Drug-regulatable transcription factors

Abstract

Provided herein are synthetic inducible transcription factors that can be activated by their cognate ligands (e.g., caffeine, cannabinoids, nicotine, rapamycin, or mifepristone), and isolated cells expressing the inducible transcription factors. Also provided are methods of using the inducible transcription factors to regulate transcription of a gene of interest. TIFF2024515182000031.tif70134

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 176,801, filed April 19, 2021, and U.S. Provisional Application No. 63 / 176,848, filed April 19, 2021, each of which is incorporated by reference in its entirety for all purposes.

[0002] Sequence Listing This application contains a Sequence Listing that was submitted via EFS-Web and is incorporated herein by reference in its entirety. The ASCII copy, created in XX month, 20XX, is named XXXXXUS_sequencelisting.txt and is X,XXX,XXX bytes in size.

[0003] Field This application relates to synthetic inducible transcription factors that can be activated by their cognate ligands (e.g., caffeine, cannabinoids, nicotine, rapamycin, or mifepristone), and isolated cells expressing the inducible transcription factors. Also provided are methods of using the inducible transcription factors to regulate transcription of a gene of interest. [Background technology]

[0004] background Currently available cell and gene therapy products can lack expression control and can raise safety concerns, such as toxicity, in subjects receiving such therapies. Thus, additional methods of expression control and regulation of these therapies are needed. Summary of the Invention

[0005] overview In one aspect, provided herein is an engineered cell comprising an inducible transcription factor (ITF), The ITF: a first monomer comprising a DNA-binding domain and a first ligand-binding domain; a second monomer comprising a transcription effector domain and a second ligand binding domain; Including, each monomer is capable of oligomerization via a cognate ligand that binds to each ligand-binding domain; Ligand-induced oligomerization forms ITF, the cognate ligand is selected from the group consisting of caffeine, cannabidiol (CBD), phytocannabinoids, and nicotine; Optionally, the DNA binding domain comprises a zinc finger (ZF) protein domain; Optionally, each ligand binding domain comprises a single domain antibody; Single domain antibodies are H Contains H, Optionally, ITF can regulate the transcription of a gene of interest operably linked to an ITF responsive promoter.

[0006] In some embodiments, aV H H is anti-caffeine V H H(ac V H H) Optionally, an anti-caffeine H H(ac V H H) comprises the amino acid sequence of SEQ ID NO: 52, and / or Optionally, each of the first ligand binding domain and the second ligand binding domain is selected from the group consisting of ac V H Contains H, or b. The cognate ligand is cannabidiol or a phytocannabinoid; V H H comprises an amino acid sequence selected from the group consisting of SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, and SEQ ID NO:57 (CA-14, DB-6, DB-11, DB-18, and DB-21, respectively); Optionally, one of the first or second ligand binding domains comprises the amino acid sequence of SEQ ID NO:53 (CA-14). HH, and the other of the first or second binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, and SEQ ID NO:57 (DB-6, DB-11, DB-18, and DB-21, respectively). H Contains H, Optionally, one of the first or second ligand binding domains comprises the amino acid sequence of SEQ ID NO:53 (CA-14). H H, and the other of the first or second binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, and SEQ ID NO:57 (DB-6, DB-11, DB-18, and DB-21, respectively). H Contains H, Optionally, one of the first or second ligand binding domains comprises the amino acid sequence of SEQ ID NO:53 (CA-14). H H, and the other of the first or second binding domain comprises a VHH comprising the amino acid sequence of SEQ ID NO: 57 (DB-21); or c. each ligand binding domain comprises an anti-nicotine antibody heavy chain variable domain (Anti-Nic VH) or an anti-nicotine antibody light chain variable domain (Anti-Nic VL); Optionally, the anti-Nic VH comprises the amino acid sequence of SEQ ID NO:58, and the anti-Nic VL comprises the amino acid sequence of SEQ ID NO:59; Optionally, one of the first or second ligand binding domains comprises an anti-Nic VH, and the other of the first or second ligand binding domains comprises an anti-Nic VL.

[0007] In another aspect, provided herein is an engineered cell comprising an inducible transcription factor (ITF), The ITF: a first monomer comprising a DNA-binding domain and a first ligand-binding domain; a second monomer comprising a transcription effector domain and a second ligand binding domain; Including, each monomer is capable of oligomerization via binding of a cognate ligand that binds to each ligand-binding domain; Ligand-induced oligomerization forms ITF, the DNA binding domain comprises a zinc finger (ZF) protein domain which is modular and contains an array of six ZF motifs; the cognate ligand is selected from the group consisting of rapamycin, AP1903, AP20187, FK1012, derivatives thereof, and analogs thereof; Optionally, ITF can regulate the transcription of a gene of interest operably linked to an ITF responsive promoter.

[0008] In some embodiments, a. one of the first or second ligand binding domains comprises an FKBP domain and the other of the first or second ligand binding domains comprises an FRB domain; Optionally, the FKBP comprises the amino acid sequence of SEQ ID NO: 60, Optionally, the FRB domain comprises the amino acid sequence of SEQ ID NO: 61; or b. the first ligand binding domain comprises an FKBP domain and the second ligand binding domain comprises an FRB domain; Optionally, the FKBP comprises the amino acid sequence of SEQ ID NO: 60, Optionally, the FRB domain comprises the amino acid sequence of SEQ ID NO: 61; or c. one of the first or second ligand binding domains comprises an FRB domain and the other of the first or second ligand binding domains comprises an FKBP domain; Optionally, the FKBP comprises the amino acid sequence of SEQ ID NO: 60, Optionally, the FRB domain comprises the amino acid sequence of SEQ ID NO: 61; or d. the first ligand binding domain comprises an FRB domain and the second ligand binding domain comprises an FKBP domain; Optionally, the FKBP comprises the amino acid sequence of SEQ ID NO: 60, Optionally, the FRB domain comprises the amino acid sequence of SEQ ID NO:61.

[0009] In some embodiments, a. the first monomer and / or the second monomer further comprises a nuclear localization signal (NLS); Optionally, the NLS comprises an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4; and / or b. the second monomer further comprises a nuclear export signal (NES); Optionally, the NES comprises an amino acid sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14.

[0010] In another aspect, provided herein is an engineered cell comprising an inducible transcription factor (ITF), ITF contains a DNA-binding domain, a transcriptional effector domain, and a ligand-binding domain. ITF undergoes nuclear localization upon binding of its ligand-binding domain to its cognate ligand, When localized in the cell nucleus, ITF is capable of regulating the transcription of a gene of interest that is operably linked to an ITF responsive promoter; the cognate ligand is mifepristone or a derivative thereof; Optionally, the ligand binding domain comprises a progesterone receptor domain, the progesterone receptor domain comprising the amino acid sequence of SEQ ID NO: 68; Optionally, the DNA binding domain comprises a zinc finger (ZF) protein domain; Optionally, the ITF further comprises a peptide linker between the DNA binding domain and the transcriptional effector domain; Optionally, the DNA binding domain binds to an ITF responsive promoter; Optionally, the cell further comprises an expression cassette comprising an ITF responsive promoter operably linked to an exogenous polynucleotide sequence encoding a gene of interest; Optionally, the ITF responsive promoter comprises an ITF binding domain sequence and a core promoter sequence; Optionally, the core promoter sequence comprises a minimal promoter, wherein the minimal promoter is selected from the group consisting of minP, minCMV, YB_TATA, minTATA, and minTK, or the core promoter sequence is derived from a constitutive promoter, wherein the core promoter sequence is derived from a constitutive promoter selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, EF1a, hCAGG, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb.

[0011] In some embodiments, a. ZF protein domains are modular in design and are composed of one or more zinc finger arrays (ZFAs); b. the ZF protein domain comprises an array of 1-10 zinc finger motifs; and / or c. The ZF protein domain contains an array of six zinc finger motifs.

[0012] In some embodiments, a. the transcription effector domain comprises a transcription activation domain; Optionally, the transcriptional activation domain is selected from the group consisting of a herpes simplex virus protein 16 (VP16) activation domain; an activation domain comprising four tandem copies of VP16; a VP64 activation domain; a p65 activation domain of NFκB; an Epstein-Barr virus R transactivator (Rta) activation domain; a tripartite activator comprising VP64, p65, and Rta activation domains (VPR activation domain); and a histone acetyltransferase (HAT) core domain of human E1A-associated protein p300 (p300 HAT core activation domain), or b. the transcriptional effector domain comprises a transcriptional repressor domain; Optionally, the transcriptional repressor domain is a Krüppel-associated box (KRAB) repression domain; a truncated Krüppel-associated box (KRAB) repression domain; a histone deacetylase 4 (HDAC4) repressor domain; a scleraxis (SCX) HLH domain, an inhibitor of DNA binding 1 (ID1) HLH domain, a HECT domain- and RCC1-like domain-containing protein 2 (HERC2) Cyt-b5 domain, a twist-related protein 1 (TWST1) HLH domain, a homeobox protein Nkx-2.2 (NKX22) homeodomain. , inhibitor of DNA binding 1 (ID3) HLH domain, and twist-related protein 2 (TWST2) HLH domain, and EED repressor domain; repressor element silencing transcription factor (REST) ​​repression domain; WRPW motif of hairy-related basic helix-loop-helix repressor protein (the motif is known as the WRPW repression domain); DNA (cytosine-5)-methyltransferase 3B (DNMT3B) repression domain; and HP1 alpha chromoshadow repression domain.

[0013] In another aspect, provided herein is an expression system, the expression system comprising: a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding a first monomer, the first monomer comprising a DNA-binding domain and a first ligand-binding domain; a second expression cassette comprising a second promoter and an exogenous polynucleotide sequence encoding a second monomer, the second monomer comprising a transcription effector domain and a second ligand binding domain; Including, each monomer is capable of oligomerization via a cognate ligand that binds to each ligand-binding domain; Ligand-induced oligomerization of the first and second monomers forms an inducible transcription factor (ITF), the cognate ligand is selected from the group consisting of caffeine, cannabidiol (CBD), phytocannabinoids, and nicotine; Optionally, the DNA binding domain comprises a zinc finger (ZF) protein domain; Optionally, the ZF protein domain is modular in design and composed of one or more zinc finger arrays (ZFAs); Optionally, the ZF protein domain comprises an array of 1-10 zinc finger motifs; Optionally, the expression system further comprises a third expression cassette comprising an ITF responsive promoter operably linked to a gene of interest, the ITF responsive promoter comprising a core promoter sequence and a sequence that binds to the DNA binding domain of the first engineered polypeptide.

[0014] In another aspect, provided herein is an expression system, the expression system comprising: a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding a first monomer, the first monomer comprising a DNA-binding domain and a first ligand-binding domain; a second expression cassette comprising a second promoter and an exogenous polynucleotide sequence encoding a second monomer, the second monomer comprising a transcription effector domain and a second ligand binding domain; Including, each monomer is capable of oligomerization via binding of a cognate ligand that binds to each ligand-binding domain; Ligand-induced oligomerization of the first and second monomers forms an inducible transcription factor (ITF), the DNA binding domain is modular and comprises a zinc finger protein domain comprising 10 zinc finger arrays (ZFAs); the cognate ligand is selected from the group consisting of rapamycin, AP1903, AP20187, FK1012, derivatives thereof, and analogs thereof; Optionally, each ligand binding domain comprises an FKBP domain or an FRB domain; Optionally, the first monomer and / or the second monomer further comprises a nuclear localization signal (NLS); Optionally, the second monomer further comprises a nuclear export signal (NES); Optionally, ITF can regulate the transcription of a gene of interest operably linked to an ITF responsive promoter; Optionally, the expression system further comprises a third expression cassette comprising an ITF-responsive promoter operably linked to a gene of interest, the third promoter comprising a core promoter sequence and a sequence that binds to the DNA-binding domain of the first engineered polypeptide.

[0015] In another aspect, provided herein is an expression system comprising a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding an inducible transcription factor (ITF), ITF contains a DNA-binding domain, a transcriptional effector domain, and a ligand-binding domain. ITF undergoes nuclear localization upon binding of its ligand-binding domain to its cognate ligand, When localized in the cell nucleus, ITF is capable of regulating the transcription of a gene of interest that is operably linked to an ITF responsive promoter; the cognate ligand is mifepristone or a derivative thereof; Optionally, the ligand binding domain comprises a progesterone receptor domain; Optionally, the DNA binding domain comprises a zinc finger (ZF) protein domain; Optionally, the ZF protein domain is modular in design and composed of one or more zinc finger arrays (ZFAs); Optionally, the ZF protein domain comprises 1-10 zinc finger motifs; Optionally, the ITF further comprises a linker located between the DNA binding domain and the transcriptional effector domain; Optionally, the expression system further comprises an expression cassette comprising an ITF responsive promoter operably linked to an exogenous polynucleotide sequence encoding a gene of interest.

[0016] In another aspect, provided herein is an engineered cell comprising an expression system of any of the above aspects or embodiments.

[0017] In certain embodiments, a. the cell comprises a human cell, and / or b. the cells comprise stem cells; and / or c. the cell comprises an immune cell; and / or d. The cell is selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, bone marrow cells, macrophages, monocytes, dendritic cells, red blood cells, platelet cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells.

[0018] In another aspect, provided herein is a gene switch for regulating transcription of a gene of interest, the gene switch comprising: a. an engineered cell of any one of the above aspects or embodiments, and a cognate ligand selected from the group consisting of caffeine, cannabidiol (CBD), a phytocannabinoid, and nicotine to induce the formation of an inducible transcription factor (ITF); or b. An engineered cell of any one of the above aspects or embodiments and a cognate ligand selected from the group consisting of rapamycin, AP1903, AP20187, FK1012, derivatives thereof, and analogs thereof; or c. The engineered cells of any one of the above aspects or embodiments, and mifepristone, or a derivative thereof.

[0019] In another aspect, provided herein is a method of modulating transcription of a gene of interest, the method comprising: a. contacting an engineered cell of any one of the above aspects or embodiments with a cognate ligand selected from the group consisting of caffeine, cannabidiol (CBD), phytocannabinoids, and nicotine to induce formation of an inducible transcription factor (ITF); Optionally, further comprising culturing the engineered cells for a period of time sufficient to allow ITF to regulate transcription of a gene operably linked to the ITF responsive promoter; Optionally, the contacting step is carried out in a human or an animal; Optionally, the step of contacting the transformed cell with the cognate ligand comprises administering a pharmacological dose of the cognate ligand to a human or animal; or b. contacting the engineered cell of any one of the above aspects or embodiments with a cognate ligand selected from the group consisting of rapamycin, AP1903, AP20187, FK1012, derivatives thereof, and analogs thereof to induce the formation of an inducible transcription factor (ITF); Optionally, further comprising culturing the engineered cells for a period of time sufficient to allow ITF to regulate transcription of a gene operably linked to the ITF responsive promoter; Optionally, the engineered cell is in a human or animal, and contacting the engineered cell with the cognate ligand comprises administering a pharmacological dose of rapamycin to the human or animal; Optionally, the transcriptional effector domain of the second monomer comprises a transcriptional activation domain and modulating transcription comprises activating transcription of the gene of interest, or the transcriptional effector domain of the second monomer comprises a transcriptional repressor domain and modulating transcription comprises repressing transcription of the gene of interest; or c. Contacting the engineered cell of any one of the above aspects or embodiments with mifepristone, or a derivative thereof, to induce nuclear localization of inducible transcription factor (ITF), Optionally, further comprising culturing the engineered cells for a period of time sufficient to allow ITF to regulate transcription of a gene operably linked to the ITF responsive promoter; Optionally, the engineered cell is in a human or animal, and contacting the engineered cell with mifepristone comprises administering a pharmacological dose of mifepristone to the human or animal; Optionally, the transcription effector domain comprises a transcription activation domain and regulating transcription comprises activating transcription of the gene of interest, or the transcription effector domain comprises a transcription repressor domain and regulating transcription comprises repressing transcription of the gene of interest.

[0020] Also provided herein are inducible transcription factors that can be activated by a cognate ligand selected from caffeine, cannabinoids, nicotine, and rapamycin.

[0021] The inducible transcription factors described herein are activatable by ligands, which can be used in vivo, such as to control gene expression in therapeutic cells.

[0022] In some aspects, the present disclosure provides engineered cells comprising an inducible transcription factor (ITF), The ITF: (i) a first monomer comprising a DNA-binding domain and a first ligand-binding domain; (II) a second monomer comprising a transcription effector domain and a second ligand binding domain; Including, Each monomer is capable of oligomerization via a cognate ligand that binds to each ligand-binding domain, and the ligand-induced oligomerization forms ITF, the cognate ligand being selected from the group consisting of caffeine, cannabidiol (CBD), phytocannabinoids, and nicotine.

[0023] In some embodiments, the DNA binding domain comprises a zinc finger (ZF) protein domain. In some embodiments, the ZF protein domain is modular in design and is composed of one or more zinc finger arrays (ZFAs). In some embodiments, the ZF protein domain comprises an array of 1-10 ZF motifs. In some embodiments, the ZF protein domain comprises six ZF motifs.

[0024] In some embodiments, the first ligand binding domain and the second ligand binding domain bind distinct epitopes of the cognate ligand.

[0025] In some aspects, each ligand binding domain comprises a single domain antibody.

[0026] In some embodiments, the single domain antibody comprises H In some embodiments, V H H is anti-caffeine V H H(ac V H H). In some embodiments, the anti-caffeine V H H(acV H H) comprises the amino acid sequence of SEQ ID NO: 52. In some embodiments, each of the first ligand-binding domain and the second ligand-binding domain comprises ac V H Contains H.

[0027] In some embodiments, the cognate ligand is cannabidiol or a phytocannabinoid, H H comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 53 to 57 (CA14, DB6, DB11, DB18, and DB21).

[0028] In some embodiments, one of the first or second ligand binding domains comprises the amino acid sequence of SEQ ID NO:53 (CA-14). H H, and the other of the first or second binding domain comprises an amino acid sequence selected from the group consisting of 54 to 57 (DB6, DB11, DB18, and DB21). H Contains H.

[0029] In some embodiments, one of the first or second ligand binding domains comprises the amino acid sequence of SEQ ID NO:53 (CA-14). H H, and the other of the first or second binding domain comprises the amino acid sequence of SEQ ID NO: 54 (DB-21) H Contains H.

[0030] In some embodiments, each ligand binding domain comprises an anti-nicotine antibody heavy chain variable domain (anti-Nic VH) or an anti-nicotine antibody light chain variable domain (anti-Nic VL).

[0031] In some embodiments, the anti-Nic VH comprises the amino acid sequence of SEQ ID NO:58.

[0032] In some embodiments, the anti-Nic VL comprises the amino acid sequence of SEQ ID NO:59.

[0033] In some aspects, one of the first or second ligand binding domains comprises an anti-Nic VH and the other of the first or second ligand binding domains comprises an anti-Nic VL.

[0034] In some aspects, the present disclosure provides engineered cells comprising an inducible transcription factor (ITF), The ITF: (i) a first monomer comprising a DNA-binding domain and a first ligand-binding domain; (ii) a second monomer comprising a transcriptional effector domain and a second ligand binding domain; Including, Each monomer is capable of oligomerization via binding of a cognate ligand that binds to each ligand-binding domain, and the ligand-induced oligomerization forms an ITF, the DNA-binding domain is modular and comprises a zinc finger (ZF) protein domain that comprises an array of six ZF motifs, and the cognate ligand is selected from the group consisting of rapamycin, AP1903, AP20187, FK1012, derivatives thereof, or analogs thereof.

[0035] In some embodiments, one of the first or second ligand binding domains comprises an FKBP domain and the other of the first or second ligand binding domains comprises an FRB domain.

[0036] In some embodiments, the FKBP comprises the amino acid sequence of SEQ ID NO:60.

[0037] In some embodiments, the FRB domain comprises the amino acid sequence of SEQ ID NO:61.

[0038] In some embodiments, the first ligand binding domain comprises an FKBP domain and the second ligand binding domain comprises an FRB domain.

[0039] In some embodiments, one of the first or second ligand binding domains comprises an FRB domain and the other of the first or second ligand binding domains comprises an FKBP domain.

[0040] In some embodiments, the first monomer and / or the second monomer further comprises a nuclear localization signal (NLS).

[0041] In some embodiments, the NLS comprises an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0042] In some embodiments, the second monomer further comprises a nuclear export signal (NES).

[0043] In some aspects, the NES comprises an amino acid sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14.

[0044] In some embodiments, ITF can regulate the transcription of a gene of interest that is operably linked to an ITF responsive promoter.

[0045] In some aspects, the present disclosure provides a method for producing a method for treating a cancer cell comprising: (i) a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding a first monomer, the first monomer comprising a DNA-binding domain and a first ligand-binding domain; (ii) a second expression cassette comprising a second promoter and an exogenous polynucleotide sequence encoding a second monomer, the second monomer comprising a transcription effector domain and a second ligand binding domain; and and providing an expression system comprising: Each monomer is capable of oligomerization via a cognate ligand that binds to each ligand-binding domain, and ligand-induced oligomerization of the first and second monomers forms an inducible transcription factor (ITF), and the cognate ligand is selected from the group consisting of caffeine, cannabidiol (CBD), phytocannabinoids, and nicotine.

[0046] In some embodiments, the DNA binding domain comprises a zinc finger (ZF) protein domain.

[0047] In some embodiments, the ZF protein domain is modular in design and is composed of one or more zinc finger arrays (ZFAs).

[0048] In some embodiments, the ZF protein domain comprises an array of 1-10 zinc finger motifs.

[0049] In some embodiments, the ZF protein domain comprises an array of six zinc finger motifs.

[0050] In some aspects, each ligand binding domain comprises a single domain antibody.

[0051] In some embodiments, the single domain antibody comprises H Contains H.

[0052] In some embodiments, V H H is anti-caffeine V H H(acV H H).

[0053] In some embodiments, the anti-caffeine V H H(acV H H) comprises the amino acid sequence of SEQ ID NO: 52. In some embodiments, each of the first ligand-binding domain and the second ligand-binding domain comprises the amino acid sequence of acV H Contains H.

[0054] In some aspects, the first monomer and the second monomer are capable of forming a homodimer upon binding to caffeine.

[0055] In some embodiments, the cognate ligand is cannabidiol or a phytocannabinoid, H H comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 53 to 57 (CA14, DB6, DB11, DB18, and DB21).

[0056] In some embodiments, the first ligand binding domain comprises the amino acid sequence of SEQ ID NO:53 (CA-14). H H, and the second binding domain comprises an amino acid sequence selected from the group consisting of 54 to 57 (DB6, DB11, DB18, and DB21). H Contains H.

[0057] In some embodiments, the first ligand binding domain comprises the amino acid sequence of SEQ ID NO:53 (CA-14).H H, and the second binding domain comprises the amino acid sequence of SEQ ID NO: 54 to 57 (DB-21) H Contains H.

[0058] In some aspects, the first monomer and the second monomer are capable of forming a heterodimer upon binding to cannabidiol or a phytocannabinoid.

[0059] In some embodiments, each ligand binding domain comprises an anti-nicotine antibody heavy chain variable domain (anti-Nic VH) or an anti-nicotine antibody light chain variable domain (anti-Nic VL).

[0060] In some embodiments, the anti-Nic VH comprises the amino acid sequence of SEQ ID NO:58.

[0061] In some embodiments, the anti-Nic VL comprises the amino acid sequence of SEQ ID NO:59.

[0062] In some embodiments, the first ligand binding domain comprises an anti-Nic VH and the second binding domain comprises an anti-Nic VL.

[0063] In some embodiments, the first ligand binding domain comprises an anti-Nic VL and the second ligand binding domain comprises an anti-Nic VH.

[0064] In some aspects, the first monomer and the second monomer are capable of forming a heterodimer upon binding to nicotine.

[0065] In some embodiments, the expression system further comprises a third expression cassette comprising an ITF responsive promoter operably linked to a gene of interest, the ITF responsive promoter comprising a core promoter sequence and a sequence that binds to the DNA binding domain of the first engineered polypeptide.

[0066] In some aspects, the core promoter sequence comprises a minimal promoter, hi some aspects, the minimal promoter is selected from the group consisting of minP, minCMV, YB_TATA, minTATA, and minTK.

[0067] In some aspects, the core promoter sequence is derived from a constitutive promoter selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, EF1a, hCAGG, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb.

[0068] In some embodiments, the DNA binding domain comprises a zinc finger (ZF) protein domain and the sequence that binds to the DNA binding domain comprises one or more ZF binding sites.

[0069] In some aspects, the present disclosure provides a method for producing a method for treating a cancer cell comprising: (i) a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding a first monomer, the first monomer comprising a DNA-binding domain and a first ligand-binding domain; (ii) a second expression cassette comprising a second promoter and an exogenous polynucleotide sequence encoding a second monomer, the second monomer comprising a transcription effector domain and a second ligand binding domain; and and providing an expression system comprising: Each monomer is capable of oligomerization via binding of a cognate ligand that binds to each ligand-binding domain, and ligand-induced oligomerization of the first and second monomers forms an inducible transcription factor (ITF), the DNA-binding domain is modular and comprises a zinc finger protein domain that includes six zinc finger motifs, and the cognate ligand is selected from the group consisting of rapamycin, AP1903, AP20187, FK1012, derivatives thereof, and analogs thereof.

[0070] In some embodiments, each ligand binding domain comprises an FKBP domain or an FRB domain. In some embodiments, the FKBP comprises the amino acid sequence of SEQ ID NO:60.

[0071] In some embodiments, the FRB domain comprises the amino acid sequence of SEQ ID NO: 61. In some embodiments, the first ligand binding domain comprises an FKBP domain and the second ligand binding domain comprises an FRB domain. In some embodiments, the first ligand binding domain comprises an FRB domain and the second ligand binding domain comprises an FKBP domain.

[0072] In some aspects, the first monomer and the second monomer are capable of forming a heterodimer upon binding to a ligand selected from the group consisting of rapamycin, AP1903, AP20187, FK1012, derivatives thereof, or analogs thereof.

[0073] In some embodiments, the first monomer and / or the second monomer further comprises a nuclear localization signal (NLS). In some embodiments, the NLS comprises an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0074] In some embodiments, the second monomer further comprises a nuclear export signal (NES), hi some embodiments, the NES comprises an amino acid sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14.

[0075] In some embodiments, ITF can regulate the transcription of a gene of interest that is operably linked to an ITF responsive promoter.

[0076] In some aspects, the first and / or second promoter is a constitutive promoter or a regulatable promoter.

[0077] In some aspects, the first and / or second promoter is a synthetic promoter.

[0078] In some aspects, the first promoter, the second promoter, or both the first and second promoters are constitutive promoters selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEF1aV1, hCAGG, hEF1aV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb.

[0079] In some embodiments, the expression system further comprises a third expression cassette comprising an ITF responsive promoter operably linked to a gene of interest, the third promoter comprising a core promoter sequence and a sequence that binds to the DNA binding domain of the first engineered polypeptide, In some embodiments, the core promoter sequence comprises a minimal promoter.

[0080] In some embodiments, the transcription effector domain comprises a transcription activation domain, which in some embodiments is selected from the group consisting of a herpes simplex virus protein 16 (VP16) activation domain, an activation domain comprising four tandem copies of VP16, a VP64 activation domain, a p65 activation domain of NFκB, an Epstein-Barr virus R transactivator (Rta) activation domain, a tripartite activator comprising VP64, p65, and Rta activation domains (VPR activation domain), and a histone acetyltransferase (HAT) core domain of human E1A-associated protein p300 (p300 HAT core activation domain).

[0081] In some embodiments, the transcriptional effector domain comprises a transcriptional repressor domain. In some embodiments, the transcriptional repressor domain comprises a Krüppel-associated box (KRAB) repression domain; histone deacetylase 4 (HDAC4) repressor domain; scleraxis (SCX) HLH domain, inhibitor of DNA binding 1 (ID1) HLH domain, HECT domain and RCC1-like domain-containing protein 2 (HERC2) Cyt-b5 domain, twist-related protein 1 (TWST1) HLH domain, homeobox protein Nkx-2.2 (NKX22) homeodomain, DNA binding 1 (ID 3) Inhibitors of HLH domains, and are selected from the group consisting of twist-related protein 2 (TWST2) HLH domain, EED repressor domain; repressor element silencing transcription factor (REST) ​​repression domain; WRPW motif of hairy-related basic helix-loop-helix repressor protein (the motif is known as the WRPW repression domain); DNA (cytosine-5)-methyltransferase 3B (DNMT3B) repression domain; and HP1 alpha chromoshadow repression domain.

[0082] In some embodiments, the DNA binding domain binds to an ITF responsive promoter.

[0083] In some aspects, the first promoter is a constitutive promoter, a regulatable promoter, or a synthetic promoter.

[0084] In some aspects, the first promoter is a constitutive promoter selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEF1aV1, hCAGG, hEF1aV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb.

[0085] In some embodiments, the expression system further comprises an expression cassette comprising an ITF responsive promoter operably linked to an exogenous polynucleotide sequence encoding a gene of interest.

[0086] In some aspects, the ITF responsive promoter comprises an ITF binding domain sequence and a promoter sequence.

[0087] In some aspects, the promoter sequence is derived from a promoter selected from the group consisting of minP, NFkB response element, CREB response element, NFAT response element, SRF response element 1, SRF response element 2, AP1 response element, TCF-LEF response element promoter fusion, hypoxia responsive element, SMAD binding element, STAT3 binding site, minCMV, YB_TATA, minTATA, minTK, an inducer molecule responsive promoter, and tandem repeats thereof.

[0088] In some embodiments, the ITF responsive promoter comprises a minimal promoter.

[0089] In some aspects, the disclosure provides engineered cells comprising the expression systems described herein.

[0090] In some embodiments, the engineered cells are human cells.

[0091] In some embodiments, the engineered cells are stem cells.

[0092] In some embodiments, the engineered cell is an immune cell.

[0093] In some aspects, the engineered cells are selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, bone marrow cells, macrophages, monocytes, dendritic cells, red blood cells, platelet cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells.

[0094] In some aspects, the present disclosure provides a gene switch for regulating transcription of a gene of interest comprising an engineered cell comprising caffeine-ITF and an effective amount of caffeine.

[0095] In some aspects, the present disclosure provides a gene switch for regulating the transcription of a gene of interest comprising an engineered cell comprising phytocannabinoid-ITF and an effective amount of cannabidiol (CBD) or a phytocannabinoid.

[0096] In some aspects, the present disclosure provides a gene switch for regulating transcription of a gene of interest comprising an engineered cell comprising nicotine-ITF and an effective amount of nicotine.

[0097] In some aspects, the disclosure provides a gene switch for regulating transcription of a gene of interest comprising an engineered cell comprising rapamycin-ITF and an effective amount of rapamycin.

[0098] In some aspects, the disclosure provides a method of regulating transcription of a gene of interest, the method comprising contacting an engineered cell containing an inducible transcription factor (ITF) inducible by caffeine, a phytocannabinoid, or nicotine with a cognate ligand selected from the group consisting of caffeine, cannabidiol (CBD), a phytocannabinoid, and nicotine to induce formation of the ITF.

[0099] In some embodiments, the method further comprises culturing the engineered cells for a period of time sufficient to allow ITF to regulate transcription of the gene operably linked to the ITF responsive promoter.

[0100] In some aspects, the contacting step is performed in a human or an animal.

[0101] In some aspects, the step of contacting the transformed cell with the cognate ligand comprises administering a pharmacological dose of the cognate ligand to a human or animal.

[0102] In some embodiments, the cognate ligand comprises caffeine.

[0103] In some embodiments, the cognate ligand is cannabidiol (CBD).

[0104] In some embodiments, the cognate ligand is nicotine.

[0105] In some aspects, the disclosure provides a method of regulating transcription of a gene of interest comprising contacting an engineered cell containing rapamycin-ITF with rapamycin to induce the formation of an inducible transcription factor (ITF).

[0106] In some embodiments, the method further comprises culturing the engineered cells for a period of time sufficient to allow ITF to regulate transcription of the gene operably linked to the ITF responsive promoter.

[0107] In some aspects, the engineered cells are in a human or animal, and contacting the engineered cells with the cognate ligand comprises administering a pharmacological dose of rapamycin to the human or animal.

[0108] In some embodiments, the transcriptional effector domain of the second monomer comprises a transcriptional activation domain, and modulating transcription comprises activating transcription of a gene of interest.

[0109] In some embodiments, the transcriptional effector domain of the second monomer comprises a transcriptional repressor domain, and modulating transcription comprises suppressing transcription of the gene of interest.

[0110] Also provided herein are inducible transcription factors that can be activated by mifepristone.

[0111] The inducible transcription factors described herein can be used in vivo, such as to control gene expression in therapeutic cells.

[0112] In some aspects, the present disclosure provides engineered cells comprising an inducible transcription factor (ITF), wherein ITF comprises a DNA binding domain, a transcription effector domain, and a ligand binding domain, wherein ITF undergoes nuclear localization upon binding of the ligand binding domain with a cognate ligand, and when localized in the cell nucleus, ITF can regulate the transcription of a gene of interest operably linked to an ITF responsive promoter, wherein the cognate ligand is mifepristone or a derivative thereof. In some aspects, the ligand binding domain comprises a progesterone receptor domain. In some aspects, the progesterone receptor domain comprises the amino acid sequence of SEQ ID NO:68.

[0113] In some embodiments, the DNA binding domain comprises a zinc finger (ZF) protein domain. In some embodiments, the ZF protein domain is modular in design and is composed of one or more zinc finger arrays (ZFAs). In some embodiments, the ZF protein domain comprises 1-10 zinc finger motifs. In some embodiments, the ZF protein domain comprises 6 zinc finger motifs.

[0114] In some embodiments, the ITF further comprises a peptide linker between the DNA binding domain and the transcriptional effector domain.

[0115] In some embodiments, the DNA binding domain binds to an ITF-responsive promoter. In some embodiments, the ITF-responsive promoter comprises an ITF-binding domain sequence and a core promoter sequence. In some embodiments, the core promoter sequence comprises a minimal promoter. In some embodiments, the minimal promoter is selected from the group consisting of minP, minCMV, YB_TATA, minTATA, and minTK. In some embodiments, the core promoter sequence is derived from a constitutive promoter. In some embodiments, the core promoter sequence is derived from a constitutive promoter selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, EF1a, hCAGG, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb.

[0116] In some embodiments, the cells further comprise an expression cassette comprising an ITF responsive promoter operably linked to an exogenous polynucleotide sequence encoding a gene of interest.

[0117] In some embodiments, the transcription effector domain comprises a transcription activation domain, which in some embodiments is selected from the group consisting of a herpes simplex virus protein 16 (VP16) activation domain, an activation domain comprising four tandem copies of VP16, a VP64 activation domain, a p65 activation domain of NFκB, an Epstein-Barr virus R transactivator (Rta) activation domain, a tripartite activator comprising VP64, p65, and Rta activation domains (VPR activation domain), and a histone acetyltransferase (HAT) core domain of human E1A-associated protein p300 (p300 HAT core activation domain).

[0118] In some embodiments, the transcription effector domain comprises a transcription repressor domain. In some embodiments, the transcription repressor domain is a Krüppel-associated box (KRAB) repression domain; a truncated Krüppel-associated box (KRAB) repression domain; histone deacetylase 4 (HDAC4) repressor domain; scleraxis (SCX) HLH domain, inhibitor of DNA binding 1 (ID1) HLH domain, HECT domain and RCC1-like domain containing protein 2 (HERC2) Cyt-b5 domain, twist-related protein 1 (TWST1) HLH domain, homeobox protein Nkx-2.2 (NKX22) homeodomain, Indole, inhibitor of DNA binding 1 (ID3) HLH domain, and twist-related protein 2 (TWST2) HLH domain, and EED repressor domain; repressor element silencing transcription factor (REST) ​​repression domain; WRPW motif of hairy-related basic helix-loop-helix repressor protein (the motif is known as the WRPW repression domain); DNA (cytosine-5)-methyltransferase 3B (DNMT3B) repression domain; and HP1 alpha chromoshadow repression domain.

[0119] In some aspects, the present disclosure provides an expression system comprising a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding an inducible transcription factor (ITF), wherein ITF comprises a DNA binding domain, a transcription effector domain, and a ligand binding domain, wherein ITF undergoes nuclear localization upon binding of the ligand binding domain with a cognate ligand, and when localized in the cell nucleus, ITF can regulate the transcription of a gene of interest operably linked to an ITF responsive promoter, wherein the cognate ligand is mifepristone or a derivative thereof. In some aspects, the DNA binding domain binds to the ITF responsive promoter. In some aspects, the first promoter is a constitutive promoter, a regulatable promoter, or a synthetic promoter. In some aspects, the first promoter is a constitutive promoter selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEF1aV1, hCAGG, hEF1aV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb.

[0120] In some embodiments, the expression system further comprises an expression cassette comprising an ITF-responsive promoter operably linked to an exogenous polynucleotide sequence encoding a gene of interest. In some embodiments, the ITF-responsive promoter comprises an ITF binding domain sequence and a core promoter sequence. In some embodiments, the core promoter sequence comprises a minimal promoter. In some embodiments, the minimal promoter is selected from the group consisting of minP, minCMV, YB_TATA, minTATA, and minTK. In some embodiments, the core promoter sequence is derived from a constitutive promoter. In some embodiments, the core promoter sequence is derived from a constitutive promoter selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, EF1a, hCAGG, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb.

[0121] In some aspects, the disclosure provides engineered cells comprising any of the expression systems described herein.

[0122] In some embodiments, the engineered cells comprise human cells. In some embodiments, the engineered cells comprise stem cells. In some embodiments, the engineered cells comprise immune cells. In some embodiments, the cells are selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, bone marrow cells, macrophages, monocytes, dendritic cells, red blood cells, platelet cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells.

[0123] In some aspects, the present disclosure provides a gene switch for regulating transcription of a gene of interest comprising any of the engineered cells described herein and an effective amount of mifepristone.

[0124] In some aspects, the present disclosure provides a method of regulating transcription of a polypeptide of interest comprising contacting any of the engineered cells described herein with mifepristone to induce nuclear localization of an inducible transcription factor (ITF). In some aspects, the method further comprises culturing the engineered cells for a period of time sufficient to allow ITF to regulate transcription of a gene operably linked to an ITF-responsive promoter. In some aspects, the engineered cells are in a human or animal, and contacting the engineered cells with mifepristone comprises administering a pharmacological dose of mifepristone to the human or animal. In some aspects, the transcription effector domain comprises a transcription activation domain, and regulating transcription comprises activating transcription of the gene of interest. In some aspects, the transcription effector domain comprises a transcription repressor domain, and regulating transcription comprises suppressing transcription of the gene of interest. [Brief description of the drawings]

[0125] These and other features, aspects, and advantages of the present disclosure will become better understood with regard to the following description and accompanying drawings.

[0126] [Figure 1] Shown is the fold change in reporter expression following treatment with various concentrations of the cognate ligand for cells expressing an inducible transcription factor. [Diagram 2] Shown is the percentage of cells positive for reporter expression after treatment with various concentrations of the cognate ligand for cells expressing caffeine-, nicotine-, or cannabinoid-inducible transcription factors with the first and second monomers, each containing a nuclear localization signal. [Diagram 3] 4 shows the mean fluorescence intensity of reporter expression after treatment with various concentrations of cognate ligand for cells expressing caffeine-, nicotine-, or cannabinoid-inducible transcription factors with the first and second monomers, each containing a nuclear localization signal. [Figure 4]Shown is the fold change in reporter expression following treatment with various concentrations of mifepristone for cells expressing mifepristone-inducible transcription factors. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0127] Detailed Description Terms used in the claims and specification are defined as set forth below unless otherwise specified.

[0128] The term "in vivo" refers to a process that takes place within a living organism.

[0129] As used herein, the term "mammal" includes both humans and non-humans, including, but not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0130] The term percent "identity" in the context of two or more nucleic acid or polypeptide sequences refers to two or more sequences or subsequences that, when compared and aligned for maximum correspondence, have a certain percentage of the same nucleotides or amino acid residues, as determined using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN, or other algorithms available to those of skill in the art) or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequences being compared, e.g., over a functional domain, or alternatively, over the entire length of the two sequences being compared.

[0131] For sequence comparison, typically, one sequence serves as a reference sequence to which test sequence is compared.When using sequence comparison algorithm, test and reference sequences are input into computer, coordinates of subsequences are designated as necessary, and sequence algorithm program parameters are designated.The sequence comparison algorithm then calculates the percent sequence identity of test sequence to reference sequence based on designated program parameters.

[0132] Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).

[0133] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available from the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0134] The term "sufficient amount" means an amount sufficient to produce a desired effect, for example an amount sufficient to inhibit transcriptional repression in a cell.

[0135] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0136] Inducible transcription factors Provided herein are inducible transcription factors (ITFs) whose activity can be induced by their cognate ligand. Also provided herein are inducible transcription factors whose activity can be induced by mifepristone.

[0137] In some embodiments, the inducible transcription factor comprises a first monomer comprising a DNA-binding domain and a first ligand-binding domain; and a second monomer comprising a transcription effector domain and a second ligand-binding domain. When a cognate ligand binds to the first monomer and the second monomer, the first and second monomers oligomerize (e.g., dimerize), and the ligand-induced oligomerization of the first and second monomers forms ITF. In some embodiments, the first monomer is a first antibody domain, the second monomer is a second antibody domain, and the first antibody domain and the second antibody domain are capable of oligomerization. In some embodiments, the inducible transcription factor is a polypeptide comprising a DNA-binding domain, a transcription effector domain, and a ligand-binding domain. When a cognate ligand binds to the ligand-binding domain, ITF undergoes nuclear localization and can regulate the transcription of a gene of interest operably linked to an ITF-responsive promoter.

[0138] "Ligand binding domain" refers to a polypeptide domain that specifically binds to a cognate ligand. As used herein, the terms "specifically bind" and "specifically recognize" are similar and refer to the binding of a polypeptide molecule (e.g., a ligand binding domain) to a ligand (e.g., caffeine, cannabinoids, nicotine, rapamycin, or mifepristone), as such binding is understood by those of skill in the art. For example, a ligand binding domain that specifically binds to a cognate ligand may bind other ligands with lower affinity, as determined, for example, by immunoassays, BIAcore®, KinExA 3000 instruments (Sapidyne Instruments, Boise, Id.), or other assays known in the art. In certain embodiments, a ligand binding domain that specifically binds to a cognate ligand may bind to the cognate ligand with a K that is at least 2-fold, 5-fold, 10-fold, 20-fold, 25-fold, 30-fold, or more than the K when the ligand binding domain nonspecifically binds to another ligand.

[0139] As used herein, a "DNA binding domain" refers to a protein domain that contains at least one structural motif that recognizes double-stranded or single-stranded DNA. A DNA binding domain can recognize a specific DNA sequence (recognition sequence) or have a general affinity for DNA. An example of a DNA binding domain capable of specific sequence recognition is a zinc finger (ZF) protein domain.

[0140] As used herein, "zinc finger (ZF) protein domain" refers to a protein of at least one motif that contains multiple finger-like projections that make tandem contacts with DNA. As used herein, "zinc finger array (ZFA)" refers to multiple zinc finger protein motifs that are linked together. Each zinc finger motif binds to a different nucleic acid motif. This results in a ZFA specific to any desired nucleic acid sequence. The ZF motifs can be directly adjacent to each other or separated by a flexible linker sequence. In some embodiments, the ZFA is an array, string, or chain of ZF motifs arranged in tandem. The ZFA can have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 zinc finger motifs. A ZFA may have 1-10, 1-15, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 4-5, 4-6, 4-7, 4-8, 4-9, 4-10, 5-6, 5-7, 5-8, 5-9, 5-10, or 5-15 zinc finger motifs. In some embodiments, a ZF protein domain comprises 1-10 zinc finger motifs. In some embodiments, a ZF protein domain comprises six zinc finger motifs. An exemplary zinc finger (ZF) protein domain comprising six zinc finger motifs is provided as SEQ ID NO:1. A ZF protein domain can have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more ZFAs. A ZF domain can have 1-10, 1-15, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 4-5, 4-6, 4-7, 4-8, 4-9, 4-10, 5-6, 5-7, 5-8, 5-9, 5-10, 5-15, 10-15, 10-20, or 10-25 ZFAs.

[0141] As used herein, "transcriptional effector domain" refers to a polypeptide domain that can regulate the transcription of a gene when targeted to the promoter region of the gene. In some embodiments, a DNA binding domain that is present in the same polypeptide molecule as the transcriptional effector domain or in the same quaternary structure (e.g., oligomerized monomer) as the transcriptional effector domain can allow targeting to the promoter region of a gene.

[0142] The transcription effector domain may include a transcription activator domain. As used herein, "transcription activator domain" refers to a polypeptide domain that can activate or increase the level of transcription of a gene when targeting the promoter region of the gene. Examples of transcription activators include the herpes simplex virus protein 16 (VP16) activation domain; an activation domain that includes four tandem copies of VP16; a VP64 activation domain; the p65 activation domain of NFκB ("p65"); the Epstein-Barr virus R transactivator (Rta) activation domain; a tripartite activator that includes VP64, p65, and Rta activation domains (VPR activation domain); a tripartite activator that includes VP64, p65, and HSF1 activation domains (VPH activation domain); and the histone acetyltransferase (HAT) core domain of human E1A-associated protein p300 (p300 HAT core activation domain). In some embodiments, the transcription activator domain, when targeted to the promoter region of a gene, can increase the transcription level of the gene by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, or at least 500% when compared to the transcription level of the gene in the absence of the transcription regulator domain. In some embodiments, the transcription activator domain, when targeted to the promoter region of a gene, can increase the transcription level of the gene by 10%-50%, 10%-100%, 10%-100%, 10%-200%, 10%-300%, 10%-400%, 10%-500%, 50%-500%, 100%-500%, 200%-500%, when compared to the transcription level of the gene in the absence of the transcription regulator domain.

[0143] The transcription effector domain may include a transcription repressor domain. As used herein, a "transcription repressor domain" refers to a polypeptide domain that can inhibit or reduce the level of transcription of a gene when targeted to the promoter region of the gene. Examples of transcription repressors include the Krüppel-associated box (KRAB) repression domain; histone deacetylase 4 (HDAC4) repressor domain; scleraxis (SCX) HLH domain, inhibitor of DNA binding 1 (ID1) HLH domain, HECT domain and RCC1-like domain-containing protein 2 (HERC2) Cyt-b5 domain, twist-related protein 1 (TWST1) HLH domain, homeobox protein Nkx-2.2 (NKX22) homeodomain, DNA binding 1 (ID3) HLH domain, and the like. ) HLH domains, and twist-related protein 2 (TWST2) HLH domain, EED repressor domain; repressor element silencing transcription factor (REST) ​​repression domain; the WRPW motif of hairy-related basic helix-loop-helix repressor protein (the motif is known as the WRPW repression domain); DNA (cytosine-5)-methyltransferase 3B (DNMT3B) repression domain; and the HP1 alpha chromoshadow repression domain.

[0144] In some embodiments, the transcriptional repressor domain, when targeted to the promoter region of a gene, can reduce the transcription level of the gene by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, or at least 500% when compared to the transcription level of the gene in the absence of the transcriptional repressor domain. In some embodiments, the transcriptional repressor domain, when targeted to the promoter region of a gene, can reduce the transcription level of the gene by 10% to 50%, 10% to 100%, 10% to 100%, 10% to 200%, 10% to 300%, 10% to 400%, 10% to 500%, 50% to 500%, 100% to 500%, or 200% to 500% when compared to the transcription level of the gene in the absence of the transcriptional repressor domain.

[0145] As used herein, "nuclear localization signal" or "NLS" refers to an amino acid sequence motif present in a protein sequence that signals the cell to import the protein into the nucleus by nuclear transport. NLSs typically contain a short, surface-exposed amino acid sequence rich in positively charged residues (e.g., lysine or arginine). Examples of NLSs include the amino acid sequences of SEQ ID NOs: 2-4.

[0146] As used herein, "nuclear transport signal" or "NES" refers to an amino acid sequence motif that is typically about 15 residues long and contains four hydrophobic residues that targets proteins for transport from the cell nucleus to the cytoplasm through the nuclear pore complex using nuclear transport. Examples of NES include the amino acid sequences of SEQ ID NOs: 5-14.

[0147] The ITF described herein may include a peptide linker that separates two domains. In general, any two domains can be linked together with a peptide linker, and an ITF that features three or more domains may include two or more linkers. The selection of a suitable linker sequence that links two domains is within the skill of a person skilled in the art. The peptide linker may be any polypeptide sequence that separates two polypeptide domains (e.g., an inducible transcription factor and a degron) without interfering with the function of the polypeptide domains. Examples of peptide linkers include GSGSGSGS (SEQ ID NO:15), KEGS (SEQ ID NO:16), EGK, EAAAK (SEQ ID NO:17), AAPAKQE (SEQ ID NO:18), GSGSGSGSGGAEAAAKEAAAKEAAAKA (SEQ ID NO:19, referred to herein as "concatenated Max Jen linker" or "ConMJ"), AAPAKQEAAAPAKQEAAAPAKQEAAAPAPAAKAEAPAAAPAAKA (SEQ ID NO:20, referred to herein as "ecpd"), and AEAAAKEAAAKEAAAKA (SEQ ID NO:21).

[0148] The term "expression cassette" refers to a recombinantly or synthetically produced polynucleotide having a set of nucleic acid elements that allow for transcription of a particular polynucleotide in a target cell. The expression cassettes described herein can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the expression cassette portion of an expression vector includes, among other sequences, the nucleic acid sequence to be transcribed and a promoter.

[0149] As used herein, a "promoter" refers to a control region of a nucleic acid sequence where the initiation and rate of transcription of the remainder of the nucleic acid sequence is controlled. A promoter may also contain subregions to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, may bind. A promoter may be constitutive, inducible, repressible, tissue-specific, or any combination thereof. A promoter drives the expression or drives the transcription of the nucleic acid sequence it regulates. As used herein, a promoter is considered to be "operably linked" when it is in the correct functional location and orientation relative to the nucleic acid sequence it regulates, to control (drive) the initiation and / or expression of the transcription of that sequence.

[0150] A promoter may be a promoter naturally associated with a gene or sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment of a given gene or sequence. Such promoters may be referred to as "endogenous". In some embodiments, a coding nucleic acid sequence may be placed under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with the coded sequence in its natural environment. Such promoters may include promoters of other genes; promoters isolated from any other cell; and synthetic promoters or enhancers that are not "natural", such as those that contain different elements and / or mutations of different transcriptional regulatory regions that modify expression through methods of genetic engineering known in the art. In addition to synthetically producing promoter and enhancer nucleic acid sequences, the sequences may be produced using nucleic acid amplification techniques, including recombinant cloning and / or polymerase chain reaction (PCR) (see, e.g., U.S. Pat. Nos. 4,683,202 and 5,928,906).

[0151] As used herein, a "regulatable promoter" refers to a promoter whose ability to initiate / activate or inhibit / repress transcriptional activity is regulated by a signal. The signal can be an endogenous or usually exogenous condition (e.g., light), a compound (e.g., a chemical or non-chemical compound), or a protein (e.g., ITF, as described herein) that contacts the regulatable promoter in such a way that it regulates (e.g., induces or represses) promoter activity. For example, an ITF-responsive promoter is a regulatable promoter that can be regulated by ITF.

[0152] As used herein, an "inducible promoter" refers to a promoter whose ability to initiate or activate transcriptional activity is regulated by a signal. The signal can be an endogenous or usually exogenous condition (e.g., light), a compound (e.g., a chemical or non-chemical compound), or a protein (e.g., ITF comprising a transcriptional activation domain as described herein) that contacts the inducible promoter in such a way as to activate transcriptional activity from the inducible promoter. For example, an ITF-responsive promoter can be an inducible promoter that can be activated by ITF.

[0153] As used herein, a "repressible promoter" refers to a promoter whose ability to inhibit or repress transcriptional activity is regulated by a signal. The signal can be an endogenous or usually exogenous condition (e.g., light), a compound (e.g., a chemical or non-chemical compound), or a protein (e.g., ITF, which contains a transcriptional repressor domain as described herein) that contacts the repressible promoter in such a way that it is active in repressing transcriptional activity from the repressible promoter. For example, an ITF-responsive promoter can be a repressible promoter that is repressible by ITF.

[0154] As used herein, a promoter is "responsive to" or "modulated by" or "regulated by" a signal if in the presence of that signal transcription from the promoter is activated, inactivated, increased, or decreased. In some embodiments, a promoter contains a response element. A "response element" is a short sequence of DNA within a promoter region that binds to specific molecules (e.g., transcription factors) that modulate (regulate) gene expression from the promoter. Response elements that may be used in accordance with the present disclosure include, but are not limited to, phloretin regulatable control element (PEACE), zinc finger DNA binding domain (DBD), interferon gamma activating sequence (GAS) (Decker, T. et al. J Interferon Cytokine Res. 1997 Mar; 17(3): 121-34, incorporated herein by reference), interferon stimulated response element (ISRE) (Han, KJ et al. J Biol Chem. 2004 Apr 9; 279(15): 15652-61, incorporated herein by reference), NF-kappa B response element (Wang, V. et al. Cell Reports. 2012; 2(4): 824-839, incorporated herein by reference), and STAT3 response element (Zhang, D. et al. J of Biol Chem. 1996; 271: 9503-9509, incorporated herein by reference). Other response elements are encompassed by this specification. Response elements can also contain tandem repeats (e.g., consecutive repeats of the same nucleotide sequence encoding the response element) to generally increase the sensitivity of the response element to its cognate binding molecule. Tandem repeats can be labeled 2x, 3x, 4x, 5x, etc. to indicate the number of repeats present.

[0155] Non-limiting examples of regulatable promoters (e.g., inducible and repressible promoters) are listed in Table 1, which shows the design of promoters and transcription factors, and the effects of transcription factors (TF) and inducer molecules on transgene transcription (T) are shown (B, binding; D, dissociation; nd, undetermined) (A, activation; DA, deactivation; DR, derepression) (see Horner, M. & Weber, W. FEBS Letters 586 (2012) 20784-2096m, and references cited therein). Non-limiting examples of components of regulatable promoters include those shown in Table 2.

[0156] (Table 1) TIFF2024515182000002.tif209151TIFF2024515182000003.tif184155

[0157] (Table 2) TIFF2024515182000004.tif205151

[0158] As used herein, a "constitutive promoter" refers to a promoter that generally allows for continuous or unregulated transcriptional activity.

[0159] Other non-limiting examples of constitutive promoters include the cytomegalovirus (CMV) promoter, the elongation factor 1-alpha (EF1a) promoter and EF1a variants hEF1aV1 and hEF1aV2, the elongation factor (EFS) promoter, the MND promoter (a synthetic promoter containing the U3 region of a modified MoMuLV LTR with a myeloproliferative sarcoma virus enhancer), the phosphoglycerate kinase (PGK) promoter, the spleen focus forming virus (SFFV) promoter, the simian virus 40 (SV40) promoter, and the ubiquitin C (UbC) promoter. Examples of constitutive promoter nucleic acid sequences are shown in Table 3.

[0160] (Table 3) TIFF2024515182000005.tif180158TIFF2024515182000006.tif233159TIFF2024515182000007.tif233155TIFF2024515182000008.tif198162 TIFF2024515182000009.tif233158TIFF2024515182000010.tif199161TIFF2024515182000011.tif181161TIFF2024515182000012.tif110154

[0161] Transcription factors that contain an oligomerizable antibody domain and / or are inducible by caffeine, cannabinoids, or nicotine In some embodiments, the present disclosure provides inducible transcription factors (ITFs) that comprise an oligomerizable antibody domain and / or are inducible by caffeine, a cannabinoid (e.g., a phytocannabinoid such as cannabidiol), nicotine, or a derivative thereof.

[0162] In some embodiments, the ITF comprises a first monomer comprising a DNA binding domain and a first ligand binding domain comprising a first antibody or fragment thereof; and a second monomer comprising a transcription effector domain and a second ligand binding domain comprising a second antibody or fragment thereof. Upon binding to a cognate ligand selected from caffeine, a cannabinoid (e.g., a phytocannabinoid such as cannabidiol), and nicotine, the first antibody or fragment thereof and the second antibody or fragment thereof oligomerize (e.g., dimerize), and the ligand-induced oligomerization of the first and second antibodies or fragments thereof forms an inducible transcription factor. In some embodiments, the first and second antibodies or fragments thereof are selected from a VH antibody domain, a VL antibody domain, and a single domain antibody.

[0163] In some embodiments, the ITF is inducible by caffeine, a cannabinoid, or nicotine and comprises a first monomer comprising a DNA-binding domain and a first ligand-binding domain; and a second monomer comprising a transcription effector domain and a second ligand-binding domain. Upon binding to a cognate ligand selected from caffeine, a cannabinoid (e.g., a phytocannabinoid such as cannabidiol), and nicotine, the first monomer and the second monomer oligomerize (e.g., dimerize), and the ligand-induced oligomerization of the first and second monomers forms an inducible transcription factor.

[0164] In some embodiments, the cognate ligand is caffeine or a derivative thereof. Caffeine is a central nervous system (CNS) stimulant of the methylxanthine class. Caffeine is classified as generally recognized as safe (GRAS) by the U.S. Food and Drug Administration. A toxic dose of more than 10 grams per day for an adult is much higher than a typical dose of less than 500 milligrams per day. In some embodiments, the cognate ligand is caffeine, and the first ligand-binding domain and the second ligand-binding domain each specifically bind to caffeine.

[0165] In some embodiments, the cognate ligand is a cannabinoid. In some embodiments, the first ligand-binding domain and the second ligand-binding domain each specifically bind to a cannabinoid (e.g., a phytocannabinoid such as cannabidiol). As used herein, "cannabinoid" refers to any compound that acts on cannabinoid receptors, which are expressed in various parts of the body and are involved in regulating mood, appetite, memory, and immune response. Cannabinoids include endocannabinoids, synthetic cannabinoids, and phytocannabinoids. Endocannabinoids are naturally produced by the mammalian body and include anandamide (N-arachidonoylethanolamide) and 2-arachidonoylglycerol (2-AG). "Synthetic cannabinoids" refers to compounds that interact with cannabinoid receptors but are not known to be produced in nature. Examples of synthetic cannabinoids include JWH-018, JWH-073, JWH-398, JWH-250, CP 47,497, and HU-210. "Phytocannabinoid" refers to a cannabinoid that is naturally produced by a plant. Phytocannabinoids include cannabinoids produced by the cannabis plant (e.g., tetrahydrocannabinol, cannabidiol, cannabichromene, and cannabigerol), as well as cannabinoids produced by additional types of plants, such as beta-caryophyllene (produced by plants including cannabis, black pepper, and cloves), and diindolylmethane (produced by cruciferous vegetables including broccoli, cauliflower, cabbage, and Brussels sprouts). In some embodiments, the cannabinoid is a phytocannabinoid. In some embodiments, the phytocannabinoid is cannabidiol. Cannabidiol (also referred to as "CBD") is a non-psychoactive cannabis-derived cannabinoid used to treat a variety of ailments, including pain, insomnia, and anxiety. Typical doses of CBD range from 2mg to 50mg. Cannabis flowers produce a molecule known as cannabidiol acid (CBDA), which upon heat activation is decarboxylated to form cannabidiol.In some embodiments, the phytocannabinoid is selected from cannabidiol and cannabidiolic acid. In some embodiments, the cognate ligand is a cannabinoid (e.g., a phytocannabinoid such as CBD), and the first ligand-binding domain and the second ligand-binding domain each specifically bind to a cannabinoid (e.g., a phytocannabinoid such as CBD).

[0166] In some embodiments, the cognate ligand is nicotine or a derivative thereof. Nicotine is a chiral alkaloid that is naturally produced in plants of the Solanaceae family (most predominantly in tobacco and Duboisia hopwoodii) and is widely used recreationally as a stimulant. A typical dose of nicotine present in a cigarette is about 10 mg to about 12 mg, and about 1 mg to 1.5 mg of nicotine is inhaled during smoking of a cigarette. In some embodiments, the cognate ligand is nicotine, and each of the first ligand-binding domain and the second ligand-binding domain specifically binds to nicotine.

[0167] In embodiments, the first ligand binding domain comprises a first antibody or fragment thereof and the second ligand binding domain comprises a second antibody or fragment thereof, and the first antibody or fragment thereof and the second antibody or fragment thereof are capable of oligomerizing (e.g., dimerizing) in the presence of a cognate ligand.

[0168] In some embodiments, the first ligand binding domain and the second ligand binding domain each comprise a single domain antibody. As used herein, a "single domain antibody" (also known as nanobody) refers to a V-domain antibody derived from camelids (camels and llamas). H H) and cartilaginous fish (V from sharks NAR In some embodiments, a single domain antibody is an antigen-binding fragment derived from a heavy chain only antibody, such as those present in HH. In some embodiments, the first ligand binding domain comprises a first single domain antibody and the second ligand binding domain comprises a second domain antibody, and the first single domain antibody and the second single domain antibody are capable of dimerizing in the presence of a ligand.

[0169] In some embodiments, the ITF is a caffeine-inducible transcription factor. H H is anti-caffeine V H H (referred to herein as "acV H It is also called "Anti-caffeine V H". H "H" refers to a camelid single domain antibody having an antigen binding domain that specifically binds caffeine.

[0170] In some embodiments, the anti-caffeine V H H comprises the amino acid sequence of SEQ ID NO: 52. In some embodiments, the first ligand-binding domain comprises the first anti-caffeine V H H(acV H H), the second ligand binding domain comprises a second anti-caffeine V H H(acV H In some embodiments, the first anti-caffeine V H In some embodiments, the first monomer and the second monomer each comprise the amino acid sequence of SEQ ID NO: 52. In some embodiments, the first anti-caffeine V H H and the second anti-caffeine V H H has an identical amino acid sequence (or shares at least 95%, 96%, 96%, 98%, or 99% sequence identity) and is capable of dimerizing in the presence of caffeine, thereby causing the first monomer and the second monomer to dimerize.

[0171] In some embodiments, ITF is a cannabinoid-inducible transcription factor. In some embodiments, the cognate ligand is a cannabinoid (e.g., a phytocannabinoid such as CBD), and the first ligand-binding domain and the second ligand-binding domain comprise a single domain antibody. In some embodiments, the single domain antibody comprises a V H H. In some embodiments, V H H is anti-CBD V H H. Anti-CBD V H Examples of H include CA14 (SEQ ID NO:53), DB6 (SEQ ID NO:54), DB11 (SEQ ID NO:55), DB18 (SEQ ID NO:56), and DB21 (SEQ ID NO:57). H H comprises an amino acid sequence selected from SEQ ID NOs: 53-57. In some embodiments, one of the first or ligand binding domains comprises the amino acid sequence of SEQ ID NO: 53 (CA-14) and the other of the first or second ligand binding domains comprises the amino acid sequence of SEQ ID NO: 54-57 (DB6, DB11, DB18, and DB21, respectively). In some embodiments, one of the first or second ligand binding domains comprises the amino acid sequence of SEQ ID NO: 53 (CA-14) and the other of the first or second ligand binding domains comprises the amino acid sequence of SEQ ID NO: 57 (DB21). In some embodiments, the first anti-CBD V H H and a second anti-CBD V H The H's are non-identical and can dimerize in the presence of the CBD.

[0172] In some embodiments, one of the first or second ligand binding domains comprises an antibody heavy chain (VH) and the other of the first or second ligand binding domains comprises an antibody light chain (VL), and the VH and VL are capable of dimerizing in the presence of a cognate ligand.

[0173] In some embodiments, the ITF is a nicotine-inducible transcription factor. In some embodiments, the cognate ligand is nicotine, and the first and second ligand binding domains each comprise an anti-nicotine antibody heavy chain variable domain (anti-Nic VH) or an anti-nicotine antibody light chain variable domain (anti-Nic VL). In some embodiments, the anti-Nic VH comprises the amino acid sequence of SEQ ID NO: 58. In some embodiments, the anti-Nic VL comprises the amino acid sequence of SEQ ID NO: 59. In some embodiments, one of the first or second ligand binding domains comprises an anti-Nic VH, and the other of the first or second ligand binding domains comprises an anti-Nic VL. In some embodiments, the anti-Nic VH and the anti-Nic VL dimerize in the presence of nicotine, thereby dimerizing the first and second monomers.

[0174] In some embodiments, the DNA binding domain of ITF inducible by caffeine, cannabinoids, or nicotine comprises a zinc finger (ZF) protein domain.

[0175] In some embodiments, the ZF protein domain is modular in design and is composed of at least one zinc finger array (ZFA).

[0176] In some embodiments, the ZF protein domain comprises an array of 1-10 zinc finger motifs. In some embodiments, the ZF protein domain comprises six zinc finger motifs. In some embodiments, the ZF protein domain comprises the amino acid sequence of SEQ ID NO:1.

[0177] In some embodiments, the transcription effector domain of ITF inducible by caffeine, cannabinoid, or nicotine is a transcription activator domain. In some embodiments, the transcription activator domain is selected from the group consisting of herpes simplex virus protein 16 (VP16) activation domain, activation domain containing four tandem copies of VP16, VP64 activation domain, p65 activation domain of NFκB, Epstein-Barr virus R transactivator (Rta) activation domain, tripartite activator containing VP64, p65, and Rta activation domains (VPR activation domain), and histone acetyltransferase (HAT) core domain of human E1A-associated protein p300 (p300 HAT core activation domain).

[0178] In some embodiments, the transcriptional effector domain of ITF inducible by caffeine, cannabinoids, or nicotine is a transcriptional repressor domain. In some embodiments, the transcriptional repressor domain is a Krüppel-associated box (KRAB) repression domain; a truncated Krüppel-associated box (KRAB) repression domain; a histone deacetylase 4 (HDAC4) repressor domain; a scleraxis (SCX) HLH domain, an inhibitor of DNA binding 1 (ID1) HLH domain, a HECT domain and an RCC1-like domain-containing protein 2 (HERC2) Cyt-b5 domain, a twist-related protein 1 (TWST1) HLH domain, a homeobox protein Nkx-2.2 (NKX22) homeobox protein ... the OD domain, the inhibitor of DNA binding 1 (ID3) HLH domain, and the twist-related protein 2 (TWST2) HLH domain, and the EED repressor domain; the repressor element silencing transcription factor (REST) ​​repression domain; the WRPW motif of the hairy-related basic helix-loop-helix repressor protein (the motif is known as the WRPW repression domain); the DNA (cytosine-5)-methyltransferase 3B (DNMT3B) repression domain; and the HP1 alpha chromoshadow repression domain.

[0179] In some embodiments, the first monomer and / or the second monomer of ITF that is an inducible caffeine, cannabinoid, or nicotine, comprises a nuclear localization signal (NLS). In some embodiments, the NLS comprises an amino acid sequence of a sequence selected from SEQ ID NOs: 2-4. In some embodiments, the NLS comprises the amino acid sequence of SEQ ID NO: 2.

[0180] In some embodiments, the first monomer of ITF inducible by caffeine, cannabinoid, or nicotine comprises a nuclear localization signal (NLS).

[0181] In some embodiments, a first monomer of ITF inducible by caffeine, a cannabinoid, or nicotine comprises a nuclear localization signal (NLS), and a second monomer of ITF inducible by rapamycin or a derivative or analog thereof comprises a nuclear localization signal (NLS).

[0182] In some embodiments, the second monomer of ITF inducible by caffeine, cannabinoid, or nicotine comprises a nuclear export signal (NES). In some embodiments, the NES comprises an amino acid sequence selected from SEQ ID NOs: 5-14. In some embodiments, the NES comprises the amino acid sequence of SEQ ID NO: 5.

[0183] In some embodiments, a first monomer of ITF inducible by caffeine, a cannabinoid, or nicotine comprises a nuclear localization signal (NLS), and a second monomer of ITF inducible by rapamycin or a derivative or analog thereof comprises a nuclear export signal (NES).

[0184] In some embodiments, the first monomer of ITF inducible by caffeine, cannabinoid, or nicotine comprises a peptide linker separating a DNA binding domain and a first ligand binding domain. In some embodiments, the DNA binding domain is N-terminal to the first ligand binding domain. In some embodiments, the first ligand binding domain is N-terminal to the DNA binding domain.

[0185] In some embodiments, the second monomer of ITF inducible by caffeine, cannabinoid, or nicotine comprises a peptide linker separating the transcription effector domain and the second ligand binding domain. In some embodiments, the transcription effector domain is N-terminal to the second ligand binding domain. In some embodiments, the second ligand binding domain is N-terminal to the transcription effector domain.

[0186] When ITF inducible by caffeine, cannabinoids, or nicotine is formed by ligand-induced oligomerization of the first and second monomers, the ITF can regulate the transcription of a gene of interest. The oligomerization product of the first and second monomers results in functional ITF because the quaternary protein structure of the oligomer contains both a DNA-binding domain and a transcriptional effector domain.

[0187] Transcription factors induced by mifepristone In some embodiments, the present disclosure provides an inducible transcription factor (ITF) that can be induced by mifepristone or a derivative thereof (i.e., mifepristone-inducible ITF or "mifepristone-ITF"). Mifepristone-ITF comprises a DNA binding domain, a transcription effector domain, and a ligand binding domain. Upon binding to a cognate ligand (e.g., mifepristone or a derivative thereof), ITF undergoes nuclear localization. When localized in the cell nucleus, ITF can regulate the transcription of a gene of interest that is operably linked to an ITF-responsive promoter.

[0188] Mifepristone (also known as RU486) is an antiprogesterone and antiglucocorticosteroid drug used clinically to induce abortion and to treat hyperglycemia in patients with Cushing's disease. Mifepristone oral tablets are available in doses of 200 mg and 300 mg.

[0189] In some embodiments, the ligand binding domain of mifepristone-ITF comprises a progesterone receptor domain. The progesterone receptor (also known as NR3C3 or nuclear receptor subfamily 3, group C, member 3) is a nuclear receptor that is activated by the hormone progesterone. An example of a progesterone receptor sequence is provided as SEQ ID NO:68. In some embodiments, the ligand binding domain of mifepristone-ITF comprises the amino acid sequence of SEQ ID NO:68.

[0190] In some embodiments, the DNA binding domain of mifepristone-ITF comprises a zinc finger (ZF) protein domain.

[0191] In some embodiments, the ZF protein domains are modular in design and are composed of zinc finger arrays (ZFAs).

[0192] In some embodiments, the ZF protein domain comprises 1-10 ZFAs. In some embodiments, the ZF protein domain comprises at least 1 ZFA. In some embodiments, the ZF protein domain comprises at least 2 ZFAs. In some embodiments, the ZF protein domain comprises at least 3 ZFAs. In some embodiments, the ZF protein domain comprises at least 4 ZFAs. In some embodiments, the ZF protein domain comprises at least 5 ZFAs. In some embodiments, the ZF protein domain comprises at least 10 ZFAs. In some embodiments, the ZF protein domain comprises the amino acid sequence of SEQ ID NO:1.

[0193] In some embodiments, the transcription effector domain of mifepristone-ITF is a transcription activator domain. In some embodiments, the transcription activator domain is selected from the group consisting of herpes simplex virus protein 16 (VP16) activation domain, an activation domain containing four tandem copies of VP16, a VP64 activation domain, a p65 activation domain of NFκB, an Epstein-Barr virus R transactivator (Rta) activation domain, a tripartite activator containing VP64, p65, and Rta activation domains (VPR activation domain), and a histone acetyltransferase (HAT) core domain of human E1A-associated protein p300 (p300 HAT core activation domain).

[0194] In some embodiments, the transcriptional effector domain of mifepristone-ITF is a transcriptional repressor domain. In some embodiments, the transcriptional repressor domain is a Krüppel-associated box (KRAB) repression domain; a truncated Krüppel-associated box (KRAB) repression domain; histone deacetylase 4 (HDAC4) repressor domain; scleraxis (SCX) HLH domain, inhibitor of DNA binding 1 (ID1) HLH domain, HECT domain and RCC1-like domain-containing protein 2 (HERC2) Cyt-b5 domain, twist-related protein 1 (TWST1) HLH domain, homeobox protein Nkx-2.2 (NKX22) homeobox protein (NKX22) repressor domain, or a combination thereof. the OD domain, the inhibitor of DNA binding 1 (ID3) HLH domain, and the twist-related protein 2 (TWST2) HLH domain, and the EED repressor domain; the repressor element silencing transcription factor (REST) ​​repression domain; the WRPW motif of the hairy-related basic helix-loop-helix repressor protein (the motif is known as the WRPW repression domain); the DNA (cytosine-5)-methyltransferase 3B (DNMT3B) repression domain; and the HP1 alpha chromoshadow repression domain.

[0195] In some embodiments, mifepristone-ITF comprises a peptide linker located between the DNA binding domain and the transcriptional effector domain.

[0196] In some embodiments, the DNA binding domain is N-terminal to the transcription effector domain. In some embodiments, mifepristone-ITF comprises, from N-terminal to C-terminal, a DNA binding domain, a ligand binding domain (e.g., a progesterone receptor domain), and a transcription effector domain.

[0197] In some embodiments, the transcription effector domain is N-terminal to the DNA binding domain. In some embodiments, mifepristone-ITF comprises, from N-terminal to C-terminal, a transcription effector domain, a ligand binding domain (e.g., a progesterone receptor domain, and a DNA binding domain.

[0198] When mifepristone-ITF comes into contact with its cognate ligand (ie, mifepristone or a derivative thereof), ITF translocates to the nucleus where it can regulate the transcription of genes of interest.

[0199] In some embodiments, the gene of interest is operably linked to an ITF responsive promoter. In some embodiments, the ITF responsive promoter comprises an ITF binding domain sequence and a core promoter sequence.

[0200] Expression systems for producing ITFs inducible by caffeine, cannabinoids (e.g., phytocannabinoids such as cannabidiol), nicotine ITFs formed by oligomerizable antibodies or fragments thereof, and / or comprising oligomerizable antibody domains. Also provided is an expression system for producing an inducible transcription factor (ITF) comprising: a first monomer comprising a DNA binding domain, a first antibody or fragment thereof that binds to a cognate ligand; and a second monomer comprising a transcription effector domain and a second antibody or fragment thereof that binds to the cognate ligand, wherein the first antibody or fragment thereof and the second antibody or fragment thereof are capable of oligomerizing (e.g., dimerizing) in the presence of the cognate ligand.

[0201] In some embodiments, the expression system for producing ITF comprises a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding a first monomer; and a second expression cassette comprising a second promoter and an exogenous polynucleotide sequence encoding a second monomer.

[0202] In some embodiments, the first promoter and / or the second promoter are constitutive promoters selected from CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEF1aV1, hCAGG, hEF1aV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb.

[0203] In some embodiments, the first promoter and / or the second promoter are regulatable promoters.

[0204] In some embodiments, the first promoter and / or the second promoter are synthetic promoters.

[0205] Expression system for producing ITF inducible by caffeine, cannabinoids, or nicotine Also provided are expression systems for producing the inducible transcription factors (ITFs) inducible by caffeine, cannabinoids, or nicotine described herein.

[0206] In some embodiments, an expression system for producing an inducible transcription factor (ITF) inducible by caffeine, a cannabinoid, or nicotine comprises a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding a first monomer described herein; and a second expression cassette comprising a second promoter and an exogenous polynucleotide sequence encoding a second monomer described herein.

[0207] In some embodiments, the first promoter and / or the second promoter are constitutive promoters selected from CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEF1aV1, hCAGG, hEF1aV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb.

[0208] In some embodiments, the first promoter and / or the second promoter are regulatable promoters.

[0209] In some embodiments, the first promoter and / or the second promoter are synthetic promoters.

[0210] Transcription factors containing a ZF domain with an array of six zinc finger motifs In some embodiments, the disclosure provides an ITF comprising: (i) a first monomer comprising a ZF domain comprising an array of six zinc finger motifs, and (ii) a first ligand binding domain; and (i) a second monomer comprising a transcriptional effector domain, and (ii) a second ligand binding domain, wherein the first and second ligand binding domains are capable of oligomerizing (e.g., dimerizing) in the presence of a cognate ligand.

[0211] In some embodiments, the ITF comprises a ZF domain that comprises an array of six zinc finger motifs and is inducible by rapamycin or a derivative or analogue thereof (referred to herein as "rapamycin-inducible transcription factor" or "rapamycin-ITF"). Rapamycin-ITF comprises a first monomer comprising a DNA-binding domain and a first ligand-binding domain, and a second monomer comprising a transcription effector domain and a second ligand-binding domain. The DNA-binding domain of rapamycin-ITF comprises a zinc finger (ZFA) protein domain that is modular and comprises 10 zinc finger arrays (ZFAs). Upon binding to a cognate ligand selected from rapamycin, AP1903, AP20187, and FK1012, and derivatives and analogues thereof, the first monomer and the second monomer are capable of oligomerization. Ligand-induced oligomerization of the first and second monomers forms rapamycin-ITF, which can bind to a ZF protein binding site in a promoter operably linked to a gene of interest and regulate transcription of the gene of interest.

[0212] "Rapamycin or its derivatives or analogs" refers to an immunosuppressant macrolide that blocks the mammalian target of rapamycin (mTOR). Rapamycin and its derivatives and analogs have antiproliferative activity, antifungal activity and / or anticancer activity. Examples of rapamycin derivatives or analogs include AP1903, AP20187, and FK1012.

[0213] In some embodiments, the rapamycin-ITF comprises a first ligand-binding domain and a second binding domain, each of which binds to rapamycin or a derivative or analog thereof, hi some embodiments, the first and second monomers of rapamycin-ITF are capable of forming a dimer upon binding to a ligand selected from rapamycin, AP1903, AP20187, and FK1012, or derivatives or analogs thereof.

[0214] In some embodiments, one of the first or second ligand binding domain of rapamycin-ITF comprises an FK506 binding protein (FKBP), and the other of the first or second ligand binding domain comprises an FKBP-rapamycin binding (FRB) domain of the mammalian target of rapamycin (mTOR) kinase. FKBP (also known as FKB12) binds to rapamycin with high affinity (Kd=0.2 nM), and the FKBP-rapamycin complex can associate with FRP, thus forming an FKBP-rapamycin-FRB complex. An exemplary FKBP is provided as SEQ ID NO:60. An exemplary FRB is provided as SEQ ID NO:61. In some embodiments, one of the first or second ligand binding domain comprises the amino acid sequence of SEQ ID NO:60, and the other of the first or second ligand binding domain comprises the amino acid sequence of SEQ ID NO:61.

[0215] In some embodiments, the ZF protein domain of rapamycin-ITF comprises the amino acid sequence of SEQ ID NO:1.

[0216] In some embodiments, the transcriptional effector domain of rapamycin-ITF is a transcriptional activator domain, hi some embodiments, the transcriptional activator domain is selected from the group consisting of the herpes simplex virus protein 16 (VP16) activation domain, an activation domain comprising four tandem copies of VP16, a VP64 activation domain, the p65 activation domain of NFκB, the Epstein-Barr virus R transactivator (Rta) activation domain, a tripartite activator comprising VP64, p65, and Rta activation domains (VPR activation domain), and the histone acetyltransferase (HAT) core domain of human E1A-associated protein p300 (p300 HAT core activation domain).

[0217] In some embodiments, the transcriptional effector domain of rapamycin-ITF is a transcriptional repressor domain. In some embodiments, the transcriptional repressor domain is a Krüppel-associated box (KRAB) repression domain; a truncated Krüppel-associated box (KRAB) repression domain; histone deacetylase 4 (HDAC4) repressor domain; scleraxis (SCX) HLH domain, inhibitor of DNA binding 1 (ID1) HLH domain, HECT domain and RCC1-like domain containing protein 2 (HERC2) Cyt-b5 domain, twist-related protein 1 (TWST1) HLH domain, homeobox protein Nkx-2.2 (NKX22) homeobox protein (NKX22) repressor domain, or a combination thereof. the OD domain, the inhibitor of DNA binding 1 (ID3) HLH domain, and the twist-related protein 2 (TWST2) HLH domain, and the EED repressor domain; the repressor element silencing transcription factor (REST) ​​repression domain; the WRPW motif of the hairy-related basic helix-loop-helix repressor protein (the motif is known as the WRPW repression domain); the DNA (cytosine-5)-methyltransferase 3B (DNMT3B) repression domain; and the HP1 alpha chromoshadow repression domain.

[0218] In some embodiments, the first monomer and / or the second monomer of rapamycin-ITF comprises a nuclear localization signal (NLS). In some embodiments, the NLS comprises an amino acid sequence selected from SEQ ID NOs: 5-7. In some embodiments, the NLS comprises the amino acid sequence of SEQ ID NO: 5.

[0219] In some embodiments, a first monomer of rapamycin-ITF comprises a nuclear localization signal (NLS). In some embodiments, a first monomer of rapamycin-ITF comprises a nuclear localization signal (NLS) and a second monomer of ITF induced by rapamycin or a derivative or analog thereof comprises a nuclear localization signal (NLS).

[0220] In some embodiments, the second monomer of rapamycin-ITF comprises a nuclear export signal (NES). In some embodiments, the NES comprises an amino acid sequence selected from SEQ ID NOs: 8-17. In some embodiments, the NES comprises the amino acid sequence of SEQ ID NO: 8.

[0221] In some embodiments, a first monomer of rapamycin-ITF contains a nuclear localization signal (NLS) and a second monomer of ITF induced by rapamycin or a derivative or analog thereof contains a nuclear export signal (NES).

[0222] In some embodiments, the first monomer of rapamycin-ITF comprises a peptide linker separating the DNA binding domain and the first ligand binding domain. In some embodiments, the DNA binding domain is N-terminal to the first ligand binding domain. In some embodiments, the first ligand binding domain is N-terminal to the DNA binding domain.

[0223] In some embodiments, the second monomer of rapamycin-ITF comprises a peptide linker separating the transcription effector domain and the second ligand binding domain. In some embodiments, the transcription effector domain is N-terminal to the second ligand binding domain. In some embodiments, the second ligand binding domain is N-terminal to the transcription effector domain.

[0224] When rapamycin-ITF is formed by ligand-induced oligomerization of the first and second monomers, ITF can regulate the transcription of a gene of interest. The oligomerization product of the first and second monomers results in functional ITF because the quaternary protein structure of the oligomer contains both a DNA-binding domain and a transcriptional effector domain.

[0225] An expression system for producing an oligomerizable ITF containing a ZF domain with an array of six zinc finger motifs Also provided is an expression system for producing an ITF comprising: (i) a first monomer comprising a ZF domain comprising an array of six zinc finger motifs and (ii) a first ligand binding domain; and (i) a second monomer comprising a transcription effector domain and (ii) a second ligand binding domain, wherein the first and second ligand binding domains are capable of oligomerizing (e.g., dimerizing) in the presence of a cognate ligand. In some embodiments, the cognate ligand is selected from rapamycin, AP1903, AP20187, FK1012, derivatives thereof, or analogs thereof, and the expression system is for producing a rapamycin-inducible transcription factor (rapamycin-ITF) as described herein.

[0226] In some embodiments, the expression system comprises a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding a first monomer of rapamycin-ITF described herein; and a second expression cassette comprising a second promoter and an exogenous polynucleotide sequence encoding a second monomer of rapamycin-ITF described herein.

[0227] In some embodiments, the first promoter and / or the second promoter are constitutive promoters selected from CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEF1aV1, hCAGG, hEF1aV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb.

[0228] In some embodiments, the first promoter and / or the second promoter is an inducible promoter.

[0229] In some embodiments, the first promoter and / or the second promoter are synthetic promoters.

[0230] Expression system for producing mifepristone-ITF Also provided is an expression system for producing the mifepristone-inducible transcription factor (mifepristone-ITF) described herein.

[0231] In some embodiments, the expression system comprises a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding mifepristone-ITF as described herein.

[0232] In some embodiments, the first promoter and / or the second promoter are constitutive promoters selected from CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEF1aV1, hCAGG, hEF1aV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb.

[0233] In some embodiments, the first promoter and / or the second promoter is an inducible promoter.

[0234] In some embodiments, the first promoter and / or the second promoter are synthetic promoters.

[0235] In some embodiments, the expression system further comprises a second expression cassette comprising an ITF-responsive promoter operably linked to a gene of interest, the ITF-responsive promoter comprising a core promoter sequence and a sequence that binds to the DNA-binding domain of mifepristone-ITF. In some embodiments, the core promoter sequence comprises a minimal promoter.

[0236] Expression system containing an ITF-responsive promoter In some embodiments, the expression systems provided herein further comprise an expression cassette comprising an ITF-responsive promoter operably linked to a gene of interest, the ITF-responsive promoter comprising a core promoter sequence and a sequence that binds to the DNA-binding domain of ITF.

[0237] In some embodiments, the ITF described herein can regulate the transcription of a gene operably linked to an ITF-responsive promoter. As used herein, "ITF-responsive promoter" refers to a synthetic regulatable promoter that can be specifically recognized by the ITF described herein and controlled by the presence of the cognate ligand of ITF.

[0238] In some embodiments, the ITF-responsive promoter comprises a core promoter sequence and an ITF-binding domain that is specifically recognized by an inducible transcription factor (ITF) as described herein. As used herein, "core promoter sequence" refers to a portion of a promoter that comprises a promoter sequence that is sufficient to interact with RNA polymerase II and initiate transcription.

[0239] The ITF binding domain binds to the DNA binding domain of ITF and may contain one or more zinc finger binding sites.

[0240] The binding domain may comprise one or more zinc finger binding sites. The zinc finger binding site is a polynucleotide sequence capable of binding to a zinc finger protein domain (e.g., the zinc finger protein domain of SEQ ID NO: 1). In some embodiments, the ZF protein domain of ITF comprises an array of six zinc finger motifs, and the ITF binding domain of the ITF-responsive promoter comprises at least one binding site for the six zinc finger motifs. The binding domain may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more zinc finger binding sites. An exemplary zinc finger binding site comprises GGCGTAGCCGATGTCGCG (SEQ ID NO: 62). In some embodiments, the binding domain comprises one zinc finger binding site. In some embodiments, the binding domain comprises two or more zinc finger binding sites. The zinc finger binding sites may be separated by a DNA linker. The DNA linker can be 5-40, 5-30, 10-40, 10-30 base pairs in length in some embodiments. In some embodiments, the binding domain comprises two zinc finger binding sites. In some embodiments, the binding domain comprises three zinc finger binding sites. In some embodiments, the binding domain comprises four zinc finger binding sites. An exemplary binding domain comprising a zinc finger binding site has the sequence: cgggtttcgtaacaatcgcatgaggattcgcaacgccttcGGCGTAGCCGATGTCGCGctcccgtctcagtaaaggtcGGCGTAGCCGATGTCGCGcaatcggactgccttcgtacGGCGTAGCCGATGTCGCGcgtatcagtcgcctcggaacGGCGTAGCCGATGTCGCG (SEQ ID NO: 63) The binding domain of SEQ ID NO:63 contains four binding sites, each of which binds to the zinc finger protein domain of SEQ ID NO:1, each of the binding sites being separated by a DNA linker.

[0241] In some embodiments, the core promoter sequence comprises a minimal promoter, hi some embodiments, the core promoter sequence comprises a promoter selected from minP, minCMV, YB_TATA, and minTK.

[0242] In some embodiments, the core promoter sequence comprises a core promoter sequence derived from a constitutive promoter sequence, hi some embodiments, the core promoter sequence is derived from a constitutive promoter selected from CMV, EFS, SFFV, SV40, MND, PGK, UbC, EF1a, hCAGG, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb.

[0243] In some embodiments, the core promoter sequence comprises: TCTAGAGGGTATATAATGGGGGCCA (SEQ ID NO: 64) Includes.

[0244] An exemplary ITF responsive promoter has the sequence: cgggtttcgtaacaatcgcatgaggattcgcaacgccttcGGCGTAGCCGATGTCGCGctcccgtctcagtaaaggtcGGCGTAGCCGATGTCGCGcaatcggactgccttcgtacGGCGTAGCC GATGTCGCGcgtatcagtcgcctcggaacGGCGTAGCCGATGTCGCGcattcgtaagaggctcactctcccttacacggagtggataACTAGTTCTAGAGGGTATATAATGGGGGCCA (SEQ ID NO: 65) Includes.

[0245] In some embodiments, the expression system for producing ITF inducible by caffeine, cannabinoids, or nicotine further comprises a third expression cassette comprising an ITF responsive promoter operably linked to a gene of interest, the ITF responsive promoter comprising a core promoter sequence and a sequence that binds to the DNA binding domain of ITF.

[0246] In some embodiments, the expression system for producing a rapamycin-inducible transcription factor further comprises a third expression cassette comprising an ITF-responsive promoter operably linked to a gene of interest, the ITF-responsive promoter comprising a core promoter sequence and a sequence that binds to the DNA-binding domain of ITF.

[0247] In some embodiments, the expression system for producing a mifepristone-inducible transcription factor further comprises a second expression cassette comprising an ITF-responsive promoter operably linked to a gene of interest, the ITF-responsive promoter comprising a core promoter sequence and a sequence that binds to the DNA-binding domain of ITF.

[0248] Isolated polynucleotide molecules and heterologous constructs Also provided herein are isolated polynucleotide molecules and heterologous constructs that include one or more components of the expression systems described herein.

[0249] An "isolated" nucleic acid molecule or polynucleotide refers to a nucleic acid molecule, such as DNA or RNA, that is removed from its natural environment. For example, a polynucleotide encoding ITF as described herein that is contained in a heterologous construct is considered to be isolated. Further examples of isolated polynucleotides include recombinant polynucleotides that are maintained in heterologous host cells, or purified (partially or substantially) polynucleotides in solution. An isolated polynucleotide also includes a polynucleotide molecule that is normally contained in a cell that contains the polynucleotide molecule, but the polynucleotide molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0250] Isolated polynucleotide molecules include, but are not limited to, cDNA polynucleotides, RNA polynucleotides, RNAi oligonucleotides (e.g., siRNA, miRNA, antisense oligonucleotides, shRNA, etc.), mRNA polynucleotides, circular plasmids, linear DNA fragments, vectors, minicircles, ssDNA, bacterial artificial chromosomes (BACs), and yeast artificial chromosomes (YACs), and oligonucleotides.

[0251] In some embodiments, the isolated polynucleotide molecule is selected from DNA, cDNA, RNA, mRNA, and naked plasmid (linear or circular).

[0252] By a nucleic acid or polynucleotide having a nucleotide sequence that is at least, for example, 95% "identical" to a reference nucleotide sequence of the present invention, it is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence, except that the polynucleotide sequence may contain up to 5 point mutations per each 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a polynucleotide having a nucleotide sequence that is at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or replaced with another nucleotide, or up to 5% of the total number of nucleotides in the reference sequence may be inserted into the reference sequence. These modifications of the reference sequence may occur at the 5' or 3' terminal position of the reference nucleotide sequence, or anywhere between these terminal positions, either individually between residues in the reference sequence, or in one or more consecutive groups within the reference sequence. As a practical matter, whether any particular polynucleotide sequence is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a nucleotide sequence of the present invention can be conventionally determined using known computer programs.

[0253] An "engineered polynucleotide" is a polynucleotide that does not occur in nature. However, it should be understood that while an engineered polynucleotide is non-naturally occurring as a whole, it may contain naturally occurring nucleotide sequences. In some embodiments, an engineered polynucleotide contains nucleotide sequences from different organisms (e.g., from different species). For example, in some embodiments, an engineered polynucleotide contains murine nucleotide sequences, bacterial nucleotide sequences, human nucleotide sequences, and / or viral nucleotide sequences. The term "engineered polynucleotide" includes recombinant and synthetic nucleic acids. "Recombinant polynucleotide" refers to a molecule that is constructed by linking nucleotide molecules and, in some embodiments, can replicate in a living cell. "Synthetic polynucleotide" refers to a molecule that is amplified or synthesized chemically or by other means. Synthetic polynucleotides include those that are chemically or otherwise modified, but are capable of base pairing with naturally occurring nucleotide molecules. Modifications include, but are not limited to, one or more modified internucleotide linkages and non-naturally occurring nucleic acids. Modifications are described in further detail in U.S. Patent No. 6,673,611 and U.S. Patent Publication No. 2004 / 0019001, each of which is incorporated by reference in its entirety. The modified internucleotide linkages can be phosphorodithioate or phosphorothioate linkages. The non-natural nucleic acids can be locked nucleic acids (LNAs), peptide nucleic acids (PNAs), glycol nucleic acids (GNAs), phosphorodiamidate morpholino oligomers (PMOs or "morpholinos"), and threose nucleic acids (TNAs). The non-natural nucleic acids are described in further detail in International Application No. 1998 / 039352, U.S. Patent Publication No. 2013 / 0156849, and U.S. Patent Nos. 6,670,461; 5,539,082; 5,185,444, each of which is incorporated by reference in its entirety. Recombinant and synthetic polynucleotides also include molecules resulting from the replication of any of the foregoing.The engineered polynucleotides of the disclosure can be encoded by a single molecule (e.g., contained in the same plasmid or other vector) or by multiple distinct molecules (e.g., multiple distinct independently replicating molecules).

[0254] The engineered polynucleotides of the present disclosure can be produced using standard molecular biology methods (see, e.g., Green and Sambrook, Molecular Cloning, A Laboratory Manual, 2012, Cold Spring Harbor Press). In some embodiments, the engineered nucleic acid constructs are produced using GIBSON ASSEMBLY® cloning (see, e.g., Gibson, DGet al. Nature Methods, 343-345, 2009, and Gibson, DGet al. Nature Methods, 901-903, 2010, each of which is incorporated herein by reference). GIBSON ASSEMBLY® typically uses three enzyme activities in a single tube reaction: a 5' exonuclease, a Y-extension activity of DNA polymerase, and a DNA ligase activity. The 5' exonuclease activity bites back the 5' end sequence, exposing the complementary sequence for annealing. The polymerase activity then fills in the gaps on the annealed region. DNA ligase then seals the nicks and covalently links the DNA fragments together. The overlapping sequences of adjacent fragments are much longer than those used in Golden Gate Assembly, thus resulting in a high percentage of correct assembly. In some embodiments, engineered nucleic acid constructs are produced using IN-FUSION® Cloning (Clontech).

[0255] In some embodiments, the polynucleotide molecule described herein is included in a heterologous construct. The term "vector" or "expression vector" is synonymous with "heterologous construct" and refers to a polynucleotide molecule used to introduce and direct the expression of one or more genes operably associated with the construct in a target cell. This term includes the construct as a self-replicating nucleic acid structure, as well as the vector integrated into the genome of the host cell into which it is introduced. In some embodiments, the heterologous construct includes a lentiviral vector.

[0256] In some embodiments, a first heterologous construct is provided herein, comprising: a first expression cassette comprising a polynucleotide molecule encoding a first monomer of ITF inducible by caffeine, cannabinoids, or nicotine; and a second heterologous construct comprising a first expression cassette comprising a polynucleotide molecule encoding a second monomer of ITF inducible by caffeine, cannabinoids, or nicotine. In some embodiments, a first heterologous construct is provided herein, comprising: a first expression cassette comprising a polynucleotide molecule encoding a first monomer of rapamycin-inducible transcription factor (rapamycin-ITF); and a second heterologous construct comprising a first expression cassette comprising a polynucleotide molecule encoding a second monomer of rapamycin-inducible transcription factor (rapamycin-ITF).

[0257] In some embodiments, provided herein is a heterologous construct comprising an expression cassette comprising a polynucleotide molecule encoding a mifepristone-inducible transcription factor (mifepristone-ITF).

[0258] In some embodiments, an engineered polynucleotide or heterologous construct of the present disclosure is configured to produce more than one polypeptide. For example, a polynucleotide can be configured to produce two different polypeptides (e.g., ITF and a second polypeptide).

[0259] In some embodiments, the engineered polynucleotide or heterologous construct of the present disclosure is configured to produce multiple polypeptides. For example, the polynucleotide can be configured to produce two different polypeptides (e.g., a first monomer and a second monomer of rapamycin-ITF or an ITF inducible by caffeine, cannabinoids, or nicotine). The polynucleotide molecule can be configured to produce a first monomer and a second monomer of ITF, both monomers being under the control of the same promoter.

[0260] In some embodiments, the engineered nucleic acid may be multicistronic, i.e., two or more separate polypeptides (e.g., a first monomer and a second monomer of rapamycin-ITF or an ITF inducible by caffeine, cannabinoids, nicotine, or mifepristone) may be produced from a single transcript. The engineered nucleic acid may be multicistronic through the use of various linkers, for example, a polynucleotide sequence encoding a first exogenous polynucleotide may be linked in a 5' to 3' direction to a nucleotide sequence encoding a second exogenous polynucleotide, such as first gene:linker:second gene. The linker polynucleotide sequence may encode one or more 2A ribosomal skipping elements, such as T2A. Other 2A ribosomal skipping elements include, but are not limited to, E2A, P2A, and F2A. The 2A ribosomal skipping elements allow for the production of separate polypeptides encoded by the first and second genes during translation. The linker can encode a cleavable linker polypeptide sequence, such as a furin cleavage site or a TEV cleavage site, where following expression, the cleavable linker polypeptide is cleaved such that separate polypeptides encoded by the first and second genes are produced. The cleavable linker can include a polypeptide sequence that further facilitates cleavage, such as a flexible linker (e.g., a Gly-Ser-Gly sequence).

[0261] The linker can encode an internal ribosome entry site (IRES) such that separate polypeptides encoded by the first and second genes are produced during translation. The linker can encode a splice acceptor, such as a viral splice acceptor.

[0262] The linker may be a combination of linkers, such as a furin-2A linker, that can produce separate polypeptides through 2A ribosomal skipping followed by further cleavage of the furin site, allowing complete removal of the 2A residue. In some embodiments, the linker combination may include a furin sequence, a flexible linker, and a 2A linker. Thus, in some embodiments, the linker is a furin-Gly-Ser-Gly-2A fusion polypeptide. In some embodiments, the linker is a furin-Gly-Ser-Gly-T2A fusion polypeptide.

[0263] In general, a multicistronic system can express any number of genes or portions thereof using any number or combination of linkers (e.g., an engineered nucleic acid can encode a first, second, and third effector molecule, each separated by a linker, such that separate polypeptides encoded by the first, second, and third effector molecules are produced).

[0264] As used herein, "linker" may refer to a peptide linker that connects a first polypeptide sequence and a second polypeptide sequence, or may refer to a multicistronic linker as described above.

[0265] In some embodiments, a heterologous construct is provided herein that includes a multicistronic expression cassette comprising a promoter; a first polynucleotide sequence encoding a first monomer of ITF inducible by caffeine, cannabinoids, or nicotine; a second polynucleotide sequence encoding a second monomer of ITF inducible by caffeine, cannabinoids, or nicotine; and a cleavable linker between the first polynucleotide and the second polynucleotide. In some embodiments, a heterologous construct is provided herein that includes a multicistronic expression cassette comprising a promoter; a first polynucleotide sequence encoding a first monomer of a rapamycin-inducible transcription factor; a second polynucleotide sequence encoding a second monomer of a rapamycin-inducible transcription factor; and a cleavable linker between the first polynucleotide and the second polynucleotide.

[0266] In some embodiments, the engineered nucleic acids of the present disclosure include a post-transcriptional regulatory element (PRE). A PRE can enhance gene expression by enabling tertiary RNA structure stability and 3' end formation. Non-limiting examples of PREs include Hepatitis B virus PRE (HPRE) and Woodchuck Hepatitis virus PRE (WPRE). In some embodiments, the post-transcriptional regulatory element is a Woodchuck Hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, a WPRE includes alpha, beta, and gamma components of a WPRE element. In some embodiments, a WPRE includes an alpha component of a WPRE element. Examples of WPRE sequences include SEQ ID NO:66 and SEQ ID NO:67.

[0267] Engineered cells Also provided are cells and methods of producing cells that express the inducible transcription factors (ITFs) described herein or that include one or more expression systems or heterologous constructs of the present disclosure. These cells are referred to herein as "engineered cells." Typically, these cells that include one or more engineered nucleic acids do not occur in nature. In some embodiments, the cells are isolated cells that recombinantly express one or more engineered polynucleotides. In some embodiments, the engineered polynucleotides are expressed from one or more vectors or selected loci from the genome of the cell. In some embodiments, the cells are engineered to include a polynucleotide that includes a promoter operably linked to a nucleotide sequence.

[0268] The engineered cells of the present disclosure may comprise an engineered polynucleotide integrated into the genome of the cell. The engineered cells may comprise an engineered polynucleotide that is engineered in a transient expression system, such as a plasmid or mRNA, that is capable of expression without integration into the genome of the cell.

[0269] In some embodiments, an engineered cell is provided that comprises an ITF as described herein. In some embodiments, the cell further comprises an expression cassette comprising an ITF-responsive promoter as described herein operably linked to an exogenous polynucleotide sequence encoding a gene of interest.

[0270] In some embodiments, engineered cells are provided that contain an ITF inducible by caffeine or a derivative thereof (i.e., a caffeine-inducible transcription factor or "caffeine-ITF") as described herein. In some embodiments, engineered cells are provided that contain an expression system encoding a first and second monomer of the caffeine-ITF as described herein.

[0271] In some embodiments, engineered cells are provided that contain an ITF inducible by a cannabinoid (i.e., a cannabinoid-inducible transcription factor or "cannabinoid-ITF") as described herein. In some embodiments, engineered cells are provided that contain an expression system encoding a first and second monomer of the cannabinoid-ITF as described herein.

[0272] In some embodiments, engineered cells are provided that contain an ITF inducible by nicotine or a derivative thereof (i.e., a nicotine-inducible transcription factor or "nicotine-ITF") as described herein. In some embodiments, engineered cells are provided that contain an expression system encoding a first and second monomer of nicotine-ITF as described herein.

[0273] In some embodiments, engineered cells are provided that contain an ITF inducible by rapamycin or a derivative or analog thereof (i.e., rapamycin-inducible transcription factor or "rapamycin-ITF") as described herein. In some embodiments, engineered cells are provided that contain an expression system encoding a first and second monomer of rapamycin-ITF as described herein.

[0274] In some embodiments, engineered cells are provided that contain an ITF inducible by mifepristone or a derivative thereof (i.e., mifepristone-inducible transcription factor or "mifepristone-ITF") as described herein. In some embodiments, engineered cells are provided that contain an expression system encoding the mifepristone-ITF as described herein.

[0275] The engineered cells of the present disclosure can be human cells. The engineered cells can be human primary cells. The engineered primary cells can be any somatic cell. The engineered primary cells can be any stem cell. In some embodiments, the engineered cells are derived from a subject. In some embodiments, the engineered cells are allogeneic with respect to the subject.

[0276] The engineered cells of the present disclosure can be isolated from a subject, for example, a subject known or suspected to have cancer. Cell isolation methods are known to those skilled in the art and include, but are not limited to, sorting techniques based on cell surface marker expression, such as FACS sorting, positive isolation techniques, and negative isolation, magnetic isolation, and combinations thereof. The engineered cells can be allogeneic with respect to the subject being treated. The allogeneic modified cells can be HLA-matched to the subject being treated. The engineered cells can be cultured cells, such as ex vivo cultured cells. The engineered cells can be ex vivo cultured cells, such as primary cells isolated from a subject. The cultured cells can be cultured with one or more cytokines.

[0277] In some embodiments, the engineered cells of the present disclosure are selected from: T cells (e.g., CD8+ T cells, CD4+ T cells, or gamma delta T cells), cytotoxic T lymphocytes (CTLs), regulatory T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, myeloid cells, macrophages (e.g., M1 macrophages or M2 macrophages), monocytes, dendritic cells, erythrocytes, platelet cells, neurons, oligodendrocytes, astrocytes, placode-derived cells, Schwann cells, cardiomyocytes, endothelial cells, nodal cells, microglial cells, hepatocytes, bile duct cells, beta cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells.

[0278] In some embodiments, an engineered cell of the present disclosure is a T cell (e.g., a CD8+ T cell, a CD4+ T cell, or a gamma-delta T cell). In some embodiments, an engineered cell of the present disclosure is a cytotoxic T lymphocyte (CTL). In some embodiments, an engineered cell of the present disclosure is a regulatory T cell. In some embodiments, an engineered cell of the present disclosure is a natural killer T (NKT) cell. In some embodiments, an engineered cell of the present disclosure is a natural killer cell (NK). In some embodiments, an engineered cell of the present disclosure is a B cell. In some embodiments, an engineered cell of the present disclosure is a tumor infiltrating lymphocyte (TIL). In some embodiments, an engineered cell of the present disclosure is an innate lymphoid cell. In some embodiments, an engineered cell of the present disclosure is a mast cell. In some embodiments, an engineered cell of the present disclosure is an eosinophil. In some embodiments, an engineered cell of the present disclosure is a basophil. In some embodiments, an engineered cell of the present disclosure is a neutrophil. In some embodiments, an engineered cell of the present disclosure is a bone marrow cell. In some embodiments, the engineered cell of the present disclosure is a macrophage, e.g., an M1 macrophage or an M2 macrophage). In some embodiments, the engineered cell of the present disclosure is a monocyte. In some embodiments, the engineered cell of the present disclosure is a dendritic cell. In some embodiments, the engineered cell of the present disclosure is a red blood cell. In some embodiments, the engineered cell of the present disclosure is a platelet cell. In some embodiments, the cell of the present disclosure is a neuron. In some embodiments, the cell of the present disclosure is a microglial cell. In some embodiments, the cell of the present disclosure is an oligodendrocyte. In some embodiments, the cell of the present disclosure is an astrocyte. In some embodiments, the cell of the present disclosure is a placode-derived cell. In some embodiments, the engineered cell of the present disclosure is a Schwann cell. In some embodiments, the engineered cell of the present disclosure is a cardiomyocyte. In some embodiments, the engineered cell of the present disclosure is an endothelial cell. In some embodiments, the engineered cell of the present disclosure is a nodal cell.In some embodiments, the engineered cells of the present disclosure are microglial cells. In some embodiments, the engineered cells of the present disclosure are hepatocytes. In some embodiments, the engineered cells of the present disclosure are cholangiocytes. In some embodiments, the engineered cells of the present disclosure are beta cells. In some embodiments, the engineered cells of the present disclosure are human embryonic stem cells (ESCs). In some embodiments, the engineered cells of the present disclosure are ESC-derived cells. In some embodiments, the engineered cells of the present disclosure are pluripotent stem cells. In some embodiments, the engineered cells of the present disclosure are mesenchymal stromal cells (MSCs). In some embodiments, the engineered cells of the present disclosure are induced pluripotent stem cells (iPSCs). In some embodiments, the engineered cells of the present disclosure are iPSC-derived cells. In some embodiments, the engineered cells are autologous. In some embodiments, the engineered cells are allogeneic. In some embodiments, the engineered cells of the present disclosure are CD34+ cells, CD3+ cells, CD8+ cells, CD16+ cells, and / or CD4+ cells.

[0279] In some embodiments, the cell of the present disclosure is a tumor cell selected from an adenocarcinoma cell, a bladder tumor cell, a brain tumor cell (e.g., a glioma cell or a glioblastoma cell), a breast tumor cell, a cervical tumor cell, a colon tumor cell, an esophageal tumor cell, a glioma cell, a kidney tumor cell, a liver tumor cell, a lung tumor cell, a melanoma cell, a mesothelioma cell, an ovarian tumor cell, a pancreatic tumor cell, a prostate tumor cell, a skin tumor cell, a thyroid tumor cell, and a uterine tumor cell.

[0280] Also provided are methods that include culturing the engineered cells of the present disclosure. Methods of culturing engineered cells as described herein are known. Those skilled in the art will recognize that the culture conditions will depend on the particular engineered cells of interest. Those skilled in the art will recognize that the culture conditions will depend on the particular downstream use of the engineered cells, for example, the particular culture conditions for the subsequent administration of the engineered cells to a subject.

[0281] How to Manipulate Cells Also provided herein are compositions and methods for engineering cells with any of the polynucleotide molecules or constructs described herein.

[0282] Generally, cells are engineered by introducing (i.e., delivering) one or more polynucleotides of the present disclosure. Delivery methods include, but are not limited to, viral-mediated delivery, lipid-mediated transfection, nanoparticle delivery, electroporation, sonication, and cell membrane deformation by physical means. Those skilled in the art will understand that the choice of delivery method may depend on the particular cell type to be engineered.

[0283] Viral-Mediated Delivery Viral vector-based delivery platforms can be used to engineer cells. Generally, viral vector-based delivery platforms engineer cells by introducing (i.e., delivering) them into a host cell. For example, viral vector-based delivery platforms can engineer cells by introducing any of the engineered nucleic acids described herein. Viral vector-based delivery platforms can be nucleic acids, but as such, engineered nucleic acids can also include nucleic acids derived from engineered viruses. Such engineered viral nucleic acids can also be referred to as recombinant viruses or engineered viruses.

[0284] A viral vector-based delivery platform may encode two or more engineered nucleic acids, genes, or transgenes within the same nucleic acid. For example, a nucleic acid from an engineered virus, such as a recombinant virus or engineered virus, may encode one or more transgenes, including but not limited to any of the engineered nucleic acids described herein that encode one or more effector molecules. One or more transgenes encoding one or more effector molecules can be configured to express one or more effector molecules. A viral vector-based delivery platform may encode one or more genes, called cis-acting elements or cis-acting genes, such as viral genes required for viral infectivity and / or viral production (e.g., capsid proteins, envelope proteins, viral polymerase, viral transcriptase, etc.), in addition to one or more transgenes (e.g., transgenes encoding one or more effector molecules).

[0285] A viral vector-based delivery platform can include two or more viral vectors, such as separate viral vectors encoding engineered nucleic acids, genes, or transgenes, as described herein and referred to as trans-acting elements or genes. For example, a helper-dependent viral vector-based delivery platform can provide additional genes required for viral infectivity and / or virus production on one or more additional separate vectors in addition to a vector encoding one or more effector molecules. One viral vector can deliver multiple engineered nucleic acids, such as one vector delivering engineered nucleic acids configured to produce two or more effector molecules. Two or more viral vectors can deliver two or more engineered nucleic acids, such as two or more vectors delivering one or more engineered nucleic acids configured to produce one or more effector molecules. The number of viral vectors used can depend on the packaging capacity of the viral vector-based vaccine platform referred to above, but a person skilled in the art can select a suitable number of viral vectors.

[0286] In general, any of the viral vector-based systems can be used for in vitro production of molecules such as effector molecules, or can be used in in vivo and ex vivo gene therapy procedures, for example, to deliver engineered nucleic acids encoding one or more effector molecules. Selection of a suitable viral vector-based system depends on a variety of factors, such as the size of the cargo / payload, the immunogenicity of the viral system, the intended target cell, the strength and timing of gene expression, and other factors recognized by those skilled in the art.

[0287] The viral vector-based delivery platform can be an RNA-based virus or a DNA-based virus.Exemplary viral vector-based delivery platforms include, but are not limited to, herpes simplex virus, adenovirus, measles virus, influenza virus, Indiana vesiculovirus, Newcastle disease virus, vaccinia virus, poliovirus, myxoma virus, reovirus, mumps virus, Maraba virus, rabies virus, rotavirus, hepatitis virus, rubella virus, dengue virus, chikungunya virus, respiratory syncytial virus, lymphocytic choriomeningitis virus, morbillivirus, lentivirus, replicating retrovirus, rhabdovirus, Seneca Valley virus, Sindbis virus, and any variant or derivative thereof.Other exemplary viral vector-based delivery platforms have been described in the art, such as vaccinia, fowlpox, self-replicating alphaviruses, Maraba virus, adenoviruses (see, e.g., Tatsis et al., Adenoviruses, Molecular Therapy (2004) 10, 616-629), or lentiviruses, including, but not limited to, second, third or hybrid second / third generation lentiviruses and recombinant lentiviruses of any generation designed to target specific cell types or receptors (see, e.g., Hu et al., Immunization Delivered by Lentiviral Vectors for Cancer and Infectious Diseases, Immunol Rev. (2011) 239(1):45-61; Sakuma et al., Lentiviral vectors: basic to translational, Biochem J. (2012) 443(3):603-18; Cooper et al., Rescue of splicing-mediated intron loss maximizes expression in lentiviral vectors containing the human ubiquitin C promoter, Nucl. Acids Res. (2015) 43(1):682-690; Zufferey et al., Self-Inactivating Lentivirus Vector for Safe and Efficient In vivo Gene Delivery, J. Virol. (1998) 72(12):9873-9880).

[0288] This sequence may be preceded by one or more sequences that target intracellular compartments. Upon introduction (i.e., delivery) into a host cell, the infected cell (i.e., engineered cell) can express ITF as described herein. Vaccinia vectors and methods useful in immunization protocols are described, for example, in U.S. Pat. No. 4,722,848. Another vector is BCG (Bacille Calmette Guerin). BCG vectors are described in Stover et al. (Nature 351:456-460 (1991)). A wide variety of other vectors useful for introduction (i.e., delivery) of engineered nucleic acids, such as Salmonella typhi vectors, and the like, will be apparent to those skilled in the art from the description herein.

[0289] The viral vector-based delivery platform may be a virus that targets tumor cells, referred to herein as an oncolytic virus. Examples of oncolytic viruses include, but are not limited to, oncolytic herpes simplex viruses, oncolytic adenoviruses, oncolytic measles viruses, oncolytic influenza viruses, oncolytic Indiana vesiculoviruses, oncolytic Newcastle disease viruses, oncolytic vaccinia viruses, oncolytic polioviruses, oncolytic myxoma viruses, oncolytic reoviruses, oncolytic mumps viruses, oncolytic Maraba viruses, oncolytic rabies viruses, oncolytic rotaviruses, oncolytic hepatitis viruses, oncolytic rubella viruses, oncolytic dengue viruses, oncolytic chikungunya viruses, oncolytic respiratory syncytial viruses, oncolytic lymphocytic choriomeningitis viruses, oncolytic morbilliviruses, oncolytic lentiviruses, oncolytic replicating retroviruses, oncolytic rhabdoviruses, oncolytic Seneca Valley viruses, oncolytic Sindbis viruses, and any variants or derivatives thereof. Any of the oncolytic viruses described herein may be recombinant oncolytic viruses that include another transgene (e.g., an engineered nucleic acid) encoding one or more ITFs or ITF monomers. The transgene encoding one or more ITFs or ITF monomers may be configured to express one or more ITFs or ITF monomers.

[0290] In some embodiments, the virus is selected from a lentivirus, a retrovirus, an oncolytic virus, an adenovirus, an adeno-associated virus (AAV), and a virus-like particle (VLP).

[0291] Viral vector-based delivery platforms can be retrovirus-based. Generally, retroviral vectors consist of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimal cis-acting LTRs are sufficient for replication and packaging of the vector, which is then used to integrate one or more engineered nucleic acids (e.g., transgenes encoding one or more ITFs or ITF monomers) into target cells to provide persistent transgene expression. Retrovirus-based delivery systems include, but are not limited to, delivery systems based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT / US94 / 05700). Other retroviral systems include the Phoenix retroviral system.

[0292] The viral vector-based delivery platform can be lentivirus-based. In general, lentivirus vectors are retroviral vectors that can transduce or infect non-dividing cells and typically produce high viral titers. The lentivirus-based delivery platform can be HIV-based, such as the ViraPower system (ThermoFisher) or the pLenti system (Cell Biolabs). The lentivirus-based delivery platform can be SIV or FIV-based. Other exemplary lentiviral-based delivery platforms are described in further detail in U.S. Pat. Nos. 7,311,907, 7,262,049, 7,250,299, 7,226,780, 7,220,578, 7,211,247, 7,160,721, 7,078,031, 7,070,993, 7,056,699, and 6,955,919, each of which is incorporated herein by reference for all purposes.

[0293] The viral vector-based delivery platform can be adenovirus-based.Generally, adenovirus-based vectors can achieve very high transduction efficiency in many cell types, do not require cell division, achieve high titers and expression levels, and can be produced in large quantities in a relatively simple system.Generally, adenovirus can be used for the transient expression of transgenes in infected cells.Because adenoviruses are typically not integrated into the genome of the host. Adenovirus-based delivery platforms are described in more detail in Li et al., Invest Opthalmol Vis Sci 35:2543 2549, 1994; Borras et al., Gene Ther 6:515 524, 1999; Li and Davidson, PNAS 92:7700 7704, 1995; Sakamoto et al., H Gene Ther 5:1088 1097, 1999; WO94 / 12649, WO93 / 03769, WO93 / 19191, WO94 / 28938, WO95 / 11984, and WO95 / 00655, each of which is incorporated herein by reference for all purposes. Other exemplary adenovirus-based delivery platforms are described in more detail in U.S. Pat. Nos. 5,585,362, 6,083,716, 7,371,570, 7,348,178, 7,323,177, 7,319,033, 7,318,919, and 7,306,793, and International Patent Application No. 96 / 13597, each of which is incorporated herein by reference for all purposes.

[0294] The viral vector-based delivery platform can be adeno-associated virus (AAV)-based. Adeno-associated virus (AAV) vectors can be used to transduce cells with engineered nucleic acids (e.g., any of the engineered nucleic acids described herein). AAV systems can be used for in vitro production of ITF or ITF monomers, or for in vivo and ex vivo gene therapy procedures, such as in vivo delivery of engineered nucleic acids encoding one or more ITF or ITF monomers (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. Nos. 4,797,368, 5,436,146, 6,632,670, 6,642,051, 7,078,387, 7,314,912, 6,498,244, 7,906,111; U.S. Patent Publication Nos. 2003 / 0138772, 2007 / 0036760, and 2009 / 0197338; Gao, et al. al., J. Virol, 78(12):6381-6388 (June 2004); Gao, et al, Proc Natl Acad Sci USA, 100(10):6081-6086 (May 13, 2003), as well as International Patent Applications Nos. 2010 / 138263 and 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994), each of which is incorporated herein by reference for all purposes. Exemplary methods for constructing recombinant AAV vectors are described in further detail in U.S. Pat. No. 5,173,414, Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985), Tratschin, et al., Mol. Cell, Biol. 4:2072-2081 (1984), Hermonat & Muzyczka, PNAS 81:64666470 (1984), and Samuiski et al., J. Virol. 63:03822-3828 (1989), each of which is incorporated herein by reference for all purposes.Generally, an AAV-based vector comprises a capsid protein having an amino acid sequence corresponding to any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.Rh10, AAV11, and variants thereof.

[0295] The viral vector-based delivery platform can be a virus-like particle (VLP) platform. Generally, VLPs are constructed by producing viral structural proteins and purifying the resulting viral particles. Then, after purification, the cargo / payload (e.g., any of the engineered nucleic acids described herein) is encapsulated ex vivo within the purified particles. Thus, the production of VLPs maintains the separation of the nucleic acid encoding the viral structural proteins and the nucleic acid encoding the cargo / payload. The viral structural proteins used in VLP production can be produced in a variety of expression systems, including mammalian, yeast, insect, bacterial, or in vivo translational expression systems. The purified viral particles can be denatured and reformed in the presence of the desired cargo using methods known to those of skill in the art to produce VLPs. The production of VLPs is described in more detail in Seow et al. (Mol Ther. 2009 May;17(5):767-777), incorporated herein by reference for all purposes.

[0296] Viral vector-based delivery platforms can be engineered to target (i.e., infect) a range of cells, target a narrow subset of cells, or target specific cells. In general, the envelope protein chosen for the viral vector-based delivery platform determines the tropism of the virus. The viruses used in the viral vector-based delivery platform can be pseudotyped to target specific cells of interest. The viral vector-based delivery platform is pantropic and can infect a range of cells. For example, a pantropic viral vector-based delivery platform can include a VSV-G envelope. The viral vector-based delivery platform is amphotropic and can infect mammalian cells. Thus, one skilled in the art can select the appropriate tropism, pseudotype, and / or envelope protein to target the desired cell type.

[0297] Lipid structure delivery system The engineered nucleic acid of the present disclosure (e.g., a polynucleotide molecule encoding rapamycin-ITF, or a first and second monomer of ITF inducible by caffeine, cannabinoids, or nicotine, or a polynucleotide molecule encoding mifepristone-ITF) can be introduced into cells using a lipid-mediated delivery system. Generally, lipid-mediated delivery systems use a structure composed of an external lipid membrane that encases an internal compartment. Examples of lipid-based structures include, but are not limited to, lipid-based nanoparticles, liposomes, micelles, exosomes, vesicles, extracellular vesicles, cells, or tissues. The lipid structure delivery system can deliver cargo / payload (e.g., any of the engineered nucleic acids described herein) in vitro, in vivo, or ex vivo.

[0298] Lipid-based nanoparticles can include, but are not limited to, unilamellar liposomes, multilamellar liposomes, and lipid preparations. As used herein, "liposome" is a general term that encompasses in vitro preparations of lipid vehicles formed by encapsulating a desired cargo, such as an engineered nucleic acid, such as any of the engineered nucleic acids described herein, within a lipid shell or lipid aggregate. Liposomes can be characterized as having a vesicular structure with a bilayer membrane that generally comprises phospholipids, and an internal medium that generally comprises an aqueous composition. Liposomes include, but are not limited to, emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers, and the like. The liposomes can be unilamellar liposomes. The liposomes can be multilamellar liposomes. The liposomes can be multivesicular liposomes. The liposomes can be positively charged, negatively charged, or neutrally charged. In certain embodiments, the liposomes are neutrally charged. Liposomes can be formed from standard vesicle-forming lipids, which generally include neutral and negatively charged phospholipids and sterols, such as cholesterol. The selection of lipids is generally guided by consideration of the desired purpose, such as criteria for in vivo delivery, such as liposome size, acid instability, and stability of liposomes in the bloodstream. A variety of methods are available for preparing liposomes, as described, for example, in Szoka et al., Ann.Rev.Biophys.Bioeng.9;467(1980), U.S. Patent Nos. 4,235,871, 4,501,728, 4,501,728, 4,837,028, and 5,019,369, each of which is incorporated herein by reference for all purposes.

[0299] Multilamellar liposomes are generally produced spontaneously when lipids, including phospholipids, are suspended in an excess of aqueous solution, resulting in multiple lipid layers separated by aqueous media. Water and dissolved solutes are trapped in a closed structure between the lipid bilayers after self-rearrangement of the lipid components. The desired cargo (e.g., polypeptides, nucleic acids, small molecule drugs, engineered nucleic acids, such as any of the engineered nucleic acids described herein, viral vectors, viral-based delivery systems, etc.) can be encapsulated in the aqueous interior of the liposome, attached to the liposome via a linking molecule associated with both the liposome and the polypeptide / nucleic acid, interspersed within the lipid bilayer of the liposome, encapsulated in the liposome, complexed with the liposome, or otherwise associated with the liposome, allowing it to be delivered to the target entity. Lipophilic molecules or molecules with lipophilic regions can also be dissolved in or associated with the lipid bilayer.

[0300] The liposomes used according to the present embodiment can be produced by different methods, as may be known to those skilled in the art. The preparation of liposomes is described in more detail in WO2016 / 201323, International Applications PCT / US85 / 01161 and PCT / US89 / 05040, and U.S. Patent Nos. 4,728,578, 4,728,575, 4,737,323, 4,533,254, 4,162,282, 4,310,505, and 4,921,706, each of which is incorporated herein by reference for all purposes.

[0301] The liposomes can be cationic liposomes. Examples of cationic liposomes are described in more detail in U.S. Patent Nos. 5,962,016; 5,030,453; 6,680,068, U.S. Application No. 2004 / 0208921, and International Patent Application Nos. 03 / 015757A1, 04 / 029213A2, and 02 / 100435A1, each of which is incorporated herein by reference in its entirety.

[0302] Lipid-mediated gene delivery methods are described, for example, in WO 96 / 18372; WO 93 / 24640; Mannino & Gould-Fogerite, BioTechniques 6(7):682-691 (1988); U.S. Patent No. 5,279,833 Rose U.S. Patent No. 5,279,833; WO 91 / 06309; and Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7414 (1987), each of which is incorporated herein by reference for all purposes.

[0303] Exosomes are small membrane vesicles of endocytic origin that are released into the extracellular environment after fusion of multivesicular bodies with the plasma membrane. The size of exosomes ranges between 30-100 nm in diameter. Their surface consists of a lipid bilayer from the plasma membrane of the donor cell, they contain cytosol from the cell that produced the exosome, and display membrane proteins from the parent cell on their surface. Exosomes useful for delivery of nucleic acids are known to those skilled in the art, for example, exosomes described in more detail in U.S. Pat. No. 9,889,210, incorporated herein by reference for all purposes.

[0304] As used herein, the term "extracellular vesicles" or "EVs" refers to cell-derived vesicles that contain a membrane that encloses an internal space. In general, extracellular vesicles include all membrane-bound vesicles that have a smaller diameter than the cell from which they are derived. In general, extracellular vesicles range from 20 nm to 1000 nm in diameter and can contain a variety of macromolecular cargo, either within the internal space and / or across the membrane that is presented on the exterior surface of the extracellular vesicle. The cargo can include nucleic acids (e.g., any of the engineered nucleic acids described herein), proteins, carbohydrates, lipids, small molecules, and / or combinations thereof. By way of example, and not limitation, extracellular vesicles include apoptotic bodies, cell fragments, vesicles derived from cells by direct or indirect manipulation (e.g., by successive extrusion or treatment with alkaline solutions), vesiculated organelles, and vesicles produced by living cells (e.g., by direct plasma membrane budding or fusion of late endosomes with the plasma membrane). Extracellular vesicles can be derived from living or dead organisms, explanted tissues or organs, and / or cultured cells.

[0305] As used herein, the term "exosome" refers to a small (20-300 nm diameter, more preferably 40-200 nm diameter) cell-derived vesicle that includes a membrane surrounding an internal space and is produced from a cell by direct plasma membrane budding or fusion of a late endosome with the plasma membrane. Exosomes contain lipids or fatty acids and polypeptides, and optionally include a payload (e.g., a therapeutic agent), a receiver (e.g., a targeting moiety), a polynucleotide (e.g., a nucleic acid, RNA, or DNA, such as any of the engineered nucleic acids described herein), a sugar (e.g., a monosaccharide, polysaccharide, or glycan), or other molecules. Exosomes are derived from producing cells and can be isolated from producing cells based on their size, density, biochemical parameters, or a combination thereof. Exosomes are a type of extracellular vesicle. Generally, exosome production / biogenesis does not result in the destruction of the producing cells. Exosomes and the preparation of exosomes are described in further detail in WO2016 / 201323, which is incorporated herein by reference in its entirety.

[0306] As used herein, the term "nanovesicles" (also referred to as "microvesicles") refers to small (between 20-250 nm in diameter, more preferably between 30-150 nm in diameter) vesicles of cell origin, comprising a membrane surrounding an internal space, and produced from cells by direct or indirect manipulation, such that the nanovesicles are not produced by the producing cells without such manipulation. Generally, nanovesicles are a subspecies of extracellular vesicles. Suitable manipulations of the producing cells include, but are not limited to, continuous extrusion, treatment with alkaline solutions, sonication, or combinations thereof. The production of nanovesicles may, in some instances, result in the destruction of the producing cells. Preferably, the population of nanovesicles is substantially free of vesicles derived from the producing cells by direct budding from the plasma membrane or fusion of late endosomes with the plasma membrane. Nanovesicles comprise lipids or fatty acids and polypeptides, and optionally comprise a payload (e.g., a therapeutic agent), a receiver (e.g., a targeting moiety), a polynucleotide (e.g., a nucleic acid, RNA, or DNA, such as any of the engineered nucleic acids described herein), a sugar (e.g., a monosaccharide, polysaccharide, or glycan), or other molecule. Once it has been derived from the production cell according to the engineered procedure, the nanovesicle can be isolated from the production cell based on its size, density, biochemical parameters, or a combination thereof.

[0307] Lipid nanoparticles (LNPs) are generally synthetic lipid structures that form membrane and vesicle-like structures depending on the amphiphilic nature of the lipids (Riley 2017). Generally, these vesicles deliver cargo / payload, such as any of the engineered nucleic acids or viral systems described herein, by absorbing into the membrane of the target cell and releasing the cargo into the cytosol. The lipids used in LNP formation can be cationic, anionic, or neutral. The lipids can be synthetic or naturally derived, and in some instances biodegradable. The lipids can include fats, cholesterol, phospholipids, lipid conjugates including, but not limited to, polyethylene glycol (PEG) conjugates (PEGylated lipids), waxes, oils, glycerides, and fat-soluble vitamins. The lipid composition generally includes a defined mixture of materials, such as cationic, neutral, anionic, and amphiphilic lipids. In some instances, certain lipids are included to provide functional chemical groups that prevent LNP aggregation, prevent lipid oxidation, or facilitate attachment of additional moieties. Lipid composition can affect overall LNP size and stability. In one example, lipid composition includes dilinoleylmethyl-4-dimethylaminobutyrate (MC3) or MC3-like molecules. MC3 and MC3-like lipid compositions can be formulated to include one or more other lipids, such as PEG or PEG-conjugated lipids, sterols, or neutral lipids. In addition, LNPs can be further engineered or functionalized to facilitate targeting of specific cell types. Another consideration in LNP design is the balance between targeting efficiency and cytotoxicity.

[0308] Micelles are generally spherical synthetic lipid structures formed using single-chain lipids, where the hydrophilic heads of the single-chain lipids form the outer layer or membrane, and the hydrophobic tails of the single-chain lipids form the micellar core. Micelles typically refer to lipid structures that contain only a lipid monolayer. Micelles are described in more detail in Quader et al. (Mol Ther. 2017 Jul 5;25(7):1501-1513), which is incorporated herein by reference for all purposes.

[0309] Nucleic acid vectors, such as expression vectors, directly exposed to serum may have some undesirable consequences, including degradation of nucleic acid by serum nucleases or off-target stimulation of the immune system by free nucleic acid. Similarly, viral delivery systems directly exposed to serum may induce undesirable immune responses and / or neutralization of the viral delivery system. Therefore, encapsulation of engineered nucleic acid and / or viral delivery systems can be used to avoid degradation while also avoiding potential off-target effects. In certain instances, the engineered nucleic acid and / or viral delivery system is fully encapsulated within the delivery vehicle, for example, within the aqueous interior of the LNP. Encapsulation of engineered nucleic acid and / or viral delivery systems within LNPs can be performed by techniques well known to those skilled in the art, such as microfluidic mixing and droplet generation performed on a microfluidic droplet generation device. Such devices include, but are not limited to, standard T-junction devices or flow focusing devices. In one example, a desired lipid formulation, such as an MC3 or MC3-like containing composition, is provided to a droplet generating device in parallel with an engineered nucleic acid or viral delivery system and any other desired agent, such that the delivery vector and desired agent are fully encapsulated within the interior of the MC3 or MC3-like based LNPs. In one example, the droplet generating device can control the size range and size distribution of the LNPs produced. For example, the LNPs can have a size ranging from 1 to 1000 nanometers in diameter, e.g., 1, 10, 50, 100, 500, or 1000 nanometers. Following droplet generation, the delivery vehicles (e.g., engineered nucleic acid and / or viral delivery systems) encapsulating the cargo / payload can be further processed or manipulated to prepare them for administration.

[0310] Nanoparticle Delivery Nanomaterials can be used to deliver engineered nucleic acids (e.g., polynucleotide molecules encoding chimeric polypeptides). Nanomaterial vehicles can, importantly, be made of non-immunogenic materials, generally avoiding eliciting immunity against the delivery vector itself. These materials include, but are not limited to, lipids (as previously described), inorganic nanomaterials, and other polymeric materials. Nanomaterial particles are described in further detail in Riley et al. (Recent Advances in Nanomaterials for Gene Delivery-A Review. Nanomaterials 2017,7(5),94), incorporated herein by reference for all purposes.

[0311] Genome Editing Genome editing system can be used to engineer the host genome to encode engineered nucleic acid, for example, the polynucleotide encoding ITF or ITF monomer of the present disclosure.Generally, "genome editing system" refers to any system for incorporating exogenous gene into the genome of host cell.Genome editing system includes, but is not limited to, transposon system, nuclease genome editing system, and viral vector-based delivery platform.

[0312] A transposon system can be used to integrate engineered nucleic acids, such as engineered nucleic acids of the present disclosure, into a host genome. A transposon generally comprises a terminal inverted repeat (TIR) ​​flanking a cargo / payload nucleic acid and a transposase. The transposon system can provide a transposon in cis or in trans, with the TIR flanking cargo. The transposon system can be a retrotransposon system or a DNA transposon system. Generally, the transposon system randomly integrates the cargo / payload (e.g., engineered nucleic acid) into the host genome. Examples of transposon systems include those using transposons of the Tc1 / mariner transposon superfamily, such as the Sleeping Beauty transposon system, and are described in further detail in Hudecek et al. (Crit Rev Biochem Mol Biol. 2017 Aug;52(4):355-380), and U.S. Patent Nos. 6,489,458, 6,613,752, and 7,985,739, each of which is incorporated herein by reference for all purposes. Another example of a transposon system includes the PiggyBac transposon system, and is described in further detail in U.S. Patent Nos. 6,218,185 and 6,962,810, each of which is incorporated herein by reference for all purposes.

[0313] Nuclease genome editing systems can be used to engineer host genomes to encode engineered nucleic acids, such as the isolated polynucleotides or heterologous constructs of the present disclosure. Without wishing to be bound by theory, nuclease-mediated gene editing systems used to introduce exogenous genes generally exploit the cells' natural DNA repair mechanisms, particularly the homologous recombination (HR) repair pathway. Briefly, following damage to genomic DNA (typically a double-strand break), the cell can eliminate the damage by using another source of DNA with identical or substantially identical sequences at both its 5' and 3' ends as a template during DNA synthesis to repair the damage. In the natural situation, HDR can use other chromosomes present in the cell as templates. In gene editing systems, an exogenous polynucleotide is introduced into the cell and used as a homologous recombination template (HRT or HR template). Generally, any additional exogenous sequence not naturally found in the chromosome, with the lesion contained between the 5' and 3' complementary ends within the HRT (e.g., a gene or part of a gene), can be incorporated (i.e., "integrated") into a given genomic locus during templated HDR. Thus, a typical HR template for a given genomic locus has a nucleotide sequence identical to a first region of the endogenous genomic target locus, a nucleotide sequence identical to a second region of the endogenous genomic target locus, and a nucleotide sequence encoding a cargo / payload nucleic acid (e.g., any of the engineered nucleic acids described herein, e.g., any of the engineered nucleic acids encoding one or more ITFs or ITF monomers).

[0314] In some instances, the HR template may be linear. Examples of linear HR templates include, but are not limited to, linearized plasmid vectors, ssDNA, synthetic DNA, and PCR amplified DNA. In certain instances, the HR template may be circular, such as a plasmid. The circular template may include a supercoiled template.

[0315] The identical or substantially identical sequences found at the 5' and 3' ends of the HR template are generally referred to as arms (HR arms) with respect to the foreign sequence to be introduced. The HR arms can be identical (i.e., 100% identical) to the region of the endogenous genomic target locus. The HR arms can, in some cases, be substantially identical to the region of the endogenous genomic target locus. While substantially identical HR arms can be used, it can be advantageous for the HR arms to be identical, because the efficiency of the HDR pathway can be affected by HR arms with less than 100% identity.

[0316] Each HR arm, i.e., the 5' and 3' HR arms, can be the same size or different sizes. Each HR arm can be 50, 100, 200, 300, 400, or 500 bases or more in length, respectively. The HR arms can generally be any length, but practical considerations, such as the effect of the HR arm length and overall template size on the overall editing efficiency, can also be taken into account. The HR arms can be identical or substantially identical to the region of the endogenous genome target locus immediately adjacent to the cleavage site. Each HR arm can be identical or substantially identical to the region of the endogenous genome target locus immediately adjacent to the cleavage site. Each HR arm can be identical or substantially identical to the region of the endogenous genome target locus within a certain distance of the cleavage site, such as 1 base pair, 10 base pairs or less, 50 base pairs or less, or 100 base pairs or less, etc., of each other.

[0317] Nuclease genome editing systems can use various nucleases to cleave target genomic loci, including, but not limited to, clustered regularly interspaced short palindromic repeats (CRISPR) family nucleases or derivatives thereof, transcription activator-like effector nucleases (TALENs) or derivatives thereof, zinc finger nucleases (ZFNs) or derivatives thereof, and homing endonucleases (HEs) or derivatives thereof.

[0318] A CRISPR-mediated gene editing system can be used to engineer a host genome to encode an engineered nucleic acid, such as an engineered nucleic acid encoding one or more of the ITF or ITF monomers described herein. The CRISPR system is described in more detail in M. Adli ("The CRISPR tool kit for genome editing and beyond" Nature Communications; volume 9 (2018), Article number: 1911), which is incorporated herein by reference for all that it teaches. Generally, a CRISPR-mediated gene editing system includes a CRISPR-associated (Cas) nuclease and an RNA that directs cleavage to a specific target sequence. An exemplary CRISPR-mediated gene editing system is the CRISPR / Cas9 system, which is composed of a Cas9 nuclease and an RNA with a CRISPR RNA (crRNA) domain and a transactivating CRISPR (tracrRNA) domain. A crRNA typically has two RNA domains: a guide RNA sequence (gRNA) that directs specificity to a target sequence ("defined nucleotide sequence"), e.g., a genomic sequence, through base pair hybridization; and an RNA domain that hybridizes to the tracrRNA. The tracrRNA can interact with a nuclease (e.g., Cas9), thereby facilitating recruitment to a genomic locus. The crRNA and tracrRNA polynucleotides can be separate polynucleotides. The crRNA and tracrRNA polynucleotides can be a single polynucleotide, also referred to as a single guide RNA (sgRNA). While the Cas9 system is illustrated herein, other CRISPR systems can be used, such as the Cpf1 system. Nucleases can include derivatives thereof, such as Cas9 functional mutants, e.g., Cas9 "nickase" mutants, which generally mediate only a single strand cleavage of a defined nucleotide sequence, as opposed to the complete double strand cleavage typically produced by the Cas9 enzyme.

[0319] In general, the components of the CRISPR system interact with each other to form a ribonucleoprotein (RNP) complex to mediate sequence-specific cleavage. In some CRISPR systems, each component can be produced separately and used to form an RNP complex. In some CRISPR systems, each component can be produced separately in vitro and contacted with each other (i.e., "complexed") in vitro to form an RNP complex. The in vitro produced RNPs can then be introduced (i.e., "delivered") into the cytosol and / or nucleus of a cell, for example, the cytosol and / or nucleus of a T cell. The in vitro produced RNP complexes can be delivered to cells by various means, including but not limited to electroporation, lipid-mediated transfection, cell membrane deformation by physical means, lipid nanoparticles (LNPs), virus-like particles (VLPs), and sonication. In a particular example, the in vitro produced RNP complexes can be delivered to cells using Nucleofactor / Nucleofection® electroporation-based delivery system (Lonza®). Other electroporation systems include, but are not limited to, MaxCyte electroporation system, Miltenyi CliniMACS electroporation system, Neon electroporation system, and BTX electroporation system. CRISPR nucleases, such as Cas9, can be produced in vitro (i.e., synthesized and purified) using various protein production techniques known in the art. CRISPR RNAs, such as sgRNAs, can be produced in vitro (i.e., synthesized and purified) using various RNA production techniques known to those skilled in the art, such as in vitro transcription or chemical synthesis.

[0320] The RNP complex produced in vitro can be complexed with different ratios of nuclease and gRNA.The RNP complex produced in vitro can also be used in different amounts in CRISPR-mediated editing system.For example, depending on the number of cells that are desired to be edited, the total amount of RNP added can be adjusted, such as the amount of RNP complex added when editing a large number of cells in reaction.

[0321] In some CRISPR systems, each component (e.g., Cas9 and sgRNA) is encoded by a polynucleotide separately, and each polynucleotide can be introduced into a cell together or separately. In some CRISPR systems, each component can be encoded by a single polynucleotide (i.e., a multi-promoter or multi-cistronic vector, see the description of an exemplary multi-cistronic system below) and introduced into a cell. After expression of the CRISPR components encoded by each polynucleotide in the cell (e.g., translation of nuclease and transcription of CRISPR RNA), an RNP complex can be formed in the cell and then directed to site-specific cleavage.

[0322] Some RNPs can be engineered to have moieties that facilitate delivery of the RNP into the nucleus. For example, the Cas9 nuclease can have a nuclear localization signal (NLS) domain, where the Cas9 RNP complex is delivered into the cytosol of a cell, or after translation of Cas9 and subsequent RNP formation, the NLS can facilitate further transport of the Cas9 RNP into the nucleus.

[0323] The cells described herein can be engineered using non-viral methods, for example, the nucleases and / or CRISPR-mediated gene editing systems described herein can be delivered to cells using non-viral methods. The cells described herein can be engineered using viral methods, for example, the nucleases and / or CRISPR-mediated gene editing systems described herein can be delivered to cells using viral methods, for example, adenovirus, retrovirus, lentivirus, or any of the other viral-based delivery methods described herein.

[0324] In some CRISPR systems, two or more CRISPR compositions can be provided, each of which targets the same gene or common genomic locus with two or more target nucleotide sequences separately.For example, two separate CRISPR compositions can be provided to direct cleavage at two different target nucleotide sequences within a certain distance from each other.In some CRISPR systems, two or more CRISPR compositions can be provided, each of which targets opposite strands of the same gene or common genomic locus separately.For example, two separate CRISPR "nickase" compositions can be provided to direct cleavage at the same gene or common genomic locus on opposite strands.

[0325] In general, the features of the CRISPR-mediated editing system described herein can be applied to other nuclease-based genome editing systems. TALEN is an engineered site-specific nuclease, which is composed of the DNA binding domain of TALE (transcription activator-like effector) and the catalytic domain of restriction endonuclease Fokl. By changing the amino acids present in the highly variable residue region of the monomer of DNA binding domain, different artificial TALENs can be made to target different nucleotide sequences. The DNA binding domain then directs nuclease to the target sequence and creates double-strand breaks. TALEN-based systems are described in further detail in U.S. Ser. No. 12 / 965,590; U.S. Pat. No. 8,450,471; U.S. Pat. No. 8,440,431; U.S. Pat. No. 8,440,432; U.S. Pat. No. 10,172,880; and U.S. Ser. No. 13 / 738,381, all of which are incorporated by reference in their entireties herein. ZFN-based editing systems are described in further detail in U.S. Patent Nos. 6,453,242, 6,534,261, 6,599,692, 6,503,717, 6,689,558, 7,030,215, 6,794,136, 7,067,317, 7,262,054, 7,070,934, 7,361,635, 7,253,273, and U.S. Patent Publication Nos. 2005 / 0064474, 2007 / 0218528, and 2005 / 0267061, all of which are incorporated by reference in their entireties for all purposes.

[0326] Other engineered delivery systems A variety of additional means for introducing engineered nucleic acids (e.g., polynucleotide molecules encoding ITF or monomers of ITF, as described herein) into cells or other target recipient entities, such as any of the lipid structures described herein.

[0327] Electroporation can be used to deliver polynucleotides to recipient entities. Electroporation is a method of internalizing cargo / payload into the internal compartment of a target cell or entity through the application of an electric field to transiently permeabilize the outer membrane or shell of the target cell or entity. In general, this method involves placing a cell or target entity between two electrodes in a solution containing the cargo of interest (e.g., any of the engineered nucleic acids described herein). The lipid membrane of the cell is then disrupted, i.e., permeabilized, by applying a transient set voltage, thereby allowing the cargo to enter the interior of the entity, e.g., the cytoplasm of the cell. In the example of a cell, at least some, but not most, of the cell remains viable. Cells and other entities can be electroporated in vitro, in vivo, or ex vivo. Electroporation conditions (e.g., number of cells, concentration of cargo, recovery conditions, voltage, time, volume, pulse type, pulse length, volume, cuvette length, composition of electroporation solution, etc.) vary depending on several factors, including, but not limited to, the type of cell or other recipient entity, the cargo to be delivered, the desired efficiency of internalization, and the desired survival rate. Optimization of such criteria is within the skill of one of ordinary skill in the art. A variety of devices and protocols can be used for electroporation. Examples include, but are not limited to, the Neon® Transfection System, MaxCyte® Flow Electroporation™, Lonza® Nucleofector™ System, and Bio-Rad® Electroporation System.

[0328] Other means for introducing an engineered nucleic acid (e.g., a polynucleotide molecule encoding ITF or a monomer of ITF described herein) into a cell or other target recipient entity include, but are not limited to, sonication, gene guns, hydrodynamic injection, and cell membrane deformation by physical means.

[0329] Compositions and methods for delivering engineered mRNA, such as naked plasmids or mRNA, in vivo are described in detail in Kowalski et al. (Mol Ther. 2019 Apr 10;27(4):710-728) and Kaczmarek et al. (Genome Med. 2017;9:60), each of which is incorporated by reference herein for all purposes.

[0330] Genetic Switch Also provided is a gene switch comprising (i) an isolated cell comprising an ITF as described herein, and (ii) a cognate ligand. In some embodiments, the isolated cell further comprises a gene operably linked to an ITF-responsive promoter.

[0331] In some embodiments, the gene switch comprises (i) an isolated cell comprising a caffeine-inducible transcription factor, and (ii) caffeine.

[0332] In some embodiments the gene switch comprises (i) an isolated cell comprising a cannabinoid-inducible transcription factor, and (ii) a cannabinoid. In some embodiments the cannabinoid is a phytocannabinoid. In some embodiments the cannabinoid is cannabidiol.

[0333] In some embodiments, the gene switch comprises (i) an isolated cell comprising a nicotine-inducible transcription factor, and (ii) nicotine.

[0334] In some embodiments, the gene switch comprises (i) an isolated cell comprising a rapamycin-inducible transcription factor, and (ii) rapamycin or an analog or derivative thereof.

[0335] In some embodiments, the gene switch comprises (i) an isolated cell comprising a mifepristone-inducible transcription factor, and (ii) mifepristone or a derivative thereof.

[0336] How to use Methods of using the ITFs described herein are also encompassed by the present disclosure. In some embodiments, the methods include regulating the transcription of a gene of interest.

[0337] In some aspects, provided herein are methods of regulating transcription, the methods comprising contacting an isolated cell expressing a first monomer and a second monomer of an inducible transcription factor inducible by caffeine, a cannabinoid, or nicotine described herein with a cognate ligand selected from caffeine, a cannabinoid, and nicotine to induce formation of an inducible transcription factor (ITF), and culturing the isolated cell for a period of time sufficient to allow the activated ITF to regulate transcription of a gene operably linked to an ITF responsive promoter.

[0338] In some aspects, provided herein are methods of regulating transcription, the methods comprising contacting an isolated cell expressing a first monomer and a second monomer of a rapamycin-inducible transcription factor described herein with a cognate ligand comprising rapamycin or a derivative or analog thereof to induce the formation of an inducible transcription factor (ITF), and culturing the isolated cell for a period of time sufficient to allow the activated ITF to regulate the transcription of a gene operably linked to an ITF responsive promoter.

[0339] In some aspects, provided herein are methods of regulating transcription, the methods comprising contacting an isolated cell expressing an inducible transcription factor (ITF) with mifepristone to induce nuclear localization of the ITF, and culturing the isolated cell for a period of time sufficient to allow ITF to regulate transcription of a gene operably linked to an ITF responsive promoter.

[0340] In some embodiments, the method of regulating transcription is a method of activating transcription. In such embodiments, the transcriptional effector domain of the inducible transcription factor may be a transcriptional activation domain.

[0341] In some embodiments, the method of regulating transcription is a method of repressing transcription. In such embodiments, the transcriptional effector domain of the inducible transcription factor may be a transcriptional repressor domain.

[0342] In some aspects, methods of treating a disease are also encompassed by the present disclosure, comprising administering to a subject an effective amount of an engineered polynucleotide encoding an inducible transcription factor, or an isolated cell comprising a polynucleotide molecule encoding an inducible transcription factor, as described above. In some aspects, methods of doing so in a subject in need thereof are provided herein, comprising administering a therapeutically effective dose of any of the engineered cells, isolated cells, or compositions disclosed herein.

[0343] In vivo methods In some aspects, the methods provided herein also include modulating transcription of a gene of interest in vivo, for example, by delivering to a subject (i) cells engineered to produce an ITF as described herein, and (ii) a cognate ligand (e.g., caffeine, cannabinoids, nicotine, rapamycin, or mifepristone).

[0344] In some embodiments, the subject is a human or animal, and contacting the transformed cell with the cognate ligand comprises administering a pharmacological dose of the cognate ligand to the human or animal.

[0345] In some aspects, the methods provided herein also include delivering a composition in vivo that can produce the engineered cells described herein, e.g., can deliver any of the expression systems or polynucleotide molecules described herein to cells in vivo. Such compositions include any of the viral-mediated delivery platforms, any of the lipid structure delivery systems, any of the nanoparticle delivery systems, any of the genome editing systems, or any of the other engineered delivery systems described herein that can engineer cells in vivo.

[0346] The methods provided herein also include delivering in vivo a composition capable of producing any of the inducible transcription factors (and in some embodiments, genes regulated by the inducible transcription factors) described herein. Compositions capable of in vivo production of inducible transcription factors (and in some embodiments, genes regulated by the inducible transcription factors) include, but are not limited to, any of the engineered nucleic acids described herein. Compositions capable of in vivo production of inducible transcription factors (and in some embodiments, genes regulated by the inducible transcription factors) can be naked mRNA or naked plasmids.

[0347] Pharmaceutical Compositions The inducible transcription factors, expression systems, and cells of the present disclosure can be formulated in pharmaceutical compositions. These compositions can contain, in addition to one or more engineered nucleic acids or engineered cells, pharma- ceutically acceptable excipients, carriers, buffers, stabilizers, or other materials known to those skilled in the art. Such materials must be non-toxic and must not interfere with the efficacy of the active ingredient. The exact nature of the carrier or other materials can depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal.

[0348] Whether it is cells, polypeptides, nucleic acids, small molecules, or other pharma- ceutically useful compounds according to the present disclosure that are administered to an individual, the administration is preferably a "therapeutically effective amount" or a "prophylactically effective amount" (although in some cases prophylaxis may be considered treatment), which is sufficient to show benefit to the individual. The actual amount administered, as well as the rate and time course of administration, will depend on the nature and severity of the disease being treated. Prescription of treatment, e.g., determining dosage, etc., is within the responsibility of general practitioners and other physicians, and will usually take into account the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration, and other factors known to the practitioner. Examples of the above techniques and protocols can be found in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (ed), 1980.

[0349] The compositions may be administered alone or in combination with other treatments, either simultaneously or sequentially, depending on the condition to be treated.

[0350] Enumerated embodiments 1. 1. An engineered cell comprising an inducible transcription factor (ITF), The ITF a first monomer comprising a DNA-binding domain and a first ligand-binding domain; a second monomer comprising a transcription effector domain and a second ligand binding domain; Including, each monomer is capable of oligomerization via a cognate ligand that binds to each ligand-binding domain; Ligand-induced oligomerization forms ITF, The cognate ligand is selected from the group consisting of caffeine, cannabidiol (CBD), phytocannabinoids, and nicotine; Engineered cells. 2. 2. The engineered cell of embodiment 1, wherein the DNA binding domain comprises a zinc finger (ZF) protein domain. 3. The engineered cell of embodiment 2, wherein the ZF protein domain is modular in design and composed of one or more zinc finger arrays (ZFAs). 4. 4. The engineered cell of embodiment 3, wherein the ZF protein domain comprises an array of 1-10 zinc finger motifs. 5. The engineered cell of any one of embodiments 1 to 4, wherein the ZF protein domain comprises an array of six zinc finger motifs. 6. 6. The engineered cell of any one of embodiments 1 to 5, wherein each ligand binding domain comprises a single domain antibody. 7. Single domain antibodies, V H 7. The engineered cell of embodiment 6, comprising H. 8. V H H is anti-caffeine V H H(ac V H H). The engineered cell of embodiment 7. 9. Anti-caffeine V H H(ac V H The engineered cell of embodiment 8, wherein H) comprises the amino acid sequence of SEQ ID NO:52. 10. Each of the first ligand-binding domain and the second ligand-binding domain is H 10. The engineered cell of embodiment 8 or embodiment 9, comprising H. 11. The cognate ligand is cannabidiol or a phytocannabinoid, H 8. The engineered cell of embodiment 7, wherein H comprises an amino acid sequence selected from the group consisting of SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, and SEQ ID NO:57 (CA-14, DB-6, DB-11, DB-18, and DB-21, respectively). 12. One of the first or second ligand-binding domains comprises the amino acid sequence of SEQ ID NO:53 (CA-14). HH, and the other of the first or second binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, and SEQ ID NO:57 (DB-6, DB-11, DB-18, and DB-21, respectively). H 13. The engineered cell of embodiment 12, comprising H. 13. One of the first or second ligand-binding domains comprises the amino acid sequence of SEQ ID NO:53 (CA-14). H H, and the other of the first or second binding domain comprises the amino acid sequence of SEQ ID NO: 57 (DB-21) H 13. The engineered cell of embodiment 12, comprising H. 14. 6. The engineered cell of any one of embodiments 1 to 5, wherein each ligand-binding domain comprises an anti-nicotine antibody heavy chain variable domain (anti-Nic VH) or an anti-nicotine antibody light chain variable domain (anti-Nic VL). 15. The engineered cell of embodiment 14, wherein the anti-Nic VH comprises the amino acid sequence of SEQ ID NO:58. 16. The engineered cell of embodiment 14 or embodiment 15, wherein the anti-Nic VL comprises the amino acid sequence of SEQ ID NO:59. 17. 17. The engineered cell of any one of embodiments 14-16, wherein one of the first or second ligand binding domains comprises an anti-Nic VH and the other of the first or second ligand binding domain comprises an anti-Nic VL. 18. 1. An engineered cell comprising an inducible transcription factor (ITF), The ITF a first monomer comprising a DNA-binding domain and a first ligand-binding domain; a second monomer comprising a transcription effector domain and a second ligand binding domain; Including, each monomer is capable of oligomerization via binding of a cognate ligand that binds to each ligand-binding domain; Ligand-induced oligomerization forms ITF, the DNA-binding domain comprises a zinc finger (ZF) protein domain which is modular and contains an array of six ZF motifs; the cognate ligand is selected from the group consisting of rapamycin, AP1903, AP20187, FK1012, derivatives thereof, and analogs thereof; Engineered cells. 19. 19. The engineered cell of embodiment 18, wherein one of the first or second ligand binding domains comprises an FKBP domain and the other of the first or second ligand binding domain comprises an FRB domain. 20. 20. The engineered cell of embodiment 19, wherein the FKBP comprises the amino acid sequence of SEQ ID NO:60. twenty one. The engineered cell of embodiment 19 or embodiment 20, wherein the FRB domain comprises the amino acid sequence of SEQ ID NO:61. twenty two. 22. The engineered cell of any one of embodiments 19-21, wherein the first ligand binding domain comprises an FKBP domain and the second ligand binding domain comprises an FRB domain. twenty three. 23. The engineered cell of any one of embodiments 19 to 22, wherein one of the first or second ligand-binding domain comprises an FRB domain, and the other of the first or second ligand-binding domain comprises an FKBP domain. twenty four. 24. The engineered cell of any one of embodiments 1 to 23, wherein the first monomer and / or the second monomer further comprises a nuclear localization signal (NLS). twenty five. 25. The engineered cell of embodiment 24, wherein the NLS comprises an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4. 26. 26. The engineered cell of any one of embodiments 1 to 25, wherein the second monomer further comprises a nuclear export signal (NES). 27. 27. The engineered cell of embodiment 26, wherein the NES comprises an amino acid sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14. 28. 28. The engineered cell of any one of embodiments 1-27, wherein ITF is capable of regulating the transcription of a gene of interest operably linked to an ITF responsive promoter. 29. below: a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding a first monomer, the first monomer comprising a DNA-binding domain and a first ligand-binding domain; a second expression cassette comprising a second promoter and an exogenous polynucleotide sequence encoding a second monomer, the second monomer comprising a transcription effector domain and a second ligand binding domain; An expression system comprising: each monomer is capable of oligomerization via a cognate ligand that binds to each ligand-binding domain; Ligand-induced oligomerization of the first and second monomers forms an inducible transcription factor (ITF); The cognate ligand is selected from the group consisting of caffeine, cannabidiol (CBD), phytocannabinoids, and nicotine; Expression system. 30. 30. The expression system of embodiment 29, wherein the DNA binding domain comprises a zinc finger (ZF) protein domain. 31. 31. The expression system of embodiment 30, wherein the ZF protein domain is modular in design and composed of one or more zinc finger arrays (ZFAs). 32. 32. The expression system of embodiment 31, wherein the ZF protein domain comprises an array of 1 to 10 zinc finger motifs. 33. 33. An expression system according to any one of embodiments 29 to 32, wherein the ZF protein domain comprises an array of six zinc finger motifs. 34. 34. The expression system of any one of embodiments 29 to 33, wherein each ligand binding domain comprises a single domain antibody. 35. Single domain antibodies, V H 35. The expression system of embodiment 34, comprising H. 36. V H H is anti-caffeine V H H(ac V H H). 37. Anti-caffeine V H H(acV H 37. The expression system of embodiment 36, wherein H) comprises the amino acid sequence of SEQ ID NO: 52. 38. Each of the first ligand-binding domain and the second ligand-binding domain is H 38. The expression system of embodiment 36 or embodiment 37, comprising H. 39. 39. The expression system of embodiment 38, wherein the first monomer and the second monomer are capable of forming a homodimer upon binding to caffeine. 40. The cognate ligand is cannabidiol or a phytocannabinoid, H 36. The expression system of embodiment 35, wherein H comprises an amino acid sequence selected from the group consisting of SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, and SEQ ID NO:57 (CA14, DB6, DB11, DB18, and DB21, respectively). 41. The first ligand-binding domain comprises the amino acid sequence of SEQ ID NO:53 (CA-14). H H, and the second binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, and SEQ ID NO:57 (DB6, DB11, DB18, and DB21, respectively). H 41. The expression system of embodiment 40, comprising H. 42. The first ligand-binding domain comprises the amino acid sequence of SEQ ID NO:53 (CA-14). H H, and the second binding domain comprises the amino acid sequence of SEQ ID NO: 57 (DB-21) V H 41. The expression system of embodiment 40, comprising H. 43. 43. The expression system according to any one of embodiments 40 to 42, wherein the first monomer and the second monomer are capable of forming a heterodimer upon binding to cannabidiol or a phytocannabinoid. 44. 34. The engineered expression system of any one of embodiments 29 to 33, wherein each ligand binding domain comprises an anti-nicotine antibody heavy chain variable domain (anti-Nic VH) or an anti-nicotine antibody light chain variable domain (anti-Nic VL). 45. 45. The expression system of embodiment 44, wherein the anti-Nic VH comprises the amino acid sequence of SEQ ID NO:58. 46. 46. ​​The expression system of embodiment 44 or 45, wherein the anti-Nic VL comprises the amino acid sequence of SEQ ID NO:59. 47. 47. The expression system according to any one of embodiments 44 to 46, wherein the first ligand binding domain comprises an anti-Nic VH and the second binding domain comprises an anti-Nic VL. 48. 47. The expression system according to any one of embodiments 44 to 46, wherein the first ligand-binding domain comprises an anti-Nic VL and the second ligand-binding domain comprises an anti-Nic VH. 49. 49. The expression system according to any one of embodiments 44 to 48, wherein the first monomer and the second monomer are capable of forming a heterodimer upon binding to nicotine. 50. 50. The expression system of any one of embodiments 29 to 49, further comprising a third expression cassette comprising an ITF responsive promoter operably linked to a gene of interest, the ITF responsive promoter comprising a core promoter sequence and a sequence that binds to the DNA-binding domain of the first engineered polypeptide. 51. 51. The expression system of embodiment 50, wherein the core promoter sequence comprises a minimal promoter. 52. 52. The expression system of embodiment 50 or embodiment 51, wherein the DNA-binding domain comprises a zinc finger (ZF) protein domain and the sequence that binds to the DNA-binding domain comprises one or more ZF binding sites. 53. 53. The expression system of embodiment 52, wherein the ZF protein domain comprises an array of six zinc finger motifs and the sequence that binds to the DNA binding domain comprises at least one binding site for the six zinc finger motifs. 54. below: a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding a first monomer, the first monomer comprising a DNA-binding domain and a first ligand-binding domain; a second expression cassette comprising a second promoter and an exogenous polynucleotide sequence encoding a second monomer, the second monomer comprising a transcription effector domain and a second ligand binding domain; An expression system comprising: each monomer is capable of oligomerization via binding of a cognate ligand that binds to each ligand-binding domain; Ligand-induced oligomerization of the first and second monomers forms an inducible transcription factor (ITF); the DNA binding domain is modular and comprises a zinc finger protein domain comprising 10 zinc finger arrays (ZFAs); the cognate ligand is selected from the group consisting of rapamycin, AP1903, AP20187, FK1012, derivatives thereof, and analogs thereof; Expression system. 55. 55. The expression system of embodiment 54, wherein each ligand binding domain comprises an FKBP domain or an FRB domain. 56. 56. The expression system of embodiment 55, wherein the FKBP comprises the amino acid sequence of SEQ ID NO:60. 57. 57. An expression system according to embodiment 55 or embodiment 56, wherein the FRB domain comprises the amino acid sequence of SEQ ID NO: 61. 58. 58. The expression system according to any one of embodiments 55 to 57, wherein the first ligand-binding domain comprises an FKBP domain and the second ligand-binding domain comprises an FRB domain. 59. 58. The expression system according to any one of embodiments 55 to 57, wherein the first ligand-binding domain comprises an FRB domain and the second ligand-binding domain comprises an FKBP domain. 60. 60. The expression system according to any one of embodiments 55 to 59, wherein the first monomer and the second monomer are capable of forming a heterodimer upon binding to a ligand selected from the group consisting of rapamycin, AP1903, AP20187, FK1012, derivatives thereof, or analogs thereof. 61. 61. The expression system according to any one of embodiments 29 to 60, wherein the first monomer and / or the second monomer further comprises a nuclear localization signal (NLS). 62. 62. The expression system of embodiment 61, wherein the NLS comprises an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4. 63. 63. The expression system according to any one of embodiments 29 to 62, wherein the second monomer further comprises a nuclear export signal (NES). 64. 64. The expression system of embodiment 63, wherein the NES comprises an amino acid sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14. 65. 65. The expression system according to any one of embodiments 29 to 64, wherein ITF is capable of regulating the transcription of a gene of interest operably linked to an ITF responsive promoter. 66. 66. The expression system according to any one of embodiments 29 to 65, wherein the first and / or second promoter is a constitutive promoter or a regulatable promoter. 67. 67. The expression system according to any one of embodiments 29 to 66, wherein the first and / or second promoter is a synthetic promoter. 68. 66. An expression system according to any one of embodiments 29 to 65, wherein the first promoter and / or the second promoter is a constitutive promoter selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEF1aV1, hCAGG, hEF1aV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb. 69. 69. The expression system of any one of embodiments 29 to 68, further comprising a third expression cassette comprising an ITF-responsive promoter operably linked to a gene of interest, the third promoter comprising a core promoter sequence and a sequence that binds to the DNA-binding domain of the first engineered polypeptide. 70. 70. The expression system of embodiment 69, wherein the core promoter sequence comprises a minimal promoter. 71. 71. The expression system of embodiment 70, wherein the minimal promoter is selected from the group consisting of minP, minCMV, YB_TATA, minTATA, and minTK. 72. 70. The expression system of embodiment 69, wherein the core promoter sequence is derived from a constitutive promoter. 73. 73. The expression system of embodiment 72, wherein the core promoter sequence is derived from a constitutive promoter selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, EF1a, hCAGG, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb. 74. 74. The expression system according to any one of embodiments 29 to 73, wherein the transcription effector domain comprises a transcription activation domain. 75. 75. The expression system of embodiment 74, wherein the transcription activation domain is selected from the group consisting of a herpes simplex virus protein 16 (VP16) activation domain; an activation domain comprising four tandem copies of VP16; a VP64 activation domain; a p65 activation domain of NFκB; an Epstein-Barr virus R transactivator (Rta) activation domain; a tripartite activator comprising VP64, p65, and Rta activation domains (VPR activation domain); and a histone acetyltransferase (HAT) core domain of human E1A-associated protein p300 (p300 HAT core activation domain). 76. 74. The expression system according to any one of embodiments 29 to 73, wherein the transcriptional effector domain comprises a transcriptional repressor domain. 77. Transcriptional repressor domains include the Krüppel-associated box (KRAB) repression domain; histone deacetylase 4 (HDAC4) repressor domain; scleraxis (SCX) HLH domain, inhibitor of DNA binding 1 (ID1) HLH domain, HECT domain and RCC1-like domain-containing protein 2 (HERC2) Cyt-b5 domain, twist-related protein 1 (TWST1) HLH domain, homeobox protein Nkx-2.2 (NKX22) homeodomain, and inhibitor of DNA binding 1 (ID3) HLH domain. 77. The expression system of embodiment 76, wherein the expression domain is selected from the group consisting of: a Twist-related protein 2 (TWST2) HLH domain, an EED repressor domain; a repressor element silencing transcription factor (REST) ​​repression domain; a WRPW motif of Hairy-related basic helix-loop-helix repressor protein (the motif is known as the WRPW repression domain); a DNA (cytosine-5)-methyltransferase 3B (DNMT3B) repression domain; and an HP1 alpha chromoshadow repression domain. 78. 78. The expression system of any one of embodiments 29 to 77, wherein the DNA-binding domain binds to an ITF responsive promoter. 79. An engineered cell comprising an expression system according to any one of embodiments 29 to 53. 80. An engineered cell comprising an expression system according to any one of embodiments 54 to 70. 81. The engineered cell of any one of embodiments 1-28, 79, or 80, comprising a human cell. 82. The engineered cell of any one of embodiments 1-28 or 79-81, comprising a stem cell. 83. The engineered cell of any one of embodiments 1-28 or 79-81, comprising an immune cell. 84. 82. The engineered cell of any one of embodiments 1-28 or 79-81, selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, bone marrow cells, macrophages, monocytes, dendritic cells, red blood cells, platelet cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells. 85. A gene switch for regulating the transcription of a gene of interest, comprising: An engineered cell according to any one of embodiments 8 to 10, Effective doses of caffeine Including, gene switches. 86. A gene switch for regulating the transcription of a gene of interest, comprising: An engineered cell according to any one of embodiments 11 to 13, An effective amount of cannabidiol (CBD) or phytocannabinoids Including, gene switches. 87. A gene switch for regulating the transcription of a gene of interest, comprising: An engineered cell according to any one of embodiments 14 to 17, Effective dose of nicotine Including, gene switches. 88. A gene switch for regulating the transcription of a gene of interest, comprising: An engineered cell according to any one of embodiments 18 to 23, an effective amount of rapamycin; Including, gene switches. 89. 1. A method for modulating transcription of a gene of interest, comprising: Contacting the engineered cells of embodiment 81 with a cognate ligand selected from the group consisting of caffeine, cannabidiol (CBD), phytocannabinoids, and nicotine to induce the formation of an inducible transcription factor (ITF). A method comprising: 90. Culturing the engineered cells for a period of time sufficient to allow ITF to regulate transcription of the gene operably linked to the ITF responsive promoter. 90. The method of embodiment 89, further comprising: 91. 90. The method of embodiment 89, wherein the contacting step is carried out in a human or an animal. 92. 92. The method of embodiment 91, wherein the step of contacting the transformed cell with the cognate ligand comprises administering a pharmacological dose of the cognate ligand to a human or animal. 93. The method of any one of embodiments 89-92, wherein the cognate ligand comprises caffeine. 94. The method of any one of embodiments 89-92, wherein the cognate ligand is cannabidiol (CBD). 95. The method of any one of embodiments 89-92, wherein the cognate ligand is nicotine. 96. 1. A method for modulating transcription of a gene of interest, comprising: contacting the engineered cells of embodiment 80 with rapamycin to induce the formation of inducible transcription factors (ITFs). A method comprising: 97. Culturing the engineered cells for a period of time sufficient to allow ITF to regulate transcription of the gene operably linked to the ITF responsive promoter. 97. The method of embodiment 96, further comprising: 98. 97. The method of embodiment 96, wherein the engineered cell is in a human or animal, and the step of contacting the engineered cell with the cognate ligand comprises administering a pharmacological dose of rapamycin to the human or animal. 99. The method of any one of embodiments 96-98, wherein the transcriptional effector domain of the second monomer comprises a transcriptional activation domain, and regulating transcription comprises activating transcription of a gene of interest. 100. 100. The method of any one of embodiments 96-99, wherein the transcriptional effector domain of the second monomer comprises a transcriptional repressor domain, and regulating transcription comprises suppressing transcription of the gene of interest. 101. 1. An engineered cell comprising an inducible transcription factor (ITF), ITF comprises a DNA-binding domain, a transcriptional effector domain, and a ligand-binding domain; ITF undergoes nuclear localization upon binding to its cognate ligand in the ligand-binding domain, when localized in the cell nucleus, ITF is capable of regulating the transcription of a gene of interest that is operably linked to an ITF responsive promoter; the cognate ligand is mifepristone or a derivative thereof; Engineered cells. 102. 102. The engineered cell of embodiment 101, wherein the ligand binding domain comprises a progesterone receptor domain. 103. The engineered cell of embodiment 102, wherein the progesterone receptor domain comprises the amino acid sequence of SEQ ID NO:68. 104. The engineered cell of any one of embodiments 101 to 103, wherein the DNA binding domain comprises a zinc finger (ZF) protein domain. 105. The engineered cell of embodiment 104, wherein the ZF protein domain is modular in design and composed of one or more zinc finger arrays (ZFAs). 106. The engineered cell of embodiment 105, wherein the ZF protein domain comprises between 1 and 10 zinc finger motifs. 107. The engineered cell of any one of embodiments 104 to 106, wherein the ZF protein domain comprises six zinc finger motifs. 108. The engineered cell of any one of embodiments 101 to 107, wherein the ITF further comprises a peptide linker between the DNA binding domain and the transcriptional effector domain. 109. The engineered cell of any one of embodiments 101-108, wherein the DNA binding domain binds to an ITF responsive promoter. 110. The engineered cell of any one of embodiments 101 to 109, wherein the ITF responsive promoter comprises an ITF binding domain sequence and a core promoter sequence. 111. 111. The engineered cell of embodiment 110, wherein the core promoter sequence comprises a minimal promoter. 112. 112. The engineered cell of embodiment 111, wherein the minimal promoter is selected from the group consisting of minP, minCMV, YB_TATA, minTATA, and minTK. 113. The engineered cell of embodiment 110, wherein the core promoter sequence is derived from a constitutive promoter. 114. 114. The engineered cell of embodiment 113, wherein the core promoter sequence is derived from a constitutive promoter selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, EF1a, hCAGG, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb. 115. An expression cassette comprising an ITF-responsive promoter operably linked to an exogenous polynucleotide sequence encoding a gene of interest. 115. The engineered cell of any one of embodiments 101 to 114, further comprising: 116. The engineered cell of any one of embodiments 101-115, wherein the transcriptional effector domain comprises a transcriptional activation domain. 117. The engineered cell of embodiment 116, wherein the transcriptional activation domain is selected from the group consisting of a herpes simplex virus protein 16 (VP16) activation domain; an activation domain comprising four tandem copies of VP16; a VP64 activation domain; a p65 activation domain of NFκB; an Epstein-Barr virus R transactivator (Rta) activation domain; a tripartite activator comprising VP64, p65, and Rta activation domains (VPR activation domain); and a histone acetyltransferase (HAT) core domain of human E1A-associated protein p300 (p300 HAT core activation domain). 118. 116. The engineered cell of any one of embodiments 101-115, wherein the transcriptional effector domain comprises a transcriptional repressor domain. 119. Transcriptional repressor domains include the Krüppel-associated box (KRAB) repression domain; truncated Krüppel-associated box (KRAB) repression domain; histone deacetylase 4 (HDAC4) repressor domain; scleraxis (SCX) HLH domain; inhibitor of DNA binding 1 (ID1) HLH domain; HECT domain and RCC1-like domain-containing protein 2 (HERC2) Cyt-b5 domain; twist-related protein 1 (TWST1) HLH domain; homeobox protein Nkx-2.2 (NKX22) homeodomain; and DNA binding 1 (ID3) H domain. The engineered cell of embodiment 118, wherein the inhibitor is selected from the group consisting of an inhibitor of the LH domain, and a twist-related protein 2 (TWST2) HLH domain, and an EED repressor domain; a repressor element silencing transcription factor (REST) ​​repression domain; a WRPW motif of the hairy-associated basic helix-loop-helix repressor protein (the motif is known as the WRPW repression domain); a DNA (cytosine-5)-methyltransferase 3B (DNMT3B) repression domain; and an HP1 alpha chromoshadow repression domain. 120. A first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding an inducible transcription factor (ITF). An expression system comprising: ITF comprises a DNA-binding domain, a transcriptional effector domain, and a ligand-binding domain; ITF undergoes nuclear localization upon binding to its cognate ligand in the ligand-binding domain, when localized in the cell nucleus, ITF is capable of regulating the transcription of a gene of interest that is operably linked to an ITF responsive promoter; the cognate ligand is mifepristone or a derivative thereof; Expression system. 121. 121. The expression system of embodiment 120, wherein the ligand binding domain comprises a progesterone receptor domain. 122. 122. The expression system of embodiment 121, wherein the progesterone receptor domain comprises the amino acid sequence of SEQ ID NO:68. one two three. 123. An expression system according to any one of embodiments 120 to 122, wherein the DNA binding domain comprises a zinc finger (ZF) protein domain. 124. The expression system of embodiment 123, wherein the ZF protein domain is modular in design and composed of one or more zinc finger arrays (ZFAs). 125. 125. The expression system of embodiment 124, wherein the ZF protein domain comprises 1 to 10 zinc finger motifs. 126. 126. An expression system according to any one of embodiments 120 to 125, wherein the ZF protein domain comprises six zinc finger motifs. 127. 127. The expression system according to any one of embodiments 120 to 126, wherein the ITF further comprises a linker located between the DNA binding domain and the transcription effector domain. 128. 128. An expression system according to any one of embodiments 120 to 127, wherein the transcription effector domain comprises a transcription activation domain. 129. The expression system of embodiment 128, wherein the transcriptional activation domain is selected from the group consisting of a herpes simplex virus protein 16 (VP16) activation domain; an activation domain comprising four tandem copies of VP16; a VP64 activation domain; a p65 activation domain of NFκB; an Epstein-Barr virus R transactivator (Rta) activation domain; a tripartite activator comprising VP64, p65, and Rta activation domains (VPR activation domain); and a histone acetyltransferase (HAT) core domain of human E1A-associated protein p300 (p300 HAT core activation domain). 130. 128. An expression system according to any one of embodiments 120 to 127, wherein the transcriptional effector domain comprises a transcriptional repressor domain. 131. Transcriptional repressor domains include the Krüppel-associated box (KRAB) repression domain; histone deacetylase 4 (HDAC4) repressor domain; scleraxis (SCX) HLH domain, inhibitor of DNA binding 1 (ID1) HLH domain, HECT domain and RCC1-like domain-containing protein 2 (HERC2) Cyt-b5 domain, twist-related protein 1 (TWST1) HLH domain, homeobox protein Nkx-2.2 (NKX22) homeodomain, and inhibitor of DNA binding 1 (ID3) HLH domain. The expression system of embodiment 130, wherein the agent is selected from the group consisting of a twist-related protein 2 (TWST2) HLH domain, an EED repressor domain; a repressor element silencing transcription factor (REST) ​​repression domain; a WRPW motif of hairy-related basic helix-loop-helix repressor protein (the motif is known as the WRPW repression domain); a DNA (cytosine-5)-methyltransferase 3B (DNMT3B) repression domain; and an HP1 alpha chromoshadow repression domain. 132. 132. The expression system according to any one of embodiments 120 to 131, wherein the DNA-binding domain binds to an ITF-responsive promoter. 133. 133. The expression system according to any one of embodiments 120 to 132, wherein the first promoter is a constitutive promoter, a regulatable promoter, or a synthetic promoter. 134. 134. The expression system of embodiment 133, wherein the first promoter is a constitutive promoter selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEF1aV1, hCAGG, hEF1aV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb. 135. An expression cassette comprising an ITF-responsive promoter operably linked to an exogenous polynucleotide sequence encoding a gene of interest. 135. The expression system according to any one of embodiments 120 to 134, further comprising: 136. 136. The expression system of embodiment 135, wherein the ITF responsive promoter comprises an ITF binding domain sequence and a core promoter sequence. 137. 137. The expression system of embodiment 136, wherein the core promoter sequence comprises a minimal promoter. 138. 138. The expression system of embodiment 137, wherein the minimal promoter is selected from the group consisting of minP, minCMV, YB_TATA, minTATA, and minTK. 139. 139. The expression system of embodiment 138, wherein the core promoter sequence is derived from a constitutive promoter. 140. The expression system of embodiment 139, wherein the core promoter sequence is derived from a constitutive promoter selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, EF1a, hCAGG, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb. 141. An engineered cell comprising the expression system of any one of embodiments 120 to 140. 142. 142. The engineered cell of any one of embodiments 101-119 or 141, comprising a human cell. 143. The engineered cell of any one of embodiments 101-119, 141, or 142, comprising a stem cell. 144. 143. The engineered cell of any one of embodiments 1-119, 141, or 142, comprising an immune cell. 145. 143. The engineered cell of any one of embodiments 101-119, 141, or 142, selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, bone marrow cells, macrophages, monocytes, dendritic cells, red blood cells, platelet cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells. 146. A gene switch for regulating the transcription of a gene of interest, comprising: An engineered cell according to any one of embodiments 101 to 119 or 141 to 145; An effective dose of mifepristone Including, gene switches. 147. 1. A method for modulating transcription of a polypeptide of interest, comprising the steps of: Contacting the engineered cells according to any one of embodiments 101-119 or 142-146 with mifepristone to induce nuclear localization of inducible transcription factor (ITF). A method comprising: 148. Culturing the engineered cells for a period of time sufficient to allow ITF to regulate transcription of the gene operably linked to the ITF responsive promoter. 148. The method of embodiment 147, further comprising: 149. The method of embodiment 147, wherein the engineered cells are in a human or animal, and the step of contacting the engineered cells with mifepristone comprises administering a pharmacological dose of mifepristone to the human or animal. 150. The method of any one of embodiments 147-149, wherein the transcriptional effector domain comprises a transcriptional activation domain, and regulating transcription comprises activating transcription of a gene of interest. 151. 150. The method of any one of embodiments 147-149, wherein the transcriptional effector domain comprises a transcriptional repressor domain, and regulating transcription comprises suppressing transcription of the gene of interest. EXAMPLES

[0351] Below are examples of specific embodiments for carrying out the present disclosure. The examples are presented for illustrative purposes only and are not intended to limit the scope of the present disclosure in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

[0352] The practice of the present disclosure will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA techniques, and pharmacology, within the skill of those in the art. Such techniques are explained fully in the literature, see, for example, TECreighton, Proteins: Structures and Molecular Properties (WH Freeman and Company, 1993); A. L. Lehninger, Biochemistry (Worth Publishers, Inc., latest supplement); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3rd Edition (Easton, Pennsylvania: Mack Publishing Company, 1992); rd Ed. (Plenum Press) Vols A and B (1992).

[0353] Example 1: Transcriptional regulation by drug-inducible transcription factors Transduction assays were performed to assess mCherry expression in response to inducible transcription factors activated by caffeine, rapamycin, CBD, or nicotine.

[0354] Materials and Methods U87-MG cells were transduced with a lentivirus encoding a synthetic ITF-responsive promoter (SEQ ID NO: 65) composed of 4xZF binding sites that bind ZF10 linked to the minimal promoter YBTATA. The promoter drives expression of mCherry. This cell line was designated the "reporter cell." The caffeine-inducible transcription factor construct was expressed in the anti-caffeine V H H ("aCaff"), a first monomeric construct (Construct 1) composed of a zinc finger protein domain (ZF10) of SEQ ID NO: 1, a nuclear localization signal of SEQ ID NO: 2, a cleavable linker, and a blue fluorescent protein tag, as well as a nuclear export signal (NES) of SEQ ID NO: 5, a VPR transcription activation domain, an anti-caffeine V H The rapamycin-inducible transcription factor constructs included a first monomeric construct (construct 3) comprised of an FKBP domain, a zinc finger protein domain of SEQ ID NO: 1, a nuclear localization signal of SEQ ID NO: 2, a cleavable linker, and a blue fluorescent protein tag (construct 1), and a second monomeric construct (construct 4) comprised of a nuclear export signal (NES) of SEQ ID NO: 5, a VPR transcription activation domain, an FRB domain, a cleavable linker, and a green fluorescent protein tag. The cannabinoid-inducible transcription factor constructs included a first monomeric construct (construct 4) comprised of an FKBP domain, a zinc finger protein domain of SEQ ID NO: 1, a nuclear localization signal of SEQ ID NO: 2, a cleavable linker, and a blue fluorescent protein tag (construct 1). H H(CA-14), a zinc finger protein domain of SEQ ID NO:1, a nuclear localization signal of SEQ ID NO:2, a cleavable linker, and a blue fluorescent protein tag (Construct 5), and a nuclear export signal (NES) of SEQ ID NO:5, a VPR transcription activation domain, a first anti-CBD V HA second anti-CBD V that can oligomerize with H H The nicotine-inducible transcription factor constructs included a first monomeric construct (construct 7) composed of an anti-nicotine VH, a zinc finger protein domain of SEQ ID NO: 1, a nuclear localization signal of SEQ ID NO: 2, a cleavable linker, and a blue fluorescent protein tag, and a second monomeric construct (construct 8) composed of a nuclear export signal (NES) of SEQ ID NO: 5, a VPR transcription activation domain, an anti-nicotine VL capable of oligomerizing with the anti-nicotine VH of the first construct, a cleavable linker, and a green fluorescent protein tag.

[0355] On day 1, reporter cells were transduced with lentiviruses encoding the DNA constructs shown in Table 4.

[0356] Table 4. Constructs used to transduce reporter cells TIFF2024515182000013.tif47134

[0357] On day 2, to assay for transcriptional regulation regulated by caffeine, rapamycin, cannabidiol (CBD), and nicotine, cell groups A-D and a control cell group (non-transduced) were split into 48-well plates with caffeine, rapamycin, CBD, or nicotine drug treatments as shown in Table 5. Cell population E was frozen for drug treatment at a later date.

[0358] Table 5: Assay conditions TIFF2024515182000014.tif77154

[0359] On day 4, media was removed from 48-well plates, cells were trypsinized, and then resuspended in fluorescence-activated cell sorting (FACS) buffer and Sytox Red (fluorescence in APC channel) viability dye. Cells were run on a flow cytometer and gated by FSC / SSC for live cells, FSC / Sytox Red for live cells, and green fluorescent protein (GFP) / blue fluorescent protein (BFP)+ for transduced cells. mCherry geometric mean fluorescence intensity (gMFI) was measured at each concentration and normalized to no drug for cell groups A-D and control cell group, as shown in Figure 1.

[0360] result As shown in Figure 1, both rapamycin-regulated transcriptional regulation systems induced mCherry expression in the presence of the drug in a concentration-dependent manner.

[0361] Example 2: A transcriptional regulatory system containing two nuclear localization signals Transfection assays were performed to assess the transcriptional regulatory activity of caffeine-, CBD-, and nicotine-inducible transcription factors using a first and second monomer, each of which contains a nuclear localization signal (NLS).

[0362] Materials and Methods U87MG cells transduced with 4xZF10-1 BS_minYBTATA:mCherry vector (referred to as "reporter cells") were seeded at 6e5 / cell in 6-well plates on day 0.

[0363] Designing a caffeine-inducible transcription factor construct and anti-caffeine V H H ("aCaff"), a zinc finger protein domain of SEQ ID NO: 1 ("ZF10"), a 3X FLAG-tagged nuclear localization signal (NLS) of SEQ ID NO: 2, a cleavable linker, and a blue fluorescent protein tag (BFP), and a first monomeric construct (Construct 10) composed of a Caffeine VPR transcription activation domain, a 3X FLAG-tagged NLS of SEQ ID NO: 2, a VPR transcription activation domain, an anti-caffeine VPR transcription activation domain, and a VPR transcription activation domain. HThe first monomeric construct (construct 11) was composed of an anti-nicotine VH ("aCaff"), a cleavable linker, and a green fluorescent protein tag (GFP). Nicotine-inducible transcription factor constructs were designed and included a first monomeric construct (construct 12) composed of an anti-nicotine VH, a zinc finger protein domain of SEQ ID NO: 1, an NLS of SEQ ID NO: 2, a cleavable linker, and a BFP tag, and a second monomeric construct (construct 13) composed of a 3X FLAG-tagged nuclear localization signal (NLS) of SEQ ID NO: 2, a VPR transcription activation domain, an anti-nicotine VL capable of oligomerizing with the anti-nicotine VH of the first construct, a cleavable linker, and a GFP tag. The cannabinoid-inducible transcription factor constructs included a first anti-CBD VH, a zinc finger protein domain of SEQ ID NO: 1, an NLS of SEQ ID NO: 2, a cleavable linker, and a BFP tag. H H (CA-14), a first monomeric construct (construct 14) consisting of a zinc finger protein domain of SEQ ID NO: 1, a nuclear localization signal of SEQ ID NO: 2, a cleavable linker, and a BFP tag, and a second monomeric construct (construct 15) consisting of a 3X FLAG-tagged nuclear localization signal (NLS) of SEQ ID NO: 2, a VPR transcription activation domain, a first anti-CBD V H A second anti-CBD V that can oligomerize with H H The second monomeric construct (construct 15) consisted of H(DB-21), a cleavable linker, and a GFP tag.

[0364] On day 1, reporter cells were co-transduced with lentiviruses encoding the DNA constructs shown in Table 6.

[0365] Table 6. Constructs used to transduce reporter cells TIFF2024515182000015.tif39128

[0366] On the second day, cells from each cell group FH were split and treated with 10 uM, 1 uM, 0.1 uM, or 0 uM of drug (caffeine for group F, nicotine for group G, or CBD for group H).

[0367] On day 5, flow cytometry was performed and cells were gated on GFP / BFP positive cells and assessed for mCherry expression. mCherry expression was analyzed and plotted as the percentage of mCherry positive cells (Figure 2) and by the mean fluorescence intensity of mCherry (Figure 3).

[0368] result As shown in Figures 2 and 3, nicotine treatment at concentrations of 10 uM and 1 uM induced concentration-dependent reporter expression in cells expressing a nicotine-inducible transcription factor containing an NLS in the first and second monomers.

[0369] Example 3: Transcriptional regulation by drug-inducible transcription factors Transduction assays were performed to assess mCherry expression in response to inducible transcription factors activated by mifepristone.

[0370] Materials and Methods U87-MG cells were transduced with a lentivirus encoding a synthetic ITF-responsive promoter (SEQ ID NO: 65) containing 4xZF binding sites that bind ZF10 linked to the minimal promoter YBTATA. The promoter drives expression of mCherry. This cell line was designated the "reporter cell." The mifepristone-inducible transcription factor construct contains (N- to C-terminally) a zinc finger protein domain of SEQ ID NO: 1 ("ZF10"), a progesterone receptor domain of SEQ ID NO: 68, a p65 transcription activator domain of SEQ ID NO: 70, a cleavable linker (E2A-T2A) of SEQ ID NO: 72, and a blue fluorescent protein tag (BFP) of SEQ ID NO: 74. On day 1, reporter cells were transduced with a lentivirus encoding the mifepristone-inducible transcription factor construct.

[0371] To assay for mifepristone-regulated transcriptional regulation, cell population E was thawed and 4 days later, cells were split into 48-well plates and treated with 0 nM, 1 nM, 100 nM, 1000 nM, or 10000 nM mifepristone. Six days after thawing, cells were trypsinized and then resuspended in FACS buffer and Sytox Red (fluorescence in APC channel) viability dye. Cellular mCherry geometric mean fluorescence intensity (gMFI) was measured at each concentration and normalized to no drug as shown in Figure 4.

[0372] result As shown in FIG. 4, the mifepristone-regulated transcriptional regulation system induced mCherry expression in the presence of the drug in a concentration-dependent manner. Table 14: Sequence TIFF2024515182000016.tif169156TIFF2024515182000017.tif208165TIFF2024515182000018.tif228166TIFF2024515182000019.t if234157TIFF2024515182000020.tif204165TIFF2024515182000021.tif152165TIFF2024515182000022.tif234155TIFF20245151820 00023.tif234152TIFF2024515182000024.tif213165TIFF2024515182000025.tif227165TIFF2024515182000026.tif234155TIFF202 4515182000027.tif234153TIFF2024515182000028.tif211164TIFF2024515182000029.tif171164TIFF2024515182000030.tif114151

[0373] While the present disclosure has been specifically shown and described with reference to preferred and various alternative embodiments, it will be understood by those skilled in the art that various changes in form and details can be made therein without departing from the spirit and scope of the disclosure and the appended claims.

[0374] Incorporation by Reference All publications, patents, patent applications, and other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, or other document was individually indicated to be incorporated by reference for all purposes.

[0375] Equivalent While various specific embodiments have been shown and described, the above specification is not limiting. It will be understood that various changes can be made without departing from the spirit and scope of the disclosure. Many variations will be apparent to those skilled in the art in light of the scope of this specification.

Claims

1. 1. An engineered cell comprising an inducible transcription factor (ITF), The ITF is a first monomer comprising a DNA-binding domain and a first ligand-binding domain; a second monomer comprising a transcription effector domain and a second ligand binding domain; Including, each monomer is capable of oligomerization via a cognate ligand that binds to each ligand-binding domain; Ligand-induced oligomerization forms the ITF; the cognate ligand is selected from the group consisting of caffeine, cannabidiol (CBD), a phytocannabinoid, nicotine, rapamycin, AP1903, AP20187, FK1012, derivatives thereof, and analogs thereof; Optionally, the DNA binding domain comprises a zinc finger (ZF) protein domain; Optionally, each ligand binding domain comprises a single domain antibody; The single domain antibody is Ｈ Contains H, Optionally, the ITF is capable of regulating the transcription of a gene of interest operably linked to an ITF-responsive promoter. Engineered cells.

2. a. The V Ｈ H is anti-caffeine V Ｈ H(ac V Ｈ H) Optionally, said anti-caffeine V Ｈ H(ac V Ｈ H) comprises the amino acid sequence of SEQ ID NO:52; and / or Optionally, each of the first ligand binding domain and the second ligand binding domain comprises the ac V Ｈ Contains H, or b. the cognate ligand is cannabidiol or a phytocannabinoid, and the V Ｈ H comprises an amino acid sequence selected from the group consisting of SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, and SEQ ID NO:57 (CA-14, DB-6, DB-11, DB-18, and DB-21, respectively); Optionally, one of the first or second ligand binding domains comprises the amino acid sequence of SEQ ID NO:53 (CA-14). Ｈ H, and the other of the first or second binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, and SEQ ID NO:57 (DB-6, DB-11, DB-18, and DB-21, respectively). Ｈ Contains H, Optionally, one of the first or second ligand binding domains comprises the amino acid sequence of SEQ ID NO:53 (CA-14). Ｈ H, and the other of the first or second binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, and SEQ ID NO:57 (DB-6, DB-11, DB-18, and DB-21, respectively). Ｈ Contains H, Optionally, one of the first or second ligand binding domains comprises the amino acid sequence of SEQ ID NO:53 (CA-14). Ｈ H, and the other of the first or second binding domain comprises the amino acid sequence of SEQ ID NO: 57 (DB-21). Ｈ Contains H, or c. each ligand binding domain comprises an anti-nicotine antibody heavy chain variable domain (anti-Nic VH) or an anti-nicotine antibody light chain variable domain (anti-Nic VL); Optionally, the anti-Nic VH comprises the amino acid sequence of SEQ ID NO:58, and the anti-Nic VL comprises the amino acid sequence of SEQ ID NO:59; Optionally, one of the first or second ligand binding domains comprises the anti-Nic VH and the other of the first or second ligand binding domains comprises the anti-Nic VL; or d. one of the first or the second ligand binding domain comprises an FKBP domain and the other of the first or the second ligand binding domain comprises an FRB domain; Optionally, the FKBP comprises the amino acid sequence of SEQ ID NO:60; Optionally, the FRB domain comprises the amino acid sequence of SEQ ID NO:61; or e. the first ligand binding domain comprises the FKBP domain and the second ligand binding domain comprises the FRB domain; Optionally, the FKBP comprises the amino acid sequence of SEQ ID NO:60; Optionally, the FRB domain comprises the amino acid sequence of SEQ ID NO:61; or f. one of the first or the second ligand binding domain comprises the FRB domain and the other of the first or the second ligand binding domain comprises the FKBP domain; Optionally, the FKBP comprises the amino acid sequence of SEQ ID NO:60; Optionally, the FRB domain comprises the amino acid sequence of SEQ ID NO:61; or g. the first ligand binding domain comprises the FRB domain and the second ligand binding domain comprises the FKBP domain; Optionally, the FKBP comprises the amino acid sequence of SEQ ID NO:60; Optionally, the FRB domain comprises the amino acid sequence of SEQ ID NO:

61. The engineered cell of claim 1.

3. a. the first monomer and / or the second monomer further comprises a nuclear localization signal (NLS); Optionally, the NLS comprises an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4; and / or b. the second monomer further comprises a nuclear export signal (NES); Optionally, the NES comprises an amino acid sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14; The engineered cell of claim 1.

4. a. the ZF protein domain is modular in design and composed of one or more zinc finger arrays (ZFAs); b. the ZF protein domain comprises an array of 1-10 zinc finger motifs, and / or c. the ZF protein domain comprises an array of six zinc finger motifs; The engineered cell of claim 1.

5. a. the transcriptional effector domain comprises a transcriptional activation domain; Optionally, the transcriptional activation domain is selected from the group consisting of: herpes simplex virus protein 16 (VP16) activation domain; an activation domain comprising four tandem copies of VP16; a VP64 activation domain; the p65 activation domain of NFκB; an Epstein-Barr virus R transactivator (Rta) activation domain; a tripartite activator comprising VP64, p65, and Rta activation domains (VPR activation domain); and a histone acetyltransferase (HAT) core domain of human E1A-associated protein p300 (p300 HAT core activation domain), or b. the transcriptional effector domain comprises a transcriptional repressor domain; Optionally, the transcriptional repressor domain is selected from the group consisting of Krüppel-associated box (KRAB) repression domain; a truncated Krüppel-associated box (KRAB) repression domain; histone deacetylase 4 (HDAC4) repressor domain; scleraxis (SCX) HLH domain, inhibitor of DNA binding 1 (ID1) HLH domain, HECT domain and RCC1-like domain-containing protein 2 (HERC2) Cyt-b5 domain, twisted-related protein 1 (TWST1) HLH domain, homeobox protein Nkx-2.2 (NKX22) homeodomain, DNA binding 1 ( ID3) Inhibitors of HLH domains, and twist-related protein 2 (TWST2) HLH domains, and EED repressor domains; repressor element silencing transcription factor (REST) ​​repression domain; WRPW motif (SEQ ID NO: 76) of hairy-related basic helix-loop-helix repressor protein (said motif is known as the WRPW (SEQ ID NO: 76) repression domain); DNA (cytosine-5)-methyltransferase 3B (DNMT3B) repression domain; and HP1 alpha chromoshadow repression domain; The engineered cell of claim 1.

6. a. comprises human cells, and / or b. comprises stem cells; and / or c. comprises immune cells; and / or d. selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTL), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TIL), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, bone marrow cells, macrophages, monocytes, dendritic cells, red blood cells, platelet cells, human embryonic stem cells (ESC), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSC), induced pluripotent stem cells (iPSC), and iPSC-derived cells; The engineered cell of claim 1.

7. A gene switch for regulating the transcription of a gene of interest, comprising:

10. The engineered cell of claim 1, and a cognate ligand selected from the group consisting of caffeine, cannabidiol (CBD), phytocannabinoids, nicotine, rapamycin, AP1903, AP20187, FK1012, derivatives thereof, and analogs thereof, to induce the formation of an inducible transcription factor (ITF). Including, gene switches.

8. 1. A method for modulating transcription of a gene of interest, comprising: a. contacting the engineered cell of claim 1 with a cognate ligand selected from the group consisting of caffeine, cannabidiol (CBD), phytocannabinoids, and nicotine to induce the formation of an inducible transcription factor (ITF); Optionally, further comprising culturing the engineered cells for a period of time sufficient to allow the ITF to regulate transcription of a gene operably linked to an ITF responsive promoter; Optionally, the contacting step is carried out in a human or an animal; Optionally, the step of contacting the transformed cell with said cognate ligand comprises administering to said human or animal a pharmacological dose of said cognate ligand; or b. contacting the engineered cells of claim 1 with a cognate ligand selected from the group consisting of rapamycin, AP1903, AP20187, FK1012, derivatives thereof, and analogs thereof to induce the formation of an inducible transcription factor (ITF), Optionally, further comprising culturing the engineered cells for a period of time sufficient to allow the ITF to regulate transcription of a gene operably linked to an ITF responsive promoter; Optionally, the engineered cell is in a human or animal, and contacting the engineered cell with the cognate ligand comprises administering a pharmacological dose of the rapamycin to the human or animal; Optionally, the transcription effector domain of the second monomer comprises a transcription activation domain, and modulating transcription comprises activating transcription of the gene of interest, or the transcription effector domain of the second monomer comprises a transcription repressor domain, and modulating transcription comprises repressing transcription of the gene of interest. A method comprising:

9. 1. An engineered cell comprising an inducible transcription factor (ITF), the ITF comprises a DNA-binding domain, a transcriptional effector domain, and a ligand-binding domain; the ITF undergoes nuclear localization upon binding of the ligand-binding domain to its cognate ligand; when localized in the cell nucleus, said ITF is capable of regulating the transcription of a gene of interest operably linked to an ITF responsive promoter; the cognate ligand is mifepristone or a derivative thereof; Optionally, the ligand binding domain comprises a progesterone receptor domain, the progesterone receptor domain comprising the amino acid sequence of SEQ ID NO:68; Optionally, the DNA binding domain comprises a zinc finger (ZF) protein domain; Optionally, the ITF further comprises a peptide linker between the DNA binding domain and the transcriptional effector domain; Optionally, the DNA binding domain binds to the ITF responsive promoter; Optionally, the cell further comprises an expression cassette comprising the ITF responsive promoter operably linked to an exogenous polynucleotide sequence encoding the gene of interest; Optionally, the ITF responsive promoter comprises an ITF binding domain sequence and a core promoter sequence; Optionally, the core promoter sequence comprises a minimal promoter, wherein the minimal promoter is selected from the group consisting of minP, minCMV, YB_TATA, minTATA, and minTK, or the core promoter sequence is derived from a constitutive promoter, wherein the core promoter sequence is derived from a constitutive promoter selected from the group consisting of CMV, EFS, SFFV, SV40, MND, PGK, UbC, EF1a, hCAGG, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, and hUBIb. Engineered cells.

10. a. the ZF protein domain is modular in design and composed of one or more zinc finger arrays (ZFAs); b. the ZF protein domain comprises an array of 1-10 zinc finger motifs, and / or c. the ZF protein domain comprises an array of six zinc finger motifs; The engineered cell of claim 9.

11. a. the transcriptional effector domain comprises a transcriptional activation domain; Optionally, the transcriptional activation domain is selected from the group consisting of: herpes simplex virus protein 16 (VP16) activation domain; an activation domain comprising four tandem copies of VP16; a VP64 activation domain; the p65 activation domain of NFκB; an Epstein-Barr virus R transactivator (Rta) activation domain; a tripartite activator comprising VP64, p65, and Rta activation domains (VPR activation domain); and a histone acetyltransferase (HAT) core domain of human E1A-associated protein p300 (p300 HAT core activation domain), or b. the transcriptional effector domain comprises a transcriptional repressor domain; Optionally, the transcriptional repressor domain is selected from the group consisting of Krüppel-associated box (KRAB) repression domain; a truncated Krüppel-associated box (KRAB) repression domain; histone deacetylase 4 (HDAC4) repressor domain; scleraxis (SCX) HLH domain, inhibitor of DNA binding 1 (ID1) HLH domain, HECT domain and RCC1-like domain-containing protein 2 (HERC2) Cyt-b5 domain, twisted-related protein 1 (TWST1) HLH domain, homeobox protein Nkx-2.2 (NKX22) homeodomain, DNA binding 1 ( ID3) Inhibitors of HLH domains, and twist-related protein 2 (TWST2) HLH domains, and EED repressor domains; repressor element silencing transcription factor (REST) ​​repression domain; WRPW motif (SEQ ID NO: 76) of hairy-related basic helix-loop-helix repressor protein (said motif is known as the WRPW (SEQ ID NO: 76) repression domain); DNA (cytosine-5)-methyltransferase 3B (DNMT3B) repression domain; and HP1 alpha chromoshadow repression domain; The engineered cell of claim 9.

12. a. comprises human cells, and / or b. comprises stem cells; and / or c. comprises immune cells; and / or d. selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTL), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TIL), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, bone marrow cells, macrophages, monocytes, dendritic cells, red blood cells, platelet cells, human embryonic stem cells (ESC), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSC), induced pluripotent stem cells (iPSC), and iPSC-derived cells; The engineered cell of claim 9.

13. 10. A gene switch for regulating transcription of a gene of interest, comprising the engineered cell of claim 9 and mifepristone, or a derivative thereof.

14. A method for regulating the transcription of a gene of interest, comprising the steps of:

10. Contacting the engineered cell of claim 9 with mifepristone, or a derivative thereof, to induce nuclear localization of the inducible transcription factor (ITF), comprising: Optionally, further comprising culturing the engineered cells for a period of time sufficient to allow the ITF to regulate transcription of a gene operably linked to an ITF responsive promoter; Optionally, the engineered cell is in a human or animal, and contacting the engineered cell with mifepristone comprises administering a pharmacological dose of the mifepristone to the human or animal; Optionally, the transcription effector domain comprises a transcription activation domain and regulating transcription comprises activating transcription of the gene of interest, or the transcription effector domain comprises a transcription repressor domain and regulating transcription comprises repressing transcription of the gene of interest.

15. below: a) a first expression cassette comprising a first promoter and an exogenous polynucleotide sequence encoding a first monomer, the first monomer comprising a DNA-binding domain and a first ligand-binding domain; a second expression cassette comprising a second promoter and an exogenous polynucleotide sequence encoding a second monomer, the second monomer comprising a transcription effector domain and a second ligand binding domain; Including, each monomer is capable of oligomerization via a cognate ligand that binds to each ligand-binding domain; ligand-induced oligomerization of the first and second monomers to form an inducible transcription factor (ITF); The cognate ligand is selected from the group consisting of caffeine, cannabidiol (CBD), phytocannabinoids, nicotine, rapamycin, AP1903, AP20187, FK1012, derivatives thereof, and analogs thereof; Expression systems, or b) a first promoter and an exogenous polynucleotide sequence encoding an inducible transcription factor (ITF); Including, the ITF comprises a DNA-binding domain, a transcriptional effector domain, and a ligand-binding domain; the ITF undergoes nuclear localization upon binding of the ligand-binding domain to its cognate ligand; when localized in the cell nucleus, said ITF is capable of regulating the transcription of a gene of interest operably linked to an ITF responsive promoter; the cognate ligand is mifepristone or a derivative thereof; 1. An expression system comprising: Optionally, the DNA binding domain comprises a zinc finger (ZF) protein domain; Optionally, said ZF protein domain is of modular design and composed of one or more zinc finger arrays (ZFAs); Optionally, said ZF protein domain comprises an array of 1-10 zinc finger motifs; Optionally, the expression system further comprises a third expression cassette comprising an ITF responsive promoter operably linked to a gene of interest, the ITF responsive promoter comprising a core promoter sequence and a sequence that binds to the DNA binding domain of the first engineered polypeptide. Expression system.

16. a. The ZF protein domain is modular in design and is composed of one or more zinc finger arrays (ZFAs); and / or b. the ZF protein domain comprises an array of 1-10 zinc finger motifs; 16. An expression system according to claim 15.

17. 16. An engineered cell comprising the expression system of claim 15.

18. a. comprises human cells, and / or b. comprises stem cells; and / or c. comprises immune cells; and / or d. selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTL), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TIL), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, bone marrow cells, macrophages, monocytes, dendritic cells, red blood cells, platelet cells, human embryonic stem cells (ESC), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSC), induced pluripotent stem cells (iPSC), and iPSC-derived cells; 20. The engineered cell of claim 17.

Images