Glycan-modified nucleic acids, methods of preparation, and therapeutic uses

Abstract

The present disclosure relates to glyconucleic acids, such as glycoRNA and glycoDNA, as described herein.Methods and compositions related to glycosylated ribonucleic acids (glycoRNA) are provided.

Description

[Technical Field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Application No. 63 / 179,065, filed April 23, 2021, U.S. Provisional Application No. 63 / 188,930, filed May 14, 2021, and U.S. Provisional Application No. 63 / 189,492, filed May 17, 2021, each of which is incorporated by reference in its entirety.

[0002] Sequence Listing Reference

[0001] This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference. The ASCII copy created on April 22, 2022, is named 772233_202320_SL.txt and is 16,179 bytes in size.

[0003] Federal Government Support This invention was made with federal support under Grant No. R24 GM137763 awarded by the National Institutes of Health. The U.S. Government has certain rights in this invention.

[0004] The present disclosure relates to glyconucleic acids, such as glycoRNA and glycoDNA, as described herein.Methods and compositions related to glycosylated ribonucleic acids (glycoRNA) are provided. [Background technology]

[0005] Glycans are polymers of monosaccharides (single sugar molecules) that have been shown to regulate a wide range of important biological processes, from cell-cell contact to host-pathogen interactions and even the organization of multicellular organisms (see, e.g., Varki and Gagneux, 2015). Glycans, in particular, regulate important cellular functions in the context of cell surface events and are present in cells of all organisms (see, e.g., Varki and Gagneux, 2015). Glycans regulate a variety of important cellular functions, particularly in the context of cell surface events. For example, complex glycans facilitate the folding and critical transport of proteins and lipids for secretion or membrane presentation. Thus, many fundamental processes, such as embryogenesis, host-pathogen recognition, and tumor-immune interactions, depend on glycosylation. Glycans are present in all cells across all kingdoms of life studied to date and are composed of approximately 10 monomeric carbohydrate units in mammals. Glycans can contain fucose attached to GlcNAc residues in the glycan core or in the glycan arms. Sialic acid residues can be found at the termini of glycans. In addition, some glycans are bisected N-glycans.

[0006] RNA is another biopolymer required by all living organisms. While RNA is primarily composed of four bases, post-transcriptional modifications (PTMs) can dramatically expand the chemical diversity of RNA. Over 100 PTMs have been identified to date (see, for example, Frye et al., 2018; Machnicka et al., 2013; Nachtergaele, 2016). The use of non-canonical or unnatural nucleotides further fuels the chemical diversity of RNA. In addition to being messengers, RNA can function as scaffolds, molecular decoys, enzymes, and network regulators throughout the nucleus and cytosol (see, for example, Cech and Steitz, 2014; Sharp, 2009; Wang and Chang, 2011).

[0007] DNA is another biopolymer that is important to all known forms of life: it provides organisms with the instructions they need to carry out functions for development, survival, and reproduction.

[0008] Although both RNA and DNA are nucleic acids, there are some differences between them. The differences in their bases are basically limited. They also contain different sugars. DNA is originally confined to the nucleus of the cell, but RNA can leave the nucleus.

[0009] There remains a need for therapeutic methods and compositions for delivering nucleic acids to specific cells within a subject's body. Summary of the Invention [Means for solving the problem]

[0010] The present disclosure relates to novel conjugates of asparagine-linked (N-linked) glycans and nucleic acids (DNA, RNA), for example, linked via bioorthogonal click chemistry. It is important to develop such novel conjugates that can modulate the biophysical properties of the conjugate, for example, modulate the stability of the nucleic acid in biological systems (e.g., serum) and / or modulate the delivery of the nucleic acid (e.g., targeted delivery to specific membranes or organelles). In one aspect, the present disclosure provides pharmaceutical compositions comprising a modified RNA comprising a glycan moiety. In some embodiments, the pharmaceutical composition comprises a modified RNA comprising a glycan moiety comprising at least six monosaccharides. In some embodiments, the pharmaceutical compositions of the present invention further comprise a pharmaceutically acceptable carrier. The pharmaceutical composition may comprise a glyconucleic acid comprising a nucleic acid and at least one glycan moiety comprising at least six monosaccharides conjugated to the nucleic acid, and a pharmaceutically acceptable carrier. The glycan moiety may comprise at least eight monosaccharides. The glycan moiety may comprise at least ten monosaccharides. The glycan moiety can comprise an N-linked glycan or an O-linked glycan.

[0011] The glycan moiety can include a biantennary glycan. The biantennary glycan can include a first terminal residue and a second terminal residue. The glycan moiety can include a triantennary glycan. The triantennary glycan can include a first terminal residue, a second terminal residue, and a third terminal residue.

[0012] In some embodiments, the glycan moiety comprises sialic acid, fucose, or a combination thereof. In some embodiments, the glycan moiety comprises GlcNAc, mannose, galactose, sialic acid, fucose, or a combination thereof. When the first, second, and third terminal residues are present, at least one of them may comprise sialic acid. When the first, second, and third terminal residues are present, at least one of them may comprise fucose. When the first, second, and third terminal residues are present, at least one of them may comprise GlcNAc. When the first, second, and third terminal residues are present, at least one of them may comprise mannose. When the first, second, and third terminal residues are present, at least one of them may comprise NeuNAc. When the first, second, and third terminal residues are present, at least one of them may comprise galactose.

[0013] The nucleic acid of the pharmaceutical composition may be RNA. The nucleic acid of the pharmaceutical composition may be siRNA. The nucleic acid of the pharmaceutical composition may be mRNA. The nucleic acid of the pharmaceutical composition may be circular RNA. The nucleic acid of the pharmaceutical composition may be guide RNA. The nucleic acid of the pharmaceutical composition may be aptamer RNA. The nucleic acid of the pharmaceutical composition may be DNA.

[0014] At least one glycan moiety may comprise a compound in Table 2A or 2B. The modified nucleic acid may comprise a nucleic acid in Table 1. At least one glycan moiety may be conjugated to the modified nucleic acid by a click chemistry reaction. The nucleic acid may be conjugated to the glycan via a linker group covalently attached to the end of the nucleic acid. The nucleic acid may be conjugated to the glycan via a linker covalently attached to a chemically modified nucleotide in the middle of the nucleic acid. The nucleic acid may be conjugated to the glycan via a linker covalently attached to a chemically modified nucleotide that is not located at the 3' or 5' end of the nucleic acid. The nucleic acid may be conjugated to the glycan via a chemical handle inserted between two nucleotides of the nucleic acid. In embodiments, the two nucleotides do not include the nucleotides at the 3' or 5' end of the nucleic acid.

[0015] In another embodiment, a compound of formula (I): ALB(I) or a salt, co-crystal, tautomer, stereoisomer, solvate, hydrate, polymorph, or isotopically enriched derivative thereof, wherein A is a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) nucleic acid containing a first click chemistry handle; B is an asparagine-linked glycan (N-glycan) containing a second click chemistry handle; Provided herein are compounds, or salts, co-crystals, tautomers, stereoisomers, solvates, hydrates, polymorphs, or isotopically enriched derivatives thereof, wherein L comprises a linker formed by a bioorthogonal click chemistry reaction between a first click chemistry handle and a second click chemistry handle.

[0016] Also provided herein is a method for preparing a compound of formula (I), comprising reacting a nucleic acid A comprising a first click chemistry handle with a compound B, which is an asparagine-linked glycan (N-glycan) comprising a second click chemistry handle, wherein the first step reaction is carried out under bioorthogonal click chemistry conditions.

[0017] The glyconucleic acid compound may have formula (I): ALB(I), or a salt, co-crystal, tautomer, stereoisomer, solvate, hydrate, polymorph, or isotopically enriched derivative thereof, wherein A is a nucleic acid comprising a first click chemistry handle, B is an asparagine-linked glycan (N-glycan) comprising a second click chemistry handle, and L comprises a linker formed by a bioorthogonal click chemistry reaction between the first and second click chemistry handles. A may be an RNA comprising the first click chemistry handle. A may be an siRNA comprising the first click chemistry handle. A may be an mRNA comprising the first click chemistry handle. A may be a circular RNA comprising the first click chemistry handle. A may be a DNA comprising the first click chemistry handle.

[0018] A can include a first click chemistry handle selected from those listed under "Reagent A" in Table 4, and B can include a second click chemistry handle selected from those listed under "Reagent B" in Table 4. A can include a first click chemistry handle selected from those listed under "Reagent B" in Table 4, and B can include a second click chemistry handle selected from those listed under "Reagent A" in Table 4. B can be an asparagine-linked glycan comprising a biantennary glycan, wherein the biantennary glycan comprises a first terminal residue and a second terminal residue. B can be an asparagine-linked glycan comprising a triantennary glycan, wherein the triantennary glycan comprises a first terminal residue, a second terminal residue, and a third terminal residue.

[0019] When the first, second, and third terminal residues are present, at least one of them may comprise sialic acid. When the first, second, and third terminal residues are present, at least one of them may comprise fucose. When the first, second, and third terminal residues are present, at least one of them may comprise GlcNAc. When the first, second, and third terminal residues are present, at least one of them may comprise mannose. When the first, second, and third terminal residues are present, at least one of them may comprise NeuNAc. When the first, second, and third terminal residues are present, at least one of them may comprise galactose.

[0020] The present disclosure also relates to a method of treating a disease or condition, comprising administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition disclosed herein or a glyconucleic acid disclosed herein. The disease or condition may be selected from an inflammatory disorder, an autoimmune disease, cancer, a metabolic disease, a clotting disease, an anticlotting disease, an allergy, a viral disease, and a microbial infection. In embodiments, the disease or condition is inflammation. In embodiments, the disease or condition is cancer. In embodiments, the disease or condition is an autoimmune disease. In embodiments, the disease or condition is an IgE-mediated allergy. In embodiments, the disease or condition is systemic lupus erythematosus. In embodiments, the disease or condition is a microbial infection. In embodiments, the disease or condition is a viral infection. In embodiments, the disease or condition is a metabolic disease.

[0021] In another aspect, methods and compositions related to glycosylated ribonucleic acid (glycoRNA) are provided. In certain aspects, methods are provided for reducing interactions between cells expressing a glycan-binding protein (GBP) and cells displaying cell-surface glycosylated ribonucleic acid (glycoRNA). In some embodiments, such methods comprise contacting cells expressing a GBP and / or cells displaying cell-surface glycoRNA with an agent that binds to the GBP and / or cell-surface glycoRNA, such that interactions between the GBP-expressing cells and the cell-surface glycoRNA are reduced. Such methods can be performed in vitro, in vivo, or ex vivo. Conjugates, fusion proteins, and compositions useful, for example, for practicing the methods of the present disclosure are also provided. Methods for targeting agents to cells expressing a GBP and for evaluating biological samples for glycoRNA are also provided.

[0022] The present disclosure further relates to a method for reducing interactions between cells expressing a glycan-binding protein (GBP) and cells displaying cell-surface glycosylated ribonucleic acid (glycoRNA), comprising contacting cells expressing the GBP with a soluble glycoRNA that binds to the GBP expressed on the surface of the GBP-expressing cells, in an amount effective to reduce interactions between the GBP-expressing cells and cells displaying cell-surface glycoRNA.

[0023] The soluble glycoRNA may comprise RNA of the Y RNA family. The soluble glycoRNA may comprise Y5 RNA. The soluble glycoRNA may comprise snoRNA, tRNA, snRNA, rRNA, or any combination thereof. The soluble glycoRNA may comprise soluble sialylated RNA. The soluble sialylated RNA may comprise Neu5Ac, Neu5Gc, or a combination thereof. The soluble glycoRNA is conjugated to one or more agents. The one or more agents may comprise a therapeutic agent. The one or more agents may comprise a detectable label. The GBP may comprise a sialic acid-binding immunoglobulin-like lectin (Siglec). The Siglec may comprise Siglec-11. The Siglec may comprise Siglec-14. The GBP may comprise a C-type lectin. The GBP may comprise a galectin. The GBP may comprise a selectin. [Brief explanation of the drawings]

[0024] [Figure 1A] Schematic and blot images showing that the glycan reporter Ac4ManNAz is incorporated into mammalian cellular RNA. A schematic diagram of the RNA extraction protocol is shown. Ac4ManNAz = peracetylated N-azidoacetylmannosamine. Prot.K = proteinase K. DBCO = dibenzocyclooctyne. [Figure 1B] Schematic and blot images are shown demonstrating the incorporation of the glycan reporter Ac4ManNAz into mammalian cellular RNA. RNA blotting of HeLa cells treated with 100 μM Ac4ManNAz for the indicated times is shown. After RNA purification, Ac4ManNAz was conjugated with DBCO-biotin, visualized with streptavidin-IR800 (Strep), and imaged with an infrared scanner. Prior to RNA transfer to the membrane, total RNA was stained with SYBR Gold (Sybr) and imaged to assess quality and loading. All subsequent blots were prepared in this manner, with Ac4ManNAz always used at 100 μM. Areas of glycoRNA and nonspecific labeling (*) are visible. [Figure 1C]Schematic and blot images showing that the glycan reporter Ac4ManNAz is incorporated into mammalian cellular RNA. An RNA blot of HeLa RNA labeled with Ac4ManNAz and treated in vitro with Turbo DNase or RNase cocktail (A / T1) + / - SUPERaseIn (RNase inhibitor) is shown. [Figure 1D] Schematic and blot images are shown demonstrating that the glycan reporter Ac4ManNAz is incorporated into mammalian cellular RNA. RNA blots of mouse RNA after in vivo delivery of Ac4ManNAz by intraperitoneal injection of 300 mg Ac4ManNAz / kg / day for the days indicated are shown. RNA from liver and spleen was analyzed. Mock (m) mice were injected with DMSO only. RNase treatment was performed on the extracted RNA. [Figure 2A] Figure 1 shows blots and scatter plots demonstrating that small, non-polyadenylated, and conserved transcripts comprise the pool of cellular glycoRNA. Figure 2 shows blots of total RNA or polyadenylated (polyA)-enriched RNA from HeLa cells treated with Ac4ManNAz. [Figure 2B] Figure 1 shows blots and scatter plots demonstrating that small, non-polyadenylated, and conserved transcripts comprise the pool of cellular glycoRNA. Figure 2 shows blots of total RNA from HeLa cells treated with Ac4ManNAz after fractionation by differential precipitation using a silica-based column. [Figure 2C] Blots and scatter plots showing that small, non-polyadenylated, and conserved transcripts comprise the pool of cellular glycoRNA. Blots of total RNA from H9 human embryonic stem cells (H9) treated with Ac4ManNAz after sucrose gradient (15-30% sucrose) fractionation are shown. The input profile is shown to the right of the gradient. [Figure 2D]Figure 2 shows blots and scatter plots demonstrating that small, non-polyadenylated, and conserved transcripts comprise the pool of cellular glycoRNAs. Figure 2 shows a scatter plot analysis of Ac4ManNAz-enriched RNA purified from the small RNA fraction of Figure 2C from HeLa and H9 cells. Mapping of reads to snRNAs, snoRNAs, and Y RNAs is shown. Overlaid is the significance score (-log10 (adjusted p-value) as the size of each data point for HeLa cells and the color of each data point for H9 cells. [Figure 2E] Blots and scatter plots are shown showing that small, non-polyadenylated, and conserved transcripts comprise the cellular glycoRNA pool. Representative blots of total RNA from wild-type (WT) or Y5 knockout (KO) 293T cells treated with Ac4ManNAz are shown. Figure inserts show quantification of biological triplicates of the figure blots. p values ​​were calculated by paired two-tailed t-test. [Figure 3A] 1 shows blots and graphs of glycans modifying RNA to contain sialic acid. 2 shows blots of RNA from HeLa cells treated with 1.75 mM 9-azidosialic acid for the times indicated. [Figure 3B] Figure 1 shows blots and graphs of glycans modifying RNA to contain sialic acid. Figure 2 shows blots of HeLa cell RNA labeled with Ac4ManNAz and treated with Vibrio cholerae (VC) sialidase or heat-inactivated sialidase (VC-sialidase-HI). [Figure 3C] 1 shows a blot and graph of glycans modifying RNA to contain sialic acid. 2 shows a blot of RNA from HeLa cells treated with Ac4ManNAz and P-3FAX-Neu5Ac at the concentrations shown. [Figure 3D]Figure 3D shows a blot and graph of glycans modifying RNA to contain sialic acids. Unlabeled total RNA was isolated from H9 cells, reacted with the indicated enzymes (no enzyme, RNase cocktail treatment, or sialidase treatment), purified to remove cleaved metabolites, and treated with a fluorogenic 1,2-diamino-4,5-methylenedioxybenzene (DMB) probe. The presence and abundance of specific sialic acids were quantified by HPLC analysis. The inset in Figure 3D shows a Sybr gel image of total RNA from each condition. The major sialic acid peaks are #2 and #3. The identity of peak #1 is unknown but is RNase-sensitive. [Figure 3E] 3D shows a blot and graph of glycans that modify RNA to contain sialic acid. 3E shows a graph showing quantification of DMB obtained from biological quadruplicates of 4188, H9, and HeLa cells. [Figure 4A] Figure 1 shows blots, graphs, and a scheme demonstrating that different sets of N-glycans are enriched with glycoRNA. Blotting of RNA from ldlD CHO cells labeled with Ac4ManNAz, galactose (Gal, 10 μM), N-acetylgalactosamine (GalNAc, 100 μM), or all for 24 hours is shown. [Figure 4B] Figure 1 shows blots, graphs, and a scheme demonstrating that different sets of N-glycans are co-enriched with glycoRNA. Blotting of RNA from HeLa cells treated for 24 hours with Ac4ManNAz and NGI-1, an inhibitor of OST, at the concentrations shown. [Figure 4C]

[0033] Figure 4 shows blots, graphs, and schemes demonstrating that different sets of N-glycans are co-enriched with glycoRNA. Blots as in Figure 4B, but with kifunensine at the concentrations shown. [Figure 4D]1 shows blots, graphs, and schemes demonstrating that different sets of N-glycans are enriched with glycoRNA. 2 shows graphs quantifying Ac4ManNAz signal after in vitro treatment of Ac4ManNAz-labeled HeLa cell RNA with the indicated enzymes in biological triplicates at 37°C for 1 hour each. [Figure 4E] Figure 1 shows blots, graphs, and schemes demonstrating that different sets of N-glycans are enriched with glycoRNA.Figure 2 shows a schematic diagram of the method used to release glycans from RNA samples and subsequently purify the released glycans for mass spectrometry analysis. [Figure 4F] Blots, graphs, and schemes showing that distinct sets of N-glycans are enriched with glycoRNA are shown. Unsupervised clustering analysis of glycans (rows) released by PNGaseF cleavage from peptide and RNA fractions (columns) of 293, H9, or HeLa cells is shown. Glycans had to be found in at least one biological replicate of the six included samples. [Figure 4G] 1 shows blots, graphs, and schemes demonstrating that different sets of N-glycans are enriched with glycoRNA. 2 shows principal component analysis plots of glycans released by PNGaseF from peptides and RNA. [Figure 4H] Figure 1 shows blots, graphs, and schemes demonstrating that different sets of N-glycans are enriched with glycoRNA. Figure 2 shows a series of bar graphs of the proportion of glycans containing fucose or sialic acid modifications released from peptide or RNA samples. The numbers on the horizontal axis are the absolute number of glycans found to contain each modification from a given dataset. [Figure 5A] Images and graphs are shown demonstrating that glycoRNA is present on the external surface of live cells. Blotting of RNA and proteins after subcellular fractionation designed to robustly purify nuclei is shown. Non-nuclear proteins GAPDH and β-tubulin, as well as nuclear histone 3 lysine 4 trimethylation (H3K4me3), are visualized by Western blot. [Figure 5B] Images and graphs are shown demonstrating that glycoRNA is present on the external surface of live cells. Blotting of RNA and proteins after subcellular fractionation designed to separate soluble cytosol from membranous organelles is shown. Membrane proteins RPN1, Sec63, and soluble β-tubulin are visualized by Western blot. [Figure 5C] Figure 1 shows images and graphs demonstrating that glycoRNA is present on the external surface of live cells. Blotting of RNA from HeLa cells labeled with 100 μM Ac4ManNAz for 24 hours and then exposed to fresh medium containing 100 μM Ac4ManNAz with or without 150 nM VC-Sia at 37°C for 60 minutes. [Figure 5D] Images and graphs are shown demonstrating that glycoRNA is present on the external surface of live cells. Graphs are shown quantifying the experiments shown in Figure 5C in biological triplicates and experiments with similarly treated 293T or K562 cells. p values ​​were calculated by paired two-tailed t-test. [Figure 5E] Images and graphs are shown demonstrating that glycoRNA is present on the external surface of live cells. A schematic diagram of lectin-based proximal labeling of cell surface RNA is shown. Live cells are stained with a biotinylated lectin that recruits streptavidin-HRP, which can generate nitrene radicals from biotin-aniline after the addition of hydrogen peroxide. RNA from these cells is then extracted and analyzed for biotin labeling, revealing whether the RNA was in close proximity to the lectin. [Figure 5F] Figure 5B shows images and graphs demonstrating that glycoRNA is present on the external surface of live cells. Figure 5C shows blots of total RNA samples prepared as described in Figure 5E. Lanes 5 and 6 were treated in vitro with RNase cocktail or VC-Sia (after RNA purification) to demonstrate any sensitivity of the biotin-aniline signal to these enzymes. [Figure 5G]Images and graphs are shown demonstrating that glycoRNA is present on the exterior surface of live cells. Blotting of total RNA samples is shown, similar to the experiment reported in Figure 5F, except that cells were first lysed with a hypotonic buffer, which disrupts cell membranes that are normally impermeable to nitrene radicals. rRNA labeling is visible in this figure but not in Figure 5F. [Figure 6A] Figure 1 shows a scheme and graphs demonstrating the contribution of cell surface glycoRNA to binding to selected Siglec proteins. A schematic model of glycoRNA on the cell surface is shown with two glycans identified in PNGaseF release experiments. The predicted binding sites for anti-dsRNA antibody (J2) and Siglec-Fc proteins are highlighted. [Figure 6B] Figure 1 shows a scheme and graphs demonstrating the contribution of cell surface glycoRNAs to binding to selected Siglec proteins. FACS analysis of single HeLa cells pretreated with the indicated enzymes or inhibitors and then stained with J2 antibody is shown. The gated region (orange) shows a population shift toward the highly fluorescent J2-binding side. [Figure 6C] Figure 1 shows a scheme and graphs demonstrating the contribution of cell surface glycoRNA to binding to select Siglec proteins. Figure 1 shows FACS analysis of single HeLa cells pretreated for 12 hours with the OST inhibitor NGI-1 at the concentrations indicated. The vertical dashed line represents the J2-high population, and the proportion of cells within this region is shown as a percentage for each sample. [Figure 6D] Figure 1 shows a scheme and graphs demonstrating the contribution of cell surface glycoRNA to binding to selected Siglec proteins. Figure 2 shows FACS analysis of single HeLa cells pretreated with RNase and then stained with the Siglec-Fc reagents shown in the figure. [Figure 7A] 7A-7C show exemplary glycan moiety structures. In certain embodiments, glyconucleic acids of the present disclosure comprise glycan moieties shown in FIGS. [Figure 7B]7A-7C show exemplary glycan moiety structures. In certain embodiments, glyconucleic acids of the present disclosure comprise glycan moieties shown in FIGS. [Figure 7C-1] 7A-7C show exemplary glycan moiety structures. In certain embodiments, glyconucleic acids of the present disclosure comprise glycan moieties shown in FIGS. [Figure 7C-2] 7A-7C show exemplary glycan moiety structures. In certain embodiments, glyconucleic acids of the present disclosure comprise glycan moieties shown in FIGS. [Figure 7C-3] 7A-7C show exemplary glycan moiety structures. In certain embodiments, glyconucleic acids of the present disclosure comprise glycan moieties shown in FIGS. [Figure 8A] A schematic diagram of the copper-catalyzed alkyne-azide cycloaddition (CuAAC) reaction between an alkyne-modified nucleic acid and an azidoglycan is shown. The nucleic acids can vary in backbone composition and length, and the position of the modified nucleotide. The reaction between a short (20 nt) nucleic acid, showing a 3'-terminal alkyne modification, and a terminal azide-containing glycan (ranging from simple oligosaccharide-containing glycans (fewer than 10 sugars) to more complex glycan structures functionalized with fucose (triangles) and sialic acid (diamonds)) is shown. Although multiple glycans are shown in the diagram, a single modified nucleic acid species is reacted with a single glycan species in the CuAAC reaction. [Figure 8B] Figure 1 shows a schematic diagram of the copper-catalyzed alkyne-azide cycloaddition (CuAAC) reaction between an alkyne-modified nucleic acid and an azidoglycan. 3' 5-octadiynyl dU is shown, an example of a modified nucleotide bearing an alkyne moiety. [Figure 9] Figure 9 shows examples of nucleic acids on which glycan moieties can be placed. Nucleic acids can vary in sugar composition (RNA or DNA), length, and can contain unnatural compositions, such as LNA, phosphonothioates, or other modifications. Exemplary nucleic acids shown include siRNA, ASO, mRNA, aptamer, circRNA, and guide RNA, each of which is linked to a glycan. Figure 9 shows that glycan modifications can be placed at the 5' end, 3' end, or internally, as shown in the depictions of mRNA, aptamer, and circRNA. [Figure 10A] The azido-N-glycans used to prepare the nucleic acid-N-glycan conjugates in Example 10 are shown below. The types and concentrations of the azido-N-glycans used in Example 10 are shown below: A2G0-Asn-N3 (G-28) (50 nmol), 2,3SA2-A2G2-Asn-N3 (G-35) (50 nmol), A2G2-Asn-N3 (G-29) (50 nmol), and 2,6SA2-A2G2-Asn-N3 (G-30) (50 nmol). [Figure 10B] 1 shows the azido-N-glycan used to prepare the nucleic acid-N-glycan conjugate in Example 10. FIG. 2 shows the MALDI-MS spectrum of G-28. [Figure 10C] 1 shows the azido-N-glycan used to prepare the nucleic acid-N-glycan conjugate in Example 10. FIG. 2 shows the MALDI-MS spectrum of G-29. [Figure 10D] 1 shows the azido-N-glycan used to prepare the nucleic acid-N-glycan conjugate in Example 10. FIG. 2 shows the MALDI-MS spectrum of G-35. [Figure 10E] 1 shows the azido-N-glycan used to prepare the nucleic acid-N-glycan conjugate in Example 10. FIG. 2 shows the MALDI-MS spectrum of G-30. [Figure 11] Figure 1 shows SybrGold nucleic acid staining of the corresponding products after reacting alkyne-RNA or alkyne-DNA with the specific N-glycans G-28 (50 nmol), G-35 (50 nmol), G-29 (50 nmol), and G-30 (50 nmol) in Example 10. New shifted bands are shown corresponding to the conjugates bound to the resulting N-glycan-RNA or N-glycan-DNA. [Figure 12] 1 shows a blot depicting duplexes formed between exemplary glycoRNAs R-1 to R-6 and complementary sense strand I-1. [Figure 13A]1 shows a graph showing the expression of glycoRNA compared to the X-3 / I-4 duplex. 2 shows the relative expression of Cy5 signal in human CD14+ monocytes after 4 hours of incubation with glycoRNA compared to the X-3 / I-4 duplex of glycoRNA. [Figure 13B] 1 shows a graph depicting the expression of glycoRNA compared to the X-3 / I-4 duplex. 2 shows the relative expression of Cy5 signal in human CD3+ T cells after 4 hours of incubation with glycoRNA. [Figure 13C] 1 shows a graph depicting the expression of glycoRNA compared to the X-3 / I-4 duplex. 2 shows the relative expression of Cy5 signal in human CD3+ T cells after 4 hours of incubation with glycoRNA. [Figure 14] FIG. 1 shows a graph depicting cell signaling knockdown (% β-catenin) using glyoRNA (R-1 / I-1 duplex, R-2 / I-1 duplex, R-16 / I-1 duplex, and R-3 / I-1 duplex). [Figure 15A] 1 shows a graph showing the mean fluorescence intensity of Cy5 expression of glycoRNA compared to X-3 / I-4 duplex in HepG2 cells. The relative expression of Cy5 signal in HepG2 cells by glycoRNA duplexes R-1 / I-1, R-2 / I-1, R-3 / I-1, R-4 / I-1, R-5 / I-1, and R-6 / I-1 compared to X-3 / I-4 after 4 hours of incubation at 10 nM concentration is shown. [Figure 15B] 1 shows a graph showing the mean fluorescence intensity of Cy5 expression of glycoRNA compared to X-3 / I-4 duplex in HepG2 cells. The relative expression of Cy5 signal in HepG2 cells by glycoRNA duplexes R-1 / I-1, R-2 / I-1, R-3 / I-1, R-4 / I-1, R-5 / I-1, and R-6 / I-1 compared to X-3 / I-4 after 4 hours of incubation at 100 nM concentration is shown. [Figure 16A] Figure 1 shows Cy5 fluorescence images obtained as described in Example 18 showing internalization and / or localization of glycol RNA duplexes within and on HepG2 cells. R-1 / I-1. [Figure 16B] R-2 / I-1 show Cy5 fluorescence images obtained as described in Example 18 showing internalization and / or localization of glycol RNA duplexes within and on HepG2 cells. [Figure 16C] R-3 / I-1 show Cy5 fluorescence images obtained as described in Example 18 showing internalization and / or localization of glycol RNA duplexes within and on HepG2 cells. [Figure 16D] Figure 1 shows Cy5 fluorescence images obtained as described in Example 18 showing internalization and / or localization of glycol RNA duplexes within and on HepG2 cells. [Figure 16E] R-5 / I-1 show Cy5 fluorescence images obtained as described in Example 18 showing internalization and / or localization of glycol RNA duplexes within and on HepG2 cells. [Figure 16F] R-6 / I-1 show Cy5 fluorescence images obtained as described in Example 18 showing internalization and / or localization of glycol RNA duplexes within and on HepG2 cells. DETAILED DESCRIPTION OF THE INVENTION

[0025] In one aspect, the present disclosure provides a pharmaceutical composition comprising a modified nucleic acid comprising a glycan moiety. In some embodiments, the pharmaceutical composition of the present invention further comprises a pharmaceutically acceptable carrier. Glycans modify lipids and proteins, mediating inter- and intramolecular interactions in all domains of life. RNA is not considered a primary target for naturally occurring glycosylation. Surprisingly, it is demonstrated herein that mammals use RNA as a third scaffold for glycosylation. Using a series of chemical and biochemical approaches, conserved small non-coding RNAs were discovered to bear sialylated glycans. These "glycoRNAs" were present in multiple cell types and mammalian species, in cultured cells, and in vivo. Assembly of glycoRNAs relies on the canonical N-glycan biosynthetic machinery, resulting in structures rich in sialic acid and fucose. Analysis of live cells revealed that the majority of glycoRNAs are present on the cell surface and can interact with anti-dsRNA antibodies and members of the Siglec receptor family. Collectively, these findings point to an expanding role for RNA in extracellular biology.

[0026] Glycans can be attached to RNA or DNA using synthetic chemistry or enzymatic processes to form glyconucleic acids, such as glycoRNA or glycoDNA. Specifically, the glycans attached to RNA or DNA contain at least one monosaccharide. In other embodiments, the glycans attached to RNA or DNA contain at least 10 monosaccharides. Preferably, the glycans attached to RNA or DNA contain at least six monosaccharides. Preferably, the glycans attached to RNA or DNA contain at least 10 monosaccharides. Attaching glycans to RNA or DNA can create more stable biophysical materials. Glycans can facilitate targeting of RNA to cellular populations, and cells can be targeted with or without internalization. The glycans of endogenous mammalian glycoRNA appear to be structurally unique to those found on proteins (Flynn et al., 2019). Different glycan compositions can exist, including fucosylated, sialylated, and asialylated glycans. The majority of naturally occurring cellular glycoRNAs are present on the cell surface and are highly conserved small RNA species.

[0027] Glycoconjugates of nucleic acids, such as linear or circular DNA and RNA, offer several advantages. In particular, glycoconjugates can be administered for targeted delivery to a desired organ or cell type without the need for additional delivery vehicles, such as lipid nanoparticles (LNPs). Selectivity for a particular organ or cell type can be achieved by selecting an appropriate set of glycans for conjugation to the nucleic acid. Glycoconjugated nucleic acids, particularly RNA, are also more stable than non-glycosylated nucleic acids.

[0028] Glycoconjugates of nucleic acids, such as RNA, can facilitate cellular targeting and, potentially, endosomal escape. Known targeting moieties, such as triple N-acetylgalactosamine (GalNac), a chemically linked trisaccharide, can facilitate targeting of RNA to cell populations, such as the liver, ultimately enabling internalization. Glycans can also target cells without internalization. Glycoconjugates containing glycoRNA can be directly localized to the cell surface. Once glycoRNA reaches cells, they can bind to glycoreceptors on the cell surface and activate cellular signaling. For example, binding of glycoRNA to Siglec cell surface receptors can result in activation of the immunoreceptor tyrosine-inhibitory (ITIM) domain of Siglec proteins, thereby causing cellular inhibition. GlycoRNA can also be delivered intracellularly. Glycans on circular RNA (circRNA) or mRNA can result in more stable biophysical materials, which may be useful, among other things, for stability or loading into lipid nanoparticles (LNPs).

[0029] Glycans can be conjugated to biomolecules, including RNA (e.g., linear mRNA, circular mRNA, siRNA, miRNA, etc.), or DNA (e.g., linear DNA or circular DNA). Additionally, glycan components can be enzymatically modified with various monosaccharides using glycosyltransferases (see, e.g., Van Delft et al., 2015). Furthermore, the orientation of glycans to generate programmable binding interfaces for glycan receptors can be defined using RNAs that form specific structures and contain modified nucleotides at specific positions.

[0030] After glyconucleic acids such as glycoRNA and glycoDNA are produced, they can be formulated for administration to the body in any desired manner, such as parenteral administration, e.g., intravenous (IV), intramuscular, intraspinal, intraperitoneal, subcutaneous, or intravitreal injection into the organ or tissue of interest; topical application; or administration to the body, e.g., via aerosolization followed by nasal or oral inhalation. GlycoRNA can be packaged in LNPs or can be naked. Small RNA therapeutics may work well when using naked RNA, because long RNAs can be destroyed with a single cleavage. For naked large RNAs, local administration may be best for systemic delivery.

[0031] definition Unless defined herein, scientific and technical terms used in connection with the present invention have the meanings commonly understood by those of ordinary skill in the art. Furthermore, unless otherwise required by context, singular terms include the plural and plural terms include the singular. Generally, the terminology used in connection with and techniques of biochemistry, enzymology, molecular and cell biology, microbiology, genetics, and protein and nucleic acid chemistry, and hybridization described herein are those well known and commonly used in the art.

[0032] The methods and techniques of the present invention are generally carried out according to conventional methods well known in the art and described in various general and more specific references cited and discussed throughout the specification, unless otherwise indicated. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989), Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and supplements to 2002), Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring. Harbor, NY (1990), Taylor and Drickamer, Introduction to Glycobiology, Oxford Univ. Press (2003), Worthington Enzyme Manual, Worthington Biochemical Corp., Freehold, NJ, Handbook of Biochemistry: Section A Proteins, Vol I, CRC Press (1976), Handbook of Biochemistry: Section A Proteins, Vol II, CRC. Press (1976), Essentials of Glycobiology, Cold Spring Harbor Laboratory See Press (1999).

[0033] When a range of values ​​is expressed, it is understood that each intervening value (to one-tenth of the unit of the lower limit, unless the context clearly dictates otherwise) between the upper and lower limit of that range, and any other stated or intervening value in that stated range, is encompassed by the methods and compositions of the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed by the methods and compositions of the invention, subject to any specifically excluded limit in the stated range. When the stated range includes one or both of its limits, ranges excluding either or both of those included limits are also encompassed by the methods and compositions of the invention.

[0034] Certain ranges are presented herein using numerical values ​​preceded by the term "about." The term "about" is used herein to provide literal support for the exact number it precedes and for numbers that are near or approximately the number it precedes. In determining whether a number is near or approximately a specifically recited number, the unrecited number that is near or approximately that number may be a number that, in the context in which it is presented, provides a substantial equivalent to the specifically recited number.

[0035] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. It should be further noted that the claims may be drafted to exclude any element. Accordingly, this statement is intended to serve as a prelude to the use of exclusive terminology such as "solely," "only," and the like, or the use of a "negative" limitation in connection with the recitation of claim elements.

[0036] All publications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0037] The following terms, unless otherwise indicated, shall be understood to have the following meanings:

[0038] Throughout this specification and claims, the word "comprise" or variations such as "comprises" or "comprising" will be understood to mean the inclusion of a specified integer or group of integers, but not the exclusion of any other integer or group of integers.

[0039] As used herein, the terms "glycosylated nucleic acid" and "glyconucleic acid" should be understood to refer to a modified nucleic acid comprising a glycan moiety as described and disclosed herein. As used herein, the terms "glycosylated ribonucleic acid" and "glycoRNA" should be understood to refer to a modified ribonucleic acid comprising a glycan moiety as described and disclosed herein. As used herein, the terms "glycosylated deoxyribonucleic acid" and "glycoDNA" should be understood to refer to a modified deoxyribonucleic acid comprising a glycan moiety as described and disclosed herein.

[0040] As used herein, the term "polymer" refers to a substance composed of natural or synthetic monomers, such as ribonucleotides.

[0041] As used herein, the term "moiety" refers to a molecule. For example, a "carbohydrate moiety" or an "oligosaccharide moiety" generally refers to a glycan component.

[0042] A "modified sequence" is a nucleic acid molecule that contains at least one difference from a naturally occurring nucleic acid molecule. Modified sequences include all exogenous modified and unmodified heterologous sequences (i.e., sequences derived from organisms or cells other than the organism or cell harboring the modified sequence), as well as endogenous genes, operons, coding sequences, or non-coding sequences that have been modified, mutated, or contain deletions or insertions compared to the naturally occurring sequence. Such sequences also include all sequences, regardless of origin, that are linked to an inducible promoter or another regulatory sequence not naturally associated with it. Furthermore, such sequences include all sequences that can be used to downregulate or knock out the expression of endogenous genes. These include antisense molecules, RNAi molecules, constructs for inducing homologous recombination, Cre / lox constructs, etc.

[0043] The term "polynucleotide" or "nucleic acid molecule" or "nucleotide sequence" refers to a polymeric form of nucleotides at least 10 bases in length. The term encompasses DNA molecules (e.g., cDNA or genomic DNA or synthetic DNA) and RNA molecules (e.g., mRNA or synthetic RNA), as well as analogs of DNA or RNA that contain non-natural nucleotide analogs, non-natural internucleoside linkages, or both. Nucleic acids can be in any topological structure. For example, nucleic acids can be single-stranded, double-stranded, triple-stranded, quadruplexed, partially double-stranded, branched, hairpinned, circular, or padlocked.

[0044] Unless otherwise specified, and as an example of all sequences described herein in the general form "SEQ ID NO:1," a "nucleic acid comprising SEQ ID NO:1" refers to a nucleic acid having, at least in part, either (i) the sequence of SEQ ID NO:1, or (ii) a sequence complementary to SEQ ID NO:1. The choice between the two is dictated by the context. For example, if the nucleic acid is used as a probe, the choice between the two is dictated by the requirement that the probe be complementary to a desired target.

[0045] An "isolated" RNA, DNA, or mixed polymer is one that is substantially separated from other cellular components that naturally accompany the natural polynucleotide in its native host cell, such as naturally associated ribosomes, polymerases, and genomic sequences.

[0046] As used herein, an "isolated" component (e.g., a sugar ligand) is one that has been substantially separated from cellular components (membrane lipids, chromosomes, proteins) of the host cell from which it was derived or from the medium in which the host cell was cultured. The term does not require that the biomolecule be separated from all other chemicals, although certain isolated biomolecules may be purified to near homogeneity.

[0047] The nucleic acids (also referred to as polynucleotides) of the present invention include sense and antisense strands of RNA, cDNA, and genomic DNA, as well as synthetic forms and mixed polymers of the above. As will be readily understood by those skilled in the art, they may be chemically or biochemically modified or contain non-natural or derivatized nucleotide bases. Such modifications include, for example, labels, methylation, substitution of one or more analogs of naturally occurring nucleotides, internucleotide modifications such as uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendant moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralens, etc.), chelators, alkylators, and modified linkages (e.g., α-anomeric nucleic acids, etc.). Synthetic molecules that mimic the ability of polynucleotides to bind to designated sequences through hydrogen bonds and other chemical interactions are also encompassed. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule. Other modifications may include, for example, analogs with bridging moieties or other structures, such as modifications of the ribose ring found in "locked" nucleic acids.

[0048] The term "down-regulation," as in "down-regulating a signal," refers to a process in which the levels of target gene expression before and after contact with a sugar ligand can be compared, for example, with respect to mRNA or protein levels. If the amount of RNA or protein expressed from the target gene is determined to be lower after contact with the sugar ligand, it can be concluded that the sugar ligand down-regulates target gene expression. The level of target RNA or protein in a cell can be determined by any desired method. For example, the level of target RNA can be determined by Northern blot analysis, reverse transcription combined with polymerase chain reaction (RT-PCR), or RNase protection assay. The level of protein can be determined, for example, by Western blot analysis.

[0049] "Functionally linked" or "operably linked" expression control sequence refers to a linkage in which the expression control sequence is adjacent to the gene of interest to control the gene of interest, and an expression control sequence that acts in trans or at a distance to control the gene of interest. This term is also used herein to refer to a glycan moiety conjugated to a synthetic scaffold domain as described herein.

[0050] As used herein, the term "peptide" refers to short polypeptides, e.g., typically less than about 50 amino acids in length, and more typically less than about 30 amino acids in length. As used herein, the term encompasses analogs and mimetics that mimic structure and, therefore, biological function.

[0051] The term "polypeptide" encompasses naturally occurring and non-naturally occurring proteins, as well as fragments, variants, derivatives, and analogs thereof. Polypeptides can be monomeric or polymeric. Furthermore, polypeptides can contain multiple different domains, each of which has one or more different activities.

[0052] The term "isolated protein" or "isolated polypeptide" refers to a protein or polypeptide that, depending on its origin or source, (1) is free from association with naturally associated components that accompany it in its natural state; (2) exists in a purity not found in nature (where purity can be judged with respect to the presence of other cellular material) (e.g., free from other proteins from the same species); (3) is expressed by cells from a different species; or (4) does not occur in nature (e.g., is a fragment of a naturally occurring polypeptide, or contains amino acid analogs or derivatives not found in nature, or contains linkages other than standard peptide bonds). Thus, a polypeptide that is chemically synthesized or synthesized by cellular machinery other than that of the cell from which it originates is "isolated" from its naturally associated components. A polypeptide or protein can also be rendered substantially free of naturally associated components by isolation using protein purification techniques well known in the art. When defined in this way, "isolated" does not necessarily require that the protein, polypeptide, peptide, or oligopeptide so described has been physically removed from its natural environment.

[0053] As used herein, the term "polypeptide fragment" refers to a polypeptide that has an amino-terminal and / or carboxy-terminal deletion compared to the full-length polypeptide. In preferred embodiments, a polypeptide fragment is a contiguous sequence in which the amino acid sequence of the fragment is identical to the corresponding positions in the naturally occurring sequence. Fragments are typically at least 5, 6, 7, 8, 9, or 10 amino acids in length, preferably at least 12, 14, 16, or 18 amino acids in length, more preferably at least 20 amino acids in length, more preferably at least 25, 30, 35, 40, or 45 amino acids in length, even more preferably at least 50 or 60 amino acids in length, and even more preferably at least 70 amino acids in length.

[0054] As used herein, the 20 common amino acids and their abbreviations follow conventional usage. See Immunology - A Synthesis (Golub and Gren eds., Sinauer Associates, Sunderland, Mass., 2002), incorporated herein by reference. nd ed. 1991). Stereoisomers of the 20 common amino acids (e.g., D-amino acids), unnatural amino acids, such as α-,α-disubstituted amino acids, N-alkyl amino acids, and other unconventional amino acids may also be suitable components of the polypeptides of the invention. Examples of unconventional amino acids include 4-hydroxyproline, γ-carboxyglutamate, ε-N,N,N-trimethyllysine, ε-N-acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, N-methylarginine, and other similar amino acids and imino acids (e.g., 4-hydroxyproline). In the polypeptide notation used herein, the left-hand end corresponds to the amino terminus and the right-hand end corresponds to the carboxy terminus, in accordance with standard usage and convention.

[0055] As used herein, the term "region" refers to a physically contiguous portion of the primary structure of a biomolecule. In the case of a protein, a region is defined as a contiguous portion of the amino acid sequence of that protein.

[0056] As used herein, the term "domain" refers to a structure of a biomolecule that contributes to the known or potential function of the biomolecule. A domain may be coextensive with a region or portion thereof. A domain may also include distinct, non-contiguous regions of a biomolecule. Examples of protein domains include, but are not limited to, Ig domains, extracellular domains, transmembrane domains, and cytoplasmic domains.

[0057] As used herein, the term "molecule" means any compound, including but not limited to small molecules, peptides, proteins, sugars, nucleotides, nucleic acids, lipids, etc., and such compounds may be natural or synthetic.

[0058] As used herein, the term "monosaccharide" refers to a carbohydrate molecule that cannot be hydrolyzed into two or more simpler carbohydrates. Examples of monosaccharides include, but are not limited to, GlcNAc, mannose, fucose, glucose, fructose, and galactose.

[0059] The term "N-linked glycan" or "N-glycan" generally refers to an N-linked oligosaccharide structure covalently attached to a nitrogen atom, optionally via an amide bond, as an N-glycan conjugated to an asparagine or arginine residue via an N-acetylglucosamine residue of the glycan by a glycosyltransferase. These "N-linked glycosylation sites" occur, for example, in the primary structure of peptides containing the standard amino acid sequence asparagine-X-serine / threonine, where X is any amino acid residue except proline and aspartic acid. "N-linked glycan" refers to an N-linked oligosaccharide structure. N-glycans can be attached to proteins or scaffolds, which can be further engineered in vitro or in vivo. Common N-linked glycans typically include complex, hybrid, high-mannose, branched, and hyperantennary structures. The term "N-linked" with respect to glycans can refer to a scaffold with N-acetylglucosamine (GlcNAc) residues attached to the amide nitrogen of an asparagine residue (N-linked) of a protein or scaffold that is similar or identical to that produced in humans.

[0060] "O-glycan" or "O-linked glycan" refers to an O-linked oligosaccharide structure. O-glycans can be attached to proteins or scaffolds, which can be further manipulated in vitro or in vivo. Common O-GalNAc core structures typically include core 1, core 2, and poly-N-acetyllactosamine (LacNAc) structures. In some embodiments, O-linked oligosaccharides are covalently attached via the oxygen atom of a serine residue. The term "O-linked" with respect to glycans can refer to conjugates in which an N-acetylgalactosamine (GalNAc) residue is attached to the oxygen atom of a serine or threonine residue of a protein or scaffold, similar to or identical to those produced in humans.

[0061] The term "glycan" refers to an oligosaccharide structure; the major oligosaccharide structures found on glycoproteins include glucose (Glu), galactose (Gal), mannose (Man), fucose (Fuc), N-acetylgalactosamine (GalNAc), N-acetylglucosamine (GlcNAc), N-acetylgalactosamine (GalNAc), and sialic acid (e.g., N-acetylneuraminic acid (NeuAc or NANA)). Hexoses (Hex), classified as monosaccharides with six carbon atoms, such as glucose, galactose, and mannose, are not readily distinguishable by mass spectrometry and may also be present. N-glycans differ in the number of branches ("antennae" or "arms") containing terminal sugars (e.g., GlcNAc, galactose, fucose, and sialic acid) attached to the "trimannosyl core." The term "trimannosyl core," also referred to as "M3," "M3GN2," "trimannose core," "pentasaccharide core," or "persimannose core," refers to the Man3GlcNAc2 oligosaccharide structure, in which the Manα1,3 and Manα1,6 arms extend from a di-GlcNAc structure (GlcNAc2):β1,4GlcNAc-β1,4GlcNAc. N-glycans are classified by their branched chain components (e.g., high mannose, complex, or hybrid).

[0062] "High mannose" N-glycans contain four or more mannose residues in a di-GlcNAc oligosaccharide structure. "M9" refers to Man9GlcNAc2. "M5" refers to Man5GlcNAc2.

[0063] A "hybrid" N-glycan has at least one GlcNAc residue at the terminal of the α1,3 mannose (Manα1,3) arm of the trimannose core and zero or more mannoses in the α1,6 mannose (Manα1,3) arm of the trimannose core. An example of a hybrid glycan is GlcNAcMan3GlcNAc2.

[0064] "Complex" N-glycans typically have at least one GlcNAc residue attached to the Manα1,3 arm and at least one GlcNAc attached to the Manα1,6 arm of the trimannose core (sometimes referred to as "G0" or fucosylated "G0F"). Complex N-glycans may also have galactose or N-acetylgalactosamine residues ("G2" or fucosylated "G2F"), optionally modified with sialic acid or derivatives ("G2S2" or fucosylated "G2FS2") (e.g., "Neu" refers to neuraminic acid and "Ac" refers to acetyl). Complex N-glycans may also have intrachain substitutions including "bisected" GlcNAc and core fucose. Complex N-glycans are often referred to as "hyperantennary glycans" or may also have multiple antennae on the trimannose core, which may be triantennary, tetraantennary, or pentaantennary glycans, also referred to as "multiantennary glycans."

[0065] As used herein, the term "predominantly" or variations thereof, such as "major" or "main," are understood to refer to the glycan species that is determined to have the highest molar percentage (%) of the total N-glycans analyzed by mass spectrometry, e.g., MALDI-TOF MS, after removal of sugar ligands (e.g., treatment with PNGase to release glycans). In other words, the term "predominantly" defines an individual substance, e.g., a particular glycoform, that is present at a higher molar percentage than any other individual substance. For example, if a composition consists of 40 molar percent A species, 35 molar percent B species, and 25 molar percent C species, the composition will primarily contain A species. Additionally, the terms "rich," "uniform," "homogeneous," and "essentially consisting of" are synonymous with "predominantly" with respect to one or more glycans.

[0066] The mole percent of N-glycans measured by MALDI-TOF-MS in positive mode refers to the mole percent of sugars transferred relative to the mole percent total amount of N-glycans. Certain cation adducts, such as potassium and sodium ions, are usually accompanied by elution peaks in which the mass of the N-glycans increases by the molecular mass of the respective adduct.

[0067] An "effective amount" or "therapeutically effective amount" means a dosage sufficient to produce a desired result, e.g., an amount sufficient to achieve a beneficial or desired result (including a prophylactic and / or therapeutic result), e.g., a reduction in symptoms of a medical condition (e.g., cancer, infectious disease, immune-mediated disease (e.g., autoimmune disorder, inflammatory disease), etc.) compared to a control. In some embodiments, with respect to cancer, a therapeutically effective amount is sufficient to slow tumor growth, reduce tumor size, and / or the like. An effective amount can be administered in one or more administrations.

[0068] When a range of values ​​is listed, it is intended to encompass each value and subrange within the range. For example, "C 1~6 "Alkyl" refers to C1, C2, C3, C4, C5, C6, C 1~6 , C 1~5 , C 1~4, C 1~3 , C 1~2 , C 2~6 , C 2~5 , C 2~4 , C 2~3 , C 3~6 , C 3~5 , C 3~4 , C 4~6 , C 4~5 , and C 5~6 Alkyl is intended to be included.

[0069] The term "alkyl" refers to a straight or branched chain saturated hydrocarbon group having from 1 to 10 carbon atoms ("C 1~10 In some embodiments, an alkyl group has 1 to 9 carbon atoms ("C 1~9 In some embodiments, the alkyl group has 1 to 8 carbon atoms ("C 1~8 In some embodiments, the alkyl group has 1 to 7 carbon atoms ("C 1~7 In some embodiments, the alkyl group has 1 to 6 carbon atoms ("C 1~6 In some embodiments, the alkyl group has 1 to 5 carbon atoms ("C 1~5 In some embodiments, the alkyl group has 1 to 4 carbon atoms ("C 1~4 In some embodiments, the alkyl group has 1 to 3 carbon atoms ("C 1~3 In some embodiments, the alkyl group has 1 to 2 carbon atoms ("C 1~2 In some embodiments, the alkyl group has 1 carbon atom ("C alkyl"). In some embodiments, the alkyl group has 2 to 6 carbon atoms ("C 2~6 alkyl). C 1~6Examples of alkyl groups include methyl (C1), ethyl (C2), propyl (C3) (e.g., n-propyl, isopropyl), butyl (C4) (e.g., n-butyl, tert-butyl, sec-butyl, isobutyl), pentyl (C5) (e.g., n-pentyl, 3-pentanyl, amyl, neopentyl, 3-methyl-2-butanyl, tertiary amyl), and hexyl (C6) (e.g., n-hexyl). Additional examples of alkyl groups include n-heptyl (C7), n-octyl (C8), and the like. Unless otherwise specified, each instance of an alkyl group is independently unsubstituted ("unsubstituted alkyl") or substituted ("substituted alkyl") with one or more substituents (e.g., halogen, e.g., F). In certain embodiments, an alkyl group is an unsubstituted C 1~10 Alkyl (e.g., unsubstituted C 1~6 Alkyl, for example, -CH3(Me), unsubstituted ethyl (Et), unsubstituted propyl (Pr, e.g., unsubstituted n-propyl (n-Pr), unsubstituted isopropyl (i-Pr), unsubstituted butyl (Bu, e.g., unsubstituted n-butyl (n-Bu), unsubstituted tert-butyl (tert-Bu or t-Bu), unsubstituted sec-butyl (sec-Bu), unsubstituted isobutyl (i-Bu)). In certain embodiments, the alkyl group is a substituted C 1~10 Alkyl (e.g., substituted C 1~6 alkyl, for example, -CF3, Bn).

[0070] The term "heteroalkyl" refers to an alkyl group that further includes at least one heteroatom (e.g., 1, 2, 3, or 4 heteroatoms) selected from oxygen, nitrogen, or sulfur, located within the parent chain (i.e., inserted between adjacent carbon atoms) and / or at one or more terminal position(s) of the parent chain. In certain embodiments, a heteroalkyl group is a saturated group having 1 to 20 carbon atoms and one or more heteroatoms ("C 1~20 In some embodiments, a heteroalkyl group refers to a saturated group having 1 to 18 carbon atoms and one or more heteroatoms in the parent chain ("C 1~18In some embodiments, a heteroalkyl group is a saturated group having 1 to 16 carbon atoms and one or more heteroatoms in the parent chain ("C 1~16 In some embodiments, a heteroalkyl group is a saturated group having 1 to 14 carbon atoms and one or more heteroatoms in the parent chain ("C 1~14 In some embodiments, a heteroalkyl group is a saturated group having 1 to 12 carbon atoms and one or more heteroatoms in the parent chain ("C 1~12 In some embodiments, a heteroalkyl group is a saturated group having 1 to 10 carbon atoms and one or more heteroatoms in the parent chain ("C 1~10 In some embodiments, a heteroalkyl group is a saturated group having 1 to 8 carbon atoms and one or more heteroatoms in the parent chain ("C 1~8 In some embodiments, a heteroalkyl group is a saturated group having 1 to 6 carbon atoms and one or more heteroatoms in the parent chain ("C 1~6 In some embodiments, a heteroalkyl group is a saturated group having 1 to 4 carbon atoms and 1 or 2 heteroatoms in the parent chain ("C 1~4 In some embodiments, a heteroalkyl group is a saturated group having 1 to 3 carbon atoms and 1 heteroatom in the parent chain ("C 1~3 In some embodiments, a heteroalkyl group is a saturated group having 1 to 2 carbon atoms and 1 heteroatom in the parent chain ("C 1~2In some embodiments, a heteroalkyl group is a saturated group having one carbon atom and one heteroatom ("C heteroalkyl"). In some embodiments, a heteroalkyl group, as defined herein, is a partially unsaturated group having one or more heteroatoms and at least one unsaturated carbon, e.g., a carbonyl group, in the parent chain. For example, a heteroalkyl group can include an amide or ester functionality in its parent chain such that one or more carbon atoms are unsaturated carbonyl groups. Unless otherwise specified, each heteroalkyl group is independently unsubstituted ("unsubstituted heteroalkyl") or substituted with one or more substituents ("substituted heteroalkyl"). In certain embodiments, a heteroalkyl group is an unsubstituted C 1~20 In certain embodiments, the heteroalkyl group is an unsubstituted C 1~10 In certain embodiments, the heteroalkyl group is a substituted C 1~20 In certain embodiments, the heteroalkyl group is an unsubstituted C 1~10 It is heteroalkyl.

[0071] The term "alkenyl" refers to the radical of a straight- or branched-chain hydrocarbon group having 2 to 10 carbon atoms and one or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 double bonds). In some embodiments, an alkenyl group has 2 to 9 carbon atoms ("C 2~9 In some embodiments, the alkenyl group has 2 to 8 carbon atoms ("C 2~8 In some embodiments, the alkenyl group has 2 to 7 carbon atoms ("C 2~7 In some embodiments, an alkenyl group has 2 to 6 carbon atoms ("C 2~6 In some embodiments, an alkenyl group has 2 to 5 carbon atoms ("C 2~5 In some embodiments, the alkenyl group has 2 to 4 carbon atoms ("C 2~4In some embodiments, the alkenyl group has 2 to 3 carbon atoms ("C 2~3 In some embodiments, the alkenyl group has two carbon atoms ("C2 alkenyl"). The one or more carbon-carbon double bonds can be internal (as in 2-butenyl) or terminal (as in 1-butenyl). C 2~4 Examples of alkenyl groups include ethenyl (C2), 1-propenyl (C3), 2-propenyl (C3), 1-butenyl (C4), 2-butenyl (C4), butadienyl (C4), and the like. 2~6 Examples of alkenyl groups include the above-mentioned C 2~4 Alkenyl groups include pentenyl (C5), pentadienyl (C5), hexenyl (C6), and the like. Additional examples of alkenyl include heptenyl (C7), octenyl (C8), octatrienyl (C8), and the like. Unless otherwise specified, each alkenyl group is independently unsubstituted ("unsubstituted alkenyl") or substituted with one or more substituents ("substituted alkenyl"). In certain embodiments, an alkenyl group is an unsubstituted C 2~10 In certain embodiments, the alkenyl group is a substituted C 2~10 Alkenyl groups have a C=C double bond with no specified configuration (e.g., -CH=CHCH3 or [ka] ) can be an (E)- or a (Z)-double bond.

[0072] The term "alkynyl" refers to the radical of a straight- or branched-chain hydrocarbon group having 2 to 10 carbon atoms and one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 triple bonds). 2~10 In some embodiments, an alkynyl group has 2 to 9 carbon atoms ("C 2~9 In some embodiments, an alkynyl group has 2 to 8 carbon atoms ("C 2~8In some embodiments, an alkynyl group has 2 to 7 carbon atoms ("C 2~7 In some embodiments, an alkynyl group has 2 to 6 carbon atoms ("C 2~6 In some embodiments, an alkynyl group has 2 to 5 carbon atoms ("C 2~5 In some embodiments, an alkynyl group has 2 to 4 carbon atoms ("C 2~4 In some embodiments, the alkynyl group has 2 to 3 carbon atoms ("C 2~3 In some embodiments, the alkynyl group has two carbon atoms ("C2 alkynyl"). The one or more carbon-carbon triple bonds can be internal (as in 2-butynyl) or terminal (as in 1-butynyl). C 2~4 Examples of alkynyl groups include, but are not limited to, ethynyl (C2), 1-propynyl (C3), 2-propynyl (C3), 1-butynyl (C4), 2-butynyl (C4), and the like. 2~6 Examples of alkenyl groups include the above-mentioned C 2~4 Alkynyl groups include pentynyl (C5), hexynyl (C6), and the like. Additional examples of alkynyl include heptynyl (C7), octynyl (C8), and the like. Unless otherwise specified, each alkynyl group is independently unsubstituted ("unsubstituted alkynyl") or substituted with one or more substituents ("substituted alkynyl"). In certain embodiments, an alkynyl group is an unsubstituted C 2~10 In certain embodiments, the alkynyl group is a substituted C 2~10 It is alkynyl.

[0073] The term "carbocyclyl" or "carbocyclic" refers to a ring system having 3 to 14 ring carbon atoms ("C 3~14 "Carbocyclyl" refers to a radical of a non-aromatic cyclic hydrocarbon group having 3 to 10 ring carbon atoms ("C 3~10In some embodiments, a carbocyclyl group has 3 to 8 ring carbon atoms ("C 3~8 In some embodiments, a carbocyclyl group has 3 to 7 ring carbon atoms ("C 3~7 In some embodiments, a carbocyclyl group has 3 to 6 ring carbon atoms ("C 3~6 In some embodiments, the carbocyclyl group has 4 to 6 ring carbon atoms ("C 4~6 In some embodiments, the carbocyclyl group has 5 to 6 ring carbon atoms ("C 5~6 In some embodiments, a carbocyclyl group has 5 to 10 ring carbon atoms ("C 5~10 carbocyclyl). Exemplary C 3~6 Carbocyclyl groups include, but are not limited to, cyclopropyl (C), cyclopropenyl (C), cyclobutyl (C), cyclobutenyl (C), cyclopentyl (C), cyclopentenyl (C), cyclohexyl (C), cyclohexenyl (C), cyclohexadienyl (C), and the like. 3~8 The carbocyclyl group includes, but is not limited to, the above-mentioned C 3~6 Examples include carbocyclyl groups, and cycloheptyl (C7), cycloheptenyl (C7), cycloheptadienyl (C7), cycloheptatrienyl (C7), cyclooctyl (C8), cyclooctenyl (C8), bicyclo[2.2.1]heptanyl (C7), bicyclo[2.2.2]octanyl (C8), and the like. 3~10 The carbocyclyl group includes, but is not limited to, the above-mentioned C 3-8 Carbocyclyl groups, and cyclononyl (C9), cyclononenyl (C9), cyclodecyl (C 10 ), cyclodecenyl (C 10 ), octahydro-1H-indenyl (C9), decahydronaphthalenyl (C 10 ), spiro[4.5]decanyl (C 10As the above examples illustrate, in certain embodiments, a carbocyclyl group is either monocyclic ("monocyclic carbocyclyl") or polycyclic (e.g., including fused, bridged, or spiro ring systems, such as bicyclic ("bicyclic carbocyclyl") or tricyclic ("tricyclic carbocyclyl") ring systems) and can be saturated or contain one or more carbon-carbon double or triple bonds. "Carbocyclyl" also encompasses ring systems in which a carbocyclyl ring, as defined above, is fused to one or more aryl or heteroaryl groups, where the point of attachment is on the carbocyclyl ring; in such cases, the carbon number continues to refer to the carbon number of the carbocyclyl ring. Unless otherwise specified, each carbocyclyl group is independently unsubstituted ("unsubstituted carbocyclyl") or substituted with one or more substituents ("substituted carbocyclyl"). In certain embodiments, the carbocyclyl group is an unsubstituted C 3~14 In certain embodiments, the carbocyclyl group is a substituted C 3~14 It is a carbocyclyl.

[0074] In some embodiments, "carbocyclyl" refers to a monocyclic saturated carbocyclyl group having 3 to 14 ring carbon atoms ("C 3~14 In some embodiments, a cycloalkyl group has 3 to 10 ring carbon atoms ("C 3~10 In some embodiments, a cycloalkyl group has 3 to 8 ring carbon atoms ("C 3~8 In some embodiments, a cycloalkyl group has 3 to 6 ring carbon atoms ("C 3~6 In some embodiments, a cycloalkyl group has 4 to 6 ring carbon atoms ("C 4~6 In some embodiments, a cycloalkyl group has 5 to 6 ring carbon atoms ("C 5~6 In some embodiments, a cycloalkyl group has 5 to 10 ring carbon atoms ("C 5~10 Cycloalkyl). C 5~6Examples of cycloalkyl groups include cyclopentyl (C5) and cyclohexyl (C5). 3~6 Examples of cycloalkyl groups include the above-mentioned C 5~6 Cycloalkyl groups include cyclopropyl (C3) and cyclobutyl (C4). 3~8 Examples of cycloalkyl groups include the above-mentioned C 3~6 Cycloalkyl groups include cycloalkyl groups, as well as cycloheptyl (C7) and cyclooctyl (C8). Unless otherwise specified, each cycloalkyl group is independently unsubstituted ("unsubstituted cycloalkyl") or substituted with one or more substituents ("substituted cycloalkyl"). In certain embodiments, cycloalkyl groups include unsubstituted C 3~14 In certain embodiments, the cycloalkyl group is a substituted C 3~14 It is cycloalkyl.

[0075] The term "heterocyclyl" or "heterocyclic" refers to the radical of a 3- to 14-membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("3- to 14-membered heterocyclyl"). In heterocyclyl groups having one or more nitrogen atoms, the point of attachment can be at a carbon or nitrogen atom, where valence allows. Heterocyclyl groups can be either monocyclic ("monocyclic heterocyclyl") or polycyclic (e.g., fused, bridged, or spiro ring systems, e.g., bicyclic ("bicyclic heterocyclyl") or tricyclic ("tricyclic heterocyclyl")) and can be saturated or contain one or more carbon-carbon double or triple bonds. Heterocyclyl polycyclic ring systems can contain one or more heteroatoms in one or both rings. "Heterocyclyl" also includes ring systems in which a heterocyclyl ring, as defined above, is fused to one or more carbocyclyl groups, where the point of attachment is on the carbocyclyl or heterocyclyl ring, or in which a heterocyclyl ring, as defined above, is fused to one or more aryl or heteroaryl groups, where the point of attachment is on the heterocyclyl ring; in such cases, the number of ring members continues to refer to the number of ring members in the heterocyclyl ring system. Unless otherwise specified, each heterocyclyl is independently unsubstituted ("unsubstituted heterocyclyl") or substituted with one or more substituents ("substituted heterocyclyl"). In certain embodiments, the heterocyclyl group is a 3- to 14-membered unsubstituted heterocyclyl. In certain embodiments, the heterocyclyl group is a 3- to 14-membered substituted heterocyclyl.

[0076] In some embodiments, a heterocyclyl group is a 5- to 10-membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur (a "5- to 10-membered heterocyclyl"). In some embodiments, a heterocyclyl group is a 5- to 8-membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur (a "5- to 8-membered heterocyclyl"). In some embodiments, a heterocyclyl group is a 5- to 6-membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur (a "5- to 6-membered heterocyclyl"). In some embodiments, a 5- to 6-membered heterocyclyl has 1 to 3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5- to 6-membered heterocyclyl has 1 to 2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5- to 6-membered heterocyclyl has 1 ring heteroatom selected from nitrogen, oxygen, and sulfur.

[0077] Exemplary 3-membered heterocyclyl groups having one heteroatom include, but are not limited to, aziridinyl, oxiranyl, and thiiranyl. Exemplary 4-membered heterocyclyl groups having one heteroatom include, but are not limited to, azetidinyl, oxetanyl, and thietanyl. Exemplary 5-membered heterocyclyl groups having one heteroatom include, but are not limited to, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl, and pyrrolyl-2,5-dione. Exemplary 5-membered heterocyclyl groups having two heteroatoms include, but are not limited to, dioxolanyl, oxathiolanyl, and dithiolanyl. Exemplary 5-membered heterocyclyl groups having three heteroatoms include, but are not limited to, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary 6-membered heterocyclyl groups having one heteroatom include, but are not limited to, piperidinyl, tetrahydropyranyl, dihydropyridinyl, and thianyl. Exemplary 6-membered heterocyclyl groups having two heteroatoms include, but are not limited to, piperazinyl, morpholinyl, dithianyl, and dioxanyl. Exemplary 6-membered heterocyclyl groups having three heteroatoms include, but are not limited to, triazinyl. Exemplary 7-membered heterocyclyl groups having one heteroatom include, but are not limited to, azepanyl, oxepanyl, and thiepanyl. Exemplary 8-membered heterocyclyl groups having one heteroatom include, but are not limited to, azocanyl, oxecanyl, and thiocanyl.Exemplary bicyclic heterocyclyl groups include, but are not limited to, indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, tetrahydrobenzothienyl, tetrahydrobenzofuranyl, tetrahydroindolyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, decahydroisoquinolinyl, octahydrochromenyl, octahydroisochromenyl, decahydronaphthyridinyl, decahydro-1,8-naphthyridinyl, octahydropyrrolo[3,2-b]pyrrole, indolinyl, phthalimidyl, naphthalimidyl, chromanyl, chromenyl, 1H-benzo[e][1,4]diphenylmethyl ... azepinyl, 1,4,5,7-tetrahydropyrano[3,4-b]pyrrolyl, 5,6-dihydro-4H-furo[3,2-b]pyrrolyl, 6,7-dihydro-5H-furo[3,2-b]pyranyl, 5,7-dihydro-4H-thieno[2,3-c]pyranyl, 2,3-dihydro-1H-pyrrolo[2,3-b]pyridinyl, 2,3-dihydrofuro[2,3-b]pyridinyl, 4,5,6,7-tetrahydro-1H-pyrrolo[2,3-b]pyridinyl, 4,5,6,7-tetrahydrofuro[3,2-c]pyridinyl, 4,5,6,7-tetrahydrothieno[3,2-b]pyridinyl, 1,2,3,4-tetrahydro-1,6-naphthyridinyl, and the like.

[0078] The term "aryl" refers to a radical of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 pi electrons shared by the ring system) having 6 to 14 ring carbon atoms and 0 heteroatoms provided in the aromatic ring system ("C 6~14 In some embodiments, an aryl group has 6 ring carbon atoms ("C aryl"; e.g., phenyl). In some embodiments, an aryl group has 10 ring carbon atoms ("C 10 aryl"; e.g., naphthyl, such as 1-naphthyl and 2-naphthyl). In some embodiments, the aryl group has 14 ring carbon atoms ("C 14"Aryl"; e.g., anthracyl). "Aryl" also encompasses ring systems in which an aryl ring, as defined above, is fused with one or more carbocyclyl or heterocyclyl groups, where the radical or point of attachment is on the aryl ring, and in such cases the number of carbon atoms continues to refer to the number of carbon atoms in the aryl ring system. Unless otherwise specified, each aryl group is independently unsubstituted ("unsubstituted aryl") or substituted with one or more substituents ("substituted aryl"). In certain embodiments, an aryl group is an unsubstituted C 6~14 In certain embodiments, the aryl group is a substituted C 6~14 It is aryl.

[0079] The term "heteroaryl" refers to a radical of a 5-14-membered monocyclic or polycyclic (e.g., bicyclic, tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 pi-electrons shared by the ring system) having ring carbon atoms and 1-4 ring heteroatoms provided in the aromatic ring system, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-14-membered heteroaryl"). In heteroaryl groups having one or more nitrogen atoms, the point of attachment can be at a carbon or nitrogen atom, where valency permits. Heteroaryl polycyclic ring systems can contain one or more heteroatoms in one or both rings. "Heteroaryl" encompasses ring systems in which a heteroaryl ring, as defined above, is fused to one or more carbocyclyl or heterocyclyl groups, where the point of attachment is on the heteroaryl ring; in such cases, the number of ring members continues to refer to the number of ring members in the heteroaryl ring system. "Heteroaryl" also includes ring systems in which a heteroaryl ring, as defined above, is fused to one or more aryl groups, where the point of attachment is at either the aryl or heteroaryl ring; in such cases, the number of ring members refers to the number of ring members in the fused polycyclic (aryl / heteroaryl) ring system. In polycyclic heteroaryl groups in which one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl, etc.), the point of attachment can be at either ring, i.e., either the ring with a heteroatom (e.g., 2-indolyl) or the ring without a heteroatom (e.g., 5-indolyl).

[0080] In some embodiments, a heteroaryl group is a 5- to 10-membered aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms provided in the aromatic ring system, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5- to 10-membered heteroaryl"). In some embodiments, a heteroaryl group is a 5- to 8-membered aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms provided in the aromatic ring system, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5- to 8-membered heteroaryl"). In some embodiments, a heteroaryl group is a 5- to 6-membered aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms provided in the aromatic ring system, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5- to 6-membered heteroaryl"). In some embodiments, a 5- to 6-membered heteroaryl has 1 to 3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, a 5- to 6-membered heteroaryl has 1 to 2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, a 5- to 6-membered heteroaryl has 1 ring heteroatom selected from nitrogen, oxygen, and sulfur. Unless otherwise specified, each heteroaryl group is independently unsubstituted ("unsubstituted heteroaryl") or substituted with one or more substituents ("substituted heteroaryl"). In certain embodiments, a heteroaryl group is a 5- to 14-membered unsubstituted heteroaryl. In certain embodiments, a heteroaryl group is a 5- to 14-membered substituted heteroaryl.

[0081] Exemplary 5-membered heteroaryl groups having one heteroatom include, but are not limited to, pyrrolyl, furanyl, and thiophenyl. Exemplary 5-membered heteroaryl groups having two heteroatoms include, but are not limited to, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5-membered heteroaryl groups having three heteroatoms include, but are not limited to, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary 5-membered heteroaryl groups having four heteroatoms include, but are not limited to, tetrazolyl. Exemplary 6-membered heteroaryl groups having one heteroatom include, but are not limited to, pyridinyl. Exemplary 6-membered heteroaryl groups having two heteroatoms include, but are not limited to, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary 6-membered heteroaryl groups having three or four heteroatoms include, but are not limited to, triazinyl and tetrazinyl, respectively. Exemplary 7-membered heteroaryl groups having one heteroatom include, but are not limited to, azepinyl, oxepinyl, and thiepinyl. Exemplary 5,6-bicyclic heteroaryl groups include, but are not limited to, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzothiazolyl, benzoisothiazolyl, benzothiadiazolyl, indolizinyl, and purinyl. Exemplary 6,6-bicyclic heteroaryl groups include, but are not limited to, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl. Exemplary tricyclic heteroaryl groups include, but are not limited to, phenanthridinyl, dibenzofuranyl, carbazolyl, acridinyl, phenothiazinyl, phenoxazinyl, and phenazinyl.

[0082] The addition of the suffix "-ene" to a group indicates that the group is a divalent moiety, for example, alkylene is a divalent moiety of alkyl, alkenylene is a divalent moiety of alkenyl, alkynylene is a divalent moiety of alkynyl, heteroalkylene is a divalent moiety of heteroalkyl, heteroalkenylene is a divalent moiety of heteroalkenyl, heteroalkynylene is a divalent moiety of heteroalkynyl, carbocyclylene is a divalent moiety of carbocyclyl, heterocyclylene is a divalent moiety of heterocyclyl, arylene is a divalent moiety of aryl, and heteroarylene is a divalent moiety of heteroaryl.

[0083] Unless explicitly stated otherwise, a group is optionally substituted. The term "optionally substituted" refers to substituted or unsubstituted. In certain embodiments, alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl groups are optionally substituted. "Optionally substituted" refers to a group that may be substituted or unsubstituted (e.g., a "substituted" or "unsubstituted" alkyl, a "substituted" or "unsubstituted" alkenyl, a "substituted" or "unsubstituted" alkynyl, a "substituted" or "unsubstituted" heteroalkyl, a "substituted" or "unsubstituted" heteroalkenyl, a "substituted" or "unsubstituted" heteroalkynyl, a "substituted" or "unsubstituted" carbocyclyl, a "substituted" or "unsubstituted" heterocyclyl, a "substituted" or "unsubstituted" aryl, or a "substituted" or "unsubstituted" heteroaryl group). In general, the term "substituted" means that at least one hydrogen atom present in a group has been replaced with an acceptable substituent, e.g., a substituent that, upon substitution, results in a stable compound, e.g., a compound that does not spontaneously undergo transformation, such as by rearrangement, cyclization, elimination, or other reaction. Unless otherwise specified, a "substituted" group has a substituent at one or more substitutable positions of the group; when more than one position in any given structure is substituted, the substituents can be the same or different at each position. The term "substituted" is intended to encompass substitution with all permissible substituents of organic compounds, including any of the substituents described herein that result in the formation of a stable compound. The present disclosure contemplates all such combinations that result in a stable compound. For purposes of this disclosure, heteroatoms such as nitrogen can have hydrogen substituents and / or any suitable substituents described herein that satisfy the valence of the heteroatom and result in the formation of a stable moiety. The present disclosure is not intended to be limited in any way to the exemplary substituents described herein.

[0084] When substituted, exemplary carbon atom substituents include, but are not limited to, halogen, —CN, —NO 2 , —N 3 , —SO 2 H, —SO 3 H, —OH, —ORaa 、-ON(R bb )2、-N(R bb )2、-N(R bb )3 + X - 、-N(OR cc )R bb 、-SH、-SR aa 、-SSR cc 、-C(=O)R aa 、-CO2H、-CHO、-C(OR cc )3、-CO2R aa 、-OC(=O)R aa 、-OCO2R aa 、-C(=O)N(R bb )2、-OC(=O)N(R bb )2、-NR bb C(=O)R aa 、-NR bb CO2R aa 、-NR bb C(=O)N(R bb )2、-C(=NR bb )R aa 、-C(=NR bb )OR aa 、-OC(=NR bb )R aa 、-OC(=NR bb )OR aa 、-C(=NR bb )N(R bb )2、-OC(=NR bb )N(R bb )2、-NR bb C(=NR bb )N(R bb )2、-C(=O)NR bb SO2R aa 、-NR bb SO2R aa 、-SO2N(R bb )2、-SO2R aa 、-SO2OR aa 、-OSO2R aa 、-S(=O)R aa 、-OS(=O)R aa 、-Si(R aa )3、-OSi(R aa )3-C(=S)N(R bb )2、-C(=O)SRaa , -C(=S)SR aa , -SC(=S)SR aa , -SC(=O)SR aa , -OC(=O)SR aa , -SC(=O)OR aa , -SC(=O)R aa , -P(=O)(R aa )2, -P(=O)(OR cc )2, -OP(=O)(R aa )2, -OP(=O)(OR cc )2, -P(=O)(N(R bb )2)2, -OP(=O)(N(R bb )2)2, -NR bb P(=O)(R aa )2, -NR bb P(=O)(OR cc )2, -NR bb P(=O)(N(R bb )2)2, -P(R cc )2, -P(OR cc )2, -P(R cc )3 + X - , -P(OR cc )3 + X - , -P(R cc )4, -P(OR cc )4, -OP(R cc )2, -OP(R cc )3 + X - , -OP(OR cc )2, -OP(OR cc )3 + X - , -OP(R cc )4, -OP(OR cc )4, -B(R aa )2, -B(OR cc )2, -BR aa (OR cc ), C 1~10 Alkyl, C 1~10 Perhaloalkyl, C 2~10 Alkenyl, C 2~10 Alkynyl, C 1~10 Heteroalkyl, C 2~10 Heteroalkenyl, C 2~10Heteroalkynyl, C 3~10 Carbocyclyl, 3- to 14-membered heterocyclyl, C 6~14 and 5- to 14-membered heteroaryl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl independently has 0, 1, 2, 3, 4, or 5 R dd is substituted with an X group - is a counterion, or Or two geminal hydrogens on a carbon atom can be bonded to the groups: =O, =S, =NN(R bb )2, =NNR bb C(=O)R aa , =NNR bb C(=O)OR aa , =NNR bb S(=O)2R aa , =NR bb , or =NOR cc is replaced by Each R aa independently, C 1~10 Alkyl, C 1~10 Perhaloalkyl, C 2~10 Alkenyl, C 2~10 Alkynyl, C 1~10 Heteroalkyl, C 2~10 Heteroalkenyl, C 2~10 Heteroalkynyl, C 3~10 Carbocyclyl, 3- to 14-membered heterocyclyl, C 6~14 aryl, and 5- to 14-membered heteroaryl, or two R aa The groups are linked to form a 3- to 14-membered heterocyclyl or 5- to 14-membered heteroaryl ring, where each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl independently has 0, 1, 2, 3, 4, or 5 R dd is substituted with a group, Each R bb are independently hydrogen, -OH, or -OR aa , -N(R cc )2, -CN, -C(=O)Raa , -C(=O)N(R cc )2, -CO2R aa , -SO2R aa , -C(=NR cc ) OR aa , -C(=NR cc )N(R cc )2, -SO2N(R cc )2, -SO2R cc , -SO2OR cc , -SOR aa , -C(=S)N(R cc )2, -C(=O)SR cc , -C(=S)SR cc , -P(=O)(R aa )2, -P(=O)(OR cc )2, -P(=O)(N(R cc )2)2, C 1~10 Alkyl, C 1~10 Perhaloalkyl, C 2~10 Alkenyl, C 2~10 Alkynyl, C 1~10 Heteroalkyl, C 2~10 Heteroalkenyl, C 2~10 Heteroalkynyl, C 3~10 Carbocyclyl, 3- to 14-membered heterocyclyl, C 6~14 aryl, and 5- to 14-membered heteroaryl, or two R bb The groups are linked to form a 3- to 14-membered heterocyclyl or 5- to 14-membered heteroaryl ring, where each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl independently has 0, 1, 2, 3, 4, or 5 R dd is substituted with an X group - is the counterion, Each R cc are independently hydrogen, C 1~10 Alkyl, C 1~10 Perhaloalkyl, C 2~10 Alkenyl, C 2~10 Alkynyl, C 1~10 Heteroalkyl, C 2~10 Heteroalkenyl, C 2~10Heteroalkynyl, C 3~10 Carbocyclyl, 3- to 14-membered heterocyclyl, C 6~14 aryl, and 5- to 14-membered heteroaryl, or two R cc The groups are linked to form a 3- to 14-membered heterocyclyl or 5- to 14-membered heteroaryl ring, where each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl independently has 0, 1, 2, 3, 4, or 5 R dd is substituted with a group, Each R dd are halogens, -CN, -NO2, -N3, -SO2H, -SO3H, -OH, -OR ee , -ON(R ff )2, -N(R ff )2, -N(R ff )3 + X - , -N(OR ee )R ff , -SH, -SR ee , -SSR ee , -C(=O)R ee , -CO2H, -CO2R ee , -OC(=O)R ee , -OCO2R ee , -C(=O)N(R ff )2, -OC(=O)N(R ff )2, -NR ff C(=O)R ee , -NR ff CO2R ee , -NR ff C(=O)N(R ff )2, -C(=NR ff ) OR ee , -OC(=NR ff )R ee , -OC(=NR ff ) OR ee , -C(=NR ff )N(R ff )2, -OC(=NR ff )N(R ff )2, -NR ff C(=NR ff )N(Rff )2, -NR ff SO2R ee , -SO2N(R ff )2, -SO2R ee , -SO2OR ee , -OSO2R ee , -S(=O)R ee , -Si(R ee )3, -OSi(R ee )3, -C(=S)N(R ff )2, -C(=O)SR ee , -C(=S)SR ee , -SC(=S)SR ee , -P(=O)(OR ee )2, -P(=O)(R ee )2, -OP(=O)(R ee )2, -OP(=O)(OR ee )2, C 1~6 Alkyl, C 1~6 Perhaloalkyl, C 2~6 Alkenyl, C 2~6 Alkynyl, C 1~6 Heteroalkyl, C 2~6 Heteroalkenyl, C 2~6 Heteroalkynyl, C 3~10 Carbocyclyl, 3-10 membered heterocyclyl, C 6~10 aryl, 5- to 10-membered heteroaryl, or two geminal R dd The substituents may be linked to form =O or =S, where each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl independently has 0, 1, 2, 3, 4, or 5 R gg is substituted with an X group - is the counterion, Each R ee independently, C 1~6 Alkyl, C 1~6 Perhaloalkyl, C 2~6 Alkenyl, C 2~6 Alkynyl, C 1~6 Heteroalkyl, C 2~6 Heteroalkenyl, C 2~6Heteroalkynyl, C 3~10 Carbocyclyl, C 6~10 aryl, 3- to 10-membered heterocyclyl, and 3- to 10-membered heteroaryl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently selected from 0, 1, 2, 3, 4, or 5 R gg is substituted with a group, Each R ff are independently hydrogen, C 1~6 Alkyl, C 1~6 Perhaloalkyl, C 2~6 Alkenyl, C 2~6 Alkynyl, C 1~6 Heteroalkyl, C 2~6 Heteroalkenyl, C 2~6 Heteroalkynyl, C 3~10 Carbocyclyl, 3-10 membered heterocyclyl, C 6~10 aryl, and 5- to 10-membered heteroaryl, or two R ff The groups are linked to form a 3- to 10-membered heterocyclyl or 5- to 10-membered heteroaryl ring, where each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl independently has 0, 1, 2, 3, 4, or 5 R gg is substituted with a group,

[0085] Each R gg are independently halogen, -CN, -NO2, -N3, -SO2H, -SO3H, -OH, -OC 1~6 Alkyl, -ON(C 1~6 alkyl)2, -N(C 1~6 alkyl)2, -N(C 1~6 Alkyl)3 + X - , -NH(C 1~6 alkyl)2 + X - , -NH2(C 1~6 alkyl) + X - , -NH3 +X - , -N(OC 1~6 Alkyl)(C 1~6 alkyl), -N(OH)(C 1~6 alkyl), -NH(OH), -SH, -SC 1~6 Alkyl, -SS(C 1~6 alkyl), -C(=O)(C 1~6 alkyl), -CO2H, -CO2(C 1~6 alkyl), -OC(=O)(C 1~6 alkyl), -OCO2(C 1~6 alkyl), -C(=O)NH2, -C(=O)N(C 1~6 alkyl)2, -OC(=O)NH(C 1~6 alkyl), -NHC(=O)(C 1~6 alkyl), -N(C 1~6 alkyl)C(=O)(C 1~6 alkyl), -NHCO2(C 1~6 alkyl), -NHC(=O)N(C 1~6 alkyl)2, -NHC(=O)NH(C 1~6 alkyl), -NHC(=O)NH2, -C(=NH)O(C 1~6 alkyl), -OC(=NH)(C 1~6 alkyl), -OC(=NH)OC 1~6 Alkyl, -C(=NH)N(C 1~6 alkyl)2, -C(=NH)NH(C 1~6 alkyl), -C(=NH)NH2, -OC(=NH)N(C 1~6 alkyl)2, -OC(=NH)NH(C 1~6 alkyl), -OC(=NH)NH2, -NHC(=NH)N(C 1~6 alkyl)2, -NHC(=NH)NH2, -NHSO2(C 1~6 alkyl), -SO2N(C 1~6 alkyl)2, -SO2NH(C 1~6 alkyl), -SO2NH2, -SO2(C 1~6 alkyl), -SO2O(C 1~6 alkyl), -OSO2(C 1~6 alkyl), -SO(C 1~6 alkyl), -Si(C 1~6 alkyl)3, -OSi(C1~6 alkyl)3-C(=S)N(C 1~6 alkyl)2, C(=S)NH(C 1~6 alkyl), C(=S)NH2, -C(=O)S(C 1~6 alkyl), -C(=S)SC 1~6 Alkyl, -SC(=S)SC 1~6 Alkyl, -P(=O)(OC 1~6 alkyl)2, -P(=O)(C 1~6 alkyl)2, -OP(=O)(C 1~6 alkyl)2, -OP(=O)(OC 1~6 Alkyl)2, C 1~6 Alkyl, C 1~6 Perhaloalkyl, C 2~6 Alkenyl, C 2~6 Alkynyl, C 1~6 Heteroalkyl, C 2~6 Heteroalkenyl, C 2~6 Heteroalkynyl, C 3~10 Carbocyclyl, C 6~10 aryl, 3- to 10-membered heterocyclyl, 5- to 10-membered heteroaryl, or two geminal R gg The substituents are linked to form =O or =S, where X - is the counterion.

[0086] Before the methods and compositions of the present disclosure are described in more detail, it is to be understood that the methods and compositions of the present invention are not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present methods and compositions will be limited only by the appended claims.

[0087] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Exemplary methods and materials are described below, but methods and materials similar or equivalent to those described herein may be used in the practice of the present invention and will be apparent to those skilled in the art. All publications and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. The materials, methods, and examples are illustrative only and are not intended to be limiting.

[0088] It will be understood that certain features of the methods and compositions of the invention, which are described in separate embodiments for clarity, may also be provided in combination in a single embodiment. Conversely, various features of the methods and compositions of the invention, which are described in a single embodiment for brevity, may be provided separately or in any suitable subcombination. All combinations of embodiments are specifically embraced by the application and disclosed herein to the extent such combinations encompass operable processes and / or compositions just as if every combination were individually and explicitly disclosed. In addition, all subcombinations recited in embodiments describing such variables are also specifically embraced by the methods and compositions of the invention and disclosed herein just as if every such subcombination were individually and explicitly disclosed herein.

[0089] As will be apparent to those skilled in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has distinct components and features which may be readily distinguished from, or combined with the features of, any of the other several embodiments without departing from the scope or spirit of the inventive method. Any recited method may be carried out in the order of events recited or in any other order which is logically possible.

[0090] As used herein, the term "salt" refers to any salt, including pharmaceutically acceptable salts. Salts include ionic compounds formed by the neutralization reaction of an acid and a base. A salt is composed of one or more cations (positively charged ions) and one or more anions (negative ions), such that the salt is electrically neutral (has no net charge). Salts of the compounds of the present invention include those derived from inorganic and organic acids and bases. Examples of acid addition salts are salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods known in the art, such as ion exchange. Other salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobiolate, and hydroxybenzoates. Salts derived from suitable bases include alkali metal, alkaline earth metal, ammonium, and N(C1-4 alkyl) salts. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.Further salts include ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkyl sulfonates, and aryl sulfonates.

[0091] The term "solvate" refers to a compound or its salt form that is associated with a solvent, usually by solvolysis. This physical association may involve hydrogen bonding. Conventional solvents include water, methanol, ethanol, acetic acid, DMSO, THF, diethyl ether, and the like. The compounds described herein may be prepared, for example, in crystalline form, and may be solvated. Suitable solvates include pharmaceutically acceptable solvates, including both stoichiometric and non-stoichiometric solvates. In some cases, the solvate may be capable of isolation, for example, when one or more solvent molecules are incorporated into the crystal lattice of a crystalline solid. "Solvate" encompasses both solution-phase and isolatable solvates. Representative solvates include hydrates, ethanolates, and methanolates.

[0092] The term "hydrate" refers to a compound associated with water. Typically, the number of water molecules contained in a hydrate of a compound is a fixed ratio to the number of compound molecules in the hydrate. Thus, a hydrate of a compound can be represented, for example, by the general formula R×xH2O, where R is the compound and x is a number greater than 0. A given compound can form two or more types of hydrates, including, for example, a monohydrate (x is 1), a lower-order hydrate (x is a number greater than 0 and less than 1 (e.g., hemihydrate (R×0.5H2O))), and a polyhydrate (x is a number greater than 1 (e.g., dihydrate (R×2H2O) and hexahydrate (R×6H2O))).

[0093] The term "tautomer" or "tautomerism" refers to two or more interconvertible compounds resulting from at least one formal migration of a hydrogen atom and at least one change in valency (e.g., from a single bond to a double bond, a triple bond to a double bond, or vice versa). The exact ratio of tautomers depends on several factors, including temperature, solvent, and pH. Tautomerization (i.e., the reaction resulting in a tautomeric pair) can be catalyzed by acid or base. Exemplary tautomerizations include keto to enol, amide to imide, lactam to lactim, enamine to imine, and enamine to (different) enamine.

[0094] It should also be understood that compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space are referred to as "isomers." Isomers that differ in the arrangement of their atoms in space are referred to as "stereoisomers." Stereoisomers that are not mirror images of one another are referred to as "diastereomers," and stereoisomers that are non-superimposable mirror images of each other are referred to as "enantiomers." When a compound has an asymmetric center, for example, the compound is bonded to four different groups, a pair of enantiomers is possible. Enantiomers can be characterized by the absolute configuration of their asymmetric center and are described by the R- and S-ordering rules of Cahn and Prelog, or by the way the molecule rotates the plane of polarized light and is designated as dextrorotatory or levorotatory (i.e., (+) or (-) isomer, respectively). Chiral compounds can exist as individual enantiomers or as mixtures thereof. A mixture containing equal proportions of enantiomers is referred to as a "racemic mixture."

[0095] Polymorph: The term "polymorph" refers to a crystalline form of a compound (or its salt, hydrate, or solvate) in a particular crystal packing arrangement. All polymorphs have the same elemental composition. Different crystalline forms usually have different X-ray diffraction patterns, infrared spectra, melting points, density, hardness, crystal shape, optical and electrical properties, stability, and solubility. Depending on the recrystallization solvent, crystallization rate, storage temperature, and other factors, one crystalline form may predominate. Various polymorphs of a compound can be prepared by crystallization under different conditions.

[0096] The term "crystalline" or "crystalline form" refers to a solid form that exhibits substantial three-dimensional order. In certain embodiments, a solid crystalline form is a solid form that is substantially non-amorphous. In certain embodiments, the X-ray powder diffraction (XRPD) pattern of the crystalline form comprises one or more sharp, distinct peaks.

[0097] The term "co-crystal" refers to a crystal structure comprising at least two different components (e.g., a compound disclosed herein and an acid), where each of the components is independently an atom, ion, or molecule. In certain embodiments, neither component is a solvent. In certain embodiments, at least one component is a solvent. A co-crystal of a compound disclosed herein and an acid differs from a salt formed from a compound disclosed herein and an acid. In the case of a salt, the compound disclosed herein is complexed with the acid in such a way that proton transfer (e.g., complete proton transfer) from the acid to the compound disclosed herein occurs at room temperature. However, in the case of a co-crystal, the compound disclosed herein is complexed with the acid in such a way that proton transfer from the acid to the compound disclosed herein does not readily occur at room temperature. In certain embodiments, no proton transfer occurs from the acid to the compound disclosed herein in the co-crystal. In certain embodiments, partial proton transfer occurs from the acid to the compound disclosed herein in the co-crystal. Co-crystals can be useful to improve the properties (e.g., solubility, stability, ease of formulation, or ease of formulation) of the compounds disclosed herein.

[0098] The term "isotope" refers to varieties of a particular chemical element such that all isotopes of a given element share the same number of protons in each atom of that element, but the isotopes differ in the number of neutrons.

[0099] "Subjects" to which administration is contemplated include, but are not limited to, humans (i.e., male or female of any age group, e.g., pediatric subjects (e.g., infants, children, adolescents) or adult subjects (e.g., young adults, middle-aged adults, or elderly adults)) and / or non-human animals, e.g., mammals (e.g., primates (e.g., cynomolgus monkeys, rhesus monkeys); commercially important mammals, e.g., cows, pigs, horses, sheep, goats, cats, and / or dogs) and birds (e.g., commercially important birds, e.g., chickens, ducks, geese, and / or turkeys). In certain embodiments, the animal is a mammal. The animal can be male or female, and at any stage of development. The non-human animal can be a transgenic animal. "Patient" refers to a human subject in need of treatment for a disease.

[0100] The terms "administer," "administering," or "administration" refer to implanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing a compound of the present invention or a pharmaceutical composition thereof.

[0101] The terms "treatment," "treat," and "treating" refer to reversing, alleviating, delaying the onset of, or inhibiting the progression of a "pathology" as described herein (e.g., a disease, disorder, or condition, or one or more signs or symptoms thereof). In some embodiments, treatment may be administered after one or more signs or symptoms have developed or been observed. In other embodiments, treatment may be administered in the absence of signs or symptoms of a disease or condition. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., taking into account symptom history and / or genetic or other susceptibility factors). Treatment may be continued after symptoms have resolved, e.g., to delay or prevent recurrence.

[0102] The term "biological sample" refers to any sample, including tissue samples (e.g., tissue sections and needle biopsies of tissue); cell samples (e.g., cytological smears (e.g., Pap smears or blood smears) or samples of cells obtained by microdissection); whole organism samples (e.g., yeast or bacterial samples); or cell fractions, debris, or organelles (e.g., obtained by lysing cells and centrifuging or otherwise separating their components). Other examples of biological samples include blood, serum, urine, semen, feces, cerebrospinal fluid, interstitial fluid, mucus, tears, sweat, pus, biopsy tissue (e.g., obtained by surgical or needle biopsy), nipple aspirate, breast milk, vaginal fluid, saliva, swabs (e.g., oral swabs), or any substance containing biomolecules derived from a primary biological sample.

[0103] Characteristics of nucleic acids As described elsewhere herein, the present disclosure provides pharmaceutical compositions comprising modified nucleic acids comprising glycan moieties. As used herein, the term "modified nucleic acid" refers to a nucleic acid that has been chemically modified in one or more ways compared to a naturally occurring nucleic acid.

[0104] In some embodiments, the modified nucleic acid is modified to allow conjugation to a glycan moiety of a nucleic acid. In some embodiments, the modified nucleic acid comprises a non-nucleotide chemical handle that allows conjugation to a glycan moiety of a nucleic acid. In some embodiments, the modified nucleic acid comprises a click chemistry handle that allows conjugation to a glycan moiety that comprises a second click chemistry handle. In some embodiments, the modified nucleic acid comprises a click chemistry handle attached to a base of a nucleotide. In some embodiments, the modified nucleic acid comprises a linear nucleic acid, the modified nucleic acid comprises a click chemistry handle attached to the end of the polynucleotide chain. In some embodiments, the modified nucleic acid comprises a click chemistry handle attached to the backbone of the nucleic acid.

[0105] In some embodiments, modified nucleic acids are modified to provide increased stability of the nucleic acid compared to a naturally occurring version of the analogous nucleic acid. In some embodiments, the present disclosure contemplates any sugar, backbone, and base modifications known in the art for creating modified nucleic acids with increased stability compared to the corresponding unmodified nucleic acid. In some embodiments, modified nucleic acids include at least one chemical modification described in Ochoa, et al., Molecules 2020, 25(20), 4659, which is incorporated herein by reference in its entirety. For example, modified nucleic acids can include at least one modification described by Ochoa, et al. in Figure 1 and Table 1 disclosed therein.

[0106] In some embodiments, the modified nucleic acid is an siRNA comprising a modified backbone.

[0107] In some embodiments, the modified nucleic acid is modified to minimize immune response. For example, the modified nucleic acid may be a modified mRNA that contains one or more chemical modifications that result in a reduced immunogenic response when administered to a subject compared to unmodified mRNA.

[0108] In some embodiments, the modified nucleic acid is a circular RNA, where the circular RNA is modified compared to naturally occurring RNA by being self-ligated and lacking a cap or tail. In some embodiments, the modified nucleic acid is a capped RNA, whereby the 5' and / or 3' ends are capped by chemical modification.

[0109] In some embodiments, modified nucleic acids comprise non-natural nucleotides. Examples of modified nucleotides (e.g., non-natural nucleotides) include, but are not limited to, diaminopurine, S 2 T, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5- Methoxyaminomethyl-2-thiouracil, β-D-mannosylqueuosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-D46-isopentenyladenine, uracil-5-oxyacetic acid(v), wybutoxocine, pseudouracil, queuosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine.

[0110] In some embodiments, the modified nucleic acid comprises at least one non-natural nucleotide. In some embodiments, at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 95% of the bases are modified to be non-natural. In some embodiments, about 100% or all of the bases are modified.

[0111] In some embodiments, the modified nucleic acid comprises a modification to at least one phosphate group, hi some embodiments, at least one of the phosphate linkages is phosphorothioate.

[0112] In some embodiments, the modified nucleic acid comprises a modification in at least one sugar group. In some embodiments, the modified nucleic acid comprises at least one 2-fluororibose. In some embodiments, the modified nucleic acid comprises at least one 2-methoxyribose.

[0113] In some embodiments, the modified nucleic acid does not contain any non-natural nucleotides, for example, the modified nucleic acid includes a nucleic acid portion that contains only naturally occurring nucleotides, and the modified nucleic acid is modified only in that the nucleic acid portion is conjugated to a glycan moiety.

[0114] In some embodiments, the modified nucleic acid comprises modified RNA or modified DNA.

[0115] In some embodiments, the pharmaceutical composition comprises a modified nucleic acid that is a naked modified nucleic acid. As used herein, the term "naked" refers to a modified nucleic acid that is not formulated in a nanoparticle, such as, but not limited to, a lipid nanoparticle.

[0116] In some embodiments, the modified nucleic acid comprises about 15, about 20, about 25, about 30, about 50, about 100, about 500, about 1000, about 1500, about 2000, about 2500, about 3000, about 4000, about 5000, about 6000, about 7000, about 8000, about 9000, or about 10000 nucleotides, or any number and range therebetween. In some embodiments, the modified nucleic acid comprises at least about 15, at least about 20, at least about 25, at least about 30, at least about 50, at least about 100, at least about 500, at least about 1000, at least about 1500, at least about 2000, at least about 2500, at least about 3000, at least about 4000, at least about 5000, at least about 6000, at least about 7000, at least about 8000, at least about 9000, or at least about 10,000 nucleotides. In some embodiments, the modified nucleic acid comprises more than 10,000 nucleotides. In some embodiments, the modified nucleic acid contains fewer than about 15, fewer than about 20, fewer than about 25, fewer than about 30, fewer than about 50, fewer than about 100, fewer than about 500, fewer than about 1000, fewer than about 1500, fewer than about 2000, fewer than about 2500, fewer than about 3000, fewer than about 4000, fewer than about 5000, fewer than about 6000, fewer than about 7000, fewer than about 8000, fewer than about 9000, or fewer than about 10000 nucleotides.

[0117] In some embodiments, the modified nucleic acid comprises one or more non-natural nucleotides. In some embodiments, the modified nucleic acid comprises one or more non-natural or modified nucleotides that have been modified so that they can form a covalent bond between the modified nucleic acid and the glycan moiety. The one or more modified nucleotides that allow for conjugation to a glycan moiety can be found at any position in the nucleic acid. In certain embodiments, the number of glycan-modified nucleotides varies. In certain embodiments, the number of glycan-modified nucleotides is 1. In other embodiments, the number of glycan-modified nucleotides ranges from one glycan-modified nucleotide to all glycan-modified nucleotides. In other embodiments, the number of glycan-modified nucleotides ranges from one glycan-modified nucleotide to all glycan-modified nucleotides, as well as any ranges and individual values ​​therebetween. In certain embodiments, the number of glycan-modified nucleotides is 2. In certain embodiments, the number of glycan-modified nucleotides is 3. In certain embodiments, the number of glycan-modified nucleotides is 5. In certain embodiments, the number of glycan-modified nucleotides is 10. In some embodiments, the modified nucleic acid comprises at least one chemically modified nitrogenous base, hi some embodiments, the modified nucleic acid comprises two, three, four, five, or more chemically modified nitrogenous bases.

[0118] In some embodiments, modified nucleic acids comprise modified RNA. Throughout this disclosure, in any embodiment described herein, when such an embodiment refers to a modified nucleic acid, it is understood that the embodiment is also applicable to modified RNA. The modified RNA can be a whole hairpin RNA or short hairpin RNA (shRNA), microRNA (miRNA), guide RNA (gRNA), transfer RNA (tRNA), antisense RNA (asRNA), heterologous nuclear RNA (hnRNA), coding RNA, non-coding RNA (ncRNA), long non-coding RNA (long ncRNA or lncRNA), satellite RNA, viral satellite RNA, signal recognition particle RNA, small cytoplasmic RNA, small nuclear RNA (snRNA), ribosomal RNA (rRNA), Piwi-interacting RNA (piRNA), polyinosinic acid, ribozyme, flexizyme, small nucleolar RNA (snoRNA), splice leader RNA, viral RNA, viral satellite RNA, circular RNA, naked RNA, extracellular RNA (exRNA), Cajal body-specific RNA (scaRNA), Xist RNA, or HOTAIR RNA. In some embodiments, the modified nucleic acid comprises a modified RNA comprising a microRNA-binding moiety. In some embodiments, the modified RNA comprises a sequence encoding a polypeptide. In some embodiments, the modified RNA is naked modified RNA. In some embodiments, the modified RNA is linear RNA. In some embodiments, the modified RNA is circular RNA. In some embodiments, the modified RNA is mRNA. In some embodiments, the modified RNA is miRNA.

[0119] In some embodiments, the glycoRNA comprises a sequence encoding a chimeric antigen receptor. The chimeric antigen receptor may comprise an antigen-binding domain, a transmembrane domain, and an intracellular domain. In some embodiments, the antigen-binding protein comprises an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the antigen-binding domain is linked to a transmembrane domain, and the transmembrane domain is linked to an intracellular signaling domain to produce a chimeric antigen receptor. In some embodiments, the antigen-binding domain binds to a tumor antigen, a tolerogen, or a pathogen antigen, or the antigen is a tumor antigen or a pathogen antigen. In some embodiments, the antigen-binding domain is an antibody or antibody fragment thereof (e.g., scFv, Fv, Fab, dAb). In some embodiments, the antigen-binding domain is a bispecific antibody. In some embodiments, the bispecific antibody has a first immunoglobulin variable domain that binds to a first epitope and a second immunoglobulin variable domain that binds to a second epitope. In some embodiments, the first epitope and the second epitope are the same. In some embodiments, the first epitope and the second epitope are different.

[0120] In some embodiments, a transmembrane domain links the binding domain and the intracellular signaling domain, hi some embodiments, the transmembrane domain is a hinge protein (e.g., an immunoglobulin hinge), a polypeptide linker (e.g., a GS linker), a KIR2DS2 hinge, a CD8a hinge, or a spacer.

[0121] In some embodiments, the intracellular signaling domain comprises at least a portion of a T cell signaling molecule. In some embodiments, the intracellular signaling domain comprises an immunoreceptor tyrosine-based activation motif. In some embodiments, the intracellular signaling domain comprises at least a portion of CD3ζ, common FcRγ (FCER1G), FcγR11a, FcRβ (FcεRib), CD3γ, CD3δ, CD3ε, CD79a, CD79b, DAP10, DAP12, or any combination thereof. In some embodiments, the intracellular signaling domain further comprises an intracellular costimulatory signaling domain.

[0122] In some embodiments, the intracellular costimulatory signaling domain comprises at least one or more of a TNF receptor protein, an immunoglobulin-like protein, a cytokine receptor, an integrin, a signaling lymphocyte activation molecule, or an activating NK cell receptor protein. In some embodiments, the intracellular costimulatory signaling domain is selected from the group consisting of CD27, CD28, 4-1BB, OX40, GITR, CD30, CD40, PD-1, ICOS, BAFFR, HVEM, ICAM-1, LFA-1, CD2, CDS, CD7, CD287, LIGHT, NKG2C, NKG2D, SLAMF7, NKp80, NKp30, NKp44, NKp46, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, IA4, CD49D, ITGA6, VLA6, CD49f, ITGAD, CD103, ITGAL, ITGAM, ITGAX, ITGB1, CD29, ITGB2, CD18, ITGB7, TNFR2, TRAN and at least one or more of a ligand that binds to CE / TRANKL, CD226, SLAMF4, CD84, CD96, CEACAM1, CRTAM, CD229, CD 160, PSGL1, CD100, CD69, SLAMF6, SLAMF1, SLAMF8, CD162, LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, B7-H3, or CD83.

[0123] In some embodiments, the modified nucleic acid comprises modified DNA. Throughout this disclosure, in any embodiment described herein, when such an embodiment refers to a modified nucleic acid, it is understood that the embodiment is also applicable to modified DNA. In some embodiments, the modified DNA is naked modified DNA. In some embodiments, the modified DNA is linear DNA. In some embodiments, the modified DNA is circular DNA.

[0124] In some embodiments, the modified nucleic acid comprises a nucleotide sequence selected from those set forth in Table 1. The modified nucleic acids set forth in Table 1 can include any base modification, any sugar modification, and / or any phosphate modification. The term "position" in Table 1 refers to a position within a nucleic acid. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 1-10] [Table 1-11] [Table 1-12] [Table 1-13] [Table 1-14] [Table 1-15] [Table 1-16]

[0125] In some embodiments, the modified nucleic acid comprises nucleotides having a sequence having at least about 70% sequence identity, at least about 75% sequence identity, at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least about 91% sequence identity, at least 92% sequence identity, at least about 93% sequence identity, at least about 94% sequence identity, at least 95% sequence identity, about 96% sequence identity, about 97% sequence identity, at least 98% sequence identity, at least about 99% sequence identity, or more, to a sequence selected from those in Table 1.

[0126] Glycan Characteristics As described elsewhere herein, the present disclosure provides pharmaceutical compositions comprising modified nucleic acids comprising a glycan moiety. In some embodiments, the glycan moiety comprises at least one monosaccharide. In some embodiments, the glycan moiety comprises at least two monosaccharides. In some embodiments, the glycan moiety comprises at least three monosaccharides. In some embodiments, the glycan moiety comprises at least four monosaccharides. In some embodiments, the glycan moiety comprises at least five monosaccharides. In some embodiments, the glycan moiety comprises at least six monosaccharides. In some embodiments, the glycan moiety comprises at least seven monosaccharides. In some embodiments, the glycan moiety comprises at least eight monosaccharides. In some embodiments, the glycan moiety comprises at least nine monosaccharides. In some embodiments, the glycan moiety comprises at least ten monosaccharides. The glycan moiety can contain at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more monosaccharides. In certain embodiments, the number of sugars per glycan on the modified nucleic acid varies. In certain embodiments, the number of sugars per glycan on the modified nucleic acid is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10. In certain embodiments, at least one or all of the glycans on the modified nucleic acid contain at least about 10 sugar residues. In certain embodiments, at least one or all of the glycans on the modified nucleic acid contain at least about 9 sugar residues. In certain preferred embodiments, at least one or all of the glycans on the modified nucleic acid contain at least about 6 sugar residues.

[0127] In some embodiments, the glycan moiety comprises GlcNAc, mannose, galactose, sialic acid, and fucose, or a combination thereof. In some embodiments, the glycan moiety comprises sialic acid, fucose, or a combination thereof. In some embodiments, the glycan moiety comprises sialic acid. In some embodiments, the glycan moiety comprises fucose. In some embodiments, the glycan moiety comprises mannose. In some embodiments, the glycan moiety comprises GlcNAc (N-acetylglucosamine). In some embodiments, the glycan moiety comprises galactose. In some embodiments, the glycan moiety comprises fucose linked to a GlcNAc residue.

[0128] In some embodiments, the glycan moiety comprises a biantennary glycan, wherein the biantennary glycan comprises a first terminal residue and a second terminal residue. In some embodiments, at least one of the first terminal residue or the second terminal residue of the biantennary glycan comprises sialic acid. In some embodiments, at least one of the first terminal residue or the second terminal residue of the biantennary glycan comprises a sialic acid residue comprising one or more polysialic acid terminal modifications. In some embodiments, at least one of the first terminal residue or the second terminal residue of the biantennary glycan comprises fucose. In some embodiments, one of the first terminal residue or the second terminal residue of the biantennary glycan comprises fucose, and the other comprises sialic acid.

[0129] In some embodiments, the glycan moiety comprises a triantennary glycan, wherein the triantennary glycan comprises a first terminal residue, a second terminal residue, and a third terminal residue. In some embodiments, at least one of the first terminal residue, the second terminal residue, or the third terminal residue of the triantennary glycan comprises sialic acid. In some embodiments, at least one of the first terminal residue, the second terminal residue, or the third terminal residue of the triantennary glycan comprises a sialic acid residue comprising one or more polysialic acid terminal modifications. In some embodiments, at least one of the first terminal residue or the second terminal residue of the triantennary glycan comprises fucose. In some embodiments, at least one of the first terminal residue, the second terminal residue, or the third terminal residue of the triantennary glycan comprises sialic acid, and at least one of the remaining terminal residues comprises fucose.

[0130] In some embodiments where the glycan moiety comprises a biantennary or triantennary glycan, the glycan comprises a fucose linked to a GlcNAc residue in the core or stem region of the glycan. In some embodiments where the glycan moiety comprises a biantennary or triantennary glycan, the glycan comprises a fucose linked to a GlcNAc residue in the dendritic, branched, or arm region of the glycan.

[0131] In some embodiments, the glycan moiety comprises a bisected glycan. In some embodiments, the glycan moiety comprises a biantennary glycan comprising a GlcNAc moiety attached to a monosaccharide, the monosaccharide linking two branches of the biantennary glycan, thereby forming the bisected glycan.

[0132] In some embodiments, the glycan moiety is an N-linked glycan, such that the glycan is conjugated to the modified nucleic acid via a nitrogen atom.

[0133] In some embodiments, the glycan moiety comprises a glycan comprising an N-acetylglucosamine (GlcNAc) at its non-reducing end and further comprising a conjugation handle covalently attached to the non-reducing-end GlcNAc. As used herein, the terms "non-reducing-end GlcNAc" and "non-reducing-end GlcNAc" refer to a GlcNAc monosaccharide residue that is part of a glycan moiety and forms the terminus of the glycan. Illustratively, in the following exemplary glycan G-1, the "GlcNAc(b1-" at the end of the IUPAC name indicates the non-reducing-end GlcNAc. GlcNAc(b1-2)Man(a1-3)[GlcNAc(b1-2)Man(a1-6)]Man(b1-4)GlcNAc(b1-4)[Fuc(a1-6)]GlcNAc(b1-

[0134] In some embodiments, the glycan moiety comprises a glycan comprising a GlcNAc at a non-reducing end and further comprising an asparagine residue covalently linked to the non-reducing terminal GlcNAc of the glycan. In some embodiments, the asparagine residue is covalently linked to the non-reducing terminal GlcNAc of the glycan as shown below: [ka] In the formula, * indicates the point of attachment to the non-reducing terminal GlcNAc of the glycan, and ** indicates the point of attachment to the modified RNA or to a linker group attached to the modified RNA.

[0135] In some embodiments, the asparagine residue is covalently linked to the non-reducing terminal GlcNAc as shown below: [ka] In the formula, * indicates the attachment point to the non-reducing terminal GlcNAc of the glycan.

[0136] In some embodiments, the glycan moiety comprises a glycan comprising a GlcNAc at its non-reducing end and further comprising an arginine residue covalently linked to the non-reducing-end GlcNAc. In some embodiments, the glycan moiety comprises a glycan comprising a GlcNAc at its non-reducing end and further comprising a click chemistry azide handle covalently linked to the non-reducing-end GlcNAc either directly or via a linker group. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises one or more polyethylene glycol units. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises 1 to 10 PEG units. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises one PEG unit. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises two PEG units. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises three PEG units. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises four PEG units, hi some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises five PEG units.

[0137] In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises one or more peptide residues.

[0138] In some embodiments, the glycan moiety comprises a glycan comprising a GlcNAc at a non-reducing end and further comprising a conjugation handle covalently attached to the non-reducing end GlcNAc, wherein the conjugation handle is aminooxy-PEG3-azide: [ka] or relates to a glyco-nucleic acid conjugate that is the product of a click chemistry reaction between an aminooxy-PEG3-azide and an alkyne moiety attached to the nucleic acid portion of the glyco-nucleic acid conjugate.

[0139] In some embodiments, the glycan moiety comprises a glycan comprising a GlcNAc at a non-reducing end and further comprising an aminooxy-PEG3-azide covalently attached to the non-reducing terminal GlcNAc, as shown below: [ka] In the formula, * indicates the attachment point to the non-reducing terminal GlcNAc of the glycan.

[0140] In some embodiments, the glycan moiety comprises a glycan comprising a GlcNAc at a non-reducing end and further comprising a linker covalently attached to the non-reducing end GlcNAc, such as: [ka] In the formula, * indicates the point of attachment to the non-reducing terminal GlcNAc of the glycan, and ** indicates the point of attachment to the modified RNA or to a linker group attached to the modified RNA.

[0141] In some embodiments, the glycan portion comprises a glycan selected from those shown in Figures 7A-7C. In some embodiments, the glycan portion comprises a glycan selected from those shown in Figure 7A. In some embodiments, the glycan portion comprises a glycan selected from those shown in Figure 7B. In some embodiments, the glycan portion comprises a glycan selected from those shown in Figure 7C.

[0142] In some embodiments, the glycan moiety comprises a glycan selected from those set forth in Table 2A below. [Table 2A]

[0143] In some embodiments, the glycan moiety is or comprises a glycan that differs from a glycan listed in Table 2A by the replacement of a single monosaccharide. In some embodiments, the glycan moiety is or comprises a glycan that differs from a glycan listed in Table 2A by the replacement of two monosaccharides. As a non-limiting example, the glycan moiety can comprise a glycan listed in Table 2A in which mannose has been replaced with galactose (or vice versa), while the remaining glycan moiety remains unchanged.

[0144] In some embodiments, the glycan moiety comprises a glycan described in Table 2A that further comprises a conjugation handle covalently attached to the non-reducing terminal GlcNAc.

[0145] In some embodiments, the glycan moiety comprises a glycan described in Table 2A, further comprising an asparagine residue covalently linked to the non-reducing terminal GlcNAc. In some embodiments, the glycan moiety comprises a glycan exemplified by any of the glycans described in Table 2A, further comprising an asparagine residue covalently linked to the non-reducing terminal GlcNAc, as shown below: [ka] In the formula, * indicates the point of attachment to the non-reducing terminal GlcNAc of the glycan, and ** indicates the point of attachment to the modified RNA or to a linker group attached to the modified RNA.

[0146] In some embodiments, the glycan moiety comprises a glycan described in Table 2A, further comprising an asparagine residue covalently attached to the non-reducing terminal GlcNAc, as shown below: [ka] In the formula, * indicates the attachment point to the non-reducing terminal GlcNAc of the glycan.

[0147] In some embodiments, the glycan moiety comprises a glycan described in Table 2A, further comprising an arginine residue covalently linked to the non-reducing-end GlcNAc. In some embodiments, the glycan moiety comprises a glycan described in Table 2A, further comprising a click chemistry azide handle covalently linked to the non-reducing-end GlcNAc, either directly or via a linker group. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises one or more peptide residues. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises one or more polyethylene glycol (PEG) units. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises 1 to 10 PEG units. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises one PEG unit. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises two PEG units. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises three PEG units. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises four PEG units. In some embodiments, the linker group bridging the non-reducing-end GlcNAc and the azide comprises five PEG units.

[0148] In some embodiments, the glycan moiety comprises a glycan described in Table 2A further comprising a conjugation handle covalently attached to the non-reducing terminal GlcNAc, wherein the conjugation handle is aminooxy-PEG3-azide: [ka] or relates to a glyco-nucleic acid conjugate that is the product of a click chemistry reaction between an aminooxy-PEG3-azide and an alkyne moiety attached to the nucleic acid portion of the glyco-nucleic acid conjugate.

[0149] In some embodiments, the glycan moiety comprises a glycan described in Table 2A, further comprising an aminooxy-PEG3-azide covalently attached to the non-reducing terminal GlcNAc, as shown below: [ka] In the formula, * indicates the attachment point to the non-reducing terminal GlcNAc of the glycan.

[0150] In some embodiments, the glycan moiety comprises a glycan described in Table 2A, further comprising a linker covalently attached to the non-reducing terminal GlcNAc, as shown below: [ka] In the formula, * indicates the point of attachment to the non-reducing terminal GlcNAc of the glycan, and ** indicates the point of attachment to the modified RNA or to a linker group attached to the modified RNA.

[0151] In some embodiments, the glycan moiety comprises an azide-functionalized glycan selected from those set forth in Table 2B below. [Table 2B-1] [Table 2B-2] [Table 2B-3]

[0152] Characteristics of glycan-nucleic acid conjugation As noted above, in one aspect, the present disclosure provides a glyconucleic acid comprising: i) a modified nucleic acid; and ii) at least one glycan moiety conjugated to the modified nucleic acid.

[0153] In some embodiments, the modified nucleic acid is conjugated to the glycan moiety via a nitrogen atom. In some embodiments, the modified nucleic acid is conjugated to the glycan moiety via an amide bond. In some embodiments, the glycan moiety is an N-linked glycan, wherein the glycan is linked to the amide nitrogen of an asparagine or arginine residue via an N-acetylglucosamine residue.

[0154] In some embodiments, the modified nucleic acid is conjugated to the glycan by a click chemistry reaction. In some embodiments, the modified nucleic acid moiety comprises a first click chemistry handle and the glycan moiety comprises a second click chemistry handle, such that the modified nucleic acid moiety and the glycan moiety are covalently linked by a chemical moiety formed by a click chemistry reaction between the first and second handles. In some embodiments, the modified nucleic acid moiety comprises an alkyne handle and the glycan moiety comprises an azide handle, such that the modified nucleic acid moiety and the glycan moiety are covalently linked by a chemical moiety formed by a click chemistry reaction between the azide handle and the alkyne handle. In some embodiments, the modified nucleic acid moiety comprises an alkyne handle and the glycan moiety comprises an azide handle, such that the modified nucleic acid moiety and the glycan moiety are covalently linked by a triazole formed by a click chemistry reaction between the azide handle and the alkyne handle. In some embodiments, the modified nucleic acid moiety comprises an azide handle and the glycan moiety comprises an alkyne handle, such that the modified nucleic acid moiety and the glycan moiety are covalently linked by a chemical moiety formed by a click chemistry reaction between the azide handle and the alkyne handle. In some embodiments, the modified nucleic acid moiety comprises an azide handle and the glycan moiety comprises an alkyne handle, such that the modified nucleic acid moiety and the glycan moiety are covalently linked by a triazole formed by a click chemistry reaction between the azide handle and the alkyne handle.

[0155] In some embodiments, the modified nucleic acid moiety comprises a modification of the ribose such that the ribose is modified with an azide moiety capable of undergoing a click chemistry reaction. In some embodiments, the modified nucleic acid moiety comprises a modification of the ribose such that the ribose is modified with an alkyne moiety capable of undergoing a click chemistry reaction. In some embodiments, the ribose is modified at a position selected from the 2'OH, 3'OH, and 5'OH.

[0156] In some embodiments, the non-reducing end of the glycan moiety comprises an azide moiety capable of undergoing a click chemistry reaction. In some embodiments, the non-reducing end of the glycan moiety comprises an alkyne moiety capable of undergoing a click chemistry reaction.

[0157] In some embodiments, the modified nucleic acid is conjugated to the glycan through a strong non-covalent interaction. In some embodiments, the modified nucleic acid is conjugated to the glycan through a high-affinity biotin / streptavidin interaction. In some embodiments, the modified nucleic acid includes a biotin moiety and the glycan includes a streptavidin moiety such that the biotin and streptavidin moieties interact. In some embodiments, the modified nucleic acid includes a streptavidin moiety and the glycan includes a biotin moiety such that the biotin and streptavidin moieties interact.

[0158] In some embodiments, the modified nucleic acid is conjugated to the glycan via a linker group covalently attached to the end of the modified nucleic acid. In some embodiments, the modified nucleic acid is conjugated to the glycan via a linker covalently attached to the chemically modified nucleotide in the middle of the polynucleotide. In some embodiments, the modified nucleic acid is conjugated to the glycan via a chemical handle inserted between the two nucleotides in the middle of the polynucleotide.

[0159] In some embodiments, the modified nucleic acid comprises a cleavable linker between the nucleic acid and the glycan moiety. In some embodiments, the cleavable linker is a pH-dependently cleavable bond. In some embodiments, the cleavable linker is a disulfide bond. In some embodiments, the cleavable linker is a peptide cleavage site. In some embodiments, the cleavable linker is a cit-val linker.

[0160] In some embodiments, the modified nucleic acid is conjugated with two or more glycan moieties. In some embodiments, the two or more glycan moieties are different glycan moieties. In some embodiments, the nucleic acid comprises a nucleotide modified with an orthogonal modification that allows coupling to two or more chemically different glycans. For example, the nucleic acid can be modified with two or more different conjugation handles that allow selective conjugation to two or more chemically different glycans, where each glycan comprises a different complementary conjugation handle.

[0161] In some embodiments, the modified nucleic acid is conjugated to one or more glycans by a bioorthogonal reaction. In some embodiments, the bioorthogonal reaction is a bioorthogonal click chemistry reaction. In some embodiments, the bioorthogonal reaction comprises a strain-promoted azide-alkyne cycloaddition. In some embodiments, the bioorthogonal reaction comprises the reaction of trans-cyclooctene and tetrazine.

[0162] Exemplary Glycan-Nucleic Acid Conjugates In one aspect, the present disclosure provides a compound of formula (I): ALB(I) or a salt, co-crystal, tautomer, stereoisomer, solvate, hydrate, polymorph, or isotopically enriched derivative thereof, wherein A is a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) nucleic acid containing a first click chemistry handle; B is an asparagine-linked glycan (N-glycan) containing a second click chemistry handle; L comprises a linker formed by a bioorthogonal click chemistry reaction between the first click chemistry handle and the second click chemistry handle.

[0163] In certain embodiments of Formula (I), the compound, or a salt, co-crystal, tautomer, stereoisomer, solvate, hydrate, polymorph, or isotopically enriched derivative thereof, is provided, wherein A is a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) nucleic acid, B is an asparagine-linked glycan (N-glycan), and L is a linker. In certain embodiments, L is any linker described herein.

[0164] In certain embodiments of Formula (I), A is a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) nucleic acid, B is an asparagine-linked glycan (N-glycan), and L comprises a linker formed by a bioorthogonal click chemistry reaction between the first click chemistry handle and the second click chemistry handle.

[0165] In certain embodiments of Formula (I), A is a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) nucleic acid, B is an asparagine-linked glycan (N-glycan), and L comprises a linker formed by a bioorthogonal click chemistry reaction between a first click chemistry handle and a second click chemistry handle, wherein the first click chemistry handle was attached to A prior to the click chemistry reaction and the second click chemistry handle was attached to B prior to the click chemistry reaction.

[0166] In certain embodiments, A in Formula (I) is DNA (e.g., comprising a first click chemistry handle). In certain embodiments, A in Formula (I) is an antisense oligonucleotide (ASO). In certain embodiments, A in Formula (I) is an antisense oligonucleotide (ASO) (e.g., comprising a first click chemistry handle). In certain embodiments, A in Formula (I) is single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), plasmid DNA (pDNA), genomic DNA (gDNA), complementary DNA (cDNA), antisense DNA, chloroplast DNA (ctDNA or cpDNA), microsatellite DNA, mitochondrial DNA (mtDNA or mDNA), kinetoplast DNA (kDNA), provirus, lysogen, repetitive DNA, satellite DNA, or viral DNA. In certain embodiments, A in Formula (I) is single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), plasmid DNA (pDNA), genomic DNA (gDNA), complementary DNA (cDNA), antisense DNA, chloroplast DNA (ctDNA or cpDNA), microsatellite DNA, mitochondrial DNA (mtDNA or mDNA), kinetoplast DNA (kDNA), provirus, rhizogen, repetitive DNA, satellite DNA, or viral DNA, comprising a first click chemistry handle. In certain embodiments, A in Formula (I) is DNA comprising the following sequence: 5'-GGC TGG TCC GAG TGC AGT GGT GTT TAC AAC TAA TTG ATC ACA ACC AGT TAC AGA TTT CT / i5OctdU / TGT TCC TTC TCC ACT CCC ACT GCT TCA CTT GAC TAG CCT T-3' (SEQ ID NO: 1).

[0167] In certain embodiments, A has a sequence that has at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, or at least 90% sequence identity, at least 92% sequence identity, at least 95% sequence identity, or at least 98% sequence identity to the full-length sequence of SEQ ID NO: 1. In certain embodiments, A has a sequence that has at least 80% sequence identity to the full-length sequence of SEQ ID NO: 1.

[0168] In certain embodiments, A in Formula (I) is an RNA comprising a first click chemistry handle. In certain embodiments, A in Formula (I) is a small interfering RNA (siRNA). In certain embodiments, A in Formula (I) is a small interfering RNA (siRNA) comprising a first click chemistry handle. In certain embodiments, A in Formula (I) is an siRNA comprising a modification (e.g., at the 2' position). In certain embodiments, A in Formula (I) is an siRNA comprising a modification selected from the group consisting of a 2'OMe modification, a fluorine modification (e.g., at the 2' position), and a phosphorothioate modification. In certain embodiments, A in Formula (I) is an siRNA comprising a modification selected from the group consisting of a 2'OMe modification, a fluorine modification, and a phosphorothioate modification, and also comprising a first click chemistry handle. In certain embodiments, A in Formula (I) is an mRNA. In certain embodiments, A in Formula (I) is an mRNA comprising a first click chemistry handle. In certain embodiments, A in formula (I) is a guide RNA. In certain embodiments, A in formula (I) is a guide RNA comprising a first click chemistry handle. In certain embodiments, A in formula (I) is a circular RNA (circRNA). In certain embodiments, A in formula (I) is a circular RNA (circRNA) comprising a first click chemistry handle. In certain embodiments, A in formula (I) is an aptamer RNA. In certain embodiments, A in formula (I) is an aptamer RNA comprising a first click chemistry handle.In certain embodiments, A in formula (I) is single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), small interfering RNA (siRNA), messenger RNA (mRNA), messenger RNA precursor (pre-mRNA), short or short hairpin RNA (shRNA), microRNA (miRNA), guide RNA (gRNA), transfer RNA (tRNA), antisense RNA (asRNA), heterologous nuclear RNA (hnRNA), coding RNA, non-coding RNA (ncRNA), long non-coding RNA (long ncRNA or lncRNA), satellite RNA, viral satellite RNA, signal recognition particle RNA, small cytoplasmic RNA, small nuclear RNA (snRNA), ribosomal RNA (rRNA), Piwi-interacting RNA (piRNA), polyinosinic acid, ribozyme, flexizyme, small nucleolar RNA (snoRNA), splice leader RNA, viral RNA, or viral satellite RNA. In certain embodiments, A in formula (I) is a single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), small interfering RNA (siRNA), messenger RNA (mRNA), messenger RNA precursor (pre-mRNA), short hairpin RNA or short hairpin RNA (shRNA), microRNA (miRNA), guide RNA (gRNA), transfer RNA (tRNA), antisense RNA (asRNA), heterologous nuclear RNA (hnRNA), or the like, comprising a first click chemistry handle. A), coding RNA, non-coding RNA (ncRNA), long non-coding RNA (long ncRNA or lncRNA), satellite RNA, viral satellite RNA, signal recognition particle RNA, small cytoplasmic RNA, small nuclear RNA (snRNA), ribosomal RNA (rRNA), Piwi-interacting RNA (piRNA), polyinosinic acid, ribozyme, flexizyme, small nucleolar RNA (snoRNA), splice leader RNA, viral RNA, or viral satellite RNA.In certain embodiments, A has a sequence that has at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 92% sequence identity, at least 95% sequence identity, or at least 98% sequence identity to the full-length sequence of: AGUUGGTCCGAGUGUUGUGGGUUAUUGUUAAGUU / i5OctdU / AUUUAACAUUGUCU CCCCCCACAACCGCGCUUGACUAGCUUGCUG (SEQ ID NO: 2).

[0169] In certain embodiments, A has a sequence having at least 80% sequence identity to the full-length sequence of SEQ ID NO: 2. In certain embodiments, A in formula (I) is an RNA comprising SEQ ID NO: 2.

[0170] In certain embodiments, L in formula (I) comprises a linker formed by a bioorthogonal click chemistry reaction (e.g., copper-catalyzed azide-alkyne cyclization (CuAAC), strain-promoted azide-alkyne cycloaddition (SPAAC), trans-cyclooctyne (TCO)-tetrazine ligation, trans-cyclooctene-tetrazine ligation, alkene-tetrazine ligation, crosslinking between a primary amine and an N-hydroxysuccinimide ester (NHS ester), trans-cyclooctyne-azide coupling, or cyclopropane-azide coupling, Staudinger ligation of azides). In certain embodiments, L in Formula (I) comprises a linker formed by a bioorthogonal click chemistry reaction (e.g., copper-catalyzed azide-alkyne cyclization (CuAAC), strain-promoted azide-alkyne cycloaddition (SPAAC), trans-cyclooctyne (TCO)-tetrazine ligation, trans-cyclooctene-tetrazine ligation, crosslinking between a primary amine and an N-hydroxysuccinimide ester (NHS ester), trans-cyclooctyne-azide coupling, or cyclopropene-azide coupling, Staudinger ligation of azides). In certain embodiments, L in Formula (I) comprises a linker formed by a bioorthogonal click chemistry reaction between a first click chemistry handle and a second click chemistry handle. In certain embodiments, L in Formula (I) comprises a linker formed by a bioorthogonal click chemistry reaction between a first click chemistry handle and a second click chemistry handle, as shown in Table 3 or 4 below. In certain embodiments, L in formula (I) comprises a linker formed by a click chemistry reaction that is copper-catalyzed azide-alkyne cyclization (CuAAC). In certain embodiments, L in formula (I) comprises a linker formed by a click chemistry reaction that is a copper-free reaction.In certain embodiments, L in Formula (I) comprises a linker formed by a click chemistry reaction that is strain-promoted azide-alkyne cycloaddition (SPAAC), trans-cyclooctyne (TCO)-tetrazine ligation, trans-cyclooctene-tetrazine ligation, Staudinger ligation of azide, crosslinking between a primary amine and an N-hydroxysuccinimide ester (NHS ester), trans-cyclooctyne-azide coupling, or cyclopropane-azide coupling. In certain embodiments, L in Formula (I) comprises a linker formed by a click chemistry reaction that is strain-promoted azide-alkyne cycloaddition (SPAAC). In certain embodiments, L in Formula (I) comprises a linker formed by a click chemistry reaction that is trans-cyclooctyne (TCO)-tetrazine ligation or trans-cyclooctene-tetrazine ligation. In certain embodiments, L in Formula (I) comprises a linker formed by a click chemistry reaction that is trans-cyclooctyne (TCO)-tetrazine ligation. In certain embodiments, L in Formula (I) comprises a linker formed by a click chemistry reaction that is trans-cyclooctene-tetrazine ligation. In certain embodiments, L in Formula (I) comprises a linker formed by a click chemistry reaction that is Staudinger ligation of an azide, crosslinking between a primary amine and an N-hydroxysuccinimide ester (NHS ester), trans-cyclooctyne-azide coupling, or cyclopropane-azide coupling. In certain embodiments, L in Formula (I) comprises a linker formed by a click chemistry reaction that is Staudinger ligation of an azide. In certain embodiments, L in Formula (I) comprises a linker formed by a click chemistry reaction that is crosslinking between a primary amine and an N-hydroxysuccinimide ester (NHS ester).In certain embodiments, L in formula (I) comprises a linker formed by a click chemistry reaction that is trans-cyclooctyne-azide coupling. In certain embodiments, L in formula (I) comprises a linker formed by a click chemistry reaction that is cyclopropane-azide coupling.

[0171] A click chemistry handle or click-chemistry handle can be a reactant or reactive group that can participate in a click chemistry reaction. For example, a strained alkyne (e.g., cyclooctyne) is a click chemistry handle because it can participate in strain-promoted cycloaddition. Generally, a click chemistry reaction requires at least two molecules containing click chemistry handles that can react with each other. Such click chemistry handle pairs that are reactive with each other are sometimes referred to herein as partner click chemistry handles. For example, azide is a partner click chemistry handle for cyclooctyne or any other alkyne. Exemplary click chemistry handles (click chemistry handle 1 and click chemistry handle 2) suitable for use in accordance with some embodiments of the present invention are described herein, e.g., in Tables 3 and 4. Other suitable click chemistry handles will be known to those of skill in the art. For two molecules to be conjugated via click chemistry, the click chemistry handles of the molecules are reactive with each other, for example, in that a reactive moiety on one of the click chemistry handles can react with a reactive moiety on the other click chemistry handle to form a covalent bond. Such reactive pairs of click chemistry handles are well known to those of skill in the art and include, but are not limited to, those listed in Table 3. [Table 3]

[0172] Table 3 provides examples of click chemistry handles and reactions. R, R1, and R2 can represent any molecule containing a sortase recognition motif. In some embodiments, each occurrence of R, R1, and R2 independently represents RR-LPXT-[X] y -or- [X] y -LPXT-RR, where each occurrence of X independently represents any amino acid residue, each occurrence of y is an integer between 0 and 10 (inclusive), and each occurrence of RR independently represents a protein or agent (e.g., a protein, peptide, detectable label, binding agent, small molecule, etc.), and optionally an additional linker.

[0173] In some embodiments, click chemistry handles are used that can react to form covalent bonds in the absence of a metal catalyst. Such click chemistry handles are well known to those skilled in the art and include those described in Becer, Hoogenboom, and Schubert, "Click Chemistry beyond Metal-Catalyzed Cycloaddition," Angewandte Chemie International Edition (2009) 48:4900-4908. See Table 4 below. [Table 4-1] [Table 4-2]

[0174] In certain embodiments, A comprises a first click chemistry handle that is an alkyne. In certain embodiments, A comprises a first click chemistry handle that is an alkyne, for example, where the alkyne has the following structure: [ka] Includes.

[0175] In certain embodiments, nucleic acid A comprises a first click chemistry handle that is an alkyne attached to a base of the nucleic acid. In certain embodiments, A has the following structure: [ka] wherein A is RNA or DNA. In certain embodiments, A comprises a first click chemistry handle that is an alkene(vinyl) and B comprises a second click chemistry handle that is a tetrazine. In certain embodiments, A comprises a first click chemistry handle that is an alkene(vinyl) (e.g., Figures 2B and / or 2C in Kubota et al.) in Kubota et al., "Expanding the Scope of RNA Metabolic Labeling with Vinyl Nucleosides and Inverse Electron-Demand Diels-Alder Chemistry." ACS Chemical Biology vol. 14, 8 (2019): 1698-1707 (incorporated herein by reference). In certain embodiments, A comprises a first click chemistry handle that is an alkene(vinyl) (e.g., of Figures 2B and / or 2C in Kubota et al.) and a second click chemistry handle that is a tetrazine (e.g., of Figure 3A in Kubota et al.) of Kubota et al., "Expanding the Scope of RNA Metabolic Labeling with Vinyl Nucleosides and Inverse Electron-Demand Diels-Alder Chemistry." ACS Chemical Biology vol. 14, 8(2019):1698-1707 (incorporated herein by reference). In certain embodiments, A comprises a first click chemistry handle that is an alkene, wherein A is [ka] Includes.

[0176] In certain embodiments, L is substituted or unsubstituted alkylene, alknylene, substituted or unsubstituted alkenylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted carbocyclylene, substituted or unsubstituted heterocyclylene, substituted or unsubstituted arylene, substituted or unsubstituted heteroarylene, —O—, —N(R A )-, -S-, -C(=O)-, -C(=O)O-, -C(=O)NR A -, -NR A C(=O)-, -NR A C(=O)R A -, -C(=O)R A -, -NR A C(=O)O-, -NR A C(=O)N(R A )-, -OC(=O)-, -OC(=O)O-, -OC(=O)N(R A )-, -S(O)NR A -, -NR A S(O)2-, or a combination thereof, and each R A are independently hydrogen or substituted or unsubstituted alkyl.

[0177] In certain embodiments, L is substituted or unsubstituted alkylene, alknylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted carbocyclylene, substituted or unsubstituted heterocyclylene, substituted or unsubstituted arylene, substituted or unsubstituted heteroarylene, —O—, —N(R A )-, -S-, or a combination thereof, and each R A are independently hydrogen or substituted or unsubstituted alkyl.

[0178] In certain embodiments, L is or includes substituted or unsubstituted alkylene, alknylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted carbocyclylene, substituted or unsubstituted heterocyclylene, substituted or unsubstituted arylene, substituted or unsubstituted heteroarylene, -O-, or a combination thereof.

[0179] In certain embodiments, L is or includes a substituted or unsubstituted alkylene, alknylene, substituted or unsubstituted carbocyclylene, substituted or unsubstituted heterocyclylene, substituted or unsubstituted arylene, substituted or unsubstituted heteroarylene, -O-, or a combination thereof.

[0180] In certain embodiments, L is or includes a substituted or unsubstituted alkylene, alknylene, substituted or unsubstituted carbocyclylene, substituted or unsubstituted heterocyclylene, substituted or unsubstituted arylene, substituted or unsubstituted heteroarylene, -O-, or a combination thereof.

[0181] In certain embodiments, L is or includes a substituted or unsubstituted heteroarylene. In certain embodiments, L is or includes a substituted or unsubstituted 5- to 6-membered heteroarylene. In certain embodiments, L is or includes a substituted or unsubstituted 5- to 6-membered heteroarylene having 2 to 3 nitrogen atoms in the heteroaryl ring. In certain embodiments, L is or includes a substituted or unsubstituted 5-membered heteroarylene having 2 to 3 nitrogen atoms in the heteroaryl ring. In certain embodiments, L is or includes a substituted or unsubstituted triazole.

[0182] In certain embodiments, L comprises substituted or unsubstituted heterocyclylene. In certain embodiments, L comprises substituted or unsubstituted heterocyclylene fused to substituted or unsubstituted carbocyclylene. In certain embodiments, L comprises substituted or unsubstituted heterocyclylene fused to substituted or unsubstituted cyclooctylene. In certain embodiments, L comprises substituted or unsubstituted 6-membered heterocyclylene fused to substituted or unsubstituted cyclooctylene. In certain embodiments, L comprises substituted or unsubstituted dihydropyridazine fused to substituted or unsubstituted cyclooctylene. In certain embodiments, L comprises substituted dihydropyridazine fused to unsubstituted cyclooctylene. In certain embodiments, L comprises octahydrocycloocta[d]pyridazine.

[0183] In certain embodiments, L comprises a substituted or unsubstituted heteroarylene fused to a substituted or unsubstituted carbocyclylene. In certain embodiments, L comprises a substituted or unsubstituted heteroarylene fused to a substituted or unsubstituted cyclooctylene. In certain embodiments, L comprises a substituted or unsubstituted 5-membered heteroarylene fused to a substituted or unsubstituted cyclooctylene. In certain embodiments, L comprises a substituted or unsubstituted triazole fused to a substituted or unsubstituted cyclooctylene.

[0184] In certain embodiments, L in formula (I) is of the following formula: [ka] where * indicates the point of attachment to A and # indicates the point of attachment to B. In certain embodiments, L in formula (I) is of the following formula: [ka] where * indicates the point of attachment to A and # indicates the point of attachment to B. In certain embodiments, L is of the formula: [ka] where * indicates the point of attachment to A and # indicates the point of attachment to B.

[0185] In certain embodiments, L in formula (I) is bound to a base of nucleic acid A. In certain embodiments, L in formula (I) is bound to the 2'OH position of ribose, the 3'OH position of ribose or deoxyribose, or the 5'OH position of ribose or deoxyribose of nucleic acid A. In certain embodiments, L in formula (I) is bound to the 2'OH position of ribose of nucleic acid A. In certain embodiments, L in formula (I) is bound to the 3'OH position of ribose or deoxyribose of nucleic acid A. In certain embodiments, L in formula (I) is bound to the interior of nucleic acid A, the 3' end of nucleic acid A, or the 5' end of nucleic acid A. In certain embodiments, L in formula (I) is bound to the interior of nucleic acid A. In certain embodiments, A in formula (I) is a circular RNA (circRNA) and L is bound to the interior of A. In certain embodiments, L in formula (I) is bound to the 5'OH position of ribose or deoxyribose of nucleic acid A. In certain embodiments, L in formula (I) is attached to the non-reducing end of N-glycan B. In certain embodiments, B is an N-glycan that is a monoantennary N-glycan, a biantennary N-glycan, a triantennary N-glycan, or a pentaantennary N-glycan. In certain embodiments, B is an N-glycan that is a monoantennary N-glycan. In certain embodiments, B is an N-glycan that is a biantennary N-glycan. In certain embodiments, B is an N-glycan that is a triantennary N-glycan. In certain embodiments, B is an N-glycan that is a pentaantennary N-glycan. In certain embodiments, B is an N-glycan that contains sialic acid. In certain embodiments, B is an N-glycan of the following formula: [ka] As will be appreciated by those skilled in the art, the symbolic structures of N-glycan B and compounds of formula (I) are generally as indicated within standard nomenclature in glycan chemistry, for example, where squares represent N-acetylglucosamine (GlcNAc), dark circles represent D-mannose (Man), triangles represent L-fucose (Fuc), light circles represent D-galactose (Gal), and diamonds represent sialic acid, and as a further example, glycans as represented by the Symbolic Glycan Notation (SNFG) are available on the NCBI website.

[0186] In certain embodiments, the compound of formula (I) is as shown in Figure 9. In some embodiments, the compound of formula (I) is as shown in Figure 9, where A is an siRNA. In some embodiments, the compound of formula (I) is as shown in Figure 9, where A is an ASO. In some embodiments, the compound of formula (I) is as shown in Figure 9, where A is an mRNA. In some embodiments, the compound of formula (I) is as shown in Figure 9, where A is an aptamer. In some embodiments, the compound of formula (I) is as shown in Figure 9, where A is a circular RNA (circRNA). In some embodiments, the compound of formula (I) is as shown in Figure 9, where A is a guide RNA.

[0187] In certain embodiments, the compound of Formula (I) comprises SEQ ID NO: 1 or SEQ ID NO: 2, wherein i5OctdU is conjugated to G-28: [ka] is formed.

[0188] In certain embodiments, the compound of Formula (I) comprises SEQ ID NO: 1 or SEQ ID NO: 2, wherein i5OctdU is conjugated to G-35 and [ka] is formed.

[0189] In certain embodiments, the compound of Formula (I) comprises SEQ ID NO: 1 or SEQ ID NO: 2, wherein i5OctdU is conjugated to G-29 and [ka] is formed.

[0190] In certain embodiments, the compound of Formula (I) comprises SEQ ID NO: 1 or SEQ ID NO: 2, wherein i5OctdU is conjugated to G-30 and [ka] is formed.

[0191] In some embodiments, the compound of formula (I) is any of the compounds described above, or a salt, co-crystal, tautomer, stereoisomer, solvate, hydrate, polymorph, or isotopically enriched derivative thereof.

[0192] In certain embodiments, the compound of formula (I) is not a nucleic acid-glycan conjugate disclosed in Flynn et al., Mammalian Y RNAs are modified at discrete guanosine residues with N-glycans, bioRxiv, September 30, 2019 (e.g., as disclosed in Figure 4, any of Figures 1-4).

[0193] Exemplary Methods for Making Glycan-Nucleic Acid Conjugates The present disclosure provides a compound of formula (I): ALB(I) or a salt, co-crystal, tautomer, stereoisomer, solvate, hydrate, polymorph, or isotopically enriched derivative thereof, wherein A is a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) nucleic acid containing a first click chemistry handle; B is an asparagine-linked glycan (N-glycan) containing a second click chemistry handle; L comprises a linker formed by a bioorthogonal click chemistry reaction between a first click chemistry handle and a second click chemistry handle; The method includes a first step of reacting nucleic acid A, which is a ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) comprising the first click chemistry handle, with compound B, which is an asparagine-linked glycan (N-glycan) comprising the second click chemistry handle, wherein the reaction in the first step is carried out under bioorthogonal click chemistry conditions.

[0194] In certain embodiments, in the method of preparing a compound of Formula (I), the substituents A, B, and linker L are as described herein. In certain embodiments, in the method of preparing a compound of Formula (I), A is DNA or RNA, such as ASO, siRNA, mRNA, guide RNA, circRNA, or aptamer RNA. In certain embodiments, in the method of preparing a compound of Formula (I), A is DNA (e.g., comprising a first click chemistry handle). In certain embodiments, A in Formula (I) is an antisense oligonucleotide (ASO). In certain embodiments, A in Formula (I) is an antisense oligonucleotide (ASO) (e.g., comprising a first click chemistry handle). In certain embodiments, A in Formula (I) is siRNA, mRNA, guide RNA, circRNA, or aptamer RNA. In certain embodiments, A in formula (I) is single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), plasmid DNA (pDNA), genomic DNA (gDNA), complementary DNA (cDNA), antisense DNA, chloroplast DNA (ctDNA or cpDNA), microsatellite DNA, mitochondrial DNA (mtDNA or mDNA), kinetoplast DNA (kDNA), provirus, rhizogen, repetitive DNA, satellite DNA, or viral DNA. In certain embodiments, A in formula (I) is a single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), plasmid DNA (pDNA), genomic DNA (gDNA), complementary DNA (cDNA), antisense DNA, chloroplast DNA (ctDNA or cpDNA), microsatellite DNA, mitochondrial DNA (mtDNA or mDNA), kinetoplast DNA (kDNA), provirus, rhizogen, repeat DNA, satellite DNA, or viral DNA, comprising a first click chemistry handle. In certain embodiments, in the method for preparing a compound of formula (I), A is a DNA comprising SEQ ID NO: 1.In certain embodiments, A has a sequence having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 92% sequence identity, at least 95% sequence identity, or at least 98% sequence identity to the full-length sequence of SEQ ID NO: 1. In certain embodiments, in the method of preparing a compound of Formula (I), A has a sequence having at least 80% sequence identity to the full-length sequence of SEQ ID NO: 1. In certain embodiments, in the method of preparing a compound of Formula (I), A is DNA, wherein the DNA comprises SEQ ID NO: 1.

[0195] In certain embodiments, in the method of preparing a compound of Formula (I), A is an RNA comprising a first click chemistry handle. In certain embodiments, A in Formula (I) is a small interfering RNA (siRNA). In certain embodiments, A in Formula (I) is a small interfering RNA (siRNA) comprising a first click chemistry handle. In certain embodiments, A in Formula (I) is an siRNA comprising a modification selected from the group consisting of a 2'OMe modification, a fluorine modification, and a phosphorothioate modification. In certain embodiments, A in Formula (I) is an siRNA comprising a first click chemistry handle and comprising a modification selected from the group consisting of a 2'OMe modification, a fluorine modification, and a phosphorothioate modification. In certain embodiments, A in Formula (I) is an mRNA. In certain embodiments, A in Formula (I) is an mRNA comprising a first click chemistry handle. In certain embodiments, A in Formula (I) is a guide RNA. In certain embodiments, A in formula (I) is a guide RNA comprising a first click chemistry handle. In certain embodiments, A in formula (I) is a circular RNA (circRNA). In certain embodiments, A in formula (I) is a circular RNA (circRNA) comprising a first click chemistry handle. In certain embodiments, A in formula (I) is an aptamer RNA. In certain embodiments, A in formula (I) is an aptamer RNA comprising a first click chemistry handle.In certain embodiments, A in formula (I) is single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), small interfering RNA (siRNA), messenger RNA (mRNA), messenger RNA precursor (pre-mRNA), short or short hairpin RNA (shRNA), microRNA (miRNA), guide RNA (gRNA), transfer RNA (tRNA), antisense RNA (asRNA), heterologous nuclear RNA (hnRNA), coding RNA, non-coding RNA (ncRNA), long non-coding RNA (long ncRNA or lncRNA), satellite RNA, viral satellite RNA, signal recognition particle RNA, small cytoplasmic RNA, small nuclear RNA (snRNA), ribosomal RNA (rRNA), Piwi-interacting RNA (piRNA), polyinosinic acid, ribozyme, flexizyme, small nucleolar RNA (snoRNA), splice leader RNA, viral RNA, or viral satellite RNA. In certain embodiments, A in formula (I) is a single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), small interfering RNA (siRNA), messenger RNA (mRNA), messenger RNA precursor (pre-mRNA), short hairpin RNA or short hairpin RNA (shRNA), microRNA (miRNA), guide RNA (gRNA), transfer RNA (tRNA), antisense RNA (asRNA), heterologous nuclear RNA (hnRNA), or the like, comprising a first click chemistry handle. A), coding RNA, non-coding RNA (ncRNA), long non-coding RNA (long ncRNA or lncRNA), satellite RNA, viral satellite RNA, signal recognition particle RNA, small cytoplasmic RNA, small nuclear RNA (snRNA), ribosomal RNA (rRNA), Piwi-interacting RNA (piRNA), polyinosinic acid, ribozyme, flexizyme, small nucleolar RNA (snoRNA), splice leader RNA, viral RNA, or viral satellite RNA.In certain embodiments, A has a sequence having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 92% sequence identity, at least 95% sequence identity, or at least 98% sequence identity to the full-length sequence of SEQ ID NO: 2. In certain embodiments, A has a sequence having at least 80% sequence identity to the full-length sequence of SEQ ID NO: 2. In certain embodiments, in the method of preparing a compound of Formula (I), A is an RNA comprising SEQ ID NO: 2. In certain embodiments, in the method of preparing a compound of Formula (I), A is an RNA, wherein the RNA comprises SEQ ID NO: 2.

[0196] In certain embodiments, in the method for preparing a compound of Formula (I), the first step is carried out under bioorthogonal click chemistry reaction conditions, such as the following click chemistry reaction conditions: copper-catalyzed azide-alkyne cyclization (CuAAC), strain-promoted azide-alkyne cycloaddition (SPAAC, e.g., cyclooctyne-azide cycloaddition, cyclooctene-tetrazine cycloaddition), tetracyclooctyne (TCO)-tetrazine ligation, or Staudinger ligation of azide. In certain embodiments, the first step is carried out under the reaction conditions shown in Tables 3 or 4 above. In certain embodiments, the first step is carried out under CuAAC conditions and includes diluting alkyne-modified nucleic acid A with water and optionally denaturing it at a temperature of 90-100°C for about 1-5 minutes to form a reaction mixture. In certain embodiments, the first step is carried out under copper-free click chemistry reaction conditions (e.g., one of reactions 1-13 in Table 4) and involves diluting modified nucleic acid A (e.g., alkene-modified DNA, alkyne-modified RNA, alkene-modified DNA, or alkyne-modified RNA) with water to form a reaction mixture. In certain embodiments, the first step is carried out under CuAAC conditions and involves diluting alkyne-modified nucleic acid A with water without denaturation at a temperature of 90-100°C for about 1-5 minutes to form a reaction mixture. In certain embodiments, the first step is carried out under CuAAC conditions and involves diluting alkyne-modified nucleic acid A with water, with denaturation carried out at a temperature of 90-100°C (e.g., about 95°C) for about 1-5 minutes (e.g., about 2 minutes) to form a reaction mixture. In certain embodiments, the first step is performed under CuAAC conditions and involves diluting the alkyne-modified nucleic acid A with water to a final concentration of 90 μM to 125 μM or 95 μM to 115 μM, e.g., 100 μM to 125 μM (e.g., 100 μM). In certain embodiments, the first step is performed under SPAAC conditions, e.g., cyclooctyne-azide cycloaddition conditions, and involves diluting the alkyne-modified (e.g., strained alkyne-modified, e.g., cyclooctyne-modified) nucleic acid A with water to a final concentration of 1 μM to 115 μM or 5 to 100 μM, e.g., 1 μM to 100 μM.In certain embodiments, an alkyne-modified nucleic acid, A, is prepared by coupling RNA or DNA modified at the 5' end with an internal amino modification ( / iUniAmM / ) (e.g., internal amino modifications of nucleic acids available from Integrated DNA Technologies) to DIBAC (dibenzoazacyclooctyne or "DBCO" (dibenzocyclooctyne)) using N-hydroxysuccinimide (NHS) reaction conditions.

[0197] In certain embodiments, the first step is followed by placing the reaction mixture on ice, followed by folding in MgCl (e.g., 200 μM MgCl) and a neutral buffer (e.g., phosphate buffered saline (PBS) at pH 7.0). In certain embodiments, the first step is followed by placing the reaction mixture on ice, followed by folding in MgCl (e.g., 200 μM MgCl) and a neutral buffer (e.g., phosphate buffered saline (PBS) at pH 7.0) at 35-39° C. for about 5-10 minutes. In certain embodiments, the method further comprises adding the ligand 2-(4-((bis((1-(tert-butyl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)-1H-1,2,3-triazol-1-yl)acetic acid (BTTAA) to the reaction mixture and incubating at room temperature, e.g., about 18-75°C (e.g., 18-23°C, 20-25°C, 25-40°C, 40-50°C, 50-55°C, 55-60°C, 60-70°C, or 70-75°C). In certain embodiments, the method further comprises reacting A (e.g., about 10 μM A, about 10-20 μM A), B (e.g., about 20 μM or about 20-30 μM B), and optionally Cu-BTTAA (e.g., about 100-110 μM Cu-BTTAA). In certain embodiments, the method further comprises reacting A (e.g., about 10 μM A), B (e.g., about 20 μM B), and Cu-BTTAA (e.g., about 100-110 μM Cu-BTTAA). In certain embodiments, the method further includes reacting A (e.g., about 10 μM A), B (e.g., about 20 μM B), optional Cu-BTTAA (e.g., about 100-110 μM Cu-BTTAA), and sodium ascorbate with a buffer solution (e.g., PBS) at about 18-75°C (e.g., 18-23°C, 20-25°C, 25-40°C, 40-50°C, 50-55°C, 55-60°C, 60-70°C, 70-75°C) for at least about 6-48 hours.In certain embodiments, the method further includes reacting A (e.g., about 10-20 μM A), B (e.g., about 20-30 μM B), optional Cu-BTTAA (e.g., about 100-110 μM Cu-BTTAA), and sodium ascorbate with a buffer solution (e.g., PBS) at about 18-75°C (e.g., 18-23°C, 20-25°C, 25-40°C, 40-50°C, 50-55°C, 55-60°C, 60-70°C, 70-75°C) for at least about 6-48 hours. In certain embodiments, the method further includes reacting A (e.g., about 1-100 μM A) as a first click chemistry handle comprising a cyclooctyne (e.g., DIBAC / DBCO), B (e.g., about 100-1000 μM B) as a second click chemistry handle comprising an azide, optional Cu-BTTAA (e.g., about 100-110 μM Cu-BTTAA), and sodium ascorbate with a buffer (e.g., PBS) and a solvent (e.g., acetonitrile, DMSO) in an amount of 0-50% (e.g., 25-50%) of either the buffer or the solvent in the reaction mixture at about 18-75°C (e.g., 18-23°C, 20-25°C, 25-40°C, 40-50°C, 50-55°C, 55-60°C, 60-70°C, 70-75°C) for at least about 6-48 hours.

[0198] In certain embodiments, the method further includes reacting A (e.g., about 1-100 μM A) as a first click chemistry handle comprising a cyclooctyne (e.g., DIBAC / DBCO), B (e.g., about 100-1000 μM B) as a second click chemistry handle comprising an azide, a buffer (e.g., PBS) and a solvent (e.g., acetonitrile, DMSO) to a final concentration of 0-50% (e.g., 25-50%) of either the buffer or the solvent in the reaction mixture at about 18-75°C (e.g., 18-23°C, 20-25°C, 25-40°C, 40-50°C, 50-55°C, 55-60°C, 60-70°C, 70-75°C) for at least about 6-48 hours.

[0199] In certain embodiments, the method further includes reacting A (e.g., about 1-100 μM A), B (e.g., about 100-1000 μM B), optionally Cu-BTTAA (e.g., about 100-110 μM Cu-BTTAA), a buffer (e.g., PBS) and a solvent (e.g., acetonitrile, DMSO) to a final concentration of 0-50% (e.g., 25-50%) of either the buffer or the solvent in the reaction, at about 18-75°C (e.g., 18-23°C, 20-25°C, 25-40°C, 40-50°C, 50-55°C, 55-60°C, 60-70°C, 70-75°C) for at least about 6-48 hours. In certain embodiments, the method further includes reacting A (e.g., about 10-20 μM A), B (e.g., about 20-30 μM B), optional Cu-BTTAA (e.g., about 100-110 μM Cu-BTTAA), a buffer (e.g., PBS) and a solvent (e.g., acetonitrile, DMSO) to a final concentration of 0-50% (e.g., 25-50%) of either the buffer or the solvent in the reaction at about 18-75°C (e.g., 18-23°C, 20-25°C, 25-40°C, 40-50°C, 50-55°C, 55-60°C, 60-70°C, 70-75°C) for at least about 6-24 hours. In certain embodiments, the method further includes reacting A (e.g., about 10-20 μM A), B (e.g., about 20-30 μM B), optional Cu-BTTAA (e.g., about 100-110 μM Cu-BTTAA), a buffer (e.g., PBS) and a solvent (e.g., acetonitrile, DMSO) to a final concentration of 0-50% (e.g., 25-50%) of either the buffer or the solvent in the reaction at about 18-75°C (e.g., 18-23°C, 20-25°C, 25-40°C, 40-50°C, 50-55°C, 55-60°C, 60-70°C, 70-75°C) for at least about 24-48 hours.In certain embodiments, the first step is carried out under conditions for a click chemistry reaction that is strain-promoted azide-alkyne cycloaddition (SPAAC), trans-cyclooctyne (TCO)-tetrazine ligation, trans-cyclooctene-tetrazine ligation, Staudinger ligation of azide, crosslinking between a primary amine and an N-hydroxysuccinimide ester (NHS ester), trans-cyclooctyne-azide coupling, or cyclopropane-azide coupling. In certain embodiments, the first step is carried out under conditions for a click chemistry reaction that is strain-promoted azide-alkyne cycloaddition (SPAAC). In certain embodiments, the first step is carried out under conditions for a click chemistry reaction that is strain-promoted azide-alkyne cycloaddition (SPAAC), which involves a reaction between a cyclooctyne (e.g., DIBAC / DBCO) as the first click chemistry handle and an azide as the second click chemistry handle. In certain embodiments, the first step is carried out under click chemistry reaction conditions for trans-cyclooctyne (TCO)-tetrazine ligation or trans-cyclooctene-tetrazine ligation. In certain embodiments, the first step is carried out under click chemistry reaction conditions for trans-cyclooctyne (TCO)-tetrazine ligation. In certain embodiments, the first step is carried out under click chemistry reaction conditions for trans-cyclooctene-tetrazine ligation. In certain embodiments, the first step is carried out under click chemistry reaction conditions for Staudinger ligation of azide, crosslinking between a primary amine and an N-hydroxysuccinimide ester (NHS ester), trans-cyclooctyne-azide coupling, or cyclopropane-azide coupling. In certain embodiments, the first step is carried out under click chemistry reaction conditions for Staudinger ligation of azide.In certain embodiments, the first step is carried out under click chemistry reaction conditions for crosslinking between a primary amine and an N-hydroxysuccinimide ester (NHS ester). In certain embodiments, the first step is carried out under click chemistry reaction conditions for trans-cyclooctyne-azide coupling. In certain embodiments, the first step is carried out under click chemistry reaction conditions for cyclopropane-azide coupling. In certain embodiments, the method further includes adding about 10-25 mM ethylenediaminetetraacetic acid (EDTA) (e.g., about 15-20 mM EDTA, about 18-20 mM EDTA, about 20-22 mM EDTA, about 20 mM EDTA), e.g., to quench the reaction. In certain embodiments, the method further comprises a step of enzymatic conversion of the N-glycan of the compound of Formula (I), e.g., adding a sugar(s) (e.g., a sugar) with a sialyltransferase or a fucosyltransferase, or cleaving (e.g., cleaving an existing sugar(s)) with a mannosidase. In certain embodiments, the method further comprises a step of precipitation of the compound of Formula (I) and / or column purification, e.g., with a silica-based RNA or DNA desalting column. In certain embodiments, in the method of preparing a compound of Formula (I), the first click chemistry handle and the second click chemistry handle are as described herein. In certain embodiments, in the method of preparing a compound of Formula (I), the first click chemistry handle and the second click chemistry handle are one of the click chemistry handle pairs shown in Table 3 or 4. In certain embodiments, in the method for preparing a compound of Formula (I), the first click chemistry handle and the second click chemistry handle are click chemistry handles used in CuAAC. In certain embodiments, the first click chemistry handle is an alkyne or an azide. In certain embodiments, the first click chemistry handle is an alkyne (e.g., an unstrained alkyne, a strained alkyne).In certain embodiments, the first click chemistry handle is an alkyne having the formula: In certain embodiments, nucleic acid A comprises a first click chemistry handle that is an alkyne attached to a base of the nucleic acid. In certain embodiments, A has the structure: [ka] wherein A is RNA or DNA.

[0200] In certain embodiments, nucleic acid A comprises a first click chemistry handle that is an alkyne attached to the 2'OH position of the ribose of the nucleic acid. In certain embodiments, in the method of preparing a compound of Formula (I), the first click chemistry handle and the second click chemistry handle are click chemistry handles used in copper-free bioorthogonal click chemistry reactions, such as the click chemistry handle partners shown in Reactions 1-13 of Table 4 (e.g., azide-cyclooctyne, azide-activated alkyne, tetrazine-alkene, tetrazole-alkene, thiol-alkene). In certain embodiments, in the method of preparing a compound of Formula (I), the first click chemistry handle and the second click chemistry handle are cyclooctyne and azide, respectively. In certain embodiments, the first click chemistry handle and the second click chemistry handle are click chemistry handles used in the alkene-tetrazine retro Diels-Alder [4 + 2] cycloaddition or alkene-tetrazole 1,3-dipolar cycloaddition (photoclick) shown in Table 4. In certain embodiments, the first click chemistry handle is an alkene (e.g., trans-cyclooctene, norbornene, cyclopropene, 1-methylcyclopropene (MCp)). In certain embodiments, A comprises a first click chemistry handle that is an alkene (e.g., trans-cyclooctene, norbornene, and 1-methylcyclopropene (MCp)). In certain embodiments, A comprises a first click chemistry handle that is an alkene (vinyl) and B comprises a second click chemistry handle that is a tetrazine.In certain embodiments, A comprises a first click chemistry handle that is an alkene (vinyl) as in Kubota et al., “Expanding the Scope of RNA Metabolic Labeling with Vinyl Nucleosides and Inverse Electron-Demand Diels-Alder Chemistry,” ACS Chemical Biology vol. 14, 8 (2019): 1698-1707 (incorporated herein by reference) (e.g., Figures 2B and / or 2C in Kubota et al.), and B comprises a second click chemistry handle that is a tetrazine (e.g., Figure 3A in Kubota et al.). In certain embodiments, nucleic acid A comprises a first click chemistry handle that is an alkyne (e.g., an unstrained alkyne, a strained alkyne) attached to the 2′ OH position of the ribose, the 3′ OH position of the ribose or deoxyribose, or the 5′ OH position of the ribose or deoxyribose of nucleic acid A. In certain embodiments, A in Formula (I) comprises a first click chemistry handle that is an alkyne (e.g., an unstrained alkyne, a strained alkyne) attached to the 2'-OH position of the ribose of nucleic acid A. In certain embodiments, A in Formula (I) comprises a first click chemistry handle that is an alkyne (e.g., an unstrained alkyne, a strained alkyne) attached to the 3'-OH position of the ribose or deoxyribose of nucleic acid A. In certain embodiments, A in Formula (I) comprises a first click chemistry handle that is an alkyne (e.g., an unstrained alkyne, a strained alkyne) attached to the interior of nucleic acid A, the 3' end of nucleic acid A, or the 5' end of nucleic acid A. In certain embodiments, A in Formula (I) comprises a first click chemistry handle that is an alkyne (e.g., an unstrained alkyne, a strained alkyne) attached to the interior of nucleic acid A. In certain embodiments, A comprises a first click chemistry handle that is a cyclooctyne (e.g., DIBAC, DBCO).In certain embodiments, A comprises a first click chemistry handle that is a cyclooctyne (e.g., DIBAC, DBCO), and B comprises a second click chemistry handle that is an azide. In certain embodiments, A comprises a first click chemistry handle that is an alkene. In certain embodiments, A comprises a first click chemistry handle that is an alkene (vinyl) (e.g., Figures 2B and / or 2C in Kubota et al.) in Kubota et al., "Expanding the Scope of RNA Metabolic Labeling with Vinyl Nucleosides and Inverse Electron-Demand Diels-Alder Chemistry." ACS Chemical Biology vol. 14, 8 (2019): 1698-1707 (incorporated herein by reference). In certain embodiments, A comprises a first click chemistry handle that is an alkene, where A is: [ka] Includes.

[0201] In certain embodiments, the first click chemistry handle is an azide. In certain embodiments, nucleic acid A comprises a first click chemistry handle that is an azide attached to a base of the nucleic acid. In certain embodiments, the second click chemistry handle is an alkyne (e.g., an unstrained alkyne, a strained alkyne). In certain embodiments, compound B comprises a second click chemistry handle (e.g., a handle in Table 3 or 4) attached to the non-reducing end of an N-glycan. In certain embodiments, compound B comprises a second click chemistry handle that is an alkyne or azide attached to the non-reducing end of an N-glycan. In certain embodiments, compound B comprises a second click chemistry handle that is an alkyne attached to the non-reducing end of an N-glycan. In certain embodiments, compound B comprises a second click chemistry handle that is an azide attached to the non-reducing end of an N-glycan. In certain embodiments, A comprises a first click chemistry handle that is an alkyne (e.g., unstrained alkyne, cyclooctyne) attached to DNA or RNA, and compound B comprises a second click chemistry handle that is an azide attached to an N-glycan. In certain embodiments, A comprises a first click chemistry handle that is an alkyne (e.g., unstrained alkyne, cyclooctyne), and compound B comprises a second click chemistry handle that is an azide attached to the non-reducing end of an N-glycan.

[0202] In certain embodiments, B is an N-glycan that is a monoantennary N-glycan, a biantennary N-glycan, a triantennary N-glycan, or a pentaantennary N-glycan. In certain embodiments, B is an N-glycan that contains sialic acid. In certain embodiments, compound B has the following formula: [ka] It is of the type.

[0203] In certain embodiments, compound B is G-28, G-35, G-29, or G-30.

[0204] In certain embodiments, Compound B is a compound of Table 2B.

[0205] In certain embodiments, compound B is prepared by converting an amino-N-glycan to the corresponding azido-N-glycan by fluorosulfuryl azide-mediated diazotransfer. In certain embodiments, the azido-N-glycan, compound B, has the following formula: [ka] The amino N-glycan is prepared by adding fluorosulfuryl azide, water, and a base (e.g., Na2CO3) to the amino N-glycan at a basic pH (e.g., about 8.5-9.5, about 9.0) at room temperature (e.g., about 18-23°C) for about 1-2 hours (e.g., 1 hour). In certain embodiments, the azido-N-glycan, Compound B, is prepared according to Scheme 1 below. Scheme 1. Preparation of Azido-N-Glycan (Exemplary Compound B) [ka]

[0206] In certain embodiments, the compound of formula (I) that is prepared is a compound shown in Figure 9. In certain embodiments, the compound of formula (I) that is prepared is a compound disclosed elsewhere herein.

[0207] Use of glyconucleic acid In one aspect, provided herein are methods and processes that utilize the modified glyconucleic acids of the present disclosure.

[0208] In one embodiment, the present disclosure provides a method in which an isolated cell or a plurality of isolated cells is contacted with a modified glyconucleic acid of the present disclosure. In one embodiment, the present disclosure provides a method for producing a treated cell or a plurality of cells, comprising providing an isolated cell or a plurality of isolated cells, providing a modified nucleic acid comprising a glycan as described herein, and contacting the modified nucleic acid with the isolated cell or a plurality of cells, wherein the isolated cell or a plurality of cells is capable of binding to the modified nucleic acid. In some embodiments, the modified nucleic acid comprising a glycan comprises a small modified RNA, such as an siRNA. In some embodiments, the modified nucleic acid comprising a glycan comprises a large modified RNA, such as an mRNA. In some embodiments, contacting the isolated cell or a plurality of cells further comprises electroporation.

[0209] In one embodiment, the present disclosure provides a method for producing a chimeric antigen receptor comprising contacting a suitable cell with a glyconucleic acid of the present disclosure, wherein the glyconucleic acid comprises a modified RNA comprising a sequence encoding a chimeric antigen receptor polypeptide. In some embodiments, the method comprises administering to a subject an effective amount of a pharmaceutical composition comprising a pharmaceutically acceptable carrier and the modified RNA of the present disclosure, wherein the modified RNA comprises a sequence encoding a chimeric antigen receptor polypeptide.

[0210] In some embodiments, the glyconucleic acids of the present disclosure are internalized by cells. In some embodiments, the glyconucleic acids of the present disclosure are internalized by cells more efficiently than analogous unmodified nucleic acids. In some embodiments, the glyconucleic acids of the present disclosure are internalized by cells at least about 10% more, at least about 15% more, at least 20% more, at least about 25% more, at least about 30% more, at least about 35% more, at least about 40% more, at least about 45% more, at least 50% more, at least 55% more, at least 60% more, at least 65% more, at least 70% more, at least 75% more, at least 80% more, at least 85% more, at least 90% more, at least 95% more, at least 100% more, or at least 200% more efficiently than analogous unmodified nucleic acids.

[0211] In some embodiments, the glyconucleic acids of the present disclosure bind to the surface of a cell. In some embodiments, cell surface binding results in at least one change in cell signaling. In some embodiments, binding of the glyconucleic acid to the cell surface enhances at least one cell signaling pathway. In some embodiments, binding of the glyconucleic acid to the cell surface attenuates at least one cell signaling pathway.

[0212] Route of administration, formulation, and pharmacodynamic effects Provided herein are pharmaceutical compositions suitable for administration to a subject, comprising glyconucleic acids, e.g., glycoRNA and glycoDNA. Pharmaceutical compositions generally comprise glyconucleic acids, e.g., glycoRNA and glycoDNA, and a pharmaceutically acceptable carrier in a form suitable for administration to a subject. The pharmaceutically acceptable carrier is determined in part by the particular composition being administered and the particular method used to administer the composition. Accordingly, there are a wide variety of suitable formulations of pharmaceutical compositions comprising glyconucleic acids, e.g., glycoRNA and glycoDNA. Pharmaceutical compositions are generally formulated sterile, substantially isotonic, and in full compliance with all Good Manufacturing Practices (GMP) regulations of the U.S. Food and Drug Administration.

[0213] Examples of suitable carriers include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. The use of such media and compounds for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or compound is incompatible with the glyconucleic acids, e.g., glycoRNA and glycoDNA, described herein, its use in the compositions is contemplated. Supplementary therapeutic agents may also be incorporated into the compositions. Typically, pharmaceutical compositions are formulated to be compatible with their intended route of administration. Glyconucleic acids, e.g., glycoRNA and glycoDNA, may be administered parenterally, topically, intravenously, orally, subcutaneously, intraarterially, intradermally, transdermally, rectally, intracranially, intraperitoneally, intranasally, intramuscularly, or as an inhalant. Glyconucleic acids, e.g., glycoRNA and glycoDNA, may optionally be administered in combination with other therapeutic agents that are at least partially effective in treating the disease, disorder, or condition targeted by the glyconucleic acids, e.g., glycoRNA and glycoDNA.

[0214] Solutions or suspensions used for parenteral, intradermal, or subcutaneous administration may contain the following components: a sterile diluent such as water for injection, saline, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; an antibacterial compound such as benzyl alcohol or methylparaben; an antioxidant such as ascorbic acid or sodium bisulfite; a chelating compound such as ethylenediaminetetraacetic acid (EDTA); a buffer such as acetate, citrate, or phosphate, and a compound for adjusting tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be placed in glass or plastic ampoules, disposable syringes, or multiple-dose vials.

[0215] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Suitable carriers for intravenous administration include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). In all cases, the composition is typically sterile and fluid to the extent that easy syringability exists. The composition must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The desired fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial activity can be achieved by various antibacterial and antifungal compounds, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it is preferable to include isotonic compounds, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the compositions of the present invention. Prolonged absorption of injectable compositions can be brought about by including in the composition a compound that delays absorption, for example, aluminum monostearate and gelatin.

[0216] Sterile injectable solutions can be prepared by incorporating glyconucleic acids, such as glycoRNA and glycoDNA, in an effective amount in a suitable solvent, if desired, with one or a combination of ingredients recited herein.

[0217] Generally, dispersions are prepared by incorporating glyconucleic acids, such as glycoRNA and glycoDNA, into a sterile vehicle containing a basic dispersion medium and any other desired ingredients. In the case of sterile powders for preparing sterile injections, the preparation method is vacuum drying and freeze-drying, which produces a powder of the active ingredient and any other desired ingredients from a previously sterile-filtered solution. Glyconucleic acids, such as glycoRNA and glycoDNA, can be administered in the form of a depot injection or implant preparation, which can be formulated in a manner that allows sustained or pulsed release of glyconucleic acids.

[0218] Sterile injectable solutions can be prepared by incorporating glyconucleic acids, such as glycoRNA and glycoDNA, in an effective amount in a suitable solvent, if desired, with one or a combination of ingredients recited herein.

[0219] Generally, dispersions are prepared by incorporating glyconucleic acids, such as glycoRNA and glycoDNA, into a sterile vehicle containing a basic dispersion medium and any other desired ingredients. In the case of sterile powders for preparing sterile injectable solutions, preparation methods include vacuum drying and freeze-drying, which produce a powder of the active ingredient and any additional desired ingredients from a previously sterile-filtered solution. Glyconucleic acids, such as glycoRNA and glycoDNA, can be administered in the form of depot injections or implants, which can be formulated to allow sustained or pulsed release of the glyconucleic acid and / or their payload(s) (e.g., encoded protein).

[0220] For administration by inhalation, glyconucleic acids, e.g., glycoRNA and glycoDNA, can be delivered in any suitable form using any suitable device, for example, as an aerosol spray from a pressurized container or dispenser containing a suitable propellant, e.g., a gas such as carbon dioxide, or as a dry powder using a nebulizer, a nebulized aerosol, or a dry powder inhaler.

[0221] Glyconucleic acids, such as glycoRNA and glycoDNA, can be prepared as pharmaceutical compositions in the form of suppositories (e.g., containing conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

[0222] In some embodiments, glyconucleic acids, such as glycoRNA and glycoDNA, are formulated with a carrier that reduces the rate at which the glyconucleic acid is excreted from the subject's body. For example, controlled-release formulations, including implants and microencapsulated delivery systems, are suitable. Biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid, can be used. Methods for preparing such formulations are readily apparent to those skilled in the art.

[0223] In one embodiment, pharmaceutical compositions comprising glyconucleic acids, e.g., glycoRNA and glycoDNA, are administered intravenously to a subject benefiting from the pharmaceutical composition. In other embodiments, the compositions are administered into the lymphatic system, e.g., by intralymphatic or intranodal injection (see, e.g., Senti et al., 2008 PNAS 105(46):17908), or by intramuscular injection, subcutaneous administration, or direct injection into the thymus or liver.

[0224] Pharmaceutically acceptable carriers can be used to deliver the glyconucleic acids described herein, such as glycoRNA and glycoDNA. Pharmaceutically acceptable carriers are generally used with compounds to make them useful for treatment or as a product. Generally, for any substance, a pharmaceutically acceptable carrier is a material that is combined with the substance for delivery to a subject.

[0225] Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners, etc. may be required or desired.In some cases, carriers are necessary for delivery, for example, to solubilize insoluble compounds for liquid delivery, or buffers to control the pH of substances so that their activity is maintained, or diluents to prevent substance loss in storage containers.However, in other cases, carriers are convenient, for example, liquids that improve the convenience of administration.The pharmaceutically acceptable salts of compounds described herein can be synthesized by methods known to those skilled in the art.

[0226] Typically, a pharmaceutically acceptable composition is highly purified to be free of contaminants, is biocompatible and non-toxic, and is suitable for administration to a subject. When water is a component of the carrier, the water is highly purified and treated to be free of contaminants (e.g., endotoxins).

[0227] Pharmaceutically acceptable carriers can be, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and / or mineral oil. Pharmaceutical compositions may further comprise lubricants, wetting agents, sweeteners, flavorings, emulsifiers, suspending agents, and / or preservatives.

[0228] In a specific example, glyconucleic acids, e.g., glycoRNA and glycoDNA, can be stored in an appropriate buffer, e.g., an FDA-approved anticoagulant storage solution, such as anticoagulant citrate dextrose A (ACD-A), citrate phosphate dextrose (CPD), citrate phosphate dextrose dextrose (CP2D), or citrate phosphate dextrose adenine (CPDA-1). The composition can be stored for up to 21 days.

[0229] In other examples, glyconucleic acids, e.g., glycoRNA and glycoDNA, can be stored in approved additive solutions, e.g., AS-1 (Adsol), AS-3 (Nutricel), AS-5 (Optisol), or AS-7 (SOLX).

[0230] A medical device is provided that includes a container containing a pharmaceutical composition comprising the glyconucleic acids described herein, e.g., glycoRNA and glycoDNA, and an applicator for intravenous injection of the pharmaceutical composition into a subject.

[0231] Medical kits are provided that include pharmaceutical compositions comprising the glyconucleic acids described herein, e.g., glycoRNA and glycoDNA, and medical devices for intravenous injection of the pharmaceutical compositions into a subject.

[0232] In some embodiments, nanoparticles comprising a lipid component and glyconucleic acids, e.g., glycoRNA and glycoDNA, can be administered, for example, parenterally or topically or by topical application. In some embodiments, at least a portion of the protein expressed by the glyconucleic acid, e.g., glycoRNA and glycoDNA, is localized to the location of a desired target tissue or target cell by topical administration.

[0233] Administering a pharmaceutical composition comprising at least one nanoparticle to a subject can include contacting one or more cells with the pharmaceutical composition by topical administration or topical application.

[0234] In some embodiments, the method of administration comprises administering electroporation. In some embodiments, the method comprises providing a modified RNA comprising a glycan moiety, as disclosed and described elsewhere herein, and administering electroporation to a subject.

[0235] In some embodiments, the pharmaceutical compositions disclosed herein are formulated for systemic administration to a human subject in need of the pharmaceutical composition. In some embodiments, the pharmaceutical compositions disclosed herein are formulated for systemic administration to a mammalian subject in need of the pharmaceutical composition. In some embodiments, the pharmaceutical compositions disclosed herein are formulated for multiple systemic administration to a human subject in need of the pharmaceutical composition. In some embodiments, the pharmaceutical compositions disclosed herein are formulated for multiple systemic administration to a mammalian subject in need of the pharmaceutical composition.

[0236] In some embodiments, a pharmaceutical composition comprising a modified nucleic acid conjugated to a glycan provides a sustained pharmacodynamic effect when administered to a subject. In some embodiments, a pharmaceutical composition comprising a modified nucleic acid conjugated to a glycan provides a pharmacodynamic effect for at least one week after administration to a subject. In some embodiments, a pharmaceutical composition comprising a modified nucleic acid conjugated to a glycan provides a pharmacodynamic effect for at least one month after administration to a subject. In some embodiments, a pharmaceutical composition comprising a modified nucleic acid conjugated to a glycan provides a pharmacodynamic effect for at least three months after administration to a subject. In some embodiments, a pharmaceutical composition comprising a modified nucleic acid conjugated to a glycan provides a pharmacodynamic effect for at least six months after administration to a subject. In some embodiments, a pharmaceutical composition comprising a modified nucleic acid conjugated to a glycan provides a pharmacodynamic effect for at least one year after administration to a subject. In some embodiments, a pharmaceutical composition comprising a modified nucleic acid conjugated to a glycan provides a pharmacodynamic effect for at least 18 months after administration to a subject. In some embodiments, the modified nucleic acid conjugate provides increased circulation time in the body of a subject compared to a comparable nucleic acid that is not conjugated to a glycan. In some embodiments, the modified nucleic acid conjugate has an increased half-life in the body of a subject compared to a comparable nucleic acid that is not conjugated to a glycan. In some embodiments, the modified nucleic acid conjugate has increased stability in the body of a subject compared to a comparable nucleic acid that is not conjugated to a glycan.

[0237] In another aspect, the present disclosure provides a pharmaceutical composition comprising a glyconucleic acid of the present disclosure formulated as part of a nanoparticle composition. In one embodiment, the glyconucleic acid is present inside or within a nanoparticle. In another embodiment, the glyconucleic acid is present on the surface of a nanoparticle. In some embodiments, the nanoparticle is a lipid nanoparticle (LNP). In some embodiments, the nanoparticle is an LNP, such as, but not limited to, those described in Patent Application Publications WO2017049245A2, WO2019089828A1, and US20170210697A1 (each of which is incorporated by reference in its entirety). In another embodiment, the nanoparticle is a polymeric nanoparticle. In another embodiment, the nanoparticle is a polymeric nanoparticle, such as, but not limited to, those described in Begines, et al. (Nanomaterials 2020 Jul;10(7):1403). In another aspect, the present disclosure provides a process for producing a nanoparticle formulation comprising a glyconucleic acid of the present disclosure. In one embodiment, a process for producing glyconucleic acid nanoparticles includes providing a nucleic acid, contacting the nucleic acid with a glycan under conditions such that the nucleic acid is conjugated to the glycan to produce a modified nucleic acid comprising a glycan moiety, and then contacting the modified nucleic acid comprising the glycan moiety with nanoparticles under conditions such that nanoparticles comprising the glyconucleic acid are formed. In some embodiments, the nanoparticles are LNPs.

[0238] In some embodiments, the glyconucleic acids of the present disclosure exhibit serum stability. In some embodiments, the conjugation of the glycan to the nucleic acid confers stability to the entire conjugate, such that the conjugate has a longer serum shelf life than the same nucleic acid lacking the conjugated glycan. In one aspect, the present disclosure provides a method for producing serum containing the glyconucleic acids of the present disclosure, the method comprising providing a modified nucleic acid comprising a glycan moiety comprising at least 10 monosaccharides, and providing serum, wherein the glycan stabilizes the nucleic acid in the serum.

[0239] Dosage The dosage and frequency of administration of glycoRNA and its pharmaceutical compositions can be determined by the attending physician based on various factors, such as the severity of the disease, the patient's age, sex, and diet, the severity of any inflammation, the administration time, and other clinical factors. In one example, intravenous administration is initiated at a minimally effective dose, and the dose is increased over a preselected time course until a favorable effect is observed. Thereafter, escalation of the dosage is limited to a level that provides a commensurate increase in efficacy while taking into account any adverse effects that may occur.

[0240] Non-limiting examples of suitable dosages include, for example, 1 x 10 10 ~1×10 14 , 1×10 11 ~1×10 13 , or 5 × 10 11 ~5×10 12 The number of glycoRNAs can range from about 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , 9×10 10 , 1×10 11 , 2 × 10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , 9×10 11 , 1×10 12 Each dose of glycoRNA can be administered at intervals of time such as once daily, once weekly, twice weekly, once monthly, or twice monthly.

[0241] Pharmaceutical compositions containing effective levels of glycoRNA are provided. Such compositions contain a plurality of glycoRNAs, e.g., 1×10 3 glycoRNA, or 1 x 10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 , 1×109 , 1×10 10 , 1×10 11 , 1×10 12 , or 1×10 12 The glycoRNA may contain more than 1000 glycoRNAs. In a specific example, the glycoRNA may be administered in saline at a mass-to-volume (%m / v) concentration of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or greater than 90%. The administration time to the patient may range from 10 minutes to 4 hours or longer.

[0242] Dosage forms comprising pharmaceutical compositions comprising glycoRNAs described herein are provided. In some embodiments, the dosage forms are formulated as suspensions for intravenous injection.

[0243] The pharmaceutically acceptable suspension of glycoRNA is preferably packaged in a volume of about 10 to about 250 ml. The package may be a syringe or an intravenous bag suitable for infusion. Administration of the suspension is carried out, for example, by intravenous or intraarterial injection, optionally using an intravenous drip from an intravenous drip bag. Administration is typically carried out intravenously in the arm or via a central venous catheter. For doses exceeding 50 ml, the use of an intravenous drip is preferred.

[0244] In certain embodiments, the nanoparticles disclosed herein may be administered one or more times daily at a dosage level sufficient to deliver about 0.0001 mg / kg to about 100 mg / kg, about 0.001 mg / kg to about 0.05 mg / kg, about 0.005 mg / kg to about 0.05 mg / kg, about 0.001 mg / kg to about 0.005 mg / kg, about 0.05 mg / kg to about 0.5 mg / kg, about 0.01 mg / kg to about 50 mg / kg, about 0.1 mg / kg to about 40 mg / kg, about 0.5 mg / kg to about 30 mg / kg, about 0.01 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 10 mg / kg, or about 1 mg / kg to about 25 mg / kg of glycoRNA per subject body weight per day to achieve the desired therapeutic effect.

[0245] In some embodiments, the nanoparticles disclosed herein are administered to a subject in a single dose. In some embodiments, the nanoparticles disclosed herein are administered in multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) fixed doses. In each embodiment of this paragraph, the "multiple doses" can be separated from each other by a short time (1-5 minutes), a medium time (6-30 minutes), or a long time (more than 30 minutes, several hours, or even days).

[0246] The nanoparticles can be administered to a subject using any dosage effective for treating a disease, disorder, and / or condition. The exact dosage required will vary from subject to subject, depending on the subject's age and general condition, the severity of the disease, the specific formulation, its mode of administration, its mode of activity, etc. However, it will be understood that the total daily amount of the composition to be used can be determined by the attending physician within the scope of sound medical judgment. The specific pharmaceutically effective dose level for any particular patient will depend on various factors, including the severity of the disease, the specific composition used, the patient's age, weight, health, sex, and diet, the time of administration, the route of administration, the duration of treatment, and similar factors well known in the medical field.

[0247] Diseases, Disorders, and Conditions In one aspect, provided herein are methods for modulating the concentration of a target in a subject to treat or prevent a disease, disorder, or condition associated with the presence, absence, elevated, or decreased concentration of the target. As used herein, the term "target" refers to a molecule or other chemical entity that is involved in the pathogenesis of, or exhibits symptoms of, a disease, disorder, or condition. The subject may be suffering from, or at risk of developing, a disease, disorder, or condition. The methods provided herein include administering a suitable glyconucleic acid, e.g., glycoRNA and glycoDNA, described herein, in an amount effective to substantially modulate the concentration of the target, thereby preventing or treating the disease, disorder, or condition. In some embodiments, the glyconucleic acid, e.g., glycoRNA and glycoDNA, is formulated as a pharmaceutical composition. In some embodiments, the pharmaceutical composition is formulated for parenteral administration, e.g., intravenous injection, to a subject. In some embodiments, the pharmaceutical composition is formulated for topical administration to a subject. The composition can be administered to the subject in any desired regimen, for example, by a single administration to the subject, or multiple administrations can be carried out over a certain period of time.For example, two, three, four, five or more administrations can be provided to the subject.In some embodiments, administration can be provided as needed, for example, as long as symptoms related to disease, disorder or condition persist.In some embodiments, repeated administrations may be required during the remaining life of the subject.The treatment period can vary, for example, can be within 1 year, 6 months, 3 months, 2 months, 1 month, 2 weeks, 1 week, 3 days, 2 days, or 1 day.

[0248] In some embodiments, the composition is administered at least twice over a treatment period such that the disease, disorder, or condition is treated or its symptoms are reduced. In some embodiments, the composition is administered at least twice over a treatment period such that the disease, disorder, or condition is treated or its symptoms are prevented. In some embodiments, the pharmaceutical composition is administered a sufficient number of times over the treatment period such that the concentration of the target is substantially reduced during the treatment period. In some embodiments where the target is an autoantibody, the pharmaceutical composition is administered a sufficient number of times over the treatment period such that the concentration of the target autoantibody is substantially reduced during the treatment period, thereby preventing, reducing, or delaying one or more symptoms of the autoantibody-mediated disease, disorder, or condition. In some embodiments, reducing the concentration of the target includes reducing the peak concentration, while in other instances, it includes reducing the average concentration. In some embodiments, a substantial reduction during the treatment period can be determined by comparing pre- or post-treatment periods in human subjects, or by comparing measurements made in a treated population with a matched untreated control population. In some embodiments, the concentration of the target is reduced by at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or greater than 99.99% over part or all of the treatment period. In some embodiments, the target concentration is maintained for about 1, 5, 10, 15, 20, 30, 40, or 50 minutes, or for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours, or for 1, 2, 3, 4, 5, or 6 days, or for about 1, 2, 3, 4, 5, or 6 days after administration. a reduction of at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or greater than 99.99% within 3, 4, 5, or 6 weeks.

[0249] In some embodiments, the pharmaceutical composition is administered a sufficient number of times over the treatment period such that the concentration of the target is reduced at a rate that exceeds i) the endogenous rate of clearance of the target by the human subject, or ii) the endogenous rate of production of the target by the human subject, or iii) both i) and ii). In some embodiments, the pharmaceutical composition is administered a sufficient number of times over the treatment period such that the concentration of the target is substantially reduced for at least about 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or more than 6 months. In some embodiments, the pharmaceutical composition is administered a sufficient number of times over the treatment period such that the concentration of the target is substantially reduced for at least the duration of the treatment period.

[0250] In some embodiments, the pharmaceutical composition is administered frequently enough to effectively reduce the concentration of the target below a level associated with the symptoms of the disease, disorder, or condition.

[0251] In some embodiments, the time interval between administrations within a treatment period is within a period during which the number of glycoRNAs is reduced to less than about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the number of glycoRNAs present in the administered pharmaceutical composition.

[0252] Target-related diseases, disorders, and conditions that can be treated or prevented by administering glyconucleic acids, eg, glycoRNA and glycoDNA, are described herein.

[0253] Target-related diseases, disorders, and conditions that may be modulated for therapeutic benefit by administering glyconucleic acids, e.g., glycoRNA and glycoDNA, include, but are not limited to, anti-autoantibody mediated diseases, diseases associated with complement dysregulation, immune complex-related diseases, amyloidosis, diseases associated with infectious agents or pathogens (e.g., bacterial, fungal, viral, parasitic infections), diseases associated with toxic proteins, diseases associated with lipid accumulation, diseases associated with mammalian apoptotic cells, mammalian necrotic cells, mammalian abnormal cells, or mammalian oncogenic cells, and metabolic diseases.

[0254] In some embodiments, provided herein are methods for treating or preventing a disease or condition associated with a target (e.g., a molecule or entity) that can be modulated for therapeutic effect. In certain embodiments, the methods comprise administering to a subject in need thereof a glyconucleic acid, e.g., glycoRNA and glycoDNA, or a composition, preferably a pharmaceutical composition, comprising a glyconucleic acid, in an amount effective to treat or prevent the disease or condition associated with the molecule or entity.

[0255] Methods for treating or preventing inflammation and inflammation-related diseases, including sepsis, autoimmune diseases, cancer, and microbial infections, are provided, comprising administering to a subject in need thereof a glyconucleic acid, e.g., glycoRNA and / or glycoDNA, in an amount effective to treat or prevent inflammation or an inflammation-related disease. In some embodiments, the glycoRNA comprises a sequence encoding a chemokine or cytokine receptor.

[0256] Methods for regulating chemokine homeostasis at an inflammatory site are provided, comprising administering to a subject in need thereof a glyconucleic acid, e.g., glycoRNA and / or glycoDNA, in an amount effective to regulate chemokine homeostasis at the inflammatory site. In some embodiments, the glyconucleic acid is glycoDNA or glycoRNA comprising a sequence encoding a chemokine receptor.

[0257] Additionally, methods of inducing toxin clearance are provided, comprising administering to a subject in need thereof a glyconucleic acid, e.g., glycoRNA and / or glycoDNA, comprising a sequence encoding a peptide capable of interacting with a toxin, such as, for example, an antibody, scFv, or nanobody, in an amount effective to remove the toxin from the circulation. Such methods can be used to sequester the toxin, reducing the amount of tissue damage that would otherwise occur within the vasculature and eliminating its pathogenic effects in a less rapid manner.

[0258] In some embodiments, methods for treating diseases, including but not limited to metabolic diseases, cancer, clotting diseases, and anti-clotting diseases, are provided. The methods include administering to a subject in need thereof a pharmaceutical composition of glyconucleic acid, e.g., glycoRNA and / or glycoDNA, comprising a sequence encoding a peptide provided herein, in an amount sufficient to treat the metabolic disease, cancer, clotting disease, or anti-clotting disease in the subject.

[0259] In some embodiments, the disease, disorder, or condition is a metabolic disease. In some embodiments, the disease, disorder, or condition is cancer. In some embodiments, the disease, disorder, or condition is a clotting disease. In some embodiments, the disease, disorder, or condition is an anti-clotting disease. In some embodiments, the disease, disorder, or condition is an autoimmune disease. In some embodiments, the disease, disorder, or condition is an IgE-mediated allergy. In some embodiments, the disease, disorder, or condition is systemic lupus erythematosus. In some embodiments, the disease, disorder, or condition is a viral infection.

[0260] In some embodiments, glyconucleic acids, e.g., glycoRNA and / or glycoDNA, increase expression of a target. In some embodiments, glycoRNA comprises a circular RNA that includes a sequence encoding a peptide or protein.

[0261] In another aspect, provided are pharmaceutical compositions comprising the glyconucleic acids of the present disclosure for use in treating the diseases, disorders, and conditions disclosed herein. In yet another aspect, provided are pharmaceutical compositions comprising the glyconucleic acids of the present disclosure for use in the manufacture of a medicament for treating the diseases, disorders, and conditions disclosed herein.

[0262] Combination therapy In one embodiment, the present invention is directed to a method of killing cancer cells in a subject by administering to the subject a therapeutically effective amount of glyconucleic acid, e.g., glycoRNA and / or glycoDNA. In one aspect of this embodiment, the glyconucleic acid, e.g., glycoRNA and glycoDNA, is administered intravenously. In another aspect of this embodiment, the glyconucleic acid, e.g., glycoRNA and glycoDNA, is administered to a tumor in the subject. In yet another aspect of this embodiment, the glyconucleic acid, e.g., glycoRNA and glycoDNA, is administered in the vicinity of the tumor or systemically in a vehicle that allows delivery to the tumor.

[0263] In another embodiment, the present invention is directed to a method of treating cancer in a subject by administering to the subject a therapeutically effective amount of glyconucleic acid, e.g., glycoRNA and / or glycoDNA. In one aspect of this embodiment, the glycoRNA is administered intravenously. In another aspect of this embodiment, the glycoRNA is administered to a tumor in the subject. In yet another aspect of this embodiment, the glycoRNA is administered in the vicinity of the tumor or systemically in a vehicle that allows delivery to the tumor.

[0264] Cancer (and cancer cells) refers to any cancer that a subject may suffer from. Such cancers include liver cancer, colon cancer, pancreatic cancer, lung cancer, and bladder cancer. Liver cancer can be primary liver cancer or cancer that has metastasized to the liver from another tissue. Primary liver cancers include hepatocellular carcinoma and hepatoblastoma. Metastatic cancers include colon cancer and pancreatic cancer.

[0265] In one embodiment, the present invention is directed to a method of killing cancer cells in a subject by administering to the subject a therapeutically effective amount of an immune checkpoint inhibitor together with a therapeutically effective amount of a glyconucleic acid, e.g., glycoRNA and / or glycoDNA. In one aspect of this embodiment, administering the immune checkpoint inhibitor together with the glyconucleic acid (e.g., glycoRNA) increases the efficacy of the glyconucleic acid (e.g., glycoRNA).

[0266] In another embodiment, the present invention is directed to a method of treating cancer in a subject by administering to the subject a therapeutically effective amount of an immune checkpoint inhibitor together with a therapeutically effective amount of a glyconucleic acid, e.g., glycoRNA and / or glycoDNA. In one aspect of this embodiment, administering the immune checkpoint inhibitor together with the glyconucleic acid (e.g., glycoRNA) increases the efficacy of the glyconucleic acid (e.g., glycoRNA).

[0267] As described above, immune checkpoint inhibitors and glyconucleic acids, e.g., glycoRNA and / or glycoDNA, are administered intravenously, administered to the subject's tumor, administered in the vicinity of the tumor, or administered systemically in a vehicle that allows delivery to the tumor.

[0268] In one aspect of this embodiment, the immune checkpoint inhibitor is a monoclonal antibody that blocks the interaction between receptors on mammalian, such as human, cells, e.g., PD-1, PD-L1, CTLA4, Lag3, and Tim3, and their ligands. In a particular aspect, the monoclonal antibody is a monoclonal antibody against PD1 or PDL1.

[0269] Examples of monoclonal antibodies include atezolizumab, durvalumab, nivolumab, pembrolizumab, and ipilimumab. In yet another aspect of this embodiment, the immune checkpoint inhibitor is a small molecule that blocks the interaction between receptors on mammalian cells, such as human cells, such as PD-1, PD-L1, CTLA4, Lag3, and Tim3, and their ligands. In a particular aspect, the small molecule blocks the binding between PD1 and PDL1. BMS202 and similar ligands are examples of such small molecules.

[0270] The immune checkpoint inhibitor administered with the glyconucleic acid, e.g., glycoRNA and / or glycoDNA molecule, is a monoclonal antibody or small molecule as described above. The immune checkpoint inhibitor can be administered before, after, or simultaneously with the combination of the glyconucleic acid molecule.

[0271] In another embodiment, the pharmaceutical composition is used in conjunction with an immune checkpoint inhibitor as described herein. Accordingly, this embodiment of the invention is directed to a therapeutic combination comprising an immune checkpoint inhibitor and a pharmaceutical composition comprising a glyconucleic acid, e.g., glycoRNA and / or glycoDNA, in a pharmaceutically acceptable carrier as described herein.

[0272] In some embodiments, the modified nucleic acid further comprises at least one therapeutic moiety operably linked to the modified nucleic acid. In some embodiments, the at least one therapeutic moiety is selected from the group consisting of an antibody, a small molecule, an isotope, an enzyme, or a peptide. In some embodiments, the at least one therapeutic moiety is operably linked to the modified nucleic acid via a click chemistry reaction. In some embodiments, the at least one therapeutic moiety is operably linked to the modified nucleic acid via a high-affinity biotin / streptavidin interaction. In some embodiments, the at least one therapeutic moiety is operably linked to the modified nucleic acid via a linker group covalently attached to a terminus of the modified nucleic acid. In some embodiments, the at least one therapeutic moiety is operably linked to the modified nucleic acid via a linker covalently attached to a central chemically modified nucleotide of the polynucleotide. In some embodiments, the at least one therapeutic moiety is operably linked to the modified nucleic acid via a chemical handle inserted between the central two nucleotides of the polynucleotide.

[0273] In certain embodiments, glyconucleic acids, e.g., glycoRNA and / or glycoDNA, are conjugated to toxins or radionucleotides. In some embodiments, such glyconucleic acids conjugated to toxins or radionucleotides bind to receptors on target cells and kill the cells.

[0274] Optionally, glyconucleic acids, such as glycoRNA and / or glycoDNA, can be conjugated to a targeting antibody or antibody fragment, which can result in enhanced targeting of the glyconucleic acid to the desired cell or organ and can further stabilize the glyconucleic acid (e.g., increase serum half-life).

[0275] In another embodiment, a pharmaceutical composition comprising glyconucleic acids, e.g., glycoRNA and / or glycoDNA, is used in combination with a chemotherapeutic agent. Illustrative examples of cytotoxic chemotherapeutic agents that may be administered with the pharmaceutical composition include azaribine, anastrozole, azacitidine, bleomycin, bortezomib, bryostatin-1, busulfan, camptothecin, 10-hydroxycamptothecin, carmustine, Celebrex, chlorambucil, cisplatin, irinotecan, carboplatin, cladribine, cyclophosphamide, cytarabine, dacarbazine, docetaxel, dactinomycin, daunomycin glucuronide, daunorubicin, dexamethasone, diethylstilbestrol, doxorubicin, doxorubicin glucuronide, epirubicin, ethinyl estradiol, estramustine, etoposide, etoposide glucuronide, and floxuridine. , fludarabine, flutamide, fluorouracil, fluoxymesterone, gemcitabine, hydroxyprogesterone caproate, hydroxyurea, idarubicin, ifosfamide, leucovorin, lomustine, mechlorethamine, medroxyprogesterone acetate, megestrol acetate, melphalan, mercaptopurine, methotrexate, mitoxantrone, mithramycin, mitomycin, mitotane, phenylbutyrate, prednisone, procarbazine, paclitaxel, pentostatin, semustine, streptozocin, tamoxifen, taxane, taxol, testosterone propionate, thalidomide, thioguanine, thiotepa, teniposide, topotecan, uracil mustard, vinblastine, vinorelbine, and vincristine.

[0276] In some embodiments, the chemotherapeutic agent is panobinostat, actinomycin, all-trans retinoic acid, azacitidine, azathioprine, bleomycin, bortezomib, carboplatin, capecitabine, cisplatin, chlorambucil, cyclophosphamide, cytosine arabinoside, daunorubicin, docetaxel, 5-fluorouracil, deoxyfluorouridine, doxorubicin, epirubicin, adriamycin, epothilone, etoposide, cefotaxime ... poside, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, irinotecan, nitrogen mustard, mercaptopurine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, teniposide, thioguanine, topotecan, valrubicin, vemurafenib, vinblastine, vincristine, vindesine, vinorelbine, and hydroxycamptothecin.

[0277] In some embodiments, the chemotherapeutic agent is selected from the group consisting of docetaxel, panobinostat, 5-fluorouracil, paclitaxel, cisplatin, irinotecan, topotecan, and etoposide.

[0278] Optionally, a therapeutic moiety, e.g., a radioisotope, a chemotherapeutic agent, or any of the therapeutic agents disclosed herein, can be conjugated to the glyconucleic acid, e.g., glycoRNA and / or glycoDNA.

[0279] The term "chemotherapeutic agent" refers to a biological compound (macromolecule) or chemical compound (small molecule) that can be used to treat cancer. Types of chemotherapeutic agents include, but are not limited to, histone deacetylase inhibitors (HDACIs), alkylating agents, antimetabolites, alkaloids, cytotoxic / anticancer antibiotics, topoisomerase inhibitors, tubulin inhibitors, proteins, antibodies, kinase inhibitors, etc. Chemotherapeutic agents include compounds for targeted therapy and non-targeted compounds of conventional chemotherapy.

[0280] Non-limiting examples of chemotherapeutic agents include: erlotinib, afatinib, docetaxel, adriamycin, 5-FU (5-fluorouracil), panobinostat, gemcitabine, cisplatin, carboplatin, paclitaxel, bevacizumab, trastuzumab, pertuzumab, metformin, temozolomide, tamoxifen, doxorubicin, rapamycin, lapatinib, hydroxycamptothecin, trametinib. Further examples of chemotherapeutic agents include: oxaliplatin, bortezomib, sunitinib, letrozole, imatinib, PI3K inhibitors, fulvestrant, leucovorin, lonafarnib, sorafenib, gefitinib, crizotinib, irinotecan, topotecan, valrubicin, vemurafenib, telbivinib, capecitabine, vandetanib, chlorambucil, panitumumab, cetuximab, rituximab, tositumomab, temsirolimus, everolimus, pazopanib, canfosfamide, thiotepa, cyclophosphamide; alkyl sulfonates, e.g., busulfan, improsulfan, and piposulfan; ethyleneimines, benzodopa zodopa, carboquone, meturedopa, uredopa, methylmelamines (including altretamine, triethylenemelamine, triethylphosphamide, triethylthiophosphamide, and trimethylenemelamine); bullatacin, bullatacinone; bryostatin; kallistatin, CC-1065 (including its synthetic analogs adozelesin, carzelesin, and bizelesin), cryptophycins (especially cryptophycin 1 and cryptophycin 8); dolastatins, duocarmycins (including the synthetic analogs KW-2189 and CB1-TM1); eleutherobin; pancratistatin, sarcodictiin, spongistatin;Nitrogen mustards, e.g., chlorambucil, chlornaphazine, cyclophosphamide, estramustine, ifosfamide, bis-chloroethyl-methylamine, mechlorethaminoxide, melphalan, nobembine, phenesterine, prednimustine, trofosfamide, uramustine, nitrosoureas, e.g., carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine, antibiotics, e.g., enediyne antibiotics (e.g., calicheamicin, calicheamicin γ1I, calicheamicin ω1I, dynemicin, dynemicin A); diphosphates, e.g., chlorambucil, chlornaphazine, cyclophosphamide, estramustine, ifosfamide, bis-chloroethyl-methylamine, mechlorethaminoxide, melphalan, nobembine, phenesterine, prednimustine, trofosfamide, uramustine; nitrosoureas, e.g., carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine; antibiotics, e.g., enediyne antibiotics (e.g., calicheamicin, calicheamicin γ1I, calicheamicin ω1I, dynemicin, dynemicin A); Lodronate, esperamicin, and neocarzinostatin chromophores and related chromoprotein enediyne antibiotic chromophores), aclacinomycin, actinomycin, all-trans retinoic acid, anthramycin, azaserine, bleomycin, actinomycin C, carabicin, carminomycin, carzinophilin, chromomycin, actinomycin D, daunorubicin, deoxyfluorouridine, detorubicin, 6-diazo-5-oxo-L-norleucine, morpholinodoxorubicin, cyanomorpholinodoxorubicin, 2-pyrroline-doxorubicin, eoxydoxorubicin doxorubicin), epirubicin, esorubicin, idarubicin, marcelomycin, mitomycin, mycophenolic acid, nogalamycin, olivomycin, peplomycin, porfiromycin, puromycin, queramycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; antimetabolites, e.g., methotrexate; folic acid analogues, e.g., dimethylfolate, methotrexate, pteropterin, trimetrexate; purine analogues, e.g., fludarabine, 6-mercaptopurine, methotrexate, thiamiprine, thioguanine; pyrimidine analogues, e.g., ancitabine, azacitidine, azathioprine, bleomycin, 6-nitrouridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine;Androgens, calosterone, dromostanolone propionate, epithiostanol, mepitiostane, testolactone; antiadrenergics, e.g., aminoglutethimide, mitotane, trilostane; folic acid supplements, e.g., folinic acid; aceglatone; aldophosphamide glycosides; aminolevulinic acid; eniluracil, amsacrine, bestravcil, bisantrene, edatraxate, defofamine, demeclohexyl Cortin, diaziquone, eflornithine, elliptinium acetate, epothilone, etoglucide; gallium nitrate; hydroxyurea; lentinan, lonidamine, maytansinoids, maytansine, ansamitocin, mitoguazone, mitoxantrone, mopidamol, nitraerine, pentostatin, phenamet, pirarubicin, losoxantrone, podophyllic acid; 2-ethylhydrazine; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, Oreg.), razoxane, rhizoxin, schizofiran, spirogermanium, tenuazonic acid, triaziquone; 2,2',2''-trichloro-triethylamine; trichothecenes (especially T-2 toxin, verrucarin A, roridin A, and anguidine); urethane, vindesine, dacarbazine, mannomustine; dibromomannitol; dibromodulcitol; pipobroman, gacytosine, arabinoside ("Ara-C"). "); cyclophosphamide; thiotepa; thioguanine; 6-mercaptopurine; methotrexate; vinblastine; etoposide, ifosfamide, mitoxantrone, vincristine, vinorelbine, novantrone; pemetrexed; teniposide, edatrexate, daunomycin; aminopterin; ibandronate; CPT-11; topoisomerase inhibitor RFS2000; DMFO, retinoids, such as retinoic acid; and pharmaceutically acceptable salts or derivatives thereof.;

[0281] Methods relating to cells expressing glycan-binding proteins Aspects of the present disclosure include methods for reducing interactions between cells expressing glycan-binding proteins (GBPs) and cells displaying cell-surface glycosylated ribonucleic acid (glycoRNA). The methods are based, in part, on the unexpected discovery, described for the first time herein, that cells display glycoRNA on their surfaces and that such glycoRNA is recognized by GBPs expressed on the cell surface. Thus, with the benefit of this disclosure, it will be appreciated that a variety of methods and agents related to the interaction between GBPs and glycoRNA are contemplated and provided herein. Such methods and agents are useful in a variety of contexts, including, but not limited to, research, therapeutic, and diagnostic settings.

[0282] Some embodiments provide a method for reducing the interaction between a GBP-expressing cell and a cell displaying a cell-surface glycoRNA, comprising contacting the GBP-expressing cell with a soluble glycoRNA that binds to the GBP expressed on the surface of the GBP-expressing cell in an amount effective to reduce the interaction between the GBP-expressing cell and the cell displaying the cell-surface glycoRNA. In this context, "soluble" means that the glycoRNA is not associated with the cell membrane when contact with the GBP-expressing cell is initiated. As used herein, "reducing the interaction" or "reduced interaction" is compared to the interaction between the GBP-expressing cell and the cell displaying the cell-surface glycoRNA in the absence of contact. Soluble glycoRNAs include those in which binding of the soluble glycoRNA to the GBP expressed on the surface of the GBP-expressing cell interferes with (e.g., inhibits) the ability of the GBP to bind to the glycoRNA displayed on the surface of the cell displaying the cell-surface glycoRNA.

[0283] A variety of glycoRNAs can be used. In certain embodiments, the soluble glycoRNA includes glycosylated (e.g., sialylated) RNA from the Y RNA family, a non-limiting example of which is Y5 RNA. Additional glycoRNAs useful in the present methods include glycosylated (e.g., sialylated) small nucleolar RNAs (snoRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), and any combination thereof. The glycoRNA can include various glycans. In certain embodiments, the glycoRNA includes N-glycans. According to some embodiments, when a glycoRNA includes N-glycans, the glycoRNA does not include O-glycans. In certain embodiments, the glycoRNA includes sialylated glycans, e.g., sialylated N-glycans. Sialylated glycans include, but are not limited to, glycans sialylated with Neu5Ac, Neu5Gc, or combinations thereof.

[0284] Soluble glycoRNA can be conjugated to one or more drugs.Various strategies for conjugating a drug of interest to RNA can be used to conjugate a drug of interest to soluble glycoRNA.Non-limiting examples include those described in Lau et al.(2012) Mol.Pharm.9:71-8, Liu et al.(2014) Nucleic Acids Res.42:11805-11817, Xia et al.(2009) Mol.Pharm.6:747-751, Sugo et al.(2016) J.Control.Release 237:1-13, and other documents (the disclosures of which are incorporated herein by reference in their entirety for all purposes).

[0285] In certain embodiments, to promote stable association of glycoRNA with one or more agents of interest, glycoRNA is engineered to possess or contain an MS2-RNA stem-loop motif (MS2), which has been shown to bind to the MS2 coat protein (MS2-CP), thus providing non-covalent association of glycoRNA with agents containing MS2-CP.

[0286] In certain embodiments, the soluble glycoRNA is conjugated to one or more therapeutic agents. As used herein, a "therapeutic agent" is a physiologically or pharmacologically active substance that can produce a desired biological effect at a target site in an animal, such as a mammal, or a human. A therapeutic agent can be any inorganic or organic compound. A therapeutic agent can reduce, inhibit, alleviate, reduce, arrest, or stabilize the occurrence or progression of a disease, disorder, or cell proliferation in an animal, such as a mammal, or a human. Examples include, but are not limited to, peptides, proteins, nucleic acids (including siRNA, miRNA, and DNA), polymers, and small molecules. In various embodiments, the therapeutic agent may be characterized or uncharacterized.

[0287] According to some embodiments, the soluble glycoRNA is conjugated to one or more agents that kill cells expressing the GBP to which the soluble glycoRNA binds, prevent cell proliferation, and / or the like. Such agents can vary and include cytostatic agents and cytotoxic agents, e.g., agents that can kill target cells with or without being internalized by the target cell. In some embodiments, the agent is a cytotoxic agent selected from enediynes, lexitropsins, duocarmycins, taxanes, puromycins, dolastatins, maytansinoids, and vinca alkaloids. According to certain embodiments, the cytotoxic agent is paclitaxel, docetaxel, CC-1065, CPT-11 (SN-38), topotecan, doxorubicin, morpholino-doxorubicin, rhizoxin, cyanomorpholino-doxorubicin, dolastatin-10, echinomycin, combretastatin, calicheamicin, maytansinoid, maytansine, maytansine DM1, maytansine DM4, DM-1, an auristatin, or other dolastatin derivatives such as auristatin E or auristatin F, AEB (AEB-071), AEVB (5-benzoylvaleric acid AE ester), AEFP (antibody-endostatin fusion protein), MMAE (monomethylauristatin E), MMAF (monomethylauristatin F), pyrrolobenzodiazepine (PBD), eleutherobin, netropsin, or any combination thereof.

[0288] In certain embodiments, the soluble glycoRNA comprises a detectable label. Detectable labels that may be used include, but are not limited to, fluorescent labels, colorimetric labels, chemiluminescent labels, enzyme-linked reagents, multicolored reagents, avidin-streptavidin-linked detection reagents, and the like.

[0289] According to some embodiments, the detectable label is a fluorescent label. A fluorescent label is a labeling moiety that can be detected by a fluorescence detector. For example, binding of a fluorescent label to an analyte of interest (e.g., GBP in a GBP-expressing cell) allows the analyte of interest to be detected by a fluorescence detector. Examples of fluorescent labels include, but are not limited to, fluorescent molecules that fluoresce when contacted with a reagent, fluorescent molecules that fluoresce when irradiated with electromagnetic radiation (e.g., UV, visible light, X-rays, etc.), fluorescent labels that can be detected by photoacoustic imaging, etc.

[0290] According to some embodiments, the detectable label is an in vivo imaging agent. As used herein, the phrase "in vivo imaging" refers to a method of detecting glycoRNA in whole living mammals (and thereby detecting GBPs and / or cells expressing GBPs to which soluble glycoRNAs are bound). Optically detectable agents, such as fluorescent agents (e.g., indocyanine green (ICG)), bioluminescent agents (e.g., luciferase, e.g., nanoluciferase), and radiolabeled agents, can be detected by in vivo imaging. In vivo imaging can be used to obtain two-dimensional and three-dimensional images of a mammal or tissues or cells therein. Charge-coupled device cameras, photodiodes, avalanche photodiodes, photomultiplier tubes, CMOS, or three-dimensional tomography devices can be used to perform in vivo imaging. For example, Burdette JE (2008) Journal of Mol. Endocrin. 40:253-261 reviews the use of computed tomography, magnetic resonance imaging, ultrasonography, positron emission tomography, single-photon emission computed tomography, etc. for in vivo imaging. Methods using detectable labels for real-time imaging of luciferase expression in living animals can be easily adapted for use in the subject methods disclosed herein (e.g., Greer LF et al. (2002) Luminescence 17:43-74). In vivo imaging of fluorescent proteins in living animals is described, for example, in Hoffman (2002) Cell Death and Differentiation 9:786-789. In some embodiments, in vivo imaging can be performed by detecting labels that emit light at wavelengths designed to penetrate biological tissue. Such labels include fluorescent dyes or proteins that emit at longer wavelengths, such as infrared and near-infrared dyes or proteins, including, but not limited to, dyes or proteins that emit in the range of about 600 nm to about 800 nm, about 650 nm to about 800 nm, or about 700 nm to about 800 nm.Alternatively, labels designed to emit light that penetrates biological tissue may include non-fluorescent reagents, including but not limited to red-shifted luciferase.

[0291] In vivo imaging may also involve computed tomography, magnetic resonance imaging, ultrasound, positron emission tomography, or single-photon emission computed tomography (SPECT) (see Burdette JE (2008) Journal of Mol. Endocrin., 40:253-261 for details). SPECT may also be used in the subject methods with an integrated X-ray CAT (CT) scanner (SPECT / CT). Information from numerous in vivo imaging methods, such as those described above, can provide the three-dimensional distribution of glycoRNA (and thereby GBP-expressing cells) in a subject.

[0292] According to some embodiments, the soluble glycoRNA comprises an in vivo imaging agent, which is a photoacoustic imaging agent. Photoacoustic imaging (PAI) overcomes the traditional depth limitations of ballistic optical imaging and the resolution limitations of diffuse optical imaging. It uses acoustic waves generated in response to the absorption of pulsed laser light to provide noninvasive images of absorbed optical energy density at depths of several centimeters with a resolution of approximately 100 μm. This versatile and scalable imaging technique has proven useful for molecular imaging, enabling visualization of biological processes using contrast agents introduced throughout the body. Agents useful for photoacoustic imaging include those described in Weber et al. (2016) Nature Methods 13:639-650. In certain embodiments, the soluble glycoRNA comprises a photoacoustic imaging agent, which is the tricarbocyanine dye indocyanine green (ICG), which is safe for intravenous administration.

[0293] In certain embodiments, the GBP to which the soluble glycoRNA binds comprises a lectin. In some non-limiting examples, the glycoRNA comprises a sialylated glycan, and the GBP to which the soluble glycoRNA binds is a sialoglycan-binding lectin. Non-limiting examples of sialoglycan-binding lectins include sialic acid-binding immunoglobulin-like lectins (Siglecs).

[0294] Siglecs are a family of immunomodulatory receptors whose function is regulated by glycan ligands. In humans, the Siglec family consists of 15 family members expressed on a limited set of hematopoietic lineage cells, with known exceptions including Siglec-4 (MAG), expressed on oligodendrocytes and Schwann cells, and Siglec-6, expressed on placental trophoblast cells. Siglecs recognize sialylated glycan ligands on glycoproteins and glycolipids with unique but overlapping specificity via their outermost N-terminal V-set domains. Recognition of these ligands can affect cell signaling via immunoreceptor tyrosine-based inhibitory motifs (ITIMs) in their cytoplasmic tails. In the majority of Siglecs, these ITIMs have the ability to recruit phosphatases; therefore, these members are referred to as inhibitory Siglecs. Exceptions include Siglec-1 and MAG, which lack such motifs, and activated Siglecs (Siglec-14 to -16), which associate with adaptor proteins that contain immunoreceptor tyrosine-based activation motifs (ITAMs) due to positively charged amino acids in their transmembrane domains.

[0295] Siglecs can be classified into two groups based on their genetic homology among mammalian species. The first group is present in all mammals and consists of Siglec-1 (sialoadhesin), Siglec-2 (CD22), Siglec-4, and Siglec-15. The second group consists of CD33-related Siglecs, including Siglec-3 (CD33), -5, -6, -7, -8, -9, -10, -11, -14, and -16. Monocytes, monocyte-derived macrophages, and monocyte-derived dendritic cells share a similar Siglec profile: high expression of Siglec-3, -7, and -9, low expression of Siglec-10, and expression of Siglec-1 upon stimulation with IFN-α. In contrast, macrophages express primarily Siglec-1, -3, -8, -9, -11, -15, and -16 depending on their differentiation state. Conventional dendritic cells, like monocyte-derived dendritic cells, express Siglec-3, -7, and -9, but also express low levels of Siglec-2 and Siglec-15. Plasmacytoid dendritic cells express Siglec-1 and Siglec-5. Downregulation of Siglec-7 and Siglec-9 expression on monocyte-derived dendritic cells was observed after 48 hours of stimulation with LPS, whereas monocyte-derived macrophages showed no change in Siglec expression upon LPS induction. Siglecs are also present on other immune cells, such as B cells, basophils, neutrophils, and NK cells. Further details regarding Siglecs can be found, for example, in Angata et al. (2015) Trends Pharmacol Sci. 36(10):645-660, Lubbers et al. (2018) Front. Immunol. 9:2807, Bochner et al. (2016) J Allergy Clin Immunol. 135(3):598-608, and Duan et al. (2020) Annu. Rev. Immunol. 38(1):365-395, the disclosures of which are incorporated herein by reference in their entirety and for all purposes.

[0296] In certain embodiments, the GBP to which the soluble glycoRNA binds comprises a CD33-associated Siglec. In one non-limiting example, the CD33-associated Siglec is Siglec-11. In another non-limiting example, the CD33-associated Siglec is Siglec-14.

[0297] In certain embodiments, the GBP to which the soluble glycoRNA binds comprises a C-type lectin. C-type lectins are a superfamily of proteins defined by the presence of at least one C-type lectin-like domain (CTLD) that recognize a broad repertoire of ligands and regulate a wide variety of physiological functions. While most research has focused on the ability of C-type lectins to function in antimicrobial innate and adaptive immune responses, there is increasing recognition that these proteins have a major role in autoimmune diseases and contribute to numerous other aspects of multicellular organisms. The term C-type lectin refers to Ca 2+ dependent carbohydrate-binding lectins and Ca 2+The term C-type lectins was introduced to distinguish CLRs from non-innate carbohydrate-binding lectins. C-type lectins share at least one carbohydrate-recognition domain, which is a compact structural module containing conserved residue motifs and determines the carbohydrate specificity of CLRs. Of particular interest for their role in linking both innate and adaptive immunity are the Dectin-1 and Dectin-2 family of genes, which are confined to the telomeric region of the natural killer cluster of genes. These two groups of C-type lectins are primarily expressed by cells of the myeloid lineage, such as monocytes, macrophages, dendritic cells (DCs), and neutrophils. C-type lectins not only function as antigen uptake receptors for internalization and presentation to T cells, but also initiate multiple signaling pathways, leading to the activation of NF-κB, type I interferon (IFN), and / or inflammasomes. This, in turn, triggers the production of pro- or anti-inflammatory cytokines and chemokines, subsequently fine-tuning the adaptive immune response. Further details regarding C-type lectins can be found, for example, in Zelensky et al. (2005) FEBS J. 272:6179-6217, Geijtenbeek & Grinhuis (2009) Nature Reviews Immunology 9:465-479; Brown et al. (2018) Nature Reviews Immunology 18:374-389, Dambuza & Brown (2015) Curr. Opin. Immunol. 32:21-7, and Chiffoleau (2018) Front. Immunol. 9:227, the disclosures of which are incorporated herein by reference in their entirety and for all purposes.According to some embodiments, the GBP to which the soluble glycoRNA binds comprises a C-type lectin selected from Dectin-1, lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1), C-type lectin-like receptor-1 (CLEC-1), C-type lectin-like receptor-2 (CLEC-2), myeloid inhibitory C-type lectin-like receptor (MICL), CLEC9A, DC immunoreceptor (DCIR), Dectin-2, blood DC antigen-2 (BDCA-2), macrophage-inducible C-type lectin (MINCLE), macrophage galactose lectin (MGL), and asialoglycoprotein receptor (ASGPR).

[0298] In certain embodiments, the GBP to which the soluble glycoRNA binds comprises a selectin. Selectins are transmembrane C-type lectins that mediate leukocyte trafficking and adhesive interactions of leukocytes, platelets, and endothelial cells with specific tumor cells. These lectins are present on endothelial cells (E-selectin), leukocytes (L-selectin), and platelets (P-selectin), and are abundantly expressed on some tumor types. X and SLe ASelectins preferentially bind to glycans containing glycoepitopes. Selectins are functionally relevant in the context of leukocyte recruitment in the TME, tumor-promoting inflammation, and the acquisition of metastatic potential. P-selectin (CD62P) is involved in tumor growth and metastasis because it mediates interactions between activated platelets and cancer cells, thereby contributing to tumorigenesis. E-selectin (CD62E) also plays a key role in cancer cell adhesion at different stages of the metastatic cascade and promotes tumor cell extravasation. Finally, L-selectin (CD62L), constitutively expressed on leukocytes, promotes cell adhesion and hematogenous metastasis by regulating tumor-leukocyte interactions and aiding in embolization. Further details regarding selectins can be found, for example, in Cagnoni et al. (2016) Front Oncol. 6:109, Barthel et al. (2007) Expert Opin Ther Targets 11(11):1473-91, and Chen & Geng (2006) Arch Immunol Ther Exp 54(2):75-84, the disclosures of which are incorporated herein by reference in their entirety and for all purposes. According to some embodiments, the GBP to which the soluble glycoRNA binds comprises a selectin selected from P-selectin (CD62P), E-selectin (CD62E), and L-selectin (CD62L).

[0299] In certain embodiments, the GBP to which the soluble glycoRNA binds comprises a galectin. Galectins are a family of highly conserved glycan-binding soluble lectins, defined by a conserved carbohydrate recognition domain (CRD) and a common structural fold. Vasta GR (2012) Adv Exp Med Biol 946:21-36. Mammalian galectins have been classified into three types based on structural features: prototype galectins (Gal-1, -2, -5, -7, -10, -11, -13, -14, and -15), which contain a single CRD and exist as monomers or dimerize through non-covalent interactions; tandem repeat galectins (Gal-4, -6, -8, -9, and -12), which exist as bivalent galectins containing two different CRDs connected by a linker peptide; and finally, Gal-3, the only chimeric member of the galectin family. Galectins regulate distinct events in tumorigenesis and metastasis. They contribute to immune evasion and immune escape by regulating effector T cell apoptosis, clonal expansion, regulatory T cell (Treg) function, and cytokine secretion. The expression levels of some galectins also change during malignant transformation, confirming their role in cancer progression. Gal-1, abundantly secreted by almost all malignant tumor cells, has been characterized as a major promoter of an immunosuppressive tumorigenic microenvironment. Another family member, Gal-3, has demonstrated significant tumorigenic effects in numerous tumors. Similar to Gal-1, Gal-3 signaling contributes to tipping the balance toward an immunosuppressive TME by interacting with specific glycans and attenuating antitumor responses. In this regard, Gal-3 has been shown to promote anergy in tumor-infiltrating lymphocytes (TILs). According to some embodiments, the glycan-binding moiety comprises a glycan-binding domain of a galectin selected from Gal-1, Gal-2, Gal-3, Gal-4, Gal-5, Gal-6, Gal-7, Gal-8, Gal-9, Gal-10, Gal-11, Gal-12, Gal-13, Gal-14, and Gal-15.In certain embodiments, the GBP to which the soluble glycoRNA binds comprises Gal-1. According to some embodiments, the GBP to which the soluble glycoRNA binds comprises Gal-3.

[0300] In certain embodiments, methods are provided for reducing interactions between cells expressing a GBP and cells displaying cell-surface glycoRNA, comprising contacting the cells expressing the GBP with an agent identified to bind to the GBP expressed on the surface of the cells expressing the GBP and to bind to cell-surface glycoRNA, in an amount effective to reduce interactions between the cells expressing the GBP and the cells displaying the cell-surface glycoRNA (i.e., the GBP is identified as a GBP that binds to cell-surface glycoRNA prior to contacting), wherein binding of the agent to the GBP expressed on the surface of the cells expressing the GBP interferes with (e.g., inhibits) the ability of the GBP to bind to glycoRNA displayed on the surface of the cells displaying cell-surface glycoRNA.

[0301] According to some embodiments, an agent that binds to a GBP expressed on the surface of a GBP-expressing cell is a ligand of the GBP. As used herein, a "ligand" is a substance that forms a complex with a biomolecule to achieve a biological purpose. The ligand can be a substance selected from circulating factors, secreted factors, cytokines, growth factors, hormones, peptides, polypeptides, small molecules, and nucleic acids that form a complex with a GBP on the surface of a GBP-expressing cell. In certain embodiments, when the agent is a ligand, the ligand is modified so that complex formation with the GBP occurs but the normal biological consequences of such complex formation do not occur.

[0302] In certain embodiments, the agent that binds to GBP expressed on the surface of a GBP-expressing cell is a small molecule. "Small molecule" refers to a compound having a molecular weight of 1000 atomic mass units (amu) or less. In some embodiments, the small molecule is 750 amu or less, 500 amu or less, 400 amu or less, 300 amu or less, or 200 amu or less. In certain embodiments, the small molecule is not made up of repeating unit molecules such as those found in polymers.

[0303] According to some embodiments, the agent that binds to GBP expressed on the surface of a GBP-expressing cell is an antibody. "Antibody" refers to antibodies or immunoglobulins of any isotype (e.g., IgG (e.g., IgG1, IgG2, IgG3, or IgG4), IgE, IgD, IgA, IgM, etc.), full-length antibodies (e.g., antibodies composed of tetramers (and tetramers are composed of two heavy and light chain polypeptide dimers)); single-chain antibodies (e.g., scFv); antibody fragments (e.g., full-length or single-chain antibody fragments) that retain specific binding to GBP, including, but not limited to, single-chain Fv (scFv), Fab, (Fab')2, (scFv')2, and diabodies; chimeric antibodies; monoclonal antibodies, human antibodies, humanized antibodies (e.g., humanized full-length antibodies, humanized half antibodies, or humanized antibody fragments, e.g., humanized scFv); and fusion proteins comprising the antigen-binding portion of an antibody and a non-antibody protein. In certain embodiments, the antibody is selected from an IgG, Fv, single-chain antibody, scFv, Fab, F(ab')2, or Fab'. The antibody may be detectably labeled, for example, with an in vivo imaging agent, a radioisotope, an enzyme that generates a detectable product, a fluorescent protein, etc. The antibody may further be conjugated to another moiety, for example, a member of a specific binding pair, such as biotin (a member of the biotin-avidin specific binding pair).

[0304] Agents that bind to GBPs expressed on the surface of GBP-expressing cells can be selected to bind one or more specific GBPs. Non-limiting examples of such agents include those that bind to one or more Siglecs (e.g., Siglec-11, Siglec-14, and / or the like), one or more C-type lectins, one or more galectins, and / or one or more selectins. Agents can be selected based on the type(s) of glycoRNA displayed on cells that display cell surface glycoRNA, in combination with the identified glycoRNA-binding properties of GBPs expressed on the surface of GBP-expressing cells. In one non-limiting example, if a cell displaying cell surface glycoRNA displays glycoRNA containing sialylated glycans and a cell expressing GBP expresses one or more Siglecs (e.g., Siglec-11, Siglec-14, and / or the like), the selected agent may bind to one or more of the Siglecs and block their interaction with the glycoRNA containing sialylated glycans. Antibodies, ligands, and other agents capable of binding to various types of GBPs and blocking GBP binding are known and may be used when practicing the methods of the present disclosure. By way of example, Siglec-blocking antibodies are available and are described, for example, in Pia Lenza et al. (2020) Cell 9(12):2691, the disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0305] In certain aspects, methods are provided for reducing interactions between cells expressing a glycan GBP and cells displaying cell surface glycoRNA, the methods comprising contacting cells displaying the cell surface glycoRNA with an agent that binds to and / or edits the cell surface glycoRNA in an amount effective to reduce interactions between cells expressing the GBP and cells displaying the cell surface glycoRNA.

[0306] According to some embodiments, the agent edits cell-surface glycoRNA. In certain embodiments, such an agent comprises an enzyme that removes glycans from cell-surface glycoRNA. By way of example, when cell-surface glycoRNA contains sialylated glycans, an agent comprising a sialidase can be used. Suitable sialidases include, but are not limited to, prokaryotic sialidases and eukaryotic sialidases. Prokaryotic sialidases that can be used include bacterial sialidases. One example of a bacterial sialidase useful in the conjugates of the present disclosure is Salmonella typhimurium sialidase (e.g., UniProtKB:P29768). Another example of a bacterial sialidase useful in the conjugates of the present disclosure is Vibrio cholerae sialidase (e.g., UniProtKB:P0C6E9). Eukaryotic sialidases that can be used include, for example, mammalian sialidases and non-mammalian eukaryotic sialidases. Mammalian sialidases (or mammalian neuraminidases) of interest include those derived from primates, e.g., human or non-human neuraminidases. In certain embodiments, the sialidase is a human sialidase. According to some embodiments, the human sialidase is selected from human neuraminidase 1 (e.g., UniProtKB:Q99519), human neuraminidase 2 (e.g., UniProtKB:Q9Y3R4), human neuraminidase 3 (e.g., UniProtKB:Q9UQ49), and human neuraminidase 4 (e.g., UniProtKB:Q8WWR8). It will be understood that the sialidase may be a derivative of a wild-type sialidase, such as a truncated derivative, a derivative containing more amino acids than the corresponding wild-type sialidase, a derivative containing one or more amino acid substitutions (e.g., one or more conservative substitutions, one or more non-conservative substitutions, substitution of a natural amino acid with a non-natural amino acid, and / or the like). The derivative retains at least some of the glycoside hydrolase activity of the original wild-type sialidase.

[0307] In certain embodiments, when an agent comprising a sialidase is used, the sialidase may be linked (e.g., conjugated, fused, etc.) to a targeting moiety, such as an antibody, ligand, etc., that binds to a cell surface molecule (e.g., a tumor antigen, a cell surface receptor, and / or the like) on the surface of a cell that displays cell surface glycoRNA. Non-limiting examples of such agents include those described in U.S. Patent Application No. US2019 / 0248919, the disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0308] According to some embodiments, when an agent that edits cell surface glycoRNA is used, the agent comprises a ribonuclease (RNase). Non-limiting examples of RNases useful in practicing the methods of the present disclosure include RNase A, T1 RNase, T2 RNase, and RNase 1. In some embodiments, the RNase is a human RNase, a non-limiting example of which is human RNase 1 (UniProtKB: P07998).

[0309] In certain embodiments, the agent binds to but does not edit cell-surface glycoRNA. According to some embodiments, such an agent is an antibody that binds to cell-surface glycoRNA. Suitable antibodies include anti-RNA antibodies, including, but not limited to, anti-double-stranded RNA (dsRNA) antibodies. One non-limiting example of an anti-dsRNA antibody that can be used is the J2 antibody available from Absolute Antibody, which has been demonstrated in the Examples section herein to bind to glycoRNA, or an antibody that has the binding properties of the J2 antibody, e.g., an antibody that competes with the J2 antibody for binding to glycoRNA.

[0310] According to some embodiments, when an agent binds to but does not edit cell-surface glycoRNA, the agent comprises a glycan-binding moiety that binds to cell-surface glycoRNA. For example, the agent can be a soluble "decoy receptor" for glycoRNA that interferes with (e.g., blocks) the binding of cell-surface GBP to cell-surface-displayed glycoRNA. In certain embodiments, the glycan-binding moiety comprises a sialoglycan-binding domain of a sialoglycan-binding lectin. Non-limiting examples of sialoglycan-binding moieties include those that comprise the sialoglycan-binding domain of Siglecs (e.g., CD33-associated Siglecs, including, but not limited to, Siglec-11, Siglec-14, etc.). The "glycan-binding domain" or "sialoglycan-binding domain" of a lectin refers to the domain of a lectin or its glycan / sialoglycan-binding variant (e.g., a glycan / sialoglycan-binding fragment) that is responsible for binding to the corresponding glycan(s). Siglecs, for example, contain an extracellular N-terminal V-set Ig (Ig-V) domain responsible for binding sialoside ligands. The amino acid sequences and domains (e.g., extracellular domains) of Siglecs and other lectins are known, and any such domain can be included in the glycan-binding moiety, if desired.

[0311] Aspects of the present disclosure further include methods of targeting an agent to a cell expressing a GBP, the method comprising contacting the cell expressing the GBP with a soluble glycoRNA stably associated with the agent. In certain embodiments, "stably associated" refers to a physical association between two entities, where the average half-life of the association is at least one day in PBS at 4°C. In some embodiments, the physical association between the two entities has an average half-life in PBS at 4°C of at least one day, at least one week, at least one month, e.g., at least six months, e.g., at least one year. According to some embodiments, the stable association occurs due to a covalent bond between the two entities, a non-covalent bond (e.g., ionic or metallic bond) between the two entities, or other types of chemical affinity, e.g., hydrogen bonding, van der Waals forces, etc.

[0312] According to some embodiments, the agent stably associated (e.g., conjugated) with the soluble glycoRNA is a therapeutic agent. For example, the soluble glycoRNA can be used for targeted delivery of a therapeutic agent to cells expressing a cell-surface GBP that binds to the soluble glycoRNA. In certain embodiments, the agent is an agent that modulates cells expressing a GBP. By "modulating agent" is meant an agent that modulates (e.g., induces or inhibits) one or more activities of a GBP-expressing cell when the soluble glycoRNA binds to the GBP in the GBP-expressing cell. In some embodiments, an agent that modulates a GBP-expressing cell binds to a cell surface molecule (e.g., a receptor) on the surface of the GBP-expressing cell and induces signal transduction (which may be activating or inhibitory signaling) via the cell surface molecule. According to some embodiments, for example, when it is desired to stop the growth of or kill a GBP-expressing cell, the agent stably associated (e.g., conjugated) with the soluble glycoRNA is a cytostatic or cytotoxic agent described elsewhere herein.

[0313] In certain embodiments, the agent stably bound (e.g., conjugated) to the soluble glycoRNA comprises a detectable label, non-limiting examples of which are described elsewhere herein. Such methods are useful, for example, when it is desirable to detect cells expressing GBP in vitro and / or in vivo, e.g., by in vivo imaging.

[0314] Aspects of the present disclosure further include methods for inducing signal transduction through a GBP expressed on the surface of a GBP-expressing cell, the method comprising contacting the GBP-expressing cell with a soluble glycoRNA, wherein binding of the soluble glycoRNA to the GBP expressed on the surface of the GBP-expressing cell induces signal transduction through the GBP. The soluble glycoRNA may have one or any combination of glycoRNA properties described elsewhere herein, including any of the soluble glycoRNA conjugates described elsewhere herein. In certain embodiments, the soluble glycoRNAs are selected so that they bind to and induce signal transduction through a glycan-binding lectin. The glycan-binding lectin may be a sialoglycan-binding lectin, non-limiting examples of which include Siglecs. The Siglec(s) may be any of the Siglecs described elsewhere herein. In certain embodiments, soluble glycoRNAs that bind to one or more CD33-associated Siglecs (eg, Siglec-11, Siglec-14, and / or the like) are used.

[0315] Any of the methods described herein for reducing interactions between GBP-expressing cells and cells displaying cell surface glycoRNA, for targeting agents to GBP-expressing cells, and for inducing signaling through GBPs expressed on the surface of, for example, GBP-expressing cells, can be performed in vitro, in vivo, or ex vivo.

[0316] For in vivo embodiments, in some embodiments, the contacting comprises administering soluble glycoRNA to an individual in need thereof (e.g., an individual in need of reduced interaction between GBP-expressing cells and cells displaying cell surface glycoRNA) in an amount effective to reduce interaction between GBP-expressing cells and cells displaying cell surface glycoRNA in the individual. Also provided is a method in which the contacting comprises administering a drug to an individual in need thereof (e.g., an individual in need of reduced interaction between GBP-expressing cells and cells displaying cell surface glycoRNA) in an amount effective to reduce interaction between GBP-expressing cells and cells displaying cell surface glycoRNA in the individual. In certain embodiments, the contacting comprises administering soluble glycoRNA to an individual in need thereof (e.g., an individual in need of GBP-mediated signaling), wherein binding of the soluble glycoRNA to GBP expressed on the surface of GBP-expressing cells in the individual induces GBP-mediated signaling. Soluble glycoRNA (including conjugates thereof) and any of the other agents described herein can be administered by a suitable route of administration, non-limiting examples of which include oral administration (e.g., in tablet form, capsule form, liquid form, etc.), parenteral administration (e.g., by intravenous, intraarterial, subcutaneous, intramuscular, or epidural injection), topical administration, intranasal administration, or intratumoral administration.

[0317] According to any of the in vivo embodiments described herein, the individual in need of administration of soluble glycoRNA may have a medical condition, non-limiting examples of which include cancer, an autoimmune disorder, an inflammatory disease, an infectious disease, or any combination thereof.

[0318] Aspects of the present disclosure further include methods of evaluating a biological sample for glycosylated ribonucleic acid (glycoRNA), comprising performing a glycoRNA detection assay on the biological sample. In some embodiments, the sample is a cell sample, i.e., a sample containing cells. A cell sample can be derived from a collection of biological tissue or cultured cells, etc. A cell sample can be heterogeneous, containing a variety of different cell types (including two or more, three or more, four or more, five or more, etc.), or can be substantially homogeneous, containing essentially one type of cell, depending on the source from which the cell sample is obtained. When the sample is a cell sample, the assay can be a cell-surface glycoRNA detection assay. It will be understood that a variety of cell-surface glycoRNA detection assays can be performed with the benefit of the present disclosure. In certain embodiments, the cell-surface glycoRNA detection assay comprises contacting cells of the cell sample with a glycoRNA-binding agent and assessing binding of the glycoRNA-binding agent to cell-surface glycoRNA in the sample. According to some embodiments, the glycoRNA-binding agent is an antibody that binds to cell-surface glycoRNA. Suitable antibodies include, but are not limited to, anti-RNA antibodies, including anti-double-stranded RNA (dsRNA) antibodies. One non-limiting example of an anti-dsRNA antibody that can be used is the J2 antibody available from Absolute Antibody, which has been demonstrated in the Examples section of this specification to bind to glycoRNA, or an antibody that has the binding properties of the J2 antibody, for example, an antibody that competes with the J2 antibody for binding to glycoRNA.

[0319] In certain embodiments, the cell-surface glycoRNA detection assay comprises contacting cells of a cell sample with a ribonuclease (RNase) to digest cell-surface glycoRNA, if present, and assessing degradation of the cell-surface glycoRNA. Non-limiting examples of RNases useful in practicing the methods of the present disclosure include RNase A, T1 RNase, T2 RNase, and RNase 1. In some embodiments, the RNase is a human RNase, a non-limiting example of which is human RNase 1 (UniProtKB:P07998).

[0320] A method for evaluating a biological sample for glycoRNA can include performing a free glycoRNA detection assay on the biological sample. "Free glycoRNA" refers to RNA that is released (e.g., secreted, shed, and / or the like) from a cell. The free glycoRNA detection assay can be performed on a cellular sample or a non-cellular sample.

[0321] The method of evaluating a biological sample for glycoRNA can be performed on a variety of biological samples, including cell culture media samples, tissue samples, body fluid samples, etc. In some embodiments, the sample is any solid or liquid sample taken from any living cell or organism, including, but not limited to, human or animal tissues, organs, tissue cultures, bioreactor samples, eukaryotes, and prokaryotes. For example, the sample can be or can be taken from, e.g., amniotic fluid, aqueous humor, vitreous humor, bile, blood, plasma, serum, cerebrospinal fluid, earwax, chyle, chyme, endolymph, perilymph, exudate, feces, gastric juice, lymph, mucus, pericardial fluid, peritoneal fluid, pleural fluid, pus, mucosal secretions, saliva, sebum, semen, serum, smegma, sputum, synovial fluid, sweat, tears, urine, vaginal secretions, vaginal excretions, vomit, etc.

[0322] The sample used in the method of the present disclosure can be collected by any convenient means. In some cases, a useful cell sample can be a biopsy or can be derived from a biopsy. Biopsy tissue can be collected from healthy tissue or diseased tissue (including, for example, cancer tissue). Depending on the type of cancer and / or the type of biopsy to be performed, the sample can be prepared by solid tissue biopsy or liquid biopsy.

[0323] In some cases, the sample can be prepared by surgical biopsy. Any convenient and suitable technique for surgical biopsy can be used to collect the sample used in the methods described herein, including but not limited to, for example, excision biopsy, incision biopsy, wire-directed biopsy, etc. In some cases, surgical biopsy can be performed as part of a surgical procedure with a primary purpose other than collecting a sample, including but not limited to, for example, tumor resection, mastectomy, lymph node surgery, axillary lymph node dissection, sentinel lymph node surgery, etc.

[0324] Various other biopsy techniques can be used to obtain the biopsy tissue used as the sample described herein.As a non-limiting example, sample can be collected by needle biopsy.Any convenient and suitable technique for needle biopsy can be used to collect sample, including but not limited to, for example, fine needle aspiration (FNA), core needle biopsy, stereotactic core biopsy, suction biopsy, etc.

[0325] Aspects of the present disclosure further include methods for producing glycosylated ribonucleic acid (glycoRNA), comprising culturing glycoRNA-producing cells under conditions in which glycoRNA is produced, and isolating the produced glycoRNA. Such methods are useful in a variety of contexts, including, but not limited to, producing soluble glycoRNA for incorporation into conjugates and / or pharmaceutical compositions of the present disclosure. Culture conditions, isolation methods, and the like useful for carrying out the soluble glycoRNA production methods of the present disclosure are described in detail in the Examples section below.

[0326] In some embodiments, production of a glycoRNA of interest can involve the production (e.g., large-scale production) of cells of a given type (wild-type or glycoengineered), which are then first biochemically fractionated to isolate membranes, followed by separation of the RNA from proteins and other biomolecules by chemical means (e.g., precipitation). In certain embodiments, glycans are enriched using lectins or other glycan-binding proteins to purify the glycoRNA from any other RNA in the RNA-membrane preparation. In some embodiments, post-purification glycoengineering is performed, non-limiting examples of which include removal or addition of sialic acid, fucose, and / or the like.

[0327] In some embodiments, during the cell culture / production stage, the method may include one or any combination of the following: providing excess nucleotides to the cells to increase the rate of RNA biosynthesis compared to the rate in the absence of excess nucleotides; providing excess sugars (e.g., excess glucose, galactose, GlcNAc, or any combination thereof) to the cells to increase the rate of glycan biosynthesis compared to the rate in the absence of excess sugars; inhibiting one or more cell membrane turnover pathways in the cells to enhance the accumulation of cell surface glycoRNA; and inhibiting part of the glycan biosynthesis pathway to favor the production of RNA glycans, for example, inhibiting O-glycan production and favoring N-glycan production.

[0328] Aspects of the present disclosure further include methods for manipulating the display of glycosylated ribonucleic acids (glycoRNAs) on cell surfaces. In certain embodiments, such methods involve introducing into cells one or more expression constructs encoding one or more ribonucleic acids and / or glycan biosynthetic enzymes, such that the cells display one or more glycoRNAs of interest on their surfaces. According to some embodiments, the one or more displayed glycoRNAs are utilized to uniquely identify the cells. For example, one or more cells can be genetically engineered to display one or more genetically modified glycoRNAs to serve as a "barcode" that uniquely identifies the one or more cells.

[0329] Conjugates, fusion proteins, and compositions Aspects of the present disclosure further include conjugates, fusion proteins, and compositions. In some embodiments, the conjugates, fusion proteins, and compositions are useful for practicing any of the methods of the present disclosure, including any of the methods described elsewhere herein. Any of the conjugates, fusion proteins, and compositions described in the methods section herein are provided by the present disclosure.

[0330] In certain embodiments, any of the soluble glycoRNAs described elsewhere herein are provided conjugated to any of the agents described elsewhere herein. By way of example, the agent can be a therapeutic agent, an agent comprising a detectable label, etc.

[0331] Some aspects provide a targeting moiety (e.g., an antibody, a ligand, a small molecule, an aptamer, and / or the like) conjugated to a ribonuclease (RNase). Non-limiting examples of RNases that can be used in the conjugate include RNase A, T1 RNase, T2 RNase, and RNase 1. In certain embodiments, the RNase is a human RNase. According to some embodiments, the RNase is human RNase 1 (UniProtKB:P07998).

[0332] In certain embodiments, fusion proteins are provided that include a targeting moiety (e.g., an antibody, a ligand, and / or any other proteinaceous targeting moiety) fused to an RNase. For example, if it is desired to degrade glycoRNA on the surface of target cells, the targeting moiety can be selected based on its ability to specifically bind to a molecule expressed on the surface of such cells that displays glycoRNA.

[0333] Compositions comprising any of the soluble glycoRNAs, conjugates, and / or fusion proteins of the present disclosure are also provided. In certain embodiments, the compositions of the present disclosure comprise any of the soluble glycoRNAs, conjugates, and / or fusion proteins of the present disclosure present in a liquid medium. The liquid medium can be, for example, an aqueous liquid medium such as water or a buffer solution. One or more additives may be present in such compositions, such as salts (e.g., NaCl, MgCl, KCl, MgSO), buffers (Tris buffer, N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES), 2-(N-morpholino)ethanesulfonic acid (MES), 2-(N-morpholino)ethanesulfonic acid sodium salt (MES), 3-(N-morpholino)propanesulfonic acid (MOPS), N-tris[hydroxymethyl]methyl-3-aminopropanesulfonic acid (TAPS), and the like, solubilizers, surfactants (e.g., non-ionic surfactants such as Tween®-20), nuclease inhibitors, protease inhibitors, glycerol, chelating agents, and the like.

[0334] Aspects of the present disclosure further include pharmaceutical compositions, in some embodiments, comprising any of the soluble glycoRNAs, conjugates, and / or fusion proteins of the present disclosure and a pharmaceutically acceptable carrier.

[0335] Soluble glycoRNA, conjugates, and / or fusion proteins can be incorporated into various formulations for therapeutic administration. More specifically, soluble glycoRNA, conjugates, and / or fusion proteins can be formulated into pharmaceutical compositions by combining with suitable pharmaceutically acceptable excipients or diluents, and can be formulated into solid, semi-solid, liquid, or gaseous preparations, such as tablets, capsules, powders, granules, ointments, solutions, injections, inhalants, and aerosols.

[0336] Formulations of soluble glycoRNA, conjugates, and / or fusion proteins for administration to an individual (e.g., suitable for administration to humans) are typically sterile and may further be free of detectable pyrogens or other contaminants that would contraindicate administration to a patient by the selected route of administration.

[0337] In pharmaceutical dosage forms, the soluble glycoRNA, conjugates, and / or fusion proteins may be administered in the form of their pharmaceutically acceptable salts, or they may be used alone or in appropriate association with other pharmaceutically active compounds, as well as in combination therewith. The following methods and carriers / excipients are merely exemplary and are not intended to limit the invention.

[0338] For oral preparations, the soluble glycoRNA, conjugates, and / or fusion proteins may be used alone or in combination with suitable additives for producing tablets, powders, granules, or capsules, such as conventional additives such as lactose, mannitol, corn starch, or potato starch; binders such as crystalline cellulose, cellulose derivatives, acacia, corn starch, or gelatin; disintegrants such as corn starch, potato starch, or sodium carboxymethylcellulose; lubricants such as talc or magnesium stearate; and, if desired, diluents, buffers, wetting agents, preservatives, and flavoring agents.

[0339] Soluble glycoRNA, conjugates, and / or fusion proteins can be formulated for parenteral administration (e.g., intravenous, intraarterial, intraosseous, intramuscular, intracerebral, intraventricular, intrathecal, subcutaneous, etc.). In certain embodiments, soluble glycoRNA, conjugates, and / or fusion proteins are formulated for injection by dissolving, suspending, or emulsifying the soluble glycoRNA, conjugate, and / or fusion protein in an aqueous or non-aqueous solvent, such as vegetable oil or other similar oils, synthetic fatty acid glycerides, esters of higher fatty acids, or propylene glycol, and, if necessary, with conventional additives, such as solubilizers, isotonicity agents, suspending agents, emulsifiers, stabilizers, and preservatives.

[0340] Pharmaceutical compositions containing soluble glycoRNA, conjugates, and / or fusion proteins can be prepared by mixing soluble glycoRNA, conjugates, and / or fusion proteins having the desired purity with any physiologically acceptable carriers, excipients, stabilizers, surfactants, buffers, and / or isotonicity agents. Acceptable carriers, excipients, and / or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to, buffers such as phosphate, citric acid, and other organic acids; antioxidants such as ascorbic acid, glutathione, cysteine, methionine, and citric acid; preservatives (e.g., ethanol, benzyl alcohol, phenol, m-cresol, p-chloro-m-cresol, methyl or propyl paraben, benzalkonium chloride, or combinations thereof); amino acids such as arginine, glycine, ornithine, lysine, histidine, glutamic acid, aspartic acid, isoleucine, leucine, alanine, phenylalanine, tyrosine, tryptophan, and the like. monosaccharides, disaccharides, and other carbohydrates; low molecular weight (less than about 10 residues) polypeptides; proteins, such as gelatin or serum albumin; chelating agents, such as EDTA; sugars, such as trehalose, sucrose, lactose, glucose, mannose, maltose, galactose, fructose, sorbose, raffinose, glucosamine, N-methylglucosamine, galactosamine, and neuraminic acid; and / or non-ionic surfactants, such as Tween, Brij®, Pluronic®, Triton®-X, or polyethylene glycol (PEG).

[0341] Pharmaceutical composition can be in liquid form, freeze-dried form, or liquid form reconstituted from freeze-dried form, where freeze-dried preparation is reconstituted with sterile solution before administration.The standard procedure for reconstituting freeze-dried composition is to add a certain volume (usually the volume equal to the volume removed during freeze-drying) of pure water back into it.However, a solution containing antibacterial agent can also be used to prepare pharmaceutical composition for parenteral administration.

[0342] Aqueous formulations can be prepared in pH buffers, for example, at a pH ranging from about 4.0 to about 7.0, or from about 5.0 to about 6.0, or alternatively at a pH of about 5.5. Examples of buffers suitable for pHs within this range include phosphate, histidine, citrate, succinate, acetate, and other organic acid buffers. The buffer concentration can be, for example, from about 1 mM to about 100 mM or from about 5 mM to about 50 mM, depending on the buffer and the desired tonicity of the formulation.

[0343] To adjust the tonicity of the formulation, an isotonicity agent may be included. Exemplary isotonicity agents include sodium chloride, potassium chloride, glycerin, and any component from the group of amino acids, sugars, and combinations thereof. In some embodiments, the aqueous formulation is isotonic, although hypertonic or hypotonic solutions may be suitable. The term "isotonic" refers to a solution having the same tonicity as some other solution to which it is being compared, such as physiological saline solution or serum. The isotonicity agent may be used in an amount of about 5 mM to about 350 mM, for example, in an amount of 100 mM to 350 mM.

[0344] Surfactants may also be added to the formulation to reduce aggregation, minimize particle formation in the formulation, and / or reduce adsorption. Exemplary surfactants include polyoxyethylene sorbitan fatty acid esters (Tween), polyoxyethylene alkyl ethers (Brij), alkylphenyl polyoxyethylene ethers (Triton-X), polyoxyethylene-polyoxypropylene copolymers (Poloxamer, Pluronic), and sodium dodecyl sulfate (SDS). Examples of suitable polyoxyethylene sorbitan fatty acid esters are polysorbate 20 (sold under the trademark Tween 20™) and polysorbate 80 (sold under the trademark Tween 80™). Examples of suitable polyethylene-polypropylene copolymers are those sold under the names Pluronic® F68 or Poloxamer 188™. Examples of suitable polyoxyethylene alkyl ethers are those sold under the trademark Brij™. Exemplary concentrations of surfactants can range from about 0.001% to about 1% w / v.

[0345] A lyoprotectant may also be added to protect the soluble glycoRNA, conjugate, and / or fusion protein from destabilizing conditions during the lyophilization process. For example, known lyoprotectants include sugars (including glucose and sucrose); polyols (including mannitol, sorbitol, and glycerol); and amino acids (including alanine, glycine, and glutamic acid). The lyoprotectant may be present in an amount of, for example, about 10 mM to 500 nM.

[0346] In some embodiments, pharmaceutical compositions comprise a soluble glycoRNA, conjugate, and / or fusion protein and one or more of the above-identified components (e.g., surfactants, buffers, stabilizers, tonicity agents), and are essentially free of one or more preservatives, e.g., ethanol, benzyl alcohol, phenol, m-cresol, p-chloro-m-cresol, methyl or propyl paraben, benzalkonium chloride, and combinations thereof. In other embodiments, a preservative is included in the formulation, e.g., at a concentration ranging from about 0.001 to about 2% (w / v).

[0347] kit Aspects of the present disclosure further include kits, which, in certain embodiments, are useful for carrying out the methods of the present disclosure, such as in vitro, in vivo, or ex vivo methods for reducing interactions between GBP-expressing cells and cells displaying cell surface glycoRNA, methods for targeting agents to GBP-expressing cells, methods for inducing signaling through GBPs expressed on the surface of GBP-expressing cells, etc.

[0348] Thus, kits of the present disclosure may include any of the soluble glycoRNAs, conjugates, and / or fusion proteins of the present disclosure, including any of the soluble glycoRNAs, conjugates, and / or fusion proteins described elsewhere but not repeated here for brevity. The kits may also include soluble glycoRNAs, conjugates, and / or fusion proteins present in a pharmaceutical composition. When kits of the present disclosure include a pharmaceutical composition, the kit may include a quantity of the composition present in a unit dose (e.g., an ampoule) or multi-dose form. Thus, in certain embodiments, the kit may include one or more (e.g., two or more) unit doses (e.g., an ampoule) of a pharmaceutical composition comprising any of the soluble glycoRNAs, conjugates, and / or fusion proteins of the present disclosure. As used herein, the term "unit dose" refers to a physically discrete unit suitable for administration to human and animal subjects as a unitary dosage, each unit containing a predetermined amount of the composition calculated to be sufficient to produce a desired therapeutic effect. The amount of a unit dose will depend on various factors, such as the particular soluble glycoRNA, conjugate, and / or fusion protein used, the effect to be achieved, and the pharmacodynamic effects in the individual associated with the soluble glycoRNA, conjugate, and / or fusion protein. In yet other embodiments, the kit may contain a single, multi-dose composition.

[0349] In certain embodiments, the kits of the present disclosure include instructions for using the contents of the kit in methods for targeting agents to GBP-expressing cells, for inducing signaling through GBP expressed on the surface of GBP-expressing cells, and / or for interactions between GBP-expressing cells and cells displaying cell surface glycoRNA in vitro, in vivo, or ex vivo.

[0350] The instructions (e.g., instructions for use (IFU)) included in the kit may be recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic. Thus, the instructions may be present in the kit as a package insert on the label of the container of the kit or a component thereof (i.e., associated with the packaging or subpackaging). In other embodiments, the instructions are present as an electronic storage data file present on a suitable computer-readable storage medium, such as a portable flash drive, DVD, CD-ROM, diskette, etc. In yet other embodiments, the actual instructions are not present in the kit, but means are provided for obtaining the instructions from a remote source, e.g., via the internet. An example of this embodiment is a kit that provides a web address where the instructions can be viewed and / or from which the instructions can be downloaded. Similar to the instructions, the means for obtaining the instructions is displayed on a suitable substrate.

[0351] In certain embodiments, the present disclosure provides a composition comprising a compound of Formula (I) described herein, or a salt, solvate, hydrate, polymorph, cocrystal, tautomer, stereoisomer, isotopically labeled derivative, or prodrug thereof, and optionally an excipient. In certain embodiments, the composition is used for human applications (e.g., medical applications, industrial applications, research applications). In certain embodiments, the composition is used for non-human veterinary applications (e.g., for non-human animals (e.g., livestock, companion animals)). In certain embodiments, the non-human animal is a mammal (e.g., a primate (e.g., a cynomolgus monkey or a rhesus monkey), a commercially important mammal (e.g., a cow, a pig, a horse, a sheep, a goat, a cat, or a dog), or a bird (e.g., a commercially important bird, such as a chicken, a duck, a goose, or a turkey)). In certain embodiments, the non-human animal is a research animal (e.g., a primate, a rat, a mouse, a dog, a fish). In certain embodiments, the non-human animal is a fish, reptile, or amphibian. The non-human animal can be male or female at any stage of development. In certain embodiments, the non-human companion animal is a dog. In certain embodiments, the non-human companion animal is a cat. In certain embodiments, the non-human companion animal is a bird. The compositions described herein can be prepared by any method known in the art. In another aspect, kits are provided that include a first container containing a compound or composition described herein and instructions for use (e.g., for administering the compound or composition to a subject or for contacting a biological sample with the compound or composition). The kit may further include a container (e.g., a vial, an ampoule, a bottle, a syringe, and / or a dispenser container, or other suitable container). In some embodiments, the provided kits may optionally further include a second container containing an excipient for diluting or suspending the compound or composition described herein.

[0352] Exemplary Embodiments: Section A The embodiments described below ar...

Claims

1. a) i) a small interfering RNA (siRNA); ii) at least one oligosaccharide moiety comprising a hyperantennary complex type N-glycan comprising at least one GlcNAc residue attached to the Manal-3 arm and at least one GlcNAc attached to the Manal-6 arm of the trimannose core; or a salt thereof; b) a pharma- ceutically acceptable carrier; and 23. A pharmaceutical composition comprising:

2. a) i) a small interfering RNA (siRNA); ii) at least one oligosaccharide moiety covalently attached to the siRNA, the oligosaccharide moiety comprising a hybrid N-glycan comprising a trimannose core, at least one GlcNAc residue at the terminal end of an α1,3 mannose (Manα1,3) arm of the trimannose core, and zero or more mannoses at an α1,6 mannose (Manα1,3) arm of the trimannose core; or a salt thereof; b) a pharma- ceutically acceptable carrier; and 23. A pharmaceutical composition comprising:

3. a) i) a small interfering RNA (siRNA); ii) at least one oligosaccharide moiety comprising a high mannose type N-glycan comprising four or more mannose residues of a di-GlcNAc oligosaccharide structure covalently attached to the siRNA; or a salt thereof; b) a pharma- ceutically acceptable carrier; and 23. A pharmaceutical composition comprising:

4. A pharmaceutical composition described in any one of claims 1 to 3, wherein at least one of the oligosaccharide moieties contains at least six monosaccharides.

5. The pharmaceutical composition according to any one of claims 1 to 3, wherein the at least one oligosaccharide moiety comprises at least 8 monosaccharides.

6. The pharmaceutical composition according to any one of claims 1 to 2, wherein the at least one oligosaccharide moiety comprises at least 10 monosaccharides.

7. The pharmaceutical composition according to any one of claims 1 to 3, wherein at least one of the terminal residues of the hyperantennary complex type N-glycan or the hybrid type N-glycan comprises a monosaccharide selected from sialic acid, fucose, GlcNAc, mannose and galactose.

8. The pharmaceutical composition of any one of claims 1 to 3, wherein the at least one oligosaccharide moiety is covalently attached to the siRNA via a click chemistry reaction.

9. The pharmaceutical composition of any one of claims 1 to 3, wherein the siRNA is covalently attached to the oligosaccharide moiety via a linker group covalently attached to an end of the siRNA.

10. The pharmaceutical composition of any one of claims 1 to 3, wherein the siRNA is covalently attached to the oligosaccharide moiety via a linker that is covalently attached to a central chemically modified nucleotide of the siRNA.

11. The pharmaceutical composition of any one of claims 1 to 3, wherein the siRNA is covalently linked to the oligosaccharide moiety via a chemical handle inserted between two nucleotides of the siRNA.

12. The pharmaceutical composition of claim 1, wherein the at least one oligosaccharide moiety comprises a tetraantennary complex-type N-glycan comprising a first terminal residue, a second terminal residue, a third terminal residue and a fourth terminal residue.

13. The pharmaceutical composition of claim 12, wherein at least one of the first terminal residue, the second terminal residue, the third terminal residue and the fourth terminal residue comprises a monosaccharide selected from sialic acid, GlcNAc and galactose.

14. The pharmaceutical composition of claim 12, wherein at least one of the first terminal residue, the second terminal residue, the third terminal residue and the fourth terminal residue comprises galactose.

15. The pharmaceutical composition of claim 12, wherein the at least one oligosaccharide moiety comprises a fucose linked to a GlcNAc residue in the core or stem region of the complex-type N-glycan.

16. The pharmaceutical composition of claim 1, wherein the at least one oligosaccharide moiety comprises a bisected complex-type N-glycan.

17. The pharmaceutical composition of any one of claims 1 to 3, wherein the at least one oligosaccharide moiety comprises fucose linked to a GlcNAc residue in the core or base region of the complex type N-glycan, in the core or base region of the hybrid type N-glycan, or in the core or base region of the high mannose type N-glycan.

18. The pharmaceutical composition of claim 12, wherein at least one of the first terminal residue, the second terminal residue, the third terminal residue and the fourth terminal residue comprises sialic acid.

19. The pharmaceutical composition of claim 12, wherein at least one of the first terminal residue, the second terminal residue, the third terminal residue and the fourth terminal residue comprises GlcNAc.

20. The pharmaceutical composition of claim 12, wherein at least one of the first terminal residue, the second terminal residue, the third terminal residue and the fourth terminal residue comprises mannose.

21. The pharmaceutical composition of any one of claims 1 to 3, wherein the at least one oligosaccharide moiety comprises a biantennary complex-type N-glycan comprising a first terminal residue and a second terminal residue, a biantennary complex hybrid-type N-glycan comprising a first terminal residue and a second terminal residue, or a biantennary complex high mannose-type N-glycan comprising a first terminal residue and a second terminal residue.

22. The pharmaceutical composition of claim 21, wherein at least one of the first terminal residue and the second terminal residue comprises a monosaccharide selected from sialic acid, GlcNAc, and galactose.

23. The pharmaceutical composition of claim 21, wherein at least one of the first terminal residue and the second terminal residue comprises sialic acid.

24. The pharmaceutical composition of claim 21, wherein at least one of the first terminal residue and the second terminal residue comprises GlcNAc.

25. The pharmaceutical composition of claim 21, wherein at least one of the first terminal residue and the second terminal residue comprises mannose.

26. The pharmaceutical composition of claim 21, wherein the at least one oligosaccharide moiety comprises a fucose linked to a GlcNAc residue in the core or stem region of a biantennary N-glycan.

27. The pharmaceutical composition of any one of claims 1 to 3, wherein the at least one oligosaccharide moiety comprises a triantennary complex-type N-glycan comprising a first terminal residue, a second terminal residue and a third terminal residue, a triantennary complex hybrid-type N-glycan comprising a first terminal residue, a second terminal residue and a third terminal residue, or a triantennary complex high mannose-type N-glycan comprising a first terminal residue, a second terminal residue and a third terminal residue.

28. The pharmaceutical composition of claim 27, wherein at least one of the first terminal residue and the second terminal residue comprises a monosaccharide selected from sialic acid, GlcNAc, and galactose.

29. The pharmaceutical composition of claim 27, wherein at least one of the first terminal residue, the second terminal residue and the third terminal residue comprises sialic acid.

30. The pharmaceutical composition of claim 27, wherein at least one of the first terminal residue, the second terminal residue and the third terminal residue comprises GlcNAc.

31. The pharmaceutical composition of claim 27, wherein at least one of the first terminal residue, the second terminal residue and the third terminal residue comprises galactose.

32. The pharmaceutical composition of claim 27, wherein the at least one oligosaccharide moiety comprises a fucose linked to a GlcNAc residue in the core or stem region of a triantennary complex-type N-glycan. **Claim 33**: The at least one oligosaccharide moiety is G-1 (GlcNAc(b1-2)Man(a1-3)[GlcNAc(b1-2)Man(a1-6)]Man(b1-4)GlcNAc(b1-4)[Fuc(a1-6)]GlcNAc(b1-), G-2 (Neu5Ac(a2-6)Gal(b1-4)GlcNAc(b1-2)Man(a1-3)[Neu5Ac(a2-6)Gal(b1-4)GlcNAc(b1-2)Man(a1-6)]Man(b1-4)GlcNAc(b1-4)[Fuc(a1-6)]GlcNAc(b1-), G-4 (Gal(b1-4)GlcNAc(b1-2)Man(a1-3)[Gal(b1-4)GlcNAc(b1-2)Man(a1-6)][GlcNAc(b1-4)]Man(b1-4)GlcNAc(b1-4)GlcNAc(b1), G-5 (NeuNAc(a2-3)Gal(b1-4)GlcNAc(b1-2)Man(a1-3)[NeuNAc(a2-3)Gal(b1-4)GlcNAc(b1-2)Man(a1-6)]Man(b1-4)GlcNAc(b1-4)GlcNAc(b1-), G-8 (GlcNAc(b1-2)Man(a1-3)[GlcNAc(b1-2)Man(a1-6)]Man(b1-4)GlcNAc(b1-4)GlcNAc(b1-), G-9 (Gal(b1-4)GlcNAc(b1-2)Man(a1-3)[Gal(b1-4)GlcNAc(b1-2)Man(a1-6)]Man(b1-4)GlcNAc(b1-4)GlcNAc(b1-), G-10 (Neu5Ac(a2-6)Gal(b1-4)GlcNAc(b1-2)Man(a1-3)[Neu5Ac(a2-6)Gal(b1-4)GlcNAc(b1-2)Man(a1-6)]Man(b1-4)GlcNAc(b1-4)GlcNAc(b1-), G-11 (Gal(b1-4)GlcNAc(b1-2)Man(a1-3)[Gal(b1-4)GlcNAc(b1-2)Man(a1-6)]Man(b1-4)GlcNAc(b1-4)[Fuc(a1-6)]GlcNAc(b1-), and G-342. The pharmaceutical composition of claim 1, comprising a glycan selected from: (Neu5Ac(a2-3)Gal(b1-4)GlcNAc(b1-2)Man(a1-3)[Neu5Ac(a2-3)Gal(b1-4)GlcNAc(b1-2)Man(a1-6)]Man(b1-4)GlcNAc(b1-4)GlcNAc(b1-).

34. A glyconucleic acid of formula (I): A-L-B (I) or a salt thereof, comprising the steps of: A is siRNA, B is a hyperantennary complex type N-glycan, a hybrid type N-glycan or a high mannose glycan; L, a) a polynucleotide comprising A and a first click chemistry handle; b) an oligosaccharide moiety comprising B and a second click chemistry handle; and a linker formed by a bioorthogonal click chemistry reaction between The method comprises reacting a polynucleotide comprising A and a first click chemistry handle with an oligosaccharide moiety comprising B and a second click chemistry handle, wherein the reaction of the first step is carried out under bioorthogonal click chemistry conditions.

35. A pharmaceutical composition comprising a glyconucleic acid or a salt thereof produced by the method of claim 34.

36. The pharmaceutical composition of claim 3, wherein the at least one oligosaccharide moiety comprises a biantennary high mannose type N-glycan comprising a first terminal residue and a second terminal residue.

37. The pharmaceutical composition of claim 3, wherein the at least one oligosaccharide moiety comprises a triantennary high mannose N-glycan comprising a first terminal residue, a second terminal residue and a third terminal residue.

38. The pharmaceutical composition of claim 3, wherein the at least one oligosaccharide moiety comprises the glycan Man(a1-6)[Man(a1-3)]Man(a1-6)[Man(a1-3)]Man(b1-4)GlcNAc(b1-4)GlcNAc(b1- ("G-7").

Images