Oral Delivery of Oligonucleotides

Abstract

The present disclosure provides an oligonucleotide composition comprising (1) the oligonucleotide of the present disclosure, for example, ASO, siRNA, shRNA, DNA or RNA aptamer, gene therapy vector, miRNA, miRNA mimic, antimiR, DNA or RNA decoy, CpG oligonucleotide, or any therapeutic or diagnostic oligonucleotide known in the art, and (ii) a caprylic acid derivative, for example, 5-CNAC.In some aspects, the oligonucleotide composition is formulated for gastrointestinal delivery.Thus, in some aspects, the present disclosure provides an oligonucleotide composition for oral delivery, comprising a therapeutic or diagnostic oligonucleotide (for example, ASO) and a caprylic acid derivative (for example, 5-CNAC or its derivative).

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This PCT application claims priority to U.S. Provisional Application No. 63 / 178,361, filed April 22, 2021; U.S. Provisional Application No. 63 / 261,506, filed September 22, 2021; and U.S. Provisional Application No. 63 / 288,379, filed December 10, 2021, the disclosures of which are incorporated herein by reference in their entireties.

[0002] Viewing electronic sequence listings via EFS-WEB The electronic sequence listing submitted with this application (filename: 4009_023PC03_Seqlisting_ST25.txt; file size: 35,805 bytes; and data creation date: April 20, 2022) is hereby incorporated by reference in its entirety.

[0003] The present disclosure relates to oral formulations comprising an oligonucleotide, e.g., an antisense oligonucleotide (ASO), siRNA, shRNA, and at least one delivery agent derived from caprylic acid, e.g., SNAC or 5-CNAC. [Background technology]

[0004] Oral delivery of pharmacologically active agents is generally the delivery route of choice; it is convenient, relatively easy, and generally painless, leading to higher patient compliance than other delivery methods. However, biological, chemical, and physical barriers, such as variable pH in the gastrointestinal tract, strong digestive enzymes, and active agent-impermeable gastrointestinal membranes, can make oral delivery of some pharmacologically active agents problematic in mammals; for example, oral delivery of therapeutic nucleic acids (such as antisense oligonucleotides).

[0005] Oral delivery of hydrophilic macromolecules with molecular weights above 1000 Da remains challenging due to sensitivity to pH and gastric / small intestinal enzymes, as well as low permeability through the intestinal epithelial membrane, including minimal passive or carrier-mediated intercellular permeation across the phospholipid bilayer and limited paracellular transport through tight junctions.

[0006] Thus, there is a need for the development of systems that allow for the oral delivery of therapeutic nucleic acids, such as antisense oligonucleotides. Summary of the Invention

[0007] The present disclosure provides therapeutic oligonucleotides: (i) Oral ingestion; (ii) a biological or therapeutic effect; and / or (iii) circulating plasma levels, The present invention provides a method of increasing the oral intake, the oral intake, the biological or therapeutic effect, and / or the circulating plasma level of a therapeutic oligonucleotide comprising administering the therapeutic oligonucleotide in combination with N-(5-chlorosalicyloyl)-8-aminocaprylic acid (5-CNAC). In some aspects, the oral intake, the biological or therapeutic effect, and / or the circulating plasma level of a therapeutic oligonucleotide in combination with N-(8-[2-hydroxybenzoyl]amino)caprylic acid (SNAC) are increased by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, or 200% compared to the oral intake, biological or therapeutic effect, and / or circulating plasma level observed when the therapeutic oligonucleotide is administered without 5-CNAC or when the therapeutic oligonucleotide is administered in combination with N-(8-[2-hydroxybenzoyl]amino)caprylic acid (SNAC).

[0008] The present disclosure provides an oligonucleotide composition comprising a therapeutic oligonucleotide and 5-CNAC or its salt, wherein the oligonucleotide composition is formulated for delivery to the gastrointestinal tract.In some aspects, the salt of 5-CNAC is selected from the group consisting of sodium salt, potassium salt, calcium salt, and any combination thereof, wherein the salt of 5-CNAC is monosodium salt or disodium salt.In some aspects, the therapeutic oligonucleotide is an antisense oligonucleotide (ASO), a small interfering RNA (siRNA), a small hairpin RNA (shRNA), a DNA aptamer and / or an RNA aptamer, a microRNA (miRNA), an anti-microRNA (antimiR), a CpG oligonucleotide, or a DNA decoy and / or an RNA decoy.

[0009] The disclosure also provides a method of making an oligonucleotide composition comprising a therapeutic oligonucleotide and 5-CNAC or a salt thereof, the method comprising: (i) a therapeutic oligonucleotide selected from the group consisting of ASO, siRNA, shRNA, DNA or RNA aptamer, miRNA, miRNA mimic, antimiR, DNA or RNA decoy, and CpG oligonucleotide; and (ii) 5-CNAC or a salt thereof, mixing the wherein the salt is a monosodium salt or a disodium salt. In some aspects, the blending comprises dry blending. In some aspects, the method further comprises encapsulating the dry blend obtained in step.

[0010] Also provided is a tablet or capsule comprising an oligonucleotide composition, the oligonucleotide composition comprising: (i) a therapeutic oligonucleotide selected from the group consisting of ASO, siRNA, shRNA, DNA or RNA aptamer, miRNA, miRNA mimic, antimiR, DNA or RNA decoy, and CpG oligonucleotide; and (ii) 5-CNAC or a salt thereof, Including, wherein the salt is a monosodium salt or a disodium salt. A tablet or capsule is provided. In some aspects, the tablet or capsule comprises an enteric coating, a pH sensitive coating, or a combination thereof. In some aspects, the tablet or capsule weighs between 10 mg and 500 mg. In some aspects, the tablet or capsule comprises between 1 mg and 500 mg of therapeutic oligonucleotide.

[0011] The present disclosure also provides a method of treating a disease or condition in a subject in need of treatment, comprising administering to the subject an effective amount of an oligonucleotide composition as disclosed herein, or a tablet or capsule as disclosed herein. In some aspects, the oligonucleotide composition, tablet or capsule is administered orally. In some aspects, the oligonucleotide composition, tablet or capsule is administered in a single dose or multiple doses. In some aspects, the oligonucleotide composition, tablet or capsule is administered at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 or 60 minutes before a meal. In some aspects of the methods, oligonucleotide compositions, tablets or capsules disclosed herein, the therapeutic oligonucleotide is selected from the group consisting of: 1018ISS, AB-729, Abetimus, AEG35156 (GEM640), afovirsen, aganilsen, agatrimod, alicaforsen, ALNAAT-02, amlivirsen, anivamersen, apatursen, aprinocarsen, APTA-16, AR-177 (ZINTEVIR (trademark)), ARC19499 (BAX-499), archexin, AROANG-3, AROAPOC-3, ARO-HSD, AS1411 (AGRO100), ASM-8, asbashiran (asva siran), atesidorsen, ATL-1102, ATU-027, avacincaptad pegol (ZIMURA™), AVI-4126 (Resten MP™), AVI-7288, AVI-7537, AVT-02, AZD-8233, AZD-8701, valifolsen, bamosiran, bazlitoran, BC007, beclanorsen, versetiran, bepirovirsen, bevasiranib, BIIB-080, BMN044, BMN053, bribolizide, casimerce , cavrotolimod, cemdisiran, cenersen, cepadakrusen (CIVI008), cimderlirsen, cobitolimod, cobomarsen, CODA-001 (NEXAGON™), cofirasersen, cosdosiran, CpG7909, CPG-8954, cupabimod, custricene, dambatirsen, daplusiran, defibrotide (DEFITE LIO (trademark), dematirsen, donidarolsen, drisapersen (KYNDRISA (trademark), DYN-101, edifoligid, egapetibongol, EIF-4E, eluforsen, emapticapegol, aprontersen, eteplirsen (EXONDYS51 (trademark), fazilsilane, fesomersen, fitusiran, homivirsen (VITRAVENE (trademark), frenlosirsen, gataparsen, givosiran (GIVLAARI (trademark),GNKG-168 (CPG-685), golodirsen (SRP-4053, VYONDYS53™), GPI-2A, GTI-2040 (LOR-2040), GTI-2501, GTX-102, HBVAXPRO, imetelstat, IMT-504, inclisiran, inotersen (TEGSEDI™), ION-224, ION-253, ION-363, ION-464, ION-541, ION-859, IONIS-A GTLRx, IONIS-APO(a)-Rx, IONISAR-2.5Rx, IONIS-C9Rx, IONIS-DNM2-2.5Rx, IONISENAC-2.5Rx, IONIS-FB-LRx, IONIS-FX ILRx, IONIS-FXIRx, IONIS-GCGRRx, IONIS-HBVLRX, IONIS-MAPTRx, IONIS-PKKRx, IONISTMPRSS-6LRx, IONIS-TTRRx, ISIS EIF4E Rx, ISIS-104838, ISIS-1082, ISIS-113715, ISIS-2503, ISIS-333611, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843, ISIS-757456, ISIS-863633, ISTH-0036, JNJ-3989, rademirsen, lexanersen (WVE-120102), lexaptepid pegol (NOX-H94), ritenimod, LSP-GR3, lumasiran, mipomersen (KYNAMRO™), miravirsen, monarsen, mongersen, MT -5745, MTL-CEBPA, ND-L02-s0201 (BMS-986263), nedosiran, NS-089, nusinersen (SPINRAZA™), oblimersen (SPC2996, GENASENSE™), olapteseedopegol (NOX-A12), olezarsen, olpaciran, OLX-101, patisiran (ONPATTRO™), pegaptanib (MACUGEN™), pegnibacogin, pegprelanib (FOVISTA™), peracarsen, plexigeneversen, PUL-042, QPI-1007, QR-1123, QRX-421a, ladavirsen, remlarsen,lenavirdine, levusiran, RG-012, RG-101, RG-6346, RGLS-4326, rimigorsen, losomidonal, rovanersen (WVE-120101), sapablursen, SB010, sepofarsen, siG-12D-LODER, SLN124, SR-063, SRP-5051, STK-001, STP-705, suvodirsen, tadnersen, temavirsen, teprasiran, tilsotolimod, chibanisiran ( tivanisiran (SYLENTIS™), tofersen, tominersen, tomligisiran, TOP-1731, travedersen (AP-12009), trecovirsen, varodarsen, VEGLIN3, vidutolimod, viltolarsen (VILTEPSO™), VIR-2218, voranesorsen (WAYLIVRA™), bupanorsen, butrisiran, WVE-003, WVE-004, WVEN-531, zilebesiran, and zilganersen. [Brief description of the drawings]

[0012] [Figure 1A] 1 shows the structures of caprylic acid and two caprylic acid derivatives, namely SNAC and 5-CNAC. [Figure 2A] 1 shows structures of exemplary caprylic acid derivatives. [Figure 2A] The structures of representative caprylic acid derivatives are shown below. [Diagram 2] 1 shows chemical structures of exemplary oral delivery agents. [Diagram 3]

[0023] Figure 1 shows the detailed chemical structure and full name of sepadacrusen, an antisense oligonucleotide conjugate that targets PCSK9. CIVI008 is a formulation of sepadacrusen for oral delivery. [Figure 4] 1 shows the detailed chemical structure of ISIS 863633, an antisense oligonucleotide conjugate targeting PCSK9. [Diagram 5] 1 shows potential topologies of oligonucleotides that contain partially double-stranded nucleic acids, such as RNA sponges or tough decoys. The arrows in the structures represent antisense sequences that can bind to target RNAs (e.g., microRNAs). [Figure 6] 1 shows the design of the clinical trial described in Example 1. [Figure 7] Plasma concentration levels of CIVI008 following administration with or without SNAC are shown. [Figure 8] FIG. 1 shows plasma AUC levels for the subcutaneous (SQ) groups (P0001, P0002, P0901, and P0902) and oral (PO) groups (P0301, P0302, P0303, P1201, P1202, P1203, P0401, P0402, P0403, P1301, P1302, P1303, P0501, and P1401) in the study of Example 1. [Figure 9] 1 shows liver concentration levels for CIVI008 in the SQ and PO groups of the study presented in Example 1. [Figure 10] The mean change in PCSK9 expression levels relative to baseline levels at days 35 and 42 after oral administration of CIVI008 is shown. [Figure 11A] The changes versus baseline in plasma LDL cholesterol levels are shown following administration of 1 or 2 capsules of CIVI008 (FIG. 11A) or under control conditions (FIG. 11B). [Figure 12] 1 shows the change from baseline in plasma LDL cholesterol levels during the course of the study shown in Example 1. [Figure 13] 1 shows a schematic illustration of the study shown in Example 3. [Figure 14] 1 shows plasma concentration levels of CIVI008 after dosing with 5-CNAC. [Figure 15] 1 shows a comparison between the pharmacokinetic parameters (mean AUC0-5 and mean Cmax) corresponding to administration of CIVI008 capsules containing either SNAC or 5-CNAC. [Figure 16]Plasma concentration levels and pharmacokinetic parameters (mean AUC0-5 and mean Cmax) corresponding to administration of CIVI008 in size 4 capsules (Group A) or size 0 capsules (Group B) containing 5-CNAC are shown. [Figure 17] 1 shows the mean AUC and mean Cmax on days 1 and 3 in monkeys dosed with 5 mg to 30 mg of CIVI008 formulated with 5-CNAC. [Figure 18A] A comparison of mean pharmacokinetic parameters on days 1 and 3 in monkeys administered similar doses of CIVI008 in capsules prepared either by dry blending (FIG. 18A) or lyophilization (FIG. 18B). [Figure 18B] A comparison of mean pharmacokinetic parameters on days 1 and 3 in monkeys administered similar doses of CIVI008 in capsules prepared either by dry blending (FIG. 18A) or lyophilization (FIG. 18B). [Figure 19] After 22 days of treatment, PCSK9 and plasma LDL were reduced from baseline. [Figure 20] 1 shows the % LDL reduction from baseline in monkeys administered CIVI008 formulated with either SNAC or 5-CNAC. [Figure 21] Plasma concentration levels and pharmacokinetic parameters (mean AUC0-5, mean Cmax and Tmax) corresponding to administration of CIVI008 with or without GalNac formulated with 5-CNAC in size 0 capsules are shown. [Figure 22] Plasma concentration levels and pharmacokinetic parameters (mean AUC0-5, mean Cmax and Tmax) corresponding to administration of oligos to Factor VII with or without GalNac formulated with 5-CNAC in size 0 capsules are shown. [Diagram 23]Schematic diagram showing exemplary constructs comprising one or more of the caprylic acid derivatives of the present disclosure, including attachment to a single-stranded or double-stranded oligonucleotide via a 5' covalent linkage and / or a 3' covalent linkage, attachment to an internal site (i.e., not at the 5' or 3' end), attachment of multiple chain-linked caprylic acid derivatives, attachment of a caprylic acid derivative to a loop, attachment of a caprylic acid derivative to an overhang, and attachment of a caprylic acid derivative to a non-complementary region. [Figure 25B] The changes versus baseline in plasma LDL cholesterol levels are shown following administration of 1 or 2 capsules of CIVI008 (FIG. 11A) or under control conditions (FIG. 11B).

[0013] The present disclosure provides compositions comprising an oligonucleotide or combination thereof, including, for example, antisense oligonucleotides (ASOs), small interfering RNAs (siRNAs), small hairpin RNAs (shRNAs), RNA aptamers and / or DNA aptamers, microRNAs (miRNAs), anti-microRNAs (antimiRs), DNA or RNA decoys (see, for example, FIG. 5), CpG oligonucleotides, or any combination thereof, and a delivery agent comprising a caprylic acid derivative, for example, SNAC or 5-CNAC. In some aspects, the oligonucleotide compositions of the present disclosure are formulated for delivery to the gastrointestinal tract, for example, for oral delivery.

[0014] Caprylic acid derivatives, such as SNAC or 5-CNAC, act by several different mechanisms to improve nucleic acid absorption in the gastrointestinal tract. Their lipophilic properties allow them to penetrate and modify the plasma membrane composition. Thus, intracellular accumulation of the therapeutic agent is possible via intercellular processes. In addition, caprylic acid derivatives, such as SNAC or 5-CNAC, can reduce the tendency of the therapeutic agent to aggregate (e.g., form multimers that may affect absorption). Caprylic acid derivatives, such as SNAC or 5-CNAC, can also act as buffers to neutralize the acidic conditions of the stomach (gastric pH generally in the range of 1-2.5), which may enhance absorption of the therapeutic agent in at least two ways. First, digestive enzymes are more active at acidic pH. Thus, the probability of enzymatic degradation is reduced, as the local increase in pH neutralizes the degradative enzymes. This extension of the half-life of the therapeutic agent allows more of the agent to be absorbed into the gastrointestinal cells and into the systemic circulation. Second, the buffering activity of caprylic acid derivatives such as SNAC or 5-CNAC allows the solubility of the therapeutic agent to be altered (e.g., increased). 10 (sodium caprate) and other oral delivery agents. 10 C acts through opened epithelial tight junctions as a result of inositol 1,4,5-triphosphate (IP3)- and calcium-mediated cell signaling events that trigger contraction of the parajunctional actomyosin ring (PAMR) and allow for increased tight junction permeability. 10A major concern with caprylic acid is its antimicrobial effect (see, e.g., Cox et al., 2008, Pharm. Res. 25:114-122; Petschow et al., 1996, Antimicrob. Agents Chemother. 40:302-306; Van Immerseel et al., 2004, Appl. Environ. Microbiol. 70:3582-3587; and Chadeganipour and Haims, 2001, Mycoses 44:109-112), which may promote changes in the gastrointestinal microflora. Such changes in the gastrointestinal microflora may also cause local inflammation. Similar antimicrobial effects have not been observed with caprylic acid derivatives such as SNAC or 5-CNAC.

[0015] In some aspects, the oligonucleotides used in the compositions and methods of the present disclosure include antisense oligonucleotides, e.g., antisense oligonucleotide conjugates, that target a nucleic acid, e.g., an mRNA encoding PCSK9. Specific examples of nucleic acid therapeutic agents that can be delivered in the compositions and methods disclosed herein include CIVI008 and ISIS863633, which are shown in Figures 3 and 4, respectively.

[0016] In some aspects, the oligonucleotide compositions disclosed herein include a caprylic acid derivative, such as SNAC or 5-CNAC, that protects the oligonucleotide from conditions that may cause degradation and / or aggregation of the oligonucleotide, such as conditions in the digestive tract, e.g., stomach. In some aspects, the oligonucleotide compositions disclosed herein can be used to administer therapeutic or diagnostic oligonucleotides to other sites in the body that have specific conditions, such as low pH, high pH, ​​or the presence of nucleases, that may result in degradation of the oligonucleotide. For example, the pH level of the vagina is 3.8-4.5; the pH level in the bladder is about 6.0 (ranging from 4.5 to about 8); and nuclease levels are high in fluids such as tears, saliva, mucus, or sweat. In other words, a formulation for treatment of mucosal tissue, urogenital tract, or a formulation for topical administration can also contain a caprylic acid derivative, such as SNAC or 5-CNAC, as disclosed herein.

[0017] Despite its structural similarity to SNAC, experimental data presented herein demonstrate that 5-CNAC is unexpectedly efficient at increasing the absorption and bioavailability of therapeutic oligonucleotides (e.g., ASOs). Thus, by co-formulating a therapeutic oligonucleotide with 5-CNAC, oral administration of the therapeutic oligonucleotide results in plasma concentrations that are much higher than those observed when the same oligonucleotide is formulated with SNAC. It has been observed that formulations containing 5-CNAC can avoid the need for a delivery moiety such as GalNAc. In other words, when a therapeutic oligonucleotide is formulated with 5-CNAC, it is possible to avoid conjugating the therapeutic oligonucleotide to GalNAc, yet still achieve plasma concentrations equal to or greater than those observed when the oligonucleotide is conjugated to GalNAc.

[0018] The oligonucleotide compositions disclosed herein, for example, compositions comprising oligonucleotides (e.g., in pill or capsule form), comprise at least one delivery agent that protects the payload (i.e., nucleic acid therapeutic agent) during passage through the digestive tract (e.g., during passage through the stomach and upper small intestine), for example, after oral administration. In some aspects, the delivery agent (e.g., for oral delivery) is a salt (e.g., sodium salt) of a fatty acid, such as a caprylic acid derivative (e.g., 8-[2-hydroxybenzoyl]amino) caprylic acid, SNAC or 5-CNAC, or a combination thereof. In a particular aspect, the delivery agent (e.g., for oral delivery) is a salt, for example, the sodium salt (e.g., monosodium salt or disodium salt) of SNAC or the sodium salt (e.g., monosodium salt or disodium salt) of 5-CNAC.

[0019] Also provided herein are methods of making the oligonucleotide compositions and delivery agents disclosed herein.The disclosure also provides a method of treating a subject in need thereof, comprising administering an oligonucleotide composition disclosed herein.

[0020] definition In order that this description may be more readily understood, certain terms are first defined. Further definitions are provided throughout the Detailed Description of this specification.

[0021] It should be noted that the term "a" or "an" item refers to one or more of that item, for example, "a nucleotide sequence" should be understood to represent a sequence of one or more nucleotides. Thus, the terms "a" (or "an"), "one or more," and "at least one" may be used synonymously herein.

[0022] Furthermore, "and / or" herein should be considered as a specific disclosure of each of the two particular features or components in the presence or absence of the other. Thus, the term "and / or" as used herein in phrases such as "A and / or B" is intended to include "A and B," "A or B," "A" (single), and "B" (single). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to include each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (single); B (single); and C (single).

[0023] Whenever an aspect is described herein using the term "comprising," it should be understood that this also describes a similar aspect that can be described using "consisting of" and / or "consisting essentially of."

[0024] Unless otherwise defined, all technical and scientific terms used herein shall have the same meaning as that commonly understood by those skilled in the art in the technical field related to this disclosure.For example, see the Concise Dictionary of Biomedicine and Molecular Biology, 2nd Edition, Juo, Pei-Show, 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd Edition, 1999, Academic Press Publishers; and the Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press; these are the general dictionary for many of the terms used in this disclosure for those skilled in the art.

[0025] Units, prefixes, and symbols are expressed in the form accepted by the International System of Units (SI). Numeric ranges are inclusive of the numbers that define the range. Unless otherwise specified, the 5' to 3' direction of nucleotide sequences is expressed from left to right. The amino to carboxy direction of amino acid sequences is expressed from left to right. The headings provided herein are not intended to limit the various aspects of the disclosure which may be obtained by reference to the specification as a whole. Thus, the terms defined immediately below are more particularly defined by reference to the specification as a whole.

[0026] The term "about" as used herein means "approximately," "roughly," "on the order of," or "in the range of." When the term "about" is used in conjunction with a numerical range, it refers to a modification by extending the range above or below the numerical values ​​set forth. In general, the term "about" can modify the numerical value recited above or below that value, for example, by a variance of 10 percent.

[0027] As used herein, the term "derivative" refers to a compound that is structurally related to the compounds disclosed herein (e.g., C8, SNAC, or 5-CNAC), e.g., a compound having the same carbon skeleton, e.g., a chemical modification has been introduced into a side chain or group disclosed herein at one or more positions, where the derivative has a biological activity substantially similar to that of the substance or molecule (e.g., the ability to function as an oral delivery agent); it is a derivative.

[0028] For purposes of this disclosure, the terms "oligomer" and "oligonucleotide" are used synonymously to refer to a molecule formed by the covalent linkage of two or more nucleotides, where a single nucleotide (unit) may also be referred to as a monomer or unit.

[0029] The term "nucleotide" herein refers to a glycoside that includes a sugar moiety, a base moiety, and a covalent linking group (such as a phosphate or phosphorothioate internucleoside linking group), and includes both natural nucleotides, such as DNA or RNA, and non-natural nucleotides that include modified sugar and / or base moieties. Non-natural nucleotides are also referred to herein as "nucleotide analogs." A single nucleotide may also be referred to herein as a monomer or unit. In certain aspects, the term "nucleotide analog" refers to a nucleotide that has a modified sugar moiety. Non-limiting examples of nucleotides that have modified sugar moieties (e.g., LNA) are disclosed herein. In other aspects, the term "nucleotide analog" refers to a nucleotide that has a modified nucleobase moiety. Nucleotides having modified nucleobase moieties include, but are not limited to, 5-methyl-cytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine. In some aspects, the terms "nucleotide", "unit" and "monomer" are used synonymously. When referring to a sequence of nucleotides or monomers, it is understood that reference is made to a sequence of bases such as A, T, G, C, or U, and analogs thereof.

[0030] The term "nucleoside" is used herein to mean a glycoside that includes a sugar moiety and a base moiety, and thus refers to a nucleotide unit that is covalently linked by an internucleoside bond between nucleotides of a polynucleotide, e.g., ASO, disclosed herein. In the field of biotechnology, the term "nucleotide" is often used to mean a nucleic acid monomer or unit. With respect to a polynucleotide, e.g., ASO, disclosed herein, the term "nucleotide" can potentially refer to a nucleic acid base sequence that includes a single base, i.e., cytosine (DNA and RNA), guanine (DNA and RNA), adenine (DNA and RNA), thymine (DNA) and uracil (RNA), with a sugar backbone and an internucleoside bond present. Similarly, the term "nucleotide" refers to a "nucleoside", especially in the case of an oligonucleotide in which one or more of the internucleoside linking groups are modified. For example, the term "nucleotide" can be used to specify the presence or nature of an internucleoside bond.

[0031] In some aspects, the terms "nucleoside," "nucleotide," "unit," and "monomer" are used synonymously. Note that when referring to a sequence of nucleotides or monomers, what is being referenced is the sequence of bases such as A, T, G, C, or U.

[0032] The plural form of the term "nucleic acid" or "nucleotide" is intended to include multiple nucleic acids. In some aspects, the term "nucleic acid" or "nucleotide" refers to an in vivo or in vitro target sequence, such as pre-mRNA, mRNA, or DNA. When the term refers to a nucleic acid or nucleotide in a target sequence, the nucleic acid or nucleotide may be a naturally occurring sequence in a cell. In some aspects, the term "nucleic acid" or "nucleotide" refers to the sequence of an oligonucleotide of the present disclosure, such as an ASO, an siRNA, an shRNA, a DNA or RNA aptamer, an miRNA, an miRNA mimic, an antimiR, a DNA or RNA decoy, a CpG oligonucleotide, or any therapeutic or diagnostic oligonucleotide known in the art.

[0033] When this term refers to a sequence in an oligonucleotide, for example, the ASO disclosed herein, the nucleic acid or nucleotide can be non-natural, i.e., chemically synthesized, enzymatically produced, recombinantly produced, or any combination thereof.In some aspects, the nucleic acid or nucleotide in an oligonucleotide, for example, the ASO disclosed herein, is synthetic or recombinantly produced, but is not a natural sequence or a fragment thereof.In some aspects, the nucleic acid or nucleotide in a polynucleotide, for example, the ASO disclosed herein, is not natural; this is because it comprises at least one nucleoside analogue that is not natural in nature.

[0034] As used herein, the terms "reverse complement," "reverse complementary," and "reverse complementarity" are synonymous with the terms "complement," "complementary," and "complementarity."

[0035] The term "complementary" means that two sequences are complementary when one of the sequences binds to the other in an antiparallel manner, where the 3' end of each sequence binds to the 5' end of the other sequence, and where each A, T(U), G, and C of one sequence is juxtaposed to a T(U), A, C, and G of the other sequence, respectively. Typically, complementary sequences of oligonucleotides have at least 90%, preferably 95%, and most preferably 100% complementarity to a given sequence.

[0036] The terms "corresponding nucleotide analog" and "corresponding nucleotide" are used to indicate that the nucleotide analog and the nucleotide of the natural nucleotide are identical. For example, if the 2-deoxyribose unit of the nucleotide is linked to adenine, the "corresponding nucleotide analog" includes a pentose unit (different from 2-deoxyribose) linked to adenine. Examples of nucleobases include, but are not limited to, adenine, guanine, cytosine, thymidine, uracil, xanthine, hypoxanthine, 5-methylcytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine. In some aspects, the nucleobases are independently selected from the group consisting of adenine, guanine, cytosine, thymidine, uracil, and 5-methylcytosine. In some aspects, the nucleobases are independently selected from the group consisting of adenine, guanine, cytosine, thymidine, and 5-methylcytosine. In some aspects, at least one of the nucleobases present in the oligomer of the present disclosure is a modified nucleobase selected from the group consisting of 5-methylcytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine.

[0037] "Nucleotide analogue" is a variant of natural nucleotide, such as modified DNA or RNA nucleotides at sugar and / or base moiety.In principle, analogues can be simply "silent" or "equivalent" to the natural nucleotide in the oligonucleotide; that is, they have no functional effect on the activity of oligonucleotide to inhibit target gene expression.Such "equivalent" analogues can still be useful; for example, they can be useful when they are easier or cheaper to manufacture, or more stable to storage or manufacturing conditions, or can be used as tags or labels, etc.

[0038] As used herein, the term "nucleotide length" refers to the total number of nucleotides (monomers) in a given sequence. As will be understood by those skilled in the art, the 5' terminal nucleotide of a nucleic acid, e.g., an ASO, includes the 5' terminal group but does not include the 5' internucleoside linkage group.

[0039] The compounds described herein, such as caprylic acid derivatives or oligonucleotides, may contain multiple asymmetric centers and may exist in the form of optically pure optical isomers or mixtures of optical isomers (e.g., racemates, mixtures of diastereoisomers, diastereoisomeric racemates or mixtures of diastereoisomeric racemates).In some aspects, the asymmetric center may be an asymmetric carbon atom.The term "asymmetric carbon atom" refers to a carbon atom that has four different substituents.According to the Cahn-Ingold-Prelog transformation, the asymmetric carbon atom may be in the "R" or "S" configuration.

[0040] A "coding region," "coding sequence," or "open reading frame" herein is a portion of a polynucleotide that consists of codons that can be translated into amino acids. A "stop codon" (TAG, TGA, or TAA) is typically not translated into amino acids but can be considered part of the coding region; on the other hand, any flanking sequences, such as promoters, ribosome binding sites, transcription terminators, introns, untranslated regions ("UTRs"), etc., are not part of the coding region. The boundaries of a coding region are typically determined by a 5'-terminal start codon that codes for the amino terminus of the resulting polypeptide and a 3'-terminal translation stop codon that codes for the carboxyl terminus of the resulting polypeptide. In some aspects, oligonucleotides disclosed herein, such as ASOs (such as CIVI008), can be targeted to the PCSK9 coding region of a nucleic acid, such as an RNA, that codes for a PCSK9 protein.

[0041] The term "non-coding region" as used herein refers to a nucleotide sequence that is not a coding region. Examples of non-coding regions include, but are not limited to, promoters, ribosome binding sites, transcription terminators, introns, untranslated regions ("UTRs"), non-coding exons, and the like. Some exons can be the entire or part of the 5' untranslated region (5'UTR) or 3' untranslated region (3'UTR) of each transcript. Untranslated regions are important for efficient translation of transcripts and control of the translation rate and half-life of the transcripts. In some aspects, the oligomers (e.g., ASOs) or antisense oligonucleotide conjugates (e.g., ISIS863633) disclosed herein can target PCSK9 non-coding regions of nucleic acids (e.g., RNA) encoding PCSK9 proteins.

[0042] The term "region" when used in reference to a nucleotide sequence refers to a portion of that sequence. For example, the phrase "region within a nucleotide sequence" or "region within the complement of a nucleotide sequence" refers to a sequence that is shorter than the nucleotide sequence but is at least 10 nucleotides longer, respectively, located within the particular nucleotide sequence or the complement of the nucleotide sequence. The term "sub-sequence" or "subsequence" can also refer to a region of a nucleotide sequence.

[0043] When referring to a nucleotide sequence, the term "downstream" means that a nucleic acid or nucleotide sequence is located 3' to a reference nucleotide sequence. In certain aspects, downstream nucleotide sequences refer to sequences following the transcription start site. For example, the translation start codon of a gene is located downstream of the transcription start site. In some aspects, the oligonucleotides, e.g., ASOs, disclosed herein can target the region downstream of the target protein open reading frame (ORF) of a nucleic acid, e.g., RNA, that codes for a target protein.

[0044] The term "upstream" refers to a nucleotide sequence located 5' of a reference nucleotide sequence. In some aspects, an oligonucleotide, e.g., an ASO, disclosed herein can be targeted to a region of a nucleic acid, e.g., an RNA, encoding a target protein, upstream of the target protein ORF.

[0045] The term "regulatory region" as used herein refers to a nucleotide sequence located upstream (5' non-coding sequence), within, or downstream (3' non-coding sequence) of a coding region, which influences the transcription, RNA processing, stability, or translation of the associated coding region. Regulatory regions may include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, UTRs, and stem-loop structures. When a coding region is intended for expression in eukaryotic cells, polyA signals and transcription termination sequences are usually located 3' of the coding sequence. In some aspects, the oligonucleotides disclosed herein, e.g., ASOs, may target regulatory regions.

[0046] The term "transcript" herein refers to the primary transcript that is synthesized by transcription of DNA and processed into messenger RNA (mRNA), i.e., precursor messenger RNA (pre-mRNA) and the processed mRNA itself. The term "transcript" may be used synonymously with "pre-mRNA" and "mRNA". After the DNA strand is transcribed as the primary transcript, the newly synthesized primary transcript is modified in multiple ways to become a mature functional form and produce different proteins and RNAs (mRNA, tRNA, rRNA, lncRNA, miRNA, etc.). Thus, the term "transcript" includes exons, introns, 5'UTR, and 3'UTR.

[0047] The term "expression" herein refers to the process by which a gene product, e.g., RNA or polypeptide, is produced from a polynucleotide. This includes, but is not limited to, transcription of a polynucleotide into messenger RNA (mRNA) and translation of mRNA into a polypeptide. Expression produces a "gene product." A gene product herein can be either a nucleic acid, e.g., messenger RNA produced by transcription of a gene, or a polypeptide translated from a transcript. Gene products as described herein further include nucleic acids that have undergone post-transcriptional modifications, e.g., polyadenylation or splicing, or polypeptides that have undergone post-translational modifications, e.g., methylation, glycosylation, lipidation, association with other protein subunits, or proteolytic cleavage.

[0048] The terms "individual," "subject," "host," and "patient" are used synonymously herein and refer to any mammalian subject, particularly humans, for whom diagnosis, treatment, or therapy is desired. The compositions and methods described herein are applicable to both human treatment and veterinary applications. In some aspects, the subject is a mammal. In some aspects, the subject is a human.

[0049] As used herein, a "mammalian subject" includes all mammals, including, but not limited to, humans, pet animals (e.g., dogs, cats, etc.), farm animals (e.g., cows, sheep, pigs, horses, etc.), and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, etc.).

[0050] The term "pharmaceutical composition" refers to a formulation in which the biological activity of the active ingredient may be effective, without any additional ingredients that may cause unacceptable toxicity to the subject to which the composition is administered. Such compositions may be sterile. The term "oral pharmaceutical composition" refers to a pharmaceutical composition that may be administered orally. Oral administration is a route of administration in which a substance is taken through the mouth. The abbreviation "Per os" for oral (PO) is also sometimes used to indicate oral drug intake. Many therapeutic drugs are taken orally because they are intended to have a systemic effect, for example by reaching different parts of the body via the bloodstream.

[0051] The term "delivery agent" as used herein refers to a carrier compound or a carrier molecule useful for the oral delivery of a nucleic acid therapeutic agent of the present disclosure, such as an ASO. The term "oral delivery agent" as used herein refers to a carrier compound or a carrier molecule useful for the oral delivery of a nucleic acid therapeutic agent of the present disclosure, such as an ASO.

[0052] In some aspects, the pharmaceutical composition of the present disclosure is administered orally.The term "oral" and its grammatical variants (e.g., orally) herein include any kind of oral delivery route (including buccal, sublabial, and sublingual).Orally administered drugs can be in various forms; such forms include oral solid drug (OSD) forms (e.g., tablets that are swallowed, chewed, or dissolved in water or under the tongue; capsules and chewable capsules, for example, with coatings that dissolve in the stomach or intestine and release drug there; sustained or extended release tablets and capsules that release drug gradually; powders; or granules), and oral liquid drug forms (e.g., tea, drops, liquid, suspension, or syrup).

[0053] "Administering" in the present specification means administering a composition, for example an oral pharmaceutical composition comprising an oligonucleotide of the present disclosure, for example an ASO, siRNA, shRNA, DNA or RNA aptamer, gene therapy vector, miRNA, miRNA mimic, antimiR, DNA or RNA decoy, CpG oligonucleotide, or any therapeutic or diagnostic oligonucleotide known in the art, to a subject by a pharma- ceutically acceptable route, for example, orally. An "effective amount" is, for example, an amount sufficient for an oral pharmaceutical composition comprising an oligonucleotide disclosed herein to achieve a specifically stated purpose, for example, the purpose of treating a disease or condition. An "effective amount" can be determined empirically in a routine manner in relation to the stated purpose.

[0054] As used herein, "treat," "treatment," or "treating" does not necessarily mean curing the disease or condition, but may refer, for example, to lessening the severity of the disease or condition; shortening the duration of the course of the disease or condition; ameliorating or eliminating one or more symptoms associated with the disease or condition; delaying the onset of the disease or condition; or providing a beneficial effect to a subject afflicted with a disease or condition. The term also includes prophylaxis or prevention of the disease or condition, or its symptoms or sequelae.

[0055] "Prevent" or "preventing" herein refers to reducing the occurrence or severity of a particular outcome. In some aspects, preventing an outcome is achieved by prophylactic treatment. In some aspects, an oral pharmaceutical composition comprising a nucleic acid therapeutic agent disclosed herein is administered prophylactically to a subject. In some aspects, the subject is at risk of developing a disease or condition.

[0056] The terms "oligonucleotide composition of the disclosure," "therapeutic oligonucleotide of the disclosure," or "oligonucleotide of the disclosure" refer, for example, to:1018ISS, AB-729, Abetimus, AEG35156 (GEM640), afovirsen, aganilsen, agatrimod, alicaforsen, ALNAAT-02, amlivirsen, anivamersen, apatursen, aprinocarsen, APTA-16, AR-177 (ZINTEVIR (trademark)), ARC19499 (BAX-499), archexin, AROANG-3, AROAPOC-3, ARO-HSD, AS1411 (AGRO100), ASM-8, asbashiran (asva siran), atesidorsen, ATL-1102, ATU-027, avacincaptad pegol (ZIMURA™), AVI-4126 (Resten MP™), AVI-7288, AVI-7537, AVT-02, AZD-8233, AZD-8701, valifolsen, bamosiran, bazlitoran, BC007, beclanorsen, versetiran, bepirovirsen, bevasiranib, BIIB-080, BMN044, BMN053, bribolizide, casimerce , cavrotolimod, cemdisiran, cenersen, cepadakrusen (CIVI008), cimderlirsen, cobitolimod, cobomarsen, CODA-001 (NEXAGON™), cofirasersen, cosdosiran, CpG7909, CPG-8954, cupabimod, custricene, dambatirsen, daplusiran, defibrotide (DEFITE LIO (trademark), dematirsen, donidarolsen, drisapersen (KYNDRISA (trademark), DYN-101, edifoligid, egapetibongol, EIF-4E, eluforsen, emapticapegol, aprontersen, eteplirsen (EXONDYS51 (trademark), fazilsilane, fesomersen, fitusiran, homivirsen (VITRAVENE (trademark), frenlosirsen, gataparsen, givosiran (GIVLAARI (trademark),GNKG-168 (CPG-685), golodirsen (SRP-4053, VYONDYS53™), GPI-2A, GTI-2040 (LOR-2040), GTI-2501, GTX-102, HBVAXPRO, imetelstat, IMT-504, inclisiran, inotersen (TEGSEDI™), ION-224, ION-253, ION-363, ION-464, ION-541, ION-859, IONIS-A GTLRx, IONIS-APO(a)-Rx, IONISAR-2.5Rx, IONIS-C9Rx, IONIS-DNM2-2.5Rx, IONISENAC-2.5Rx, IONIS-FB-LRx, IONIS-FX ILRx, IONIS-FXIRx, IONIS-GCGRRx, IONIS-HBVLRX, IONIS-MAPTRx, IONIS-PKKRx, IONISTMPRSS-6LRx, IONIS-TTRRx, ISIS EIF4E Rx, ISIS-104838, ISIS-1082, ISIS-113715, ISIS-2503, ISIS-333611, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843, ISIS-757456, ISIS-863633, ISTH-0036, JNJ-3989, rademirsen, lexanersen (WVE-120102), lexaptepid pegol (NOX-H94), ritenimod, LSP-GR3, lumasiran, mipomersen (KYNAMRO™), miravirsen, monarsen, mongersen, MT -5745, MTL-CEBPA, ND-L02-s0201 (BMS-986263), nedosiran, NS-089, nusinersen (SPINRAZA™), oblimersen (SPC2996, GENASENSE™), olapteseedopegol (NOX-A12), olezarsen, olpaciran, OLX-101, patisiran (ONPATTRO™), pegaptanib (MACUGEN™), pegnibacogin, pegprelanib (FOVISTA™), peracarsen, plexigeneversen, PUL-042, QPI-1007, QR-1123, QRX-421a, ladavirsen, remlarsen,lenadilsen, levusiran, RG-012, RG-101, RG-6346, RGLS-4326, rimigorsen, losomidnal, rovanersen (WVE-120101), sapablursen, SB010, sepofarsen, siG-12D-LODER, SLN124, SR-063, SRP-5051, STK-001, STP-705, suvodirsen, tadnersen, temavirsen, teprasiran, tilsotolimod, tivanisiran (SYLENTIS™), tofersen, tominersen, tomurizi tomligisiran, TOP-1731, travedersen (AP-12009), trecovirsen, varodarsen, VEGLIN3, vidutolimod, viltolarsen (VILTEPSO™), VIR-2218, voranesorsen (WAYLIVRA™), bupanorsen, butrisiran, WVE-003, WVE-004, WVEN-531, zilbesiran, zilganersen, and unconjugated forms thereof, i.e., forms of the molecule that contain the nucleotide oligomer portion but no conjugated portion such as a GalNAc portion or a polyethylene glycol (PEG).

[0057] As used herein, the term "CIVI008" refers to the compound of FIG. 3 (cepadacrusen) formulated for oral administration.

[0058] The term "unconjugated" herein refers to the oligonucleotide portion of an oligonucleotide conjugate (e.g., sepadacrusen, CIVI008) as illustrated in Figure 3. As shown in Figure 3, an unconjugated ASO would correspond to an ASO that does not have the antisense oligomer portion of the ASO, i.e., the GalNAc portion. In the case of a double-stranded therapeutic oligonucleotide (e.g., siRNA), the unconjugated form would include a sense / antisense duplex that does not have a delivery moiety (e.g., GalNAc) that may be covalently attached to the sense strand.

[0059] Section 1: Oligonucleotide compositions containing caprylic acid derivatives This disclosure: (i) ASO, siRNA, shRNA, DNA or RNA aptamers, miRNA, miRNA mimics, antimiR, DNA or RNA decoys, CpG oligonucleotides, any therapeutic or diagnostic oligonucleotide known in the art, or combinations thereof; and (ii) a caprylic acid derivative, such as SNAC or 5-CNAC, a salt thereof, or any combination thereof; The present invention provides an oligonucleotide composition comprising:

[0060] In some aspects, the oligonucleotide compositions of the present disclosure are delivered to the digestive tract, e.g., orally. Thus, in some aspects, the present disclosure provides oligonucleotide compositions for oral delivery, for example, comprising: ASO, siRNA, shRNA, DNA or RNA aptamers, miRNA, miRNA mimics, antimiR, DNA or RNA decoys, CpG oligonucleotides, or any therapeutic or diagnostic oligonucleotide known in the art, and caprylic acid derivatives, such as SNAC or 5-CNAC.

[0061] The term "caprylic acid derivative" as used herein refers to a molecule that contains a six-membered carbocyclic ring bearing a fatty acid substituent, such as C8 (caprylic acid), where the ring further contains at least one polar substituent, such as an -OH or halogen group.

[0062] In some aspects, the term "caprylic acid derivative" broadly includes compounds in FIG. 2 that contain, for example, butyric acid (C4), pentanoic acid (C5), or heptanoic acid (C7) fatty acid moieties. In some aspects, the caprylic acid derivatives of the present disclosure (e.g., 5-CNAC) can be used as oligonucleotide delivery agents. In some aspects, the caprylic acid derivatives of the present disclosure (e.g., 5-CNAC) can be used as gastrointestinal delivery agents. In some aspects, the caprylic acid derivatives of the present disclosure (e.g., 5-CNAC) can be used as oral delivery agents.

[0063] In some aspects, the caprylic acid derivatives include compounds of the formula: [ka] where (i)R 1 , R 2 , R 3 , and R 4 are independently hydrogen, -OH, -NR 6 R 7 , halogen, C 1 ~C 4 Alkyl, or C 1 ~C 4 is alkoxy; (ii)R 5 is a substituted or unsubstituted C 2 ~C 16 Alkylene, substituted or unsubstituted C 2 ~C 16 Alkenylene, substituted or unsubstituted C 1 ~C 12 Alkyl (arylene), or substituted or unsubstituted aryl (C 1 ~C 4 alkylene); and (iii)R 6 and R 7 are independently hydrogen, oxygen, or C 1 ~C 4 It is an alkyl.

[0064] In some aspects, the caprylic acid derivatives include compounds of the formula shown below (see FIG. 1B): [ka] wherein the benzene ring contains at least one aliphatic substituent between C2 and C12 (e.g., C8) and at least two polar substituents, where (a) at least one of R1, R2, R3, R4, or R5 independently comprises or consists of a halogen (e.g., a halogen selected from F, Cl, or Br); (b) at least one of R1, R2, R3, R4, or R5 independently comprises or consists of a hydroxy group; (c) at least two of R1, R2, R3, R4, or R5 are not H; (d) X1, X2, X3, X4, and X5 are linear or branched alkyl spacers each having n CH 2 units, where n is 0 to 5 (e.g., -CH 2 -, -CH 2 -CH 2 -, -CH 2 -CH 2 -CH 2 - or other linear groups).

[0065] A "halogen" group refers to fluorine, chlorine, bromine or iodine.

[0066] A "hydroxy functional group" or "hydroxy group" is OH.

[0067] In some aspects, the cyclic moiety of the caprylic acid derivatives of the present disclosure, e.g., molecules of formula I or formula II, is a benzene ring. However, in other aspects, the cyclic moiety of the caprylic acid derivatives of the present disclosure can be a 3-10 membered carbocyclic or heterocyclic ring, which can be saturated, partially unsaturated, or aromatic. In some aspects, the heterocyclic ring contains 1-4 heteroatoms selected from O, S, and N. In some aspects, the ring is optionally fused to 1-4 5- or 6-membered rings, where each ring can independently be saturated, partially unsaturated, or aromatic, carbocyclic, or heterocyclic; and where each fused heterocyclic ring can independently contain 1 or 2 heteroatoms selected from O, N, and S.

[0068] "Carbocycle" refers to a 3- to 10-membered carbon ring, which may be saturated, partially unsaturated, aromatic, and which is bonded to the remainder of the molecule via any available C atom.

[0069] "Heterocycle" refers to a 3- to 10-membered ring containing at least one heteroatom selected from N, O and S, which may be saturated, partially unsaturated, aromatic, and which is bonded to the remainder of the molecule via any available C atom.

[0070] Examples of carbocycles and heterocycles include, among others, phenyl, naphthyl, thienyl, furyl, pyrrolyl, thiazolyl, isothiazolyl, imidazolyl, pyrazolyl, 1,2,3-triazolyl, 1,2,4-triazolyl, tetrazolyl, 1,3,4-thiadiazolyl, 1,2,4-thiadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, benzimidazolyl, benzofurani, isobenzofuranyl, indolyl, isoindolyl, benzothiophenyl, benzothiazolyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, azetidinyl and aziridinyl.

[0071] In some aspects, at least one of the cyclic substituents is bonded to the ring via an ether, thioether, carbon-carbon, or amide bond. In some aspects, at least one non-fatty acid cyclic substituent is bonded to the ring via an ether, thioether, carbon-carbon, or amide bond. In some aspects, the alicyclic substituent is bonded to the ring via an ether, thioether, carbon-carbon, or amide bond. In some aspects, at least one, two, three, four, or five substituents R of formula I are bonded to the ring via an ether, thioether, carbon-carbon, or amide bond. 1 , R 2 , R 3 , R 4 , or R 5 or at least one, two, three, four, or five substituents R of formula II 1 , R 2 , R 3 , R 4 , or R 5 or the 3-10 membered carbocyclic or heterocyclic rings disclosed above, the substituents can be independently selected from the group consisting of an alkyl chain, an amine functionality, a hydroxy functionality, a carboxylic acid functionality, a carboxylic acid amide, a halogen, or any combination thereof.

[0072] In the present disclosure, the term "alkyl" or "alkyl chain" refers to a saturated hydrocarbon moiety, which may be linear, branched, cyclic, or cyclic with linear or branched side chains. The term "alkyl" includes partially unsaturated hydrocarbons, such as propenyl. Examples include methyl, ethyl, n- or isobutyl, n- or cyclohexyl. The term "alkyl" may also include alkyl groups linked or bridged by heteroatoms. In the present invention, heteroatoms are nitrogen (N), sulfur (S), and oxygen (O).

[0073] An "amine functional group" or "amine group" is, for example, a hydrogen (-H) and a C 1 ~C nThe functional group NRR′ has R and R′ independently selected from alkyl groups such as alkyl, where n is an integer from 0 to 20.

[0074] A "carboxylic acid functional group" or "carboxylic acid group" is defined as COOH or its anion, COO - It is.

[0075] "Carboxylic acid amide" refers to, for example, an amide having hydrogen (-H) and C 1 ~C n CONRR′ with R and R′ independently selected from alkyl groups such as alkyl, where n is an integer from 0 to 20.

[0076] The caprylic acid derivative of the present disclosure can be in any form commonly used in pharmaceutical technology.In certain aspects, it includes, but is not limited to, sodium salt, magnesium salt, potassium salt, ammonium salt, free acid, or mixtures of the above forms.Other pharmaceutically acceptable salts are known to those skilled in the art, and can be obtained from, inter alia, Haynes et al. (2005) J. Pharmaceutical Sci. 94:2111-2120.

[0077] In some aspects, the caprylic acid derivative comprises a compound of formula I or formula II as described above, where the caprylic acid derivative is a free acid or a sodium salt, such as a monosodium salt or a disodium salt. In some aspects, the caprylic acid derivative is a hydrate or solvate. In some aspects, the caprylic acid derivative is an alcohol solvate. In some aspects, the alcohol solvate is an ethanol solvate. In some aspects, the ethanol solvate is a solvate of a salt. In some aspects, the ethanol solvate is an ethanol solvate of a monosodium salt. In some aspects, the ethanol solvate is an ethanol solvate of a disodium salt. In some aspects, the caprylic acid derivative is a hydrate. In some aspects, the hydrate is a hydrate of a salt. In some aspects, the hydrate is a hydrate of a monosodium salt. In some aspects, the hydrate is a hydrate of a disodium salt.

[0078] Thus, in some aspects, the caprylic acid derivative may include the free acid of 5-CNAC, a sodium salt of 5-CNAC, such as the monosodium salt of 5-CNAC, the disodium salt of 5-CAN, or a combination thereof. In some aspects, the caprylic acid derivative is a hydrate of 5-CNAC. In some aspects, the caprylic acid derivative is a solvate of 5-CNAC. In some aspects, the caprylic acid derivative is an alcohol solvate of 5-CNAC. In some aspects, the alcohol solvate is an ethanol solvate of CNAC. In some aspects, the ethanol solvate is a solvate of a salt of 5-CNAC. In some aspects, the ethanol solvate is an ethanol solvate of the monosodium salt of 5-CNAC. In some aspects, the ethanol solvate is an ethanol solvate of the disodium salt of 5-CNAC. In some aspects, the caprylic acid derivative is a hydrate of 5-CNAC. In some aspects, the hydrate is a hydrate of a salt of 5-CNAC. In some aspects, the hydrate is a hydrate of the monosodium salt of 5-CNAC. In some aspects, the hydrate is a hydrate of the disodium salt of 5-CNAC.

[0079] In some aspects, the caprylic acid derivatives include a single compound (e.g., SNAC or 5-CNAC). In other aspects, the caprylic acid derivatives include a combination of compounds (e.g., a combination of SNAC or 5-CNAC). In some aspects, the caprylic acid derivatives include C8, SNAC, 5-CNAC, 4-CNAB, 4-MOAC, SNAD, 4-HPO (8-(4-hydroxyphenoxy)octanoic acid), 5-PPA (5-phenyl pentanoate), 2-PHOD (8-(2-hydroxyphenoxy)octyldiethanolamine), 3-TBA (4-m-tolyloxybutyric acid), 2-HPOD (2-(5-pentanoic acid)-5-(2-hydroxyphenyl)-1,3,4-oxadiazole), 7-OPHA (7-oxo-7-phenylheptanoic acid), 3-HPSB (4-(3-hydroxyphenylsulfanyl)butyric acid), 4-IBOA ((4-isopropylbenzyloxy)acetic acid), 3-FPSB (4-(3-fluorophenylsulfanyl)butyric acid), or any combination thereof.

[0080] In some aspects, the caprylic acid derivatives of the present disclosure are compounds of formula I or formula II in which caprylic acid (C8) is replaced with other fatty acid moieties. Thus, in some aspects of the present disclosure, the C8 moiety of the caprylic acid derivatives disclosed herein can be optionally replaced with other fatty acid moieties, which are at least 6 carbon atoms in length, for example, 6-20 carbon atoms in length (C6-C20), optionally 6-18 carbon atoms in length (i.e., C6-C18), optionally 6-16 carbon atoms in length (i.e., C6-C16), optionally 6-14 carbon atoms in length (i.e., C6-C14), optionally 6-12 carbon atoms in length (i.e., C6-C12), and optionally 6-10 carbon atoms in length (i.e., C6-C10).

[0081] In some aspects, the C8 portion of any of the caprylic acid derivatives disclosed herein (e.g., 5-CNAC) can be replaced with a C6, C7, C9, C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 fatty acid moiety. In some aspects, the C8 portion of any of the caprylic acid derivatives disclosed herein (e.g., 5-CNAC) can be replaced with a C6, C7, C9, C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 unsaturated fatty acid moiety. In some aspects, the C8 portion of any of the caprylic acid derivatives disclosed herein (e.g., 5-CNAC) can be replaced with a C6, C7, C8, C9, C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 saturated fatty acid portion.

[0082] In some aspects, said fatty acid is essential fatty acid.In view of the beneficial health effects of certain essential fatty acid, the inclusion of such fatty acid in caprylic acid derivative can improve the therapeutic benefits of oral preparation.In some aspects, said essential fatty acid is the n-6 or n-3 essential fatty acid selected from the group consisting of linoleic acid, gamma linoleic acid, dihomo-gamma-linoleic acid, arachidonic acid, adrenic acid, docosapentaenoic acid n-6, alpha-linolenic acid or stearidonic acid.

[0083] Fatty acid chains vary widely in length and may be classified according to chain length. Medium chain fatty acids (MCFAs) include fatty acids having chains of about 6-12 carbons. In some aspects, the fatty acids are MCFAs. Long chain fatty acids (LCFAs) include fatty acids having chains of 13-20 carbons or longer. In some aspects, the fatty acids are LCFAs.

[0084] In some aspects, the fatty acid is a C6 chain. In some aspects, the fatty acid is a C7 chain. In some aspects, the fatty acid is a C8 chain. In some aspects, the fatty acid is a C9 chain. In some aspects, the fatty acid is a C10 chain. In some aspects, the fatty acid is a C11 chain. In some aspects, the fatty acid is a C12 chain. In some aspects, the fatty acid is a C13 chain. In some aspects, the fatty acid is a C14 chain. In some aspects, the fatty acid is a C15 chain. In some aspects, the fatty acid is a C16 chain. In some aspects, the fatty acid is a C17 chain. In some aspects, the fatty acid is a C18 chain. In some aspects, the fatty acid is a C19 chain. In some aspects, the fatty acid is a C20 chain.

[0085] In some aspects, the fatty acids are C6-C7, C6-C8, C6-C9, C6-C10, C6-C11, C6-C12, C6-C13, C6-C14, C6-C15, C6-C16, C6-C17, C6-C18, C 6~C19, C6~C20, C7~C8, C7~C9, C7~C10, C7~C11, C7~C12, C7~C13, C7~C14, C7~C15, C7~C16, C7~C17, C7~C18, C7~C19, C7~C20 , C8~C9, C8~C10, C8~C11, C8~C12, C8~C13, C8~C14, C8~C15, C8~C16, C8~C17, C8~C18, C8~C19, C8~C20, C9~C10, C9~C11, C9~ C12, C9~C13, C9~C14, C9~C15, C9~C16, C9~C17, C9~C18, C9~C19, C9~C20, C10~C11, C10~C12, C10~C13, C10~C14, C10~C15, C1 0~C16, C10~C17, C10~C18, C10~C19, C10~C20, C11~C12, C11~C13, C11~C14, C11~C15, C11~C16, C11~C17, C11~C18, C11~C19 , C11~C20, C12~C13, C12~C14, C12~C15, C12~C16, C12~C17, C12~C18, C12~C19, C12~C20, C13~C14, C13~C15, C13~C16, C13~ C17, C13-C18, C13-C19, C13-C20, C14-C15, C14-C16, C14-C17, C14-C18, C14-C19, C14-C20, C15-C16, C15-C17, C15-C18, C15-C19, C15-C20, C16-C17, C16-C18, C16-C19, C16-C20, C17-C18, C17-C19, C17-C20, C18-C19, C18-C20, or C19-C20 chain.

[0086] In some aspects, the fatty acid is a straight chain fatty acid. In other aspects, the fatty acid is a branched chain fatty acid. Suitable fatty acids include saturated straight chain fatty acids, saturated branched chain fatty acids, unsaturated fatty acids, hydroxy fatty acids, and polycarboxylic acids.

[0087] Examples of useful saturated branched chain fatty acids include those with an even number of carbon atoms, such as caproic acid (C6), caprylic acid (C8), capric acid (C10), lauric acid (C12), myristic acid (C14), palmitic acid (C16), or stearic acid (C18), and those with an odd number of carbon atoms, such as propionic acid (C3), n-valeric acid (C5), enanthic acid (C7), pelargonic acid (C9), hendecanoic acid (C11), tridecanoic acid (C13), pentadecanoic acid (C15), or heptadecanoic acid (C17).

[0088] Examples of suitable saturated branched chain fatty acids include isocaproic acid, isocaprylic acid, isocapric acid, isolauric acid, 11-methyldodecanoic acid, isomyristic acid, 13-methyl-tetradecanoic acid, isopalmitic acid, 15-methyl-hexadecanoic acid, or isostearic acid.Suitable saturated odd-carbon branched chain fatty acids include anteiso fatty acids that terminate in an isobutyl group, such as 6-methyl-octanoic acid, 8-methyl-decanoic acid, 10-methyl-dodecanoic acid, 12-methyl-tetradecanoic acid, or 14-methyl-hexadecanoic acid.

[0089] Examples of suitable unsaturated fatty acids include 4-decenoic acid, caproic acid, 4-dodecenoic acid, 5-dodecenoic acid, lauroleic acid, 4-tetradecenoic acid, 5-tetradecenoic acid, 9-tetradecenoic acid, palmitoleic acid, 6-octadecanoic acid, oleic acid, and the like.

[0090] Examples of suitable hydroxy fatty acids include α-hydroxylauric acid, α-hydroxymyristic acid, α-hydroxypalmitic acid, α-hydroxystearic acid, ω-hydroxylauric acid, α-hydroxyarachic acid, 9-hydroxy-12-octadecanoic acid, ricinoleic acid, 9-hydroxy-trans-10,12-octadecadienoic acid, 9,10-dihydroxystearic acid, 12-hydroxystearic acid, and the like.

[0091] Examples of suitable polycarboxylic acids include adipic acid, pimelic acid, suberic acid, azelaic acid, sebacic acid, etc. In some aspects, each fatty acid is independently selected from valeric acid, enanthic acid, pelargonic acid, undecylic acid, lauric acid, tridecylic acid, myristic acid, pentadecylic acid, palmitic acid, margaric acid, or stearic acid. In some aspects, each fatty acid is independently selected from alpha-linolenic acid, stearidonic acid, eicosapentaenoic acid, docosahexaenoic acid, linoleic acid, gamma linoleic acid, dihomo-gamma linoleic acid, arachidonic acid, docosatetraenoic acid, palmitoleic acid, vaccenic acid, paulinitanic acid, oleic acid, elaidic acid, bosseopentaenoic acid, or other mono- or polyunsaturated fatty acids.

[0092] In some aspects, the caprylic acid derivative comprises or consists of N-(8-(2-hydroxybenzoyl)amino)caprylic acid, as shown below: [ka]

[0093] In some aspects, the caprylic acid derivative comprises a salt of N-(8-(2-hydroxybenzoyl)amino)caprylic acid. In some aspects, the caprylic acid derivative comprises a solvate of N-(8-(2-hydroxybenzoyl)amino)caprylic acid. In some aspects, the caprylic acid derivative comprises a hydrate of N-(8-(2-hydroxybenzoyl)amino)caprylic acid. In some aspects, the caprylic acid derivative comprises a salt, hydrate, or solvate of N-(8-(2-hydroxybenzoyl)amino)caprylic acid, or any combination thereof.

[0094] In some aspects, the salt of N-(8-(2-hydroxybenzoyl)amino)caprylic acid is selected from the group consisting of sodium, potassium, calcium salts of N-(8-(2-hydroxybenzoyl)amino)caprylic acid, and any combination thereof. In some aspects, the salt of N-(8-(2-hydroxybenzoyl)amino)caprylic acid is a sodium salt. In some aspects, the salt of N-(8-(2-hydroxybenzoyl)amino)caprylic acid is a disodium salt. In some aspects, the salt of N-(8-(2-hydroxybenzoyl)amino)caprylic acid is a monosodium salt (salcaprozate sodium 203787-91-1, SNAC, sodium 8-(2-hydroxybenzamido)octanoate) as shown below: [ka]

[0095] In some aspects, the caprylic acid derivatives include 5-CNAC (N-(5-chlorosalicyloyl)-8-aminocaprylic acid), as shown below: [ka]

[0096] In some aspects, the caprylic acid derivative comprises a salt of N-(5-chlorosalicyloyl)-8-aminocaprylic acid. In some aspects, the caprylic acid derivative comprises a solvate of N-(5-chlorosalicyloyl)-8-aminocaprylic acid. In some aspects, the caprylic acid derivative comprises a hydrate of N-(5-chlorosalicyloyl)-8-aminocaprylic acid. In some aspects, the caprylic acid derivative comprises a salt, hydrate, or solvate of N-(5-chlorosalicyloyl)-8-aminocaprylic acid, or any combination thereof.

[0097] In some aspects, the salt of N-(5-chlorosalicyloyl)-8-aminocaprylic acid is selected from the group consisting of sodium salt, potassium salt, calcium salt, and any combination thereof of N-(5-chlorosalicyloyl)-8-aminocaprylic acid. In some aspects, the salt of N-(5-chlorosalicyloyl)-8-aminocaprylic acid is a sodium salt. In some aspects, the salt of N-(5-chlorosalicyloyl)-8-aminocaprylic acid is a disodium salt. In some aspects, the salt of N-(5-chlorosalicyloyl)-8-aminocaprylic acid is a monosodium salt.

[0098] In some aspects, the caprylic acid derivative includes 4-CNAB (4-[(4-chloro-2-hydroxy-benzoyl)amino]butanoic acid; salclobuzate), as shown below. [ka]

[0099] In some aspects, the caprylic acid derivative comprises a salt of 4-[(4-chloro-2-hydroxy-benzoyl)amino]butanoic acid. In some aspects, the caprylic acid derivative comprises a solvate of 4-[(4-chloro-2-hydroxy-benzoyl)amino]butanoic acid. In some aspects, the caprylic acid derivative comprises a hydrate of 4-[(4-chloro-2-hydroxy-benzoyl)amino]butanoic acid. In some aspects, the caprylic acid derivative comprises a salt, hydrate, or solvate of 4-[(4-chloro-2-hydroxy-benzoyl)amino]butanoic acid, or any combination thereof.

[0100] In some aspects, the salt of 4-[(4-chloro-2-hydroxy-benzoyl)amino]butanoic acid is selected from the group consisting of sodium, potassium, calcium salts of 4-[(4-chloro-2-hydroxy-benzoyl)amino]butanoic acid, and any combination thereof. In some aspects, the salt of 4-[(4-chloro-2-hydroxy-benzoyl)amino]butanoic acid is a sodium salt. In some aspects, the salt of 4-[(4-chloro-2-hydroxy-benzoyl)amino]butanoic acid is a disodium salt. In some aspects, the salt of 4-[(4-chloro-2-hydroxy-benzoyl)amino]butanoic acid is a monosodium salt.

[0101] In some aspects, the caprylic acid derivatives include 4-MOAC (N-(8-[4-methoxy-chloro-2-hydroxybenzoyl-amino)octanoic acid), as shown below: [ka]

[0102] In some aspects, the caprylic acid derivative comprises a salt of N-(8-[4-methoxy-chloro-2-hydroxybenzoyl]-amino)octanoic acid. In some aspects, the caprylic acid derivative comprises a solvate of N-(8-[4-methoxy-chloro-2-hydroxybenzoyl]-amino)octanoic acid. In some aspects, the caprylic acid derivative comprises a hydrate of N-(8-[4-methoxy-chloro-2-hydroxybenzoyl]-amino)octanoic acid. In some aspects, the caprylic acid derivative comprises a salt, hydrate, or solvate of N-(8-[4-methoxy-chloro-2-hydroxybenzoyl]-amino)octanoic acid, or any combination thereof.

[0103] In some aspects, the salt of N-(8-[4-methoxy-chloro-2-hydroxybenzoyl]-amino)octanoic acid is selected from the group consisting of sodium salt, potassium salt, calcium salt, and any combination thereof of N-(8-[4-methoxy-chloro-2-hydroxybenzoyl]-amino)octanoic acid. In some aspects, the salt of N-(8-[4-methoxy-chloro-2-hydroxybenzoyl]-amino)octanoic acid is a sodium salt. In some aspects, the salt of N-(8-[4-methoxy-chloro-2-hydroxybenzoyl]-amino)octanoic acid is a disodium salt. In some aspects, the salt of N-(8-[4-methoxy-chloro-2-hydroxybenzoyl]-amino)octanoic acid is a monosodium salt.

[0104] In some aspects, the caprylic acid derivative comprises SNAD (N-(10-[2-hydroxybenzoyl]-amino)decanoic acid), as shown below: [ka]

[0105] In some aspects, the caprylic acid derivative comprises a salt of N-(10-[2-hydroxybenzoyl]-amino)decanoic acid. In some aspects, the caprylic acid derivative comprises a solvate of N-(10-[2-hydroxybenzoyl]-amino)decanoic acid. In some aspects, the caprylic acid derivative comprises a hydrate of N-(10-[2-hydroxybenzoyl]-amino)decanoic acid. In some aspects, the caprylic acid derivative comprises a salt, hydrate, or solvate of N-(10-[2-hydroxybenzoyl]-amino)decanoic acid, or any combination thereof.

[0106] In some aspects, the salt of N-(10-[2-hydroxybenzoyl]-amino)decanoic acid is selected from the group consisting of sodium salt, potassium salt, calcium salt, and any combination thereof of N-(10-[2-hydroxybenzoyl]-amino)decanoic acid. In some aspects, the salt of N-(10-[2-hydroxybenzoyl]-amino)decanoic acid is a sodium salt. In some aspects, the salt of N-(10-[2-hydroxybenzoyl]-amino)decanoic acid is a disodium salt. In some aspects, the salt of N-(10-[2-hydroxybenzoyl]-amino)decanoic acid is a monosodium salt.

[0107] In some aspects, the caprylic acid derivative comprises a compound presented in Figure 1A, Figure 1B, or Figure 2. In some aspects, the caprylic acid derivative comprises a salt of a compound presented in Figure 1A, Figure 1B, or Figure 2. In some aspects, the caprylic acid derivative comprises a solvate of a compound presented in Figure 1A, Figure 1B, or Figure 2. In some aspects, the caprylic acid derivative comprises a hydrate of a compound presented in Figure 1A, Figure 1B, or Figure 2. In some aspects, the caprylic acid derivative comprises a salt, hydrate, or solvate of a compound presented in Figure 1A, Figure 1B, or Figure 2, or any combination thereof.

[0108] In some aspects, the salt of the compound presented in Figure 1A, Figure 1B, or Figure 2 is selected from the group consisting of a sodium salt, a potassium salt, a calcium salt, and any combination thereof, of the compound presented in Figure 1A, Figure 1B, or Figure 2. In some aspects, the salt of the compound presented in Figure 1A, Figure 1B, or Figure 2 is a sodium salt. In some aspects, the salt of the compound presented in Figure 1A, Figure 1B, or Figure 2 is a disodium salt. In some aspects, the salt of the compound presented in Figure 1A, Figure 1B, or Figure 2 is a monosodium salt. U.S. Patent Nos. 5,650,386A, 6,399,798B2, 7,384,982B2, 7,659,311B2, 8,003,697B2, 8,207,227B2, 8,658,695B2, 7,544,833B2, 7,659,311, 8,003,697, 8,207,227, 8,658,695, 7,384,982, 9,278,123B2 Nos. 10086047B2, 8435946B2, 8748383B2, and 7569539B2; and U.S. Patent Application Nos. 20180360918A1, 20110092426A1, and 20150283212A1, all of which are incorporated by reference in their entireties.

[0109] In some aspects, the caprylic acid derivative comprises SNAC, 5-CNAC, a solvate of a salt of a compound of formula I or formula II, or a combination thereof. In some aspects, the caprylic acid derivative is a solvate of a salt of 5-CNAC, such as a solvate of the monosodium or disodium salt of 5-CNAC, or a combination thereof. The term "solvate" as used herein includes, but is not limited to, a molecular or ionic complex of a solvent molecule or ion with a molecule or ion of the caprylic acid derivative or its salt, or a hydrate or solvate thereof.

[0110] In some aspects, the caprylic acid derivative comprises SNAC, 5-CNAC, a hydrate of a salt of a compound of Formula I or Formula II, or a combination thereof. In some aspects, the caprylic acid derivative is a hydrate of a salt of 5-CNAC, such as a hydrate of the monosodium or disodium salt of 5-CNAC, or a combination thereof. As used herein, the term "hydrate" refers to (i) a substance that contains water in combination with said molecular form; and (ii) a crystalline substance containing one or more water of crystallization molecules or a crystalline substance containing free water; These include, but are not limited to:

[0111] In some aspects, the caprylic acid derivatives include solvates of SNAC, 5-CNAC, or salts of compounds of formula I or II, where the salts are sodium, potassium, calcium, or combinations thereof. In some aspects, the caprylic acid derivatives include solvates of SNAC, 5-CNAC, or salts of compounds of formula I or II, where the salts are sodium salts.

[0112] In some aspects, the caprylic acid derivative comprises a solvate of SNAC, 5-CNAC, or a salt of a compound of formula I or formula II, where the salt is a monosodium salt. In some aspects, the caprylic acid derivative comprises a sodium salt of a compound of formula I. In some aspects, the caprylic acid derivative comprises a sodium salt of a compound of formula II. In some aspects, the caprylic acid derivative comprises a sodium salt of SNAC, e.g., monosodium SNAC. In some aspects, the caprylic acid derivative comprises a sodium salt of 5-CNAC, e.g., monosodium 5-CNAC or disodium 5-CNAC.

[0113] In some aspects, the caprylic acid derivative comprises an alcohol solvate of a salt of C8, C10, SNAC, or 5-CNAC, where the salt is a sodium salt. In some aspects, the caprylic acid derivative comprises an alcohol solvate of a salt of C8, C10, SNAC, or 5-CNAC, where the salt is a monosodium salt. In some aspects, the caprylic acid derivative comprises a hydrate of a salt of C8, C10, SNAC, or 5-CNAC, where the salt is a sodium salt. In some aspects, the caprylic acid derivative comprises a hydrate of a salt of C8, C10, SNAC, or 5-CNAC, where the salt is a monosodium salt. In some aspects, the caprylic acid derivative comprises a hydrate of a salt of C8, C10, SNAC, or 5-CNAC, where the salt is a sodium salt, and the hydrate is a monohydrate.

[0114] Methods for preparing sodium salts, alcohol solvates, and hydrates are described, for example, in International Patent Publication WO00 / 059863; the entire contents of this reference are incorporated herein by reference. For example, the method for forming anhydrous sodium salts may involve evaporating or drying an ethanol solvate to prepare the sodium salt from the ethanol solvate by methods known in the art. Drying is typically carried out at a temperature of about 80°C to about 120°C, for example, about 85°C to about 90°C. In some aspects, drying is carried out at about 85°C. The drying step is typically carried out at a pressure of about 660 mmHg (8.8 kPa) or greater. The anhydrous sodium salt typically contains less than about 5% by weight of ethanol, and preferably less than about 2% by weight of ethanol, based on 100% total weight of the anhydrous sodium salt.

[0115] The sodium salt of the caprylic acid derivative disclosed herein can also be prepared by making a slurry of the delivery agent in water and adding aqueous sodium hydroxide, sodium alkoxide, etc. Suitable sodium alkoxides include, but are not limited to, sodium methoxide, sodium ethoxide, and combinations thereof.Another method of preparing sodium salt is to react the delivery agent with sodium hydroxide to obtain sodium salt.

[0116] The sodium salt can be isolated as a solid by concentrating the solution containing the sodium salt by vacuum distillation into a thick paste.The paste can be dried in a vacuum oven to obtain the sodium salt of the caprylic acid derivative as a solid.The solid can also be isolated by spray drying an aqueous solution of disodium salt.The caprylic acid derivative disclosed herein can be prepared by methods known in the art, for example, as described above in U.S. Patent Nos. 5,773,647 and 5,866,536; these references are incorporated herein by reference in their entirety.

[0117] The ethanol solvates of the caprylic acid derivatives (e.g., C8, C10, SNAC, 5-CNAC, or any combination thereof) disclosed herein include, but are not limited to, molecular or ionic complexes of the ethanol solvent molecules or ions with the molecules or ions of the sodium salt of the delivery agent.Typically, the ethanol solvates contain about one ethanol molecule or ion for each molecule of the sodium salt of the caprylic acid derivative.

[0118] The ethanol solvate of the sodium salt of the caprylic acid derivative can be prepared by dissolving the caprylic acid derivative in ethanol.The caprylic acid derivative / ethanol solution is then reacted with a molar excess of sodium-containing salt (such as monosodium-containing salt) relative to the caprylic acid derivative (i.e., for each mole of delivery agent, there is more than one mole of sodium cation) to obtain the ethanol solvate.Suitable monosodium salts include, but are not limited to, sodium hydroxide; sodium alkoxides (such as sodium methoxide and sodium ethoxide); and any combination of the above.Generally, the reaction is carried out at or below the reflux temperature of the mixture (such as ambient temperature).The resulting slurry is then concentrated by atmospheric distillation, the concentrated slurry is cooled, and the ethanol solvate is recovered by methods known in the art, such as by filtering the solid matter.The recovered solid matter can then be vacuum dried to obtain the ethanol solvate.

[0119] The hydrate of the sodium salt of the caprylic acid derivative may be prepared by drying the ethanol solvate to form anhydrous disodium salt and hydrating the anhydrous sodium salt as described above. In some aspects, the monohydrate of the sodium salt is formed. Anhydrous sodium salts are highly hygroscopic, so exposure to moisture in air leads to the formation of the hydrate. In general, the hydration step is carried out in an environment with a relative humidity of at least 50% at about ambient temperature to about 50°C, preferably ambient temperature to about 30°C. Alternatively, the anhydrous sodium salt may be hydrated with steam.

[0120] The caprylic acid derivatives of the present disclosure typically contain an effective amount of one or more caprylic acid derivatives disclosed herein (e.g., SNAC, 5-CNAC, or any combination thereof); i.e., a sufficient amount to deliver an active agent (e.g., ASO such as CIVI008) to obtain a desired effect. Generally, the caprylic acid derivative (e.g., SNAC, 5-CNAC, or any combination thereof) is present in an amount of about 2.5% to about 99.4% by weight. In some aspects, the caprylic acid derivative (e.g., SNAC, 5-CNAC, or any combination thereof) is present in an amount of about 15% to about 75% by weight. In some aspects, the caprylic acid derivative (e.g., SNAC, 5-CNAC, or any combination thereof) is present in an amount of at least about 25%, at least about 30%, or at least about 35% by weight, and not more than about 60% or about 70%. Thus, in some aspects, the caprylic acid derivative (e.g., SNAC, 5-CNAC, or any combination thereof) is present in an amount of at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, or at least about 70% by weight. In some aspects, the caprylic acid derivative (e.g., SNAC, 5-CNAC, or any combination thereof) is present in an amount of about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, or about 70% by weight.

[0121] In some aspects, the caprylic acid derivative (e.g., 5-CNAC) can interact with the oligonucleotide by non-covalent bond. In some aspects, the caprylic acid derivative (e.g., 5-CNAC) is non-covalently attached to the oligonucleotide disclosed herein. In some aspects, the caprylic acid derivative (e.g., 5-CNAC) is non-covalently attached to the 5' end of the oligonucleotide. In some aspects, the caprylic acid derivative (e.g., 5-CNAC) is non-covalently attached to the 3' end of the oligonucleotide. In some aspects, one caprylic acid derivative (e.g., 5-CNAC) can be covalently attached to the 5' end of the oligonucleotide, and a second caprylic acid derivative (e.g., 5-CNAC) can be covalently attached to the 3' end of the oligonucleotide. In some aspects, one caprylic acid derivative (e.g., 5-CNAC) can be covalently attached to a site that is neither the 5' end nor the 3' end of the oligonucleotide. In some aspects, when multiple caprylic acid derivative units are attached to an oligonucleotide, each caprylic acid derivative unit can be the same. In some aspects, when multiple caprylic acid derivative units are attached to an oligonucleotide, at least one caprylic acid derivative unit can be different. In some aspects, when multiple caprylic acid derivative units are attached to an oligonucleotide, all caprylic acid derivative units are different. In some aspects, one caprylic acid derivative (e.g., 5-CNAC) can be covalently attached to an oligonucleotide via a spacer or linker. In some aspects, one caprylic acid derivative (e.g., 5-CNAC) can be covalently attached to an oligonucleotide via a cleavable linker. In some aspects, the cleavable linker is a pH-sensitive cleavable linker. In some aspects, the cleavable linker can be cleaved by enzymes, such as enzymes present in the digestive tract (such as enzymes present in the stomach or small intestine).

[0122] In some aspects, the cleavable bond can comprise an oxidation-reduction cleavable linker (e.g., a disulfide bond), a reactive oxygen species cleavable linker (e.g., a thioketal cleavable linker), a pH-dependent cleavable linker (e.g., a low pH destabilized hydrazone bond), an enzyme-cleavable linker, a protease-cleavable linker, an esterase-cleavable linker, a phosphatase-cleavable linker, an autolytic linker (e.g., p-aminobenzylcarbamate, pABC), or any combination thereof.

[0123] In some aspects, the cleavable linker comprises or consists of a cinnamyl group, a naphthyl group, a biphenyl group, a heterocycle, a monoaromatic group, a coumarin, a furan, a thiophene, a thiazole, an oxazole, an isoxazole, a pyrrole, a pyrazole, a pyridine, an imidazone, a triazole, or any combination thereof. In some aspects, the cleavable linker comprises or consists of a dipeptide, a tripeptide, a tetrapeptide, a pentapeptide, or a hexapeptide. In some aspects, the dipeptide is selected from the group consisting of valine-alanine, valine-citrulline, phenylalanine-lysine, N-methylvaline-citrulline, cyclohexylalanine-lysine, and beta-alanine-lysine. In some aspects, the tripeptide is glutamic acid-valine-citrulline. In some aspects, the cleavable linker comprises valine-alanine-p-aminobenzylcarbamate or valine-citrulline-p-aminobenzylcarbamate.

[0124] In some aspects, the disclosure provides an example construct in the following schema: [CAD]m-[L]n-oligonucleotide Schema A Oligonucleotide-[L]o-[CAD]p Schema B [CAD]m-[L]n-oligonucleotide-[L]o-[CAD]p Schema C where: CAD is a caprylic acid derivative, e.g., 5-CNAC; L is a linker, e.g., a cleavable or non-cleavable linker; and m, n, o, and p are independently integers of 0 to 5.

[0125] In oligonucleotides containing multiple strands, the oral delivery agent (e.g., 5-CNAC) can be attached to either end of the nucleotide sequence, e.g., the 5' end or the 3' end, or both. Thus, in some aspects, the disclosure provides constructs according to the following scheme: [CAD]m-[L]n-oligonucleotide Schema D [CAD]o-[L]p-oligonucleotides Oligonucleotide-[L]m-[CAD]n Schema E Oligonucleotide-[L]o-[CAD]p [CAD]m-[L]n-oligonucleotide Schema F Oligonucleotide-[L]o-[CAD]p Oligonucleotide-[L]m-[CAD]n Schema G [CAD]o-[L]p-oligonucleotides [CAD]m-[L]n-oligonucleotide-[L]o-[CAD]p Schema H [CAD]q-[L]r-oligonucleotide-[L]s-[CAD]t [CAD]m-[L]n-oligonucleotide Schema I [CAD]o-[L]p-oligonucleotide-[L]q-[CAD]r [CAD]m-[L]n-oligonucleotide-[L]o-[CAD]p Schema J [CAD]q-[L]r-oligonucleotides Oligonucleotide-[L]m-[CAD]n Schema K [CAD]o-[L]p-oligonucleotide-[L]q-[CAD]r [CAD]m-[L]n-oligonucleotide-[L]o-[CAD]p Schema L Oligonucleotide-[L]q-[CAD]r where: CAD is a caprylic acid derivative, e.g., 5-CNAC; L is a linker, e.g., a cleavable or non-cleavable linker; and m, n, o, and p are independently integers of 0 to 5.

[0126] In some aspects, m, n, o, p, q, r, s, or t is 1. In some aspects, m is 0. In some aspects, m is 1. In some aspects, m is greater than 1. In some aspects, n is 0. In some aspects, n is 1. In some aspects, n is greater than 1. In some aspects, o is 0. In some aspects, o is 1. In some aspects, o is greater than 1. In some aspects, p is 0. In some aspects, p is 1. In some aspects, p is greater than 1. In some aspects, q is 0. In some aspects, q is 1. In some aspects, q is greater than 1. In some aspects, r is 0. In some aspects, r is 1. In some aspects, r is greater than 1. In some aspects, s is 0. In some aspects, s is 1. In some aspects, s is greater than 1. In some aspects, t is 0. In some aspects, t is 1. In some aspects, t is greater than 1. Exemplary constructs are shown in FIG.

[0127] When multiple CADs and Ls are present in a construct, they can be the same or different. Thus, for example, in a construct of Schema C, both CAD units can be the same (e.g., 5-CNAC) or different. In a construct of Schema C, both L units can be the same or different.

[0128] In some aspects, a branching unit [B] is present between [CAD] and [L], or between [L] and the oligonucleotide. In some aspects, the branching unit [B] provides 2, 3, or 4 branch points; i.e., the [B] branching unit can link two [CAD] units, three [CAD] units, or four [CAD] units; these units are not linked to each other, but are linked to the construct via the [B] branching unit.

[0129] In some aspects, the caprylic acid derivative, e.g., 5-CNAC, can be covalently attached to a linking loop, e.g., a loop that links the antisense and sense strands of a hairpin (e.g., a hairpin in an shRNA). In some aspects, the caprylic acid derivative, e.g., 5-CNAC, can be attached to an oligonucleotide via a non-terminal position, i.e., a site different from the 5' and 3' ends.

[0130] In some aspects, the caprylic acid derivative (e.g., 5-CNAC) is an oral delivery agent.In some aspects, the oral delivery agent (e.g., 5-CNAC) is covalently linked to the antisense oligonucleotide (e.g., the oligonucleotide part of CIVI008 or ISIS863633 that does not have GalNAc moiety) or antisense oligonucleotide conjugate (e.g., CIVI008 or ISIS863633) disclosed herein, either directly or via a linker or a combination of linkers, and wherein the linker or combination of linkers can include a cleavable linker.In some aspects, the oral delivery agent (e.g., 5-CNAC) is covalently linked to the antisense oligonucleotide, either directly or via a spacer.

[0131] In some aspects, the oral delivery agent (e.g., 5-CNAC) is covalently linked to the non-nucleotide or non-polynucleotide moiety of the antisense oligonucleotide conjugate disclosed herein (e.g., the GalNAc moiety of CIVI008 or ISIS863633) directly or via a linker, spacer, or combination thereof. Thus, in some aspects, the oral delivery agent (e.g., 5-CNAC) or combination thereof is linked to a GalNAc conjugate moiety that includes, for example, a cleavable linker. Cleavage of the cleavable linker or combination thereof can release both GalNAc and the oral delivery agent (e.g., 5-CNAC) from the complex. In other aspects, the GalNAc moiety and the oral delivery agent are linked via two separate cleavable linkers, which can be the same or different types. In some aspects, both cleavable linkers can be cleaved by the same mechanism (e.g., two pH-sensitive linkers). In other aspects, each cleavable linker may be cleaved by a different mechanism (e.g., one linker may be a pH sensitive linker and the second linker may be cleaved enzymatically, e.g., by esterases).

[0132] In some aspects, the oral delivery agent (e.g., 5-CNAC) can be covalently linked to the 5' of the oligonucleotide disclosed herein, e.g., ASO. In some aspects, the oral delivery agent (e.g., 5-CNAC) can be covalently linked to the 3' of the oligonucleotide disclosed herein, e.g., ASO. In some aspects, the oral delivery agent (e.g., 5-CNAC) can be covalently linked directly (e.g., to the 5' or 3' nucleotide) to the 5' or 3' of the oligonucleotide disclosed herein, e.g., to the ASO. In some aspects, the oral delivery agent (e.g., 5-CNAC) can be indirectly covalently linked to the 5' or 3' of the oligonucleotide disclosed herein, e.g., to the 5' or 3' nucleotide of the ASO, via a linker, spacer, or combination thereof.

[0133] In some aspects, the oral delivery agent (e.g., 5-CNAC) can be covalently linked to the antisense oligonucleotide conjugate disclosed herein, such as CIVI008. In some aspects, the oral delivery agent (e.g., 5-CNAC) can be covalently linked to the nucleic acid portion of the antisense oligonucleotide conjugate disclosed herein. In some aspects, the oral delivery agent (e.g., 5-CNAC) can be covalently linked to the non-nucleotide or non-polynucleotide portion (e.g., GalNAc portion) of the antisense oligonucleotide conjugate disclosed herein, such as CIVI008 or its non-conjugated form (i.e., does not have a GalNAc portion).

[0134] In some aspects, the oral delivery agent (e.g., 5-CNAC) can be covalently linked to the antisense oligonucleotide conjugate disclosed herein, such as ASO, via a linker, spacer, or a combination thereof.In some aspects, the oral delivery agent (e.g., 5-CNAC) can be covalently linked to the nucleic acid portion of the antisense oligonucleotide conjugate disclosed herein, such as CIVI008, via a linker, spacer, or a combination thereof.In some aspects, the oral delivery agent (e.g., 5-CNAC) can be covalently linked to the non-nucleotide or non-polynucleotide portion (e.g., GalNAc portion) of the antisense oligonucleotide conjugate disclosed herein, via a linker, spacer, or a combination thereof.

[0135] In some aspects, a nucleic acid therapeutic agent, such as an antisense oligonucleotide (ASO), a small interfering RNA (siRNA), a small hairpin RNA (shRNA), a DNA or RNA aptamer, a gene therapy vector, a microRNA (miRNA), an anti-microRNA (antimiR), a DNA or RNA decoy, a CpG oligonucleotide, a ribozyme, a circular RNA (circRNA), or any other therapeutic oligonucleotide known in the art, can be covalently attached to two or more of the oral delivery agents disclosed herein, such as caprylic acid derivatives (SNAC, 5-CNAC, SNAD, 4-CNAB, 4-MOAC, 4-HPO, 3-TBA, 3-HPSB, 5-PPA, 2-HPOD, 4-IBOA, 2-PHOD, 7-OPHA, 3-FPSB, a molecule disclosed in FIG. 1A, FIG. 1B, or FIG. 2, a derivative thereof, a pharma- ceutical acceptable hydrate, solvate, or salt thereof, or any combination thereof). In some aspects, the nucleic acid therapeutic agent is not linked to a GalNAc moiety.

[0136] In some aspects, a nucleic acid therapeutic agent, e.g., ASO, siRNA, shRNA, DNA or RNA aptamers, gene therapy vectors, miRNA, miRNA mimics, antimiR, DNA or RNA decoys, CpG oligonucleotides, or any therapeutic or diagnostic oligonucleotide known in the art, is covalently linked at different sites to two or more oral delivery agents disclosed herein, e.g., caprylic acid derivatives (SNAC, 5-CNAC, SNAD, 4-CNAB, 4-MOAC, 4-HPO, 3-TBA, 1A, 1B, or 2, its derivatives, pharma- ceutically acceptable hydrates, solvates, or salts thereof, or any combination thereof) (e.g., one or more oral delivery agents covalently linked to the nucleic acid moiety and one or more oral delivery agents covalently linked to a heterologous moiety, such as a GalNAc moiety; or one or more oral delivery agents covalently linked to a nucleic acid that is not linked to a delivery moiety, such as a GalNAc moiety).

[0137] A composition for oral delivery can be prepared, for example, by mixing the following: (i) a nucleic acid therapeutic, e.g., an ASO, an siRNA, an shRNA, a DNA or RNA aptamer, a gene therapy vector, an miRNA, an miRNA mimic, an antimiR, a DNA or RNA decoy, a CpG oligonucleotide, or any therapeutic or diagnostic oligonucleotide known in the art (e.g., CIVI008 or an unconjugated form thereof, i.e., does not contain a GalNAc moiety), wherein the nucleic acid therapeutic may or may not contain an attached GalNAc moiety; and (ii) Oral delivery agents (e.g., 5-CNAC), wherein the oral delivery agent comprises a caprylic acid derivative (such as SNAC, 5-CNAC, SNAD, 4-CNAB, 4-MOAC, 4-HPO, 3-TBA, 3-HPSB, 5-PPA, 2-HPOD, 4-IBOA, 2-PHOD, 7-OPHA, 3-FPSB, a molecule disclosed in FIG. 1A, FIG. 1B, or FIG. 2, a derivative thereof, a pharma- ceutically acceptable hydrate, solvate, or salt thereof, or any combination thereof).

[0138] Accordingly, the present disclosure provides a method of making a composition for oral delivery (e.g., a pill or tablet), comprising mixing (i) and (ii): (i) a nucleic acid therapeutic, e.g., an ASO, an siRNA, an shRNA, a DNA or RNA aptamer, a gene therapy vector, an miRNA, an miRNA mimic, an antimiR, a DNA or RNA decoy, a CpG oligonucleotide, or any therapeutic or diagnostic oligonucleotide known in the art (e.g., CIVI008 or an unconjugated form thereof, i.e., does not contain a GalNAc moiety), wherein the nucleic acid therapeutic may or may not contain an attached GalNAc moiety; and (ii) Oral delivery agents (e.g., 5-CNAC), wherein the oral delivery agent comprises a caprylic acid derivative (such as SNAC, 5-CNAC, SNAD, 4-CNAB, 4-MOAC, 4-HPO, 3-TBA, 3-HPSB, 5-PPA, 2-HPOD, 4-IBOA, 2-PHOD, 7-OPHA, 3-FPSB, a molecule disclosed in FIG. 1A, FIG. 1B, or FIG. 2, a derivative thereof, a pharma- ceutically acceptable hydrate, solvate, or salt thereof, or any combination thereof).

[0139] In some aspects, when the caprylic acid derivative is covalently attached to an oligonucleotide, such as a nucleic acid therapeutic agent (such as an ASO, siRNA, shRNA, DNA or RNA aptamer, gene therapy vector, miRNA, miRNA mimic, antimiR, DNA or RNA decoy, CpG oligonucleotide, or any therapeutic or diagnostic oligonucleotide known in the art (e.g., CIVI008), the attachment of the caprylic acid derivative (e.g., 5-CNAC) can be performed by solid phase synthesis. Thus, in some aspects, the present disclosure provides any of the caprylic acid derivatives disclosed herein, such as 5-CNAC or its derivatives, or phosphoramidite forms, such as the compounds disclosed in Figure 1A, Figure 1B, Figure 2, or any combination thereof. Thus, the present disclosure provides 5-CNAC phosphoramidites. Also provided are phosphoramidite forms of caprylic acid derivatives (such as SNAC, 5-CNAC, SNAD, 4-CNAB, 4-MOAC, 4-HPO, 3-TBA, 3-HPSB, 5-PPA, 2-HPOD, 4-IBOA, 2-PHOD, 7-OPHA, 3-FPSB, molecules disclosed in Figure 1A, Figure 1B, or Figure 2). In some aspects, the disclosure provides kits including 5-CNAC phosphoramidites and instructions for conjugating such 5-CNAC phosphoramidites to oligonucleotides.

[0140] In some aspects, the disclosure provides a method of making a therapeutic oligonucleotide conjugate, comprising covalently attaching at least one caprylic acid derivative (e.g., 5-CNAC) disclosed herein to an oligonucleotide oligomer (e.g., an antisense oligonucleotide). In some aspects, the disclosure provides a method of making a therapeutic oligonucleotide conjugate, comprising covalently or non-covalently attaching at least one caprylic acid derivative (e.g., 5-CNAC) disclosed herein to an oligonucleotide oligomer of SEQ ID NO: 134 (oligonucleotide oligomer in CIVI008, sepadacrusen).

[0141] In some aspects, the oligonucleotide comprises, consists of, or consists essentially of a single stranded oligonucleotide of 10-100 contiguous nucleotides in length. In some aspects, the oligonucleotide comprises, consists of, or consists essentially of a single stranded oligonucleotide of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 , 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides in length.

[0142] In some aspects, the oligonucleotides are of a contiguous length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 , 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides in length.

[0143] In some aspects, the oligonucleotides have a contiguous length of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, In some embodiments, the single stranded oligonucleotide comprises at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, or at least 100 nucleotides.

[0144] In some aspects, the oligonucleotides have a contiguous length of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, and / or at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, or at least 100 nucleotides.

[0145] In some aspects, the oligonucleotide has a contiguous length of about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, about 45 to about 50, about 50 to about 55, about 55 to about 60, about 60 to about 65, about 65 to about 70, about 70 to about 75, about 75 to about 80, about 80 to about 90 about 85, about 85 to about 90, about 90 to about 95, about 95 to about 100, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 15 to about 25, about 25 to about 35, about 35 to about 45, about 45 to about 55, about 55 to about 65, about 65 to about 75, about 75 to about 85, about 85 to about 95, about 10 to about 25, about 15 to about 30, about 20 to about 35, about 25 to about 40, about 30 to about 45, about 35 to about 50, about 40 to about 55, about 45 to about 60, about 50 to about 65, about 55 to about 70, about 60 to about 75, about 65 to about 80, about 70 to about 85, about 75 to about 90, about 80 to about 95, about 85 to about 100 , about 10 to about 30, about 15 to about 35, about 20 to about 40, about 25 to about 45, about 30 to about 50, about 35 to about 55, about 40 to about 60, about 45 to about 65, about 50 to about 70, about 55 to about 75, about 60 to about 80, about 65 to about 85, about 70 to about 90, about 75 to about 95, or about 80 to about 100 nucleotides.

[0146] In some aspects, the oligonucleotide has a contiguous length of about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, about 45 to about 50, about 50 to about 55, about 55 to about 60, about 60 to about 65, about 65 to about 70, about 70 to about 75, about 75 to about 80, about 80 to about 90 about 85, about 85 to about 90, about 90 to about 95, about 95 to about 100, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 15 to about 25, about 25 to about 35, about 35 to about 45, about 45 to about 55, about 55 to about 65, about 65 to about 75, about 75 to about 85, about 85 to about 95, about 10 to about 25, about 15 to about 30, about 20 to about 35, about 25 to about 40, about 30 to about 45, about 35 to about 50, about 40 to about 55, about 45 to about 60, about 50 to about 65, about 55 to about 70, about 60 to about 75, about 65 to about 80, about 70 to about 85, about 75 to about 90, about 80 to about 95, about 85 to about 100 , about 10 to about 30, about 15 to about 35, about 20 to about 40, about 25 to about 45, about 30 to about 50, about 35 to about 55, about 40 to about 60, about 45 to about 65, about 50 to about 70, about 55 to about 75, about 60 to about 80, about 65 to about 85, about 70 to about 90, about 75 to about 95, or about 80 to about 100 nucleotides.

[0147] In some aspects, the oligonucleotide comprises, consists of, or consists essentially of a double-stranded nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand and / or the antisense strand are 10-100 contiguous nucleotides in length.

[0148] In some aspects, the oligonucleotide comprises a double-stranded nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand and / or the antisense strand are a contiguous length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 109, 109, 109, 108, 109, 110, 111, 120, 130, 140, 141, , 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides.

[0149] In some aspects, the oligonucleotide is comprised of a double-stranded nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand and / or the antisense strand are a contiguous length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 109, 109, 109, 108, 109, 110, 111, 121, 122, 133, 14 , 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides.

[0150] In some aspects, the oligonucleotide comprises a double-stranded nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand and / or the antisense strand are at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, or at least 100 nucleotides.

[0151] In some aspects, the oligonucleotide comprises a double-stranded nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand and / or the antisense strand have a contiguous length of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, or at least 100 nucleotides.

[0152] In some aspects, the oligonucleotide comprises a double-stranded nucleic acid including a sense strand and an antisense strand, and the sense strand and / or the antisense strand have a continuous length of about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, about 45 to about 50, about 50 to about 55, about 55 to about 60, about 60 to about 65, about 65 to about 70, about 70 to about 75, about 75 to about 80, about 80 to about 85, about 85 to about 90, about 90 to about 95, about 95 to about 100, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 15 to about 25, about 25 to about about 35, about 35 to about 45, about 45 to about 55, about 55 to about 65, about 65 to about 75, about 75 to about 85, about 85 to about 95, about 10 to about 25, about 15 to about 30, about 20 to about 35, about 25 to about 40, about 30 to about 45, about 35 to about 50, about 40 to about 55, about 45 to about 60, about 50 to about 65, about 55 to about 70, about 60 to about 75, about 65 to about 80, about 70 to about 85, about 75 to about 90, about 80 to about 95, about 85 to about 100, about 10 to about 30, about 15 to about 35, about 20 to about 40, about 25 to about 45, about 30 to about 50, about 35 to about 55, about 40 to about 60, about 45 to about 65, about 50 to about 70, about 55 to about 75, about 60 to about 80, about 65 to about 85, about 70 to about 90, about 75 to about 95, or about 80 to about 100 nucleotides.

[0153] In some aspects, the oligonucleotide is composed of a double-stranded nucleic acid including a sense strand and an antisense strand, and the sense strand and / or the antisense strand have a continuous length of about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, about 45 to about 50, about 50 to about 55, about 55 to about 60, about 60 to about 65, about 65 to about 70, about 70 to about 75, about 75 to about 80, about 80 to about 85, about 85 to about 90, about 90 to about 95, about 95 to about 100, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 15 to about 25, about 25 to about about 35, about 35 to about 45, about 45 to about 55, about 55 to about 65, about 65 to about 75, about 75 to about 85, about 85 to about 95, about 10 to about 25, about 15 to about 30, about 20 to about 35, about 25 to about 40, about 30 to about 45, about 35 to about 50, about 40 to about 55, about 45 to about 60, about 50 to about 65, about 55 to about 70, about 60 to about 75, about 65 to about 80, about 70 to about 85, about 75 to about 90, about 80 to about 95, about 85 to about 100, about 10 to about 30, about 15 to about 35, about 20 to about 40, about 25 to about 45, about 30 to about 50, about 35 to about 55, about 40 to about 60, about 45 to about 65, about 50 to about 70, about 55 to about 75, about 60 to about 80, about 65 to about 85, about 70 to about 90, about 75 to about 95, or about 80 to about 100 nucleotides.

[0154] In some aspects, the oligonucleotide comprises, consists of, or consists essentially of a partially double-stranded nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand and / or the antisense strand are contiguous 10-100 nucleotides in length. In some aspects, the partially double-stranded molecule comprises a region of complementarity between the sense strand and the antisense strand, and one or more overhangs. In some aspects, the overhang can be at the 5' end of the sense strand. In some aspects, the overhang can be at the 3' end of the sense strand. In some aspects, the overhang can be at the 5' end of the antisense strand. In some aspects, the overhang can be at the 3' end of the antisense strand. In some aspects, the overhang can be at the 5' end of the sense strand, the 3' end of the sense strand, the 5' end of the antisense strand, the 3' end of the antisense strand, or any combination thereof.

[0155] Potential topologies of oligonucleotides containing partially double-stranded nucleic acids, such as RNA sponges or tough decoys, are shown in FIG.

[0156] In some aspects, the double-stranded nucleic acid is a single-stranded molecule comprising the sense strand and the antisense strand linked by a loop. In some aspects, the double-stranded nucleic acid is a double-stranded molecule in which the sense strand and the antisense strand are not linked by a loop.

[0157] In some aspects, the oligonucleotide is an ASO. In some aspects, the ASO is a gapmer. In some aspects, the oligonucleotide is an ASO that includes at least one nucleotide analogue, such as an LNA unit or a 5-MOE unit. In some aspects, the ASO is about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides in length. In some aspects, the ASO is 12 nucleotides in length. In some aspects, the ASO is 13 nucleotides in length. In some aspects, the ASO is 14 nucleotides in length. In some aspects, the ASO is 15 nucleotides in length. In some aspects, the ASO is 16 nucleotides in length. In some aspects, the ASO is 17 nucleotides in length. In some aspects, the ASO is 18 nucleotides in length. In some aspects, the ASO is 19 nucleotides in length. In some aspects, the ASO is 20 nucleotides in length. In some aspects, the ASO is 21 nucleotides in length. In some aspects, the ASO is 22 nucleotides in length.

[0158] In some aspects, the ASO can be conjugated with a moiety that can target a specific tissue, for example, the liver. In some aspects, the ASO conjugate comprises an ASO of about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides in length. In some aspects, the ASO conjugate comprises an ASO of 12 nucleotides in length. In some aspects, the ASO conjugate comprises an ASO of 13 nucleotides in length. In some aspects, the ASO conjugate comprises an ASO of 14 nucleotides in length. In some aspects, the ASO conjugate comprises an ASO of 15 nucleotides in length. In some aspects, the ASO conjugate comprises an ASO of 16 nucleotides in length. In some aspects, the ASO conjugate comprises an ASO of 17 nucleotides in length. In some aspects, the ASO conjugate comprises an ASO of 18 nucleotides in length. In some aspects, the ASO conjugate comprises an ASO that is 19 nucleotides in length. In some aspects, the ASO conjugate comprises an ASO that is 20 nucleotides in length. In some aspects, the ASO conjugate comprises an ASO that is 21 nucleotides in length. In some aspects, the ASO conjugate comprises an ASO that is 22 nucleotides in length.

[0159] In some aspects of the disclosure, the oligonucleotide is a nucleic acid therapeutic agent.

[0160] In certain aspects, the compositions and methods disclosed herein relate to the following therapeutic agents: In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0161] 1018ISS In some aspects, the nucleic acid therapeutic agent is 1018 ISS. 1018ISS is also known as ISS-1018, and is a CpG oligonucleotide that functions as an immune stimulant. In some aspects, the present disclosure provides a composition comprising 1018ISS and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising 1018ISS and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising 1018ISS and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery. The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising 1018ISS (e.g., a composition, such as a pharmaceutical composition, comprising 1018ISS and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising 1018ISS and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0162] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising 1018ISS (e.g., a composition, such as a pharmaceutical composition, comprising 1018ISS and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising 1018ISS and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0163] The oligonucleotide sequence of 1018ISS is TGACTGTGAACGTTCGAGATGA (SEQ ID NO:1). In some aspects, 1018ISS is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0164] AEG35156(GEM640) In some aspects, the nucleic acid therapeutic agent is AEG35156. AEG35156 is an antisense oligonucleotide that targets X-linked inhibitor of apoptosis (XIAP) and treats hepatocellular carcinoma, acute myeloid leukemia, B-cell lymphoma, chronic lymphocytic leukemia, multiple sclerosis, non-small cell lung cancer, or pancreatic cancer. In some aspects, the present disclosure provides a composition comprising AEG35156 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising AEG35156 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising AEG35156 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0165] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising AEG35156 (e.g., a composition, such as a pharmaceutical composition, comprising AEG35156 and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising AEG35156 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0166] The oligonucleotide sequence of AEG35156 is UGCACCCTGGATACCAUUU (SEQ ID NO: 136). In some aspects, AEG35156 is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0167] AB-729 In some aspects, the nucleic acid therapeutic agent is AB-729. AB-729 is an anti-miRNA that targets HBsAg of the Hepatitis B virus and treats Hepatitis B infection. In some aspects, the present disclosure provides a composition comprising AB-729 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising AB-729 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising AB-729 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0168] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that includes AB-729 (e.g., a composition such as a pharmaceutical composition that includes AB-729 and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that includes AB-729 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, AB-729 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0169] Abechimus In some aspects, the nucleic acid therapeutic agent is avetimus. avetimus is an immunosuppressant oligonucleotide for treating lupus nephritis. In some aspects, the present disclosure provides a composition comprising avetimus and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising avetimus and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising avetimus and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0170] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that includes avetimus (e.g., a composition such as a pharmaceutical composition that includes avetimus and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule that includes avetimus and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0171] The oligonucleotide sequences of Abetimus include GTGTGTGTGTGTGTGTGTGT (subunit 1) (SEQ ID NO:2), CACACACACACACACACACA (subunit 2) (SEQ ID NO:3), CACACACACACACACACACA (subunit 3) (SEQ ID NO:4), CACACACACACACACACACA (subunit 4) (SEQ ID NO:5), CACACACACACACACACACA (subunit 5) (SEQ ID NO:6), GTGTGTGTGTGTGTGTGTGT (subunit 6) (SEQ ID NO:7), GTGTGTGTGTGTGTGTGTGT (subunit 7) (SEQ ID NO:8), and GTGTGTGTGTGTGTGTGTGT (subunit 8) (SEQ ID NO:9). In some aspects, Abetimus is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety, such as GalNAc. In some aspects, the unconjugated form (eg, without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0172] Afovirsen In some aspects, the nucleic acid therapeutic agent is afovirsen. Afovirsen is an antisense oligonucleotide that targets human papillomavirus mRNA and is an antisense oligonucleotide for the treatment of human papillomavirus infection. In some aspects, the present disclosure provides a composition comprising afovirsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising afovirsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising afovirsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0173] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising afovirsen (e.g., a composition, such as a pharmaceutical composition, comprising afovirsen and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising afovirsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0174] The oligonucleotide sequence of afovirsen is TTGCTTCCATCTTCCTCGTC (SEQ ID NO: 10). In some aspects, afovirsen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0175] Aganilsen In some aspects, the nucleic acid therapeutic agent is aganirsen. Aganirsen, also known as GS101, is an antisense oligonucleotide that targets insulin receptor substrate-1 (IRS1) and is used to inhibit corneal neovascularization, which is a major risk factor for corneal graft rejection. In some aspects, the present disclosure provides a composition comprising aganirsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising aganirsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising aganirsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0176] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising aganirsen (e.g., a composition, such as a pharmaceutical composition, comprising aganirsen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising aganirsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0177] The oligonucleotide sequence of aganirsen is TATCCGGAGGGCTCGCCATGCTGCT (SEQ ID NO: 11). In some aspects, aganirsen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0178] Agatolimod In some aspects, the nucleic acid therapeutic agent is agatolimod.Agatolimod, also known as CPG-7909, AMA1-C1 or PF-3512676, is a CpG oligodeoxynucleotide that acts as a toll-like receptor 9 (TLR9) agonist, and is a CpG oligodeoxynucleotide for the treatment of cancer, such as basal cell carcinoma, non-Hodgkin's lymphoma, breast cancer, metastatic or recurrent malignant tumors, non-small cell lung cancer, infectious diseases, allergies, and asthma.In some aspects, the present disclosure provides a composition comprising agatolimod and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof.In some aspects, the caprylic acid derivative disclosed herein is a disodium salt.In a particular aspect, the present disclosure provides a composition comprising agatolimod and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising agatolimod and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0179] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising agatolimod (e.g., a composition, such as a pharmaceutical composition, comprising agatolimod and a monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising agatolimod and a caprylic acid derivative disclosed herein, e.g., the monosodium or disodium salt of 5-CNAC.

[0180] The oligonucleotide sequence of agatolimod is TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 12). In some aspects, agatolimod is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0181] Arikaforsen In some aspects, the nucleic acid therapeutic agent is alicaforsen. Alicaforsen is an antisense oligonucleotide targeting ICAM-1 for treating severe exacerbations in moderate to severe inflammatory bowel disease. In some aspects, the present disclosure provides a composition comprising alicaforsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising alicaforsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising alicaforsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0182] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering alicaforsen (e.g., a composition, such as a pharmaceutical composition, comprising alicaforsen and the monosodium or disodium salt of 5-CNAC) to the subject. Also provided is a pill or capsule comprising alicaforsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0183] The oligonucleotide sequence of alicaforsen is GCCCAAGCTGGCATCCGTCA (SEQ ID NO: 13). In some aspects, alicaforsen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0184] AGRO100 In some aspects, the nucleic acid therapeutic agent is AGRO100. AGRO100, also known as AS1411, is an aptamer that targets IKBKG and is used to treat acute myeloid leukemia, advanced solid tumors, metastatic renal cell carcinoma, and myeloid leukemia. In some aspects, the present disclosure provides a composition comprising AGRO100 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising AGRO100 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising AGRO100 and the disodium salt of 5-CNAC. In some aspects, the composition is formulated for oral delivery.

[0185] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising AGRO100 (e.g., a composition, such as a pharmaceutical composition, comprising AGRO100 and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising AGRO100 and a caprylic acid derivative disclosed herein, e.g., the monosodium or disodium salt of 5-CNAC.

[0186] The oligonucleotide sequence of AGR0100 is GGTGGTGGTGGTTGTGGTGGTGGTGG (SEQ ID NO: 14). In some aspects, AGRO100 is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0187] Amlivirsen In some aspects, the nucleic acid therapeutic agent is amlivirsen. Amlivirsen is an antiviral antisense oligonucleotide. In some aspects, the present disclosure provides a composition comprising amlivirsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising amlivirsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising amlivirsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0188] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising amlivirsen (e.g., a composition, such as a pharmaceutical composition, comprising amlivirsen and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising amlivirsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0189] The oligonucleotide sequence of amlivirsen is GCAGAGGTGAAGCGAAGUGC (SEQ ID NO: 15). In some aspects, amlivirsen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0190] Anivamersen / Pegnibakogin In some aspects, the nucleic acid therapeutic agent is anibamersen and / or pegnivacogin. Anivamersen and pegnivacogin are components of the REG1 anticoagulant system. Pegnivacogin is an RNA aptamer inhibitor of coagulation factor IXa, and anibamersen is a complementary sequence-reversed oligonucleotide. In some aspects, the present disclosure provides a composition comprising anibamersen or pegnivacogin and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising anibamersen or pegnivacogin and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising anibamersen or pegnivacogin and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0191] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising anibamersen or pegnivacogin (e.g., a composition, such as a pharmaceutical composition, comprising anibamersen or pegnivacogin and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising anibamersen or pegnivacogin and a caprylic acid derivative disclosed herein, e.g., the monosodium or disodium salt of 5-CNAC.

[0192] The oligonucleotide sequence of pegnivacogin is GUGGACUAUACCGCGUAAUGCUGCCUCCACT (SEQ ID NO: 16). The oligonucleotide sequence of anivamersen is CGCGGUAUAGUCCAC (SEQ ID NO: 17). In some aspects, the anivamersen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc or PEG. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0193] Apatrusen In some aspects, the nucleic acid therapeutic agent is apatorsen. Apatorsen, also known as OGX-427, is an antisense oligonucleotide that targets Hsp27 and is used to treat advanced squamous cell lung cancer. In some aspects, the present disclosure provides a composition comprising apatorsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising apatorsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising apatorsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0194] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that includes apatorsen (e.g., a composition such as a pharmaceutical composition that includes apatorsen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule that includes apatorsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0195] The oligonucleotide sequence of apatrusen is GGGACGCGGCGCTCGGUCAU (SEQ ID NO: 18). In some aspects, apatrusen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0196] Aprino Carsen In some aspects, the nucleic acid therapeutic agent is aprinocarcen. Aprinocarcen is an antisense oligonucleotide for cancer treatment, which targets PKC-a. In some aspects, the present disclosure provides a composition comprising aprinocarcen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising aprinocarcen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising aprinocarcen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0197] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising aprinocarcen (e.g., a composition, such as a pharmaceutical composition, comprising aprinocarcen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising aprinocarcen and a caprylic acid derivative disclosed herein, e.g., the monosodium or disodium salt of 5-CNAC.

[0198] The oligonucleotide sequence of aprinocarsen is GGTGGTGGTGGTTGTGGTGGTGGTGG (SEQ ID NO: 19). In some aspects, aprinocarsen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0199] APTA-16 In some aspects, the nucleic acid therapeutic agent is APTA-16. APTA-16 is an aptamer for treating acute myeloid leukemia, myelodysplastic syndrome, or liver cancer, and targets histone methyltransferase. In some aspects, the present disclosure provides a composition comprising APTA-16 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising APTA-16 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising APTA-16 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0200] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises APTA-16 (e.g., a composition such as a pharmaceutical composition that comprises APTA-16 and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that comprises APTA-16 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, APTA-16 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0201] ZINTEVIR(trademark) In some aspects, the nucleic acid therapeutic agent is AR-177. AR-177, also known as ZINTEVIR™, is an oligonucleotide analogue that functions as an integrase inhibitor and can be used to treat HIV-1 infection. In some aspects, the present disclosure provides a composition comprising AR-177 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising AR-177 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising AR-177 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0202] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising AR-177 (e.g., a composition, such as a pharmaceutical composition, comprising AR-177 and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising AR-177 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0203] The oligonucleotide sequence of AR-177 is GTGGTGGGTGGGTGGGT (SEQ ID NO:20). In some aspects, AR-177 is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0204] ARC19499 In some aspects, the nucleic acid therapeutic agent is ARC19499. ARC19499, also known as BAX-499, is an RNA aptamer for treating hemophilia, and targets TFPI. In some aspects, the present disclosure provides a composition comprising ARC19499 and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising ARC19499 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising ARC19499 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0205] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising ARC19499 (e.g., a composition, such as a pharmaceutical composition, comprising ARC19499 and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising ARC19499 and a caprylic acid derivative disclosed herein, e.g., the monosodium or disodium salt of 5-CNAC.

[0206] The oligonucleotide sequence of ARC19499 is GGAAUAUACUUGGCUCGUUAGGUGCGUAUAUA (SEQ ID NO:21). In some aspects, ARC19499 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0207] Archexin In some aspects, the nucleic acid therapeutic agent is archexin. Archexin, also known as RX-201, is an antisense oligonucleotide for treating metastatic renal cancer, ovarian cancer, renal cell carcinoma, glioblastoma, gastric cancer, pancreatic cancer, lung cancer, or cervical cancer, and targets AKT-1 protein kinase. In some aspects, the present disclosure provides a composition comprising archexin and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising archexin and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising archexin and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0208] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising archexin (e.g., a composition, such as a pharmaceutical composition, comprising archexin and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising archexin and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0209] The oligonucleotide sequence of archexin is GCTGCATGATCTCCTTGGCG (SEQ ID NO: 22). In some aspects, archexin is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0210] Asvasiran In some aspects, the nucleic acid therapeutic agent is asvasiran. Asvasiran is an siRNA for the treatment of respiratory syncytial virus infection, targeting the RSV N gene. In some aspects, the present disclosure provides a composition comprising asvasiran and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising asvasiran and 5-CNAC. In a particular aspect, the present disclosure provides a composition salt comprising asvasiran and 5-CNAC disodium. In some aspects, the composition is formulated for oral delivery.

[0211] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising asvasiran (e.g., a composition, such as a pharmaceutical composition, comprising asvasiran and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising asvasiran and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0212] The oligonucleotide sequence of asvasiran is a double-stranded RNA that includes the antisense sequence CUUGACUUUGCUAAGAGCCTT (SEQ ID NO: 23) and the sense sequence GGCUCUUAGCAAAGUCAAGTT (SEQ ID NO: 24). In some aspects, asvasiran is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0213] Atesidorsen In some aspects, the nucleic acid therapeutic agent is atecidrsen. Atesidorsen, also known as ATL1103, is an antisense oligonucleotide for the treatment of acromegaly, cancer, or diabetic retinopathy, and targets somatotropin receptors. In some aspects, the present disclosure provides a composition comprising atecidrsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising atecidrsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising atecidrsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0214] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising atesidorsen (e.g., a composition, such as a pharmaceutical composition, comprising atesidorsen and a monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising atesidorsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0215] The oligonucleotide sequence of atesidorsen is UCAGGGCATTCTTTCCAUUC (SEQ ID NO: 25). In some aspects, atesidorsen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0216] ATU-027 In some aspects, the nucleic acid therapeutic agent is ATU-027. ATU-027 is an siRNA that targets protein kinase N3 and prevents cancer progression, for example in prostate and pancreatic cancer. In some aspects, the present disclosure provides a composition comprising ATU-027 and a caprylic acid derivative disclosed herein, for example, 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising ATU-027 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising ATU-027 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0217] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising ATU-027 (e.g., a composition, such as a pharmaceutical composition, comprising ATU-027 and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising ATU-027 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0218] The oligonucleotide sequence of ATU-027 is an RNA duplex that includes the antisense sequence AGACUUGAGGACUUCCUGGACAA (SEQ ID NO:26) and the sense sequence UUGUCCAGGAAGUCCUCAAGUCU (SEQ ID NO:27). In some aspects, ATU-027 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0219] AVT-02 In some aspects, the nucleic acid therapeutic agent is AVT-02 developed by Avontec GmbH. AVT-02 is a short double-stranded oligonucleotide decoy for treating psoriasis vulgaris, and targets STAT-1. In some aspects, the present disclosure provides a composition comprising AVT-02 and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising AVT-02 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising AVT-02 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0220] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that includes AVT-02 (e.g., a composition such as a pharmaceutical composition that includes AVT-02 and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that includes AVT-02 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, AVT-02 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0221] ZIMURA(trademark) In some aspects, the nucleic acid therapeutic agent is avacincaptado pegol (ZIMURA™). Avacincaptado pegol is a PEG-linked oligonucleotide for treating polypoidal choroidal vasculopathy, Stargardt's disease, or wet age-related macular degeneration, and functions as a complement C5 inhibitor. In some aspects, the present disclosure provides a composition comprising avacincaptado pegol and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising avacincaptado pegol and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising avacincaptado pegol and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0222] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising avacincaptado pegol (e.g., a composition, such as a pharmaceutical composition, comprising avacincaptado pegol and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising avacincaptado pegol and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0223] The oligonucleotide sequence of Avacincaptad pegol is CGCCGCGGUCUCAGGCGCUGAGUCUGAGUUUACCUGCGT (SEQ ID NO: 28). In some aspects, Avacincaptad is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc or PEG. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0224] AVI-7537 In some aspects, the nucleic acid therapeutic agent is AVI-7537. AVI-7537 is a morpholino antisense oligonucleotide that targets the VP24 gene of Ebola virus. In some aspects, the present disclosure provides a composition comprising AVI-7537 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising AVI-7537 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising AVI-7537 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0225] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising AVI-7537 (e.g., a composition, such as a pharmaceutical composition, comprising AVI-7537 and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising AVI-7537 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0226] The oligonucleotide sequence of AVI-7537 is GCCATGGTTTTTTCTCAGG (SEQ ID NO: 29). In some aspects, AVI-7537 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0227] AVI-7288 In some aspects, the nucleic acid therapeutic agent is AVI-7288. AVI-7288 is a morpholino antisense oligonucleotide that targets the Marburg virus nucleoprotein (NP). In some aspects, the present disclosure provides a composition comprising AVI-7288 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising AVI-7288 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising AVI-7288 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0228] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises AVI-7288 (e.g., a composition such as a pharmaceutical composition that comprises AVI-7288 and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that comprises AVI-7288 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, AVI-7288 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0229] Baliforsen In some aspects, the nucleic acid therapeutic agent is valifolsen. Valifolsen, also known as IONIS-598769, is an antisense oligonucleotide for treating myotonic dystrophy. In some aspects, the present disclosure provides a composition comprising valifolsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising valifolsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising valifolsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0230] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising valifolsen (e.g., a composition, such as a pharmaceutical composition, comprising valifolsen and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising valifolsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0231] The oligonucleotide sequence of valifolsen is TCCCGAATGTCCGACA (SEQ ID NO:30). In some aspects, valifolsen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0232] Bamosiran In some aspects, the nucleic acid therapeutic agent is bamosiran. Bamosiran, also known as SYL-040012, is an siRNA for treating glaucoma or elevated intraocular pressure, and targets the β2 adrenergic receptor. In some aspects, the present disclosure provides a composition comprising bamosiran and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising bamosiran and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising bamosiran and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0233] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising bamosiran (e.g., a composition, such as a pharmaceutical composition, comprising bamosiran and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising bamosiran and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0234] The oligonucleotide sequence of bamosiran is a double-stranded RNA comprising an antisense strand of the sequence CAUUGUGCAUGUGAUCCAGTT (SEQ ID NO: 31) and a sense strand of the sequence CUGGAUCACAUGCACAAUGTT (SEQ ID NO: 32). In some aspects, bamosiran is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0235] Bazlitoran In some aspects, the nucleic acid therapeutic agent is bazlitoran. Bazlitoran, also known as IMO-8400, is a DNA oligonucleotide for treating Waldenstrom's macroglobulinemia, and targets the toll-like receptors TLR7, TLR8 and TLR9. In some aspects, the present disclosure provides a composition comprising bazlitoran and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising bazlitoran and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising bazlitoran and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0236] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein that comprises bazlitoran (e.g., a composition, such as a pharmaceutical composition, that comprises bazlitoran and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that comprises bazlitoran and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0237] The oligonucleotide sequence of bazlitoran is CTATCTGUCGTTCTCTGU (SEQ ID NO: 33). In some aspects, bazlitoran is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0238] BC007 In some aspects, the nucleic acid therapeutic is BC007. BC007 is an unmodified DNA aptamer from the aptamer family that binds and neutralizes autoantibodies against G protein-coupled receptors (GPCR-AAB). BC007 binds to β1-adrenergic receptor autoantibodies. BC007 can be used to treat dilated cardiomyopathy or chronic fatigue syndrome. In some aspects, the present disclosure provides a composition comprising BC007 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising BC007 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising BC007 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0239] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein comprising BC007 (e.g., a composition, such as a pharmaceutical composition, comprising BC007 and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising BC007 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, BC007 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0240] Beclanorsen In some aspects, the nucleic acid therapeutic agent is beclanorsen. Beclanorsen, also known as SPC-2996, is an antisense oligonucleotide for treating lymphocytic leukemia and targets Bcl-2. In some aspects, the present disclosure provides a composition comprising beclanorsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising beclanorsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising beclanorsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0241] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising beclanorsen (e.g., a composition, such as a pharmaceutical composition, comprising beclanorsen and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising beclanorsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0242] The oligonucleotide sequence of beclanorsen is CUCCCAACGTGCGCCA (SEQ ID NO: 34). In some aspects, beclanorsen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0243] Bepivirsen In some aspects, the nucleic acid therapeutic agent is bepilovirsen. Bepilovirsen, also known as ISIS-505358, ISIS-GSK3RX, GSK-3228836 or IONIS HBVRX, is an antisense oligonucleotide for treating hepatitis B. In some aspects, the present disclosure provides a composition comprising bepilovirsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising bepilovirsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising bepilovirsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0244] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising bepilovirsen (e.g., a composition, such as a pharmaceutical composition, comprising bepilovirsen and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising bepilovirsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0245] The oligonucleotide sequence of bepilovirsen is GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 35). In some aspects, bepilovirsen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0246] Bevasiranib In some aspects, the nucleic acid therapeutic agent is bevasiranib. Bevasiranib is an siRNA for treating exudative age-related macular degeneration, and targets VEGF. In some aspects, the present disclosure provides a composition comprising bevasiranib and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is disodium salt. In a particular aspect, the present disclosure provides a composition comprising bevasiranib and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising bevasiranib and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0247] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein comprising bevasiranib (e.g., a composition, such as a pharmaceutical composition, comprising bevasiranib and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising bevasiranib and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0248] The oligonucleotide sequence of bevasiranib is an RNA duplex that comprises an antisense strand of sequence ACCUCACCAAGGCCAGCACTT (SEQ ID NO: 36) and a sense strand of sequence GUGCUGCCUUGGUGAGGUTT (SEQ ID NO: 37). In some aspects, bevasiranib is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0249] BMN044 In some aspects, the nucleic acid therapeutic agent is BMN044. BMN044, also known as PRO44, is an antisense oligonucleotide for treating Duchenne muscular dystrophy, and targets the mRNA encoding dystrophin. In some aspects, the present disclosure provides a composition comprising BMN044 and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising BMN044 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising BMN044 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0250] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises BMN044 (e.g., a composition such as a pharmaceutical composition that comprises BMN044 and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that comprises BMN044 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, BMN044 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0251] BMN053 In some aspects, the nucleic acid therapeutic agent is BMN053. BMN053, also known as PRO53, is an antisense oligonucleotide for treating Duchenne muscular dystrophy and targets dystrophin. In some aspects, the present disclosure provides a composition comprising BMN053 and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising BMN053 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising BMN053 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0252] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein (e.g., a composition, such as a pharmaceutical composition, comprising BMN053 and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising BMN053 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, BMN053 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0253] Briboligid In some aspects, the nucleic acid therapeutic agent is brivolidide. Brivolidide is a 23bp decoy DNA that functions as an early growth response factor 1 inhibitor. Brivolidide can be used to treat pain, for example, postoperative pain. In some aspects, the present disclosure provides a composition comprising brivolidide and a caprylic acid derivative disclosed herein, for example, 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising brivolidide and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising brivolidide and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0254] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising brivolidide (e.g., a composition, such as a pharmaceutical composition, comprising brivolidide and a monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising brivolidide and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0255] The oligonucleotide sequence of Briboligide is a double-stranded DNA comprising CTACGCCCACCGCCCACGCATAC (SEQ ID NO: 38) and GTATGCGTGGGCGGTGGGCGTAG (SEQ ID NO: 39). In some aspects, Briboligide is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0256] Casimersen In some aspects, the nucleic acid therapeutic agent is casimersen. Casimersen is a morpholino antisense oligonucleotide for treating Duchenne muscular dystrophy, and targets exon 45 of dystrophin. In some aspects, the present disclosure provides a composition comprising casimersen and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising casimersen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising casimersen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0257] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising casimersen (e.g., a composition, such as a pharmaceutical composition, comprising casimersen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising casimersen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0258] The oligonucleotide sequence of casimersen is CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 40). In some aspects, the casimersen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0259] Cavrotolimod In some aspects, the nucleic acid therapeutic agent is cavrotolimod. Cavrotolimod is an immunostimulant oligonucleotide that functions as a TLR9 agonist and can be used to treat hematological malignancies, Merkel cell carcinoma, solid tumors, or squamous cell carcinoma. In some aspects, the present disclosure provides a composition comprising cavrotolimod and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising cavrotolimod and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising cavrotolimod and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0260] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising cavrotolimod (e.g., a composition, such as a pharmaceutical composition, comprising cavrotolimod and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising cavrotolimod and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0261] The oligonucleotide sequence of cavrotolimod is TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 41). In some aspects, cavrotolimod is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0262] Cemdisiran In some aspects, the nucleic acid therapeutic agent is cemdisiran. Cemdisiran, also known as AD062643, is an siRNA for treating hemolytic uremic syndrome, IgA nephropathy, paroxysmal nocturnal hemoglobinuria, or myasthenia gravis, and targets complement C5. In some aspects, the present disclosure provides a composition comprising cemdisiran and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising cemdisiran and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising cemdisiran and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0263] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising cemdisiran (e.g., a composition, such as a pharmaceutical composition, comprising cemdisiran and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising cemdisiran and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0264] The oligonucleotide sequence of cemdisiran is an RNA duplex that includes an antisense strand of the sequence UAUUAUAAAAAUAUCUUGCUUUUTT (SEQ ID NO: 42) and a sense strand of the sequence AAGCAAGAUAUUUUUAUAAUAN (SEQ ID NO: 43). In some aspects, cemdisiran is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0265] Senersen In some aspects, the nucleic acid therapeutic agent is cenersen.Cenersen is an antisense oligonucleotide for treating myelodysplastic syndrome, acute myeloid leukemia, or chronic lymphocytic leukemia, and targets p53.In some aspects, the present disclosure provides a composition comprising cenersen and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof.In some aspects, the caprylic acid derivative disclosed herein is a disodium salt.In a particular aspect, the present disclosure provides a composition comprising cenersen and 5-CNAC.In a particular aspect, the present disclosure provides a composition comprising cenersen and 5-CNAC disodium salt.In some aspects, the composition is formulated for oral delivery.

[0266] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising cenersen (e.g., a composition, such as a pharmaceutical composition, comprising cenersen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising cenersen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0267] The oligonucleotide sequence of cenersen is CCCTGCTCCCCCCTGGCTCC (SEQ ID NO: 44). In some aspects, cenersen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0268] Little Bird In some aspects, the nucleic acid therapeutic agent is cobitolimod. Cobitolimod is an oligodeoxyribonucleotide for treating ulcerative colitis or cerebral edema, and is an agonist of Toll-like 9 receptor. In some aspects, the present disclosure provides a composition comprising cobitolimod and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising cobitolimod and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising cobitolimod and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0269] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising cobitolimod (e.g., a composition, such as a pharmaceutical composition, comprising cobitolimod and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising cobitolimod and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0270] The oligonucleotide sequence of cobitolimod is GGAACAGTTCGTCCATGGC (SEQ ID NO: 45). In some aspects, cobitolimod is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0271] Cobomarsen In some aspects, the nucleic acid therapeutic agent is cobomarsen. Cobomarsen, also known as MRG-106 or M11667, is an anti-miRNA (antimir) for treating cutaneous T-cell lymphoma, adult T-cell leukemia-lymphoma, chronic lymphocytic leukemia, diffuse large B-cell lymphoma, or amyotrophic lateral sclerosis, and targets miR-155. In some aspects, the present disclosure provides a composition comprising cobomarsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising cobomarsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising cobomarsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0272] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises cobomarsen (e.g., a composition such as a pharmaceutical composition that comprises cobomarsen and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that comprises cobomarsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, cobomarsen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0273] NEXAGON(trademark) In some aspects, the nucleic acid therapeutic is CODA-001. CODA-001, also known as NEXAGON™, is an antisense oligonucleotide for treating wounds, leg ulcers, diabetic foot ulcers, or corneal injuries, and targets the gap bifurcation. NEXAGON™ is a natural, unmodified oligonucleotide (30-mer) that downregulates the expression of the major gap junction protein Cx43. In some aspects, the disclosure provides a composition comprising CODA-001 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the disclosure provides a composition comprising CODA-001 and 5-CNAC. In a particular aspect, the disclosure provides a composition comprising CODA-001 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0274] The disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising CODA-001 (e.g., a composition, such as a pharmaceutical composition, comprising CODA-001 and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising CODA-001 and a caprylic acid derivative disclosed herein, e.g., the monosodium or disodium salt of 5-CNAC.

[0275] The oligonucleotide sequence of CODA-001 is GTAATTGCGGCAAGAAGAATTGTTTCTGTC (SEQ ID NO: 46). In some aspects, CODA-001 is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0276] Cofirasersen In some aspects, the nucleic acid therapeutic agent is cofirasersen. Cofirasersen, also known as IONIS-ENACRX and ION-827359, is an antisense oligonucleotide for treating lung disease, chronic bronchitis, or cystic fibrosis, and targets ENaC. In some aspects, the present disclosure provides a composition comprising cofirasersen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising cofirasersen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising cofirasersen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0277] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising cofirasersen (e.g., a composition, such as a pharmaceutical composition, comprising cofirasersen and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising cofirasersen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0278] The oligonucleotide sequence of cofirasersen is CCCGATAGCTGGTUGU (SEQ ID NO: 47). In some aspects, cofirasersen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0279] Cosdosiran In some aspects, the nucleic acid therapeutic agent is cosdosiran. Cosdosiran, also known as QPI-1007, is a neuroprotective siRNA for treating non-arteritic anterior ischemic optic neuropathy, inhibiting caspase 2 synthesis. In some aspects, the present disclosure provides a composition comprising cosdosiran and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising cosdosiran and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising cosdosiran and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0280] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising cosdosiran (e.g., a composition, such as a pharmaceutical composition, comprising cosdosiran and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising cosdosiran and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0281] The oligonucleotide sequence of cosdosiran is an RNA duplex that comprises an antisense strand of the sequence GCCAGAAUGUGGAACUCCU (SEQ ID NO: 48) and a sense strand of the sequence AGGAGUUCCACAUUCUGGC (SEQ ID NO: 49). In some aspects, cosdosiran is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0282] CPG-8954 In some aspects, the nucleic acid therapeutic agent is CPG-8954. CPG-8954 is a CpG oligonucleotide for treating cancer and viral infection. In some aspects, the present disclosure provides a composition comprising CPG-8954 and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising CPG-8954 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising CPG-8954 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0283] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising CPG-8954 (e.g., a composition, such as a pharmaceutical composition, comprising CPG-8954 and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising CPG-8954 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0284] The oligonucleotide sequence of CPG-8954 is GGGGGGGTGTCGCAGCAGGGG (SEQ ID NO:50). In some aspects, CPG-8954 is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0285] Cupabimod In some aspects, the nucleic acid therapeutic agent is cupabimod. Cupabimod, also known as AMG-0103, is an oligonucleotide for treating pain, for example, chronic discogenic lumbar pain. In some aspects, the present disclosure provides a composition comprising cupabimod and a caprylic acid derivative disclosed herein, for example, 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising cupabimod and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising cupabimod and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0286] The disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising cupabimod (e.g., a composition, such as a pharmaceutical composition, comprising cupabimod and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising cupabimod and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0287] The oligonucleotide sequence of cupabimod is a double-stranded DNA that includes the sequences GGAGGAAATCCCTTCAAGG (SEQ ID NO:51) and CCTTGAAGGGATTTCCCTCC (SEQ ID NO:52). In some aspects, cupabimod is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0288] Kustorisen In some aspects, the nucleic acid therapeutic agent is custricene. Custricene, also known as OGX-011 and ISIS-112989, is an antisense oligonucleotide for treating metastatic castration-resistant prostate cancer and targets clusterin. In some aspects, the present disclosure provides a composition comprising custricene and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising custricene and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising custricene and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0289] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising custricen (e.g., a composition, such as a pharmaceutical composition, comprising custricen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising custricen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0290] The oligonucleotide sequence of custrice is CAGCAGCAGAGTCTTCAUCAU (SEQ ID NO: 53). In some aspects, custrice is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0291] Danbathilsen In some aspects, the nucleic acid therapeutic agent is dambatirsen. Dambatirsen, also known as AZD9150 and ISIS-481464, is an antisense oligonucleotide for treating bladder cancer, colorectal cancer, head and neck cancer, malignant ascites, non-small cell lung cancer, pancreatic cancer, solid tumors, liver cancer, non-Hodgkin's lymphoma, or diffuse large B-cell lymphoma, and targets STAT3 transcription factor. In some aspects, the present disclosure provides a composition comprising dambatirsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising dambatirsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising dambatirsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0292] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising dambatirsen (e.g., a composition, such as a pharmaceutical composition, comprising dambatirsen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising dambatirsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0293] The oligonucleotide sequence of dambatirsen is CUATTTGGATGTCAGC (SEQ ID NO: 54). In some aspects, dambatirsen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0294] Daplusiran In some aspects, the nucleic acid therapeutic agent is daplusiran. Daplusiran is an antiviral siRNA. In some aspects, the present disclosure provides a composition comprising daplusiran and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising daplusiran and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising daplusiran and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0295] The disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising daplusiran (e.g., a composition, such as a pharmaceutical composition, comprising daplusiran and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising daplusiran and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0296] The oligonucleotide sequence of daplusiran is an RNA duplex that comprises an antisense strand of the sequence GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 55) and a sense strand of the sequence AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 56). In some aspects, daplusiran is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0297] Defibrotide (DEFITELIO™) In some aspects, the nucleic acid therapeutic agent is defibrotide (DEFITELIO™). Defibrotide, also known as DASOVAS™, NORAVID™, or PROCICLIDE™, is a heparanase inhibitor that functions as an inhibitor of angiogenesis and platelet aggregation. Defibrotide is a mixture of single-stranded oligonucleotides purified from porcine intestinal mucosa. Defibrotide can be used to treat venous occlusive disorder, graft-versus-host disease, neuropathy, thrombotic microangiopathy, deep vein thrombosis, thrombosis, diabetic nephropathy, or multiple myeloma. In some aspects, the present disclosure provides a composition comprising defibrotide and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising defibrotide and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising defibrotide and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0298] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises defibrotide (e.g., a composition such as a pharmaceutical composition that comprises defibrotide and the monosodium salt or disodium salt of 5-CNAC). Also provided is a pill or capsule that comprises defibrotide and a caprylic acid derivative disclosed herein, such as the monosodium salt or disodium salt of 5-CNAC. In some aspects, defibrotide is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0299] Dematirsen In some aspects, the nucleic acid therapeutic agent is a dematirsen antisense oligonucleotide. In some aspects, the present disclosure provides a composition comprising dematirsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising dematirsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising dematirsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0300] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising dematirsen (e.g., a composition, such as a pharmaceutical composition, comprising dematirsen and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising dematirsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0301] The oligonucleotide sequence of dematirsen is GUUGCCUCCGGUUCUGAAGGUGUUC (SEQ ID NO:57). In some aspects, dematirsen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0302] Donida Lorsen In some aspects, the nucleic acid therapeutic agent is a donidarolsen antisense oligonucleotide. Donidarolsen, also known as ISIS-721744, is a plasma kallikrein inhibitor that can be used to treat COVID2019 infection, hereditary angioedema, or acute respiratory disease. In some aspects, the present disclosure provides a composition comprising donidarolsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising donidarolsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising donidarolsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0303] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein comprising donidarolsen (e.g., a composition, such as a pharmaceutical composition, comprising donidarolsen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising donidarolsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0304] The oligonucleotide sequence of donidarolsen is TGCAAGTCTCTTGGCAAACA (SEQ ID NO: 58). In some aspects, donidarolsen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0305] Drisapersen (KYNDRISA(TM)) In some aspects, the nucleic acid therapeutic agent is drisapersen (KYNDRISA™). Drisapersen, also known as GSK2402968A, is an antisense oligonucleotide for treating Duchenne muscular dystrophy, and targets the mRNA encoding dystrophin. In some aspects, the present disclosure provides a composition comprising drisapersen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising drisapersen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising drisapersen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0306] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein comprising drisapersen (e.g., a composition, such as a pharmaceutical composition, comprising drisapersen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising drisapersen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0307] The oligonucleotide sequence of drisapersen is UCAAGGAAGAUGGCAUUUCU (SEQ ID NO:59). In some aspects, drisapersen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0308] Ejiphorigid In some aspects, the nucleic acid therapeutic agent is edifoligide. Edifoligide is a 14bp decoy DNA that functions as a CDC2 kinase inhibitor and can be used to treat coronary restenosis or vascular graft blockage. In some aspects, the present disclosure provides a composition comprising edifoligide and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising edifoligide and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising edifoligide and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0309] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising edifoligide (e.g., a composition, such as a pharmaceutical composition, comprising edifoligide and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising edifoligide and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0310] The oligonucleotide sequence of edifoligide is a double-stranded DNA comprising the sequences CTAGATTTCCCGCG (SEQ ID NO:60) and GATCCCGCGGGAAAT (SEQ ID NO:61). In some aspects, edifoligide is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0311] Egaputibonpegol In some aspects, the nucleic acid therapeutic agent is egaptibone pegol. Egaptibone pegol, also known as ARC1779, is an aptamer for treating intracranial embolism, cerebral thromboembolism, carotid artery stenosis, von Willebrand's disease, thrombotic thrombocytopenic purpura, thrombotic microangiopathy, thrombosis, or acute myocardial infarction, and targets VWF GP1BA. In some aspects, the present disclosure provides a composition comprising egaptibone pegol and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising egaptibone pegol and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising egaptibongol and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0312] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising egaptibone pegol (e.g., a composition, such as a pharmaceutical composition, comprising egaptibone pegol and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising egaptibone pegol and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0313] The oligonucleotide sequence of egaptibone pegol is GCGUGCAGUGCCUUCGGCCGTGCGGTGCCUCCGUCACGCT (SEQ ID NO: 62). In some aspects, egaptibone is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc or PEG. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0314] EIF-4E In some aspects, the nucleic acid therapeutic agent is EIF-4E ASO. EIF-4E ASO is an antisense oligonucleotide for treating prostate cancer disclosed in US20140323543A1; this reference is incorporated herein by reference. In some aspects, the present disclosure provides a composition comprising EIF-4E ASO and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising EIF-4E ASO and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising EIF-4E ASO and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0315] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein comprising EIF-4E ASO (e.g., a composition, such as a pharmaceutical composition, comprising EIF-4E ASO and a monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising EIF-4E ASO and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0316] The oligonucleotide sequence of the EIF-4E ASO is TGTTATATTCCTGGATCCTT (SEQ ID NO: 63). In some aspects, the EIF-4E is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0317] Eluforsen In some aspects, the nucleic acid therapeutic agent is eluforsen. Eluforsen, also known as QR-010, is an oligonucleotide partially complementary to Phe508del-CFTR RNA. Eluforsen, also known as QR-010, is designed to repair CFTR-encoded mRNA. In some aspects, the present disclosure provides a composition comprising eluforsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising eluforsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising eluforsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0318] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising eluforsen (e.g., a composition, such as a pharmaceutical composition, comprising eluforsen and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising eluforsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0319] The oligonucleotide sequence of eluforsen is AUCAUAGGAAACACCAAAGAUGAUAUUUUCUUU (SEQ ID NO:64). In some aspects, eluforsen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0320] Emapuchicapegol In some aspects, the nucleic acid therapeutic agent is emapticappegol. Emapticappegol, also known as NOX-E36, is an aptamer for treating type 2 systemic lupus erythematosus, diabetes, chronic inflammatory disease, albuminuria, and renal injury, and targets CCL2. In some aspects, the present disclosure provides a composition comprising emapticappegol and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising emapticappegol and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising emapticappegol and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0321] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising emapticappegol (e.g., a composition, such as a pharmaceutical composition, comprising emapticappegol and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising emapticappegol and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0322] The oligonucleotide sequence of emapticap pegol is GCACGUCCCUCACCGGUGCAAGUGAAGCCGUGGCUCUGCG (SEQ ID NO: 65). In some aspects, emapticap is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc or PEG. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0323] Aprontelsen In some aspects, the nucleic acid therapeutic agent is aprontersen. Aprontersen, also known as ION-TTR-LRX or AKCEA-TTR-LRX, is an antisense oligonucleotide that functions as a prealbumin expression inhibitor and can be used to treat amyloidosis or transthyretin-associated hereditary amyloidosis. In some aspects, the present disclosure provides a composition comprising aprontersen and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising aprontersen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising aprontersen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0324] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that includes aprontersen (e.g., a composition, such as a pharmaceutical composition, that includes aprontersen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule that includes aprontersen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0325] The oligonucleotide sequence of aprontersen is UCUUGGTTACATGAAAUCCC (SEQ ID NO: 66). In some aspects, aprontersen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0326] Eteplirsen (EXONDYS51™) In some aspects, the nucleic acid therapeutic agent is eteplirsen (EXONDYS51™). Eteplirsen, also known as AVI-4658, is an antisense oligonucleotide for treating Duchenne muscular dystrophy and targets DMD exon 51. In some aspects, the present disclosure provides a composition comprising eteplirsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising eteplirsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising eteplirsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0327] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising eteplirsen (e.g., a composition, such as a pharmaceutical composition, comprising eteplirsen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising eteplirsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0328] The oligonucleotide sequence of eteplirsen is CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 67). In some aspects, eteplirsen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0329] Fesomerssen In some aspects, the nucleic acid therapeutic agent is a fesomersene antisense oligonucleotide. In some aspects, the present disclosure provides a composition comprising fesomersene and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising fesomersene and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising fesomersene and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0330] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising fesomersen (e.g., a composition, such as a pharmaceutical composition, comprising fesomersen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising fesomersen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0331] The oligonucleotide sequence of fesomersen is ACGGCATTGGTGCACAGUUU (SEQ ID NO: 68). In some aspects, fesomersen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0332] Fitsirran In some aspects, the nucleic acid therapeutic agent is fitusiran. Fitusiran, also known as ALN-57213, is an siRNA for treating hemophilia A and B, and targets SERPINC1. In some aspects, the present disclosure provides a composition comprising fitusiran and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising fitusiran and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising fitusiran and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0333] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising fitusiran (e.g., a composition, such as a pharmaceutical composition, comprising fitusiran and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising fitusiran and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0334] The oligonucleotide sequence of Fitusiran is an RNA duplex comprising an antisense strand of the sequence UUGAAGUAAAUGGUGUUAACCAG (SEQ ID NO:69) and a sense strand of the sequence GGUUAACACCAUUUACUUCAA (SEQ ID NO:70). In some aspects, Fitusiran is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0335] Homivirsen (VITRAVENE™) In some aspects, the nucleic acid therapeutic agent is fomivirsen (VITRAVENE™). Fomivirsen is an antisense oligonucleotide for treating cytomegalovirus-induced retinitis and HIV infection, targeting cytomegalovirus mRNA. In some aspects, the disclosure provides a composition comprising fomivirsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the disclosure provides a composition comprising fomivirsen and 5-CNAC. In a particular aspect, the disclosure provides a composition comprising fomivirsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0336] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising fomivirsen (e.g., a composition, such as a pharmaceutical composition, comprising fomivirsen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising fomivirsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0337] The oligonucleotide sequence of fomivirsen is GCGTTTGCTCTTCTTCTTGCG (SEQ ID NO: 71). In some aspects, fomivirsen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0338] Ghataparsen In some aspects, the nucleic acid therapeutic agent is gataparsen. Gataparsen is an antisense oligonucleotide for treating acute myeloid leukemia, non-small cell lung cancer, or prostate cancer, and targets BIRC5. In some aspects, the present disclosure provides a composition comprising gataparsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is disodium salt. In a particular aspect, the present disclosure provides a composition comprising gataparsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising gataparsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0339] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein comprising gataparsen (e.g., a composition, such as a pharmaceutical composition, comprising gataparsen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising gataparsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0340] The oligonucleotide sequence of gataparsen is TGTGCTATTCTGTGAATT (SEQ ID NO: 72). In some aspects, gataparsen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0341] Givociran (GIVLAARI(TM)) In some aspects, the nucleic acid therapeutic agent is givosiran (GIVLAARI™). Givosiran is an siRNA for treating acute hepatic porphyria, targeting 5-aminolevulinic acid synthase (ALAS1). In some aspects, the present disclosure provides a composition comprising givosiran and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising givosiran and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising givosiran and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0342] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising givosiran (e.g., a composition, such as a pharmaceutical composition, comprising givosiran and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising givosiran and a caprylic acid derivative disclosed herein, e.g., the monosodium or disodium salt of 5-CNAC.

[0343] The oligonucleotide sequence of Givosiran is antisense AAUGAUGAGACACUCUUUCUGGU (SEQ ID NO: 73) and sense CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 74). In some aspects, Givosiran is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0344] GNKG-168 In some aspects, the nucleic acid therapeutic agent is GNKG-168. GNKG-168, also known as CPG-685, is an oligonucleotide that functions as a TLR9 agonist. GNKG-168 can be used to treat chronic lymphocytic leukemia. In some aspects, the present disclosure provides a composition comprising GNKG-168 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising GNKG-168 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising GNKG-168 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0345] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises GNKG-168 (e.g., a composition such as a pharmaceutical composition that comprises GNKG-168 and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule that comprises GNKG-168 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0346] The oligonucleotide sequence of GNKG-168 is TCGTCGACGTCGTTCGTTCTC (SEQ ID NO: 75). In some aspects, GNKG-168 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0347] Golodirsen (VYONDYS53(trademark)) In some aspects, the nucleic acid therapeutic agent is gologirsen (VYONDYS53™). Gologirsen, also known as SRP-4053 and VYONDYS53™, is an antisense oligonucleotide used to treat Duchenne muscular dystrophy by splicing modulation, and targets DMD exon 53. In some aspects, the present disclosure provides a composition comprising gologirsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising gologirsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising gologirsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0348] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises gologirsen (e.g., a composition such as a pharmaceutical composition that comprises gologirsen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule that comprises gologirsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0349] The oligonucleotide sequence of gologirsen is GTTGCCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: 76). In some aspects, gologirsen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0350] GPI-2A In some aspects, the nucleic acid therapeutic agent is GPI-2A. GPI-2A is an antisense oligonucleotide for treating HIV and inhibits the capsid expression of human immunodeficiency virus type 1. In some aspects, the present disclosure provides a composition comprising GPI-2A and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising GPI-2A and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising GPI-2A and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0351] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising GPI-2A (e.g., a composition, such as a pharmaceutical composition, comprising GPI-2A and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising GPI-2A and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0352] The oligonucleotide sequence of GPI-2A is GGTTCTTTTGGTCCTTGTCT (SEQ ID NO: 77). In some aspects, GPI-2A is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0353] GTI-2040 In some aspects, the nucleic acid therapeutic agent is GTI-2040. GTI-2040, also known as LOR-2040, is an antisense oligonucleotide for treating renal cell carcinoma and functions as a DNA synthesis inhibitor. GTI-2040 can be used to treat acute myeloid leukemia, bladder cancer, breast cancer, chronic myeloid leukemia, colorectal cancer, myelodysplastic syndrome, non-small cell lung cancer, or prostate cancer. In some aspects, the present disclosure provides a composition comprising GTI-2040 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising GTI-2040 and 5-CNAC. In a particular aspect, the disclosure provides a composition comprising GTI-2040 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0354] The disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising GTI-2040 (e.g., a composition, such as a pharmaceutical composition, comprising GTI-2040 and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising GTI-2040 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0355] The oligonucleotide sequence of GTI-2040 is GGCTAATCGCTCCACCAAG (SEQ ID NO: 78). In some aspects, GTI-2040 is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0356] GTI-2501 In some aspects, the nucleic acid therapeutic agent is GTI-2501. GTI-2501 is an antisense oligonucleotide for treating renal cell carcinoma, and functions as a DNA synthesis inhibitor by targeting ribonucleoside-diphosphate reductase large subunit. GTI-2501 can be used to treat acute myeloid leukemia, bladder cancer, breast cancer, chronic myeloid leukemia, colorectal cancer, myelodysplastic syndrome, non-small cell lung cancer, or prostate cancer. In some aspects, the present disclosure provides a composition comprising GTI-2501 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising GTI-2501 and 5-CNAC. In a particular aspect, the disclosure provides a composition comprising GTI-2501 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0357] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising GTI-2501 (e.g., a composition, such as a pharmaceutical composition, comprising GTI-2501 and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising GTI-2501 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0358] The oligonucleotide sequence of GTI-2501 is CTCTAGCGTCTAAAGCCGA (SEQ ID NO: 79). In some aspects, GTI-2501 is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0359] HBVAXPRO In some aspects, the nucleic acid therapeutic agent is HBVAXPRO. HBVAXPRO is a decoy for treating hepatitis B and targets HBV. In some aspects, the present disclosure provides a composition comprising HBVAXPRO and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising HBVAXPRO and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising HBVAXPRO and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0360] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that includes HBVAXPRO (e.g., a composition such as a pharmaceutical composition that includes HBVAXPRO and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that includes HBVAXPRO and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, HBVAXPRO is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0361] IMT-504 In some aspects, the nucleic acid therapeutic agent is IMT-504. IMT-504 is a B cell immunostimulatory oligonucleotide for treating diabetes, rabies, breast cancer, chronic lymphocytic leukemia, hepatitis B, influenza virus infection, neuropathic pain, osteoporosis, or sepsis. In some aspects, the present disclosure provides a composition comprising IMT-504 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising IMT-504 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising IMT-504 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0362] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising IMT-504 (e.g., a composition, such as a pharmaceutical composition, comprising IMT-504 and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising IMT-504 and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0363] The oligonucleotide sequence of IMT-504 is TCATCATTTTGTCATTTTGTCATT (SEQ ID NO: 80). In some aspects, IMT-504 is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0364] Inclisiran In some aspects, the nucleic acid therapeutic agent is inclisiran. Inclisiran, also known as ALN-60212, is an siRNA for treating hypercholesterolemia and targets PCSK9. In some aspects, the present disclosure provides a composition comprising inclisiran and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising inclisiran and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising inclisiran and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0365] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising inclisiran (e.g., a composition, such as a pharmaceutical composition, comprising inclisiran and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising inclisiran and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0366] The oligonucleotide sequence of inclisiran is an RNA duplex that includes an antisense strand with the sequence CUAGACCUGUTUUGCUUUUGUN (SEQ ID NO: 81) and a sense strand with the sequence ACAAAAGCAAAACAGGUCUAGAA (SEQ ID NO: 82). In some aspects, inclisiran is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0367] Inotersen In some aspects, the nucleic acid therapeutic agent is inotersen (TEGSEDI™). Inotersen is an antisense oligonucleotide for treating hereditary transthyretin-mediated amyloidosis or polyneuropathy, and targets TTR. In some aspects, the present disclosure provides a composition comprising inotersen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising inotersen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising inotersen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0368] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising inotersen (e.g., a composition, such as a pharmaceutical composition, comprising inotersen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising inotersen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0369] The oligonucleotide sequence of inotersen is UCUUGGTTACATGAAAUCCC (SEQ ID NO: 83). In some aspects, inotersen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0370] Imetelstat In some aspects, the nucleic acid therapeutic agent is imetelstat. Imetelstat is a telomerase inhibitor oligonucleotide for treating myelodysplastic syndrome, myelofibrosis, multiple myeloma, acute myelogenous leukemia, chronic myelogenous leukemia, breast cancer, essential thrombocythemia, lymphoproliferative disease, non-small cell lung cancer, polycythemia vera, or solid tumors. In some aspects, the present disclosure provides a composition comprising imetelstat and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising imetelstat and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising imetelstat and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0371] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises imetelstat (e.g., a composition, such as a pharmaceutical composition, that comprises imetelstat and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule that comprises imetelstat and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0372] The oligonucleotide sequence of Imetelstat is TAGGGTTAGACAA (SEQ ID NO: 84). In some aspects, Imetelstat is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0373] IONIS-APO(a)-Rx In some aspects, the nucleic acid therapeutic agent is IONIS-APO(a)-Rx. IONIS-APO(a)-Rx is an antisense oligonucleotide for treating high lipoprotein levels, targeting apolipoprotein A. In some aspects, the present disclosure provides a composition comprising IONIS-APO(a)-Rx and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising IONIS-APO(a)-Rx and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising IONIS-APO(a)-Rx and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0374] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that includes IONIS-APO(a)-Rx (e.g., a composition such as a pharmaceutical composition that includes IONIS-APO(a)-Rx and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that includes IONIS-APO(a)-Rx and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, IONIS-APO(a)-Rx is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0375] IONIS-C9Rx In some aspects, the nucleic acid therapeutic agent is IONIS-C9Rx. IONIS-C9Rx is an antisense oligonucleotide for treating ALS, and targets C9ORF72. In some aspects, the present disclosure provides a composition comprising IONIS-C9Rx and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising IONIS-C9Rx and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising IONIS-C9Rx and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0376] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises IONIS-C9Rx (e.g., a composition such as a pharmaceutical composition that comprises IONIS-C9Rx and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that comprises IONIS-C9Rx and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, IONIS-C9Rx is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0377] IONIS-DNM2-2.5Rx In some aspects, the nucleic acid therapeutic agent is IONIS-DNM2-2.5Rx. IONIS-DNM2-2.5Rx is an antisense oligonucleotide for treating centronuclear myopathy and targets DNM2. In some aspects, the present disclosure provides a composition comprising IONIS-DNM2-2.5Rx and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising IONIS-DNM2-2.5Rx and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising IONIS-DNM2-2.5Rx and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0378] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that includes IONIS-DNM2-2.5Rx (e.g., a composition such as a pharmaceutical composition that includes IONIS-DNM2-2.5Rx and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that includes IONIS-DNM2-2.5Rx and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, IONIS-DNM2-2.5Rx is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0379] IONIS-FXIRx In some aspects, the nucleic acid therapeutic agent is IONIS-FXIRx. IONIS-FXIRx is an antisense oligonucleotide for treatment in total knee arthroplasty, and targets factor XI. In some aspects, the present disclosure provides a composition comprising IONIS-FXIRx and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising IONIS-FXIRx and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising IONIS-FXIRx and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0380] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that includes IONIS-FXIRx (e.g., a composition such as a pharmaceutical composition that includes IONIS-FXIRx and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that includes IONIS-FXIRx and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, IONIS-FXIRx is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0381] IONIS-GCGRRx In some aspects, the nucleic acid therapeutic agent is IONIS-GCGRRx. IONIS-GCGRRx is an antisense oligonucleotide for treating type 2 diabetes and targets glucagon receptor. In some aspects, the present disclosure provides a composition comprising IONIS-GCGRRx and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising IONIS-GCGRRx and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising IONIS-GCGRRx and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0382] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises IONIS-GCGRRx (e.g., a composition such as a pharmaceutical composition that comprises IONIS-GCGRRx and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that comprises IONIS-GCGRRx and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, IONIS-GCGRRx is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0383] IONIS-MAPTRx In some aspects, the nucleic acid therapeutic agent is IONIS-MAPTRx. IONIS-MAPTRx is an antisense oligonucleotide for treating Alzheimer's disease, and targets MAPT. In some aspects, the present disclosure provides a composition comprising IONIS-MAPTRx and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising IONIS-MAPTRx and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising IONIS-MAPTRx and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0384] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises IONIS-MAPTRx (e.g., a composition such as a pharmaceutical composition that comprises IONIS-MAPTRx and the monosodium salt or disodium salt of 5-CNAC). Also provided is a pill or capsule that comprises IONIS-MAPTRx and a caprylic acid derivative disclosed herein, such as the monosodium salt or disodium salt of 5-CNAC. In some aspects, IONIS-MAPTRx is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0385] IONIS-TTRRx In some aspects, the nucleic acid therapeutic agent is IONIS-TTRRx. IONIS-TTRRx is an antisense oligonucleotide for treating familial amyloid polyneuropathy (FAP) and targets transthyretin. In some aspects, the present disclosure provides a composition comprising IONIS-TTRRx and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising IONIS-TTRRx and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising IONIS-TTRRx and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0386] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises IONIS-TTRRx (e.g., a composition such as a pharmaceutical composition that comprises IONIS-TTRRx and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule that comprises IONIS-TTRRx and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC. In some aspects, IONIS-TTRRx is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0387] ISIS EIF4E Rx In some aspects, the nucleic acid therapeutic agent is ISIS EIF4E Rx. ISIS EIF4E Rx is an antisense oligonucleotide for treating castration-resistant prostate cancer, and targets eIF-4E. In some aspects, the present disclosure provides a composition comprising ISIS EIF4E Rx and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivative, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising ISIS EIF4E Rx and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising ISIS EIF4E Rx and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0388] The present disclosure also provides a method for treating or preventing disease or pathology in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises ISIS EIF4E Rx (e.g., a composition such as a pharmaceutical composition that comprises ISIS EIF4E Rx and the monosodium salt or disodium salt of 5-CNAC). Also provided is a pill or capsule that comprises ISIS EIF4E Rx and a caprylic acid derivative disclosed herein, such as the monosodium salt or disodium salt of 5-CNAC. In some aspects, ISIS EIF4E Rx is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0389] ISIS-104838, ISIS-1082, ISIS-2503, ISIS-333611, ISIS-113715, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843, and ISIS-757456 In some aspects, the nucleic acid therapeutic agent is ISIS-104838, ISIS-1082, ISIS-2503, ISIS-333611, ISIS-113715, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843, or ISIS-757456. In some aspects, the present disclosure provides a composition comprising ISIS-104838, ISIS-1082, ISIS-2503, ISIS-333611, ISIS-113715, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843, or ISIS-757456 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising ISIS-104838, ISIS-1082, ISIS-2503, ISIS-333611, ISIS-113715, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843, or ISIS-757456, and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising ISIS-104838, ISIS-1082, ISIS-2503, ISIS-333611, ISIS-113715, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843, or ISIS-757456, and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0390] The disclosure also provides a method of treating or preventing a disease or condition in a subject in need of such treatment or prevention, the method comprising administering to a subject an effective amount of any of the compounds described herein, including ISIS-104838, ISIS-1082, ISI-2503, ISIS-333611, ISIS-113715, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843, or ISIS-757456. The method includes administering to the subject a disclosed composition (e.g., a composition such as a pharmaceutical composition comprising ISIS-104838, ISIS-1082, ISI-2503, ISIS-333611, ISIS-113715, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843, or ISIS-757456 and the monosodium or disodium salt of 5-CNAC). Also provided are pills or capsules containing ISIS-104838, ISIS-1082, ISI-2503, ISIS-333611, ISIS-113715, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843, or ISIS-757456 and a caprylic acid derivative as disclosed herein, e.g., the monosodium or disodium salt of 5-CNAC. In some aspects, ISIS-104838, ISIS-1082, ISI-2503, ISIS-333611, ISIS-113715, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843 or ISIS-757456 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc.In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0391] Rademyrsen In some aspects, the nucleic acid therapeutic agent is rademircene. Rademircene is an antisense oligonucleotide that targets miR-21. In some aspects, rademircene can be used to treat Alport syndrome. In some aspects, the present disclosure provides a composition comprising rademircene and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising rademircene and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising rademircene and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0392] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising rademircene (e.g., a composition, such as a pharmaceutical composition, comprising rademircene and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising rademircene and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0393] The oligonucleotide sequence of rademircene is ACATCAGTCTGAUAAGCTA (SEQ ID NO: 85). In some aspects, rademircene is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0394] Lexaptepidopegol In some aspects, the nucleic acid therapeutic agent is lexaptepidopegol. Lexaptepidopegol, also known as NOX-H94, is an aptamer for treating anemia, end-stage renal disease, anemia associated with chronic disease, chronic disease, and inflammation, and targets hepcidin. In some aspects, the present disclosure provides a composition comprising lexaptepidopegol and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising lexaptepidopegol and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising lexaptepidopegol and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0395] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising lexaptepidopegol (e.g., a composition, such as a pharmaceutical composition, comprising lexaptepidopegol and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising lexaptepidopegol and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0396] The oligonucleotide sequence of lexaptepide pegol is GCGCCGUAUGGGAUUAAGUAAAUGAGGAGUUGGAGGAAGGGCGC (SEQ ID NO: 86). In some aspects, lexaptepide is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc or PEG. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0397] Ritenimod In some aspects, the nucleic acid therapeutic agent is ritenimod. Ritenimod is a 26-mer modified oligodeoxynucleotide (ODN) that functions as a TLR9 agonist. In some aspects, the present disclosure provides a composition comprising ritenimod and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising ritenimod and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising ritenimod and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0398] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising ritenimod (e.g., a composition, such as a pharmaceutical composition, comprising ritenimod and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising ritenimod and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0399] The oligonucleotide sequence of ritenimod is TAAACGTTATAACGTTATGACGTCAT (SEQ ID NO: 87). In some aspects, ritenimod is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0400] Lumasilan In some aspects, the nucleic acid therapeutic agent is lumasiran. Lumasiran is an siRNA for treating primary oxaluria type 1, and targets HAO1. In some aspects, the present disclosure provides a composition comprising lumasiran and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising lumasiran and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising lumasiran and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0401] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising lumasiran (e.g., a composition, such as a pharmaceutical composition, comprising lumasiran and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising lumasiran and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0402] The oligonucleotide sequence of Lumasiran is a double-stranded RNA (dsRNA) comprising an antisense strand of the sequence GACUUUCAUCCUGGAAAUAUA (SEQ ID NO: 88) and a sense strand of the sequence UAUAUUUCCAGGAUGAAAGUCCA (SEQ ID NO: 89). In some aspects, Lumasiran is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0403] Mipomersen In some aspects, the nucleic acid therapeutic agent is mipomersen (KYNAMRO™). Mipomersen is an antisense oligonucleotide for treating familial hypercholesterolemia and targets APOB. In some aspects, the present disclosure provides a composition comprising mipomersen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising mipomersen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising mipomersen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0404] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising mipomersen (e.g., a composition, such as a pharmaceutical composition, comprising mipomersen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising mipomersen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0405] The oligonucleotide sequence of mipomersen is GCCUCAGTCTGCTTCGCACC (SEQ ID NO: 90). In some aspects, mipomersen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0406] Mirabilis In some aspects, the nucleic acid therapeutic agent is miravirsen. Miravirsen, also known as SPC3649, is an antisense oligonucleotide for treating chronic hepatitis C (CHC) infection, and targets miRNA-122. In some aspects, the present disclosure provides a composition comprising miravirsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising miravirsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising miravirsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0407] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising miravirsen (e.g., a composition, such as a pharmaceutical composition, comprising miravirsen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising miravirsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0408] The oligonucleotide sequence of miravirsen is CCATTGTCACACTCC (SEQ ID NO: 91). In some aspects, miravirsen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0409] Mongersen In some aspects, the nucleic acid therapeutic agent is mongersen. Mongersen, also known as GED-0301, is an antisense oligonucleotide for treating Crohn's disease and targets SMAD7. In some aspects, the present disclosure provides a composition comprising mongersen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising mongersen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising mongersen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0410] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising mongersen (e.g., a composition, such as a pharmaceutical composition, comprising mongersen and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising mongersen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0411] The oligonucleotide sequence of mongersen is GTCGCCCCTTCTCCCCGCAGC (SEQ ID NO:92). In some aspects, mongersen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0412] MTL-CEBPA In some aspects, the nucleic acid therapeutic agent is MTL-CEBPA. MTL-CEBPA is a small activating RNA (saRNA) designed to alleviate immune suppression of bone marrow cells by restoring C / EBP-α protein to normal levels using an RNA activation mechanism. MTL-CEBPA can be used to treat liver cancer, solid tumors, colorectal cancer, hepatocellular carcinoma, or liver disorders. In some aspects, the present disclosure provides a composition comprising MTL-CEBPA and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising MTL-CEBPA and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising MTL-CEBPA and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0413] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising MTL-CEBPA (e.g., a composition, such as a pharmaceutical composition, comprising MTL-CEBPA and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising MTL-CEBPA and a caprylic acid derivative disclosed herein, e.g., the monosodium or disodium salt of 5-CNAC. See, e.g., Setten et al., (2018) "Development of MTL-CEBPA: Small Activating RNA Drug for Hepatocellular Carcinoma," Curr. Pharm. Biotechnol. 19(8):611-621. In some aspects, the MTL-CEBPA is unconjugated; i.e., the oligonucleotide is not attached to a delivery moiety, such as GalNAc. In some aspects, the unconjugated form (eg, without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0414] ND-L02-s0201 In some aspects, the nucleic acid therapeutic agent is ND-L02-s0201. ND-L02-s0201, also known as BMS-986263, is an siRNA for treating extensive liver fibrosis and targets HSP47. In some aspects, the present disclosure provides a composition comprising ND-L02-s0201 and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising ND-L02-s0201 and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising ND-L02-s0201 and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0415] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein comprising ND-L02-s0201 (e.g., a composition, such as a pharmaceutical composition, comprising ND-L02-s0201 and a monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising ND-L02-s0201 and a caprylic acid derivative disclosed herein, such as a monosodium or disodium salt of 5-CNAC. In some aspects, ND-L02-s0201 is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0416] Nedosilan In some aspects, the nucleic acid therapeutic agent is nedosiran. Nedosiran is an siRNA for treating primary oxaluria and targets LDHA. In some aspects, the present disclosure provides a composition comprising nedosiran and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is disodium salt. In a particular aspect, the present disclosure provides a composition comprising nedosiran and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising nedosiran and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0417] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising nedosiran (e.g., a composition, such as a pharmaceutical composition, comprising nedosiran and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising nedosiran and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0418] The oligonucleotide sequence of Nedosilan is a double-stranded RNA (dsRNA) comprising an antisense strand of the sequence UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 93) and a sense strand of the sequence AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 94). In some aspects, Nedosilan is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0419] Nusinersen In some aspects, the nucleic acid therapeutic agent is nusinersen (SPINRAZA™). Nusinersen is an antisense oligonucleotide (splice modulator) for treating infantile-onset spinal muscular atrophy, and targets exon 7 of motor neuron survival gene 2 (SMN2) splicing modulator. In some aspects, the present disclosure provides a composition comprising nusinersen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising nusinersen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising nusinersen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0420] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein comprising nusinersen (e.g., a composition, such as a pharmaceutical composition, comprising nusinersen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising nusinersen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0421] The oligonucleotide sequence of nusinersen is TCACCTTTATAATGCTGG (SEQ ID NO: 95). In some aspects, nusinersen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0422] Oblimersen In some aspects, the nucleic acid therapeutic agent is oblimersen (GENASENSE™). Oblimersen is an antisense oligonucleotide for treating melanoma and targets Bcl-2. In some aspects, the present disclosure provides a composition comprising oblimersen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising oblimersen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising oblimersen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0423] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising oblimersen (e.g., a composition, such as a pharmaceutical composition, comprising oblimersen and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising oblimersen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0424] The oligonucleotide sequence of oblimersen is TCTCCCAGCGTGCGCCAT (SEQ ID NO: 96). In some aspects, oblimersen is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0425] Orapteseedopegol In some aspects, the nucleic acid therapeutic agent is oraptedopegol. Oraptedopegol, also known as NOX-A12, is an aptamer for treating chronic lymphocytic leukemia, multiple myeloma, hematopoietic stem cell transplantation, autologous stem cell transplantation, glioblastoma, metastatic colorectal cancer, or metastatic pancreatic cancer, and targets CXCL12. In some aspects, the present disclosure provides a composition comprising oraptedopegol and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising oraptedopegol and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising oraptedopegol and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0426] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising olaptedopegol (e.g., a composition, such as a pharmaceutical composition, comprising olaptedopegol and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising olaptedopegol and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0427] The oligonucleotide sequence of orapteseed pegol is GCGUGGUGUGAUCUAGAUGUAUUGGCUGAUCCUAGUCAGGUACGC (SEQ ID NO: 97). In some aspects, orapteseed is unconjugated; i.e., the oligonucleotide is not linked to a delivery moiety such as GalNAc or PEG. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0428] Olpaciran In some aspects, the nucleic acid therapeutic agent is olpaciran. Olpaciran is an siRNA for treating cardiovascular disease and targets lipoprotein(a) (Lp(a)). In some aspects, the present disclosure provides a composition comprising olpaciran and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising olpaciran and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising olpaciran and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0429] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising olpaciran (e.g., a composition, such as a pharmaceutical composition, comprising olpaciran and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising olpaciran and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0430] The oligonucleotide sequence of olpaciran is a double-stranded RNA (dsRNA) comprising an antisense strand of the sequence CAGCCCCUUAUUGUUAUACGA (SEQ ID NO: 98) and a sense strand of the sequence UCGUAUAACAAUAAGGGGCUG (SEQ ID NO: 99). In some aspects, olpaciran is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0431] Patisiran In some aspects, the nucleic acid therapeutic is patisiran (ONPATTRO™). Patisiran is an siRNA for treating hereditary transthyretin-mediated amyloidosis and neuropathy, targeting transthyretin. In some aspects, the present disclosure provides a composition comprising patisiran and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising patisiran and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising patisiran and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0432] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising patisiran (e.g., a composition, such as a pharmaceutical composition, comprising patisiran and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule comprising patisiran and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0433] The oligonucleotide sequence of patisiran is a double-stranded RNA (dsRNA) comprising an antisense strand of the sequence GUAACCAAGAGUAUUCCAUTT (SEQ ID NO: 100) and a sense strand of the sequence AUGGAAUACUCUUGGUUACTT (SEQ ID NO: 101). In some aspects, patisiran is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, e.g., as an oral capsule.

[0434] Pegaptanib In some aspects, the nucleic acid therapeutic agent is pegaptanib (MACUGEN™). Pegaptanib is an aptamer for treating wet macular degeneration and age-related neovascular macular degeneration, and targets VEGF. In some aspects, the present disclosure provides a composition comprising pegaptanib and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising pegaptanib and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising pegaptanib and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0435] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises pegaptanib (e.g., a composition such as a pharmaceutical composition that comprises pegaptanib and the monosodium salt or disodium salt of 5-CNAC).Also provided is a pill or capsule that comprises pegaptanib and a caprylic acid derivative disclosed herein, such as the monosodium salt or disodium salt of 5-CNAC.

[0436] The oligonucleotide sequence of pegaptanib is CGGAAUCAGUGAAUGCUUAUACAUCCGT (SEQ ID NO: 102). In some aspects, pegaptanib is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc or PEG. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0437] Pegprelanib In some aspects, the nucleic acid therapeutic agent is pegplelanib (FOVISTA™). Pegplelanib is an aptamer for treating subfoveal neovascular age-related macular degeneration and targets PDGF-B. In some aspects, the present disclosure provides a composition comprising pegplelanib and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising pegplelanib and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising pegplelanib and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0438] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises pegprelanib (e.g., a composition such as a pharmaceutical composition that comprises pegprelanib and the monosodium salt or disodium salt of 5-CNAC).Also provided is a pill or capsule that comprises pegprelanib and a caprylic acid derivative disclosed herein, such as the monosodium salt or disodium salt of 5-CNAC.

[0439] The oligonucleotide sequence of pegprelanib is CAGGCUACGCGTAGAGCAUCATGATCCUGT (SEQ ID NO: 103). In some aspects, pegprelanib is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc or PEG. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0440] Perakkarsen In some aspects, the nucleic acid therapeutic agent is peracarsen. Peracarsen, also known as IONIC-APO(a)-LRX and ISIS-681257, is an antisense oligonucleotide for treating hyperlipoproteinemia, targeting apolipoprotein A. In some aspects, the present disclosure provides a composition comprising peracarsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or a derivative thereof, or any of the compounds disclosed in, for example, FIG. 1A, FIG. 1B, FIG. 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising peracarsen and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising peracarsen and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0441] The present disclosure also provides a method of treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a composition disclosed herein comprising peracarsen (e.g., a composition, such as a pharmaceutical composition, comprising peracarsen and the monosodium or disodium salt of 5-CNAC). Also provided is a pill or capsule comprising peracarsen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0442] The oligonucleotide sequence of peracarsen is TGCTCCGTTGGTGCTTGTTC (SEQ ID NO: 104). In some aspects, peracarsen is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., without GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0443] Prexijebersen In some aspects, the nucleic acid therapeutic agent is plexigeneversene. Plexigeneversene is an antisense oligonucleotide for treating acute myeloid leukemia, myelodysplastic syndrome, chronic myeloid leukemia, precursor cell lymphoblastic leukemia-lymphoma, colorectal cancer, head and neck cancer, lymphoma, solid tumor, thyroid cancer, or breast cancer, and targets GRB2. In some aspects, the present disclosure provides a composition comprising plexigeneversene and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some aspects, the caprylic acid derivative disclosed herein is a disodium salt. In a particular aspect, the present disclosure provides a composition comprising plexigeneversene and 5-CNAC. In a particular aspect, the present disclosure provides a composition comprising plexigeneversene and 5-CNAC disodium salt. In some aspects, the composition is formulated for oral delivery.

[0444] The present disclosure also provides a method for treating or preventing a disease or condition in a subject in need of such treatment or prevention, comprising administering to the subject an effective amount of a composition disclosed herein that comprises plexigeneversen (e.g., a composition such as a pharmaceutical composition that comprises plexigeneversen and the monosodium or disodium salt of 5-CNAC).Also provided is a pill or capsule that comprises plexigeneversen and a caprylic acid derivative disclosed herein, such as the monosodium or disodium salt of 5-CNAC.

[0445] The oligonucleotide sequence of plexigeneversin is ATATTTGGCGATGGCTTC (SEQ ID NO: 105). In some aspects, plexigeneversin is unconjugated; that is, the oligonucleotide is not linked to a delivery moiety such as GalNAc. In some aspects, the unconjugated form (e.g., does not have GalNAc) is formulated with 5-CNAC, for example, as an oral capsule.

[0446] Rada Bilsen In some aspects, the nucleic acid therapeutic agent is ladavirsen. Ladavirsen, also known as AVI-7100, is an antisense oligonucleotide for treating influenza A virus infection. In some aspects, the present disclosure provides a composition comprising ladavirsen and a caprylic acid derivative disclosed herein, such as 5-CNAC or its derivatives, or any of the compounds disclosed in, for example, Figure 1A, Figure 1B, Figure 2, or any combination thereof. In some...

Claims

1. A tablet or capsule containing a pH-sensitive enteric coating agent, (i) a therapeutic oligonucleotide, either unconjugated or conjugated to a targeting moiety, and (ii) N-(5-chlorosalicyloyl)-8-aminocaprylic acid (5-CNAC), or a salt thereof An oral composition comprising: The oligonucleotide composition is formulated to release the therapeutic oligonucleotide in the small intestine. Oral compositions.

2. The oral composition of claim 1, wherein the therapeutic oligonucleotide is an antisense oligonucleotide (ASO), a small interfering RNA (siRNA), a small hairpin RNA (shRNA), a DNA aptamer and / or an RNA aptamer, a microRNA (miRNA), an anti-microRNA (antimiR), a CpG oligonucleotide, or a DNA decoy and / or an RNA decoy.

3. The oral composition of claim 1, wherein the salt of 5-CNAC is selected from the group consisting of sodium salts, potassium salts, calcium salts, and any combination thereof, and the salt of 5-CNAC is a mono- or di-salt.

4. The oral composition of claim 1, wherein the targeting moiety comprises GalNAc.

5. The therapeutic oligonucleotide comprising: 1018ISS, AB-729, Abetimus, AEG35156 (GEM640), afovirsen, aganilsen, agatrimod, alicaforsen, ALNAAT-02, amlivirsen, anivamersen, apatursen, aprinocarsen, APTA-16, AR-177 (ZINTEVIR (trademark)), ARC19499 (BAX-499), archexin, AROANG-3, AROAPOC-3, ARO-HSD, AS1411 (AGRO100), ASM-8, asbashiran (asva siran), atesidorsen, ATL-1102, ATU-027, avacincaptad pegol (ZIMURA (trademark)), AVI-4126 (Resten MP (trademark)), AVI-7288, AVI-7537, AVT-02, AZD-8233, AZD-8701, variforsen, bamosiran, bazlitoran, BC007, beclanorsen, versesiran, bepirovirsen, bevasiranib, BIIB-080, BMN044, BMN053, brivolizide, casimerce , cavrotolimod, cemdisiran, cenersen, cepadakrusen (CIVI008), cimderlirsen, cobitolimod, cobomarsen, CODA-001 (NEXAGON™), cofirasersen, cosdosiran, CpG7909, CPG-8954, cupabimod, custricene, dambatirsen, daplusiran, defibrotide (DEFITE LIO (trademark)), dematirsen, donidarolsen, drisapersen (KYNDRISA (trademark)), DYN-101, egifoligide, egaptibongol, EIF-4E, eluforsen, emapticapegol, aprontersen, eteplirsen (EXONDYS51 (trademark)), fadilsilane, fesomersen, fitusiran, homivirsen (VITRAVENE (trademark)), frenlosirsen, gataparsen, givosiran (GIVLAARI (trademark)),GNKG-168 (CPG-685), golodirsen (SRP-4053, VYONDYS53™), GPI-2A, GTI-2040 (LOR-2040), GTI-2501, GTX-102, HBVAXPRO, imetelstat, IMT-504, inclisiran, inotersen (TEGSEDI™), ION-224, ION-253, ION-363, ION-464, ION-541, ION-859, IONIS-A GTLRx, IONIS-APO(a)-Rx, IONISAR-2.5Rx, IONIS-C9Rx, IONIS-DNM2-2.5Rx, IONISENAC-2.5Rx, IONIS-FB-LRx, IONIS-FX ILRx, IONIS-FXIRx, IONIS-GCGRRx, IONIS-HBVLRX, IONIS-MAPTRx, IONIS-PKKRx, IONISTMPRSS-6LRx, IONIS-TTRRx, ISIS EIF4E Rx, ISIS-104838, ISIS-1082, ISIS-113715, ISIS-2503, ISIS-333611, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843, ISIS-757456, ISIS-863633, ISTH-0036, JNJ-3989, rademirsen, lexanersen (WVE-120102), lexaptepid pegol (NOX-H94), ritenimod, LSP-GR3, lumasiran, mipoton Mersen (KYNAMRO™), miravirsen, monarsen, mongersen, MT-5745, MTL-CEBPA, ND-L02-s0201 (BMS-986263), nedosiran, NS-089, nusinersen (SPINRAZA™), oblimersen (SPC2996, GENASENSE™), olapteseedopegol (NOX-A12), olezarsen, olpatiran, OLX-101, patisiran (ONPATTRO™), pegaptanib (MACUG, EN™), pegnivacogin, pegprelanib (FOVISTA™), peracarsen, plexigenes, PUL-042, QPI-1007, QR-1123, QRX-421a, ladavirsen, remlarsen, lenadilsen, revusiran, RG-012, RG-101, RG-6346, RGLS-4326, rimigolsen (rimigolsen gorsen), losomidonal, rovanersen (WVE-120101), sapabrusen, SB010, sepofarsen, siG-12D-LODER, SLN124, SR-063, SRP-5051, STK-001, STP-705, suvodirsen, tadnersen (t adnersen), temavirsen, teprasiran, tilsotolimod, tivanisiran (SYLENTIS™), tofersen, tominersen, tomligisiran, TOP-1731, travedersen (AP-12009), trecovirsen, valodarsen (var odarsen), VEGLIN3, vidutolimod, viltolarsen (VILTEPSO™), VIR-2218, voranesorsen (WAYLIVRA™), bupanorsen, butrisirane, WVE-003, WVE-004, WVEN-531, zilebesiran, and zilganersen, selected from the group consisting of The oral composition of claim 1.

6. The oral composition of claim 1, wherein the therapeutic oligonucleotide comprises an array selected from the group consisting of SEQ ID NOs: 1-157.

7. The oral composition of claim 1, further comprising at least one additive.

8. The oral composition of claim 7, wherein the at least one additive comprises a pH adjuster, a preservative, a surfactant, a plasticizer, a lubricant, a fluidization aid, a compression aid, a solubilizer, a diluent, or a combination thereof.

9. The oral composition of claim 1, wherein the pH-sensitive enteric coating agent dissolves in intestinal fluids at a pH value higher than the pH value of the stomach, does not substantially disintegrate or dissolve in the stomach, and has a pH value of about 5.5 to about 7.5 or about 7.2 to about 7.

3.

10. The oral composition of claim 1, wherein the pH-sensitive enteric coating agent comprises hydroxypropyl methylcellulose, a copolymer of methacrylic acid and methacrylic methacrylate, or a combination thereof.

11. The oral composition of claim 1, further comprising an enzyme inhibitor that prevents enzymatic degradation of the therapeutic oligonucleotide in the stomach and / or intestines.

12. The oral composition of claim 1, wherein the capsule is a gelatin capsule.

13. The oral composition of claim 1, wherein the tablet or capsule has a weight of 10 mg to 500 mg.

14. The oral composition of claim 1, wherein the tablet or capsule contains 1 mg to 500 mg of a therapeutic oligonucleotide. (i) a therapeutic oligonucleotide in the range of about 1 mg to about 100 mg, about 5 mg to about 100 mg, about 10 mg to about 100 mg, about 20 mg to about 100 mg, or about 20 mg to about 50 mg; and (ii) about 100 to about 200 mg of 5-CNAC The oral composition of claim 1 , comprising: (i) a therapeutic oligonucleotide comprising a sequence selected from SEQ ID NOs: 1 to 157; and (ii) N-(5-chlorosalicyloyl)-8-aminocaprylic acid (5-CNAC), or a salt thereof A tablet or capsule comprising: A tablet or capsule comprising a pH sensitive enteric coating.

17. The therapeutic oligonucleotide is selected from the group consisting of 1018ISS, AB-729, avetimus, AEG35156 (GEM640), afovirsen, aganirsen, agatrimod, alicaforsen, ALNAAT-02, amlivirsen, anivamersen, apatursen, aprinocarsen, APTA-16, AR-177 (ZINTEVIR (trademark)), ARC19499 (BAX-499), archexin, AROANG-3, AROAPOC-3, ARO-HSD, AS1411 (AGRO100), ASM-8, asvasiran, atesidorsen, ATL-1102, ATU-027, avacincaptad pegol (ZIMURA™), AVI-4126 (Resten MP™), AVI-7288, AVI-7537, AVT-02, AZD-8233, AZD-8701, variforsen, bamosiran, bazlitoran, BC007, beclanosen, versesiran, bepirovirsen, bevasiranib, BIIB-080, BMN044, B MN053, brivolizide, casimersen, cavrotolimod, cemdisiran, cenersen, cepadakrusen (CIVI008), cimderlirsen, cobitolimod, cobomarsen, CODA-001 (NEXAGON™), cofirasersen, cosdosiran, CpG7909, CPG-8954, cupabimod, custricene, dambatirsen, daplusiran ran), defibrotide (DEFITELIO™), dematirsen, donidarolsen, drisapersen (KYNDRISA™), DYN-101, egifoligide, egaptibongol, EIF-4E, elforsen, emapticapegol, aprontersen, eteplirsen (EXONDYS51™), fadilsilane, fesomersen, fitusiran, fomivirsen (VITRAVENE™), frenlosirsen, gataparsen,Givosiran (GIVLAARI™), GNKG-168 (CPG-685), golodirsen (SRP-4053, VYONDYS53™), GPI-2A, GTI-2040 (LOR-2040), GTI-2501, GTX-102, HBVAXPRO, imetelstat, IMT-504, inclisiran, inotersen (TEGSEDI™), ION-224, ION-253, ION-363, ION-464, ION-541, ION-8 59, IONIS-AGTLRx, IONIS-APO(a)-Rx, IONISAR-2.5Rx, IONIS-C9Rx, IONIS-DNM2-2.5Rx, IONISENAC-2.5Rx, IONIS-FB-LRx, ION IS-FXILRx, IONIS-FXIRx, IONIS-GCGRRx, IONIS-HBVLRX, IONIS-MAPTRx, IONIS-PKKRx, IONISTMPRSS-6LRx, IONIS-TTRRx, ISIS EIF4E Rx, ISIS-104838, ISIS-1082, ISIS-113715, ISIS-2503, ISIS-333611, ISIS-426115, ISIS-449884, ISIS-463588, ISIS-5132, ISIS-702843, ISIS-757456, ISIS-863633, ISTH-0036, JNJ-3989, rademirsen, lexanersen (WVE-120102), lexaptepid pegol (NOX-H94), ritenimod, LSP-GR3, lumasiran, mipoton Mersen (KYNAMRO™), miravirsen, monarsen, mongersen, MT-5745, MTL-CEBPA, ND-L02-s0201 (BMS-986263), nedosiran, NS-089, nusinersen (SPINRAZA™), oblimersen (SPC2996, GENASENSE™), olapteseedopegol (NOX-A12), olezarsen, olpatiran, OLX-101, patisiran (ONPATTRO™), pegaptanib (MACUG, EN™), pegnivacogin, pegprelanib (FOVISTA™), peracarsen, plexigenes, PUL-042, QPI-1007, QR-1123, QRX-421a, ladavirsen, remlarsen, lenadilsen, revusiran, RG-012, RG-101, RG-6346, RGLS-4326, rimigolsen (rimigolsen gorsen), losomidonal, rovanersen (WVE-120101), sapabrusen, SB010, sepofarsen, siG-12D-LODER, SLN124, SR-063, SRP-5051, STK-001, STP-705, suvodirsen, tadnersen (t adnersen), temavirsen, teprasiran, tilsotolimod, tivanisiran (SYLENTIS™), tofersen, tominersen, tomligisiran, TOP-1731, travedersen (AP-12009), trecovirsen, valodarsen (var odarsen), VEGLIN3, vidutolimod, viltolarsen (VILTEPSO™), VIR-2218, voranesorsen (WAYLIVRA™), bupanorsen, butrisirane, WVE-003, WVE-004, WVEN-531, zilebesiran, and zilganersen, selected from the group consisting of 17. The tablet or capsule of claim 16.

18. A method for producing the oral composition of claim 1, comprising: (a) mixing (i) the therapeutic oligonucleotide, (ii) 5-CNAC or a salt thereof, and (iii) at least one excipient, wherein the mixing comprises dry mixing; and (b) encapsulating the dry blend from step (a) into a capsule, the capsule comprising a pH sensitive enteric coating, the capsule being formulated to release the therapeutic oligonucleotide in the small intestine. A method comprising:

19. Use of an oral composition according to any one of claims 1 to 15 in the manufacture of a medicament for treating a disease or condition in a human subject.

Images