Influenza-coronavirus combination vaccine

Abstract

The present disclosure provides a combination mRNA vaccine for influenza and respiratory viruses, such as coronaviruses (e.g., SARS-CoV-2), and methods of using the vaccine.

Description

[Technical field]

[0001] Related Applications This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 63 / 175,007, filed April 14, 2021, and U.S. Provisional Patent Application No. 63 / 242,346, filed September 9, 2021, which are incorporated by reference in their entireties herein.

[0002] Reference to sequence listing submitted as a text file via EFS-WEB This application contains a sequence listing that has been submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety. The ASCII copy, created on April 13, 2022, is named M137870180WO00-JXV-SEQ and is 202,400 bytes in size. [Background technology]

[0003] Respiratory disease is a medical term that encompasses pathological conditions affecting the organs and tissues that allow gas exchange in higher organisms, including the upper respiratory tract, trachea, bronchi, bronchioles, alveoli, pleura and pleural cavity, and the condition of the respiratory nerves and muscles. Respiratory diseases range from mild and self-limited, such as the common cold, to life-threatening, such as bacterial pneumonia, pulmonary embolism, acute asthma, and lung cancer. Respiratory diseases are a common and prominent cause of illness and death worldwide. Approximately 1 billion cases of the "common cold" occur in the United States each year. Among them, respiratory diseases are the most frequent reason for hospitalization of children.

[0004] Seasonal influenza is an acute respiratory infection caused by influenza viruses - influenza A and influenza B viruses, members of the Orthomyxoviridae family - that circulates worldwide. Seasonal influenza is characterized by sudden onset of fever, (usually dry) cough, headache, muscle and joint pain, severe fatigue (feeling sick), sore throat, and runny nose. In developed countries, most deaths associated with influenza occur in people aged 65 years and older. Epidemics can result in high levels of worker / school absenteeism / absenteeism and productivity loss. Clinics and hospitals may become overcrowded during peak illnesses. The impact of seasonal influenza epidemics in developing countries is not fully known, but studies estimate that 99% of deaths in children under 5 years of age with influenza-related lower respiratory tract infections occur in developing countries.

[0005] Human coronaviruses are highly contagious, enveloped, single-stranded, positive-stranded RNA viruses in the Coronaviridae family. Two subfamilies of the Coronaviridae family are known to cause human disease. The most important are the β-coronaviruses (betacoronaviruses). β-coronaviruses are a common etiology of mild to moderate upper respiratory tract infections. However, outbreaks of COVID-19, such as the infection caused by a coronavirus first identified in December 2019 in the city of Wuhan, China, have been associated with high mortality rates. Termed severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (previously termed "2019 novel coronavirus" or "2019-nCoV"), this recently identified coronavirus has rapidly infected hundreds of thousands of people. The pandemic disease caused by the SARS-CoV-2 virus has been named Coronavirus Disease 2019 (COVID-19) by the World Health Organization (WHO). The first genome sequence of a SARS-CoV-2 isolate (Wuhan-Hu-1; USA-WA1 / 2020 isolate) was released on January 10, 2020, by researchers at Virological, a UK-based discussion forum for the analysis and interpretation of viral molecular evolution and epidemiology, from the China CDC in Beijing. The sequence was then deposited in GenBank on January 12, 2020, and has the Genbank accession number MN908947.1. Several SARS-CoV-2 strain variants have since been identified, some of which are more infectious than SARS-CoV-2 isolates.

[0006] The continuing health problems associated with respiratory viruses, such as influenza and coronaviruses, are of international concern and highlight the importance of developing effective and safe vaccine candidates against these viruses. Summary of the Invention

[0007] In some aspects, the disclosure provides a combination vaccine comprising a first messenger ribonucleic acid (mRNA) polynucleotide comprising an open reading frame (ORF) encoding a first respiratory virus antigenic polypeptide, where the first respiratory virus antigenic polypeptide is an influenza virus antigen; a second mRNA polynucleotide comprising an ORF encoding a second respiratory virus antigenic polypeptide from a coronavirus; and a lipid nanoparticle.

[0008] In another aspect, the disclosure provides a combination vaccine comprising a first messenger ribonucleic acid (mRNA) polynucleotide comprising an open reading frame (ORF) encoding a first respiratory virus antigenic polypeptide, wherein the first respiratory virus antigenic polypeptide is an influenza virus antigen; a second mRNA polynucleotide comprising an ORF encoding a second respiratory virus antigenic polypeptide from a second influenza virus; a third mRNA polynucleotide comprising an ORF encoding a third respiratory virus antigenic polypeptide from a third influenza virus; a fourth mRNA polynucleotide comprising an ORF encoding a fourth respiratory virus antigenic polypeptide from a fourth influenza virus; a fifth mRNA polynucleotide comprising an ORF encoding a fifth respiratory virus antigenic polypeptide from a first coronavirus; and a sixth mRNA polynucleotide comprising an ORF encoding a sixth respiratory virus antigenic polypeptide from a second coronavirus; and a lipid nanoparticle.

[0009] In some embodiments, the first, second, third, and fourth viruses are selected from influenza A virus and influenza B virus. In some embodiments, the second virus is a betacoronavirus. In some embodiments, the coronavirus (e.g., the first coronavirus, the second coronavirus, or both the first and second coronaviruses) is selected from the group consisting of MERS-CoV, SARS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH, and HCoV-HKU1.

[0010] In some embodiments, the first respiratory virus antigenic polypeptide is from influenza virus B. In some embodiments, the first respiratory virus antigenic polypeptide is from influenza virus A. In some embodiments, the first respiratory virus antigenic polypeptide is a hemagglutinin antigen (HA) or a neuraminidase antigen (NA).

[0011] In some embodiments, the second respiratory virus antigenic polypeptide is from SARS-CoV. In some embodiments, the second respiratory virus antigenic polypeptide is from SARS-CoV-2. In some embodiments, the second respiratory virus antigenic polypeptide is from a non-SARS human coronavirus (HCoV).

[0012] In some embodiments, the vaccine comprises at least two mRNA polynucleotides comprising ORFs encoding influenza virus antigens. In some embodiments, the vaccine comprises two to four mRNA polynucleotides comprising ORFs encoding influenza virus antigens. In some embodiments, the vaccine comprises at least two mRNA polynucleotides comprising ORFs encoding respiratory virus antigenic polypeptides from a coronavirus.

[0013] In some embodiments, the vaccine comprises less than 15 mRNA polynucleotides. In some embodiments, the vaccine comprises 3-10 mRNA polynucleotides. In some embodiments, the vaccine comprises 4-10 mRNA polynucleotides. In some embodiments, the vaccine comprises 5-10 mRNA polynucleotides. In some embodiments, the vaccine comprises 8-9 mRNA polynucleotides.

[0014] In some embodiments, the vaccine comprises at least three mRNA polynucleotides encoding influenza virus antigenic polypeptides. In some embodiments, the vaccine comprises at least eight mRNA polynucleotides encoding influenza virus antigenic polypeptides. In some embodiments, the vaccine comprises at least two mRNA polynucleotides encoding coronavirus antigenic polypeptides.

[0015] In some embodiments, the first and second mRNA polynucleotides are present in the combination vaccine in a 1:1 ratio. In some embodiments, the combination vaccine comprises a 4:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from influenza virus to coronavirus. In some embodiments, the combination vaccine comprises a 3:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from influenza virus to coronavirus. In some embodiments, the combination vaccine comprises a 2:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from influenza virus to coronavirus. In some embodiments, the combination vaccine comprises a 5:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from influenza virus to coronavirus. In some embodiments, the combination vaccine comprises a 4:2 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from influenza virus to coronavirus. In some embodiments, the combination vaccine comprises a 1:2 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from influenza virus to coronavirus. In some embodiments, the combination vaccine comprises an 8:2 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from the first virus to the second virus. In some embodiments, the combination vaccine comprises an 8:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from the first virus to the second virus. In some embodiments, the respiratory virus antigenic polypeptides of the first virus comprise HA and NA in a 4:4 ratio.

[0016] In some embodiments, each of the mRNA polynucleotides in the combination vaccine are complementary to and do not interfere with each other mRNA polynucleotides in the combination vaccine.

[0017] In some embodiments, at least one of the respiratory virus antigenic polypeptides is derived from a naturally occurring antigen. In some embodiments, at least one of the respiratory virus antigenic polypeptides is a stabilized version of a naturally occurring antigen. In some embodiments, at least one of the respiratory virus antigenic polypeptides is a non-naturally occurring antigen.

[0018] In some embodiments, the vaccine further comprises an mRNA polynucleotide encoding a structurally modified variant of a respiratory virus antigenic polypeptide, wherein the structurally modified variant is a structurally modified variant of any one of the first or second respiratory virus antigenic polypeptides.

[0019] In some embodiments, at least one of the first and second mRNA polynucleotides is polycistronic. In some embodiments, each of the first and second mRNA polynucleotides is polycistronic.

[0020] Another aspect of the disclosure provides a multivalent RNA composition comprising a first messenger ribonucleic acid (mRNA) polynucleotide comprising an open reading frame (ORF) encoding a first respiratory virus antigenic polypeptide from a first virus and a second mRNA polynucleotide comprising an ORF encoding a second respiratory virus antigenic polypeptide from a coronavirus, wherein the multivalent RNA composition comprises more than 40% poly-A tail RNA and / or the first and / or second mRNA polynucleotides differ in length from each other by at least 100 nucleotides.

[0021] In some embodiments, the composition is produced by a method that includes: (a) combining in a single reaction vessel a linearized first DNA molecule encoding a first mRNA polynucleotide and a linearized second DNA molecule encoding a second mRNA polynucleotide, where the first DNA molecule and the second DNA molecule are obtained from different sources; and (b) simultaneously transcribing the linearized first DNA molecule and the linearized second DNA molecule in vitro to obtain a multivalent RNA composition.

[0022] In some embodiments, the different sources are a first and a second bacterial cell culture, and the first and the second bacterial cell culture are not co-cultured. In some embodiments, the amount of the first and the second DNA molecules present in the reaction mixture is normalized prior to the start of the IVT.

[0023] In some embodiments, the coronavirus is selected from the group consisting of MERS-CoV, SARS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH, and HCoV-HKU1.

[0024] Another aspect of the present disclosure is a method for producing a method for manufacturing a semiconductor device comprising the steps of: Provided is a multivalent RNA composition comprising between 2 and 15 mRNA polynucleotides, each comprising a separate open reading frame (ORF) encoding a respiratory virus antigenic polypeptide, wherein at least one respiratory virus antigenic polypeptide is an influenza virus and at least one respiratory virus antigenic polypeptide is a coronavirus, and each mRNA polynucleotide comprises one or more non-coding sequences in a untranslated region (UTR), optionally in the 5'UTR or 3'UTR.

[0025] In some embodiments, the non-coding sequence is located in the 3'UTR of an mRNA, upstream of the polyA tail of the mRNA.

[0026] In some embodiments, the non-coding sequence is located in the 3'UTR of the mRNA, downstream of the polyA tail of the mRNA.

[0027] In some embodiments, the non-coding sequence is located in the 3'UTR of the mRNA, between the last codon of the ORF of the mRNA and the first "A" of the poly-A tail of the mRNA. In some embodiments, the non-coding sequence comprises 1-10 nucleotides. In some embodiments, the non-coding sequence comprises one or more RNAse cleavage sites. In some embodiments, the RNAse cleavage site is an RNase H cleavage site.

[0028] In some embodiments, the coronavirus antigen is selected from the group consisting of MERS-CoV, SARS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH, and HCoV-HKU1.

[0029] In some aspects, the disclosure provides a multivalent RNA composition comprising a first messenger ribonucleic acid (mRNA) polynucleotide comprising an open reading frame (ORF) encoding a first respiratory virus antigenic polypeptide from an influenza virus and a second mRNA polynucleotide comprising an ORF encoding a second respiratory virus antigenic polypeptide from a coronavirus, wherein at least one of the respiratory virus antigenic polypeptides is derived from a naturally occurring antigen or a stabilized version of a naturally occurring antigen, and further comprising an mRNA polynucleotide encoding a structurally modified variant of the respiratory virus antigenic polypeptide, wherein the structurally modified variant is a structurally modified variant of either one of the first or second respiratory virus antigenic polypeptides.

[0030] In some embodiments, the coronavirus is selected from the group consisting of MERS-CoV, SARS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH, and HCoV-HKU1.

[0031] In some embodiments, the structurally modified variant is a structurally modified variant of a first respiratory virus antigenic polypeptide.

[0032] In some embodiments, the structurally modified variant is a structurally modified variant of a second respiratory virus antigenic polypeptide.

[0033] Another aspect of the present disclosure provides a multivalent RNA composition comprising: 5 to 15 messenger ribonucleic acid (mRNA) polynucleotides, each comprising an open reading frame (ORF) encoding a distinct respiratory virus antigenic polypeptide, wherein the respiratory virus antigenic polypeptides are from two different viral families, the two viral families including influenza virus and coronavirus; and a lipid nanoparticle.

[0034] In some embodiments, the composition has 3-6 mRNA polynucleotides that contain ORFs encoding influenza antigens, hi some embodiments, the composition has 1-5 mRNA polynucleotides that contain ORFs encoding coronavirus antigens.

[0035] In some aspects, the disclosure provides a multivalent RNA composition comprising a set of at least six messenger ribonucleic acid (mRNA) polynucleotides, each comprising an open reading frame (ORF) encoding a respiratory virus antigenic polypeptide from a first or second virus, wherein the first virus is an influenza virus and the second virus is a coronavirus, and the composition comprises a ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from the first virus to the second virus of 4:1, 4:2, or 4:3.

[0036] In some embodiments, the first and second mRNA polynucleotides are present in the combination vaccine in a 1:1 ratio. In some embodiments, the multivalent RNA composition comprises a 4:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from the first virus to the second virus. In some embodiments, the multivalent RNA composition comprises a 3:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from the first virus to the second virus. In some embodiments, the multivalent RNA composition comprises a 2:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from the first virus to the second virus. In some embodiments, the multivalent RNA composition comprises a 5:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from the first virus to the second virus. In some embodiments, the multivalent RNA composition comprises a 4:2 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from the first virus to the second virus. In some embodiments, the polyvalent RNA composition comprises a 1:2 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from a first virus to a second virus, in some embodiments, the polyvalent RNA composition comprises an 8:1 or 8:2 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from a first virus to a second virus.

[0037] In some embodiments, the antigenic polypeptides comprise a fusion (F) protein, a spike (S) protein, and a hemagglutinin antigen (HA). In some embodiments, the multivalent RNA compositions described herein further comprise a neuraminidase (NA) antigen.

[0038] In some embodiments, the polyvalent RNA compositions described herein further comprise at least one lipid nanoparticle (LNP). In some embodiments, the LNP comprises a molar ratio of 20-60% ionizable lipid, 5-25% non-cationic lipid, 25-55% sterol, and 0.5-15% PEG-modified lipid. In some embodiments, the ionizable amino lipid comprises the structure of Compound 1: [ka]

[0039] In some embodiments, the respiratory virus antigenic polypeptide comprises a cell surface glycoprotein.

[0040] In some aspects, the disclosure provides a method for vaccinating a subject, comprising administering to the subject a combination vaccine, the combination vaccine comprising a first messenger ribonucleic acid (mRNA) polynucleotide comprising an open reading frame (ORF) encoding a first respiratory virus antigenic polypeptide from an influenza virus, and a second mRNA polynucleotide comprising an ORF encoding a second respiratory virus antigenic polypeptide from a coronavirus.

[0041] In some embodiments, the subject is over 65 years of age. In some embodiments, the subject is under 18 years of age.

[0042] In some embodiments, the method prevents a respiratory infection in a subject. In some embodiments, the method reduces the severity of a respiratory infection in a subject.

[0043] In some embodiments, the subject is seronegative for at least one of the antigenic polypeptides. In some embodiments, the subject is seronegative for all of the antigenic polypeptides. In some embodiments, the subject is seropositive for at least one of the antigenic polypeptides. In some embodiments, the subject is seropositive for all of the antigenic polypeptides.

[0044] In some embodiments, any of the methods disclosed herein further comprises administering a booster vaccine, hi some embodiments, the booster vaccine is administered between 3 weeks and 1 year after the combination vaccine.

[0045] In some embodiments, the booster vaccine comprises at least one mRNA polynucleotide comprising an ORF encoding a first or second respiratory virus antigenic polypeptide. In some embodiments, the booster vaccine comprises at least one mRNA polynucleotide comprising an ORF encoding a first or second respiratory virus antigenic polypeptide. In some embodiments, the booster vaccine comprises at least one mRNA polynucleotide comprising an ORF encoding a structurally modified variant of the first or second respiratory virus antigenic polypeptide.

[0046] In some embodiments, the combination vaccine is a seasonal booster vaccine.

[0047] In some embodiments, the combination vaccine is any of the vaccines disclosed herein.

[0048] In some embodiments, the disclosure provides methods of preventing or reducing the severity of a respiratory infection by administering to a subject a combination / multivalent vaccine described herein in an amount effective to prevent infection or reduce the severity of a respiratory infection in a subject on a single dose or a single dose with a booster.

[0049] In some embodiments, the combination vaccine is administered to the subject at a dose of 50 μg. In some embodiments, the combination vaccine is administered to the subject at a dose of 25 μg. In some embodiments, the combination vaccine is administered to the subject at a dose of 100 μg.

[0050] In some embodiments, each RNA polynucleotide of the vaccine is formulated in a separate LNP. In some embodiments, the RNA polynucleotides of the vaccine are co-formulated in the LNP.

[0051] In some embodiments, any of the compositions or vaccines described herein (e.g., for use in any of the methods described herein) comprises an mRNA polynucleotide encoding four HA antigens, hi some embodiments, the four HA antigens are present in a 1:1:1:1 ratio.

[0052] In some embodiments, any of the compositions or vaccines described herein further comprises an mRNA polynucleotide encoding the four NA antigens, hi some embodiments, the four NA antigens are present in a 1:1:1:1 ratio.

[0053] In some embodiments, the ratio of HA antigen to NA antigen is 1: 1. In some embodiments, the ratio of HA antigen to NA antigen is 3:1.

[0054] In some embodiments, in any of the compositions described herein (e.g., for use in any of the methods described herein), the coronavirus is a betacoronavirus. [Brief description of the drawings]

[0055] [Figure 1] 1 is a series of graphs showing hemagglutinin (HA)-reactive IgG antibody titers against each of the four HA antigens 21 days after a single dose of the indicated formulation. [Diagram 2]1 is a series of graphs showing NA-reactive IgG antibody titers against each of the four NA antigens 21 days after a single dose of the indicated formulations. [Diagram 3] Graph showing SARS-CoV-2 S2P-specific IgG antibody titers 21 days after a single dose of the indicated formulations. [Figure 4] 1 is a series of graphs showing normalized hemagglutinin (HA)-reactive IgG antibody titers against each of the four HA antigens 21 days after a single dose of the indicated formulation. [Diagram 5] Graph showing normalized SARS-CoV-2 S2P-specific IgG antibody titers 21 days after a single dose of the indicated formulations. [Figure 6] Graph showing SARS-CoV-2 S2P-specific IgG antibody titers 21 days after a single dose of the indicated formulations. [Figure 7] Graph showing SARS-CoV-2 B.1.351 variant-specific IgG antibody titers 21 days after a single dose of the indicated formulation. [Figure 8] 2 is a graph showing hemagglutinin (HA)-reactive IgG antibody titers against the H1 HA Wisconsin antigen (SEQ ID NO: 22) 21 days after a single dose of the indicated formulation. [Figure 9] Graph showing hemagglutinin (HA)-reactive IgG antibody titers against H3 HA Hong Kong antigen (SEQ ID NO: 19) 21 days after one dose / 36 days after two doses of the indicated formulations. [Figure 10] Graph showing hemagglutinin (HA)-reactive IgG antibody titers against B HA Phuket antigen (SEQ ID NO:21) after 21 days of one dose / 36 days of two doses of the indicated formulations. [Figure 11] 1 is a graph showing hemagglutinin (HA)-reactive IgG antibody titers against B HA Washington antigen (SEQ ID NO:20) 21 days after a single dose of the indicated formulation. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0056] Respiratory viruses are the most common disease agents in humans and have a significant impact on morbidity and mortality worldwide. Certain respiratory agents from several viral families are well suited for efficient person-to-person transmission, leading to global circulation. Community-based studies have confirmed that these viruses are the most common etiology of acute respiratory infections. Effective vaccines and antiviral drugs against most of these viruses are still not available.

[0057] Thus, in some embodiments, the present disclosure provides combination vaccines comprising an RNA (e.g., mRNA) polynucleotide encoding at least two respiratory antigenic polypeptides from at least two different respiratory viruses. In some embodiments, the two different viruses are from the Orthomyxoviridae and Coronaviridae (optionally, Orthocoronavirus) families. In some embodiments, the respiratory antigenic polypeptides are from the Alphainfluenzavirus, Betainfluenzavirus, or Betacoronavirus genus.

[0058] As a result of synthesis, formulation, and delivery limitations, it has been difficult to create combination RNA vaccines. Disclosed herein is a combination of two or more RNA polynucleotides encoding respiratory antigens in a lipid nanoparticle carrier. Disclosed herein is a method for successfully generating functional combinations of RNA polynucleotides encoding antigens to generate highly effective combination vaccines. One limitation of combination vaccines relates to interference between antigens such that a complete and robust immune response is not generated against all of the antigens in the vaccine. It has been demonstrated that combination vaccines can be generated that encode multiple antigens, i.e., 8-10 antigens, and still produce a complete immune response. In some embodiments, each of the mRNA polynucleotides in the combination vaccine are complementary to and do not interfere with each other with the mRNA polynucleotides in the combination vaccine. Thus, the antigens generated from administration of the combination vaccine do not interfere with each other's immune response. As demonstrated by the data described in the Examples, administration of a combination vaccine comprising mRNA polynucleotides encoding antigens from the Orthomyxoviridae family (e.g., influenza antigens) and the Coronaviridae family (e.g., SARS-CoV-2) quite surprisingly did not inhibit or reduce neutralizing antibody titers against each respective antigen compared to separate administration of mRNA encoding each single antigen.

[0059] Also provided herein are methods of administering the vaccine, methods of producing the vaccine, compositions comprising the vaccine, and nucleic acids encoding the vaccine. As described herein, the vaccines described herein can be used to induce a balanced immune response, including both cellular and humoral immunity, without many of the risks associated with DNA vaccination. Optionally, such vaccines, referred to herein as multivalent or combination vaccines, can be administered to seropositive or seronegative subjects. For example, a subject may have previously been infected with a respiratory virus or previously received a dose of a vaccine (e.g., an mRNA vaccine) that induces antibodies against a respiratory virus, so that the subject may not have received the vaccine, may not have antibodies that react with at least one of the respiratory virus antigenic polypeptides of the vaccine, or may have pre-existing antibodies to at least one of the respiratory virus antigens of the vaccine. In some embodiments, the subject may have pre-existing antibodies to all of the respiratory virus antigens of the vaccine.

[0060] Antigens and Combination Vaccines An antigen is a protein capable of inducing an immune response (e.g., causing the immune system to produce antibodies against the antigen). The vaccines of the present disclosure offer unique advantages over conventional protein-based vaccination approaches, e.g., recombinant protein production techniques, in which protein antigens are purified or produced in vitro. The vaccines of the present disclosure feature mRNA encoding the desired antigen, which when introduced into the body, i.e., administered in vivo to a mammalian subject (e.g., human), causes the body's cells to express the desired antigen. The vaccines of the present disclosure feature mRNA encoding the desired viral surface antigen, e.g., glycoprotein antigen, which when introduced into the body, i.e., administered in vivo to a mammalian subject (e.g., human), causes the body's cells to express the desired peptide, optionally naturally folded into a human glycosylation pattern. Thus, a combination vaccine encoding viral surface antigens from a range of pathogenic viruses presents the properly folded and optionally glycosylated viral antigens all in the same manner as if they were produced during an actual infection. Thus, mRNA vaccines thus provide the best vehicle for making vaccines against respiratory viruses and can be produced without the associated risks of using attenuated viruses. To facilitate delivery of the mRNA of the present disclosure to body cells, the mRNA is encapsulated in lipid nanoparticles (LNPs). Once delivered and taken up by the body's cells, the mRNA is translated in the cytosol and the protein or glycoprotein antigens are folded and processed by the host cell machinery. The protein and / or glycoprotein antigens are presented and induce adaptive humoral and cellular immune responses. Since neutralizing antibodies are directed against expressed viral receptor-binding proteins and glycoprotein antigens, these viral protein antigens are therefore considered the most relevant target antigens for vaccine development. In brief, neutralizing antibodies are generally directed against viral surface proteins, e.g., glycoproteins, responsible for binding to cells, and when blocked by specific antibodies, the virus is neutralized.As used herein, the use of the term "antigen" encompasses immunogenic viral surface proteins, e.g., glycoproteins, and immunogenic fragments (immunogenic fragments that induce (or are capable of inducing) an immune response against (at least one) respiratory virus), unless otherwise stated. In some embodiments, the antigen is a naturally occurring antigen (e.g., a respiratory virus antigenic polypeptide encodes a naturally occurring antigen). In some embodiments, at least one respiratory virus antigenic polypeptide is a non-naturally occurring antigen, or an engineered version of a protein or glycoprotein antigen for use in a combination vaccine. In some embodiments, at least one of the respiratory virus antigenic polypeptides is a stabilized version of a naturally occurring antigen (e.g., a coronavirus spike protein stabilized by one or more amino acid substitutions, additions, or deletions, e.g., two proline substitutions). In another embodiment, other modifications, such as deletions or mutations of the cytoplasmic tail, are engineered into the viral surface protein, e.g., glycoprotein, to facilitate protein processing or conformational stability.

[0061] It should be understood that the term "protein" encompasses glycoproteins, proteins, peptides, and fragments thereof, and the term "antigen" encompasses antigenic portions of such molecules that elicit an immune response. In the viral vaccines contained herein, the term "antigen" includes viral surface proteins, e.g., glycoproteins, fragments of viral proteins (e.g., glycoproteins), and engineered and / or mutated versions of viral proteins (e.g., glycoproteins) derived from respiratory viruses.

[0062] Orthomyxoviridae family The Orthomyxoviridae family is a family of negative strand RNA viruses and includes alphainfluenza viruses, betainfluenza viruses, deltainfluenza viruses, gammainfluenza viruses, Aisa viruses, Thogoto viruses, and Quaranja viruses. The vaccines described herein may contain viral antigenic polypeptides from alphainfluenza viruses or betainfluenza viruses, both of which are associated with human influenza.

[0063] All influenza viruses are negative-stranded RNA viruses with segmented genomes. Influenza A and B viruses have eight genes that code for 10 proteins, including the surface proteins hemagglutinin (HA) and neuraminidase (NA). Influenza A viruses can be further subdivided into different subtypes according to the differences in these two surface proteins. To date, 16 HA subtypes and 9 NA subtypes have been identified. However, during the 20th century, the only influenza A subtypes that circulated widely in humans were A(H1N1), A(H1N2), A(H2N2), and A(H3N2). All known subtypes of influenza A viruses have been isolated from birds and can affect various mammalian species. As with humans, the number of influenza A subtypes isolated from other mammalian species is limited. Nearly all influenza A pandemics have been caused by descendants of the 1918 virus, including the "drift" H1N1 virus, as well as the reassortant H2N2 and H3N2 viruses. Influenza A contains HA and NA proteins on the surface of its viral envelope. HA allows the virus to recognize and bind to target cells and also transmits viral RNA to the cell. NA is important for the subsequent release of daughter virus particles produced in the infected cell so that they can spread to other cells.

[0064] Influenza type B viruses infect almost exclusively humans. Influenza B viruses are not classified into subtypes, but can be classified into lineages. Currently circulating influenza type B viruses belong to either the B / Yamagata (B / Yamagata / 16 / 88-like) or B / Victoria (B / Victoria / 2 / 87-like) lineages. Influenza B viruses mutate at a rate 2-3 times slower than type A, however, they significantly affect children and young adults each year. The influenza B virus capsid is encapsulated while the virion consists of an envelope, matrix protein, nucleoprotein complex, nucleocapsid, and polymerase complex. It can be spherical or filamentous. Its 500 or so surface projections are made of HA and NA. The influenza B virus genome is 14,548 nucleotides long and consists of eight segments of linear negative-sense single-stranded RNA. The segmented genome is encapsulated, with each segment within a separate nucleocapsid, and the nucleocapsids are surrounded by an envelope.

[0065] The mRNA vaccine of the present invention comprises an mRNA encoding the HA and, optionally, the NA antigen of the influenza virus circulating at the time of the vaccine design. An exemplary vaccine of the present invention comprises an mRNA encoding the HA antigen and, optionally, the NA antigen of the circulating H1N1 and H3N2 viruses. The vaccine of the present invention may comprise an mRNA encoding the HA antigen of each circulating influenza A subtype, or an mRNA encoding the HA antigen of each predominant influenza A subtype combined with an mRNA encoding the HA antigen of each circulating influenza B lineage (or each predominant influenza lineage). In an exemplary embodiment, the vaccine also comprises an mRNA encoding the NA antigen corresponding to the selected HA antigen. A predominant virus, or a predominant virus in circulation, is one that is detected in the human population at epidemic frequency or above a certain threshold as understood by the skilled artisan, and evidence that the strain(s) are circulating in the population, for example, in a population representing the northern or southern hemisphere, is essential.

[0066] The mRNA vaccine of the present invention can include multiple mRNAs, and thus can include, for example, an mRNA encoding an HA antigen and, optionally, also the corresponding NA antigen of the most common A / H1N1, A / H3N2, B / Victoria, and B / Yamagata lineages, but can further include an mRNA encoding an HA antigen and, optionally, also the corresponding NA antigen of the second most common A / H1N1, A / H3N2, B / Victoria, and / or B / Yamagata lineages. In an exemplary embodiment, the mRNA vaccine of the present invention includes an mRNA encoding an HA antigen of an influenza A virus strain of the A(H1N1) subtype, an mRNA encoding an HA antigen of an influenza A virus strain of the A(H3N2) subtype, an mRNA encoding an HA antigen of an influenza b virus strain of the B / Victoria lineage, and an mRNA encoding an HA antigen of an influenza B virus strain of the B / Yamagata lineage.

[0067] In some embodiments, the antigen is an influenza antigen. The influenza antigen is hemagglutinin (HA) or neuraminidase (NA). In some embodiments, the influenza antigen is a fragment of HA or NA, a derivative of HA or NA, or a modified HA or NA. For example, in some embodiments, the NA is a wild-type NA (e.g., enzymatically active). In some embodiments, the NA is a modified NA, such as an enzymatically inactive NA. As used herein, "enzymatically inactive NA" refers to an NA that has been mutated to have no or minimal catalytic activity (e.g., Richard et al., J Clin Virol., 2008, 41(1):20-24; Yen et al., J Virol., 2006, 80(17):8787-8795). For example, in some embodiments, the enzymatically inactive NA has less than 30%, 25%, 20%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0% of the catalytic activity of wild-type NA (e.g., in an enzyme activity assay as known in the art). In some embodiments, at least one of Arg118, Asp151, Arg152, Arg224, Glu276, Arg292, Arg371, and Tyr406 is mutated. In some embodiments, 1, 2, 3, 4, 5, 6, 7, or all 8 amino acids are mutated. In some embodiments, the mutations are R118K, D151G, and E227D.

[0068] In some embodiments, the mRNA vaccines of the present disclosure may include a combination of an mRNA encoding HA, optionally in combination with an mRNA encoding an NA antigen, or a fragment, derivative, or modified version thereof. In some embodiments, the mRNA vaccines may include a combination of an mRNA encoding HA and an mRNA encoding an NA antigen, or a fragment, derivative, or modified version thereof. In some embodiments, the vaccine includes an mRNA encoding 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 HA antigens, and / or an mRNA encoding 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 NA antigens (e.g., 4 HA antigens, or 4 HA antigens and 4 NA antigens), or any combination thereof. In some embodiments, the vaccine includes an mRNA encoding one HA antigen. In some embodiments, the vaccine includes an mRNA encoding two HA antigens. In some embodiments, the vaccine includes an mRNA encoding three HA antigens. In some embodiments, the vaccine includes an mRNA encoding four HA antigens. In some embodiments, the vaccine includes an mRNA encoding five HA antigens. In some embodiments, the vaccine comprises mRNA encoding six HA antigens. In some embodiments, the vaccine comprises mRNA encoding one HA antigen and one NA antigen. In some embodiments, the vaccine comprises mRNA encoding two HA antigens and mRNA encoding two NA antigens. In some embodiments, the vaccine comprises mRNA encoding three HA antigens and mRNA encoding three NA antigens. In some embodiments, the vaccine comprises mRNA encoding four HA antigens and mRNA encoding four NA antigens. In some embodiments, the vaccine comprises mRNA encoding five HA antigens and mRNA encoding five NA antigens. In some embodiments, the vaccine comprises mRNA encoding six HA antigens and mRNA encoding six NA antigens.

[0069] The multiple mRNA formats allow the vaccines of the invention to encode HA antigens, and optionally corresponding NA antigens, of circulating strains / lineages representing multiple distinct influenza clades and subclades, generating a more effective vaccine in the fight against the next or future influenza seasons.

[0070] Coronaviridae Family The Coronaviridae family includes enveloped positive-stranded RNA viruses that infect mammals, amphibians, and birds. The Coronaviridae subfamily, Orthocoronavirus, includes RNA viruses that cause disease in mammals and birds, causing respiratory infections ranging from the common cold to more deadly diseases (e.g., SARS, MERS, COVID-19). In some embodiments, the respiratory virus antigenic polypeptide is from the genus Betacoronavirus, e.g., MERS-CoV, SARS-CoV (SARS-CoV-1), SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH, or HCoV-HKU1.

[0071] The genome of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a single-stranded positive-stranded RNA (+ssRNA) with a size of 29.8–30 kb encoding approximately 9860 amino acids (Chan et al. 2000, supra; Kim et al. 2020 Cell, May 14; 181(4): 914-921. e10). SARS-CoV-2 is a polycistronic mRNA with a 5' cap and a 3'-polyA tail. The SARS-CoV-2 genome is organized into specific genes that code for structural and nonstructural proteins (Nsp). The order of structural proteins in the genome is 5'-replicase (open reading frame (ORF) 1 / ab)-structural proteins [spike (S)-envelope (E)-membrane (M)-nucleocapsid (N)]-3'. The genome of coronaviruses includes a variable number of open reading frames that code for accessory, nonstructural, and structural proteins (Song et al. 2019 Viruses;11(1):p.59). Most of the antigenic peptides are located in the structural proteins (Cui et al. 2019 Nat.Rev.Microbiol.;17(3):181-192). The spike surface glycoprotein (S), small envelope protein (E), matrix protein (M), and nucleocapsid protein (N) are the four major structural proteins. The S protein can be considered as one of the most important targets in coronavirus vaccine development among all other structural proteins, since it contributes to cell tropism and virus entry and can induce neutralizing antibodies (NAb) and protective immunity.

[0072] As used herein, the term "spike protein" refers to a glycoprotein that forms a homotrimer that protrudes from the envelope (viral surface) of viruses, including betacoronaviruses. The trimerized spike protein promotes the entry of the virion into the host cell by binding to a receptor on the surface of the host cell and subsequently fusing the viral membrane with the host cell membrane. The S protein is a large, highly glycosylated type I transmembrane fusion protein composed of 1,160-1,400 amino acids depending on the virus type. The spike protein of betacoronaviruses contains approximately 1100-1500 amino acids.

[0073] The mRNA of the present invention is designed to produce SARS-CoV-2 spike protein (i.e., encodes a spike protein such that the spike protein is expressed when the mRNA is delivered to a cell or tissue, e.g., a cell or tissue in a subject), as well as structurally modified antigenic variants thereof. One skilled in the art will appreciate that while an essentially full-length or complete spike protein may be necessary for a virus, e.g., a betacoronavirus, to perform its intended function of facilitating viral entry into a host cell, a certain amount of variation in the structure and / or sequence of the spike protein may be tolerated when attempting to elicit an immune response primarily against the spike protein. For example, a slight truncation, e.g., of one to a few, perhaps up to 5 or up to 10 amino acids, from the N-terminus or C-terminus of the encoded spike protein, e.g., the encoded spike protein antigen, may be tolerated without altering the antigenic properties of the protein. Similarly, a variation (e.g., conservative substitution) of one to a few, perhaps up to 5 or up to 10 amino acids (or more) of the encoded spike protein, e.g., the encoded spike protein antigen, may be tolerated without altering the antigenic properties of the protein. In some embodiments, the spike protein is not a stabilized spike protein, for example, the spike protein is stabilized by two proline substitutions (2P mutations).

[0074] In some embodiments, the spike protein is from different virus strains. Strains are genetic variants of microorganisms (e.g., viruses). New virus strains can be created when two or more viruses infect the same cell in nature due to mutation or exchange of genetic components, such as antigenic drift or antigenic shift.

[0075] Antigenic drift is a type of genetic change in viruses caused by the accumulation of mutations in viral genes that code for viral surface proteins that recognize host antibodies. This results in new strains of virus particles that are not effectively inhibited by the antibodies that prevented infection by previous strains. This makes it easier for the altered virus to spread throughout partially immune populations.

[0076] Antigenic shift is the process by which two or more different strains of a virus, or two or more different strains of a virus, combine to form a new subtype with a mixture of surface antigens of two or more original strains. The term is often applied specifically to influenza, since it is the best-known example, but it is well known that the process also occurs with other viruses. Antigenic shift is a special case of reassortment or viral shift that results in a change in phenotype. Antigenic shift contrasts with antigenic drift, which is the natural mutation of known strains of a virus over time that can result in loss of immunity or vaccine mismatch. Antigenic shift is often associated with large-scale rearrangements of viral surface antigens, resulting in reassortments that drastically change the phenotype of the virus.

[0077] A viral strain, as used herein, is a genetic variant or virus characterized by mutations in one or more surface proteins or other proteins of the virus. For example, in the case of SARS-CoV-2, a different amino acid sequence in the SARS-CoV-2 spike protein, when the immune response in an individual to the new strain is less effective than to the strain used to immunize or initially infect the individual. New viral strains can arise from natural mutations, or a combination of natural mutations and immune selection, resulting from a continuing immune response in immunized or previously infected individuals. New viral strains can differ by one, two, three, or more amino acid mutations in the regions of the spike protein responsible for viral functions such as receptor binding or viral fusion with target cells. The spike protein from the new strain can differ by as much as 80%, 85%, 90%, 95%, 98%, 99% identity from the parent strain at the amino acid level.

[0078] A natural virus strain is a variant of a given virus that is recognizable because it has some "unique phenotypic characteristics" that remain stable under natural conditions (e.g., biological, serological, and / or molecular characteristics that are stable and heritable). Such "unique phenotypic characteristics" are biological characteristics that differ from the reference virus to which it is compared, such as unique antigenic characteristics, host range (e.g., infects a different type of host), symptoms of disease caused by the strain, different types of disease caused by this strain (e.g., transmitted by different means), etc. "Unique phenotypic characteristics" may be detected clinically (e.g., clinical symptoms detected in hosts infected with the strain) or within comparative animal experiments where a skilled virologist can distinguish between animals infected with a reference control virus and animals infected with a novel strain, without knowing which animals were infected with which virus and without having information about the differences between the two viruses. Importantly, virus variants with simple differences in genome sequence are not separate strains in the absence of a recognizable distinct viral phenotype. The degree of variation in the genomic sequence is irrelevant to the classification of a variant as a strain, since distinct phenotypes can result from small numbers of mutations.

[0079] As an example, in some embodiments, the mRNA encodes an antigen from at least one virus strain variant or includes a mutation from at least one virus strain that is not wild-type SARS-CoV-2. In some embodiments, the vaccine includes an mRNA encoding a spike protein associated with the B.1.1.7 lineage (UK) variant (20B / 501Y.V1 VOC 202012 / 01). The B.1.1.7 lineage variant has a mutation in the receptor binding domain (RBD) of the spike protein at position 501, an N501Y mutation, in which the amino acid asparagine (N) is replaced with a tyrosine (Y). Additionally, the variant has a spontaneously occurring 69 / 70 deletion that results in a conformational change in the spike protein, a P681H mutation near the S1 / S2 furin cleavage site, and an ORF8 stop codon (Q27 stop) caused by a mutation in ORF8. The 501.V2 (South Africa, SA) variant contains multiple mutations in the spike protein, including N501Y and E484K, but does not have a deletion in 69 / 70. The E484K mutation is considered an "escape" mutation compared to at least one form of monoclonal antibody against SARS-CoV-2, and may therefore alter the antigenicity of the virus. Other mutations discovered include the D614G mutation, which is believed to increase the transmission rate of the virus, and the N543Y mutation (which emerged from mink farms in the Netherlands and Denmark). In some embodiments, the spike protein is a structurally modified variant with multiple mutations, including mutations from two or more variants (e.g., a combination of mutations found in the B.1.1.7 and 502Y.V2 variants).

[0080] The coronavirus S protein can be divided into two important functional subunits, the N-terminal S1 subunit that forms the globular head of the S protein, and the C-terminal S2 region that forms the protein stalk and is directly embedded in the viral envelope. Upon interaction with a potential host cell, the S1 subunit recognizes and binds to receptors on the host cell, particularly the angiotensin-converting enzyme 2 (ACE2) receptor, while the S2 subunit, the most conserved component of the S protein, is responsible for fusing the viral envelope with the host cell membrane. (See, for example, Shang et al., PLoS Pathog. 2020 Mar;16(3):e1008392). Each monomer of the trimeric S protein trimer contains two subunits, S1 and S2, that mediate attachment and membrane fusion, respectively. As part of the in vivo infection process, the two subunits are separated from each other by an enzymatic cleavage process. The S protein is first cleaved in vivo by furin-mediated cleavage at the S1 / S2 site in infected cells, with a subsequent serine protease-mediated cleavage event occurring at the S2' site within S1. In SARS-CoV2, the S1 / S2 cleavage site is at amino acids 676-TQTNSPRRAR / SVA-688 (see SEQ ID NO: 49). The S2' cleavage site is at amino acids 811-KPSKR / SFI-818 (see SEQ ID NO: 50).

[0081] As used herein, for example, in the context of designing a SARS-CoV-2 S protein antigen encoded by a nucleic acid, e.g., an mRNA, of the invention, the term "S1 subunit" (e.g., an S1 subunit antigen) refers to the N-terminal subunit of the spike protein beginning at the N-terminus of the S protein and ending at the S1 / S2 cleavage site, while the term "S2 subunit" (e.g., an S2 subunit antigen) refers to the C-terminal subunit of the spike protein beginning at the S1 / S2 cleavage site and ending at the C-terminus of the spike protein. As noted above, one of skill in the art will appreciate that while essentially full-length or complete spike protein S1 or S2 subunits are required for receptor binding or membrane fusion, respectively, a certain amount of variation in the structure and / or sequence of S1 or S2 is tolerated when one seeks to primarily elicit an immune response against the spike protein subunits. For example, minor truncations, e.g., one to a few, perhaps up to 4, 5, 6, 7, 8, 9 or 10 amino acids, from the N-terminus or C-terminus of an encoded subunit, e.g., the encoded S1 or S2 protein antigen, can be tolerated without altering the antigenic properties of the protein. Similarly, variations (e.g., conservative substitutions) of one to a few, perhaps up to 4, 5, 6, 7, 8, 9 or 10 amino acids (or more) of an encoded spike protein subunit, e.g., the encoded S1 or S2 protein antigen, can be tolerated without altering the antigenic properties of the protein(s).

[0082] The S1 and S2 subunits of the SARS-CoV-2 spike protein further comprise domains that are easily distinguishable by structure and function, which in turn can be characterized when designing antigens encoded by nucleic acid vaccines, particularly the mRNA vaccines of the present invention. The domains in the S1 subunit include the N-terminal domain (NTD) and the receptor binding domain (RBD), which further comprises the receptor binding motif (RBM) in the S2 subunit, including the fusion peptide (FP), heptad repeat 1 (HR1), heptad repeat 2 (HR2), the transmembrane domain (TM), and the cytoplasmic domain, also known as the cytoplasmic tail (CT) (Lu R. et al., supra; Wan et al., J. Virol. Mar 2020, 94(7)e00127-20). The HR1 and HR2 domains are sometimes referred to as the "fusion core region" of SARS-CoV-2 (Xia et al., 2020 Cell Mol Immunol. Jan;17(1):1-12.). The S1 subunit includes the N-terminal domain (NTD), the linker region, the receptor binding domain (RBD), the first subdomain (SD1), and the second subdomain (SD2). The S2 subunit includes, among others, the first heptad repeat (HR1), the second heptad repeat (HR2), the transmembrane domain (TM), and the cytoplasmic tail. The NTD and RBD of S1 are excellent antigens for the vaccine design approach of the present invention, as these domains have been shown to be targets of neutralizing antibodies in betacoronavirus-infected individuals.

[0083] The compositions provided herein include mRNAs that can encode any one or more full-length or partial (sequence truncations or other deletions) S protein subunits (e.g., S1 or S2 subunits), one or more domains or domain combinations of the S protein subunits (e.g., NTD, RBD, or NTD-RBD fusions with or without SD1 and / or SD2), or chimeras of full-length or partial and S2 protein subunits. Other S protein subunit and / or domain configurations are contemplated herein. Exemplary SARS-CoV-2 mRNA vaccines are provided in PCT / US2021 / 015145 and PCT / US2021 / 016979, each of which is incorporated herein by reference in its entirety.

[0084] Also, the genome of SARS-CoV (e.g., SARS-CoV-1) contains a single positive-stranded RNA approximately 29,700 nucleotides long. The overall genome organization of SARS-CoV is similar to that of other coronaviruses. The reference genome contains 13 genes encoding at least 14 proteins. Two large overlapping reading frames (ORFs) encompass 71% of the genome. The remainder has 12 potential ORFs, including genes for the structural proteins S (spike), E (small envelope), M (membrane), and N (nucleocapsid). Other potential ORFs encode unique putative SARS-CoV-specific polypeptides that lack obvious sequence identity to known proteins. A detailed analysis of the SARS-CoV genome has been published in J Mol Biol 2003;331:991-1004.

[0085] In some embodiments, a vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding a SARS-CoV S protein. In some embodiments, a vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an S1 subunit of a SARS-CoV S protein. In some embodiments, a vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an S2 subunit of a SARS-CoV S protein. In some embodiments, a vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding a SARS-CoV E protein. In some embodiments, a vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding a SARS-CoV N protein. In some embodiments, a vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding a SARS-CoV M protein. In some embodiments, a vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding at least one of the following SARS-CoV proteins: S protein (S, S1, and / or S2), E protein, N protein, and M protein.

[0086] MERS-CoV is a positive-sense single-stranded RNA virus of the genus Betacoronavirus. The genome is systematically classified into two clades, clade A and clade B. The genome of MERS-CoV encodes at least four unique accessory proteins, such as 3, 4a, 4b, and 5, two replicase proteins (open reading frames 1a and 1b), and four major structural proteins, including spike (S), envelope (E), nucleocapsid (N), and membrane (M) proteins (Almazan F et al. MBio 2013;4(5):e00650-13). The S protein is particularly important in mediating virus binding to cells expressing the receptor dipeptidyl peptidase-4 (DPP4) through the receptor binding domain (RBD) in the S1 subunit, while the S2 subunit subsequently mediates virus entry via fusion with the virus and target cell membranes (Li FJ Virol 2015;89(4):1954-64, Raj VS et al. Nature 2013;495(7440):251-4).

[0087] In some embodiments, a vaccine of this disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding a MERS-CoV S protein. In some embodiments, a vaccine of this disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an S1 subunit of a MERS-CoV S protein. In some embodiments, a vaccine of this disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an S2 subunit of a MERS-CoV S protein. In some embodiments, a vaccine of this disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding a MERS-CoV E protein. In some embodiments, a vaccine of this disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding a MERS-CoV N protein. In some embodiments, a vaccine of this disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding a MERS-CoV M protein. In some embodiments, a vaccine of this disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding at least one of the following MERS-CoV proteins: S protein (S, S1, and / or S2), E protein, N protein, and M protein.

[0088] Human coronavirus OC43 is an enveloped positive-stranded single-stranded RNA virus in the species Betacoronavirus-1 (genus Betacoronavirus, subfamily Coronavirinae, family Coronaviridae, class Nidovirus). Four HCoV-OC43 genotypes (A-D) have been identified with genotype D most likely resulting from recombination. Along with HCoV-229E, a species in the Alphacoronavirus genus, HCoV-OC43 is among the known viruses that cause the common cold. Both viruses can cause severe lower respiratory tract infections, including pneumonia, in infants, the elderly, and immunocompromised individuals, such as those undergoing chemotherapy and those with HIV-AIDS. In some embodiments, the vaccines of the present disclosure comprise an RNA (e.g., mRNA) polynucleotide encoding an HCoV-OC43 protein.

[0089] Human coronavirus HKU1 (HCoV-HKU1) is a positive-sense single-stranded RNA virus with an HE gene, which is distinguished as a group 2 or betacoronavirus. The genome organization is the same as that of other group II coronaviruses, with the characteristic gene order 1a, 1b, HE, S, E, M, and N. In addition, accessory protein genes are present between the S and E genes (ORF4), as well as at the position of the N gene (ORF8). A TRS is likely located within the AAUCUAAAC sequence preceding each ORF except E. In some embodiments, a vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HKU1 HE protein. In some embodiments, a vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HKU1 S protein. In some embodiments, a vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HKU1 E protein. In some embodiments, a vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HKU1 M protein. In some embodiments, a vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HKU1 N protein. In some embodiments, a vaccine of the disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding at least one of the following HKU1 proteins: HE protein, S protein, E protein, N protein, and M protein.

[0090] In some embodiments, the betacoronavirus is human coronavirus NL63 (HCoV-NL63 or HCoV-NL). Human New Haven coronavirus, HCoV-NH, is a strain of human coronavirus NL63. Genes predicted to encode the S, E, M, and N proteins are found in the 3' portion of the HCoV-NL63 genome. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding the NL63 S protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding the NL63 S protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding the H NL63 KU1 E protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding the NL63 M protein. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding the NL63 N protein. In some embodiments, a vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding at least one of the following NL63 proteins: S protein, E protein, N protein, and M protein.

[0091] Human coronavirus 229E (HCoV-229E) is a single-stranded positive-stranded RNA virus species of the Alphacoronavirus genus in the subfamily Coronavirinae of the family Coronaviridae of the class Nidoviridae. Together with human coronavirus OC43, it is responsible for the common cold. In some embodiments, the vaccine of the present disclosure comprises an RNA (e.g., mRNA) polynucleotide encoding an HCoV-229E antigenic protein.

[0092] Those skilled in the art will understand that virus classification will evolve as more viruses are identified and sequenced. Although specific examples of respiratory viruses involved in human disease are described and exemplified herein, the mRNA vaccines of the present invention may include other human respiratory viruses, such as viruses of these families, or related human respiratory viruses not specifically described. To the extent that viruses are specifically identified herein as belonging to a particular family or subfamily, they are expressly indicated to be within that family / subfamily, even if they are later reclassified or identified differently or inconsistently in other publications or sources. If a virus has been classified under one of the families, subfamilies, or genera described or claimed herein, in the past, present, or future, it will be understood that those terms are considered to be within the scope of that viral family, subfamily, or genus as defined and used herein.

[0093] An embodiment of the present disclosure provides a combination vaccine (e.g., a combination mRNA vaccine). The "combination vaccine" of the present disclosure refers to a vaccine that includes at least two polynucleotides, each of which includes an open reading frame encoding at least one respiratory virus antigenic polypeptide, where there is at least one polynucleotide encoding an influenza antigen and at least one polynucleotide encoding a coronavirus antigen. In another embodiment, the antigenic polypeptide is derived from a viral surface receptor-binding glycoprotein or a protein of the virus involved, since this results in the induction of the best neutralizing antibody response. In some embodiments, the combination vaccine comprises 2 to 15 mRNA polynucleotides, e.g., 2 to 4, 3 to 4, 3 to 5, 3 to 6, 3 to 7, 3 to 8, 3 to 9, 3 to 10, 3 to 11, 3 to 12, 3 to 13, 3 to 14, 3 to 15, 4 to 5, 4 to 6, 4 to 7, 4 to 8, 4 to 9, 4 to 10, 4 to 11, 4 to 12, 4 to 13, 4 to 14, 4 to 15, 5 to 6, 5 to 7, 5 to 8, 5 to 9, 5 to 10, 5 to 11, 5 to 12, 5 to 13, 5 to 14, 5 to 15, 6 to 7, 6 to 8, 6 to 9, 6 to 10, 6 to 11, 6 to 12, and / or 14-15, 6-13, 6-14, 6-15, 7-8, 7-9, 7-10, 7-11, 7-12, 7-13, 7-14, 7-15, 8-9, 8-10, 8-11, 8-12, 8-13, 8-14, 8-15, 9-10, 9-11, 9-12, 9-13, 9-14, 9-15, 10-11, 10-12, 10-13, 10-14, 10-15, 11-12, 11-13, 11-14, 11-15, 12-13, 12-14, 12-15, 13-14, 13-15, or 14-15 mRNA polynucleotides. In some embodiments, the combination vaccine comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mRNA polynucleotides. In certain embodiments, all of the RNAs encode viral surface proteins, e.g., glycoproteins, involved in receptor binding to facilitate viral entry into host cells.

[0094] In some embodiments, the vaccine comprises at least two mRNA polynucleotides encoding influenza virus antigenic polypeptides. In some embodiments, the vaccine comprises at least three mRNA polynucleotides encoding influenza virus antigenic polypeptides. In some embodiments, the vaccine comprises at least four mRNA polynucleotides encoding influenza virus antigenic polypeptides. In some embodiments, the vaccine comprises at least 5, 6, 7, 8, 9, 10, 11, or 12 mRNA polynucleotides encoding influenza virus antigenic polypeptides.

[0095] In some embodiments, the vaccine comprises at least two mRNA polynucleotides encoding coronavirus antigenic polypeptides, hi some embodiments, the vaccine comprises at least 2, 3, 4, 5, or 6 mRNA polynucleotides encoding coronavirus antigenic polypeptides.

[0096] In some embodiments, the mRNAs encoding influenza antigens are present in equal amounts (e.g., a 1:1 ratio) in the formulation, e.g., a 1:1 ratio of mRNAs encoding separate HA antigens, or a 1:1 ratio of mRNAs encoding separate HA and NA antigens. In an exemplary vaccine comprising mRNAs encoding four different HA antigens, a "1:1 ratio" of mRNAs would comprise mRNAs in a first, second, third, and fourth mRNA in a 1:1:1:1 ratio. In an exemplary vaccine comprising mRNAs encoding four different HA antigens and four different NA antigens, a "1:1 ratio" of mRNAs would comprise mRNAs encoding different HA antigens in a 1:1:1:1 ratio of first, second, third, and fourth mRNAs, and multiple mRNAs encoding different NA antigens in a 1:1:1:1 ratio of first, second, third, and fourth mRNAs.

[0097] In some embodiments, the ratios of mRNAs encoding different HA antigens are equivalent to each other (e.g., 1:1:1:1) and the ratios of mRNAs encoding different NA antigens are equivalent to each other (e.g., 1:1:1:1), however the ratio of mRNAs encoding HA antigens to mRNAs encoding NA antigens is not 1:1. In an exemplary vaccine comprising mRNAs encoding four different HA antigens and four different NA antigens, a "3:1 ratio" of mRNAs would comprise mRNAs encoding different HA antigens in a first, second, third, and fourth mRNA in a ratio of 3:3:3:3, and multiple mRNAs encoding different NA antigens in a first, second, third, and fourth mRNA in a ratio of 1:1:1:1. In some embodiments, HA:NA is 1:1, 1:2, 1:3, 1:4, 2:1, 3:1, or 4:1.

[0098] In some embodiments, the first and second mRNA polynucleotides are present in the combination vaccine at a 1:1 ratio (e.g., flu mRNA polynucleotide:coronavirus mRNA polynucleotide). In some embodiments, the combination vaccine comprises a 4:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from a first virus (e.g., influenza) to a second virus. In some embodiments, the combination vaccine comprises a 3:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from a first virus (e.g., influenza) to a second virus (e.g., coronavirus). In some embodiments, the combination vaccine comprises a 2:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from a first virus (e.g., influenza) to a second virus (e.g., coronavirus). In some embodiments, the combination vaccine comprises a 5:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from a first virus (e.g., influenza) to a second virus (e.g., coronavirus) (, ). In some embodiments, the combination vaccine comprises a 1:2 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from a first virus (influenza) to a second virus (e.g., coronavirus). In some embodiments, the combination vaccine (e.g., multivalent RNA composition) comprises a 4:1, 4:2, 4:3, 1:4, 2:4, or 3:4 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from a first virus to a second virus (e.g., coronavirus).

[0099] In some embodiments, each of the mRNA polynucleotides in the combination vaccine is complementary, i.e., does not interfere with, the mRNA polynucleotides in the combination vaccine. That is, the antigens produced from administration of the combination vaccine do not significantly interfere with the immune response to any other antigen produced in response to the vaccine in a manner that would reduce the antigen's ability to elicit a protective immune response in the subject. In some embodiments, the combination vaccine is additive with respect to neutralizing antibodies against each individual antigen in the vaccine. As shown in Figures 1-11, administration of a combination vaccine comprising an mRNA polynucleotide encoding an influenza antigen and a SARS-CoV-2 antigen did not inhibit or reduce neutralizing antibody titers against each respective antigen compared to separate administration of the mRNA encoding each single antigen.

[0100] In each embodiment or aspect of the invention, it is understood that the featured vaccine comprises an mRNA encapsulated within an LNP. While it is possible to encapsulate each unique mRNA in its own LNP, mRNA vaccine technology enjoys the significant technical advantage of being able to encapsulate multiple mRNAs in a single LNP product.

[0101] nucleic acid The compositions of the present disclosure include (at least one) messenger RNA (mRNA) having an open reading frame (ORF) encoding an influenza virus antigen and a coronavirus antigen. In some embodiments, the mRNA further comprises a 5' UTR, a 3' UTR, a poly(A) tail, and / or a 5' cap analog.

[0102] In some embodiments, the first, second, and / or third mRNA polynucleotides in the composition differ in length from each other by at least 100 nucleotides (e.g., 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or more nucleotides).

[0103] It should also be understood that the respiratory virus vaccines of the present disclosure may include any 5' untranslated region (UTR) and / or any 3' UTR. Exemplary UTR sequences include SEQ ID NOs: 29-32, however, other UTR sequences may be used or substituted for any of the UTR sequences described herein. In some embodiments, the 5' UTR of the present disclosure comprises a sequence selected from SEQ ID NO: 29 (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) and SEQ ID NO: 30 (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC). In some embodiments, a 3'UTR of the disclosure comprises a sequence selected from SEQ ID NO: 31 (UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) and SEQ ID NO: 32 (UGAUAAUAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC). UTRs may also be omitted from the RNA polynucleotides provided herein.

[0104] Nucleic acids include polymers of nucleotides (nucleotide monomers). Nucleic acids are therefore also called polynucleotides. Nucleic acids can be or include, for example, deoxyribonucleic acids (DNA), ribonucleic acids (RNA), threose nucleic acids (TNA), glycol nucleic acids (GNA), peptide nucleic acids (PNA), locked nucleic acids (LNA including LNA with β-D-ribo configuration, α-LNA (diastereomer of LNA) with α-L-ribo configuration, 2′-amino-LNA with 2′-amino functionalization, and 2′-amino-α-LNA with 2′-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA), and / or chimeras and / or combinations thereof.

[0105] "Messenger RNA" (mRNA) refers to any RNA that codes for (at least one) protein (naturally occurring, non-naturally occurring, or modified polymer of amino acids) that can be translated to produce the encoded polypeptide in vitro, in vivo, in situ, or ex vivo. Those of skill in the art will understand that unless otherwise indicated, the nucleic acid sequences described in this application may list a "T" in a representative DNA sequence, but when the sequence represents an mRNA, the "T" is replaced with a "U". Thus, any of the DNAs disclosed and identified herein by a particular sequence identification number also discloses the corresponding mRNA sequence complementary to the DNA, in which each "T" in the DNA sequence is replaced with a "U".

[0106] An open reading frame (ORF) is a continuous stretch of DNA or RNA that begins with a start codon (e.g., a methionine (ATG or AUG)) and ends with a stop codon (e.g., TAA, TAG, or TGA, or UAA, UAG, or UGA). ORFs typically encode proteins. The sequences disclosed herein may further include additional elements, such as 5' and 3' UTRs, although it will be understood that these elements, unlike ORFs, need not necessarily be present in the RNA polynucleotides of the present disclosure.

[0107] Variants In some embodiments, the compositions of the present disclosure include RNA encoding respiratory virus antigens and structurally modified variants that represent multiple viral antigens. Antigenic variants or structurally modified variants refer to molecules that differ in amino acid sequence from a wild-type (naturally occurring), native, or reference protein sequence. Antigenic / structurally modified variants may have substitutions, deletions, and / or insertions at certain positions in the amino acid sequence compared to the native or reference sequence. Typically, variants have at least 50% identity to the wild-type, native, or reference sequence. In some embodiments, variants share at least 80% or at least 90% identity with the wild-type, native, or reference sequence.

[0108] Variant antigens / polypeptides encoded by the nucleic acids of the present disclosure may contain amino acid changes that confer any of a number of desirable properties, for example, improving their immunogenicity, varying the breadth of their immunogenicity, i.e., the breadth of the immune response generated, improving their expression, and / or improving their stability or PK / PD properties in a subject. Variant antigens / polypeptides may be made using conventional mutagenesis techniques and assayed accordingly to determine whether they have the desired properties. Assays for determining expression levels and immunogenicity are well known in the art, and examples of such assays are described in the Examples section. Similarly, the PK / PD properties of protein variants can be measured using art-recognized techniques, for example, by evaluating the expression of antigens over time in vaccinated subjects and / or by confirming the persistence of the induced immune response. The stability of the protein(s) encoded by the variant nucleic acids may be measured by analyzing the thermal stability or stability upon urea denaturation, or using in silico predictions. Methods for such experiments and in silico evaluations are known in the art.

[0109] In some embodiments, the composition comprises an RNA or RNA ORF comprising the nucleotide sequence of any one of the sequences provided herein, or comprises a nucleotide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleotide sequence of a wild-type (naturally occurring) or variant antigen.

[0110] The term "identity" refers to the relationship between two or more polypeptide (e.g., antigen) or polynucleotide (nucleic acid) sequences, as determined by comparing the sequences. Identity also refers to the degree of sequence relatedness between sequences or between sequences, and is determined by the number of matches between strings of two or more amino acid or nucleic acid residues. Identity measures the percentage of identical matches between the smaller of two or more sequences with gap alignment (if any) addressed by a particular mathematical model or computer program (e.g., "algorithm"). The identity of related antigens or nucleic acids can be easily calculated by known methods. "Percent identity (%)" as applied to a polypeptide or polynucleotide sequence is defined as the percentage of residues (amino acid or nucleic acid residues) in a candidate amino acid or nucleic acid sequence that are identical to the residues in the amino acid or nucleic acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Methods and computer programs for alignment are well known in the art. It is understood that identity depends on the calculation of percent identity, but may have different values ​​due to gaps and penalties introduced in the calculation. In general, variants of a particular polynucleotide or polypeptide (e.g., antigen) have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, but less than 100% sequence identity to that of a particular reference polynucleotide or polypeptide, as determined by sequence alignment programs and parameters described herein and known to those of skill in the art. Such alignment tools include those in the BLAST suite (Stephen F. Altschul, et al (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402).Another popular local alignment technique is the Smith-Waterman algorithm (Smith, TF & Waterman, MS (1981) "Identification of common molecular subsequences." J. Mol. Biol. 147:195-197). A general global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, SB & Wunsch, CD (1970) "A general method applicable to the search for similarities in the amino acid sequences of two proteins." J. Mol. Biol. 48:443-453). More recently, the Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed, which is said to generate global alignments of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm.

[0111] Thus, polynucleotides encoding proteins or glycoproteins containing substitutions, insertions, and / or additions, deletions, and covalent modifications compared to a reference sequence, particularly a polypeptide (e.g., antigen) sequence disclosed herein, are included within the scope of this disclosure. For example, sequence tags or amino acids, such as one or more lysines, can be added to the peptide sequence (e.g., at the N-terminus or C-terminus). Sequence tags can be used for detection, purification, or localization of the peptide. Lysines can be used to increase the solubility of the peptide or to allow biotinylation. Alternatively, amino acid residues located in the carboxy- and amino-terminal regions of the amino acid sequence of a peptide or protein can be optionally deleted to result in a truncated sequence. Certain amino acids (e.g., C- or N-terminal residues) can alternatively be deleted depending on the use of the sequence, e.g., expression of the sequence as part of a larger sequence that is soluble or linked to a solid support. In some embodiments, sequences for (or encoding) signal sequences, termination sequences, transmembrane domains, linkers, multimerization domains (e.g., fold-on regions), and the like can be replaced with alternative sequences that achieve the same or similar functions. In some embodiments, cavities in the core of the protein may be filled, for example, by introducing larger amino acids, to improve stability. In other embodiments, buried hydrogen bond networks may be replaced with hydrophobic residues to improve stability. In yet other embodiments, glycosylation sites may be removed and replaced with appropriate residues. Such sequences are easily identifiable by those skilled in the art. It should also be understood that some of the sequences provided herein contain sequence tags or terminal peptide sequences (e.g., at the N-terminus or C-terminus), which may be deleted before use in, for example, the preparation of an mRNA vaccine.

[0112] As will be appreciated by those of skill in the art, protein fragments, functional protein domains, and homologous proteins are also considered to be within the scope of the respiratory virus antigens of interest. For example, provided herein is any protein fragment (meaning a polypeptide sequence that is at least one amino acid residue shorter than the reference antigen sequence, but otherwise identical) of a reference protein, provided that the fragment is immunogenic and confers a protective immune response against respiratory viruses.

[0113] In addition to structurally modified variants that are identical to the reference protein but are truncated, in some embodiments, structurally modified variants include antigens that have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations compared to the reference antigen. Some examples of structurally modified variants are shown in the sequences provided or referenced herein. The length of the antigen / antigenic polypeptide can range from about 4, 6, or 8 amino acids to the full-length protein.

[0114] Stabilizing Element Naturally occurring eukaryotic mRNA molecules may contain stabilizing elements, including, but not limited to, untranslated regions (UTRs) at their 5'-end (5'UTR) and / or their 3'-end (3'UTR), in addition to other structural features, such as a 5'-cap structure or a 3'-poly(A) tail. Both the 5'UTR and the 3'UTR are typically elements of the premature mRNA, transcribed from genomic DNA. Structural features characteristic of mature mRNAs, such as the 5'-cap and the 3'-poly(A) tail, are usually added to the transcribed (premature) mRNA during mRNA processing.

[0115] In some embodiments, the composition comprises an RNA polynucleotide having an open reading frame encoding at least one antigenic polypeptide with at least one modification, at least one 5'-end cap, and formulated into lipid nanoparticles. 5'-capping of the polynucleotide can be completed simultaneously during the in vitro transcription reaction using the following chemical RNA cap analogs to generate a 5'-guanosine cap structure according to the manufacturer's protocol: 3'-O-Me-m7G(5')ppp(5')G [ARCA cap], G(5')ppp(5')A, G(5')ppp(5')G, m7G(5')ppp(5')A, m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). 5'-capping of the modified RNA is completed post-transcriptionally using vaccinia virus capping enzyme to generate the "cap 0" structure: m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). The cap 1 structure can be generated using both vaccinia virus capping enzyme and 2'-O methyltransferase to generate m7G(5')ppp(5')G-2'-O-methyl. The cap 2 structure can be generated from the cap 1 structure by 2'-O-methylating the penultimate 5'-nucleotide using 2'-O methyltransferase. The cap 3 structure can be generated from the cap 2 structure by 2'-O-methylating the penultimate 5'-nucleotide using 2'-O methyltransferase. The enzymes can be from recombinant sources.

[0116] A 3'-poly(A) tail is typically a stretch of adenine nucleotides added to the 3' end of a transcribed mRNA. In some cases, it may contain up to about 400 adenine nucleotides. In some embodiments, the length of the 3'-poly(A) tail may be an essential element for the stability of an individual mRNA. In some embodiments, a combination vaccine (e.g., a multivalent RNA composition) comprises more than 20%, 30%, 40%, 50%, or 60% polyA tail RNA.

[0117] In some embodiments, the composition comprises a stabilizing element. The stabilizing element may comprise, for example, a histone stem loop. A 32 kDa protein, stem loop binding protein (SLBP), has been identified. It associates with histone stem loops at the 3' end of histone messages in both the nucleus and the cytoplasm. Its expression level is regulated by the cell cycle, peaking during S phase, when histone mRNA levels also rise. This protein has been shown to be essential for efficient 3' end processing of histone pre-mRNAs by U7 snRNP. SLBP continues to associate with stem loops after processing, and then promotes translation of mature histone mRNAs into histone proteins in the cytoplasm. The RNA binding domain of SLBP is conserved throughout metazoans and protozoans, and binding to histone stem loops depends on the structure of the loop. The minimal binding site comprises at least three nucleotides 5' and two nucleotides 3' to the stem loop.

[0118] In some embodiments, the mRNA comprises a coding region, at least one histone stem loop, and optionally a poly(A) sequence or polyadenylation signal. The poly(A) sequence or polyadenylation signal should generally improve the expression level of the encoded protein. The encoded protein, in some embodiments, is not a histone protein, a reporter protein (e.g., luciferase, GFP, EGFP, β-galactosidase, EGFP), or a marker or selection protein (e.g., alpha-globin, galactokinase, and xanthine:guanine phosphoribosyltransferase (GPT)).

[0119] In some embodiments, the mRNA comprises a combination of a poly(A) sequence or a polyadenylation signal and at least one histone stem loop, which in themselves represent alternative mechanisms, but which also act synergistically to increase protein expression above the levels observed with either of the individual elements. The synergistic effect of the combination of poly(A) and at least one histone stem loop is independent of the order of the elements, nor of the length of the poly(A) sequence.

[0120] In some embodiments, the mRNA does not contain a histone downstream element (HDE). A "histone downstream element (HDE)" comprises a purine-rich polynucleotide stretch of approximately 15-20 nucleotides 3' of a naturally occurring stem-loop, which corresponds to a binding site for U7 snRNA, which is involved in processing histone pre-mRNA to mature histone mRNA. In some embodiments, the nucleic acid does not contain an intron.

[0121] The mRNA may or may not contain enhancer and / or promoter sequences, which may be modified or unmodified, and may or may not be activated. In some embodiments, the histone stem loop generally originates from a histone gene and comprises two adjacent partially or fully reverse-complementary sequences separated by a spacer of short sequences, which form the loop of the structure. The unpaired loop region typically cannot base pair with any of the stem loop elements. It is often present in RNA, as it is an important component of many RNA secondary structures, but may also be present in single-stranded DNA. The stability of the stem loop structure generally depends on the length, the number of mismatches or bulges, and the base composition of the paired region. In some embodiments, wobble base pairs (non-Watson-Crick base pairs) may occur. In some embodiments, at least one histone stem loop sequence comprises a length of 15-45 nucleotides.

[0122] In some embodiments, the mRNA has one or more AU-rich sequences removed. These sequences (sometimes referred to as AURES) are destabilizing sequences found in the 3'UTR. AURES may be removed from the RNA vaccine. Alternatively, AURES may remain in the RNA vaccine.

[0123] Signal peptide In some embodiments, the composition comprises an mRNA having an ORF encoding a signal peptide fused to a respiratory virus antigen. Signal peptides, which comprise the N-terminal 15-60 amino acids of a protein, are typically required for membrane permeation along the secretory pathway and therefore universally control entry of most proteins into the secretory pathway in both eukaryotes and prokaryotes. In eukaryotes, the signal peptide of a nascent precursor protein (preprotein) directs ribosomes to the rough endoplasmic reticulum (ER) membrane and initiates transmembrane transport of the growing peptide chain for processing. ER processing produces a mature protein, and the signal peptide is typically cleaved from the precursor protein by the ER-resident signal peptidase of the host cell or is retained uncleaved to function as a membrane anchor. Signal peptides can also facilitate targeting of proteins to the cell membrane.

[0124] The length of the signal peptide can be 15 to 60 amino acids. For example, the length of the signal peptide can be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 amino acids. In some embodiments, the length of the signal peptide is 20-60, 25-60, 30-60, 35-60, 40-60, 45-60, 50-60, 55-60, 15-55, 20-55, 25-55, 30-55, 35-55, 40-55, 45-55, 50-55, 15-50, 20-50, 25-50, 30-50, 35-50 , 40-50, 45-50, 15-45, 20-45, 25-45, 30-45, 35-45, 40-45, 15-40, 20-40, 25-40, 30-40, 35-40, 15-35, 20-35, 25-35, 30-35, 15-30, 20-30, 25-30, 15-25, 20-25, or 15-20 amino acids in length.

[0125] Signal peptides from heterologous genes (which naturally regulate the expression of genes other than respiratory viral antigens) are known in the art and may be tested for desirable properties and then incorporated into the nucleic acids of the present disclosure.

[0126] Fusion proteins In some embodiments, the compositions of the present disclosure include an mRNA encoding an antigenic fusion protein. Thus, the encoded antigen(s) may include two or more proteins (e.g., proteins and / or protein fragments) linked together. Alternatively, the protein to which the protein antigen is fused does not promote a strong immune response against itself, but rather promotes a strong immune response against a respiratory viral antigen. The antigenic fusion protein, in some embodiments, retains functional properties from each of the original proteins.

[0127] Scaffolding In some embodiments, the mRNA vaccines provided herein encode a fusion protein that includes a respiratory virus antigen linked to a scaffold moiety. In some embodiments, such a scaffold moiety confers a desired property to the antigen encoded by the nucleic acid of the present disclosure. For example, the scaffold protein can improve the immunogenicity of an antigen, for example, by modifying the structure of the antigen, modifying the uptake and processing of the antigen, and / or causing the binding of the antigen to a binding partner.

[0128] In some embodiments, the scaffold moiety is a protein that can self-assemble into highly symmetric, stable, and structurally organized protein nanoparticles with diameters of 10-150 nm, a size range highly suitable for optimal interaction with various cells of the immune system. In some embodiments, viral proteins or virus-like particles can be used to form stable nanoparticle structures. Examples of such viral proteins are known in the art. For example, in some embodiments, the scaffold moiety is Hepatitis B surface antigen (HBsAg). HBsAg forms spherical particles with an average diameter of about 22 nm, lacks nucleic acid, and is therefore non-infectious (Lopez-Sagaseta, J. et al. Computational and Structural Biotechnology Journal 14 (2016) 58-68). In some embodiments, the scaffold moiety is Hepatitis B core antigen (HBcAg), which self-assembles into particles with diameters of 24-31 nm, similar to the viral cores obtained from HBV-infected human livers. The generated HBcAg self-assembles into two classes of nanoparticles of different sizes, with diameters of 300 Å and 360 Å, corresponding to 180 or 240 protomers. In some embodiments, respiratory viral antigens are fused to HBsAG or HBcAG to promote self-assembly of nanoparticles displaying respiratory viral antigens.

[0129] In some embodiments, bacterial protein platforms may be used. Non-limiting examples of these self-assembling proteins include ferritin, lumazine, and encapsulin.

[0130] Ferritin is a protein whose main function is the storage of iron in cells. Ferritin is made up of 24 subunits, each composed of four alpha-helical bundles, which self-assemble into a quaternary structure with octahedral symmetry (Cho KJ et al. J Mol Biol. 2009; 390: 83-98). Several high-resolution structures of ferritin have been determined, confirming that Helicobacter pylori ferritin is made up of 24 identical protomers, while in animals there are ferritin light and heavy chains that can assemble alone or combine into particles of 24 subunits in different ratios (Granier T. et al. J Biol Inorg Chem. 2003; 8: 105-111, Lawson DM et al. Nature. 1991; 349: 541-544). Ferritin self-assembles into nanoparticles with robust thermal and chemical stability. Therefore, ferritin nanoparticles are well suited for carrying and exposing antigens.

[0131] Lumazine synthase (LS) is also well suited as a nanoparticle platform for antigen display. LS, responsible for the penultimate catalytic step in the biosynthesis of riboflavin, is an enzyme present in a wide variety of organisms, including archaea, bacteria, fungi, plants, and eubacteria (Weber SE Flavins and Flavoproteins. Methods and Protocols, Series: Methods in Molecular Biology. 2014). The LS (lumazine synthetase) monomer is 150 amino acids long and consists of a beta sheet of adjacent tandem alpha helices. Several different quaternary structures have been reported for LS, showing its morphological versatility, from homopentamers to symmetrical organizations of 12 pentamers that form capsids with a diameter of 150 Å. Even LS cages of more than 100 subunits have been described (Zhang X. et al. J Mol Biol. 2006; 362: 753-770).

[0132] Encapsulin, a novel protein cage nanoparticle isolated from the thermophilic Thermotoga maritima, can also be used as a platform for presenting antigens on the surface of self-assembled nanoparticles. Encapsulin is organized from 60 copies of identical 31 kDa monomers with a thin icosahedral T=1 symmetric cage structure with inner and outer diameters of 20 and 24 nm, respectively (Sutter M. et al. Nat Struct Mol Biol. 2008, 15: 939-947). The exact function of encapsulin in T. maritima is still not clearly understood, but its crystal structure has recently been solved and its function has been hypothesized as a cellular compartment that encapsulates proteins such as DyP (dye decolorizing peroxidase) and Flp (ferritin-like protein) involved in oxidative stress response (Rahmanpour R. et al. FEBS J. 2013, 280: 2097-2104).

[0133] In some embodiments, the RNA of the present disclosure encodes a respiratory virus antigen fused to a foldon domain. The foldon domain can be obtained, for example, from bacteriophage T4 fibritin (see, for example, Tao Y, et al. Structure. 1997 Jun 15; 5(6): 789-98).

[0134] Linkers and cleavable peptides In some embodiments, the mRNA of the present disclosure encodes two or more polypeptides, referred to herein as a fusion protein. In some embodiments, the mRNA further encodes a linker located between at least one or each domain of the fusion protein. The linker may be, for example, a cleavable linker or a protease-sensitive linker. In some embodiments, the linker is selected from the group consisting of an F2A linker, a P2A linker, a T2A linker, an E2A linker, and combinations thereof. This family of self-cleaving peptide linkers, referred to as 2A peptides, has been described in the art (see, for example, Kim, J Het al. (2011) PLoS ONE 6:e18556). In some embodiments, the linker is an F2A linker. In some embodiments, the linker is a GGGS linker. In some embodiments, the fusion protein contains three domains with an intervening linker and has the structure domain-linker-domain-linker-domain.

[0135] Any cleavable linker known in the art may be used in the context of the present disclosure. Such exemplary linkers include F2A linker, T2A linker, P2A linker, and E2A linker (see, for example, WO2017 / 127750). Those skilled in the art will understand that other art-recognized linkers may be suitable for use in the constructs (e.g., encoded by the nucleic acids of the present disclosure). Those skilled in the art will also understand that other polycistronic constructs (mRNAs that separately encode multiple antigens / polypeptides within the same molecule) may be suitable for use as provided herein.

[0136] Array Optimization In some embodiments, the ORF encoding the antigen of the present disclosure is codon-optimized. Codon optimization methods are known in the art. For example, any one or more of the ORFs of the sequences provided herein may be codon-optimized. Codon optimization may be used in some embodiments to match codon frequencies in target and host organisms to ensure proper folding; to bias GC content to increase mRNA stability or reduce secondary structure; to minimize tandem repeat codons or base runs that may impair gene assembly or expression; to customize transcriptional and translational control regions; to insert or remove protein trafficking sequences; to remove / add post-translational modification sites in the encoded protein (e.g., glycosylation sites); to add, remove or shuffle protein domains; to insert or remove restriction sites; to modify ribosome binding sites and mRNA degradation sites; to adjust the translation rate to allow various domains of the protein to fold properly; or to reduce or eliminate problematic secondary structures within the polynucleotide. Codon optimization tools, algorithms, and services are known in the art, and non-limiting examples include services and / or proprietary methods from GeneArt (Life Technologies), DNA2.0 (Menlo Park Calif.). In some embodiments, the open reading frame (ORF) sequence is optimized using an optimization algorithm.

[0137] In some embodiments, the codon-optimized sequence shares less than 95% sequence identity with a naturally occurring or wild-type sequence ORF (e.g., a naturally occurring or wild-type mRNA sequence encoding a respiratory virus antigen). In some embodiments, the codon-optimized sequence shares less than 90% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a respiratory virus antigen). In some embodiments, the codon-optimized sequence shares less than 85% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a respiratory virus antigen). In some embodiments, the codon-optimized sequence shares less than 80% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a respiratory virus antigen). In some embodiments, the codon-optimized sequence shares less than 75% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a respiratory virus antigen).

[0138] In some embodiments, the codon-optimized sequence shares 65%-85% (e.g., about 67%-85% or about 67%-80%) sequence identity to a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a respiratory viral antigen). In some embodiments, the codon-optimized sequence shares 65%-75% or about 80% sequence identity to a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a respiratory viral antigen).

[0139] In some embodiments, the codon optimized sequence encodes an antigen that is the same or more immunogenic (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% or more) than a respiratory virus antigen encoded by a non-codon optimized sequence.

[0140] The modified mRNA, when transfected into a mammalian host cell, has a stability of 12 to 18 hours, or more than 18 hours, for example, 24, 36, 48, 60, 72 hours, or more than 72 hours, and is capable of being expressed by the mammalian host cell.

[0141] In some embodiments, the codon-optimized RNA may have an increased level of G / C. The G / C content of a nucleic acid molecule (e.g., mRNA) may affect the stability of the RNA. RNA with increased amounts of guanine (G) and / or cytosine (C) residues is believed to be more functionally stable than RNA containing large amounts of adenine (A) and thymine (T) or uracil (U) nucleotides. As an example, WO02 / 098443 discloses a pharmaceutical composition containing an mRNA stabilized by sequence modifications in the translation region. Due to the degeneracy of the genetic code, the modifications work by replacing existing codons with those that further increase the stability of the RNA without changing the resulting amino acid. The method is limited to the coding region of the RNA.

[0142] Unmodified nucleotides In some embodiments, the mRNA is not chemically modified and comprises standard ribonucleotides consisting of adenosine, guanosine, cytosine, and uridine. In some embodiments, the nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those present in transcribed RNA (e.g., A, G, C, or U). In some embodiments, the nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those present in DNA (e.g., dA, dG, dC, or dT).

[0143] chemical modification In some embodiments, the compositions of the present disclosure include RNA having an open reading frame encoding a respiratory virus antigen, where the nucleic acid comprises nucleotides and / or nucleosides that can be standard (unmodified) or modified as known in the art. In some embodiments, the nucleotides and nucleosides of the present disclosure include modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally occurring or non-naturally occurring modified nucleotides and nucleosides. Such modifications can include modifications in the sugar, backbone or nucleobase moieties of the nucleotides and / or nucleosides, as recognized in the art.

[0144] In some embodiments, the naturally occurring modified nucleotides or nucleotides of the present disclosure are generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the widely recognized MODOMICS database.

[0145] In some embodiments, the non-naturally occurring modified nucleotides or nucleosides of the present disclosure are generally known or recognized in the art. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides can be found, inter alia, in published U.S. application Nos. PCT / US2012 / 058519, PCT / US2013 / 075177, PCT / US2014 / 058897, PCT / US2014 / 058891, PCT / US2014 / 070413, PCT / US2015 / 036773, PCT / US2015 / 036759, PCT / US2015 / 036771, or PCT / IB2017 / 051367, all of which are incorporated herein by reference.

[0146] Thus, the nucleic acids of the disclosure (e.g., DNA nucleic acids and RNA nucleic acids such as mRNA nucleic acids) can include standard nucleotides and nucleosides, naturally occurring nucleotides and nucleosides, non-naturally occurring nucleotides and nucleosides, or any combination thereof.

[0147] Nucleic acids of the disclosure (e.g., DNA nucleic acids and RNA nucleic acids such as mRNA nucleic acids) in some embodiments comprise a variety (more than one) different types of standard and / or modified nucleotides and nucleosides. In some embodiments, a particular region of a nucleic acid contains one or more (optionally different) types of standard nucleotides and nucleosides and / or modified nucleotides and nucleosides.

[0148] In some embodiments, modified RNA nucleic acids (e.g., modified mRNA nucleic acids) introduced into a cell or organism exhibit reduced degradation in the cell or organism, respectively, compared to unmodified nucleic acids comprising standard nucleotides and nucleosides.

[0149] In some embodiments, modified RNA nucleic acids (e.g., modified mRNA nucleic acids) introduced into a cell or organism may exhibit reduced immunogenicity (e.g., reduced innate response) in the cell or organism, respectively, compared to unmodified nucleic acids comprising standard nucleotides and nucleosides.

[0150] Nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) in some embodiments contain non-naturally modified nucleotides that are introduced during or after the synthesis of the nucleic acid to achieve a desired function or property. The modifications may be in the internucleotide linkage, the purine or pyrimidine base, or the sugar. Modifications may be introduced by chemical synthesis or may be introduced at the end of the chain or anywhere in the chain using a polymerase enzyme. Any region of the nucleic acid may be chemically modified.

[0151] The present disclosure provides modified nucleosides and nucleotides of nucleic acids (e.g., RNA nucleic acids such as mRNA nucleic acids). A "nucleoside" refers to a compound or derivative thereof that contains a sugar molecule (e.g., pentose or ribose) in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as a "nucleobase"). A "nucleotide" refers to a nucleoside that includes a phosphate group. Modified nucleotides can be synthesized in any useful manner, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. A polynucleotide can include a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acid would include a region of nucleotides.

[0152] Base pairing of modified nucleotides encompasses not only standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides containing non-standard or modified bases and / or modified nucleotides, where the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between non-standard and standard bases, or between two complementary non-standard base structures, for example, in these nucleic acids with at least one chemical modification. One example of such non-standard base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil. Any combination of base / sugar or linker can be incorporated into the polynucleotides of the present disclosure.

[0153] In some embodiments, modified nucleobases in a nucleic acid (e.g., an RNA nucleic acid such as an mRNA nucleic acid) include 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (ψ). In some embodiments, modified nucleobases in a nucleic acid (e.g., an RNA nucleic acid such as an mRNA nucleic acid) include 5-methoxymethyluridine, 5-methylthiouridine, 1-methoxymethylpseudouridine, 5-methylcytidine, and / or 5-methoxycytidine. In some embodiments, a polynucleotide includes a combination of at least two (e.g., two, three, four, or more) of any of the foregoing modified nucleobases, including but not limited to chemical modifications.

[0154] In some embodiments, an mRNA of the disclosure comprises 1-methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions in the nucleic acid.

[0155] In some embodiments, an mRNA of the disclosure comprises 1-methylpseudouridine (m1ψ) substitutions at one or more or all of the uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more or all of the cytidine positions of the nucleic acid.

[0156] In some embodiments, an mRNA of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions in the nucleic acid.

[0157] In some embodiments, an mRNA of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all of the uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more or all of the cytidine positions of the nucleic acid.

[0158] In some embodiments, an mRNA of the disclosure includes a uridine at one or more or all uridine positions of the nucleic acid.

[0159] In some embodiments, the mRNA is uniformly modified (e.g., completely modified, modified throughout the entire sequence) for a particular modification. For example, a nucleic acid can be uniformly modified with 1-methyl-pseudouridine, i.e., all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified by replacing any type of nucleoside residue present in the sequence with a modified residue, such as those listed above.

[0160] The nucleic acid of the present disclosure can be modified partially or completely along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) can be uniformly modified in the nucleic acid of the present disclosure, or in a given sequence region thereof (e.g., mRNA, including or excluding poly-A tail). In some embodiments, all nucleotides X in the nucleic acid of the present disclosure (or in the sequence region thereof) are modified nucleotides, and X can be any one of nucleotides A, G, U, C, or any one of the following combinations: A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, or A+G+C.

[0161] Nucleic acids may contain from about 1% to about 100% modified nucleotides (with respect to the overall nucleotide content or with respect to any one or more types of nucleotides, i.e., A, G, U, or C) or any intervening percentage (e.g., 1%-20%, 1%-25%, 1%-50%, 1%-60%, 1%-70%, 1%-80%, 1%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-90% , 10%-95%, 10%-100%, 20%-25%, 20%-50%, 20%-60%, 20%-70%, 20%-80%, 20%-90%, 20%-95%, 20%-100%, 50%-60%, 50%-70%, 50%-80%, 50%-90%, 50%-95%, 50%-100%, 70%-80%, 70%-90%, 70%-95%, 70%-100%, 80%-90%, 80%-95%, 80%-100%, 90%-95%, 90%-100%, and 95%-100%). It will be appreciated that any remaining percentages will contain unmodified A, G, U or C.

[0162] The mRNA may contain 1% to 100% modified nucleotides, or any range of percentages (e.g., at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides). For example, the nucleic acid may contain modified pyrimidines such as modified uracil or modified cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in the nucleic acid are replaced with modified uracils (e.g., 5-substituted uracils). The modified uracils may be replaced by a compound with a single unique structure, or by multiple compounds with different structures (e.g., two, three, four, or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in a nucleic acid are replaced with modified cytosines (e.g., 5-substituted cytosines). The modified cytosines may be replaced by a compound having a single unique structure, or may be replaced by multiple compounds having different structures (e.g., two, three, four, or more unique structures).

[0163] Untranslated Regions (UTRs) The mRNA of the present disclosure may include one or more regions or portions that act or function as untranslated regions. When the mRNA is designed to encode at least one antigen of interest, the nucleic acid may include one or more of these untranslated regions (UTRs). The wild-type untranslated region of a nucleic acid is transcribed but not translated. In an mRNA, the 5'UTR starts at the transcription initiation site and continues up to, but not including, the start codon, while the 3'UTR starts immediately after the stop codon and continues up to the transcription termination signal. There is increasing evidence of the regulatory role played by UTRs in terms of stability and translation of nucleic acid molecules. Regulatory features of UTRs can be incorporated into the polynucleotides of the present disclosure, particularly to improve the stability of the molecule. Also, specific features can be incorporated to ensure controlled downregulation of the transcript in case the transcript is misdirected to an undesired organ site. A variety of 5'UTR and 3'UTR sequences are known and available in the art.

[0164] The 5'UTR is the region of an mRNA immediately upstream (5') from the start codon (the first codon of an mRNA transcript that is translated by the ribosome). 5'UTRs do not code for proteins (they are non-coding). Natural 5'UTRs have characteristics that play a role in translation initiation. They have signatures such as the Kozak sequence, which is commonly known to be involved in the process by which the ribosome initiates the translation of many genes. The Kozak sequence has the consensus CCR(A / G)CCAUGG (SEQ ID NO:68), where R is a purine (adenine or guanine) that is three bases upstream of the start codon (AUG) followed by another "G". 5'UTRs are also known to form secondary structures involved in elongation factor binding.

[0165] In some embodiments of the present disclosure, the 5'UTR is a heterologous UTR, i.e., a UTR found in nature associated with a different ORF. In another embodiment, the 5'UTR is a synthetic UTR, i.e., does not exist in nature. Synthetic UTRs include UTRs that have been mutated to improve the properties of a gene, for example, to increase its expression, as well as those that are completely synthetic. Exemplary 5'UTRs include a-globin or b-globin from Xenopus or human (8278063, 9012219), human cytochrome b-245a polypeptide, and hydroxysteroid (17b) dehydrogenase, and tobacco etch virus (US8278063, 9012219). The CMV immediate early 1 (IE1) gene (US2014 / 0206753, WO2013 / 185069), sequence GGGAUCCUACC (SEQ ID NO: 48) (WO2014 / 144196) can also be used. In another embodiment, the 5'UTR of the TOP gene is a 5'UTR of a TOP gene lacking a 5'TOP motif (oligopyrimidine tract) (e.g., WO / 2015 / 101414, WO / 2015 / 101415, WO / 2015 / 062738, WO2015 / 024667, WO2015 / 024667; a 5'UTR element from the ribosomal protein large 32 (L32) gene (WO / 2015 / 101414, WO20 15 / 101415, WO / 2015 / 062738), a 5'UTR element from the 5'UTR of the hydroxysteroid (17-beta) dehydrogenase 4 gene (HSD17B4) (WO2015 / 024667), or a 5'UTR element from the 5'UTR of ATP5A1 (WO2015 / 024667) may be used. In some embodiments, an internal ribosome entry site (IRES) is used in place of the 5'UTR.

[0166] In some embodiments, the 5'UTR of the disclosure comprises a sequence selected from SEQ ID NO:29 and SEQ ID NO:30.

[0167] The 3'UTR is the region of an mRNA that is immediately downstream (3') of the stop codon (the codon of the mRNA transcript that signals the end of translation). The 3'UTR does not code for a protein (it is non-coding). Native or wild-type 3'UTRs are known to be embedded with stretches of adenosines and uridines. These AU-rich signatures are particularly common in genes with high turnover rates. Based on their sequence features and functional properties, AU-rich elements (AREs) can be separated into three classes (Chen et al, 1995): Class I AREs contain several dispersed copies of the AUUUA motif within a U-rich region. C-Myc and MyoD contain class I AREs. Class II AREs have two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules that contain this type of ARE include GM-CSF and TNF-a. Class III AREs are less well defined. These U-rich regions do not contain the AUUUA motif. c-Jun and Myogenin are two well-studied examples of this class. While most proteins that bind to AREs are known to destabilize messengers, members of the ELAV family, particularly HuR, have been reported to enhance mRNA stability. HuR binds to all three classes of AREs. Engineering a HuR-specific binding site into the 3'UTR of a nucleic acid molecule will result in HuR binding and therefore stabilization of the message in vivo.

[0168] The introduction, removal, or modification of 3'UTR AU-rich elements (AREs) can be used to modulate the stability of the nucleic acids (e.g., RNA) of the present disclosure. When engineering a particular nucleic acid, one or more copies of AREs can be introduced to reduce the stability of the nucleic acid of the present disclosure, thereby suppressing translation and reducing the production of the resulting protein. Similarly, AREs can be identified and removed or mutated to increase intracellular stability and thus increase the translation and production of the resulting protein. Transfection experiments can be performed in relevant cell lines using the nucleic acids of the present disclosure, and protein production can be assayed at various times after transfection. For example, cells can be transfected with various ARE engineered molecules and transfected with the relevant protein using an ELISA kit, and the proteins produced can be assayed 6 hours, 12 hours, 24 hours, 48 ​​hours, and 7 days after transfection.

[0169] One of skill in the art will appreciate that heterologous or synthetic 5'UTRs may be used with any desired 3'UTR sequence. For example, heterologous 5'UTRs may be used with synthetic 3'UTRs and heterologous 3"UTRs.

[0170] Non-UTR sequences can also be used as regions or subregions within a nucleic acid. For example, intron sequences or portions of intron sequences can be incorporated into regions of the nucleic acid of the present disclosure. The incorporation of intron sequences can increase protein production as well as nucleic acid levels.

[0171] A combination of features may be included in the flanking regions, among other features. For example, an ORF may be flanked by a 5'UTR that may contain a strong Kozak translation initiation signal and / or a 3'UTR that may contain an oligo(dT) sequence for templated addition of a polyA tail. The 5'UTR may include a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different genes, such as the 5'UTR described in U.S. Patent Application Publication No. 2010 / 293625 and PCT / US2014 / 069155, which are incorporated herein by reference in their entirety.

[0172] It should be understood that any UTR from any gene may be incorporated into the region of the nucleic acid. Furthermore, multiple wild-type UTRs of any known gene may be utilized. It is also within the scope of the present disclosure to provide artificial UTRs that are not variants of the wild-type region. These UTRs or portions thereof may be placed in the same orientation as the transcript from which they were selected, or may be modified in orientation or position. Thus, the 5' or 3' UTR may be inverted, shortened, extended, or made with one or more other 5' or 3' UTRs. As used herein, the term "modified" refers to the UTR sequence and means that the UTR has been altered in some way with respect to the reference sequence. For example, the 3' or 5' UTR may be modified compared to the wild-type or native UTR by a change in orientation or position, as taught above, or may be modified by the inclusion of additional nucleotides, deletion of nucleotides, swapping or translocation of nucleotides. Any of these changes that produce a "modified" UTR (either 3' or 5') include variant UTRs.

[0173] In some embodiments, double, triple, or quadruple UTRs, such as 5'UTR or 3'UTR, can be used. As used herein, a "double" UTR is one in which two copies of the same UTR are encoded in tandem or substantially in tandem. For example, the double beta-globin 3'UTR described in US Patent Publication No. 2010 / 0129877, the entire contents of which are incorporated herein by reference, can be used.

[0174] It is also within the scope of the present disclosure to have patterned UTR.As used herein, "patterned UTR" refers to a UTR that reflects a repeating or alternating pattern, such as ABABAB or AABBABBAABB or ABCABCABC or its variants being repeated once, twice, or three or more times.In these patterns, each letter A, B, or C represents a UTR that is different at the nucleotide level.

[0175] In some embodiments, the flanking region is selected from a family of transcripts whose proteins share a common function, structure, feature, or characteristic. For example, a polypeptide of interest may belong to a family of proteins that are expressed in a particular cell, tissue, or at a certain time during development. UTRs from any of these genes may be swapped with any other UTRs from the same or different family of proteins to create new polynucleotides. As used herein, "family of proteins" is used in the broadest sense and refers to a group of two or more polypeptides of interest that share at least one function, structure, feature, location, origin, or expression pattern.

[0176] The untranslated region may also include a translational enhancer element (TEE). By way of non-limiting example, the TEE may include those described in U.S. Patent Application Publication No. 20090226470, which is incorporated by reference in its entirety, and TEEs known in the art.

[0177] In vitro transcription of RNA Aspects of the present disclosure provide a method for generating (synthesizing) an RNA transcript (e.g., an mRNA transcript) comprising contacting a DNA template (e.g., a first input DNA and a second input DNA) with an RNA polymerase (e.g., T7 RNA polymerase, a T7 RNA polymerase variant, etc.) under conditions that result in the production of an RNA transcript. This process is referred to as "in vitro transcription" or "IVT". IVT conditions typically require a purified linear DNA template containing a promoter, a buffer system containing nucleoside triphosphates, dithiothreitol (DTT) and magnesium ions, and an RNA polymerase. The exact conditions used in the transcription reaction depend on the amount of RNA required for a particular application. A typical IVT reaction is performed by incubating a DNA template with an RNA polymerase and nucleoside triphosphates containing GTP, ATP, CTP, UTP (or nucleotide analogs) in a transcription buffer. An RNA transcript with a 5'-terminal guanosine triphosphate is generated from this reaction.

[0178] In some embodiments, wild-type T7 polymerase is used in the IVT reaction. In some embodiments, modified or variant T7 polymerase is used in the IVT reaction. In some embodiments, the T7 RNA polymerase variant comprises an amino acid sequence that shares at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity with wild-type T7 (WT T7) polymerase. In some embodiments, the T7 polymerase variant is a T7 polymerase variant described by International Application Publication No. WO2019 / 036682 or WO2020 / 172239, the contents of each of which are incorporated herein by reference. In some embodiments, the RNA polymerase (e.g., T7 RNA polymerase or T7 RNA polymerase variant) is present in the reaction (e.g., IVT reaction) at a concentration of 0.01 mg / ml to 1 mg / ml. For example, the RNA polymerase can be included in the reaction at a concentration of 0.01 mg / mL, 0.05 mg / ml, 0.1 mg / ml, 0.5 mg / ml or 1.0 mg / ml.

[0179] The input deoxyribonucleic acid (DNA) serves as a nucleic acid template for an RNA polymerase. The DNA template may comprise a polynucleotide encoding a polypeptide of interest (e.g., an antigenic polypeptide). In some embodiments, the DNA template comprises an RNA polymerase promoter (e.g., a T7 RNA polymerase promoter) located 5' from and operably linked to the polynucleotide encoding the polypeptide of interest. The DNA template may also comprise a nucleotide sequence encoding a polyadenylation (polyA) tail located at the 3' end of the gene of interest. In some embodiments, the input DNA comprises a plasmid DNA (pDNA). As used herein, "plasmid DNA" or "pDNA" refers to an extrachromosomal DNA molecule that is physically separated from the chromosomal DNA in a cell and can replicate independently. In some embodiments, the plasmid DNA is isolated from the cell (e.g., as a plasmid DNA preparation). In some embodiments, the plasmid DNA comprises an origin of replication that may contain one or more heterologous nucleic acids, e.g., a nucleic acid encoding a therapeutic protein that may serve as a template for an RNA polymerase. The plasmid DNA may be circularized or linear (e.g., plasmid DNA linearized by restriction enzyme digestion).

[0180] Multivalent mRNA constructs are typically produced by transcribing one mRNA product at a time, purifying each mRNA product, and then mixing the purified mRNA products together prior to formulation. This type of process requires significant time and financial investment, especially at a Good Manufacturing Practice (GMP) scale.

[0181] Aspects of the present disclosure relate to methods for generating compositions comprising polyvalent, distinct RNAs (e.g., two or more distinct RNAs). In some aspects, the methods of polyvalent transcription disclosed herein involve selecting an amount of input DNA for an IVT reaction that results in a polyvalent RNA composition with a higher purity than RNA compositions generated using previous methods. It has been observed that certain features or characteristics of co-transcribed (e.g., simultaneously transcribed in vitro) DNA molecules, such as length differences between DNA molecules, poly-A tail efficiency of DNA molecules, etc., and / or other reagents present in the co-IVT reaction mixture (e.g., RNA polymerase, nucleotide triphosphate (NTP), etc.), can introduce compositional bias into the resulting polyvalent RNA composition. Surprisingly, methods have been discovered that reduce such compositional bias. In some embodiments, modifying the input DNA amount results in the generation of a polyvalent RNA composition with increased purity (e.g., as measured by the percentage of RNA that includes a poly-A tail) compared to RNA compositions generated by previous methods. It was also surprisingly discovered that the simultaneous IVT methods described herein result in highly pure polyvalent RNA compositions even when there is a large difference in the length of the input DNA used in the IVT reactions (e.g., more than 100 nucleotides).

[0182] Thus, in some aspects, the disclosure provides methods for generating a multivalent RNA composition, the method comprising simultaneously in vitro transcribing at least two DNA molecules in a reaction mixture comprising a first population of DNA molecules encoding a first RNA and a second population of DNA molecules encoding a second RNA different from the first RNA, and obtaining a multivalent RNA composition having a predetermined ratio of first RNA to second RNA generated by IVT.

[0183] As used herein, the term "multivalent RNA composition" refers to a composition that comprises more than two different mRNAs. A multivalent RNA composition can comprise more than two different RNAs, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different RNAs. In some embodiments, a multivalent RNA composition comprises more than 10 different RNAs. The term "different RNA" refers to any RNA that is not the same as another RNA in a multivalent RNA composition. For example, two RNAs are different if they have i) different lengths (regardless of whether the RNAs are identical throughout the shorter of the two lengths), ii) different nucleotide sequences, iii) different chemical modification patterns, or iv) any combination of the above.

[0184] In some embodiments, each input DNA (e.g., population of input DNA molecules) in a simultaneous IVT reaction is obtained from a different source (e.g., synthesized separately, e.g., in different cells or cell populations). In some embodiments, each input DNA (e.g., population of input DNA) is obtained from a different bacterial cell or population of bacterial cells. For example, in a simultaneous IVT reaction with three populations of input DNA, the first input DNA is produced in bacterial cell population A, the second input DNA is produced in bacterial cell population B, and the third input DNA is produced in bacterial population C, where each of A, B, and C is not the same bacterial culture (e.g., co-cultured in the same vessel or plate). Methods for obtaining populations of input DNA (e.g., plasmid DNA) are known, for example, as described by Sambrook, Joseph. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001.

[0185] Some aspects include normalizing the amount of DNA used in the multivalent simultaneous IVT reaction. In some embodiments, the normalization is based on the molar mass of the input DNA. In some embodiments, the normalization is based on the degradation rate of the input DNA. In some embodiments, the normalization is based on the degradation rate of the resulting mRNA (e.g., measured based on polyA variants, or T7 polymerase-deficient or truncated transcripts present in the reaction mixture). In some embodiments, the normalization is based on the nucleotide content of the input DNA (e.g., the amount of A, G, C, U, or any combination thereof). In some embodiments, the normalization is based on the purity of the input DNA. In some embodiments, the normalization is based on the polyA tail efficiency of the input DNA. In some embodiments, the normalization is based on the length of the input DNA.

[0186] In some embodiments, the mRNAs are in a predetermined mRNA ratio, which may include ratios of 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different RNAs (e.g., depending on the number of different RNAs in the composition). In some embodiments, the predetermined ratio includes ratios between more than 10 RNAs. As used herein, "predetermined mRNA ratio" refers to the desired final ratio of RNA molecules in a multivalent RNA composition. The desired final ratio of an RNA composition varies depending on the final peptide(s) or polypeptide product(s) encoded by the RNA. For example, a multivalent RNA mixture may include two RNAs (e.g., an RNA encoding a first antigen and an RNA encoding a second antigen), and in this example, the desired final ratio of RNA molecules may be 1 (first antigen RNA):1 (second antigen RNA). In another example, a multivalent RNA composition can include several (e.g., 3, 4, 5, 6, 7, 8, or more) RNAs encoding different antigenic peptides (e.g., when used as a vaccine), in which case a desirable ratio can include 3 to 10 RNAs (e.g., a:b:c, a:b:c:d, a:b:c:d:e, a:b:c:d:e:f, a:b:c:d:e:f:g, a:b:c:d:e:f:g:h, a:b:c:d:e:f:g:h:i, a:b:c:d:e:f:g:h:i:j, etc., where each of a through j is a number between 1 and 10).

[0187] In some embodiments, normalization is based on the lowest level present in the input DNA (e.g., lowest molar mass, degradation rate (e.g., of the input DNA and / or output RNA), nucleotide content, purity, and / or poly-A tail efficiency). In some embodiments, normalization is based on the highest level present in the input DNA (e.g., highest molar mass, degradation rate (e.g., of the input DNA and / or output RNA), nucleotide context, purity, and / or poly-A tail efficiency). In some embodiments, normalization is based on the rate of RNA production of the input DNA (e.g., the highest rate of RNA production of the input DNA in the reaction mixture or the lowest rate of RNA production of the input DNA).

[0188] In some embodiments, the present disclosure relates to IVT methods in which the amount of input DNA (e.g., a first DNA or a second DNA) is adjusted or normalized to improve production of a multivalent RNA composition having a predefined component mRNA ratio.

[0189] As described herein, certain factors that affect polyvalent RNA composition purity, such as large differences in size between input DNA (e.g., differences in length of 100, 200, 500, 1000 or more nucleotides) and / or poly-A tail efficiency of a given DNA during IVT, can be addressed prior to IVT by normalizing the amount of input DNA based on one or more of those factors.

[0190] The number of input DNAs (e.g., population of input DNA molecules) used in the IVT reaction can vary depending on the number of different RNA molecules that are desired to be included in the polyvalent RNA composition. In some embodiments, the IVT reaction mixture comprises two or more different input DNAs, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more different input DNAs. In some embodiments, the IVT reaction comprises more than 15 different input DNAs. The term "different input DNAs" encompasses input DNAs that code for different RNAs, for example, i) have different lengths (whether or not the RNAs are identical throughout the shorter of the two lengths), ii) have different nucleotide sequences, iii) have different chemical modification patterns, or iv) have any combination of the above.

[0191] In some embodiments, two or more of the input DNA molecules used in the IVT reaction code for mRNA molecules having different lengths (e.g., containing different numbers of nucleotides). In some embodiments, the difference in length between two or more of the mRNA molecules encoded by different input DNA molecules in the IVT reaction mixture is greater than 70, 80, 90, or 100 nucleotides (e.g., two input DNA molecules in the composition code for mRNA molecules that are not within 70, 80, 90, or 100 nucleotides of each other in length). In some embodiments, the difference in length between two or more of the mRNA molecules encoded by different input DNA molecules is greater than 100 nucleotides, e.g., 500 nucleotides, 1000 nucleotides, 1500 nucleotides, 2000 nucleotides, 3000 nucleotides, 4000 nucleotides, or more.

[0192] In certain embodiments, a combination vaccine (e.g., a multivalent RNA composition) is produced by combining a linearized first DNA molecule encoding a first mRNA polynucleotide, a linearized second DNA molecule encoding a second mRNA polynucleotide, and a linearized third DNA molecule encoding a third mRNA polynucleotide in a single reaction vessel, where the first DNA molecule, the second DNA molecule, and the third DNA molecule are obtained from different sources. In some embodiments, the different sources are first, second, and third bacterial cell cultures, where the first, second, and third bacterial cell cultures are not co-cultured. In some embodiments, the different sources are first, second, and third bacterial cell cultures, where the first, second, and third bacterial cell cultures are co-cultured. In some embodiments, the amounts of the first, second, and third DNA molecules present in the reaction mixture are normalized before the start of in vitro transcription.

[0193] In some embodiments, the linearized first DNA molecule, the linearized second DNA molecule, and the linearized third DNA molecule are simultaneously transcribed in vitro to obtain the polyvalent RNA composition.

[0194] In some embodiments, the in vitro transcription template encodes a 5' untranslated (UTR) region, contains an open reading frame, encodes a 3' UTR and a poly A tail. The particular nucleic acid sequence composition and length of the in vitro transcription template depends on the mRNA encoded by the template.

[0195] "5' untranslated region" (UTR) refers to the region of an mRNA immediately upstream (i.e., 5') from the start codon (i.e., the first codon of the mRNA transcript translated by the ribosome) that does not code for a polypeptide. If an RNA transcript is being produced, the 5'UTR may contain a promoter sequence. Such promoter sequences are known in the art. It should be understood that no such promoter sequences are present in the vaccines of the present disclosure.

[0196] "3' untranslated region" (UTR) refers to the region of an mRNA immediately downstream (i.e., 3') from a stop codon (i.e., a codon of the mRNA transcript that signals the termination of translation) that does not encode a polypeptide.

[0197] An "open reading frame" is a contiguous stretch of DNA beginning with a start codon (eg, methionine (ATG)) and ending with a stop codon (eg, TAA, TAG, or TGA) that encodes a polypeptide.

[0198] A "poly(A) tail" is a region of an mRNA downstream, e.g., immediately downstream (i.e., 3'), of the 3'UTR that contains multiple consecutive adenosine monophosphates. A poly(A) tail can contain 10-300 adenosine monophosphates. For example, a poly(A) tail can contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenosine monophosphates. In some embodiments, a poly(A) tail contains 50-250 adenosine monophosphates. In relevant biological environments (e.g., within a cell, in vivo), the poly(A) tail functions, for example, to protect the mRNA from enzymatic degradation in the cytoplasm and assists in transcription termination and / or transport of the mRNA from the nucleus and translation.

[0199] In some embodiments, the nucleic acid comprises 200 to 3,000 nucleotides. For example, the nucleic acid may comprise 200 to 500, 200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500, 500 to 2000, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 3000, 1500 to 3000, or 2000 to 3000 nucleotides.

[0200] In vitro transcription systems typically include a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor, and a polymerase.

[0201] NTPs may be produced in-house, selected from a supplier, or synthesized as described herein. NTPs may be selected from those described herein, including, but not limited to, natural and unnatural (modified) NTPs.

[0202] Any number of RNA polymerases or variants may be used in the methods of the present disclosure. The polymerase may be selected from mutant polymerases, such as, but not limited to, phage RNA polymerases, e.g., T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, and / or polymerases capable of incorporating modified nucleic acids and / or modified nucleotides, including, but not limited to, chemically modified nucleic acids and / or nucleotides. Some embodiments exclude the use of DNase.

[0203] In some embodiments, the RNA transcript is capped via enzymatic capping. In some embodiments, the RNA comprises a 5' end cap, e.g., 7mG(5')ppp(5')NlmpNp.

[0204] Non-coding sequences Aspects of the present disclosure relate to multivalent RNA compositions comprising mRNA, e.g., 2-15 mRNA polynucleotides, each comprising a separate open reading frame (ORF) encoding a respiratory virus antigenic polypeptide, and each mRNA polynucleotide comprising one or more non-coding sequences in a untranslated region (UTR) having a unique identifier sequence, or a non-coding sequence. As used herein, "non-coding sequence" refers to a sequence of a biomolecule (e.g., a nucleic acid, a protein, etc.) that functions to recognize another biomolecule when that other biomolecule is bound to that sequence.

[0205] Typically, the non-coding sequence is a heterologous sequence that is incorporated into or added to the sequence of a target biological molecule and used as a reference to identify the target molecule of interest. In some embodiments, the non-coding sequence is a sequence of a nucleic acid (e.g., a heterologous or synthetic nucleic acid) that is incorporated into or added to the target nucleic acid and used as a reference to identify the target nucleic acid. In some embodiments, the non-coding sequence is of the formula (N)n. In some embodiments, n is an integer ranging from 5 to 20, 5 to 10, 10 to 20, 7 to 20, or 7 to 30. In some embodiments, n is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more. In some embodiments, N is a nucleotide independently selected from A, G, T, U, and C, or analogs thereof. Thus, some embodiments include a nucleic acid (e.g., an mRNA) that (i) has a target sequence of interest (e.g., a coding sequence (e.g., encoding a therapeutic peptide or protein)) and (ii) includes unique non-coding sequence.

[0206] In some embodiments, one or more in vitro transcribed mRNAs comprise one or more non-coding sequences in a non-translated region (UTR), such as the 5'UTR or 3'UTR. By including a non-coding sequence in a UTR of an mRNA, the non-coding sequence is prevented from being translated into a peptide. In some embodiments, the non-coding sequence is located in the 3'UTR of the mRNA. In some embodiments, the non-coding sequence is located upstream of the polyA tail of the mRNA. In some embodiments, the non-coding sequence is located downstream (e.g., after) the polyA tail of the mRNA. In some embodiments, the non-coding sequence is located between the last codon of the ORF of the mRNA and the first "A" of the polyA tail of the mRNA. In some embodiments, the polynucleotide non-coding sequence located in the UTR comprises 1-10 nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides). In some embodiments, the UTR comprising the polynucleotide non-coding sequence further comprises one or more (e.g., 1, 2, 3, or more) RNAse cleavage sites, such as an RNase H cleavage site. In some embodiments, each different RNA of a multivalent RNA composition comprises a different (e.g., unique) non-coding sequence. In some embodiments, the RNA of a multivalent RNA composition is detected and / or purified according to the polynucleotide non-coding sequence of the RNA. In some embodiments, the mRNA non-coding sequence is used to identify the presence of mRNA in a sample (e.g., a reaction product or drug product) or to determine the relative ratio of different mRNAs. In some embodiments, the mRNA non-coding sequence is detected using one or more of deep sequencing, PCR, and Sanger sequencing.Exemplary non-coding sequences include AACGUGAU, AAAACAUCG, ATGCCUAA, AGUGGUCA, ACCACUGU, ACAUUGGC, CAGAUCUG, CAUCAAGU, CGCUGAUC, ACAAGCUA, CUGUAGCC, AGUACAAG, AACAACCA, AACCGAGA, AACGCUUA, AAGACGA, AAGGUACA, ACACAGAA, ACAGCAGA, ACCUCCAA, ACGCUCGA, ACGUAUCA, ACUAUGCA, AGAGUCAA, AGAUCGCA, AGCAGGAA, AGUCACUA, AUCCUGUA, AUUGAGGA, CAACCACA, GACUAGUA, CAAUGGAA, CACUUCGA, CAGCGUUA, CAUACCAA, CCAGUUCA, CCGAAGUA, ACAGUG, CGAUGU, UUAGGC, AUCACG, and UGACCA.

[0207] In some embodiments, the polyvalent RNA composition comprises: (a) combining in a single reaction vessel a linearized first DNA molecule encoding a first mRNA polynucleotide, a linearized second DNA molecule encoding a second mRNA polynucleotide, and a linearized third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecule encoding a third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth mRNA polynucleotide, wherein the first DNA molecule, the second DNA molecule, and the third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecule are obtained from different sources; (b) simultaneously in vitro transcribing a linearized first DNA molecule, a linearized second DNA molecule, and a linearized third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecule to obtain a polyvalent RNA composition. The different sources may be bacterial cell cultures that cannot be co-cultured. In some embodiments, the amounts of the first, second, and third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecules present in the reaction mixture before the start of IVT are normalized.

[0208] chemical synthesis Solid-phase chemical synthesis. The nucleic acids of the present disclosure may be produced in whole or in part using solid-phase technology. Solid-phase chemical synthesis of nucleic acids is an automated method in which molecules are immobilized on a solid support and synthesized stepwise in a reaction solution. Solid-phase synthesis is useful for site-specific introduction of chemical modifications into nucleic acid sequences.

[0209] Solution Phase Chemical Synthesis. The synthesis of the nucleic acids of the present disclosure by sequential addition of monomer building blocks can be carried out in solution phase.

[0210] Combination of synthetic methods. Each of the synthetic methods discussed above has its own advantages and limitations. Attempts have been made to combine these methods to overcome their limitations. Such combinations of methods are within the scope of this disclosure. The use of solid-phase or liquid-phase chemical synthesis combined with enzymatic ligation provides an efficient way to generate long-chain nucleic acids that cannot be obtained by chemical synthesis alone.

[0211] Ligation of nucleic acid regions or subregions Ligase-mediated assembly of nucleic acids may also be used. DNA or RNA ligases promote intermolecular ligation of the 5' and 3' ends of polynucleotide chains through the formation of phosphodiester bonds. Nucleic acids such as chimeric polynucleotides and / or circular nucleic acids may be prepared by ligation of one or more regions or subregions. DNA fragments can be joined by ligase-catalyzed reactions to generate recombinant DNAs with different functions. Two oligodeoxynucleotides, one containing a 5' phosphoryl group and the other containing a free 3' hydroxyl group, serve as substrates for DNA ligase.

[0212] purification Purification of nucleic acids as described herein may include, but is not limited to, nucleic acid cleanup, quality assurance and quality control. Cleanup can be performed by methods known in the art, such as, but not limited to, AGENCORT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNA™ Oligo-T Capture Probes (EXIQON® Inc, Vedbaek, Denmark), or HPLC-based purification methods, including, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reversed-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). The term "purified" when used in reference to nucleic acids, such as "purified nucleic acid", refers to something that has been separated from at least one contaminant. A "contaminant" is any substance that renders something unsuitable, impure, or adulterated. Thus, purified nucleic acid (e.g., DNA and RNA) is present in a form or setting that is different from that in which it is found in nature or that was present before it was subjected to a processing or purification method.

[0213] Quality assurance and / or quality control checks can be performed using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC.

[0214] In some embodiments, the nucleic acid may be sequenced by methods including, but not limited to, reverse transcriptase PCR.

[0215] Quantification In some embodiments, the nucleic acids of the present disclosure may be quantified in exosomes or derived from one or more bodily fluids, including peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, sputum fluid, amniotic fluid, earwax, breast milk, bronchoalveolar lavage fluid, semen, prostatic fluid, Cowper's or pre-ejaculatory fluid, sweat, feces, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyle, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretions, stool, pancreatic juice, sinus lavage, bronchopulmonary aspirate, blastodermal cavity fluid, and umbilical cord blood. Alternatively, the exosomes may be obtained from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta.

[0216] Assays can be performed using construct-specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or combinations thereof, and exosomes can be isolated using immunohistochemistry, such as enzyme-linked immunosorbent assay (ELISA). Exosomes can also be isolated by size-exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunosorbent capture, affinity purification, microfluidic separation, or combinations thereof.

[0217] These methods allow researchers to monitor residual or delivered levels of nucleic acid in real time, as the nucleic acids of the present disclosure, in some embodiments, differ from endogenous forms by structural or chemical modifications.

[0218] In some embodiments, nucleic acids may be quantified using methods such as, but not limited to, ultraviolet-visible spectroscopy (UV / Vis). A non-limiting example of a UV / Vis spectrometer is the NANODROP® spectrometer (ThermoFisher, Waltham, MA). The quantified nucleic acids may be analyzed to determine whether the nucleic acids are of the appropriate size and to confirm that no degradation of the nucleic acid has occurred. Nucleic acid degradation may be confirmed by methods such as, but not limited to, agarose gel electrophoresis, HPLC-based purification methods, including, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE), and capillary gel electrophoresis (CGE).

[0219] Lipid Nanoparticles (LNPs) In some embodiments, the mRNA of the present disclosure is formulated in lipid nanoparticles (LNPs). Lipid nanoparticles typically include ionizable amino lipids, non-cationic lipids, sterols, and PEG lipid components along with the nucleic acid cargo of interest. Lipid nanoparticles of the present disclosure can be formulated using components, compositions, and methods as generally known in the art (e.g., PCT / US2016 / 052352; PCT / US2016 / 068300; PCT / US2017 / 037551; PCT / US2015 / 027400; PCT / US2016 / 047406; PCT / US2016 / 000129; PCT / US2016 / 014280; PCT / US2016 / 01 4280; PCT / US2017 / 038426; PCT / US2014 / 027077; PCT / US2014 / 055394; PCT / US2016 / 052117; PCT / US2012 / 069610; PCT / US2017 / 027492; PCT / US2016 / 059575 and PCT / US2016 / 069491 (all of which are incorporated by reference in their entireties).

[0220] The vaccines of the present disclosure are typically formulated in lipid nanoparticles. Vaccines can be produced using mixing processes such as, for example, microfluidics and T-mixing of two fluid streams, one containing the mRNA and the other with the lipid component. In some embodiments, the vaccines are prepared by combining an ionizable amino lipid, a phospholipid (such as DOPE or DSPC), a PEG lipid (such as 1,2-dimyristoyl-OT-glycerol methoxypolyethylene glycol, also known as PEG-DMG), and a structured lipid (such as cholesterol) in alcohol (e.g., ethanol). The lipids can be combined to obtain the desired molar ratio and diluted with water and alcohol (e.g., ethanol) to a final lipid concentration of, for example, about 5.5 mM to about 25 mM.

[0221] Vaccines including mRNA and lipid components can be prepared, for example, by combining a lipid solution with an mRNA solution in a weight:weight ratio of lipid component to mRNA of about 5:1 to about 50:1. The lipid solution can be rapidly injected into the mRNA solution using a microfluidic-based system (e.g., NanoAssemblr) at a flow rate of, for example, about 10 ml / min to about 18 ml / min to produce a suspension (e.g., with a water to alcohol ratio of about 1:1 to about 4:1).

[0222] The vaccine can be processed by dialysis to remove alcohol (e.g., ethanol) and perform buffer exchange. The formulation can be dialyzed against phosphate buffered saline (PBS) at pH 7.4, for example, in a volume larger than the primary product (e.g., using a Slide-A-Lyzer cassette (Thermo Fisher Scientific Inc., Rockford, Ill.)), for example, with a molecular weight cutoff of 10 kD. The aforementioned exemplary method induces nanoprecipitation and particle formation. The same nanoprecipitation can also be achieved using alternative processes, including but not limited to T-type and direct injection.

[0223] The vaccines of the present disclosure are typically formulated in lipid nanoparticles. In some embodiments, the lipid nanoparticles comprise at least one ionizable amino lipid, at least one non-cationic lipid, at least one sterol, and / or at least one polyethylene glycol (PEG)-modified lipid.

[0224] In some embodiments, the lipid nanoparticles comprise 20-60 mol% of ionizable amino lipids. For example, the lipid nanoparticles may comprise 20-50 mol%, 20-40 mol%, 20-30 mol%, 30-60 mol%, 30-50 mol%, 30-40 mol%, 40-60 mol%, 40-50 mol%, or 50-60 mol% of ionizable amino lipids. In some embodiments, the lipid nanoparticles comprise 20 mol%, 30 mol%, 40 mol%, 50 mol%, or 60 mol% of ionizable amino lipids.

[0225] In some embodiments, the lipid nanoparticles contain 5-25 mol% non-cationic lipid. For example, the lipid nanoparticles may contain 5-20 mol%, 5-15 mol%, 5-10 mol%, 10-25 mol%, 10-20 mol%, 10-25 mol%, 15-25 mol%, 15-20 mol%, or 20-25 mol% non-cationic lipid. In some embodiments, the lipid nanoparticles contain 5 mol%, 10 mol%, 15 mol%, 20 mol%, or 25 mol% non-cationic lipid.

[0226] In some embodiments, the lipid nanoparticles contain 25-55 mol% sterol. For example, the lipid nanoparticles may contain 25-50 mol%, 25-45 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 30-35 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 45-55 mol%, 45-50 mol%, or 50-55 mol% sterol. In some embodiments, the lipid nanoparticles contain 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, or 55 mol% sterol.

[0227] In some embodiments, the lipid nanoparticles contain 0.5-15 mol% of PEG-modified lipid. For example, the lipid nanoparticles contain 0.5-10 mol%, 0.5-5 mol%, 1-15 mol%, 1-10 mol%, 1-5 mol%, 2-15 mol%, 2-10 mol%, 2-5 mol%, 5-15 mol%, 5-10 mol%, or 10-15 mol%. In some embodiments, the lipid nanoparticles contain 0.5 mol%, 1 mol%, 2 mol%, 3 mol%, 4 mol%, 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, 11 mol%, 12 mol%, 13 mol%, 14 mol%, or 15 mol% of PEG-modified lipid.

[0228] In some embodiments, the lipid nanoparticles comprise 20-60 mol% ionizable amino lipid, 5-25 mol% non-cationic lipid, 25-55 mol% sterol, and about 0.5-15 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticles comprise 40-50 mol% ionizable amino lipid, 5-15% neutral lipid, 20-40 mol% cholesterol, and about 0.5-3 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticles comprise 45-50 mol% ionizable amino lipid, 9-13% neutral lipid, 35-45 mol% cholesterol, and about 2-3 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticles comprise 48 mol% ionizable amino lipid, 11 mol% neutral lipid, 68.5 mol% cholesterol, and about 2.5 mol% PEG-modified lipid.

[0229] In some embodiments, the ionizable amino lipids of the present disclosure are compounds of formula (I): [ka] or a salt or isomer thereof, wherein: R1 is C 5~30 Alkyl, C 5~20 alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are H, C 1-14 Alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, where Q is a carbocycle, a heterocycle, -OR, -O(CH2) nN(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N( R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R8, -O(CH2) n n is selected from OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(R)N(R)2C(O)OR, wherein each n is independently selected from 1, 2, 3, 4, and 5; Each R5, C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 alkenyl, and H; R8 is C 3~6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 carbocycle, and heterocycle; Each R is C 1-3 Alkyl, C 2-3alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl, Each R* is C 1-12 Alkyl and C 2-12 alkenyl, Each Y is independently 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0230] In some embodiments, a subset of compounds of formula (I) are those in which R4 is -(CH2) n Q, -(CH2) n When CHQR, -CHQR, or -CQ(R), (i) Q is not -N(R) when n is 1, 2, 3, 4, or 5, or (ii) Q is not a 5-, 6-, or 7-membered heterocycloalkyl when n is 1 or 2.

[0231] In some embodiments, another subset of compounds of formula (I) includes R1 is C 5~30 Alkyl, C 5~20 alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are H, C 1-14 Alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) nCHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, where Q is selected from the group consisting of C 3-6 Carbocyclic ring, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n and a 5-14 membered heterocycloalkyl having one or more heteroatoms selected from N, O, and S, which are selected from oxo (=O), OH, amino, mono- or di-alkylamino, and C(O)OR, -N(OR)C(O)R, -N(OR)S(O)R, -N(OR)C(O)OR, -N(OR)C(O)N(R), -N(OR)C(S)N(R), -N(OR)C(=NR)N(R), -N(OR)C(=CHR)N(R), -C(=NR)N(R), -C(O)N(R)OR, and a 5-14 membered heterocycloalkyl having one or more heteroatoms selected from N, O, and S, which are selected from oxo (=O), OH, amino, mono- or di-alkylamino, and C(O)OR. 1-3 alkyl, each n being independently selected from 1, 2, 3, 4, and 5; Each R5, C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3Alkyl, C 2-3 alkenyl, and H; R8 is C 3~6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 carbocycle, and heterocycle; Each R is C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl, Each R* is C 1-12 Alkyl and C 2-12 alkenyl, Each Y is independently C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0232] In some embodiments, another subset of compounds of formula (I) includes R1 is C 5~30 Alkyl, C 5~20 alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are H, C 1-14 Alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, wherein Q is selected from the group consisting of C 3~6 A 5-14 membered heterocyclic ring having one or more heteroatoms selected from a carbocyclic ring, N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n and (i) R4 is selected from -(CH2)N(R)OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R)2, each n is independently selected from 1, 2, 3, 4, and 5; and Q is a 5-14 membered heterocycle; and (i) R4 is -(CH2) n Q (wherein n is 1 or 2), or (ii) R4 is -(CH2) n or (iii) when R4 is -CHQR and -CQ(R)2, Q is either a 5-14 membered heteroaryl or an 8-14 membered heterocycloalkyl; Each R5, C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 alkenyl, and H; R8 is C 3~6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 carbocycle, and heterocycle; Each R is C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl, Each R* is C 1-12 Alkyl and C 2-12 alkenyl, Each Y is independently C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0233] In some embodiments, another subset of compounds of formula (I) includes R1 is C 5~30 Alkyl, C 5~20alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are H, C 1-14 Alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, where Q is selected from the group consisting of C 3-6 Carbocyclic ring, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R)2, wherein each n is independently selected from 1, 2, 3, 4, and 5; Each R5, C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 alkenyl, and H; R8 is C 3~6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 carbocycle, and heterocycle; Each R is C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl, Each R* is C 1-12 Alkyl and C 2-12 alkenyl, Each Y is independently 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0234] In some embodiments, another subset of compounds of formula (I) includes R1 is C 5~30 Alkyl, C 5~20alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are H, C 2-14 Alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocycle or carbocycle; R4 is -(CH2) n Q or -(CH2) n CHQR, where Q is -N(R)2 and n is selected from 3, 4, and 5; Each R5, C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R is C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl, Each R* is C 1-12 Alkyl and C 1-12 alkenyl, Each Y is independently C3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0235] In some embodiments, another subset of compounds of formula (I) includes R1 is C 5~30 Alkyl, C 5~20 alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are C 1-14 Alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocycle or carbocycle; R4 is -(CH2) n Q, -(CH2) n -CHQR, -CHQR, and -CQ(R), where Q is -N(R) and n is selected from 1, 2, 3, 4, and 5; Each R5, C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R is C 1-3 Alkyl, C 2-3alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl, Each R* is C 1-12 Alkyl and C 1-12 alkenyl, Each Y is independently C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0236] In some embodiments, a subset of compounds of formula (I) includes compounds of formula (IA): [ka] or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M1 is a bond or M′; and R4 is unsubstituted C 1-3 Alkyl, or -(CH2) n Q, where Q is OH, -NHC(S)N(R), -NHC(O)N(R), -N(R)C(O)R, -N(R)S(O)R, -N(R)R, -NHC(=NR)N(R), -NHC(=CHR)N(R), -OC(O)N(R), -N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -P(O)(OR')O-, -SS-, an aryl group, and a heteroaryl group; R and R are H, C 1-14 Alkyl, and C 2-14 alkenyl.

[0237] In some embodiments, a subset of compounds of formula (I) includes compounds of formula (II): [ka] or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; M1 is a bond or M′; and R4 is unsubstituted C 1-3 Alkyl, or -(CH2) n Q, where n is 2, 3, or 4; Q is OH, -NHC(S)N(R), -NHC(O)N(R), -N(R)C(O)R, -N(R)S(O)R, -N(R)R, -NHC(=NR)N(R), -NHC(=CHR)N(R), -OC(O)N(R), -N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -P(O)(OR')O-, -SS-, an aryl group, and a heteroaryl group; R and R are independently selected from H, C 1-14 Alkyl, and C 2-14 alkenyl.

[0238] In some embodiments, subsets of compounds of formula (I) include those of formula (IIa), (IIb), (IIc), or (IIe): [ka] or a salt or isomer thereof, wherein R4 is as described herein.

[0239] In some embodiments, a subset of compounds of formula (I) includes compounds of formula (IId): [ka] or a salt or isomer thereof, wherein n is 2, 3, or 4; m, R', R", and R2-R6 are as described herein. For example, each of R2 and R3 is C5-14 Alkyl and C 5-14 alkenyl.

[0240] In some embodiments, the ionizable amino lipids of the present disclosure include compounds having the following structure: [ka]

[0241] In some embodiments, the ionizable amino lipids of the present disclosure include compounds having the following structure: [ka]

[0242] In some embodiments, the non-cationic lipids of the present disclosure are 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3 ... Lysoleoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2 cholesteryl hemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine -phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.

[0243] In some embodiments, the PEG-modified lipids of the present disclosure include PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. In some embodiments, the PEG-modified lipid is DMG-PEG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG, and / or PEG-DPG.

[0244] In some embodiments, sterols of the present disclosure include cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and mixtures thereof.

[0245] In some embodiments, the LNPs of the present disclosure comprise an ionizable amino lipid of Compound 1, where the non-cationic lipid is DSPC, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG (e.g., PEG2000-DMG).

[0246] In some embodiments, the lipid nanoparticles comprise 45-55 mole percent (mol%) of an ionizable amino lipid (e.g., Compound 1). For example, the lipid nanoparticles may comprise 45-47, 45-48, 45-49, 45-50, 45-52, 46-48, 46-49, 46-50, 46-52, 46-55, 47-48, 47-49, 47-50, 47-52, 47-55, 48-50, 48-52, 48-55, 49-50, 49-52, 49-55, or 50-55 mol% of an ionizable amino lipid (e.g., Compound 1). For example, the lipid nanoparticles may comprise 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 mol% of an ionizable amino lipid.

[0247] In some embodiments, the lipid nanoparticles contain 5-15 mol% of a non-cationic (neutral) lipid (e.g., DSPC). For example, the lipid nanoparticles may contain 5-6, 5-7, 5-8, 5-9, 5-10, 5-11, 5-12, 5-13, 5-14, 5-15, 6-7, 6-8, 6-9, 6-10, 6-11, 6-12, 6-13, 6-14, 6-15, 7-8, 7-9, 7-10, 7-11, 7-12, 7-13, 7-14, 7-15, 8-9, 8-10, 8-11, 8-12, 8-13 , 8-14, 8-15, 9-10, 9-11, 9-12, 9-13, 9-14, 9-15, 10-11, 10-12, 10-13, 10-14, 10-15, 11-12, 11-13, 11-14, 11-15, 12-13, 12-14, 13-14, 13-15, or 14-15 mol% of a non-cationic (neutral) lipid (e.g., DSPC). For example, the lipid nanoparticles may contain 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mol% of DSPC.

[0248] In some embodiments, the lipid nanoparticles comprise 35-40 mol% sterol (e.g., cholesterol). For example, the lipid nanoparticles may comprise 35-36, 35-37, 35-38, 35-39, 35-40, 36-37, 36-38, 36-39, 36-40, 37-38, 37-39, 37-40, 38-39, 38-40, or 39-40 mol% cholesterol. For example, the lipid nanoparticles may comprise 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, or 40 mol% cholesterol.

[0249] In some embodiments, the lipid nanoparticles contain 1-3 mol% DMG-PEG. For example, the lipid nanoparticles may contain 1-1.5, 1-2, 1-2.5, 1-3, 1.5-2, 1.5-2.5, 1.5-3, 2-2.5, 2-3, or 2.5-3 mol% DMG-PEG. For example, the lipid nanoparticles may contain 1, 1.5, 2, 2.5, or 3 mol% DMG-PEG.

[0250] In some embodiments, the lipid nanoparticles comprise 50 mol% ionizable amino lipid, 10 mol% DSPC, 38.5 mol% cholesterol, and 1.5 mol% DMG-PEG. In some embodiments, the lipid nanoparticles comprise 48 mol% ionizable amino lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% PEG2000-DMG.

[0251] In some embodiments, the LNPs of the disclosure comprise an N:P ratio of about 2:1 to about 30:1.

[0252] In some embodiments, the LNPs of the disclosure comprise an N:P ratio of about 6:1.

[0253] In some embodiments, the LNPs of the disclosure comprise an N:P ratio of about 3:1.

[0254] In some embodiments, the LNPs of the present disclosure comprise a wt / wt ratio of ionizable amino lipid components to RNA of about 10:1 to about 100:1.

[0255] In some embodiments, the LNPs of the present disclosure comprise a wt / wt ratio of ionizable amino lipid components to RNA of about 20:1.

[0256] In some embodiments, the LNPs of the present disclosure comprise a wt / wt ratio of ionizable amino lipid components to RNA of about 10:1.

[0257] In some embodiments, the average diameter of the LNPs of the disclosure is about 50 nm to about 150 nm.

[0258] In some embodiments, the average diameter of the LNPs of the disclosure is about 70 nm to about 120 nm.

[0259] Multivalent vaccines The compositions provided herein may include an RNA or multiple RNAs encoding two or more antigens of the same or different species, i.e., the compositions may be multivalent compositions (e.g., vaccines). In some embodiments, the compositions include an RNA or multiple RNAs encoding two or more respiratory virus antigens. In some embodiments, the RNAs may encode 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 or more respiratory virus antigens.

[0260] In some embodiments, two or more different mRNAs encoding antigens may be formulated in the same lipid nanoparticle (e.g., four NA antigens and four HA antigens are formulated in a single lipid nanoparticle, or an influenza antigen and a coronavirus antigen are formulated in a single lipid nanoparticle). In other embodiments, two or more different RNAs encoding antigens may be formulated in separate lipid nanoparticles (each RNA is formulated in a single lipid nanoparticle). The lipid nanoparticles may then be combined and administered as a single vaccine composition (e.g., a vaccine composition including multiple RNAs encoding multiple antigens) or may be administered separately.

[0261] Pharmaceutical preparations Provided herein are compositions (e.g., pharmaceutical compositions), methods, kits, and reagents for the prevention or treatment of respiratory viruses, e.g., in humans and other mammals. The compositions provided herein can be used as therapeutic or prophylactic agents. They can be used in medicines to prevent and / or treat respiratory virus infections.

[0262] In some embodiments, a respiratory virus vaccine containing RNA as described herein can be administered to a subject (e.g., a mammalian subject, such as a human subject), and the RNA polynucleotide is translated in vivo to produce an antigenic polypeptide (antigen).

[0263] An "effective amount" of a composition (e.g., comprising RNA) is based, at least in part, on the target tissue, the target cell type, the means of administration, the physical properties of the RNA (e.g., length, nucleotide composition, and / or degree of modified nucleosides), the other components of the vaccine, and other determinants, such as the age, weight, height, sex, and general health of the subject. Typically, an effective amount of a composition provides an induced or boosted immune response as a function of antigen production in the cells of the subject. In some embodiments, an effective amount is the amount necessary to prevent infection or reduce the severity of a respiratory infection in a subject based on a single dose of a combination vaccine or a single dose of a combination vaccine with a booster dose. In some embodiments, an effective amount of a composition containing an RNA polynucleotide having at least one chemical modification is more efficient than a composition containing a corresponding unmodified polynucleotide encoding the same antigen or peptide antigen. Increased antigen production may be demonstrated by increased cell transfection (percentage of cells transfected with the RNA vaccine), increased protein translation and / or expression from the polynucleotide, decreased nucleic acid degradation (e.g., as indicated by an increased duration of protein translation from a modified polynucleotide), or a change in the antigen-specific immune response of the host cell.

[0264] The term "pharmaceutical composition" refers to a combination of an active agent and an inert or active carrier that makes the composition particularly suitable for diagnostic or therapeutic use in vivo or ex vivo. A "pharmaceutical acceptable carrier" is one that does not cause undesirable physiological effects after or upon administration to a subject. A carrier in a pharmaceutical composition must also be "acceptable" in the sense of being compatible with the active ingredient and capable of stabilizing it. One or more solubilizing agents may be utilized as pharmaceutical carriers for delivery of the active agent. Examples of pharmaceutical acceptable carriers include, but are not limited to, biocompatible vehicles, adjuvants, additives, and diluents to achieve a composition that can be used as a dosage form. Examples of other carriers include colloidal silicon oxide, magnesium stearate, cellulose, and sodium lauryl sulfate. Additional suitable pharmaceutical carriers and diluents, as well as pharmaceutical necessities for their use, are described in Remington's Pharmaceutical Sciences.

[0265] In some embodiments, compositions (including polynucleotides and their encoded polypeptides) according to the present disclosure may be used for the treatment or prevention of respiratory viral infections. Certain compositions may be administered prophylactically as part of an active immunization scheme, or therapeutically, to healthy individuals or early in infection during the incubation period or during active infection after symptom onset. In some embodiments, the amount of RNA provided to a cell, tissue, or subject may be an amount effective for immunoprophylaxis.

[0266] The vaccines disclosed herein can be administered to a subject to induce an antigen-specific immune response as a combination vaccine (i.e., both mRNAs encoding the antigens are included in the same formulation) or as separate vaccines (i.e., the mRNA encoding the influenza antigen and the mRNA encoding the coronavirus antigen are administered separately). When the vaccines are administered as separate vaccines, the two mRNAs can be administered to the subject at the same time (i.e., within 1 hour of each other) or at different times (i.e., 1 hour, 12 hours, 24 hours, 2 days, 7 days, more than 2 weeks apart). When the vaccines are administered as separate vaccines, the two mRNAs can be administered to the subject at the same site or at different sites (i.e., as injections into separate arms). In some embodiments, the combination vaccine can be the only vaccine that a subject receives that contains nucleic acids encoding influenza or coronavirus antigens. Alternatively, the vaccines can be administered in various combinations as prime and / or booster doses.

[0267] Vaccines can be administered to seropositive or seronegative subjects. For example, a subject may not have been treated or have antibodies that react with a virus that has an antigen, the antigen being a viral antigen or a fragment thereof encoded by the mRNA of the vaccine. Such a subject is said to be seronegative for that vaccine. Alternatively, a subject may have previously been infected with a virus that carries the antigen, or may have previously been administered a dose of a vaccine (e.g., an mRNA vaccine) that induces antibodies against the antigen, and thus have pre-existing antibodies against the viral antigen encoded by the mRNA of the vaccine. Such a subject is said to be seropositive for that vaccine. In some cases, a subject may have previously been exposed to a virus, but not to a particular variant or strain of the virus, or to a particular vaccine associated with that variant or strain. Such a subject is considered to be seronegative for a particular variant or strain.

[0268] Thus, the present disclosure provides compositions (e.g., mRNA vaccines) that induce strong neutralizing antibodies against influenza and coronavirus antigens in subjects. Such compositions may be administered to seropositive or seronegative subjects in some embodiments. Seronegative subjects may not have been treated and may not have antibodies that react with the particular virus to which the subject is immunized. Seronegative subjects may have pre-existing antibodies against a particular virus because they may have previously been infected with the virus, variant, or strain, or may have previously been administered a dose of a vaccine (e.g., an mRNA vaccine) that induces antibodies against the virus, variant, or strain.

[0269] In some embodiments, the composition comprises an mRNA encoding at least one (e.g., one, two, or more) coronavirus antigens, such as SARS-CoV-2 antigens from different SARS-CoV-2 mutant strains (also referred to herein as variants). In some embodiments, the mRNA vaccine comprises multiple mRNAs encoding SARS-CoV-2 antigens from different variants within a single lipid nanoparticle.

[0270] The composition may be administered with other prophylactic or therapeutic compounds. As a non-limiting example, the prophylactic or therapeutic compound may be an adjuvant or a booster. As used herein, the term "booster" or "booster vaccine" refers to an additional administration of a prophylactic combination (vaccine) composition when referring to a prophylactic composition such as a vaccine. In some embodiments, the booster vaccine comprises at least one mRNA polynucleotide having an ORF encoding a first, second, or third respiratory virus antigenic polypeptide. In some embodiments, the booster vaccine comprises at least one mRNA polynucleotide having an ORF encoding each of the first, second, and third respiratory virus antigenic polypeptides. In some embodiments, the booster vaccine comprises at least one mRNA polynucleotide having an ORF encoding a variant of the first, second, or third respiratory virus antigenic polypeptide.

[0271] A booster (or booster vaccine) may be administered following the earlier administration of the prophylactic composition, hi some embodiments, the combination vaccine is a seasonal booster vaccine (e.g., the combination vaccine is administered annually, such as every fall or winter). The administration time between the first administration of the prophylactic composition and the booster can be, but is not limited to, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months. In exemplary embodiments, the time between the first administration of the prophylactic composition and the booster may be, but is not limited to, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, or 6 months. In one embodiment, the booster vaccine is administered between 3 weeks and 1 year after the combination vaccine.

[0272] In some embodiments, the compositions may be administered intramuscularly, intranasally, or intradermally, similar to the administration of inactivated vaccines well known in the art.

[0273] The composition can be used in various settings depending on the prevalence of infection or the degree or level of unmet medical need. As a non-limiting example, the RNA vaccine can be used to treat and / or prevent various infectious diseases. RNA vaccines have superior properties in that they produce much larger antibody titers, better neutralizing immunity, produce a more durable immune response, and / or produce a faster response than commercially available vaccines.

[0274] Provided herein are pharmaceutical compositions comprising RNA and / or complexes, optionally in combination with one or more pharma- ceutically acceptable excipients.

[0275] The RNA may be formulated or administered alone or in combination with one or more other components, for example, an immunizing composition may include other components, including, but not limited to, an adjuvant.

[0276] In some embodiments, the immunizing composition does not include an adjuvant (is adjuvant-free).

[0277] The RNA may be formulated or administered in combination with one or more pharma- ceutically acceptable excipients. In some embodiments, the vaccine composition comprises at least one additional active agent, such as a therapeutic active agent, a prophylactic active agent, or a combination of both. The vaccine composition may be sterile, pyrogen-free, or both sterile and pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceuticals, such as vaccine compositions, can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005, which is incorporated herein by reference in its entirety.

[0278] In some embodiments, the immunizing composition is administered to a human, human patient, or subject. For purposes of this disclosure, the term "active ingredient" generally refers to an RNA vaccine or a polynucleotide contained therein, such as an RNA polynucleotide (e.g., an mRNA polynucleotide) that encodes an antigen.

[0279] Formulations of the vaccine compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such methods of preparation include the step of bringing into association the active ingredient (e.g., mRNA polynucleotide) with an excipient and / or one or more accessory ingredients, and then dividing, shaping, and / or packaging the product into the desired single or multi-dose units as necessary and / or desired.

[0280] The relative amounts of active ingredient, pharma- ceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated, and also depending on the route by which the composition is administered. By way of example, a composition may contain from 0.1% to 100%, e.g., 0.5 to 50%, 1 to 30%, 5 to 80%, at least 80% (w / w) active ingredient.

[0281] In some embodiments, the RNA can be formulated with one or more excipients to (1) increase stability, (2) increase cell transfection, (3) allow sustained or delayed release (e.g., from a depot formulation), (4) modify biodistribution (e.g., target specific tissues or cell types), (5) increase translation of the encoded protein in vivo, and / or (6) modify the release profile of the encoded protein (antigen) in vivo. In addition to conventional excipients such as any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersing or suspending aids, surfactants, isotonicity agents, thickening or emulsifying agents, preservatives, excipients can include, but are not limited to, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with RNA (e.g., for implantation into a subject), hyaluronidase, nanoparticle mimetics, and combinations thereof.

[0282] Dosage / Administration Provided herein are immunizing compositions (e.g., RNA vaccines), methods, kits, and reagents for the prevention and / or treatment of at least one respiratory viral infection in humans and other mammals. The immunizing compositions can be used as therapeutic or prophylactic agents. In some embodiments, the immunizing compositions are used to provide prophylactic protection from a respiratory viral infection. In some embodiments, the immunizing compositions are used to treat a respiratory viral infection. In some embodiments, the immunizing compositions are used to reduce the severity of a respiratory viral infection in a subject. In some embodiments, the immunizing compositions are used to prime immune effector cells, for example to activate peripheral blood mononuclear cells (PBMCs) ex vivo, and then infused (re-infused) into a subject.

[0283] The subject may be any mammal, including non-human primates and human subjects. Typically, the subject is a human subject. In some embodiments, the subject is 60 years of age or older (e.g., 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 years of age or older). In some embodiments, the subject is under 18 years of age (e.g., under 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 year old).

[0284] In some embodiments, the immunizing composition (e.g., an RNA vaccine) is administered to a subject (e.g., a mammalian subject, such as a human subject) in an amount effective to induce an antigen-specific immune response. RNA encoding a respiratory viral antigen is expressed and translated in vivo to produce the antigen, which then stimulates an immune response in the subject.

[0285] Preventive protection from respiratory viruses can be achieved after administration of the immunizing composition (e.g., RNA vaccine) of the present disclosure. The immunizing composition may be administered once, twice, three times, four times, or more, although a single administration of the vaccine may be sufficient (optionally followed by a single booster). Although not desirable, it is also possible to administer an immunizing composition to an infected individual to achieve a therapeutic response. Dosage regimens may need to be adjusted accordingly.

[0286] A method for inducing an immune response in a subject against a respiratory virus antigen (or multiple antigens) is provided in the present disclosure. In some embodiments, the method involves administering to a subject an immunization composition comprising an mRNA having an open reading frame encoding a respiratory virus antigen, thereby inducing an immune response specific to the respiratory virus antigen in the subject, and the anti-antigen antibody titer in the subject is increased after vaccination compared to the anti-antigen antibody titer in a subject vaccinated with a prophylactically effective dose of a conventional vaccine against the antigen. An "anti-antigen antibody" is a serum antibody that specifically binds to an antigen.

[0287] A prophylactically effective dose is a dose effective to prevent viral infection at a clinically acceptable level. In some embodiments, an effective dose is a dose listed on the vaccine package insert. As used herein, a conventional vaccine refers to a vaccine other than the mRNA vaccine of the present disclosure. For example, a conventional vaccine includes, but is not limited to, a live microbial vaccine, an inactivated microbial vaccine, a subunit vaccine, a protein antigen vaccine, a DNA vaccine, a virus-like particle (VLP) vaccine, and the like. In an exemplary embodiment, a conventional vaccine is a vaccine that has achieved regulatory approval and / or been registered by a national drug regulatory agency (e.g., the Food and Drug Administration (FDA) or the European Medicines Agency (EMA) in the United States).

[0288] In some embodiments, the anti-antigen antibody titer in the subject increases by 1 log to 10 logs after vaccination compared to the anti-antigen antibody titer in a subject vaccinated with a prophylactically effective dose of a conventional vaccine against a respiratory virus or in an unvaccinated subject. In some embodiments, the anti-antigen antibody titer in the subject increases by 1 log, 2 log, 3 log, 4 log, 5 log, or 10 logs after vaccination compared to the anti-antigen antibody titer in a subject vaccinated with a prophylactically effective dose of a conventional vaccine against a respiratory virus or in an unvaccinated subject.

[0289] Another aspect of the present disclosure provides a method for inducing an immune response to a respiratory virus in a subject. The method involves administering to the subject a composition (e.g., an RNA vaccine) comprising an RNA that includes an open reading frame encoding a respiratory virus antigen, thereby inducing an immune response specific to the respiratory virus in the subject, wherein the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine against the respiratory virus at a dosage level 2-fold to 100-fold higher than that of the immunizing composition.

[0290] In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at a dosage level twice as high as the immunizing composition of the present disclosure. In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at a dosage level three times as high as the immunizing composition of the present disclosure. In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at a dosage level four times, five times, ten times, fifty times, or one hundred times as high as the immunizing composition of the present disclosure. In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at a dosage level between 10 times and 1000 times as high as the immunizing composition of the present disclosure. In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at a dosage level between 10 times and 1000 times as high as the immunizing composition of the present disclosure.

[0291] In other embodiments, the immune response is assessed by determining the [protein] antibody titer in the subject. In other embodiments, the ability to promote a robust T cell response(s) is measured using art-recognized techniques.

[0292] Other aspects of the disclosure provide methods of eliciting an immune response in a subject against a respiratory virus by administering to the subject an immunizing composition (e.g., an RNA vaccine) comprising RNA having an open reading frame encoding a respiratory virus antigen, thereby inducing an immune response in the subject specific to the respiratory virus antigen, wherein the immune response in the subject is induced 2 days to 10 weeks earlier than an immune response induced in a subject vaccinated with a prophylactically effective amount of a conventional vaccine against the respiratory virus. In some embodiments, the immune response in the subject is induced at a dosage level 2-fold to 100-fold higher than in a subject vaccinated with a prophylactically effective dose of a conventional vaccine compared to the immunizing composition of the present disclosure.

[0293] In some embodiments, an immune response in a subject is induced 2 days, 3 days, 1 week, 2 weeks, 3 weeks, 5 weeks, or 10 weeks earlier than the immune response induced in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

[0294] Also provided herein is a method of eliciting an immune response in a subject against a respiratory virus by administering to the subject RNA having an open reading frame encoding a first antigen, wherein the RNA does not contain a stabilizing element and an adjuvant is not co-formulated or co-administered with the vaccine.

[0295] The immunizing composition (e.g., RNA vaccine) may be administered by any route that produces a therapeutically effective outcome. Such routes include, but are not limited to, intradermal, intramuscular, intranasal, and / or subcutaneous administration. The present disclosure provides a method that includes administering an RNA vaccine to a subject in need thereof. The exact amount required will vary from subject to subject depending on the subject's race, age, and general condition, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. RNA is typically formulated in unit dosage form for ease of administration and uniformity of dosage. However, it will be understood that the total daily usage of RNA may be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level, prophylactically effective dose level, or appropriate imaging dose level for any particular patient will depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the specific compound used; the specific composition used; the age, weight, general health, sex, and diet of the patient; the time of administration, route of administration, and excretion rate of the specific compound used; the duration of treatment; drugs used in combination or concomitantly with the specific compound used; and similar factors well known in the medical arts.

[0296] Effective amounts of RNA provided herein can be as low as 25 μg (total mRNA), e.g., administered as a single dose or two 12.5 μg doses. As used herein, "dose" refers to the total amount of RNA in the composition (e.g., including all of the NA and / or HA antigens in the formulation). In some embodiments, an effective amount is a total dose of 25 μg to 300 μg, 50 μg to 300 μg, 100 μg to 300 μg, 150 μg to 300 μg, 200 μg to 300 μg, 250 μg to 300 μg, 150 μg to 200 μg, 150 μg to 250 μg, 150 μg to 300 μg, 200 μg to 250 μg, or 250 μg to 300 μg. For example, the effective amount may be a total dose of 25 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, 200 μg, 210 μg, 220 μg, 230 μg, 240 μg, 250 μg, 260 μg, 270 μg, 280 μg, 290 μg, or 300 μg. In some embodiments, the effective amount is a total dose of 25 μg. In some embodiments, the effective amount is a total dose of 30 μg. In some embodiments, the effective amount is a total dose of 50 μg. In some embodiments, the effective amount is a total dose of 66 μg. In some embodiments, the effective amount is a 67 μg total dose. In some embodiments, the effective amount is a 68 μg total dose. In some embodiments, the effective amount is a 132 μg total dose. In some embodiments, the effective amount is a 133 μg total dose. In some embodiments, the effective amount is a 134 μg total dose. In some embodiments, the effective amount is a 266 μg total dose. In some embodiments, the effective amount is a 267 μg total dose. In some embodiments, the effective amount is a 268 μg total dose. In some embodiments, the effective amount is a 100 μg total dose. In some embodiments, the effective amount is a 200 μg total dose. In some embodiments, the effective amount is a 300 μg total dose.

[0297] The RNAs described herein may be formulated in dosage forms described herein, such as intranasally, intratracheally, or for injection (e.g., intravenously, intraocularly, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous).

[0298] Vaccine efficacy Some aspects of the present disclosure provide formulations of immunization compositions (e.g., RNA vaccines), in which the RNA is formulated in an effective amount to generate an antigen-specific immune response in a subject (e.g., production of antibodies specific to a respiratory virus antigen). An "effective amount" is a dose of RNA effective to generate an antigen-specific immune response. Also provided herein are methods of inducing an antigen-specific immune response in a subject.

[0299] As used herein, an immune response to a vaccine or LNP of the present disclosure is the development in a subject of a humoral and / or cellular immune response to the respiratory viral protein(s) present in the vaccine. For purposes of this disclosure, a "humoral" immune response refers to an immune response mediated by antibody molecules, including, for example, secretory (IgA) or IgG molecules, while a "cellular" immune response refers to one mediated by T-lymphocytes (e.g., CD4+ helper and / or CD8+ T cells (e.g., CTLs) and / or other white blood cells). One important aspect of cellular immunity involves antigen-specific responses by cytolytic T cells (CTLs). CTLs have specificity for peptide antigens that are presented along with proteins encoded by the major histocompatibility complex (MHC) and expressed on the cell surface. CTLs help induce and promote the destruction of intracellular microbes or the lysis of cells infected with such microbes. Another aspect of cellular immunity involves antigen-specific responses by helper T cells. Helper T cells act to stimulate the function and help focus the activity of nonspecific effector cells against cells that present peptide antigens on their surface in conjunction with MHC molecules. The cellular immune response also results in the production of cytokines, chemokines, and other such molecules produced by activated T cells and / or other leukocytes, including those derived from CD4+ and CD8+ T cells.

[0300] In some embodiments, antigen-specific immune response is characterized by measuring the anti-respiratory virus antigen antibody titer produced in a subject administered with the immunization composition provided herein.Antibody titer is a measurement of the amount of antibody in a subject, for example, antibody specific to a particular antigen or epitope of an antigen.Antibody titer is typically expressed as the reciprocal of the highest dilution that produces a positive result.For example, enzyme-linked immunosorbent assay (ELISA) is a common assay for quantifying antibody titer, for example.

[0301] In some embodiments, antibody titers are used to assess whether a subject has contracted an infectious disease or to determine whether immunization is required. In some embodiments, antibody titers are used to quantify the strength of an autoimmune response, to determine whether a booster immunization is required, to determine whether a previous vaccine was effective, and to confirm recent or past infection. According to the present disclosure, antibody titers can be used to determine the strength of the immune response induced in a subject by an immunization composition (e.g., an RNA vaccine).

[0302] In some embodiments, the anti-respiratory virus antigen antibody titer produced in the subject is increased by at least 1 log compared to the control. For example, the anti-respiratory virus antigen antibody titer produced in the subject may be increased by at least 1.5-fold, at least 2-fold, at least 2.5-fold, or at least 3 logs compared to the control. In some embodiments, the anti-respiratory virus antigen antibody titer produced in the subject is increased by 1, 1.5, 2, 2.5, or 3 logs compared to the control. In some embodiments, the anti-respiratory virus antigen antibody titer produced in the subject is increased by 1 to 3 logs compared to the control. For example, the anti-respiratory virus antigen antibody titer produced in the subject may be increased by 1 to 1.5, 1 to 2, 1 to 2.5, 1 to 3, 1.5 to 2, 1.5 to 2.5, 1.5 to 3, 2 to 2.5, 2 to 3, or 2.5 to 3 logs compared to the control.

[0303] In some embodiments, the anti-respiratory virus antigen antibody titer produced in the subject is increased by at least 2-fold compared to the control. For example, the anti-respiratory virus antigen antibody titer produced in the subject may be increased by at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold compared to the control. In some embodiments, the anti-respiratory virus antigen antibody titer produced in the subject is increased by 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-fold compared to the control. In some embodiments, the anti-respiratory virus antigen antibody titer produced in the subject is increased by 2- to 10-fold compared to the control. For example, the anti-respiratory virus antigen antibody titer produced in a subject may be increased by 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8-10, 8-9, or 9-10 fold compared to a control.

[0304] In some embodiments, the antigen-specific immune response is measured as the ratio of the geometric mean titers (GMT) of serum neutralizing antibody titers against a respiratory virus (referred to as the geometric mean ratio (GMR)). The geometric mean titer (GMT) is the average antibody titer in a group of subjects, calculated by multiplying all the values ​​together and taking the nth root of that number, where n is the number of subjects with available data.

[0305] In some embodiments, the control is an anti-respiratory virus antigen antibody titer produced in a subject who has not received an immunization composition (e.g., an RNA vaccine). In some embodiments, the control is an anti-respiratory virus antigen antibody titer produced in a subject who has received a recombinant or purified protein vaccine. Recombinant protein vaccines typically contain protein antigens produced in heterologous expression systems (e.g., bacteria or yeast) or purified from large amounts of pathogenic organisms.

[0306] In some embodiments, the ability of an immunization composition (e.g., an RNA vaccine) to be effective is measured in a mouse model. For example, an immunization composition can be administered to a mouse model and the mouse model is evaluated for induction of neutralizing antibody titers. Viral challenge studies can also be used to evaluate the efficacy of the vaccines of the present disclosure. For example, an immunization composition can be administered to a mouse model, the mouse model challenged with a virus, and the mouse model evaluated for survival and / or immune response (e.g., neutralizing antibody response, T cell response (e.g., cytokine response)).

[0307] As used herein, "standard of care" refers to medical or psychological treatment guidelines and may be general or specific. "Standard of care" refers to appropriate treatment based on scientific evidence and collaboration between medical professionals involved in the treatment of a given condition. It is the diagnostic and treatment process that a physician / clinician should follow for a particular type of patient, disease, or clinical situation. As provided herein, a "standard of care dose" refers to a dose of recombinant or purified protein vaccine, or live attenuated or inactivated vaccine, or VLP vaccine that a physician / clinician or other medical professional administers to a subject to treat or prevent a respiratory viral infection or related condition while following standard treatment guidelines for treating or preventing a respiratory viral infection or related condition.

[0308] In some embodiments, the anti-respiratory virus antigen antibody titers produced in a subject administered an effective amount of the immunizing composition are equivalent to the anti-respiratory virus antigen antibody titers produced in a control subject administered a standard care dose of a recombinant or purified protein vaccine, or a live attenuated or inactivated vaccine, or a VLP vaccine.

[0309] Vaccine efficacy can be evaluated using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun 1;201(11):1607-10). For example, vaccine efficacy can be measured in a double-blind randomized controlled clinical trial. Vaccine efficacy can be expressed as the proportional reduction in disease incidence (AR) between the incidence of the non-vaccinated test cohort (ARU) and the incidence of the vaccinated test cohort (ARV), and can be calculated from the relative risk (RR) of disease in the vaccinated group using the following formula: Efficacy = (ARU-ARV) / ARU x 100, and Efficacy = (1-RR) x 100.

[0310] Similarly, vaccine efficacy can be assessed using standard analyses (see, for example, Weinberg et al., J Infect Dis. 2010 Jun 1;201(11):1607-10). Vaccine efficacy evaluates how a vaccine (which may already be found to have high vaccine efficacy) reduces disease in a population. This measure can evaluate the net balance of benefits and side effects of a vaccination program, as well as the vaccine itself, under natural field conditions, rather than in controlled clinical trials. Vaccine efficacy is proportional to vaccine efficacy (potency), but is also influenced by the degree of immunization of target groups in the population, as well as other non-vaccine related factors that affect the "real world" outcomes of hospitalization, outpatient visits, or costs. For example, retrospective case-control analyses may be used to compare vaccination rates in a set of infected cases and appropriate controls. Vaccine efficacy can be expressed as a difference in proportions by use of the odds ratio (OR) of developing an infection despite vaccination. Efficacy = (1-OR) x 100

[0311] In some embodiments, the efficacy of the immunizing composition (e.g., an RNA vaccine) is at least 60% as compared to an unvaccinated control subject. For example, the efficacy of the immunizing composition can be at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 95%, at least 98%, or 100% as compared to an unvaccinated control subject.

[0312] Sterilizing immunity. Sterilizing immunity refers to an inherent immune state that prevents effective pathogen infection of a host. In some embodiments, an effective amount of the immunizing composition of the present disclosure is sufficient to provide sterilizing immunity in a subject for at least one year. For example, an effective amount of the immunizing composition of the present disclosure is sufficient to provide sterilizing immunity in a subject for at least two years, at least three years, at least four years, or at least five years. In some embodiments, an effective amount of the immunizing composition of the present disclosure is sufficient to provide sterilizing immunity in a subject at a dose at least 5 times lower than a control. For example, an effective amount may be sufficient to provide sterilizing immunity in a subject at a dose at least 10 times, 15 times, or 20 times lower than a control.

[0313] Detectable Antigen. In some embodiments, an effective amount of an immunizing composition of the present disclosure is sufficient to produce a detectable level of a respiratory viral antigen as measured in the subject's serum 1-72 hours after administration.

[0314] Titer. Antibody titer is a measurement of the amount of antibody in a subject, for example, an antibody that is specific to a particular antigen (e.g., an anti-respiratory virus antigen). Antibody titer is typically expressed as the reciprocal of the highest dilution that produces a positive result. For example, enzyme-linked immunosorbent assay (ELISA) is a common assay for quantifying antibody titer.

[0315] In some embodiments, an effective amount of the immunizing composition of the present disclosure is sufficient to produce a neutralizing antibody titer of 1,000-10,000 produced by neutralizing antibodies to a respiratory virus antigen as measured in the subject's serum 1-72 hours after administration. In some embodiments, an effective amount is sufficient to produce a neutralizing antibody titer of 1,000-5,000 produced by neutralizing antibodies to a respiratory virus antigen as measured in the subject's serum 1-72 hours after administration. In some embodiments, an effective amount is sufficient to produce a neutralizing antibody titer of 5,000-10,000 produced by neutralizing antibodies to a respiratory virus antigen as measured in the subject's serum 1-72 hours after administration.

[0316] In some embodiments, the neutralizing antibody titer is at least 100 NT 50 For example, the neutralizing antibody titer is at least 200, 300, 400, 500, 600, 700, 800, 900, or 1000 NT. 50 In some embodiments, the neutralizing antibody titer may be at least 10,000 NT. 50 It is.

[0317] In some embodiments, the neutralizing antibody titer is at least 100 neutralizing units per milliliter (NU / mL). For example, the neutralizing antibody titer can be at least 200, 300, 400, 500, 600, 700, 800, 900, or 1000 NU / mL. In some embodiments, the neutralizing antibody titer is at least 10,000 NU / mL.

[0318] In some embodiments, the anti-respiratory virus antigen antibody titer produced in the subject is increased by at least 1 log compared to the control. For example, the anti-respiratory virus antigen antibody titer produced in the subject can be increased by at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 logs compared to the control.

[0319] In some embodiments, the anti-respiratory virus antigen antibody titer produced in the subject is increased by at least 2-fold compared to the control. For example, the anti-respiratory virus antigen antibody titer produced in the subject is increased by at least 3, 4, 5, 6, 7, 8, 9, or 10-fold compared to the control.

[0320] In some embodiments, the geometric mean, which is the n-th root of the product of n numbers, is commonly used to describe proportional growth. In some embodiments, the geometric mean is used to characterize the antibody titers produced in a subject.

[0321] Controls can be, for example, unvaccinated subjects, or subjects administered a live attenuated viral vaccine, an inactivated viral vaccine, or a protein subunit vaccine.

[0322] Hemagglutination inhibition assay The hemagglutination inhibition (HAI) test is a classical laboratory procedure for the classification or subtyping of hemagglutinating viruses and for further determining the antigenic characteristics of influenza virus isolates, provided that the reference antisera used contain antibodies against currently circulating viruses (see, for example, Pedersen JC Methods Mol Biol. 2014;1161:11-25). The antisera used are based on antigen preparations derived from either wild-type strains or high-growth reassortants made using wild-type or antigenically equivalent strains.

[0323] To perform the assay, serial dilutions of virus are prepared across the rows of a 96-well microtiter plate in a U- or V-bottom configuration. As an example, the most concentrated sample in the first well can be diluted 1 / 5 of the stock, and subsequent wells can be 2-fold dilutions (1 / 10, 1 / 20, 1 / 40, etc.). The last well serves as a negative control without virus. Each row of the plate typically has a different virus and the same pattern of dilution. After the serial dilutions, a standardized concentration of red blood cells (RBCs) is added to each well and mixed gently. The plate is incubated at room temperature. After the incubation period, the assay can be analyzed to distinguish between agglutinated and non-agglutinated wells. The relative concentration or titer of the virus sample is based on the well with the most recent agglutinated appearance, just before a pellet is observed.

[0324] Serological methods such as HAI testing are essential for many epidemiological and immunological studies, as well as for the evaluation of antibody responses after vaccination. Serological methods are also very useful in situations where virus identification is not feasible (e.g., after viral shedding has ceased). HAI testing is used to identify circulating influenza viruses that are antigenically similar to influenza viruses from the previous season's vaccine. As used herein, "antigenically similar" refers to viruses that have HAI titers that differ by no more than two dilutions.

[0325] In some embodiments, an HAI assay is used to measure the efficacy of a candidate vaccine, such as those provided herein. In some embodiments, the mRNA vaccine has a 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold increased HAI titer compared to a control (e.g., HAI titer from a subject administered a conventional seasonal influenza vaccine, such as FLUBLOK®).

[0326] In some embodiments, an HA ELISA assay is performed to examine HA antibody titers (e.g., IgG antibody titers) resulting from administration of the candidate vaccine (see, e.g., Examples 1, 2, 4, 7, and 8). In some embodiments, the mRNA vaccine has a 1 log, 2 log, 3 log, 4 log, 5 log, 6 log, 7 log, 8 log, 9 log, or 10 log increase in HA IgG antibody titers compared to a control (e.g., PBS). In some embodiments, the control comprises the HA-reactive IgG antibody titer in the subject prior to administration of the composition (e.g., vaccine). In some embodiments, the candidate vaccine has a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold increase in HA IgG antibody titers compared to the control.

[0327] Neuraminidase inhibition assay The neuraminidase inhibition (NAI) assay is a laboratory procedure for identifying neuraminidase (NA) glycoprotein subtypes in influenza viruses or the NA subtype specificity of antibodies against influenza viruses (see, e.g., Pedersen JC Methods Mol Biol. 2014;1161:27-36). Serological procedures for subtyping NA glycoproteins are important for the identification and classification of avian influenza (AI) viruses.

[0328] There are two basic forms of influenza virus NA assays based on the use of different substrate molecules: long-standing assays based on the use of large substrates such as fetuin (e.g., enzyme-linked lectin assays (ELLA)), and newer assays that utilize small substrate molecules. Fetuin-based methods are used to determine viral NA potency and therefore a standardized NA dose for use in NA inhibition (NAI) assays. Once determined, the standardized dose is added to serial dilutions of test antisera, negative control serum, and reference anti-NA serum. Any inhibitory effect of serum on NA activity can then be determined and NAI titers calculated. Small substrate-based methods can be fluorescent assays using the substrate 2-(4-methylumbelliferyl)-α-DN-acetylneuraminic acid (MUNANA). The substrate is added to serially diluted test antisera, and cleavage of the MUNANA substrate by NA releases the fluorescent product methylumbelliferone. The inhibitory effect of serum on influenza virus NA is measured using the IC 50 The IC50 value is determined based on the concentration of serum required to reduce 50% of NA activity. Alternatively, the small substrate-based method may be a chemiluminescence-based (CL) assay using a sialic acid 1,2-dioxetane derivative (NA-Star) substrate or a modified NA-XTD substrate. The CL assay provides a long-lasting chemiluminescence light signal, and neuraminidase inhibitor IC50 values ​​are achieved over a range of virus dilutions.

[0329] In some embodiments, the mRNA vaccine has an NAI titer that is increased by 2, 3, 4, 5, 6, 7, 8, 9, or 10 times compared to a control. In some embodiments, the control is a conventional seasonal influenza vaccine that contains only an HA antigen (e.g., no NA antigen). In some embodiments, the control is the NAI titer value of wild-type NA. In some embodiments, the mRNA vaccine has an NAI titer that is at least 2 times higher than the control value. In some embodiments, the NAI value of the vaccine is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or at least 99% of the control (e.g., the NAI value of wild-type NA).

[0330] In some embodiments, an NA ELISA assay is performed to examine the NA antibody titers (e.g., IgG antibody titers) resulting from administration of the candidate vaccine (see, e.g., Examples 1, 2, 4, 7, and 8). In some embodiments, the mRNA vaccine has a 1 log, 2 log, 3 log, 4 log, 5 log, 6 log, 7 log, 8 log, 9 log, or 10 log increase in NA IgG antibody titers compared to a control (e.g., PBS). In some embodiments, the control comprises the NA-reactive IgG antibody titers in the subject prior to administration of the composition (e.g., vaccine). In some embodiments, the candidate vaccine has a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold increase in NA IgG antibody titers compared to the control. EXAMPLES

[0331] Example 1. Immunogenicity of combination vaccines (influenza, SARS-CoV-2) In this example, different combinations of vaccines containing mRNA encoding influenza and SARS-CoV-2 antigens were tested at high doses (HD) and low doses (LD). In this study, the antigens were formulated separately in different LNPs and mixed before administration. The experiments were performed as shown in Table 1 below. The vaccines included mRNA-1273 (mRNA encoding a spike protein with two proline substitutions; SEQ ID NO: 15), mRNA-1010 (four hemagglutinin (HA) antigens combined in a 1:1:1:1 ratio (e.g., by mass) to assess interference between HAs; SEQ ID NOs: 19, 20, 21, and 22), and mRNA-1020 (four HAs combined with four neuraminidase (NA) antigens in an eight antigen mixture (i.e., 1:1:1:1:1:1:1:1:1) to assess any interference between HAs in the presence of NAs; SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, and 26, respectively). All vaccines were tested individually (groups 2-7) and in combination with SARS-CoV-2 and influenza vaccine mixtures (groups 8-11).

[0332] Mice were administered a dose intramuscularly on day 0 and serum samples were collected on day 21. IgG antibody titers were measured by ELISA against individual HA antigens, NA antigens, and SARS-CoV-2 Sp2 recombinant protein. As shown in Figures 1-3, the presence of other antigens in the combination vaccine did not reduce the neutralization titers against each of the individual antigens in the vaccine (e.g., similar neutralization titers were observed between the combination vaccine and the individual antigen vaccine). Figures 4-5 show the results using normalized geometric mean titers of IgG antibodies, demonstrating that SARS-CoV-2 / Influenza (4xHA) at a high dose (group 8) induced robust antibody responses against all components in the vaccine compared to individual antigen administration (at the high dose level). [Table 1]

[0333] Example 2. Immunogenicity of combination vaccines (influenza, SARS-CoV-2) at different ratios Different combinations of vaccines containing mRNAs encoding influenza and SARS-CoV-2 antigens were tested in a ratio of 1:1 and 2:1, respectively. The experiments were performed as shown in Table 2 below. The SARS-CoV-2 vaccines included mRNA-1273 (an mRNA encoding a spike protein with two proline substitutions; SEQ ID NO: 15), mRNA-1283 (an mRNA encoding the SARS-CoV-2 spike protein N-terminal domain, the receptor binding domain, and the influenza hemagglutinin transmembrane domain connected by a linker; SEQ ID NO: 17), or a mixture of mRNA-1273 or mRNA-1283 in a ratio of 1:1 with mRNAs encoding the spike protein of the SARS-CoV-2 B.1.351 (RSA) variant (mRNA-1273.351 and mRNA-1283.351; SEQ ID NOs: 16 and 18, respectively). The influenza vaccine contained mRNA-1010 (mRNA encoding four HA antigens in a 1:1:1:1 ratio; SEQ ID NOs: 19, 20, 21, and 22). All vaccines were tested individually (groups 2-7) and in combination as mixtures of influenza vaccine and SARS-CoV-2 vaccine in ratios of 1:1 (groups 9, 11, 13, and 15) and 2:1 (groups 8, 10, 12, and 14).

[0334] On day 0, BALB / c mice were administered a dose and serum samples were collected on days 21 and 36. IgG antibody titers were measured by ELISA against individual HA antigens and SARS-CoV-2 SP2 recombinant protein. Results from day 21, shown in Figures 6-11, demonstrate that the presence of other antigens in the combination vaccine did not reduce neutralization titers against each of the individual antigens in the vaccine (e.g., similar neutralization titers were observed between the combination vaccine and the individual antigen vaccine). In addition, similar neutralization titers against each of the individual antigens in the vaccine were observed between the 1:1 (groups 9, 11, 13, and 15) and 2:1 (groups 8, 10, 12, and 14) ratios of influenza:SARS-CoV-2 combination vaccines. [Table 2]

[0335] Example 3. Immunogenicity of neuraminidase antigenic variants and HA / NA antigen ratios in mRNA vaccines against influenza In this example, the immunogenicity of combinations of neuraminidase (NA) antigen mutations E227D and D151G with various mass ratios of hemagglutinin (HA) to NA antigens is measured as antibody titers in BALB / c mice. The immunogenicity of the different vaccines is evaluated for antibody titers and dose response compared to 1:1 to 3:1 ratios of HA / NA antigens administered in the mRNA vaccine, as well as individual antigens, as outlined in Table 3. The vaccines consist of eight different Flu glycoprotein antigens (groups 2-9 or SEQ ID NOs: 62, 63, 27, 28, 64, 65, 66, 67, respectively) containing either the E227D or D151G neuraminidase antigenic mutations tested individually, the 2021 / 22 Northern Hepatitis B virus (CHV) containing either the D151G (SEQ ID NOs: 27, 62, 64, 66) or E227D (SEQ ID NOs: 28, 63, 65, 67) neuraminidase antigenic mutations (groups 10 and 11, respectively). It includes mRNA-1020 (four HA antigens (SEQ ID NOs: 19, 20, 21, 22) and four NA antigens in a ratio of 1:1:1:1:1:1:1:1:1) in combination with a Hemisphere composition, or mRNA-1030 (four HA antigens (SEQ ID NOs: 19, 20, 21, 22) and four NA antigens in a ratio of 3:3:3:3:1:1:1:1) in combination with a 2021 / 22 Northern Hemisphere composition containing either the D151G (SEQ ID NOs: 27, 62, 64, 66) or E227D (SEQ ID NOs: 28, 63, 65, 67) neuraminidase antigen mutations (groups 12 and 13, respectively).

[0336] The mRNA vaccine or PBS (as a control) is administered to BALB / c mice and blood samples are taken from the mice on day 21. An ELISA assay is used to determine IgG antibody titers against each of the different influenza glycoprotein antigens. [Table 3]

[0337] Example 4. Immunogenicity of HA / NA antigen ratios in mRNA vaccines against influenza viruses circulating in the Northern and Southern Hemisphere In this example, the immunogenicity of various mass ratios of HA to NA antigens is measured as antibody titers in BALB / c mice. The immunogenicity of multiple influenza virus HA and NA antigens as mRNA vaccines is evaluated for antibody titers and dose response compared to 1:1 to 3:1 ratios of HA / NA antigens administered in the mRNA vaccine, as well as individual antigens.

[0338] Antigens tested included a mixture of four HA antigens from Northern or Southern Hemisphere strains in a ratio of 1:1:1:1 (groups 2 and 3), or four HA antigens combined with four NAs from Southern Hemisphere strains in a mixture of eight antigens in a ratio of 1:1:1:1:1:1:1:1 (group 5), or a mixture of four HA antigens combined with four NAs from Northern or Southern Hemisphere strains in a mixture of eight antigens in a ratio of 3:3:3:3:1:1:1:1 (groups 6 and 7), or a mixture of five HA antigens in a ratio of 1:1:1:1:1 (group 8).

[0339] BALB / c mice are administered the mRNA vaccine or PBS (as a control) on days 1 and 22 as outlined in Table 4. Blood samples are taken from the mice on days 21 and 36 and analyzed by ELISA to determine IgG antibody titers against each of the different influenza glycoprotein antigens. [Table 4]

[0340] Example 5. Phase I / II Clinical Trial This is a Phase 1 / 2 randomized, stratified, observer-blinded study to evaluate the reactogenicity and immunogenicity of simultaneous administration of mRNA encoding four different HA antigens (mRNA-1010) and mRNA encoding the SARS-CoV-2 spike protein with a stabilizing double proline mutation (mRNA-1273; SEQ ID NO: 33), as well as a combination vaccine (mRNA-1073) containing mRNA encoding four different HA antigens and mRNA encoding the SARS-CoV-2 spike protein with a stabilizing double proline mutation (SEQ ID NO: 33) compared to the individual vaccines alone in healthy adults 18-75 years of age.

[0341] On day 1, each participant will receive two injections, one administered intramuscularly in the deltoid muscle of each arm. The vaccines to be tested include: 1) mRNA-1273, mRNA encoding the full-length S protein of SARS-CoV-2 modified to introduce the S 2P in the pre-fusion conformation (SEQ ID NO: 33) (50 μg); 2) mRNA-1010, mRNA encoding the HA surface glycoprotein of four strains according to the WHO of 2022 NH influenza seasonal cell or recombinant-based vaccines (50 μg); and 3) mRNA-1073, mRNA encoding each of the antigens in (1) and (2). This product (mRNA-1073) will also be used to prepare low doses of vaccine in groups 5 and 6. The diluent for the placebo and vaccine will be 0.9% sodium chloride (regular commercial saline) injection that meets the standards of the United States Pharmacopeia (USP).

[0342] The study will enroll approximately 1,050 generally healthy adults aged 18-75 years who have been previously fully vaccinated with a COVID-19 primary series with a locally approved and certified SARS-CoV-2 vaccine, with the most recent COVID-19 vaccination (primary series or booster) required to be ≥120 days (or <120 days per local guidance) prior to the randomization visit. Participants must not have received an approved influenza vaccine within 180 days of randomization and must have no history of confirmed influenza infection within 180 days of screening or SARS-CoV-2 infection within 90 days of screening. The numbers of participants and groups are shown in the table below.

[0343] In phase 1, randomization will be stratified by age (balanced across the two age groups within each vaccination arm, 18-49 years and 50-75 years), while in phase 2, randomization will be stratified across both age groups (balanced across the two age groups within each vaccination arm, 18-49 years and 50-75 years) and receipt of a COVID-19 booster dose (yes or no).

[0344] Vaccines (mRNA-1073, mRNA-1010, or mRNA-1273) and placebo will be administered as a single intramuscular (IM) injection into the deltoid muscle of each arm. Safety and / or immunogenicity and / or biomarker study visits will occur on days 4, 8, 29, and 181 (end of study). [Table 5]

[0345] research materials mRNA-1073 is intended to be administered as a single dose and to induce protection against influenza and SARS-CoV-2. mRNA-1073 contains mRNA encoding the four HA antigens of influenza virus strains recommended by WHO for NH seasonal vaccines in 2022, and mRNA for the S protein of SARS-CoV-2 virus, formulated in a mixture of four lipids common to the sponsor's mRNA vaccine platform: compound 1, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and 1-monomethoxypolyethyleneglycol-2,3-dimyristylglycerol with polyethylene glycol of average molecular weight 2000 (PEG-2000-DMG). mRNA-1073 is intended as a single annual dose for protection against seasonal influenza and SARS-CoV-2, based on antigens encoded by mRNA-1010 and mRNA-1273. Commercially available 0.9% sodium chloride, USP, is used appropriately for dose preparation.

[0346] mRNA-1010 is administered as a single dose and is intended to induce protection against influenza A and B viruses. It is a quadrivalent vaccine containing mRNA encoding the HA of the four strains recommended by the WHO for NH cell- or recombinant-based vaccines in 2022, formulated in a mixture of four lipids common to the sponsor's mRNA vaccine platform: Compound 1, cholesterol, DSPC, and PEG-2000-DMG. As the HA component, it uses equal amounts of mRNA encoding each of the four different strains. mRNA-1010 is administered as a single dose and is intended to induce protection against all seasonal influenza viruses covered by the vaccine.

[0347] mRNA-1273 is administered as a single dose and is intended to induce protection against SARS-CoV-2. mRNA-1273 contains the mRNA CX-024414 encoding the S-2P of Wuhan-Hu-1. mRNA-1273 consists of mRNA formulated in a mixture of four lipids common to the sponsor's mRNA vaccine platform: Compound 1, cholesterol, DSPC, and PEG-200-DMG.

[0348] Primary objective The primary objective is to evaluate the safety and reactogenicity of the investigational vaccine. This is determined by measuring the frequency and severity of each required local and systemic reactogenic adverse reaction during the 7-day follow-up period after vaccination, the frequency and severity of any unsolicited AEs during the 28-day follow-up period after vaccination, and the frequency of any SAEs, AESIs, MAAEs, and AEs leading to discontinuation on Day 1 to Day 181 / EoS.

[0349] Second objective As a second objective, the evaluation of humoral immunogenicity against influenza and vaccine-matched strains of SARS CoV 2 across the investigational vaccine groups on Day 29 is included. This is achieved by measuring the GMT and GMFR on Day 29 compared to Day 1 (baseline) by the HAI assay for influenza and the pseudovirus neutralization assay (PsVNA) (or binding antibody assay) for SARS-CoV-2. For influenza, the percentage of participants with seroconversion (defined as a titer of ≥1:40 on Day 29 if the baseline is <1:10, or a four-fold or greater increase if the baseline is ≥1:10 with anti-HA antibodies) is measured by the HAI assay. For SARS-CoV-2, the percentage of participants with a serological response (defined as a titer of ≥4-fold on Day 29 if the baseline is ≥LLOQ, or ≥4×LLOQ if the baseline titer is <LLOQ with the nAb titer) is measured by the PsVNA (or binding antibody assay).

[0350] Additional secondary objectives are to assess humoral immunogenicity against vaccine-matched strains of influenza and SARS-CoV-2 at all evaluable humoral immunogenicity time points, as measured by HAI for influenza and PsVNA (or binding antibody assays) for SARS-CoV-2, as well as the percentage of participants with seroconversion (influenza) and seroresponse (SARS-CoV-2) as defined above, and by GMT and GMFR, compared to day 1 (baseline).

[0351] Purpose of exploration Exploratory objectives include: assess humoral immunogenicity against vaccine-incompatible strains (GMT and GMFR (compared to day 1) against vaccine-incompatible strains); assess humoral immunogenicity against vaccine-matched and incompatible strains using alternative methods (GMT and GMFR (compared to day 1) against vaccine-matched and incompatible strains assayed by alternative methods (e.g., microneutralization assay for influenza or ligand binding assay for SARS CoV2); assess cellular immunogenicity in a subset of participants (frequency, magnitude, and phenotype of virus-specific T cell and B cell responses measured by flow cytometry or other methods, and performing targeted repertoire analysis of B cells and T cells post-vaccination), further characterize immune responses across study vaccines (frequency, specificity, or other endpoints determined for further characterization of immune responses), and evaluate the occurrence of clinical influenza and COVID-19 in study participants and characterize their immune responses to infections and viral isolates (assess frequency of laboratory-confirmed clinical influenza and COVID-19, and immune responses to infections and viral isolates).

[0352] Immunogenicity assessment Blood samples for immunogenicity assessment will be collected according to the item schedule for the following analytes: serum antibody levels measured by hemagglutination inhibition assay HAI assay (influenza), serum neutralizing antibody levels measured by microneutralization assay (influenza), serum neutralizing antibody titers measured by pseudoviral neutralization assay, and / or serum binding antibody titers (SARS-CoV-2) using ELISA or multiplex assays, and cellular immunogenicity (in a subset of participants) will be measured.

[0353] Evaluation of respiratory viral infections During the study, participants may experience symptoms consistent with influenza or SARS-CoV-2 infection. All participants will provide a nasopharyngeal (NP) swab specimen prior to injection on Day 1 for evaluation of infection with respiratory pathogens, including influenza virus and SARS-CoV2, as influenza or COVID-19 symptoms may confound reactogenicity assessment. In addition, clinical information will be carefully collected to assess the severity of clinical cases.

[0354] Efficacy assessment: The study will not be powered for efficacy evaluation, but symptoms of infection with respiratory pathogens will be tracked as an exploratory objective in this study.

[0355] Sample size: The sample size of this study is not determined by statistical assumptions of formal hypothesis testing. The proposed number of participants is deemed sufficient to provide a descriptive summary of the safety and immunogenicity of the different study arms.

[0356] The study will enroll approximately 1,050 generally healthy adults aged 18-75 years who have previously been fully vaccinated with a COVID-19 primary series with a locally approved and certified SARS-CoV-2 vaccine, with their most recent COVID-19 vaccination required to be ≥120 days prior to the randomization visit (or <120 days per local guidance). Participants must not have received an approved influenza vaccine within 180 days of randomization and must have no history of influenza infection within 180 days of screening or confirmed SARS-CoV-2 infection within 90 days of screening.

[0357] Approximately 550 participants will be enrolled in Phase 1 in a 1:2:2:2:2:2 ratio. In Phase 2, another 500 participants will be enrolled in a 1:1 ratio in arms 1 and 2.

[0358] Immunogenicity analysis Analysis of immunogenicity is based on the per protocol (PP) set. If the number of participants in the full analysis set (FAS) and the PP set differ by more than 10% (defined as the difference divided by the total number of participants in the PP set), a supportive analysis of immunogenicity may be performed using the FAS.

[0359] For immunogenicity endpoints, the geometric mean of specific antibody titers with corresponding 95% confidence intervals (CI) at each time point and the geometric mean fold rise (GMFR) of specific antibody titers with corresponding 95% CI at each post-baseline time point above pre-injection baseline on day 1 are provided by treatment group, adjusted for baseline antibody titers and other potential covariates including age group and primary vaccine type. Descriptive summary statistics including median, minimum, and maximum are also provided.

[0360] In summarizing geometric mean titers, antibody titers reported below the lower limit of quantitation (LLOQ) are replaced by 0.5 x the LLOQ. Values ​​above the upper limit of quantitation (ULOQ) are converted to the ULOQ.

[0361] The seroconversion rate from baseline of mRNA-1010 is provided with a two-sided 95% CI using the Clopper-Pearson method at each time point after baseline. The seroconversion rate is defined as the proportion of participants having either a pre-vaccination HAI titer < 1:10 and a post-vaccination HAI titer ≥ 1:40, or a pre-vaccination HAI titer ≥ 1:10 and a minimum 4-fold increase in the post-vaccination HAI antibody titer.

[0362] The serum response of mRNA-1273 is defined as either participants with a geometric mean fold rise (GMFR) of neutralizing antibody (nAb) titer and binding antibody (bAb) titer on day 29 that is ≥ 4-fold compared to day 1 in those with a baseline titer ≥ LLOQ, or participants with a titer ≥ 4 × LLOQ on day 29 if the baseline titer is < LLOQ.

[0363] The immunogenicity of mRNA-1073 follows the same rules as mRNA-1010 and mRNA-1273.

[0364] Interim analysis In the study, two interim analyses (IAs) and a final analysis are conducted.

[0365] The IA (IA1) will be performed on data from Phase 1 participants (550 participants) after completing the Day 29 visit and will include safety and immunogenicity data collected up to Day 29. Either nAb or bAb assays will be used for the assessment of immunogenicity in all participants. Dose selection of mRNA-1073 can be supported by overall safety and immunogenicity data from the mRNA-1073 group in IA1. The second IA (IA2) will be performed on data from Phase 2 participants (500 participants) after completing the Day 29 visit and will include safety and potential immunogenicity data collected up to Day 29. The IA will be performed by a separate team of unblinded programmers and statisticians. Analyses will be presented by vaccination group. A final analysis of all endpoints will be performed after Phases 1 and 2, with all participants completing Day 181 / EoS. The final report will include a complete analysis of all safety and immunogenicity data up to Day 181 / EoS. For immunogenicity analysis, either nAb or bAb assays will be used for all participants in the Phase 1 study, and potentially all participants in the Phase 2 study.

[0366] [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8]

Table 6-9

Table 6-10

Table 6-11

Table 6-12

Table 6-13

Table 6-14

Table 6-15

Table 6-16

Table 6-17

Table 6-18

Table 6-19

Table 6-20

Table 6-21

Table 6-22

Table 6-23

Table 6-24

Table 6-25

Table 6-26

Table 6-27

Table 6-28

Table 6-29

Table 6-30

Table 6-31

Table 6-32

Table 6-33

Table 6-34

Table 6-35

Table 6-36

Table 6-37

Table 6-38

Table 6-39

Table 6-40

Table 6-41

Table 6-42

[0367] Any of the mRNA sequences described herein may include a 5'UTR and / or a 3'UTR. The UTR sequence may be selected from the following sequences or other known UTR sequences may be used. It should also be understood that any of the mRNAs described herein may further include a poly(A) tail and / or a cap (e.g., 7mG(5')ppp(5')NlmpNp). Additionally, while many of the mRNAs and encoded antigen sequences described herein include a signal peptide and / or peptide tag (e.g., a C-terminal His tag), it should be understood that the indicated signal peptide and / or peptide tag may be replaced with a different signal peptide and / or peptide tag or the signal peptide and / or peptide tag may be omitted. 5'UTR: GGGAAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC (SEQ ID NO: 29) 5'UTR: GGGAAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 30) 3'UTR:UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 31) 3'UTR:UGAUAAUAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 32)

[0368] Embodiment 1. A combination vaccine comprising: a first messenger ribonucleic acid (mRNA) polynucleotide having an open reading frame (ORF) encoding a first respiratory virus antigenic polypeptide from an influenza virus; and a second mRNA polynucleotide having an ORF encoding a second respiratory virus antigenic polypeptide from a coronavirus.

[0369] 2. The vaccine of embodiment 1, wherein said vaccine comprises at least two mRNA polynucleotides having an ORF encoding a first respiratory virus antigenic polypeptide from an influenza virus.

[0370] 3. The vaccine of embodiment 1, wherein the vaccine comprises at least two mRNA polynucleotides having an ORF encoding a second respiratory virus antigenic polypeptide from a coronavirus.

[0371] 4. The vaccine of any one of embodiments 1 to 8, wherein the vaccine comprises less than 15 mRNA polynucleotides.

[0372] 5. The vaccine of embodiment 4, wherein the vaccine comprises 3 to 10 mRNA polynucleotides.

[0373] 6. The vaccine of embodiment 4, wherein the vaccine comprises 4 to 10 mRNA polynucleotides.

[0374] 7. The vaccine of embodiment 4, wherein the vaccine comprises 5 to 10 mRNA polynucleotides.

[0375] 8. The vaccine of embodiment 4, wherein the vaccine comprises 8 to 9 mRNA polynucleotides.

[0376] 9. The vaccine of any one of embodiments 1 to 8, wherein the first and second mRNA polynucleotides are present in the combination vaccine in a 1:1 ratio.

[0377] 10. The vaccine of any one of embodiments 1-9, wherein said vaccine comprises at least two mRNA polynucleotides encoding influenza virus antigenic polypeptides.

[0378] 11. The vaccine of any one of embodiments 1-10, wherein the vaccine comprises at least three mRNA polynucleotides encoding influenza virus antigenic polypeptides.

[0379] 12. The vaccine of any one of the preceding embodiments, wherein said vaccine comprises at least four mRNA polynucleotides encoding influenza virus antigenic polypeptides.

[0380] 13. The vaccine of any one of embodiments 1 to 12, wherein the vaccine comprises at least two mRNA polynucleotides encoding coronavirus antigenic polypeptides.

[0381] 14. The vaccine of any one of embodiments 1-13, wherein the combination vaccine comprises a 4:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from a first virus family to a second virus family.

[0382] 15. The vaccine of any one of embodiments 1-13, wherein the combination vaccine comprises a 3:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from the first virus family to the second virus family.

[0383] 16. The vaccine of any one of embodiments 1-13, wherein the combination vaccine comprises a 5:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from the first virus family to the second virus family.

[0384] 17. The vaccine of any one of embodiments 1-13, wherein the combination vaccine comprises a 2:1 ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from the first virus family to the second virus family.

[0385] 18. The vaccine of any one of embodiments 1-13, wherein the combination vaccine comprises a ratio of mRNA polynucleotides encoding respiratory virus antigenic polypeptides from the first virus family to the second virus family of 4:2.

[0386] 19. The vaccine of any one of embodiments 1-13, wherein the combination vaccine comprises a 1:2 ratio of mRNA polynucleotides encoding respiratory viral antigenic polypeptides from the first virus family to the second virus family to the third virus family.

[0387] 20. The combination vaccine comprises: (a) combining in a single reaction vessel a linearized first DNA molecule encoding said first mRNA polynucleotide and a linearized second DNA molecule encoding said second mRNA polynucleotide, said first DNA molecule and said second DNA molecule being obtained from different sources; (b) simultaneously transcribing the linearized first DNA molecule and the linearized second DNA molecule in vitro to obtain a multivalent RNA composition.

[0388] 21. The vaccine of embodiment 20, wherein the different sources are a first and a second bacterial cell culture, and wherein the first and second bacterial cell cultures are not co-cultured.

[0389] 22. The vaccine of embodiment 20, wherein the amounts of the first and second DNA molecules present in the reaction mixture are normalized before the start of IVT.

[0390] 23. The vaccine of any one of embodiments 1 to 22, wherein the combination vaccine is a multivalent RNA composition, and the multivalent RNA composition comprises more than 40% poly-A tail RNA.

[0391] 24. The vaccine of any one of embodiments 1-23, wherein the combination vaccine is a multivalent RNA composition and each of the first and second mRNA polynucleotides differs in length from each other by at least 100 nucleotides.

[0392] 25. The vaccine of any one of embodiments 1-24, wherein the combination vaccine is a multivalent RNA composition, and each of the first and second (and optionally the third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, or fifteenth) mRNA polynucleotides comprises one or more non-coding sequences in the untranslated region (UTR), optionally in the 5'UTR or 3'UTR.

[0393] 26. The vaccine of embodiment 25, wherein the non-coding sequence is located in the 3'UTR of the mRNA, upstream of the polyA tail of the mRNA.

[0394] 27. The vaccine of embodiment 25, wherein the non-coding sequence is located in the 3'UTR of the mRNA, downstream of the polyA tail of the mRNA.

[0395] 28. The vaccine of embodiment 25, wherein the non-coding sequence is located in the 3'UTR of the mRNA, between the last codon of the ORF of the mRNA and the first "A" of the poly-A tail of the mRNA.

[0396] 29. The vaccine of embodiment 25, wherein the non-coding sequence comprises 1 to 10 nucleotides.

[0397] 30. The vaccine of any one of embodiments 25 to 29, wherein the non-coding sequence comprises one or more RNAse cleavage sites.

[0398] 31. The vaccine of embodiment 30, wherein the RNAse cleavage site is an RNase H cleavage site.

[0399] 32. The vaccine of any one of embodiments 1 to 31, wherein each of the mRNA polynucleotides in the combination vaccine are complementary to and do not interfere with each other with the mRNA polynucleotides in the combination vaccine.

[0400] 33. The vaccine of any one of embodiments 1-32, wherein at least one of the respiratory virus antigenic polypeptides is derived from a naturally occurring antigen.

[0401] 34. The vaccine of any one of embodiments 1-32, wherein at least one of the respiratory virus antigenic polypeptides is a stabilized version of a naturally occurring antigen.

[0402] 35. The vaccine of any one of embodiments 1-32, wherein at least one of the respiratory virus antigenic polypeptides is a non-naturally occurring antigen.

[0403] 36. The vaccine of any one of embodiments 1-33, wherein the vaccine further comprises an mRNA polynucleotide encoding a variant of a respiratory virus antigenic polypeptide, the variant being a variant of any one of the first or second respiratory virus antigenic polypeptides.

[0404] 37. The vaccine of any one of embodiments 1 to 36, wherein the second respiratory virus antigenic polypeptide is selected from the group consisting of MERS-CoV, SARS-CoV, SARS-CoV-2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH, and HCoV-HKU1.

[0405] 38. The vaccine of any one of embodiments 1-37, wherein the first respiratory viral antigenic polypeptide is influenza HA and / or influenza NA.

[0406] 39. The vaccine of any one of embodiments 1-38, wherein the antigenic polypeptide comprises a fusion (F) protein, a spike (S) protein, and a hemagglutinin antigen (HA).

[0407] 40. The vaccine of any one of embodiments 1 to 39, further comprising at least one lipid nanoparticle (LNP).

[0408] 41. The vaccine of embodiment 40, wherein the LNP comprises a molar ratio of 20-60% ionizable amino lipid, 5-25% non-cationic lipid, 25-55% sterol, and 0.5-15% PEG-modified lipid.

[0409] 42. A method for vaccinating a subject, comprising: The method includes administering to the subject a combination vaccine, the combination vaccine comprising a first messenger ribonucleic acid (mRNA) polynucleotide having an open reading frame (ORF) encoding a first respiratory virus antigenic polypeptide from an influenza virus, and a second mRNA polynucleotide having an ORF encoding a second respiratory virus antigenic polypeptide from a coronavirus.

[0410] 43. The method of embodiment 42, wherein the subject is 65 years of age or older.

[0411] 44. The method of embodiment 42, wherein the subject is under 18 years of age.

[0412] 45. The method of embodiment 42, wherein the method prevents a respiratory infection in the subject.

[0413] 46. ​​The method of embodiment 42, wherein the method reduces the severity of a respiratory infection in the subject.

[0414] 47. The method of embodiment 42, wherein the subject is seronegative for at least one of the antigenic polypeptides.

[0415] 48. The method of embodiment 42, wherein the subject is seronegative for all of the antigenic polypeptides.

[0416] 49. The method of embodiment 42, wherein the subject is seropositive for at least one of the antigenic polypeptides.

[0417] 50. The method of embodiment 42, wherein the subject is seropositive for all of the antigenic polypeptides.

[0418] 51. The method of any one of embodiments 42-50, further comprising administering a booster vaccine.

[0419] 52. The method of embodiment 51, wherein the booster vaccine is administered between 3 weeks and 1 year after the combination vaccine.

[0420] 53. The method of embodiment 51 or 52, wherein the booster vaccine comprises at least one mRNA polynucleotide having an ORF encoding the first or second respiratory virus antigenic polypeptide.

[0421] 54. The method of embodiment 51 or 52, wherein the booster vaccine comprises at least one mRNA polynucleotide having an ORF encoding each of the first and second respiratory virus antigenic polypeptides.

[0422] 55. The method of embodiment 51 or 52, wherein the booster vaccine comprises at least one mRNA polynucleotide having an ORF encoding a variant of the first or second respiratory virus antigenic polypeptide.

[0423] 56. The method of any one of embodiments 42-55, wherein the combination vaccine is a seasonal booster vaccine.

[0424] 57. The method according to any one of embodiments 42-56, wherein the combination vaccine is a vaccine according to any one of embodiments 1-41.

[0425] 58. A method for preventing or reducing the severity of a respiratory infection by administering to a subject a vaccine according to any one of embodiments 1 to 41, wherein the vaccine is administered in an amount effective to prevent infection or reduce the severity of a respiratory infection in the subject, based on a single dose or a single dose with a booster.

[0426] 59. The method of any one of embodiments 42-58, wherein the combination vaccine is administered to the subject in a dose of 20 μg or 50 μg.

[0427] Equivalent All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is indicated, which in some cases may include the entire document.

[0428] As used herein, in the specification, as well as in the embodiments and / or claims, the indefinite articles "a" and "an" should be understood to mean "at least one," unless clearly indicated to the contrary.

[0429] It is also to be understood that, unless expressly indicated to the contrary, in any method that includes two or more steps or acts claimed in this specification, the order of the method steps or acts is not necessarily limited to the order in which the method steps or acts are described.

[0430] In the claims, as well as in the above specification, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like, are to be understood to mean open-ended, i.e., including but not limited to. Only the transitional phrases "consisting of" and "consisting essentially of" shall be closed or semi-closed transitional phrases, respectively, as set forth in the U.S. Patent and Trademark Office Guidelines at Section 2111.03.

[0431] The terms "about" and "substantially" in front of a numerical value mean ±10% of the stated numerical value.

[0432] When a range of values ​​is given, each value between and including the upper and lower limits of the range is specifically contemplated and described herein.

Claims

1. A vaccine comprising: a first effective amount of a first messenger ribonucleic acid (mRNA) comprising an open reading frame (ORF) encoding a first respiratory virus antigenic polypeptide, said first respiratory virus antigenic polypeptide being an influenza hemagglutinin antigen (HA) protein, said first mRNA formulated in a first lipid nanoparticle (LNP); a second effective amount of a second mRNA comprising an ORF encoding a second respiratory virus antigenic polypeptide, said second respiratory virus antigenic polypeptide being a fusion protein comprising an N-terminal domain (NTD) of SARS-CoV-2 spike (S) protein linked to a receptor binding domain (RBD) of the SARS-CoV-2 spike (S) protein by a first linker, said second mRNA being formulated in said first LNP; wherein each of the first and second ORFs comprises nucleosides consisting of 1-methyl-pseudouridine (m1ψ), adenosine, guanosine, and cytidine.

2. A vaccine comprising: a first effective amount of a first messenger ribonucleic acid (mRNA) comprising an open reading frame (ORF) encoding a first respiratory virus antigenic polypeptide, said first respiratory virus antigenic polypeptide being an influenza hemagglutinin antigen (HA) protein, said first mRNA formulated in a first lipid nanoparticle (LNP); a second effective amount of a second mRNA comprising an ORF encoding a second respiratory virus antigenic polypeptide, wherein the second respiratory virus antigenic polypeptide is a fusion protein comprising an N-terminal domain (NTD) of SARS-CoV-2 spike (S) protein linked to a receptor binding domain (RBD) of the SARS-CoV-2 spike (S) protein by a first linker, wherein the second mRNA is formulated into a second LNP; wherein each of the first and second ORFs comprises nucleosides consisting of 1-methyl-pseudouridine (m1ψ), adenosine, guanosine, and cytidine.

3. 3. The vaccine of claim 1 or 2, wherein in the fusion protein of the second respiratory virus antigenic polypeptide, the RBD is linked to the transmembrane domain (TD) with a second linker.

4. 4. The vaccine of claim 1, comprising mRNA encoding three influenza virus HA antigens.

5. 5. The vaccine of claim 4, further comprising mRNA encoding three influenza virus NA antigens.

6. (a) mRNA encoding the HA antigen of influenza A / (H1N1) virus; (b) mRNA encoding the HA antigen of influenza A / (H3N2) virus; (c) an mRNA encoding an HA antigen of an influenza B / Victoria lineage virus; and (d) an mRNA encoding the HA antigen of influenza B / Yamagata lineage virus; 6. The vaccine of claim 1 , comprising:

7. 7. The vaccine of any one of claims 1 to 6, wherein each LNP comprises a molar ratio of 20-60% ionizable amino lipid, 5-25% non-cationic lipid, 25-55% sterol, and 0.5-15% PEG-modified lipid.

8. 8. The vaccine of claim 7, wherein each LNP comprises a molar ratio of 40-50% ionizable amino lipid, 20-40% cholesterol, 5-15% neutral lipid, and 0.5-3% PEG-modified lipid.

9. The ionizable amino lipid has the formula (IId): 【Chemistry 1】 or a salt or isomer thereof, wherein n is 2, 3, or 4; R ２ and R ３ But, C ５－１４ Alkyl and C ５－１４ alkenyl; R ５ But, C １－３ Alkyl, C ２－３ independently selected from the group consisting of alkenyl, and H; R ６ But, C １－３ Alkyl, C ２－３ independently selected from the group consisting of alkenyl, and H; R' is C １－１８ Alkyl, C ２－１８ independently selected from the group consisting of alkenyl, -R*YR", -YR", and H; Each R" is C ３－１４ Alkyl and C ３－１４ alkenyl; Each R* is C １－１２ Alkyl and C ２－１２ alkenyl; Each Y is independently C ３－６ is a carbocyclic ring; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; 9. The vaccine of claim 7 or 8.

10. 10. The vaccine of claim 9, wherein the ionizable amino lipid has the structure of Compound 1: 【Chemistry 2】

11. 11. A vaccine according to any one of claims 1 to 10 for use in a method of inducing an immune response in a subject.

12. 11. A vaccine according to any one of claims 1 to 10 for use in the prevention and / or treatment of respiratory viral infections.

Images