Programmed read-through of nonsense codons by specific oligonucleotides

Abstract

The present invention relates to the field of genetic engineering. In particular, the present invention relates to compositions and methods for treating genetically based diseases and disorders. For example, nucleic acid oligomers that promote translational read-through of premature stop codons that generate non-functional proteins are contemplated. DNA and modified nucleic acid oligos that bind at +4 to +8 (+4, +5, +6, +7 and +8) nucleotide positions downstream of the premature stop codon have successfully promoted read-through of the premature stop codon in the cystic fibrosis gene.

Description

[Technical field]

[0001] Statement of Government Support This invention was made with Government support under GM127094 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0002] FIELD OF THEINVENTION The present invention relates to the field of genetic engineering. In particular, the present invention relates to compositions and methods for treating genetically-based diseases and disorders caused by translation of non-functional proteins from mRNAs with nonsense stop codons. For example, DNA and modified nucleic acid (NA) oligomers that promote translational read-through of premature mRNA stop (nonsense) codons are contemplated. Nonsense codon read-through results in full-length proteins and restores protein function. For example, DNA oligomers that bind starting at +4 to +8 nucleotide positions (i.e., +4, +5, +6, +7, +8 positions) downstream from the first nucleotide of the premature mRNA stop codon (+1 position, see FIG. 1) have successfully promoted read-through. [Background technology]

[0003] background Mutations resulting in premature nonsense (i.e., stop) codons are responsible for more than 10% of human genetic diseases. Stop codons usually result in the physical release of a protein from the ribosome. Thus, premature stop codons result in the translation of a short (e.g., truncated), often non-functional, protein, resulting in disease.

[0004] Most tested drugs (e.g., aminoglycosides (e.g., G418)) can provide total readthrough of nonsense or stop codons, but can also induce miscoding of many cellular mRNAs, thereby producing clinically unacceptable levels of toxicity.

[0005] What is needed in the art are compositions and methods that increase readthrough of premature termination codons in specific mRNA molecules. Summary of the Invention [Means for solving the problem]

[0006] Summary of the Invention The present invention relates to the field of genetic engineering. In particular, the present invention relates to compositions and methods for treating genetically-based diseases and disorders caused by translation of non-functional proteins from mRNAs with nonsense stop codons. For example, DNA and modified nucleic acid (NA) oligomers that promote translational read-through of premature mRNA stop (nonsense) codons are contemplated. Nonsense codon read-through results in full-length proteins and restores protein function. For example, DNA oligomers that initiate and bind at +4 to +8 nucleotide positions downstream from the first nucleotide of the premature mRNA stop codon (+1, see FIG. 1) (i.e., +4, +5, +6, +7, +8 positions) successfully promoted read-through. In comparison, nucleotides placed further downstream (such as at the +9 position) from the first nucleotide of the first nonsense stop codon did not promote read-through.

[0007] In one embodiment, the present invention contemplates a deoxyribonucleic acid (DNA) antisense oligomer complementary to a ribonucleic acid (RNA) sequence beginning between +4 and +8 nucleotide positions downstream of the first nucleotide in a premature stop codon in a messenger RNA (mRNA) molecule. In one embodiment, the premature stop codon is UGAC (RNA). In one embodiment, the premature stop codon is UGAG. In one embodiment, the premature stop codon is UGAA. In one embodiment, the premature stop codon is UGAU. In one embodiment, the DNA oligomer has a melting temperature (T mIn one embodiment, the DNA oligomer has the sequence CCTCCACTCAGTGTGATTCCACCTTC (CFTR +4(60)). In one embodiment, the DNA oligomer is CCACTCAGTGTGATTCCACC (CFTR +7(49)). In one embodiment, the DNA oligomer is GACCTCCACTCAGTGTGATTCCACC (CFTR +7(60)). In one embodiment, the DNA oligomer is CTCAGTGTGATTCCAC (CFTR +8(32)). In one embodiment, the DNA oligomer is ACTCAGTGTGATTCCAC (CFTR +8(34)). In one embodiment, the DNA oligomer is TCCACTCAGTGTGATTCCAC (CFTR +8(47)). In one embodiment, the DNA oligomer is CTCGTTGACCTCCACTCAGTGTGATTCCAC (CFTR +8(66)). In one embodiment, the DNA oligomer is CTGAAGCTGACCCTCAGGCC (Mecp2 +8(57) 255X). In one embodiment, the DNA oligomer is CGGGGAGTGTGGTGGCAG (Mecp2 +8(57) 270X). In one embodiment, the DNA oligomer is TGCAGGAGACCGTACTCCCC (Mecp2 +8(57) 294X). In one embodiment, the antisense oligomer comprises at least one nucleotide having a modification. In one embodiment, these modifications include, but are not limited to, 2'-fluoride (F) modifications, 2'-O-methyl (Ome) modifications, and phosphothioate (PS) linkage modifications. In one embodiment, the antisense oligomer is a CFTR +8(47) oligo, including a fluoride modified CFTR +8(47) oligo. In one embodiment, the fluoride modified CFTR +8(47) oligomer is F In one embodiment, the fluoride-modified CFTR+8(47) oligomer is F CCACF T.C.A.G. F TGTG F ATTC F CAC F It is.

[0008] In one embodiment, the present invention contemplates a composition comprising: i) a deoxyribonucleic acid (DNA) or modified nucleic acid antisense oligomer; and ii) an RNA sequence and a messenger ribonucleic acid (mRNA) molecule encoding a premature stop codon, wherein the antisense oligomer is complementary to the RNA sequence beginning between +4 and +8 nucleotide positions downstream of the first nucleotide of the premature stop codon. In one embodiment, the antisense oligomer is hybridized to the RNA sequence. In one embodiment, the mRNA molecule encodes the cystic fibrosis transmembrane conductance regulator protein (CFTR). In one embodiment, the mRNA molecule encodes methylcytosine-binding protein 2 (Mecp2). In one embodiment, the composition further comprises an aminoglycoside. In one embodiment, the composition further comprises an aminoglycoside concentration that is 1 / 5 of conventional aminoglycoside concentrations that promote translational read-through. In one embodiment, the aminoglycoside is G418. In one embodiment, the aminoglycoside includes, but is not limited to, gentamicin, amikacin, tobramycin, kanamycin, streptomycin, or neomycin. In one embodiment, the premature stop codon is UGAC. In one embodiment, the premature stop codon is UGAG. In one embodiment, the premature stop codon is UGAA. In one embodiment, the premature stop codon is UGAT. In one embodiment, the DNA oligomer has a melting temperature (T mIn one embodiment, the DNA oligomer has the sequence CCTCCACTCAGTGTGATTCCACCTTC (CFTR +4(60)). In one embodiment, the DNA oligomer is CCACTCAGTGTGATTCCACC (CFTR +7(49)). In one embodiment, the DNA oligomer is GACCTCCACTCAGTGTGATTCCACC (CFTR +7(60)). In one embodiment, the DNA oligomer is CTCAGTGTGATTCCAC (CFTR +8(32)). In one embodiment, the DNA oligomer is ACTCAGTGTGATTCCAC (CFTR +8(34)). In one embodiment, the DNA oligomer is TCCACTCAGTGTGATTCCAC (CFTR +8(47)). In one embodiment, the DNA oligomer is CTCGTTGACCTCCACTCAGTGTGATTCCAC (CFTR +8(66)). In one embodiment, the DNA oligomer is CTGAAGCTGACCCTCAGGCC (Mecp2 +8(57) 255X). In one embodiment, the DNA oligomer is CGGGGAGTGTGGTGGCAG (Mecp2 +8(57) 270X). In one embodiment, the DNA oligomer is TGCAGGAGACCGTACTCCCC (Mecp2 +8(57) 294X). In one embodiment, the antisense oligomer comprises at least one nucleotide having a modification. In one embodiment, these modifications include, but are not limited to, 2'-fluoride (F) modifications, 2'-O-methyl (Ome) modifications, and phosphothioate (PS) linkage modifications. In one embodiment, the antisense oligomer is a CFTR +8(47) oligo, including a fluoride modified CFTR +8(47) oligo. In one embodiment, the fluoride modified CFTR +8(47) oligomer is F In one embodiment, the fluoride-modified CFTR+8(47) oligomer is F CCACF T.C.A.G. F TGTG F ATTC F CAC F It is.

[0009] In one embodiment, the present invention contemplates a method comprising: a) providing a patient comprising: i) a messenger ribonucleic acid (mRNA) molecule having a premature stop codon and exhibiting at least one symptom of a medical disorder; and ii) a pharma- ceutically acceptable composition comprising a deoxyribonucleic acid (DNA) or modified nucleic acid antisense oligomer complementary to an mRNA sequence beginning between +4 and +8 nucleotide positions downstream of the first nucleotide of the premature stop codon; and b) administering the pharma- ceutically acceptable composition to the patient such that at least one symptom of the medical disorder is reduced. In one embodiment, the medical disorder is caused by the premature stop codon. In one embodiment, the medical disorder is cystic fibrosis or Rett's syndrome. In one embodiment, the pharma- ceutically acceptable composition further comprises an aminoglycoside. In one embodiment, the administering step does not produce aminoglycoside side effects. In one embodiment, the aminoglycoside is G418. In one embodiment, the aminoglycoside includes, but is not limited to, gentamicin, amikacin, tobramycin, kanamycin, streptomycin, or neomycin. In one embodiment, the mRNA molecule encodes a cystic fibrosis transmembrane conductance regulator protein. In one embodiment, the mRNA molecule encodes methylcytosine-binding protein 2. In one embodiment, the premature stop codon is UGAC. In one embodiment, the premature stop codon is UGAG. In one embodiment, the premature stop codon is UGAA. In one embodiment, the premature stop codon is UGAT. In one embodiment, the DNA oligomer has a melting temperature (T mIn one embodiment, the DNA oligomer has the sequence CCTCCACTCAGTGTGATTCCACCTTC (CFTR +4(60)). In one embodiment, the DNA oligomer is CCACTCAGTGTGATTCCACC (CFTR +7(49)). In one embodiment, the DNA oligomer is GACCTCCACTCAGTGTGATTCCACC (CFTR +7(60)). In one embodiment, the DNA oligomer is CTCAGTGTGATTCCAC (CFTR +8(32)). In one embodiment, the DNA oligomer is ACTCAGTGTGATTCCAC (CFTR +8(34)). In one embodiment, the DNA oligomer is TCCACTCAGTGTGATTCCAC (CFTR +8(47)). In one embodiment, the DNA oligomer is CTCGTTGACCTCCACTCAGTGTGATTCCAC (CFTR +8(66)). In one embodiment, the DNA oligomer is CTGAAGCTGACCCTCAGGCC (Mecp2 +8(57) 255X). In one embodiment, the DNA oligomer is CGGGGAGTGTGGTGGCAG (Mecp2 +8(57) 270X). In one embodiment, the DNA oligomer is TGCAGGAGACCGTACTCCCC (Mecp2 +8(57) 294X). In one embodiment, the antisense oligomer comprises at least one nucleotide having a modification. In one embodiment, these modifications include, but are not limited to, 2'-fluoride (F) modifications, 2'-O-methyl (Ome) modifications, and phosphothioate (PS) linkage modifications. In one embodiment, the antisense oligomer is a CFTR +8(47) oligo, including a fluoride modified CFTR +8(47) oligo. In one embodiment, the fluoride modified CFTR +8(47) oligomer is F In one embodiment, the fluoride-modified CFTR+8(47) oligomer is F CCACF T.C.A.G. F TGTG F ATTC F CAC F It is.

[0010] In one embodiment, the present invention contemplates a method comprising: a) providing a patient comprising: i) a messenger ribonucleic acid (mRNA) molecule having a premature stop codon and exhibiting at least one symptom of a medical disorder; and ii) a pharma- ceutically acceptable composition comprising an aminoglycoside and a deoxyribonucleic acid (DNA) or modified nucleic acid antisense oligomer complementary to an mRNA sequence beginning between +4 and +8 nucleotide positions downstream of the first nucleotide of the premature stop codon; and b) administering the pharma- ceutically acceptable composition to the patient such that at least one symptom of the medical disorder is reduced. In one embodiment, the administering has a synergistic reduction of the at least one symptom compared to the aminoglycoside alone. In one embodiment, the medical disorder is caused by the premature stop codon. In one embodiment, the medical disorder is cystic fibrosis or Rett's syndrome. In one embodiment, the pharma- ceutically acceptable composition further comprises an aminoglycoside. In one embodiment, the administering step does not cause aminoglycoside side effects. In one embodiment, the aminoglycoside is G418. In one embodiment, the aminoglycoside includes, but is not limited to, gentamicin, amikacin, tobramycin, kanamycin, streptomycin, or neomycin. In one embodiment, the mRNA molecule encodes a cystic fibrosis transmembrane conductance regulator protein. In one embodiment, the mRNA molecule encodes a methylcytosine-binding protein 2. In one embodiment, the premature stop codon is UGAC. In one embodiment, the premature stop codon is UGAG. In one embodiment, the premature stop codon is UGAA. In one embodiment, the premature stop codon is UGAT. In one embodiment, the DNA oligomer has a melting temperature (T mIn one embodiment, the DNA oligomer has a melting temperature (T mIn one embodiment, the DNA oligomer has the sequence CCTCCACTCAGTGTGATTCCACCTTC (CFTR +4(60)). In one embodiment, the DNA oligomer is CCACTCAGTGTGATTCCACC (CFTR +7(49)). In one embodiment, the DNA oligomer is GACCTCCACTCAGTGTGATTCCACC (CFTR +7(60)). In one embodiment, the DNA oligomer is CTCAGTGTGATTCCAC (CFTR +8(32)). In one embodiment, the DNA oligomer is ACTCAGTGTGATTCCAC (CFTR +8(34)). In one embodiment, the DNA oligomer is TCCACTCAGTGTGATTCCAC (CFTR +8(47)). In one embodiment, the DNA oligomer is CTCGTTGACCTCCACTCAGTGTGATTCCAC (CFTR +8(66)). In one embodiment, the DNA oligomer is CTGAAGCTGACCCTCAGGCC (Mecp2 +8(57) 255X). In one embodiment, the DNA oligomer is CGGGGAGTGTGGTGGCAG (Mecp2 +8(57) 270X). In one embodiment, the DNA oligomer is TGCAGGAGACCGTACTCCCC (Mecp2 +8(57) 294X). In one embodiment, the antisense oligomer comprises at least one nucleotide having a modification. In one embodiment, these modifications include, but are not limited to, 2'-fluoride (F) modifications, 2'-O-methyl (Ome) modifications, and phosphothioate (PS) linkage modifications. In one embodiment, the antisense oligomer is a CFTR +8(47) oligo, including a fluoride modified CFTR +8(47) oligo. In one embodiment, the fluoride modified CFTR +8(47) oligomer is F In one embodiment, the fluoride-modified CFTR+8(47) oligomer is F CCACF T.C.A.G. F TGTG F ATTC F CAC F It is.

[0011] In one embodiment, the present invention contemplates a method comprising: a) providing a pharma- ceutically acceptable composition comprising: i) a patient exhibiting at least one symptom of cystic fibrosis; and ii) a deoxyribonucleic acid (DNA) or modified nucleic acid antisense oligomer complementary to a messenger ribonucleic acid (mRNA) sequence beginning between +4 and +8 nucleotide positions downstream of the first nucleotide of a premature stop codon in an mRNA molecule; and b) providing the pharma- ceutically acceptable composition to the patient such that at least one symptom of cystic fibrosis is reduced. In one embodiment, the pharma- ceutically acceptable composition further comprises an aminoglycoside. In one embodiment, the administering step does not produce aminoglycoside side effects. In one embodiment, the aminoglycoside is G418. In one embodiment, the aminoglycoside includes, but is not limited to, gentamicin, amikacin, tobramycin, kanamycin, streptomycin, or neomycin. In one embodiment, the mRNA sequence encodes a cystic fibrosis transmembrane conductance regulator protein. In one embodiment, the premature stop codon is UGAC. In one embodiment, the premature stop codon is UGAG. In one embodiment, the premature stop codon is UGAA. In one embodiment, the premature stop codon is UGAT. In one embodiment, the DNA oligomer is incubated at a temperature, including but not limited to, 32° C., 34° C., 40° C., 47° C., 53° C., or 66° C. Melting temperature (T mIn one embodiment, the DNA oligomer has the sequence CCTCCACTCAGTGTGATTCCACCTTC (CFTR +4(60)). In one embodiment, the DNA oligomer is CCACTCAGTGTGATTCCACC (CFTR +7(49)). In one embodiment, the DNA oligomer is GACCTCCACTCAGTGTGATTCCACC (CFTR +7(60)). In one embodiment, the DNA oligomer is CTCAGTGTGATTCCAC (CFTR +8(32)). In one embodiment, the DNA oligomer is ACTCAGTGTGATTCCAC (CFTR +8(34)). In one embodiment, the DNA oligomer is TCCACTCAGTGTGATTCCAC (CFTR +8(47)). In one embodiment, the DNA oligomer is CTCGTTGACCTCCACTCAGTGTGATTCCAC (CFTR +8(66)). In one embodiment, the antisense oligomer comprises at least one nucleotide having a modification. In one embodiment, these modifications include, but are not limited to, a 2'-fluoride (F) modification, a 2'-O-methyl (Ome) modification, and a phosphothioate (PS) linkage modification. In one embodiment, the antisense oligomer is a CFTR +8(47) oligo, including a fluoride modified CFTR +8(47) oligo. In one embodiment, the fluoride modified CFTR +8(47) oligomer is TCCACTCAGTGTGATTCCAC F In one embodiment, the fluoride-modified CFTR+8(47) oligomer is F CCAC F T.C.A.G. F TGTG F ATTC F CAC F It is.

[0012] In one embodiment, the present invention contemplates a method comprising: a) providing a pharma- ceutically acceptable composition comprising: i) a patient exhibiting at least one symptom of Rett Syndrome; and ii) a deoxyribonucleic acid (DNA) or modified nucleic acid antisense oligomer complementary to a messenger ribonucleic acid (mRNA) sequence beginning between +4 and +8 nucleotide positions downstream of the first nucleotide of a premature stop codon in an mRNA molecule; and b) administering the pharma- ceutically acceptable composition to the patient such that at least one symptom of Rett Syndrome is reduced. In one embodiment, the pharma- ceutically acceptable composition further comprises an aminoglycoside. In one embodiment, the administering step does not produce aminoglycoside side effects. In one embodiment, the aminoglycoside is G418. In one embodiment, the aminoglycoside includes, but is not limited to, gentamicin, amikacin, tobramycin, kanamycin, streptomycin, or neomycin. In one embodiment, the mRNA sequence encodes methylcytosine binding protein 2. In one embodiment, the premature stop codon is UGAA. In one embodiment, the premature stop codon is UGAT. In one embodiment, the DNA oligomer is CTGAAGCTGACCCTCAGGCC (Mecp2 +8(57) 255X). In one embodiment, the DNA oligomer is CGGGGAGTGTGGTGGCAG (Mecp2 +8(57) 270X). In one embodiment, the DNA oligomer is TGCAGGAGACCGTACTCCCC (Mecp2 +8(57) 294X).

[0013] In one embodiment, the present invention contemplates a method comprising: a) providing a pharma- tically acceptable composition comprising: i) a patient exhibiting at least one symptom of cystic fibrosis; and ii) an aminoglycoside and a deoxyribonucleic acid (DNA) or modified nucleic acid antisense oligomer complementary to a messenger ribonucleic acid (mRNA) sequence beginning between +4 and +8 nucleotide positions downstream of the first nucleotide of a premature stop codon in an mRNA molecule; and b) administering the pharma- tically acceptable composition to the patient such that the at least one symptom of cystic fibrosis is reduced. In one embodiment, the administering step has a synergistic reduction of the at least one symptom compared to the aminoglycoside alone. In one embodiment, the administering step does not produce aminoglycoside side effects. In one embodiment, the aminoglycoside is G418. In one embodiment, the aminoglycoside includes, but is not limited to, gentamicin, amikacin, tobramycin, kanamycin, streptomycin, or neomycin. In one embodiment, the mRNA sequence encodes a cystic fibrosis transmembrane conductance regulator protein. In one embodiment, the premature stop codon is UGAC. In one embodiment, the premature stop codon is UGAG. In one embodiment, the DNA oligomer has a melting temperature (T mIn one embodiment, the DNA oligomer has the sequence CCTCCACTCAGTGTGATTCCACCTTC (CFTR +4(60)). In one embodiment, the DNA oligomer is CCACTCAGTGTGATTCCACC (CFTR +7(49)). In one embodiment, the DNA oligomer is GACCTCCACTCAGTGTGATTCCACC (CFTR +7(60)). In one embodiment, the DNA oligomer is CTCAGTGTGATTCCAC (CFTR +8(32)). In one embodiment, the DNA oligomer is ACTCAGTGTGATTCCAC (CFTR +8(34)). In one embodiment, the DNA oligomer is TCCACTCAGTGTGATTCCAC (CFTR +8(47)). In one embodiment, the DNA oligomer is CTCGTTGACCTCCACTCAGTGTGATTCCAC (CFTR +8(66)). In one embodiment, the antisense oligomer comprises at least one nucleotide having a modification. In one embodiment, these modifications include, but are not limited to, 2'-fluoride (F) modifications, 2'-O-methyl (Ome) modifications, and phosphothioate (PS) linkage modifications. In one embodiment, the antisense oligomer is a CFTR +8(47) oligo, including a fluoride modified CFTR +8(47) oligo. In one embodiment, the fluoride modified CFTR +8(47) oligomer is TCCACTCAGTGTGATTCCAC F In one embodiment, the fluoride-modified CFTR+8(47) oligomer is F CCAC F T.C.A.G. F TGTG F ATTC F CAC F It is.

[0014] In one embodiment, the present invention contemplates a method comprising: a) providing a pharma- ceutically acceptable composition comprising: i) a patient exhibiting at least one symptom of Rett Syndrome; and ii) an aminoglycoside and a deoxyribonucleic acid (DNA) antisense oligomer complementary to a messenger ribonucleic acid (mRNA) sequence beginning between +4 and +8 nucleotide positions downstream of the first nucleotide of a premature stop codon in an mRNA molecule; and b) administering the pharma- ceutically acceptable composition to the patient such that the at least one symptom of Rett Syndrome is reduced. In one embodiment, the administering step has a synergistic reduction of the at least one symptom compared to the aminoglycoside alone. In one embodiment, the administering step does not produce aminoglycoside side effects. In one embodiment, the aminoglycoside is G418. In one embodiment, the aminoglycoside includes, but is not limited to, gentamicin, amikacin, tobramycin, kanamycin, streptomycin, or neomycin. In one embodiment, the mRNA sequence encodes methylcytosine binding protein 2. In one embodiment, the premature stop codon is UGAC. In one embodiment, the premature stop codon is UGAG. In one embodiment, the DNA oligomer has a melting temperature (T m ). In one embodiment, the premature stop codon is UGAA. In one embodiment, the premature stop codon is UGAT. In one embodiment, the DNA oligomer is CTGAAGCTGACCCTCAGGCC (Mecp2 +8(57) 255X). In one embodiment, the DNA oligomer is CGGGGAGTGTGGTGGCAG (Mecp2 +8(57) 270X). In one embodiment, the DNA oligomer is TGCAGGAGACCGTACTCCCC (Mecp2 +8(57) 294X).

[0015] definition To facilitate understanding of the present invention, a number of terms are defined below. Terms defined herein have the same meaning as commonly understood by those skilled in the art directly related to the present invention. Terms such as "a," "an," and "the" are intended to refer not only to a singular entity, but also to a plural entity, including a general class of which a specific example may be used for illustration. While the terminology herein is used to describe specific embodiments of the present invention, their usage does not define the scope of the invention, except as outlined in the claims.

[0016] The terms "about" or "approximately" as used herein, in any context of any assay measurement system, refer to ±5% of a given measurement.

[0017] The generic term "+#(##)" refers to the nomenclature format of antisense nucleotide linkages as used herein. For example, the designation of the above antisense oligonucleotide "+8(70)" means that "+8" refers to the registered linkage nucleotide that is 8 nucleotides downstream from the first nucleotide of the nonsense / premature stop codon, and "(70)" is the melting temperature of a similar DNA-DNA duplex with the same sequence of the above antisense oligo. The designation of other antisense oligos shown herein follows the same format and interpretation.

[0018] The term "aminoglycoside" as used herein refers to any organic molecule that contains an amino sugar moiety. Clinically, aminoglycosides are a pharmaceutical and bacteriological classification of traditional gram-negative antibacterial drugs that inhibit protein synthesis and contain amino-modified glycosides as part of the molecule. For example, aminoglycosides include, but are not limited to, G418, gentamicin, amikacin, tobramycin, kanamycin, streptomycin and neomycin. It is generally known that administration of conventional concentrations (i.e., doses) of aminoglycosides produces side effects in a large percentage of patients. Such side effects include, but are not limited to, the hearing, renal and vestibular related systems.

[0019] The term "effective amount," as used herein, refers to a particular amount of a pharmaceutical composition comprising a therapeutic agent that achieves a clinically beneficial result (i.e., reduction of symptoms, for example). The toxicity and therapeutic efficacy of such compositions can be determined using standard, e.g., LD, in cell cultures or experimental animals. 50 (a dose that is lethal to 50% of the population) and ED 50 The dose ratio between toxic and therapeutic effects is the therapeutic index, which is the ratio LD 50 / ED 50 Compounds that exhibit large therapeutic indices are preferred. The data obtained from these cell culture assays and additional animal studies can be used in formulating a range of dosages for use in humans. The dosage of such compounds is preferably within the ED 50 The dosage will vary within this range depending on the dosage form used, sensitivity of the patient, and the route of administration.

[0020] The term "symptoms" as used herein refers to any subjective or objective evidence of disease or physical disorder observed by a patient.For example, subjective evidence is usually based on patient self-reporting and may include, but is not limited to, pain, headache, visual disturbance, nausea and / or vomiting.Alternatively, objective evidence is usually the result of medical examination, including, but not limited to, temperature, complete blood count, lipid panel, thyroid panel, blood pressure, heart rate, electrocardiogram, tissue and / or body imaging scan.

[0021] The term "associated with," as used herein, refers to an art-accepted causative relationship between a genetic mutation and a medical condition or disease, e.g., it is art-accepted that patients having a CTFR gene that contains a mutation that results in a premature stop codon have or are at risk for cystic fibrosis.

[0022] The term "disease" or "medical condition", as used herein, refers to any disturbance of the normal state of a living animal or plant body or one of its parts that prevents or alters the performance of a vital function. It is typically manifested by characteristic signs and symptoms, which are usually a response to: i) environmental factors (as malnutrition, industrial accidents, or climate); ii) specific infectious agents (as worms, bacteria, or viruses); iii) an inherent defect of the organism (as a genetic abnormality); and / or iv) a combination of these factors.

[0023] The terms "reduce," "inhibit," "diminish," "suppress," "decrease," "prevent," and grammatical equivalents (including "lower," "smaller," etc.), when referring to the expression of any symptom in an untreated subject compared to a treated subject, mean that the amount and / or magnitude of the symptom in the treated subject is lower than that in the untreated subject by any amount that would be recognized by any medically trained personnel as being directly clinically relevant. In one embodiment, the amount and / or magnitude of the symptom in the treated subject is at least 10% lower, at least 25% lower, at least 50% lower, at least 75% lower, and / or at least 90% lower than the amount and / or magnitude of the symptom in the untreated subject.

[0024] The terms "administered" or "administering," as used herein, refer to any method of providing a composition to a patient such that the composition has its intended effect on the patient. Exemplary methods of administration are by direct mechanisms such as local tissue administration (i.e., for example, extravascular placement), oral ingestion, transdermal patch, topically, inhalation, suppository, and the like.

[0025] The term "patient" or "subject" as used herein may be a human or animal, and need not be hospitalized. For example, an outpatient, nursing home individual is a "patient". A patient may include a human or non-human animal of any age, and thus includes both adults and juveniles (i.e., children). The term "patient" is not intended to imply a need for medical treatment, and thus a patient may participate in an experiment, whether voluntarily or involuntarily, whether clinical or in support of basic science research.

[0026] The term "protein," as used herein, refers to any of a number of naturally occurring highly complex substances (such as enzymes or antibodies) that consist of amino acid residues joined by peptide bonds and contain the elements carbon, hydrogen, nitrogen, oxygen, and usually sulfur. Generally, proteins contain on the order of a few hundred amino acids.

[0027] The term "peptide" as used herein refers to any of a variety of amides derived from two or more amino acids by linking the amino group of one amino acid with the carboxyl group of another, usually obtained by partial hydrolysis of proteins. Generally, peptides contain on the order of several dozen amino acids.

[0028] The term "polypeptide" refers to any of a variety of amides derived from two or more amino acids by linking the amino group of one amino acid with the carboxyl group of another, usually obtained by partial hydrolysis of proteins. Generally, peptides contain on the order of several dozen or more amino acids.

[0029] The terms "pharmacologically acceptable" or "pharmacologically acceptable" as used herein refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to animals or humans.

[0030] The term "pharmacologically acceptable carrier" as used herein includes any and all solvents or dispersion media, including, but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, as well as vegetable oils, coatings, isotonic and absorption delaying agents, liposomes, commercially available detergents, etc. Supplementary active ingredients can also be incorporated into such carriers.

[0031] "Nucleic acid sequence" and "nucleotide sequence" as used herein refer to an oligonucleotide or polynucleotide, and fragments or portions thereof, as well as DNA or RNA or modified analogs thereof, of genomic or synthetic origin, which may be single-stranded or double-stranded and may represent the sense or antisense strand.

[0032] The term "modified nucleic acid," as used herein, refers to any nucleic acid molecule that has a modified backbone, sugar, nucleobase, or novel bases or base pairs.

[0033] The term "isolated nucleic acid," as used herein, refers to any nucleic acid molecule that has been removed from its natural state (e.g., removed from a cell, and in preferred embodiments, free of other genomic nucleic acid).

[0034] The terms "amino acid sequence" and "polypeptide sequence" as used herein are interchangeable and refer to a sequence of amino acids.

[0035] The term "portion," when used in reference to a nucleotide sequence, refers to a fragment of that nucleotide sequence. The fragment may range in size from 5 nucleotide residues to the entire nucleotide sequence minus one nucleic acid residue. When used in reference to an amino acid sequence, it refers to a fragment of that amino acid sequence. The fragment may range in size from 2 amino acid residues to the entire amino acid sequence minus one amino acid residue.

[0036] The terms "nucleic acid sequence" and "nucleotide sequence" as used herein refer to oligonucleotides or polynucleotides, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin, which may be single-stranded or double-stranded and may represent the sense or antisense strand.

[0037] The term "isolated nucleic acid," as used herein, refers to any nucleic acid molecule that has been removed from its natural state (e.g., removed from a cell, and in preferred embodiments, free of other genomic nucleic acid).

[0038] The terms "amino acid sequence" and "polypeptide sequence" as used herein are interchangeable and refer to a sequence of amino acids.

[0039] The term "portion," when used in reference to an amino acid sequence, refers to a fragment of that amino acid sequence. The fragment can range in size from two amino acid residues to the entire amino acid sequence minus one amino acid residue.

[0040] As used herein, the term "antisense" is used in reference to a nucleic acid sequence that is complementary to a specific RNA sequence (e.g., mRNA). Antisense RNA can be produced by any method, including synthesis by splicing a gene of interest in reverse orientation to a viral promoter that allows synthesis of a coding strand. Once introduced into a cell, this transcribed strand combines with the natural mRNA produced by the cell to form a duplex. These duplexes then block either the further transcription of the mRNA or its translation. In this way, mutant phenotypes can be produced. The term "antisense strand" is used in reference to a nucleic acid strand that is complementary to the "sense" strand. The designation (-) (i.e., "negative") is sometimes used in reference to the antisense strand, and the designation (+) is sometimes used in reference to the sense (i.e., "positive") strand.

[0041] The term "functionally equivalent codons" as used herein refers to different codons that code for the same amino acid. This phenomenon is often referred to as the "degeneracy" of the genetic code. For example, six different codons code for the amino acid arginine.

[0042] A "variant" of a protein is defined as an amino acid sequence that differs by one or more amino acids from the polypeptide sequence or any homologue of this polypeptide sequence. Variants may have "conservative" changes (e.g., replacement of leucine with isoleucine), where the substituted amino acid has similar structural or chemical properties. More rarely, variants may have "non-conservative" changes (e.g., replacement of glycine with tryptophan). Similar minor variations may also include amino acid deletions or insertions (i.e., additions), or both. Guidance in determining which and how many amino acid residues can be substituted, inserted or deleted without abolishing biological or immunological activity can be found in the DNAStar® ELISA Kit. (登録商標)The invention may be found using computer programs, including but not limited to software.

[0043] Nucleotide "variants" are defined as novel nucleotide sequences that differ from a reference oligonucleotide by having deletions, insertions and substitutions, which can be detected using a variety of methods (e.g., sequencing, hybridization assays, etc.).

[0044] A "deletion" is defined as a change in either the nucleotide or amino acid sequence in which one or more nucleotides or amino acid residues, respectively, are absent.

[0045] An "insertion" or "addition" is a change in a nucleotide or amino acid sequence which results in the addition of one or more nucleotides or amino acid residues.

[0046] A "substitution" results from the replacement of one or more nucleotides or amino acids by different nucleotides or amino acids, respectively.

[0047] As used herein, the term "complementary" or "complementarity" is used in reference to "polynucleotides" and "oligonucleotides" (which are interchangeable terms referring to sequences of nucleotides) related by base pairing rules. For example, the sequence "CAGT" is complementary to the sequence "GTCA". Complementarity can be "partial" or "total". "Partial" complementarity may mean that one or more nucleic acid bases are not matched according to the base pairing rules. "Total" or "complete" complementarity between nucleic acids may mean that each and every nucleic acid base is matched with another base under the base pairing rules. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands. This is particularly important in amplification reactions, as well as detection methods that rely on binding between nucleic acids.

[0048] The terms "homology" and "homologous" as used herein in reference to a nucleotide sequence refer to the degree of complementarity with another nucleotide sequence. There can be partial or complete homology (i.e., identity). A nucleotide sequence that is partially complementary, i.e., "substantially homologous" to a nucleic acid sequence, is a sequence that at least partially inhibits a completely complementary sequence from hybridizing to a target nucleic acid sequence. Inhibition of hybridization of a completely complementary sequence to a target sequence can be tested using a hybridization assay (Southern or Northern blot, solution hybridization, etc.) under low stringency conditions. A substantially homologous sequence or probe competes for or inhibits the binding (i.e., hybridization) of a completely homologous sequence to a target sequence under low stringency conditions. This does not mean that the conditions of low stringency are such that non-specific binding is allowed; they require that the binding of two sequences to each other is a specific (i.e., selective) interaction. The absence of non-specific binding can be tested by using a second target sequence that lacks even a partial degree of complementarity (e.g., less than about 30% identity); in the absence of non-specific binding, the probe does not hybridize to the second non-complementary target.

[0049] The terms "homology" and "homologous" as used herein in reference to amino acid sequences refer to the degree of primary structure identity between two amino acid sequences. Such degree of identity may relate to a portion of each amino acid sequence, or to the entire length of the amino acid sequence. Two or more amino acid sequences that are "substantially homologous" may have at least 50% identity, preferably at least 75% identity, more preferably at least 85% identity, most preferably at least 95% identity, or 100% identity.

[0050] An oligonucleotide sequence that is a "homolog" is defined herein as an oligonucleotide sequence that exhibits greater than or equal to 50% identity to a sequence when sequences having a length of 100 bp or greater are compared.

[0051] As used herein, the terms "hybridization," "hybridized," or "hybridizing" are used in reference to the pairing of complementary nucleic acids using any process in which a strand of nucleic acid binds to a complementary strand through base pairing to form a hybridization complex. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) depend on the degree of complementarity between the nucleic acids, the stringency of the conditions involved, the T of the hybrid formed, and the degree of complementarity between the nucleic acids. m and the G:C ratio within the nucleic acid.

[0052] As used herein, the term "hybridization complex" refers to a complex formed between two nucleic acid sequences by the formation of hydrogen bonds between complementary G and C bases, and between complementary A and T bases; these hydrogen bonds may be further stabilized by base stacking interactions. The two complementary nucleic acid sequences hydrogen bond in an antiparallel configuration. Hybridization complexes form in solution (e.g., C 0 t or R 0 In some embodiments, the nucleic acid sequence may be immobilized on a solid support (e.g., a nylon membrane or nitrocellulose filter as used in Southern and Northern blotting, dot blotting, or a glass slide as used in in situ hybridization, including FISH (fluorescence in situ hybridization)).

[0053] As used herein, the term "T m" is used in reference to the "melting temperature." The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half-dissociated into single strands. As indicated by standard references, T m A simple estimate of the value, when the nucleic acid is in an aqueous solution of 1M NaCl, is given by the formula: T m =81.5+0.41(% G+C) can be calculated by Anderson et al., "Quantitative Filter Hybridization" In: Nucleic Acid Hybridization (1985). More sophisticated calculations have been done to compare structural and sequence properties with T m is taken into account in the calculation of

[0054] The term "DNA oligomer" is said to have a "5' end" and a "3' end" because mononucleotides are reacted to make the oligonucleotide in such a manner that the 5' phosphate of one mononucleotide pentose ring is unidirectionally attached to the 3' oxygen of its neighbor via a phosphodiester linkage. Thus, an end of an oligonucleotide is said to be the "5' end" when its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring. An end of an oligonucleotide is said to be the "3' end" when its 3' oxygen is not linked to the 5' phosphate of another mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, may also be said to have a 5' end and a 3' end. In either a linear or circular DNA molecule, separate elements are said to be "upstream" or 5' of the "downstream" or 3' element. This terminology reflects the fact that transcription proceeds in a 5' to 3' manner along the DNA strand. The promoter and enhancer elements that induce transcription of linked genes are generally located 5' or upstream of the coding region. However, enhancer elements can exert their effect even when located 3' of the promoter element and coding region. Transcription termination and polyadenylation signals are located 3' and downstream of the coding region.

[0055] As used herein, the term "oligonucleotide having a nucleotide sequence encoding a gene" refers to a nucleic acid sequence that comprises the coding region of a gene, i.e., the nucleic acid sequence that encodes a gene product. The coding region may be present in cDNA, genomic DNA, or RNA form. When present in DNA form, the oligonucleotide may be single-stranded (i.e., the sense strand) or double-stranded. Appropriate control elements (e.g., enhancers / promoters, splice sites, polyadenylation signals, etc.) may be placed immediately adjacent to the coding region of the gene, as necessary to allow proper initiation of transcription and / or accurate processing of the primary RNA transcript. Alternatively, the coding region utilized in the expression vector of the present invention may include endogenous enhancers / promoters, splice sites, intervening sequences, polyadenylation signals, etc., or a combination of both endogenous and exogenous control elements.

[0056] As used herein, the terms "nucleic acid molecule encoding", "RNA sequence encoding", "DNA sequence encoding" and "DNA encoding" refer to the order or sequence of (deoxy)ribonucleotides along a chain of (deoxy)ribonucleic acid. The order of these (deoxy)ribonucleotides determines the order of amino acids along a polypeptide (protein) chain. DNA and RNA sequences thus code for amino acid sequences.

[0057] As used herein, the term "coding region" or "open reading frame (ORF)" when used in reference to a structural gene refers to a nucleotide sequence that encodes the amino acids found in a nascent polypeptide as a result of translation of an mRNA molecule. In eukaryotes, the coding region is bounded on the 5' side by the nucleotide triplet "ATG", which encodes the initiator methionine, and on the 3' side by one of three triplets (i.e., TAA, TAG, TGA) that specify a stop codon.

[0058] As used herein, the term "structural gene" refers to a DNA sequence that codes for an RNA or protein. In contrast, a "regulatory gene" is a structural gene that codes for a product (e.g., a transcription factor) that controls the expression of other genes.

[0059] As used herein, the term "gene" refers to a deoxyribonucleotide sequence that includes the coding region of a structural gene and includes sequences located adjacent to the coding region, flanking both the 5' and 3' ends at a distance of about 1 kb on either end, such that the gene corresponds to the length of the full-length mRNA. Sequences located 5' to the coding region and present on the mRNA are referred to as 5' non-translated sequences. Sequences located 3' or downstream of the coding region and present on the mRNA are referred to as 3' non-translated sequences. The term "gene" encompasses both cDNA and genomic forms of a gene. Genomic forms or clones of a gene contain the coding region interrupted by non-coding sequences referred to as "introns" or "intervening regions" or "intervening sequences". Introns are segments of a gene that are transcribed into heterogeneous nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or "spliced ​​out" from the nuclear or primary transcript; introns are therefore absent in messenger RNA (mRNA) transcripts. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.

[0060] In addition to containing introns, genomic forms of a gene may also contain sequences located on both the 5' and 3' end of the sequences present on the RNA transcript. These sequences are referred to as "flanking" sequences or regions (these flanking sequences are located 5' or 3' to the untranslated sequences present on the mRNA transcript). The 5' flanking region may contain regulatory sequences such as promoters and enhancers that control or influence the transcription of the gene. The 3' flanking region may contain sequences that direct the termination of transcription, post-transcriptional cleavage and polyadenylation.

[0061] The term "binding" as used herein includes any physical attachment or close association, which may be permanent or temporary. In general, interactions such as hydrogen bonds, hydrophobic forces, van der Waals forces, covalent bonds, and ionic bonds facilitate the physical association between the molecule of interest and the analyte being measured. The "binding" interaction may be of short duration, such that the binding is in a situation that allows a chemical reaction to occur. This is typical when the binding component is an enzyme and the analyte is a substrate for that enzyme. Reactions resulting from contact between the binding agent and the analyte are also within the definition of binding for purposes of the present invention.

[0062] The term "binding site" as used herein refers to any molecular configuration having a specific tertiary and / or quaternary structure that undergoes physical binding or close association with a binding component. For example, the molecular configuration may include a sequence of amino acids. Alternatively, the molecular configuration may include a sequence of nucleic acids. Furthermore, the molecular configuration may include a lipid bilayer or other biological material.

[0063] BRIEF DESCRIPTION OF THE DRAWINGS The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee. [Brief description of the drawings]

[0064] [Figure 1]FIG. 1 shows an illustration of the different nucleotide accession nomenclature between that used to describe the present invention and that disclosed in Kar et al., “Induction of Translational Readthrough across the Thalassemia-Causing Premature Stop Codon in β-Globin-Encoding mRNA” Biochemistry 59(1):80-84 (2020; online October 2, 2019). [Diagram 2] FIG. 2 shows an illustration of the translation of a hypothetical protein from an mRNA molecule (black) with either a premature (nonsense) or natural (wild-type) stop codon. FIG. 2A: A truncated protein (blue, left) is generated at the premature stop codon (red, left). A full-length protein (blue, right) is generated at the natural stop codon (blue, left). FIG. 2B: Illustration of a release factor (green) that recognizes and binds to either the premature stop codon (red, left) or the natural stop codon (red, right). The release factor sterically "pulls" the stop codon into the ribosome (grey), thereby releasing the translated protein (blue). Figure 2C: Diagram of site-specific antisense DNA or modified oligos (lime-green) placed downstream of a premature stop codon (red, left) that interferes with the steric "pulling" of a release factor (green) on the ribosome (grey) or other interactions with this factor, thereby allowing complete mRNA readthrough and translation of the full-length protein. [Diagram 3] Figure 3 illustrates a rabbit reticulocyte luciferase mRNA translation assay. Figure 3A: A stepwise diagram showing the translation of a luciferase mRNA molecule (black) with a stop codon (red) into a full-length luciferase protein (blue) that emits light (arrow). Figure 3B: Exemplary data of light intensity (e.g., relative light units (RLUs)) during luciferase mRNA translation. Left panel: Light intensity pattern as a function of time (e.g., seconds). Center panel: Rate of luciferase translation as indicated by light intensity fluctuation over time. Right panel: Maximum achievable rate of luciferase translation as indicated by light intensity fluctuation over time. [Figure 4] Figure 4 shows one embodiment of the CAN1 arginine permease gene / luciferase expression construct (Can1-luc). Top panel: Schematic of the construct showing the relative positions of the luciferase gene with a premature stop codon and the Can1 open reading frame and natural terminal stop codon. Bottom panel: DNase sequence of the Can1-luc construct with a TGA premature stop codon and a DNase oligo hybridized to the Can1-luc construct at the +8 nucleotide position downstream of the premature stop codon. [Diagram 5] FIG. 5 shows exemplary data demonstrating readthrough of a premature stop codon in a CAN1-luc expression construct having a DNA oligo hybridized at the +8 nucleotide position downstream of the premature stop codon. [Figure 6] Figure 6 shows one embodiment of the cystic fibrosis gene / nanoluciferase expression construct (511-565 CFTR). Top panel: Schematic of the construct showing the relative positions of the luciferase gene with a premature stop codon (UGAG or UGAC) and the natural terminal stop codon within the cystic fibrosis open reading frame (CFTR). Bottom panel: Deoxyribonucleic acid sequence of the CFTR construct with a TGA premature stop codon and a deoxyribonucleic acid oligo hybridized to the CFTR construct at the +8 nucleotide position downstream of the premature stop codon. [Figure 7] FIG. 7 shows exemplary data illustrating read-through analysis of CFTR premature stop codon (UGAC) construct expression in the presence of DNA oligos targeted to various nucleotide positions downstream of the premature stop codon and also with different melting temperatures. [Figure 8] 8 shows exemplary data demonstrating the effect of the aminoglycoside G418 on 511-565 CFTR construct expression. Increasing concentrations of G418 increase expression of premature stop codon constructs (UGAG, UGAC) while simultaneously decreasing expression of the wild-type construct without the premature stop codon (GGAG). [Figure 9]9 shows exemplary data demonstrating the synergistic effect of the +8(66) DNA oligo and the aminoglycoside G418 on CFTR DNA construct expression readthrough of a premature stop codon. It is also shown that the +8 oligo in combination with G418 reduces the effective concentration of the aminoglycoside. [Figure 10] FIG. 10 shows exemplary data demonstrating the synergistic effect of the +8(47) DNA oligo and the aminoglycoside G418 on CFTR DNA construct expression readthrough of a premature stop codon. [Figure 11] FIG. 11 shows exemplary data correlating nanoluciferase activity with expressed protein levels validating read-through promotion by oligo constructs as contemplated herein. [Figure 12-1] Figure 12 provides a schematic of a luciferase-based assay (TermiLuc, Susorov, 2020) to identify loss of translation termination steps and promote read-through. Figure 12A: Schematic of the Termi-Luc assay. Figure 12B: An example of a eukaryotic termination complex. [Figure 12-2] Same as above. [Figure 13] FIG. 13 shows exemplary data demonstrating that readthrough-promoting oligos +7 and +8 inhibit termination in a sequence-specific manner in the Termi-Luc assay. [Figure 14] FIG. 14 shows exemplary structures of modified oligos with 2'-fluoride substitutions. [Figure 15] FIG. 15 shows exemplary data demonstrating enhanced read-through with fluoride-modified oligos using a rabbit reticulocyte lysate (RRL) assay. [Figure 16] Figure 16 shows exemplary data demonstrating promotion of CFTR nonsense codon read-through in a dose-dependent manner by a combination of G418 and a modified antisense oligonucleotide. O = modified oligo; G = G418 in cultures of cells expressing CFTR with the premature stop codon G542X fused to HRP to measure chemiluminescence resulting from full-length protein expression. [Figure 17] Figure 17 shows one embodiment of a full-length Mecp2 gene / nanoluciferase expression construct. Figure 17A: Schematic of the construct showing the relative positions of the luciferase gene with premature stop codons and the natural terminal stop codon within the full-length Mecp2 open reading frame. Figure 17B: Exemplary data showing the effect of the +8 DNA oligo on read-through efficiency for the four premature stop codons responsible for Rett syndrome. [Figure 18-1] 18A-D show exemplary data showing next generation bulk sequencing results of PCR amplicons using the TOPO cloning (e.g., allele exclusion) method. [Figure 18-2] Same as above. [Figure 19-1] 19A-F show exemplary data showing analysis of gene expression using both quantitative polymerase chain reaction and Western blot. [Figure 19-2] Same as above. [Figure 19-3] Same as above. [Figure 20-1] 20A-C show exemplary data from a TECC / 24 conductance assay performed one week after filter seeding. [Figure 20-2] Same as above. [Figure 21] 21A-B show exemplary data of transepithelial resistance of the CFF-16HBEge cell line. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0065] Detailed Description of the Invention The present invention relates to the field of genetic engineering. In particular, the present invention relates to compositions and methods for treating genetically-based diseases and disorders caused by translation of non-functional proteins from mRNAs with nonsense stop codons. For example, DNA and modified nucleic acid (NA) oligomers that promote translational read-through of premature mRNA stop (nonsense) codons are contemplated. Nonsense codon read-through results in full-length proteins and restores protein function. For example, DNA oligomers that bind starting at +4 to +8 nucleotide positions (i.e., +4, +5, +6, +7, +8 positions) downstream from the first nucleotide (+1, see FIG. 1) of the premature mRNA stop codon have successfully promoted read-through.

[0066] In one embodiment, the present invention contemplates a method for treating genetic disorders caused by premature nonsense or stop codons. In one embodiment, the genetic disorders include, but are not limited to, cystic fibrosis (CF) or Rett syndrome. In one embodiment, the nonsense or stop codon is an X-stop codon. In one embodiment, the X-stop codon is G542X. In one embodiment, the X-stop is R255X(Rett). In one embodiment, the X-stop is R270X(Rett). In one embodiment, the X-stop is R294X(Rett).

[0067] II. Conventional stop codon read-through method Much effort has been made to identify therapeutic agents that read through premature termination codons and restore full-length protein translation. Small molecules (e.g., aminoglycoside antibiotics) produce systematic miscoding of mRNAs and are of limited therapeutic value. They also produce stop codon readthrough associated with mutant mRNAs, but widespread miscoding of cellular mRNAs makes such molecules toxic and generally poor therapeutic agents. Dabrowski et al., "Advances in therapeutic use of a drug-stimulated translational readthrough of premature termination codons," Mol Med 24 (2018); and Keeling et al., "Therapeutics Based on Stop Codon Readthrough," Annu Rev Genomics Hum Genet. (2014).

[0068] The major reported adverse effects of aminoglycosides are ototoxicity, nephrotoxicity, and neuromuscular blockade. Avent et al., "Current use of aminoglycosides: indications, pharmacokinetics and monitoring for toxicity" Intern Med J. 41(6):441-449(2011). Conventional dosing of aminoglycosides is about 3-5 mg / kg / day given intravenously / intramuscularly (IV / IM) in separate doses, usually every 8 hours. Long-term dosing intervals are about every 24 hours or longer at 4-7 mg / kg / dose IV once daily.

[0069] Aminoglycoside antibiotics are used as conventional treatment for pulmonary exacerbations of cystic fibrosis (CF) to slow the decline in lung function that ultimately causes death in most patients. The prognosis for CF is improving, and therefore the side effects of treatment are becoming increasingly important. Prayle et al., "Side effects of aminoglycosides on the kidney, ear and balance in cystic fibrosis" Thorax 65(7):654-658(2010).

[0070] Observational studies suggest that morbidity from aminoglycoside side effects is disturbingly common and that aggressive treatment may result in more side effects. One common side effect of aminoglycosides is nephrotoxicity. Although the definition of toxicity varies between studies, approximately 5-10% of (non-CF) adult patients receiving aminoglycosides have a significant increase in serum creatinine. Meyer RD., "Risk factors and comparisons of clinical nephrotoxicity of aminoglycosides" Am J Med 80:119-125(1986).

[0071] Toxicity is a function of the aminoglycoside class, but experimental data suggest that gentamicin is more toxic than tobramycin and amikacin. De Broe et al., "Choice of drug and dosage regimen. Two important risk factors for aminoglycoside nephrotoxicity" Am J Med 80:115-118(1986). A quantitative overview of randomized controlled trials (RCTs) broadly reached the same conclusion. Buring et al., "Randomized trials of aminoglycoside antibiotics: quantitative overview" Rev Infect Dis 10:951-7(1988).

[0072] Manipulation of aminoglycoside dosing regimens offers a cost-effective and simple way to reduce renal injury. Given the saturable uptake of aminoglycosides, it has been reported that a once-daily dose is predicted to be less nephrotoxic than the same daily dose divided into three doses. For example, a large randomized trial of tobramycin in patients with CF established that a once-daily dosing regimen was equally effective as a multiple-daily dosing regimen, a finding that has been confirmed in subsequent meta-analyses. In the pediatric group receiving a once-daily dose, serum creatinine levels decreased over the course of treatment compared with increases in the group receiving three divided doses. Further supporting renal safety, in the once-daily arm, NAG increases were 33% lower than those in the group receiving a three-times-daily regimen in both adults and children. Smyth et al., "Once versus three-times daily regimens of tobramycin treatment for pulmonary exacerbations of cystic fibrosis-the TOPIC study: a randomised controlled trial" Lancet 365:573-578(2008); and Smyth et al., "Once-daily versus multiple-daily dosing with intravenous aminoglycosides for cystic fibrosis" Cochrane Database Syst Rev 2006;(3):CD002009. The pharmacokinetics of aminoglycosides is complicated by the circadian rhythm of elimination. Patients in the once-daily group, most of whom received the antibiotic at night, had a lower elimination rate of tobramycin than those in the three-times-daily group.Touw et al., "Population pharmacokinetics of tobramycin administered thrice daily and once daily in children and adults with cystic fibrosis" J Cyst Fibros 6:327-333(2007). There is daily variation in renal clearance of the drug, and reduced clearance may occur at night. This results in increased renal exposure to aminoglycosides during the disease process when the drug is administered at night compared to the morning.

[0073] A selection of studies report ototoxicity as measured by pure tone audiometry (PTA) in CF patients. For example, a study of 70 patients recruited from a CF clinic found that using a definition of two or more thresholds of >20 dB or one >25 dB, they found an overall prevalence of hearing loss of 17% when receiving aminoglycosides. Mulheran et al., "Occurrence and risk of cochleotoxicity in cystic fibrosis patients receiving repeated high-dose aminoglycoside therapy" Antimicrob Agents Chemother 45:2502-2509(2001).

[0074] It has been reported that DNA oligonucleotides complementary to β-globin mRNA at +1 or +9 nucleotides downstream of an artificially introduced premature stop codon "UAG" can induce translational readthrough in cells. Kar et al., "Induction of Translational Readthrough across the Thalassemia-Causing Premature Stop Codon in β-Globin-Encoding mRNA" Biochemistry 59(1):80-84 (2020; online October 2, 2019). However, these DNA oligonucleotides have not been shown to be effective therapeutic agents for any known genetic disorder.

[0075] It should be noted that the DNA oligo start position nomenclature system of Kar et al. is different from that used in the present invention, and the DNA oligo positions used by Kar et al. do not apply to CFTR and Mecp2. In particular, the +1 and +9 positions of Kar correspond to the +4 and +12 positions (respectively) in the case shown herein (see FIG. 1). In conclusion, DNA oligos complementary to mRNA sequences starting at +5 to +8 nucleotide positions downstream of the first nucleotide of the premature stop codon have not been previously reported. In particular, oligonucleotides complementary to CFTR and Mecp2 at +4 to +8 nucleotide positions downstream of the first nucleotide of the premature stop codon have not been previously reported. For example, nucleotides placed further downstream of the first nucleotide of the nonsense codon (e.g., positions +9, +12) did not promote read-through of CFTR.

[0076] II. Nonsense codon-associated protein release factor In one embodiment, this invention contemplates compositions and methods that induce efficient mRNA-specific read-through of premature stop (nonsense) codons with minimal off-target side effects.Although it is not necessary to understand the mechanism of an invention, it is believed that such an approach relies on the structural differences between cellular recognition of stop codons and sense codons.

[0077] For example, cellular recognition of stop codons is thought to be mediated by protein release factors (i.e., eRF1 in eukaryotes). Recognition occurs at the A-site codon, where the eRF1 protein interacts with the mRNA nucleotide sequence at the stop codon and the following nucleotide (e.g., UGAC or UAAA). On the other hand, sense codons of triplets are recognized by tRNA, where the mRNA sequence downstream of the A-site codon then passes through the ribosomal mRNA tunnel into solution. Thus, the eRF1 recognition protein requires the mRNA to be "pulled in" to the A-site codon, whereas the tRNA does not.

[0078] DNA oligonucleotides that base-pair with mRNA next to the ribosomal tunnel were tested to determine whether they could: i) restrict mRNA mobility; ii) render stop codon recognition by eRF1 inefficient; and iii) render tRNA more efficient at misreading the stop codon, thus resulting in readthrough, or iv) act to promote readthrough via a different mechanism.

[0079] III. +4 to +8 antisense oligodeoxyribonucleotides In one embodiment, the present invention contemplates antisense oligonucleotides (oligos) that bind to mRNA at or between +4 and +8 nucleotides downstream of the first nucleotide of the nonsense stop codon.

[0080] The data presented herein demonstrate that DNA antisense oligos annealing to mRNA sequences downstream of premature stop codons promote translational readthrough. Surprisingly, the most effective annealing site for DNA oligos starts at position +8 downstream of the premature stop codon. In that case, position +1 is the first nucleotide of the premature stop codon. It was observed that not all DNA oligos placed downstream of the premature stop codon are equal in promoting readthrough. Readthrough with DNA oligos annealing starting at positions +4 and +7 was lower than that starting at +8, but was more efficient than background readthrough, making a range of antisense oligos binding between +4 and +8 susceptible to promoting translational readthrough of stop codons.

[0081] Translational read-through of a protein truncated around a premature stop codon may differ from that of a full-length protein. For example, stop codons are known to differ in the efficiency of translation termination and subsequent release of the truncated protein. For example, a nonsense mutation resulting in a UGAC premature stop codon is much less efficient at terminating translation (e.g., a weak stop codon) than a wild-type UAAA stop codon (e.g., as a strong stop codon). Because a purine (A, G) nucleotide at position +4 makes translation termination more efficient than a pyrimidine (C, U) at position +4. Thus, UGAC - a "weak" stop codon - is more prone to read-through than a "strong" UAAA stop codon. Indeed, most studies testing small molecules report the most efficient read-through of the UGAC stop codon, whereas UAAA or UGAG may be completely resistant to read-through.

[0082] In one embodiment, the invention contemplates antisense oligonucleotides that efficiently read through and translate functional proteins from mRNAs with "weak" premature stop codons and / or mRNAs with "strong" stop codons, either individually or in combination with aminoglycosides. The data suggest that antisense oligonucleotides complementary to mRNA nucleotide sequences at positions +4 to +8 downstream of the first nucleotide of the premature stop codon are effective therapeutic candidates for genetic diseases caused by nonsense mutations. These findings indicate that DNA complementation of aberrant mRNAs can be specific, yet versatile, since antisense oligos or other nucleic acid sequences (i.e., RNA, LNA and other modifications) can bind to mRNAs with premature stop codons that cause a variety of diseases.

[0083] Some genetic diseases are caused by mRNA molecules with premature stop codons, resulting in truncated proteins being translated and released. In contrast, if an mRNA molecule has a natural (wild-type) stop codon at the appropriate position, a full-length protein is translated and released. See Figure 2A. Translation termination protein factors bind to the stop codon and function to "pull" it into the ribosome, resulting in the release of the protein from the ribosome and preventing further mRNA translation. See Figure 2B. Site-specific antisense oligos placed downstream from the premature stop codon prevent the "pull" of the stop codon into the ribosome, thus inhibiting premature protein translation termination, which results in the read-through of the premature stop codon and the translation of the full-length protein. See Figure 2C.

[0084] The data presented herein were collected using a translation assay in a commercially available cell extract (i.e., rabbit reticulocyte lysate). See Figures 3A and 3B. Preliminary data showed that an antisense oligo placed at the +8 nucleotide position from the RNA premature stop codon (the +1 position corresponds to the U of the stop codon) resulted in excellent readthrough of two different mRNA sequences with premature stop codons, while placement at other downstream positions resulted in less efficient readthrough. Furthermore, the data show that readthrough efficiency was substantially increased by combination of the antisense oligo with low concentrations of an aminoglycoside (e.g., G418), thereby providing 30-40% restoration of functional protein translation.

[0085] The DNA antisense oligo contemplated herein was verified using a DNA expression construct containing a premature stop codon and a luciferase gene. The basic methodology used a CAN1 gene expression construct encoding an arginine permease amino acid transporter protein. The CAN1 expression construct places a TAG premature stop codon at the end of the CAN1 open reading frame, followed by a luciferase open reading frame. See FIG. 4. Then, a DNA antisense oligo +8 (70) with a nucleic acid sequence of 5'-GCGCCGGGCCTTTCTTTATGTTTTTGGCGT-3' was placed at the +8 nucleic acid position downstream of the first nucleotide of the premature stop codon. The data show that the +8 antisense oligo placed downstream of the premature stop codon increases the read-through of the premature stop codon in the CAN1-luc DNA expression construct. See FIG. 5.

[0086] IV. Treating Cystic Fibrosis with Antisense Oligos In one embodiment, the present invention contemplates multiple specific +4 to +8 (eg, +4, +5, +6, +7, +8) antisense oligomers useful in the treatment of cystic fibrosis.

[0087] Cystic fibrosis is an inherited, life-threatening disorder that damages the pulmonary and digestive systems. In particular, cystic fibrosis affects the cells that produce mucus, sweat, and digestive fluids, making these fluids thick and sticky. The causative agent of cystic fibrosis is thought to be the gene mutation G542X, which has a population frequency of about 2.4%.

[0088] In one embodiment, the present invention contemplates a modified cystic fibrosis transmembrane conductance regulator (CFTR) deoxyribonucleic acid (DNA) construct. In one embodiment, the modified CFTR DNA construct comprises a CFTR open reading frame that includes a premature TGA stop codon. In one embodiment, the TGA premature stop codon is a G542X mutation. In one embodiment, the modified CFTR DNA construct further comprises a nanoluciferase gene and a natural stop codon. In one embodiment, the modified CFTR mRNA construct molecule is hybridized to a single-stranded DNA antisense oligo at the +8 nucleotide position downstream of the TGA premature stop codon. In one embodiment, the DNA antisense oligo is 5'-CTCGTTGACCTCCACTCAGTGTGATTCCAC-3'. See FIG. 6.

[0089] 511-565 CFTR DNA expression vector constructs were designed in several different codon configurations: i) a single wild-type sense codon ("GGAG") followed by a wild-type stop codon; ii) a premature stop codon "TGAG" containing a G542X mutation (e.g., a strong stop codon); and iii) a premature stop codon "TGAC" containing a G542X mutation (a weak stop codon) that renders the situation more prone to artificial readthrough. The data showed that CFTR DNA expression vector constructs with the "TGAC" premature stop codon, provided with a DNA antisense oligo that hybridizes at the +8 nucleotide position downstream of the "TGAC" premature stop codon, showed significant translational readthrough compared to downstream positions at +4, +7, +9, +11, and +14 nucleotides. Surprisingly, the +8(32), +8(34), +8(47), and +8(66) DNA antisense oligos showed 4-5 fold higher readthrough compared to other downstream positions. Nevertheless, antisense oligos hybridized at positions +4 and +7 showed dramatically higher readthrough than background readthrough, whereas oligos hybridizing at positions +9, +11 and +14 showed reduced readthrough. See Figure 7.

[0090] The above CFTR premature stop codon DNA construct expression read-through analysis was also performed with the aminoglycoside G418 having the following structure: [ka] The experiment was carried out using The data showed that G418 inhibits wild-type sense codon (GGAG) readthrough in a concentration-dependent manner. Furthermore, G418 promotes premature stop codon (UGAG and UGAC) readthrough in a concentration-dependent manner. See FIG. 8.

[0091] Since aminoglycosides are used in the clinical treatment of several premature stop codon-related diseases, DNA antisense oligos and G418 were evaluated for synergistic effects. The data show that the combination of +8(66) antisense oligos and G418 provides a synergistic effect that promotes up to 5-fold readthrough of premature stop codons using CFTR DNA expression constructs when compared to either G418 or +8(66) DNA oligos alone. See Figure 9. The strong UGAG (patient mutation situation) premature stop codon is more difficult to readthrough than the UGAC premature stop codon. Surprisingly, G418 concentrations of 0.5 μM and 0.1 μM had significantly higher readthrough rates than the 1 μM G418 concentration for both weak (UGAC) and strong UGAG premature codons (patient mutation situation). Similar synergistic data was observed when G418 and +8(47) DNA antisense oligos were used in combination as opposed to alone with CFTR UGAG mRNA. See FIG.

[0092] This mRNA read-through induced by the antisense oligo of the present disclosure was verified by correlating nanoluciferase activity with expressed protein levels. See Figure 11. These data show that translational read-through correlates with a proportionally increased amount of full-length protein, as revealed by an increased luciferase signal.

[0093] The termination step during induced oligo translation read-through of the stop codon was evaluated with a modified luciferase assay (e.g., Termiluc). Briefly, this assay identifies translation termination upon appearance of light in the presence of eRF1 eukaryotic termination protein. See Figures 12A and 12B. The data show that read-through promoter oligonucleotides inhibit translation termination in vivo in a sequence-specific manner. See Figure 13.

[0094] Translation termination was accompanied by inhibition of protein release as shown by antisense oligos +7 and +8 using the Termiluc assay. See Figure 13. These data are consistent with the read-through data obtained in the rabbit reticulocyte lysate (RRL) assay. Furthermore, the +9 antisense oligo was the least efficient, consistent with the RRL data.

[0095] These data suggest that antisense oligos as contemplated herein specifically interfere with the translation termination step, thereby reducing the release of truncated proteins and allowing ribosomes to continue translation. Although it is not necessary to understand the mechanism of an invention, it is believed that the stop codon readthrough technology of the present disclosure can be programmed to provide specificity for a particular stop codon of a particular mRNA.

[0096] V. Modified Antisense Oligos In one embodiment, the present invention contemplates a +4 to +8 antisense oligomer readthrough promoter that contains at least one ribose modification. In one embodiment, these modifications include, but are not limited to, 2'-fluoride (F) modifications, 2'-O-methyl (Ome) modifications, and phosphothioate (PS) linkage modifications. See FIG. 14. For example, the +8(47) oligo contains at least one nucleic acid modified with fluoride (NA). F ): i) 1 modification: TCCACTCAGTGTGATTCCAC F and ii) six modifications: U F CCAC F T.C.A.G. F TGTG F ATTC F CAC F The data presented herein demonstrate that these modified antisense oligos promote read-through in RRL assays with improved stability and / or efficacy, as well as in mammalian cell culture. See Figures 15 and 16.

[0097] Fischer rat thyroid (FRT) cells expressing CFTR(G542X) and horseradish peroxidase (HRP) fusion proteins were cultured in Ham's F-12, Coon's Modification (Sigma-Aldrich, St. Louis, MO, #F6636) buffer with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, #26140-079), 1% penicillin-streptomycin (Thermo Fisher Scientific, #15140-122), and 100 μg / mL hygromycin B (Thermo Fisher Scientific, #10687010) at 37 °C and 5% CO. 2 These FRT cells were then cultured at 2 × 10 4 Cells were seeded into Costar 96-well plates at a density of 100 cells / well.

[0098] 24 hours after seeding, FRT cells expressing CFTR(G542X) were incubated with different concentrations of G418 and / or the following modified 8(47) antisense oligo: U F CCAC F T.C.A.G. F TGTG F ATTC F CAC F With or without, the mixture was incubated for a further 24 hours.

[0099] The cells were then washed 3 times with 1xDPBS, followed by incubation with SuperSignal West Femto HRP substrate (15μL / well, Thermo Fisher Scientific, #34096) for 5 minutes at room temperature, followed by HRP luminescence assay. The HRP-catalyzed luminescence was read on a Tecan microplate reader under the following conditions: room temperature; no shaking / no delay; integration time, 0.1 s; read height, 8.00 mm. The data show that the combination of G418 and the oligo produces a dose-response-related synergistic effect of nonsense codon read-through. See Figure 16.

[0100] These data suggest that the chemically modified oligo, together with G418, improves readthrough of premature stop codons in cells expressing a disease-causing variant of CFTR (associated with the G542X mutation).

[0101] VI. Treatment of Rett Syndrome with Antisense Oligos In one embodiment, the present invention contemplates a number of specific +4 to +8 (eg, +4, +5, +6, +7, +8) antisense oligomers useful in the treatment of Rett Syndrome.

[0102] Rett syndrome is a rare genetic mutation that affects brain development found primarily in females. Briefly, infants appear normal for the first six months of life, but over time rapidly lose coordination, speech, and use of their hands. The condition may then stabilize for several years. There is no cure, but medication, physical therapy, speech therapy, and nutritional support can help manage symptoms, prevent complications, and improve quality of life. In recent years, a genetic basis has been found that appears to involve a premature stop codon.

[0103] It is believed that a dysfunctional brain protein, methylcytosine-binding protein 2 (Mecp2), may be responsible for many of the symptoms of Rett syndrome. The MECP2 gene provides instructions for making a protein called MeCP2. This protein helps regulate gene activity (expression) by modifying chromatin (a complex of DNA and proteins that packages DNA into chromosomes). The MeCP2 protein is present in cells throughout the body, but it is particularly abundant in brain cells.

[0104] In the brain, the MeCP2 protein is important for the function of several types of cells, including nerve cells (neurons). The protein likely plays a role in maintaining connections (synapses) between neurons, where cell-cell communication occurs. Many of the genes known to be regulated by the MeCP2 protein play a role in normal brain function, particularly in maintaining synapses.

[0105] Those skilled in the art believe that MeCP2 protein may also be involved in processing molecules called messenger RNA (mRNA), which serve as genetic blueprints for making proteins.By cutting and reorganizing mRNA molecules in different ways, MeCP2 protein controls the production of different versions of a particular protein.This process is known as alternative splicing.In the brain, alternative splicing of proteins plays a role in normal communication between neurons and may also be necessary for the function of other types of brain cells.

[0106] Most cases of Rett syndrome are caused by mutations in the methylcytosine-binding protein 2 (Mecp2) gene. The MECP2 gene is located on the X chromosome. 90%-95% of girls with Rett syndrome have mutations in the MECP2 gene. Amir et al., "Rett syndrome is caused by mutations in X-linked MECP2," Nature Genetics 23(2):185-188(1999); Schollen et al., "Gross rearrangements in the MECP2 gene in three patients with Rett syndrome: Implications for routine diagnosis of Rett syndrome," Human Mutations 22:116-120(2003); and Zoghbi, HY, "MeCP2 dysfunction in humans and mice," Journal of Child Neurology 20:736-740(2005). It is generally believed that approximately eight mutations in the MECP2 gene are responsible for the most prevalent cause of Rett syndrome. The occurrence and severity of Rett syndrome symptoms depends on the location and type of mutation on the MECP2 gene. Percy et al., "Rett syndrome: North American database," Journal of Child Neurology 22(12):1338-1341 (2007).

[0107] The data presented herein uses a Mecp2 DNA expression vector construct expressing Mecp2 mRNA with one of four premature stop codons containing a nonsense mutation (e.g., R168X, R255X, R270X, or R294X). See Figure 17A. The data show that a +8 DNA antisense oligo only modestly enhanced readthrough of the mRNA at three of the four premature stop codons. See Figure 17B. EXAMPLES

[0108] experiment Example 1 cell culture A. Exemplary Cell Lines CFF-16HBEge CFTR G542X CFF-16HBEge CFTR R1162X CFF-16HBEge CFTR-W1282X CFFT-16HBEge CFTR Y122X

[0109] B. Exemplary Cell Culture Conditions Culture medium (store complete medium at 4°C) [Table 1] Freezing solution (freshly made) [Table 2]

[0110] C. Other Reagents DPBS (Hyclone SH30028.02) TrypLE Express (Gibco 12604-021)

[0111] D. Coating solution (freshly made) [Table 3]

[0112] Coat the flasks with coating solution: 1 ml of the above solution for a T-25 flask, 2 ml for a T-75. Distribute the solution evenly over the surface, making sure the entire surface is wet with the solution, and leave at 37°C for 2-3 hours. After incubation, remove the liquid completely. Do not reuse the solution. Do not rinse the container. The coated flasks can be stored at 4°C for several months.

[0113] E. Exemplary Subculture Protocol Subculture at 80-100% confluency Remove medium, rinse with DPBS and remove Add TrypLE Express (spread it over the cell surface) and incubate the flask at 37°C After 3-5 minutes, examine the flask under a microscope to observe the degree of cell detachment. If the cells appear to be coming off the surface, use your palm to tap the side of the flask to encourage further detachment. If the cells are still attached, place the flask back in the incubator for a few more minutes and examine the flask again. The goal is for >95% of the cells to be removed from the surface. Pipette the cells repeatedly to break up any clumps and transfer the cell suspension to a centrifuge tube. · Centrifuge for 3.5 minutes at 1200 rpm to pellet the cells. o NOTE: If the cells cannot be centrifuged (e.g. high throughput 96 well format), this step may be omitted. Discard the liquid and resuspend the cell pellet in complete medium. · Split cells 1:10-1:20 and subculture for 1 week. o CFF medium change schedule – 3 times per week

[0114] F. Exemplary Liquid Nitrogen Storage Protocol · Cells are treated as for subculture, except the cell pellet is resuspended in freezing solution. · Transfer the cells into freeze vials (1-1.5mL / vial). Aliquot into 4-6 vials for T-75 flasks and 2-4 vials for T-75 depending on cell density. o CFF freeze 5 million cells / vial for thawing into T-75 flasks. Place the vials in a conditioned cooling chamber and plate at -80°C freezing overnight (chamber regulates cooling at approximately 1°C / min) · Transfer the vials from the cooling chamber to liquid nitrogen storage as quickly as possible.

[0115] G. Exemplary culture of frozen stock cells Remove the vial of cells from the liquid nitrogen and thaw the cells in a 37°C water bath. Resuspend in 5mL complete medium Centrifuge at 1200 rpm for 3.5 minutes to pellet the cells Remove the liquid (to remove the DMSO) Resuspend the cell pellet in 9mL medium (for a T-75 flask) and seed the cells onto the coated flask Cells were incubated at 37°C in a 5% CO incubator. 2 and multiply it. After overnight incubation, the cells should attach to the flask. Round, unattached cells are dead cells.

[0116] Example II Gene editing A. Cas9 Protein Complex The RNP complex contains: Cas9: S. pyogenes Cas9 Guide RNA target sequence: 5' - GAGAAAGACAATATAGTTCT - 3'

[0117] B. Protospacer accessory motif sequence: TGG

[0118] C. Homology-directed repair donor template sequence (ssODN: 5' - 3'): [ka]

[0119] D. Amplification / Sequencing Primers Forward primer: 5'-ATGGAAGCCCAGTGAAGATAC-3' Reverse primer: 5'-CTAGCCATAAAACCCCAGGA-3'

[0120] Example III Sequencing Bulk sequencing of PCR amplicons was performed using primers according to Example II. TOPO cloning (e.g., allele exclusion) method sequenced plasmid vectors. See Figure 18A-D.

[0121] The data show that no large deletions or rearrangements were identified by next generation sequencing of the CFTR locus. However, an insertion of unknown size was observed at intron 6 position (hg38) Chr7:117536118 of one CFTR allele in the 16HBE14o- parental cells and the derived 16HBEge cells. This insertion contains SV40 genomic sequences. It was used in the immortalization process to generate the 16HBE14o- cells and is not the result of gene editing. Several lines of evidence support that the allele with the above insertion results in degraded CFTR transcripts or non-functional CFTR; thus, the 16HBE14o- cells are functionally monoallelic. The 16HBEge cell line is homozygous for the engineered CFTR variant and expresses CFTR from the same number of alleles as the 16HBE14o- cells.

[0122] Example IV Gene expression This example shows the results of mRNA analysis by quantitative polymerase chain reaction (qPCR) and protein analysis by Western blot.

[0123] The data show that the antisense, SMG1i, is a pharmacological inhibitor of the NMD mediator SMG1 and restores mRNA levels of the PTC allele. As usual, a smaller increase in CFTR WT mRNA is also observed with SMG1i. See Figures 19A-F.

[0124] Example V Electrophysiology Functional assays were performed one week after filter seeding using the TECC / 24 Conductance Assay, which demonstrated resistance but no measurable CFTR function, see Figures 20A-C.

[0125] The transepithelial resistance of the CFF-16HBEge line is stable over time (up to 50 passages tested in the CFF-16HBEge CFTR W1282X cell line). See Figures 21A-B.

Claims

1. A deoxyribonucleic acid (DNA) antisense oligomer complementary to a ribonucleic acid (RNA) sequence beginning between +4 and +8 nucleotide positions downstream of the first nucleotide in a premature termination codon in a messenger RNA (mRNA) molecule.

2. 2. The oligomer of claim 1, wherein the premature stop codon is selected from the group consisting of UGAC, UGAG, UGAA and UGAU.

3. The oligomer has a melting temperature (T ｍ 2. The oligomer of claim 1 having the formula:

4. The oligomer is CCTCCACTCAGTGTGATTCCACCTTC (CFTR +4 (60)); CCACTCAGTGTGATTCCACC (CFTR +7 (49)); GACCTCCACTCAGTGTGATTCCACC (CFTR +7 (60)); CTCAGTGTGATTCCAC (CFTR +8 (32)); ACTCAGTGTGATTCCAC (CFTR +8 (34)); TCCACTCAGTGTGATTCCAC (CFTR +8 (47)); CTCGTTGACCTCCACTCAGTGTGATTCCAC (CFTR +8 (66)); CTGAAGCTGACCCTCAGGCC (Mecp2 +8(57) 255X); CGGGGAGTGTGGTGGCAG (Mecp2 +8(57) 270X); and TGCAGGAGACCGTACTCCCC (Mecp2 +8(57) 294X) 2. The oligomer of claim 1 selected from the group consisting of:

5. The oligomer of claim 1 , wherein the oligomer comprises at least one nucleotide having a modification.

6. 6. The oligomer of claim 5, wherein the modification is selected from the group consisting of a 2'-fluoride (F) modification, a 2'-O-methyl (Ome) modification, and a phosphothioate (PS) linkage modification.

7. A composition comprising: i) a deoxyribonucleic acid (DNA) or modified nucleic acid antisense oligomer; and ii) a messenger ribonucleic acid (mRNA) molecule encoding an RNA sequence and a premature stop codon, wherein said antisense oligomer is complementary to said RNA sequence beginning between +4 and +8 nucleotide positions downstream of the first nucleotide of said premature stop codon.

8. The composition of claim 7 , wherein the antisense oligomer is hybridized to the RNA sequence.

9. 8. The composition of claim 7, wherein the mRNA molecule encodes cystic fibrosis transmembrane conductance regulator protein (CFTR) or methylcytosine-binding protein 2 (Mecp2).

10. The composition of claim 7 , further comprising an aminoglycoside.

11. 11. The composition of claim 10, further comprising an aminoglycoside concentration that is 1 / 5 of conventional aminoglycoside concentrations that promote translational read-through.

12. 8. The composition of claim 7, wherein the premature stop codon is selected from the group consisting of UGAC, UGAG, UGAA and UGAT.

13. The oligomer has a melting temperature (T ｍ 8. The composition of claim 7 having the formula:

14. The oligomer is CCTCCACTCAGTGTGATTCCACCTTC (CFTR +4 (60)); CCACTCAGTGTGATTCCACC (CFTR +7 (49)); GACCTCCACTCAGTGTGATTCCACC (CFTR +7 (60)); CTCAGTGTGATTCCAC (CFTR +8 (32)); ACTCAGTGTGATTCCAC (CFTR +8 (34)); TCCACTCAGTGTGATTCCAC (CFTR +8 (47)); CTCGTTGACCTCCACTCAGTGTGATTCCAC (CFTR +8 (66)); CTGAAGCTGACCCTCAGGCC (Mecp2 +8(57) 255X); CGGGGAGTGTGGTGGCAG (Mecp2 +8(57) 270X); and TGCAGGAGACCGTACTCCCC (Mecp2 +8(57) 294X) The composition of claim 7, selected from the group consisting of:

15. The composition of claim 7 , wherein the oligomer comprises at least one nucleotide having a modification.

16. 16. The composition of claim 15, wherein the modification is selected from the group consisting of a 2'-fluoride (F) modification, a 2'-O-methyl (Ome) modification, and a phosphothioate (PS) linkage modification.

17. A pharma-ceutically acceptable composition comprising a messenger ribonucleic acid (mRNA) molecule having a premature stop codon for use in reducing at least one symptom of a medical disorder in a patient exhibiting at least one symptom of the medical disorder, said pharma-ceutically acceptable composition comprising deoxyribonucleic acid (DNA) or a modified nucleic acid antisense oligomer complementary to an mRNA sequence beginning between +4 and +8 nucleotide positions downstream of the first nucleotide of the premature stop codon.

18. 18. The pharma- ceutically acceptable composition of claim 17, wherein the medical disorder is cystic fibrosis or Rett syndrome and is caused by the premature stop codon.

19. 20. The pharma- ceutically acceptable composition of claim 17, further comprising an aminoglycoside.

20. The pharma- ceutically acceptable composition of claim 19, which does not produce aminoglycoside side effects.

21. 18. The pharma- ceutically acceptable composition of claim 17, wherein the mRNA molecule encodes cystic fibrosis transmembrane conductance regulator protein or methylcytosine-binding protein 2.

22. 18. The pharma- ceutically acceptable composition of claim 17, wherein the premature stop codon is selected from the group consisting of UGAC, UGAG, UGAA, or UGAT.

23. The oligomer has a melting temperature (T ｍ 20. The pharma- ceutically acceptable composition of claim 17, having the formula:

24. The oligomer is CCTCCACTCAGTGTGATTCCACCTTC (CFTR +4 (60)); CCACTCAGTGTGATTCCACC (CFTR +7 (49)); GACCTCCACTCAGTGTGATTCCACC (CFTR +7 (60)); CTCAGTGTGATTCCAC (CFTR +8 (32)); ACTCAGTGTGATTCCAC (CFTR +8 (34)); TCCACTCAGTGTGATTCCAC (CFTR +8 (47)); CTCGTTGACCTCCACTCAGTGTGATTCCAC (CFTR +8 (66)); CTGAAGCTGACCCTCAGGCC (Mecp2 +8(57) 255X); CGGGGAGTGTGGTGGCAG (Mecp2 +8(57) 270X); and TGCAGGAGACCGTACTCCCC (Mecp2 +8(57) 294X) 18. The pharma- ceutically acceptable composition of claim 17, selected from the group consisting of:

25. 20. The pharma- ceutically acceptable composition of claim 17, wherein the oligomer comprises at least one nucleotide having a modification.

26. 26. The pharma- ceutically acceptable composition of claim 25, wherein said modification is selected from the group consisting of a 2'-fluoride (F) modification, a 2'-O-methyl (Ome) modification, and a phosphothioate (PS) linkage modification.

27. ​​A combination comprising a messenger ribonucleic acid (mRNA) molecule having a premature stop codon for use in reducing at least one symptom of a medical disorder in a patient exhibiting at least one symptom of the medical disorder, said combination comprising an aminoglycoside and a deoxyribonucleic acid (DNA) or modified nucleic acid antisense oligomer complementary to an mRNA sequence starting between +4 and +8 nucleotide positions downstream of the first nucleotide of the premature stop codon.

28. The combination of claim 27, having a synergistic reduction in at least one symptom compared to the aminoglycoside alone.

29. 28. The combination of claim 27, wherein the medical disorder is cystic fibrosis or Rett syndrome and is caused by the premature stop codon.

30. 28. The combination of claim 27, wherein the pharma- ceutically acceptable composition further comprises an aminoglycoside.

31. The combination of claim 30, which does not cause aminoglycoside side effects.

32. 28. The combination of claim 27, wherein the mRNA molecule encodes cystic fibrosis transmembrane conductance regulator protein or methylcytosine-binding protein 2.

33. 28. The combination of claim 27, wherein the premature stop codon is selected from the group consisting of UGAC, UGAG, UGAA and UGAT.

34. The oligomer has a melting temperature (T ｍ 28. The combination of claim 27, wherein

35. The oligomer is CCTCCACTCAGTGTGATTCCACCTTC (CFTR +4 (60)); CCACTCAGTGTGATTCCACC (CFTR +7 (49)); GACCTCCACTCAGTGTGATTCCACC (CFTR +7 (60)); CTCAGTGTGATTCCAC (CFTR +8 (32)); ACTCAGTGTGATTCCAC (CFTR +8 (34)); TCCACTCAGTGTGATTCCAC (CFTR +8 (47)); CTCGTTGACCTCCACTCAGTGTGATTCCAC (CFTR +8 (66)); CTGAAGCTGACCCTCAGGCC (Mecp2 +8(57) 255X); CGGGGAGTGTGGTGGCAG (Mecp2 +8(57) 270X); and TGCAGGAGACCGTACTCCCC (Mecp2 +8(57) 294X) 28. The combination of claim 27, selected from the group consisting of:

36. 28. The combination of claim 27, wherein the oligomer comprises at least one nucleotide having a modification.

37. 37. The combination of claim 36, wherein said modification is selected from the group consisting of a 2'-fluoride (F) modification, a 2'-O-methyl (Ome) modification and a phosphothioate (PS) linkage modification.

38. A composition comprising a messenger ribonucleic acid (mRNA) molecule having a premature stop codon for use in reducing at least one symptom of a medical disorder in a patient exhibiting at least one symptom of the medical disorder, said composition comprising an aminoglycoside, and wherein said composition is administered in combination with a deoxyribonucleic acid (DNA) or modified nucleic acid antisense oligomer complementary to an mRNA sequence starting between +4 and +8 nucleotide positions downstream of the first nucleotide of the premature stop codon.

39. A composition comprising a messenger ribonucleic acid (mRNA) molecule having a premature stop codon for use in reducing at least one symptom of a medical disorder in a patient exhibiting at least one symptom of the medical disorder, said composition comprising deoxyribonucleic acid (DNA) or a modified nucleic acid antisense oligomer complementary to an mRNA sequence starting between +4 and +8 nucleotide positions downstream of the first nucleotide of the premature stop codon, said composition being administered in combination with an aminoglycoside.

Images