Compositions and methods for treating TDP-43 proteinopathy

Abstract

The present disclosure relates to the use of UNC13A cryptic exon splice variant specific inhibitors for reducing expression of UNC13A cryptic exon splice variants in cells, reducing phosphorylated TAR-DNA binding protein-43 (TDP-43) in cells, treating TAR-DNA binding protein 43 (TDP-43) proteinopathy in a subject, or treating a subject identified as having an UNC13A mutation in intron 20-21 of UNC13A. Antisense oligonucleotides against UNC13A cryptic splice variants are also contemplated.

Description

[Technical field]

[0001] Description of sequence listing The sequence listing associated with this application is provided in text format in lieu of a paper copy and is hereby incorporated by reference herein. The name of the text file containing the sequence listing is 630264_403WO_SEQUENCE_LISTING.txt. The text file is 243KB, was created on April 5, 2022, and has been submitted electronically via EFS-Web. [Background technology]

[0002] A hallmark pathological feature of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) is the depletion of the RNA-binding protein TDP-43 in the nuclei of neurons in the brain and spinal cord. TDP-43, encoded by TARDBP, is an abundant, ubiquitously expressed RNA-binding protein that is normally localized in the nucleus. It is involved in fundamental RNA processing activities, including RNA transcription, alternative splicing, and RNA transport (1). TDP-43 can bind to thousands of pre-messenger RNA / mRNA targets (2, 3). Reduction of TDP-43 from the otherwise normal adult nervous system alters the splicing or expression levels of over 1,500 RNAs, including long intron-containing transcripts (2). The main splicing regulatory function of TDP-43 is to suppress the inclusion of cryptic exons during splicing (4–7). Unlike normal conserved exons, these hidden exons are hidden in introns and are usually removed from mature mRNA. When TDP-43 is depleted from cells, these hidden exons are spliced ​​into messenger RNA, which often introduces frameshift and premature termination or even nonsense-mediated decay of mRNA. However, the key hidden splicing events of the disease remain to be identified. Therefore, there is a need to discover hidden splicing targets that are regulated by TDP-43 and are also involved in the development of TDP-43 proteinopathy as therapeutic targets. Summary of the Invention [Means for solving the problem]

[0003] In one aspect, the disclosure provides a method for reducing expression of an UNC13A cryptic exon splice variant in a cell, the method comprising administering an UNC13A cryptic exon splice variant-specific inhibitor, wherein (a) the UNC13A cryptic exon splice variant comprises a cryptic exon between exon 20 and exon 21 of the UNC13A cryptic exon splice variant mature mRNA transcript; and (b) the UNC13A cryptic exon splice variant-specific inhibitor comprises an antisense oligonucleotide.

[0004] In another aspect, the disclosure provides a method of reducing phosphorylated TAR-DNA binding protein 43 (TDP-43) in a cell, the method comprising administering an UNC13A cryptic exon splice variant-specific inhibitor, wherein (a) the UNC13A cryptic exon splice variant comprises a cryptic exon between exon 20 and exon 21 of the UNC13A cryptic exon splice variant mature mRNA transcript; and (b) the UNC13A cryptic exon splice variant-specific inhibitor comprises an antisense oligonucleotide.

[0005] In another aspect, the disclosure provides a method of treating a TAR-DNA binding protein 43 (TDP-43) proteinopathy in a subject, the method comprising administering to the subject an UNC13A cryptic exon splice variant-specific inhibitor, wherein (a) the UNC13A cryptic exon splice variant comprises a cryptic exon between exon 20 and exon 21 of the UNC13A cryptic exon splice variant mature mRNA transcript; and (b) the UNC13A cryptic exon splice variant-specific inhibitor comprises an antisense oligonucleotide.

[0006] In yet another aspect, the disclosure provides a method of treating a subject identified as having an UNC13A genetic mutation in intron 20-21, the method comprising administering to the subject an UNC13A cryptic exon splice variant-specific inhibitor, wherein (a) the UNC13A cryptic exon splice variant comprises a cryptic exon between exon 20 and exon 21 of the UNC13A cryptic exon splice variant mature mRNA transcript; and (b) the UNC13A cryptic exon splice variant-specific inhibitor comprises an antisense oligonucleotide.

[0007] In an embodiment, the hidden exon comprises the base sequence of SEQ ID NO:5 or SEQ ID NO:6.

[0008] In embodiments, the UNC13A cryptic exon splice variant comprises SEQ ID NO:7 or SEQ ID NO:8.

[0009] In embodiments, the UNC13A cryptic exon splice variant-specific inhibitor comprises an antisense oligonucleotide complementary to: (a) the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO: 641; or (b) the 3' end of a cryptic exon having the sequence set forth in SEQ ID NO: 642.

[0010] In embodiments, the UNC13A cryptic exon splice variant-specific inhibitor comprises an antisense oligonucleotide complementary to: (a) the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO: 643; or (b) the 3' end of a cryptic exon having the sequence set forth in SEQ ID NO: 644.

[0011] In embodiments, the UNC13A cryptic exon splice variant-specific inhibitor comprises an antisense oligonucleotide complementary to: (a) the exon 20 splice donor site region of the preprocessed mRNA encoding UNC13A; (b) the cryptic exon splice acceptor site region of the preprocessed mRNA encoding UNC13A; (c) the cryptic exon splice donor site region of the preprocessed mRNA encoding UNC13A; or (d) the exon 21 splice acceptor site region of the preprocessed mRNA encoding UNC13A.

[0012] In embodiments, the exon 20 splice donor site region in the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO: 12; the cryptic exon splice acceptor site region in the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO: 91; the cryptic exon splice donor site region in the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO: 220; or the exon 21 splice acceptor site region in the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO: 299.

[0013] In an embodiment, the antisense oligonucleotide has 15 to 40 bases. In an embodiment, the antisense oligonucleotide has 20 to 30 bases. In an embodiment, the antisense oligonucleotide has 18 to 25 bases. In an embodiment, the antisense oligonucleotide has 18 to 22 bases.

[0014] In an embodiment, the antisense oligonucleotide has a base sequence having at least 80%, 85%, 90%, or 95% identity to any one of SEQ ID NOs: 13 to 90, 92 to 219, 221 to 298, 300 to 377, and 423 to 640. In an embodiment, the antisense oligonucleotide has a base sequence that includes or consists of any one of SEQ ID NOs: 13 to 90, 92 to 219, 221 to 298, 300 to 377, and 423 to 640. In an embodiment, the antisense oligonucleotide has a base sequence that includes or consists of any one of SEQ ID NOs: 423 to 432, 439 to 443, 491 to 498, 502 to 507, and 513 to 514.

[0015] In embodiments, the antisense oligonucleotide: (a) has 18 to 30 bases, 18 to 25 bases, or 18 to 22 bases complementary to SEQ ID NO: 650; (b) has 18 to 30 bases, 18 to 25 bases, or 18 to 22 bases complementary to SEQ ID NO: 651; (c) has 18 to 30 bases, 18 to 25 bases, or 18 to 22 bases complementary to SEQ ID NO: 652; (d) has 18 to 30 bases, 18 to 25 bases, or 18 to 22 bases complementary to SEQ ID NO: 653; or (e) has 18 to 21 bases complementary to SEQ ID NO: 654.

[0016] In embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In embodiments, the modified antisense oligonucleotide comprises a 2'OMe antisense oligonucleotide, a 2'O-methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or an LNA antisense oligonucleotide.

[0017] The present disclosure also provides a pharmaceutical composition comprising an antisense oligonucleotide having 15 to 40 bases and comprising a base sequence having at least 80% identity to any one of SEQ ID NOs: 13 to 90, 92 to 219, 221 to 298, 300 to 377, and 423 to 640, and a pharma- ceutical composition comprising a pharma- ceutical acceptable excipient.

[0018] The present disclosure also provides a pharmaceutical composition comprising an antisense oligonucleotide having: (a) 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 650; (b) 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 651; (c) 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 652; (d) 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 653; or (e) 18-21 bases complementary to SEQ ID NO: 654, and a pharma- ceutically acceptable excipient.

[0019] In another aspect, the present disclosure provides a modified antisense oligonucleotide having 15 to 40 bases and comprising a base sequence having at least 80% identity to any one of SEQ ID NOs: 13 to 90, 92 to 219, 221 to 298, 300 to 377, and 423 to 640.

[0020] In yet another aspect, the present disclosure provides a modified antisense oligonucleotide having 15 to 40 bases, the base sequence being complementary to (a) the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO: 641 or (b) the 3' end of a cryptic exon having the sequence set forth in SEQ ID NO: 642.

[0021] The present disclosure also provides kits that include the UNC13A cryptic exon splice variant-specific antisense oligonucleotides of the present disclosure. [Brief description of the drawings]

[0022] [Figure 1A] Nuclear depletion of TDP-43 results in inclusion of cryptic exons in UNC13A RNA and reduced expression of UNC13A protein. Splicing analysis was performed on RNA-sequencing results generated from TDP-43-positive and TDP-43-negative neuronal nuclei isolated from the frontal cortex of seven FTD / FTD-ALS patients. FACS, fluorescence-activated cell sorting. [Figure 1B]Nuclear depletion of TDP-43 results in inclusion of cryptic exons into UNC13A RNA and reduced expression of UNC13A protein. 65 alternatively spliced ​​genes identified by both MAJIQ ( P (ΔΨ > 0.1) > 0.95) (ΔΨ, change in local splicing variation between the two conditions) and LeafCutter ( P < 0.05). [Figure 1C] Nuclear depletion of TDP-43 results in inclusion of cryptic exons in UNC13A RNA and reduced expression of UNC13A protein. Visualization of RNA-sequencing alignment between exon 20 and exon 21 in UNC13A(hg38). Libraries were generated as described in (Figure 1A). CE, cryptic exons. [Figure 1D] Nuclear depletion of TDP-43 results in inclusion of a cryptic exon in UNC13A RNA and reduced expression of UNC13A protein. iCLIP of TDP-43 shows that TDP-43 binds to intron 20-21. An example of a region in intron 20-21 that is frequently bound by TDP-43. The TDP-43 binding motif (UG)n is highlighted in orange. [Figure 1E] Nuclear depletion of TDP-43 results in inclusion of the cryptic exon in UNC13A RNA and reduced expression of UNC13A protein. RT-qPCR confirmed inclusion of the cryptic exon in UNC13A mRNA upon TDP-43 depletion in SH-SY5Y cells (five independent cell culture experiments for each condition) (Figure 1E) and three independent induced motor neurons (iMNs) (four independent cell culture experiments for each iMN) (Figure 1H). The positions of primers spanning the cryptic exon-associated regions are indicated. qRT-PCR was normalized using RPLP0. (Two-tailed Welch two-sample t-test, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; mean ± sem). [Figure 1F]Nuclear depletion of TDP-43 results in inclusion of a cryptic exon in UNC13A RNA and reduced expression of UNC13A protein. Immunoblots (n=3) of UNC13A protein and TDP-43 in SH-SY5Y cells (Figure 1F) and iMNs (Figure 1I) treated with scrambled shRNA or TDP-43 shRNA. GAPDH served as a loading control. [Figure 1G] Nuclear depletion of TDP-43 results in inclusion of cryptic exons in UNC13A RNA and reduced expression of UNC13A protein. Quantification of blots in (Figure 1F) (two-tailed Welch's two-sample t test, *P<0.05, **P<0.01). [Figure 1H] Nuclear depletion of TDP-43 results in inclusion of the cryptic exon in UNC13A RNA and reduced expression of UNC13A protein. RT-qPCR confirmed inclusion of the cryptic exon in UNC13A mRNA upon TDP-43 depletion in SH-SY5Y cells (five independent cell culture experiments for each condition) (Figure 1E) and three independent induced motor neurons (iMNs) (four independent cell culture experiments for each iMN) (Figure 1H). The positions of primers spanning the cryptic exon-associated regions are indicated. qRT-PCR was normalized using RPLP0. (Two-tailed Welch two-sample t-test, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; mean ± sem). [Figure 1I] Nuclear depletion of TDP-43 results in inclusion of a cryptic exon in UNC13A RNA and reduced expression of UNC13A protein. Immunoblots (n=3) of UNC13A protein and TDP-43 in SH-SY5Y cells (Figure 1F) and iMNs (Figure 1I) treated with scrambled shRNA or TDP-43 shRNA. GAPDH served as a loading control. [Figure 1J]Nuclear depletion of TDP-43 results in inclusion of cryptic exons in UNC13A RNA and reduced expression of UNC13A protein. RT-qPCR (n=5) analysis confirmed inclusion of UNC13A cryptic exons upon TDP-43 depletion in human iPSC-derived neurons (3 independent cell culture experiments). qRT-PCR was normalized using RPLP0 and GAPDH (2-tailed Welch's two-sample t-test; ***P<0.001, ****P<0.0001; mean±sem). [Figure 2A] Inclusion of UNC13A cryptic exons in human TDP-43 proteinopathies. UNC13A cryptic exon expression levels are significantly increased in the frontal cortex of FTLD-TDP patients. qRT-PCR primer pairs used for detection of cryptic exons are shown at the top. qRT-PCR was normalized using GAPDH and RPLP0 (two-tailed Mann-Whitney test, ****P<0.0001; error bars represent 95% confidence intervals). [Figure 2B] Inclusion of UNC13A cryptic exons in human TDP-43 proteinopathies. The UNC13A cryptic exon is detected in nearly 50% of frontal and temporal cortex tissues from neuropathologically confirmed FTLD-TDP patients in the NYGC ALS Consortium cohort. The cryptic exon is also notably absent from healthy controls, FTLD-FUS, FTLD-TAU, and ALS-SOD1 patient tissues. [Figure 2C] Inclusion of UNC13A cryptic exons in human TDP-43 proteinopathies. UNC13A cryptic exon signals positively correlate with phosphorylated TDP-43 levels in the frontal cortex of FTLD-TDP patients from the Mayo Clinic Brain Bank (Spearman's ρ=0.572, p-value<0.0001). Data points are colored according to patient-reported genetic mutations. [Figure 2D] Inclusion of UNC13A cryptic exons in human TDP-43 proteinopathies. Spearman correlation between UNC13A cryptic exon signals and phosphorylated TDP-43 levels. Rows colored in green indicate correlations within each gene mutation group. Rows colored in blue indicate correlations within each disease group. [Diagram 3] UNC13A cryptic splicing is a pathological feature of human brain associated with loss of TDP-43 in the nucleus. A: BaseScope™ in situ hybridization and immunofluorescence were performed on sections from the medial frontal pole. Representative images show the presence of UNC13A cryptic exons (arrowheads) in neurons showing depletion of nuclear TDP-43. Neurons with normal nuclear TDP-43 in patients and controls do not show the cryptic exon (arrow). B: Representative images showing expression of UNC13A mRNA in layer 2-3 neurons from the medial frontal pole. UNC13A mRNA was visualized using BaseScope™ in situ hybridization combined with immunofluorescence for TDP-43 and NeuN using a probe targeting the canonical exon 20 / 21 junction. UNC13A mRNA expression is restricted to neurons (arrows). Images are maximum intensity projections of confocal image Z-stacks. Scale bar corresponds to 10 μm. [Figure 4A] Risk haplotypes associated with ALS / FTD susceptibility enhance inclusion of cryptic exons when TDP-43 is dysfunctional. LocusZoom plot showing the ALS / FTD-associated SNP, rs12608932, in UNC13A. The most significant GWAS hit was selected as the baseline. Other SNPs are colored based on their level of binding equilibrium with rs12608932 in the EUR population. Two SNPs (black triangles) in intron 20-21, rs12608932 and rs12973192, are in strong linkage disequilibrium. [Figure 4B] Risk haplotypes associated with ALS / FTD susceptibility enhance inclusion of cryptic exons when TDP-43 is dysfunctional: UNC13A splice variants have a higher inclusion of the risk allele (G) at rs12973192 (two-tailed paired t-test, **P=0.0094). [Figure 4C]The risk haplotype associated with ALS / FTD susceptibility enhances the inclusion of cryptic exons when TDP-43 is dysfunctional. Both simple linear regression model (Figure 4C) and multiple regression model (Figure 4D) show a strong correlation between the abundance of UNC13A cryptic exons and the number of risk alleles. The normality of the residuals is tested by the Shapiro-Wilk normality test (p-value = 0.2604). [Figure 4D] Risk haplotypes associated with ALS / FTD susceptibility enhance the inclusion of cryptic exons when TDP-43 is dysfunctional. Both simple linear regression models (Figure 4C) and multiple regression models (Figure 4D) show a strong correlation between the abundance of UNC13A cryptic exons and the number of risk alleles. Normality of the residuals is tested by the Shapiro-Wilk normality test (p-value = 0.2604). Tabulated results of multiple regression analysis using the number of risk alleles of rs12973192, TDP-43 phosphorylation level, sex, and reported genetic variants as predictor variables. Rows colored with the same color indicate factors within the same variable. Normality of the residuals is tested by the Shapiro-Wilk normality test (p-value = 0.1751). [Figure 4E] Risk haplotypes associated with ALS / FTD susceptibility enhance inclusion of cryptic exons when TDP-43 is dysfunctional. Diagram of the location of rs56041637 relative to the two known GWAS hits and UNC13A cryptic exons. [Figure 4F] Risk haplotypes associated with ALS / FTD susceptibility enhance the inclusion of cryptic exons when TDP-43 is dysfunctional. UNC13A cryptic exon minigene reporter construct design and location of primer pairs used for RT-PCR. Transcription of GFP and mCherry is controlled by bidirectional promoters (blue). Black triangles represent the location of genetic mutations, as shown in (E). [Figure 4G]Risk haplotypes associated with ALS / FTD susceptibility enhance the inclusion of cryptic exons when TDP-43 is dysfunctional. Splicing of the minigenes was assessed in WT and TDP-43- / - HEK293T cells. HEK293T cells do not endogenously express UNC13A. The PCR products represented by each band are marked on the left side of each gel. In addition to the inclusion of the cryptic exon (b), some splice variants contain a longer version of the cryptic exon (c) (Figure 5) or a complete intron upstream of the cryptic exon (d). The risk allele-containing minigenes showed a near-complete loss of the canonical splicing product (a) and an increase in alternative splicing products. [Figure 4H] Risk haplotypes associated with ALS / FTD susceptibility enhance the inclusion of cryptic exons when TDP-43 is dysfunctional. In HeLa cells expressing different UNC13A minigene reporters, depletion of TDP-43 by siRNA (and cycloheximide (CHX) treatment) led to the inclusion of cryptic exons, which could be restored by overexpressing TDP-43 protein (GFP-TDP-43), but not by an RNA-binding-deficient mutant TDP-43 (GFP-TDP-43-5FL). [Figure 4I] Risk haplotypes associated with ALS / FTD susceptibility enhance the inclusion of cryptic exons when TDP-43 is dysfunctional. Survival curves of FTLD-TDP patients stratified according to the number of risk haplotypes (0, 1, or 2) they carry. Patients with heterozygous and homozygous risk haplotypes had shorter survival times after disease onset (n=205, Mayo Clinic Brain Bank) (score (log-rank) test, p-value=0.01). Dashed lines indicate median survival for each genotype. The effect of risk haplotypes is modeled as an additive model using Cox multivariate analysis adjusted for gene mutation, sex, and age at onset. Risk table is shown at the bottom. Summary results of the analysis are shown in Figure 15A. [Figure 4J]Risk haplotypes associated with ALS / FTD susceptibility enhance inclusion of cryptic exons when TDP-43 is dysfunctional. A model showing how UNC13A protein expression levels are most markedly reduced in patients who carry the UNC13A risk haplotype and exhibit TDP-43 pathology. [Diagram 5] Splicing analysis using MAJIQ shows the inclusion of a cryptic exon between exon 20 and exon 21 of UNC13A. A and B: TDP-43 depletion introduces two alternative 3' splicing acceptors in intron 20-21: one at chr19:17642591 (ΔΨ=0.05184) and the other at chr19:17642541 (ΔΨ=0.48865). C and D: An alternative 5' splicing donor is also introduced at chr19:17642414 (ΔΨ=0.772). A much higher usage of the 3' splice acceptor at chr19:17642541 was observed (B), so the focus was on the 128 bp cryptic exon (C) defined by this 3' splice acceptor and an alternative 5' splice donor. A and C are splice graphs showing the inclusion of the cryptic exon (CE) between exon 20 and exon 21 of UNC13A. B and D are violin plots corresponding to A and C, respectively. Each violin in (B and D) represents the posterior probability distribution of the expected relative inclusion (PSI or Ψ) of the color-matching junction in the splice graph. The tails of each violin represent the 10th and 90th percentiles. The boxes represent the interquartile range and the middle line indicates the median. The open circle marks the expected PSI (E[Ψ]). The change in the relative inclusion level of each junction between the two conditions is referred to as ΔΨ or ΔPSI ( 12 ). [Figure 6A]Intron 20-21 of UNC13A is conserved in most primates. The Primates Multiz Alignment & Conservation track of the UCSC (39) genome browser (http: / / genome.ucsc.edu) includes 20 mammals, of which 17 are primates. Exon 20 and exon 21 of UNC13A are well conserved among mammals. However, intron 20-21 (Figure 6B), the cryptic exon (Figure 6C), and the splicing acceptor site upstream of the cryptic exon (Figure 6C) and the splicing donor site downstream of the cryptic exon (Figure 6D) are only conserved in primates. [Figure 6B] Intron 20-21 of UNC13A is conserved in most primates. The Primates Multiz Alignment & Conservation track of the UCSC (39) genome browser (http: / / genome.ucsc.edu) includes 20 mammals, of which 17 are primates. Exon 20 and exon 21 of UNC13A are well conserved among mammals. However, intron 20-21 (Figure 6B), the cryptic exon (Figure 6C), and the splicing acceptor site upstream of the cryptic exon (Figure 6C) and the splicing donor site downstream of the cryptic exon (Figure 6D) are only conserved in primates. [Figure 6C] Intron 20-21 of UNC13A is conserved in most primates. The Primates Multiz Alignment & Conservation track of the UCSC (39) genome browser (http: / / genome.ucsc.edu) includes 20 mammals, of which 17 are primates. Exon 20 and exon 21 of UNC13A are well conserved among mammals. However, intron 20-21 (Figure 6B), the cryptic exon (Figure 6C), and the splicing acceptor site upstream of the cryptic exon (Figure 6C) and the splicing donor site downstream of the cryptic exon (Figure 6D) are only conserved in primates. [Figure 6D]Intron 20-21 of UNC13A is conserved in most primates. The Primates Multiz Alignment & Conservation track of the UCSC (39) genome browser (http: / / genome.ucsc.edu) includes 20 mammals, of which 17 are primates. Exon 20 and exon 21 of UNC13A are well conserved among mammals. However, intron 20-21 (Figure 6B), the cryptic exon (Figure 6C), and the splicing acceptor site upstream of the cryptic exon (Figure 6C) and the splicing donor site downstream of the cryptic exon (Figure 6D) are only conserved in primates. [Figure 7A] Depletion of TDP-43 in induced motor neurons (iMNs) leads to the inclusion of a cryptic exon in UNC13A. RT-PCR confirmed the expression of the cryptic exon-containing UNC13A mRNA isoform upon TDP-43 depletion in three independent iMNs (four independent cell culture experiments for each iMN and condition). In addition to the splice variant containing the cryptic exon, we detected the inclusion of a longer version of the cryptic exon (Figure 5A) and a complete intron upstream of the cryptic exon (Figure 4G). The PCR products represented by each band are marked on the left side of each gel. The positions of the PCR primer pairs used are indicated at the top of each gel image. [Figure 7B] Depletion of TDP-43 in induced motor neurons (iMNs) leads to inclusion of a cryptic exon in UNC13A. PCR primer pairs spanning the cryptic exon and exon 21 junction confirm that inclusion of the cryptic exon occurs only upon TDP-43 knockdown. [Figure 8]Total UNC13A transcripts are not significantly altered in the frontal cortex of most FTLD-TDP patients from the Mayo Clinic Brain Bank. A decrease in total UNC13A transcripts was observed in FTD patients with no reported gene mutations and in FTD patients with GRN mutations. This may be due to a currently unknown specific pathology. qRT-PCR primer pairs used for detection are shown at the top. qRT-PCR was normalized using GAPDH and RPLP0 (two-tailed Mann-Whitney test, ns: P>0.05; **P<0.01; ****P<0.0001; error bars represent 95% confidence intervals). [Figure 9] UNC13A cryptic exons can also be detected in disease-related tissues of ALS / FTLD, ALS-TDP, and ALS / AD patients. The diagnosis of these patients has not been confirmed neuropathologically. Therefore, it is unclear whether TDP-43 localization abnormalities are present in these patients. ALS patients were classified based on whether they carried SOD1 mutations (ALS-SOD1 vs. ALS-TDP). ALS-AD refers to ALS patients suspected of having Alzheimer's disease. ALS-FTLD refers to patients suffering from FTD and ALS simultaneously. [Figure 10A] UNC13A cryptic exon signals and total UNC13A signals correlate with phosphorylated TDP-43 levels in the frontal cortex of FTLD-TDP patients from the Mayo Clinic Brain Bank. UNC13A cryptic exon signals correlate positively with phosphorylated TDP-43 levels in the frontal cortex of FTLD-TDP patients from the Mayo Clinic Brain Bank (Spearman's ρ=0.572, p-value<0.0001). Data points are colored according to the patient's disease type. [Figure 10B] UNC13A cryptic exon signal and total UNC13A signal correlate with phosphorylated TDP-43 levels in the frontal cortex of FTLD-TDP patients from the Mayo Clinic Brain Bank. Total UNC13A signal negatively correlates with phosphorylated TDP-43 levels in the same samples. Data points are colored according to the genetic mutation (Figure 10B) and disease type (Figure 10C) for which the patient was reported, respectively. [Figure 10C] UNC13A cryptic exon signal and total UNC13A signal correlate with phosphorylated TDP-43 levels in the frontal cortex of FTLD-TDP patients from the Mayo Clinic Brain Bank. Total UNC13A signal negatively correlates with phosphorylated TDP-43 levels in the same samples. Data points are colored according to the genetic mutation (Figure 10B) and disease type (Figure 10C) for which the patient was reported, respectively. [Figure 10D] UNC13A cryptic exon signals and total UNC13A signals correlate with phosphorylated TDP-43 levels in the frontal cortex of FTLD-TDP patients from the Mayo Clinic Brain Bank. Spearman correlation between total UNC13A signals and phosphorylated TDP-43 levels. Rows colored in green indicate correlations within each gene mutation group. Rows colored in blue indicate correlations within each disease group. [Figure 10E] UNC13A cryptic exon signals and total UNC13A signals correlate with phosphorylated TDP-43 levels in the frontal cortex of FTLD-TDP patients from the Mayo Clinic Brain Bank. Scatter plot using raw data as input. Cryptic exon signals vs. phosphorylated TDP-43 levels. [Figure 10F] UNC13A cryptic exon signals and total UNC13A signals correlate with phosphorylated TDP-43 levels in the frontal cortex of FTLD-TDP patients from the Mayo Clinic Brain Bank. Scatter plot using raw data as input. Cryptic exon signals vs. phosphorylated TDP-43 levels. [Figure 10G] UNC13A cryptic exon signal and total UNC13A signal correlate with phosphorylated TDP-43 levels in the frontal cortex of FTLD-TDP patients from the Mayo Clinic Brain Bank. Scatter plots using untransformed data as input. Total UNC13A signal versus phosphorylated TDP-42 levels. qRT-PCR primer pairs are indicated at the top of each panel. [Figure 10H]UNC13A cryptic exon signal and total UNC13A signal correlate with phosphorylated TDP-43 levels in the frontal cortex of FTLD-TDP patients from the Mayo Clinic Brain Bank. Scatter plots using untransformed data as input. Total UNC13A signal versus phosphorylated TDP-42 levels. qRT-PCR primer pairs are indicated at the top of each panel. [Figure 11A] Cryptic splicing of UNC13A is associated with loss of nuclear TDP-43 in the human brain. Design of the UNC13Ae20 / CE BaseScope™ probe to target alternatively spliced ​​UNC13A transcripts. [Figure 11B] Cryptic splicing of UNC13A is associated with loss of nuclear TDP-43 in human brain. Design of UNC13Ae20 / e21 BaseScope™ probes to target the canonical UNC13A transcript. Each "Z" binds to the transcript independently. Both "Z"s must be in close proximity for successful signal amplification and to ensure binding specificity. [Figure 11C] Cryptic splicing of UNC13A is associated with loss of nuclear TDP-43 in the human brain. BaseScope™ in situ hybridization and immunofluorescence were performed on sections from the medial frontal pole. Representative images show the presence of the UNC13A cryptic exon (arrowhead) in neurons showing nuclear TDP-43 depletion and cytoplasmic aggregation. Patient and control neurons with normal nuclear TDP-43 do not show the cryptic exon (arrow). [Figure 11D]Cryptic splicing of UNC13A is associated with loss of nuclear TDP-43 in the human brain. Representative images showing expression of UNC13A mRNA in layer 2-3 neurons from the medial frontal pole. UNC13A mRNA was visualized using BaseScope in situ hybridization combined with immunofluorescence for TDP-43 and NeuN using a probe targeting the exon 20 / 21 junction. UNC13A mRNA expression is restricted to neurons (arrows). Images are maximum intensity projections of confocal image Z-stacks. Scale bar corresponds to 10 μm. [Figure 11E] Cryptic splicing of UNC13A is associated with loss of nuclear TDP-43 in the human brain. Six non-overlapping Z-stack images of layers 2-3 of the medial frontal pole were captured per subject using a 63X oil objective and flattened to a maximum intensity projection image. Counts of points per image were obtained using the "Analyze Particles" plugin in ImageJ. Each data point represents the number of cryptic exon points of UNC13A in a single image. Cryptic exon abundance differs between patients but is always above the technical background of the assay, as observed in controls. Data are presented as mean + / - standard deviation. [Figure 12A] The inclusion level of cryptic exons is influenced by the genotype of rs12973192. Visualization of RNA-seq alignment between exon 20 and exon 21 of UNC13A RNA-seq libraries were generated from TDP-43-negative neuronal nuclei as described in Figure 1A . [Figure 12B] The level of cryptic exon inclusion is influenced by the genotype of rs12973192. Samples that are heterozygous (C / G) or homozygous (G / G) at rs12973192 have a higher relative inclusion (Ψ) of cryptic exons, except for SRR8571945. [Figure 12C]The level of cryptic exon inclusion is influenced by rs12973192 genotype. Proportion of C and G alleles of UNC13A splice variants in TDP-43-depleted iMN and SRR8571950 neuronal nuclei. To test whether the observed percentage differences were different from those expected if both alleles were equally included in the cryptic exon, an exact binomial test was performed for each replicate. [Figure 13A] UNC13A cryptic exon abundance is associated with the number of risk alleles. Simple linear regression models (Figure 13A) and multiple regression models (Figure 13B) using untransformed data show a strong correlation between UNC13A cryptic exon abundance and the number of risk alleles. [Figure 13B] UNC13A cryptic exon abundance is associated with the number of risk alleles. Simple linear regression models (Figure 13A) and multiple regression models (Figure 13B) using untransformed data show a strong correlation between UNC13A cryptic exon abundance and the number of risk alleles. Summary results of multiple regression analysis using the number of risk alleles, TDP-43 phosphorylation levels, sex, and reported genetic variants as predictor variables. Rows colored with the same color indicate factors within the same variable. [Figure 13C] The abundance of UNC13A cryptic exons is associated with the number of risk alleles. Simple linear regression models in Figures 13C and 13E and multiple regression models using transformed (Figures 13A and 13D) and untransformed (E and F) data in Figures 13D and 13F show that the abundance of total UNC13A mRNA transcripts is not significantly correlated with the number of risk alleles at rs12971392 carried by patients. This may be a result of the expression of UNC13A from neurons not affected by TDP-43 pathology, as shown in Figures 3B and 11D. The normality of the residuals was tested with the Shapiro-Wilk normality test, and the results are shown at the bottom of each panel. The qPCR primer pairs used for detection are shown at the top of each panel. [Figure 13D]The abundance of UNC13A cryptic exons is associated with the number of risk alleles. Simple linear regression models in Figures 13C and 13E and multiple regression models using transformed (Figures 13A and 13D) and untransformed (E and F) data in Figures 13D and 13F show that the abundance of total UNC13A mRNA transcripts is not significantly correlated with the number of risk alleles at rs12971392 carried by patients. This may be a result of the expression of UNC13A from neurons not affected by TDP-43 pathology, as shown in Figures 3B and 11D. The normality of the residuals was tested with the Shapiro-Wilk normality test, and the results are shown at the bottom of each panel. The qPCR primer pairs used for detection are shown at the top of each panel. [Figure 13E] The abundance of UNC13A cryptic exons is associated with the number of risk alleles. Simple linear regression models in Figures 13C and 13E and multiple regression models using transformed (Figures 13A and 13D) and untransformed (E and F) data in Figures 13D and 13F show that the abundance of total UNC13A mRNA transcripts is not significantly correlated with the number of risk alleles at rs12971392 carried by patients. This may be a result of the expression of UNC13A from neurons not affected by TDP-43 pathology, as shown in Figures 3B and 11D. The normality of the residuals was tested with the Shapiro-Wilk normality test, and the results are shown at the bottom of each panel. The qPCR primer pairs used for detection are shown at the top of each panel. [Figure 13F]The abundance of UNC13A cryptic exons is associated with the number of risk alleles. Simple linear regression models in Figures 13C and 13E and multiple regression models using transformed (Figures 13A and 13D) and untransformed (E and F) data in Figures 13D and 13F show that the abundance of total UNC13A mRNA transcripts is not significantly correlated with the number of risk alleles at rs12971392 carried by patients. This may be a result of the expression of UNC13A from neurons not affected by TDP-43 pathology, as shown in Figures 3B and 11D. The normality of the residuals was tested with the Shapiro-Wilk normality test, and the results are shown at the bottom of each panel. The qPCR primer pairs used for detection are shown at the top of each panel. [Figure 14] rs56041637 and rs62121687 are in strong linkage disequilibrium with both GWAS hits in intron 20-21 of UNC13A. Using genetic variants identified in whole genome sequencing data of 297 ALS patients of European ancestry (Answer ALS, July 2020), we searched for other genetic variants in intron 20-21 not represented in previous GWAS. All loci showing variation from the 297 patients are along the axes of the heat plot. Each tile represents the Bonferroni-corrected p-value of the chi-square test. P-values ​​less than 0.05 are shown in yellow, other values ​​in blue or grey. Blue and red blocks highlight the association of rs12608932 and rs12973192, respectively, with other genetic variants in intron 20-21. Significant associations common to both are boxed in black. Two additional SNPs, rs56041637 (with rs12608932, Bonferroni-corrected p-value < 0.0001; with rs12973192, Bonferroni-corrected p-value < 0.0001) and rs62121687 (with rs12608932, Bonferroni-corrected p-value < 0.0001; with rs12973192, Bonferroni-corrected p-value < 0.0001), were both found to be in LD. However, rs62121687 was excluded from further analysis because it was included in the GWAS with a p-value of 0.0186585 (36). [Figure 15A] UNC13A risk haplotypes reduce survival in patients with FTLD-TDP. Summary results of Cox multivariate analyses of additive models (adjusted for genetic variants, sex, and age at onset). [Figure 15B] UNC13A risk haplotypes reduce the survival time of FTLD-TDP patients. Survival curves of FTLD-TDP patients (n=205, Mayo Clinic Brain Bank) with dominant (Figure 15B) and recessive (Figure 15C) models and their corresponding risk tables. Both dominant (Figures 15B and 15C) and recessive (Figures 15D and 15E) models show that the presence of risk haplotypes can reduce the survival of FTLD-TDP patients. The dashed lines indicate the median survival of each genotype. The log-rank p-value was calculated using the score test. The green colored rows indicate factors within one variable. [Figure 15C] UNC13A risk haplotypes reduce survival of FTLD-TDP patients. Summary results of Cox multivariate analysis (adjusted for genetic variants, sex, and age at onset) for dominant (Figure 15C) and recessive (Figure 15D) models. Both dominant (Figures 15B and 15C) and recessive (Figures 15D and 15E) models show that the presence of risk haplotypes may reduce survival of FTLD-TDP patients. Dashed lines indicate median survival for each genotype. Log-rank p-values ​​were calculated using a score test. Rows colored in green indicate factors within one variable. [Figure 15D]UNC13A risk haplotypes reduce the survival of FTLD-TDP patients. Survival curves of FTLD-TDP patients (n=205, Mayo Clinic Brain Bank) with dominant (Figure 15B) and recessive (Figure 15C) models and their corresponding risk tables. Summary results of Cox multivariate analysis (adjusted for genetic variants, sex, and age at onset) of dominant (Figure 15C) and recessive (Figure 15D) models. Both dominant (Figures 15B and 15C) and recessive (Figures 15D and 15E) models show that the presence of risk haplotypes may reduce the survival of FTLD-TDP patients. The dashed lines indicate the median survival of each genotype. The log-rank p-value was calculated using the score test. The rows colored in green indicate factors within one variable. [Figure 15E] UNC13A risk haplotypes reduce the survival time of FTLD-TDP patients. Both dominant (Figures 15B and 15C) and recessive (Figures 15D and 15E) models show that the presence of risk haplotypes can reduce the survival of FTLD-TDP patients. The dashed lines indicate the median survival of each genotype. The log-rank p-value was calculated using a score test. The green colored rows indicate the factors within one variable. [Figure 16A]The impact of UNC13A risk haplotypes on survival is more prominent in C9ORF72 hexanucleotide repeat expansion carriers and GRN mutation carriers. Survival curves of FTLD-TDP patients (n=80, Mayo Clinic Brain Bank) carrying C9ORF72 or GRN mutations according to additive model (Figure 16A), dominant model (Figure 16C), and recessive model (Figure 16E), and their corresponding risk tables. Summary results of Cox multivariate analysis (adjusted for genetic mutations, sex, and age at onset) of additive model (Figure 16B), dominant model (Figure 16D), and recessive model (Figure 16F). When we only include FTLD-ALS patients with mutations associated with TDP-43 pathology, both additive model (Figures 16A and 16B) and dominant model (Figures 16C and 16D) show that the impact of risk haplotypes on survival time becomes more important. Although the survival distributions of the two groups are not significantly different (log-rank p-value=0.3), the number of risk haplotypes remains a strong prognostic factor (p-value=0.03800). The dashed lines indicate the median survival for each genotype. Log-rank p-values ​​were calculated using the score test. [Figure 16B] The effect of UNC13A risk haplotypes on survival is more pronounced in C9ORF72 hexanucleotide repeat expansion carriers and GRN mutation carriers. [Figure 16C]The impact of UNC13A risk haplotypes on survival is more prominent in C9ORF72 hexanucleotide repeat expansion carriers and GRN mutation carriers. Survival curves of FTLD-TDP patients (n=80, Mayo Clinic Brain Bank) carrying C9ORF72 or GRN mutations according to additive model (Figure 16A), dominant model (Figure 16C), and recessive model (Figure 16E), and their corresponding risk tables. Summary results of Cox multivariate analysis (adjusted for genetic mutations, sex, and age at onset) of additive model (Figure 16B), dominant model (Figure 16D), and recessive model (Figure 16F). When we only include FTLD-ALS patients with mutations associated with TDP-43 pathology, both additive model (Figures 16A and 16B) and dominant model (Figures 16C and 16D) show that the impact of risk haplotypes on survival time becomes more important. Although the survival distributions of the two groups are not significantly different (log-rank p-value=0.3), the number of risk haplotypes remains a strong prognostic factor (p-value=0.03800). The dashed lines indicate the median survival for each genotype. Log-rank p-values ​​were calculated using the score test. [Figure 16D] The effect of UNC13A risk haplotypes on survival is more pronounced in C9ORF72 hexanucleotide repeat expansion carriers and GRN mutation carriers. [Figure 16E]The impact of UNC13A risk haplotypes on survival is more prominent in C9ORF72 hexanucleotide repeat expansion carriers and GRN mutation carriers. Survival curves of FTLD-TDP patients (n=80, Mayo Clinic Brain Bank) carrying C9ORF72 or GRN mutations according to additive model (Figure 16A), dominant model (Figure 16C), and recessive model (Figure 16E), and their corresponding risk tables. Summary results of Cox multivariate analysis (adjusted for genetic mutations, sex, and age at onset) of additive model (Figure 16B), dominant model (Figure 16D), and recessive model (Figure 16F). When we only include FTLD-ALS patients with mutations associated with TDP-43 pathology, both additive model (Figures 16A and 16B) and dominant model (Figures 16C and 16D) show that the impact of risk haplotypes on survival time becomes more important. Although the survival distributions of the two groups are not significantly different (log-rank p-value=0.3), the number of risk haplotypes remains a strong prognostic factor (p-value=0.03800). The dashed lines indicate the median survival for each genotype. Log-rank p-values ​​were calculated using the score test. [Figure 16F] The effect of UNC13A risk haplotypes on survival is more pronounced in C9ORF72 hexanucleotide repeat expansion carriers and GRN mutation carriers. [Figure 17] The UNC13A genomic region including exon 20, cryptic exon #1 (128 bp), and exon 21 is shown. [Figure 18] The STMN2 exon structure of the reference transcript and the splice variant containing cryptic exon 2a (top) and exon 2a sequence (bottom) are shown. [Figure 19A] 1 shows UNC13A mRNA levels in motor neurons after treatment with UNC13A-specific 2'MOE antisense oligonucleotides as measured by qPCR. qPCR results using primers / probes specific for the inclusion of UNC13A cryptic exons are shown. [Figure 19B]1 shows UNC13A mRNA levels in motor neurons after treatment with UNC13A-specific 2'MOE antisense oligonucleotides as measured by qPCR. qPCR results using primers / probes specific for the inclusion of UNC13A cryptic exons are shown. [Figure 19C] 1 shows UNC13A mRNA levels in motor neurons after treatment with UNC13A-specific 2'MOE antisense oligonucleotides as measured by qPCR. qPCR results using primers / probes specific for reference UNC13A are shown. [Figure 19D] 1 shows UNC13A mRNA levels in motor neurons after treatment with UNC13A-specific 2'MOE antisense oligonucleotides as measured by qPCR. qPCR results using primers / probes specific for reference UNC13A are shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0023] Before describing the present disclosure in more detail, it may be helpful to an understanding thereof to provide definitions of certain terms used herein. Additional definitions are set forth throughout the disclosure.

[0024] As used herein, any concentration range, percentage range, ratio range, or integer range, unless otherwise indicated, should be understood to include any integer value within the stated range, and, where appropriate, fractions thereof (e.g., tenths and hundredths of integers) or subranges.

[0025] As used herein, the term "about" means ±20% of a given range, value, or structure, unless otherwise indicated.

[0026] As used herein, the terms "a" and "an" should be understood to refer to "one or more" of the listed components. The use of the alternatives (e.g., "or") should be understood to mean either one, both, or any combination thereof of the alternatives. As used herein, the terms "including," "having," and "comprising" are used interchangeably and this term and variations thereof are intended to be interpreted in an open-ended manner.

[0027] "Optional" or "optionally" means that the described element, component, event, or circumstance may or may not occur, and includes cases where the element, component, event, or circumstance occurs and cases where it does not occur.

[0028] As used herein, "nucleic acid" or "nucleic acid molecule" or "polynucleotide" refers to any of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), oligonucleotides, such as those produced by polymerase chain reaction (PCR) or in vitro translation, and those produced by either ligation, cleavage, endonuclease action, exonuclease action, or mechanical action (e.g., shearing). Nucleic acids can be composed of multiple monomers that are naturally occurring nucleotides (e.g., deoxyribonucleotides and ribonucleotides), analogs of naturally occurring nucleotides (e.g., alpha enantiomers of naturally occurring nucleotides), or combinations of both. Modified nucleotides can have modifications or substitutions in sugar moieties, or pyrimidine or purine base moieties (e.g., morpholino nucleotides). The nucleic acid monomers of a polynucleotide can be linked by phosphodiester bonds or analogs of such bonds. Analogs of phosphodiester bonds include phosphorothioates, phosphorodithioates, phosphoroselenoates, phosphorodiselenoates, phosphoroanilothioates, phosphoranilidates, phosphoramidates, etc. Nucleic acid molecules can be either single-stranded or double-stranded.

[0029] As used herein, "protein" or "polypeptide" refers to a compound composed of amino acid residues covalently linked by peptide bonds. The term "protein" may be synonymous with the term "polypeptide" or may further refer to a complex of two or more polypeptides. In certain embodiments, a polypeptide may be a fragment. As used herein, "fragment" refers to a polypeptide that lacks one or more amino acids found in a reference sequence. A fragment may contain a binding domain, antigen, or epitope found in the reference sequence. A fragment of a reference 5 polypeptide may have at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more amino acids of the amino acid sequence of the reference sequence.

[0030] The term "isolated" means that a material, complex, compound, or molecule is removed from its original environment (e.g., the natural environment if it occurs in nature). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide separated from some or all of the coexisting materials in the natural system is isolated. Such a nucleic acid may be part of a vector, and / or such a nucleic acid or polypeptide may be part of a composition (e.g., a cell lysate), and is still isolated in that such a vector or composition is not part of the natural environment for the nucleic acid or polypeptide. The term "gene" refers to a segment of DNA involved in the production of a polypeptide chain. It includes the regions before and after the coding region "leader and trailer" and, if present, the intervening sequences (introns) between the individual coding segments (exons).

[0031] As used herein, the term "recombinant" or "genetically engineered" refers to a cell, microorganism, nucleic acid molecule, polypeptide, or vector that has been genetically engineered with human intervention. For example, a recombinant polynucleotide refers to a cell or microorganism that has been modified with human or machine introduction of an exogenous or heterologous nucleic acid molecule, or altered with human or machine intervention such that the expression of an endogenous nucleic acid molecule or gene is directed, unregulated, or constitutive. Human-induced genetic changes can include, for example, modifications that introduce nucleic acid molecules (which may include expression control elements such as promoters) that code for one or more proteins or enzymes, or additions, deletions, substitutions, or other functional disruptions or additions of the genetic material or encoded products of a cell. Exemplary human- or machine-introduced modifications include modifications in the coding region of a heterologous or homologous polypeptide, or functional fragments thereof, from a reference or parent molecule.

[0032] A "wild-type" gene or gene product is that which is most frequently observed in a population and is thus arbitrarily designed as the "normal" or "reference" or "wild-type" form of the gene.

[0033] As used herein, "mutation" refers to a change in the sequence of a nucleic acid molecule or polypeptide molecule compared to a reference or wild-type nucleic acid molecule or polypeptide molecule, respectively. Mutations can result in several different types of changes in the sequence, including substitution, insertion, or deletion of a nucleotide(s) or amino acid(s).

[0034] "Conservative substitutions" refer to amino acid substitutions that significantly affect or change the binding characteristics of a particular protein. Generally, conservative substitutions are ones in which the substituted amino acid residue is replaced with an amino acid residue having a similar side chain. Conservative substitutions include those found in one of the following groups: Group 1: Alanine (Ala or A), Glycine (Gly or G), Serine (Ser or S), Threonine (Thr or T); Group 2: Aspartic Acid (Asp or D), Glutamic Acid (Glu or Z); Group 3: Asparagine (Asn or N), Glutamine (Gln or Q); Group 4: Arginine (Arg or R), Lysine (Lys or K), Histidine (His or H); Group 5: Isoleucine (Ile or I), Leucine (Leu or L), Methionine (Met or M), Valine (Val or V); and Group 6: Phenylalanine (Phe or F), Tyrosine (Tyr or Y), Tryptophan (Trp or W). Additionally or alternatively, amino acids can be grouped into conservative substitution groups with similar function, chemical structure, or composition (e.g., acidic, basic, aliphatic, aromatic, or sulfur-containing). For example, an aliphatic group may include, for substitution purposes, Gly, Ala, Val, Leu, and Ile. Other conservative substitution groups include: sulfur-containing: Met and cysteine ​​(Cys or C); acidic: Asp, Glu, Asn, and Gln; small aliphatic, non-polar, or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; polar, negatively charged residues and their amides: Asp, Asn, Glu, and Gln; polar, positively charged residues: His, Arg, and Lys; large aliphatic, non-polar residues: Met, Leu, Ile, Val, and Cys; and large aromatic residues: Phe, Tyr, and Trp. Additional information can be found in Creighton (1984) Proteins, WH Freeman and Company.

[0035] The term "expression" as used herein refers to the process by which a polypeptide is produced based on a coding sequence of a nucleic acid molecule such as a gene. The process may include transcription, post-transcriptional regulation, post-transcriptional modification, translation, post-translational regulation, post-translational modification, or any combination thereof.

[0036] As used herein, "sequence identity" refers to the percentage of nucleotides (amino acid residues) in one sequence that are identical to nucleotides (amino acid residues) in another reference polynucleotide (polypeptide) sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and does not consider conservative substitutions as part of the sequence identity. Sequence identity values ​​(%) can be generated using the NCBI BLAST 2.0 software as defined in Altschul et al. (1997) "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25: 3389-3402 (parameters set to default values).

[0037] As used herein, "UNC13A" refers to a presynaptic protein found in central and neuromuscular synapses that regulates the release of neurotransmitters, peptides, and hormones. The UNC13A reference or wild-type mRNA transcript contains 44 exons that code for a 1,703 amino acid protein. In an embodiment, the NCBI reference sequence: NP_001073890.2 (SEQ ID NO: 11) is an example of a wild-type or reference UNC13A protein. In an embodiment, the NCBI reference sequence NM_001080421.3 (SEQ ID NO: 1) is an example of a wild-type or reference UNC13A mRNA transcript. In an embodiment, UNC13A includes all forms of UNC13A, including wild-type, splice isoforms, variants, mutants, native conformations, misfolds, and post-translational modifications. In an embodiment, UNC13A does not include UNC13A hidden exon splice variants.

[0038] As used herein, the term "preprocessed mRNA" or "pre-mRNA" or "precursor mRNA" refers to the primary transcript synthesized from transcription of a DNA template that has not been processed, e.g., spliced, 5' capped, or 3' polyA tailed, to become a mature mRNA that can be translated into a protein by ribosomes.

[0039] As used herein, the term "cryptic exon" or "pseudoexon" refers to an exon that is not present in or used in the detection of wild-type pre-mRNA but is selected in a variant isoform; cryptic exons can arise as a result of mutations that create new splice sites or remove existing binding sites for splicing repressors. Cryptic exons can also emerge from transposable elements (e.g., Alu elements).

[0040] As used herein, "UNC13A cryptic exon splice variant" refers to an mRNA, or a protein encoded by said mRNA, that includes a cryptic exon between exon 20 and exon 21. The cryptic exon is taken from intron 20-21 of the UNC13A gene. In embodiments, the cryptic exon has the nucleotide sequence of SEQ ID NO:5 or SEQ ID NO:6. In embodiments, the UNC13A cryptic exon splice variant may have the nucleotide sequence of SEQ ID NO:7, which encodes the protein sequence of SEQ ID NO:8, or the nucleotide sequence of SEQ ID NO:9, which encodes the protein sequence of SEQ ID NO:10.

[0041] As used herein, "transcription activation response element DNA binding protein 43" or "TAR-DNA binding protein 43" or "TDP-43" generally refers to a 414 amino acid residue protein encoded by TARDBP. In embodiments, the wild-type TDP43 amino acid sequence is provided in Uniprot Accession No. Q13148 (SEQ ID NO: 378). In embodiments, TDP43 includes all forms of TDP-43, including wild-type, splice isoforms, variants, mutants, native conformations, misfolded, and post-translationally modified (e.g., ubiquitinated, phosphorylated, acetylated, sumoylated, or cleaved to C-terminal fragments) proteins.

[0042] As used herein, "TAR-DNA binding protein 43 proteinopathy" or "TDP-43 proteinopathy" refers to a neurodegenerative disease characterized by the deposition of TDP-43-positive protein inclusions in the brain and / or spinal cord of a subject. Cytoplasmic inclusions of hyperphosphorylated, ubiquitinated, and truncated TDP-43 are pathological hallmarks of diseases including, but not limited to, amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), facial onset sensorimotor neuropathy (FOSMN), hippocampal sclerosis (HS), limbic-predominant age-related TDP-43 encephalopathy (LATE), cerebral age-related TDP-43 encephalopathy with sclerosis (CARTS), Guam Parkinson-Dementia Complex (G-PDC), Guan ALS (G-ALS), multisystem proteinopathy (MSP), Perry disease, Alzheimer's disease (AD), and chronic traumatic encephalopathy (CTE).

[0043] The terms "complementary" and "complementarity" refer to polynucleotides (i.e., sequences of nucleotides) associated with base pairing rules. For example, the sequence "AGT" is complementary to the sequence "TCA". Complementarity can be "partial", where only some of the nucleic acid bases match according to the base pairing rules, or there can be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands greatly affects the efficiency and strength of hybridization between nucleic acid strands. While complete complementarity is often desired, some embodiments may include one or more, preferably 6, 5, 4, 3, 2, or 1 mismatches with respect to the target nucleic acid (e.g., RNA). Variations at any position within the oligomer are included. In certain embodiments, sequence variations near the ends of the oligomer are generally preferred over internal variations, and when present, are usually within about 6, 5, 4, 3, 2, or 1 nucleotide of the 5' and / or 3' ends.

[0044] The terms "antisense oligomer" or "antisense compound" or "antisense oligonucleotide" or "oligonucleotide" are used interchangeably and refer to short, single-stranded polynucleotides (e.g., 10-50 subunits) composed of DNA, RNA, or both, which hybridize to a target sequence of nucleic acid (usually RNA) by Watson-Crick base pairing to form a nucleic acid:oligomer heteroduplex within the target sequence. Antisense oligonucleotides may contain unmodified nucleotides or may contain modified, non-natural, or analog nucleotides, such as morpholinos, phosphorothioates, peptide nucleic acids, LNA, 2'-O-Me RNA, 2'F-RNA, 2'-O-MOE-RNA, 2'F-ANA, or any combination thereof.

[0045] Such antisense oligomers can be designed to block or inhibit translation of an mRNA, or inhibit natural pre-mRNA splice processing, or induce degradation of a target mRNA, and may be said to be "directed at" or "targeted to" the target sequence to which they hybridize. In embodiments, the target sequence is a region surrounding or including the AUG start codon of the mRNA, a 3' or 5' splice site of the preprocessed mRNA, or a branch point. The target sequence may be within an exon, or within an intron, or a combination thereof. A splice site target sequence may include an mRNA sequence having its 5' end 1 to about 25 base pairs downstream of the normal splice acceptor junction of the preprocessed mRNA. Exemplary target sequences for splice sites are any region of the preprocessed mRNA that includes the splice site, or is entirely contained within an exon coding sequence, or spans a splice acceptor or donor site. More generally, an oligomer is said in the present disclosure to be "targeted to" a biologically relevant target, such as the human UNC13A gene pre-mRNA encoding the UNC13A protein, when the oligomer is targeted to the target nucleic acid in the manner described above. Exemplary targeting sequences include those listed in Tables 2-5.

[0046] The term "oligonucleotide analog" refers to an oligonucleotide having: (i) a modified backbone structure, e.g., a backbone other than the standard phosphodiester linkages found in natural oligo- and polynucleotides; and (ii) optionally, a modified sugar moiety, e.g., a morpholino moiety other than a ribose or deoxyribose moiety. Oligonucleotide analogs support bases that can hydrogen bond to standard polynucleotide bases by Watson-Crick base pairing, and the analog backbone presents the bases in a manner that allows such hydrogen bonding in a sequence-specific manner between the bases of the oligonucleotide analog molecule and the standard polynucleotide (e.g., single-stranded RNA or single-stranded DNA). Exemplary analogs are those that have a substantially uncharged, phosphorus-containing backbone.

[0047] An oligonucleotide "subunit" refers to one nucleotide (or nucleotide analog) unit that contains a purine or pyrimidine base-pairing moiety. The term may refer to a nucleotide unit with or without an associated intersubunit bond, but when referring to a "charged subunit," the charge is usually present in the intersubunit bond (e.g., a phosphate or phosphorothioate bond, or a cationic bond).

[0048] The purine or pyrimidine base pairing moiety, also referred to herein simply as "nucleobase", "base" or "base", may be adenine, cytosine, guanine, uracil, thymine, or inosine. Bases such as pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trimethyl-115-methoxybenzene, 3-methyluracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidine (e.g., 5-methylcytidine), 5-alkyluridine (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidine or 6-alkylpyrimidine (e.g., 6-methyluridine), propyne, quesosine, 2-thiouridine, 4-thiouridine, wybutosine, wybutoxosine, 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 5'-carboxymethyl These include aminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, β-D-galactosyl cuosine, 1-methyladenosine, 1-methylinosine, 2,2-dimethylguanosine, 3-methylcytidine, 2-methyladenosine, 2-methylguanosine, N6-methyladenosine, 7-methylguanosine, 5-methoxyaminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylcarbonylmethyluridine, 5-methyloxyuridine, 5-methyl-2-thiouridine, 2-methylthio-N6-isopentenyladenosine, β-D-mannosyl cuosine, uridine-5-oxyacetic acid, 2-thiocytidine, and threonine derivatives (Burgin et al., 1996, Biochemistry, 35:14090; Uhlman & Peyman, supra). "Modified base" in this embodiment refers to a nucleotide base other than adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) as shown above; such bases can be used at any position in the antisense molecule. Those skilled in the art will understand that T and U can be interchangeable depending on the application of the oligomer. For example, in the case of other antisense chemistries, such as 2'-O-methyl antisense oligonucleotides, which are more RNA-like, the T base can be shown as U.

[0049] The term "targeting sequence" refers to a sequence of an oligomer or oligomer analog that is complementary (further meaning substantially complementary) to a "target sequence" in an RNA genome. The entire sequence of an antisense oligomer or only a portion of the sequence may be complementary to the target sequence. For example, in an oligomer having 20-30 bases, about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 may be a targeting sequence that is complementary to the target region. Typically, a targeting sequence is formed from consecutive bases of an oligomer, but may instead be formed from non-contiguous sequences that, when placed together, for example, from opposite ends of the oligomer, constitute a sequence that spans the target sequence.

[0050] A "targeting sequence" can have "near" or "substantial" complementarity to a target sequence and still function for the purposes of this disclosure, i.e., still be "complementary".Preferably, the oligomer analog compound used in this disclosure has at most one mismatch with the target sequence in 10 nucleotides, preferably at most one mismatch in 20 nucleotides.Alternatively, the antisense oligomer used has at least 90% sequence identity, preferably at least 95% sequence identity, with the exemplary targeting sequence specified herein.

[0051] An "amino acid subunit" or "amino acid residue" refers to an α-amino acid residue (-CO-CHR-NH-) or a β- or other amino acid residue (e.g., -CO-(CH2) nCHR-NH-), where R is a side chain (which may include hydrogen) and n is 1-7, preferably 1-4. The term "natural amino acid" refers to amino acids present in proteins found in nature, such as the 20 (L)-amino acids utilized during protein biosynthesis, as well as other amino acids such as 4-hydroxyproline, hydroxylysine, desmosine, isodesmosine, homocysteine, citrulline, and ornithine. The term "unnatural amino acid" refers to amino acids not present in proteins found in nature, examples of which include beta-alanine (β-Ala), 6-aminohexanoic acid (Ahx), and 6-aminopentanoic acid. Further examples of "unnatural amino acids" include, but are not limited to, the (D)-amino acids known to those of skill in the art, norleucine, norvaline, p-fluorophenylalanine, ethionine, and the like.

[0052] The term "target sequence" refers to the portion of a target RNA to which an oligonucleotide or antisense drug is directed, i.e., the sequence to which the oligonucleotide hybridizes by Watson-Crick base pairing of complementary sequences. In embodiments, the target sequence may be a contiguous region of a pre-mRNA that contains both intronic and exonic target sequences. In embodiments, the target sequence consists of either exclusively intronic or exclusively exonic sequences.

[0053] When hybridization occurs in an antiparallel configuration, the target sequence and the targeting sequence are described as being "complementary" to each other. The targeting sequence can have "near" or "substantial" complementarity with the target sequence and still function for the purposes of this disclosure, i.e., still be functionally "complementary". In certain embodiments, the oligonucleotide can have at most one mismatch with the target sequence in 10 nucleotides, and preferably at most one mismatch in 20 nucleotides. Alternatively, the oligonucleotide can have at least 90% sequence identity, preferably at least 95% sequence identity, with the exemplary antisense targeting sequences described herein.

[0054] An oligonucleotide "specifically hybridizes" to a target polynucleotide if the oligomer hybridizes to the target under physiological conditions substantially above 45°C, preferably at least 50°C, usually 60°C to 80°C or higher. Such hybridization preferably corresponds to stringent hybridization conditions. At a given ionic strength and pH, Tm is the temperature at which 50% of the target sequence hybridizes to a complementary polynucleotide. Again, such hybridization can occur with "near" or "substantial" complementarity of the antisense oligomer to the target sequence, as well as exact complementarity.

[0055] A "nuclease resistant" oligomeric molecule (oligomer) refers to one whose backbone is substantially resistant to nuclease cleavage in either the unhybridized or hybridized form, and which exhibits little or no nuclease cleavage by common extracellular and intracellular nucleases in the body, i.e., under normal nuclease conditions in the body to which the oligomer is exposed.

[0056] "Effective amount" or "therapeutically effective amount" refers to the amount of therapeutic agent, such as UNC13A cryptic splice variant inhibitor, administered to a mammalian subject, either as a single dose or as part of a series of doses that is effective to produce a desired therapeutic effect.In the case of antisense oligonucleotides, this effect is usually brought about by inhibiting the translation or natural splice processing of the selected target sequence.The "effective amount" of targeting UNC13A cryptic exon splice variant mRNA also relates to the amount that is effective to regulate the expression of UNC13A cryptic exon splice variant protein.

[0057] The term "inhibit" or "inhibitor" refers to a direct or indirect alteration, interference, reduction, downregulation, blocking, suppression, elimination, or degradation in the expression, amount, or activity of a target gene, target protein, or signaling relative to (1) a control, endogenous, or reference target or pathway, or (2) the absence of the target or pathway, where the alteration, interference, reduction, downregulation, blocking, suppression, elimination, or degradation is statistically, biologically, or clinically significant. The term "inhibit" or "inhibitor" includes gene "knockout" and gene "knockdown" methods, e.g., by chromosome editing.

[0058] For example, an "UNC13A cryptic exon splice variant inhibitor" may block, inactivate, reduce, or minimize the activity of an UNC13A cryptic exon splice variant, or reduce the expression of an UNC13A cryptic exon splice variant or promote its degradation, thereby reducing the activity by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more compared to an untreated UNC13A cryptic exon splice variant. "Treatment" of an individual or cell is any type of intervention provided as a means of altering the natural course of a disease or condition of an individual or cell. Treatment includes, but is not limited to, administration of, for example, a pharmaceutical composition, and may be performed either prophylactically or after initiation of a pathological event or contact with a pathogen. Treatment includes, inter alia, any desired effect on the symptoms or pathology of an inflammation-related disease or condition described herein.

[0059] Also included is "prophylactic" treatment, which may be aimed at reducing the rate of progression of the disease or condition being treated, delaying the onset of the disease or condition, or reducing the severity of its onset. "Treatment" or "prophylaxis" does not necessarily indicate a complete eradication, cure, or prevention of the disease or condition, or symptoms associated therewith. Additional definitions are provided in the following sections.

[0060] UNC13A cryptic exon splice variant In one aspect, the present disclosure provides novel UNC13A cryptic splice variants that contain cryptic exons between exons 20 and 21. These cryptic exons are absent in wild-type UNC13A from neuronal nuclei and are absent in any of the known isoforms of UNC13A. The cryptic exons are derived from intron 20-21 of the UNC13A gene (SEQ ID NO: 4). Depletion of TDP-43 results in two alternative 3' splicing acceptors in intron 20-21. One is at chr19:17642591 (ΔΨ=0.05184) and the other is at chr19:17642541 (ΔΨ=0.48865). An alternative 5' splicing donor is also provided at chr19:17642414 (ΔΨ=0.772). The 3' splice acceptor at chr19:17642541, which is more frequently used than the 3' splice acceptor at chr19:17642591, and the alternative 5' splice donor result in a 128 bp cryptic exon ("cryptic exon #1") having the nucleotide sequence set forth in SEQ ID NO:5. The UNC13A cryptic exon #1 variant comprises the nucleotide sequence set forth in SEQ ID NO:7, which encodes a protein comprising the amino acid sequence set forth in SEQ ID NO:8. The 3' splice acceptor at chr19:17642591 and the alternative 5' splice donor result in a 179 bp cryptic exon ("cryptic exon #2") having the nucleotide sequence set forth in SEQ ID NO:6. The UNC13A cryptic exon #2 variant comprises the nucleotide sequence set forth in SEQ ID NO:9, which encodes a protein comprising the amino acid sequence set forth in SEQ ID NO:10.

[0061] The expression level of UNC13A hidden exon #1 splice variant is significantly increased in the frontal cortex of patients with frontotemporal lobar degeneration with TDP-43 inclusions (FTLD-TDP) compared to normal controls. UNC13A hidden exon #1 splice variant has also been detected in disease-related tissues of ALS patients. In embodiments, the expression of UNC13A hidden splice variant #1 or UNC13A hidden splice variant #2 can be used as a biomarker to identify subjects suffering from TDP-43 proteinopathy, such as FTLD or ALS.

[0062] When TDP-43 is depleted from the nucleus and accumulates in the cytoplasm, it is phosphorylated. Hyperphosphorylated TDP43 (pTDP-43) is a key feature of the pathology of TDP-43 proteinopathy. UNC13A hidden exon #1 splice variant is strongly associated with phosphorylated TDP-43 levels in FTD / ALS patients. In embodiments, the expression of UNC13A hidden splice variant #1 or UNC13A hidden splice variant #2 can be used as a biomarker of phosphorylated TDP-43 levels in subjects.

[0063] Several genetic mutations in intron 20-21 of UNC13A have been identified that promote the inclusion of UNC13A cryptic exons upon TDP-43 depletion. Examples of such genetic mutations include rs12608932 (hg38 chr19:17.641,880 A → C), rs12973192 (hg38 chr19:17,642,430 C → G), rs56041637 (hg38 chr19:17,642,033-17,642,056 CATC 0-2 repeats → 3-5 CATC repeats), and rs62121687 (hg38 chr19:17,642,351 C → A). Furthermore, UNC13A genetic mutations that increase the inclusion of cryptic exons are associated with reduced survival in FTD-ALS patients. In embodiments, identification of UNC13A intron 20-21 genetic mutations in a subject can be used as a biomarker for the inclusion of hidden exons in UNC13A. In embodiments, identification of UNC13A intron 20-21 genetic mutations in a subject with TDP-43 proteinopathy (e.g., FTD, ALS) can be used as a biomarker for reduced survival. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8]

Table 1-9

Table 1-10

Table 1-11

Table 1-12

Table 1-13

Table 1-14

Table 1-15

Table 1-16

Table 1-17

Table 1-18

Table 1-19

Table 1-20

Table 1-21

Table 1-22

Table 1-23

Table 1-24

Table 1-25

[0064] UNC13A cryptic exon splice variant-specific inhibitor The present disclosure provides UNC13A cryptic exon splice variant specific inhibitors that can be used in the research and treatment methods described herein. In embodiments, the UNC13A cryptic exon splice variant specific inhibitors selectively bind to or reduce or inhibit the expression or activity of UNC13A cryptic exon splice variants across full length UNC13A or other variants thereof (i.e., variants that do not contain the cryptic exon from intron 20-21, such as SEQ ID NO:5 or SEQ ID NO:6). In embodiments, the UNC13A cryptic exon splice variant specific inhibitors selectively bind to or reduce or inhibit the activity of UNC13A cryptic exon splice variant #1, UNC13A cryptic exon splice variant #2, or both UNC13A cryptic exon splice variant #1 and UNC13A cryptic exon splice variant #2 across full length UNC13A or other variants thereof. In embodiments, UNC13A cryptic exon splice variant specific inhibitors specifically target intron 20-21, or a peptide region encoded therefrom, such as the cryptic exons of SEQ ID NO: 5 or SEQ ID NO: 6. In embodiments, UNC13A cryptic exon splice variant specific inhibitors exhibit no more than about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5% of the activity of full length UNC13A or a variant that does not contain the cryptic exon of intron 20-21, compared to a cryptic exon splice variant of UNC13A.

[0065] UNC13A cryptic exon splice variant-specific inhibitors include, but are not limited to, inhibitory nucleic acids (eg, RNA interference agents, antisense oligonucleotides), peptides, antibodies, binding proteins, small molecules, ribozymes, and aptamers.

[0066] In an embodiment, UNC13A hidden exon splice variant specific inhibitor comprises a small molecule.Small molecule is a compound with mass less than 2000 Dalton.The molecular weight of small molecule is preferably less than 1000 Dalton, more preferably less than 600 Dalton, for example, the compound is less than 500 Dalton, less than 400 Dalton, less than 300 Dalton, less than 200 Dalton, or less than 100 Dalton.

[0067] Small molecules can be organic or inorganic. Exemplary organic small molecules include, but are not limited to, aliphatic hydrocarbons, alcohols, aldehydes, ketones, organic acids, esters, mono- and disaccharides, aromatic hydrocarbons, amino acids, and lipids. Exemplary inorganic small molecules include trace minerals, ions, free radicals, and metabolites. Alternatively, small molecules can be synthetically engineered to be composed of fragments or small moieties or longer amino acid chains that fill the binding pocket of an enzyme. Typically, small molecules are less than 1 kilodalton.

[0068] In an embodiment, the UNC13A cryptic exon splice variant specific inhibitor comprises an antibody or a binding fragment thereof. The term "antibody" refers to an intact antibody comprising at least two heavy (H) chains and two light (L) chains linked together by disulfide bonds, and any antigen-binding portion or fragment of the intact antibody that has or retains the ability to bind to the antigen target molecule recognized by the intact antibody, such as scFv, Fab, or Fab'2 fragments. Thus, the term "antibody" herein is used in the broadest sense and includes polyclonal and monoclonal antibodies, such as intact antibodies and their functional (antigen-binding) antibody fragments, such as fragment antigen-binding (Fab) fragments, F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rIgG) fragments, single-chain antibody fragments, such as single-chain variable fragments (scFv), and single domain antibodies (e.g., sdAb, sdFv, nanobodies). The term encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific, such as bispecific antibodies, diabodies, triabodies, tetrabodies, tandem di-scFvs, and tandem tri-scFvs. Unless otherwise indicated, the term "antibody" should be understood to encompass functional antibody fragments thereof. The term also encompasses intact or full-length antibodies, including antibodies of any class or subclass, including IgG and its subclasses (IgG1, IgG2, IgG3, IgG4), IgM, IgE, IgA, and IgD.

[0069] Monoclonal antibodies, or antigen-binding portions thereof, may be non-human, chimeric, humanized, or human. Immunoglobulin structure and function are reviewed, for example, in Harlow et al., Eds., Antibodies: A Laboratory Manual, Chapter 14 (Cold Spring Harbor Laboratory, Cold Spring Harbor, 1988).

[0070] The terms "VL" and "VH" refer to the variable binding regions from an antibody light chain and an antibody heavy chain, respectively. The variable binding regions contain separate and distinct subregions known as "complementarity determining regions" (CDRs) and "framework regions" (FRs). The terms "complementarity determining regions" and "CDRs" are synonymous with "hypervariable regions" or "HVRs" and generally refer to amino acid sequences within an antibody variable region that together confer antigen specificity and / or binding affinity to the antibody, with consecutive CDRs (i.e., CDR1 and CDR2, CDR2 and CDR3) separated from each other in the primary amino acid sequence by framework regions. There are three CDRs in each variable region (HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3, also referred to as CDRH and CDRL, respectively). In embodiments, the antibody VH comprises four FRs and three CDRs: FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4, and the antibody VL comprises four FRs and four CDRs: FR1-LCDR1-FR2-LCDR2-FR3-LCDR3-FR4. Generally, the VH and VL together form an antigen-binding site via their respective CDRs.

[0071] Numbering of the CDR and framework regions may be determined according to any known method or scheme, such as the Kabat, Chothia, EU, IMGT, and AHo numbering schemes (see, e.g., Kabat et al., "Sequences of Proteins of Immunological Interest", US Dept. Health and Human Services, Public Health Service National Institutes of Health, 1991, 5). thed.; Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987); Lefranc et al., Dev. Comp. Immunol. 27:55, 2003; Honegger and Pluckthun, J. Mol. Bio. 309:657-670 (2001)). The Antigen Receptor Numbering and Receptor Classification (ANARCI) software tool (2016, Bioinformatics 15:298-300) can be used to annotate equivalent residue positions for comparison of different molecules.

[0072] In embodiments, the UNC13A cryptic exon splice variant-specific antibody or antigen-binding fragment thereof binds to a peptide encoded by SEQ ID NO:5 or SEQ ID NO:6.

[0073] In an embodiment, the UNC13A cryptic exon splice variant specific inhibitor comprises an inhibitory nucleic acid. "Inhibitory nucleic acid" refers to a short single-stranded or double-stranded nucleic acid molecule that has a sequence complementary to a target gene or mRNA transcript and can reduce the expression of the target gene or mRNA transcript. Reduction of expression can be achieved through various processes including blocking transcription or translation (e.g., steric hindrance), degradation of the target mRNA transcript, blocking pre-mRNA splicing sites, blocking mRNA processing (e.g., capping, polyadenylation). Inhibitory nucleic acids can be single-stranded or double-stranded. Inhibitory nucleic acids can be composed of DNA, RNA, or both. Inhibitory nucleic acids can contain unmodified nucleotides, modified nucleotides, non-natural nucleotides, or analog nucleotides. Inhibitory nucleic acids include, but are not limited to, antisense oligonucleotides, siRNAs, shRNAs, miRNAs, double-stranded RNAs (dsRNAs), and endoribonuclease-prepared siRNAs (esiRNAs).

[0074] As used herein, the term "siRNA" or "small interfering RNA" refers to short double-stranded polynucleotide sequences (e.g., 17-30 subunits) that mediate sequence-specific post-transcriptional gene silencing, translational inhibition, transcriptional inhibition, or the process of epigenetic RNAi in animals (Zamore et al., Cell 101:25-33, 2000; Fire et al., Nature 391:806, 1998; Hamilton et al., Science 286:950-951, 1999; Lin et al., Nature 402:128-129, 1999; Sharp, Genes Dev. 13:139-141, 1999; and Strauss, Science 286:886, 1999).

[0075] In an embodiment, the siRNA comprises a first strand and a second strand with the same number of nucleosides, but the first strand and the second strand are offset so that the two terminal nucleosides of the first strand and the second strand remain overhanging. In an embodiment, the two overhanging nucleosides are thymidine residues. The antisense (or guide) strand of the siRNA comprises a region that is at least partially complementary to the target RNA. In an embodiment, there is 100% complementarity between the antisense strand of the siRNA and the target RNA. In an embodiment where there is partial complementarity of the antisense strand of the siRNA, the complementarity must be sufficient to allow the siRNA or its cleavage product to direct sequence-specific silencing, for example, by RNAi cleavage of the target RNA. In some embodiments, the antisense strand of the siRNA comprises one or more mismatches with respect to the target RNA, for example, 10, 8, 6, 5, 4, 3, 2 or less. Mismatches are most tolerated in the terminal regions, and if present, are preferably within 6, 5, 4, or 3 nucleotides of the terminal region(s), e.g., the 5' or 3' end. The sense (or passenger) strand of the siRNA only needs to be sufficiently complementary to the antisense strand to maintain the overall double-stranded nature of the molecular RNA-induced silencing complex (RISC).

[0076] In embodiments, siRNA may be modified or contain nucleoside analogs. The single-stranded region of siRNA may be modified or contain nucleoside analogs, such as the unpaired region(s) of a hairpin structure or the region that connects two complementary regions. In embodiments, siRNA may be modified to stabilize the 3' end, 5' end, or both of the siRNA. For example, the modification may stabilize the siRNA against exonuclease degradation or to favor the antisense strand entering the RNA-induced silencing complex (RISC). In embodiments, each strand of the siRNA may be 30, 25, 24, 23, 22, 21, or 20 nucleotides or less in length. In further embodiments, each strand is at least 19 nucleotides in length. For example, each strand can be 21-25 nucleotides in length, such that the siRNA has a duplex region of at least 17, 18, 19, 29, 21, 22, 23, 24, or 25 nucleotide pairs and one or more 2-3 nucleotide overhangs, e.g., overhangs at one or both 3' ends.

[0077] Endoribonuclease-prepared siRNAs (esiRNAs) are siRNAs that result from cleavage of long double-stranded RNA by endoribonucleases such as RNAseIII or Dicer. esiRNA products are a heterogeneous mixture of siRNAs targeting the same mRNA sequence.

[0078] As used herein, the term "miRNA" or "microRNA" refers to small non-coding RNAs of approximately 20-22 nucleotides that are generated from a long RNA hairpin loop precursor structure known as pri-miRNA. The pri-miRNA undergoes a two-step cleavage process to become a microRNA duplex that is incorporated into RISC. The level of complementarity between the miRNA guide strand and the target RNA determines which silencing mechanism is used. miRNAs that bind with perfect or extensive complementarity to an RNA target sequence, usually in the 3'-UTR, induce cleavage of the target via the RNA-mediated interference (RNAi) pathway. miRNAs with limited complementarity to the target RNA repress expression of the target gene at the translational level.

[0079] As used herein, the term "shRNA" or "short hairpin RNA" refers to a double-stranded structure formed from two complementary (19-22 bp) RNA sequences linked by a short loop (4-11 nt). Typically, shRNAs are encoded in vectors that are introduced into cells, where they are processed in the cytosol by Dicer into siRNA duplexes, which are incorporated into the RISC complex, where the complementarity between the guide strand and the RNA target mediates RNA target-specific cleavage and degradation.

[0080] As used herein, the term "ribozyme" refers to a catalytically active RNA molecule capable of site-specific cleavage of a target mRNA. In certain embodiments, the ribozyme is a Valkud satellite ribozyme, a hairpin ribozyme, a hammerhead ribozyme, or a hepatitis delta ribozyme.

[0081] In embodiments, the antisense oligonucleotides of the present disclosure target intron 20-21 and / or adjacent sequences of exon 20 or exon 21. Aberrant splicing can be corrected using splice-switching antisense oligonucleotides. Splice-switching antisense oligonucleotides hybridize at or near the splice site, thereby blocking the aberrant splice site and thereby preventing recognition by the cellular splicing machinery. In embodiments, splice-switching antisense oligonucleotides are modified to be nuclease-resistant, and the resulting target nucleic acid:oligonucleotide heteroduplex is not cleaved by RNase H. Splice-switching antisense oligonucleotides may contain nucleotides that do not form RNase H substrates when paired with RNA or nucleotide chemical mixtures, such that the use of consecutive DNA-like bases is avoided. Thus, in embodiments, splice-switching antisense oligonucleotides may modify the splicing of UNC13A without changing the abundance of UNC13A mRNA transcripts.

[0082] In an embodiment, the antisense oligonucleotide is complementary to the exon 20 splice donor site region of the pre-processed mRNA encoding UNC13A; the cryptic exon splice acceptor site region of the pre-processed mRNA encoding UNC13A; the cryptic exon splice donor site region of the pre-processed mRNA encoding UNC13A; or the exon 21 splice acceptor site region of the pre-processed mRNA encoding UNC13A. In an embodiment, the exon 20 splice donor site region in the pre-processed mRNA encoding UNC13A comprises or consists of SEQ ID NO: 12. In an embodiment, the cryptic exon splice acceptor site region of the pre-processed mRNA encoding UNC13A comprises or consists of SEQ ID NO: 91. In an embodiment, the cryptic exon splice donor site region of the pre-processed mRNA encoding UNC13A comprises or consists of SEQ ID NO: 220. In embodiments, the exon 21 splice acceptor site region in the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO:299.

[0083] In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO: 641. In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 3' end of a cryptic exon having the sequence set forth in SEQ ID NO: 642.

[0084] In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO: 643. In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 3' end of a cryptic exon having the sequence set forth in SEQ ID NO: 644. In embodiments, the UNC13A cryptic exon splice variant-specific antisense oligonucleotide has a length of about 15-40 bases, e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 bases. In embodiments, the UNC13A cryptic exon splice variant-specific antisense oligonucleotide has a length of about 18-30 bases, 18-25 bases, 18-22 bases, or 20-30 bases.

[0085] In an embodiment, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has a base sequence having at least 80%, 85%, 90%, 95%, or 100% identity to any one of the sequences in Tables 2 to 7 (e.g., SEQ ID NOs: 13 to 90, 92 to 219, 221 to 298, 300 to 377, and 423 to 640). In an embodiment, the UNC13A hidden exon splice variant-specific antisense oligonucleotide comprises or consists of any one of the sequences in Tables 2 to 5 (e.g., SEQ ID NOs: 13 to 90, 92 to 219, 221 to 298, 300 to 377, and 423 to 640). In an embodiment, the UNC13A cryptic exon splice variant-specific antisense oligonucleotide comprises or consists of any one of the sequences set forth in SEQ ID NOs: 423-432, 439-443, 491-498, 502-507, and 513-514.

[0086] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 650. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 650.

[0087] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 651. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 651.

[0088] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 652. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 652.

[0089] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 653. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 653.

[0090] In an embodiment, the UNC13A cryptic exon splice variant-specific antisense oligonucleotide has 18-21 bases complementary to SEQ ID NO: 654. In an embodiment, the UNC13A cryptic exon splice variant-specific antisense oligonucleotide has 18, 19, 20, or 21 bases complementary to SEQ ID NO: 654.

[0091] In embodiments, the UNC13A hidden exon splice variant specific antisense oligonucleotide is a modified antisense oligonucleotide. The modified antisense oligonucleotide may comprise at least one backbone modification, nucleobase modification, 2'-ribose substitution, or bridged nucleobase. Examples of modified oligonucleotide chemistries include, but are not limited to, phosphoramidate morpholino oligonucleotides and phosphorodiamidate morpholino oligonucleotides (PMO), phosphorothioate modified oligonucleotides, 2'O-methyl (2'O-Me) modified oligonucleotides, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), phosphorodithioate oligonucleotides, 2'O-methoxyethyl (2'-MOE) modified oligonucleotides, 2'-fluoro modified oligonucleotides, 2'O,4'C-ethylene bridged nucleic acids (ENAs), tricycloDNA, tricycloDNA phosphorothioate nucleotides, constrained ethyl bridged nucleic acids, 2'-O-[2-(N-methylcarbamoyl))ethyl] modified oligonucleotides, morpholino oligonucleotides, and peptide-conjugated phosphoramidate morpholino oligonucleotides (PPMOs). In embodiments, UNC13A hidden exon splice variant-specific antisense oligonucleotides comprise 2'O-Me modified nucleotides and phosphorothioate linkages.

[0092] In some embodiments, the compositions provided herein may be assembled into pharmaceutical or research kits to facilitate use in therapeutic or research applications. The kits may include one or more containers containing (a) the UNC13A cryptic exon splice variant-specific antisense oligonucleotide(s) described herein; and (b) instructions for use. In some embodiments, kit component (a) may be in a pharmaceutical formulation and dosage suitable for a particular application and mode of administration. For example, kit component (a) may be provided in a unit-dose or multi-dose container, such as a sealed ampoule or vial. Kit components may require mixing of one or more components prior to use or may be prepared in a premixed state. Kit components may be liquid or solid and may require the addition of solvent or further dilution. Kit components may be sterile. Instructions for use may be in written or electronic form and may be combined with the kit (e.g., written insert, CD, DVD) or provided via internet or web-based communication. Kits may be shipped and stored at refrigerated or frozen temperatures.

[0093] Pharmaceutical Compositions In some aspects, the disclosure provides a pharmaceutical composition comprising an UNC13A cryptic exon splice variant specific inhibitor as described herein and a pharma- ceutically acceptable carrier. As used herein, the term "pharma- ceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are within the scope of sound medical judgment and suitable for use in contact with cells and / or tissues without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0094] As used herein, the term "pharmaceutical acceptable carrier" refers to a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersant, suspending agent, diluent, excipient, thickener, solvent, or encapsulating material, that is involved in moving or transporting the compound useful in the present invention into or to a patient so that it can perform its intended function. Each carrier must be "acceptable" in the sense that it is compatible with the other components of the formulation and does not damage the cells or tissues with which it is in contact. Additional components that can be included in the pharmaceutical composition used to carry out the present invention are known in the art and are described, for example, in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA) (incorporated herein by reference).

[0095] As is well known in the medical arts, the dosage for any one patient will depend on many factors, including the patient's size, weight, body surface area, age, the level of UNC13A cryptic exon splice variant-specific inhibitor needed to achieve a therapeutic effect, the stability of the UNC13A cryptic exon splice variant-specific inhibitor, the particular disease being treated, the stage of the disease, sex, the time and route of administration, general health, and other medications being administered concomitantly.

[0096] The pharmaceutical composition may be administered in a manner suitable for the disease or condition to be treated (or prevented), as determined by those skilled in the medical arts. The appropriate dose of the composition, the suitable duration and frequency of administration will be determined by factors such as the patient's health status, the patient's size (i.e., body weight, weight, or body area), the type and severity of the patient's disease, the specific form of the active ingredient, and the method of administration. In general, an appropriate dose and treatment regimen provides a sufficient amount of the composition(s) to provide a therapeutic and / or prophylactic benefit (e.g., improved clinical outcome, e.g., more frequent complete or partial remissions, or longer disease-free and / or overall survival, or reduced severity of symptoms, as described herein). For prophylactic use, the dose should be sufficient to prevent, delay the onset of, or reduce the severity of the disease or disorder associated with the disease. The prophylactic benefit of the compositions administered in accordance with the methods described herein can be determined by conducting preclinical (e.g., in vitro and in vivo animal studies) and clinical studies and analyzing the data obtained therefrom using appropriate statistical, biological, and clinical methods and procedures, all of which can be readily performed by one of ordinary skill in the art.

[0097] The composition (e.g., pharmaceutical composition) can be administered by any route, for example, enterally (e.g., orally), parenterally, intravenously, intramuscularly, intraarterially, intramedullary, intrathecal, subpial, intraparenchymal, intrastriatal, intracranially, intracisternally, intracerebrally, intraventricularly, intraocularly, intraventricularly, intralumbar, subcutaneously, transdermally, intradermally, rectally, intravaginally, intraperitoneally, topically (by powder, ointment, cream, and / or infusion), mucosally, nasally, bucally, sublingually; by intratracheal infusion, bronchial infusion, and / or by inhalation; and / or as an oral spray, nasal spray, and / or aerosol. In general, the most suitable administration route will depend on various factors, such as the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract) and / or the condition of the subject. In some embodiments, the composition is directly injected into the CNS of the subject. In some embodiments, the direct injection into the CNS is an intracerebral injection, an intraparenchymal injection, an intrathecal injection, a subpial injection, or any combination thereof. In some embodiments, the direct injection into the CNS is a direct injection into the cerebrospinal fluid (CSF) of the subject, and optionally, the direct injection is an intracisternal injection, an intraventricular injection, and / or an intralumbar injection.

[0098] How to use UNC13A hidden price variant inhibitors The present disclosure provides methods of using the UNC13A cryptic exon splice variant specific inhibitors disclosed herein for various research and therapeutic applications. In one aspect, the present disclosure provides a method of reducing expression of an UNC13A cryptic exon splice variant in a cell, the method comprising administering an UNC13A cryptic exon splice variant specific inhibitor, the UNC13A cryptic exon splice variant comprising a cryptic exon between exon 20 and exon 21 of a mature mRNA transcript of the UNC13A cryptic exon splice variant. In an embodiment, the UNC13A cryptic exon splice variant specific inhibitor selectively inhibits expression or activity of the UNC13A cryptic exon splice variant across full length UNC13A (wild type) or other variants thereof (i.e., variants that do not contain the cryptic exon from intron 20-21, such as SEQ ID NO:5 or SEQ ID NO:6).

[0099] In an embodiment, the cryptic exon is obtained from intron 20-21 of the UNC13A gene. In an embodiment, the cryptic exon comprises SEQ ID NO:5 or SEQ ID NO:6. In an embodiment, the UNC13 cryptic exon splice variant comprises the polynucleotide sequence of SEQ ID NO:7 or SEQ ID NO:9. In an embodiment, the UNC13 cryptic exon splice variant comprises the amino acid sequence of SEQ ID NO:8 or SEQ ID NO:10.

[0100] In embodiments, UNC13 cryptic splice variant specific inhibitors include inhibitory nucleic acids, peptides, antibodies, binding proteins, small molecules, ribozymes, or aptamers.

[0101] In an embodiment, the UNC13 cryptic splice variant specific inhibitor comprises an inhibitory nucleic acid. The inhibitory nucleic acid may be an antisense oligonucleotide, an siRNA, an shRNA, an miRNA, a double-stranded RNA (dsRNA), or an esiRNA. In an embodiment, the inhibitory nucleic acid comprises an antisense oligonucleotide complementary to: the exon 20 splice donor site region of the pre-processed mRNA encoding UNC13A; the cryptic exon splice acceptor site region of the pre-processed mRNA encoding UNC13A; the cryptic exon splice donor site region of the pre-processed mRNA encoding UNC13A; or the exon 21 splice acceptor site region of the pre-processed mRNA encoding UNC13A. In an embodiment, the exon 20 splice donor site region comprises or consists of SEQ ID NO: 12. In an embodiment, the cryptic exon splice acceptor site region comprises or consists of SEQ ID NO: 91. In embodiments, the cryptic exon splice donor site region comprises or consists of SEQ ID NO: 220. In embodiments, the exon 21 splice acceptor site comprises or consists of SEQ ID NO: 299.

[0102] In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO: 641. In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 3' end of a cryptic exon having the sequence set forth in SEQ ID NO: 642.

[0103] In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 5' end of the cryptic exon having the sequence set forth in SEQ ID NO: 643. In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 3' end of the cryptic exon having the sequence set forth in SEQ ID NO: 644.

[0104] In an embodiment, the UNC13 cryptic splice variant-specific antisense oligonucleotide has a length of about 15 to 40 bases, preferably about 18 to 30 bases, 18 to 25 bases, 18 to 22 bases, or 20 to 30 bases.

[0105] In an embodiment, the UNC13 hidden splice variant-specific antisense oligonucleotide has a base sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of the sequences set forth in Table 2 (e.g., SEQ ID NOs: 13 to 90), Table 3 (SEQ ID NOs: 92 to 219), Table 4 (SEQ ID NOs: 221 to 298), Table 5 (SEQ ID NOs: 300 to 377), Table 7B (SEQ ID NOs: 423 to 522), and Table 8B (SEQ ID NOs: 523 to 640). In an embodiment, the UNC13 hidden splice variant-specific antisense oligonucleotide comprises or consists of any one of the sequences set forth in Table 2 (e.g., SEQ ID NOs: 13 to 90), Table 3 (SEQ ID NOs: 92 to 219), Table 4 (SEQ ID NOs: 221 to 298), Table 5 (SEQ ID NOs: 300 to 377), Table 7B (SEQ ID NOs: 423 to 522), and Table 8B (SEQ ID NOs: 523 to 640).

[0106] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 650. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 650.

[0107] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 651. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 651.

[0108] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 652. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 652.

[0109] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 653. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 653.

[0110] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-21 bases complementary to SEQ ID NO: 654. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, or 21 bases complementary to SEQ ID NO: 654. In embodiments, the UNC13 hidden splice variant-specific antisense oligonucleotide is a modified antisense oligonucleotide. In embodiments, modified antisense oligonucleotides include phosphoramidate morpholino oligonucleotides, phosphorodiamidate morpholino oligonucleotides, phosphorothioate modified oligonucleotides, 2'O-methyl (2'O-Me) modified oligonucleotides, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), phosphorodithioate oligonucleotides, 2'O-methoxyethyl (2'-MOE) modified oligonucleotides, 2'-fluoro modified oligonucleotides, 2'O,4'C-ethylene bridged nucleic acids (ENAs), tricycloDNA, tricycloDNA phosphorothioate nucleotides, constrained ethyl bridged nucleic acids, 2'-O-[2-(N-methylcarbamoyl)ethyl] modified oligonucleotides, morpholino oligonucleotides, and peptide conjugated phosphoramidate morpholino oligonucleotides (PPMOs), or any combination thereof.

[0111] In embodiments, the cell is in a subject. As used herein, a "patient" or "subject" includes an animal, such as a human, cow, horse, sheep, lamb, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit, or guinea pig. An animal can be a mammal, such as a non-primate and a primate (e.g., monkey and human). In embodiments, a patient is a human, such as a human infant, child, adolescent, or adult.

[0112] In embodiments, the subject is identified as having an UNC13A genetic mutation in intron 20-21. In embodiments, the UNC13 genetic mutation comprises rs12608932 (hg38 chr19:17.641,880 A→C), rs12973192 (hg38 chr19:17,642,430 C→G), rs56041637 (hg38 chr19:17,642,033-17,642,056 0-2 CATC repeats→3-5 CATC repeats), and rs62121687 (hg38 chr19:17,642,351 C→A), or any combination thereof.

[0113] In another aspect, the disclosure provides a method for reducing phosphorylated TAR-DNA binding protein 43 (TDP-43) in a cell, the method comprising administering an UNC13A cryptic exon splice variant-specific inhibitor, wherein the UNC13A cryptic exon splice variant comprises a cryptic exon between exon 20 and exon 21 of the UNC13A cryptic exon splice variant mature mRNA transcript.

[0114] In embodiments, the UNC13A cryptic exon splice variant-specific inhibitor selectively inhibits the expression or activity of the UNC13A cryptic exon splice variant across full-length UNC13A (wild type) or other variants thereof (i.e., variants that do not contain the cryptic exon from intron 20-21, such as SEQ ID NO:5 or SEQ ID NO:6).

[0115] In an embodiment, the cryptic exon is obtained from intron 20-21 of the UNC13A gene. In an embodiment, the cryptic exon comprises SEQ ID NO:5 or SEQ ID NO:6. In an embodiment, the UNC13 cryptic exon splice variant comprises the polynucleotide sequence of SEQ ID NO:7 or SEQ ID NO:9. In an embodiment, the UNC13 cryptic exon splice variant comprises the amino acid sequence of SEQ ID NO:8 or SEQ ID NO:10.

[0116] In embodiments, UNC13 cryptic splice variant specific inhibitors include inhibitory nucleic acids, peptides, antibodies, binding proteins, small molecules, ribozymes, or aptamers.

[0117] In an embodiment, the UNC13 cryptic splice variant specific inhibitor comprises an inhibitory nucleic acid. The inhibitory nucleic acid may be an antisense oligonucleotide, an siRNA, an shRNA, an miRNA, a double-stranded RNA (dsRNA), or an esiRNA. In an embodiment, the inhibitory nucleic acid comprises an antisense oligonucleotide complementary to: the exon 20 splice donor site region of the pre-processed mRNA encoding UNC13A; the cryptic exon splice acceptor site region of the pre-processed mRNA encoding UNC13A; the cryptic exon splice donor site region of the pre-processed mRNA encoding UNC13A; or the exon 21 splice acceptor site region of the pre-processed mRNA encoding UNC13A. In an embodiment, the exon 20 splice donor site region comprises or consists of SEQ ID NO: 12. In an embodiment, the cryptic exon splice acceptor site region comprises or consists of SEQ ID NO: 91. In embodiments, the cryptic exon splice donor site region comprises or consists of SEQ ID NO: 220. In embodiments, the exon 21 splice acceptor site comprises or consists of SEQ ID NO: 299.

[0118] In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO: 641. In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 3' end of a cryptic exon having the sequence set forth in SEQ ID NO: 642.

[0119] In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 5' end of the cryptic exon having the sequence set forth in SEQ ID NO: 643. In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 3' end of the cryptic exon having the sequence set forth in SEQ ID NO: 644.

[0120] In an embodiment, the UNC13 cryptic splice variant-specific antisense oligonucleotide has a length of about 15 to 40 bases, preferably about 18 to 30 bases, 18 to 25 bases, 18 to 22 bases, or 20 to 30 bases.

[0121] In an embodiment, the UNC13 hidden splice variant-specific antisense oligonucleotide has a base sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of the sequences set forth in Table 2 (e.g., SEQ ID NOs: 13 to 90), Table 3 (SEQ ID NOs: 92 to 219), Table 4 (SEQ ID NOs: 221 to 298), Table 5 (SEQ ID NOs: 300 to 377), Table 7B (SEQ ID NOs: 423 to 522), and Table 8B (SEQ ID NOs: 523 to 640). In an embodiment, the UNC13 hidden splice variant-specific antisense oligonucleotide comprises or consists of any one of the sequences set forth in Table 2 (e.g., SEQ ID NOs: 13 to 90), Table 3 (SEQ ID NOs: 92 to 219), Table 4 (SEQ ID NOs: 221 to 298), Table 5 (SEQ ID NOs: 300 to 377), Table 7B (SEQ ID NOs: 423 to 522), and Table 8B (SEQ ID NOs: 523 to 640).

[0122] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 650. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 650.

[0123] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 651. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 651.

[0124] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 652. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 652.

[0125] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 653. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 653.

[0126] In an embodiment, the UNC13A cryptic exon splice variant-specific antisense oligonucleotide has 18-21 bases complementary to SEQ ID NO: 654. In an embodiment, the UNC13A cryptic exon splice variant-specific antisense oligonucleotide has 18, 19, 20, or 21 bases complementary to SEQ ID NO: 654.

[0127] In an embodiment, the UNC13 hidden splice variant specific antisense oligonucleotide is a modified antisense oligonucleotide. In an embodiment, the modified antisense oligonucleotide comprises phosphoramidate morpholino oligonucleotide, phosphorodiamidate morpholino oligonucleotide, phosphorothioate modified oligonucleotide, 2'O-methyl (2'O-Me) modified oligonucleotide, peptide nucleic acid (PNA), locked nucleic acid (LNA), phosphorodithioate oligonucleotide, 2'O-methoxyethyl (2'-MOE) modified oligonucleotide, 2'-fluoro modified oligonucleotide, 2'O,4'C-ethylene bridged nucleic acid (ENA), tricyclo DNA, tricyclo DNA phosphorothioate nucleotide, constrained ethyl bridged nucleic acid, 2'-O-[2-(N-methylcarbamoyl)ethyl] modified oligonucleotide, morpholino oligonucleotide, and peptide conjugate phosphoramidate morpholino oligonucleotide (PPMO), or any combination thereof.

[0128] In an embodiment, the cell is in a subject. In an embodiment, the subject is identified as having an UNC13A genetic mutation in intron 20-21. In an embodiment, the UNC13 genetic mutation comprises rs12608932 (hg38 chr19:17.641,880 A→C), rs12973192 (hg38 chr19:17,642,430 C→G), rs56041637 (hg38 chr19:17,642,033-17,642,056 0-2 CATC repeats→3-5 CATC repeats), and rs62121687 (hg38 chr19:17,642,351 C→A), or any combination thereof.

[0129] In another aspect, the disclosure provides a method of treating a TAR-DNA binding protein 43 (TDP-43) proteinopathy in a subject, the method comprising administering to the subject a UNC13A cryptic exon splice variant-specific inhibitor, wherein the UNC13A cryptic exon splice variant comprises a cryptic exon between exon 20 and exon 21 of the UNC13A cryptic exon splice variant mature mRNA transcript.

[0130] In embodiments, the UNC13A cryptic exon splice variant-specific inhibitor selectively inhibits the expression or activity of the UNC13A cryptic exon splice variant across full-length UNC13A (wild type) or other variants thereof (i.e., variants that do not contain the cryptic exon from intron 20-21, such as SEQ ID NO:5 or SEQ ID NO:6).

[0131] In an embodiment, the cryptic exon is obtained from intron 20-21 of the UNC13A gene. In an embodiment, the cryptic exon comprises SEQ ID NO:5 or SEQ ID NO:6. In an embodiment, the UNC13 cryptic exon splice variant comprises the polynucleotide sequence of SEQ ID NO:7 or SEQ ID NO:9. In an embodiment, the UNC13 cryptic exon splice variant comprises the amino acid sequence of SEQ ID NO:8 or SEQ ID NO:10.

[0132] In embodiments, UNC13 cryptic splice variant specific inhibitors include inhibitory nucleic acids, peptides, antibodies, binding proteins, small molecules, ribozymes, or aptamers.

[0133] In an embodiment, the UNC13 cryptic splice variant specific inhibitor comprises an inhibitory nucleic acid. The inhibitory nucleic acid may be an antisense oligonucleotide, an siRNA, an shRNA, an miRNA, a double-stranded RNA (dsRNA), or an esiRNA. In an embodiment, the inhibitory nucleic acid comprises an antisense oligonucleotide complementary to: the exon 20 splice donor site region of the pre-processed mRNA encoding UNC13A; the cryptic exon splice acceptor site region of the pre-processed mRNA encoding UNC13A; the cryptic exon splice donor site region of the pre-processed mRNA encoding UNC13A; or the exon 21 splice acceptor site region of the pre-processed mRNA encoding UNC13A. In an embodiment, the exon 20 splice donor site region comprises or consists of SEQ ID NO: 12. In an embodiment, the cryptic exon splice acceptor site region comprises or consists of SEQ ID NO: 91. In embodiments, the cryptic exon splice donor site region comprises or consists of SEQ ID NO: 220. In embodiments, the exon 21 splice acceptor site comprises or consists of SEQ ID NO: 299.

[0134] In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO: 641. In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 3' end of a cryptic exon having the sequence set forth in SEQ ID NO: 642.

[0135] In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 5' end of the cryptic exon having the sequence set forth in SEQ ID NO: 643. In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 3' end of the cryptic exon having the sequence set forth in SEQ ID NO: 644.

[0136] In an embodiment, the UNC13 cryptic splice variant-specific antisense oligonucleotide has a length of about 15 to 40 bases, preferably about 18 to 30 bases, 18 to 25 bases, 18 to 22 bases, or 20 to 30 bases.

[0137] In an embodiment, the UNC13 hidden splice variant-specific antisense oligonucleotide has a base sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of the sequences set forth in Table 2 (e.g., SEQ ID NOs: 13 to 90), Table 3 (SEQ ID NOs: 92 to 219), Table 4 (SEQ ID NOs: 221 to 298), Table 5 (SEQ ID NOs: 300 to 377), Table 7B (SEQ ID NOs: 423 to 522), and Table 8B (SEQ ID NOs: 523 to 640). In an embodiment, the UNC13 hidden splice variant-specific antisense oligonucleotide comprises or consists of any one of the sequences set forth in Table 2 (e.g., SEQ ID NOs: 13 to 90), Table 3 (SEQ ID NOs: 92 to 219), Table 4 (SEQ ID NOs: 221 to 298), and Table 5 (SEQ ID NOs: 300 to 377), Table 7B (SEQ ID NOs: 423 to 522), and Table 8B (SEQ ID NOs: 523 to 640).

[0138] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 650. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 650.

[0139] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 651. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 651.

[0140] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 652. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 652.

[0141] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 653. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 653.

[0142] In an embodiment, the UNC13A cryptic exon splice variant-specific antisense oligonucleotide has 18-21 bases complementary to SEQ ID NO: 654. In an embodiment, the UNC13A cryptic exon splice variant-specific antisense oligonucleotide has 18, 19, 20, or 21 bases complementary to SEQ ID NO: 654.

[0143] In an embodiment, the UNC13 hidden splice variant specific antisense oligonucleotide is a modified antisense oligonucleotide. In an embodiment, the modified antisense oligonucleotide comprises phosphoramidate morpholino oligonucleotide, phosphorodiamidate morpholino oligonucleotide, phosphorothioate modified oligonucleotide, 2'O-methyl (2'O-Me) modified oligonucleotide, peptide nucleic acid (PNA), locked nucleic acid (LNA), phosphorodithioate oligonucleotide, 2'O-methoxyethyl (2'-MOE) modified oligonucleotide, 2'-fluoro modified oligonucleotide, 2'O,4'C-ethylene bridged nucleic acid (ENA), tricyclo DNA, tricyclo DNA phosphorothioate nucleotide, constrained ethyl bridged nucleic acid, 2'-O-[2-(N-methylcarbamoyl)ethyl] modified oligonucleotide, morpholino oligonucleotide, and peptide conjugate phosphoramidate morpholino oligonucleotide (PPMO), or any combination thereof.

[0144] In an embodiment, the cell is in a subject. In an embodiment, the subject is identified as having an UNC13A genetic mutation in intron 20-21. In an embodiment, the UNC13 genetic mutation comprises rs12608932 (hg38 chr19:17.641,880 A→C), rs12973192 (hg38 chr19:17,642,430 C→G), rs56041637 (hg38 chr19:17,642,033-17,642,056 0-2 CATC repeats→3-5 CATC repeats), and rs62121687 (hg38 chr19:17,642,351 C→A), or any combination thereof.

[0145] In embodiments, the TDP-43 proteinopathy comprises amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), facial onset sensorimotor neuropathy (FOSMN), hippocampal sclerosis (HS), limbic predominant age-related TDP-43 encephalopathy (LATE), cerebral aging-associated TDP-43 encephalopathy with sclerosis (CARTS), Guam Parkinson-Dementia Complex (G-PDC), Guan ALS (G-ALS), multisystem proteinopathy (MSP), Perry's disease, Alzheimer's disease (AD), and chronic traumatic encephalopathy (CTE), or any combination thereof.

[0146] In another aspect, the disclosure provides a method of treating a subject identified as having an UNC13A genetic mutation in intron 20-21, the method comprising administering to the subject an UNC13A cryptic exon splice variant-specific inhibitor, wherein the UNC13A cryptic exon splice variant comprises a cryptic exon between exon 20 and exon 21 of the UNC13A cryptic exon splice variant mature mRNA transcript. In embodiments, the UNC13 gene mutations include rs12608932 (hg38 chr19:17.641,880 A→C), rs12973192 (hg38 chr19:17,642,430 C→G), rs56041637 (hg38 chr19:17,642,033-17,642,056 0-2 CATC repeats→3-5 CATC repeats), and rs62121687 (hg38 chr19:17,642,351 C→A), or any combination thereof.

[0147] In embodiments, the subject has decreased expression of TDP-43. In embodiments, the subject exhibits decreased nuclear TDP-43.

[0148] In embodiments, the UNC13A cryptic exon splice variant-specific inhibitor selectively inhibits the expression or activity of the UNC13A cryptic exon splice variant across full-length UNC13A (wild type) or other variants thereof (i.e., variants that do not contain the cryptic exon from intron 20-21, such as SEQ ID NO:5 or SEQ ID NO:6).

[0149] In an embodiment, the cryptic exon is obtained from intron 20-21 of the UNC13A gene. In an embodiment, the cryptic exon comprises SEQ ID NO:5 or SEQ ID NO:6. In an embodiment, the UNC13 cryptic exon splice variant comprises the polynucleotide sequence of SEQ ID NO:7 or SEQ ID NO:9. In an embodiment, the UNC13 cryptic exon splice variant comprises the amino acid sequence of SEQ ID NO:8 or SEQ ID NO:10.

[0150] In embodiments, UNC13 cryptic splice variant specific inhibitors include inhibitory nucleic acids, peptides, antibodies, binding proteins, small molecules, ribozymes, or aptamers.

[0151] In an embodiment, the UNC13 cryptic splice variant specific inhibitor comprises an inhibitory nucleic acid. The inhibitory nucleic acid may be an antisense oligonucleotide, an siRNA, an shRNA, an miRNA, a double-stranded RNA (dsRNA), or an esiRNA. In an embodiment, the inhibitory nucleic acid comprises an antisense oligonucleotide complementary to: the exon 20 splice donor site region of the pre-processed mRNA encoding UNC13A; the cryptic exon splice acceptor site region of the pre-processed mRNA encoding UNC13A; the cryptic exon splice donor site region of the pre-processed mRNA encoding UNC13A; or the exon 21 splice acceptor site region of the pre-processed mRNA encoding UNC13A. In an embodiment, the exon 20 splice donor site region comprises or consists of SEQ ID NO: 12. In an embodiment, the cryptic exon splice acceptor site region comprises or consists of SEQ ID NO: 91. In embodiments, the cryptic exon splice donor site region comprises or consists of SEQ ID NO: 220. In embodiments, the exon 21 splice acceptor site comprises or consists of SEQ ID NO: 299.

[0152] In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO: 641. In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 3' end of a cryptic exon having the sequence set forth in SEQ ID NO: 642.

[0153] In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 5' end of the cryptic exon having the sequence set forth in SEQ ID NO: 643. In embodiments, the inhibitory nucleic acid, e.g., antisense oligonucleotide, comprises a sequence complementary to the 3' end of the cryptic exon having the sequence set forth in SEQ ID NO: 644.

[0154] In an embodiment, the UNC13 cryptic splice variant-specific antisense oligonucleotide has a length of about 15 to 40 bases, preferably about 18 to 30 bases, 18 to 25 bases, 18 to 22 bases, or 20 to 30 bases.

[0155] In an embodiment, the UNC13 hidden splice variant-specific antisense oligonucleotide has a base sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of the sequences set forth in Table 2 (e.g., SEQ ID NOs: 13 to 90), Table 3 (SEQ ID NOs: 92 to 219), Table 4 (SEQ ID NOs: 221 to 298), Table 5 (SEQ ID NOs: 300 to 377), Table 7B (SEQ ID NOs: 423 to 522), and Table 8B (SEQ ID NOs: 523 to 640). In an embodiment, the UNC13 hidden splice variant-specific antisense oligonucleotide comprises or consists of any one of the sequences set forth in Table 2 (e.g., SEQ ID NOs: 13 to 90), Table 3 (SEQ ID NOs: 92 to 219), Table 4 (SEQ ID NOs: 221 to 298), Table 5 (SEQ ID NOs: 300 to 377), Table 7B (SEQ ID NOs: 423 to 522), and Table 8B (SEQ ID NOs: 523 to 640).

[0156] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 650. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 650.

[0157] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 651. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 651.

[0158] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 652. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 652.

[0159] In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18-30 bases, 18-25 bases, or 18-22 bases complementary to SEQ ID NO: 653. In embodiments, the UNC13A hidden exon splice variant-specific antisense oligonucleotide has 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases complementary to SEQ ID NO: 653.

[0160] In an embodiment, the UNC13A cryptic exon splice variant-specific antisense oligonucleotide has 18-21 bases complementary to SEQ ID NO: 654. In an embodiment, the UNC13A cryptic exon splice variant-specific antisense oligonucleotide has 18, 19, 20, or 21 bases complementary to SEQ ID NO: 654.

[0161] In an embodiment, the UNC13 hidden splice variant specific antisense oligonucleotide is a modified antisense oligonucleotide. In an embodiment, the modified antisense oligonucleotide comprises phosphoramidate morpholino oligonucleotide, phosphorodiamidate morpholino oligonucleotide, phosphorothioate modified oligonucleotide, 2'O-methyl (2'O-Me) modified oligonucleotide, peptide nucleic acid (PNA), locked nucleic acid (LNA), phosphorodithioate oligonucleotide, 2'O-methoxyethyl (2'-MOE) modified oligonucleotide, 2'-fluoro modified oligonucleotide, 2'O,4'C-ethylene bridged nucleic acid (ENA), tricyclo DNA, tricyclo DNA phosphorothioate nucleotide, constrained ethyl bridged nucleic acid, 2'-O-[2-(N-methylcarbamoyl)ethyl] modified oligonucleotide, morpholino oligonucleotide, and peptide conjugate phosphoramidate morpholino oligonucleotide (PPMO), or any combination thereof.

[0162] In an embodiment, the subject is afflicted with a TDP-43 proteinopathy, which includes amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), facial onset sensorimotor neuropathy (FOSMN), hippocampal sclerosis (HS), limbic predominant age-related TDP-43 encephalopathy (LATE), cerebral age-related TDP-43 encephalopathy with sclerosis (CARTS), Guam Parkinson-Dementia Complex (G-PDC), Guan ALS (G-ALS), multisystem proteinopathy (MSP), Perry's disease, Alzheimer's disease (AD), and chronic traumatic encephalopathy (CTE), or a combination thereof.

[0163] In embodiments, the disclosed treatment methods reduce, prevent, or slow the onset or progression of one or more symptoms characteristic of TDP-43 proteinopathy, including motor dysfunction, cognitive dysfunction, emotional / behavioral dysfunction, paralysis, tremors, unsteadiness, rigidity, spasms, muscle weakness, muscle spasms, muscle rigidity, muscle atrophy, difficulty swallowing, difficulty breathing, speech and language disorders (e.g., slurred speech), slow movement, difficulty walking, dementia, depression, anxiety, or any combination thereof.

[0164] In an embodiment, the treatment method of the present disclosure comprises administering an UNC13A hidden splice variant specific inhibitor as a monotherapy for the treatment of TDP-43 proteinopathy or in combination with one or more additional therapies.Combined therapy can mean administering the composition of the present disclosure (e.g., antisense oligonucleotide) to a subject at the same time as, before, or after one or more additional therapies.Concurrent administration of combined therapy can mean that the composition of the present disclosure (e.g., antisense oligonucleotide) and the additional therapy are formulated for administration in the same dosage form or are administered in separate dosage forms.

[0165] In embodiments, one or additional therapeutic approaches that may be used in combination with the UNC13A cryptic splice variant-specific inhibitors of the present disclosure include: inhibitory nucleic acids or antisense oligonucleotides targeting neurodegenerative disease-associated genes or transcripts (e.g., C9ORF72), gene editing drugs (e.g., CRISPR, TALEN, ZFN-based systems) targeting neurodegeneration-associated genes (e.g., C9ORF72), agents that reduce oxidative stress, such as free radical scavengers (e.g., Radicava (edaravone), bromocriptine); antiglutamate drugs (e.g., riluzole, topiramate, lamotrigine, dextromethorphan, gabapentin, and AMPA receptor antagonists (e.g., talampanel); anti-apoptotic drugs (e.g., minocycline, sodium phenylbutyrate, and arimoclomol); anti-inflammatory drugs (e.g., gangliosides, celecoxib, cyclosporine, nimesulide, azathioprine, cyclophosphamide, plasma exchange, glatiramer acetate, and thalidomide); beta-lactam antibiotics (penicillin and its derivatives, ceftriaxone, and cephalosporins); dopamine agonists (pramipexole, dexpramipexole); and neurotrophic factors (e.g., IGF-1, GDNF, BDNF, CTNF, VEGF, colivelin, zaliproden, thyrotrophin-releasing hormone, and ADNF).

[0166] In embodiments, the UNC13A hidden splice variant-specific inhibitor of the present disclosure is administered in combination with an additional therapy that targets C9ORF72. In some embodiments, the additional therapy that targets C9ORF72 comprises an inhibitory nucleic acid that targets a C9ORF72 transcript, a C9ORF72-specific antisense oligonucleotide, or a C9ORF72-specific gene editing agent. Examples of C9ORF72-specific therapeutics are described in: U.S. Patent No. 9,963,699 (antisense oligonucleotides); PCT Publication No. WO2019 / 032612 (antisense oligonucleotides); U.S. Patent No. 10,221,414 (antisense oligonucleotides); U.S. Patent No. 10,407,678 (antisense oligonucleotides); U.S. Patent No. 9,963,699 (antisense oligonucleotides); U.S. Patent Publication No. US2019 / 0316126 (inhibitory nucleic acids); U.S. Patent Publication No. 2019 / 0167815 (gene editing); PCT Publication No. 2017 / 109757 (gene editing), each of which is incorporated by reference in its entirety.

[0167] In embodiments, the disclosed treatment methods, including the treatment of TDP-43 proteinopathies such as ALS or FTD, may be used in combination with STMN2 cryptic splice variant-specific inhibitors. STMN2 encodes a microtubule stability regulator called stathmin-2, and is the gene whose expression is most significantly reduced when TDP-43 is depleted from neurons. The stathmin 2 gene is annotated to contain five constitutive exons and proposed alternative exons between exons 4 and 5 (see Table 10). STMN2 possesses a cryptic exon (exon 2a) contained in intron 1 that is normally excluded from the mature STMN2 mRNA (see Figure 18). The first intron of STMN2 (Table 10) contains a TDP-43 binding site. When TDP-43 is lost or its function is impaired, exon 2a is incorporated into the mature mRNA. Exon 2a harbors a stop codon and a polyadenylation signal (Figure 18), resulting in truncated STMN2 mRNA and an 8-fold reduction in stathmin-2. Aberrant splicing and reduced stathmin-2 levels appear to be major features of sporadic and familial ALS cases (except for those with SOD1 mutations) and FTLD-TDP. [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4] [Table 10-5] [Table 10-6] [Table 10-7] [Table 10-8] [Table 10-9] [Table 10-10]

[0168] In embodiments, the STMN2 cryptic exon splice variant-specific inhibitor selectively inhibits the expression or activity of the STMN2 cryptic exon splice variant across full-length STMN2 (wild type) or other variants thereof (i.e., variants that do not contain cryptic exon 2a contained in intron 1).

[0169] In an embodiment, the STMN2 cryptic exon is obtained from intron 1 of the STMN2 gene. In an embodiment, the cryptic exon 2a comprises the red sequence shown in FIG.

[0170] In embodiments, STMN2 cryptic splice variant-specific inhibitors include inhibitory nucleic acids, peptides, antibodies, binding proteins, small molecules, ribozymes, or aptamers.

[0171] In embodiments, the STMN2 cryptic splice variant-specific inhibitor targets cryptic exon 2a.

[0172] In an embodiment, the STMN2 cryptic splice variant specific inhibitor comprises an inhibitory nucleic acid. The inhibitory nucleic acid may be an antisense oligonucleotide, an siRNA, an shRNA, an miRNA, a double-stranded RNA (dsRNA), or an esiRNA. In an embodiment, the inhibitory nucleic acid comprises an antisense oligonucleotide complementary to: an exon 1 splice donor site region in the pre-processed mRNA encoding STMN2; a cryptic exon 2a splice acceptor site region in the pre-processed mRNA encoding STMN2.

[0173] In an embodiment, the STMN2 cryptic splice variant-specific antisense oligonucleotide has a length of about 15 to 40 bases, preferably about 18 to 30 bases, 18 to 25 bases, 18 to 22 bases, or 20 to 30 bases.

[0174] In an embodiment, the STMN2 hidden splice variant-specific antisense oligonucleotide is a modified antisense oligonucleotide. In an embodiment, the modified antisense oligonucleotide comprises a phosphoramidate morpholino oligonucleotide, a phosphorodiamidate morpholino oligonucleotide, a phosphorothioate modified oligonucleotide, a 2'O-methyl (2'O-Me) modified oligonucleotide, a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a phosphorodithioate oligonucleotide, a 2'O-methoxyethyl (2'-MOE) modified oligonucleotide, a 2'-fluoro modified oligonucleotide, a 2'O,4'C-ethylene bridged nucleic acid (ENA), a tricyclo DNA, a tricyclo DNA phosphorothioate nucleotide, a constrained ethyl bridged nucleic acid, a 2'-O-[2-(N-methylcarbamoyl)ethyl] modified oligonucleotide, a morpholino oligonucleotide, and a peptide-conjugated phosphoramidate morpholino oligonucleotide (PPMO), or any combination thereof.

[0175] The UNC13A cryptic splice variant-specific inhibitors of the present disclosure may be administered by any route, for example, enterally (e.g., orally), parenterally, intravenously, intramuscularly, intraarterially, intramedullary, intrathecal, subpial, intraparenchymal, intrastriatal, intracranially, intracisternally, intracerebrally, intraventricularly, intraocularly, intraventricularly, intralumbar, subcutaneously, transdermally, intradermally, rectally, intravaginally, intraperitoneally, topically (by powders, ointments, creams, and / or infusions), mucosally, nasally, bucally, sublingually; by intratracheal infusion, bronchial infusion, and / or by inhalation; and / or as an oral spray, nasal spray, and / or aerosol. Preferably, the UNC13A hidden splice variant-specific inhibitors (e.g., antisense oligonucleotides) of the present disclosure are administered directly to the subject's CNS, for example, intrathecally, subpial, intraparenchymal, intrastriatal, intracranial, intracisternal, intracerebral, intraventricular, intraocular, intraventricular, intralumbar, or any combination thereof.

[0176] In embodiments, the methods of the disclosure reduce expression or activity of an UNC13A hidden splice variant in a cell by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more compared to the expression level of an UNC13A hidden splice variant in a cell that is not contacted with an UNC13A hidden splice variant-specific inhibitor in the cell. In some embodiments, the disclosed methods can increase expression or activity of UNC13A cryptic splice variants in cells by 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-100%, 30-20%, 30-20%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-10 ...40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-100%, 30-2 Reduce by ~60%, 30~70%, 30~80%, 30~90%, 30~95%, 30~100%, 40~50%, 40~60%, 40~70%, 40~80%, 40~90%, 40~95%, 40~100%, 50~60%, 50~70%, 50~80%, 50~90%, 50~95%, 50~100%, 60~70%, 60~80%, 60~90%, 60~95%, 60~100%, 70~80%, 70~90%, 70~95%, 70~100%, 80~90%, 80~95%, 80~100%, 90~95%, 90~100%.

[0177] In embodiments, the methods of the disclosure reduce expression or activity of UNC13A hidden splice variant in the CNS of a subject by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more compared to the expression level of UNC13A hidden splice variant in the CNS of an untreated subject. In embodiments, the disclosed methods reduce expression or activity of UNC13A hidden splice variants in the CNS of a subject by 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-9 ... %, 30~70%, 30~80%, 30~90%, 30~95%, 30~100%, 40~50%, 40~60%, 40~70%, 40~80%, 40~90%, 40~95%, 40~100%, 50~60%, 50~70%, 50~80%, 50~90%, 50~95%, 50~100%, 60~70%, 60~80%, 60~90%, 60~95%, 60~100%, 70~80%, 70~90%, 70~95%, 70~100%, 80~90%, 80~95%, 80~100%, 90~95%, 90~100% reduction. EXAMPLES

[0178] Example 1: TDP-43 suppresses the inclusion of a cryptic exon in the FTD / ALS gene UNC13A Materials and Methods RNA-Seq alignment and splicing analysis The detailed pipeline v2.0.1 for RNA-Seq alignment and splicing analysis is available at https: / / github.com / emc2cube / Bioinformatics / sh_RNAseq.sh. FASTQ files were downloaded from the Gene Expression Omnibus (GEO) database as GSE126543. Adapters in the FASTQ files were removed using trimmomatic (0.39) (ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36). FastQC (v0.11.9) was then used to assess the quality of the resulting files. RNA-Seq reads were then mapped to human (hg38) using STARv2.7.3a.

[0179] Splicing analysis MAJIQ (2.2) and VOILA (12) were used to analyze MAJIQ: alternative splicing events. Briefly, by using the UCSC transcriptome annotation (release 82) annotated with de novo detected junctions, reads spanning aberrantly mapped junctions were used to construct transcript splice graphs in MAJIQ with the following parameters: "majiq build-c config --min-intronic-cov 1 --simplify". Here, de novo refers to junctions that are not in the UCSC transcriptome annotation but have sufficient evidence in the RNA-Seq data (--min-intronic-cov1). Distinct local splice variations (LSVs) were identified in each RNA-Seq sample using gene splice graphs and the MAJIQ quantifier (majiq psi) (estimates the proportion of each junction in each LSV, expressed as the fraction spliced ​​at (PSI or Ψ)). The command "majiq deltapsi" was used to calculate the change in PSI (ΔPSI or ΔΨ) of each junction between the two conditions (TDP-43 positive vs. TDP-43 negative neuronal nuclei). VOILA was used to visualize gene splice graphs, posterior distributions of PSI and ΔPSI.

[0180] LeafCutter (commit 249fc26 in https: / / github.com / davidaknowles / leafcutter): Using already aligned RNA-Seq reads as described above, reads spanning exon-exon junctions and mapping a minimum of 6 np to each exon were extracted from the alignment (bam) files (using filter_cs.py with default settings). Intron clustering was performed using default settings in leafcutter_cluster.py. Differential deletion of introns between the two conditions (TDP-43 positive neuronal nuclei vs. TDP-43 positive neuronal nuclei) was calculated using leafcutter_ds.R.

[0181] cell culture SH-SY5Y (ATCC) cells were grown at 37 °C, 5% CO2 in DMEM / F12 medium supplemented with Glutamax (Thermo Scientific), 10% fetal bovine serum, and 10% penicillin-streptomycin. For shRNA treatment, cells were plated on day 0 and transduced with shRNA on day 2, followed by medium refreshment on day 3 and harvesting for readout (RT-qPCR, immunoblotting) on ​​day 6. HEK293T TDP-43 knockout and parental HEK-293T cells were generated as described (37). Cells were cultured at 37°C and 5% CO2 in DMEM medium (Gibco 10564011) supplemented with 10% fetal bovine serum (Invitrogen 16000-044), 1% penicillin-streptomycin, 2 mM L-glutamine (Gemini Biosciences), and 1x MEM non-essential amino acid solution (Gibco).

[0182] Immunoblotting SH-SY5Y cells and iPSC-derived motor neurons (iPSC-MNs) were transfected and treated as above before lysis. Cells were lysed in ice-cold RIPA buffer (Sigma-Aldrich R0278) supplemented with protease inhibitor cocktail (Thermo Fisher 78429) and phosphatase inhibitor (Thermo Fisher 78426). Lysates were pelleted in a tabletop centrifuge at maximum speed for 15 min at 4 °C, after which a bicinchoninic acid (Invitrogen 23225) assay was performed to measure protein concentration. 60 μg (SH-SY5Y) and 30 μg (iPSCs-MNs) protein of each sample was denatured in LDS sample buffer (Invitrogen NP0008) containing 2.5% 2-mercaptoethanol (Sigma-Aldrich) for 10 min at 70 °C. These samples were loaded onto 4-12% Bis-Tris gels for gel electrophoresis (Thermo Fisher NP0335BOX) and then transferred onto 0.45 μm nitrocellulose membranes (Bio-Rad 162-0115) using a wet transfer method (Bio-Rad Mini Transblot Electrophoresis Cell 170-3930) for 2 h at 100 V. The membranes were blocked with Odyssey blocking buffer (LiCOr 927-40010) for 1 h and then incubated overnight at room temperature in blocking buffer containing antibodies to UNC13A (1:500, Proteintech 55053-1-AP), TDP-43 (1:1,000, Abnova H00023435-M01), or GAPDH (Cell Signaling Technologies 5174S). The membranes were then incubated for 1 h in blocking buffer containing HRP-conjugated anti-mouse IgG (H+L) (1:2000, Fisher 62-6520) or HRP-conjugated anti-rabbit IgG (H+L) (1:2000, Life Technologies 31462). The ECL Prime kit (Invitrogen) was used to develop the blots, which were imaged using a ChemiDox XRS+System (BIO-RAD).Band intensities were quantified using Fiji and then normalized to corresponding controls.

[0183] RNA extraction, cDNA synthesis, and RT-qPCR / RT-PCR to detect UNC13A splice variants Total RNA was extracted using the RNeasy Micro kit (Qiagen) according to the manufacturer's instructions and lysates were passed through QIAshredder columns (Qiagen) to maximize yield. RNA was quantified with Nanodrop (Thermo Scientific) and 75ng was used for cDNA synthesis with SuperScript IV VILO Master Mix (Thermo Scientific). qPCR was performed with 6ng cDNA input in 20ul reactions using PowerTrack SYBR Green Master Mix (Thermo Scientific) with standard cycling parameters (95°C for 2 minutes, 40 cycles of 95°C for 15 seconds / 60°C for 60 seconds) followed by standard dissociation (95°C for 15 seconds at 1.6°C / s, 60°C for 60 seconds at 1.6°C / s, 95°C for 15 seconds at 0.075°C / s). ΔΔCt was calculated with RPLP0 as housekeeper and the relevant shScramble as reference, and measured Ct values ​​above 40 were set to 40 for visualization. The following primer pairs were used: [Table 11]

[0184] RT-PCR was performed with an input of 15 ng of cDNA in a 100 μl reaction using NEBNext Ultra II Q5 Master Mix (New England Biolabs) and the resulting products were visualized on a 1.5% TAE gel. The following primer pairs were used: [Table 12]

[0185] shRNA cloning, lentiviral packaging, and cell transduction The shRNA sequences were derived from the Broad GPP Portal (TDP-43: AGATCTTAAGACTGGTCATTC (SEQ ID NO: 391), Scramble: GATATCGCTTCTACTAGTAAG (SEQ ID NO: 392)). To clone, complementary oligos were synthesized to generate 4 nt overhangs, annealed, and ligated into pRSITCH (Tet-inducible U6) or pRSI16 (constitutive U6) (Cellecta). Ligations were transformed into Stbl3 chemically competent cells (Thermo Scientific) and grown at 30°C. Large-scale plasmid generation was performed using Maxiprep columns (Promega) with purified plasmids used as input for lentiviral packaging with second generation packaging plasmids psPAX2 and pMD2.G (Cellecta) and transduced into Lenti-X 293T cells (Takara) using Lipofectamine 2000 (Invitrogen). At 48 and 72 hours post-transfection, viral supernatants were collected and concentrated using a Lenti-X Concentrator (Takara). Viral titers were determined by serial dilution in relevant cell lines and reading %BFP+ by flow cytometry. Dilutions were performed with a minimum of 80% BFP+ cells selected for the experiment.

[0186] Validating variants A variant of iPSC-derived motor neuron cells was established by PCR amplification of UNC13A exon 19 to exon 21 (UNC13A_19_21 FWD5'-3'=CAACCTGGACAAGCGAACTG (sequence number 387), UNC13A_19_21 RVS5'-3'=GGGCTGCTCATCGTAGTAAAC (sequence number 388)). The resulting product was purified using Wizard SV gel and PCR clean-up columns (Promega) and submitted to Sanger and NGS (Amplicon EZ) (Genewiz).

[0187] Maintenance of iPSCs and Differentiation into Motor Neurons (iPSC-MN) iPSC lines were obtained from a public biobank (GM25256-Corriell Institute; NDS00262, NDS00209-NINDS) and maintained in mTeSR1 medium (StemCell Technologies) on Matrigel (Corning). iPSCs were fed daily and split every 4–7 days using ReLeSR (StemCell Technologies) according to the manufacturer's instructions. Differentiation of iPSCs into motor neurons was performed as previously described (41). In brief, iPSCs were dissociated, placed into ultra-low attachment flasks (Corning), and formed 3D spheroids in medium containing DMEMF12 / Neurabasal (Thermo Fisher), N2 supplement (Thermo Fisher), and B-27 supplement-Xeno-free (Thermo Fisher). Small molecules were added to induce neuronal precursor patterning of the spheroids (LDN193189, SB-431542, Chir99021) followed by motor neuron induction (RA, SAG, DAPT). After 14 days, neurospheroids were dissociated with papain and DNAse (Worthington Biochemical) and plated on poly-D-lysine / laminin-coated plates in Neurobasal medium (ThermoFisher) containing neurotrophic factors (BDNF, GDNF, CNTF; R&D Systems). For viral transduction, neuronal cultures were incubated for 18 hours with medium containing lentiviral particles for shScramble or shTDP-43. Infection efficiency of >90% was assessed by RFP expression. Seven days after transduction, neuronal cultures were analyzed for RNA and protein. [Table 13]

[0188] Human iPSC-neurons to detect UNC13A splice variants The complementary cDNA was generated from our previous publication (10) using CRISPRi-i 3 Neuronal iPSCs (iPSCs) 3 N). TDP-43 is downregulated by approximately 50%. Quantitative real-time PCR (RT-qPCR) was performed using SYBR GreenER qPCR SuperMix (Invitrogen). Samples were run in triplicate and RT-qPCR was performed on a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). The following primer pairs were used: UNC13A_CE FWD 5'-3'=TGGATGGAGAGATGGAACCT (SEQ ID NO: 379), UNC13A_CE RVS 5'-3'=GGGCTGTCTCATCGTAGTAAAC (SEQ ID NO: 380). Relative quantification was determined using the ΔΔCt method and normalized to endogenous controls RPLP0 and GAPDH (GAPDH FWD 5'-3'=GTTCGACAGTCAGCCGCATC (SEQ ID NO: 397), GAPDH RVS 5'-3'=GGAATTTGCCATGGGTGGA (SEQ ID NO: 398); RPLP0_2 FWD 5'-3'=TCTACAACCCTGAAGTGCTTGAT (SEQ ID NO: 399), RPLP0_2 RVS 5'-3'=CAATCTGCAGACAGACACTGG (SEQ ID NO: 400). Relative transcript levels of wild type UNC13A were normalized to healthy controls (mean set to 1).

[0189] Postmortem brain tissue for detecting UNC13A splice variants Postmortem brain tissues from FTLD-TDP patients and cognitively normal control individuals were obtained from the Mayo Clinic Florida Brain Bank. A trained neurologist and neuropathologist independently confirmed the diagnosis at neurological and pathological examination, respectively. Written informed consent was given by all participants or approved family members, and the entire protocol was approved by the Mayo Clinic Institutional Review Board and Ethics Committee. Complementary DNA (cDNA) from 500 ng of RNA (RIN ≥ 7.0) from the medial frontal cortex was available from a previous study, as were matched pTDP-43 data for samples (42). Quantitative real-time PCR (RT-qPCR) was performed in triplicate on all samples using SYBR GreenER qPCR SuperMix (Invitrogen, Carlsbad, CA, USA) following standard protocols. The primer pair used to detect UNC13A splice variants was UNC13A_CE FWD 5'-3'=TGGATGGAGAGATGGAACCT (SEQ ID NO: 379), UNC13A_CE RVS 5'-3'=GGGCTGTCTCATCGTAGTAAAC (SEQ ID NO: 380). RT-qPCR was performed on a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). Relative quantification was determined using the ΔΔCt method and normalized to endogenous controls RPLP0 and GAPDH (GAPDH FWD 5'-3'=GTTCGACAGTCAGCCGCATC (SEQ ID NO: 397), GAPDH RVS 5'-3'=GGAATTTGCCATGGGTGGA (SEQ ID NO: 398); RPLP0_2 FWD 5'-3'=TCTACAACCCTGAAGTGCTTGAT (SEQ ID NO: 399), RPLP0_2 RVS 5'-3'=CAATCTGCAGACAGACACTGG (SEQ ID NO: 400). Relative transcript levels were normalized to healthy controls (mean set to 1).

[0190] Quantification of UNC13A splice variants RNA-Seq data generated by the NYGC ALS Consortium cohort were downloaded from NCBI's Gene Expression Omnibus (GEO) database (GSE137810, GSE124439, GSE116622, and GSE153960). We used 1658 available and quality-controlled samples, classified as described in (10). After preprocessing and aligning reads to human (hg38), as described above, RSEM (v1.3.2) was used to estimate the expression of full-length UNC13A. The average TPM of UNC13A across all tissue samples from all individuals averaged 10.5. Duplicate PCRs were removed using MarkDuplicates in Picard Tools (2.23.0) using the command "MarkDuplicates REMOVE_DUPLICATES=true CREATE_INDEX=true". Bedtools (2.27.1) using the command "bedtools intersect-split" was used to quantify reads spanning either the "exon 19-exon 20" junction, the "exon 20-CE" junction, the "CE-exon 21" junction, or the "exon 20-exon 21" junction. Due to the relatively low expression levels of UNC13A in postmortem tissues and tissue heterogeneity, it is possible that not all tissues have enough detectable UNC13A for us to detect splice variants. Because UNC13A contains more than 40 exons, RNA-Seq coverage of mRNA transcripts is often not uniformly distributed (43), and we examined reads spanning the “exon 19-exon 20” junction contained in both the canonical isoform and the splice variant, with a strong correlation (Pearson's r = 0.99) between the number of reads mapped to the “exon 19-exon 20” junction and the number of reads mapped to the “exon 20-exon 21” junction.It was observed that samples with at least two reads spanning either the “exon 20-CE” junction or the “CE-exon 21” junction had either at least UNC13A TPM=1.55 or 20 reads spanning the “exon 19-exon 20” junction. Therefore, 1,151 samples with TPM ≥ 1.55 or at least 20 reads mapping to the “exon 19-exon 20” junction were selected as suitable samples for UNC13A splice variant analysis.

[0191] Genotyping of the rs12608932 and rs12973192 SNPs in human postmortem brain Genomic DNA (gDNA) was extracted from human frontal cortex using the Wizard Genomic DNA Purification Kit (Promega) according to the manufacturer's instructions. TaqMan SNP genotyping assays were performed on 20 ng of gDNA per assay using commercially available premixes consisting of primer pairs and VIC / FAM-labeled probes specific for each SNP (catalog no. 4351379, assay ID "43881386_10" for rs12608932 and assay ID "11514504_10" for rs12973192, Thermo Fisher Scientific) and run on a QuantStudio™ 7 Flex real-time PCR system (Applied Biosystems) according to the manufacturer's instructions. The PCR program was 60°C for 30 s, 95°C for 10 min, 40 cycles of 95°C for 15 s, 60°C (rs12973192) or 62.5°C for 1 min (rs12608932), and 60°C for 30 s.

[0192] Splicing reporter assay Minigene constructs were designed in silico, synthesized with GeneScript, and subcloned into a vector containing a GFP splicing control. HEK293T TDP-43 knockout cells and parental HEK-293T cells were cultured in standard P12 tissue culture plates (1.6 × 10 5 Cells (100 ng / well) were seeded on 100 wells of 1000-well cultures, allowed to attach overnight, and transfected with the indicated splicing reporter constructs (400 ng / well) using Lipofectamine 3000 transfection reagent (Invitrogen). Each reporter contained one of the splicing modules (shown in Figure 4E) expressed from a bidirectional promoter. 24 hours after transfection, RNA was extracted from these cells using the PureLink RNA Mini Kit (Life Technologies) with on-column PureLink DNase treatment according to the manufacturer's protocol. RNA was reverse transcribed into cDNA using the High Capacity cDNA Reverse Transcription Kit (Invitrogen) according to the manufacturer's instructions. PCR was performed using OneTaq 2X Master Mix with Standard Buffer (NEB) with the following primers: mCherry FWD 5'-3'=GTTCATGCGCTTCAAGGTG (SEQ ID NO: 407), mCherry RVS 5'-3'=TTGGTCACCTTCAGCTTGG (SEQ ID NO: 408); EGFP FWD 5'-3'=ACAGGTACTGTGCCTATCAAAG (SEQ ID NO: 409); EGFP RVS 5'-3'=TGTGGCGGATCTTGAAGTTAG (SEQ ID NO: 410) on a Mastercycler Pro (Eppendorf) thermocycler PCR machine. PCR products were separated by electrophoresis on a 1.5% TAE gel and imaged with a ChemiDox XRS+ System (BIO-RAD).

[0193] Generation of pTB UNC13A minigene construct The pTBUNC13A minigene construct containing the human UNC13A cryptic exon sequence and nucleotide flanking sequences upstream of the cryptic exon (50 bp of the end of intron 19 upstream of the cryptic exon, the entire exon 20, the entire sequence of intron 20) and downstream (approximately 300 bp intron 20) of the cryptic exon were amplified from human genomic DNA and subcloned into the NdeI site of the pTB vector using the following primers: FWD 5'-3'=AGGTCATATGCACTGCTATAGTGGGAAGTTC (SEQ ID NO: 411) and RVS 5'-3'=CTTACATATGTAATAACTCAACCACACTTCCATC (SEQ ID NO: 412). Note that a similar approach has been used previously to study TDP-43 splicing regulation of other TDP-43 targets (44).

[0194] Rescue of UNC13A splicing using pTB minigene and TDP-43 overexpression constructs HeLa cells were grown in Opti-MEM I reduced serum medium, GlutaMAX supplement (Gibco) supplemented with 10% fetal bovine serum (Sigma) and 1% penicillin / streptomycin (Gibco). For double transfection and knockdown experiments, cells were first transfected in serum-free medium with 1.0 μg of pTB UNC13A minigene construct and 1.0 μg of one of the following plasmids (GFP, GFP-TDP-43, or GFP-TDP-435FL) (constructs expressing tagged TDP-43 protein have been described previously (40, 44)) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Four hours after transfection, the medium was replaced with complete medium containing siLentfect (Bio-Rad) and siRNA complexes (AllStars Neg.Control siRNA or siRNA against TARDBP 3'UTR, a region not included in the TDP-43 overexpression construct) (Qiagen) according to the manufacturer's protocol. Cycloheximide (Sigma) was added to a final concentration of 100 μg / ml 6 hours before harvesting the cells. Cells were then harvested and RNA was extracted using TRIzol reagent (Zymo Research) according to the manufacturer's instructions. Approximately 1 μg of RNA was converted to cDNA using the High Capacityc DNA Reverse Transcription Kit with RNA inhibitors (Applied Biosystems). RT-qPCR assays were performed on the cDNA (diluted 1:40) with SYBR GreenER qPCR SuperMix (Invitrogen) using the QuantStudio7™ Flex Real-Time PCR System (Applied Biosystems). All samples were analyzed in triplicate. The RT-qPCR program was as follows: 50° C. for 2 min, 95° C. for 10 min, and 40 cycles of 95° C. for 15 s and 60° C. for 1 min. For dissociation curves, a dissociation stage of 95° C. for 15 s, 60° C. for 1 min, and 95° C. for 15 s was added to the end of the program. Relative quantification was determined using the ΔΔCt method and normalized to the endogenous controls RPLP0 and GAPDH.Relative transcript levels of wild-type UNC13A and GFP were normalized to the control siRNA condition (mean set to 1). The following primer pairs were used: [Table 14]

[0195] In situ hybridization UNC13A cryptic exon analysis in postmortem brain samples Patients and neuropathological diagnostic evaluation Postmortem brain tissue samples used in this study were obtained from the University of California, San Francisco (UCSF) Neurodegenerative Diseases Brain Bank. Table 6 presents demographic, clinical, and neuropathological information. Consent for brain donation was obtained from subjects or their surrogate decision makers in accordance with the Declaration of Helsinki and procedures approved by the UCSF Committee on Human Research. Brains were freshly cut into 1 cm thick coronal slabs, and alternating slices were fixed in 10% neutral buffered formalin for 72 h. Blocks from the medial frontal pole were dissected from the fixed coronal slabs, cryoprotected in graded sucrose solutions, frozen, and cut into 50 μm thick sections as described previously (45). Clinical and neuropathological diagnoses were performed as previously described (44). Subjects were selected based on clinical and neuropathological evaluations. Selected patients had a primary clinical diagnosis of behavioral variant frontotemporal dementia (bvFTD) with or without amyotrophic lateral sclerosis (ALS) / motor neuron disease (MND), and 2) a neuropathological diagnosis of frontotemporal lobar degeneration (FTLD)-TDP, type B. We excluded patients if they had a known disease-causing mutation: postmortem interval ≥ 24 h, Alzheimer's neuropathological changes > sparse, Tar amyloid phase > 2, Braak neurofibrillary tangle stage > 4, CERAD neuritic plaque density > sparse, and Lewy body disease > brainstem predominant (45). [Table 6]

[0196] In situ hybridization (ISH) and immunofluorescence To detect single RNA molecules, the BaseScope Red Assay kit (ACDBIO, USA) was used. One 50 μm thick fixed frozen tissue section from each subject was used for staining. Experiments were performed under RNase-free conditions, where necessary. Probes targeting the transcript of interest, UNC13A, specific for either the mRNA (exon 20 / 21 junction) or the cryptic exon containing the spliced ​​target (exon 20 / cryptic exon junction) were used. Positive (Homo sapiens PPIB) and negative (Escherichia coli DapB) control probes were also included. In situ hybridization was performed according to vendor specifications for the BaseScope Red assay kit. Briefly, frozen tissue sections were washed with PBS and placed under an LED growth light (HTG Supply, LED-6B240) chamber at 4 °C for 48 h to quench tissue autofluorescence. Sections were quickly rinsed with PBS to block endogenous peroxidase activity. Sections were transferred onto slides and allowed to dry overnight. Slides were subjected to target retrieval and protease treatment and then proceeded to ISH. The probes were detected with TSA Plus-Cy3 (Akoya Biosciences) and subjected to immunofluorescence staining using antibodies against TDP-43 (rabbit polyclonal, Proteintech, RRID:AB_615042) and NeuN (guinea pig polyclonal, Synaptic systems), and counterstained with DAPI (Life Technologies) for nuclei.

[0197] Image acquisition and analysis Z-stack images were captured using a Leica SP8 confocal microscope with a 63x oil immersion objective (1.4NA). For the RNA probe, image capture settings were established during initial acquisition based on PPIB and DAPB signals and remained constant for the UNC13A probe and across subjects. Image capture settings for TDP-43 and NeuN were modified based on differences in staining intensity between cases. For each case, six non-overlapping Z-stack images were captured across cortical layers 2-3. RNA puncta of UNC13A cryptic exons were quantified using the "Analyze Particles" plugin in ImageJ. Briefly, all images were brightness corrected and transformed into maximum intensity Z-projections using similar parameters, images were auto-thresholded (between modes), and puncta were counted (size: 6-infinity, circularity 0-1).

[0198] Linkage disequilibrium analysis Realigned VCF files generated by GATK HaplotypeCallers were downloaded from Answer ALS in July 2020. Sites in intron 20-21 were filtered using VCFtools (0.1.16). Filtered VCF files were merged using BCFtools (1.8). As some sites contained more than 2 alleles, we tested for genotype independence using chi-square statistics using the command "vcftools--geno-chisq--min-alleles2--max-alleles8" (4.0.0).

[0199] statistical methods Survival curves were compared using the coxph function in the survival(3.1.12) R package, which fit a multivariable Cox proportional hazards model including sex, reported genetic variants, and age at onset, and performing a score (log-rank) test. Effect sizes were reported as hazard ratios. The proportional hazards assumption was tested using the cox.zph() function. Survival curves were plotted using ggsurvplot() in the suvminer(v.0.4.8) R package.

[0200] After excluding all samples without cryptic exon signals (n=4), correlations between cryptic exon signals and the phosphorylation level of TDP-43 or the number of risk haplotypes were performed. Linear mixed-effects models were analyzed using the lmerTest R package (3.1.3).

[0201] Statistical analyses were performed and graphs were generated using R (version 4.0.0) or Prism 8 (GraphPad).

[0202] result To discover cryptic splicing targets regulated by TDP-43 that may also be involved in disease pathogenesis, recently generated RNA sequencing (RNA-seq) datasets were utilized (11). To identify changes associated with loss of TDP-43 from the nucleus, Liu et al. ingeniously realized that they could use fluorescence-activated cell sorting (FACS) to enrich for neuronal nuclei that did or did not contain TDP-43, and then perform RNA-seq to compare transcriptomes between TDP-43-positive and TDP-43-negative neuronal nuclei from seven frozen neocortex-derived postmortem brains of FTD / ALS patients. They identified a number of interesting differentially expressed genes (11). The current study did not look for differentially expressed genes as Liu et al., but instead explored novel alternative splicing events affected by loss of TDP-43. Splicing analysis was performed using two pipelines, MAJIQ (12) and LeafCutter (13), designed to detect novel splicing events (Figure 1A). Each RNA-seq library contained approximately 50M paired-end reads of 125 bp length, longer read length, and coverage, facilitating the discovery of splicing changes caused by loss of TDP-43. 197 alternative splicing events (P(ΔΨ>0.1)>0.95) (ΔΨ, change in local splicing diversity between the two conditions; P: probability) were identified by MAJIQ and 152 by LeafCutter (P<0.05). There were 65 alternatively spliced ​​genes in common between both analyses, likely because each tool uses different definitions of transcript variation and different criteria to control for false positives (Figure 1B). Notably, among the alternatively spliced ​​genes identified by both tools were STMN2 and POLDIP3, both of which have been extensively validated as bona fide TDP-43 splicing targets ( 8 – 10 , 14 ).

[0203] Unexpectedly, we found that UNC13A was one of the most prominent alternatively spliced ​​genes in neurons depleted of TDP-43 from the nucleus (Figure 1B and Figures 5A-5D). Depletion of TDP-43 leads to the inclusion of a 128 bp cryptic exon #1 (hg38; chr19:17642414-17642541) between canonical exons 20 and 21 (Figures 1C and 1D) or a ### bp cryptic exon #2 (hg38; chr19:17642414-17642591) between exons 20 and 21. Since a high frequency of 3' splice acceptor usage of chr19:17642541 was observed, the focus of the study is on the 128 bp cryptic exon #1. Hereinafter, in this example, unless otherwise specified, reference to a "cryptic exon" refers to the 128 bp "cryptic exon #1". This new exon, called CE#1 (cryptic exon), is absent in wild-type neuronal nuclei (Figure 1C) and is absent in any of the known human isoforms of UNC13A (15). Furthermore, analysis of ultraviolet crosslinking and immunoprecipitation (iCLIP) data for TDP-43 in SH-SY5Y cells (3) provides evidence that TDP-43 directly binds to an intron carrying this cryptic exon (Figure 1D). Insertion of the 128 bp cryptic exon sequence into the mature transcript was confirmed by direct sequencing. Intron 20-21 and CE sequences of UNC13A are conserved among most primates (Figures 6A and 6B), but not in mice, as are other cryptic splicing targets of STMN2 and TDP-43 (4, 8, 9). Overall, these results suggest that TDP-43 functions to suppress the inclusion of cryptic exons into the UNC13A mRNA transcript.

[0204] To test whether TDP-43 directly regulates this UNC13A cryptic splicing event, doxycycline-inducible shRNA was used to reduce TDP-43 levels in SH-SY5Y cells. Quantitative reverse transcription PCR (qRT-PCR) was used to detect the inclusion of the cryptic exon, which was present in cells depleted of TDP-43 (by treatment with shTARDBP) but not in control shRNA-treated cells (Figure 1E). Concomitant with the increase in cryptic exon levels was a corresponding decrease in the levels of the standard UNC13A transcript upon TDP-43 depletion (Figure 1E). A marked decrease in UNC13A protein in TDP-43-depleted cells was also observed by immunoblotting (Figure 1F, 1G). TDP-43 levels were measured in induced motor neurons (iMNs) (Figures 1H, 1I; Figures 7A and 7B) and in human iPSC-derived excitatory neurons (i 3 Depletion of TDP-43 leads to the inclusion of cryptic exons in UNC13A and reduced UNC13A mRNA and protein. Thus, reduced levels of TDP-43 in human cells and neurons leads to the inclusion of cryptic exons in the UNC13A transcript and reduced UNC13A protein.

[0205] UNC13A belongs to a gene family first discovered in C. elegans based on the uncoordinated (unc) motility exhibited by animals carrying mutations in these genes due to defects in neurotransmitter release (16). UNC13A encodes a large multidomain protein expressed in the nervous system that localizes to neuromuscular junctions and plays a key role in the vesicle priming step before synaptic vesicle fusion (17-20). In vitro studies demonstrate that a cryptic exon splicing event upon TDP-43 depletion causes a marked reduction in UNC13A expression (Figure 1F). Mice lacking Unc13a (also called Munc13-1) exhibit morphological defects in spinal motor neurons and functional deficits at the neuromuscular junction. These data suggest that depletion of TDP-43 results in loss of UNC13A function (21).

[0206] To extend this analysis of UNC13A cryptic exon inclusion to a larger collection of patient samples, we first analyzed a series of 115 frontal cortex brain samples from the Mayo Clinic Brain Bank and found a significant increase in UNC13A cryptic exon (CE) levels in FTLD-TDP patients compared to healthy controls (Figure 2A). We also observed a decrease in total UNC13A transcripts in the frontal cortex of several subtypes of FTD patients (Figure 8). Next, brain samples from the New York Genome Center (NYGC) were analyzed. After filtering for relatively high-quality data (Methods), this dataset contains RNA-seq data for 1151 samples from 413 individuals (multiple tissues per individual), of which 330 are ALS or FTD patients. FACS analysis by Liu et al. (11) showed that pathological neuronal nuclei with TDP-43 loss represent only about 7% of all neuronal nuclei and less than 2% of all cortical cells (11), and splicing analysis algorithms were expected to struggle to detect differentially spliced ​​genes in RNA-seq data generated from bulk RNA sequencing. To overcome this problem, we specifically searched for reads that spanned exon 20-CE and CE-exon 21 junctions. Due to noise generated from bulk sequencing, UNC13A splice variants were scored as present if there were more than two reads across at least one exon-exon junction. From 49 patients, we identified 63 samples that met the above criteria. Notably, we detected UNC13A splice variants in nearly 50% of frontal and temporal cortex tissues provided by neuropathologically confirmed FTLD-TDP patients. We also detected splice variants in some ALS patients without confirmed pathology (Figure 9). Notably, we did not observe UNC13A CE in any of the samples from FTLD-FUS (n=9), FTLD-TAU (n=18), and ALS-SOD1 (n=22) patients, nor in any of the control samples (n=197). Thus, UNC13A cryptic exon inclusion is a strong and specific aspect of pathology in TDP-43 proteinopathy (Figure 2B).

[0207] TDP-43 becomes phosphorylated when it is depleted from the nucleus and accumulates in the cytoplasm. Hyperphosphorylated TDP-43 (pTDP-43) is a key feature of the pathology (22). To determine the relationship between pTDP-43 levels and UNC13A cryptic exon inclusion, we analyzed a set of 86 FTD patients from the Mayo Clinic Brain Bank, for whom RNA-seq and pTDP-43 levels were obtained from the frontal cortex. A significant association between higher pTDP-43 levels and higher levels of UNC13A cryptic exon inclusion was found in patients with all disease subtypes (Spearman's ρ = 0.564, P < 0.0001) (Figures 3C and 3D, and Figure 10A; figures using untransformed data: Figures 10E and 10F). Levels of total UNC13A transcripts were also negatively correlated with pTDP-43 levels (Figures 10B, 10C, 10G, and 10H). Thus, inclusion of UNC13A cryptic exons and reduced full-length transcript levels appear to be common features of multiple TDP-43 proteinopathies and strongly correlate with the burden of TDP-43 pathology.

[0208] To visualize UNC13A CE with single-cell sensitivity with spatial resolution, we designed custom BaseScope™ in situ hybridization probes that specifically bind to exon 20-exon 21 (Figure 11A) or exon 21-CE junctions (Figure 11B). To minimize potential binding to pre-mRNA, the probes were designed to span exon-exon junctions. These probes were used for in situ hybridization along with immunofluorescence for NeuN (detecting neurons) and TDP-43 (detecting nuclear or cytoplasmic TDP-43). Sections of the medial frontal pole of four FTLD-TDP patients and three controls were stained. Using the exon 21-CE probe, strong UNC13A CE inclusion was detected in nearly all neurons depleted of TDP-43 from the nucleus, but not in neurons with TDP-43 in the nucleus (Figure 3A, Figures 11C and 11E). Using an exon 20 / 21 probe, UNC13A mRNA was detected in both case and control neurons (Figure 3B, Figure 11D). The inclusion of the cryptic exon in UNC13A is now considered a strong aspect of FTLD-TDP pathology. UNC13A is one of the top GWAS hits for ALS and FTD-ALS, replicated in multiple studies (23-28). SNPs in UNC13A are associated with increased risk of sporadic ALS (24) and sporadic FTD with TDP-43 pathology (23). In addition to increased susceptibility to ALS, SNPs in UNC13A are also associated with shorter survival in ALS patients (29-32). However, the mechanism by which genetic variations in UNC13A increase risk for ALS and FTD is unclear. Notably, the two most significantly associated SNPs, rs12608932 (A>C) and rs12973192 (C>G), are both located in the same intron that we found to harbor the cryptic exon, with rs12973192 located to the right of the cryptic exon itself (Figure 4A), which immediately suggested the hypothesis that these SNPs (or other nearby genetic variations tagged by these SNPs) may predispose UNC13A to cryptic exon inclusion upon TDP-43 depletion.To test this hypothesis, we analyzed the proportion of RNA-seq reads spanning introns 20-21 that support the inclusion of cryptic exons (Figures 12A and 12B). Of the seven RNA-seq libraries from TDP-43-depleted neuronal nuclei included in the initial splicing analysis, two of three patients were homozygous (G / G) and one patient who was heterozygous (C / G) for the risk allele at rs12973192 showed inclusion of the cryptic exon in nearly all UNC13A mRNAs that mapped to introns 20-21. In contrast, patients who were homozygous (C / C) for the reference allele showed very little inclusion of the cryptic exon. An alternative way to directly assess the impact of UNC13A risk alleles on inclusion of cryptic exons is to measure potential allelic imbalance in RNA from individuals who by chance are heterozygous for the risk allele. In other words, are there equal numbers of RNAs with cryptic exon inclusion generated from risk and protective alleles? Or are there more with risk alleles? Two of the iMN lines used to detect cryptic exon inclusion upon TDP-43 knockdown (Figure 1G, iMN1 and iMN2) are heterozygous (C / G) for rs12973192. We sequenced RT-PCR products spanning the cryptic exon to analyze the allele distribution of these two samples, as well as one patient sample from the original RNA-seq dataset (Figure 1A) that is heterozygous (C / G) at rs12973192 (Figure 12B). A significant difference between the proportion of C alleles and the proportion of G alleles was found in spliced ​​variants, with the risk allele more abundant (p-value = 0.01, two-tailed paired t-test; Figure 4B and Figure 12C). Given this evidence of the influence of risk alleles on cryptic exon inclusion, we extended our analysis by genotyping FTD-TDP patients (n=86) from the Mayo Clinic Brain Bank dataset for UNC13A risk alleles at rs12973192 and rs12608932. We excluded one patient who was homozygous (C / C) for the reference allele at rs12973192 but heterozygous (A / C) at rs12608932.The remaining patients (n=85) have exactly the same number of risk alleles at both loci. The correlation between the level of cryptic exon inclusion (in frontal cortex RNA-seq) and the number of risk alleles at rs12973192 was first modeled as a simple linear regression - a strong correlation (P=0.0136) was found between the number of risk alleles and the abundance of UNC13A cryptic exon inclusion (Figure 4C). After including other known variables such as TDP-43 phosphorylation levels, sex, genetic mutations, and disease type as predictors of UNC13A cryptic exon abundance in the multiple linear regression model (corrected R20 = 0.001). 2 = 0.3616, figure and statistics from untransformed data, Figure 13A), the number of risk alleles was found to be one of the strongest predictors of cryptic exon inclusion (p-value = 0.00792, figure from untransformed data, Figure 13B), but not of overall UNC13A expression levels (Figures 13C and 13D, untransformed data, Figures 13E and 13F). Taken together, these data suggest that genetic variations in UNC13A that increase risk for ALS and FTD in humans promote the inclusion of cryptic exons upon nuclear depletion of TDP-43.

[0209] GWAS SNPs usually do not cause traits but rather "tag" other adjacent genetic variations (33). Thus, a major challenge in human genetics is to go from GWAS hits to identifying genetic variations that cause increased disease risk (34). A LocusZoom (35) plot (Figure 4A), generated using linear mixed model analysis of the ALS GWAS results (36), suggests that the strongest association signal to UNC13A is indeed in the region surrounding the two lead SNPs (rs12973192 and rs12608932). To search for other genetic variants in intron 20-21 that may also cause disease risk by affecting the inclusion of cryptic exons but were not included in the original GWAS, we analyzed genetic variants identified in whole genome sequencing data of ALS patients (Answer ALS). This dataset includes 297 ALS patients of European ancestry. We searched for novel genetic variants that could be tagged by the two SNPs by looking for other loci in intron 20-21 that are in linkage disequilibrium with both rs12608932 and rs12973192. One that fit these criteria was found - rs56041637 (FDR-corrected P-value < 0.0001 for rs12608932 and P-value < 0.0001 for rs12973192) (Figure 14). rs56041637 is a CATC repeat insertion. In the patient dataset, it was observed that patients homozygous for the risk alleles at both rs12608932 and rs12973192 tended to have 3-5 CATC repeats at rs56041637; patients homozygous for the reference alleles at both rs12608932 and rs12973192 tended to have short (0-2) repeats at rs56041637. Thus, in addition to the two major GWAS SNPs (rs12608932 and rs12973192), another one, rs56041637, is now nominated as a potential cause of disease risk by predisposing UNC13A to cryptic exon inclusion when TDP-43 is depleted from the nucleus.

[0210] To directly test whether these three variants in UNC13A, which are part of the FTD / ALS risk haplotype, increase the inclusion of cryptic exons upon TDP-43 depletion, we synthesized minigene reporter constructs containing either the risk haplotype or the protective haplotype (Figure 4F). The reporters co-express full-length EGFP and mCherry constructs separated by UNC13A intron 20-21 with either the reference sequence (control) or the ALS / FTD risk alleles of rs12608932 (C), rs56041637 ((CATC)4), and rs12973192 (G) using a bidirectional reporter. WT and TDP-43-deficient HEK-293T cells, which do not endogenously express UNC13A (37), were transfected with each minigene reporter construct. Using RT-PCR, we found that both versions of intron 20-21 were efficiently spliced ​​out in WT cells (Figure 4G, lanes 1-4). However, in TDP43- / - cells, there was a reduction in splicing products that completely excise intron 20-21. Instead, they splice out products that contain the cryptic exon, a longer variant of the cryptic exon (cryptic exon #2) (Figure 5A), or both CE and intron 20-CE (Figure 4G, lanes 5-6). Strikingly, in TDP-43- / - cells transfected with a minigene construct carrying a risk haplotype in the intron, there is an even greater reduction in complete intron 20-21 splicing, with a concomitant increase in cryptic splicing products (Figure 4G, lanes 7-8). Expression of the TDP-43-independent splicing reporter and the efficiency of the splicing mechanism are indicated by the expression levels of TDP-43-independent EGFP. We also tested this construct with the UNC13A intron embedded in the context of a different minigene reporter construct, the CFTR gene.Knockdown of TDP-43 in HeLa cells transfected with this construct resulted in a missplicing defect.Demonstrating a direct role for TDP-43 in regulating this splicing event, expression of WT TDP-43 (but not an RNA-binding-deficient mutant version in which five phenylalanine residues were mutated to leucine (5FL)) rescued the missplicing (Figure 4H). Overall, these two assays provide direct functional evidence that 1) TDP-43 regulates splicing of UNC13A intron 20-21 and 2) genetic variants associated with ALS and FTD susceptibility enhance inclusion of cryptic exons when TDP-43 is dysfunctional.

[0211] To define whether these SNPs affect survival in FTD-ALS patients (n=205) from the Mayo Clinic Brain Bank, we assessed the association of risk haplotypes with survival time after onset of the disease. Using Cox multivariate analysis corrected for other factors known to affect survival (gene mutations, sex, age at onset), risk haplotypes were associated with survival time under an additive model (log-rank p-value=0.01) (Figure 4I). The number of risk haplotypes carried by an individual was a strong prognostic factor (hazard ratio (HR)=1.733, p-value=0.00717) (Figure 15A). This association remained significant under a dominant model (log-rank test p-value=0.05, Figures 15B and 15C) as well as a recessive model (log-rank test p-value=0.02, Figures 15D and 15E), indicating that carrying a risk haplotype reduces patients' survival time after disease onset. The effect was more pronounced when including only patients with either the C9ORF72 hexanucleotide repeat expansion or GRN mutations (Figures 16A-16F). Thus, genetic alterations in UNC13A that increase the inclusion of cryptic exons are associated with decreased patient survival.

[0212] Here, we found that TDP-43 controls the cryptic splicing events of the FTD / ALS gene UNC13A. The most important genetic variants associated with disease risk, including the new ones we list here, are located within the introns that carry the cryptic exons themselves. Brain samples from FTLD-TDP patients carrying these SNPs showed more inclusions of UNC13A cryptic exons than samples from FTLD-TDP patients that do not contain risk alleles. These risk alleles do not seem to be sufficient to cause the inclusion of cryptic exons, since we do not detect it in the RNA-seq data of healthy control samples (e.g., GTEx). Instead, the risk alleles of UNC13A are true genetic risk factors or modifiers, and the cryptic splicing events depend on TDP-43 loss. Thus, it is proposed that the UNC13A risk allele acts as a kind of Achilles heel, lurking beneath the surface and not causing problems until TDP-43 starts to malfunction (Figure 4J). Severe loss-of-function mutations in the UNC13A coding region are not expected to be observed, as they cause early lethality as in mice. SNPs that promote the inclusion of cryptic exons appear to be harmless on their own, but become harmful only if TDP-43 function is compromised (e.g., by mutation or nuclear depletion). The discovery of novel TDP-43-dependent cryptic splicing events in bona fide FTD-ALS risk genes opens up many new directions for validating UNC13A as a biomarker and therapeutic target in ALS and FTD. It remains a mystery why TDP-43 pathology is associated with ALS or FTD or FTD / ALS, or other age-related neuropathological changes (38). Dysfunction-associated cryptic splicing of TDP-43 occurs across diverse regions and neuronal contexts in the human brain.It is tempting to speculate that in addition to STMN2 and, here, UNC13A, there may be a disease-subtype-specific portfolio of other important cryptic exonic splicing events (and genetic variations that increase or decrease susceptibility to some of these events) that account for the heterogeneity of the clinical manifestations of TDP-43 dysfunction.

[0213] Example 2: Inhibition of cryptic exon splice variants of UNC13A using antisense oligonucleotides Antisense oligonucleotides (ASOs) targeting UNC13A transcripts are synthesized (Tables 2-5) and delivered into cultured iPSC-derived motor neurons (MNs) by either lipid transfection or gymnosis method (free-uptake method). iMNs are cultured in the presence of ASOs for 2-3 days, after which lentiviruses delivering either scrambled or TDP-43-targeting shRNAs are transduced. Cells are cultured for an additional 4-5 days after lentiviral infection, after which mRNA and protein isolation is performed. mRNA is reverse transcribed into cDNA and subjected to qPCR using primers / probes specific for inclusion of UNC13A cryptic exons, in addition to primers / probes targeting properly spliced ​​(WT) UNC13A and housekeeping genes. Protein lysates were processed for UNC13A detection by Western blot. [Table 2-1] [Table 2-2] [Table 2-3] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 4-1] [Table 4-2] [Table 4-3] [Table 5-1] [Table 5-2] [Table 5-3]

[0214] Example 3: Screening of antisense oligonucleotides Antisense oligonucleotides (ASOs) were designed to target cryptic exons of the UNC13A transcript (Table 7A). ASOs 1-45 (SEQ ID NOs: 423-467) in Table 7B are 18-mers that tile the 5' end of the cryptic exon containing the splice acceptor region (SEQ ID NO: 641) at 3 nucleotide intervals. ASOs 121-142 (SEQ ID NOs: 468-489) in Table 7B are 18-mers that tile the 5' end of the cryptic exon at 1 nucleotide intervals. ASOs 248-280 (SEQ ID NOs: 490-522) in Table 7B are 18-mers that tile the 3' end of the cryptic exon containing the splice donor region (SEQ ID NO: 642) at 3 nucleotide intervals. The genomic coordinates of the ASOs are shown as follows: 5' end of the hidden exon: chr19:17,642,491-17,642,641; 3' end of the hidden exon: chr19:17,642,363-17,642,470. ASOs with 2'MOE modifications targeting hidden exons of the UNC13A transcript were synthesized (Table 7B) and delivered to cultured iPSC-derived motor neurons (MNs) at a concentration of 3 mM by free uptake. Motor neurons were cultured in the presence of UNC13A-specific ASOs and three non-targeting ASOs for 2 days, after which lentiviruses delivering either scrambled or TDP-43-targeting shRNAs were transduced. Cells were cultured for an additional 7 days after lentivirus infection, after which mRNA was isolated. The mRNA was reverse transcribed to cDNA and subjected to qPCR using primers / probes specific for the inclusion of UNC13A cryptic exons (Figures 19A-19B) in addition to primers / probes targeting properly spliced ​​UNC13A (Figures 19C-19D). Regions were identified where active ASOs reduced the inclusion of cryptic exons while increasing total UNC13A RNA levels (5' splice acceptor region ASOs: ASOs 1-10 and 17-21 corresponding to SEQ ID NOs: 423-432 and 439-443; 3' splice donor region ASOs: ASOs 249-256, 260-265, and 271-272 corresponding to SEQ ID NOs: 491-498, 502-507, and 513-514, respectively). 21mer ASOs were designed to further tile these regions (Table 8B).ASOs 306-354 (SEQ ID NOs: 523-571) in Table 8B are 21-mers that tile the 5' end of the hidden exon (SEQ ID NO: 643) at 1 nucleotide intervals. ASOs 355-423 (SEQ ID NOs: 572-640) in Table 8B are 21-mers that tile the 3' end of the hidden exon (SEQ ID NO: 644) at 1 nucleotide intervals. [Table 7A] [Table 7B-1] [Table 7B-2] [Table 7B-3] [Table 8A] [Table 8B-1] [Table 8B-2] [Table 8B-3] [Table 8B-4] [Table 9]

[0215] References 1. C. Lagier-Tourenne, M. Polymenidou, DWCleveland, TDP-43 and FUS / TLS: Emerging roles in RNA processing and neurodegeneration. Hum. Mol. Genet. (2010), doi:10.1093 / hmg / ddq137. 2.M.Polymenidou,C.Lagier-Tourenne,K.R.Hutt,S.C.Huelga,J.Moran,T.Y.Liang,S.C.Ling,E.Sun,E.Wancewicz,C.Mazur,H.Kordasiewicz,Y.Sedaghat,J.P.Donohue,L.Shiue,C.F.Bennett,G.W.Yeo,D.W.Cleveland,Long pre-mRNA depletion and RNA missplicing contribute to neuronal vulnerability from loss of TDP-43.Nat.Neurosci.(2011),doi:10.1038 / nn.2779. 3.J.R.Tollervey,T.Curk,B.Rogelj,M.Briese,M.Cereda,M.Kayikci,J.Konig,T.Hortobagyi,A.L.Nishimura,V.Zupunski,R.Patani,S.Chandran,G.Rot,B.Zupan,C.E.Shaw,J.Ule,Characterizing the RNA targets and position-dependent splicing regulation by TDP-43.Nat.Neurosci.(2011),doi:10.1038 / nn.2778. 4.J.P.Ling,O.Pletnikova,J.C.Troncoso,P.C.Wong,TDP-43 repression of nonconserved cryptic exons is compromised in ALS-FTD.Science(80-.).(2015),doi:10.1126 / science.aab0983. 5.A.Donde,M.Sun,J.P.Ling,K.E.Braunstein,B.Pang,X.Wen,X.Cheng,L.Chen,P.C.Wong,Splicing repression is a major function of TDP-43 in motor neurons.Acta Neuropathol.(2019),doi:10.1007 / s00401-019-02042-8. 6.M.Sun,W.Bell,K.D.LaClair,J.P.Ling,H.Han,Y.Kageyama,O.Pletnikova,J.C.Troncoso,P.C.Wong,L.L.Chen,Cryptic exon incorporation occurs in Alzheimer’s brain lacking TDP-43 inclusion but exhibiting nuclear clearance of TDP-43.Acta Neuropathol.(2017),doi:10.1007 / s00401-017-1701-2. 7.Y.H.Jeong,J.P.Ling,S.Z.Lin,A.N.Donde,K.E.Braunstein,E.Majounie,B.J.Traynor,K.D.LaClair,T.E.Lloyd,P.C.Wong,Tdp-43 cryptic exons are highly variable between cell types.Mol.Neurodegener.(2017),doi:10.1186 / s13024-016-0144-x. 8.J.R.Klim,L.A.Williams,F.Limone,I.Guerra San Juan,B.N.Davis-Dusenbery,D.A.Mordes,A.Burberry,M.J.Steinbaugh,K.K.Gamage,R.Kirchner,R.Moccia,S.H.Cassel,K.Chen,B.J.Wainger,C.J.Woolf,K.Eggan,ALS-implicated protein TDP-43 sustains levels of STMN2,a mediator of motor neuron growth and repair.Nat.Neurosci.(2019),doi:10.1038 / s41593-018-0300-4. 9.Z.Melamed,J.Lopez-Erauskin,M.W.Baughn,O.Zhang,K.Drenner,Y.Sun,F.Freyermuth,M.A.McMahon,M.S.Beccari,J.W.Artates,T.Ohkubo,M.Rodriguez,N.Lin,D.Wu,C.F.Bennett,F.Rigo,S.Da Cruz,J.Ravits,C.Lagier-Tourenne,D.W.Cleveland,Premature polyadenylation-mediated loss of stathmin-2 is a hallmark of TDP-43-dependent neurodegeneration.Nat.Neurosci.(2019),doi:10.1038 / s41593-018-0293-z. 10.M.Prudencio,J.Humphrey,S.Pickles,ALBrown,SEHill,J.M.Kachergus,J.Shi,MGHeckman,MRSpiegel,C.Cook,Y.Song,M.Yue,LMDaughrity,Y.Carlomagno,K.Jansen-West,CFde Castro,M.DeTure,S.Koga,Y.C.Wang,P.Sivakumar,C.Bodo,A.Candalija,K.Talbot,B.T.Selvaraj,K.Burr,S.Chandran,J.Newcombe,T.Lashley,I.Hubbard,D.Catalano,D.Kim,N.Propp,S.Fennessy,D.Fagegaltier,H.Phatnani,M.Secrier,EMCFisher,B.Oskarsson,M.van Blitterswijk,R.Rademakers,NRGraff-Radford,BFBoeve,DSKnopman,RCPetersen,KAJosephs,E.Aubrey Thompson,T.Raj,M.Ward,DWDickson,TFGendron,P.Fratta,L.Petrucelli,Truncated stathmin-2 is a marker of TDP-43 pathology in frontotemporal dementia.J.Clin.Invest.(2020),doi:10.1172 / JCI139741. 11.EYLiu,J.Russ,CPCali,JMPhan,A.Amlie-Wolf,EBLee,Loss of Nuclear TDP-43 Is Associated with Decondensation of LINE Retrotransposons.Cell Rep.(2019),doi:10.1016 / j.celrep.2019.04.003. doi:10.7554 / eLife.11752 [ PubMed ] 12. Vaquero-Garcia, A. Barrera, MRGazzara, J. Gonzalez-Vallinas, NFLahens, JB Hogenesch, KWLynch, Y. Barash. http: / / dx.doi.org / 10.1038 / s41588-017-0004-9. [ PubMed ] [ Cross Ref ] 14. Shiga, T. Ishihara, A. Miyashita, M. Kuwabara, T. Kato, N. Watanabe, A. Yamahira, C. Kondo, A. Yokoseki, M. Takahashi, R. Kuwano, A. Kakita, M. Nishizawa, H. Takahashi, O. Onodera of TDP-43 in tissues affected with ALS.PLoS One(2012),doi:10.1371 / journal.pone.0043120. 15.LJCarithers,K.Ardlie,M.Barcus,PABranton,A.Britton,SABuia,CCCompton,DSDeluca,J.Peter-Demchok,ETGelfand,P.Guan,GE Korzeniewski,NCLockhart,CARabiner,AKRao,KLRobinson,NVRoche,SJSawyer,AVSegre,CEShive,AMSmith,LHSobin,AHUndale,KMVal entino,J.Vaught,TRYoung,HMMoore,L.Barker,M.Basile,A.Battle,J.Boyer,D.Bradbury,JPBridge,A.Brown,R.Burges,J.Choi,D.C olantuni,N.Cox,ETDermitzakis,LKDerr,MJDinsmore,K.Erickson,J.Fleming,T.Flutre,BAFoster,ERGamazon,GGetz,BMGillard,R .Guigo,KWHambright,P.Hariharan,R.Hasz,HKIm,S.Jewell,E.Karasik,M.Kellis,P.Kheradpour,S.Koester,D.Koller,A.Konkashba ev,T.Lappalainen,R.Little,J.Liu,E.Lo,JTLonsdale,C.Lu,DGMacArthur,H.Magazine,JBMaller,Y.Marcus,DCMash,MIMcCarthy,J. McLean,B.Mestichelli,M.Miklos,J.Monlong,M.Mosavel,MTMoser,S.Mostafavi,DLNicolae,J.Pritchard,L.Qi,K.Ramsey,MARivas, BERobles,DCRohrer,M.Salvatore,M.Sammeth,J.Seleski,S.Shad,LASiminoff,M.Stephens,J.Struewing,T.Sullivan,S.Sullivan,J.Syron,D.Tabor,M.Taherian,J.Roof,GFemple,JAThomas,AWThomson,D.Tidwell,HMTraino,Z.Tu,DRValley,S.Volpi,GDWalters,LDW ard, X. Wen, W. Winckler, S. Wu, J. Zhu, A. Abdallah, A. Addington, J. MAnderson, P. Bender, M. Cosentino, N. Diaz-Mayoral, T. Engel, F. Garc i,A.Green,T.Hammond,K.Jaffe,J.Keen,M.Kennedy,P.Kigonya,B.Lander,S.Nampally,C.Ny,J.Robb,V.Santhanum,N.Sharopova,S.Sin gh,C.Soria,A.Sturcke,S.Sugar,EJThomson,M.Tomaszewski,C.Trowbridge,F.Udoye,D.Vanscoy,N.Vatanian,ELWilder,P.Williams,A Novel Approach to High-Quality Postmortem Tissue Procurement:The GTEx Project.Biopreserv.Biobank.(2015),doi:10.1089 / bio.2015.0032. 16. S. Brenner, The genetics of Caenorhabditis elegans.Genetics(1974), doi:10.1093 / genetics / 7 17.N.Lipstein,NMVerhoeven-Duif,FEMichelassi,N.Calloway,PMVan Hasselt,K.Pienkowska,G.Van Haaften,MMVan Haelst,R.Van Empelen,I.Cuppen,HCVan Teeseling,AMVEvelein,JAVorstman,S.Thoms,O.Jahn,KJDuran,GRMonroe,TARyan,H.Taschenberger,JSDittman,JSRhee,G.Visser,JJJans,N.Brose,Synaptic UNC13A protein variant causes increased neurotransmission and dyskine movement disorder.J.Clin.Invest.(2017),doi:10.1172 / JCI90259. 18.L.Deng,PSKaeser,W.Xu,TCSudhof,RIM proteins activate vesicle priming by reversing autoinhibitory homodimerization of munc13.Neuron(2011),doi:10.1016 / j.neuron.2011.01.005. 19.I.Augustin,C.Rosenmund,TCSudhof,N.Brose,Munc13-1 is essential for fusion competence of glutamatergic synaptic vesicles.Nature(1999),doi:10.1038 / 22768. 20.M.A.Bohme,C.Beis,S.Reddy-Alla,E.Reynolds,M.M.Mampell,A.T.Grasskamp,J.Lutzkendorf,D.D.Bergeron,J.H.Driller,H.Babikir,F.Gottfert,I.M.Robinson,C.J.O’Kane,S.W.Hell,M.C.Wahl,U.Stelzl,B.Loll,A.M.Walter,S.J.Sigrist,Active zone scaffolds differentially accumulate Unc13 isoforms to tune Ca2+ channel-vesicle coupling.Nat.Neurosci.(2016),doi:10.1038 / nn.4364. 21.F.Varoqueaux,M.S.Sons,J.J.Plomp,N.Brose,Aberrant Morphology and Residual Transmitter Release at the Munc13-Deficient Mouse Neuromuscular Synapse.Mol.Cell.Biol.(2005),doi:10.1128 / mcb.25.14.5973-5984.2005. 22.M.Hasegawa,T.Arai,T.Nonaka,F.Kametani,M.Yoshida,Y.Hashizume,T.G.Beach,E.Buratti,F.Baralle,M.Morita,I.Nakano,T.Oda,K.Tsuchiya,H.Akiyama,Phosphorylated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis.Ann.Neurol.(2008),doi:10.1002 / ana.21425. 23.FPDiekstra,VMVan Deerlin,JCVan Swieten,A.Al-Chalabi,ACLudolph,JHWeishaupt,O.Hardiman,JELanders,RHBrown,MAVan Es,RJPasterkamp,M.Koppers,PMAndersen,K.Estrada,F.Rivadeneira,A.P.Hofferman,A.P. Damme,J.Melki,V.Meininger,A.Shatunov,CEShaw,PNLeigh,PJShaw,KEMorrison,I.Fogh,A.Chio,BJTraynor,D.Czell,M.Weber,P.Heutink,PIWDe Bakker,V.Silani,W.Robberecht,LHVJan,JV,Denf272,and UNC13A are shared risk loci for amyotrophic lateral sclerosis and frontotemporal dementia:A genome-wide meta-analysis.Ann.Neurol.(2014),doi:10.1002 / ana.24198. 24.MAVan Es,JHVeldink,CGJSaris,HMBlauw,PWJVan Vught,A.Birve,R.Lemmens,HJSchelhaas,EJNGroen,MHBHuisman,AJVan Der Kooi,M.De Visser,J.Dahlberg,K.Estrada,F.Rivadeneira,A.Hofman,MJZwartz,PTCVan Doormaal,D.Rujescu,E.Strengman,I.Giegling,P.Muglia,B.Tomik,A.Slowik,AGUitterlinden,C.Hendrich,S.Waibel,T.Meyer,ACLudolph,JDGlass,S.Purcell,S.Cichon,MMNothen,HEWichmann,ShMreber,ShM. rmeulen,LAKiemeney,JHJWokke,S.Cronin,RLMcLaughlin,O.Hardiman,K.Fumoto,RJPasterkamp,V.Meininger,J.Melki,PNLeigh,CEShaw,JELanders,A.Al-Chalabi,RHBrown,W.Robberecht,PMAndersen,HRAVOffsen,HRFO Den Berg,Genome-wide association study identifies 19p13.3(UNC13A)and 9p21.2 as susceptibility loci for sporadic amyotrophic lateral sclerosis.Nat.Genet.(2009),doi:10.1038 / ng.442. 25.A.Nicolas,K.Kenna,AERenton,N.Ticozzi,F.Faghri,R.Chia,JADominov,BJKenna,MANalls,P.Keagle,AMRivera,W.van Rheenen,NAMurphy,JJFAvan Vugt,JTGeiger,R.van der Spek,HAPliner,Shankaracharya,BNSmith,G.Marangi,SDTopp,Y.Abramzon,ASGkazi,JDEicher,A.Kenna,FOLogullo,I.Simone,G.Logroscino,F.Salvi,I.Bartolomei,G.Borgh ero,MRMurru,E.Costantino,C.Pani,R.Puddu,C.Caredda,V.Piras,S.Tranquilli,S.Cuccu,D.Corongiu,M.Melis,A.Milia,F.Marrosu,MGMarrosu,G.Floris,A.Cannas,M.Capas so,C.Caponnetto,G.Mancardi,P.Origone,P.Mandich,FLConforti,S.Cavallaro,G.Mora,K.Marinou,R.Sideri,S.Penco,L.Mosca,C.Lunetta,GLPinter,M.Corbo,N.Riva,P.Ca rrera,P.Volanti,J.Mandrioli,N.Fini,A.Fasano,L.Tremolizzo,A.Arosio,C.Ferrarese,F.Trojsi,G.Tedeschi,MRMonsurro,G.Piccirillo,C.Femiano,A.Ticca,E.Ortu,V.La Bella,R.Spataro,T.Colletti,M.Sabatelli,M.Zollino,A.Conte,M.Luigetti,S.Lattante,M.Santarelli,A.Petrucci,M.Pugliatti,A.Pirisi,LDParish,P.Occhineri,F.Giannini,C.CaDBatticcini,M.Loi, A. Calvo, C. Moglia, M. Brunetti, M. Barberis, G. Restagno, F. Casale, G. Marrali, G. Fuda, I. Ossola, S. Cammarosano, A. Canosa, A. Ilardi, U. Manera, M. Grassano, R. Tanel, F. Pisano, L. Mazzini, S. Messina, S. D'Alfonso, L. Corrado, L. Ferrucci, M. B. Harms, D. B. Goldstein, N. A. Shneider, S. Goutman, Z. Simmons, T. M. Miller, S. Chandran, S. Pal, G. Manousakis, S. Appel, E. Simpson, L. Wang, R. H. Baloh, S. Gibson, R. S. Bedlack, D. Lacomis, D. Sareen, A. Sherman, L. Bruijn, M. Penny, C. de AMMoreno,S.Kamalakaran,ASAllen,BEBoone,R.Brown,JPCarulli,A.Chesi,WKChung,ETCirulli,GMCooper,J.Couthouis,AGDay-Williams,PADion,ADGitler,J.Glass,Y.Han,T.Harris,SDHayes,ALJones,J.Keebler,BJKrueger,BNLasseigne,SELe vy,YFLu,T.Maniatis,D.McKenna-Yasek,RMMyers,S.Petrovski,SMPulst,ARRaphael,J.Ravits,Z.Ren,GARouleau,PCSapp, KBSims,JFStaropoli,LLWaite,Q.Wang,JRWimbish,WWXin,H.Phatnani,J.Kwan,JRBroach,X.Arcila-Londono,EBLee,VMVan Deerlin, E. Fraenkel, LWOstrow, F. Baas, N. Zaitlen, JDBerry, A. Malaspina, P. Fratta, G.A.Cox, L.M.Thompson, S.Finkbeiner,E.Dardiotis,E.Hornstein,DJMacGowan,T.Heiman-Patterson,MGHammell,NAPatsopoulos,J.Dubnau,A.N ath,RLMusunuri,USEvani,A.Abhyankar,MCZody,J.Kaye,S.Wyman,A.LeNail,L.Lima,JDRothstein,CNSvendsen,J.Van Eick,NJMaragakis,SJKolb,M.Judkowicz,E.Baxi,M.Benatar,JPTaylor,G.Wu,E.Rampersaud,J.Wuu,R.Rademakers,S.Zuchner, R.Schule,J.McCauley,S.Hussain,A.Cooley,M.Wallace,J.Clayman,R.Barohn,J.Statland,A.Swenson,J.Jackson,J.Trivedi, S.Khan,J.Katz,L.Jenkins,T.Burns,K.Gwathmey,J.Caress,J.McMillan,L.Elman,E.Pioro,J.Heckmann,Y.So,D.Walk,S.Mais er,J.Zhang,V.Silani,J.Gellera,A.Ratti,F.Taroni,G.Lauria,F.Verde,I.Fogh,J.Tiloca,GPComi,G.Soraru,J.Cereda,F.De Marchi,S.Gorti,M.Geroni,G.Siciliano,M.Filosto,M.Inghilleri,S.Peverelli,J.Colombrita,B.Poletti,L.Maderna,R.Del Bo,S.Gagliardi,G.Querin,C.Bertolin,V.Penzato,B.Castellotti,W.Camu,K.Mouzat,S.Lumbroso,P.Gorcia,V.Meininger,G.Bes son,E.Lagrange,P.Clavelou,N.Guy,P.Couratier,P.Vourch,V.Danel,E.Bernard,G.Lemasson,H.Laaksovirta,L.Myllykangas,L.Jansson, M. Valori, J. Ealing, H. Hamdalla, S. Rollinson, S. Pickering-Brown, RWOrrell, KCSidle, J. Hardy, ABSingleton, JOJohnson, S. Arepalli, M. Polak, S. Asress, S. Al-Sarraj, A. King, C. Troakes, C. Vance, J.de Belleroche, ALMAten Asbroek, JLMunoz-Blanco, DGHernandez, J. Ding, JRGibbs, SWScholz, MK Floeter, RHCampbell, F. Landi, R. Bowser, J. Kirby, R. Pamphlett, G. Gerhard, TLDunckley, CBBrady, NWKowall, JCTroncoso, I.Le Ber, THeiman-Patterson, F. Camel, L. Van Den Bosch, T. Strom, T. Meitinger, A. Shatunov, K. van Eijk, M. de Carvalho, M. Kooyman, B. Middlekoop, M. Moisse, R. McLaughlin, M. van Es, M. Weber, KBBoylan, M. Van Blitterswijk, K. Morrison, ANBasak, JSMora, V. Drory, P. Shaw, MRTurner, K. Talbot, O. Hardiman, KL Williams, JAFifita, GANicholson, IP Blair, J. Esteban-Perez, A. Garcia-Redondo, A. Al-Chalabi, A. Al Kheifat,P.Andersen,A.Chio,J.Cooper-Knock,A.Dekker,AGRedondo,M.Gotkine,W.Hide,A.Iacoangeli,M.Kiernan,J.L anders,J.Mill,MMNeto,JMPardina,S.Newhouse,S.Pinto,S.Pulit,W.Robberecht,C.Shaw,W.Sproviero,G.Tazelaar,P.van Damme,L.van den Berg,J.van Vugt,J.Veldink,M.Zatz,DCBauer,NATwine,E.Rogaeva,L.Zinman,A.Brice,ELFeldman,ACLudolph,JHWeishaupt,JQTrojanowski,DJStone,P.Tienari,A.Chio,CEShaw,BJTray-Norsen,Analysis and KIF5. Novel ALS Gene.Neuron(2018),doi:10.1016 / j.neuron.2018.02.027. 26.K.Placek,GMBaer,L.Elman,L.McCluskey,L.Hennessy,PMFerraro,EBLee,VMYLee,JQTrojanowski,VMVan Deerlin,M.Grossman,DJIrwin,CTMcMillan,UNC13A polymorphism contributes to frontotemporal sporadic introphic disease sclerosis.Neurobiol.Aging(2019),doi:10.1016 / j.neurobiolaging.2018.09.031. 27.J.Pottier,Y.Ren,RBPerkerson,M.Baker,GDJenkins,M.van Blitterswijk,M.DeJesus-Hernandez,JGJvan Rooij,MEMurray,E.Christopher,SKMcDonnell,Z.Fogarty,A.Batzler,S.Tian,CTVicente,B.Matchett,AMKarydas,G YRHsiung,H.Seelaar,MOMol,ECFinger,J.Graff,L.Oijerstedt,M.Neumann,P.Heutink,M.Synofzik,J.Wilke,J.Prudl o,P.Rizzu,J.Simon-Sanchez,D.Edbauer,S.Roeber,J.Diehl-Schmid,BMEvers,A.King,MMMesulam,S.Weintraub,J.Ge ula,KFBieniek,L.Petrucelli,GLAhern,EMReiman,BKWoodruff,RJCaselli,EDHuey,MRFarlow,J.Grafman,S.Mead,LTG rinberg,S.Spina,M.Grossman,DJIrwin,EBLee,ERSuh,J.Snowden,D.Mann,N.Ertekin-Taner,RJUitti,ZKWszolek,KA Josephs,JEParisi,DSKnopman,RCPetersen,JRHodges,O.Piguet,EGGeier,JSYokoyama,RARissman,E.Rogaeva,J.Keith h,L.Zinman,MCTartaglia,NJCairns,C.Cruchaga,B.Ghetti,J.Kofler,OLLopez,TGBeach,T.Arzberger,J.Herms,LSHo nig,JPVonsattel,GMHalliday,JBKwok,CLWhite,M.Gearing,J.Glass,S.Rollinson,S.Pickering-Brown,JDRohrer,JQTrojanowski,V.Van Deerlin,E.H.Bigio,C.Troakes,S.Al-Sarraj,Y.Asmann,B.L.Miller,N.R.Graff-Radford,B.F.Boeve,W.W.Seeley,I.R.A.Mackenzie,J.C.van Swieten,D.W.Dickson,J.M.Biernacka,R.Rademakers,Genome-wide analyses as part of the international FTLD-TDP whole-genome sequencing consortium reveals novel disease risk factors and increases support for immune dysfunction in FTLD.Acta Neuropathol.(2019),doi:10.1007 / s00401-019-01962-9. 28.M.van Blitterswijk,B.Mullen,A.Wojtas,MGHeckman,NNDiehl,MCBaker,M.DeJesus-Hernandez,PHBrown,MEMurray,GYRHsiu ng,H.Stewart,AMKarydas,E.Finger,A.Kertesz,EHBigio,S.Weintraub,M.Mesulam,KJHatanpaa,CLWhite,M.Neumann, MJStrong,TGBeach,ZKWszolek,C.Lippa,R.Caselli,L.Petrucelli,KAJosephs,JEParisi,DSKnopman,RCPetersen,IRMackenzie,WWSeeley,LTGrinberg,BLMiller,KBBoylan,NRGraff-Radford,BFBoeve,DWDickson,R.Rademakers,Genetic modifiers in careers of repeat expansions in the C9ORF72 gene.Mol.Neurodegener.(2014),doi:10.1186 / 1750-1326-9-38. 29.JMVidal-Taboada,A.Lopez-Lopez,M.Salvado,L.Lorenzo,C.Garcia,N.Mahy,MJRodriguez,J.Gamez,UNC13A confers risk for sporadic ALS and influences survival in a Spanish cohort.J.Neurol.(2015),doi:10.1007 / s00415-015-7843-z. 30.B.Yang,H.Jiang,F.Wang,S.Li,C.Wu,J.Bao,Y.Zhu,Z.Xu,B.Liu,H.Ren,X.Yang,UNC13A variant rs12608932 is associated with increased risk of amyotrophic lateral sclerosis and reduced patient survival: meta-analysis.Neurol.Sci.(2019),doi:10.1007 / s10072-019-03951-y. 31.HHGTan,HJWesteneng,HKvan der Burgh,MAvan Es,LABakker,K.van Veenhuijzen,KRvan Eijk,RPAvan Eijk,JHVeldink,LHvan den Berg,The Distinct Traits of the UNC13A Polymorphism in Amyotrophic Lateral Sclerosis.Ann.Neurol.(2020),doi:10.1002 / ana.25841. 32.FPDiekstra,PWJvan Vught,W.van Rheenen,M.Koppers,RJPasterkamp,MAvan Es,HJSchelhaas,M.de Visser,W.Robberecht,P.Van Damme,PMAndersen,LHvan den Berg,JHVeldink,UNC13A is a modifier of surface amyotrophic lateral sclerosis.Neurobiol.Aging(2012),doi:10.1016 / j.neurobiolaging.2011.10.029. 33.D.J.Schaid,W.Chen,N.B.Larson,From genome-wide associations to candidate causal variants by statistical fine-mapping.Nat.Rev.Genet.(2018),,doi:10.1038 / s41576-018-0016-z. 34.M.D.Gallagher,A.S.Chen-Plotkin,The Post-GWAS Era:From Association to Function.Am.J.Hum.Genet.(2018),,doi:10.1016 / j.ajhg.2018.04.002. 35.R.J.Pruim,R.P.Welch,S.Sanna,T.M.Teslovich,P.S.Chines,T.P.Gliedt,M.Boehnke,G.R.Abecasis,C.J.Willer,D.Frishman,in Bioinformatics(2011). 36.W.Van Rheenen,A.Shatunov,AMDekker,RLMcLaughlin,FPDiekstra,SLPulit,RAAVan Der Spek,U.Vosa,S.De Jong,MRRobinson,J.Young,I.Fogh,PTCVan Doormaal,GHPTazelaar,M.Koppers,AMBlokhuis,W.Sproviero,ARJones,KPKenna,KRVan Eijk,O.Harschnitz,RDSchellevis,WJBrands,J.Medic,A.Menelaou,A.Vajda,N.Ticozzi,K.Lin,B.Rogelj,K.Vrab ec,M.Ravnik-Glava,B.Koritnik,J.Zidar,L.Leonardis,LDGroselj,S.Millecamps,F.Salachas,V.Meininger,M.De Carvalho,S.Pinto,JSMora,R.Rojas-Garcia,M.Polak,S.Chandran,S.Colville,R.Swingler,KEMorrison,PJShaw,J.Hardy,RWOrrell,A.Pittman,K.Sid and,P.Fratta,A.Malaspina,S.Topp,S.Petri,S.Abdulla,C.Drepper,M.Sendtner,T.Meyer,RAOphoff,KAStaats,M.Wiedau-Pazos,C.Lomen-Hoerth,VMVan Deerlin,JQTrojanowski,L.Elman,L.McCluskey,ANBasak,J.Tunca,H.Hamzeiy,Y.Parman,T.Meitinger,P.Lichtner,M.Radivojkov-Blagojevic,CRAndres ,J.Maurel,G.Bensimon,B.Landwehrmeyer,A.Brice,CAMPayan,S.Saker-Delieu,A.Durr,NWWood,L.Tittmann,W.Lieb,A.Franke,M.Rietschel,S.Cichon,MMNothen,P.Amouyel,C.Tzourio,JFDartigues,AGUitterlinden,F.Rivadeneira,K.Estrada,A.Hofman,C.Curtis,HMBlauw,AJVan Der Kooi,M.De Visser,A.Goris,M.Weber,CEShaw,BNSmith,O.Pansarada,R.C. Bo,GPComi,S.D'Alfonso,C.Bertolin,G.Soraru,L.Mazzini,V.Pensato,C.Gellera,C.Tiloca,A.Ratti, A.Calvo,C.Moglia,M.Brunetti,S.Arcuti,R.Capozzo,C.Zecca,C.Lunetta,S.Penco,N.Riva,A.Padovani ,M.Filosto,B.Muller,RJStuit,I.Blair,K.Zhang,EPMcCann,JFifita,GANicholson,DBRowe,R.Pamphlett,MCKiernan,J.Grosskreutz,OWWitte,T.Ringer,T.Prell,B.Stubendorff,I.Knerth,C.P.Hubner. Leigh,F.Casale,A.Chio,E.Beghi,E.Pupillo,R.Tortelli,G.Logroscino,J.Powell,ACLudolph,JHWeishaupt,W.Robberecht,P.Van Damme,L.Franke,THPers,RHBrown,JDGlass,JELanders,O.Hardiman,PMandersen,P.Corcia,P.Vourc'H,V.Silani,NRWray,PMVisscher,PIWDe Bakker,MAVan Es,R.Jeroen Pasterkamp,CMLewis,G.Breen,Al-Hanbi,Al. Berg,JHVeldink,Genome-wide association analyses identify new risk variants and the genetic architecture of amyotrophic lateral sclerosis.Nat.Genet.(2016),doi:10.1038 / ng.3622. 37.H.B.Schmidt,A.Barreau,R.Rohatgi,Phase separation-deficient TDP43 remains functional in splicing.Nat.Commun.(2019),doi:10.1038 / s41467-019-12740-2. 38.P.T.Nelson,D.W.Dickson,J.Q.Trojanowski,C.R.Jack,P.A.Boyle,K.Arfanakis,R.Rademakers,I.Alafuzoff,J.Attems,C.Brayne,I.T.S.Coyle-Gilchrist,H.C.Chui,D.W.Fardo,M.E.Flanagan,G.Halliday,S.R.K.Hokkanen,S.Hunter,G.A.Jicha,Y.Katsumata,C.H.Kawas,C.D.Keene,G.G.Kovacs,W.A.Kukull,A.I.Levey,N.Makkinejad,T.J.Montine,S.Murayama,M.E.Murray,S.Nag,R.A.Rissman,W.W.Seeley,R.A.Sperling,C.L.White,L.Yu,J.A.Schneider,Limbic-predominant age-related TDP-43 encephalopathy(LATE):Consensus working group report.Brain.142(2019),pp.1503-1527. 39.W.J.Kent,C.W.Sugnet,T.S.Furey,K.M.Roskin,T.H.Pringle,A.M.Zahler,a.D.Haussler,The Human Genome Browser at UCSC.Genome Res.(2002),doi:10.1101 / gr.229102. 40.Zhang,Y.J.et al.Aberrant cleavage of TDP-43 enhances aggregation and cellular toxicity.Proc.Natl.Acad.Sci.U.S.A.(2009)doi:10.1073 / pnas.0900688106. 41.Maury,Y.et al.Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes.Nat.Biotechnol.(2015)doi:10.1038 / nbt.3049. 42.Prudencio,M.et al.Repetitive element transcripts are elevated in the brain of C9orf72 ALS / FTLD patients.Hum.Mol.Genet.26,3421-3431(2017). 43.Hansen,K.D.,Brenner,S.E.& Dudoit,S.Biases in Illumina transcriptome sequencing caused by random hexamer priming.Nucleic Acids Res.(2010)doi:10.1093 / nar / gkq224. 44.Prudencio,M.et al.Misregulation of human sortilin splicing leads to the generation of a nonfunctional progranulin receptor.Proc.Natl.Acad.Sci.USA(2012)doi:10.1073 / pnas.1211577110. 45.Nana,ALet al.Neurons selectively targeted in frontotemporal dementia reveal early stage TDP-43 pathobiology.Acta Neuropathol.(2019)doi:10.1007 / s00401-018-1942-8.

[0216] The various embodiments described above and in Appendix A can be combined to provide further embodiments. All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications, and non-patent publications mentioned herein and / or listed in the Application Data Sheet, including but not limited to U.S. Provisional Patent Application No. 63 / 171,522, filed April 6, 2021, and U.S. Provisional Patent Application No. 63 / 312,808, filed February 22, 2022, are incorporated herein by reference in their entirety. Aspects of the embodiments can be modified, if necessary, to use concepts from the various patents, applications, and publications to provide further embodiments.

[0217] These and other changes can be made to the embodiments in light of the above detailed description. In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and claims, but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by this disclosure.

Claims

1. A pharmaceutical composition for reducing expression of a UNC13A cryptic exon splice variant in a cell, comprising a UNC13A cryptic exon splice variant-specific inhibitor, (a) the UNC13A cryptic exon splice variant comprises a cryptic exon between exon 20 and exon 21 of the UNC13A cryptic exon splice variant mature mRNA transcript; (b) The pharmaceutical composition, wherein the UNC13A cryptic exon splice variant-specific inhibitor comprises an antisense oligonucleotide.

2. The pharmaceutical composition of claim 1 , wherein the hidden exon comprises the base sequence set forth in SEQ ID NO: 5 or SEQ ID NO:

6.

3. The pharmaceutical composition of claim 1 , wherein the UNC13A cryptic exon splice variant comprises SEQ ID NO:7 or SEQ ID NO:

8.

4. The UNC13A cryptic exon splice variant-specific inhibitor comprises: (a) the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO:641; or (b) the 3' end of a hidden exon having the sequence set forth in SEQ ID NO:642 The pharmaceutical composition of claim 1 , comprising an antisense oligonucleotide complementary to

5. The UNC13A cryptic exon splice variant-specific inhibitor comprises: (a) the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO:643; or (b) the 3' end of a hidden exon having the sequence set forth in SEQ ID NO:644 The pharmaceutical composition of claim 1 , comprising an antisense oligonucleotide complementary to

6. The UNC13A cryptic exon splice variant-specific inhibitor comprises: (a) the exon 20 splice donor site region of a preprocessed mRNA encoding UNC13A; (b) the cryptic exon splice acceptor site region of the preprocessed mRNA encoding UNC13A; (c) the cryptic exon splice donor site region of a preprocessed mRNA encoding UNC13A; or (d) the exon 21 splice acceptor site region of the preprocessed mRNA encoding UNC13A. The pharmaceutical composition of claim 1 , comprising an antisense oligonucleotide complementary to

7. 7. The pharmaceutical composition according to claim 6, (a) the exon 20 splice donor site region of the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO: 12; (b) the cryptic exon splice acceptor site region of the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO:91; (c) the cryptic exon splice donor site region of the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO: 220; or (d) the pharmaceutical composition, wherein the exon 21 splice acceptor site region of the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO:

299.

8. The pharmaceutical composition of claim 1, wherein the antisense oligonucleotide has 15 to 40 bases.

9. The pharmaceutical composition of claim 8, wherein the antisense oligonucleotide has 20 to 30 bases.

10. The pharmaceutical composition of claim 8, wherein the antisense oligonucleotide has 18 to 25 bases.

11. The pharmaceutical composition of claim 8, wherein the antisense oligonucleotide has 18 to 22 bases.

12. The pharmaceutical composition of claim 1, wherein the antisense oligonucleotide has a base sequence having at least 80%, 85%, 90%, or 95% identity to any one of SEQ ID NOs: 13-90, 92-219, 221-298, 300-377, and 423-640.

13. The pharmaceutical composition according to claim 12, wherein the antisense oligonucleotide comprises (a) any one of SEQ ID NOs: 13 to 90, 92 to 219, 221 to 298, 300 to 377, and 423 to 640, or a base sequence consisting of any one of them, or (b) any one of SEQ ID NOs: 423 to 432, 439 to 443, 491 to 498, 502 to 507, and 513 to 514, or a base sequence consisting of any one of them.

14. The antisense oligonucleotide is (a) having 18 to 30 bases, 18 to 25 bases, or 18 to 22 bases complementary to SEQ ID NO: 650; (b) having 18 to 30 bases, 18 to 25 bases, or 18 to 22 bases complementary to SEQ ID NO: 651; (c) having 18 to 30 bases, 18 to 25 bases, or 18 to 22 bases complementary to SEQ ID NO: 652; (d) having 18 to 30 bases, 18 to 25 bases, or 18 to 22 bases complementary to SEQ ID NO: 653; or (e) the pharmaceutical composition of claim 1, having 18 to 21 bases complementary to SEQ ID NO:

654.

15. The pharmaceutical composition of claim 12 or claim 13, wherein the antisense oligonucleotide is a modified antisense oligonucleotide.

16. 16. The pharmaceutical composition of claim 15, wherein the modified antisense oligonucleotide comprises a 2'OMe antisense oligonucleotide, a 2'O-methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or an LNA antisense oligonucleotide.

17. A pharmaceutical composition for reducing phosphorylated TAR-DNA binding protein-43 (TDP-43) in a cell, comprising a UNC13A cryptic exon splice variant-specific inhibitor, (a) the UNC13A cryptic exon splice variant comprises a cryptic exon between exon 20 and exon 21 of the UNC13A cryptic exon splice variant mature mRNA transcript; (b) The pharmaceutical composition, wherein the UNC13A cryptic exon splice variant-specific inhibitor comprises an antisense oligonucleotide.

18. The pharmaceutical composition according to claim 17, wherein the hidden exon comprises the base sequence set forth in SEQ ID NO: 5 or SEQ ID NO:

6.

19. The pharmaceutical composition of claim 17, wherein the UNC13A cryptic exon splice variant comprises SEQ ID NO:7 or SEQ ID NO:

8.

20. The UNC13A cryptic exon splice variant-specific inhibitor comprises: (a) the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO:641; or (b) the 3' end of a hidden exon having the sequence set forth in SEQ ID NO:642 The pharmaceutical composition of claim 17, comprising an antisense oligonucleotide complementary to

21. The UNC13A cryptic exon splice variant-specific inhibitor comprises: (a) the 5' end of a cryptic exon having the sequence set forth in SEQ ID NO:643; or (b) the 3' end of a hidden exon having the sequence set forth in SEQ ID NO:644 The pharmaceutical composition of claim 17, comprising an antisense oligonucleotide complementary to

22. The UNC13A cryptic exon splice variant-specific inhibitor comprises: (a) the exon 20 splice donor site region of a preprocessed mRNA encoding UNC13A; (b) the cryptic exon splice acceptor site region of the preprocessed mRNA encoding UNC13A; (c) the cryptic exon splice donor site region of a preprocessed mRNA encoding UNC13A; or (d) the exon 21 splice acceptor site region of the preprocessed mRNA encoding UNC13A. The pharmaceutical composition of claim 17, comprising an antisense oligonucleotide complementary to

23. 23. The pharmaceutical composition of claim 22, (a) the exon 20 splice donor site region of the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO: 12; (b) the cryptic exon splice acceptor site region of the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO:91; (c) the cryptic exon splice donor site region of the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO: 220; or (d) the pharmaceutical composition, wherein the exon 21 splice acceptor site region of the preprocessed mRNA encoding UNC13A comprises or consists of SEQ ID NO:

299.

24. The pharmaceutical composition according to claim 17, wherein the antisense oligonucleotide has a base sequence having at least 80% identity with any one of SEQ ID NOs: 13-90, 92-219, 221-298, 300-377, and 423-640.

25. The pharmaceutical composition according to claim 24, wherein the antisense oligonucleotide comprises (a) any one of SEQ ID NOs: 13 to 90, 92 to 219, 221 to 298, 300 to 377, and 423 to 640, or a base sequence consisting of any one of them, or (b) any one of SEQ ID NOs: 423 to 432, 439 to 443, 491 to 498, 502 to 507, and 513 to 514, or a base sequence consisting of any one of them.

26. A pharmaceutical composition for treating a TAR-DNA binding protein 43 (TDP-43) proteinopathy in a subject, comprising a UNC13A cryptic exon splice variant-specific inhibitor, (a) the UNC13A cryptic exon splice variant comprises a cryptic exon between exon 20 and exon 21 of the UNC13A cryptic exon splice variant mature mRNA transcript; (b) The pharmaceutical composition, wherein the UNC13A cryptic exon splice variant-specific inhibitor comprises an antisense oligonucleotide.

27. A pharmaceutical composition comprising an antisense oligonucleotide having 15 to 40 bases and having at least 80% identity to any one of SEQ ID NOs: 13 to 90, 92 to 219, 221 to 298, 300 to 377, and 423 to 640, and a pharma- ceutically acceptable excipient.

28. 1. A pharmaceutical composition comprising: (a) 18 to 30 bases, 18 to 25 bases, or 18 to 22 bases complementary to SEQ ID NO: 650; (b) 18 to 30 bases, 18 to 25 bases, or 18 to 22 bases complementary to SEQ ID NO: 651; (c) 18 to 30 bases, 18 to 25 bases, or 18 to 22 bases complementary to SEQ ID NO: 652; (d) 18 to 30 bases, 18 to 25 bases, or 18 to 22 bases complementary to SEQ ID NO: 653, or (e) an antisense oligonucleotide having 18 to 21 bases complementary to SEQ ID NO: 654, and a pharma- ceutically acceptable excipient. The pharmaceutical composition comprising:

29. A modified antisense oligonucleotide having 15 to 40 bases and comprising a base sequence having at least 80% identity to any one of SEQ ID NOs: 13 to 90, 92 to 219, 221 to 298, 300 to 377, and 423 to 640.

30. The modified antisense oligonucleotide of claim 29, wherein the antisense oligonucleotide has a base sequence comprising or consisting of any one of SEQ ID NOs: 13 to 90, 92 to 219, 221 to 298, 300 to 377, and 423 to 640.

31. The modified antisense oligonucleotide of claim 29, wherein the antisense oligonucleotide has a base sequence comprising or consisting of any one of SEQ ID NOs: 423-432, 439-443, 491-498, 502-507, and 513-514.

32. 30. The modified antisense oligonucleotide of claim 29, wherein the modified antisense oligonucleotide comprises a 2'OMe antisense oligonucleotide, a 2'O-methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or an LNA antisense oligonucleotide.

33. A kit comprising an antisense oligonucleotide specific for a UNC13A hidden exon splice variant, the antisense oligonucleotide having 15 to 40 bases and having at least 80% identity to any one of SEQ ID NOs: 13 to 90, 92 to 219, 221 to 298, 300 to 377, and 423 to 640.

Images