Mobile endonucleases for heritable mutations

Abstract

The present invention relates to targeted genome modification of plant cells, preferably meristematic cells.More particularly, the present invention relates to a vector expressing coding RNA, the coding RNA comprises a sequence encoding CRISPR nuclease and a mobile element, the mobile element allows the coding RNA to move between cells, preferably to meristematic cells.The present invention further relates to an editing RNA comprising coding RNA, the editing RNA further comprising a guide RNA.

Description

[Technical field]

[0001] The present invention relates to the field of molecular plant biology. The present invention relates to targeted genetic modification of plant cells. In particular, the present invention relates to targeted modification of plant meristem cells and plants derived therefrom. [Background technology]

[0002] Rapid and efficient generation of directed, heritable mutations in crop plants is important for trait research and gene validation. Introducing edits into intact meristems is considered highly desirable as it ensures transmission to the next generation. There are two approaches to generate edits in meristems: by placing an editing complex (e.g., CAS9 with guide RNA) in the meristem and directly editing those cells, or by editing somatic tissues and later initiating meristem formation.

[0003] Edited somatic cells are converted into edited meristems, resulting in their edits being transmitted to progeny, however, this method does not work in crops such as peppers where it is difficult or impossible to induce meristem formation through in vitro tissue culture.

[0004] Unfortunately, delivering transgenes directly into meristems has proven difficult, and so far success has been limited to Arabidopsis thaliana and its relatives (Clough, SJ and Bent, AF, “Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana”. Plant J. 16, 735-743 (1998) and Hamada, H. et al. “An in planta biolistic method for stable wheat transformation. Sci. Rep. 7, 11443 (2017)).

[0005] Thus, there remains a need in the art for methods that provide efficient heritable mutation of plants without the need for regeneration.

[0006] Previously, the art has shown that heritable mutations can be achieved by transfecting Cas9 transgenic N. benthamiana plants with vectors expressing one or more mobile guide RNAs. Transfection of such guide RNAs resulted in heritable gene editing (Ellison et al, Multiplexed heritable gene editing using RNA viruses and mobile single guide RNAs, Nat Plants, 2020; 6(6): 620-624).

[0007] Unfortunately, this approach entails the use of Cas9 transgenic plants to produce heritable mutations. This may require elaborate experimentation to produce such transgenic plants, or may be completely unfeasible. Moreover, any seeds produced from such plants may contain heritable mutations, but may still express transgenic Cas9 protein. In particular, such transgenic plants may be difficult to commercialize, for example, for edible consumption.

[0008] Thus, there remains a need in the art for versatile methods for efficiently generating non-transgenic plants containing heritable mutations, as well as nucleic acids and vectors for use in such methods. Summary of the Invention

[0009] The present invention can be summarized in the following embodiments.

[0010] Embodiment 1. A vector expressing a coding RNA, the coding RNA comprising a sequence encoding a CRISPR nuclease and a first mobile element, the mobile element enabling cell-to-cell movement of the coding RNA, preferably the CRISPR nuclease comprising a nuclear localization signal.

[0011] Embodiment 2.a) a virus, which preferably does not express a functional coat protein, preferably having a deletion in the sequence encoding the coat protein; b) naked DNA, preferably a circular nucleic acid molecule; or c) DNA complexes, preferably bound to a carrier, preferably selected from the group consisting of lipoplexes, liposomes, polymersomes, polyplexes, PEG, dendrimers, inorganic nanoparticles, virosomes and cell penetrating peptides. 2. The vector of embodiment 1,

[0012] Embodiment 3. The vector according to embodiment 2, which is a Tobacco Rattle Virus (TRV), Tobacco Mosaic Virus (TMV) or Sonkus Yellow Net Virus (SYNV), preferably a Tobacco Mosaic Virus RNA-Based Overexpression Vector (TRBO).

[0013] Embodiment 4. A vector according to any one of embodiments 1 to 3, wherein the mobile element allows cell-to-cell movement into meristematic cells, preferably shoot apical meristem cells.

[0014] Embodiment 5. The vector of any one of embodiments 1 to 4, wherein the mobile element is at least one of a transfer RNA (tRNA) and a gene transcript.

[0015] Embodiment 6. - the tRNA is at least one of methionine, glycine-, threonine-, arginine-, lysine- and glutamine-tRNA; and - the gene transcript is a transcript of a gene selected from the group consisting of FT, GAI, SP2G, SP3D, SP5G, SP9D, CEN-like protein 1, FT and TF protein MOTHER 1, flowering locus Ta, flowering locus Tb, PP16-1, GAIP, Scarecrow-like (SCL14P), Shoot Meristemless (STMP), Ethylene Response Factor (ERFP) and Myb (MybP), and optionally the FT gene transcript is a mutant FT and / or a truncated FT. 6. The vector of embodiment 5, wherein the vector is at least one of:

[0016] Embodiment 7. A vector according to any one of embodiments 1 to 6, further comprising a guide RNA and optionally a second mobile element enabling cell-to-cell movement of the guide RNA.

[0017] Embodiment 8. An editing RNA comprising a coding RNA as defined in any one of embodiments 1 and 4 to 6, further comprising a guide RNA as defined in embodiment 7 and optionally a second mobile element.

[0018] Embodiment 9. The editing RNA of embodiment 8, further comprising a cleavable spacer sequence located between the coding RNA and the guide RNA.

[0019] Embodiment 10. An editing RNA according to embodiment 8 or 9, wherein at least one of the first and second mobile elements is located at the 5'-end or 3'-end of the editing RNA.

[0020] Embodiment 11. An editing RNA according to any one of embodiments 8 to 10, comprising two or more guide RNAs.

[0021] Embodiment 12. The editing RNA of embodiment 11, wherein the cleavable spacer sequence is located between two or more guide RNAs.

[0022] Embodiment 13. An editing RNA according to embodiment 11 or 12, wherein two or more guide RNAs guide a CRISPR nuclease to the same gene.

[0023] Embodiment 14. A vector expressing an editing RNA as defined in any one of embodiments 8 to 13.

[0024] Embodiment 15.i) A vector according to any one of embodiments 1 to 7 and 14; and ii) An editing RNA according to any one of embodiments 8 to 13. An Agrobacterium expressing at least one of

[0025] Embodiment 16. A method for producing a meristematic cell having a targeted genomic modification, comprising: i) providing a plant; and ii) expressing in a cell of the plant a coding RNA as defined in any one of embodiments 1 and 4 to 6, a guide RNA as defined in embodiment 7 and optionally a second mobile element. Including, The coding and guide RNAs are transferred to meristematic cells, The coding RNA and the guide RNA are contained in the editing RNA according to any one of embodiments 8 to 13, and / or the guide RNA is linked to a second mobile element; A method in which, in a meristematic cell, a CRISPR nuclease is expressed from a coding RNA and a guide RNA directs the expressed CRISPR nuclease to a location in the genome to generate a targeted genome modification in the meristematic cell.

[0026] Embodiment 17. The coding RNA and the guide RNA are introduced into a plant cell. - a vector according to any one of embodiments 1 to 7 and 14; and - an Agrobacterium as defined in embodiment 15 17. The method of embodiment 16, wherein the vector is expressed by transfecting at least one of the following:

[0027] Embodiment 18. The method of embodiment 16 or 17, wherein the meristematic cell is a shoot apical meristem cell.

[0028] Embodiment 19. A meristematic cell having a targeted genomic modification, the meristematic cell being obtainable by a method according to any one of embodiments 16 to 18. [Brief description of the drawings]

[0029] [Figure 1] FIG. 1 is a schematic diagram of a vector containing a Cas9-GFP fusion with (A) and without (B) the FT sequence. [Diagram 2] Average expression (arbitrary units relative to N. benthamiana tubulin mRNA expression) of Cas9 and GFP in the shoot apex of plants whose leaves were infiltrated with Cas9-GFP constructs with or without the FT signal, as determined by qPCR. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0030] definition Throughout the specification and claims, various terms are used in connection with the methods, compositions, uses and other aspects of the invention. Such terms are to be given their ordinary meaning in the art to which the invention pertains, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definitions provided herein. It will be apparent to one skilled in the art that any methods and materials similar or equivalent to those described herein can be used to practice the present invention.

[0031] The method of carrying out the conventional techniques used in the method of the present invention will be clear to the skilled artisan. The practice of conventional techniques in molecular biology, biochemistry, computational chemistry, cell culture, recombinant DNA, bioinformatics, genomics, sequencing and related fields is well known to the skilled artisan and is discussed, for example, in the following references: Sambrook et al. Molecular Cloning. A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; Ausubel et al. Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1987 and regularly updated; and the series Methods in Enzymology, Academic Press, San Diego.

[0032] The singular terms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "cell" includes a combination of two or more cells, and the like. Thus, the indefinite article "a" or "an" generally means "at least one."

[0033] The term "and / or" refers to a situation in which one or more of the stated cases may occur alone or in combination with at least one of the stated cases, up to and including all of the stated cases.

[0034] As used herein, the term "about" is used to express and take into account small variations. For example, the term may refer to ±(+ or -) 10% or less, such as ±5% or less, ±4% or less, ±3% or less, ±2% or less, ±1% or less, ±0.5% or less, ±0.1% or less, or ±0.05% or less. In addition, amounts, ratios, and other numerical values ​​are presented in the present specification in a range format. Such range formats are used for convenience and brevity, and it should be understood that they should be flexibly understood to include numerical values ​​explicitly specified as the limits of the range, but also to include any individual numerical values ​​or subranges encompassed within the range, as if each numerical value and subrange were explicitly specified. For example, a ratio in the range of about 1 to about 200 should be understood to include the explicitly stated limits of about 1 and about 200, but also to include individual ratios such as about 2, about 3, and about 4, and subranges such as about 10 to about 50, about 20 to about 100, etc.

[0035] The term "comprises" is intended to be inclusive and open ended, not exclusive. Specifically, this term and its variations mean that the specified features, steps or components are included. These terms should not be interpreted as excluding the presence of other features, steps or components.

[0036] The terms "protein" or "polypeptide" are used interchangeably and refer to a molecule consisting of a chain of amino acids, regardless of its specific mode of action, size, three-dimensional structure, or origin. Thus, a "fragment" or "portion" of a protein can still be referred to as a "protein." An "isolated protein" is used to refer to a protein that is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell.

[0037] "Plant" refers to either an entire plant or to a portion of a plant, such as tissues or organs available from the plant (e.g., pollen, seeds, gametes, roots, leaves, flowers, flower buds, anthers, fruits, etc.), as well as any derivatives and progeny derived from such a plant by selfing or crossing. Non-limiting examples of plants include African eggplant, garlic, artichoke, asparagus, barley, sugar beet, bell pepper, bitter melon, ground cherry, bottle gourd, cabbage, canola, carrot, cassava, cauliflower, celery, chicory, kidney bean, corn salad, cotton, cucumber, eggplant, endive, fennel, gherkin, grapes, chili pepper, lettuce, corn, melon, oilseed rape, olive oil, and olive oil. Crop plants and cultivated plants include kula, parsley, parsnip, pepino, chili pepper, potato, pumpkin, radish, rice, loofah, rocket, rye, snake gourd, sorghum, spinach, loofah, pumpkin, sugar beet, sugar cane, sunflower, tomatillo, tomato, tomato rootstock, Brassica vegetables, watermelon, wax gourd, wheat, and zucchini.

[0038] "One or more plant cells" includes protoplasts, gametes, suspension cultures, microspores, pollen grains, etc., either isolated or within a tissue, organ or organism. A plant cell can be part of a multicellular structure, such as, for example, a callus, a meristem, a plant organ, or an explant.

[0039] "Similar conditions" for the cultivation of plants / plant cells means, inter alia, similar temperature, humidity, nutrient and light conditions as well as the use of similar irrigation and light / dark cycles.

[0040] The terms "homology", "sequence identity" and the like are used interchangeably herein. Sequence identity is defined herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleotide (polynucleotide) sequences as determined by comparing their sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid sequences or nucleic acid sequences, as the case may be, as determined by the match between stretches of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods. The sequence identity / similarity percentage can be determined over the entire length of the sequences.

[0041] As used herein, "sequence identity" refers to the degree to which two optimally aligned polynucleotide or peptide sequences are consistent over the entire alignment window of elements, e.g., nucleotides or amino acids. The "percent identity" for an aligned section of a test sequence and a reference sequence is the number of identical elements shared by the two aligned sequences divided by the total number of elements in the reference sequence section, i.e., the entire reference sequence or a smaller defined portion of the reference sequence. The "percent identity" is the percent identity multiplied by 100.

[0042] "Sequence identity" and "sequence similarity" can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., Needleman Wunsch) that optimally aligns the sequences over their entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g., Smith Waterman). Thus, sequences may be referred to as "substantially identical" or "essentially similar" when they share at least a certain minimal sequence identity percentage (as defined herein) (e.g., when optimally aligned using default parameters with the programs GAP or BESTFIT). Percent sequence identity is preferably determined using the "BESTFIT" or "GAP" programs of the Sequence Analysis Software Package™ (Version 10; Genetics Computer Group, Inc., Madison, Wis.). GAP uses the Needleman and Wunsch global alignment algorithm (Needleman and Wunsch, Journal of Molecular Biology 48:443-453, 1970) to align two sequences over their entire length (full length) in a way that maximizes the number of matches and minimizes the number of gaps. Global alignment is preferably used to determine sequence identity when two sequences have similar lengths. Typically, the GAP default parameters are used: gap creation penalty = 50 (nucleotides) / 8 (protein) and gap extension penalty = 3 (nucleotides) / 2 (protein).For nucleotides the default scoring matrix used is nwsgapdna and for proteins the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignments and scores for sequence identity percentages can be determined using computer programs such as the GCG Wisconsin Package, version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or open source software such as the programs "needle" (which uses the global Needleman-Wunsch algorithm) or "water" (which uses the local Smith-Waterman algorithm) of EmbossWIN, version 2.10.0, using the same parameters as GAP above or using default settings (for both "needle" and "water" and for both protein and DNA alignments, the default gap opening penalty is 10.0, the default gap extension penalty is 0.5; the default scoring matrices are Blossum62 for proteins and DNAFull for DNA). The gap extension penalty is 0.5; the default scoring matrices are Blossum62 for proteins and DNAFull for DNA). "BESTFIT" performs an optimal alignment of the best similarity intervals between two sequences and inserts gaps to maximize the number of matches using the Smith-Waterman local homology algorithm (Smith and Waterman, Advances in Applied Mathematics, 2:482-489, 1981; Smith et al., Nucleic Acids Research 11:2205-2220, 1983). When sequences have substantially different overall lengths, local alignments, such as those using the Smith-Waterman algorithm, are preferred.

[0043] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., Applied Math (1988) 48:1073. More particularly, preferred computer programs for determining sequence identity include the Basic Local Alignment Search Tool (BLAST) program, publicly available from the National Center for Biotechnology Information (NCBI), National Library of Medicine, National Institutes of Health, Bethesda, Md. 20894; see BLAST Manual, Altschul et al., NCBI, NLM, NIH; Altschul et al., J. Mol. Biol. 215:403-410 (1990); version 2.0 and above of the BLAST program allows for the introduction of gaps (deletions and insertions) in the alignment; for peptide sequences, BLASTX can be used to determine sequence identity; and for polynucleotide sequences, BLASTN can be used to determine sequence identity.

[0044] Alternatively, the percentage of similarity or identity can be determined by searching public databases using algorithms such as FASTA, BLAST, etc. Thus, the nucleic acid and protein sequences of the present invention can further be used as a "query sequence" to perform searches of public databases to identify, for example, other family members or related sequences. Such searches can be performed using the BLASTn and BLASTx programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the present invention. BLAST protein searches can be performed with the BLASTx program, score=50, wordlength=3 to obtain amino acid sequences homologous to the protein molecules of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTx and BLASTn) can be used. See the National Center for Biotechnology Information home page at http: / / www.ncbi.nlm.nih.gov / .

[0045] "Similar to," with respect to a domain, sequence, or position of a protein, with respect to an indicated domain, sequence, or position of a reference protein, as used herein, shall be understood as a domain, sequence, or position that aligns with the indicated domain, sequence, or position of the reference protein when the protein is aligned with the reference protein using an alignment algorithm as described herein, such as Needleman-Wunsch.

[0046] "Similar to," with respect to a domain, sequence, or position of a nucleic acid, with respect to a designated domain, sequence, or position of a reference nucleic acid, as used herein, shall be understood as a domain, sequence, or position that aligns with the designated domain, sequence, or position of a reference nucleic acid when the nucleic acid is aligned with the reference nucleic acid using an alignment algorithm as described herein, such as Needleman-Wunsch.

[0047] A "nucleic acid" or "polynucleotide" according to the present invention may include any polymer or oligomer of pyrimidine and purine bases, preferably cytosine, thymine and uracil, and adenine and guanine, respectively (see Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982), which is incorporated by reference in its entirety for all purposes). The present invention contemplates any deoxyribonucleotide, ribonucleotide or nucleic acid moiety and any chemical variant thereof, such as methylated, hydroxymethylated or glycosylated forms of these bases. The polymers or oligomers may be heterogeneous or homogeneous in composition and may be isolated from naturally occurring sources or may be artificially or synthetically produced. In addition, the nucleic acid may be DNA (optionally cDNA) or RNA or a mixture thereof, and may exist permanently or transiently in single-stranded or double-stranded form, including homoduplexes, heteroduplexes and hybrid states. An "isolated nucleic acid" is used to refer to a nucleic acid that is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant cell.

[0048] The nucleic acids and / or proteins of the present invention may be at least one of recombinant, synthetic or artificial nucleic acids and / or proteins.

[0049] The terms "nucleic acid construct," "nucleic acid vector," "vector," and "expression construct" are used interchangeably herein and are defined herein as an artificially created nucleic acid molecule that results from the use of recombinant DNA technology. Thus, the terms "nucleic acid construct" and "nucleic acid vector" do not include naturally occurring nucleic acid molecules, however, a nucleic acid construct may include (a portion of) a naturally occurring nucleic acid molecule.

[0050] The vector backbone can be, for example, a binary or super binary vector as known in the art and described elsewhere herein (see, for example, U.S. Pat. No. 5,591,616, U.S. Patent Publication No. 2002138879 and WO 95 / 06722), a cointegration vector or a T-DNA vector into which the chimeric gene is integrated, or, if suitable transcriptional regulatory sequences are already present, only the desired nucleic acid sequence (e.g., coding sequence, antisense or inverted repeat sequence) is integrated downstream of the transcriptional regulatory sequence. The vector can contain additional genetic elements to facilitate its use in molecular cloning, such as, for example, selectable markers, multiple cloning sites, etc.

[0051] The term "gene" refers to a DNA fragment that includes a region that is transcribed into an RNA molecule (e.g., mRNA) in a cell (transcribed region) operably linked to a suitable regulatory region (e.g., promoter). A gene will usually include several operably linked fragments, such as a promoter, a 5' leader sequence, a coding region, and a 3' untranslated sequence (3' end) that includes a polyadenylation site.

[0052] "Gene expression" refers to the process by which a DNA region that is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into RNA that is biologically active, e.g., RNA capable of being translated into a biologically active protein or peptide, or e.g., regulatory non-coding RNA.

[0053] The term "operably linked" refers to the linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter or rather a transcriptional regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked can mean that the DNA sequences that are linked are contiguous.

[0054] "Promoter" refers to a nucleic acid fragment that functions to control the transcription of one or more nucleic acids. A promoter fragment is preferably located upstream (5') from the transcription start site of a gene in the direction of transcription, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, one or more transcription start sites, and may further include any other DNA sequences, including but not limited to, transcription factor binding sites, repressor and activator protein binding sites, and any other nucleotide sequences known to those of skill in the art that function to directly or indirectly regulate the amount of transcription from a promoter.

[0055] A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically regulated (e.g., by exogenous application of certain compounds) or developmentally regulated. A "tissue-specific" promoter is active only in particular types of tissues or cells.

[0056] Optionally, the term "promoter" may also include the 5' UTR region (5' untranslated region) (e.g., as used herein, a promoter may include one or more portions upstream from the translation start codon of the transcribed region, as that region may have a role in regulating transcription and / or translation).

[0057] "3'UTR" or "3' untranslated sequence" (often referred to as 3' untranslated region or 3' end) refers to a nucleic acid sequence found downstream of the coding sequence of a gene, including, for example, a transcription termination site and (in most, but not all, eukaryotic mRNAs) a polyadenylation signal (such as, for example, AAUAAA or variants thereof). After transcription is terminated, the mRNA transcript may be cleaved downstream of the polyadenylation signal and a poly(A) tail may be added, which is involved in transport of the mRNA to the cytoplasm (where translation takes place).

[0058] The term "cDNA" means complementary DNA. Complementary DNA is made by reverse transcription of RNA into a complementary DNA sequence. The cDNA sequence thus corresponds to the RNA sequence expressed from a gene. It is understood that the sequence of the cDNA corresponds to the sequence of the mRNA, since the RNA sequence expressed from the genome may be spliced, i.e., after introns are removed and exons are spliced ​​together from the pre-mRNA, which is translated into a protein in the cytoplasm. Thus, a cDNA sequence may not be identical to the genomic DNA sequence to which it corresponds, since a genomic DNA sequence may contain exon sequences interspersed with intron sequences, while a cDNA may only code for a complete open reading frame of a protein, consisting of spliced ​​exons. Genetic modification of a gene encoding a protein may thus involve not only modifying the sequence encoding the protein, but also mutating the intron sequences of the genomic DNA and / or other genetic regulatory sequences of the gene.

[0059] The term "regeneration" is defined herein as the formation of new tissues and / or new organs from a single plant cell, callus, explant, tissue or organ. The regeneration pathway can be somatic embryogenesis or organogenesis. Somatic embryogenesis is understood herein as the formation of a somatic embryo, which can be grown to regenerate a whole plant. Organogenesis is understood herein as the formation of a new organ from an (undifferentiated) cell. Preferably, the regeneration is at least one of ectopic apical meristem formation, shoot regeneration and root regeneration.

[0060] Regeneration as defined herein may preferably relate to at least de novo shoot formation, for example regeneration may be from an (elongated) hypocotyl explant towards an (inflorescence) shoot.

[0061] Regeneration may further include the formation of new plants from a single plant cell or, for example, from a callus, explant, tissue or organ. The regeneration process may occur directly from the parent tissue or indirectly, for example, via the formation of callus.

[0062] The term "conditions permissive for regeneration" is herein understood as an environment in which plant cells or tissues can regenerate. Such conditions include, at a minimum, suitable temperature (i.e., 0°C to 60°C), nutrients, day-night cycle, watering, and one or more plant hormones and / or plant hormone-like compounds. Moreover, "optimal conditions permissive for regeneration" are those environmental conditions that allow maximum regeneration of plant cells.

[0063] The term "wild-type", when used in conjunction with a protein or nucleic acid in the context of the present invention, means that said protein or nucleic acid consists entirely of the amino acid or nucleotide sequence, respectively, that occurs in nature and that as such can be isolated from a natural organism and is not the result of modification techniques such as targeted or random mutagenesis. A wild-type protein is expressed under particular, e.g., environmental conditions as it occurs in nature, at least at certain developmental stages.

[0064] The term "endogenous" when used in connection with a protein or nucleic acid in the context of the present invention means that the protein or nucleic acid is still contained within the plant, i.e., is present in its natural environment. In most cases, an endogenous gene will be present in its normal genetic context in the plant.

[0065] Targeted mutagenesis is mutagenesis that can be designed to modify specific nucleotide or nucleic acid sequences, including, but not limited to, oligo-directed mutagenesis, RNA-guided endonucleases (e.g., CRISPR technology), TALEN or zinc finger technology.

[0066] The term "sequence of interest" includes any genetic sequence that is preferably present in a cell, such as, but not limited to, a gene, a part of a gene, or a non-coding sequence within or adjacent to a gene. A sequence of interest may be present in a chromosome, an episome, an organelle genome, such as a mitochondrial or chloroplast genome, or in genetic material that may exist independently of the body of genetic material, such as, for example, an infectious viral genome, a plasmid, an episome, a transposon. A sequence of interest may be within the coding sequence of a gene, within a transcribed non-coding sequence, such as, for example, a leader sequence, a trailer sequence, or an intron. The sequence of interest may be present in a double-stranded or single-stranded nucleic acid molecule. The nucleic acid sequence is preferably present in a double-stranded nucleic acid molecule. A sequence of interest may be any sequence present in a nucleic acid, such as, for example, a gene, a gene complex, a locus, a pseudogene, a regulatory region, a highly repetitive region, a polymorphic region, or a portion thereof. A sequence of interest may also be a region that contains a genetic or epigenetic mutation that is indicative of a phenotype or disease. Preferably, the sequence of interest is a small or longer stretch of contiguous nucleotides (i.e., a polynucleotide) of double-stranded DNA, said double-stranded DNA further comprising a sequence complementary to the target sequence in the complementary strand of said double-stranded DNA.

[0067] A "control plant", as referred to herein, is a plant of the same species and preferably the same genetic background as the plant of the present invention, i.e., a plant that has been subjected to the methods as taught herein. Preferably, the control plant differs from the putative test plant only in that the control plant does not have the target modification as detailed herein.

[0068] Preferably, the control plants are grown under the same conditions as the plants subjected to the method of the invention.

[0069] The inventors have discovered a way in which the CRISPR protein editing complex can enter existing meristems, thus bypassing the need for regeneration. To this end, the inventors fused mobile elements with guide RNAs as well as (m)RNAs encoding CRISPR proteins, thereby creating RNA molecules that can move through the plant transport system and enter the meristem.

[0070] Mobile RNA can thus be introduced into any random suitable position in plant tissue.These RNA molecules are then incorporated into vascular tissue and transported, for example, toward meristem.Alternatively or additionally, these RNA molecules are transported, for example, toward meristem through plasmodesm.Once reaching target cell, CRISPR protein coding RNA is translated into CRISPR protein and combined with guide RNA to form the required editing complex.Once edits are made in meristem, these edits will be inherited by one or more subsequent generations.

[0071] In a first aspect, the present invention therefore relates to a coding RNA comprising or consisting of a sequence encoding a CRISPR protein and a mobile element. This coding RNA can be synthetic or recombinant. The coding RNA can be a double-stranded or single-stranded ribonucleic acid molecule comprising or consisting of a sequence encoding a CRISPR protein and a mobile element. Optionally, the coding RNA is comprised in a vector, a construct or an editing RNA as defined herein. Preferably, the mobile element allows the coding RNA to move between cells. Preferably, the CRISPR protein comprises a nuclear localization signal. Preferably, the CRISPR protein is a CRISPR nuclease.

[0072] By cell-to-cell movement is herein understood the long distance transport of a molecule, such as an RNA molecule as defined herein, from one cell to another. Preferred cell-to-cell movement is through the phloem, xylem and / or plasmodesm, preferably through the phloem.

[0073] Water and mineral nutrients are transported from the roots of the plant through the xylem to the aboveground parts. The phloem supports the movement of photosynthetic products and macromolecules, for example, from source tissues to sink tissues. The phloem is composed of sieve elements, living cells without nuclei, supported by companion cells. These sieve element cells stack together to form the sieve tube, which allows molecules to flow rapidly over long distances within the plant. Macromolecules including proteins, RNA and ribonucleoprotein complexes have been found in the phloem flow. Interestingly, there is no detectable RNase activity in phloem sap. Indeed, various RNA species appear to be transported to distant tissues through the phloem (Liu et al, Nat Plants. 2018; 4(11): 869-878).

[0074] Coding RNA The coding RNA can be introduced into a first plant cell, and the mobile element guides the coding RNA into the vascular tissue of the plant. The coding RNA moves through the vascular tissue to another second plant cell, where the coding RNA translates into a CRISPR protein. Alternatively or additionally, the coding RNA moves to another second plant cell using intercellular transport through the plasmodesm.

[0075] The term "vascular tissue" of a plant is well known to those skilled in the art and includes both xylem and phloem. A preferred vascular tissue is the phloem. Thus, preferably, the mobile element directs the RNA into the phloem of the plant.

[0076] When the coding RNA reaches the second, or "target," cell, the CRISPR protein is expressed, which, when complexed with the guide RNA, is capable of modifying the target sequence in the second cell.

[0077] The sequence of the coding RNA preferably includes at least the sequence encoding the CRISPR protein and the sequence of the mobile element. The coding RNA may include additional sequences. As a non-limiting example, the CRISPR protein coding sequence may be flanked by at least one of a 5'-UTR and a 3'-UTR. The coding RNA may include additional sequences, including but not limited to one or more sequences that enhance or aid in the translation of the CRISPR protein from the coding RNA. The coding RNA may include sequences that aid in the initiation and / or termination of translation. The CRISPR protein coding sequence may include its wild-type 3'-UTR and / or wild-type 5'-UTR sequence. Additionally or alternatively, the CRISPR protein coding sequence is followed by, for example, a T-repeat sequence.

[0078] Preferably, the sequence encoding CRISPR protein is optimized for expression in plant cells, i.e. is codon-optimized for expression in plant cells.In addition or alternatively, the sequence encoding CRISPR protein can include intron sequences.Preferably, the sequence encoding CRISPR protein lacks intron sequences.

[0079] The coding RNA preferably comprises at least a mobile element and a sequence encoding a CRISPR protein. The coding RNA may comprise a single CRISPR protein coding sequence and / or a single mobile element. Alternatively, the coding RNA may comprise multiple CRISPR protein coding sequences and / or multiple mobile elements. The coding RNA may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more CRISPR protein coding sequences and / or 2, 3, 4, 5, 6, 7, 8, 9, 10 or more mobile elements. Preferably, the coding RNA comprises at least two mobile elements flanking the sequence encoding a CRISPR protein.

[0080] The coding RNA may include coding sequences for two or more different proteins, including but not limited to, coding sequences for 2, 3, 4, 5, 6 or more different proteins. As a non-limiting example, the coding RNA may include one or more CRISPR protein coding sequences and one or more reporter protein coding sequences, such as a sequence encoding green fluorescent protein (GFP).

[0081] Movable elements A mobile element as used in the present invention is preferably an element contained in at least one of the coding RNA, the editing RNA and the guide RNA as defined herein.

[0082] Editing RNA should be understood herein to include two elements, the first element being a coding RNA as defined herein, and the second element being a guide RNA. Optionally, the second element is a guide RNA as defined herein. Editing RNA can be synthetic or recombinant. Editing RNA can be a double-stranded or single-stranded ribonucleic acid molecule consisting of or comprising a coding RNA and a guide RNA. Optionally, editing RNA is included in a vector or construct.

[0083] Guide RNA is understood herein to include or consist of a mobile element and a guide RNA. Guide RNA can be synthetic or recombinant. Guide RNA can be a double-stranded or single-stranded ribonucleic acid molecule that includes or consists of a guide RNA and a mobile element. Optionally, guide RNA is included in a vector, construct or editing RNA. Optionally, editing RNA includes coding RNA and guide RNA.

[0084] Any mobile element that allows cell-to-cell movement of an RNA molecule is suitable for use in the present invention. The mobile element is capable of transferring the RNA molecule from a first "producer" cell to the vascular tissue of the plant and from the vascular tissue to a second "target" cell. The mobile element preferably transfers the RNA molecule to the xylem and / or phloem of the plant, preferably to the phloem.

[0085] Alternatively or additionally, the mobile element can use intercellular transport through the plasmodesmata to transfer the RNA molecule to a second "target" plant cell.

[0086] There are mobile RNA elements known in the art that can transport RNA molecules to specific plant tissues, such as meristems, root tissues, and / or leaves. Preferably, the mobile element transfers the RNA molecule to the meristem. However, the present invention is not limited to mobile elements that transfer the RNA molecule to the meristem. As a non-limiting example, the mobile element may additionally or alternatively transfer the RNA molecule to the gametes, leaves, and / or flowers of the plant. The cells containing the modification can then be isolated and regenerated into new plants.

[0087] Preferably, the mobile element has the ability to transfer RNA molecules to meristematic cells. The mobile element for use in the present invention thus preferably transfers RNA molecules from a first "producing" cell to a second "target" cell, the second cell being preferably a meristematic cell. Interestingly, it has previously been shown that mobile RNA elements are recognized by plant transport proteins, ensuring that the RNA associated with such mobile elements is protected from degradation during transport (Ham et al, 2009, Plant Cell (2009); 21 (1): 197-215).

[0088] Meristems are tissues that contain undifferentiated cells capable of cell division. These cells are totipotent and can develop into all other tissues and organs present in the plant: root meristem cells form root organs, and shoot meristem cells form stem organs. The mobile element preferably transfers the RNA molecule to a meristem cell, which is preferably at least one of an apical meristem cell, an intercalary meristem cell, and a floral meristem cell. Preferably, the mobile element transfers the RNA molecule to an apical meristem cell. The apical meristem cell is preferably a shoot apical meristem cell or a root apical meristem cell. Preferably, the mobile element transfers the RNA molecule to a shoot apical meristem cell (SAM). The shoot apical meristem is the source of all above-ground organs, including but not limited to leaves and flowers. The shoot apical meristem is also the site of most embryo development in the plant. Meristem cells, preferably shoot apical meristem cells, can develop into egg cells or pollen. Mobile elements for use in the present invention preferably transfer RNA molecules to meristematic cells, preferably shoot apical meristem cells, which preferably develop into egg cells and / or pollen. As used herein, it is understood that the phrase "mobile element transfers" may be used synonymously with the phrase "mobile element enables transfer."

[0089] Preferably, the coding RNA of the present invention comprises a mobile element, which allows cell-to-cell movement to meristematic cells. Preferably, the coding RNA of the present invention comprises a mobile element, which allows movement to shoot apical meristem cells. The movement of the RNA molecule of the present invention to a second cell results in a targeted genome modification in the second cell. In a non-limiting example, the targeted cell containing the targeted genome modification is a shoot apical meristem cell that develops into an egg cell and / or pollen, and thus the egg cell and / or pollen contain the targeted genome modification, which is passed on to the next generation.

[0090] The one or more mobile elements for use in the present invention may be located 5' and / or 3' to the sequence encoding the CRISPR protein. Additionally or alternatively, the mobile elements may be located 5' and / or 3' to the guide RNA.

[0091] Those skilled in the art will appreciate that any mobile element that allows cell-to-cell movement of coding RNA and optionally guide RNA and / or editing RNA may be suitable for use in the present invention. The mobile element may be at least one of a transfer RNA (tRNA) and a gene transcript or a functional fragment thereof. Examples of such mobile elements are disclosed, for example, in Zhang W, et al (2016) tRNA-Related Sequences Trigger Systemic mRNA Transport in Plants, Plant Cell. doi:10.1105 / tpc.15.01056 and Ellison EE et al, (2020) Multiplexed heritable gene editing using RNA viruses and mobile single guide RNAs. Nat Plants. doi:10.1038 / s41477-020-0670-y.

[0092] The tRNA may be a tRNA-like structure. Preferably, the tRNA or tRNA-like structure is a tRNA Ala , tRNA Arg , tRNA Asn , tRNA Asp , tRNA Cys , tRNA Gln , tRNA Glu , tRNA Gly , tRNA His , tRNA Ile , tRNA Leu , tRNA Lys , tRNA Met , tRNA phe , tRNA Pro , tRNA Ser , tRNA Thr , tRNA Trp , tRNATyr and tRNA Val Alternatively, the tRNA-like structure is selected from the group consisting of tRNA Ala , tRNA Arg , tRNA Asn , tRNA Asp , tRNA Cys , tRNA Gln , tRNA Glu , tRNA Gly , tRNA His , tRNA Ile , tRNA Leu , tRNA Lys , tRNA Met , tRNA phe , tRNA Pro , tRNA Ser , tRNA Thr , tRNA Trp , tRNA Tyr and tRNA Val and the tRNA-like structure lacks at least one of a D stem-loop, a D and T stem-loop, and a D and A stem-loop. Preferably, the tRNA or tRNA-like structure is selected from the group consisting of a tRNA Arg , tRNA Glu , tRNA Gly , tRNA Lys , tRNA Met and tRNA Thr Alternatively, the tRNA-like structure is selected from the group consisting of tRNA Arg , tRNA Glu , tRNA Gly , tRNA Lys , tRNA Met and tRNA Thr and wherein the tRNA-like structure lacks at least one of a D stem-loop, a D and T stem-loop, and a D and A stem-loop.

[0093] A tRNA or a tRNA-like structure can function as a cleavable mobile element. Thus, in certain embodiments, a tRNA or a tRNA-like structure as defined herein thus functions as a mobile element as defined herein as well as a cleavable sequence as defined herein.

[0094] The tRNA or tRNA-like structure for use in the present invention can be a naturally occurring tRNA that has the ability to function as a mobile element as well as a cleavable sequence, i.e., as a cleavable mobile element. Any naturally occurring plant tRNA can have the ability to function as a cleavable sequence. Thus, any tRNA or tRNA-like structure that functions as a mobile element can also function as a cleavable sequence, e.g., as a cleavable mobile element. Those skilled in the art understand how to easily obtain the sequence of such a plant tRNA or tRNA-like structure.

[0095] Naturally occurring tRNAs may contain recognition sites for cleavage by RNase P and / or RNase Z. Naturally occurring tRNAs may preferably contain the leader sequence AACAAA at or near the 3' and / or 5' end. The leader sequence may allow processing or "cleavage" of the mobile element. Preferably, the tRNA contains the leader sequence AACAAA at or near the 5' end of the tRNA. Suitable tRNA cleavable elements are described, for example, in Xie et al. ("Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system", 2015, Proc Natl Acad Sci USA; 112(11):3570-5), which is incorporated herein by reference. These cleavable tRNA sequences may thus additionally function as mobile elements as defined herein. A preferred cleavable tRNA is a tRNA Gly It is.

[0096] Alternatively or additionally, a tRNA or tRNA-like structure as defined herein can be modified to additionally function as a cleavable sequence. The tRNA or tRNA-like structure may be modified to include a recognition site for cleavage by at least one of RNase P and RNase Z. Preferably, the tRNA or tRNA-like structure is modified to include the leader sequence AACAAA, preferably at or very close to the 3' and / or 5' end. Preferably, the tRNA includes the leader sequence AACAAA at or very close to the 5' end of the tRNA.

[0097] The coding RNA, guide RNA and / or editing RNA comprising a cleavable mobile element are preferably cleaved in the second or "target" cell after the initial translocation. The cleavable mobile element may be located in the coding RNA, at or very close to the 3' and / or 5' end of said coding RNA. The cleavable mobile element may be located in the guide RNA, at or very close to the 3' and / or 5' end of said guide RNA. Optionally, the cleavable mobile element may be located between two or more guide RNAs comprised in a guide RNA as defined herein. The cleavable mobile element may be located in the editing RNA, at or very close to the 3' and / or 5' end of the editing RNA. As a non-limiting example, the cleavable mobile element may be located between the guide RNA, optionally the guide RNA, and the coding RNA comprised in the editing RNA. Additionally or alternatively, the cleavable mobile element may be located between one or more guide RNAs of a guide RNA as defined herein.

[0098] The mobile element may be a gene transcript or a functional fragment thereof. Preferably, the gene transcript is a transcript of a gene selected from the group consisting of FT, GAI, SP2G, SP3D, SP5G, SP9D, CEN-like protein 1, FT and TF protein MOTHER 1, flowering locus Ta and flowering locus Tb, PP16-1, GAIP, Scarecrow-like (SCL14P), Shoot Meristem-less (STMP), Ethylene Response Factor (ERFP) and Myb (MybP). The gene transcript may be a naturally occurring gene transcript, or a mutant or truncated gene transcript. Preferably, the mobile element is a gene transcript, and the gene transcript is at least one of FT, mutant FT and truncated FT. The gene transcript may be a naturally occurring gene transcript, for example, the transcript is a transcript as listed in Table 1 or a homolog or ortholog thereof.

[0099] The gene transcript or a functional fragment thereof may contain at least one of a tRNA-like structure (TLS) motif and a phosphotyrosine binding (PTB) motif.

[0100] The gene transcript or functional fragment thereof may contain a tRNA-like structure (TLS) motif. Such structures are known in the art to initiate systemic transport of RNA molecules in plants (Zhang et al, Plant Cell. 2016;28(6):1237-49. Examples of such mobile transcripts are listed in Zhang et al supra, supplemental dataset 1-3, which transcripts are incorporated herein by reference. The mobile element may be a bicistronic mRNA:tRNA gene transcript.

[0101] Alternatively or additionally, the gene transcript or functional fragment thereof may contain a phosphotyrosine binding (PTB) motif. As non-limiting examples, the genes from Cucurbita maxima cultivar Big Max: PP16-1, GAIP, Scarecrow-like (SCL14P), Shoot Meristemless (STMP), Ethylene Response Factor (ERFP), Myb (MybP) contain PTB binding motifs and have been shown in the art to be mobile and present in pumpkin phloem sap (Ham et al., supra).

[0102] [Table 1]

[0103] A mobile element for use in the present invention may have at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs: 1-16 and / or at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs: 1-16 and 28. The mobile element may be a functional fragment of any one of SEQ ID NOs: 1-16 and / or a functional fragment of any one of SEQ ID NOs: 1-16 and 28.

[0104] CRISPR proteins The coding RNA preferably comprises a sequence that codes for a CRISPR protein in addition to the mobile element. The sequence that codes for the CRISPR protein can be located 3' or 5' of the mobile element as defined herein. Preferably, the codon sequence of the CRISPR protein is optimized for expression in plant cells.

[0105] The CRISPR protein is preferably at least one of a CRISPR nuclease, a CRISPR nickase, and a CRISPR deaminase. Preferably, the CRISPR protein is a CRISPR nuclease.

[0106] The CRISPR protein encoded by the coding RNA may be any suitable CRISPR protein known in the art. Preferably, the CRISPR protein encoded by the coding RNA comprises a nuclear localization signal (NLS) that directs the expressed CRISPR protein to the nucleus of the plant cell. The NLS may be located at the C-terminus and / or N-terminus of the CRISPR protein. Any known nuclear localization signal may be suitable for use in the present invention. Preferred nuclear localization signals include, but are not limited to, the NLS MEDPTMAPKKKRKV (SEQ ID NO: 17) of SV40 large T antigen, the monopartite NLS PKKKRKV (SEQ ID NO: 18) and the NLS KRPAATKKAGQAKKKK (SEQ ID NO: 19) of nucleoplasmin. The CRISPR protein may comprise two or more nuclear localization signals, for example, one or more at the N-terminus and one or more at the C-terminus. The CRISPR protein may comprise two or more different nuclear localization signals, for example, the NLS at the C-terminus may be different from the N-terminus.

[0107] CRISPR nuclease comprises a nuclease domain and at least one domain that interacts with guide RNA. When complexed with guide RNA, CRISPR protein complex is guided to specific nucleic acid sequence by guide RNA. Guide RNA interacts with CRISPR nuclease and also interacts with target specific nucleic acid sequence, so that CRISPR nuclease can introduce double strand break at target site when guided to site containing target nucleic acid sequence via guide sequence.

[0108] If the CRISPR protein is a CRISPR nuclease, both domains of the nuclease are catalytically active and the protein is capable of introducing a double-stranded break at the target site. If the CRISPR protein is a CRISPR nickase, one domain of the nuclease is catalytically active and one domain is not catalytically active and the protein is capable of introducing a single-stranded break at the target site.

[0109] The skilled artisan knows well how to design a guide RNA in such a way that, when the guide RNA is combined with a CRISPR nuclease or CRISPR nickase, it achieves the introduction of a single- or double-stranded break at a predetermined site in a nucleic acid molecule.

[0110] CRISPR proteins can be broadly classified into six major types (types I-VI), which are further subdivided into subtypes based on the content and sequence of core elements (Makarova et al., 2011, Nat Rev Microbiol 9:467-77 and Wright et al., 2016, Cell 164(1-2):29-44). In general, the two key elements of the CRISPR protein complex are the CRISPR protein and the guide RNA.

[0111] The type II CRISPR protein complex is a single protein (~160KDa), the signature Cas9 protein, that has the ability to create crRNA to specifically cleave double-stranded DNA. Cas9 proteins typically contain two nuclease domains, a RuvC-like nuclease domain near the amino terminus and an HNH (or McrA-like) nuclease domain near the middle of the protein. Each nuclease domain of the Cas9 protein is specialized to cleave one side of the double helix (Jinek et al, 2012, Science 337(6096):816-821). The Cas9 protein is an example of a CRISPR protein in the type II CRISPR / -CAS system, which forms an endonuclease when combined with the crRNA and a second RNA called the trans-activating crRNA (tracrRNA). The crRNA and tracrRNA together function as guide RNAs. The CRISPR nuclease complex introduces a DNA double-strand break (DSB) at a location in the genome defined by the crRNA. Jinek et al. (2012, Science 337:816-820) demonstrated that a single-stranded chimeric guide RNA (defined herein as "sgRNA" or "single guide RNA"), created by fusing an integral portion of crRNA with tracrRNA, was able to form a functional CRISPR nuclease complex in combination with the Cas9 protein.

[0112] A V-type CRISPR protein complex, clustered regularly interspaced short palindromic repeats 1 or CRISPR / Cpf1 from Prevotella and Francisella, has been described. The Cpf1 gene is associated with the CRISPR locus and encodes an endonuclease that the crRNA uses to target DNA. Cpf1 is a smaller endonuclease than Cas9, which may overcome some of the limitations of the CRISPR-Cas9 system. Cpf1 is a single RNA-guided endonuclease that lacks tracrRNA, which utilizes a T-rich protospacer adjacent motif. Cpf1 cleaves DNA with sticky end-type DNA double strand breaks (Zetsche et al (2015) Cell 163(3):759-771). The V-type CRISPR protein system preferably includes at least one of Cpf1, C2c1, and C2c3.

[0113] The CRISPR protein for use in the present invention may comprise any CRISPR protein as defined herein above.Preferably, the CRISPR protein is a type II CRISPR protein, preferably a type II CRISPR nuclease, such as Cas9 (e.g., the protein of SEQ ID NO:20, encoded by SEQ ID NO:21 or the protein of SEQ ID NO:22) or a type V CRISPR protein, preferably a type V CRISPR nuclease, such as Cpf1 (e.g., the protein of SEQ ID NO:23, encoded by SEQ ID NO:24) or Mad7 (e.g., the protein of SEQ ID NO:25 or 26) or a protein derived therefrom, preferably with said protein at least about 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity over its entire length.

[0114] Preferably, the CRISPR protein is a type II CRISPR nuclease, preferably a Cas9 nuclease.

[0115] Those skilled in the art know how to find and prepare coding RNA, including sequences encoding CRISPR proteins, such as sequences encoding CRISPR nucleases. Many reports are available in the prior art regarding their design and use. For example, see the review by Haeussler et al. (J Genet Genomics. (2016) 43(5): 239-50. doi: 10.1016 / j.jgg.2016.04.008.) or the review by Lee et al. (Plant Biotechnology Journal (2016) 14(2) 448-462) regarding the design of guide RNA and its use in combination with CAS protein (originally obtained from S. pyogenes).

[0116] Generally, CRISPR nucleases such as Cas9 contain two catalytically active nuclease domains. For example, Cas9 protein can contain a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC and HNH domains work together to create double-strand breaks in DNA, both of which are single-strand breaks (Jinek et al., Science, 337:816-821).

[0117] Dead CRISPR nuclease comprises a modification such that none of the nuclease domains show cleavage activity.CRISPR nickase can be a mutant of CRISPR nuclease in which one of the nuclease domains is mutated so that it is no longer functional (i.e., there is no nuclease activity).One example is the SpCas9 mutant with either D10A or H840A mutation.Preferably, the nuclease encoded by the coding RNA is not a dead nuclease.

[0118] Preferably, the CRISPR protein is either a nickase or an (endo)nuclease.

[0119] The CRISPR protein encoded by the coding RNA may comprise or consist of the entire CRISPR type II or type V protein, or a variant or functional fragment thereof. Preferably, such a fragment binds to the guide RNA but may lack one or more residues required for, e.g., nuclease activity.

[0120] Preferably, the CRISPR protein encoded by the coding RNA of the present invention is a Cas9 protein. The Cas9 protein is expressed in Streptococcus pyogenes (SpCas9; NCBI reference sequence NC_017053.1; UniProtKB-Q99ZW2), Geobacillus thermodenitrificans (UniProtKB-A0A178TEJ9), Corynebacterium ulcerans (NCBI references: NC_015683.1, NC_017317.1); Corynebacterium diphtheria (NCBI references: NC_016782.1, NC_016786.1); Spiroplasma syrphidicola (NCBI reference: NC_021284.1); Prevotella intermedia (NCBI reference: NC_021284.1); intermedia (NCBI Reference: NC_017861.1); Spiroplasma taiwanense (NCBI Reference: NC_021846.1); Streptococcus iniae (NCBI Reference: NC_021314.1); Belliella baltica (NCBI Reference: NC_018010.1); Psychroflexus torquis (NCBI Reference: NC_018721.1); Streptococcus thermophilus (NCBI Reference: YP_820832.1); Listeria innocua (NCBI Reference: NP_472073.1); Campylobacter jejuni jejuni (NCBI Reference: YP_002344900.1); or Neisseria meningitidis (NCBI Reference: YP_002342100.1).From these, Cas9 mutants having HNH or RuvC domain inactivation homologs with SpCas9, such as SpCas9_D10A or SpCas9_H840A, or Cas9s that have been made into nickases by having equivalent substitutions at positions corresponding to D10 or H840 of the SpCas9 protein, are also included.

[0121] The CRISPR protein encoded by the coding RNA can be or be derived from Cpf1, for example, Cpf1 from Acidaminococcus sp. UniProtKB-U2UMQ6. The mutant can be a Cpf1 nickase with an inactivated RuvC or NUC domain, such that the RuvC or NUC domain no longer has nuclease activity. Those skilled in the art are familiar with the techniques available in the art that allow inactivated nucleases, such as inactivated RuvC or NUC domains, such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis. One example of a Cpf1 nickase with an inactivated NUC domain is Cpf1 R1226A (see Gao et al. Cell Research (2016) 26:901-913, Yamano et al. Cell (2016) 165(4):949-962). In this mutant, there is an arginine to alanine (R1226A) conversion in the NUC domain, which renders it inactive.

[0122] The CRISPR protein encoded by the coding RNA can be or be derived from CRISPR-CasΦ, a nuclease that is roughly half the size of Cas9. CRISPR-CasΦ uses a single crRNA for nucleic acid targeting and cleavage, as described, for example, in Pausch et al (CRISPR-CasΦ from huge phages is a hypercompact genome editor, Science (2020); 369 (6501): 333-337).

[0123] An active, partially inactive or dead CRISPR protein encoded by the coding RNA may serve to target a fused functional domain, as detailed herein, to a specific site in DNA as determined by the guide RNA.

[0124] Thus, the CRISPR protein can be fused with a functional domain. Optionally, such a functional domain is a domain of epigenetic modification, for example a histone modification domain. The domain of epigenetic modification can be selected from the group consisting of methyltransferase, demethylase, deacetylase, methylase, deacetylase, deoxygenase, glycosylase and acetylase (Cano-Rodriguez et al, Curr Genet Med Rep (2016) 4: 170-179). The methyltransferase can be selected from the group consisting of G9a, Suv39h1, DNMT3, PRDM9 and Dot1L. The demethylase can be LSD1. The deacetylase can be SIRT6 or SIRT3. The methylase can be at least one of KYP, TgSET8 and NUE. The deacetylase can be selected from the group consisting of HDAC8, RPD3, Sir2a and Sin3a. The deoxygenase can be at least one of TET1, TET2 and TET3, preferably TET1cd (Gallego-Bartolome J et al, Proc Natl Acad Sci USA. (2018); 115(9): E2125-E2134). The glycosylase can be TDG. The acetylase can be p300.

[0125] Optionally, the functional domain is a deaminase or a functional fragment thereof, selected from the group consisting of apolipoprotein B mRNA editing complex (APOBEC) family deaminases, activation-induced cytosine deaminase (AID), ACF1 / ASE deaminase, adenine deaminase, and ADAT family deaminase. Alternatively or additionally, the deaminase or functional fragment thereof may be ADAR1 or ADAR2 or a mutant thereof.

[0126] The Apolipoprotein B mRNA editing complex (APOBEC) family of cytosine deaminase enzymes includes eleven proteins that act to initiate mutagenesis in a controlled and beneficial manner.Preferably, the APOBEC deaminase is selected from the group consisting of APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4 and activation-induced (cytidine) deaminase.Preferably, the APOBEC family cytosine deaminase is activation-induced cytosine (or cytidine) deaminase (AID) or apolipoprotein B editing complex 3 (APOBEC3).Preferably, the deaminase domain fused to the CRISPR protein is an APOBEC1 family deaminase.

[0127] Another exemplary preferred type of deaminase domain that can be fused to CRISPR system nuclease is adenine or adenosine deaminase, such as ADAT adenine deaminase family. Furthermore, the adenine deaminase can be TadA or a variant thereof, as described in Gaudelli et al., 2017 (Gaudelli et al. 2017 Nature 551:464-471). Furthermore, the CRISPR system nuclease can be fused to a deaminase domain, for example, from ADAR1 or ADAR2. The deaminase domain of the present invention can comprise or consist of a whole deaminase protein or a catalytically active fragment thereof. Preferably, the deaminase domain has deaminase activity. Optionally, the CRISPR protein is further fused to a UDG inhibitor (UGI) domain.

[0128] The coding RNA of the present invention may comprise two or more sequences encoding CRISPR proteins. Optionally, the coding RNA may encode the same CRISPR protein more than twice as frequently. Alternatively or additionally, the coding RNA encodes two or more different CRISPR proteins, such as but not limited to CRISPR-Cas9 and CRISPR-Cpf1.

[0129] Guide RNA In the target cell, the coding RNA is translated, resulting in expression of the CRISPR protein, which associates with a guide RNA that guides the CRISPR protein to a specific location in the plant cell's genome, thereby achieving targeted genome modification.

[0130] In one embodiment, the present invention therefore also relates to a combination of a coding RNA as defined herein with one or more guide RNAs. The guide RNA may be included in the guide RNA. The guide RNA comprises a guide RNA and a mobile element. Optionally, the guide RNA comprises two or more mobile elements and / or two or more guide RNAs. The present invention therefore also relates to a combination of a coding RNA as defined herein with one or more guide RNAs.

[0131] The guide RNA directs the complex to a defined target site in the double-stranded nucleic acid molecule, also called the protospacer sequence. The guide RNA preferably comprises a sequence for targeting the CRISPR protein complex to the protospacer sequence that is near, at or within the sequence of interest in the genome of the plant cell.

[0132] The guide RNA can be a single guide (sg)RNA molecule, or a combination of crRNA and tracrRNA as separate molecules (e.g., for Cas9), or only a crRNA molecule (e.g., for Cpf1 and CasΦ). Preferably, the guide RNA comprises at least one of a single guide RNA (e.g., for Cas9) or only a crRNA (e.g., for Cpf1 and CasΦ).

[0133] The CRISPR protein complex for use in the method of the present invention may thus comprise a guide RNA, the guide RNA comprises a combination of crRNA and tracrRNA, and preferably the CRISPR protein is Cas9. The crRNA and tracrRNA are preferably combined into a sgRNA (single guide RNA). Alternatively, the CRISPR protein complex for use in the method of the present invention may comprise a guide RNA, the guide RNA comprises a crRNA, and preferably the CRISPR protein is Cpf1 or CasΦ.

[0134] The guide RNA for use in the methods of the invention may comprise a sequence capable of hybridizing to or adjacent to a sequence of interest, preferably a sequence of interest as defined herein. The guide RNA may comprise a nucleotide sequence that is fully complementary to a sequence in the sequence of interest, i.e., the sequence of interest comprises a protospacer sequence. Alternatively or in addition, the guide RNA for use in the methods of the invention may comprise a sequence capable of hybridizing to or adjacent to the complement of the sequence of interest.

[0135] The portion of the crRNA that is complementary to the protospacer sequence is designed to have sufficient complementarity with the protospacer sequence to hybridize with the protospacer sequence and direct sequence-specific binding of the complexed CRISPR protein. The protospacer sequence is preferably adjacent to a protospacer adjacent motif (PAM) sequence that can interact with the CRISPR protein of the RNA-guided CRISPR protein complex. For example, when the CRISPR protein is S. pyogenes Cas9, the PAM sequence is preferably 5'-NGG-3', where N can be any one of T, G, A, or C.

[0136] The skilled artisan has the ability to engineer the crRNA to target any desired sequence, preferably by engineering the sequence to be at least partially complementary to and hybridize with any desired protospacer sequence. Preferably, the complementarity between a portion of the crRNA sequence and its corresponding protospacer sequence is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 100% when optimally aligned using a suitable alignment algorithm. The portion of the crRNA sequence that is complementary to the protospacer sequence may be at least about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75 or more nucleotides in length. In some preferred embodiments, the sequence complementary to the target sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20 nucleotides in length. Preferably, the length of the sequence complementary to the target sequence is at least 17 nucleotides. Preferably, the complementary crRNA sequence is about 10-30 nucleotides in length, about 17-25 nucleotides in length, or about 15-21 nucleotides in length. Preferably, the portion of the crRNA complementary to the protospacer sequence is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length, preferably 20 or 21 nucleotides, preferably 20 nucleotides.

[0137] Molecules or sequences suitable as crRNA and tracrRNA are well known in the art (see, for example, WO 2013142578 and Jinek et al., Science (2012) 337, 816-821). Preferably, the crRNA and tracrRNA are linked together to form a single guide (sg)RNA. The crRNA and tracrRNA can be linked using any conventional method known in the art, preferably covalently linked. Covalent linkage of the crRNA and tracrRNA is described, for example, in Jinek et al., supra, and WO 13 / 176772, which are incorporated herein by reference. The crRNA and tracrRNA can be covalently linked, for example, using linker nucleotides or via a direct covalent linkage between the 3' end of the crRNA and the 5' end of the tracrRNA.

[0138] The guide RNA may be linked to a mobile element as defined herein, resulting in a guide RNA. Preferably, at least when the guide RNA is not part of an editing RNA as defined herein, the guide RNA is linked to a mobile element. Thus, the guide RNA comprises two elements: a mobile element and a guide RNA. The mobile element may be directly linked to the guide RNA. Alternatively, one or more nucleotides, for example about 1-500, 5-400, 10-300, 15-200 or 20-100 nucleotides, may be located between the mobile element and the guide RNA. The mobile element allows the cell-to-cell movement of the guide RNA.

[0139] The mobile element of the guide RNA can be the same element or a different element present in the coding RNA. Preferably, the mobile element present in the guide RNA and the mobile element present in the coding RNA guide both RNA molecules to the same target tissue. Preferably, the mobile element present in the guide RNA molecule and the mobile element present in the coding RNA molecule are the same mobile element or substantially the same mobile element.

[0140] A guide RNA may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more mobile elements. One or more mobile elements may be located upstream and / or downstream of the sgRNA. Additionally or alternatively, one or more mobile elements may be located upstream and / or downstream of the crRNA.

[0141] Optionally, a guide RNA as defined herein may comprise two or more sgRNAs and / or two or more crRNAs, e.g., to target two or more different sequences of interest or to target two or more positions of the same sequence of interest.

[0142] The guide RNA may comprise two or more guide RNA sequences. The guide RNA may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more guide RNA sequences. In other words, the guide RNA may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more single guide (sg)RNAs and / or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more crRNAs.

[0143] Different guide RNA sequences in a guide RNA can direct a CRISPR protein to different locations in the same gene. Alternatively, or in addition, different guide sequences in a guide RNA can direct a CRISPR protein to different genes in a plant cell.

[0144] There may be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more nucleotides separating different guide RNAs in the guide RNA. Optionally, different guide RNAs in the guide RNA are separated by a cleavable spacer sequence, preferably a cleavable spacer sequence as defined herein. The guide RNA may further comprise multiple mobile elements, preferably located in the guide RNA such that after cleavage of the spacer sequence, the cleaved RNA molecule will each comprise a mobile element plus a guide RNA.

[0145] RNA for editing The guide RNA and the coding RNA may be comprised in a single editing RNA, which editing RNA comprises at least the following elements: i) a sequence encoding a CRISPR protein; ii) a first movable element; and iii) Guide RNA Includes.

[0146] The sequence encoding the CRISPR protein and the first mobile element may be part of the coding RNA as defined herein. Alternatively or additionally, the guide RNA may be part of the guide RNA as defined herein. Preferably, the editing RNA thus comprises at least the following two elements: i) a coding RNA as defined herein; and ii) Guide RNA Includes.

[0147] Optionally, the editing RNA comprises the following two elements: i) a coding RNA as defined herein; and ii) a guide RNA as defined herein; Includes.

[0148] The sequence encoding the CRISPR protein may be located at the 5' end of the guide RNA. Alternatively, the guide RNA may be located at the 5' end of the sequence encoding the CRISPR protein. The sequence encoding the CRISPR protein may be located at the 5' end of the guide RNA. Alternatively, the guide RNA may be located at the 5' end of the sequence encoding the CRISPR protein. As detailed herein, the guide RNA may comprise multiple guide RNAs, optionally separated by cleavable spacer sequences and / or mobile elements. The sequence encoding the CRISPR protein is preferably located at the 5' or 3' end of the multiple guide RNAs.

[0149] The editing RNA preferably comprises at least one or more mobile elements, which may be located at the 5' end of the editing RNA, at the 3' end of the editing RNA, between the sequence encoding the CRISPR protein and the guide RNA, and / or between multiple guide RNAs within the guide RNA.

[0150] The editing RNA may comprise at least two mobile elements, such as a first and a second mobile element. Preferably, at least one of the first and second mobile elements is located at the 5'-end or 3'-end of the editing RNA. One of the mobile elements is preferably directly adjacent to the sequence encoding the CRISPR protein, and one of the mobile elements is preferably directly adjacent to the guide RNA. Thus, one of the mobile elements is located near the 5'-end or 3'-end of the sequence encoding the CRISPR protein, and the other mobile element is located near the 5'-end or 3'-end of the guide RNA.

[0151] The editing RNA may further comprise one or more cleavable spacer sequences.Preferably, the cleavable spacer is located between the sequence encoding the CRISPR protein and the guide RNA.Preferably, the spacer sequence is located between the coding RNA and the guide RNA.

[0152] When the editing RNA comprises a cleavable spacer sequence, the editing RNA preferably also comprises at least two mobile elements. Preferably, these at least two mobile elements translocate the RNA molecule to the same target tissue. Preferably, the at least two mobile elements are the same mobile element or substantially the same mobile element.

[0153] Preferably, the cleavable spacer sequence is located in the editing RNA such that upon cleavage separate RNA molecules are generated, each of the separate RNA molecules comprising a mobile element. As a non-limiting example, upon cleavage of the editing RNA, a coding RNA molecule as defined herein and a guide RNA molecule as defined herein are generated, the guide RNA molecule comprising a mobile element.

[0154] When the editing RNA comprises a cleavable spacer sequence, the orientation of the various elements in the editing RNA can be as follows: a) a first movable element; b) a sequence encoding a CRISPR protein; c) a cleavable spacer; d) a second movable element; e) Guide RNA.

[0155] Those skilled in the art will appreciate that, in editing RNA, - b), a), c), d) and e); - a), b), c), e) and d); - b) a), c), e) and d); - a), e), c), d), b); - e), a), c), d) and b); - a), e), c), b) and d); and - e) a), c), b) and d) It will be readily appreciated that other rearrangements, such as the following, are equally suitable.

[0156] The guide RNA and the mobile element can be collectively annotated as "guide RNA" as defined herein. Those skilled in the art will understand that the guide RNA can include one, two or more guide RNAs and additional mobile elements and cleavable spacer sequences as detailed herein. The cleavable sequence in the editing RNA can thus be located between two or more guide RNAs of the guide RNA.

[0157] The editing RNA can be cleaved in the first (producing) cell and / or in the second (target) cell. The cleavable spacer sequence can be any sequence known to those skilled in the art that is suitable for cleaving RNA molecules in plant cells. Non-limiting examples of such cleavable spacer sequences include, but are not limited to, the following sequences: UCGCGGCCGGGUACGUGUUGAGC (SEQ ID NO: 27) Examples of the spacer include the following:

[0158] The cleavable sequence may be a sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:27.

[0159] Alternatively, the cleavable spacer sequence may be any tRNA sequence, preferably from a plant. The cleavable tRNA sequence may be a naturally occurring sequence or may be modified to include a cleavable sequence. The tRNA sequence may be a tRNA-like structure as defined herein. The cleavable tRNA sequence may be a cleavable mobile element as defined herein. The cleavable tRNA sequence may include a recognition site for cleavage by RNase P and / or RNase Z. The cleavable tRNA sequence preferably has a tRNA leader sequence at or very close to the 3' and / or 5' end, preferably at or very close to the 5' end. The tRNA leader sequence preferably includes the sequence AACAAA or a sequence that differs from said sequence by one or two nucleotides. Suitable tRNA cleavable elements are described, for example, in Xie et al. ("Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system", 2015, Proc Natl Acad Sci USA; 112(11):3570-5), which is incorporated herein by reference.

[0160] Chemical modification of one or more RNAs The RNA of the present invention includes at least one of coding RNA, guide RNA, and editing RNA.

[0161] At least one of the RNAs of the invention may comprise or consist of unmodified or naturally occurring nucleotides. Optionally, all of the RNAs used in the methods of the invention may comprise or consist of unmodified or naturally occurring nucleotides.

[0162] Alternatively or additionally, at least one of the RNAs of the present invention may comprise or consist of modified or non-naturally occurring nucleotides. Optionally, all of the RNAs of the present invention may comprise or consist of modified or non-naturally occurring nucleotides. Such chemically modified nucleotides preferably protect one or more RNAs from degradation. Optionally, at least one of the RNAs, i.e., at least one of the coding RNA, guide RNA and editing RNA, comprises ribonucleotides and non-ribonucleotides. At least one of the RNAs may comprise one or more ribonucleotides and one or more deoxyribonucleotides.

[0163] Optionally, at least one of the RNAs, i.e., the coding RNA, the guide RNA and the editing RNA, comprises one or more non-naturally occurring nucleotides or nucleotide analogs, such as nucleotides with phosphorothioate bonds, locked nucleic acid (LNA) nucleotides comprising a methylene bridge between the 2' and 4' carbons of the ribose ring, bridged nucleic acids (BNA), 2'-O-methyl analogs, 2'-deoxy analogs, 2'-fluoro analogs or combinations thereof. Modified nucleotides may include modified bases selected from the group consisting of, but not limited to, 2-aminopurine, 5-bromo-uridine, pseudouridine, inosine and 7-methylguanosine.

[0164] At least one of the RNAs, i.e., the coding RNA, the guide RNA and the editing RNA, may be chemically modified at one or more terminal nucleotides by incorporation of 2'-O-methyl (M), 2'-O-methyl 3' phosphorothioate (MS), 2'-O-methyl 3' thio PACE (phosphonoacetate) (MSP) or combinations thereof. Such chemically modified RNAs may include increased stability and / or increased activity compared to unmodified RNA (Hendel et al, 2015, Nat Biotechnol. 33(9); 985-989; Maruggi et al, Mol Ther, 2019 Apr 10; 27(4): 757-772). In certain embodiments of the invention, deoxyribonucleotides and / or nucleotide analogs may be incorporated into the engineered RNA structure.

[0165] plant body Any plant may be suitable for use in the present invention. The present invention is thus not limited to any particular plant. Preferred plants are plants that have a vascular system, i.e., vascular plants.

[0166] Plants for use in the present invention may be monocotyledons or dicotyledons. Plants may be crop or cereal plants. Non-limiting examples of cereal plants for use in the present invention are cassava, corn, sorghum, soybean, wheat, oat or rice. Crop plants are plant species cultivated and bred by humans. Crop plants may be cultivated for food purposes (e.g., field crops) or ornamental purposes (e.g., production of cut flowers, grass for lawns, etc.). Crop plants as defined herein also include plants for the recovery of non-edible products, such as oil for fuel, plastic polymers, pharmaceutical products, cork, etc.

[0167] The plant may also be a tree or a producing plant, a fruit or a vegetable (e.g. a tree such as a citrus tree, e.g. an orange, grapefruit or lemon tree; a peach or nectarine tree; an apple or pear tree; a nut tree such as an almond or walnut or pistachio tree; a Solanum plant; a Brassica plant; a Lactuca plant; a Spinacia plant; a Capsicum plant; a Solanum plant, preferably a Solanum lycopersicum plant). Preferably, the plant is a Solanum plant. A preferred plant for use in the present invention is a Solanum lycopersicum plant.

[0168] In another preferred embodiment, the cell is obtainable from a plant selected from the group consisting of asparagus, barley, blackberry, blueberry, broccoli, cabbage, canola, carrot, cassava, cauliflower, chicory, cocoa, coffee, cotton, cucumber, eggplant, grape, chili pepper, lettuce, corn, melon, rapeseed, pepper, potato, pumpkin, raspberry, rice, rye, sorghum, spinach, squash, strawberry, sugar cane, sugar beet, sunflower, sweet pepper, tobacco, tomato, watermelon, wheat, and zucchini.

[0169] Preferably, a plant for use in the present invention comprises one or more meristems that are inaccessible or inefficiently accessible by a viral delivery vector. Preferably, a plant for use in the present invention comprises one or more shoot apical meristems that are inaccessible or inefficiently accessible by a viral delivery vector.

[0170] Preferably, the plant for use in the present invention is not Nicotiana benthamiana, and preferably is not Nicotiana benthamiana GenBank Accession PRJNA170566.

[0171] Delivery Vector At least one of the coding, guide and editing RNAs as defined herein may be introduced into the phloem by injecting one or more RNAs directly into the vascular tissue of the plant. In this regard, the coding, guide and / or editing RNA may comprise chemical modifications, for example to increase the stability of the RNA.

[0172] Alternatively or additionally, at least one of the coding RNA, guide RNA and editing RNA as defined herein is introduced into the plant cell by introducing a vector expressing one or more of said RNAs into the plant cell. Thus, in one embodiment, the present invention relates to a vector expressing an RNA of the present invention. The present invention thus relates to at least one of a vector expressing a coding RNA as defined herein, a vector expressing a guide RNA as defined herein and a vector expressing an editing RNA as defined herein. A vector of the present invention may express a combination of RNAs of the present invention. For example, a vector may express a coding RNA and a guide RNA.

[0173] The vector can be used to express the RNA of the invention in a plant host cell (first, producing cell). The RNA of the invention can thus be transcribed from an expression cassette contained in the vector. The vector backbone can be, for example, a plasmid into which the expression cassette is integrated or, if suitable transcriptional regulatory sequences are already present (e.g., (inducible) promoters), into which only the desired nucleotide sequence (e.g., a sequence encoding one or more of the RNAs of the invention) is integrated downstream of said transcriptional regulatory sequences.

[0174] Suitable promoters, preferably promoters suitable for expression of at least one of the editing RNA, the guide RNA and the coding RNA, include, but are not limited to, viral natural coat protein promoters. Such native coat protein promoters for use in the present invention can be, for example, those derived from tobacco rattle virus (e.g., as described in Deng X et al, 2013, Modification of Tobacco rattle virus RNA1 to Serve as a VIGS Vector Reveals That the 29K Movement Protein Is an RNA Silencing Suppressor of the Virus, Mol Plant-Microbe Interact. doi:10.1094 / MPMI-12-12-0280-R), pea early browning virus (e.g., as described in MacFarlane SA and Popovich AH(2000)Efficient expression of foreign proteins in roots from tobravirus vectors.Virology.doi:10.1006 / viro.1999.0098), any one of the tobacco rattle virus strains TCM, PLB, PSG and PRV (e.g., Goulden MG et al, 1990, The complete nucleotide sequence of PEBV RNA2 reveals the presence of a novel open reading frame and provides insights into the structure of tobraviral subgenomic promoters. Nucleic Acids Res. doi:10.1093 / nar / 18.15.4507). The promoter can be a PEBV promoter, a U6 promoter, or a pol III promoter.

[0175] The vector of the present invention may contain additional genetic elements that facilitate its use in molecular cloning, such as, for example, selectable markers, multiple cloning sites, etc. The vector backbone may be, for example, a binary or super binary vector as known in the art (see, for example, U.S. Pat. No. 5,591,616, U.S. Patent Publication No. 2002138879 and WO 95 / 06722), a co-recombinant vector or a T-DNA vector.

[0176] The vector according to the present invention is particularly suitable for introducing the expression of the RNA of the present invention into plant cells. Preferred expression vectors are naked DNA, DNA complexes or viral vectors.

[0177] Preferred naked DNA is a linear or circular nucleic acid molecule, such as a plasmid. Plasmid refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. The DNA complex can be a DNA molecule bound to any carrier suitable for delivering DNA to cells. Preferred carriers are selected from the group consisting of lipoplexes, liposomes, polymersomes, polyplexes, PEG, dendrimers, inorganic nanoparticles, virosomes and cell-penetrating peptides.

[0178] The vector is preferably a viral vector. The viral vector can be a DNA virus or an RNA virus. The viral vector can be or be based on a tobamovirus, a tobravirus, a potexvirus, a geminivirus, an alphamovirus, a cucumovirus, a potyvirus, a tombusvirus, a hordeivirus or a nucleorhabdovirus.

[0179] The tobamovirus virus vector can be at least one of tobacco mosaic virus (TMV) and sunhemp mosaic virus (SHMV). The tobravirus virus vector can be tobacco rattle virus (TRV). The potexvirus virus vector can be at least one of potato virus X (PVX) and papaya mosaic potexvirus (PapMV). The geminivirus virus vector can be comovirus cowpea mosaic virus (CPMV). Further examples of suitable geminivirus virus vectors can include cabbage leaf curl virus, tomato golden mosaic virus, bean yellow dwarf virus, African cassava mosaic virus, wheat dwarf virus, oak streak mastre virus, tobacco yellow dwarf virus, tomato yellow leaf curl virus, bean golden mosaic virus, sugar beet curly top virus, maize streak virus, and tomato pseudocurly top virus. The alphamovirus can be alfalfa mosaic virus (AMV). The cucumovirus can be cucumber mosaic virus (CMV). The potyvirus can be plum pox virus (PPV). The tombusvirus can be tomato bushy stunt virus (TBSV). The hordeivirus can be wheat stripe mosaic virus. The nucleorhabdovirus can be Sonkes yellow net virus (SYNV) (see, e.g., Hefferon K, Plant Virus Expression Vectors: A Powerhouse for Global Health, Biomedicines. 2017, 5(3):44 and Lico et al, Viral vectors for production of recombinant proteins in plants, J Cell Physiol, 2008; 216(2):366-77).

[0180] Preferably, the viral vector is selected from the group consisting of tobacco rattle virus (TRV), tobacco mosaic virus (TMV), Sonks yellow net virus (SYNV) and potato virus X (PVX). Preferably, the viral vector is at least one of tobacco rattle virus (TRV), tobacco mosaic virus (TMV) and Sonks yellow net virus (SYNV).

[0181] A vector for use in the present invention preferably does not express a functional coat protein. The coat protein coding sequence may comprise a mutation to eliminate expression of a functional coat protein. The mutation may be at least one of a deletion, an addition, a substitution or a combination thereof, preferably resulting in a premature stop codon. Preferably, at least a portion of the coat protein coding sequence is deleted. Preferably, at least 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the viral coat protein coding sequence is deleted from the viral genome.

[0182] Thus, the viral vector expressing one or more RNAs of the present invention may contain one or more gene deletions, for example, which may increase the viral packaging capacity, improve genome stability, and / or increase gene expression. In a preferred embodiment, the virus contains a mutation, preferably a deletion, of at least a part of the gene encoding the coat protein (CP). A preferred viral vector containing a mutation, preferably a deletion, of at least a part of the sequence encoding the coat protein is a tobamovirus virus or a tobravirus virus. A preferred viral vector containing a deletion of the coat protein is a tobamovirus, preferably a tobacco mosaic virus (TMV). A preferred viral vector is, for example, a TMV RNA-based overexpression vector (TRBO) as described in Lindbo (TRBO: A High-Efficiency Tobacco Mosaic Virus RNA-Based Overexpression Vector, Plant Physiol, 2007; 145(4): 1232-40).

[0183] Infection of plant cells with, for example, TRBO or any other suitable vector preferably results in high expression of the RNA of the present invention in the first, producing plant cell. High expression of the RNA of the present invention can be achieved, for example, by deleting viral coat protein and / or using a strong promoter. The viral vector can be, for example, a self-replicating RNA as described in WO2018 / 226972, which is incorporated herein by reference.

[0184] The vector, preferably a viral vector, may be contained in Agrobacterium to initially introduce the viral vector into the plant's cells. After infection, the viral vector is expressed from Agrobacterium in the plant cells. The viral vector may express one or more RNAs of the present invention, and may also replicate and infect surrounding plant cells. The viral vector may be modified, for example, by deletion of the coat protein, thereby preventing the virus from spreading systemically.

[0185] In one embodiment, the present invention therefore relates to an Agrobacterium expressing a vector as defined herein, preferably, the Agrobacterium is Agrobacterium tumefaciens.

[0186] In a further aspect, the present invention relates to a method of producing a plant cell with a targeted genome modification. Preferably, the plant cell is a meristematic cell. The plant cell is preferably a shoot, root or leaf cell. Preferably, the plant cell for use in the method of the present invention comprises a cell wall. Preferably, the plant cell is not a plant cell protoplast. The method preferably comprises: i) providing a plant; and ii) expressing the coding and guide RNAs as defined herein in the cells of the plant. Optionally, the guide RNA is included in the guide RNA. Optionally, the coding RNA and the guide RNA or the guide RNA is included in the editing RNA. The expressed RNA or RNAs can then be transferred to a second "target" cell. Preferably, the coding RNA and the guide RNA are transferred to a meristematic cell. Preferably, the coding RNA and the guide RNA are transferred to a shoot apical meristematic cell.

[0187] Preferably, the coding RNA is contained within the editing RNA. Preferably, the coding RNA and the guide RNA are contained within the editing RNA as defined herein. Alternatively, the coding RNA and the guide RNA are separate entities. In this embodiment, the guide RNA is preferably contained within the guide RNA. In some embodiments, the coding RNA and the guide RNA are separate entities.

[0188] Preferably, in the second "target" cell, CRISPR nuclease is expressed from coding RNA, and guide RNA guides the expressed CRISPR nuclease to the position in genome where target genome modification is to occur in target cell.Preferably, the target cell is a meristematic cell.Thus, preferably, in the meristematic cell, CRISPR nuclease is expressed from coding RNA, and guide RNA guides the expressed CRISPR nuclease to the position in genome where target genome modification is to occur in meristematic cell.

[0189] Preferably, the coding RNA and the guide RNA are expressed in a (first or "target") cell as separate entities or within the editing RNA by transfecting the plant cell with a vector as described herein. Preferably, the plant cell is transfected with a vector expressing an editing RNA as described herein and / or a combination of a first and a second vector, where the first vector expresses a coding RNA as described herein and the second vector expresses a guide RNA as defined herein.

[0190] The vector may be introduced into a plant cell by transfecting the cell with an Agrobacterium containing the vector as defined herein.

[0191] Subsequent generation of cells containing the targeted genomic modification can result in a novel plant containing the genomic modification. The methods of the invention can thus include the step of generating a plant from a cell, preferably a meristematic cell, containing the targeted genomic modification.

[0192] The generation of a plant from a plant cell containing a targeted genome modification can be carried out using any conventional method known in the art. As a non-limiting example, the generation of a cell containing a targeted genome modification can result in pollen and / or egg cells, which can then be self-pollinated or pollinated with a second plant containing a cell with the same or different targeted genome modification.

[0193] Alternatively, the meristematic cells with the target genome modification can be generated into a plant by, for example, truncation followed by regeneration. As a non-limiting example, one or more plant cells of a plant, preferably one or more cells of a cotyledon, can be transfected using the method as defined herein, followed by preferably truncating the shoot apical meristem. The newly formed meristematic cells (i.e., the "second" or "target" cells) can then contain the target genome modification, and regenerating these newly formed meristematic cells can result in a plant containing cells with the target genome modification. Alternatively, the plant can be first truncated followed by transfecting the first "producer" cells, followed by genomic modification of the newly formed meristematic cells (the "second" cells). Regenerating the newly formed meristematic cells can result in a plant containing cells with the target genome modification.

[0194] The present invention further relates to a plant cell or plant body obtainable by the method of the present invention. Preferably, the plant cell is a meristematic cell. Preferably, the plant cell and / or plant body comprises a targeted genome modification. The plant body of the present invention preferably differs from a plant body occurring in nature at least in that it comprises at least one mutation in one gene of interest. Preferably, the plant body of the present invention is not obtained essentially or exclusively by a biological process.

[0195] All or substantially all cells of the plant may contain the targeted genome modification. Alternatively, only a portion of the plant contains the targeted genome modification. Preferably, one or more meristematic cells of the plant contain the targeted modification.

[0196] The present invention has been described above with reference to several exemplary embodiments. Variations and alternative implementations of some parts or elements are possible and fall within the scope of protection as defined in the appended claims.

[0197] Description of the drawings (Figure 1) Schematic diagram of vectors containing Cas9-GFP fusions with (A) and without (B) the FT sequence. (Figure 2) Mean expression (arbitrary units relative to N. benthamiana tubulin mRNA expression) of Cas9 and GFP in the shoot apex of plants whose leaves were infiltrated with Cas9-GFP constructs with or without the FT signal, as determined by qPCR. EXAMPLES

[0198] Example 1 We investigated the use of Tobacco Rattle Virus (TRV) to transiently express CAS9 and guide RNA sequences in plants to induce somatic editing. TRV infection occurs through the transient expression of two vectors: TRV1 and TRV2. Sequences can be cloned into TRV2, and expression of those sequences occurs in plants using a subgenomic promoter. The goal of this experiment was to detect somatic editing in tomato cotyledons through infection with a TRV2 plasmid expressing two (pKG11581) or three (pKG11580) guide RNAs as well as CAS9.

[0199] Materials and Methods: Two TRV2 plasmids were generated through the introduction of two sequences. The first sequence contained either two (pKG11581) or three (pKG11580) guide RNAs. The second sequence was for the expression of NLS:Sp-CAS9, which was cloned into the TRV2 plasmid, thereby replacing the sequence encoding the TRV coat protein. A mixture of Agrobacterium samples containing TRV1:TRV2 (pKG11580 or pKG11581) in a 1:1 ratio was infiltrated into both cotyledons of seedlings (a few days after germination) of tomato cultivar Moneyberg (De Ruiter Seeds CV, The Netherlands). Two days after infiltration, petiole samples were taken to detect CAS9 expression. Seven days after infiltration, cotyledon samples were taken to detect the editing made by guide RNAs targeting two separate genes.

[0200] result: Two days after infiltration, CAS9 was detected by Q-PCR. Seven days after infiltration, one cotyledon from each seedling was collected and frozen. DNA was isolated, purified, and PCR was performed to detect editing of the target sequence. No editing was found in the control sample. Various editing was detected in the transfected cotyledons. Therefore, we conclude that CAS9 is expressed, translated, and functional, and can create editing with the sequence of CAS9 and guide RNA as cargo in TRV virus.

[0201] Thus, it is conceivable that the TRV2 plasmid can be used to deliver mobilizable RNAs that could then direct the generation of CAS9 editing complexes in meristematic cells.

[0202] Example 2 The effect of an exemplary mobile element (FT) on the mobilization of CAS9-GFP fusion mRNA was tested. N. benthamiana (Herbalistics, Australia) was grown for 5 weeks under a 16-h light (22°C), 8-h dark (20°C) and 70% relative humidity. Five individual plants were leaves infiltrated with Agrobacterium tumefaciens carrying a pBINplus vector containing a CAS9-GFP-NLS insert (Figure 1B). Another five individual plants were leaves infiltrated with A. tumefaciens carrying a pBINplus vector containing a CAS9-GFP-NLS-FT insert (Figure 1A) containing the FT mobile sequence. Three days after infiltration, a 2 mm long shoot apex sample was taken from each plant, free of any discernible leaves. RNA was extracted with the Maxwell® RSC Plant RNA Kit (Promega, AS1500) in a Maxwell RSC instrument (Promega, AS4500). RNA was measured and 1 μg of RNA per sample was synthesized to cDNA with the QuantiTect® Reverse Transcription Kit (Qiagen, order no. 205311) according to the manufacturer's instructions. All samples were subjected to quantitative PCR measurements to detect CAS9 and GFP transcripts and N. benthamiana tubulin mRNA as a reference (see Table 2 for a list of primers).

[0203] The mRNA levels were expressed in arbitrary units relative to the expression of N. benthamiana tubulin mRNA. The average CAS9 and GFP transcript levels were higher in the shoots of plants infiltrated with the CAS9-GFP construct containing the FT signal compared to plants infiltrated with the construct lacking the FT signal (Figure 2). In conclusion, the FT sequence positively influences the amount of CAS9 transcripts in the shoot apex of plants infiltrated with the pBINplus vector carrying the CAS9-GFP-NLS-FT insert.

[0204] In a related example, where Solanum lycopersicum plants were leaves infiltrated with the same A. tumefaciens carrying the pBINplus vector with the CAS9-GFP-NLS-FT construct as in the previous example, qPCR was performed on the cDNA of the full-length CAS9-GFP transcript. This was achieved by using CAS9 and GFP specific primers as shown in Table 3. This resulted in a 3881 bp fragment encompassing 78% of the total transcript length. This transcript was detected in both the infiltrated leaves as well as the SAM, confirming that the intact transcript reaches the SAM when applied to the leaves.

[0205] [Table 2]

[0206] [Table 3]

Claims

1. A vector for expressing a coding RNA, comprising: The coding RNA comprises a sequence encoding a CRISPR nuclease and a first mobile element, the mobile element enabling cell-to-cell movement of the coding RNA, and preferably, the CRISPR nuclease comprises a nuclear localization signal; vector.

2. a) a virus, preferably i) does not express a functional coat protein, and preferably has a deletion in the sequence encoding said coat protein; and ii) Tobacco Rattle Virus (TRV), Tobacco Mosaic Virus (TMV) or Sonkes Yellow Net Virus (SYNV), preferably Tobacco Mosaic Virus RNA-Based Overexpression Vector (TRBO). a virus, which is at least one of b) naked DNA, preferably a circular nucleic acid molecule; or 2. The vector according to claim 1, wherein the carrier is a DNA complex, preferably bound to a carrier, the carrier being preferably a DNA complex selected from the group consisting of lipoplexes, liposomes, polymersomes, polyplexes, PEG, dendrimers, inorganic nanoparticles, virosomes and cell penetrating peptides.

3. 3. The vector of claim 1 or 2, wherein the mobile element allows cell-to-cell movement into meristematic cells, preferably shoot apical meristem cells.

4. The mobile element is at least one of a transfer RNA (tRNA) and a gene transcript, preferably 3. The vector of claim 1, wherein the tRNA is at least one of methionine, glycine-, threonine-, arginine-, lysine- and glutamine-tRNA; and wherein the gene transcript is at least one of a transcript of a gene selected from the group consisting of FT, GAI, SP2G, SP3D, SP5G, SP9D, CEN-like protein 1, FT and TF protein MOTHER 1, flowering locus T-a, flowering locus T-b, PP16-1, GAIP, scarecrow-like (SCL14P), shoot meristemless (STMP), ethylene response factor (ERFP) and Myb (MybP), and optionally the FT gene transcript is at least one of a mutant FT and / or a truncated FT.

5. 3. The vector of claim 1 or 2, further comprising a guide RNA and optionally a second mobile element enabling cell-to-cell movement of the guide RNA.

6. An editing RNA comprising the coding RNA of claim 1, further comprising a guide RNA and optionally a second mobile element that enables cell-to-cell movement of the guide RNA.

7. The editing RNA of claim 6, further comprising a cleavable spacer sequence located between the coding RNA and the guide RNA.

8. The editing RNA of claim 6 or 7, wherein at least one of the first and second mobile elements is located at the 5' end or the 3' end of the editing RNA.

9. The editing RNA of claim 6 or 7, comprising two or more guide RNAs, preferably wherein a cleavable spacer sequence is located between the two or more guide RNAs.

10. The editing RNA of claim 9, wherein the two or more guide RNAs guide the CRISPR nuclease to the same gene.

11. A vector expressing the editing RNA described in claim 6 or 7.

12. i) the vector of claim 1; and ii) An Agrobacterium expressing at least one of the editing RNAs described in claim 6.

13. 1. A method for generating a meristematic cell having a targeted genomic modification, comprising: i) providing a plant body; and ii) expressing in the cells of the plant body the coding RNA of claim 1, the guide RNA and, optionally, a second mobile element enabling cell-to-cell movement of the guide RNA. Including, The coding RNA and the guide RNA are transferred to meristematic cells; The coding RNA and the guide RNA are contained within the editing RNA of claim 6 or 7, and / or the guide RNA is linked to the second mobile element; in the meristematic cell, a CRISPR nuclease is expressed from the coding RNA, and the guide RNA directs the expressed CRISPR nuclease to a location in the genome to generate a targeted genomic modification in the meristematic cell; Preferably, said meristematic cell is a shoot apical meristem cell.

14. The coding RNA and the guide RNA are introduced into the plant cell. - a vector according to claim 1; and - Agrobacterium according to claim 12 The method of claim 13, wherein the gene is expressed by transfecting at least one of the following:

15. A meristematic cell carrying a targeted genomic modification, the meristematic cell being obtainable by the method of claim 13.

Images