Engineered meganucleases targeting the human mitochondrial genome

Abstract

The present disclosure provides compounds of formula (II), where R1 is an optionally substituted monocyclic or bicyclic saturated, partially unsaturated or aromatic heterocyclyl containing at least one nitrogen atom, and other variables are as defined herein. The compounds are intended to inhibit the activity of coronavirus main protease (M PRO ). Methods for the preparation of the compounds and uses of the compounds, for example in the treatment and / or prevention of coronavirus diseases, such as COVID-19, are also disclosed. [Formula 1] TIFF2024514939000027.tif26170

Description

[Technical field]

[0001] The present disclosure relates to the field of molecular biology and recombinant nucleic acid technology.In particular, the present disclosure relates to a recombinant meganuclease that is genetically engineered to recognize and cleave a recognition sequence found in the human mitochondrial genome.The present disclosure further relates to the use of such recombinant meganuclease in a method for producing genetically modified eukaryotic cells, and a population of genetically modified eukaryotic cells in which mitochondrial DNA is modified.

[0002] Reference to sequence listing submitted as a text file via EFS-WEB This application contains a Sequence Listing that has been submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety. Said ASCII copy, created on Apr. 21, 2022, is named P89339_0139_5_SeqList_4-21-22.txt and is 80.6kb in size. [Background technology]

[0003] In all organisms, mitochondria regulate cellular energy and metabolism under normal growth and development, as well as in response to stress. Many of the proteins that function in these roles are encoded in the mitochondrial genome. Therefore, editing the mitochondrial genome has diverse applications in both animals and plants. In humans, harmful mitochondrial mutations are the cause of several disorders for which gene editing therapy can be applied.

[0004] Pathogenic mitochondrial DNA (mtDNA) mutations include large-scale rearrangements and point mutations in protein-coding, transfer RNA (tRNA) or ribosomal RNA (rRNA) genes. The prevalence of mtDNA-related disease diagnoses is approximately 1 in 5,000, but the population frequency of the 10 most common pathogenic mtDNA mutations is much higher, approaching 1 in 200, meaning that many "normal" individuals carry low levels of mutant genomes (Non-Patent Document 1).

[0005] Mutant mtDNA coexists with wild-type mtDNA in most cases in the patient's cells (mtDNA heteroplasmy). Several studies have shown that wild-type mtDNA has a strong protective effect, and biochemical abnormalities were observed only when the level of mutant mtDNA was higher than 80-90% (Non-Patent Document 2). It has been shown that muscle fibers develop OXPHOS defects only when the mutation load exceeds 80% (Non-Patent Document 3). Therefore, any approach that can shift this balance even by a small percentage towards the wild type has strong therapeutic potential.

[0006] However, mtDNA manipulation remains a scientific frontier due to the inability to target mtDNA with high efficiency and generate precise edits. The mitochondrial genome is difficult to edit, as it requires predictable repair mechanisms and delivery of editing technology to this organelle. Given the difficulties and unpredictability associated with mitochondrial genome editing, there is an unmet need for precise editing of mtDNA, which opens up a whole field of investigation and opportunity in life sciences. The ability to target and edit defined regions of the mitochondrial genome (preferably limited to just one gene) in a more predictable manner is a clear advantage over currently available systems. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Schon et al., Nat Rev Gen 13:878-890 (2012) [Non-Patent Document 2] Schon et al., Nature Reviews Genetics 13:878-890 (2012) [Non-Patent Document 3] Sciacco et al., Hum Mol Genet, 3:13-19 (1994) Summary of the Invention [Problem to be solved by the invention]

[0008] [Means for solving the problem]

[0009] Compositions and methods are provided herein for precise editing of mitochondrial genome. To date, attempts at mitochondrial genome editing have resulted in large-scale and unpredictable deletions / rearrangements. The present invention demonstrates that engineered meganucleases can result in precise editing of mitochondrial DNA (mtDNA), thereby opening up a whole field of research and opportunity in life science. The compositions and methods provided herein can be used to edit one specific mitochondrial gene without affecting the surrounding region.

[0010] In one aspect, the present invention provides a mitochondrial-targeted engineered meganuclease (MTEM) that binds to and cleaves a recognition sequence comprising SEQ ID NO:1 in the mitochondrial genome of a eukaryotic cell, wherein the MTEM comprises an engineered meganuclease bound to a mitochondrial transit peptide (MTP), wherein the engineered meganuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region.

[0011] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs:3-12. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs:3-12. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs:3-12. In some embodiments, the HVR1 region comprises a Y, R, K, or D at a residue corresponding to residue 66 of any one of SEQ ID NOs:3-12. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs:3-12 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs:3-12.

[0012] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of any one of SEQ ID NOs: 3-12. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NOs: 3, 5, 7, 9, 11 or 12. In some embodiments, the first subunit comprises a G, S or A at the residue corresponding to residue 19 of any one of SEQ ID NOs: 3-12. In some embodiments, the first subunit comprises an E, Q or K at the residue corresponding to residue 80 of any one of SEQ ID NOs: 3-12. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 3-12 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 3-12.

[0013] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of any one of SEQ ID NOs: 3 or 5-12. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of any one of SEQ ID NOs: 3-6 or 8-12. In some embodiments, the HVR2 region comprises a residue corresponding to residue 265 of SEQ ID NO: 6. In some embodiments, the HVR2 region comprises a Y, R, K or D at a residue corresponding to residue 257 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs:3-12 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs:3-12.

[0014] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of any one of SEQ ID NOs: 3-12. In some embodiments, the second subunit comprises a residue corresponding to residue 276 of any one of SEQ ID NOs: 4. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of any one of SEQ ID NOs: 3-12. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of any one of SEQ ID NOs: 3-12. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of any one of SEQ ID NOs: 3-12. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 3-12 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 3-12.

[0015] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, the linker covalently linking the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 3-12. In some embodiments, the engineered meganuclease comprises an amino acid sequence of any one of SEQ ID NOs: 3-12. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 33-42. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence of any one of SEQ ID NOs: 33-42.

[0016] In some embodiments, the MTP comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in any one of SEQ ID NOs: 43-45. In some embodiments, the MTP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 43-45. In some embodiments, the MTP is attached to the C-terminus of the engineered meganuclease. In some embodiments, the MTP is attached to the N-terminus of the engineered meganuclease. In some embodiments, the MTP is fused to the engineered meganuclease. In some embodiments, the MTP is attached to the engineered meganuclease by a polypeptide linker. In some embodiments, the engineered meganuclease is attached to a first MTP and a second MTP. In some embodiments, the first MTP and / or the second MTP comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in any one of SEQ ID NOs: 43-45. In some embodiments, the first MTP and / or the second MTP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 43-45. In some embodiments, the first MTP and the second MTP are identical. In some embodiments, the first MTP and the second MTP are not identical. In some embodiments, the first MTP and / or the second MTP are fused to the engineered meganuclease. In some embodiments, the first MTP and / or the second MTP are linked to the engineered meganuclease by a polypeptide linker.

[0017] In some embodiments, the MTEM is linked to a nuclear export sequence (NES). In some embodiments, the NES comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO: 46 or 47. In some embodiments, the NES comprises an amino acid sequence set forth in SEQ ID NO: 46 or 47. In some embodiments, the NES is linked to the N-terminus of the MTEM. In some embodiments, the NES is linked to the C-terminus of the MTEM. In some embodiments, the NES is fused to the MTEM. In some embodiments, the NES is linked to the MTEM by a polypeptide linker. In some embodiments, the MTEM is linked to a first NES and a second NES. In some embodiments, the first NES is linked to the N-terminus of the MTEM and the second NES is linked to the C-terminus of the MTEM. In some embodiments, the first NES and / or the second NES comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO: 46 or 47. In some embodiments, the first NES and / or the second NES comprises an amino acid sequence set forth in SEQ ID NO: 46 or 47. In some embodiments, the first NES and the second NES are identical. In some embodiments, the first NES and the second NES are not identical. In some embodiments, the first NES and / or the second NES are fused to the MTEM. In some embodiments, the first NES and / or the second NES are linked to the MTEM by a polypeptide linker.

[0018] In another aspect, the invention provides a polynucleotide comprising a nucleic acid sequence encoding a MTEM as described herein. In some embodiments, the polynucleotide is an mRNA.

[0019] In another aspect, the present invention provides a recombinant DNA construct comprising a polynucleotide comprising a nucleic acid sequence encoding MTEM as described herein. In some embodiments, the recombinant DNA construct encodes a recombinant virus comprising the polynucleotide. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV). In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to the nucleic acid sequence encoding MTEM. In some embodiments, the promoter is a constitutive promoter, or the promoter is a muscle cell specific promoter, a skeletal muscle specific promoter, a myotube specific promoter, a muscle satellite cell specific promoter, a neuron specific promoter, an astrocyte specific promoter, a microglia specific promoter, an ocular cell specific promoter, a retinal cell specific promoter, a retinal ganglion cell specific promoter, a retinal pigment epithelium specific promoter, a pancreatic cell specific promoter, or a pancreatic beta cell specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter.

[0020] In another aspect, the present invention provides a plasmid comprising any of the recombinant DNA constructs described herein. In another aspect, the present invention provides a recombinant virus comprising a polynucleotide comprising a nucleic acid sequence encoding the MTEM described herein. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV). In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to a nucleic acid sequence encoding the MTEM. In some embodiments, the promoter is a constitutive promoter, or the promoter is a muscle cell specific promoter, a skeletal muscle specific promoter, a myotube specific promoter, a muscle satellite cell specific promoter, a neuron specific promoter, an astrocyte specific promoter, a microglia specific promoter, an ocular cell specific promoter, a retinal cell specific promoter, a retinal ganglion cell specific promoter, a retinal pigment epithelium specific promoter, a pancreatic cell specific promoter, or a pancreatic beta cell specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter.

[0021] In another aspect, the present invention provides a lipid nanoparticle composition comprising a lipid nanoparticle comprising a polynucleotide, wherein the polynucleotide comprises a nucleic acid sequence encoding a MTEM as described herein. In some embodiments, the polynucleotide is an mRNA.

[0022] In another aspect, the invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and a MTEM as described herein.

[0023] In another aspect, the invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and a polynucleotide described herein.

[0024] In another aspect, the present invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and a recombinant DNA construct described herein.

[0025] In another aspect, the invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and a recombinant virus described herein.

[0026] In another aspect, the present invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and a lipid nanoparticle composition described herein.

[0027] In another aspect, the present invention provides a genetically modified eukaryotic cell comprising any of the polynucleotides described herein. In some embodiments, the genetically modified eukaryotic cell is a genetically modified mammalian cell. In some embodiments, the genetically modified eukaryotic cell is a genetically modified human cell.

[0028] In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell, the method comprising introducing into the eukaryotic cell (a) a polynucleotide comprising a nucleic acid sequence encoding a MTEM as described herein, wherein the MTEM is expressed in the eukaryotic cell, or (b) a MTEM as described herein, wherein the MTEM creates a cleavage site in a recognition sequence comprising SEQ ID NO:1 in a mutant mitochondrial genome of the eukaryotic cell. In some embodiments, the cleavage site is repaired by non-homologous end joining such that the recognition sequence comprises an insertion or deletion. In some embodiments, the mutant mitochondrial genome comprising the recognition sequence is degraded in the genetically modified eukaryotic cell. In some embodiments, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% of the mutant mitochondrial genome containing the recognition sequence is degraded in the genetically modified eukaryotic cell. In some embodiments, the ratio of wild-type mitochondrial genome to mutant mitochondrial genome containing the recognition sequence is increased in the genetically modified eukaryotic cell. In some embodiments, the ratio is about 5:95, about 10:90, about 15:85, about 20:80, about 25:75, about 30:70, about 35:65, about 40:60, about 45:55, about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 20:1, about up to 50:1, about 100:1, about 150:1, about 200:1, about 250:1, about 300:1, about 350:1, about 400:1, about 450:1, about 500:1, about 550:1, about 600:1, about 650:1, about 700:1, about 750:1, about 800:1, about 850:1, about 900:1, about 950:1, about 1000:1, or more. In some embodiments, the percentage of wild-type mitochondrial genome in the genetically modified eukaryotic cell is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more of the total mitochondrial genome in the genetically modified eukaryotic cell.In some embodiments, the percentage of mutant mitochondrial genomes containing the recognition sequence in the genetically modified eukaryotic cell is decreased by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more. In some embodiments, the cellular respiration of the genetically modified eukaryotic cell is increased by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or more. In some embodiments, cellular respiration of the genetically modified eukaryotic cell is increased by about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100%, or more.

[0029] In another aspect, the invention provides a method for producing a population of eukaryotic cells comprising a plurality of genetically modified cells, the method comprising introducing into a plurality of eukaryotic cells in the population (a) a polynucleotide comprising a nucleic acid sequence encoding a MTEM as described herein, wherein the MTEM is expressed in the plurality of eukaryotic cells, or (b) a MTEM as described herein, wherein the MTEM creates a cleavage site in a recognition sequence comprising SEQ ID NO:1 in a mutant mitochondrial genome of the plurality of eukaryotic cells. In some embodiments, the cleavage site is repaired by non-homologous end joining such that the recognition sequence comprises an insertion or deletion. In some embodiments, the mutant mitochondrial genome comprising the recognition sequence is degraded in the plurality of genetically modified eukaryotic cells. In some embodiments, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% of the mutant mitochondrial genomes that contain the recognition sequence are degraded in the plurality of genetically modified eukaryotic cells. In some embodiments, the ratio of wild-type mitochondrial genomes to mutant mitochondrial genomes that contain the recognition sequence is increased in the plurality of genetically modified eukaryotic cells. In some embodiments, the ratio of wild-type mitochondrial genomes to mutant mitochondrial genomes that contain the recognition sequence is increased in the population of eukaryotic cells. In some embodiments, the ratio is about 5:95, about 10:90, about 15:85, about 20:80, about 25:75, about 30:70, about 35:65, about 40:60, about 45:55, about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 20:1, about up to 50:1, about 100:1, about 150:1, about 200:1, about 250:1, about 300:1, about 350:1, about 400:1, about 450:1, about 500:1, about 550:1, about 600:1, about 650:1, about 700:1, about 750:1, about 800:1, about 850:1, about 900:1, about 950:1, about 1000:1, or more.In some embodiments, the percentage of wild type mitochondrial genomes in the plurality of genetically modified eukaryotic cells is increased by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more. In some embodiments, the percentage of wild type mitochondrial genomes in the population of eukaryotic cells is increased by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more. In some embodiments, the percentage of mutant mitochondrial genomes comprising the recognition sequence in the plurality of genetically modified eukaryotic cells is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more. In some embodiments, the percentage of mutant mitochondrial genomes comprising the recognition sequence in the population of eukaryotic cells is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more. In some embodiments, cellular respiration in the plurality of genetically modified eukaryotic cells is increased by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or more. In some embodiments, cellular respiration in the plurality of genetically modified eukaryotic cells is increased by about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100% or more. In some embodiments, cellular respiration in a population of eukaryotic cells is increased by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or more.In some embodiments, cellular respiration in a population of eukaryotic cells is increased by about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100%, or more.

[0030] In some embodiments, the recognition sequence is within a region of the mutant mitochondrial genome associated with a mitochondrial disorder. In some embodiments, the mitochondrial disorder is mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS). In some embodiments, the recognition sequence is located in a region of the mutant mitochondrial genome corresponding to nucleotide positions 3000-3500 of the wild-type mitochondrial genome. In some embodiments, the MTEM targets the A3243G mutation of the mutant mitochondrial genome. In some embodiments, the method is performed in vivo. In some embodiments, the method is performed in vitro. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the polynucleotide is any mRNA described herein. In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the polynucleotide is any recombinant DNA construct described herein. In some embodiments, the polynucleotide is introduced into the eukaryotic cell by a lipid nanoparticle. In some embodiments, the polynucleotide is introduced into the eukaryotic cell by a recombinant virus. In some embodiments, the recombinant virus is any recombinant virus described herein. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to the nucleic acid sequence encoding MTEM. In some embodiments, the promoter is a muscle cell specific promoter, a skeletal muscle specific promoter, a myotube specific promoter, a muscle satellite cell specific promoter, a neuron specific promoter, an astrocyte specific promoter, a microglia specific promoter, an eye cell specific promoter, a retinal cell specific promoter, a retinal ganglion cell specific promoter, a retinal pigment epithelium specific promoter, a pancreatic cell specific promoter, or a pancreatic beta cell specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter. In some embodiments, the eukaryotic cell is a mammalian cell.In some embodiments, the eukaryotic cell is a human cell. In some embodiments, the eukaryotic cell is a muscle cell, a skeletal muscle cell, a myotube cell, a muscle satellite cell, a neuron, an astrocyte, a microglial cell, an ocular cell, a retinal cell, a retinal ganglion cell, a retinal pigment epithelial cell, a pancreatic cell, or a pancreatic beta cell.

[0031] In another aspect, the invention provides a genetically modified eukaryotic cell or a population of genetically modified eukaryotic cells produced by any method for producing a genetically modified eukaryotic cell, or any method for producing a population of eukaryotic cells comprising a plurality of genetically modified cells.

[0032] In another aspect, the invention provides a method for degrading a mutant mitochondrial genome in a target cell or a population of target cells of a subject, the method comprising delivering to the target cell or population of target cells: (a) a polynucleotide comprising a nucleic acid sequence encoding a MTEM as described herein, wherein the MTEM is expressed in the target cell or population of target cells, or (b) a MTEM as described herein, wherein the MTEM creates a cleavage site in the mutant mitochondrial genome at a recognition sequence comprising SEQ ID NO:1, and the mutant mitochondrial genome is degraded. In some embodiments, the recognition sequence is located in a region of the mutant mitochondrial genome corresponding to nucleotide positions 3000-3500 of the wild type mitochondrial genome. In some embodiments, the MTEM targets the A3243G mutation in the mutant mitochondrial genome. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the target cells are muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the polynucleotide is any mRNA described herein. In some embodiments, the polynucleotide is a recombinant DNA construct.In some embodiments, the polynucleotide is any recombinant DNA construct described herein. In some embodiments, the polynucleotide is delivered to a target cell or a population of target cells by a lipid nanoparticle. In some embodiments, the polynucleotide is delivered to a target cell or a population of target cells by a recombinant virus. In some embodiments, the recombinant virus is any recombinant virus described herein. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to a nucleic acid sequence encoding MTEM. In some embodiments, the promoter is a constitutive promoter, or the promoter is a muscle cell specific promoter, a skeletal muscle specific promoter, a myotube specific promoter, a muscle satellite cell specific promoter, a neuron specific promoter, an astrocyte specific promoter, a microglia specific promoter, an eye cell specific promoter, a retinal cell specific promoter, a retinal ganglion cell specific promoter, a retinal pigment epithelium specific promoter, a pancreatic cell specific promoter, or a pancreatic beta cell specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter. In some embodiments, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% of the mutant mitochondrial genome containing the recognition sequence is degraded in the target cell or population of target cells. In some embodiments, the ratio of wild-type mitochondrial genome to mutant mitochondrial genome containing the recognition sequence is increased in the target cell or population of target cells.In some embodiments, the ratio is about 5:95, about 10:90, about 15:85, about 20:80, about 25:75, about 30:70, about 35:65, about 40:60, about 45:55, about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 20:1, about up to 50:1, about 100:1, about 150:1, about 200:1, about 250:1, about 300:1, about 350:1, about 400:1, about 450:1, about 500:1, about 550:1, about 600:1, about 650:1, about 700:1, about 750:1, about 800:1, about 850:1, about 900:1, about 950:1, about 1000:1, or more. In some embodiments, the percentage of wild-type mitochondrial genomes in a target cell or population of target cells is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more of the total mitochondrial genomes in the target cell or population of target cells. In some embodiments, the percentage of mutant mitochondrial genomes containing the recognition sequence in the genetically modified eukaryotic cell is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more. In some embodiments, cellular respiration in a target cell or population of target cells is increased by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or more. In some embodiments, cellular respiration in a target cell or population of target cells is increased by about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100%, or more.

[0033] In another aspect, the present invention provides a method for treating a condition associated with MELAS in a subject, the method comprising administering to the subject (a) a polynucleotide comprising a nucleic acid sequence encoding a MTEM as described herein, the polynucleotide being delivered to a target cell or population of target cells of the subject, and the MTEM being expressed in the target cell or population of target cells, or (b) a therapeutically effective amount of a MTEM as described herein, the MTEM being delivered to a target cell or population of target cells of the subject, the MTEM creating a cleavage site in the mutant mitochondrial genome at a recognition sequence comprising SEQ ID NO:1, and the mutant mitochondrial genome being degraded. In some embodiments, the recognition sequence is located in a region of the mutant mitochondrial genome corresponding to nucleotide positions 3000-3500 of the wild-type mitochondrial genome. In some embodiments, the MTEM targets the A3243G mutation in the mutant mitochondrial genome. In some embodiments, the method reduces or ameliorates one or more symptoms associated with MELAS. In some embodiments, the method comprises administering any of the pharmaceutical compositions described herein. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the target cells are muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. or the population of target cells is muscle cells, skeletal muscle cells, myotube cells, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells or pancreatic beta cells, or said population of target cells is a population of muscle cells, skeletal muscle cells, myotube cells, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells or pancreatic beta cells.In some embodiments, the condition is a condition of the muscles, brain, central nervous system, pancreas, or retina. In some embodiments, the condition is mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS), progressive external ophthalmoplegia, maternally inherited diabetes, migraine, or ocular myopathy. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the polynucleotide is any mRNA described herein. In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the polynucleotide is any recombinant DNA construct described herein. In some embodiments, the polynucleotide is delivered to a target cell or population of target cells by a lipid nanoparticle. In some embodiments, the polynucleotide is delivered to a target cell or population of target cells by a recombinant virus. In some embodiments, the recombinant virus is any recombinant virus described herein. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to a nucleic acid sequence encoding MTEM. In some embodiments, the promoter is a constitutive promoter, or the promoter is a muscle cell specific promoter, a skeletal muscle specific promoter, a myotube specific promoter, a muscle satellite cell specific promoter, a neuron specific promoter, an astrocyte specific promoter, a microglia specific promoter, an eye cell specific promoter, a retinal cell specific promoter, a retinal ganglion cell specific promoter, a retinal pigment epithelium specific promoter, a pancreatic cell specific promoter, or a pancreatic beta cell specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter.In some embodiments, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% of the mutant mitochondrial genomes containing the recognition sequence are degraded in the target cell or population of target cells. In some embodiments, the ratio of wild-type mitochondrial genomes to mutant mitochondrial genomes containing the recognition sequence is increased in the target cell or population of target cells. In some embodiments, the ratio is about 5:95, about 10:90, about 15:85, about 20:80, about 25:75, about 30:70, about 35:65, about 40:60, about 45:55, about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 20:1, about up to 50:1, about 100:1, about 150:1, about 200:1, about 250:1, about 300:1, about 350:1, about 400:1, about 450:1, about 500:1, about 550:1, about 600:1, about 650:1, about 700:1, about 750:1, about 800:1, about 850:1, about 900:1, about 950:1, about 1000:1, or more. In some embodiments, the percentage of wild-type mitochondrial genomes in a target cell or population of target cells is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more of the total mitochondrial genomes in the target cell or population of target cells. In some embodiments, the percentage of mutant mitochondrial genomes containing the recognition sequence in the genetically modified eukaryotic cell is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more.In some embodiments, cellular respiration in a target cell or population of target cells is increased by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or more. In some embodiments, cellular respiration in a target cell or population of target cells is increased by about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100% or more.

[0034] In one aspect, the invention provides a genetically engineered meganuclease that binds to and cleaves a recognition sequence comprising SEQ ID NO:1, wherein the genetically engineered meganuclease comprises a first subunit and a second subunit, the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region, and the HVR1 region has at least one amino acid sequence corresponding to residues 24 to 79 of any one of SEQ ID NOs:3 to 12. The present invention provides an engineered meganuclease comprising an HVR2 region having an amino acid sequence having at least 80%, 85%, 90%, 80%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215 to 270 of any one of SEQ ID NOs: 3 to 12.

[0035] In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR1 region comprises a Y, R, K, or D at the residue corresponding to residue 66 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 3-12 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs:3-12.

[0036] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of any one of SEQ ID NOs: 3-12. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NOs: 3-12. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NOs: 3-12. In some embodiments, the first subunit comprises a G, S or A at the residue corresponding to residue 19 of any one of SEQ ID NOs: 3-12. In some embodiments, the first subunit comprises an E, Q or K at the residue corresponding to residue 80 of any one of SEQ ID NOs: 3-12. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 3-12 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 3-12.

[0037] In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of any one of SEQ ID NOs: 3 or 5-12. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of any one of SEQ ID NOs: 3 or 8-12. In some embodiments, the HVR2 region comprises a residue corresponding to residue 265 of SEQ ID NO:6. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of any one of SEQ ID NOs:3-12. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs:3-12 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs:3-12.

[0038] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of any one of SEQ ID NOs: 3-12. In some embodiments, the second subunit comprises a residue corresponding to residue 276 of any one of SEQ ID NOs: 4. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of any one of SEQ ID NOs: 3-12. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of any one of SEQ ID NOs: 3-12. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of any one of SEQ ID NOs: 3-12. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 3-12 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 3-12.

[0039] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, the linker covalently linking the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 3-12. In some embodiments, the engineered meganuclease comprises an amino acid sequence of any one of SEQ ID NOs: 3-12. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 33-42. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence of any one of SEQ ID NOs: 33-42.

[0040] In some embodiments, the engineered meganuclease is linked to a nuclear export sequence (NES). In some embodiments, the NES comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO: 46 or 47. In some embodiments, the NES comprises an amino acid sequence set forth in SEQ ID NO: 46 or 47. In some embodiments, the NES is linked to the N-terminus of the engineered meganuclease. In some embodiments, the NES is linked to the C-terminus of the engineered meganuclease. In some embodiments, the NES is fused to the engineered meganuclease. In some embodiments, the NES is linked to the engineered meganuclease by a polypeptide linker. In some embodiments, the engineered meganuclease comprises a first NES and a second NES. In some embodiments, the first NES is attached to the N-terminus of the engineered meganuclease and the second NES is attached to the C-terminus of the engineered meganuclease. In some embodiments, the first NES and / or the second NES comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence shown in SEQ ID NO: 46 or 47. In some embodiments, the first NES and / or the second NES comprises an amino acid sequence shown in SEQ ID NO: 46 or 47. In some embodiments, the first NES and the second NES are identical. In some embodiments, the first NES and the second NES are not identical. In some embodiments, the first NES and / or the second NES are fused to the engineered meganuclease. In some embodiments, the first NES and / or the second NES are linked to the engineered meganuclease by a polypeptide linker.

[0041] In another aspect, the present invention provides a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease as described herein. In some embodiments, the polynucleotide is an mRNA.

[0042] In another aspect, the present invention provides a recombinant DNA construct comprising a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease as described herein. In some embodiments, the recombinant DNA construct encodes a recombinant virus comprising the polynucleotide. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV). In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to the nucleic acid sequence encoding the engineered meganuclease. In some embodiments, the promoter is a constitutive promoter, or the promoter is a muscle cell specific promoter, a skeletal muscle specific promoter, a myotube specific promoter, a muscle satellite cell specific promoter, a neuron specific promoter, an astrocyte specific promoter, a microglia specific promoter, an ocular cell specific promoter, a retinal cell specific promoter, a retinal ganglion cell specific promoter, a retinal pigment epithelium specific promoter, a pancreatic cell specific promoter, or a pancreatic beta cell specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter.

[0043] In another aspect, the present invention provides a recombinant virus comprising a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease as described herein. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV). In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to the nucleic acid sequence encoding the engineered meganuclease. In some embodiments, the promoter is a constitutive promoter, or the promoter is a muscle cell specific promoter, a skeletal muscle specific promoter, a myotube specific promoter, a muscle satellite cell specific promoter, a neuron specific promoter, an astrocyte specific promoter, a microglia specific promoter, an ocular cell specific promoter, a retinal cell specific promoter, a retinal ganglion cell specific promoter, a retinal pigment epithelium specific promoter, a pancreatic cell specific promoter, or a pancreatic beta cell specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter.

[0044] In another aspect, the present invention provides a lipid nanoparticle composition comprising a lipid nanoparticle comprising a polynucleotide, wherein the polynucleotide comprises a nucleic acid sequence encoding an engineered meganuclease as described herein. In some embodiments, the polynucleotide is an mRNA.

[0045] In another aspect, the present invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and an engineered meganuclease as described herein.

[0046] In another aspect, the invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and any of the polynucleotides described herein.

[0047] In another aspect, the invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and any of the recombinant DNA constructs described herein.

[0048] In another aspect, the invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and any of the recombinant viruses described herein.

[0049] In another aspect, the present invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and any of the lipid nanoparticle compositions described herein.

[0050] In another aspect, the present invention provides a genetically modified eukaryotic cell comprising any of the polynucleotides described herein. In some embodiments, the genetically modified eukaryotic cell is a genetically modified mammalian cell. In some embodiments, the genetically modified eukaryotic cell is a genetically modified human cell.

[0051] In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell, the method comprising introducing into a eukaryotic cell a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease as described herein, wherein the engineered meganuclease is expressed in the eukaryotic cell, and wherein the engineered meganuclease creates a cleavage site in the recognition sequence comprising SEQ ID NO:1. In some embodiments, the cleavage site is repaired by non-homologous end joining, such that the recognition sequence comprises an insertion or deletion. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is mRNA. In some embodiments, the polynucleotide is introduced into the eukaryotic cell by lipid nanoparticles or a recombinant virus. In some embodiments, the recombinant virus is a recombinant AAV.

[0052] In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell, the method comprising introducing into a eukaryotic cell an engineered meganuclease as described herein, wherein the engineered meganuclease is expressed in the eukaryotic cell, and wherein the engineered meganuclease creates a cleavage site in a recognition sequence comprising SEQ ID NO:1. In some embodiments, the cleavage site is repaired by non-homologous end joining, such that the recognition sequence comprises an insertion or deletion. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell.

[0053] In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell comprising an exogenous sequence of interest inserted into its genome, the method comprising introducing into the eukaryotic cell one or more polynucleotides comprising a first nucleic acid sequence encoding an engineered meganuclease as described herein, the first nucleic acid sequence being expressed in the eukaryotic cell, and a second nucleic acid sequence comprising a sequence of interest, wherein the engineered meganuclease creates a cleavage site in the recognition sequence comprising SEQ ID NO:1, and the sequence of interest is inserted into the genome at the cleavage site. In some embodiments, the second nucleic acid sequence further comprises a nucleic acid sequence homologous to a nucleic acid sequence adjacent to the cleavage site, and the sequence of interest is inserted into the genome at the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the first nucleic acid sequence is introduced into the eukaryotic cell as mRNA. In some embodiments, the second nucleic acid sequence is introduced into the eukaryotic cell as double-stranded DNA (dsDNA). In some embodiments, the first nucleic acid sequence is introduced into the eukaryotic cell by a recombinant virus. In some embodiments, the second nucleic acid sequence is introduced into the eukaryotic cell by a recombinant virus. In some embodiments, the recombinant virus is a recombinant AAV.

[0054] In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell comprising an exogenous sequence of interest inserted into its genome, the method comprising introducing into a eukaryotic cell a polynucleotide comprising an engineered meganuclease as described herein and a nucleic acid sequence comprising the sequence of interest, wherein the engineered meganuclease creates a cleavage site in a recognition sequence comprising SEQ ID NO:1, and the sequence of interest is inserted into the genome at the cleavage site. In some embodiments, the polynucleotide sequence further comprises a nucleic acid sequence homologous to a nucleic acid sequence adjacent to the cleavage site, and the sequence of interest is inserted into the genome at the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell as double-stranded DNA (dsDNA). In some embodiments, the polynucleotide is introduced into the eukaryotic cell by a recombinant virus. In some embodiments, the recombinant virus is a recombinant AAV.

[0055] In another aspect, the present invention provides a genetically modified eukaryotic cell produced by the methods described herein.

[0056] The foregoing and other aspects and embodiments of the present disclosure may be more fully understood by reference to the following detailed description and claims. Certain features of the present disclosure that are described in the context of separate embodiments for clarity may also be provided in combination in a single embodiment. All combinations of the embodiments are specifically embraced by the present disclosure and are disclosed herein as if each and every combination were individually and expressly disclosed. Conversely, various features of the present disclosure that are described in the context of a single embodiment for brevity may also be provided separately or in any suitable subcombination. All subcombinations of features recited in the embodiments are also specifically embraced by the present disclosure and are disclosed herein as if each and every such subcombination were individually and expressly disclosed herein. The embodiments of each aspect of the present disclosure disclosed herein apply to each other aspect of the present disclosure mutatis mutandis. [Brief description of the drawings]

[0057] [Figure 1] Figure 1 shows flow cytometry results of CHO reporter cells transfected with mRNA encoding various MIT 25-26 engineered meganucleases, or CHO 23-24 meganuclease (control), and assayed for the percentage of GFP+ cells 48 hours after transfection. Data are presented as activity index, the sum of activity score and toxicity score. [Diagram 2] Figure 1 demonstrates discrimination of MIT 25-26L.35 engineered meganuclease against wild-type sequence. Flow cytometry results of CHO reporter cells transfected with mRNA encoding MIT 25-26x.91 or MIT 25-26L.35 engineered meganuclease, or CHO 23-24 meganuclease (control), and assayed for percentage of GFP+ cells 48 hours after transfection. Data are presented as activity index, the sum of activity score and toxicity score. [Diagram 3] Figure 1 shows indel formation of various MIT 25-26 engineered meganucleases in FlpIn CHO cells that contain a portion of the human mitochondrial genome integrated on the nuclear chromosome with either wild-type or mutant MIT 25-26 binding sites. FlpIn CHO cells were nucleofected with MIT 25-26 engineered meganucleases and two days later the cells were analyzed for indel frequency at both the MIT 25-26 mutant and wild-type sites. [Figure 4]Figure 1 shows indel formation of the optimized MIT 25-26L.35 engineered meganuclease compared to the MIT 25-26x.91 engineered meganuclease in FlpIn CHO cells containing a part of the human mitochondrial genome integrated on the nuclear chromosome with either wild-type or mutant MIT 25-26 binding sites. FlpIn CHO cells were nucleofected with MIT 25-26 engineered meganuclease and after 2 days the cells were analyzed for indel frequency at both the MIT 25-26 mutant and wild-type sites. [Diagram 5] Figure 1: Demonstration of nuclear targeting of engineered meganucleases. MRC-5 cells were transfected with a plasmid encoding an engineered meganuclease with a nuclear localization sequence. Immunocytological staining was achieved with DAPI and monoclonal engineered meganuclease antibodies, as well as Mitotracker Red, which stains mitochondria. Cells were observed at 20x magnification using a Zeiss LSM710 confocal microscope. The top left photograph is a superposition of all stainings. The top right photograph shows the location of the engineered meganuclease. The bottom left photograph shows nuclear staining with DAPI, and the bottom right photograph shows mitochondria. [Figure 6] FIG. 10: Demonstration of mitochondrial targeting of engineered meganucleases. MRC-5 cells were transfected with a plasmid encoding an engineered meganuclease with a mitochondrial transit peptide (MTP). Immunocytological staining was achieved with DAPI and monoclonal engineered meganuclease antibodies, as well as Mitotracker Red, which stains mitochondria. Cells were observed at 20x magnification using a Zeiss LSM710 confocal microscope. The top left photograph is an overlay of all stainings. The top right photograph shows the location of the engineered meganuclease. The bottom left photograph shows nuclear staining with DAPI, and the bottom right photograph shows mitochondria. [Figure 7]Figure 1: Indel formation by engineered meganucleases fused to a nuclear localization signal (NLS) or a mitochondrial transit peptide (MTP). MRC-5 cells were nucleofected with engineered meganuclease constructs and indel formation at the APC 11-12 binding site was analyzed after 2 days. [Figure 8] Figure 1 shows indel formation by engineered meganucleases fused to a nuclear localization signal (NLS), a mitochondrial transit peptide (MTP) or MTP and a nuclear export sequence (NES) of SEQ ID NO: 47. MRC-5 cells were nucleofected with engineered meganuclease constructs and indel formation at the APC 11-12 binding site was analyzed after 2 days. [Figure 9] Figure 1 shows indel formation by engineered meganucleases fused to a nuclear localization signal (NLS), a mitochondrial transit peptide (MTP) or MTP and the MVMp NS2 nuclear export sequence (NES) of SEQ ID NO: 46. MRC-5 cells were nucleofected with engineered meganuclease constructs and indel formation at the APC 11-12 binding site was analyzed after 2 days. [Figure 10] Figure 1 shows indel formation by engineered MIT 25-26x.91 meganuclease fused to a nuclear localization signal (NLS), a mitochondrial transit peptide (MTP) or MTP and the MVMp NS2 nuclear export sequence (NES) of SEQ ID NO: 46. MRC-5 cells were nucleofected with engineered meganuclease constructs and indel formation at each of the three MIT 25-26x.91 binding sites was analyzed after 2 days. [Figure 11] Figure 1 shows the efficacy of the mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91 in cybrid cell lines carrying heteroplasmic MELAS mutations, 1 day after nucleofection. These data are expressed as mtDNA loss compared to MTS-GFP cells. [Figure 12]Figure 1 shows the efficacy of the mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91 in cybrid cell lines carrying heteroplasmic MELAS mutations 4 days after nucleofection. These data are expressed as mtDNA loss compared to MTS-GFP cells. [Figure 13] Figure 1 shows the efficacy of the mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91 in cybrid cell lines carrying heteroplasmic MELAS mutations 7 days after nucleofection. These data are expressed as mtDNA loss compared to MTS-GFP cells. [Figure 14] Figure 1 shows the efficacy of the mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91 in cybrid cell lines carrying heteroplasmic MELAS mutations 11 days after nucleofection. These data are expressed as mtDNA loss compared to MTS-GFP cells. [Figure 15] FIG. 1 shows mitochondrial stress test of MELAS cybrid cells 11 days after transfection with the mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91. [Figure 16] FIG. 1 shows ATP production in MELSA cybrid cells 11 days after transfection with the mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91. [Figure 17] FIG. 1 shows ATP production in MELSA cybrid cells 11 days after transfection with the mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91. [Figure 18] FIG. 1 shows energy maps of MELAS cybrid cells 11 days after transfection with the mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91, illustrating the relative contributions of glycolysis and OXPHOS to ATP production. [Figure 19]Immunofluorescence staining showing cellular localization of engineered meganuclease lacking an intracellular targeting sequence. Cells were transfected with a plasmid encoding the engineered meganuclease fused to a green fluorescent protein (GFP) peptide sequence. Immunocytological staining was achieved with DAPI and Mitotracker Red, which stains mitochondria. Cells were observed with a Zeiss LSM710 confocal microscope at 63x magnification. The top left photograph is a superposition of all stainings. The top right photograph shows the location of the engineered meganuclease. The bottom left photograph shows nuclear staining with DAPI of the nuclei and the bottom right photograph shows mitochondrial staining. [Figure 20] Immunofluorescence staining showing the cellular localization of an engineered meganuclease containing a mitochondrial targeting peptide (MTP). Cells were transfected with a plasmid encoding an engineered meganuclease fused with a mitochondrial targeting peptide sequence (MTS) on the N-terminus and a green fluorescent protein peptide (GFP) sequence on the C-terminus. Immunocytological staining was achieved with DAPI and Mitotracker Red, which stains mitochondria. Cells were observed with a Zeiss LSM710 confocal microscope at 63x magnification. The top left photograph is a superposition of all stainings. The top right photograph shows the location of the engineered meganuclease. The bottom left photograph shows nuclear staining with DAPI of the nuclei, and the bottom right photograph shows mitochondrial staining. [Figure 21] Graphs are provided showing the ratio of circular mtDNA to total mtDNA in mitochondria containing 100% mutant mtDNA (m.3243G) for the indicated control (mock, MTS-GFP, MTS-APC 11-12L.330, and MTS-MIT 25-26x.91 KO) and test engineered meganuclease transfected cells at 0, 6, 24, 48, and 72 hours after transfection. [Figure 22]Graphs are provided showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 100% mutant mtDNA (m.3243G) for indicated control (mock, MTS-GFP, MTS-APC 11-12L.330, and MTS-MIT 25-26x.91 KO) and test engineered meganuclease transfected cells at 0, 6, 24, 48, and 72 hours after transfection. [Diagram 23] Graphs are provided showing the ratio of circular mtDNA to total mtDNA in mitochondria containing wild-type mtDNA for the indicated control (mock, MTS-GFP, MTS-APC 11-12L.330, and MTS-MIT 25-26x.91 KO) and test engineered meganuclease-transfected cells at 0, 6, 24, 48, and 72 hours after transfection. [Figure 24] Graphs are provided showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing wild-type mtDNA for indicated control (mock, MTS-GFP, MTS-APC 11-12L.330, and MTS-MIT 25-26x.91 KO) and test engineered meganuclease-transfected cells at 0, 6, 24, 48, and 72 hours after transfection. [Diagram 25] Graphs are provided showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing wild-type mtDNA for indicated control (mock, MTS-GFP, MTS-APC 11-12L.330, and MTS-MIT 25-26x.91 KO) and test engineered meganuclease-transfected cells at 0, 3, 6, 12, 24, 48, and 72 hours after transfection. [Figure 26]Graphs are provided showing the ratio of circular mtDNA to total mtDNA in mitochondria containing wild-type mtDNA for the indicated control (mock, MTS-GFP, MTS-APC 11-12L.330, and MTS-MIT 25-26x.91 KO) and test engineered meganuclease-transfected cells at 0, 3, 6, 12, 24, 48, and 72 hours after transfection. [Figure 27] A graph showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) of MELAS cells transfected with the indicated controls (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 meganuclease, one day after transfection. Bar height indicates mtDNA loss normalized to MTS-GFP transfected cells. Within the bars, the relative percentage in grey corresponds to the relative percentage of wild-type mtDNA present, and the relative percentage in black corresponds to the relative percentage of mutant mtDNA present. [Figure 28] A graph showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) of MELAS cells transfected with the indicated controls (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 meganuclease, 4 days after transfection. Bar height indicates mtDNA loss normalized to MTS-GFP transfected cells. Within the bars, the relative percentage in grey corresponds to the relative percentage of wild-type mtDNA present and the relative percentage in black corresponds to the relative percentage of mutant mtDNA present. [Figure 29]Figure 1 provides a graph showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) of MELAS cells transfected with the indicated controls (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 meganuclease, 7 days after transfection. Bar height indicates mtDNA loss normalized to MTS-GFP transfected cells. Within the bars, the relative percentage in grey corresponds to the relative percentage of wild-type mtDNA present and the relative percentage in black corresponds to the relative percentage of mutant mtDNA present. [Diagram 30] Graph showing mitochondrial stress test of MELAS cybrid cells 11 days after transfection with mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91. [Diagram 31] FIG. 1 shows energy maps of MELAS cybrid cells 11 days after transfection with the mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91, illustrating the relative contributions of glycolysis and OXPHOS to ATP production. [Diagram 32] FIG. 1 shows the basal respiration rate of MELSA cybrid cells 11 days after transfection with the mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91. [Diagram 33] FIG. 1 shows the maximum respiration rate of MELSA cybrid cells 11 days after transfection with the mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91. [Diagram 34] Figure 1 shows the mitochondrial ATP production rate of MELSA cybrid cells 11 days after transfection with the mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91. [Diagram 35]Provides a graph showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) of MELAS cells transfected with the indicated controls (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 259 H>Q meganuclease, one day after transfection. Bar height indicates mtDNA loss normalized to MTS-GFP transfected cells. Within the bars, the relative percentage in grey corresponds to the relative percentage of wild-type mtDNA present and the relative percentage in black corresponds to the relative percentage of mutant mtDNA present. [Diagram 36] FIG. 13 is a graph showing mitochondrial stress test of MELAS cybrid cells one day after transfection with mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91 259 H>Q. [Figure 37] Provides a graph showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) of MELAS cells transfected with the indicated controls (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 259 H>Q meganuclease, 3 days after transfection. Bar height indicates mtDNA loss normalized to MTS-GFP transfected cells. Within the bars, the relative percentage in grey corresponds to the relative percentage of wild-type mtDNA present and the relative percentage in black corresponds to the relative percentage of mutant mtDNA present. [Figure 38] FIG. 13 is a graph showing mitochondrial stress test of MELAS cybrid cells 3 days after transfection with mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91 259 H>Q. [Figure 39]Figure 1 provides a graph showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) of MELAS cells transfected with the indicated controls (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 259 H>Q meganuclease, 7 days after transfection. Bar height indicates mtDNA loss normalized to MTS-GFP transfected cells. Within the bars, the relative percentage in grey corresponds to the relative percentage of wild-type mtDNA present and the relative percentage in black corresponds to the relative percentage of mutant mtDNA present. [Diagram 40] Graph showing mitochondrial stress test of MELAS cybrid cells 7 days after transfection with mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91 259H>Q. [Diagram 41] Graph showing the results of oligo capture assay to identify off-target cleavage induced by MIT 25-26L.35 19 A>S and MIT 25-26x.91 259 H>Q meganucleases transfected in Flp-In 293 reporter cell line. Circled dots indicate on-target sites. MT-oligo only represents negative control. [Diagram 42] Graph showing cell proliferation over time of either untreated, mitochondria containing 96% mutant mtDNA (m.3243G) in MELAS cells transfected with MIT 25-26x.91 259H>Q meganuclease at a dose of 1e5 RNA copies / cell, or untreated 0% mutant (WT cells). [Diagram 43] 13 is a bar graph showing cell doublings over time at D2, D3 and D4 after treatment of either untreated, 96% mutant mtDNA (m.3243G) containing mitochondria of MELAS cells transfected with MIT 25-26x.91 259H>Q meganuclease at a dose of 1e5 RNA copies / cell, or untreated, 0% mutant (WT cells). [Diagram 44] FIG. 1 provides an experimental schematic of a study showing the effect of engineered MTEM meganuclease editing on mitochondrial heteroplasmy in a mouse xenograft tumor model. [Diagram 45] FIG. 1 provides a graph showing tumor volumes upon administration (D18 after cybrid transduction) of three different doses of AAV9 vectors encapsidating the MIT 25-26x.91 engineered meganuclease. [Diagram 46] 1 provides a graph showing the percentage of WT mtDNA following administration of three different doses of AAV9 vectors encapsidating the MIT 25-26x.91 engineered meganuclease, 35 days after cybrid cell transduction and 17 days after meganuclease administration. [Figure 47] 1 provides a graph showing the percentage of WT mtDNA after administration of three different doses of AAV9 vectors encapsidating MIT 25-26x.91 engineered meganuclease at 35 days after cybrid cell transduction and 17 days after meganuclease administration. NS indicates statistically insignificant differences between groups. [Figure 48] Provides a graph showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 85% mutant mtDNA (m.3243G) of MELAS cells transfected with the indicated controls (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 259 H>Q meganuclease, 1 day after transfection. Bar height indicates mtDNA loss normalized to MTS-GFP transfected cells. Within the bars, the relative percentage in grey corresponds to the relative percentage of wild-type mtDNA present and the relative percentage in black corresponds to the relative percentage of mutant mtDNA present. [Figure 49] FIG. 1 is a graph showing mitochondrial stress test of MELAS cybrid cells one day after transfection with mitochondrial-targeted engineered meganuclease (MTEM) MIT 25-26x.91 259H>Q. [Figure 50] Figure 1 provides a graph showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 85% mutant mtDNA (m.3243G) of MELAS cells transfected with the indicated controls (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 259 H>Q meganuclease, 3 days after transfection. Bar height indicates mtDNA loss normalized to MTS-GFP transfected cells. Within the bars, the relative percentage in grey corresponds to the relative percentage of wild-type mtDNA present and the relative percentage in black corresponds to the relative percentage of mutant mtDNA present. [Figure 51] FIG. 13 is a graph showing mitochondrial stress test of MELAS cybrid cells 3 days after transfection with mitochondrial targeted engineered meganuclease (MTEM) MIT 25-26x.91 259 H>Q. [Figure 52] Provides a graph showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) of MELAS cells, or in WT cells containing 0% mutant mtDNA, 1 day after transfection. Mutant cells were untreated or treated with 1e5 RNA copies / cell of MIT 25-26x.91 259 H>Q meganuclease. 0% mutant cells were untreated. Bar height indicates mtDNA loss normalized to mutant mtDNA cells. Within the bars, the relative percentage in grey corresponds to the relative percentage of wild type mtDNA present, and the relative percentage in black corresponds to the relative percentage of mutant mtDNA present. [Figure 53] FIG. 13 is a graph showing mitochondrial stress test of WT or MELAS cybrid cells one day after transfection with mitochondrial-targeted engineered meganuclease (MTEM) MIT 25-26x.91 259 H>Q.

[0058] A brief description of the sequence SEQ ID NO:1 shows the nucleic acid sequence of the MIT 25-26 recognition sequence (sense).

[0059] SEQ ID NO: 2 shows the nucleic acid sequence of the MIT 25-26 recognition sequence (antisense).

[0060] SEQ ID NO:3 shows the amino acid sequence of the MIT 25-26x.91 engineered meganuclease.

[0061] SEQ ID NO: 4 shows the amino acid sequence of the MIT 25-26x.48 engineered meganuclease.

[0062] SEQ ID NO:5 shows the amino acid sequence of the MIT 25-26x.73 engineered meganuclease.

[0063] SEQ ID NO: 6 shows the amino acid sequence of the MIT 25-26x.29 engineered meganuclease.

[0064] SEQ ID NO: 7 shows the amino acid sequence of the MIT 25-26x.37 engineered meganuclease.

[0065] SEQ ID NO: 8 shows the amino acid sequence of the MIT 25-26L.35 engineered meganuclease.

[0066] SEQ ID NO: 9 shows the amino acid sequence of the MIT 25-26x.91 engineered meganuclease with an H to Q substitution at amino acid position 259, designated MIT 25-26x.91 259 H>Q.

[0067] SEQ ID NO: 10 shows the amino acid sequence of the MIT 25-26L.35 engineered meganuclease with an A to S substitution at amino acid position 19, designated MIT 25-26L.35 19 A>S.

[0068] SEQ ID NO: 11 shows the amino acid sequence of the MIT 25-26x.91 engineered meganuclease with a T to R substitution at amino acid position 263, designated MIT 25-26x.91 263 T>R.

[0069] SEQ ID NO: 12 shows the amino acid sequence of the MIT 25-26x.91 engineered meganuclease with an H to W substitution at amino acid position 46, designated MIT 25-26x.91 46 H>W.

[0070] SEQ ID NO: 13 shows the amino acid sequence of the MIT 25-26x.91 meganuclease 25 binding subunit.

[0071] SEQ ID NO: 14 shows the amino acid sequence of the MIT 25-26x.48 meganuclease 25 binding subunit.

[0072] SEQ ID NO: 15 shows the amino acid sequence of the MIT 25-26x.73 meganuclease 25 binding subunit.

[0073] SEQ ID NO: 16 shows the amino acid sequence of the MIT 25-26x.29 meganuclease 25 binding subunit.

[0074] SEQ ID NO: 17 shows the amino acid sequence of the MIT 25-26x.37 meganuclease 25 binding subunit.

[0075] SEQ ID NO: 18 shows the amino acid sequence of the MIT 25-26L.35 meganuclease 25 binding subunit.

[0076] SEQ ID NO: 19 shows the amino acid sequence of the MIT 25-26x.91 259 H>Q meganuclease 25 binding subunit.

[0077] SEQ ID NO: 20 shows the amino acid sequence of the MIT 25-26L.35 19 A>S meganuclease 25 binding subunit.

[0078] SEQ ID NO: 21 shows the amino acid sequence of the MIT 25-26x.91 263 T>R meganuclease 25 binding subunit.

[0079] SEQ ID NO: 22 shows the amino acid sequence of the MIT 25-26x.91 46 H>W meganuclease 25 binding subunit.

[0080] SEQ ID NO: 23 shows the amino acid sequence of the MIT 25-26x.91 meganuclease 26 binding subunit.

[0081] SEQ ID NO: 24 shows the amino acid sequence of the MIT 25-26x.48 meganuclease 26 binding subunit.

[0082] SEQ ID NO: 25 shows the amino acid sequence of the MIT 25-26x.73 meganuclease 26 binding subunit.

[0083] SEQ ID NO: 26 shows the amino acid sequence of the MIT 25-26x.29 meganuclease 26 binding subunit.

[0084] SEQ ID NO: 27 shows the amino acid sequence of the MIT 25-26x.37 meganuclease 26 binding subunit.

[0085] SEQ ID NO: 28 shows the amino acid sequence of the MIT 25-26L.35 meganuclease 26 binding subunit.

[0086] SEQ ID NO: 29 shows the amino acid sequence of the MIT 25-26x.91 259 H>Q meganuclease 26 binding subunit.

[0087] SEQ ID NO: 30 shows the amino acid sequence of the MIT 25-26L.35 19 A>S meganuclease 26 binding subunit.

[0088] SEQ ID NO: 31 shows the amino acid sequence of the MIT 25-26x.91 263 T>R meganuclease 26 binding subunit.

[0089] SEQ ID NO: 32 shows the amino acid sequence of the MIT 25-26x.91 46 H>W meganuclease 26 binding subunit.

[0090] SEQ ID NO: 33 shows the nucleic acid sequence of the MIT 25-26x.91 meganuclease.

[0091] SEQ ID NO: 34 shows the nucleic acid sequence of the MIT 25-26x.48 meganuclease.

[0092] SEQ ID NO: 35 shows the nucleic acid sequence of the MIT 25-26x.73 meganuclease.

[0093] SEQ ID NO: 36 shows the nucleic acid sequence of the MIT 25-26x.29 meganuclease.

[0094] SEQ ID NO: 37 shows the nucleic acid sequence of the MIT 25-26x.37 meganuclease.

[0095] SEQ ID NO: 38 shows the nucleic acid sequence of the MIT 25-26L.35 meganuclease.

[0096] SEQ ID NO: 39 shows the nucleic acid sequence of the MIT 25-26x.91 259 H>Q meganuclease.

[0097] SEQ ID NO: 40 shows the nucleic acid sequence of the MIT 25-26L.35 19A>S meganuclease.

[0098] SEQ ID NO: 41 shows the nucleic acid sequence of the MIT 25-26x.91 263 T>R meganuclease.

[0099] SEQ ID NO: 42 shows the nucleic acid sequence of the MIT 25-26x.91 46 H>W meganuclease.

[0100] SEQ ID NO: 43 shows the amino acid sequence of COX VIII MTP.

[0101] SEQ ID NO: 44 shows the amino acid sequence of SU9 MTP.

[0102] SEQ ID NO: 45 shows the amino acid sequence of COX VIII-SU9 MTP.

[0103] SEQ ID NO: 46 shows the amino acid sequence of the MVMp NS2 NES sequence.

[0104] SEQ ID NO: 47 shows the amino acid sequence of the NES sequence.

[0105] SEQ ID NO: 48 shows the amino acid sequence of the wild-type I-CreI sequence.

[0106] SEQ ID NO:49 shows the nucleic acid sequence of digital droplet PCR (ddPCR) primer P1 used to determine indel frequency at the APC 11-12 binding site.

[0107] SEQ ID NO:50 shows the nucleic acid sequence of ddPCR primer F1 used to determine indel frequency in the APC 11-12 binding site.

[0108] SEQ ID NO:51 shows the nucleic acid sequence of ddPCR primer R1 used to determine indel frequency in the APC 11-12 binding site.

[0109] SEQ ID NO:52 shows the nucleic acid sequence of ddPCR primer P2 used to determine indel frequency in the APC 11-12 binding site, and ddPCR primer P3 is utilized to determine mtDNA heteroplasmy levels and mtDNA copy number relative to nuclear DNA.

[0110] SEQ ID NO: 53 shows the nucleic acid sequence of ddPCR primer F2 used to determine indel frequency in the APC 11-12 binding site. ddPCR primer F3 is utilized to determine mtDNA heteroplasmy levels and mtDNA copy number relative to nuclear DNA.

[0111] SEQ ID NO: 54 shows the nucleic acid sequence of ddPCR primer R2 used to determine the indel frequency in the APC 11-12 binding site. ddPCR primer R3 is utilized to determine mtDNA heteroplasmy levels and mtDNA copy number relative to nuclear DNA.

[0112] SEQ ID NO: 55 shows the nucleic acid sequence of ddPCR primer F1 used to identify potential nuclear off-target site editing induced by MIT 25-26x.91 nuclease.

[0113] SEQ ID NO:56 shows the nucleic acid sequence of ddPCR primer R1 used to identify potential nuclear off-target site editing induced by MIT 25-26x.91 nuclease.

[0114] SEQ ID NO:57 shows the nucleic acid sequence of ddPCR primer F2 used to identify potential nuclear off-target site editing induced by MIT 25-26x.91 nuclease.

[0115] SEQ ID NO:58 shows the nucleic acid sequence of ddPCR primer R2 used to identify potential nuclear off-target site editing induced by MIT 25-26x.91 nuclease.

[0116] SEQ ID NO:59 shows the nucleic acid sequence of ddPCR primer F3 used to identify potential nuclear off-target site editing induced by MIT 25-26x.91 nuclease.

[0117] SEQ ID NO: 60 shows the nucleic acid sequence of ddPCR primer R3 used to identify potential nuclear off-target site editing induced by MIT 25-26x.91 nuclease.

[0118] SEQ ID NO: 61 shows the nucleic acid sequence of ddPCR primer F4 used to identify potential nuclear off-target site editing induced by MIT 25-26x.91 nuclease.

[0119] SEQ ID NO: 62 shows the nucleic acid sequence of ddPCR primer R4 used to identify potential nuclear off-target site editing induced by MIT 25-26x.91 nuclease.

[0120] SEQ ID NO: 63 shows the nucleic acid sequence of ddPCR primer P1 utilized to determine mtDNA heteroplasmy levels as well as mtDNA copy number relative to nuclear DNA (mutant alleles).

[0121] SEQ ID NO:64 shows the nucleic acid sequence of ddPCR primer F1 utilized to determine mtDNA heteroplasmy levels as well as mtDNA copy number relative to nuclear DNA.

[0122] SEQ ID NO:65 shows the nucleic acid sequence of ddPCR primer R1 utilized to determine mtDNA heteroplasmy levels as well as mtDNA copy number relative to nuclear DNA.

[0123] SEQ ID NO: 66 shows the nucleic acid sequence of ddPCR primer P2 utilized to determine mtDNA heteroplasmy levels as well as mtDNA copy number relative to nuclear DNA.

[0124] SEQ ID NO:67 shows the nucleic acid sequence of ddPCR primer F2 utilized to determine mtDNA heteroplasmy levels as well as mtDNA copy number relative to nuclear DNA.

[0125] SEQ ID NO:68 shows the nucleic acid sequence of ddPCR primer R2 utilized to determine mtDNA heteroplasmy levels as well as mtDNA copy number relative to nuclear DNA.

[0126] SEQ ID NO:69 shows the nucleic acid sequence of ddPCR primer P4 utilized to determine mtDNA heteroplasmy levels as well as mtDNA copy number relative to nuclear DNA.

[0127] SEQ ID NO: 70 shows the nucleic acid sequence of ddPCR primer F4 utilized to determine mtDNA heteroplasmy levels as well as mtDNA copy number relative to nuclear DNA.

[0128] SEQ ID NO: 71 shows the nucleic acid sequence of ddPCR primer R4 utilized to determine mtDNA heteroplasmy levels as well as mtDNA copy number relative to nuclear DNA.

[0129] SEQ ID NO: 72 shows the nucleic acid sequence of ddPCR primer P1 utilized to determine mtDNA heteroplasmy levels as well as mtDNA copy number relative to nuclear DNA (WT allele). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0130] Detailed Description of the Invention 1.1 References and Definitions The patents and scientific literature referred to in this specification establish knowledge available to those skilled in the art. References cited in this specification, including issued U.S. patents, granted applications, published foreign applications, and GenBank database sequences, are incorporated herein by reference to the same extent as if each was specifically and individually indicated to be incorporated by reference.

[0131] The present invention may be embodied in different forms and should not be construed as being limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. For example, features illustrated with respect to one embodiment can be incorporated in other embodiments, and features illustrated with respect to a particular embodiment can be deleted from that embodiment. Moreover, numerous modifications and additions to the embodiments proposed herein will be apparent to those skilled in the art in light of this disclosure, which do not depart from the invention.

[0132] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terms used in the description of the invention herein are for the purpose of describing particular embodiments only and are not intended to be limiting of the invention.

[0133] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0134] As used herein, "a," "an," or "the" may mean one or more than one. For example, "a" cell may mean a single cell or multiple cells.

[0135] As used herein, the term "5' cap" (also called RNA cap, RNA 7-methylguanosine cap or RNA m7G cap) is a modified guanine nucleotide added to the "front" or 5' end of eukaryotic messenger RNA immediately after the initiation of transcription. The 5' cap consists of a terminal group linked to the first transcribed nucleotide. Its presence is important for recognition by ribosomes and protection from RNases. Capping is coupled to transcription and occurs cotranscriptionally such that each affects the other. Shortly after the initiation of transcription, the 5' end of the mRNA being synthesized is bound by a cap synthesis complex associated with RNA polymerase. This enzyme complex catalyzes the chemical reactions required for mRNA capping. Synthesis proceeds as a multistep biochemical reaction. The capping moiety can be modified to modulate the functionality of the mRNA, such as its stability or efficiency of translation.

[0136] As used herein, the term "allele" refers to one of two or more variant forms of a gene.

[0137] As used herein, the term "allogeneic" or alternatively "allogenic" refers to any material derived from a different animal or different patient of the same species as the individual into whom the material is introduced. Two or more individuals are said to be allogeneic to one another if the genes at one or more loci are not identical. In some embodiments, allogeneic material from individuals of the same species may be sufficiently different genetically to interact antigenically.

[0138] As used herein, the term "constitutive promoter" refers to a nucleotide sequence that, when operably linked to a polynucleotide that encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.

[0139] As used herein, the term "control" or "control cell" refers to a cell that provides a reference point for measuring changes in the genotype or phenotype of a genetically modified cell. A control cell can include, for example, (a) a wild-type cell, i.e., a wild-type cell of the same genotype as the starting material for the genetic modification that resulted in the genetically modified cell, (b) a cell of the same genotype as the genetically modified cell but transformed with a null construct (i.e., a construct that has no known effect on the trait of interest), or (c) a cell that is genetically identical to the genetically modified cell but has not been exposed to conditions or stimuli or further genetic modifications that induce the expression of the modified genotype or phenotype. For example, the control or control cell of the present invention can be a cell or cell population that does not contain the MTEM or genetically engineered meganuclease described herein or a polynucleotide having an amino acid sequence that encodes the MTEM or genetically engineered meganuclease described herein.

[0140] As used herein, the term "corresponding to" in reference to modifications of two proteins or amino acid sequences is used to indicate that a particular modification of a first protein is a substitution of the same amino acid residue as a modification of a second protein, and that when the two proteins are subjected to a standard sequence alignment (e.g., using the BLASTp program), the amino acid position of the modification of the first protein corresponds to or aligns with the amino acid position of the modification of the second protein. Thus, a modification of residue "X" in a first protein to amino acid "A" corresponds to a modification of residue "Y" in a second protein to amino acid "A" when residues X and Y correspond to each other in a sequence alignment, notwithstanding the fact that X and Y may be in different numbers.

[0141] As used herein, the term "disrupted" or "disrupt" or "disrupt expression" or "disrupt target sequence" refers to the introduction of a mutation (e.g., a frameshift mutation) that disrupts gene function and thereby prevents expression and / or function of the encoded polypeptide / expression product. For example, nuclease-mediated disruption of a gene may result in expression of a truncated protein and / or expression of a protein that does not retain its wild-type function. Additionally, introduction of a donor template into a gene may not result in expression of the encoded protein, expression of a truncated protein, and / or expression of a protein that does not retain its wild-type function.

[0142] As used herein, the term "encode" refers to the inherent property of a particular sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (e.g., rRNA, tRNA, and mRNA) or a defined sequence of amino acids, and the biological properties resulting therefrom. Thus, a gene, cDNA, or RNA codes for a protein when transcription and translation of the mRNA corresponding to that gene produces a protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and is usually provided in a sequence listing, and the non-coding strand, which is used as a template for transcription of the gene or cDNA, can be said to code for the protein or other product of that gene or cDNA.

[0143] As used herein, the term "endogenous" in reference to a nucleotide sequence or protein is intended to mean a sequence or protein that is naturally contained within or expressed by a cell.

[0144] As used herein, the terms "exogenous" or "heterologous" with respect to a nucleotide or amino acid sequence are intended to mean a sequence that is purely synthetic, that originates from a foreign species, or, if originating from the same species, that has been substantially modified in composition and / or genomic locus from its native form by deliberate human intervention.

[0145] As used herein, the term "expression" refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter.

[0146] As used herein, the term "expression vector" refers to a vector that contains a recombinant polynucleotide that includes an expression control sequence operably linked to the nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression, and other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses and adeno-associated viruses) that incorporate recombinant polynucleotides.

[0147] As used herein, the term "genetically modified" refers to a cell or organism whose genomic DNA sequence has been or was in its ancestors intentionally modified by recombinant technology. As used herein, the term "genetically modified" encompasses the term "transgenic." For example, as used herein, a "genetically modified" cell can refer to a cell whose mitochondrial DNA has been intentionally modified by recombinant technology.

[0148] As used herein, the term "homologous recombination" or "HR" refers to the natural cellular process in which double-stranded DNA breaks are repaired using a homologous DNA sequence as a repair template (see, for example, Cahill et al. (2006), Front. Biosci. 11:1958-1976). The homologous DNA sequence can be an endogenous chromosomal sequence or an exogenous nucleic acid delivered to the cell.

[0149] As used herein, the term "homology arms" or "sequences homologous to sequences adjacent to a nuclease cleavage site" refers to sequences adjacent to the 5' and 3' ends of a nucleic acid molecule that facilitate the insertion of the nucleic acid molecule into the cleavage site generated by the nuclease. In general, homology arms can have a length of at least 50 base pairs, preferably at least 100 base pairs, up to 2000 base pairs or more, and can have at least 90%, preferably at least 95% or more sequence homology to their corresponding sequences in the genome. In some embodiments, the homology arms are about 500 base pairs.

[0150] As used herein, the term "in vitro transcribed RNA" refers to RNA, preferably mRNA, synthesized in vitro. Generally, in vitro transcribed RNA is generated from an in vitro transcription vector. The in vitro transcription vector contains the template used to generate the in vitro transcribed RNA.

[0151] As used herein, the term "isolated" means altered or removed from the natural state. For example, a nucleic acid or peptide that is naturally present in a living animal is not "isolated," but the same nucleic acid or peptide that is partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein may be present in a substantially purified form or may exist in a non-native environment, such as, for example, a host cell.

[0152] As used herein, the term "lentivirus" refers to a genus of the Retroviridae family.Lentiviruses are unique among retroviruses in that they can infect non-dividing cells.Lentiviruses are one of the most efficient methods of gene delivery vectors, as they can deliver a significant amount of genetic information to the DNA of host cells.HIV, SIV, and FIV are all examples of lentiviruses.

[0153] As used herein, the term "lipid nanoparticle" refers to a lipid composition having a spherical structure, typically with an average diameter of 10 to 1000 nanometers. In some formulations, the lipid nanoparticles can include at least one cationic lipid, at least one non-cationic lipid, and at least one conjugated lipid. Lipid nanoparticles known in the art that are suitable for encapsulating nucleic acids, such as mRNA, are contemplated for use in the present invention.

[0154] As used herein, the term "modification" with respect to a recombinant protein means any insertion, deletion, or substitution of amino acid residues in the recombinant sequence relative to a reference sequence (e.g., a wild-type or native sequence).

[0155] As used herein, the term "non-homologous end joining" or "NHEJ" refers to a natural cellular process in which double-stranded DNA breaks are repaired by direct joining of two non-homologous DNA segments (see, for example, Cahill et al. (2006), Front. Biosci. 11:1958-1976). DNA repair by non-homologous end joining is error-prone and frequently results in untemplated addition or deletion of DNA sequences at the repair site. In some instances, cleavage at a target recognition sequence results in NHEJ at the target recognition site. Nuclease-induced cleavage of a target site in the coding sequence of a gene followed by DNA repair by NHEJ can introduce mutations, such as frameshift mutations, into the coding sequence that disrupt gene function. Thus, genetically engineered nucleases can be used to effectively knock out genes in a population of cells.

[0156] As used herein, the term "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence encoding a protein or RNA can also include introns to the extent that a nucleotide sequence encoding a protein may, in some versions, contain one or more introns.

[0157] As used herein, the term "operably linked" is intended to mean a functional link between two or more elements. For example, an operably linked between a nucleic acid sequence encoding a nuclease described herein and a regulatory sequence (e.g., a promoter) is a functional link that allows expression of the nucleic acid sequence encoding the nuclease. An operably linked element may be contiguous or discontinuous. When used to refer to the joining of two protein coding regions, operably linked intends that the coding regions are in the same reading frame.

[0158] As used herein, unless otherwise expressly stated, the word "or" is used in the inclusive sense of "and / or" and not in the exclusive sense of "either / or."

[0159] As used herein, the terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to a compound composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, with no limit on the maximum number of amino acids that a protein or peptide sequence may contain. A polypeptide includes any peptide or protein that contains two or more amino acids linked together by peptide bonds. As used herein, the term refers to both short chains, also commonly referred to in the art as peptides, oligopeptides, and oligomers, for example, and longer chains, commonly referred to in the art as proteins, of which there are many varieties. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. A polypeptide includes a natural peptide, a recombinant peptide, or a combination thereof.

[0160] As used herein, the term "reduced" or "reduced" refers to a reduction in the percentage or ratio of cells in a population of cells that contain a mutant mitochondrial genome with a MELAS mutation compared to a population of control cells. In some embodiments, "reduced" or "reduced" refers to a reduction in the percentage of mutant mitochondrial genome or the ratio of mutant mitochondrial genome to wild-type mitochondrial genome in a single cell or cell population. Such a reduction is up to 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or up to 100%. Thus, the term "reduced" encompasses both partial and complete reduction of mutant mtDNA.

[0161] As used herein, the terms "percent identity", "sequence identity", "percent similarity", "sequence similarity", and the like, which refer to both amino acid and nucleic acid sequences, refer to a measure of the degree of similarity of two sequences based on the alignment of sequences that maximizes the similarity between aligned amino acid residues or nucleotides and is a function of the number of identical or similar residues or nucleotides, the total number of residues or nucleotides, and the presence and length of gaps in the sequence alignment. A variety of algorithms and computer programs are available for determining sequence similarity using standard parameters. As used herein, sequence similarity is measured using the BLASTp program for amino acid sequences and the BLASTn program for nucleic acid sequences, both of which are available from the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ) and described, for example, in Altschul et al. (1990), J. Mol. Biol. 215:403-410; Gish and States (1993), Nature Genet. 3:266-272; Madden et al. (1996), Meth. Enzymol. 266:131-141; Altschul et al. (1997), Nucleic Acids Res. 25:33 89-3402); Zhang et al. (2000), J. Comput. Biol. 7(1-2):203-14. As used herein, the percent similarity of two amino acid sequences is a score based on the following parameters for the BLASTp algorithm: word size=3, gap opening penalty=-11, gap extension penalty=-1, and scoring matrix=BLOSUM 62. As used herein, the percent similarity of two nucleic acid sequences is a score based on the following parameters for the BLASTn algorithm: word size=11, gap opening penalty=-5, gap extension penalty=-2, match reward=1, mismatch penalty=-3.

[0162] As used herein, the term "poly(A)" is a series of adenosines attached to an mRNA by polyadenylation. In a preferred embodiment of a construct for transient expression, the polyA is 50-5000, preferably more than 64, more preferably more than 100, and most preferably more than 300 or 400. The poly(A) sequence can be modified chemically or enzymatically to modulate the functionality of the mRNA, such as localization, stability or efficiency of translation.

[0163] As used herein, the term "polyadenylation" refers to the covalent attachment of a polyadenylyl moiety or modified variants thereof to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at the 3' end. The 3' poly(A) tail is a long sequence of adenine nucleotides (often hundreds) added to the pre-mRNA by the action of the enzyme polyadenylate polymerase. In higher eukaryotes, the poly(A) tail is added to transcripts that contain a specific sequence, the polyadenylation signal. The poly(A) tail and the proteins bound to it help protect the mRNA from degradation by exonucleases. Polyadenylation is also important for transcription termination, export of mRNA from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after DNA is transcribed into RNA, but may also occur later in the cytoplasm. After transcription is terminated, the mRNA strand is cleaved by the action of an endonuclease complex bound to RNA polymerase. The cleavage site is usually characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mRNA is cleaved, an adenosine residue is added to the free 3' end of the cleavage site.

[0164] As used herein, the term "promoter" or "regulatory sequence" refers to a nucleic acid sequence required for expression of a gene product operably linked to the promoter / regulatory sequence. In some instances, this sequence may be a core promoter sequence, and in other instances, this sequence may also include enhancer sequences and other regulatory elements required for expression of the gene product. The promoter / regulatory sequence may, for example, be one that expresses the gene product in a tissue-specific manner.

[0165] As used herein, the term "recombinant" or "genetically engineered" with respect to a protein means having an altered amino acid sequence as a result of the application of genetic engineering techniques to the nucleic acid encoding the protein and to the cell or organism expressing the protein. With respect to a nucleic acid, the term "recombinant" or "genetically engineered" means having an altered nucleic acid sequence as a result of the application of genetic engineering techniques. Genetic engineering techniques include, but are not limited to, PCR and DNA cloning techniques, transfection, transformation and other gene transfer techniques, homologous recombination, site-directed mutagenesis, and gene fusion. According to this definition, a protein that has an amino acid sequence identical to a naturally occurring protein but is produced by cloning and expression in a heterologous host is not considered to be recombinant or genetically engineered.

[0166] As used herein, the terms "recombinant DNA construct", "recombinant construct", "expression cassette", "expression construct", "chimeric construct", "construct" and "recombinant DNA fragment" are used interchangeably herein and are single-stranded or double-stranded polynucleotides. Recombinant constructs include artificial combinations of nucleic acid fragments, including but not limited to regulatory and coding sequences that are not found together in nature. For example, recombinant DNA constructs may contain regulatory and coding sequences that are derived from different sources, or regulatory and coding sequences that are derived from the same source and arranged in a manner different from that found in nature. Such constructs may be used alone or in combination with vectors.

[0167] As used herein, the term "tissue-specific promoter" refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specified by a gene, causes a gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

[0168] As used herein, the terms "transfected" or "transformed" or "transduced" or "nucleofected" refer to the process by which exogenous nucleic acid is transferred or introduced into a host cell. A "transfected" or "transformed" or "transduced" cell is one that has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.

[0169] As used herein, the term "transfer vector" refers to a composition of matter that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid to the inside of a cell. Numerous vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids and viruses. Thus, the term "transfer vector" includes autonomously replicating plasmids or viruses. The term should also be construed to further include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acid to a cell, such as, for example, polylysine compounds, liposomes, etc. Examples of viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, etc.

[0170] As used herein, the term "transient" refers to expression of a non-integrated transgene over a period of hours, days, or weeks, which is shorter than the period of expression of the gene when integrated into the genome or contained within a stable plasmid replicon in the host cell.

[0171] As used herein, the term "vector" or "recombinant DNA vector" may be a construct that includes a replication system and sequences that allow transcription and translation of sequences encoding a polypeptide in a given host cell. When a vector is used, the selection of the vector depends on the method used to transform the host cell, as is well known to those skilled in the art. Vectors may include, but are not limited to, plasmid vectors and recombinant AAV vectors, or any other vector known in the art that is suitable for delivering genes to target cells. Those skilled in the art are well aware of the genetic elements that must be present on a vector to successfully transform, select, and grow host cells that contain any of the isolated nucleotides or nucleic acid sequences described herein. In some embodiments, "vector" also refers to a viral vector. Viral vectors may include, but are not limited to, retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated viral vectors (AAV).

[0172] As used herein, the term "wild type" refers to the most common naturally occurring allele (i.e., polynucleotide sequence) in an allele population of the same kind of gene, in which the polypeptide encoded by the wild type allele has its original function. The term "wild type" also refers to the polypeptide encoded by the wild type allele. Wild type alleles (i.e., polynucleotides) and polypeptides are distinguishable from mutant or variant alleles and polypeptides that contain one or more mutations and / or substitutions to the wild type sequence. Wild type alleles or polypeptides can confer a normal phenotype in an organism, while mutant or variant alleles or polypeptides can confer an altered phenotype in some cases. Wild type nucleases are distinguishable from recombinant or non-naturally occurring nucleases. The term "wild type" can also refer to a cell, organism, and / or subject that has a wild type allele of a particular gene, or a cell, organism, and / or subject that is used for comparison purposes.

[0173] As used herein, the term "altered specificity" when referring to a nuclease means that the nuclease binds to and cleaves a recognition sequence that is not bound to and cleaved by a reference nuclease (e.g., wild-type) under physiological conditions, or the rate of cleavage of the recognition sequence is increased or decreased by a biologically significant amount (e.g., at least 2x, or 2x-10x) compared to the reference nuclease.

[0174] As used herein, the term "core sequence" refers to the four base pairs that separate the half-sites of a meganuclease recognition sequence. These bases are numbered +1 to +4. The core sequence includes the four bases that become the 3' single-stranded overhangs after meganuclease cleavage. "Core sequence" can refer to the sequence of the sense strand or the antisense (opposite) strand. Meganucleases are symmetric and recognize bases equally on both the sense and antisense strands of the core sequence. For example, the sequence A+1A+2A+3A+4 on the sense strand is recognized by the meganuclease as T+1T+2T+3T+4 on the antisense strand, and thus A+1A+2A+3A+4 and T+1T+2T+3T+4 are functionally equivalent (e.g., both can be cleaved by a given meganuclease). Thus, the sequence C+1T+2G+3C+4 is equivalent to its opposite strand sequence G+1C+2A+3G+4 due to the fact that the meganuclease binds to its recognition sequence as a symmetric homodimer.

[0175] As used herein, the term "cleave" or "cleavage" refers to hydrolysis of a phosphodiester bond in the backbone of a recognition sequence in a target sequence resulting in a double-stranded break in the target sequence, referred to herein as the "cleavage site."

[0176] As used herein, the term "DNA binding affinity" or "binding affinity" refers to the tendency of a nuclease to bind non-covalently to a reference DNA molecule (e.g., a recognition sequence or any sequence). Binding affinity is measured by the dissociation constant Kd. As used herein, a nuclease has "modified" binding affinity if the Kd of the nuclease to the reference recognition sequence is increased or decreased by a statistically significant percent change relative to the reference nuclease.

[0177] As used herein, the term "hypervariable region" refers to a localized sequence within a meganuclease monomer or subunit that contains amino acids with relatively high variability. A hypervariable region can comprise about 50-60 consecutive residues, about 53-57 consecutive residues, or preferably about 56 residues. In some embodiments, the hypervariable region residues can correspond to positions 24-79 or 215-270 of any one of SEQ ID NOs: 3-12. A hypervariable region can comprise one or more residues that contact DNA bases in a recognition sequence and can be modified to alter the base selectivity of the monomer or subunit. A hypervariable region can also comprise one or more residues that bind to the DNA backbone when the meganuclease binds to a double-stranded DNA recognition sequence. Such residues can be modified to alter the binding affinity of the meganuclease to the DNA backbone and the target recognition sequence. In different embodiments described herein, a hypervariable region can comprise 1-20 residues that exhibit variability and can be modified to affect base selectivity and / or DNA binding affinity. In certain embodiments, the hypervariable region comprises about 15-20 residues that exhibit variability and can be modified to affect base preference and / or DNA binding affinity. In some embodiments, the variable residues in the hypervariable region correspond to one or more of positions 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 3-12. In other embodiments, the variable residues in the hypervariable region correspond to one or more of positions 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 3-12.

[0178] As used herein, the term "linker" refers to an exogenous peptide sequence used to link two nuclease subunits into a single polypeptide. The linker may have a sequence found in a naturally occurring protein or may be an artificial sequence not found in a naturally occurring protein. The linker may be flexible and lack secondary structure or may have a tendency to form a particular three-dimensional structure under physiological conditions. Linkers may include, but are not limited to, those encompassed by U.S. Patent Nos. 8,445,251, 9,340,777, 9,434,931, and 10,041,053, each of which is incorporated by reference in its entirety. In some embodiments, the linker may have an amino acid sequence showing residues 154-195 of any one of SEQ ID NOs: 3-12.

[0179] As used herein, the term "meganuclease" refers to an endonuclease that binds to double-stranded DNA with a recognition sequence of more than 12 base pairs. In some embodiments, the recognition sequence of the meganuclease of the present disclosure is 22 base pairs. The meganuclease may be an endonuclease derived from I-CreI (SEQ ID NO: 48) and may refer to an engineered variant of I-CreI that has been modified, for example, with respect to the native I-CreI in terms of DNA-binding specificity, DNA-cleavage activity, DNA-binding affinity, or dimerization properties. Methods for producing such modified variants of I-CreI are known in the art (e.g., WO 2007 / 047859, which is incorporated by reference in its entirety). As used herein, the meganuclease binds to double-stranded DNA as a heterodimer. The meganuclease may also be a "single-chain meganuclease" in which a pair of DNA-binding domains are linked to a single polypeptide using a peptide linker. The term "homing endonuclease" is synonymous with the term "meganuclease." The meganucleases of the present disclosure are substantially non-toxic when expressed in target cells as described herein, such that the cells can be transfected and maintained at 37° C. without observing any deleterious effects on cell viability or significant reduction in meganuclease cleavage activity, as measured using the methods described herein.

[0180] As used herein, the terms "nuclease" and "endonuclease" are used interchangeably to refer to naturally occurring or engineered enzymes that cleave phosphodiester bonds within a polynucleotide chain.

[0181] As used herein, the term "mitochondrial targeted engineered meganuclease" or "MTEM" refers to an engineered meganuclease linked to a peptide or other molecule that can direct the engineered meganuclease to the mitochondria so that the engineered meganuclease can bind to and cleave mitochondrial DNA within the mitochondrial organelle.

[0182] As used herein, the term "mitochondrial transit peptide" or "MTP" refers to a peptide or fragment of amino acids that can bind to a separate molecule to transport the molecule within mitochondria. For example, MTP can bind to a nuclease, such as an engineered meganuclease, to transport the engineered meganuclease to mitochondria. MTP consists of an alternating pattern of hydrophobic and positively charged amino acids and can form a so-called amphipathic helix.

[0183] As used herein, the terms "recognition half-site," "recognition sequence half-site," or simply "half-site" refer to a nucleic acid sequence within a double-stranded DNA molecule that is recognized and bound by a monomer of a homodimeric or heterodimeric meganuclease, or by one subunit of a single-chain meganuclease, or by one subunit of a single-chain meganuclease.

[0184] As used herein, the term "recognition sequence" or "recognition site" refers to a DNA sequence that is bound and cleaved by a nuclease. In the case of meganucleases, the recognition sequence comprises a pair of inverted 9 base pair "half-sites" separated by 4 base pairs. In the case of single-chain meganucleases, the N-terminal domain of the protein contacts the first half-site and the C-terminal domain of the protein contacts the second half-site. Cleavage by a meganuclease creates a 4 base pair 3' overhang. An "overhang" or "sticky end" is a short single-stranded DNA segment that can be created by endonucleolytic cleavage of a double-stranded DNA sequence. In the case of meganucleases derived from I-CreI and single-chain meganucleases, the overhang comprises bases 10-13 of the 22 base pair recognition sequence. As used herein, the term "single-chain meganuclease" refers to a polypeptide that comprises a pair of nuclease subunits joined by a linker. Single-chain meganucleases have the following structure: N-terminal subunit-linker-C-terminal subunit. The two meganuclease subunits generally do not have identical amino acid sequences and bind to non-identical DNA sequences. Thus, single-chain meganucleases typically cleave pseudopalindromic or non-palindromic recognition sequences. Single-chain meganucleases are sometimes referred to as "single-chain heterodimers" or "single-chain heterodimeric meganucleases" even though they are not actually dimers. For clarity, unless otherwise stated, the term "meganuclease" can refer to dimeric or single-chain meganucleases.

[0185] As used herein, the term "specificity" refers to the ability of a nuclease to bind and cut double-stranded DNA molecules only at a specific sequence of base pairs called recognition sequence, or only at a specific set of recognition sequences. A set of recognition sequences share certain conserved positions or sequence motifs, but can be degenerate at one or more positions. A highly specific nuclease can cut only one or only a few recognition sequences. Specificity can be determined by any method known in the art.

[0186] As used herein, the term "target site" or "target sequence" refers to a region of a cell's chromosomal DNA that contains a recognition sequence for a nuclease.

[0187] As used herein, a "vector" can also refer to a viral vector (i.e., a recombinant virus). Viral vectors can include, but are not limited to, retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated viral vectors (AAV).

[0188] As used herein, the term "serotype" or "capsid" refers to a distinct variant within a species of virus that is determined based on viral cell surface antigens. Known serotypes of AAV include, among others, AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAVHSC (Weitzman and Linden (2011) in Snyder and Moullier Adeno-associated virus methods and protocols. Totowa, NJ: Humana Press).

[0189] As used herein, "control" or "control cell" refers to a cell that provides a reference point for measuring the genotypic or phenotypic changes of genetically modified cells. Control cells can include, for example, (a) wild-type cells, i.e., wild-type cells of the same genotype as the starting material for the genetic modification that resulted in the genetically modified cell, (b) cells of the same genotype as the genetically modified cell but transformed with a null construct (i.e., a construct that has no known effect on the trait of interest), or (c) cells that are genetically identical to the genetically modified cell but have not been exposed to conditions, stimuli or further genetic modifications that induce the expression of the modified genotype or phenotype.

[0190] As used herein, the term "effective amount" or "therapeutically effective amount" refers to an amount sufficient to produce beneficial or desired biological and / or clinical results. The therapeutically effective amount varies depending on the formulation or composition used, the disease and its severity, and the age, weight, physical condition and responsiveness of the subject being treated. In some specific embodiments, an effective amount of the MTEM or engineered meganuclease described herein is about 1x10 10 gc / kg ~ approx. 1x10 14 gc / kg (e.g., 1x10 10 gc / kg, 1x10 11 gc / kg, 1x10 12 gc / kg, 1x10 13 gc / kg, or 1x10 14 gc / kg) of a nucleic acid encoding a MTEM or engineered meganuclease or template nucleic acid described herein. In certain embodiments, a pharmaceutical composition comprising an effective amount of a nucleic acid encoding a MTEM or engineered meganuclease described herein and / or a template nucleic acid, or a nucleic acid encoding a MTEM or engineered meganuclease described herein and / or a template nucleic acid described herein, reduces at least one symptom of a disease in a subject.

[0191] As used herein, the terms "effective dose," "effective amount," "therapeutically effective dose," or "therapeutically effective amount" refer to an amount sufficient to effect beneficial or desired biological and / or clinical results.

[0192] As used herein, the term "gc / kg" or "gene copies / kilogram" refers to the number of copies of a nucleic acid encoding a MTEM or engineered meganuclease described herein, or the number of copies of a template nucleic acid described herein, per kilogram of body weight of a subject to which the nucleic acid encoding a MTEM or engineered meganuclease described herein and / or template nucleic acid is administered.

[0193] As used herein, the term "prevent" refers to the prevention of a disease or condition in a patient.

[0194] As used herein, the term "prophylaxis" means the prevention or protective treatment of a disease or disease state.

[0195] As used herein, the term "reduced" refers to any reduction in the symptoms or severity of a disease. Such reduction may be up to 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or up to 100%. Thus, the term "reduced" encompasses both partial and complete reduction of a disease state.

[0196] As used herein, the recitation of a numerical range for a variable is intended to convey that the present disclosure can be implemented with the variable being equal to any of the values ​​within that range. Thus, for a variable that is discrete in nature, the variable can be equal to any integer value within the numerical range, including the end points of the range. Similarly, for a variable that is continuous in nature, the variable can be equal to any real value within the numerical range, including the end points of the range. By way of example and not of limitation, a variable that is described as having a value between 0 and 2 can take on values ​​of 0, 1 or 2 if the variable is discrete in nature, and can take on values ​​of 0.0, 0.1, 0.01, 0.001, or any other real value between ≧0 and ≦2 if the variable is continuous in nature.

[0197] 2.1 Principles of the invention Mitochondria regulate cellular energy and metabolism under normal growth and development, as well as in response to stress. Thus, editing of the mitochondrial genome has diverse applications in both animals and plants. In humans, deleterious mitochondrial mutations are the cause of several disorders for which gene editing therapy can be applied. However, even considering the possibility of using mitochondrial genome editing for therapeutic applications, this remains an unexplored area of ​​science due to the inability to efficiently target mitochondrial DNA (mtDNA) and generate precise edits. The mitochondrial genome is difficult to edit because the editing technology needs to be delivered to this organelle. Furthermore, mitochondria lack predictable repair mechanisms. Previous attempts to edit the mitochondrial genome have resulted in large-scale and unpredictable deletions / rearrangements. Thus, compositions and methods that allow for targeting and editing predetermined regions of the mitochondrial genome (preferably limited to just one gene) in a more predictable manner are desirable.

[0198] The present disclosure provides compositions and methods for binding and cleaving recognition sequences on mitochondrial genome without affecting surrounding regions in the mitochondrial genome.Disclosed herein is an engineered meganuclease that is bound to MTP so that DSBs can be generated in mtDNA.The present invention demonstrates that engineered meganuclease can be directed to mitochondrial organelles and promote precise editing of mtDNA, thus opening up a whole field of prospects and opportunities in life science.

[0199] 2.2 Engineered Meganucleases and Mitochondria-Targeted Engineered Meganucleases for Recognizing and Cleaving Recognition Sequences in Human Mitochondrial DNA It is known in the art that site-specific nucleases can be used to perform DNA breaks in the genome of living cells, and such DNA breaks can lead to the permanent modification of genome through homologous recombination with transgenic DNA sequences.The use of nucleases to induce double-strand breaks in target locus is known to stimulate the homologous recombination of transgenic DNA sequences, particularly those adjacent to sequences that are homologous to genome targets.In this way, exogenous nucleic acid sequences can be inserted into target locus.

[0200] Mitochondrially targeted engineered meganucleases (MTEMs), constructed from engineered meganucleases bound to mitochondrial transit peptides (MTPs), can be effectively transported from the cytoplasm of eukaryotic cells to mitochondria. Once inside the mitochondrial organelle, MTEMs can bind and cleave recognition sequences within the mitochondrial genome. It is known in the art that site-specific nucleases can be used to make DNA breaks within the genome of living cells, and such DNA breaks can result in permanent modification of the genome via mutagenic NHEJ repair or via homologous recombination with transgenic DNA sequences. NHEJ can produce mutagenesis at the break site, resulting in inactivation of the allele. NHEJ-associated mutagenesis can inactivate the allele through the generation of premature stop codons, frameshift mutations that produce aberrant non-functional proteins, or can trigger mechanisms such as nonsense-mediated mRNA decay. The use of nucleases that induce mutagenesis via NHEJ can be used to target specific mutations or sequences present in wild-type alleles. Furthermore, the use of nucleases to induce double-strand breaks in target loci is known to stimulate homologous recombination of transgenic DNA sequences, particularly those adjacent to sequences homologous to genomic targets.In this way, exogenous nucleic acid sequences can be inserted into target loci.Such exogenous nucleic acids can code for any sequence or polypeptide of interest.In some embodiments, the site-specific nuclease can cleave the recognition sequence in the mitochondrial genome, resulting in the degradation of the mitochondrial genome from the cut ends created by the site-specific nuclease.

[0201] The nuclease used to carry out the present invention is a meganuclease. In a particular embodiment, the meganuclease used to carry out the present invention is a single-chain meganuclease. The single-chain meganuclease comprises an N-terminal subunit and a C-terminal subunit linked by a linker peptide. Each of the two domains recognizes and binds to half of the recognition sequence (i.e., the recognition half-site), and the site of DNA cleavage is in the middle of the recognition sequence near the interface of the two subunits. The DNA strand cleavage is offset by four base pairs, so that the DNA cleavage by the meganuclease generates a pair of four-base pair 3' single-stranded overhangs.

[0202] In some embodiments, the engineered meganucleases described herein are engineered to bind and cleave the MIT 25-26 recognition sequence (SEQ ID NO:1). Such engineered meganucleases are referred to herein as "MIT 25-26 meganucleases" or "MIT 25-26 nucleases." In certain embodiments, the MIT 25-26 meganuclease is coupled to an MTP for MTEM to cleave the MIT 25-26 recognition sequence of SEQ ID NO:1.

[0203] The engineered meganucleases described herein may comprise a first subunit comprising a first hypervariable (HVR1) region, and a second subunit comprising a second hypervariable (HVR2) region. Furthermore, the first subunit may bind to a first recognition half-site (e.g., MIT 25 half-site) in the recognition sequence, and the second subunit may bind to a second recognition half-site (e.g., MIT 26 half-site) in the recognition sequence. In embodiments where the engineered meganuclease is a single-chain meganuclease, the first and second subunits may be oriented such that the first subunit comprising the HVR1 region and binding to the first half-site is positioned as the N-terminal subunit, and the second subunit comprising the HVR2 region and binding to the second half-site is positioned as the C-terminal subunit. In an alternative embodiment, the first and second subunits may be oriented such that a first subunit that comprises the HVR1 region and binds to the first half-site is positioned as the C-terminal subunit, and a second subunit that comprises the HVR2 region and binds to the second half-site is positioned as the N-terminal subunit.

[0204] Exemplary MIT 25-26 meganucleases described herein are provided in Table 1 and further described below.

[0205] [Table 1]

[0206] *"MIT25 subunit %" and "MIT26 subunit %" represent the amino acid sequence identity between the MIT25- and MIT26-binding subunit regions of each meganuclease and the MIT25- and MIT26-binding subunit regions of the MIT25-26x.91 meganuclease, respectively.

[0207] In certain embodiments described herein, an engineered meganuclease binds to and cleaves a recognition sequence comprising SEQ ID NO:1 in a mitochondrial genome, and the engineered meganuclease comprises a first subunit and a second subunit, the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region.

[0208] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs:3-12. In some such embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs:3-12. In some such embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs:3-12. In some such embodiments, the HVR1 region comprises a Y, R, K or D at a residue corresponding to residue 66 of any one of SEQ ID NOs:3-12. In some such embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs:3-12. In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs:3-12. In some such embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs:3-12. In some such embodiments, the HVR2 region includes residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs:3-12.In some such embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of any one of SEQ ID NOs:3-12. In some such embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs:3-12. In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 7-153 of any one of SEQ ID NOs: 3-12, and the second subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 198-344 of any one of SEQ ID NOs: 3-12. In some such embodiments, the first subunit comprises a G, S, or A at the residue corresponding to residue 19 of any one of SEQ ID NOs: 3-12. In some such embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of any one of SEQ ID NOs: 3-12. In some such embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of any one of SEQ ID NOs: 3-12. In some such embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of any one of SEQ ID NOs: 3-12. In some such embodiments, the first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NOs: 3-12. In some such embodiments, the second subunit comprises a residue corresponding to residue 271 of any one of SEQ ID NOs: 3-12. In some such embodiments, the engineered meganuclease is a single chain meganuclease comprising a linker, the linker covalently linking the first subunit and the second subunit.In some such embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 3-12. In some such embodiments, the engineered meganuclease comprises an amino acid sequence of any one of SEQ ID NOs: 3-12. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence set forth in any one of SEQ ID NOs: 33-42. In some such embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in any one of SEQ ID NOs: 33-42.

[0209] MIT 25-26x.91 (SEQ ID NO:3) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO:3. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:3. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:3. In some embodiments, the HVR1 region comprises a Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO:3. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:3 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:3.

[0210] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:3. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of SEQ ID NO:3. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:3. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of SEQ ID NO:3. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:3 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:3.

[0211] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 3. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 3. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 3. In some embodiments, the HVR2 region comprises a Y, R, K or D at a residue corresponding to residue 257 of SEQ ID NO:3. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:3. In some embodiments, the HVR2 region comprises a residue corresponding to residue 262 of SEQ ID NO:3. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:3. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:3. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:3 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:3.

[0212] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:3. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO:3. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO:3. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:3. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:3 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:3.

[0213] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, the linker covalently linking said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:3. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO:3. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence set forth in SEQ ID NO:33. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO:33.

[0214] MIT 25-26x.48 (SEQ ID NO: 4) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO:4. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:4. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:4. In some embodiments, the HVR1 region comprises a Y, R, K, or D at the residue corresponding to residue 66 of SEQ ID NO:4. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:4 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:4.

[0215] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:4. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of SEQ ID NO:4. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:4. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of SEQ ID NO:4. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:4 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:4.

[0216] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 4. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 4. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 4. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO:4. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:4. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:4 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:4.

[0217] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:4. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO:4. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO:4. In some embodiments, the second subunit comprises a residue corresponding to residue 276 of SEQ ID NO:4. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:4. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:4 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:4.

[0218] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, the linker covalently linking said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 4. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 34. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 34.

[0219] MIT 25-26x.73 (SEQ ID NO:5) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO:5. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:5. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:5. In some embodiments, the HVR1 region comprises a Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO:5. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:5 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:5.

[0220] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:5. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of SEQ ID NO:5. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:5. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of SEQ ID NO:5. In some embodiments, the residue is a residue corresponding to residue 80 of SEQ ID NO:5. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:5 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:5.

[0221] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 5. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 5. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 5. In some embodiments, the HVR2 region comprises a Y, R, K or D at a residue corresponding to residue 257 of SEQ ID NO:5. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:5. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:5. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:5. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:5 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:5.

[0222] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:5. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO:5. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO:5. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:5. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:5 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:5.

[0223] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, the linker covalently linking said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:5. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO:5. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence set forth in SEQ ID NO:35. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO:35.

[0224] MIT 25-26x.29 (SEQ ID NO:6) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO:6. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:6. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:6. In some embodiments, the HVR1 region comprises a Y, R, K, or D at the residue corresponding to residue 66 of SEQ ID NO:6. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:6 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:6.

[0225] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:6. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of SEQ ID NO:6. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:6. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of SEQ ID NO:6. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:6 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:6.

[0226] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 6. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 6. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 6. In some embodiments, the HVR2 region comprises a Y, R, K or D at a residue corresponding to residue 257 of SEQ ID NO:6. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:6. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:6. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:6. In some embodiments, the HVR2 region comprises a residue corresponding to residue 265 of SEQ ID NO:6. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:6 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:6.

[0227] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:6. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO:6. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO:6. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:6. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:6 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:6.

[0228] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, the linker covalently linking said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:6. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO:6. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence set forth in SEQ ID NO:36. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO:36.

[0229] MIT 25-26x.37 (SEQ ID NO: 7) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO:7. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:7. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:7. In some embodiments, the HVR1 region comprises a Y, R, K, or D at the residue corresponding to residue 66 of SEQ ID NO:7. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:7 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:7.

[0230] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:7. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of SEQ ID NO:7. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:7. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of SEQ ID NO:7. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:7. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:7 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:7.

[0231] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 7. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 7. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 7. In some embodiments, the HVR2 region comprises a Y, R, K or D at a residue corresponding to residue 257 of SEQ ID NO:7. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:7. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:7. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:7 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:7.

[0232] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:7. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO:7. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO:7. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:7. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:7 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:7.

[0233] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, the linker covalently linking said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 7. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 7. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 37. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 37.

[0234] MIT 25-26L.35 (SEQ ID NO: 8) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO:8. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:8. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:8. In some embodiments, the HVR1 region comprises a Y, R, K, or D at the residue corresponding to residue 66 of SEQ ID NO:8. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:8 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:8.

[0235] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:8. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of SEQ ID NO:8. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of SEQ ID NO:8. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:8 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:8.

[0236] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 8. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 8. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 8. In some embodiments, the HVR2 region comprises a Y, R, K or D at a residue corresponding to residue 257 of SEQ ID NO:8. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:8. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:8. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:8. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:8 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:8.

[0237] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:8. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO:8. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO:8. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:8. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:8 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:8.

[0238] In some embodiments, the engineered meganuclease is a single chain meganuclease comprising a linker, the linker covalently linking said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:8. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO:8. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence set forth in SEQ ID NO:38. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO:38.

[0239] MIT 25-26x.91 259H>Q (SEQ ID NO:9) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO:9. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:9. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:9. In some embodiments, the HVR1 region comprises a Y, R, K, or D at the residue corresponding to residue 66 of SEQ ID NO:9. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:9 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:9.

[0240] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:9. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of SEQ ID NO:9. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:9. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of SEQ ID NO:9. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:9. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:9 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:9.

[0241] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 9. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 9. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 9. In some embodiments, the HVR2 region comprises a Y, R, K or D at a residue corresponding to residue 257 of SEQ ID NO:9. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:9. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:9. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:9. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:9 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:9.

[0242] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:9. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO:9. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO:9. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:9. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:9 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:9.

[0243] In some embodiments, the engineered meganuclease is a single chain meganuclease comprising a linker, the linker covalently linking said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 9. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 9. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 39. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 39.

[0244] MIT 25-26L.35 19A>S (SEQ ID NO: 10) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 10. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 10. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 10. In some embodiments, the HVR1 region comprises a Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 10. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:10 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:10.

[0245] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 10. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of SEQ ID NO: 10. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of SEQ ID NO: 10. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:10 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:10.

[0246] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 10. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 10. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 10. In some embodiments, the HVR2 region comprises a Y, R, K or D at a residue corresponding to residue 257 of SEQ ID NO:10. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:10. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:10. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:10. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:10 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:10.

[0247] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:10. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO:10. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO:10. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:10. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:10 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:10.

[0248] In some embodiments, the engineered meganuclease is a single chain meganuclease comprising a linker, the linker covalently linking said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 10. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 10. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 40. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 40.

[0249] MIT 25-26x.91 263T>R (SEQ ID NO: 11) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO:11. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:11. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:11. In some embodiments, the HVR1 region comprises a Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO:11. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:11 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:11.

[0250] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:11. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of SEQ ID NO:11. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:11. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of SEQ ID NO:11. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:11. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:11 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:11.

[0251] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 11. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 11. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 11. In some embodiments, the HVR2 region comprises a Y, R, K or D at a residue corresponding to residue 257 of SEQ ID NO:11. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:11. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:11. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:11. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:11 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:11.

[0252] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:11. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO:11. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO:11. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:11. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:11 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:11.

[0253] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, the linker covalently linking said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 11. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 11. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 41. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 41.

[0254] MIT 25-26x.91 46H>W (SEQ ID NO: 12) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 12. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 12. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 12. In some embodiments, the HVR1 region comprises a Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 12. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:12 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:12.

[0255] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:12. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of SEQ ID NO:12. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:12. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of SEQ ID NO:12. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:12. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:12 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:12.

[0256] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 12. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 12. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 12. In some embodiments, the HVR2 region comprises a Y, R, K or D at a residue corresponding to residue 257 of SEQ ID NO:12. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:12. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:12. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:12. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:12 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:12.

[0257] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:12. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO:12. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO:12. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:12. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:12 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:12.

[0258] In some embodiments, the engineered meganuclease is a single chain meganuclease comprising a linker, the linker covalently linking said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 12. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 12. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 42. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 42. MTPs for targeting engineered meganucleases to mitochondria can be 10-100 amino acids long. In certain embodiments, the MTPs are about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, or more amino acids long. The MTPs may contain additional signals that subsequently target the protein to different regions of the mitochondria, such as the mitochondrial matrix.Non-limiting examples of MTPs for use in the compositions and methods disclosed herein include rhesus F0 ATPase subunit 9 (SU9) MTP, human cytochrome c oxidase subunit VIII (CoxVIII or Cox8) MTP, the P1 isoform of subunit c of human ATP synthase MTP, aldehyde dehydrogenase targeting sequence MTP, glutaredoxin 5 MTP, pyruvate dehydrogenase MTP, peptidyl-prolyl isomerase MTP, acetyltransferase MTP, isocitrate dehydrogenase MTP, cytochrome oxidase MTP, and the subunit of the FA portion of ATP synthase MTP, CPN60 / No GG linker MTP, superoxide dismutase (SOD) MTP, superoxide dismutase dual (2 SOD) MTP, superoxide dismutase modified (SODmod) MTP, superoxide dismutase modified (2 SOD) MTP, and the FA portion of the ATP synthase MTP. SODmod) double MTP, L29 MTP, gATPase gamma subunit (FAγ51) MTP, CoxIV twin strep (ABM97483) MTP and CoxIV 10xHis MTP.

[0259] In certain embodiments, the MTP comprises at least two MTP combinations. The MTP combinations can be the same MTP combinations or different MTP combinations. In certain embodiments, the MTP comprises Cox VIII MTP (SEQ ID NO: 43) and SU9 MTP (SEQ ID NO: 44) in a single MTP represented by SEQ ID NO: 45.

[0260] To form a MTEM, an MTP can be attached to an engineered meganuclease described herein by any suitable means. In certain embodiments, an MTP can be attached to the N-terminus of an engineered meganuclease. In other embodiments, an MTP can be attached to the C-terminus of an engineered meganuclease. In some embodiments, multiple MTPs can be attached to a single engineered meganuclease to form a MTEM. For example, a first MTP can be attached to the N-terminus of an engineered meganuclease and a second MTP can be attached to the C-terminus of an engineered meganuclease. In some embodiments, the first and second MTPs are identical, and in other embodiments, the first and second MTPs are not identical. The MTPs can be attached by any means that allows the delivery of the engineered meganuclease to the mitochondria of a cell. In certain embodiments, the MTPs are attached by fusing the MTPs to the N-terminus or C-terminus of the engineered meganuclease. The MTPs can also be attached to the engineered meganuclease by a peptide linker. The linker can be, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15 or 20 amino acids. In certain embodiments, the MTP is attached to a peptide linker at the N-terminus or C-terminus of the engineered meganuclease.

[0261] In some embodiments, the MTEM or engineered meganuclease described herein for use in the compositions and methods of the present disclosure is linked to a nuclear export sequence (NES) to help prevent the engineered meganuclease from cleaving the nuclear genome. In some such embodiments, the NES comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 46 or 47. For example, the NES may comprise the amino acid sequence of SEQ ID NO: 46 or 47. In certain embodiments, the NES is linked to the N-terminus of the engineered meganuclease. In other embodiments, the NES is linked to the C-terminus of the engineered meganuclease. In certain embodiments, the NES is fused to the engineered meganuclease. In certain embodiments, the NES is linked to the engineered meganuclease by a polypeptide linker.

[0262] In certain embodiments, the MTEMs or engineered meganucleases described herein are bound to multiple NESs. For example, the engineered meganucleases described herein can include a first NES and a second NES. In some such embodiments, the first NES is bound to the N-terminus of the MTEMs or engineered meganucleases described herein, and the second NES is bound to the C-terminus of the MTEMs or engineered meganucleases described herein. In some such embodiments, the first NES and / or the second NES comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 46 or 47. For example, the first NES and / or the second NES can comprise the amino acid sequence shown in SEQ ID NO: 46 or 47. In some embodiments, the first NES and the second NES are the same. In other embodiments, the first NES and the second NES are not the same. The NES can be attached to the MTEM or engineered meganuclease described herein by any suitable means known in the art. For example, the first NES and / or the second NES can be fused to the MTEM or engineered meganuclease described herein. In some embodiments, the first NES and / or the second NES is attached to the MTEM or engineered meganuclease described herein by a polypeptide linker.

[0263] MTEMs or engineered meganucleases described herein that contain a NES may have reduced or decreased transport to the nucleus of a target cell or target cell population (e.g., a eukaryotic cell or eukaryotic cell population) compared to engineered meganucleases that do not contain a NES. For example, nuclear delivery of MTEMs or engineered meganucleases described herein that include a NES may be about 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100% or more (e.g., about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% or more) less than nuclear delivery of MTEMs or engineered meganucleases described herein that do not include a NES. In some embodiments, engineered meganucleases that include a NES may induce fewer nuclear indels (i.e., fewer breaks and resulting deletions in the nuclear genome of a target cell or target cell population) compared to MTEMs or engineered meganucleases described herein that do not include a NES. For example, nuclear indels induced by MTEMs or engineered meganucleases described herein that include a NES may be about 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100% or more fewer than nuclear indels induced by MTEMs or engineered meganucleases described herein that do not include a NES.

[0264] 2.3 Pharmaceutical Compositions In some embodiments, the present invention provides pharmaceutical compositions comprising a pharma- ceutically acceptable carrier and an MTEM or engineered meganuclease as described herein, or an isolated polynucleotide comprising a pharma- ceutically acceptable carrier and a nucleic acid sequence encoding an MTEM or engineered meganuclease as described herein.In particular, pharmaceutical compositions are provided comprising a pharma- ceutically acceptable carrier and a therapeutically effective amount of a nucleic acid encoding an MTEM or engineered meganuclease as described herein, or an MTEM or engineered meganuclease as described herein, wherein the MTEM engineered meganuclease or engineered meganuclease described herein has specificity for a recognition sequence in mtDNA, such as human mtDNA (e.g., the MIT 25-26 recognition sequence of SEQ ID NO: 1).

[0265] In other embodiments, the invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and a genetically modified cell described herein.

[0266] Such pharmaceutical compositions can be prepared according to known techniques. See, for example, Remington, The Science And Practice of Pharmacy (21st ed., Philadelphia, Lippincott, Williams & Wilkins, 2005). In preparing a pharmaceutical formulation according to the present invention, the nuclease polypeptide (or the DNA / RNA encoding it or the cells expressing it) is typically mixed with a pharma- ceutically acceptable carrier and the resulting composition is administered to a subject. The carrier must be acceptable in the sense of being compatible with any other ingredients in the formulation and not deleterious to the subject. In some embodiments, the pharmaceutical compositions described herein can further comprise one or more additional agents or biological molecules useful in treating a disease of the subject. Similarly, the additional agents and / or biological molecules can be co-administered as separate compositions.

[0267] In certain embodiments described herein, the pharmaceutical composition comprises a recombinant virus (i.e., a viral vector) comprising a polynucleotide (e.g., a viral genome) that comprises a nucleic acid sequence encoding the MTEM or engineered meganuclease described herein. Such recombinant viruses are known in the art and include recombinant retroviruses, lentiviruses, adenoviruses, and adeno-associated viruses (AAV) (2013 New Microbiol.36:1-22). Recombinant AAV useful in the present invention can have any capsid or serotype that allows for viral transduction into a target cell type and expression of the MTEM or engineered meganuclease described herein by the target cell. For example, in some embodiments, the recombinant AAV has a serotype of AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAVHSC. In some embodiments, the recombinant virus is directly injected into the target tissue. In alternative embodiments, recombinant virus is delivered systemically via the circulatory system. It is known in the art that different AAVs tend to localize in different tissues, and suitable AAV capsid / serotypes can be selected for preferential delivery to specific tissues. Thus, in some embodiments, the AAV serotype is AAV9. AAVs can also be self-complementary, so that they do not require second strand DNA synthesis in host cells (McCarty et al. (2001) Gene Ther. 8:1248-54). The nucleic acid delivered by recombinant AAV can include left (5') and right (3') inverted terminal repeats.

[0268] In certain embodiments described herein, the pharmaceutical composition comprises one or more mRNAs described herein (e.g., mRNAs encoding MTEMs or engineered meganucleases described herein) formulated in lipid nanoparticles.

[0269] The cationic lipid, non-cationic lipid and / or lipid conjugate that comprise lipid nanoparticles, and the relative molar ratio of such lipids to each other are selected based on the characteristics of the selected lipid, the nature of the intended target cell, and the characteristics of the mRNA to be delivered.Further considerations include, for example, the saturation of alkyl chain, and the size, charge, pH, pKa, fusogenicity and toxicity of the selected lipid.Therefore, the molar ratio of each component can be adjusted accordingly.

[0270] Lipid nanoparticles for use in the methods described herein can be prepared by a variety of techniques currently known in the art. Nucleic acid-lipid particles and their preparation methods are disclosed, for example, in U.S. Patent Publication Nos. 20040142025 and 20070042031, the disclosures of which are incorporated herein by reference in their entirety for all purposes.

[0271] Selection of the appropriate size of lipid nanoparticles must take into account the site of the target cells and the application for which the lipid nanoparticles are being made. Generally, lipid nanoparticles have a size within the range of about 25 to about 500 nm. In some embodiments, lipid nanoparticles have a size of about 50 nm to about 300 nm or about 60 nm to about 120 nm. The size of lipid nanoparticles can be determined by quasi-electric light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421^150 (1981), which is incorporated herein by reference. Various methods for producing populations of lipid nanoparticles in a particular size range, such as sonication or homogenization, are known in the art. One such method is described in U.S. Pat. No. 4,737,323, which is incorporated herein by reference.

[0272] Some lipid nanoparticles contemplated for use in the present invention include at least one cationic lipid, at least one non-cationic lipid, and at least one conjugated lipid. In a more specific example, the lipid nanoparticles can include about 50 mol% to about 85 mol% cationic lipid, about 13 mol% to about 49.5 mol% non-cationic lipid, and about 0.5 mol% to about 10 mol% lipid conjugate, and are produced in such a manner that they have a non-lamellar (i.e., non-bilayer) morphology. In another specific example, the lipid nanoparticles can include about 40 mol% to about 85 mol% cationic lipid, about 13 mol% to about 49.5 mol% non-cationic lipid, and about 0.5 mol% to about 10 mol% lipid conjugate, and are produced in such a manner that they have a non-lamellar (i.e., non-bilayer) morphology.

[0273] The cationic lipid can include, for example, one or more of the following: palmitoyl-oleoyl-nor-arginine (PONA), MPDACA, GUADACA, ((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate) (MC3), LenMC3, CP-LenMC3, γ-LenMC3, CP-γ-LenMC3, MC3MC, MC2MC, MC3 ether, MC4 ether, MC3 amide, Pan-MC3, Pan-MC4, and Pan MC5, 1,2-Dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 2,2-Dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-K-C2-DMA; "XTC2"), 2,2-Dilinoleyl-4-(3-dimethylaminopropyl)-[1,3]-dioxolane (DLin-K-C3-DMA), 2,2-Dilinoleyl-4-(4-dimethylaminobutyl)-[1,3]-dioxolane (DLin-K-C4-DMA), 2,2-Dilinoleyl-5-dimethylaminomethyl-[1,3]-dioxane (DLin-K6-DMA), 2,2-Dilinoleyl-4-N-methylpepiazino-[1,3]-dioxolane (DLin-K-MPZ), 2,2-Dilinoleyl-4-dimethylaminobutyl-[1,3]-dioxolane (DLin-K-MPZ), DLin-K-DMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLin-MA), nDAP), 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanediol (DOAP), 1,2-Dilinoleylxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), N,N-Dioleyl-N,N-dimethylammonium chloride (DODAC), 1,2-Dioleyloxy-N,N-dimethyl Aminopropane (DODMA), 1,2-distearyloxy-N,N-dimethylaminopropane (DSDMA), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), 3-(N-(N',N'-dimethylaminoethane)-calcium chloride) bamoyl)cholesterol (DC-Chol), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), dioctadecylamidoglycylspermine (DOGS), 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutane- 4-oxy)-1-(cis,cis-9,12-octadecadienoxy)propane (CLinDMA), 2-[5'-(cholest-5-ene-3-beta-oxy)-3´-oxapentoxy)-3-dimethyl-1-(cis,cis-9',1-2'-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), 1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), or mixtures thereof. The cationic lipid may also be DLinDMA, DLin-K-C2-DMA ("XTC2"), MC3, LenMC3, CP-LenMC3, γ-LenMC3, CP-γ-LenMC3, MC3MC, MC2MC, MC3 ether, MC4 ether, MC3 amide, Pan-MC3, Pan-MC4, Pan MC5, or mixtures thereof.

[0274] In various embodiments, the cationic lipid comprises from about 50 mol% to about 90 mol%, from about 50 mol% to about 85 mol%, from about 50 mol% to about 80 mol%, from about 50 mol% to about 75 mol%, from about 50 mol% to about 70 mol%, from about 50 mol% to about 65 mol%, or from about 50 mol% to about 60 mol% of the total lipid present in the particle.

[0275] In other embodiments, the cationic lipid comprises from about 40 mol% to about 90 mol%, from about 40 mol% to about 85 mol%, from about 40 mol% to about 80 mol%, from about 40 mol% to about 75 mol%, from about 40 mol% to about 70 mol%, from about 40 mol% to about 65 mol%, or from about 40 mol% to about 60 mol% of the total lipid present in the particle.

[0276] Non-cationic lipid may, for example, comprise one or more anionic lipids and / or neutral lipids.In certain embodiments, non-cationic lipid comprises one of the following neutral lipid components: (1) cholesterol or its derivatives; (2) phospholipid; or (3) mixture of phospholipid and cholesterol or its derivatives.Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, and mixtures thereof. The phospholipid may be a neutral lipid, including, but not limited to, dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoyl-phosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), palmitoyloleyl-phosphatidylglycerol (POPG), dipalmitoyl-phosphatidylethanolamine (DPPE), dimyristoyl-phosphatidylethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine, dielaidoyl-phosphatidylethanolamine (DEPE), stearoyloleoyl-phosphatidylethanolamine (SOPE), egg phosphatidylcholine (EPC), and mixtures thereof. In certain specific embodiments, the phospholipid is DPPC, DSPC, or a mixture thereof.

[0277] In some embodiments, the non-cationic lipid (e.g., one or more phospholipids and / or cholesterol) comprises about 10 mol% to about 60 mol%, about 15 mol% to about 60 mol%, about 20 mol% to about 60 mol%, about 25 mol% to about 60 mol%, about 30 mol% to about 60 mol%, about 10 mol% to about 55 mol%, about 15 mol% to about 55 mol%, about 20 mol% to about 55 mol%, about 25 mol% to about 55 mol%, about 30 mol% to about 55 mol%, about 13 mol% to about 50 mol%, about 15 mol% to about 50 mol%, or about 20 mol% to about 50 mol% of the total lipid present in the particle. When the non-cationic lipid is a mixture of phospholipid and cholesterol or a cholesterol derivative, the mixture may comprise up to about 40, 50, or 60 mol% of the total lipid present in the particle.

[0278] The conjugated lipid that inhibits particle aggregation can include, for example, one or more of the following: polyethylene glycol (PEG)-lipid conjugates, polyamide (ATTA)-lipid conjugates, cationic polymer-lipid conjugates (CPLs), or mixtures thereof. In one particular embodiment, the nucleic acid-lipid particles include either PEG-lipid conjugates or ATTA-lipid conjugates. In certain embodiments, the PEG-lipid conjugates or ATTA-lipid conjugates are used together with CPLs. The conjugated lipid that inhibits particle aggregation can include, for example, PEG-lipids including PEG-diacylglycerol (DAG), PEG dialkyloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), or mixtures thereof. The PEG-DAA conjugate can be PEG-dilauryloxypropyl (C12), PEG-dimyristyloxypropyl (C14), PEG-dipalmityloxypropyl (C16), PEG-distearyloxypropyl (C18), or mixtures thereof.

[0279] Further PEG-lipid conjugates suitable for use in the present invention include, but are not limited to, mPEG2000-1,2-di-O-alkyl-sn3-carbomoyl glycerides (PEG-C-DOMG).The synthesis of PEG-C-DOMG is described in PCT Application No. PCT / US08 / 88676.Still further PEG-lipid conjugates suitable for use in the present invention include, but are not limited to, 1-[8'-(1,2-dimyristoyl-3-propanoxy)-carboxamido-3',6'-dioxaoctanyl]carbamoyl-ω-methyl-poly(ethylene glycol) (2KPEG-DMG).The synthesis of 2KPEG-DMG is described in US Patent No. 7,404,969.

[0280] In some cases, the conjugated lipid (e.g., PEG-lipid conjugate) that inhibits particle aggregation may comprise about 0.1 mol% to about 2 mol%, about 0.5 mol% to about 2 mol%, about 1 mol% to about 2 mol%, about 0.6 mol% to about 1.9 mol%, about 0.7 mol% to about 1.8 mol%, about 0.8 mol% to about 1.7 mol%, about 1 mol% to about 1.8 mol%, about 1.2 mol% to about 1.8 mol%, about 1.2 mol% to about 1.7 mol%, about 1.3 mol% to about 1.6 mol%, about 1.4 mol% to about 1.5 mol%, or about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mol% (or any fraction or range thereof) of the total lipid present in the particle. Typically, in such cases, the PEG moiety has an average molecular weight of about 2,000 Daltons. In other cases, the conjugated lipid (e.g., PEG-lipid conjugate) that inhibits particle aggregation may constitute about 5.0 mol% to about 10 mol%, about 5 mol% to about 9 mol%, about 5 mol% to about 8 mol%, about 6 mol% to about 9 mol%, about 6 mol% to about 8 mol%, or about 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, or 10 mol% (or any fraction or range thereof) of the total lipid present in the particle. Typically, in such cases, the PEG moiety has an average molecular weight of about 750 Daltons.

[0281] In another embodiment, the composition comprises amphoteric liposomes containing at least one positive charge carrier and at least one negative charge carrier different from the positive charge carrier, the isoelectric point of the liposomes being between 4 and 8. This objective is achieved by the fact that the liposomes are prepared with a pH-dependent varying charge.

[0282] Liposomal structures with the desired properties are formed, for example, when the amount of membrane-forming or membrane-based cationic charge carriers exceeds the amount of anionic charge carriers at low pH and the ratio is reversed at higher pH. This is always the case when the ionizable components have pKa values ​​between 4 and 9. As the pH of the medium decreases, all cationic charge carriers become more charged and all anionic charge carriers lose charge.

[0283] Cationic compounds useful for amphoteric liposomes include those previously described hereinabove.Without being limited thereto, strong cationic compounds may include, for example, DC-Chol 3-β-[N-(N',N'-dimethylmethane)carbamoyl]cholesterol, TC-Chol 3-β-[N-(N',N',N'-trimethylaminoethane)carbamoylcholesterol, BGSC bis-guanidinium-spermidine-cholesterol, BGTC bis-guanidinium-tren-cholesterol, DOTAP(1,2-dioleoyloxypropyl)-N,N,N-trimethylammonium chloride, DOSPER(1,3-dioleoyloxy-2-(6-carboxy-spermyl)-propylarnide, DOTMA(1,2-dioleoyloxypropyl)-N,N,N-trimethylammonium chloride) (LIPOFECTIN®), DORIE ... 1,2-dioleoyloxypropyl)-3-dimethylhydroxyethylammonium bromide, DOSC (1,2-dioleoyl-3-succinyl-sn-glycerylcholine ester), DOGSDSO (1,2-dioleoyl-sn-glycero-3-succinyl-2-hydroxyethyl disulfide omithin), DDAB dimethyldioctadecylammonium bromide, DOGS ((C18)2GlySper3+) N,N-dioctadecylamido-glycol-spermine (TRANSFECTAM®) (C18)2Gly+N,N-dioctadecylamido-glycine, CTAB cetyltrimethylammonium bromide, CpyC cetylpyridinium chloride, DOEPC 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine or other O-alkyl-phosphatidylcholines or ethanolamines, amides from lysine, arginine or ornithine, and phosphatidylethanolamine.

[0284] Examples of weakly cationic compounds include, but are not limited to, His-Chol (histaminyl-cholesterol hemisuccinate), Mo-Chol (morpholine-N-ethylamino-cholesterol hemisuccinate), or histidinyl-PE.

[0285] Examples of neutral compounds include, but are not limited to, cholesterol, ceramide, phosphatidylcholine, phosphatidylethanolamine, tetraether lipids, or diacylglycerol.

[0286] Anionic compounds useful for amphoteric liposomes include the non-cationic compounds previously described herein. Non-limiting examples of weakly anionic compounds include: CHEMS (cholesterol hemisuccinate), alkyl carboxylic acids having 8 to 25 carbon atoms, or diacylglycerol hemisuccinate. Further weakly anionic compounds can include amides of aspartic acid or glutamic acid, as well as PE and PS, and their amides with glycine, alanine, glutamine, asparagine, serine, cysteine, threonine, tyrosine, glutamic acid, aspartic acid, or other amino acids or aminodicarboxylic acids. By the same principle, esters of hydroxycarboxylic acids or hydroxydicarboxylic acids with PS are also weakly anionic compounds.

[0287] In some embodiments, amphoteric liposome contains conjugated lipid such as those described herein above.Specific examples of useful conjugated lipid include, but are not limited to, PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugate (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine and PEG-modified 1,2-diacyloxypropan-3-amine.Some specific examples are PEG-modified diacylglycerol and dialkylglycerol.

[0288] In some embodiments, the neutral lipids constitute about 10 mol% to about 60 mol%, about 15 mol% to about 60 mol%, about 20 mol% to about 60 mol%, about 25 mol% to about 60 mol%, about 30 mol% to about 60 mol%, about 10 mol% to about 55 mol%, about 15 mol% to about 55 mol%, about 20 mol% to about 55 mol%, about 25 mol% to about 55 mol%, about 30 mol% to about 55 mol%, about 13 mol% to about 50 mol%, about 15 mol% to about 50 mol%, or about 20 mol% to about 50 mol% of the total lipids present in the particle.

[0289] In some cases, the conjugated lipid (e.g., PEG-lipid conjugate) that inhibits particle aggregation comprises about 0.1 mol% to about 2 mol%, about 0.5 mol% to about 2 mol%, about 1 mol% to about 2 mol%, about 0.6 mol% to about 1.9 mol%, about 0.7 mol% to about 1.8 mol%, about 0.8 mol% to about 1.7 mol%, about 1 mol% to about 1.8 mol%, about 1.2 mol% to about 1.8 mol%, about 1.2 mol% to about 1.7 mol%, about 1.3 mol% to about 1.6 mol%, about 1.4 mol% to about 1.5 mol%, or about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mol% (or any fraction or range thereof) of the total lipid present in the particle. Typically, in such cases, the PEG moiety has an average molecular weight of about 2,000 Daltons. In other cases, the conjugated lipid (e.g., PEG-lipid conjugate) that inhibits particle aggregation may constitute about 5.0 mol% to about 10 mol%, about 5 mol% to about 9 mol%, about 5 mol% to about 8 mol%, about 6 mol% to about 9 mol%, about 6 mol% to about 8 mol%, or about 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, or 10 mol% (or any fraction or range thereof) of the total lipid present in the particle. Typically, in such cases, the PEG moiety has an average molecular weight of about 750 Daltons.

[0290] Considering the total amount of neutral lipids and conjugated lipids, the remaining balance of the amphoteric liposomes can contain a mixture of cationic and anionic compounds formulated in various ratios. The ratio of cationic lipids to anionic lipids can be selected to achieve the desired properties of nucleic acid encapsulation, zeta potential, pKa, or other physicochemical properties that depend at least in part on the presence of charged lipid components.

[0291] In some embodiments, the lipid nanoparticles have a composition that specifically enhances delivery and uptake in eukaryotic cells, such as mammalian cells (e.g., human cells). In certain embodiments, the lipid nanoparticles have a composition that specifically enhances delivery and uptake in liver or, in particular, hepatic cells. In certain embodiments, the lipid nanoparticles have a composition that specifically enhances delivery and uptake in neuronal cells.

[0292] 2.4 Methods for Producing Recombinant Viruses In some embodiments, the present invention provides recombinant viruses (e.g., recombinant AAV) for use in the methods described herein. Recombinant AAV is typically produced in a mammalian cell line, such as HEK-293. The viral cap and rep genes are removed from the vector to prevent its self-replication and make room for the delivered therapeutic gene (e.g., nuclease gene), so they need to be provided in trans to the packaging cell line. In addition, the "helper" (e.g., adenovirus) components required to support replication need to be provided (Cots et al. (2013), Curr. Gene Ther. 13(5):370-81). Often, recombinant AAV is produced using triple transfection, where a cell line is transfected with a first plasmid encoding the "helper" components, a second plasmid containing the cap and rep genes, and a third plasmid containing the viral ITRs that contain the intervening DNA sequence to be packaged into the virus. The viral particles containing the encapsidated genome (ITRs and intervening gene of interest) are then isolated from the cells by freeze-thaw cycles, sonication, detergents, or other means known in the art. The particles are then purified using cesium chloride density gradient centrifugation or affinity chromatography, and subsequently delivered to a cell, tissue, or organism, such as a human patient, with the gene of interest.

[0293] Since recombinant AAV is typically produced (manufactured) intracellularly, care must be taken when carrying out the present invention to ensure that the MTEM or engineered meganuclease described herein is not expressed in the packaging cell. Since the viral genome described herein may contain a recognition sequence for a nuclease, any nuclease expressed in the packaging cell line may be able to cleave the viral genome before it can be packaged into a viral particle. This results in reduced packaging efficiency and / or packaging of fragmented genomes. Several approaches can be used to prevent nuclease expression in the packaging cell.

[0294] The MTEM or engineered meganuclease described herein can be under the control of any promoter suitable for the expression of the MTEM or engineered meganuclease described herein. In some embodiments, the promoter is a constitutive promoter, or the promoter is a tissue-specific promoter, such as a stem cell specific promoter, a CD34+ HSC specific promoter, a muscle specific promoter, a skeletal muscle specific promoter, a myotube specific promoter, a muscle satellite cell specific promoter, a neuron specific promoter, an astrocyte specific promoter, a microglia specific promoter, an eye cell specific promoter, a retinal cell specific promoter, a retinal ganglion cell specific promoter, a retinal pigment epithelium specific promoter, a pancreatic cell specific promoter, a pancreatic beta cell specific promoter, a kidney cell specific promoter, a bone marrow cell specific promoter, or an ear hair cell specific promoter. In some embodiments, the ubiquitous promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter.

[0295] In certain embodiments, the MTEM or engineered meganuclease described herein can be under the control of a tissue-specific promoter that is not active in packaging cells. For example, when developing a viral vector for delivery of nuclease genes to muscle tissue, a muscle-specific promoter can be used. Examples of muscle-specific promoters include C5-12 (Liu et al. (2004) Hum Gene Ther. 15:783-92), muscle-specific creatine kinase (MCK) promoter (Yuasa et al. (2002) Gene Ther. 9:1576-88), or smooth muscle 22 (SM22) promoter (Haase et al. (2013) BMC Biotechnol. 13:49-54). Examples of CNS (neuron) specific promoters include NSE, synapsin and MeCP2 promoters (Lentz et al. (2012) Neurobiol Dis. 48:179-88). Examples of liver-specific promoters include albumin promoters (such as Palb), human alpha 1-antitrypsin (such as Pa1AT), and hemopexin (such as Phpx) (Kramer et al., (2003) Mol. Therapy 7:375-85), hybrid liver-specific promoters (hepatic locus control region from the ApoE gene (ApoE-HCR) and liver-specific alpha 1-antitrypsin promoter), human thyroxine-binding globulin (TBG) promoter, and apolipoprotein A-II promoter. Examples of eye-specific promoters include opsin, and the corneal epithelium-specific K12 promoter (Martin et al., (2002) Methods (28):267-75) (Tong et al., (2007) J Gene Med, 9:956-66). These promoters, or other tissue-specific promoters known in the art, are not highly active in HEK-293 cells and therefore are not expected to result in significant levels of nuclease gene expression in packaging cells when incorporated into the viral vectors of the present invention. Similarly, the viral vectors of the present invention contemplate the use of other cell lines with the use of incompatible tissue-specific promoters, i.e., the well-known HeLa cell line (human epithelial cells) and the liver-specific hemopexin promoter.Other examples of tissue-specific promoters include synovial sarcoma PDZD4 (cerebellum), C6 (liver), ASB5 (muscle), PPP1R12B (heart), SLC5A12 (kidney), cholesterol-regulated APOM (liver), ADPRHL1 (heart), and monogenic malformation syndrome TP73L (muscle). (Jacox et al. (2010), PLoS One v.5(8):e12274).

[0296] Alternatively, recombinant viruses can be packaged in cells from different species where nucleases are unlikely to be expressed. For example, viral particles can be produced in microbial, insect or plant cells using mammalian promoters such as the well-known cytomegalovirus or SV40 virus early promoters that are not active in non-mammalian packaging cells. In certain embodiments, viral particles are produced in insect cells using the baculovirus system described by Gao et al. (Gao et al. (2007), J. Biotechnol. 131(2):138-43). Nucleases under the control of mammalian promoters are unlikely to be expressed in these cells (Airenne et al. (2013), Mol. Ther. 21(4):739-49). In addition, insect cells utilize different mRNA splicing motifs than mammalian cells. Thus, it is possible to incorporate mammalian introns, such as the human growth hormone (HGH) intron or the SV40 large T antigen intron, into the coding sequence of the nuclease. These introns are not efficiently spliced ​​out of the pre-mRNA transcript in insect cells, so the insect cells do not express functional nucleases and package the full-length genome. In contrast, the mammalian cells into which the resulting recombinant AAV particles are delivered properly splice the pre-mRNA and express functional nuclease proteins. Haifeng Chen has reported the use of HGH and SV40 large T antigen introns to attenuate the expression of the toxic proteins barnase and diphtheria toxin fragment A in insect packaging cells, allowing the production of recombinant AAV vectors carrying these toxin genes (Chen, H (2012) Mol Ther Nucleic Acids. 1 (11): e57).

[0297] The MTEM or engineered meganuclease gene described herein can be operably linked to an inducible promoter so that a small molecule inducer is required for nuclease expression. Examples of inducible promoters include the Tet-On system (Clontech; Chen et al. (2015), BMC Biotechnol. 15(1):4)) and the RheoSwitch system (Intrexon; Sowa et al. (2011), Spine, 36(10):E623-8). Both systems, as well as similar systems known in the art, rely on ligand-inducible transcription factors (variants of the Tet repressor and ecdysone receptor, respectively) that activate transcription in response to small molecule activators (doxycycline or ecdysone, respectively). The practice of the invention using such ligand-inducible transcription activators involves: 1) placing a nuclease gene under the control of a promoter responsive to the corresponding transcription factor, where the nuclease gene (a) has a binding site for the transcription factor, and 2) including a gene encoding the transcription factor in the packaged viral genome. The latter step is necessary because the nuclease will not be expressed in the target cell or tissue after recombinant AAV delivery if the transcription activator is not also provided to the same cell. The transcription activator then induces nuclease gene expression only in cells or tissues that have been treated with the cognate small molecule activator. This approach is advantageous because it allows for spatiotemporal regulation of nuclease gene expression by selecting when and to which tissue the small molecule inducer is delivered. However, the need to include the inducer in the viral genome, which has a significantly limited carrying capacity, poses a drawback to this approach.

[0298] In another specific embodiment, recombinant AAV is produced in a mammalian cell line that expresses a transcriptional repressor that prevents the expression of nuclease.Transcriptional repressors are known in the art and include Tet repressor, Lac repressor, Cro repressor and lambda repressor.Many nuclear hormone receptors, such as ecdysone receptor, also act as transcriptional repressors in the absence of their cognate hormone ligand.To carry out the present invention, packaging cells are transfected / transduced with a vector that codes for a transcriptional repressor, and the nuclease gene in the viral genome (packaging vector) is operably linked to a promoter that is modified to contain a binding site for the repressor, so that the repressor silences the promoter.The gene that codes for the transcriptional repressor can be placed in various locations. It can be coded on a separate vector, can be incorporated into the packaging vector outside the ITR sequence, can be incorporated into the cap / rep vector or adenovirus helper vector, or can be stably incorporated into the genome of the packaging cell so that it is constitutively expressed. Methods for modifying general mammalian promoters to incorporate transcriptional repressor sites are known in the art. For example, Chang and Roninson modified the strong constitutive CMV and RSV promoters to include the Lac repressor operator and showed that gene expression from the modified promoters was greatly attenuated in cells expressing the repressor (Chang and Roninson (1996), Gene 183:137-42). The use of a non-human transcriptional repressor ensures that the transcription of the nuclease gene is only repressed in the packaging cells expressing the repressor, and not in target cells or tissues transduced with the resulting recombinant AAV.

[0299] 2.5 Methods for Producing Genetically Modified Cells The present invention provides methods for producing genetically modified cells, both in vitro and in vivo, using MTEMs or engineered meganucleases described herein that bind and cleave recognition sequences found within mtDNA, such as human mtDNA. Cleavage at such recognition sequences may allow for NHEJ at the cleavage site, insertion of exogenous sequences by homologous recombination, or degradation of the mtDNA.

[0300] The present invention includes that the MTEMs or engineered meganucleases described herein, or nucleic acids encoding the MTEMs or engineered meganucleases described herein, can be delivered (i.e., introduced) into cells, such as eukaryotic cells (e.g., human cells).

[0301] The MTEM or engineered meganuclease described herein can be delivered to cells in the form of a protein or preferably as a nucleic acid encoding the MTEM or engineered meganuclease described herein. Such a nucleic acid can be DNA (e.g., circular or linearized plasmid DNA or PCR product) or RNA (e.g., mRNA). Thus, provided herein is a polynucleotide comprising a nucleic acid sequence encoding the MTEM or engineered meganuclease described herein. In certain embodiments, the polynucleotide is an mRNA. The polynucleotide encoding the MTEM or engineered meganuclease described herein can be operably linked to a promoter. In certain embodiments, an expression cassette is provided that comprises a promoter operably linked to a polynucleotide having a nucleic acid sequence encoding the MTEM or engineered meganuclease described herein.

[0302] In the embodiment where the sequence encoding the MTEM or engineered meganuclease is delivered in DNA form, it should be operably linked to a promoter to facilitate transcription of the sequence encoding the MTEM or engineered meganuclease. Mammalian promoters suitable for the present invention include constitutive promoters such as the cytomegalovirus early (CMV) promoter (Thomsen et al. (1984), Proc Natl Acad Sci USA, 81(3):659-63), SV40 early promoter (Benoist and Chambon (1981), Nature. 290(5804):304-10), CAG promoter, EF1 alpha promoter, or UbC promoter, as well as inducible promoters such as the tetracycline-inducible promoter (Dingermann et al. (1992), Mol Cell Biol. 12(9):4038-45). The MTEM or engineered meganuclease described herein can also be operably linked to a synthetic promoter. Synthetic promoters can include, but are not limited to, JeT promoters (WO 2002 / 012514). In certain embodiments, the nucleic acid sequence encoding the MTEM or engineered meganuclease described herein is operably linked to a tissue-specific promoter, such as a muscle cell-specific promoter, a skeletal muscle-specific promoter, a myotube-specific promoter, a muscle satellite cell-specific promoter, a neuron-specific promoter, an astrocyte-specific promoter, a microglia-specific promoter, an eye cell-specific promoter, a retinal cell-specific promoter, a retinal ganglion cell-specific promoter, a retinal pigment epithelium-specific promoter, a pancreatic cell-specific promoter, or a pancreatic beta cell-specific promoter.

[0303] In certain embodiments, the nucleic acid sequence encoding the MTEM or engineered meganuclease is delivered on a recombinant DNA construct or expression cassette. For example, the recombinant DNA construct can include an expression cassette (i.e., a "cassette") that includes a polynucleotide having a promoter and a nucleic acid sequence encoding the MTEM or engineered meganuclease described herein. The polynucleotides provided herein can be mRNA or DNA. In certain embodiments, the polynucleotide further includes a sequence encoding a selectable marker. The selectable marker can be any marker that allows for the selection of a cell or organism (e.g., a bacterium, a eukaryotic cell, a mammalian cell, a plant cell, a plant, and / or a plant part) that contains the polynucleotide described herein. In certain embodiments, the selectable marker is an antibiotic resistance gene.

[0304] In some embodiments, mRNA encoding METM is delivered to the cell because this reduces the likelihood that the gene encoding the MTEM or engineered meganuclease described herein will be integrated into the cell's genome.

[0305] Such mRNAs encoding METMs may be produced using methods known in the art, such as in vitro transcription. In some embodiments, the mRNAs are 5' capped using 7-methyl-guanosine, anti-reverse cap analog (ARCA) (U.S. Patent No. 7,074,596), CLEANCAP® analogs, such as Cap 1 analog (Trilink, San Diego, CA), or enzymatically capped, such as using vaccinia capping enzyme. In some embodiments, the mRNAs may be polyadenylated. The mRNAs may contain various 5' and 3' untranslated sequence elements to enhance expression of the encoded MTEM or engineered meganucleases described herein and / or the stability of the mRNA itself. Such elements may include post-translational regulatory elements, such as, for example, woodchuck hepatitis virus post-translational regulatory elements. The mRNAs may contain nucleoside analogs or naturally occurring nucleosides, such as pseudouridine, 5-methylcytidine, N6-methyladenosine, 5-methyluridine, or 2-thiouridine. Additional nucleoside analogs include, for example, those described in US Pat. No. 8,278,036.

[0306] The purified MTEMs or engineered meganucleases described herein can be delivered to cells to cleave mitochondrial DNA by a variety of different mechanisms known in the art, including those further detailed herein.

[0307] In another specific embodiment, the nucleic acid encoding the MTEM or engineered meganuclease described herein is introduced into the cell using a single-stranded DNA template. The single-stranded DNA can further comprise 5' and / or 3' AAV inverted terminal repeats (ITRs) upstream and / or downstream of the sequence encoding the MTEM or engineered meganuclease described herein. The single-stranded DNA can further comprise 5' and / or 3' homology arms upstream and / or downstream of the sequence encoding the MTEM or engineered meganuclease described herein.

[0308] In another specific embodiment, the gene encoding MTEM or engineered meganuclease described herein is introduced into cells using linearized DNA template.Such linearized DNA template can be produced by methods known in the art.For example, the plasmid DNA encoding nuclease can be digested by one or more restriction enzymes so that circular plasmid DNA is linearized before being introduced into cells.

[0309] The purified MTEM or engineered meganucleases described herein, or nucleic acids encoding the MTEM or engineered meganucleases described herein, can be delivered to cells to cleave mitochondrial DNA by a variety of different mechanisms known in the art, including those further detailed herein below.

[0310] In some embodiments, the MTEM or engineered meganuclease described herein, the DNA / mRNA encoding the MTEM or engineered meganuclease described herein, or the cells expressing the MTEM or engineered meganuclease described herein are formulated in a pharma- ceutically acceptable carrier for systemic administration or administration to a target tissue according to known techniques. See, for example, Remington, The Science And Practice of Pharmacy (21st ed., Philadelphia, Lippincott, Williams & Wilkins, 2005). In the preparation of pharmaceutical formulations according to the present invention, the protein / RNA / mRNA / cells are typically mixed with a pharma-ceutically acceptable carrier. The carrier must, of course, be acceptable in the sense of being compatible with any other ingredients in the formulation and must not be harmful to the patient. The carrier may be solid or liquid, or both, and may be formulated with the compound as a unit dose formulation.

[0311] In some embodiments, the MTEMs or engineered meganucleases described herein, or the DNA / mRNA encoding the MTEMs or engineered meganucleases described herein, are conjugated to a cell-penetrating peptide or targeting ligand to facilitate cellular uptake. Examples of cell-penetrating peptides known in the art include polyarginine (Jearawiriyapaisarn et al. (2008) Mol Ther. 16:1624-9), the TAT peptide from the HIV virus (Hudecz et al. (2005), Med. Res. Rev. 25:679-736), MPG (Simeoni et al. (2003) Nucleic Acids Res. 31:2717-2724), Pep-1 (Deshayes et al. (2004) Biochemistry 43:7698-7706), and HSV-1 VP-22 (Deshayes et al. (2005) Cell Mol Life 11:1624-1624). Sci. 62:1839-49. In an alternative embodiment, the MTEM or engineered meganuclease described herein, or the DNA / mRNA encoding the MTEM or engineered meganuclease described herein, is covalently or non-covalently linked to an antibody that recognizes a specific cell surface receptor expressed on a target cell, such that the MTEM protein / DNA / mRNA binds to and is internalized by the target cell. Alternatively, the MTEM protein / DNA / mRNA can be covalently or non-covalently linked to a natural ligand (or a portion of a natural ligand) of such a cell surface receptor (McCall et al. (2014) Tissue Barriers. 2(4):e944449; Dinda et al. (2013) Curr Pharm Biotechnol. 14:1264-74; Kang et al. (2014) Curr Pharm Biotechnol. 15(3):220-30; Qian et al. (2014) Expert Opin Drug Metab. Toxicol.10(11):1491-508).

[0312] In some embodiments, the MTEM or engineered meganuclease described herein, or the DNA / mRNA encoding the MTEM or engineered meganuclease described herein, is encapsulated in a biodegradable hydrogel. The hydrogel can provide sustained and tunable release of therapeutic payload to the desired area of ​​the target tissue without the need for frequent injections, and stimuli-responsive materials (e.g., temperature and pH-responsive hydrogels) can be designed to release payload in response to environmental or externally applied cues (Kang Derwent et al. (2008) Trans Am Ophthalmol Soc. 106:206-214).

[0313] In some embodiments, the MTEMs or engineered meganucleases described herein, or DNA / mRNA encoding the MTEMs or engineered meganucleases described herein, are covalently or preferably non-covalently attached to nanoparticles or encapsulated within such nanoparticles using methods known in the art (Sharma et al. (2014) Biomed Res Int. 2014). Nanoparticles are nanoscale delivery systems with length scales of <1 μm, preferably <100 nm. Such nanoparticles can be designed with cores composed of metals, lipids, polymers, or biological macromolecules, and multiple copies of nuclease proteins, mRNA, or DNA can be attached to or encapsulated by the nanoparticle core. This increases the number of copies of protein / mRNA / DNA delivered to each cell, thus increasing intracellular expression of each MTEM or engineered meganuclease described herein to maximize the chances that the target recognition sequence will be cleaved. The surface of such nanoparticles may be further modified with polymers or lipids (e.g., chitosan, cationic polymers or cationic lipids) to form core-shell nanoparticles whose surfaces impart additional functionality for enhancing cellular delivery and uptake of payloads (Jian et al. (2012) Biomaterials. 33(30):7621-30). Nanoparticles may further be advantageously conjugated to targeting molecules to direct the nanoparticles to appropriate cell types and / or to increase the likelihood of cellular uptake. Examples of such targeting molecules include antibodies specific for cell surface receptors and natural ligands (or portions of natural ligands) of cell surface receptors.

[0314] In some embodiments, the MTEM or engineered meganuclease described herein, or the DNA / mRNA encoding the MTEM or engineered meganuclease described herein, is encapsulated in a liposome or complexed using a cationic lipid (e.g., LIPOFECTAMINE™, Life Technologies Corp., Carlsbad, CA; see Zuris et al. (2015) Nat Biotechnol. 33:73-80; Mishra et al. (2011) J Drug Deliv. 2011:863734). Liposome and lipoplex formulations can protect the payload from degradation, enhance accumulation and retention at the target site, and promote cellular uptake and delivery efficiency through fusion with and / or disruption of the cell membrane of the target cell.

[0315] In some embodiments, the MTEM or engineered meganuclease described herein, or the DNA / mRNA encoding the MTEM or engineered meganuclease described herein, is encapsulated within a polymer scaffold (e.g., PLGA) or complexed using a cationic polymer (e.g., PEI, PLL) (Tamboli et al. (2011) Ther Deliv. 2(4):523-536). Polymeric carriers can be designed to provide tunable drug release rates by controlling polymer erosion and drug diffusion, and high drug encapsulation efficiency can provide protection of the therapeutic payload until intracellular delivery to the desired target cell population.

[0316] In some embodiments, the MTEM or engineered meganucleases described herein, or DNA / mRNA encoding the nMTEM or engineered meganucleases described herein, are combined with amphiphilic molecules that self-assemble into micelles (Tong et al. (2007) J Gene Med. 9(11):956-66). The polymeric micelles may include a micellar shell formed of a hydrophilic polymer (e.g., polyethylene glycol) that can prevent aggregation, mask charge interactions, and reduce non-specific interactions.

[0317] In some embodiments, the MTEM or engineered meganuclease described herein, or the DNA / mRNA encoding the MTEM or engineered meganuclease described herein, is formulated into an emulsion or nanoemulsion (i.e., having an average particle size of <1 nm) for administration and / or delivery to target cells. The term "emulsion" refers to any oil-in-water, water-in-oil, water-in-oil-in-water, or oil-in-water-in-oil dispersion or droplets, including, but not limited to, lipid structures that can form when a water-immiscible phase is mixed with an aqueous phase as a result of hydrophobic forces that direct non-polar residues (e.g., long hydrocarbon chains) away from the water and polar head groups toward the water. These other lipid structures include, but are not limited to, mono-, paucilamellar, and multilamellar lipid vesicles, micelles, and lamellar phases. Emulsions are composed of an aqueous phase and a lipophilic phase (typically containing oil and organic solvents). Emulsions also often contain one or more surfactants. Nanoemulsion formulations are well known, as described, for example, in U.S. Pat. Nos. 6,015,832, 6,506,803, 6,635,676, 6,559,189, and 7,767,216, each of which is incorporated by reference herein in its entirety.

[0318] In some embodiments, the MTEM or engineered meganucleases described herein, or the DNA / mRNA encoding the MTEM or engineered meganucleases described herein, are covalently or non-covalently linked to multifunctional polymer conjugates, DNA dendrimers, and polymer dendrimers (Mastorakos et al. (2015) Nanoscale. 7(9):3845-56; Cheng et al. (2008) J Pharm Sci. 97(1):123-43). Dendrimer generation allows for control of payload capacity and size, and can provide high payload capacity. Additionally, the presentation of multiple surface groups can be utilized to improve stability, reduce non-specific interactions, and enhance cell-specific targeting and drug release.

[0319] In some embodiments, a polynucleotide having a nucleic acid sequence encoding MTEM is introduced into a cell using a recombinant virus. Such recombinant viruses are known in the art and include recombinant retroviruses, recombinant lentiviruses, recombinant adenoviruses and recombinant AAVs (Vannucci et al. (2013 New York, 2013). Microbiol. 36:1-22). Recombinant AAV useful in the present invention can have any capsid or serotype that allows for viral transduction into the target cell type and expression of MTEM by the target cell. For example, in some embodiments, the recombinant AAV has a serotype of AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAVHSC. In some embodiments, the recombinant virus is injected directly into the target tissue. In alternative embodiments, the recombinant virus is delivered systemically via the circulatory system. It is known in the art that different AAVs tend to localize to different tissues, and appropriate AAV capsids / serotypes can be selected for preferential delivery to specific tissues. In some embodiments, the AAV serotype is AAV9. AAV can also be self-complementary, such that it does not require second strand DNA synthesis in the host cell (McCarty et al. (2001) Gene Ther. 8:1248-54). Nucleic acids delivered by recombinant AAV can contain left (5') and right (3') inverted terminal repeats.

[0320] In one embodiment, the recombinant virus used to deliver the polynucleotide having a nucleic acid sequence encoding the MTEM or engineered meganuclease described herein is a self-limiting recombinant virus. The self-limiting recombinant virus can have a limited duration in a cell or organism due to the presence of a recognition sequence for the engineered meganuclease in the vector. Thus, the self-limiting recombinant virus can be engineered to encode a promoter, the MTEM or engineered meganuclease described herein, and a meganuclease recognition site in the ITR. The self-limiting recombinant virus delivers the meganuclease gene to a cell, tissue, or organism so that the MTEM or engineered meganuclease described herein can be expressed and cleave the genome of the cell at the endogenous recognition sequence in the genome. The delivered meganuclease also finds its target site within the self-limiting recombinant virus itself and cleaves the vector at this target site. Once cleaved, the 5' and 3' ends of the viral genome are exposed and degraded by the exonuclease, thus killing the virus and stopping the production of the MTEM or engineered meganuclease described herein.

[0321] When polynucleotides having nucleic acid sequences encoding MTEMs or engineered meganucleases described herein are delivered in DNA form (e.g., plasmids) and / or via viral vectors (e.g., AAV), they must be operably linked to a promoter. In some embodiments, this may be a viral promoter, such as an endogenous promoter from a viral vector (e.g., LTR of a lentiviral vector), or a constitutive or tissue-specific promoter described elsewhere herein. In certain embodiments, polynucleotides having nucleic acid sequences encoding MTEMs or engineered meganucleases described herein are operably linked to a promoter that preferentially drives gene expression in target cells, such as neurons, glial cells (e.g., astrocytes or oligodendrocytes), muscle cells (e.g., skeletal muscle cells, cardiac muscle cells, or smooth muscle cells). In some embodiments, the target cells are muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or said population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells.

[0322] In some embodiments, methods are provided herein for producing a genetically modified eukaryotic cell or a genetically modified eukaryotic cell population by introducing a polynucleotide comprising a nucleic acid sequence encoding a polynucleotide of the present disclosure, for example an engineered meganuclease as described herein above, into a eukaryotic cell or a eukaryotic cell population. Upon expression in a eukaryotic cell or a eukaryotic cell population, the engineered meganuclease localizes to mitochondria, binds to a recognition sequence in the mitochondrial genome, and generates a cleavage site. The cleavage site generated by the engineered meganuclease can be repaired by an NHEJ repair pathway, which can result in the insertion or deletion of nucleic acid at the cleavage site. Additionally or alternatively, the cleavage site generated by the engineered meganuclease in the mitochondrial genome of a eukaryotic cell or a eukaryotic cell population can be repaired by alternative non-homologous end joining (Alt-NHEJ) or microhomology-mediated end joining (MMEJ). NHEJ or Alt-NHEJ / MMEJ can result in the insertion and / or deletion of nucleic acid at the cleavage site. In particular, NHEJ or Alt-NHEJ / MMEJ may be performed by adding 1 to 1000 (e.g., 1 to 10, 10 to 100, 100 to 200, 200 to 300, 300 to 400, 400 to 500, 500 to 600, 600 to 700, 700 to 80, 800 to 900, or 900 to 1000) nucleotides to the cleavage site, for example about 1, 5, 10, 15, 20, 25, 50, 75, 100, 125, This may result in insertions and / or deletions of 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975 or 1000 nucleotides. In some embodiments, the mitochondrial genome can be degraded in a genetically modified eukaryotic cell described herein or a population of genetically modified eukaryotic cells described herein.In some such embodiments, the percentage of the mitochondrial genome that contains the recognition sequence may be reduced by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, or by about 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100% or more compared to control cells.

[0323] In certain embodiments, mutant mitochondrial genomes containing the recognition sequence of SEQ ID NO:1 are degraded. By degrading mutant mitochondrial genomes having the recognition sequence of SEQ ID NO:1, the overall ratio of wild type to mutant mitochondrial genomes is increased after administration or expression of the MTEM or engineered meganuclease described herein. In some embodiments, the ratio of wild type to mutant mitochondrial genomes in a single genetically modified eukaryotic cell or a population of genetically modified eukaryotic cells described herein is about 5:95, about 10:90, about 15:85, about 20:80, about 25:75, about 30:70, about 35:65, about 40:60, about 45:55, about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:40, about 85:50, about 90:50, about 100:50, about 150:50, about 150:60, about 150:70, about 150:80, about 150:80, about 150:9 ... :20, about 85:15, about 90:10, about 95:5, about 20:1, about 50:1, about 100:1, about 150:1, about 200:1, about 250:1, about 300:1, about 350:1, about 400:1, about 450:1, about 500:1, about 550:1, about 600:1, about 650:1, about 700:1, about 750:1, about 800:1, about 850:1, about 900:1, about 950:1, about 1000:1 or more.

[0324] In certain embodiments, the percentage of wild-type genome in a single genetically modified eukaryotic cell or a population of genetically modified eukaryotic cells described herein may increase as mutant mitochondrial genomes comprising SEQ ID NO:1 are recognized, cleaved, and degraded by the MTEMs or engineered meganucleases described herein. The percentage of wild-type mitochondrial genome in a genetically modified eukaryotic cell or a population of genetically modified cells described herein may be about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more of the total mitochondrial genome in the genetically modified eukaryotic cell or population of genetically modified cells when compared to a eukaryotic cell or population of eukaryotic cells that does not express the MTEMs or engineered meganucleases described herein. Similarly, the percentage of mutant mitochondrial genomes containing the recognition sequence of SEQ ID NO:1 in a genetically modified eukaryotic cell or genetically modified cell population may be reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more when compared to a eukaryotic cell or eukaryotic cell population that does not express the MTEM or genetically engineered meganuclease described herein.

[0325] In some embodiments, mitochondrial respiration in a genetically modified eukaryotic cell or population of genetically modified eukaryotic cells described herein may be increased by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, or more when compared to a eukaryotic cell that does not express a MTEM or engineered meganuclease described herein. Mitochondrial respiration in a genetically modified eukaryotic cell or population of genetically modified eukaryotic cells described herein may be increased by about 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100%, or more when compared to a eukaryotic cell or population of eukaryotic cells that does not express a MTEM or engineered meganuclease described herein.

[0326] In certain cases, the recognition sequence is within a region of the mitochondrial genome associated with mitochondrial disorders.For example, the recognition sequence may be within a region of the mitochondrial genome associated with mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS).Mutations in the mtDNA gene MT-TL1 are associated with MELAS in about 80% of cases.More than 80% of MELAS cases are caused by the A3243G point mutation in tRNA-Leu.Mutations in MT-TQ, MT-TH, MT-TK, MT-TS1, MT-ND1, MT-ND5, MT-ND6, and MT-TS2 are also associated with MELAS syndrome. Some cases of MELAS syndrome appear to arise as a result of de novo spontaneous mutations in mitochondrial genes and are not inherited (Sue et al., J Pediatr 134:696-700 (1999); Singh et al., Indian J Pediatr 66:621-625 (1999); Deschauer et al., Neuromuscul Disord, 9:305-307 (1999)). MELAS begins in childhood, usually between 2 and 15 years of age, and primarily affects the nervous system and muscles. The most common early symptoms are seizures, recurrent headaches, loss of appetite and recurrent vomiting. Stroke-like episodes (hemiplegia) with temporary muscle weakness on one side of the body can also occur, which can result in altered consciousness, vision and hearing loss, loss of motor skills and intellectual disability. MELAS is caused by mutations in mtDNA.

[0327] Both normal and mutant mtDNA may be present in the same cell, a situation known as heteroplasmy. The number of defective mitochondria may be greater than the number of normal mitochondria. Symptoms may not appear in a given generation until the mutation affects a significant proportion of the mtDNA. The uneven distribution of normal and mutant mtDNA in different tissues may affect different organs in members of the same family. This may result in a variety of symptoms in affected family members.

[0328] In certain embodiments, the recognition sequence described herein in the mitochondrial genome of a eukaryotic cell or population of eukaryotic cells is located at nucleotides 3000-3500 of the mitochondrial genome. In certain embodiments, the MTEM or engineered meganuclease described herein targets the A3243G mutation of the mitochondrial genome. As used herein, "MELAS mutation" refers to the A3243G mutation of the mitochondrial genome, where the A of the wild type genome is replaced with a G in the mutant mitochondrial genome at position 3243. In certain embodiments, the recognition sequence of SEQ ID NO: 1 is located only on the mutant mitochondrial genome. Upon expression in a genetically modified eukaryotic cell or population of genetically modified eukaryotic cells, the MTEM or engineered meganuclease can localize to mitochondria, bind to the recognition sequence in the mitochondrial genome, and generate a cleavage site. Thus, by targeting the recognition sequence located only on the mutant genome, the genome can be cleaved and subsequently degraded. This specific degradation of the mutant mitochondrial genome can be used to help treat or alleviate the symptoms of MELAS.

[0329] Thus, provided herein is a method for degrading mutant mitochondrial genomes in a target cell or population of target cells by delivering a nucleic acid sequence encoding or a polynucleotide comprising a MTEM or engineered meganuclease as described herein to the target cell or population. In certain embodiments, the target cell or population of target cells comprises a mutant mitochondrial genome having a MELAS mutation (i.e., A3243G mutation), and the MTEM or engineered meganuclease recognizes and cleaves the recognition sequence of SEQ ID NO: 1. The target cell or population of target cells may be in a mammalian subject, such as a human subject. In some embodiments, the target cells are muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or said population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells.

[0330] Methods for treating a condition associated with MELAS disorder in a subject are described herein. Such methods include administering to a subject a therapeutically effective amount of a polynucleotide having a nucleic acid sequence encoding a MTEM or engineered meganuclease, or a therapeutically effective amount of a MTEM or engineered meganuclease described herein, wherein the MTEM or engineered meganuclease creates a cleavage site for the recognition sequence of SEQ ID NO: 1 in a mutant mitochondrial genome having a MELAS mutation. The cleavage site created in the mutant mitochondrial genome can result in the degradation of the mutant mitochondrial genome. In certain embodiments, treating includes reducing or alleviating at least one symptom of MELAS. Symptoms of MELAS include, but are not limited to, seizures, recurrent headaches, loss of appetite, recurrent vomiting, stroke-like episodes (hemiplegia) with temporary muscle weakness on one side of the body, altered consciousness, vision and hearing loss, loss of motor skills, and intellectual disability. In certain embodiments, the methods for treating a condition associated with MELAS in a subject include administering a pharmaceutical composition described herein.

[0331] In some embodiments, a subject receives about 1x10 of a nucleic acid encoding a MTEM or an engineered meganuclease. 10 gc / kg ~ approx. 1x10 14 gc / kg (e.g., 1x10 10 gc / kg, 1x10 11 gc / kg, 1x10 12 gc / kg, 1x10 13 gc / kg, or 1x10 14 In some embodiments, the subject is administered a pharmaceutical composition described herein at a dose of at least about 1×10 6 of a nucleic acid encoding a MTEM or an engineered meganuclease. 10 gc / kg, at least about 1 × 10 11 gc / kg, at least about 1 × 10 12 gc / kg, at least about 1 × 10 13 gc / kg, or at least about 1 × 10 14In some embodiments, the subject is administered about 1×10 6 of a nucleic acid encoding a MTEM or an engineered meganuclease. 10 gc / kg ~ approx. 1×10 11 gc / kg, approximately 1×10 11 gc / kg ~ approx. 1×10 12 gc / kg, approximately 1×10 12 gc / kg ~ approx. 1×10 13 gc / kg, or approximately 1 × 10 13 gc / kg ~ approx. 1×10 14 The pharmaceutical composition is administered at a dose of about 1x10 of a nucleic acid encoding a MTEM or engineered meganuclease. 12 gc / kg ~ approx. 9x10 13 gc / kg (e.g., about 1x10 12 gc / kg, approx. 2x10 12 gc / kg, approx. 3x10 12 gc / kg, approx. 4x10 12 gc / kg, approx. 5x10 12 gc / kg, approx. 6x10 12 gc / kg, approx. 7x10 12 gc / kg, approx. 8x10 12 gc / kg, approx. 9x10 12 gc / kg, approx. 1x10 13 gc / kg, approx. 2x10 13 gc / kg, approx. 3x10 13 gc / kg, approx. 4x10 13 gc / kg, approx. 5x10 13 gc / kg, approx. 6x10 13 gc / kg, approx. 7x10 13 gc / kg, approx. 8x10 13 gc / kg, or approximately 9x10 13 The pharmaceutical composition is administered at a dose of 100 mg / kg (100 mg / kg).

[0332] In some embodiments, the subject is administered a lipid nanoparticle formulation at a dose of about 0.1 mg / kg to about 3 mg / kg of mRNA encoding MTEM or engineered meganuclease. In some embodiments, the subject is administered a lipid nanoparticle formulation at a dose of at least about 0.1 mg / kg, at least about 0.25 mg / kg, at least about 0.5 mg / kg, at least about 0.75 mg / kg, at least about 1.0 mg / kg, at least about 1.5 mg / kg, at least about 2.0 mg / kg, at least about 2.5 mg / kg, or at least about 3.0 mg / kg of mRNA encoding MTEM or engineered meganuclease. In some embodiments, a subject is administered a lipid nanoparticle formulation at a dose of about 0.1 mg / kg to about 0.25 mg / kg, about 0.25 mg / kg to about 0.5 mg / kg, about 0.5 mg / kg to about 0.75 mg / kg, about 0.75 mg / kg to about 1.0 mg / kg, about 1.0 mg / kg to about 1.5 mg / kg, about 1.5 mg / kg to about 2.0 mg / kg, about 2.0 mg / kg to about 2.5 mg / kg, or about 2.5 mg / kg to about 3.0 mg / kg of mRNA encoding the MTEM or engineered meganuclease.

[0333] Target tissues for delivery of the MTEMs or engineered meganucleases described herein, or nucleic acids encoding the MTEMs or engineered meganucleases described herein, include, but are not limited to, muscle tissue, brain tissue, central nervous system tissue, pancreatic tissue, or eye / retina tissue. In some embodiments, the target cells for delivery are muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, eye cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of said target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, eye cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or said population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells.

[0334] In various embodiments of the methods described herein, one or more MTEMs or engineered meganucleases described herein, polynucleotides encoding such MTEMs or engineered meganucleases described herein, or recombinant viruses comprising one or more polynucleotides encoding such MTEMs or engineered meganucleases described herein, as described herein, can be administered via any suitable administration route known in the art. Thus, one or more MTEMs or engineered meganucleases described herein, polynucleotides encoding such MTEMs or engineered meganucleases described herein, or recombinant viruses comprising one or more polynucleotides encoding such MTEMs or engineered meganucleases described herein, as described herein, can be administered via administration routes including intravenous, intramuscular, intraperitoneal, subcutaneous, intrahepatic, transmucosal, transdermal, intraarterial, and sublingual. In some embodiments, the MTEMs or engineered meganucleases described herein, or mRNA or DNA vector MTEMs or engineered meganucleases described herein, are delivered to target cells (e.g., nerve cells, muscle cells, pancreatic cells, ocular cells, etc.) via direct injection into the target tissue. In some embodiments, the eukaryotic cell is a stem cell, a CD34+HSC, a muscle cell, a skeletal muscle cell, a myotube cell, a muscle satellite cell, a neuron, an astrocyte, a microglial cell, an eye cell, a retinal cell, a retinal ganglion cell, a retinal pigment epithelial cell, a pancreatic cell, a pancreatic beta cell, a kidney cell, a bone marrow cell, or an ear hair cell. In some embodiments, the condition is a condition of the muscle, the brain, the central nervous system, the pancreas, or the retina. In some embodiments, the condition is mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS), progressive external ophthalmoplegia, maternally inherited diabetes, migraine, or ocular myopathy.

[0335] Other suitable routes of administration of the MTEMs or engineered meganucleases described herein, polynucleotides encoding such MTEMs or engineered meganucleases described herein, or recombinant viruses comprising one or more polynucleotides encoding such engineered nucleases, can be readily determined by the treating physician as necessary.

[0336] In some embodiments, a therapeutically effective amount of the MTEM or engineered meganuclease described herein is administered to a subject in need thereof. If necessary, the dosage or frequency of administration of the MTEM or engineered meganuclease may be adjusted over the course of treatment based on the administering physician's judgment. The appropriate dose depends on the details of any AAV selected (e.g., serotype, etc.), the route of administration, the subject being treated (i.e., the subject's age, weight, sex, and general condition), and the mode of administration, among other factors. Thus, the appropriate dosage may vary from patient to patient. The appropriate effective amount can be readily determined by one of skill in the art. The dosage treatment may be a single dose schedule or a multiple dose schedule. Furthermore, a subject may be administered as many doses as appropriate. One of skill in the art can readily determine the appropriate number of doses. The dosage may need to be adjusted to take into account alternative routes of administration or to balance the therapeutic benefit against any side effects.

[0337] The exogenous nucleic acid molecule described herein can be introduced into cells and / or delivered to a subject by any of the means previously discussed. In certain embodiments, the exogenous nucleic acid molecule is introduced by a recombinant virus, such as a lentivirus, a retrovirus, an adenovirus, or a recombinant AAV. The recombinant AAV useful for introducing the exogenous nucleic acid molecule can have any serotype that allows the virus to transduce cells and insert the exogenous nucleic acid molecule sequence into the cell genome, including the serotypes / capsids previously described herein. The recombinant AAV can also be self-complementary so as not to require second strand DNA synthesis in the host cell. The exogenous nucleic acid molecule introduced using the recombinant AAV can be flanked by 5' (left) and 3' (right) inverted terminal repeats.

[0338] In another specific embodiment, exogenous nucleic acid molecules can be introduced into cells using single-stranded DNA templates. Single-stranded DNA can include exogenous nucleic acid molecules, and in certain embodiments, can include 5' and 3' homology arms to facilitate the insertion of nucleic acid sequences into nuclease cleavage sites by homologous recombination. Single-stranded DNA can further include a 5' AAV inverted terminal repeat (ITR) sequence 5' upstream of the 5' homology arm, and a 3' AAV ITR sequence 3' downstream of the 3' homology arm.

[0339] In another specific embodiment, a polynucleotide comprising a nucleic acid sequence encoding the MTEM or engineered meganuclease described herein and / or the exogenous nucleic acid molecule described herein can be introduced into a cell by transfection with a linearized DNA template. Plasmid DNA encoding the MTEM or engineered meganuclease described herein and / or the exogenous nucleic acid molecule can be digested with one or more restriction enzymes, for example, so that the circular plasmid DNA is linearized prior to transfection into a cell.

[0340] When delivered to a cell, the exogenous nucleic acid described herein can be operably linked to any promoter suitable for expressing the encoded polypeptide in the cell, including the mammalian promoter and inducible promoter previously discussed.The exogenous nucleic acid described herein can also be operably linked to a synthetic promoter.Synthetic promoters can include, but are not limited to, JeT promoter (WO2002 / 012514).

[0341] 2.6 Variants The present invention encompasses variants of the polypeptide and polynucleotide sequences described herein.

[0342] As used herein, "variant" is intended to mean a substantially similar sequence. A "variant" polypeptide is intended to mean a polypeptide derived from a "natural" polypeptide by deletion or addition of one or more amino acids at one or more internal sites of the native protein, and / or substitution of one or more amino acids at one or more sites of the native polypeptide. As used herein, a "natural" polynucleotide or polypeptide includes the parent sequence from which the variant is derived. Variant polypeptides encompassed by embodiments are biologically active. That is, they retain the desired biological activity of the native protein, e.g., the ability to bind and cleave a recognition sequence found in mtDNA (e.g., human mtDNA), such as the MIT 25-26 recognition sequence (SEQ ID NO:1). Such variants may result, for example, from human manipulation. In some embodiments, a biologically active variant of a native polypeptide of the embodiments (e.g., any one of SEQ ID NOs:3-12), or a biologically active variant of a recognition half-site binding subunit described herein, has at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the amino acid sequence of a native polypeptide, native subunit, native HVR1, or native HVR2 as determined by sequence alignment programs and parameters described elsewhere herein. A biologically active variant of a polypeptide or subunit of the embodiments may differ from the polypeptide or subunit by as few as about 1-40 amino acid residues, as few as about 1-20, as few as about 1-10, as few as about 5, as few as 4, 3, 2, or even 1 amino acid residue.

[0343] The polypeptide of the embodiment can be modified in various ways, including amino acid substitution, deletion, truncation and insertion. Methods for such manipulation are generally known in the art. For example, amino acid sequence variants can be prepared by mutations in DNA. Methods for mutagenesis and polynucleotide modification are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; U.S. Patent No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and references cited therein. Guidance regarding suitable amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC), which is incorporated herein by reference. Conservative substitutions, such as exchanging one amino acid for another with similar properties, may be optimal.

[0344] In some embodiments, the engineered meganucleases described herein may comprise variants of the HVR1 and HVR2 regions described herein. The parent HVR regions may, for example, comprise residues 24-79 or residues 215-270 of the exemplified engineered meganucleases. Thus, the variant HVRs may comprise amino acid sequences that have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity to the amino acid sequences corresponding to residues 24-79 or residues 215-270 of the exemplified engineered meganucleases herein, such that the variant HVR regions maintain the biological activity (i.e., binding to and cleavage of a recognition sequence) of the engineered meganuclease. Furthermore, in some embodiments described herein, the variant HVR1 region or variant HVR2 region may comprise residues that correspond to amino acid residues found at specific positions within the parent HVRs. In this context, "corresponding to" means that the amino acid residue in the variant HVR is the same amino acid residue (i.e., a separate and identical residue) that is present in the parent HVR sequence in the same relative position (i.e., with respect to the remaining amino acids in the parent sequence). By way of example, if a parent HVR sequence contains a serine residue at position 26, then a variant HVR that "contains a residue corresponding to" residue 26 also contains a serine at a position relative to (i.e., corresponding to) parent position 26.

[0345] In certain embodiments, the engineered meganucleases described herein comprise an HVR1 having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs:3-12.

[0346] In certain embodiments, the engineered meganucleases described herein comprise an HVR2 having 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs:3-12.

[0347] A substantial number of amino acid modifications to the DNA recognition domain of wild-type I-CreI meganuclease have been previously identified (e.g., U.S. Pat. No. 8,021,867), which, alone or in combination, result in engineered meganucleases with altered specificity at individual bases within the DNA recognition sequence half-sites, such that the resulting rationally designed meganuclease has a different half-site specificity than the wild-type enzyme. Table 2 provides potential substitutions that can be made in engineered meganuclease monomers or subunits to enhance specificity based on the base present at each half-site position (-1 to -9) of the recognition half-site. Such substitutions are incorporated into the variants of meganucleases described herein.

[0348] [Table 2]

[0349] Bolded items are wild-type contact residues and do not constitute "modifications" as used herein. An asterisk indicates that the residue contacts a base on the antisense strand.

[0350] Certain modifications can be made in engineered meganuclease monomers or subunits to modulate DNA binding affinity and / or activity. For example, engineered meganuclease monomers or subunits described herein can contain G, S, or A at the residue corresponding to position 19 of I-CreI or any one of SEQ ID NOs: 3-12 (WO2009001159), Y, R, K, or D at the residue corresponding to position 66 of I-CreI or any one of SEQ ID NOs: 3-12, and / or E, Q, or K at the residue corresponding to position 80 of I-CreI or any one of SEQ ID NOs: 3-12 (US Pat. No. 8,021,867).

[0351] In the case of polynucleotides, "variants" include deletions and / or additions of one or more nucleotides at one or more sites within a natural polynucleotide. Those skilled in the art will recognize that variants of the nucleic acids of the embodiments are constructed such that the open reading frame is maintained. In the case of polynucleotides, conservative variants include sequences that, due to the degeneracy of the genetic code, code for one of the amino acid sequences of the polypeptides of the embodiments. Variant polynucleotides include synthetically derived polynucleotides, such as those generated, for example, by using site-directed mutagenesis, but still code for engineered meganucleases or exogenous nucleic acid molecules or template nucleic acids of the embodiments. Generally, variants of a particular polynucleotide of the embodiments have at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to the particular polynucleotide as determined by sequence alignment programs and parameters described elsewhere herein. Variants of a particular polynucleotide of the embodiments (i.e., a reference polynucleotide) can also be assessed by comparing the percent sequence identity between the polypeptides encoded by the variant polynucleotide and the reference polynucleotide.

[0352] The deletions, insertions and substitutions of the protein sequences encompassed herein are not expected to cause fundamental changes in the characteristics of the polypeptide. However, if it is difficult to predict the exact effect of the substitution, deletion or insertion before doing so, those skilled in the art will understand that the effect can be evaluated by screening the polypeptide for its ability to preferentially bind and cleave a recognition sequence found in human mtDNA, such as the MIT 25-26 recognition sequence (SEQ ID NO: 1).

[0353] Table 3 is a summary of the sequences disclosed herein.

[0354] [Table 3] TIFF2024514939000004.tif255157TIFF2024514939000005.tif255157TIFF20245149390 00006.tif254155TIFF2024514939000007.tif254151TIFF2024514939000008.tif253156 TIFF2024514939000009.tif255160TIFF2024514939000010.tif255157TIFF20245149390 00011.tif255149TIFF2024514939000012.tif255151TIFF2024514939000013.tif102158 EXAMPLES

[0355] The present disclosure is further illustrated by the following examples, which should not be construed as limiting.Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein.Such equivalents are intended to be encompassed within the scope of the claims that follow the following examples.

[0356] Example 1. Reporter assay for MIT 25-26 nuclease activity The objective of this experiment was to determine whether various MIT 25-26 meganucleases could bind and cleave the human MIT 25-26 recognition sequence in mammalian cells and to determine whether various MIT 25-26 meganucleases could discriminate between wild-type alleles. To do this, the engineered meganucleases were evaluated using a previously described CHO cell reporter assay (see WO 2012 / 167192). To perform the assay, two CHO cell reporter strains were produced that had a non-functional green fluorescent protein (GFP) gene expression cassette integrated into the genome of the cells. The GFP gene in each cell line contains a direct sequence duplication separated by a pair of recognition sequences such that intracellular cleavage of either recognition sequence by the engineered meganuclease stimulates a homologous recombination event resulting in a functional GFP gene.

[0357] In the CHO reporter cell lines developed for this study, two recognition sequences were inserted into the GFP gene. One recognition sequence was for the human MIT 25-26 recognition sequence (either a mutant sequence differing by only one base or a wild-type sequence). Cell line number 1 (mutant) contained the mutant allele and cell line number 2 (wild-type) contained the wild-type allele. The second recognition sequence inserted into both strains was the CHO-23 / 24 recognition sequence, which is recognized and cleaved by a control engineered meganuclease called "CHO-23 / 24". The CHO-23 / 24 recognition sequence is used as a positive control and a standard activity measure.

[0358] The CHO reporter cells detailed above were transfected with mRNAs encoding various MIT 25-26 nucleases. A control sample of CHO reporter cells was transfected with mRNAs encoding CHO-23 / 24 meganucleases. In each assay, 5e4 CHO reporter cells were transfected with 2.5ng (low dose) of mRNA in 96-well plates using LIPOFECTAMINE® MESSENGERMAX (ThermoFisher) according to the manufacturer's instructions. Transfected CHO cells were evaluated by image cytometry 2 days after transfection to determine the percentage of GFP-positive cells compared to untransfected negative controls. Cells transfected with low doses of mRNA in mutant reporter cell lines were also evaluated by image cytometry on days 5 and 7. The data obtained for each time point was normalized to the % GFP positive cells observed using CHO-23 / 24 meganuclease to determine an "activity score," and the normalized data from the earliest time point was subtracted from the latest time point to determine a "toxicity score." The activity and toxicity scores were then added together to determine an "activity index," which was then normalized to the activity index of CHO-23 / 24 meganuclease to compare data between cell lines ("normalized activity index"). This was done for both wild-type and mutant cell lines to determine the specificity of the nuclease for the mutant sequence.

[0359] After nuclease optimization, the same reporter cell lines were transfected with the MIT 25-26 engineered meganuclease. The same transfection and evaluation protocol was followed with the following exceptions: the mutant cell line was transfected with 90 ng (high dose) or 2.5 ng (low dose) of mRNA, and the wild-type cell line was transfected with only the 90 ng dose.

[0360] The various MIT 25-26 engineered meganucleases tested were able to bind and cleave the MIT 25-26 recognition sequence in the mutant reporter strains (Figure 1). Furthermore, none of the engineered meganucleases were able to bind and cleave the wild-type reporter strain, indicating a high level of specificity for the mutant sequence. Furthermore, the optimized MIT 25-26 nuclease (MIT 25-26L.35) shows further discrimination against the wild-type sequence, especially at higher mRNA doses (Figure 2).

[0361] These studies demonstrated that the engineered MIT 25-26 meganucleases described herein can efficiently and selectively bind and cleave their human recognition sequences (eg, MIT 25-26) inside cells.

[0362] Example 2. Evaluation of MIT 25-26 meganuclease in FlpIn CHO cell line The aim of this experiment was to evaluate several MIT 25-26 meganucleases for (1) their activity against mutant target sites and (2) their specificity against the corresponding wild-type sequence in an in vitro model. This was performed using two FlpIn CHO cell lines that contain a portion of the human mitochondrial genome integrated on the nuclear chromosome. The integrated sequence contains either a wild-type or a mutant MIT 25-26 binding site, as well as the surrounding mtDNA sequence. Since the aim is to generate engineered meganucleases that can cleave mutant sequences with high efficiency without cleaving wild-type sequences, the mutant and wild-type binding sites differ by only one nucleotide, thus meganuclease specificity is of paramount importance. Specificity and potency were assessed by droplet digital PCR (ddPCR) by calculating insertion / deletion (indel) formation at each site.

[0363] The engineered meganucleases compared in the experiment shown in Figure 3 were: MIT 25-26x.29, MIT 25-26x.37, MIT 25-26x.48, MIT 25-26x.73, and MIT 25-26x.91. The engineered meganucleases compared in the experiment shown in Figure 4 were MIT 25-26x.91 and MIT 25-26L.35 meganucleases.

[0364] FlpIn CHO lines were generated using ThermoFisher Scientific's Flp-In™ system. The integration cassettes contained either the MIT 25-26 mutant or wild-type sequences and surrounding mtDNA sequences. To compare the specificity and potency of the various MIT 25-26 meganucleases, 6e5 FlpIn CHO cells were nucleofected using a Lonza 4D-Nucleofector™ (SF buffer, condition EN-138) with either 500ng or 5ng of MIT 25-26 meganuclease mRNA dose. Cells were harvested 2 days after nucleofection for gDNA extraction and assessed for transfection efficiency using a Beckman Coulter CytoFlex S cytometer. Transfection efficiency was greater than 95% for both cell lines. gDNA was isolated using the Macherey Nagel NucleoSpin Blood QuickPure kit.

[0365] Droplet digital PCR (ddPCR) was utilized to determine the indel frequency at both the MIT 25-26 mutant and wild-type sites using P1 / P2, F1 and R1 to generate amplicons surrounding the binding site, and P3, F2, R2 to generate a reference amplicon that acts as a genomic counter. The ratio of the two amplicons should be equal in the untreated population and reduced relative to indel formation at the binding site in treated samples. Amplifications were multiplexed in 24 μL reactions containing 1× ddPCR Supermix for Probes (no dUTP, BioRad), 250 nM of each probe, 900 nM of each primer, 20 U / μL Kpn-I HF (NEB) and 150 ng of cellular gDNA. Droplets were generated using a QX100 droplet generator (BioRad). Cycling conditions were as follows: 1 cycle of 95° C. (2° C. / s ramp) for 10 min, 45 cycles of 94° C. (2° C. / s ramp) for 10 s, 59.2° C. (2° C. / s ramp) for 30 s, 72° C. (0.2° C. / s ramp) for 1 min 30 s, 1 cycle of 98° C. for 10 min, hold at 4° C. Droplets were analyzed using a QX200 droplet reader (BioRad) and data were acquired and analyzed using QuantaSoft analysis software (BioRad).

[0366] P1 (mutant allele): TGGCAGGGCCCGGT (SEQ ID NO: 63) P2 (wild type allele): ACCGGGCTCTGCCAT (SEQ ID NO: 72) F1: CCCAAGAACAGGGTTTGTTAAG (SEQ ID NO: 64) R1: GGAATGCCATTGCGATTAG (SEQ ID NO: 65) P3: AGCAGTTCTACCGTACAACCCTAACA (SEQ ID NO: 66) F2: GGCAGTTGAGGTGGATTA (SEQ ID NO: 67) R2: GGAATGCGGTAGTTAGG (SEQ ID NO: 68)

[0367] Engineered meganucleases were designed against the MIT 25-26 mutant sequence and evaluated for indel formation in both mutant and wild-type sequences at two mRNA doses. All five of the engineered meganucleases tested showed activity at the wild-type site at very high mRNA doses (500 ng) (Figure 3). MIT 25-26x.91 produced the fewest wild-type indels at 20%, while MIT 25-26x.48 produced the most wild-type indels at 44%. With regard to mutant recognition site cleavage, both MIT 25-26x.29 and MIT 25-26x.37 were highly active at low mRNA doses (5 ng), both producing 74% indels. From the set evaluated here, MIT 25-26x.91 appears to be the most specific.

[0368] Optimized meganucleases were designed against the MIT 25-26 mutant sequence and evaluated for indel formation in both mutant and wild-type sequences along with MIT 25-26x.91 at two mRNA doses. Efficacy against the mutant sequence appeared relatively unchanged between MIT 25-26x.91 and MIT 25-26L.35, while specificity against the wild-type sequence was significantly improved with MIT 25-26L.35. MIT 25-26x.91 showed 16% wild-type indels with 500 ng of MIT 25-26x.91 mRNA, whereas MIT 25-26L.35 showed only 2% indels (Figure 4).

[0369] Taken together, these data show that a panel of MIT 25-26 meganucleases is highly active and specific for mutant MIT 25-26 sites. Moreover, they can be optimized to reduce residual off-target (wild-type) editing.

[0370] Example 3: Mitochondrial localization The goal of this experiment was to visualize engineered meganuclease localization when the nuclear localization signal (NLS) on the protein was replaced with a mitochondrial transit peptide (MTP).

[0371] 6e5 MRC-5 cells were nucleofected with 600ng of engineered meganuclease mRNA using Lonza 4D-Nucleofector™ (SE buffer, condition CM-150). Two engineered meganuclease constructs were compared: one with an NLS and one with an MTP, both at the N-terminus of the protein. 24 hours after nucleofection, cells were stained with 50nM MitoTracker™ Deep Red FM (ThermoFisher Scientific, M22426) for 30 minutes and then washed with PBS. Cells were then fixed with 4% PFA by HIER for 15 minutes and stained using DAPI and monoclonal engineered meganuclease antibody (V34 Hu). Cells were imaged using a Zeiss microscope using 20x Z-stack images.

[0372] When fused to a nuclear localization sequence, the engineered meganuclease staining appears diffuse throughout the cytoplasm and nucleus (Figure 5). However, when fused to a mitochondrial transit peptide, the engineered meganuclease staining appears punctate and overlaps with the MitoTracker staining (Figure 6). There appears to be no nuclear localization of the engineered meganuclease when bound to an MTP.

[0373] Upon replacement of the NLS with MTP, the engineered meganuclease efficiently localizes from the nucleus to the mitochondria.

[0374] Example 4: Nuclease activity using mitochondrial localization data The purpose of this experiment was to determine whether the mitochondrial targeted engineered meganuclease (MTEM) protein reaches the nucleus and causes double strand breaks (DSBs) after mRNA nucleofection. Although the staining and imaging data in Example 1 suggested that this should not have occurred, this experiment looked deeper at the molecular level to determine whether indels were being generated.

[0375] The engineered meganuclease used in this experiment was APC 11-12L.330, which has a nuclear targeting site (i.e., APC 11-12).

[0376] 6e5 MRC-5 cells were nucleofected with the same number of engineered meganuclease mRNA copies using Lonza 4D-Nucleofector™ (SE buffer, condition CM-150). Three engineered meganuclease constructs were compared: one with NLS, one without targeting sequence, and one with mitochondrial transit peptide (MTP). As these different constructs yield mRNAs of different lengths, the mRNA copy number remained consistent between transfections (5.8e11 copies). Cells were collected 2 days after nucleofection for gDNA extraction and assessed for transfection efficiency using a Beckman Coulter CytoFlex S cytometer. Transfection efficiency was greater than 95%. gDNA was isolated using Macherey Nagel NucleoSpin Blood QuickPure kit.

[0377] Digital droplet PCR (ddPCR) was utilized to determine the indel frequency at the APC 11-12 binding site using P1, F1 and R1 to generate amplicons surrounding the binding site, and P2, F2, R2 to generate a reference amplicon that acts as a genomic counter. The ratio of the two amplicons should be equal in the untreated population and reduced relative to indel formation at the binding site in treated samples. Amplifications were multiplexed in 24uL reactions containing 1x ddPCR Supermix for Probes (no dUTP, BioRad), 250nM of each probe, 900nM of each primer, 20U / uL Hind-III HF (NEB) and 120ng of cellular gDNA. Droplets were generated using a QX100 droplet generator (BioRad). Cycling conditions were as follows: 1 cycle of 95° C. (2° C. / s ramp) for 10 min, 45 cycles of 94° C. (2° C. / s ramp) for 10 s, 57.5° C. (2° C. / s ramp) for 30 s, 72° C. (2° C. / s ramp) for 1 min, 98° C. for 10 min, hold at 4° C. Droplets were analyzed using a QX200 droplet reader (BioRad), and data were acquired and analyzed using QuantaSoft analysis software (BioRad).

[0378] P1: AGCCCCGGGTACTCCTTGTT (SEQ ID NO: 49) F1: TTCCTTGCAGGAACAGAG (SEQ ID NO: 50) R1: CTGCTTGACCACCCATT (SEQ ID NO: 51) P2: CCAGCAGGCCAGGTACACC (SEQ ID NO: 52) F2: ACCGCCAAGGATGCAC (SEQ ID NO: 53) R2: GCGGGTGGGAATGGAG (SEQ ID NO: 54)

[0379] As shown in Figure 7, with the NLS fused to the N-terminus, APC 11-12L.330 is able to generate 59% indels at its intended (nuclear) target site. In the absence of any targeting sequence, it is able to generate 42% indels at its intended target site. MTP fused to the engineered meganuclease is still able to generate 23% indels at its intended target site.

[0380] Engineered meganucleases are small proteins that can diffuse in and out of the nucleus, leading to indel formation even in the absence of an NLS on the protein. This effect can be exacerbated by nucleofection of cells and permeabilization of the cell membrane, but can potentially be mitigated by the addition of a nuclear export signal (NES).

[0381] Example 5: Nuclease activity by addition of mitochondrial localization and nuclear export sequences The goal of this experiment was to determine whether the addition of a nuclear export signal (NES) to an engineered meganuclease would eliminate nuclear indels.

[0382] The NES used in Figure 8 was rationally designed based on data from Kosugi et al. 2008 Traffic 12:2053-62. The NES amino acid sequence fused to the C-terminus of the engineered meganuclease was LGAGLGALGL (SEQ ID NO: 47). The NES used in Figures 9 and 10 was taken from Minczuk et al. 2006 Proc Natl Acad Sci USA 103(52):19689-19694. The NES amino acid sequence fused to the C-terminus of the engineered meganuclease was VDEMTKKFGTLTIHDTEK (SEQ ID NO: 46).

[0383] The engineered meganuclease used in Figures 8 and 9 was APC 11-12L.330, which has a nuclear targeting site. The engineered meganuclease used in Figure 10 was MIT 25-26x.91, which has no endogenous nuclear targeting site. However, a mitochondrial sequence containing a binding site was introduced onto the nuclear chromosome of FlpIn 293 cells, and these are the cells evaluated in Figure 10 (site 0 is the nuclease binding site).

[0384] For experiments involving APC 11-12L.330, 6e5 MRC-5 cells were nucleofected with the same number of engineered meganuclease mRNA copies using a Lonza 4D-Nucleofector® (SE buffer, condition CM-150). In Figure 8, four meganuclease constructs were compared: one with an NLS, one without a targeting sequence, one with a mitochondrial transit peptide (MTP), and one with an MTP and an NES. In Figure 9, four engineered meganuclease constructs were compared: one with an NLS, one with an MTP, one with an MTP and an NES, and one with an MTP and an MVMp NS2 NES. The NLS and MTP were both fused to the N-terminus of their respective proteins, and the NES was fused to the C-terminus. Since these different constructs yield mRNAs of different lengths, the mRNA copy number was kept constant between transfections (5.8e11 copies for data in Figure 8 and 2.88e11 copies for data in Figure 9). Cells were harvested 2 days after nucleofection for gDNA extraction and assessed for transfection efficiency using a Beckman Coulter CytoFlex S cytometer. Transfection efficiency was greater than 95%. gDNA was isolated using the Macherey Nagel NucleoSpin Blood QuickPure kit.

[0385] Digital droplet PCR (ddPCR) was utilized to determine the indel frequency at the APC 11-12 binding site using P1, F1 and R1 to generate amplicons surrounding the binding site, and P2, F2, R2 to generate a reference amplicon that acts as a genomic counter. The ratio of the two amplicons should be equal in the untreated population and reduced relative to indel formation at the binding site in treated samples. Amplifications were multiplexed in 24 μL reactions containing 1× ddPCR Supermix for Probes (no dUTP, BioRad), 250 nM of each probe, 900 nM of each primer, 20 U / μL Hind-III HF (NEB) and 120 ng of cellular gDNA. Droplets were generated using a QX100 droplet generator (BioRad). Cycling conditions were as follows: 1 cycle of 95° C. (2° C. / s ramp) for 10 min, 45 cycles of 94° C. (2° C. / s ramp) for 10 s, 57.5° C. (2° C. / s ramp) for 30 s, 72° C. (2° C. / s ramp) for 1 min, 98° C. for 10 min, hold at 4° C. Droplets were analyzed using a QX200 droplet reader (BioRad), and data were acquired and analyzed using QuantaSoft analysis software (BioRad).

[0386] P1: AGCCCCGGGTACTCCTTGTT (SEQ ID NO: 49) F1: TTCCTTGCAGGAACAGAG (SEQ ID NO: 50) R1: CTGCTTGACCACCCATT (SEQ ID NO: 51) P2: CCAGCAGGCCAGGTACACC (SEQ ID NO: 52) F2: ACCGCCAAGGATGCAC (SEQ ID NO: 53) R2: GCGGGTGGGAATGGAG (SEQ ID NO: 54)

[0387] In experiments involving MIT 25-26x.91, FlpIn 293 cells were generated using the Flp-In™ system from ThermoFisher Scientific. The integration cassette contained the MIT 25-26 mutant binding site and the surrounding mtDNA sequence. Using a Neon electroporator, 1.8e12 copies of engineered meganuclease mRNA were electroporated into 1.5e6 FlpIn 293 cells (Neon condition #11, 100uL tip). For gDNA extraction, cells were collected 2 days after electroporation and evaluated for transfection efficiency using a Beckman Coulter CytoFlex S cytometer. The transfection efficiency exceeded 95%. gDNA was isolated using the Macherey Nagel NucleoSpin Blood QuickPure kit.

[0388] To identify potential nuclear off-target site editing induced by the MIT 25-26x.91 nuclease, targeted amplicon sequencing was performed at selected sites identified from an in vitro genome-wide unbiased off-targeting assay. Three nuclear genomic sequences were identified as putative off-target sites for this nuclease (site 1, site 2, and site 3). gDNA collected from cells treated with either NLS-MIT 25-26x.91, MTP-MIT 25-26x.91, or MTP-MIT 25-26x.91-MVMpNS2 NES was evaluated by targeted amplicon sequencing at the introduced nuclear on-target site (site 0) and three endogenous putative off-target sites (sites 1, 2, and 3) using primers F1><R1, F2><R2, F3><R3, and F4><R4.

[0389] F1: GCTGGCTAGCGTTT...

Claims

1. A mitochondrial targeted engineered meganuclease (MTEM) that binds to and cleaves a recognition sequence comprising SEQ ID NO:1 in the mitochondrial genome of a eukaryotic cell, comprising: the MTEM comprises an engineered meganuclease linked to a mitochondrial transit peptide (MTP); the engineered meganuclease comprises a first subunit and a second subunit; the first subunit binds to a first recognition half-site of the recognition sequence and comprises residues 7-153 of SEQ ID NO:9; the second subunit binds to a second recognition half-site of the recognition sequence and comprises residues 198-344 of SEQ ID NO:9; and MTEM, wherein said engineered meganuclease comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO:

9.

2. The MTEM of claim 1, wherein the engineered meganuclease comprises the amino acid sequence of SEQ ID NO:

9.

3. 2. The MTEM of claim 1, wherein the MTP comprises the amino acid sequence set forth in SEQ ID NO: 45 and is attached to the N-terminus of the engineered meganuclease.

4. The MTEM described in claim 2, wherein the MTP comprises the amino acid sequence set forth in SEQ ID NO:45 and is bound to the N-terminus of the engineered meganuclease.

5. The MTEM of any one of claims 1 to 4, wherein the MTEM is linked to a nuclear export sequence (NES) comprising the amino acid sequence of SEQ ID NO: 46, and the NES is linked to the C-terminus of the MTEM.

6. comprising a nucleic acid sequence encoding MTEM, The MTEM binds to and cleaves a recognition sequence consisting of SEQ ID NO: 1 in the mitochondrial genome of a eukaryotic cell; the MTEM comprises an engineered meganuclease bound to an MTP; the engineered meganuclease comprises a first subunit and a second subunit; the first subunit binds to a first recognition half-site of the recognition sequence and comprises residues 7-153 of SEQ ID NO:9; the second subunit binds to a second recognition half-site of the recognition sequence and comprises residues 198-344 of SEQ ID NO:9; and A polynucleotide, wherein said engineered meganuclease comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO:

9.

7. The polynucleotide described in claim 6, wherein the genetically engineered meganuclease comprises the amino acid sequence of SEQ ID NO:

9.

8. The polynucleotide of claim 6, wherein the MTP comprises the amino acid sequence of SEQ ID NO:45 and is linked to the N-terminus of the engineered meganuclease.

9. The polynucleotide of claim 7, wherein the MTP comprises the amino acid sequence of SEQ ID NO:45 and is linked to the N-terminus of the engineered meganuclease.

10. A polynucleotide described in any one of claims 6 to 9, wherein the MTEM is bound to an NES having the amino acid sequence of SEQ ID NO: 46, and the NES is bound to the C-terminus of the MTEM.

11. a polynucleotide comprising a nucleic acid sequence encoding MTEM, The MTEM binds to and cleaves a recognition sequence consisting of SEQ ID NO: 1 in the mitochondrial genome of a eukaryotic cell; the MTEM comprises an engineered meganuclease bound to an MTP; the engineered meganuclease comprises a first subunit and a second subunit; the first subunit binds to a first recognition half-site of the recognition sequence and comprises residues 7-153 of SEQ ID NO:9; the second subunit binds to a second recognition half-site of the recognition sequence and comprises residues 198-344 of SEQ ID NO:9; said engineered meganuclease comprising an amino acid sequence having at least 99% sequence identity to SEQ ID NO:9; and A recombinant adeno-associated virus (AAV), wherein the polynucleotide comprises a promoter operably linked to the nucleic acid sequence encoding the MTEM.

12. The recombinant AAV described in claim 11, wherein the genetically engineered meganuclease comprises the amino acid sequence of SEQ ID NO:

9.

13. The recombinant AAV described in claim 11, wherein the MTP comprises the amino acid sequence of SEQ ID NO:45 and is linked to the N-terminus of the engineered meganuclease.

14. The recombinant AAV described in claim 12, wherein the MTP comprises the amino acid sequence of SEQ ID NO:45 and is linked to the N-terminus of the engineered meganuclease.

15. A recombinant AAV described in any one of claims 11 to 14, wherein the MTEM is linked to a nuclear export sequence (NES) having the amino acid sequence of SEQ ID NO: 46, and the NES is linked to the C-terminus of the MTEM.

16. The recombinant AAV of claim 11, wherein the recombinant AAV has an AAV9 capsid.

17. The recombinant AAV described in claim 13, wherein the recombinant AAV has an AAV9 capsid.

18. The recombinant AAV described in claim 15, wherein the recombinant AAV has an AAV9 capsid.

Images