDNA3.1 vector backbone using the 4D-Nucleofector system (Lonza, Switzerland) with the following constructs: MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR2-FL-N503A-T7, MEF-DKO-hiR2-FL-D504A-T7, MEF-DKO-hiR2-FL-H505R-T7, MEF-DKO-hiR2-FL-H505 ... R2-FL-S506A-T7, MEF-DKO-hiR2-FL-G507A-T7, MEF-DKO-hiR2-FL-C508A-T7, MEF-DKO-hiR2-FL-I509V-T7, MEF-DKO-hiR2 -FL-I509A-T7, MEF-DKO-hiR2-FL-Q510A-T7, MEF-DKO-hiR2-FL-T511A-T7, MEF-DKO-hiR2-FL-Q512L-T7, MEF-DKO-hiR2-FL -Q512S-T7, MEF-DKO-hiR2-FL-Q512A-T7, MEF-DKO-hiR2-FL-R513K-T7, MEF-DKO-hiR2-FL-R513E-T7, MEF-DKO-hiR2-FL-R 513A-T7, MEF-DKO-hiR2-FL-K514E-T7, MEF-DKO-hiR2-FL-K514A-T7, MEF-DKO-hiR2-FL-D515E-T7, MEF-DKO-hiR2-FL-D515 A-T7, MEF-DKO-hiR2-FL-C516A-T7, MEF-DKO-hiR2-FL-S517A-T7, MEF-DKO-hiR2-FL-E518S-T7, MEF-DKO-hiR2-FL-E518A- T7, MEF-DKO-hiR2-FL-T519A-T7, MEF-DKO-hiR2-FL-L520A-T7, MEF-DKO-hiR2-FL-A521S-T7, MEF-DKO-hiR2-FL-T522V-T7,MEF-DKO-hiR2-FL-T522A-T7、MEF-DKO-hiR2-FL-F523W-T7、MEF-DKO-hiR2-FL-F523A-T7、MEF-DKO-hiR2-FL-V524A-T7、MEF-DKO-hiR2-FL-K525A-T7、MEF-DKO-hiR2-FL-W526A-T7、MEF-DKO-hiR2-FL-Q527P-T7、MEF-DKO-hiR2-FL-Q527A-T7、MEF-DKO-hiR2-FL-D528N-T7、MEF-DKO-hiR2-FL-D528I-T7、MEF-DKO-hiR2-FL-D528A-T7、MEF-DKO-hiR2-FL-D529H-T7、MEF-DKO-hiR2-FL-D529A-T7、MEF-DKO-hiR2-FL-T530P-T7、MEF-DKO-hiR2-FL-T530A-T7、MEF-DKO-hiR2-FL-G531S-T7、MEF-DKO-hiR2-FL-G531A-T7、MEF-DKO-hiR2-FL-P532A-T7、MEF-DKO-hiR2-FL-P533--T7、MEF-DKO-hiR2-FL-P533A-T7、MEF-DKO-hiR2-FL-M534S-T7、MEF-DKO-hiR2-FL-M534--T7、MEF-DKO-hiR2-FL-M534A-T7、MEF-DKO-hiR2-FL-D535--T7、MEF-DKO-hiR2-FL-D535A-T7、MEF-DKO-hiR2-FL-K536--T7、MEF-DKO-hiR2-FL-K536A-T7、MEF-DKO-hiR2-FL-S537E-T7、MEF-DKO-hiR2-FL-S537A-T7、MEF-DKO-hiR2-FL-D538L-T7、MEF-DKO-hiR2-FL-D538A-T7、MEF-DKO-hiR2-FL-L539A-T7、MEF-DKO-hiR2-FL-G540S-T7、MEF-DKO-hiR2-FL-G540A-T7、MEF-DKO-hiR2-FL-Q541H-T7、MEF-DKO-hiR2-FL-Q541A-T7、MEF-DKO-hiR2-FL-K542A-T7、MEF-DKO-hiR2-FL-R543Q-T7、MEF-DKO-hiR2-FL-R543A-T7、MEF-DKO-hiR2-FL-T544P-T7、MEF-DKO-hiR2-FL-T544Q-T7、MEF-DKO-hiR2-FL-T544A-T7、MEF-DKO-hiR2-FL-S545F-T7、MEF-DKO-hiR2-FL-S545A-T7、MEF-DKO-hiR2-FL-G546A-T7、MEF-DKO-hiR2-FL-A547V-T7、MEF-DKO-hiR2-FL-A547S-T7、MEF-DKO-hiR2-FL-V548A-T7、MEF-DKO-hiR2-FL-C549A-T7、MEF-DKO-hiR2-FL-H550A-T7、MEF-DKO-hiR2-FL-Q551A-T7、MEF-DKO-hiR2-FL-D552A-T7、MEF-DKO-hiR2-FL-P553A-T7、MEF-DKO-hiR2-FL-R554A-T7、MEF-DKO-hiR2-FL-T555V-T7、MEF-DKO-hiR2-FL-T555A-T7、MEF-DKO-hiR2-FL-C556A-T7、MEF-DKO-hiR2-FL-E557D-T7、MEF-DKO-hiR2-FL-E557A-T7、MEF-DKO-hiR2-FL-E558A-T7、MEF-DKO-hiR2-FL-P559A-T7、MEF-DKO-hiR2-FL-A560S-T7、MEF-DKO-hiR2-FL-S561A-T7、MEF-DKO-hiR2-FL-S562E-T7、MEF-DKO-hiR2-FL-S562A-T7、MEF-DKO-hiR2-FL-G563D-T7、MEF-DKO-hiR2-FL-G563A-T7、MEF-DKO-hiR2-FL-A564P-T7、MEF-DKO-hiR2-FL-A564S-T7、MEF-DKO-hiR2-FL-H565A-T7、MEF-DKO-hiR2-FL-I566E-T7、MEF-DKO-hiR2-FL-I566A-T7、MEF-DKO-hiR2-FL-W567A-T7、MEF-DKO-hiR2-FL-P568A-T7、MEF-DKO-hiR2-FL-D569E-T7、MEF-DKO-hiR2-FL-D569A-T7、MEF-DKO-hiR2-FL-D570A-T7、MEF-DKO-hiR2-FL-I571A-T7、MEF-DKO-hiR2-FL-T572A-T7、MEF-DKO-hiR2-FL-K573A-T7、MEF-DKO-hiR2-FL-W574A-T7, MEF-DKO-hiR2-FL-P575A-T7, MEF-DKO-hiR2-FL-I576A-T7, MEF-DKO-hiR2-F L-C577A-T7, MEF-DKO-hiR2-FL-T578A-T7, MEF-DKO-hiR2-FL-E579K-T7, MEF-DKO-hiR2-FL-E579A-T7, MEF- DKO-hiR2-FL-Q580N-T7, MEF-DKO-hiR2-FL-Q580A-T7, MEF-DKO-hiR2-FL-A581S-T7, MEF-DKO-hiR2-FL-R5 82A-T7, MEF-DKO-hiR2-FL-S583G-T7, MEF-DKO-hiR2-FL-S583A-T7, MEF-DKO-hiR2-FL-N584A-T7, MEF-DKO- hiR2-FL-H585A-T7, MEF-DKO-hiR2-FL-T586A-T7, MEF-DKO-hiR2-FL-G587N-T7, MEF-DKO-hiR2-FL-G587A- T7, MEF-DKO-hiR2-FL-F588H-T7, MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR2-FL-L589P-T7, MEF-DKO-hiR2 After electroporation of MEF-DKO-hiR2-FL-L589A-T7, MEF-DKO-hiR2-FL-H590A-T7, MEF-DKO-hiR2-FL-M591A-T7, MEF-DKO-hiR2-FL-D592A-T7, MEF-DKO-hiR2-FL-C593A-T7 and MEF-DKO-hiR2-FL-E594V-T7 cells, approximately 33,000 MEF-DKO cells carrying human iRhom2 variants with single amino acid substitutions or deletions were seeded in 100 μl of standard growth medium in each well of an F-bottom 96-well cell culture plate (Thermo Fisher Scientific, USA). On day 2, the capture antibody solution was removed and the MaxiSorp® plate was blocked with 300 μl of TBS, 1% BSA per well for 1 h at room temperature. Meanwhile, the cells were washed once with PBS, and then 80 μl of OptiMEM medium (Thermo Fisher Scientific, USA) was added per well.

[0173] Afterwards, cells (except for the unstimulated control) were stimulated with PMA (Sigma-Aldrich, USA) at a final concentration of 25 ng / ml with 20 μl per well for 1 h at 37 °C and 5% CO2. 20 μl of OptiMEM medium was added to the unstimulated control cells. The 96-well plate was then centrifuged to sediment the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate and the plate was washed four times with 350 μl TBS-T (Carl Roth, Germany) per well on a 96-head plate washer (Tecan Group, Switzerland). To avoid drying, 30 μl TBS was immediately added to each well of the MaxiSorp® plate, followed by transfer of 70 μl of cell-free supernatant per sample. Then, 100 μl per well of biotinylated goat anti-human TGFα detection antibody (provided as part of the DuoSet ELISA kit) was added at 37.5 ng / ml in TBS, and the plates were incubated for 2 h at room temperature, protected from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Carl Roth, Switzerland), carefully removing all traces of buffer after the fourth cycle, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plates were incubated for 30 min at room temperature, again protected from direct light. After rewashing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer after the fourth cycle, 100 μl of AttoPhos substrate solution (Promega, USA) was added per well for incubation at room temperature in the dark for 1 h. Fluorescence of each well was collected at an excitation wavelength of 435 nm and an emission wavelength of 555 nm using an infinite M1000 (Tecan Group, Switzerland) microplate reader.

[0174] Figure 16b shows the results from these TGFα release assays, showing that of the 137 human iRhom2 variants, 128 variants with single amino acid substitutions or deletions were functionally active as TGFα cleavage was induced by PMA, indicating that these variants were properly folded. The human iRhom2 variants hiR2-FL-C516A-T7, hiR2-FL-F523A-T7, hiR2-FL-C549A-T7, hiR2-FL-D552A-T7, hiR2-FL-C556A-T7, hiR2-FL-P559A-T7, hiR2-FL-W567A-T7, hiR2-FL-W574A-T7 and hiR2-FL-C577A-T7 showed little or no functionality and were therefore excluded from further analysis.

[0175] FACS analysis to characterize the binding of purified antibodies of the invention for epitope mapping purposes Briefly speaking, immortalized MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR2-FL-N503A-T7, MEF-DKO-hiR2-FL-D504A-T7, MEF-DKO-hiR2-FL-H505R-T7, MEF-DKO-hiR2-FL-H505A-T7, MEF-DKO-hiR2-FL-S506A-T7, MEF-DKO-hiR2-FL-G507A-T7, MEF-DKO-hiR2-FL-C508A-T7, MEF-DKO-hiR2-FL-I509V-T7, MEF-DKO-hiR2-FL-I509A-T7, MEF-DKO-hiR2-FL-Q510A-T7, MEF-DKO-hiR2-FL-T511A-T7, MEF-DKO-hiR2-FL-Q512L-T7, MEF-DKO-hiR2-FL-Q512S-T7, MEF-DKO-hiR2-FL-Q512A-T7, MEF-DKO-hiR2-FL-R513K-T7, MEF-DKO-hiR2-FL-R513E-T7, MEF-DKO-hiR2-FL-R513A-T7, MEF-DKO-hiR2-FL-K514E-T7, MEF-DKO-hiR2-FL-K514A-T7, MEF-DKO-hiR2-FL-D515E-T7, MEF-DKO-hiR2-FL-D515A-T7, MEF-DKO-hiR2-FL-C516A-T7, MEF-DKO-hiR2-FL-S517A-T7, MEF-DKO-hiR2-FL-E518S-T7, MEF-DKO-hiR2-FL-E518A-T7, MEF-DKO-hiR2-FL-T519A-T7, MEF-DKO-hiR2-FL-L520A-T7, MEF-DKO-hiR2-FL-A521S-T7, MEF-DKO-hiR2-FL-T522V-T7, MEF-DKO-hiR2-FL-T522A-T7, MEF-DKO-hiR2-FL-F523W-T7, MEF-DKO-hiR2-FL-F523A-T7, MEF-DKO-hiR2-FL-V524A-T7, MEF-DKO-hiR2-FL-K525A-T7, MEF-DKO-hiR2-FL-W526A-T7, MEF-DKO-hiR2-FL-Q527P-T7, MEF-DKO-hiR2-FL-Q527A-T7, MEF-DKO-hiR2-FL-D528N-T7MEF-DKO-hiR2-FL-D528I-T7、MEF-DKO-hiR2-FL-D528A-T7、MEF-DKO-hiR2-FL-D529H-T7、MEF-DKO-hiR2-FL-D529A-T7、MEF-DKO-hiR2-FL-T530P-T7、MEF-DKO-hiR2-FL-T530A-T7、MEF-DKO-hiR2-FL-G531S-T7、MEF-DKO-hiR2-FL-G531A-T7、MEF-DKO-hiR2-FL-P532A-T7、MEF-DKO-hiR2-FL-P533--T7、MEF-DKO-hiR2-FL-P533A-T7、MEF-DKO-hiR2-FL-M534S-T7、MEF-DKO-hiR2-FL-M534--T7、MEF-DKO-hiR2-FL-M534A-T7、MEF-DKO-hiR2-FL-D535--T7、MEF-DKO-hiR2-FL-D535A-T7、MEF-DKO-hiR2-FL-K536--T7、MEF-DKO-hiR2-FL-K536A-T7、MEF-DKO-hiR2-FL-S537E-T7、MEF-DKO-hiR2-FL-S537A-T7、MEF-DKO-hiR2-FL-D538L-T7、MEF-DKO-hiR2-FL-D538A-T7、MEF-DKO-hiR2-FL-L539A-T7、MEF-DKO-hiR2-FL-G540S-T7、MEF-DKO-hiR2-FL-G540A-T7、MEF-DKO-hiR2-FL-Q541H-T7、MEF-DKO-hiR2-FL-Q541A-T7、MEF-DKO-hiR2-FL-K542A-T7、MEF-DKO-hiR2-FL-R543Q-T7、MEF-DKO-hiR2-FL-R543A-T7、MEF-DKO-hiR2-FL-T544P-T7、MEF-DKO-hiR2-FL-T544Q-T7、MEF-DKO-hiR2-FL-T544A-T7、MEF-DKO-hiR2-FL-S545F-T7、MEF-DKO-hiR2-FL-S545A-T7、MEF-DKO-hiR2-FL-G546A-T7、MEF-DKO-hiR2-FL-A547V-T7、MEF-DKO-hiR2-FL-A547S-T7、MEF-DKO-hiR2-FL-V548A-T7、MEF-DKO-hiR2-FL-C549A-T7、MEF-DKO-hiR2-FL-H550A-T7、MEF-DKO-hiR2-FL-Q551A-T7、MEF-DKO-hiR2-FL-D552A-T7、MEF-DKO-hiR2-FL-P553A-T7、MEF-DKO-hiR2-FL-R554A-T7、MEF-DKO-hiR2-FL-T555V-T7、MEF-DKO-hiR2-FL-T555A-T7、MEF-DKO-hiR2-FL-C556A-T7、MEF-DKO-hiR2-FL-E557D-T7、MEF-DKO-hiR2-FL-E557A-T7、MEF-DKO-hiR2-FL-E558A-T7、MEF-DKO-hiR2-FL-P559A-T7、MEF-DKO-hiR2-FL-A560S-T7、MEF-DKO-hiR2-FL-S561A-T7、MEF-DKO-hiR2-FL-S562E-T7、MEF-DKO-hiR2-FL-S562A-T7、MEF-DKO-hiR2-FL-G563D-T7、MEF-DKO-hiR2-FL-G563A-T7、MEF-DKO-hiR2-FL-A564P-T7、MEF-DKO-hiR2-FL-A564S-T7、MEF-DKO-hiR2-FL-H565A-T7、MEF-DKO-hiR2-FL-I566E-T7、MEF-DKO-hiR2-FL-I566A-T7、MEF-DKO-hiR2-FL-W567A-T7、MEF-DKO-hiR2-FL-P568A-T7、MEF-DKO-hiR2-FL-D569E-T7、MEF-DKO-hiR2-FL-D569A-T7、MEF-DKO-hiR2-FL-D570A-T7、MEF-DKO-hiR2-FL-I571A-T7、MEF-DKO-hiR2-FL-T572A-T7、MEF-DKO-hiR2-FL-K573A-T7、MEF-DKO-hiR2-FL-W574A-T7、MEF-DKO-hiR2-FL-P575A-T7、MEF-DKO-hiR2-FL-I576A-T7、MEF-DKO-hiR2-FL-C577A-T7、MEF-DKO-hiR2-FL-T578A-T7、MEF-DKO-hiR2-FL-E579K-T7、MEF-DKO-hiR2-FL-E579A-T7、MEF-DKO-hiR2-FL-Q580N-T7、MEF-DKO-hiR2-FL-Q580A-T7、MEF-DKO-hiR2-FL-A581S-T7, MEF-DKO-hiR2-FL-R582A-T7, MEF-DKO-hiR2-FL-S583G-T7, MEF-DKO-hiR2-FL-S583A-T7, MEF-DKO-hiR2-FL -N584A-T7, MEF-DKO-hiR2-FL-H585A-T7, MEF-DKO-hiR2-FL-T586A-T7, MEF-DKO-hiR2-FL-G587N-T7, MEF-DKO-hiR2-FL-G587A-T7, MEF-DK O-hiR2-FL-F588H-T7, MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR2-FL-L589P-T7, MEF-DKO-hiR2-FL-L589A-T7, MEF-DKO-hiR2-FL-H590A-T7, MEF-DKO-hiR2-FL-M591A-T7, MEF-DKO-hiR2-FL-D592A-T7, MEF-DKO-hiR2-FL-C593A-T7 and MEF-DKO-hiR2-FL-E594V-T7 cells were incubated at 4 °C for 1 h in PBS with 10 mM MgCl2. They were harvested with EDTA, washed and resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide) and plated in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA) at approximately 1x10 per well. 5Cells were seeded on the wells of the wells. Plates were centrifuged at 1500 rpm, 4° C. for 3 min to pellet the cells and remove the supernatant. For primary staining, cells were resuspended in 100 μl per well of either FACS buffer alone (control) or humanized antibodies of the present invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 at 3 μg / ml in FACS buffer and incubated on ice for 1 h. Plates were then centrifuged at 1500 rpm, 4° C. for 3 min and washed twice with 200 μl FACS buffer per well. For secondary staining, cells were spun down and suspended in 100 μl per well of PE-labeled goat anti-human IgG F(ab´)2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Cell suspension was incubated on ice for 1 h, protected from light. Afterwards, the plates were centrifuged at 1500 rpm for 3 min at 4°C and washed three times with 200 μl FACS buffer per well. Finally, the cells were resuspended in 150 μl FACS buffer per well and analyzed using a BD AccuriTM C6 Plus flow cytometer (Becton Dickinson, Germany).

[0176] Figure 17a shows a representative result of this experiment. As an example, the analysis data of cells expressing the human iRhom2 variant hiR2-FL-K536A-T7 are shown for the entire panel of 128 functional human iRhom2 variants with single amino acid substitutions or deletions. Binding analysis of humanized antibody 42-B-02 (black) as a representative example of an antibody of the invention and an anti-mouse IgG secondary antibody (grey) in MEF-DKO-hiR2-FL-WT-T7 cells (left) and MEF-DKO-hiR2-FL-K536A-T7 cells (right) shows that the substitution of the single amino acid lysine 536 of human iRhom2 with alanine strongly inhibits the binding of human iRhom2 and thus contributes to the binding of humanized antibody 42-B-02 of the invention (right). Binding to MEF-DKO-hiR2-FL-WT-T7 cells (left) was used as a positive control for humanized antibody 42-B-02.

[0177] FIG. 17b, as an extension of FIG. 17a, summarizes the results of FACS analysis of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the present invention against a panel of 128 engineered functional MEF populations expressing human iRhom2 variants with single amino acid substitutions or deletions. Binding of each antibody to human iRhom2 wild type is taken as 100%. Antibody binding to any variant that is reduced by 30-59% is shown in light grey (labeled "1"), antibody binding that is reduced by 60-95% is shown in grey (labeled "2"), and antibody binding that is reduced by 95% or more is shown in dark grey (labeled "3"). These data reveal a pattern of association of amino acid positions relevant for binding for humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04.

[0178] Example 15: Analysis of the inhibitory effect of the antibodies of the invention on LPS-induced TNFα cleavage in primary human material from healthy donors in vitro In the following studies, an ELISA-based TNFα release assay was performed to analyze the inhibitory effect of antibodies of the invention on LPS-induced release of endogenous TNFα from primary human material obtained from healthy donors using peripheral blood mononuclear cells (PBMCs).

[0179] The ELISA-based TNFα release assay used in this example is described below.

[0180] Briefly, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with mouse anti-human TNFα capture antibody (provided as part of the DuoSet ELISA kit) at 4 μg / ml in TBS, 100 μl per well, overnight at 4° C. On day 2, the capture antibody solution was removed and MaxiSorp® plates were blocked with 300 μl per well of TBS, 1% BSA for 3 hours at room temperature. Meanwhile, 20,000 PBMC cells (ReachBio Research Labs, USA) from healthy donors in 80 μl of normal growth medium were seeded into each well of a Greiner CELLSTAR V-bottom 96-well plate (Greiner Bio-One, Germany) and pre-incubated for 30 min at 37° C., 5% CO2 in standard growth medium (20 μl per well) supplemented with 50 μM Batimastat (BB94, Abcam, UK) as a positive control (final concentration of 10 μM in the resulting 100 μl sample volume), 15 μg / ml human IgG1 kappa antibody (BioLegend, USA) as an isotype control (final concentration of 3 μg / ml, sample volume of 100 μl), or 15 μg / ml of the antibody of the present invention (final concentration of 3 μg / ml, sample volume of 100 μl). For stimulation, 20 μl of standard growth medium without test article was added. Afterwards, cells (except for the unstimulated control) were stimulated with LPS (Sigma-Aldrich, USA) at 0.06 ng / ml in growth medium to a final concentration of 0.01 g / ml with 20 μl per well for 2 h at 37 °C and 5% CO2. Afterwards, the 96-well plates were centrifuged to sediment the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plates and the plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well on a 96-head plate washer (Tecan Group, Switzerland). To avoid drying, 30 μl TBS was immediately added to each well of the MaxiSorp® plate, followed by transfer of 70 μl of cell-free supernatant per sample.Additionally, 100 μl of recombinant human TNFα protein (provided as part of the DuoSet ELISA kit) diluted to a defined concentration in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human TNFα detection antibody (provided as part of the DuoSet ELISA kit) was added per well at 50 ng / ml in TBS, and the plate was incubated for 2 h at room temperature, protected from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland, Carl Roth), and carefully removing all traces of buffer after the fourth cycle, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plate was incubated for 30 min at room temperature, again protected from direct light. After rewashing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer after the fourth cycle, 100 μl of AttoPhos substrate solution (Promega, USA) was added per well for incubation at room temperature in the dark for 1 h. Fluorescence of each well was collected at an excitation wavelength of 435 nm and an emission wavelength of 555 nm using an infinite M1000 (Tecan Group, Switzerland) microplate reader.

[0181] Figure 18 shows representative results from this experiment showing the effect of test articles on LPS-induced TNFα release from healthy donor PBMCs, in absolute numbers (Figure 18a) and percent inhibition (Figure 18b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and inhibited LPS-induced TNFα release by 98.9%, while the presence of an IgG isotype control did not significantly affect TNFα cleavage. In contrast, equivalent concentrations of the humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibited LPS-induced TNFα release from healthy donor PBMCs by 74.2%, 73.5%, 72.8%, 59.4%, 64.3% and 68.5%, respectively.

[0182] Example 16: Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced IL-6R cleavage in primary human material from healthy donors in vitro In the following study, an ELISA-based IL-6R release assay was performed to analyze the inhibitory effect of the antibodies of the invention on PMA-induced release of endogenous IL-6R from primary human material obtained from healthy donors using peripheral blood mononuclear cells (PBMCs).

[0183] The ELISA-based IL-6R release assay used in this example is described below.

[0184] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with mouse anti-human IL-6R capture antibody (provided as part of the DuoSet ELISA kit) at 2 μg / ml in TBS, 100 μl per well, overnight at 4°C.

[0185] 40000 PBMC cells (STEMCELL Technologies, Canada) from healthy donors in 80 μl of normal growth medium were seeded in each well of a Greiner CELLSTAR V-bottom 96-well plate (Greiner Bio-One, Germany) and pre-incubated for 30 min at 37° C. and 5% CO2 with standard growth medium (20 μl per well) supplemented with 50 μM Batimastat (BB94, Abcam, UK) as positive control (final concentration 10 μM in the resulting 100 μl sample volume), 15 μg / ml human IgG1 kappa antibody (BioLegend, USA) as isotype control (final concentration 3 μg / ml, sample volume 100 μl) or the antibody of the invention at 15 μg / ml (final concentration 3 μg / ml, sample volume 100 μl). For stimulation, 20 μl of standard growth medium without test article was added. Then, cells (except for the unstimulated control) were stimulated with PMA (Sigma-Aldrich, USA) at 150 ng / ml in growth medium to a final concentration of 25 ng / ml, 20 μl per well, at 37°C, 5% CO2 for 24 h.

[0186] On day 2, the capture antibody solution was removed and the MaxiSorp® plates were blocked with 300 μl per well of TBS, 1% BSA for 2 hours at room temperature.

[0187] Meanwhile, the 96-well plates were centrifuged to precipitate the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plates and the plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well on a 96-head plate washer (Tecan Group, Switzerland). To avoid drying, 30 μl TBS was immediately added to each well of the MaxiSorp® plate, followed by transfer of 70 μl of cell-free supernatant per sample. In addition, 100 μl of recombinant human IL-6R protein (provided as part of the DuoSet ELISA kit) diluted to a defined concentration in TBS was added to the plate as a standard reference. The plates were incubated at room temperature for 2 h. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer after the fourth cycle, 100 μl per well of biotinylated goat anti-human IL-6R detection antibody (provided as part of the DuoSet ELISA kit) was added in 100 ng / ml TBS and the plates were incubated for 2 h at room temperature, away from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland), and carefully removing all traces of buffer after the fourth cycle, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well and the plates were incubated for 30 min at room temperature, again protected from direct light. After rewashing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer after the fourth cycle, 100 μl of AttoPhos substrate solution (Promega, USA) was added per well for incubation at room temperature in the dark for 1 h. Fluorescence of each well was collected at an excitation wavelength of 435 nm and an emission wavelength of 555 nm using an infinite M1000 (Tecan Group, Switzerland) microplate reader.

[0188] Figure 19 shows representative results from this experiment, showing the effect of test articles on PMA-induced release of IL-6R from PBMCs of healthy donors, in absolute numbers (Figure 19a) and percent inhibition (Figure 19b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control, inhibiting PMA-induced IL-6R release by 96.2%, while the presence of an IgG isotype control had no significant effect on IL-6R cleavage. In contrast, equivalent concentrations of the humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibit PMA-induced IL-6R release from PBMCs of healthy donors by 75.0%, 79.0%, 75.4%, 64.6%, 73.4% and 78.4%, respectively.

[0189] Example 17: Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced HB-EGF cleavage in primary human material from healthy donors in vitro In the following study, an ELISA-based HB-EGF release assay was performed to analyze the inhibitory effect of antibodies of the invention on PMA-induced release of endogenous HB-EGF from primary human material obtained from healthy donors using peripheral blood mononuclear cells (PBMCs).

[0190] The ELISA-based HB-EGF release assay used in this example is described below.

[0191] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with mouse anti-human HB-EGF capture antibody (provided as part of the DuoSet ELISA kit) at 2 μg / ml in TBS, 100 μl per well, overnight at 4°C.

[0192] 80000 PBMCs (STEMCELL Technologies, Canada) from healthy donors in 80 μl of normal growth medium were seeded into each well of a Greiner CELLSTAR V-bottom 96-well plate (Greiner Bio-One, Germany) and pre-incubated for 30 min at 37° C. and 5% CO2 with standard growth medium (20 μl per well) supplemented with 50 μM Batimastat (BB94, Abcam, UK) as positive control (final concentration 10 μM in the resulting 100 μl sample volume), 15 μg / ml human IgG antibody (BioLegend, USA) as isotype control (final concentration 3 μg / ml, sample volume 100 μl) or the antibody of the invention at 15 μg / ml (final concentration 3 μg / ml, sample volume 100 μl). For stimulation, 20 μl of standard growth medium without test article was added. Cells (except for unstimulated controls) were then stimulated with PMA (Sigma-Aldrich, USA) at 150 ng / ml in growth medium to a final concentration of 25 ng / ml, 20 μl per well for 24 h at 37° C., 5% CO2. On day 2, the capture antibody solution was removed and the MaxiSorp® plates were blocked with 300 μl per well of TBS, 1% BSA for 2 h at room temperature.

[0193] Meanwhile, the 96-well plates were centrifuged to precipitate the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plates and the plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well on a 96-head plate washer (Tecan Group, Switzerland). To avoid drying, 30 μl TBS was immediately added to each well of the MaxiSorp® plate, followed by transfer of 70 μl of cell-free supernatant per sample. In addition, 100 μl of recombinant human HB-EGF protein (provided as part of the DuoSet ELISA kit) diluted to a defined concentration in TBS was added to the plate as a standard reference. The plates were incubated at room temperature for 2 h. After washing four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer after the fourth cycle, 100 μl per well of biotinylated goat anti-human HB-EGF detection antibody (provided as part of the DuoSet ELISA kit) at 50 ng / ml in TBS was added and the plates were incubated for 2 h at room temperature, away from direct sunlight.

[0194] After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland, Carl Roth) and carefully removing all traces of buffer from the fourth cycle onwards, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well and the plate was incubated for 30 min at room temperature, again protected from direct light. After washing again four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland) and carefully removing all traces of buffer from the fourth cycle onwards, 100 μl of AttoPhos substrate solution (Promega, USA) was added per well for 1 h incubation at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0195] Figure 20 shows representative results from this experiment, showing the effect of test articles on PMA-induced release of HB-EGF from PBMCs of healthy donors, in absolute numbers (Figure 20a) and percent inhibition (Figure 20b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and inhibited PMA-induced HB-EGF release by 100.0%, while the presence of an IgG isotype control had no significant effect on HB-EGF cleavage. In contrast, equivalent concentrations of humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibited PMA-induced HB-EGF release from PBMCs of healthy donors by 69.7%, 74.8%, 66.5%, 49.6%, 59.2% and 66.7%, respectively.

[0196] Example 18: Analysis of the inhibitory effect of the antibody of the present invention on LPS-induced TNFα cleavage in vivo In the following study, an ELISA-based TNFα release assay was performed to confirm the inhibitory effect of the antibodies of the present invention on LPS-induced endogenous TNFα release in a mouse model of septic shock. The experiment was performed using genetically humanized mice in which a portion of mouse genomic iRhom2 DNA (an exon encoding an antibody binding site) was replaced with the corresponding human genomic DNA sequence. All animal experiments were approved by the Institutional Animal Care and Use Committee of the Hospital for Special Surgery and Weill Cornell Medicine.

[0197] On day 1, one group of mice was injected with the antibody of the present invention at a concentration of 250 μg / kg in 200 μL PBS. The other group was injected with the same volume of PBS only (200 μl PBS per mouse). One hour later, all mice were injected with LPS (Sigma, USA) at a concentration of 50 μg / 200 μL (250 ng / μL) per mouse. All mice were carefully observed and euthanized by CO2 inhalation after 2 hours. Blood was removed from the thoracic cavity and centrifuged at 4000 g for 10 min at room temperature to remove cells and debris. The clear serum was transferred to a new tube and then diluted 1:10 with PBS for ELISA measurements.

[0198] For measuring TNFα release, Mouse TNF-α Uncoated ELISA Kit (Invitrogen, USA) was used. Briefly, on day 1, Costar® 96-well plates (Corning, USA) were coated with anti-mouse TNFα capture antibody (provided as part of the ELISA kit) at 100 μl per well, 1:250 in PBS, overnight at 4° C. On day 2, the capture antibody solution was removed and Costar® plates were washed three times with 250 μl per well PBS-Tween 0.05% (Boston Bio, USA) using a Nunc Immunowash plate washer (VWR, USA), and plates were blocked with 150 μl ELISA / ELISPOT Diluent (1X) (provided as part of the kit) for 1 hour. Afterwards, the blocking buffer was removed from the Costar® plates and the plates were washed three times with 250 μl per well of PBS-Tween 0.05% (Boston Bio, USA) using a Nunc Immunowash plate washer (VWR, USA). Immediately afterwards, 20 μl of biotinylated anti-mouse TNFα detection antibody (provided as part of the ELISA kit) was added to all wells at a final dilution of 1:250 in ELISA / ELISPOT Diluent. Then, 80 μl of cleared, 1:10 diluted serum or 80 μl of recombinant mouse TNFα protein (provided as part of the ELISA kit) standard reference diluted to the specified concentration in ELISA / ELISPOT Diluent was added to the plate. Samples, standards and detection antibodies were incubated for 2 hours at room temperature. After washing three times with 250 μl per well of PBS-Tween 0.05% (Boston Bio, USA) using a Nunc Immunowash plate washer (VWR, USA) and carefully removing all traces of buffer after the third cycle, 100 μl of streptavidin-horseradish peroxidase conjugate (provided as part of the ELISA kit) diluted 1:100 in ELISA / ELISPOT Diluent was added to each well and the plate was incubated at room temperature for 30 min.The plates were washed three times with 250 μl per well of PBS-Tween 0.05% (Boston Bio, USA) using a Nunc Immunowash plate washer (VWR, USA), and after carefully removing traces of buffer after the third wash, 100 μl per well of TMB substrate solution (BD, USA) was added and incubated for 15 min. The color reaction was stopped by adding 100 μl of 2N sulfuric acid (Sigma, USA), and the ELISA plate was read at 450 nm using a Multiskan Titertek Plate reader (VWR, USA).

[0199] Figure 21 shows representative results from this experiment, showing the effect of test articles on LPS-induced release of TNFα in the serum of genetically humanized mice, in absolute numbers (Figure 21a) and in percent release (Figure 21b). Assuming that LPS-induced release of TNFα in the serum of genetically humanized mice is 100%, humanized antibody 42-B-02, as a representative example of an antibody of the invention, reduces LPS-induced release of TNFα in the serum of genetically humanized mice to 17.3%.

[0200] References JPEG2024510415000005.jpg211170

[0201] array The following sequences form part of the disclosure of this application. A WIPO ST 25 compatible electronic sequence listing is also provided with this application. For the avoidance of doubt, in case of any discrepancy between the sequences in the table below and the sequences in the electronic sequence listing, the sequences in the table shall be deemed correct. JPEG2024510415000006.jpg152170JPEG2024510415000007.jpg138170JPEG2024510415000008.jpg138170JPEG2024510415 000009.jpg188170JPEG2024510415000010.jpg179170JPEG2024510415000011.jpg235170JPEG2024510415000012.jpg74170

Claims

1. A humanized antibody that binds to iRhom2, or an iRhom2-binding fragment or derivative thereof that retains iRhom2-binding ability, comprising: a) a set of three heavy chain and three light chain complementarity determining regions (CDRs) selected from: SEQ ID NOs: 2, 3, 4, 6, 7 and 8, SEQ ID NOs: 10, 11, 12, 14, 15 and 16, SEQ ID NOs: 18, 19, 20, 22, 23 and 24, SEQ ID NOs: 26, 27, 28, 30, 31 and 32, SEQ ID NOs: 34, 35, 36, 38, 39 and 40, or SEQ ID NOs: 42, 43, 44, 46, 47 and 48, and / or a) comprising the following heavy chain / light chain variable domain (HCVD / LCVD) pair: SEQ ID NOs: 1 and 5, SEQ ID NOs: 9 and 13, SEQ ID NOs: 17 and 21, SEQ ID NOs: 25 and 29, SEQ ID NOs: 33 and 37, or SEQ ID NOs: 41 and 45, The antibody or fragment is capable of binding to human iRhom2 and / or inhibiting or reducing TACE / ADAM17 activity; The humanized antibody, or an iRhom2-binding fragment or derivative thereof that retains iRhom2-binding ability.

2. The antibody or fragment of claim 1 , which binds to human iRhom2 within at least the loop 1 region.

3. The antibody or fragment according to claim 1 or 2, wherein the inhibition or reduction of TACE / ADAM17 activity is caused by interference with iRhom2-mediated TACE / ADAM17 activation.

4. When bound to human iRhom2, inhibiting or reducing induced TNFα cleavage, inhibiting or reducing induced IL-6R cleavage, and / or inhibiting or reducing induced HB-EGF cleavage; The antibody or fragment according to any one of claims 1 to 3.

5. The antibody or fragment according to any one of claims 1 to 4, which is a monoclonal antibody, or a fragment thereof that retains the iRhom2-binding ability, or a derivative thereof that retains the iRhom2-binding ability.

6. The antibody or fragment of any one of claims 1 to 5, which is an antibody in at least one of the formats selected from the group consisting of IgG, scFv, Fab, or (Fab)2.

7. The antibody or fragment of any one of claims 1 to 6, which does not exhibit cross-reactivity with human iRhom1.

8. A nucleic acid encoding at least one chain of an antibody or fragment thereof according to any one of claims 1 to 7.

9. Use of an antibody or fragment according to any one of claims 1 to 7 or a nucleic acid according to claim 8 in the manufacture of a medicament for the treatment of a human or animal subject diagnosed with, suffering from or at risk of developing an inflammatory condition, or for the prevention of such a condition.

10. A pharmaceutical composition comprising an antibody or fragment according to any one of claims 1 to 7, or a nucleic acid according to claim 8, and optionally one or more pharma- ceutically acceptable excipients.

11. 11. The antibody or fragment of any one of claims 1 to 7, the nucleic acid of claim 8, or the pharmaceutical composition of claim 10 for use in a method for treating or preventing an inflammatory condition, the method comprising administering the antibody or fragment, the nucleic acid, or the pharmaceutical composition to a human or animal subject in a therapeutically sufficient amount.

12. A medical kit of parts including: a) an antibody or fragment according to any one of claims 1 to 7, a nucleic acid according to claim 8, or a pharmaceutical composition according to claim 10; b) a device for administering the antibody or fragment, nucleic acid or pharmaceutical composition, and c) Instructions for use of the kit.

Images