Proteins and their uses

Abstract

The present invention relates to proteins suitable for treating or preventing inflammatory or autoimmune conditions, pharmaceutical compositions comprising same, and methods of use comprising same.

Description

[Technical field]

[0001] FIELD OF THEINVENTION The present invention relates to proteins suitable for treating or preventing inflammatory or autoimmune conditions, pharmaceutical compositions comprising same, and methods of use comprising same.

[0002] Cross-reference to prior application

[0002] This application claims priority to Australian Provisional Patent Applications Nos. 2021900769 and 2022900508, the entire contents of each of which are incorporated herein by reference in their entirety. [Background technology]

[0003] 2. Background of the Invention

[0003] Inflammation is a non-specific reaction by the body's immune system in response to a perceived injury or fever. Inflammation can also occur in response to autoimmune conditions in which the body's immune system mistakenly attacks the body's own cells. Inflammatory bowel disease (IBD) and asthma are examples of inflammatory conditions that are the result of an inappropriate immune response.

[0004]

[0004] IBD is a chronic idiopathic inflammation of the gastrointestinal tract that can be subdivided into two immunologically distinct conditions: Crohn's disease (CD) and ulcerative colitis (UC). CD appears to be primarily mediated by activated T helper 1 and 17 cells (Th1 / Th17) with overproduction of the proinflammatory cytokines interleukin (IL)-12 and interferon gamma (IFNγ), whereas UC is characterized by a mixed T helper 2 and 17 cell (Th2 / Th17)-mediated pathology with a key role for canonical Th2 cytokines such as IL-13. Both UC and CD are expected to carry a significant burden worldwide, with UC cases expected to increase from 1,737,130 in 2016 to 1,867,305 in 2026, and prevalent diagnosed cases of CD expected to increase from 1,339,543 in 2019 to 1,629,940 in 2029 (GlobalData, 2020).

[0005]

[0005] Asthma is broadly described as an abnormal Th2 immune response characterized by airway eosinophilia, production of IL-4, -5, -9, -10 and -13 cytokines, elevated antigen-specific immunoglobulin E (IgE) levels, increased mucus production, and structural remodeling leading to airway obstruction and hyperresponsiveness. It is estimated that approximately 300 million people worldwide suffer from asthma, and an additional 100 million may be affected by 2025. According to World Health Organisation (WHO) estimates, in 2016, at the global level, the number of deaths due to asthma was 417,918, and 24.8 million disability-adjusted life years (DALYS) were attributable to asthma (WHO, 2020).

[0006]

[0006] Despite distinct inflammatory phenotypes, both IBD and asthma appear to arise from an imbalance between effector and regulatory T cells that leads to an overwhelming inflammatory cascade. Moreover, both chronic conditions have a multifactorial etiology, with genetic and environmental factors, such as the gut microbiota, all contributing to the pathogenesis.

[0007]

[0007] Tumor necrosis factor (TNF) inhibitors have revolutionized the treatment of IBD and remain the first-line therapy for patients with moderate to severe IBD who do not respond to conventional therapies. However, a consistent proportion of patients (approximately 20%) do not respond to treatment, and a similar proportion of patients may lose efficacy each year. Although these drugs are generally considered safe, adverse events are not uncommon, and some patients have contraindications. This creates a large unmet need for agents that are effective for long periods of time and that work beyond treating immune response-induced symptoms or blocking inflammation. Summary of the Invention [Problem to be solved by the invention]

[0008]

[0008] Thus, there is a need for new or improved therapies that can be used to treat inflammatory or autoimmune conditions, such as IBD and asthma.

[0009]

[0009] The reference to any prior art in this specification is not an admission or suggestion that this prior art forms part of the common general knowledge in any jurisdiction or that this prior art could reasonably be expected to be understood, considered relevant, and / or combined with other pieces of prior art by those skilled in the art. [Means for solving the problem]

[0010] Summary of the Invention

[0010] The present inventors have identified proteins which are shown herein to exhibit utility in the treatment of inflammatory conditions such as IBD.

[0011]

[0011] The present invention provides a protein comprising an amino acid sequence having at least about 70% sequence identity to any one of SEQ ID NOs: 1 to 20, for example, any one of SEQ ID NOs: 1 to 8, particularly any one of SEQ ID NOs: 1, 4, 6, 8 and 11, more particularly any one of SEQ ID NOs: 4, 8 and 11, and even more particularly any one of SEQ ID NOs: 4 and 8, or a biologically active fragment or variant thereof.

[0012]

[0012] The amino acid sequence may be any one or more of SEQ ID NOs: 1 to 20, i.e., any one or more of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20. The amino acid sequence may be any one or more of SEQ ID NOs: 1 to 8, for example, any one or more of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, and 8. The amino acid sequence may be any one or more of SEQ ID NOs: 1, 4, 6, 8, and 11, in particular, any one or more of SEQ ID NOs: 4, 8, and 11, and more particularly, any one or both of SEQ ID NOs: 4 and 8.

[0013]

[0013] The amino acid sequence of the protein may have at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOs: 1-20, for example, any one of SEQ ID NOs: 1-8, particularly any one of SEQ ID NOs: 1, 4, 6, 8 and 11, more particularly any one of SEQ ID NOs: 4, 8 and 11, and even more particularly any one of SEQ ID NOs: 4 and 8, or other identities as described herein.

[0014]

[0014] In a particular embodiment, the amino acid sequence of the protein is any one of SEQ ID NOs: 1 to 20, for example, any one of SEQ ID NOs: 1 to 8, particularly any one of SEQ ID NOs: 1, 4, 6, 8 and 11, more particularly any one of SEQ ID NOs: 4, 8 and 11, and even more particularly any one of SEQ ID NOs: 4 and 8.

[0015]

[0015] The present invention also provides a protein or a biologically active fragment or variant thereof comprising an amino acid sequence in which a total of up to about 250 amino acids have been substituted, inserted and / or deleted in any one of SEQ ID NOs: 1 to 20, for example, any one of SEQ ID NOs: 1 to 8, particularly any one of SEQ ID NOs: 1, 4, 6, 8 and 11, more particularly any one of SEQ ID NOs: 4, 8 and 11, and even more particularly any one of SEQ ID NOs: 4 and 8.

[0016]

[0016] The amino acid sequence of the protein may have a total of up to about 225, up to about 200, up to about 175, up to about 125, up to about 100, up to about 75, up to about 50, up to about 40, up to about 30, up to about 25, up to about 20, up to about 15, or up to about 10 amino acids substituted, inserted and / or deleted in SEQ ID NOs: 1-20, for example, any one of SEQ ID NOs: 1-8, particularly any one of SEQ ID NOs: 1, 4, 6, 8 and 11, more particularly any one of SEQ ID NOs: 4, 8 and 11, and even more particularly any one of SEQ ID NOs: 4 and 8, or any other number of amino acids as described herein.

[0017]

[0017] Proteins may be isolated, purified, substantially purified, enriched, synthetic, or recombinant.

[0018]

[0018] The present invention also provides a recombinant protein encoded by a nucleotide sequence having at least about 70% sequence identity to any one of SEQ ID NOs: 21 to 53, for example, any one of SEQ ID NOs: 21 to 28, particularly any one of SEQ ID NOs: 21, 24, 26, 28 and 31, more particularly any one of SEQ ID NOs: 24, 28 and 31, more particularly any one of SEQ ID NOs: 24 and 28, or a biologically active fragment or variant thereof.

[0019]

[0019] The nucleotide sequence may be any one or more of SEQ ID NOs: 21 to 53, i.e., any one or more of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, and 53. The nucleotide sequence may be any one or more of SEQ ID NOs: 21 to 28, for example, any one or more of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, and 28. The nucleotide sequence may preferably be any one or more of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28 and SEQ ID NO:31, in particular any one or more of SEQ ID NO:24, SEQ ID NO:28 and SEQ ID NO:31, more in particular any one or more of SEQ ID NO:24 and SEQ ID NO:28.

[0020]

[0020] In some embodiments, the nucleotide sequence of the recombinant protein has at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOs: 21-53, such as any one of SEQ ID NOs: 21-28, particularly any one of SEQ ID NOs: 21, 24, 26, 28 and 31, more particularly any one of SEQ ID NOs: 24, 28 and 31, and even more particularly any one of SEQ ID NOs: 24 and 28.

[0021]

[0021] In a specific embodiment, the nucleotide sequence is any one of SEQ ID NOs: 21 to 53, particularly any one of SEQ ID NOs: 21 to 28, particularly any one of SEQ ID NOs: 21, 24, 26, 28 and 31, more particularly any one of SEQ ID NOs: 24, 28 and 31, and even more particularly any one of SEQ ID NOs: 24 and 28.

[0022] In some embodiments, the protein is selected from protein families with anti-inflammatory activity, in particular the SCP / TAPS, lysozyme and annexin protein families.

[0023]

[0023] The present invention also provides a pharmaceutical composition comprising, consisting essentially of, or consisting of a protein of the present invention or a biologically active fragment or variant thereof described herein and at least one pharma- ceutically acceptable carrier.

[0024]

[0024] The present invention also provides a method for treating or preventing an inflammatory or autoimmune condition, comprising administering to a subject in need thereof a protein of the present invention as described herein, or a biologically active fragment or variant thereof, or a pharmaceutical composition as described herein, thereby treating or preventing an inflammatory or autoimmune condition in a subject.

[0025] The present invention also provides a method for treating or preventing an inflammatory or autoimmune condition in a subject, comprising: - identifying a subject having an inflammatory or autoimmune condition; - administering to a subject in need thereof a therapeutically effective amount of a protein of the invention as described herein, or a biologically active fragment or variant thereof, or a pharmaceutical composition as described herein. thereby treating or preventing an inflammatory or autoimmune condition in a subject.

[0026]

[0026] The proteins or pharmaceutical compositions described herein may be administered or formulated for administration by any route described herein, preferably parenterally.

[0027]

[0027] The present invention also provides a method for inhibiting the progression of an inflammatory or autoimmune condition, comprising administering to a subject in need thereof a protein of the invention as described herein, or a biologically active fragment or variant thereof, or a pharmaceutical composition as described herein, thereby inhibiting the progression of an inflammatory or autoimmune condition. The protein or pharmaceutical composition as described herein may be administered or formulated for administration by any route as described herein, preferably parenterally.

[0028]

[0028] The present invention also provides a method for minimizing, reducing or ameliorating a symptom of an inflammatory or autoimmune condition comprising administering to a subject in need thereof a protein of the invention as described herein, or a biologically active fragment or variant thereof, or a pharmaceutical composition as described herein, thereby minimizing, reducing or ameliorating a symptom of an inflammatory or autoimmune condition. The protein or pharmaceutical composition as described herein may be administered or formulated for administration by any route described herein, preferably parenterally.

[0029] The invention also provides the use of a protein of the invention as described herein, or a biologically active fragment or variant thereof, in the manufacture of a medicament for treating or preventing an inflammatory or autoimmune condition. The proteins described herein may be administered or formulated for administration by any of the routes described herein, preferably parenterally.

[0030] The present invention also provides a protein of the invention as described herein, or a biologically active fragment or variant thereof, for use in treating or preventing an inflammatory or autoimmune condition. The proteins described herein may be administered or formulated for administration by any route described herein, preferably parenterally.

[0031] The inflammatory or autoimmune condition may be selected from inflammatory bowel disease, irritable bowel syndrome, type 2 diabetes, asthma, rheumatoid arthritis, lupus, allergies and celiac disease. In a particular embodiment, the inflammatory or autoimmune condition is inflammatory bowel disease, in particular ulcerative colitis or Crohn's disease.

[0032]

[0032] The present invention also provides a nucleic acid comprising a nucleotide sequence encoding a protein of the present invention, or any other protein described herein.

[0033]

[0033] The present invention also provides a vector or expression construct comprising a nucleic acid of the invention described herein.

[0034]

[0034] The present invention also provides a cell comprising the vector, expression construct or nucleic acid of the invention described herein. The cell of the invention can be any cell described herein, preferably a mammalian cell.

[0035]

[0035] The present invention also provides a method for producing a protein or a biologically active fragment or variant thereof, comprising incubating a cell described herein under conditions allowing expression of the protein or a biologically active fragment or variant thereof.

[0036] Further aspects of the invention and further embodiments of the aspects described in the preceding paragraphs will become apparent from the following description, given by way of example only, with reference to the accompanying drawings, in which: [Brief description of the drawings]

[0037] BRIEF DESCRIPTION OF THE DRAWINGS [Figure 1]

[0037] Figure 1 shows the results showing the effect of in vitro transcription / translation lysates containing different recombinant proteins of the present invention in a trinitrobenzene sulfonic acid (TNBS) colitis model. Figure 1A is a graph showing body weight percentage; data points represent mean ± SEM and sample size (n = 5 mice / group), significance was determined by comparing body weight on day 3 to control body weight using a two-sample t-test, adjusted for multiple testing, and indicated with *p ≤ 0.05 and **p ≤ 0.01. [Figure 1A]

[0037] Figure 1 shows the results showing the effect of in vitro transcription / translation lysates containing different recombinant proteins of the present invention in a trinitrobenzene sulfonic acid (TNBS) colitis model. Figure 1A is a graph showing body weight percentage; data points represent mean ± SEM and sample size (n = 5 mice / group), significance was determined by comparing body weight on day 3 to control body weight using a two-sample t-test, adjusted for multiple testing, and indicated with *p ≤ 0.05 and **p ≤ 0.01. [Figure 1B] FIG. 1B shows photographs of colon length in the naive group (A), the negative control group (B) and the hookworm lysate 13 (containing recombinant protein SEQ ID NO:1) group (C). [Figure 1C]

[0037] Figure 1C is a graph showing colon length; all individual data points are expressed as mean ± SEM and sample size (n = 5 mice / group), significance was determined by statistical comparison using a two-sample t-test versus control group, adjusted for multiple testing, and denoted as *p < 0.05, **p < 0.01, and ***p < 0.001. [Figure 1D]

[0037] Figure 1D is a graph showing the macroscopic scores; all individual data points are expressed as mean ± SEM and sample size (n = 5 mice / group), significance was determined by statistical comparison of each test group to the negative control group using the Mann-Whitney U test, adjusted for multiple testing, and denoted as *p≦0.05, and **p≦0.01. [Figure 1E]

[0037] Figure 1E is a graph showing the composite clinical score; all individual data points are expressed as mean ± SEM and sample size (n = 5 mice / group), significance was determined by statistical comparison assessed using the Mann-Whitney U test versus control group, adjusted for multiple testing, and denoted as *p≦0.05, **p≦0.01, ***p≦0.001. [Figure 2A]

[0038] FIG. 2 is a graph showing the activity of recombinant proteins of the invention on the secretion of inflammatory cytokines in human colon biopsies stimulated with anti-CD3 / CD28 beads. Recombinant proteins were expressed in mammalian cells and purified before being added to the biopsy cultures. Cytokines measured were tumor necrosis factor alpha (TNFα), interferon gamma (IFNγ) and interleukin-17A (IL-17A). Negative control: no stimulation with anti-CD3 / CD28 beads, first bar. All other samples were stimulated with anti-CD3 / CD28 beads. Positive control: cyclosporine-A (CSA), third bar. Values ​​are normalized and presented as a percentage of the PBS+beads condition. Bars represent the mean from 6-7 ulcerative colitis patients. Error bars: SEM. Statistical significance was determined by one-sample t-test and is indicated as *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001. [Figure 2B]FIG. 2 is a graph showing the activity of recombinant proteins of the invention on the secretion of inflammatory cytokines in human colon biopsies stimulated with anti-CD3 / CD28 beads. Recombinant proteins were expressed in mammalian cells and purified before being added to the biopsy cultures. Cytokines measured were tumor necrosis factor alpha (TNFα), interferon gamma (IFNγ) and interleukin-17A (IL-17A). Negative control: no stimulation with anti-CD3 / CD28 beads, first bar. All other samples were stimulated with anti-CD3 / CD28 beads. Positive control: cyclosporine-A (CSA), third bar. Values ​​are normalized and presented as percentage of PBS+beads condition. Bars represent the mean from 6-7 ulcerative colitis patients. Error bars: SEM. Statistical significance was determined by one-sample t-test and is indicated as *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001. [Figure 2C] FIG. 2 is a graph showing the activity of recombinant proteins of the invention on the secretion of inflammatory cytokines in human colon biopsies stimulated with anti-CD3 / CD28 beads. Recombinant proteins were expressed in mammalian cells and purified before being added to the biopsy cultures. Cytokines measured were tumor necrosis factor alpha (TNFα), interferon gamma (IFNγ) and interleukin-17A (IL-17A). Negative control: no stimulation with anti-CD3 / CD28 beads, first bar. All other samples were stimulated with anti-CD3 / CD28 beads. Positive control: cyclosporine-A (CSA), third bar. Values ​​are normalized and presented as percentage of PBS+beads condition. Bars represent the mean from 6-7 ulcerative colitis patients. Error bars: SEM. Statistical significance was determined by one-sample t-test and is indicated as *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001. [Figure 3A]

[0039] Figure 3 is a graph showing the effect of cell-free lysates containing different recombinant proteins of the invention fused to eGFP in a trinitrobenzenesulfonic acid (TNBS) colitis model. BALB / c mice were injected intraperitoneally with 200 μl of protein-containing supernatant (protein concentration: 100 mg / ml) the day before intrarectal administration of trinitrobenzoic acid (TNBS) and monitored daily for 3 days until euthanasia. Figure 3A is a graph showing the average percent change in initial body weight (n=5 / group) of 12 lysates compared to eGFP-only lysate control and naive mice. [Figure 3B] FIG. 3B is a graph showing the clinical scores (mean and individual data points) of 12 lysates combining fecal consistency, motility, piloerection and body weight change on day 3. [Figure 3C] Figure 3C is a graph showing macroscopic colon pathology scores (mean and individual data points) of 12 lysates at necropsy on day 3. *p≦0.05, **p≦0.01, Mann-Whitney U test compared to eGFP control. [Figure 3D]

[0039] Figure 3D is a graph showing a combined statistical analysis of the efficacy of all 78 expressed proteins compared to their respective eGFP controls. The x-axis shows the difference in the mean combined z-scores of clinical outcomes (weight loss, colon length, clinical score and macroscopic score) between treatment and control (eGFP lysate vector), and the y-axis shows the p-value, where p<0.01 or -log10>2 was considered significant. Proteins that achieved significant protection in both categories are shown in red (upper right quadrant), whereas proteins that did not show significant protection in both categories are shown in blue. [Figure 4A]

[0040] Figure 4 is a graph showing the effect of recombinant proteins of the invention in a trinitrobenzene sulfonic acid (TNBS) colitis model. BALB / c mice were injected intraperitoneally with 20 μg of recombinant hookworm protein produced in Expi293F human embryonic kidney cells the day before intrarectal administration of trinitrobenzoic acid (TNBS) and daily thereafter until termination. Control mice received either recombinant bovine serum albumin (BSA) expressed using the same production method, or PBS vehicle. Figure 4A is a graph showing the mean percent change in initial body weight. [Figure 4B] FIG. 4B is a graph showing the clinical scores (mean and individual data points). [Figure 4C]

[0040] Figure 4C is a graph showing the colon pathology macroscopic score (mean and individual data points). Data are combined from three individual experiments, n = 10-20 for each treatment group. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, Mann-Whitney U test compared to PBS control. [Figure 5A]

[0041] Figure 5 is a graph showing the activity of recombinant proteins of the invention on the secretion of inflammatory cytokines in human colon biopsies stimulated with anti-CD3 / CD28 beads. Intraepithelial lymphocytes and lamina propria cells were isolated and combined from fresh colon biopsies taken from ulcerative colitis patients. Cells were treated with either PBS control, purified recombinant hookworm proteins or bovine serum albumin, generated in Expi293F cells and then stimulated with aCD3 / CD28 Dynabeads (TCR stimulation). All data were normalized to PBS (vehicle) treated samples (100%, shown by dotted line) to account for inter-patient variability. Ac-FAR-2 was used at 10 mg / ml and all other proteins at 50 mg / ml. Positive control cells were treated with cyclosporine A (CSA) or left unstimulated (PBS). In Figure 5A, cell-free supernatants were harvested and analyzed for TNF secretion after 3 days of culture. Values ​​were normalized to PBS treatment and stimulation conditions (dotted lines) for each patient. Data were combined from two independent sampling dates, each color symbol represents an individual patient sample (n=5-12 / treatment group), and the mean value for each treatment is indicated by a horizontal line. [Figure 5B] In Figure 5B, cell-free supernatants were harvested and analyzed for IFNγ secretion after 3 days of culture. Values ​​were normalized to PBS treatment and stimulation conditions (dotted lines) for each patient. Data were combined from two independent sample collection dates, each color symbol represents an individual patient sample (n=5-12 / treatment group), and the mean value for each treatment is indicated by a horizontal line. [Figure 5C] In Figure 5C, cell-free supernatants were harvested and analyzed for IL-17A secretion after 3 days of culture. Values ​​were normalized to PBS treatment and stimulation conditions (dotted lines) for each patient. Data were combined from two independent sample collection dates, each color symbol represents an individual patient sample (n=5-12 / treatment group), and the mean value for each treatment is indicated by a horizontal line. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0038] Detailed Description of the Embodiments

[0042] It will be understood that the invention disclosed and defined herein extends to all alternative combinations of two or more of the individual features mentioned or apparent from the text or drawings, all of these different combinations constituting various alternative aspects of the invention.

[0039]

[0043] Reference will now be made in detail to certain embodiments of the invention. While the invention may be described in connection with the embodiments, it will be understood that it is not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents which may be included within the scope of the invention as defined by the claims.

[0040]

[0044] Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein that can be used in the practice of the present invention. The present invention is in no way limited to the methods and materials described. It will be understood that the invention disclosed and defined herein extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All of these different combinations constitute various alternative aspects of the present invention.

[0041]

[0045] All patents and publications referenced herein are incorporated by reference in their entirety.

[0042]

[0046] For purposes of interpreting this specification, terms used in the singular will also include the plural and vice versa.

[0043]

[0047] The present inventors have herein identified proteins that are useful in suppressing, preventing or treating inflammatory or autoimmune conditions. The proteins of the present invention are secreted by hookworm parasites. Hookworms are known to manipulate the immune system to prevent inappropriate immune responses, which promote their long-term survival and cause chronic infections, primarily due to the secretion of various hookworm excretory / secretory (ES) proteins. The proteins of the present invention are derivable or obtainable from hookworms and have been specifically identified and selected by the present inventors as described herein as proteins that may have utility in treating inflammatory or autoimmune conditions.

[0044]

[0048] As shown in the Examples, the proteins of the invention have been shown to be useful in several well-characterized models related to the activation of inflammatory responses, including colitis. These models are well-characterized in the art to include episodes of acute and / or chronic inflammation. Thus, the inventors recognize that the peptides of the invention have application in a wide range of conditions, disorders or diseases involving inflammation, including autoimmune diseases, of which only a few examples are disclosed herein.

[0045]

[0049] As shown in the Examples, the peptides of the present invention can reduce the secretion of pro-inflammatory cytokines from human immune cells, including, but not limited to, IFN-γ, TNF-α, and IL-17A.

[0046] definition

[0050] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are described. For purposes of the present invention, the following terms are defined below.

[0047]

[0051] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0048]

[0052] As used herein, the term "and / or," e.g., "X and / or Y," is to be understood to mean either "X and Y" or "X or Y," and is to be interpreted as providing clear support for both meanings or for either meaning.

[0049]

[0053] As used herein, the term "about" refers to a quantity, value, dimension, size, or amount that differs from a reference quantity, value, dimension, size, or amount by as much as 30%, 25%, 20%, 15% or 10%.

[0050]

[0054] As used herein, unless the context requires otherwise, the term "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps, but not the exclusion of any other integer or step or group of integers or steps.

[0051]

[0055] As used herein, the term "amino acid" or "amino acid residue" refers to a compound having an amino group and a carboxylic acid group. The amino acids may be L- or D-isomers or mixtures thereof. The amino acids may have naturally occurring side chains (see Table 1) or non-proteinogenic side chains. Amino acids may also include -C 1~6 Alkyl, -(CH2) n COR a , -(CH2) n R b and -POH, where n is an integer selected from 1 to 8, and R a-OH, -NH2, -NHC 1~3 Alkyl, -OC 1~3 Alkyl or -C 1~3 alkyl, and R b -OH, -SH, -SC 1~3 Alkyl, -OC 1~3 Alkyl, -NH2, -NHC 1~3 alkyl or -NHC(C=NH)NH2, and each alkyl group is -OH, -NH2, -NHC 1~3 Alkyl, -OC 1~3 Alkyl, -SH, -SC 1~3 Alkyl, -CO2H, -CO2C 1~3 Alkyl, -CONH2 and -CONHC 1~3 It may be substituted by one or more groups selected from alkyl.

[0052]

[0056] The amino acid structures and one-letter and three-letter abbreviations used throughout this specification are defined in Table 1, which lists the 20 naturally occurring proteinogenic amino acids that occur as the L-isomer in proteins.

[0053] [Table 1]

[0054]

[0057] As used herein, the term "non-proteinogenic amino acid" refers to an amino acid having a side chain that is not present in the naturally occurring L-α-amino acids set forth in Table 1. Examples of non-proteinogenic amino acids and derivatives include, but are not limited to, norleucine, 4-aminobutyric acid, 4-amino-3-hydroxy-5-phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, citrulline, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienylalanine, and / or D-isomers of the natural amino acids.

[0055]

[0058] As used herein, the term "α-amino acid" refers to an amino acid having a single carbon atom (α-carbon atom) separating the carboxyl terminus (C-terminus) and the amino terminus (N-terminus). α-Amino acids include naturally occurring and non-naturally occurring L-amino acids and their D-isomers, as well as derivatives thereof, such as salts or derivatives in which functional groups are protected by suitable protecting groups. Unless otherwise stated, the term "amino acid" as used herein refers to an α-amino acid.

[0056]

[0059] Those skilled in the art will recognize that a peptide refers to a series of two or more amino acids linked by a covalent bond (i.e., a so-called peptide bond) formed between the carboxyl group of one amino acid and the amino group of another amino acid.

[0057]

[0060] As used herein, the term "protein" or "polypeptide" will be understood to include a single polypeptide chain, i.e., a series of consecutive amino acids linked by peptide bonds, e.g., a polymer, or a series of polypeptide chains covalently or non-covalently bonded to each other (i.e., a protein or polypeptide complex). For example, a series of polypeptide chains can be covalently bonded by suitable chemical bonds or disulfide bonds. Examples of non-covalent bonds include hydrogen bonds, ionic bonds, van der Waals forces, and hydrophobic interactions. A protein or polypeptide can include amino acid residues and variants and synthetic analogs thereof. Thus, these terms include amino acid polymers in which one or more amino acid residues are non-proteinogenic synthetic amino acids, e.g., chemical analogs of the corresponding naturally occurring amino acids, and polymers containing only naturally occurring amino acids. These terms do not exclude, for example, glycosylation, acetylation, phosphorylation, and the like. For example, this definition includes proteins or polypeptides containing one or more analogs of amino acids, including, for example, polypeptides with unnatural amino acids or substituted linkages.

[0058]

[0061] As used herein, the term "isolated" is intended to refer to a molecule that is identified and separated from the form or environment in which it is found in nature. Thus, an "isolated protein" is other than the form or environment in which the protein is found in nature, and an "isolated nucleic acid" is other than the form or environment in which the nucleic acid is found in nature.

[0059]

[0062] As used herein, the term "purified" in reference to a protein of the invention will be understood to mean separated or isolated from a complex mixture, such as a cell.

[0060]

[0063] As used herein, the term "substantially purified" in the context of a protein of the invention means that the protein is substantially free from contaminating agents, e.g., at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 65%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% free from contaminating agents.

[0061]

[0064] As used herein, the term "synthetic" in the context of the proteins of the invention will be understood to refer to proteins produced by non-natural synthetic means, e.g., by chemical synthesis or artificial biological synthesis.

[0062]

[0065] As used herein, the term "recombinant" will be understood to mean the product of artificial genetic recombination. Thus, the term "recombinant protein" is intended to encompass a protein expressed by artificial recombinant means, for example when it is within an expression system or cell in which it is expressed.

[0063]

[0066] As used herein, the term "derived from" will be understood to indicate that a particular integer may be obtained from a particular source (although not necessarily directly from that source).

[0064]

[0067] Additional definitions are provided herein.

[0065] protein

[0068] The present invention relates to proteins derivable or obtainable from hookworms, including but not limited to Ancylostoma caninum, that may be useful for treating or preventing inflammatory conditions.

[0066]

[0069] Thus, in one aspect, the invention provides a protein, or a biologically active fragment or variant thereof, comprising an amino acid sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1 to 20. SEQ ID NOs: 1 to 20 are set forth in Table 2.

[0067] [Table 2]

[0068] [Table 3]

[0069] [Table 4]

[0070] [Table 5]

[0071] [Table 6]

[0072] [Table 7]

[0073]

[0070] The inventors have identified the nematode protein families to which the proteins of the invention belong. The nematode protein families are listed in the "Family" column of Table 2, and the relevant gene names are listed in the "Gene Name" column. The inventors have identified that some of the proteins of the invention also show homology to mammalian proteins, including mammalian proteins with anti-inflammatory properties. These include the hookworm SCP / TAPS, fatty acid and retinol binding protein, TTR-52 protein, lysozyme, and the proteins of the invention that belong to the annexin protein family. Thus, in some embodiments of the invention, the protein is selected from protein families with anti-inflammatory activity, in particular the SCP / TAPS, fatty acid and retinol binding protein, TTR-52 protein, lysozyme, and annexin protein families.

[0074]

[0071] SCP / TAPS are cysteine-rich proteins found in all eukaryotes. SCP / TAPS proteins are highly widespread in the genomes of gastrointestinal nematodes and constitute approximately 30% of all excretory / secretory (ES) products in hookworm parasites (Logan J et. al., Comprehensive analysis of the secreted proteome of adult Necator americanus hookworms, PLoS NTD, 2020 14(5): e0008237). Although the full sequences are often different, the spacing of Cys and some key residues are usually conserved.

[0075] Hookworm Na-ASP-2 is a group 1 SCP protein and contains the tetrad Glu99, His88, His148 and Glu125 present in many hookworm SCPs. Na-ASP-2 has been identified as having a putative fatty acid binding cleft and may bind fatty acids such as prostaglandins and leukotrienes.

[0076] Hookworm neutrophil inhibitory factor (NIF) is a group 3 SCP protein. NIF has been shown to be an integrin antagonist, binding to CD11b / CD18 and blocking adhesion of activated neutrophils to vascular endothelium. NIF has been shown to be neuroprotective after focal ischemia in rats.

[0077]

[0074] The fatty acid and retinol binding protein family (FAR) is a nematode-specific α-helix-rich protein that is involved in the development, reproduction and infection of plant parasitic nematodes and is secreted into plant tissues to subvert plant defense responses.

[0078]

[0075] The TTR-52 protein is a transthyretin-like protein expressed in and secreted from the C. elegans endoderm, where it clusters around apoptotic cells and mediates their recognition by the CED-1 phagocyte receptor.

[0079]

[0076] Although the literature on nematode lysozyme is limited, human lysozyme is produced by Paneth cells in the cecum and ascending colon. Lysozyme exhibits antibacterial activity and processes peptidoglycan in bacterial cell walls. In healthy subjects, lysozyme is normally abundant in secretions including tears, saliva, and mucus, and is also present in the cytoplasmic granules of macrophages and polymorphonuclear neutrophils (PMNs), but in subjects with inflammatory bowel disease, lysozyme may be abundant in the distal colon, where it drives the inflammatory antibacterial response. Large amounts of lysozyme can also be found in egg white, and chicken egg lysozyme has been shown to reduce dextran sulfate sodium (DSS) colitis in pigs.

[0080]

[0077] Annexin A1 is a glucocorticoid-inducible molecule that recapitulates many of the described anti-inflammatory effects of glucocorticoids. Annexin A1 is abundant in human PMN leukocytes and inhibits the protein complex NF-κB, a key regulator of inflammation. Annexin A1-deficient mice have been shown to exhibit more severe DSS colitis (de Paula-Silva M et. al., Role of the protein annexin A1 on the efficacy of anti-TNF treatment in a murine model of acute colitis, Biochem Pharmacol, 2016, 115, 104-113), and levels of annexin A1 have been shown to be reduced in RA patients compared to healthy controls. Previous studies have shown that the annexin MC12 tripeptide, when cyclized, prevents TNBS colitis in mice (Cobos Caceres C et al., An engineered cyclic peptide alleviates symptoms of inflammation in a murine model of inflammatory bowel disease, JBC, 2017, 292, 10288-10294). Annexin A1 mimetic peptides and agonists targeting the N-formyl peptide receptor 2 (FPR2) are of interest as therapeutic agents for RA (Yang YH et. al., Annexin A1: potential for glucocorticoid sparing in RA, Nature Reviews Rheumatology, 2013, 9, 595-603).

[0081]

[0078] In some embodiments, the amino acid sequence of the protein has at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs:1-20. For example, the amino acid sequence may have at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, at least 90% sequence identity to any one of SEQ ID NOs: 1-20, particularly any one of SEQ ID NOs: 1, 4, 6, 8 and 11, and more particularly any one of SEQ ID NOs: 4, 8 and 11.

[0082]

[0079] In some embodiments, the amino acid sequence of the protein is any one of SEQ ID NOs: 1-20, i.e., the amino acid sequence has 100% sequence identity to any one of SEQ ID NOs: 1-20, particularly any one of SEQ ID NOs: 1, 4, 6, 8 and 11, and more particularly any one of SEQ ID NOs: 4, 8 and 11.

[0083]

[0080] In some embodiments, the protein has an amino acid sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1-8. In these embodiments, the amino acid sequence of the protein may have at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-8. For example, the amino acid sequence may have at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, at least 90% sequence identity to any one of SEQ ID NOs: 1-8, particularly any one of SEQ ID NOs: 1, 4, 6 and 8, and more particularly any one of SEQ ID NOs: 4 and 8.

[0084]

[0081] In some embodiments, the amino acid sequence of the protein is any one of SEQ ID NOs: 1 to 8, i.e., the amino acid sequence has 100% sequence identity to any one of SEQ ID NOs: 1 to 8, particularly any one of SEQ ID NOs: 1, 4, 6 and 8, and more particularly any one of SEQ ID NOs: 4 and 8.

[0085]

[0082] In another aspect, the present invention provides a protein or a biologically active fragment or variant thereof comprising an amino acid sequence in which a total of up to about 250 amino acids have been substituted, inserted and / or deleted in any one of SEQ ID NOs: 1 to 20, particularly any one of SEQ ID NOs: 1, 4, 6, 8 and 11, and more particularly any one of SEQ ID NOs: 4, 8 and 11.

[0086]

[0083] In some embodiments, the amino acid sequence of the protein has a total of up to about 250, up to about 225, up to about 200, up to about 175, up to about 125, up to about 100, up to about 75, up to about 50, up to about 40, up to about 30, up to about 25, up to about 20, up to about 15, or up to about 10 amino acids substituted, inserted and / or deleted in any one of SEQ ID NOs: 1-20, particularly any one of SEQ ID NOs: 1, 4, 6, 8 and 11, and more particularly any one of SEQ ID NOs: 4, 8 and 11. For example, the amino acid sequence may be any one of SEQ ID NOs: 1 to 20, particularly any one of SEQ ID NOs: 1, 4, 6, 8, and 11, and more particularly any one of SEQ ID NOs: 4, 8, and 11, with a total of up to about 250, up to about 245, up to about 240, up to about 235, up to about 230, up to about 225, up to about 220, up to about 215, up to about 210, up to about 205, up to about 200, up to about 195, up to about 190, up to about 185, up to about 180, up to about 175, up to about 170, up to about 165, up to about 160, or ...50, up to about 250, up to about 250, up to about 250, up to about 250, up to about 250, up to about 250, up to about 250, up to about 250, up to about 250, up to about 250, up to about 250, up to about 250, up to about 250, up to about 155, up to about 150, up to about 145, up to about 140, up to about 135, up to about 130, up to about 125, up to about 120, up to about 115, up to about 110, up to about 105, up to about 100, up to about 95, up to about 90, up to about 86, up to about 80, up to about 75, up to about 70, up to about 65, up to about 60, up to about 55, up to about 50, up to about 45, up to about 40, up to about 35, up to about 30, up to about 25, up to about 20, up to about 15, up to about 10, up to about 5, or up to about 3 amino acids.

[0087] In some embodiments, the amino acid sequence has a total of up to about 250 amino acids substituted, inserted and / or deleted in any one of SEQ ID NOs: 1-8, particularly any one of SEQ ID NOs: 1, 4, 6 and 8, more particularly any one of SEQ ID NOs: 4 and 8, or a biologically active fragment or variant thereof. In these embodiments, the amino acid sequence may have a total of up to about 225, up to about 200, up to about 175, up to about 125, up to about 100, up to about 75, up to about 50, up to about 40, up to about 30, up to about 25, up to about 20, up to about 15, or up to about 10 amino acids substituted, inserted and / or deleted in any one of SEQ ID NOs: 1-8, particularly any one of SEQ ID NOs: 1, 4, 6 and 8, more particularly any one of SEQ ID NOs: 4 and 8. For example, the amino acid sequence may be any one of SEQ ID NOs: 1 to 8, particularly any one of SEQ ID NOs: 1, 4, 6, and 8, and more particularly any one of SEQ ID NOs: 4 and 8, in which a total of up to about 250, up to about 245, up to about 240, up to about 235, up to about 230, up to about 225, up to about 220, up to about 215, up to about 210, up to about 205, up to about 200, up to about 195, up to about 190, up to about 185, up to about 180, up to about 175, up to about 170, up to about 165, up to about 160, up to about up to about 155, up to about 150, up to about 145, up to about 140, up to about 135, up to about 130, up to about 125, up to about 120, up to about 115, up to about 110, up to about 105, up to about 100, up to about 95, up to about 90, up to about 86, up to about 80, up to about 75, up to about 70, up to about 65, up to about 60, up to about 55, up to about 50, up to about 45, up to about 40, up to about 35, up to about 30, up to about 25, up to about 20, up to about 15, up to about 10, up to about 5, or up to about 3 amino acids.

[0088]

[0085] Suitably, the proteins of the present invention or biologically active fragments or variants thereof may be isolated, purified, substantially purified, enriched, synthetic or recombinant.

[0089]

[0086] In one aspect, the present invention provides a recombinant protein encoded by a nucleotide sequence having at least 70% sequence identity to any one of SEQ ID NOs: 21 to 53, particularly any one of SEQ ID NOs: 21, 24, 26, 28 and 31, more particularly any one of SEQ ID NOs: 24, 28 and 31, and even more particularly any one of SEQ ID NOs: 24 and 28, or a biologically active fragment or variant thereof.

[0090]

[0087] SEQ ID NOs:21-40 encode the proteins of SEQ ID NOs:1-20, respectively, and are set forth in Table 3. SEQ ID NOs:21-40 correspond to native worm genome nucleotide sequences.

[0091] [Table 8]

[0092] [Table 9]

[0093] [Table 10]

[0094] [Table 11]

[0095] [Table 12]

[0096] [Table 13]

[0097] [Table 14]

[0098] [Table 15]

[0099] [Table 16]

[0100]

[0088] SEQ ID NOs: 41-53 encode the proteins of SEQ ID NOs: 1, 3-6, 8, 9, 11-13, 17, 18 and 20, respectively, and are listed in Table 4. SEQ ID NOs: 41-53 incorporate codon sequences optimized for mammalian expression constructs and incorporate a signal peptide MLVLVPLLALLAVSVHG (SEQ ID NO: 69), i.e., ATGCTGGTGCTGGCCTGCTGGCCGTGTCCGTGCACGGC (SEQ ID NO: 70). It will be understood that SEQ ID NOs: 41-53 may or may not include this signal peptide. Thus, in some embodiments, SEQ ID NOs: 41-53 do not include the signal peptide MLVLVPLLALLAVSVHG, i.e., ATGCTGGTGCTGGCCTGCTGGCCGTGTCCGTGCACGGC, in the nucleotide sequence.

[0101] [Table 17]

[0102] [Table 18]

[0103] [Table 19]

[0104] [Table 20]

[0105] [Table 21]

[0106] [Table 22]

[0107] [Table 23]

[0108]

[0089] In some embodiments, the nucleotide sequence encoding the recombinant protein may have at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 21-53, particularly any one of SEQ ID NOs: 21, 24, 26, 28 and 31, more particularly any one of SEQ ID NOs: 24, 28 and 31, and even more particularly any one of SEQ ID NOs: 24 and 28. For example, the nucleotide sequence may have at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, at least 90% sequence identity to any one of SEQ ID NOs:21-53, particularly any one of SEQ ID NOs:21, 24, 26, 28 and 31, more particularly any one of SEQ ID NOs:24, 28 and 31, and even more particularly any one of SEQ ID NOs:24 and 28.

[0109]

[0090] In some embodiments, the nucleotide sequence encoding the recombinant protein is any one of SEQ ID NOs: 21-53, i.e., the nucleotide sequence has 100% sequence identity to any one of SEQ ID NOs: 21-53, particularly any one of SEQ ID NOs: 21, 24, 26, 28 and 31, more particularly any one of SEQ ID NOs: 24, 28 and 31, and even more particularly any one of SEQ ID NOs: 24 and 28.

[0110] In some embodiments, the recombinant protein is encoded by a nucleotide sequence having at least 70% sequence identity to any one of SEQ ID NOs: 21-28, particularly any one of SEQ ID NOs: 21, 24, 26 and 28, more particularly any one of SEQ ID NOs: 24 and 28. In these embodiments, the nucleotide sequence encoding the recombinant protein may have at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 21-28, particularly any one of SEQ ID NOs: 21, 24, 26 and 28, more particularly any one of SEQ ID NOs: 24 and 28. For example, the nucleotide sequence may have at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, at least 90% sequence identity to any one of SEQ ID NOs:21-28, particularly any one of SEQ ID NOs:21, 24, 26 and 28, particularly any one of SEQ ID NOs:24 and 28.

[0111]

[0092] In some embodiments, the nucleotide sequence encoding the recombinant protein is any one of SEQ ID NOs: 21-28, i.e., the nucleotide sequence has 100% sequence identity to any one of SEQ ID NOs: 21-28, particularly any one of SEQ ID NOs: 21, 24, 26 and 28, and more particularly any one of SEQ ID NOs: 24 and 28.

[0112]

[0093] Biologically active fragments and variants of the proteins of the invention described herein are also provided.

[0113]

[0094] As used herein, a "biologically active fragment" or "fragment" is intended to refer to a portion of a protein of the invention, including a domain thereof, that retains substantially similar functional activity or substantially the same biological function or activity as the polypeptide as demonstrated in the assays disclosed herein. As used herein, the term "domain" is intended to refer to a portion of a protein that shares common structural, physiochemical and / or functional characteristics, such as hydrophobic, polar, globular, helical, or netrin-like (NTR) domains, or other properties, such as a protein-binding domain, receptor-binding domain, cofactor-binding domain, etc.

[0114]

[0095] As used herein, "biologically active variant" or "variant" is intended to encompass proteins or polypeptides having an amino acid sequence sufficiently similar to that of the protein of the present invention. In this context, the term "sufficiently similar" refers to a first amino acid sequence that contains a sufficient or minimal number of identical or equivalent amino acid residues to a second amino acid sequence such that the first and second amino acid sequences have a common structural domain and / or a common functional activity. For example, amino acid sequences that contain a common structural domain that is at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical are defined herein as being sufficiently similar. Preferably, such variants will be sufficiently similar to the amino acid sequence of the preferred proteins of the invention. Such variants will generally retain the functional activity of the proteins of the invention. Variants include proteins or polypeptides that differ in amino acid sequence due to mutagenesis.

[0115] The term "variant" is also intended to encompass peptidomimetics of the proteins of the invention described herein. Proteins or polypeptides containing at least one residue that is not naturally synthesized may also be referred to as "peptidomimetics". As used herein, a peptidomimetic is a synthetic compound having substantially the same structural and / or functional characteristics as the proteins of the invention described herein. The non-natural component of a peptidomimetic compound may conform to one or more of the following: a) residue linkages other than the natural amide bond ("peptide bond") linkage; b) non-natural residues in place of naturally occurring amino acid residues; or c) secondary structure mimics, i.e., residues that induce or stabilize secondary structures, such as beta turns, gamma turns, beta sheets, alpha helical conformations, etc. Peptide mimetics can be synthesized using a variety of procedures and methods described in the scientific and patent literature, e.g., Organic Syntheses Collective Volumes, Gilman et al. (Eds) John Wiley & Sons, Inc., NY, al-Obeidi (1998) Mol. Biotechnol. 9:205-223; Hruby (1997) Curr. Opin. Chem. Biol. 1:114-119; Ostergaard (1997) Mol. Divers. 3:17-27; Ostresh (1996) Methods Enzymol. 267:220-234.

[0116]

[0097] The term "variant" is further intended to encompass orthologs of the proteins of the present invention described herein. As used herein, the term "ortholog" is intended to refer to orthologs of the proteins of the present invention described herein from other intestinal helminths (i.e., hookworms, whipworms, and roundworms), including, but not limited to, human hookworms such as Necator americanus, Ancylostoma duodenale, and Ancylostoma ceylanicum, and Trichuris suis and Trichuris trichiura.

[0117]

[0098] As used herein, the terms "substantially similar functional activity" and "substantially the same biological function or activity" mean that the degree of biological activity is within about 50% to about 100% or more, within about 80% to about 100% or more, or within about 90% to about 100% or more of the biological activity demonstrated by the protein being compared, when the biological activity of each protein is determined by the same procedure or assay. Biological activity may be assessed using standard test methods and bioassays that one of skill in the art would recognize as generally useful for identifying such activity.

[0118] "Similarity" between two proteins is determined by comparing the amino acid sequence of a first protein with the sequence of a second protein. An amino acid of one protein is similar to a corresponding amino acid of a second protein if it is identical or has a conservative amino acid substitution.

[0119] "Conservative amino acid substitutions" include those described in Dayhoff, MO, ed., The Atlas of Protein Sequence and Structure 5, National Biomedical Research Foundation, Washington, DC (1978), and Argos, P. (1989) EMBO J. 8:779-785. For example, amino acids belonging to one of the following groups represent conservative changes or substitutions: - Ala, Pro, Gly, Gln, Asn, Ser, Thr: - Cys, Ser, Tyr, Thr; - VaI, Ile, Leu, Met, Ala, Phe; - Lys, Arg, His; - Phe, Tyr, Trp, His; and - Asp, Glu.

[0120]

[0101] Other conservative amino acid substitutions may also be made with others of the same type, such as: Non-polar: Ala, Val, Leu, Ile, Pro, Met, Phe, Trp Uncharged polar: Gly, Ser, Thr, Cys, Tyr, Asn, Gln Acidic: Asp, Glu Basic: Lys, Arg, His

[0121]

[0102] Other conservative amino acid substitutions may also be made, such as: Aromatic: Phe, Tyr, His Proton donors: Asn, Gln, Lys, Arg, His, Trp Proton acceptor: Glu, Asp, Thr, Ser, Tyr, Asn, Gln

[0122] In some embodiments, a biologically active fragment of a protein of the invention comprises less than about 225, less than about 200, less than about 175, less than about 150, less than about 125, less than about 100, less than about 75, less than about 50, or less than about 25 consecutive amino acids of the amino acid sequence of a protein of the invention described herein. Multiple fragments of a protein of the invention are also contemplated.

[0123]

[0104] In some embodiments, a biologically active variant of a protein of the present invention may share at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% sequence identity with a reference amino acid sequence, e.g., any one of SEQ ID NOs: 1-20.

[0124]

[0105] To determine percent sequence identity, optimal alignment of amino acid and / or nucleotide sequences can be performed by computerized implementation of algorithms (e.g., GAP, BESTFIT, FASTA, and TFASTA in the Genetics Software Package Release 7.0 by Intelligenetics; Genetics Computer Group, WI, USA) or by inspection, and the best alignment (i.e., resulting in the highest percentage of homology over the comparison window) can be generated by any of the selected methods. Reference can also be made to the BLAST family of programs, as disclosed, for example, in Altschul et al. (Nucl, Acids Res. 25:3389-402, 1997). A detailed discussion of sequence analysis can be found in unit 19.3 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY Eds. Ausubel et al. (John Wiley & Sons Inc NY, 1995-1999).

[0125]

[0106] The proteins of the present invention (and fragments and variants thereof) can be produced by any suitable method known to those of skill in the art. Examples of suitable methods include, but are not limited to, chemical synthesis (e.g., solid-phase peptide synthesis), use of recombinant expression systems (e.g., recombinant DNA technology), and isolation, purification and / or enrichment from naturally occurring or recombinant sources.

[0126]

[0107] In some embodiments, the proteins of the present invention (including fragments and variants thereof) are produced by chemical synthesis. Chemical synthesis methods are known in the art. Examples of suitable chemical synthesis methods include those described in Chapter 18 of CURRENT PROTOCOLS IN PROTEIN SCIENCE Eds Coligan et al (John Wiley & Sons NY, 1995-2001).

[0127] In a preferred embodiment, the protein of the present invention (including fragments and variants thereof) is produced by using recombinant DNA technology, including cell-based and cell-free technology. Recombinant technology is known in the art. Examples of suitable recombinant technology include those described in sections 16 and 17 of Sambrook et al. (MOLECULAR CLONING. A Laboratory Manual, Cold Spring Harbor Press, 1989), chapters 10 and 16 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY Eds. Ausubel et al. (John Wiley & Sons Inc NY, 1995-1999), and chapters 1, 5 and 6 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY Eds. Coligan et al. (John Wiley & Sons Inc NY, 1995-1999).

[0128] In some embodiments, the protein of the present invention or its fragment or variant may be modified by covalently attaching any type of molecule to the composition to enhance compatibility for administration, i.e., such that the covalent attachment does not interfere with the activity of the composition. For example, but not by way of limitation, derivatives include compositions modified by glycosylation, lipidation, acetylation, pegylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, linkage to cellular ligands or other proteins, among others. Any of a number of chemical modifications may be made by known techniques, including, but not limited to, specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, and the like. Additionally, the derivative may contain one or more non-proteinogenic amino acids.

[0129]

[0110] In some embodiments, the proteins of the present invention or fragments of variables thereof may be modified to attach effector moieties such as chemical linkers, detectable moieties such as, for example, fluorescent dyes, enzymes, substrates, bioluminescent substances, radioactive substances, and chemiluminescent moieties, or functional moieties such as, for example, streptavidin, avidin, biotin, cytotoxins, cytotoxic agents, and radioactive substances.

[0130]

[0111] In embodiments in which the protein of the present invention (including fragments or variants thereof) is prepared by recombinant DNA techniques, the protein may be prepared from a nucleic acid sequence encoding the protein.

[0131] nucleic acid

[0112] Thus, the present invention provides a nucleic acid comprising a nucleotide sequence encoding a protein of the present invention as described herein. Suitably, the nucleic acid may be provided in an isolated, purified or substantially purified form.

[0132]

[0113] The nucleic acids of the invention include DNA or RNA sequences, including those with an open reading frame, that encode the proteins of the invention and that can be expressed as one of the proteins of the invention under appropriate conditions. The term "nucleic acid" also includes genomic DNA, cDNA, mRNA, splice variants, antisense RNA, RNAi, DNA containing one or more single nucleotide polymorphisms (SNPs), and vectors that contain the subject nucleic acid sequence. The term also includes nucleic acids that are homologous, or substantially similar, or identical to the nucleic acids that encode the proteins of the invention. Thus, the subject invention provides genes that encode the subject proteins, and their homologs.

[0133]

[0114] The nucleic acid or polynucleotide of the present invention refers to a polymeric form of nucleotides of any length. The nucleic acid or polynucleotide can contain deoxyribonucleotides, ribonucleotides, and / or analogs or derivatives thereof. For example, the nucleic acid can be naturally occurring DNA or RNA, or a synthetic analog, as known in the art. The polynucleotide of the present invention also encompasses genomic DNA, genes, gene fragments, exons, introns, regulatory sequences, or regulatory elements such as promoters, enhancers, initiation and termination regions, other control regions, expression regulators, and expression controls; DNA, including one or more single nucleotide polymorphisms (SNPs), allelic variants, isolated DNA of any sequence, and cDNA; mRNA, tRNA, rRNA, ribozymes, splice variants, antisense RNA, antisense conjugates, RNAi, and isolated RNA of any sequence; recombinant polynucleotides, heterologous polynucleotides, branched polynucleotides, labeled polynucleotides, hybrid DNA / RNA, polynucleotide constructs, vectors containing the nucleic acid of interest, nucleic acid probes, primers, and primer pairs.

[0134]

[0115] The nucleic acids of the present invention include modified nucleic acid molecules with backbone, sugar, or heterocyclic base modifications, such as methylated nucleic acid molecules, peptide nucleic acids, and nucleic acid molecule analogs, which may be suitable, for example, as probes if they exhibit superior stability and / or binding affinity under assay conditions. They also include single-stranded, double-stranded, and triple-helical molecules, either DNA, RNA, or hybrid DNA / RNA, which may encode full-length genes or biologically active fragments thereof.

[0135]

[0116] The nucleic acids of the present invention include single nucleotide polymorphisms. Single nucleotide polymorphisms (SNPs) occur frequently in eukaryotic genomes. The nucleotide sequence determined from one individual of a species may differ from other allelic forms present in a population. The present invention encompasses such SNPs. The subject polynucleotides include those that encode variants of the polypeptides described herein. Thus, in some embodiments, the subject nucleic acids encode variant proteins that include insertions, deletions, or substitutions compared to the polypeptides described herein. Conservative amino acid substitutions include serine / threonine, valine / leucine / isoleucine, asparagine / histidine / glutamine, glutamic acid / aspartic acid, etc., as described herein.

[0136]

[0117] Modification of the native amino acid sequence, such as by insertion, deletion and / or substitution, to generate mutant proteins can be performed by various means known to those skilled in the art. For example, site-specific mutations can be introduced by ligating synthetic oligonucleotides containing the modification site into an expression vector. Oligonucleotide-directed site-specific mutagenesis procedures can also be used, such as those disclosed in Walder et al., Gene 42: 133 (1986); Bauer et al., Gene 37: 73 (1985); Craik, Biotechniques, 12-19 (January 1995); and U.S. Patent Nos. 4,518,584 and 4,737,462.

[0137]

[0118] The present invention also provides a vector or expression construct comprising a nucleic acid of the invention described herein.

[0138]

[0119] The present invention also provides a cell comprising a nucleic acid of the invention or a vector or expression construct of the invention as described herein. Suitably, the cell may be an isolated cell.

[0139] Generation method

[0120] The present invention also provides a method for preparing a recombinant protein of the present invention, comprising incubating a cell of the present invention described herein under conditions that enable the cell to express the recombinant protein.

[0140]

[0121] The nucleic acid can be inserted into an appropriate vector or expression construct for the production of a recombinant protein, for example, by inserting the vector or expression construct into a prokaryotic or eukaryotic host cell. Successful expression of a recombinant protein requires that the expression vector contains the necessary regulatory elements for transcription and translation that are compatible with and recognized by the particular host cell system used for expression. A variety of host cell systems can be utilized to express recombinant proteins, including, but not limited to, bacteria transformed with bacteriophage vectors, plasmid vectors, or cosmid DNA; yeast containing yeast vectors; fungi containing fungal vectors; insect cell lines infected with viruses (e.g., baculovirus); and mammalian cell lines transfected with plasmid or viral expression vectors or infected with recombinant viruses (e.g., vaccinia virus, adenovirus, adeno-associated virus, retrovirus, etc.).

[0141]

[0122] Using methods known in the art of molecular biology, various promoters and enhancers can be incorporated into expression vectors to increase expression of recombinant proteins, provided that the increased expression of the amino acid sequence is compatible with (e.g., non-toxic) the particular host cell system used.

[0142]

[0123] The choice of promoter depends on the expression system used. Promoters vary in strength, i.e., ability to promote transcription. In general, it is desirable to use a strong promoter to obtain high levels of transcription of the coding nucleotide sequence and expression into a recombinant protein. For example, bacterial, phage, or plasmid promoters known in the art that have been observed to produce high levels of transcription in host cell systems including E. coli include the lac promoter, the trp promoter, the recA promoter, the ribosomal RNA promoter, the P R and P L Promoters include lacUV5, ompF, bla, lpp, etc., which can be used to provide for transcription of the inserted nucleotide sequence encoding the amino acid sequence.

[0143] Other control elements for efficient transcription or translation include enhancers and regulatory signals. Enhancer sequences are DNA elements that appear to increase transcription efficiency relatively independent of their position and orientation relative to nearby coding nucleotide sequences. Thus, depending on the host cell expression vector system used, enhancers can be located either upstream or downstream from the inserted coding sequence to increase transcription efficiency. Other regulatory sites, such as transcription or translation initiation signals, can be used to regulate the expression of coding sequences.

[0144] In the case of recombinant proteins, the nucleic acid encoding it can be cloned into an expression construct or vector, which is then transfected into host cells such as Escherichia coli (E. coli) cells, yeast cells, insect cells, or mammalian cells, for example monkey COS cells, Chinese hamster ovary (CHO) cells, human embryonic kidney (HEK) cells, or myeloma cells that do not otherwise produce the protein. Exemplary cells used to express proteins are CHO cells, myeloma cells, or HEK cells. In a preferred embodiment, the cells are mammalian cells, particularly HEK cells, such as HEK293F cells, or CHO cells. Molecular cloning techniques to achieve these ends are known in the art and are described, for example, in Ausubel et al., (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date) or Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989). A wide variety of cloning and in vitro amplification methods are suitable for the construction of recombinant nucleic acids.

[0145]

[0126] As used herein, the term "promoter" should be taken in its broadest context and includes, for example, the transcriptional regulatory sequences of genomic genes, including the TATA box or initiator elements required for correct transcription initiation, with or without additional regulatory elements (e.g., upstream activating sequences, transcription factor binding sites, enhancers and silencers) that alter expression of the nucleic acid in response to developmental and / or external stimuli or in a tissue-specific manner. In this context, the term "promoter" is also used to describe a recombinant, synthetic or fusion nucleic acid, or derivative, that confers, activates or enhances expression of a nucleic acid to which it is operably linked. Exemplary promoters can contain additional copies of one or more specific regulatory elements to further enhance expression of the nucleic acid and / or to alter spatial and / or temporal expression.

[0146]

[0127] As used herein, the term "operably linked" means positioning a promoter relative to a nucleic acid such that expression of the nucleic acid is controlled by the promoter.

[0147]

[0128] A large number of vectors are available for intracellular expression. Vector components generally include, but are not limited to, one or more of the following: signal sequence, protein coding sequence (e.g., obtained from the information provided herein), enhancer element, promoter, and transcription termination sequence. Those skilled in the art will recognize suitable sequences for protein expression. Exemplary signal sequences include prokaryotic secretion signals (e.g., pelB, alkaline phosphatase, penicillinase, Ipp, or heat-stable enterotoxin II), yeast secretion signals (e.g., invertase leader, alpha-factor leader, or acid phosphatase leader), or mammalian secretion signals (e.g., herpes simplex gD signal, or human immunoglobulin G (IgG) signal). Additional examples of suitable signal sequences include those listed in Table 5 below.

[0148] [Table 24]

[0149]

[0129] In some embodiments, the signal sequence of any one of SEQ ID NOs: 54-69 is suitably used for expression of any one of the proteins of the present invention (including fragments and variants thereof). For example, the signal sequence of any one of SEQ ID NOs: 54-69 may be suitably used for expression of an isolated, recombinant or synthetic protein, including a recombinant protein encoded by an amino acid sequence of any one of SEQ ID NOs: 1-20, or a nucleotide sequence of any one of SEQ ID NOs: 21-53.

[0150] In certain embodiments, one or more of the following apply: - the signal sequence of SEQ ID NO: 54 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 11; - the signal sequence of SEQ ID NO: 55 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 10; - the signal sequence of SEQ ID NO: 56 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 1; - the signal sequence of SEQ ID NO: 57 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 9; - the signal sequence of SEQ ID NO: 58 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 13; - the signal sequence of SEQ ID NO: 59 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 20; - the signal sequence of SEQ ID NO: 60 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 2; - the signal sequence of SEQ ID NO: 61 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 6; - the signal sequence of SEQ ID NO: 62 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 8; - the signal sequence of SEQ ID NO: 63 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 7; - the signal sequence of SEQ ID NO: 64 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 14; - the signal sequence of SEQ ID NO: 65 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 19; - the signal sequence of SEQ ID NO: 66 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 15; - the signal sequence of SEQ ID NO: 67 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 16; - the signal sequence of SEQ ID NO: 68 is used for the expression of a protein comprising the amino acid sequence of SEQ ID NO: 17; The signal sequence of SEQ ID NO: 69 is used for the expression of a protein comprising the amino acid sequence of any one of SEQ ID NOs: 1 to 20.

[0151] Exemplary promoters active in mammalian cells include the cytomegalovirus immediate early promoter (CMV-IE), human elongation factor 1-alpha promoter (EF1), small nuclear RNA promoters (U1a and U1b), alpha-myosin heavy chain promoter, simian virus 40 promoter (SV40), Rous sarcoma virus promoter (RSV), adenovirus major late promoter, beta-actin promoter; hybrid regulatory elements including the CMV enhancer / beta-actin promoter or immunoglobulin promoter or active fragments thereof. Examples of useful mammalian host cell lines include the monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney lines (293 or 293 cells subcloned for growth in suspension culture; baby hamster kidney cells (BHK, ATCC CCL 10); or Chinese hamster ovary cells (CHO).

[0152]

[0132] Typical promoters suitable for expression in yeast cells, such as yeast cells selected from the group including Pichia pastoris, Saccharomyces cerevisiae, and S. pombe, include, but are not limited to, the ADH1 promoter, the GAL1 promoter, the GAL4 promoter, the CUP1 promoter, the PHO5 promoter, the nmt promoter, the RPR1 promoter, or the TEF1 promoter.

[0153]

[0133] Means for introducing isolated nucleic acids or expression constructs containing them into cells for expression are known to those skilled in the art. The technique used for a given cell depends on known successful techniques. Means for introducing recombinant DNA into cells include, inter alia, microinjection, DEAE-dextran mediated transfection, liposome mediated transfection, such as by using Lipofectamine (Gibco, MD, USA) and / or Cellfectin (Gibco, MD, USA), PEG-mediated DNA uptake, electroporation, and microparticle bombardment, such as by using DNA-coated tungsten or gold particles (Agracetus Inc., WI, USA).

[0154]

[0134] Host cells used to produce proteins may be cultured in a variety of media depending on the type of cell used. Commercially available media such as Ham's F10 (Sigma), Minimum Essential Medium ((MEM), (Sigma), RPM1-1640 (Sigma), and Dulbecco's Modified Eagle's Medium ((DMEM), Sigma) are suitable for culturing mammalian cells. Media for culturing the other cell types discussed herein are known in the art.

[0155]

[0135] The present invention also provides methods for isolating (or purifying or substantially purifying) the proteins of the present invention. Methods for isolating proteins are known in the art.

[0156]

[0136] If the protein of the invention is secreted into the medium, the supernatant from such an expression system can first be concentrated using a commercially available protein concentration filter, such as an Amicon or Millipore Pellicon ultrafiltration device. A protease inhibitor such as PMSF can be included in any of the above steps to inhibit proteolysis, and antibiotics can be included to inhibit the growth of adventitious contaminants. Alternatively, or in addition, the supernatant can be filtered and / or separated from the cells expressing the protein, for example, using continuous centrifugation.

[0157]

[0137] The protein prepared from the cells of the present invention can be purified using, for example, ion exchange, hydroxyapatite chromatography, hydrophobic interaction chromatography, gel electrophoresis, dialysis, affinity chromatography (e.g., Protein A affinity chromatography or Protein G chromatography), or any combination of the above. These methods are known in the art and are described, for example, in WO 99 / 57134, or Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, (1988).

[0158]

[0138] Those skilled in the art will also recognize that proteins can be modified to include tags for facilitating purification or detection, such as a polypeptide tag, such as a polyhistidine tag, such as a hexahistidine tag, or a myc tag, or an influenza virus hemagglutinin (HA) tag, or a simian virus 5 (V5) tag, or a FLAG tag, or a glutathione S-transferase (GST) tag. The resulting protein is then purified using methods known in the art, such as affinity purification. For example, a protein containing a hexa-his tag is purified by contacting a sample containing the protein with nickel-nitrilotriacetic acid (Ni-NTA), which specifically binds to the hexa-his tag immobilized on a solid or semi-solid support, washing the sample to remove unbound proteins, and then eluting the bound proteins. Alternatively, or in addition, a ligand or antibody that binds to the tag is used in the affinity purification method.

[0159]

[0139] Those skilled in the art will also be familiar with the use of appropriate tags to allow enzymatic ligation, including but not limited to the use of "SPYCATCHER" and / or SPYTAG sequence motifs, as well as the use of butyrase, asparaginyl peptidase or sortase.

[0160] Pharmaceutical Compositions

[0140] The present invention also provides pharmaceutical compositions comprising, consisting essentially of, or consisting of a protein of the present invention described herein and at least one pharma- ceutically acceptable carrier.

[0161]

[0141] As used herein, the terms "consisting essentially of" and "consisting of" in the context of the pharmaceutical compositions of the present invention will be understood to mean that the composition does not contain any additional active agents other than those specified in the composition.

[0162]

[0142] Suitably, the pharmaceutical composition comprises a suitable pharma- ceutically acceptable carrier. Preferably, the pharma- ceutically acceptable carrier is suitable for administration to mammals, particularly humans.

[0163]

[0143] As used herein, the term "pharmaceutically acceptable carrier" refers to a solid or liquid filler, diluent, excipient, solvent, or encapsulating substance that may be safely used in local or systemic administration. A carrier must be "acceptable" in the sense of being compatible with the other ingredients of the composition and not harmful to the recipient thereof.

[0164]

[0144] The pharmaceutical composition may be appropriately formulated for administration by a particular route. Suitable routes of administration include oral, rectal, transmucosal, transdermal, and parenteral administration. In some embodiments, the composition is formulated for oral administration, topical administration such as buccal or sublingual administration, nasal administration, rectal administration, transdermal administration, or parenteral administration such as subcutaneous, intramuscular, intraperitoneal, or intravenous administration. In a preferred embodiment, the composition is formulated for parenteral administration, particularly subcutaneous or intraperitoneal administration.

[0165]

[0145] Pharmaceutical preparations include those suitable for oral, rectal, nasal, topical (including buccal and sublingual) or parenteral (including intramuscular, subcutaneous and intravenous) administration, or in a form suitable for administration by inhalation or insufflation. Thus, the protein of the present invention, together with a conventional adjuvant, carrier, excipient, or diluent, may be placed in the form of pharmaceutical compositions and unit dosage forms thereof, in which it may be used as a solid, such as a tablet or filled capsule, or as a liquid, such as a solution, suspension, emulsion, elixir, or capsule filled therewith, all for oral use, or in the form of a suppository for rectal administration, or in the form of a sterile injectable solution for parenteral (including subcutaneous) use. Such pharmaceutical compositions and unit dosage forms thereof may contain conventional ingredients in conventional proportions, with or without additional active compounds or ingredients, and such unit dosage forms may contain any suitable effective amount of active ingredient commensurate with the intended daily dosage range to be used. The protein of the present invention may be administered in various types of parenteral dosage forms. It will be obvious to those skilled in the art that the following dosage forms may comprise as the active component, either a protein of the invention (including fragments or variants thereof) or a pharma- ceutically acceptable derivative of the protein.

[0166]

[0146] For preparing pharmaceutical compositions from the protein of the present invention, pharma- ceutically acceptable carriers can be either solid or liquid.Solid preparations include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules.Solid carriers can be one or more substances that can also act as diluents, flavorings, solubilizers, lubricants, suspending agents, binders, preservatives, tablet disintegrating agents, or encapsulating materials.

[0167]

[0147] In powders, the carrier is a finely divided solid which is in admixture with the finely divided active ingredient.

[0168]

[0148] In tablets, the active component is mixed with the carrier having the necessary binding capacity in suitable proportions and compacted to the desired shape and size.

[0169]

[0149] Powders and tablets preferably contain 5 or 10 to about 70 percent of the active compound. Suitable carriers are magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, low melting wax, cocoa butter, and the like. The term "preparation" is intended to include formulations of the active compound with encapsulating materials as carriers to provide capsules, where the active ingredient is surrounded by the carrier with or without the carrier, and thus associated with the carrier. Similarly, cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid forms suitable for oral administration.

[0170]

[0150] For preparing suppositories, a low melting wax, such as a mixture of fatty acid glycerides or cocoa butter, is first melted and the active ingredient is dispersed homogeneously therein, as by stirring, etc. The molten homogeneous mixture is then poured into convenient sized molds, allowed to cool and thereby solidify.

[0171]

[0151] Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water-propylene glycol solutions. For example, parenteral injection liquid preparations can be formulated as solutions in aqueous polyethylene glycol solution.

[0172]

[0152] Thus, the protein according to the present invention can be formulated for parenteral administration (e.g., by injection, e.g., bolus injection or continuous infusion), and can be presented in unit dose form in ampoules, pre-filled syringes, small infusions, or in multi-dose containers with added preservatives. The composition can take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and can contain formulating agents such as suspending, stabilizing and / or dispersing agents. Alternatively, the active ingredient can be in powder form, obtained by aseptic isolation of a sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

[0173]

[0153] Aqueous solutions suitable for oral use can be prepared by dissolving the active component in water and adding suitable colorants, flavors, stabilizing, and thickening agents as desired.

[0174]

[0154] Aqueous suspensions suitable for oral use may be made by dispersing finely divided active ingredient in water together with viscous materials such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, or other well-known suspending agents.

[0175]

[0155] Also included are solid form preparations that are intended to be converted into liquid form preparations for oral administration immediately before use.Such liquid forms include solutions, suspensions and emulsions.These preparations may contain, in addition to active ingredients, colorants, flavorings, stabilizers, buffers, artificial and natural sweeteners, dispersants, thickeners, solubilizers, etc.

[0176] For topical administration to the epidermis, the protein according to the present invention can be formulated as an ointment, cream or lotion, or as a transdermal patch. Ointments and creams can be formulated with an aqueous or oily base, for example, by adding suitable thickening and / or gelling agents. Lotions can be formulated with an aqueous or oily base, and generally also contain one or more emulsifiers, stabilizers, dispersants, suspending agents, thickening agents, or coloring agents.

[0177]

[0157] Formulations suitable for topical administration in the mouth include lozenges which contain the active ingredient in a flavored base, usually sucrose and acacia or tragacanth; pastilles which contain the active ingredient in an inert base such as gelatin and glycerin, or sucrose and acacia; and mouthwashes which contain the active ingredient in a suitable liquid carrier.

[0178]

[0158] The solution or suspension is applied directly to the nasal cavity by conventional means, for example, by using a dropper, pipette or spray. The formulation can be provided in single or multiple dose form. In the latter case of a dropper or pipette, this can be achieved by the patient administering an appropriate predetermined volume of the solution or suspension. In the case of a spray, this can be achieved, for example, by a metered atomizing spray pump. To improve nasal delivery and retention, the protein according to the present invention can be encapsulated by cyclodextrin or formulated with those agents that are expected to enhance delivery and retention in the nasal mucosa.

[0179]

[0159] Administration to the respiratory tract may be accomplished by aerosol formulations in which the active ingredient is provided in a pressurized pack containing a suitable propellant, such as a chlorofluorocarbon (CFC), for example, dichlorodifluoromethane, trichlorofluoromethane, or dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. The aerosol may conveniently contain a surfactant, such as lecithin. The dose of drug may be controlled by providing a metered valve.

[0180]

[0160] Alternatively, the active ingredient may be provided in the form of a dry powder, for example, a powder mix of the active compound in a suitable powder base, for example, lactose, starch, hydroxypropylmethylcellulose and starch derivatives such as polyvinylpyrrolidone (PVP).

[0181] Conveniently, the powder carrier is capable of forming a gel in the nasal cavity.The powder composition may be presented in unit dose form, for example, in capsules or cartridges (made, for example, from gelatin), or blister packs from which the powder may be administered by means of an inhaler.

[0182]

[0162] In formulations intended for administration to the respiratory tract, including intranasal formulations, the active compound will generally have a small particle size, for example of the order of 1 to 10 microns or less. Such a particle size can be obtained by means known in the art, for example by micronization.

[0183] When desired, formulations adapted to give sustained release of the active ingredient may be employed.

[0184]

[0164] The pharmaceutical product can be in unit dosage form. In such form, the preparation is divided into unit doses containing appropriate amounts of active ingredients. The unit dosage form can be a packaged preparation, the package containing a discrete amount of the preparation, for example, packet tablets, capsules, and powders in vials or ampoules. The unit dosage form can also be a capsule, tablet, cachet, or lozenge itself, or any of these in the appropriate number of packaged form.

[0185]

[0165] The pharmaceutical composition may further comprise an additional active agent other than the protein of the present invention. Examples of suitable additional active agents include agents useful in the treatment of inflammatory conditions (anti-inflammatory agents) and agents useful in the treatment of autoimmune conditions (immunosuppressants).

[0186] The present invention also provides a kit comprising a protein of the invention as described herein, or a biologically active fragment or variant thereof, or a pharmaceutical composition as described herein, and an additional active agent. In some embodiments, the additional active agent is selected from an agent useful in the treatment of an inflammatory condition and an agent useful in the treatment of an autoimmune condition.

[0187] How to use

[0167] The proteins of the invention described herein may be useful in the treatment of inflammatory or autoimmune conditions.

[0188]

[0168] Thus, the present invention provides a method for treating or preventing an inflammatory or autoimmune condition comprising administering to a subject in need thereof a protein of the invention as described herein, or a biologically active fragment or variant thereof, or a pharmaceutical composition as described herein, thereby treating or preventing an inflammatory or autoimmune condition in a subject.

[0189] The present invention also provides a method for treating or preventing an inflammatory or autoimmune condition in a subject, comprising: - identifying a subject having an inflammatory or autoimmune condition; - administering to a subject in need thereof a therapeutically effective amount of a protein of the invention as described herein, or a biologically active fragment or variant thereof, or a pharmaceutical composition as described herein. thereby treating or preventing an inflammatory or autoimmune condition in a subject.

[0190]

[0170] The present invention also provides the use of a protein described herein, or a biologically active fragment or variant thereof, in the manufacture of a medicament for treating or preventing an inflammatory or autoimmune condition.

[0191]

[0171] The present invention also provides a protein as described herein, or a biologically active fragment or variant thereof, for use in treating or preventing an inflammatory or autoimmune condition.

[0192]

[0172] The methods and uses of the present invention may further include administering an additional active agent other than the protein of the present invention. Examples of suitable active agents include agents useful in the treatment of inflammatory conditions (anti-inflammatory agents) and agents useful in the treatment of autoimmune conditions (immunosuppressants).

[0193]

[0173] The additional active agent and the protein of the present invention (including fragments or variants thereof) may be administered together in a single composition or in separate compositions. Thus, in some embodiments, the additional active agent and the protein of the present invention are administered in a single composition, such as the pharmaceutical compositions described herein. In other embodiments, the additional active agent and the protein of the present invention are administered simultaneously or sequentially in separate compositions. The additional active agent and the protein of the present invention may be administered at different times and at different frequencies, but in combination, they exert a biological effect at the same time or at overlapping times.

[0194]

[0174] As used herein, the term "inflammatory condition" refers to a condition, disorder, or disease characterized by inflammation. Symptoms of inflammation can include redness, swelling, heat, pain, and loss of function. Examples of inflammatory conditions include inflammatory bowel disease (IBD), such as ulcerative colitis and Crohn's disease, irritable bowel syndrome (IBS), type 2 diabetes, and asthma.

[0195]

[0175] As used herein, the term "autoimmune condition" refers to a condition, disorder or disease in which the body's immune system mistakenly attacks the body's own cells, resulting in an abnormal immune response. Autoimmune conditions may be genetic and / or caused by environmental factors, such as infections and chemicals, including drugs. Examples of autoimmune conditions include rheumatoid arthritis, lupus, allergies, including food allergies, and autoimmune diseases of the gastrointestinal system, including celiac disease. It will be appreciated that an autoimmune condition may also be an inflammatory condition.

[0196] As used herein, the term "treating" a subject or "treatment" of a subject includes administering to a subject a protein of the invention (or a fragment or variant thereof) or a composition described herein for the purpose of delaying, slowing, stabilizing, curing, curing, alleviating, mitigating, altering, treating, lessening deterioration, ameliorating, improving, or affecting inflammation associated with a disease or condition, or symptoms of a disease or condition. The term "treating" refers to any indication of success in treating or ameliorating an injury, pathology, or condition, and includes any objective or subjective parameter, such as relief; remission; reduction in rate of deterioration; reduction in severity of disease; stabilization, reduction in symptoms or injury, etc.

[0197]

[0177] As used herein, the terms "prevent" or "prevention" are intended to refer to at least reducing the likelihood of risk (or susceptibility) of acquiring a condition, disorder or disease, i.e., preventing at least one clinical symptom of the disease from developing in a patient who may be exposed to or predisposed to the disease, but who has not yet experienced or displayed symptoms of the disease.

[0198]

[0178] A subject in need of treatment for an inflammatory condition may exhibit a number of symptoms depending on the type of condition, disorder or disease associated with inflammation. In some embodiments, a subject in need of treatment may exhibit symptoms including pain, redness, swelling, fatigue, fever, rash, chest pain, and abdominal pain.

[0199] The presence of inflammation, amelioration of inflammation, or treatment or prevention of inflammation may be determined by any clinically or biochemically relevant method described herein or known in the art. Relevant methods may be the measurement of symptoms including pain, redness, swelling, fatigue, fever, rash, chest pain, and abdominal pain. The amelioration, treatment, or prevention may be determined directly from the subject or a sample or biopsy from the subject. The sample or biopsy may be of inflamed or diseased tissue. In this case, the levels of pro-inflammatory and / or anti-inflammatory cytokines may be measured before and after treatment as an indication of successful treatment. The presence of inflammatory leukocytes may be yet another indicator. It will be appreciated that in some embodiments, a reduction in the levels of one or more of IFN-γ, TNF-α, IL-17A compared to untreated tissue may be an indication of reduced inflammation or an anti-inflammatory response.

[0200]

[0180] Subjects who need treatment for autoimmune conditions may present with several symptoms, depending on the type of inflammation-related condition, disorder or disease. Symptoms vary depending on the affected area, the causative agent of the disease, and the individual. Early autoimmune disease symptoms include fatigue, fever, malaise, joint pain, and rash. Autoimmune diseases are usually diagnosed using a combination of medical history, blood tests (to evaluate autoantibodies, inflammation, and organ function), and other tests such as x-rays and biopsies of affected tissues.

[0201] The presence of autoimmunity, amelioration of autoimmunity, or treatment or prevention of autoimmunity may be determined by any clinically or biochemically relevant method described herein or known in the art. Relevant methods may be measurement of symptoms including inflammation, fatigue, fever, rash and pain. Amelioration, treatment or prevention may be determined directly from the subject or from a sample or biopsy from the subject. The sample or biopsy may be of diseased tissue. In this case, the levels of immune cells and molecules (e.g., antigens) may be measured before and after treatment as an indication of the success of the treatment. The presence of pro-inflammatory cytokines, anti-inflammatory cytokines and / or inflammatory leukocytes may be yet another indicator. It will be appreciated that in some embodiments, a decrease in the level of autoantibodies compared to untreated tissue may be an indication of a decreased immune response.

[0202]

[0182] In some embodiments, the methods of the present invention comprise administering a therapeutically or prophylactically effective amount of a protein of the present invention described herein or a pharmaceutical composition described herein.

[0203]

[0183] As used herein, the term "therapeutically effective amount" is generally intended to refer to an amount of an active agent, such as a protein of the present invention (or a fragment or variant thereof), that (i) treats a particular condition, disorder or disease, (ii) reduces, improves, or eliminates one or more symptoms of a particular condition, disorder or disease, or (iii) delays the onset of one or more symptoms of a particular condition, disorder or disease, as described herein. The exact dose will depend on the purpose of the treatment and can be ascertained by the skilled artisan using known techniques. Adjustments for systemic versus local delivery, age, weight, general health, sex, diet, time of administration, drug interactions, and severity of the condition, as known in the art and described above, may be necessary and can be ascertained by the skilled artisan using routine experimentation.

[0204]

[0184] As used herein, the term "prophylactically effective amount" is intended to refer to an amount of a protein of the present invention (or a fragment or variant thereof) sufficient to prevent or inhibit or delay the onset of one or more detectable symptoms of a clinical condition. One of skill in the art will recognize that such an amount may depend, for example, on the particular subject, and / or the type or severity or level of the condition, and / or predisposition (genetic or otherwise) to the condition. Thus, this term should not be construed to limit the invention to a specific amount, e.g., weight of the peptide, but rather the invention encompasses any amount of a protein of the present invention sufficient to achieve the described result in a subject.

[0205]

[0185] Appropriate dosages of the proteins of the invention will vary depending on the particular condition being treated and / or the subject being treated. Determining appropriate dosages is within the ability of a skilled physician, for example, by starting with a suboptimal dosage and incrementally modifying the dosage to determine an optimal or useful dosage. Alternatively, data from cell culture assays or animal studies can be used to determine appropriate dosages suitable for treatment / prophylaxis, where an appropriate dose is determined to be greater than or equal to the ED of the active compound with little or no toxicity. 50 The circulating concentration range includes the IC50 / IC10 concentration. Dosages may vary within this range depending on the dosage form used and the route of administration utilized. The therapeutically / prophylactically effective dose can be estimated initially from cell culture assays. The IC50 / IC10 concentration is determined in cell culture. 50 A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes (i.e., the concentration or amount of compound that achieves a half-maximal inhibition of symptoms). Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.

[0206]

[0186] Typically, a therapeutically effective dose is formulated to contain a concentration (by weight) of the protein of the invention of at least about 0.1% to about 50% or more, and all combinations and subcombinations of ranges therein. The pharmaceutical compositions described herein can be formulated to contain a protein of the invention, or a biologically active fragment or variant thereof, at a concentration of about 0.1 to less than about 50%, e.g., about 49, 48, 47, 46, 45, 44, 43, 42, 41, or 40%, with a concentration of more than about 0.1%, e.g., about 0.2, 0.3, 0.4, or 0.5%, to less than about 40%, e.g., about 39, 38, 37, 36, 35, 34, 33, 32, 31, or 30%. Exemplary compositions can contain from about 0.5% to less than about 30%, e.g., about 29, 28, 27, 26, 25, 25, 24, 23, 22, 21 or 20%, with concentrations of more than about 0.5%, e.g., about 0.6, 0.7, 0.8, 0.9 or 1%, to less than about 20%, e.g., about 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10%. Compositions can contain from about 1% to less than about 10%, e.g., about 9 or 8%, including concentrations of more than about 2%, e.g., about 3 or 4% to less than about 8%, e.g., about 7 or 6%. The active agent can be present, for example, at a concentration of about 5%. In all cases, the amount can be adjusted to compensate for differences in the amount of active ingredient actually delivered to the cells or tissues being treated in the subject.

[0207]

[0187] The protein of the present invention described herein or the pharmaceutical composition described herein may be administered or formulated for administration by any of the routes described herein. As used herein, the term "administered" means administration of a therapeutically effective dose of the protein of the present invention to a subject. As used herein, the term "formulated for administration" means that a therapeutically effective dose of the protein of the present invention is formulated in such a manner that is suitable for the route of administration. In a preferred embodiment, the protein (or pharmaceutical composition) of the present invention is administered parenterally. In another preferred embodiment, the protein (or pharmaceutical composition) of the present invention is formulated for parenteral administration.

[0208]

[0188] The frequency of administration of the proteins or pharmaceutical compositions of the invention described herein can be once a day, twice a day, or three times a day. The duration of treatment can be the duration of detectable disease.

[0209] In some embodiments, the inflammatory or autoimmune condition is selected from inflammatory bowel disease, irritable bowel syndrome, type 2 diabetes, asthma, rheumatoid arthritis, lupus, allergies, and celiac disease, and is particularly inflammatory bowel disease. In embodiments where the inflammatory condition is inflammatory bowel disease, the inflammatory bowel disease may be ulcerative colitis or Crohn's disease.

[0210] Inflammatory bowel disease (IBD) is a group of chronic inflammatory disorders of the digestive tract. It can occur as ulcerative colitis, which causes inflammation and ulcers over time in the lining of the large intestine and rectum, or as Crohn's disease, which is characterized by inflammation of the digestive tract lining disseminated throughout affected tissues such as the mouth, esophagus, stomach, and anus.

[0211] Crohn's disease is a condition characterized by chronic inflammation in the lining of the digestive system. The patches of inflammation may be small or may extend quite far along the intestine, or there may be several patches in different locations. Typical symptoms include recurrent diarrhea, often accompanied by an urgency to go to the toilet, and often the need to go but nothing to pass, abdominal pain and cramps that are usually worse after eating, extreme tiredness (fatigue) and / or weight loss. Colonoscopy is used for diagnosis by taking a small tissue sample for examination under a microscope (biopsy).

[0212] Ulcerative colitis is a chronic inflammatory condition that usually occurs in the rectum (the part of the large intestine just inside the anus) and the lower part of the colon, but can affect the entire large intestine (colon). The colon becomes inflamed, and if this inflammation becomes severe, the lining of the colon can break down and ulcers can form. Diagnosis of ulcerative colitis can be performed by blood tests to check for inflammation, anemia, and protein levels, stool samples to check for infection, x-rays to help assess the extent of the condition, sigmoidoscopy to check the degree of inflammation in the rectum and lower part of the colon, and / or colonoscopy to look at the lining of the entire colon.

[0213] Irritable bowel syndrome (IBS) is a gastrointestinal disorder characterized by a group of symptoms experienced together, including abdominal pain and alternating diarrhea and constipation. IBS can be diagnosed by blood tests (including blood tests for celiac disease), stool tests, and intestinal tests (e.g., sigmoidoscopy or colonoscopy).

[0214]

[0194] Type 2 diabetes is a progressive condition in which the body becomes resistant to the normal effects of insulin and / or the pancreas gradually loses the ability to produce sufficient insulin. Type 2 diabetes is usually characterized by hyperglycemia in association with insulin resistance and reduced insulin production. Symptoms of type 2 diabetes may include excessive thirst, increased hunger, frequent urination, fatigue, and slow wound healing. Diagnosis of type 2 diabetes can be performed by blood glucose testing (fasting or random).

[0215]

[0195] Asthma is a condition in which airways become inflamed, narrowed, swollen, and produce excess mucus. This can lead to difficulty breathing, chest pain, coughing, and wheezing. Diagnosis can be made by monitoring the pattern of symptoms and response to treatment over time, and by spirometry to determine the amount of air that can be forcibly exhaled in the first second after a full inspiration (FEV1).

[0216] Rheumatoid arthritis (RA) is a chronic autoimmune and inflammatory condition that primarily affects the joints, usually causing joint pain and swelling. In RA, the immune system targets the lining of the joints, causing inflammation and joint damage. Diagnosis can be performed by monitoring symptoms and from a variety of tests, including blood tests for the detection of inflammation and antibodies, such as anti-cyclic citrullinated peptide (anti-CCP), as well as x-rays.

[0217] Lupus is a chronic autoimmune condition that can cause inflammation in many different parts of the body. Systemic lupus erythematosus (SLE) is a type of lupus that can affect almost any organ or tissue in the body. Common symptoms can include joint and muscle pain, skin rash, fever, and fatigue. Diagnosis can usually be performed by blood tests, including antinuclear antibody (ANA) tests.

[0218]

[0198] Allergy is a condition caused by hypersensitivity of immune system to trigger or allergen. Examples of allergic conditions include hay fever, food allergy, atopic dermatitis, urticaria and allergic asthma. Symptoms or allergic reactions can include itching, sneezing, difficulty breathing and anaphylaxis. Diagnosis can be performed by allergy testing, including skin prick test, patch test, challenge test and blood test.

[0219]

[0199] Celiac disease is a chronic autoimmune condition that mainly affects the small intestine and is caused by a reaction to gluten. Celiac disease usually occurs in people with a genetic predisposition. Symptoms usually include gastrointestinal problems, including chronic diarrhea, abdominal bloating, malabsorption, loss of appetite, and failure to grow normally in children. Diagnosis can be performed by a combination of tests, including blood tests for antibody detection, intestinal biopsy, and genetic testing.

[0220]

[0200] Although the peptides of the present invention find use in humans, it will be understood that the present invention is also useful for veterinary purposes.Thus, in all aspects, the present invention is useful for livestock animals such as cows, sheep, horses and poultry; companion animals such as cats and dogs; and zoo animals.Thus, the general term "subject" or "subject to be treated / being treated" will be understood to include all animals (such as humans, apes, dogs, cats, horses and cows) that may have an inflammatory condition.

[0221]

[0201] It will be understood that the invention disclosed and defined herein extends to all alternative combinations of two or more of the individual features mentioned or apparent from the text or drawings, all of which different combinations constitute various alternative aspects of the invention. EXAMPLES

[0222] Working Example Example 1. Selection of protein-coding genes

[0202] Proteins of SEQ ID NOs: 1-20 were selected from protein-coding genes identified from two dataset inputs: the Adult ES Proteome dataset input Mulvenna et al (Proteomic analysis of the excretory / secretory component of the blood-feeding stage of the hookworm, Ancylostoma caninum. Mol Cell Proteomics. 2009;8:109-21) and the Activated L3 SSH Transcriptome database input Datu et al (Transcriptional Changes in the Hookworm, Ancylostoma caninum, during the Transition from a Free-Living to a Parasitic Larva. PLoS Negl Trop Dis. 2008:2(1):e130) using the following bioinformatics workflow.

[0223]

[0203] Step 1 - Compiling gene lists from input datasets: Protein-coding genes identified in dataset 1 (Adult ES Proteome - Mulvenna et al) were based on their gene ontology (GO) predicted from the NCBI database (2007).

[0224] In dataset 2 (Activated L3 SSH Transcriptome-Datu et al), protein-coding genes were identified at the mRNA level based on their upregulation at the mRNA level in serum-activated L3 (Datu et al, Transcriptional Changes in the Hookworm, Ancylostoma caninum, during the Transition from a Free-Living to a Parasitic Larva. PLoS Negl Trop Dis. 2008:2(1):e130). Prioritization was given to the most highly expressed mRNAs according to the Log2 signal intensity detected by SSH. The selection criteria excluded all mRNAs that were downregulated upon serum stimulation. Since the work of Mulvenna et al and Datu et al, the NCBI reference database has been significantly improved and expanded due to advances in deep sequencing technology and bioinformatics analysis. In these studies, protein-coding genes were predicted using bioinformatics software that compared each read to gene models from other parasitic and free-living nematodes, such as Brugia malayi and Caenorhabditis elegans, respectively (https: / / parasite.wormbase.org / Brugia_malayi_prjna10729 / Info / Index / ), (https: / / www.pacb.com / auto_tags / c-elegans / ).

[0225] After the above initial study was performed, more than 1.5 million expressed sequence tags (ESTs; sequences derived from randomly selected cDNA clones) were subsequently generated from different developmental stages of A. caninum (Wang Z et al, Characterizing Ancylostoma caninum transcriptome and exploring nematode parasitic adaptation. BMC Genomics. 2010 May 14;11:307). Therefore, a blast comparison of the selected ESTs was subsequently performed against the latest database to obtain a more accurate predicted gene ontology. 174 protein-coding genes were selected in step 1.

[0226] Step 2 - Validating whether the selected ESTs are full-length sequences: The NCBI BLASTx tool with default parameters of the nucleotide sequence database (nr / nt) was used to validate whether the selected 174 ESTs are in fact full-length (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PAGE_TYPE=BlastSearch). Each translated sequence query was searched against the latest protein database to confirm whether the sequence was full-length by comparing with the top BLAST hits. Some of the assembled nucleotide sequences appeared to be truncated at the 5' end or a reading frame shift was observed, and thus it was evident that no full-length protein-coding gene was present; as a result, some of these proteins were flagged as partial-length EST sequences.

[0227] Step 3 - Establishing whether the EST sequence has a defined signal peptide: Each EST sequence was queried for the presence of a defined N-terminal signal peptide (SP) by comparing it to the homologous sequence in NCBI (2016). SPs direct the protein to be transported outside the cell through the secretory pathway. However, in cell-free recombinant protein engineering, SPs are redundant since there is no ability to direct the sequence through the secretory pathway. Furthermore, SPs are hydrophobic to facilitate translocation through the membranes of various organelles and the cell itself, an undesirable property in recombinant protein expression where soluble proteins are required. The presence, location and cleavage site of N-terminal SPs were predicted for each query EST using SignalP 4.1 Server with default parameters (http: / / www.cbs.dtu.dk / services / SignalP / ). Query EST sequences with close homologs containing SPs proceeded to step 9. Any query EST sequences without obvious SPs proceeded to step 4.

[0228] Step 4 - Mapping of partial-length transcripts: Partial-length transcripts (those that do not contain defined start or stop codons or have ambiguous SP status) were mapped to PacBio Isoseq sequencing Reads of Insert (RoI). This data was obtained in collaboration with Dr Makedonka Mitreva, Washington University School of Medicine (St. Louis, USA). PacBio IsoSeq sequencing technology generates long sequencing reads up to 10 kb with low systematic bias and high consensus accuracy (https: / / www.pacb.com / products-and-services / ). Reads mapped to partial-length A. caninum ESTs from Pacific Biosciences long ead sequencing technology (PacBio) were extracted. Query ESTs were mapped against the A. caninum reference assembly and gene models using HISAT2 (https: / / bio.tools / HISAT2). Transcript consensus sequences are available at http: / / nematode.net. High-quality PacBio reads were extracted from the A. caninum transcript data and mapped against the same references. A list of A. caninum PacBio RoIs that mapped to genes identified by the ESTs was created and FASTQ data was extracted.

[0229] Steps 5 and 6 - Read Acquisition: PacBio reads were obtained for 11 of the 18 protein-coding genes of interest. The A. caninum reference genome assembly was obtained from the WormBase ParaSite (version: WBPS11 - WS265- A_caninum_9.3.2.ec.cg.pg) and contained 25,339 contigs (step 6 of the bioinformatics workflow).

[0230] Steps 7 and 8 - Aligning reads to the reference genome and obtaining full-length protein-coding sequences: PacBio reads were aligned to the reference genome using the STAR Transcriptome Aligner (STAR_2.5.2b) with default parameters (https: / / github.com / alexdobin / STAR). Predicted gene models were obtained from the WormBase ParaSite (version: WBPS11 - WS265) and contained 30,198 predicted transcripts (https: / / parasite.wormbase.org / Ancylostoma_caninum_prjna72585 / Info / Index / ). The Integrative Genomic Viewer (IGV) software (version 2.3.72) was used to inspect the alignment and further translate the PacBio reads into all six reading frames, which were then compared to the predicted WormBase ParaSite gene model alignment ( https: / / software.broadinstitute.org / software / igv / RelNotes2.3.x ).

[0231]

[0211] In more than 50% of cases, the PacBio read transcript sequence did not match the gene model. Differences detected between the WormBase ParaSite predicted gene model and the actual PacBio read transcript included truncated proteins shorter than the transcript, small changes in exon boundaries, and the detection of skipped and new exons.

[0232] After verifying the position of the start codon, SignalP online software was used to determine whether the start codon was followed by an SP. If the start codon was not followed by an SP, all six frames were examined to estimate whether there was a change in the ORF to locate the SP. The position of the stop codon was determined, and untranslated regions (UTRs) were also excluded. The final full-length protein coding sequence was carried forward to step 9.

[0233]

[0213] Step 9 - Generation of an open reading frame for cloning: Any identified SPs and stop codons were removed from the corresponding nucleotide sequence to generate an ORF for cloning into a plasmid vector for cell-free protein expression.

[0234] Example 2. Production of cell-free lysate proteins in the Leishmania tarentolae extract (LTE) system ORFs encoding selected proteins were synthesized and ligated into pLTE vectors by Protein CT Biotechnologies. pLTE DNA was propagated and cell-free lysate protein expression was optimized at James Cook University (JCU). Expression of eGFP fusion lysate proteins was monitored over time in relative fluorescence units (RFU) on a POLARstar® Omega Plate Reader Spectrophotometer. Detection of eGFP expression from a selection of 101 LTE fusion proteins. Expression was measured in relative fluorescence units (RFU) over reaction times in minutes at a wavelength range of 485 nm excitation and 520 nm emission. Protein expression was further verified by SDS-PAGE electrophoresis of non-denaturing cell-free lysates. Fluorescent proteins were visualized using a 485 nm excitation-520 nm emission filter on a BIO-RAD™ VersaDoc Imaging System.

[0235] Example 3. Administration of non-recombinant cell-free lysate to mice To examine whether recombinant cell-free lysates could be used in vivo without the need for purification of hookworm recombinant proteins, mice with trinitrobenzoic acid (TNBS)-induced colitis were administered either positive or negative non-recombinant lysates by intraperitoneal (ip) injection. There was no apparent effect of ip administration of positive or negative non-recombinant lysates on the measured parameters of TNBS-induced colitis in mice. This result strengthened the rationale for using the TNBS-induced colitis model to test cell-free lysates containing hookworm recombinant proteins in vivo.

[0236] Example 4. Effect of recombinant protein lysate in TNBS-induced colitis model In a mouse model of TNBS-induced colitis, recombinant protein lysates were directly evaluated without prior evaluation of the in vitro bioactivity of the lysates. Naive mice received DPBS only, control mice received non-recombinant cell-free lysates followed by TNBS, and the remaining experimental groups received hookworm recombinant protein lysates followed by TNBS. After induction of colitis with TNBS, mice exhibited various signs of acute colitis, including inconsistent stool formation, bloody diarrhea, and dramatic weight loss.

[0237] procedure Leishmania tarentolae Expression (LTE) Protocol Hookworm cDNA open reading frames (ORFs) were cloned into the plasmid vector pLTE eGFP. Protein-encoding ORF sequences were sent to Protein CT Biotechnologies for gene synthesis. Sufficient lysate (600 μL) of each recombinant protein was prepared to allow intraperitoneal (IP) injection of 100 μL of LTE lysate into each of five mice. Lysate reactions were performed in RNase / DNase-free 96-well culture plates. 420 μL of lysate was added to 1 μg DNA (50 μg / mL), 1.5 μL RNAse OUT Ribonuclease Inhibitor (final concentration 0.25%) and supplemented with MilliQ water to a final volume of 600 μL. The relative fluorescence units (RFU) generated by the translation of eGFP fusion proteins were continuously monitored for 2 hours on a POLARstar Omega Plate Reader Spectrophotometer (BMG LABTECH) at a wavelength range of 485 nm excitation and 520 nm emission. The lysate reactions were centrifuged at 300 g for 1 minute and the pellet was discarded. 10 μL of the supernatant was loaded onto a 12% SDS-PAGE gel in an XCell SureLockae Mini-Cell Electrophoresis System (ThermoFisher Scientific) and exposed to 140 volts for 30 minutes using a PowerPac Basic Power Supply (BIO-RAD). The fluorescent signal emitted by the eGFP-tagged recombinant protein bands was visualized using a BIO-RAD VersaDoc Imaging System at a wavelength range of 485 nm excitation and 520 nm emission.

[0238] The following lysates were evaluated: Lysate 2, containing SEQ ID NO:6 as described herein. Lysate 9, containing SEQ ID NO:15 as described herein. Lysate 11, containing SEQ ID NO:17 as described herein. Lysate 13, containing SEQ ID NO:1 as described herein. Lysate 15, containing SEQ ID NO:13 as described herein. Lysate 16, containing SEQ ID NO:2 as described herein. Lysate 17, containing SEQ ID NO:19 as described herein. Lysate 19, containing SEQ ID NO:9 as described herein.

[0239] The following lysates were also evaluated for comparison: Lysate 10, containing SEQ ID NO: 70 shown in Table 6. Lysate 12, containing SEQ ID NO:71 shown in Table 6. Lysate 14, containing SEQ ID NO:72 shown in Table 6. Lysate 20, containing SEQ ID NO:73 shown in Table 6.

[0240] [Table 25]

[0241] Animal procedures All animal experiments were performed under the parameters set out in project #A2180 approved by the JCU Animal Ethics Committee. 5-6 week old male BALB / c mice were purchased from the Animal Resource Centre (ARC) (Perth, Western Australia). Mice were weight matched to within 1 g of each other before shipping to Cairns. Mice were housed under specific pathogen-free conditions in accordance with JCU animal rights and regulations (Cairns Campus). All procedures were performed after proper training in relevant handling procedures and records of procedures were kept by the facility manager. Upon arrival at the facility, mice were assessed for health and weight. Based on their weight, mice were distributed equally into groups (n=5 mice / group) and housed in plastic cages with unlimited access to food and water. Mice were allowed to rest for 7 days before the start of the experiment. In each experiment, each group of 5 mice received an injection of cell-free lysate containing a separate hookworm recombinant protein. Each experiment had a naive group that received 100 µL of DPBS (Gibco 14190144) via the intraperitoneal (i.p.) route, a negative control group that received a cell-free lysate containing an empty pLTE vector expressing only GFP, and 5–10 groups that each received a different hookworm recombinant lysate. Each animal within an experimental group was administered 100 µL of lysate by IP injection 20 h prior to intrarectal (i.r.) administration of TNBS.

[0242] Treatment of Groups: 1. Naive (DPBS only) n=5 2. TNBS + non-recombinant negative control (empty pLTE vector) n = 5 3+. TNBS+ experimental group (lysate containing hookworm recombinant protein), n=5.

[0243] 1. Preparation of Anesthetic Agents Anesthetics were prepared aseptically in sterile phosphate buffered saline (DPBS) (Gibco) solution at the following concentrations: 6.25% ketamine (as hydrochloride) (Ketamil; Provet) (50 mg / kg) and 6.25% xylazine (2-2,6 xylidine-5,6 dihydro-4H-1,3-thiazine hydrochloride) (Xylazil; Provet) (5 mg / kg) and administered to mice at a volume of 200 μL per mouse. Anesthetics were prepared extemporaneously and stored at 4° C. until use under DS4-DS8 approval from the Queensland Government. A copy of the approval is kept by the JCU Australian Institute of Tropical Health and Medicine. Anesthetics were stored in a secure location and all use was recorded in the drug usage record.

[0244] Administration of TNBS to mice Mice were given an ip injection of 200 μL of anesthetic solution via a 29-gauge needle in the right lower quadrant of the peritoneum in a laminar flow cabinet. During this procedure, animals were lightly restrained using a collar pad. After sedation, the baseline weight of each mouse was recorded when it was no longer responsive to stimuli. For administration of TNBS solution, mice were inverted, lubricant (Durex KY Jelly) was placed in the rectum, and a SRPLO IV soft catheter (radiopaque / ETFE, gauge 20Gx11 / 4 inches, inner diameter 0.80x32 mm) was inserted 4 mm into the colon. 1.5 mg, 5% (w / v) 2,4,6-trinitrobenzenesulfonic acid solution (TNBS) (Sigma-Aldrich) in 50% ethanol in Milli-Q purified water (sterile filtered) was slowly administered into the colon in a volume of 100 μL, and the mouse was held upside down for 1 minute to prevent anal leakage. Mice were returned to appropriate cages and monitored for 30 min or until they regained consciousness.

[0245] Measurement and Monitoring

[0224] After administration of TNBS, each animal was monitored daily for changes in health and physical well-being for three days. Clinical scores for each mouse were recorded daily, including weight change, decreased motor activity, piloerection, stool consistency, and rectal bleeding.

[0246]

[0225] [Table 26]

[0247] Animals exposed to TNBS treatment in the absence of therapeutic intervention were expected to stop losing weight by the third day of the experiment. Any mice that suffered excessively or lost more than one-third of their initial body weight in a 24-hour period were sacrificed under the ethical obligations of the approved protocol. In the event of this event or any unexpected death, an "Adverse Event Form" was submitted to the JCU Animal Ethics Committee. There are no reliable positive control drugs for use in TNBS colitis, and it is widely accepted that all standard immunosuppressants and biologics perform relatively poorly and inconsistently in this acute disease model. Therefore, positive control treatments were not included in these studies, which were instead based on a group of healthy mice that did not receive TNBS and negative control mice that received empty vector lysate and were administered TNBS.

[0248] Sacrifice and tissue collection On the third day of the experiment, mice were euthanized by carbon dioxide asphyxiation and autopsied. After autopsy, mouse remains were autoclaved and disposed of by JCU approved route. Colons were removed, measured and photographed. Macroscopic pathology score was assessed by longitudinally incising the colon and flushing the rectal contents with sterile DPBS (Gibco) and observing tissue integrity under a light microscope (Olympus SX61, 0.67-45x). Macroscopic pathology score was used to assess the severity of intestinal wall thickening, adhesions to internal organs and tissues, ulcers and mucosal edema as follows:

[0249]

[0228] [Table 27]

[0250] Dissection of the colon

[0229] The 0.5 cm tissue section closest to the rectum was discarded. The 0.5 cm tissue section closest to the rectum was then rinsed with Dulbecco's phosphate-buffered saline (DPBS) and fixed in 4% formaldehyde (Sigma-Aldrich) for up to 24 hours, after which the tissue was transferred to 70% ethanol and stored at room temperature.

[0251] Within-experiment statistical analysis Statistical analysis of the various outcomes to determine the overall significance of hookworm protein lysate performance within an experiment was performed by performing statistical comparisons between each hookworm recombinant protein lysate and a non-recombinant empty vector lysate control in each experiment using R version 3.5.1. Percentage body weight change and colon length on day 3 were evaluated using two-sample t-tests. Macroscopic and clinical scoring were evaluated using the Mann-Whitney U test, as this is best suited for ordinal data. P values ​​were adjusted for multiple comparisons using the Benjamini and Hochberg False Discovery Rate (FDR). The geometric mean of significance of these four outcomes was used to rank the protective ability of the protein lysates.

[0252] statistical analysis To combine the four clinical outcomes into one value, a Z-score was determined for each outcome for each animal. The mean, standard deviation and sample size of the data set were determined and used to calculate a Z-score for each outcome for each animal. A Z-score transformation was applied to the groups by subtracting the mean from each outcome and dividing the result by the standard deviation. The macroscopic score (outcome 3) and clinical score (outcome 4) were lower in healthy mice and higher in diseased mice, but the signs of outcomes 3 and 4 were reversed because healthy mice have a higher body weight (outcome 1) and a longer colon (outcome 2). A composite score was created by summing the four Z-scores for each outcome. The significance of the composite Z-score for each protein lysate was determined using a Mann-Whitney one-tailed Student's t-test of the composite Z-score for each animal within an experimental group compared to the composite Z-score of the negative control, and data were adjusted to compensate for multiple testing.

[0253] result

[0232] Figure 1A shows the daily weight change of mice that received hookworm lysate prior to TNBS administration. The negative control group rapidly lost weight by day 1 after TNBS administration, which continued until the end of the experiment. Mice treated with cell-free lysate containing hookworm proteins prior to TNBS administration showed various degrees of protection against weight loss. Mice treated with lysates 2, 13, 16, and 17 remained healthy and lost significantly less weight by day 3 than the negative control mice.

[0254] At necropsy, colons were removed from the mice for measurement and further analysis. In this model, the length of the colon is a good indicator of the extent of TNBS-induced colitis, since inflammation spreads laterally and eventually results in transmural colitis with shortening of the colon (Wirtz S et al, Chemically induced mouse models of acute and chronic intestinal inflammation. Nat Protoc. 2017 Jul;12(7):1295-1309). Figure 1B shows the visual differences between colons of naive (A), negative control (B) and hookworm recombinant protein 13-containing lysate groups (C). Representative colons from naive mice appear healthy, whereas colons from negative control mice were highly inflamed and shortened. Colons from mice administered hookworm recombinant protein 13-containing lysate prior to TNBS were protected from TNBS-induced colon shortening.

[0255]

[0234] Figure 1C shows colon length in mice that received hookworm protein-containing lysates prior to administration of TNBS. Mice treated with lysates 2, 10, 13, and 16 had significantly longer colons than mice in the empty vector lysate control group.

[0256]

[0235] Figure 1D shows the macroscopic pathology scores of mice that received hookworm protein-containing lysates before administration of TNBS. The colons of the negative control group were scored high due to extensive colitis inflammation, while the groups that received hookworm recombinant protein lysates (especially lysates 2, 9, 11, 13, 14, 15, 16, 17, and 19) maintained colonic integrity and scored significantly lower. Mice treated with lysates 2, 13, and 16 were protected from TNBS-induced weight loss and macroscopic pathology.

[0257]

[0236] The degree of TNBS colitis in the physical appearance of the animals was monitored throughout the three-day experiment, and a clinical score was determined for each experimental group. The clinical score incorporates non-specific physiological signs that indicate an overall deterioration in the health and well-being of the animals throughout the experiment, including physical appearance (piloerection), fecal consistency, weight change, and behavior (reduced movement and mobility). A low clinical score indicates the protective properties of hookworm recombinant protein lysate against TNBS-induced colitis.

[0258]

[0237] Figure 1E shows the composite clinical scores of mice in each experimental group during the experiment. The negative control group had a significantly increased clinical score compared to the naive group. Meanwhile, mice receiving cell-free lysates 2, 13 and 6 had clinical scores equivalent to the naive group, which was consistent with the findings of weight loss. Mice treated with lysates 9, 11, 12, 14, 15, 17, 19 and 20 also had significantly lower clinical scores.

[0259] Example 4. Biological activity of recombinant proteins in human immune cells To investigate the activity of recombinant proteins in human immune cells, human T cells were isolated from punch biopsies obtained from ulcerative colitis patients and stimulated with aCD3 / CD28 coated beads in the presence of recombinant proteins SEQ ID NOs: 11, 1, 4, 6, 8 and 9 (also called AcFar2, Ac22177, Ac07727, Ac07322, Ac08034 and Ac07062, respectively; 10 μg / mL for AcFar2 and 50 μg / mL for the other proteins). Recombinant proteins were expressed and purified from HEK cells. No bead stimulation was used as a negative control and 10 μg / ml cyclosporine-A (CSA; an established T cell inhibitor) was used as a positive control. The hookworm protein Na-AIP-1, which has anti-inflammatory activity, was also used as a comparison. Na-AIP-1 was expressed in yeast and purified according to Buitrago, G. et al (A netrin domain-containing protein secreted by the human hookworm Necator americanus protects against CD4 T cell transfer in coli. Transl Res. 2021 Mar 3;S1931-5244(21)00049-9). After 72 h, culture supernatants were collected and cytokine levels were assessed by Legendplex (BioLegend) assay.

[0260]

[0293] FIG. 2 shows the effect of recombinant proteins on the secretion of the inflammatory cytokines tumor necrosis factor alpha (TNFα; FIG. 2A), interferon gamma (IFNγ; FIG. 2B) and interleukin-17A (IL-17A; FIG. 2C). Secretion of TNFα was significantly reduced by all proteins. All proteins, except SEQ ID NO: 13 (Ac2 2177), significantly reduced the level of IFNγ. Recombinant proteins SEQ ID NO: 6 (Ac07322), 8 (Ac08034) and 9 (Ac07062) significantly reduced the level of IL-17A. Taken together, these data indicate that the recombinant proteins are effective in reducing the secretion of inflammatory cytokines in human T cells.

[0261] Example 5. Effect of recombinant protein lysate in TNBS-induced colitis model The crude recombinant protein-containing lysates were directly evaluated in a mouse model of TNBS-induced colitis without prior evaluation of the in vitro bioactivity of the lysates. Proteins were selected and expressed as described in Examples 1 and 2. Testing a single dose of crude hookworm protein-containing lysates allowed for high-throughput in vivo screening of 78 proteins within 3 days. Mice were treated with lysates containing the protein of interest or with eGFP alone as a control by intraperitoneal injection the day before TNBS administration, or left untreated (naive).

[0262]

[0241] The results for the following lysates are presented in Figures 3A-C: Lysate 21 contains SEQ ID NO:18 as described herein. Lysate 22, containing SEQ ID NO:7 as described herein. Lysate 23, containing SEQ ID NO:3 as described herein. Lysate 28 contains SEQ ID NO:20 as described herein.

[0263] For comparison, the following lysates were also compared: Lysate 24 contains SEQ ID NO:74 shown in Table 7. Lysate 25 contains SEQ ID NO: 75 shown in Table 7. Lysate 26 contains SEQ ID NO:76 shown in Table 7. Lysate 27 contains SEQ ID NO:77 shown in Table 7. Lysate 29 contains SEQ ID NO:78 shown in Table 7. Lysate 30, containing SEQ ID NO:79 shown in Table 7. Lysate 31 contains SEQ ID NO:80 shown in Table 7. Lysate 32 contains SEQ ID NO:81 shown in Table 7. Lysate 33 contains SEQ ID NO:82 shown in Table 7.

[0264] [Table 28]

[0265]

[0243] A composite clinical Z-score was then generated based on the four disease outcomes (body weight change, clinical score, macroscopic pathology and colon length) to rank and compare the effects of each of the 78 hookworm protein-containing lysates across all screening experiments. The results are shown in Figure 3D.

[0266] mouse Specific pathogen-free (SPF) male and female BALB / cArc mice were purchased from the Animal Resources Centre (Perth, Australia) and used at 5-10 weeks of age. Animals were kept under SPF conditions and rested for a minimum of 7 days between arrival at our facility and experimentation. All experiments were approved by the James Cook University Animal Ethics Committee and complied with the National Health and Medical Research Council (NHMRC) Australian Code for the Care of Animals for Scientific purposes and the Queensland Animal Care and Protection Act.

[0267] Testing of proteins in the TNBS-induced colitis model After anesthesia with 6.25% ketamine (Ketamil, Provet) and 6.25% xylazil (Xylazil, Provet) in 200 ml PBS, mice were administered 100 μl of 2,4,6-trinitrobenzenesulfonic acid (TNBS) solution at 1.5 mg (5% w / v) in 50% EtOH intrarectally. Test proteins were administered intraperitoneally at 200 ml of 100 mg / ml protein in PBS on day 1 of the TNBS colitis protocol. Mice were monitored daily for weight loss and clinical scores (composite of weight loss, piloerection, fecal consistency and mobilization, scored 0-2, respectively). Macroscopic scores on the day of euthanasia included colonic tissue adhesions, ulcers, intestinal wall thickening and mucosal edema, scored 0-3, respectively.

[0268] statistical analysis Data were analyzed using GraphPad Prism 9.0. Comparison of data to the control population was performed by Mann-Whitney U test. Normalized data were compared to 100% by one-sample t test. Technical errors were removed from the data prior to analysis. Sample sizes and statistical analysis methods are indicated in the figure legends.

[0269] To evaluate the performance of the lysates in the TNBS colitis model, a composite clinical Z-score was generated. The raw data of the four outcomes were used to calculate a composite Z-score. The Z-score transformation combined the four primary outcomes of TNBS colitis (% of starting body weight on day 3 (body weight change), macroscopic pathology, clinical score, and colon length) for each mouse within a group of five mice treated with the same lysate. The Z-score converted the raw data into units of standard deviation and indicated whether the raw score value was lower or higher than the population mean. In this case, the transformation reflected the number of standard deviations of the raw score of a given colitis parameter for a test group of mice from the mean of the entire population in the screen. If the population mean scores of both the test (lysate containing hookworm proteins) and negative control (lysate with eGFP only) groups were the same value, the Z-score was zero. A positive Z-score was when the test group mean was higher than the negative control group mean, and a negative Z-score was when the test group score was lower than the negative control population mean. The four evaluated parameters were summed to generate a composite Z-score value, which was compared to the negative control group for each experiment using a two-tailed Student's t-test with unequal variances (heterogenous variances). The p-values ​​determined then allowed each test group to be compared to the other groups across the screen.

[0270]

[0248] -Log 10 To assess p-values, raw scores of colon length and weight loss on day 3 from the test group (hookworm protein lysate) were compared to the control (eGFP lysate) group and significance was determined by two-sample t-test. Raw data scores of macroscopic and clinical scores from the test group were compared to the control group and significance was determined by Mann-Whitney U-test. The resulting p-values ​​were adjusted for multiple testing and the four outcomes were transformed to generate a geometric mean of the p-values ​​for each experiment. The geometric mean was chosen because it is less likely to be affected by outliers and therefore would not skew the overall efficacy rankings. The significance of the geometric mean of the test group compared to the control group was determined.

[0271] result As expected, mice treated with lysate containing only eGFP prior to TNBS administration showed rapid weight loss (FIG. 3A), elevated clinical score (FIG. 3B) and macroscopic pathology score (FIG. 3C) compared to naive mice. As shown in FIG. 3A-C, one protein-containing lysate (lysate 23 containing SEQ ID NO: 3) was found to reduce all three disease parameters, whereas six other lysates (lysates 21, 22, 25, 26, 28 and 30) were found to reduce either clinical score or macroscopic colon pathology.

[0272] A composite Z-score generated for the 78 hookworm protein-containing lysates provided an overall difference in the mean score and p-value for each protein compared to the eGFP control. This was used to rank the proteins (Figure 3D), which allowed the identification of 20 proteins, SEQ ID NOs: 1-20, that showed significant protection in the TNBS colitis model. These 20 proteins were tested and evaluated in subsequent studies. Proteins expressed in mammalian cells are then annotated with their protein name and Pfam status in Figure 3D.

[0273] Example 6. TNBS-induced colitis model and effect of recombinant proteins in human immune cells

[0251] The proteins contained in the lysate that performed well in Example 5 were prepared as purified recombinant proteins and evaluated for efficacy in the TNBS colitis model and bioactivity on intestinal immune cells from human colitis patients. The protein lysate that performed well in Example 5 was expressed in Expi293F human embryonic kidney cells and purified to provide recombinant proteins. Five of the proteins (SEQ ID NOs: 11, 1, 4, 6 and 8, also called AcFar2, Ac22177, Ac07727, Ac07322 and Ac08034, respectively) were produced and purified in sufficient quantities to be tested in the TNBS colitis model and to examine the effect of co-culturing the purified proteins ex vivo with colon biopsies from ulcerative colitis patients. Protein SEQ ID NO: 9 (Ac07062) was produced in sufficient quantities for ex vivo testing with colon biopsies.

[0274] Expression of recombinant proteins in human embryonic kidney cells Cell-free lysate proteins were expressed in Expi293F human embryonic kidney cells (Thermo Fisher). The ORFs consisted of the signal peptide Ac-ASP-2 (SEQ ID NO: 69) from A. caninum followed by the respective ORF (minus the endogenous signal peptide) and a C-terminal 6-His tag. cDNA was synthesized with mammalian codon bias by Genscript and cloned into pcDNA3.1 plasmid (Thermo Fisher) by restriction cloning. Plasmids were purified and introduced into Expi293F cells by lipofection using the ExpiFectamine 293 Transfection Kit (Thermo Fisher) according to the manufacturer's instructions. Recombinant proteins were purified on an AKTA FPLC by immobilized metal affinity chromatography using His-trap excel nickel columns, buffer exchanged into tissue culture grade DPBS using Amicon ultra-15 centrifugal concentrators, and quantified using a bicinchoninic acid kit (Thermo Fisher). Recombinant proteins were assessed for endotoxin using the Limulus Amoebocyte Assay (Thermo Fisher) and used only if endotoxin levels were lower than 0.5 endotoxin units / mg protein. Endotoxin-free plasticware was used whenever possible.

[0275] mouse Specific pathogen-free (SPF) male and female BALB / cArc mice were purchased from the Animal Resources Centre (Perth, Australia) and used at 5-10 weeks of age. Animals were kept under SPF conditions and rested for a minimum of 7 days between arrival at our facility and experimentation. All experiments were approved by the James Cook University Animal Ethics Committee and complied with the National Health and Medical Research Council (NHMRC) Australian Code for the Care of Animals for Scientific purposes and the Queensland Animal Care and Protection Act.

[0276] Testing of proteins in the TNBS-induced colitis model After anesthesia with 6.25% ketamine (Ketamil, Provet) and 6.25% xylazil (Xylazil, Provet) in 200 ml PBS, mice were administered 100 μl of 2,4,6-trinitrobenzenesulfonic acid (TNBS) solution at 1.5 mg (5% w / v) in 50% EtOH intrarectally. Test proteins were administered intraperitoneally at 200 ml of 100 mg / ml protein in PBS on days −1, +1 and +2 of the TNBS colitis protocol. Mice were monitored daily for weight loss and clinical scores (composite of weight loss, piloerection, fecal consistency and mobilization scored 0-2, respectively). Macroscopic scores on the day of euthanasia included colonic tissue adhesions, ulcers, intestinal wall thickening and mucosal edema, each scored 0-3.

[0277] Isolation of cells from human colon biopsies Samples were obtained at the Gastroenterology Unit at Prince Charles Hospital (Chermside, QLD). The study was approved by the Human Research Ethics Committee at Prince Charles Hospital. Studies with human samples were approved by the James Cook University Human Research Ethics Committee. Twelve patients with clinically diagnosed ulcerative colitis who were not currently receiving other biological therapies were recruited into the study. Fresh colon biopsies taken from non-inflamed areas of intestinal tissue were collected and single cell suspensions of intraepithelial and lamina propria lymphocytes were isolated. Up to 10 punch biopsies were taken from the colon and stored in 5% fetal bovine serum (FBS) in PBS on ice until further processing. To isolate immune cells, all biopsies from each patient were pooled and stored in 100 mL of PBS supplemented with 5 mM EDTA, 1 mM dithiothreitol (DTT), 5% FBS, 100 mM MgCl2, 0.01 mM NaCl ... ++ and Ca ++ The tissue was placed in Hank's Balanced Salt Solution (HBSS) without PBS and incubated at 37°C for 30 minutes in a shaking incubator at 250 rpm. The supernatant was collected through a 70 mm strainer, resuspended in RPMI with 10% FBS, and kept on ice until further processing. The remaining tissue was placed in RPMI with 0.2 mg / ml DNAse-I (Merck) and 400 U / ml type I collagenase (Gibco) and incubated at 37°C for 30 minutes in a shaking incubator at 250 rpm. The sample was then filtered through a 70 mm cell strainer, resuspended in RPMI with 10% FBS, and combined with the fraction set aside after incubation with DTT.

[0278] Human cytokine release assay A total of 50,000 cells were plated per well in 96-well round-bottom plates (Falcon). Cultures were supplemented with 50 mg / ml of recombinant protein or CSA, except for Ac-FAR-2, which was added at 10 mg / ml based on previous optimization. Human T-Activator CD3 / CD28 Dynabeads (ThermoFisher) were added according to the manufacturer's recommendations. Cells were incubated overnight at 37°C, 5% CO2, and supernatants were collected and stored frozen at -80°C until further processing. For cytokine release analysis, supernatants were thawed on ice and analyzed using the Legendplex Human Inflammation Panel I kit (Biolegend) according to the manufacturer's recommendations.

[0279] statistical analysis Data were analyzed using GraphPad Prism 9.0. Comparison of data to the control population was performed by Mann-Whitney U test. Normalized data were compared to 100% by one-sample t test. Sample sizes and statistical analysis methods are indicated in the figure legends.

[0280] result The efficacy of recombinant proteins SEQ ID NOs: 11, 1, 4, 6 and 8 (AcFar2, Ac22177, Ac07727, Ac07322 and Ac08034, respectively) was evaluated in the TNBS colitis model in comparison with a PBS vehicle control and an irrelevant control protein (bovine serum albumin, BSA) expressed and purified in the same way. As expected, PBS vehicle-treated mice showed increased weight loss (Figure 4A), clinical score (Figure 4B) and macroscopic pathology score (Figure 4C), which was not affected by co-treatment with the negative control recombinant BSA. As shown in Figures 4A-C, Ac08034 and Ac07727 were able to significantly limit weight loss, clinical score and macroscopic score, whereas Ac-FAR-2 and Ac22177 significantly suppressed at least one disease parameter compared to control mice.

[0281] Recombinant proteins SEQ ID NOs: 11, 1, 4, 6, 8 and 9 (AcFar2, Ac22177, Ac07727, Ac07322, Ac08034 and Ac07062, respectively) were also evaluated for their biological activity on intestinal immune cells from human colitis patients. Analysis of culture supernatants using a bead-based multiplex assay to detect human inflammatory cytokines showed that TCR stimulation in the presence of PBS alone led to secretion of the IBD-associated cytokines TNF, IFN-γ and IL-17A, a response that was unaffected by co-treatment with BSA control and significantly suppressed by CSA (Figure 5A-C). As shown in Figure 5A-C, Ac07727 was found to significantly reduce the secretion of all three cytokines, whereas Ac07322 (although not showing protection in TNBS colitis when expressed in Expi293F cells), Ac-FAR-2 and Ac08034 were able to suppress the secretion of at least two of the inflammatory cytokines.

Claims

1. An isolated, recombinant or synthetic protein, or a biologically active fragment or variant thereof, comprising an amino acid sequence having at least about 70% sequence identity to any one of SEQ ID NOs: 11, 1, 8, 4, 6, 2, 3, 5, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 and 20, preferably any one of SEQ ID NOs: 11, 1, 8 and 4, more preferably any one of SEQ ID NOs: 11, 1 and 8.

2. The protein of claim 1, wherein the amino acid sequence has at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOs: 1-20, preferably any one of SEQ ID NOs: 11, 1, 8 and 4, more preferably any one of SEQ ID NOs: 11, 1 and 8.

3. The protein according to claim 1 or 2, wherein the amino acid sequence is any one of SEQ ID NOs: 1 to 20, preferably any one of SEQ ID NOs: 11, 1, 8 and 4, more preferably any one of SEQ ID NOs: 11, 1 and 8.

4. The protein according to any one of claims 1 to 3, wherein the amino acid sequence has at least about 70% sequence identity to any one of SEQ ID NOs: 11, 1, 8, 4, 6, 2, 3, 5 and 7, preferably any one of SEQ ID NOs: 11, 1, 8 and 4, more preferably any one of SEQ ID NOs: 11 and 1.

5. 5. The protein according to claim 1, wherein the amino acid sequence has at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99% sequence identity to any one of SEQ ID NOs: 1 to 11, preferably any one of SEQ ID NOs: 11, 1, 8 and 4, more preferably any one of SEQ ID NOs: 11 and 1, or the amino acid sequence is any one of SEQ ID NOs: 1 to 11, preferably any one of SEQ ID NOs: 11, 1, 8 and 4, more preferably any one of SEQ ID NOs: 11 and 1.

6. An isolated, recombinant or synthetic protein, or a biologically active fragment or variant thereof, comprising an amino acid sequence in which a total of up to about 250 amino acids have been substituted, inserted and / or deleted in any one of SEQ ID NOs: 11, 1, 8, 4, 6, 2, 3, 5, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 and 20, preferably any one of SEQ ID NOs: 11, 1, 8 and 4, more preferably any one of SEQ ID NOs: 11, 1 and 8.

7. The protein of claim 6, wherein a total of up to about 225, up to about 200, up to about 175, up to about 125, up to about 100, up to about 75, up to about 50, up to about 40, up to about 30, up to about 25, up to about 20, up to about 15, or up to about 10 amino acids have been substituted, inserted and / or deleted in any one of SEQ ID NOs: 1 to 20, preferably any one of SEQ ID NOs: 11, 1, 8 and 4, more preferably any one of SEQ ID NOs: 11, 1 and 8.

8. 8. The protein of claim 6 or 7, or a biologically active fragment or variant thereof, wherein the amino acid sequence has a total of up to about 250 amino acids substituted, inserted and / or deleted in any one of SEQ ID NOs: 1 to 11.

9. 8. The protein of claim 7, wherein the amino acid sequence has a total of up to about 225, up to about 200, up to about 175, up to about 125, up to about 100, up to about 75, up to about 50, up to about 40, up to about 30, up to about 25, up to about 20, up to about 15, or up to about 10 amino acids substituted, inserted and / or deleted in any one of SEQ ID NOs: 11, 1, 8, 4, 6, 2, 3, 5 and 7, preferably any one of SEQ ID NOs: 11, 1, 8 and 4, more preferably any one of SEQ ID NOs: 11 and 1.

10. A recombinant protein encoded by a nucleotide sequence having at least about 70% sequence identity to any one of SEQ ID NOs: 31, 21, 28, 24, 26, 43, 46, 48, 41, 45, 22, 23, 25, 27, 29, 30, 32, 33, 34, 35, 36, 37, 38, 39, 40, 42, 43, 44, 47, 49, 50, 51, 52 and 53, preferably any one of SEQ ID NOs: 31, 21, 28 and 24, more preferably any one of SEQ ID NOs: 31, 21 and 28, or a biologically active fragment or variant thereof.

11. The protein according to claim 10, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99% sequence identity to any one of SEQ ID NOs: 21 to 53, preferably any one of SEQ ID NOs: 31, 21, 28 and 24, more preferably any one of SEQ ID NOs: 31, 21 and 28, or the nucleotide sequence is any one of SEQ ID NOs: 21 to 53, preferably any one of SEQ ID NOs: 31, 21, 28 and 24, more preferably any one of SEQ ID NOs: 31, 21 and 28.

12. The protein of claim 11, wherein the nucleotide sequence has at least about 70% sequence identity to any one of SEQ ID NOs: 21 to 31, preferably any one of SEQ ID NOs: 31 and 21.

13. 13. The protein of any one of claims 10 to 12, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOs: 21 to 31, preferably to any one of SEQ ID NOs: 31 and 21.

14. A pharmaceutical composition comprising a protein according to any one of claims 1 to 13, or a biologically active fragment or variant thereof, and at least one pharma- ceutically acceptable carrier.

15. Use of a protein according to any one of claims 1 to 13 in the manufacture of a medicament for treating or preventing an inflammatory or autoimmune condition.

16. 14. A protein, or a biologically active fragment or variant thereof, according to any one of claims 1 to 13 for use in treating or preventing an inflammatory or autoimmune condition.

17. 17. The use according to claim 15, or the protein according to claim 16, wherein the inflammatory or autoimmune condition is selected from inflammatory bowel disease, irritable bowel syndrome, type 2 diabetes, asthma, rheumatoid arthritis, lupus, allergies and celiac disease.

18. 14. An isolated nucleic acid comprising a nucleotide sequence encoding the protein or a biologically active fragment or variant thereof according to any one of claims 1 to 13, or a vector or expression construct comprising a nucleotide sequence encoding the protein or a biologically active fragment or variant thereof according to any one of claims 1 to 13.

19. 20. A cell comprising the nucleic acid, vector or expression construct of claim 18.

20. 20. A method for producing a protein or a biologically active fragment or variant thereof, comprising incubating a cell according to claim 19 under conditions allowing expression of said protein or a biologically active fragment or variant thereof.

Images