Virus mutation detection

Abstract

The present invention provides compositions and methods that allow for the rapid detection of SARS-CoV-2 variants. The present invention provides compositions and methods for rapid PCR detection and differentiation of known SARS-CoV-2 variants. For example, using variant-specific primers, the methods and compositions disclosed herein detect and differentiate between B.1.1.7 (UK), P.1 (Brazil and Japan), B.1.351 (South Africa), and B.1.429 / 427 (California) variants (collectively referred to herein as variants of concern (VOCs)).

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 185,015, filed May 6, 2021, the contents of which are incorporated herein by reference in their entirety. (Technical field)

[0002] The present invention relates generally to diagnostic methods, and more particularly to compositions and methods for rapid PCR detection of SARS-CoV-2 variants. [Background technology]

[0003] (background) The rapid global spread of contagious diseases presents a major medical challenge. For example, the rapid spread of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has led to a global pandemic, highlighting the importance of rapid and early detection. As this pandemic progresses, more novel infectious variants are circulating. These variants may cause more severe disease with poorer prognosis and, importantly, may respond differently to treatment. Thus, rapid early detection and current variant identification are critical for successful treatment.

[0004] Conventional detection techniques for many infectious diseases include the use of polymerase chain reaction (PCR). PCR is a technique used to selectively amplify specific regions of DNA of interest (DNA target). For example, various real-time PCR assays (also called quantitative PCR (qPCR)) for detecting SARS-CoV-2 RNA have been developed worldwide, targeting different viral genes or regions. However, those assays may not detect some of the variants of concern, and when detected, may not be able to distinguish between wild type and variants of concern. Diagnosis may then fail, allowing the variants to spread further, and when detected, correct treatment may be delayed due to misidentification as wild type infection.

[0005] Another drawback of current qPCR detection approaches is that they rely on an initial step of isolating and purifying nucleic acids from clinical samples as part of a virus testing protocol. For example, the application of qPCR for relative quantification of RNA typically requires (1) isolation and purification of total RNA from the sample; (2) elution and possible concentration of that material; and (3) use of the purified RNA in a reverse transcription (RT) reaction to generate complementary DNA (cDNA), which is then utilized for the qPCR reaction.

[0006] This initial nucleic acid isolation and purification step (i.e., extraction step), required in conventional methods prior to undergoing PCR, constitutes a major obstacle in this diagnostic process, as it remains manual, laborious and expensive, further increasing the opportunities for accidental contamination and human error. Furthermore, during periods of high demand, shortages in nucleic acid extraction supplies can exacerbate the limitations of such virus detection methods. Thus, improved methods for accurate, specific and rapid diagnosis of pathogens are needed. Summary of the Invention [Means for solving the problem]

[0007] (overview) The present invention provides compositions and methods for rapid PCR detection and identification of known SARS-CoV-2 variants. For example, using variant-specific primers, the methods and compositions disclosed herein detect and distinguish between the B.1.1.7 (UK), P.1 (Brazil and Japan), B.1.351 (South Africa), and B.1.429 / 427 (California) variants (collectively referred to herein as variants of concern (VOCs)). Variants may be more infectious than wild-type SARS-CoV-2 infections, may cause more severe disease than wild-type SARS-CoV-2 infections, and may require different treatments than wild-type SARS-CoV-2 infections. Thus, by providing rapid PCR identification of variants, the compositions and methods of the present invention allow accurate treatments to be delivered quickly without the need for sequencing, which is time-consuming and expensive.

[0008] In certain embodiments, extraction-free detection and analysis techniques are used with the mutant-specific primers of the present invention. These techniques include compositions that process biological samples to provide nucleic acids available for subsequent amplification and / or detection, while eliminating the need for an initial nucleic acid extraction step. The compositions of the present invention include, for example, unique buffer compositions for sample transport and preparation that, when mixed with a sample of interest, can prepare suitable nucleic acids from the sample for direct nucleic acid amplification and analysis without the need for initial nucleic acid extraction (i.e., nucleic acid separation and purification). In one aspect, the present invention avoids the traditional approach for virus detection, which involves an RNA extraction step using industrial RNA extraction kits and techniques. Instead, according to the present invention, sample testing is direct and avoids the extraction step.

[0009] In a preferred embodiment, the compositions and methods of the present invention improve upon conventional virus testing and detection approaches by reducing the number of steps required for sample preparation and testing, and by avoiding the need for time-consuming and costly sequencing. In turn, the time required to detect VOCs and adjust treatment accordingly is greatly reduced, improving patient outcomes.

[0010] Certain aspects of the invention include methods for detecting SARS-CoV-2 variants. A preferred method includes providing a biological sample containing nucleic acid, amplifying the nucleic acid using primers specific for one or more target SARS-CoV-2 variants without amplifying wild-type SARS-CoV-2 nucleic acid, and analyzing the amplicons produced in the amplifying step to detect the presence of the one or more target SARS-CoV-2 variants.

[0011] In certain embodiments, the method further comprises detecting the presence of SARS-CoV-2 infection by using primers that amplify one or more target SARS-CoV-2 variants and wild-type SARS-CoV-2 prior to the amplifying step. The one or more target SARS-CoV-2 variants may be selected from the group consisting of B.1.1.7, P.1, B.1.351, B.1.429 / 427, and other variants of SARS-CoV-2. The primers may be specific for two or more target SARS-CoV-2 variants. In certain embodiments, the primers may be specific for three or more target SARS-CoV-2 variants.

[0012] The three or more target SARS-CoV-2 variants may include B.1.1.7, P.1, and B.1.351. In one example, the primers target the ORF-1A region. In certain embodiments, the primers target a deletion at positions 3675-35677 of the ORF-1A region compared to wild-type SARS-CoV-2. Exemplary primers include SEQ ID NO:1 and SEQ ID NO:2. In some embodiments, the amplifying step includes quantitative PCR (qPCR) using a probe including SEQ ID NO:3.

[0013] In certain embodiments, the target SARS-CoV-2 variant comprises B.1.1.7 and the primers target the S region. The primers may target a deletion at positions 69-70 of the S region compared to wild-type SARS-CoV-2. Exemplary primers include SEQ ID NO:4 and SEQ ID NO:5. The amplifying step may include quantitative PCR (qPCR) using a probe comprising SEQ ID NO:6.

[0014] In various embodiments, the target SARS-CoV-2 mutant strain includes B.1.351 and the primers target the G25563T or G28887T substitutions relative to wild-type SARS-CoV-2. Exemplary primers include SEQ ID NO: 19 and SEQ ID NO: 20, or SEQ ID NO: 22 and SEQ ID NO: 23. In this example, the amplifying step includes quantitative PCR (qPCR) using a probe including SEQ ID NO: 21 or SEQ ID NO: 24.

[0015] In some embodiments, the target SARS-CoV-2 variant comprises B.1.429 / 427 and the primers target the G27890T / G27987T or G28191T / A28272T substitutions relative to wild-type SARS-CoV-2. Exemplary primers include SEQ ID NO:25 and SEQ ID NO:26, or SEQ ID NO:28 and SEQ ID NO:29. In this example, the amplifying step comprises quantitative PCR (qPCR) using a probe comprising SEQ ID NO:27 or SEQ ID NO:30.

[0016] In certain embodiments, the method further comprises mixing the biological sample in a buffer composition comprising nuclease-free water, an antifungal agent, an antibiotic, a ribonuclease inhibitor, and a reducing agent. The amplifying step is performed on the nucleic acid in the buffer without prior extraction of the nucleic acid. The biological sample can be any bodily fluid. The bodily fluid is selected from the group consisting of saliva, sputum, mucus, phlegm, and urine. In certain embodiments, the reducing agent is a tris(2-carboxyethyl)phosphine hydrochloride solution. An exemplary antifungal agent comprises amphotericin B, and an exemplary antibiotic comprises penicillin-streptomycin. The biological sample can be obtained by nasal or throat swab. The method can further comprise heat inactivating the biological sample mixed with the buffer composition prior to the amplifying step. The mixture of the biological sample and the buffer composition can be heated to about 95° C. for about 5 minutes.

[0017] In some embodiments, the biological sample is obtained from a subject suspected of having a SARS-CoV-2 infection, and the method further comprises selecting a treatment regimen based on the detected presence of the one or more target SARS-CoV-2 variants, which treatment regimen may differ from a treatment regimen recommended for wild-type SARS-CoV-2 infection.

[0018] The methods of the invention utilize primer sets that selectively amplify nucleic acids from one or more target SARS-CoV-2 mutant strains without amplifying nucleic acids from wild-type SARS-CoV-2. In certain aspects, the primer sets of the invention are arranged in an array for multiplex analysis to simultaneously detect SARS-CoV-2 infection and identify the type of infection among a set of wild-type and known mutant strains. In various embodiments, the array may include multiple wells, each well containing a different primer-probe set for qPCR detection of one or more specific mutant strains in a single biological sample. [Brief description of the drawings]

[0019] [Figure 1] Figure 1 lists target regions in various SARS-CoV-2 variants for variant-specific detection and lists primer-probe sets targeting the listed variants.

[0020] [Diagram 2] FIG. 2 maps the mutation targets for various VOCs.

[0021] [Diagram 3] FIG. 3 shows the results of rapid PCR detection of both wild-type and VOC mutant strains using a single primer set targeting the N1 region.

[0022] [Figure 4] Figure 4 shows a map of common mutations in the SARS-CoV-2 genome.

[0023] [Diagram 5] Figure 5 shows the Cq values ​​for primer-probe sets targeting four different commonly mutated regions of the SARS-CoV-2 genome when exposed to the B.1.1.7 positive control.

[0024] [Figure 6] Figure 6 shows the Cq values ​​for primer-probe sets targeting four different commonly mutated regions of the SARS-CoV-2 genome when exposed to a wild-type positive control.

[0025] [Figure 7] FIG. 7 shows the comparative Cq values ​​of primers targeting N-region mutations for the wild-type positive control and the B.1.1.7 positive control.

[0026] [Figure 8]FIG. 8 shows the comparative Cq values ​​of primers targeting ORF1a region mutations for the wild type positive control and the B.1.1.7 positive control.

[0027] [Figure 9] FIG. 9 shows the comparative Cq values ​​of the first set of primers targeting the S region mutations for the wild type positive control and the B.1.1.7 positive control.

[0028] [Figure 10] FIG. 10 shows the comparative Cq values ​​of the second set of primers targeting the S region mutations for the wild type positive control and the B.1.1.7 positive control.

[0029] [Figure 11] FIG. 11 shows the results of NGS validation of rapid PCR detection of SARS-CoV-2 mutant strains using methods and compositions of the invention.

[0030] [Figure 12] FIG. 12 shows an exemplary flow chart for determining a specific VOC infection in a sample. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] (Detailed Description) There is an increasing concern regarding the spread of contagious diseases (e.g., influenza, common cold, potentially deadly viruses, or microbial or viral diseases, both known and unknown). In 2019, the SARS-CoV-2 outbreak led to a global pandemic and outbreak of respiratory disease, resulting in numerous deaths. Several worrisome variants have since emerged, characterized by increased transmissibility, more severe disease and poorer prognosis, as well as different treatment responses. These variants are driving new waves of infection, raising concerns regarding the detectability of these variants using current tests and their responsiveness to current vaccines. Furthermore, because these variants may respond differently to treatments and cause more severe disease, there is an urgent need not just to rapidly and inexpensively identify SARS-CoV-2 infections, but to rapidly and inexpensively identify whether the infection is due to one of the VOCs. Moreover, tracking the spread of these various variants will be beneficial in understanding and overcoming the pandemic, and inexpensive, rapid variant testing provides a valuable tool to do so.

[0032] The present invention provides compositions and methods that allow for rapid detection of SARS-CoV-2 mutant strains, including by direct PCR techniques without extraction. More specifically, the present invention provides compositions that include primer sets for selectively amplifying one or more VOCs without amplifying wild-type virus, thereby allowing for rapid diagnosis and identification of mutant strains without the need for time-consuming and costly sequencing. In various embodiments, workflows and primer-probe sets are disclosed for rapid identification of which of the four currently known VOCs are present in a biological sample. In certain embodiments, different sets of primers can be included in an array or multiplexed analysis such that multiple identification tests can be performed simultaneously on a single sample. The methods of the present invention provide a point-of-care solution for rapid and accurate identification of pathogens even when a laboratory is not available.

[0033] In certain embodiments, a method is provided for processing biological samples to provide DNA that can be used for subsequent PCR assays, while eliminating the need for an initial RNA extraction step.The method of the present invention can use a unique buffer composition for sample transport and preparation, which, when mixed with the sample of interest, can prepare nucleic acid from the sample that can be used directly for nucleic acid amplification and analysis without the need for initial nucleic acid extraction (i.e., nucleic acid separation and purification).After the clinical sample is provided in the unique buffer composition, viral particles can be inactivated by either heating or directly dissolving in the buffer.The inactivated sample can then be used for downstream qPCR diagnostic testing using the VOC-specific primer-probe set of the present invention.

[0034] Rapid replication and high global infection rates have led to the emergence of several SARS-CoV-2 variants, including the VOCs mentioned above, that exhibit worrying transmission or infection characteristics that differ from the wild-type virus. Several commonly observed mutations are mapped in Figure 4.

[0035] Exemplary primer sets are listed in FIG. 1, which includes the VOCs they selectively amplify / detect, the mutant sequences they target, as well as the forward primer, reverse primer, and probe sequences.

[0036] In various embodiments, B.1.1.7, P.1, B.1.351, and other variants may be detected together using a primer-probe set targeting the deletion at positions 3675-3677 compared to the wild-type SARS-CoV-2 virus. Exemplary primers with SEQ ID NO:1 (forward) and SEQ ID NO:2 (reverse) targeting the mutations are provided in FIG. 1 along with a probe with SEQ ID NO:3. Because the treatment methods for these VOCs are similar, further identification may not be required or may be postponed for a rapid response. Thus, a determination that a patient has one of those three VOCs using the rapid qPCR test described herein may provide valuable time-sensitive information to treat the patient while minimizing the time and costs associated with multiplex testing or sequencing. Those skilled in the art will appreciate that the present invention is readily applicable to emerging variants in that the invention is based in part on preferentially amplifying variants over standard type viral sequences. All that is required to apply the present invention to novel variants is the identification of the sequence that selects for the discovered variant.

[0037] In a particular embodiment, the B.1.1.7 variant is detected using a primer-probe set targeting the deletion at positions 69-70 compared to the wild-type SARS-CoV-2 virus. Exemplary primers having SEQ ID NO:4 (forward) and SEQ ID NO:5 (reverse) targeting that mutation are provided in FIG. 1 along with a probe comprising SEQ ID NO:6.

[0038] In a specific embodiment, the B.1.1.7 variant is detected using a primer-probe set that targets the 144Y deletion compared to the wild-type SARS-CoV-2 virus. Exemplary primers having SEQ ID NO:7 (forward) and SEQ ID NO:8 (reverse) that target that mutation are provided in FIG. 1 along with a probe containing SEQ ID NO:9.

[0039] In a particular embodiment, the B.1.1.7 variant is detected using a primer-probe set targeting the GAT>CAT mutation at position 28280 compared to the wild-type SARS-CoV-2 virus. Exemplary primers targeting that mutation, having SEQ ID NO: 10 (forward) and SEQ ID NO: 11 (reverse), are provided in FIG. 1 along with a probe comprising SEQ ID NO: 12.

[0040] In certain embodiments, the P.1 and B.1.351 variants can be detected together using a primer-probe set targeting the E484K substitution compared to the wild-type SARS-CoV-2 virus. Exemplary primers having SEQ ID NO: 13 (forward) and SEQ ID NO: 14 (reverse) targeting that mutation are provided in FIG. 1 along with a probe comprising SEQ ID NO: 15.

[0041] In certain embodiments, the P.1 and B.1.351 variants can be detected together using primer-probe sets targeting the E484K and N591Y substitutions compared to the wild-type SARS-CoV-2 virus. Exemplary primers having SEQ ID NO: 16 (forward) and SEQ ID NO: 17 (reverse) targeting the mutations are provided in FIG. 1 along with a probe comprising SEQ ID NO: 18.

[0042] In a particular embodiment, the B.1.351 variant is detected using a primer-probe set targeting the G25563T substitution compared to the wild-type SARS-CoV-2 virus. Exemplary primers targeting that mutation, having SEQ ID NO: 19 (forward) and SEQ ID NO: 20 (reverse), are provided in FIG. 1 along with a probe comprising SEQ ID NO: 21.

[0043] In a particular embodiment, the B.1.351 variant is detected using a primer-probe set targeting the C28887T substitution compared to the wild-type SARS-CoV-2 virus. Exemplary primers targeting that mutation, having SEQ ID NO:22 (forward) and SEQ ID NO:23 (reverse), are provided in FIG. 1 along with a probe comprising SEQ ID NO:24.

[0044] In a particular embodiment, the B.1.429 / 427 variant is detected using a primer-probe set targeting the G27890T and G27987T substitutions compared to the wild-type SARS-CoV-2 virus. Exemplary primers targeting the mutations, having SEQ ID NO:25 (forward) and SEQ ID NO:26 (reverse), are provided in FIG. 1 along with a probe comprising SEQ ID NO:27.

[0045] In a particular embodiment, the B.1.429 / 427 variant is detected using a primer-probe set targeting the G28191T and A28272T substitutions compared to the wild-type SARS-CoV-2 virus. Exemplary primers targeting the mutations, having SEQ ID NO:28 (forward) and SEQ ID NO:29 (reverse), are provided in FIG. 1 along with a probe comprising SEQ ID NO:30.

[0046] In certain embodiments, the B.1.429 / 427 variant is detected using a primer-probe set that targets the L452R (T22917G) substitution compared to the wild-type SARS-CoV-2 virus. Exemplary primers targeting that mutation may include TGGTAATTAAATTACCGGT (forward, SEQ ID NO: 31), ACTGAAATCTATCAGGCCGGTAGCAC (reverse, SEQ ID NO: 32), and the probe may include AAACCTTCAACACCATTACAAGG (SEQ ID NO: 33).

[0047] The above mutations are mapped to each of these four VOCs in Figure 2, showing which targeted mutations yield positive or negative results for which VOCs.

[0048] If the above Orf-mut primers (e.g., SEQ ID NOs: 1 and 2) or any other primers that detect more than one variant together are used to detect variants B.1.1.7, P.1, or B.1.351, it may then be desirable to further identify the variants detected. Thus, the sample may be subjected to the workflow shown in FIG. 12. The sample may first be tested using the N1 primer, or any other means for detecting SARS-CoV-2 in general. The sample may then be tested using the above Orf-mut primers to determine whether the infection is wild-type SARS-CoV-2 or VOC. A positive result then indicates the presence of one of the B.1.1.7, P.1, or B.1.351 variants, while a negative result indicates an infection with a wild-type or non-VOC variant, or a B.1.429 / 427 variant.

[0049] In the case of a positive Orf-mut result, the sample can be tested with primers targeting the S region (e.g., S1-mut primers targeting del69-70), where a positive result indicates that the infection is a B.1.1.7 variant. If a negative result is found, the sample can then be tested with the B.1.351 specific primers listed above, where a positive result indicates that the infection is due to a B.1.351 variant and a negative result indicates that the infection is P.1.

[0050] If an Orf-mut negative result is obtained, the sample can be tested using the B.1.429 / 427 specific primers listed above, with a positive result indicating infection with that mutant strain and a negative result indicating wild-type infection or other non-VOC mutant strains. Thus, by going through this exemplary flowchart, a specific VOC infection can be identified in up to three rapid qPCR reactions. In various embodiments, the steps of the above flowchart can be performed simultaneously using multiplex analysis. For example, a multi-well plate or array can be used, where samples can be introduced into separate primer sets in separate wells or separate locations so that all test results for a given sample can be determined at once. Alternatively, each well or location can contain a primer set specific for only one of these four VOCs. In certain embodiments, a single reaction mixture can be prepared using Orf-mut primers and B.1.429 / 427 specific primers, in which case any positive result indicates a VOC infection.

[0051] In general, the workflow for qPCR detection using the primer / probe set of the present invention includes obtaining a biological sample from an individual suspected of being infected. The method of sample collection and the type of sample collected can vary. For example, the biological sample can include body fluid, and the biological sample can be collected in any clinically acceptable manner. The body fluid sample is generally collected from a patient who either shows signs or symptoms of the disease, or is suspected of having the disease due to interacting with others who have tested positive for the disease. The above method is applicable to the detection of any mutant or combination of mutants found.

[0052] The body fluid may be any liquid material, for example, from a human or other mammal. Such body fluids include, but are not limited to, mucus, blood, plasma, serum, serum derivatives, bile, blood, maternal blood, phlegm, saliva, expectoration, sweat, amniotic fluid, menstrual fluid, mammary fluid, ovarian follicular fluid, fallopian tube fluid, ascites, urine, semen, and cerebrospinal fluid (CSF) (e.g., lumbar CS or ventricular CS). The sample may also be a medium containing cells or biological material. The sample may also be a blood clot (e.g., a blood clot obtained from whole blood after serum has been removed). In certain embodiments, the sample is blood, saliva, or semen collected from a subject.

[0053] For SARS-CoV-2, a biological sample is typically collected by nasopharyngeal or pharyngeal swab, or in some cases, the sample may be saliva. The sample is then prepared for subsequent analysis. Preparation of the sample may include mixing the sample with a buffer composition that allows preparation of nucleic acid suitable for nucleic acid amplification from the biological sample without initial extraction of nucleic acid.

[0054] As mentioned above, many virus testing approaches rely on an initial step of isolating and purifying nucleic acid from clinical samples as part of their virus testing protocols. For example, the application of qPCR for relative quantification of the RNA of interest is preceded by (1) isolation and purification of total RNA from the sample; (2) elution and possible concentration of the material; and (3) use of purified RNA in a reverse transcription (RT) reaction that produces complementary DNA (cDNA), which is then utilized for qPCR reaction. The primer-probe set of the present invention can be used on the RNA prepared using such a method. However, this initial nucleic acid isolation and purification step (i.e., extraction step) required before undergoing PCR in current methods constitutes a major obstacle in this diagnostic process. This is because it remains manual, laborious and expensive, further increasing the chance of accidental contamination and human error.

[0055] Therefore, in a preferred embodiment, the biological sample can be processed to provide DNA that can be used for subsequent PCR assay, and at the same time eliminate the need for an initial RNA extraction step.For example, a unique buffer composition can be used for sample preparation, so that when mixed with the biological sample, it can prepare nucleic acid from the sample that can be directly used for nucleic acid amplification and analysis without the need for initial nucleic acid extraction (i.e., nucleic acid separation and purification).

[0056] Exemplary primers and probes for detection of wild-type SARS-CoV-2 have been disclosed by the Chinese CDC (targeting the N and ORF1ab genes) and the WHO (targeting the E gene) and are provided in Tao S et al., 2020 and Dong I et al., 2020. The compositions and methods of the present invention for detection of wild-type COVID-19 infection using ddPCR of saliva and nasopharyngeal samples contemplate using the same primers and probes disclosed therein. Furthermore, in some embodiments, the step of performing one or more PCR assays includes using a primer-probe set specific for ribonuclease P (RNP).

[0057] An exemplary method for extraction-free real-time RT-qPCR testing intended for the qualitative detection of nucleic acids from SARS-CoV-2 VOCs in biological specimens (spit or swab samples) collected and treated with the unique buffer composition of the present invention is described below. In the case of a nasopharyngeal swab, the swab is used for collection of respiratory mucosa and then placed in an acceptable container containing the unique buffer composition of the present invention and used as both a transport medium and a sample preparation medium for possible SARS-CoV-2 viral particles. In the case of saliva, the patient simply spits into an acceptable container, at which point the saliva is then transferred to another container containing the unique buffer composition for sample preparation. Once collected and provided in the unique buffer composition, the viral particles can be inactivated by either heating or direct lysis in the buffer. The inactivated sample can then be used for downstream qPCR diagnostic testing without the need for an additional RNA extraction step (separation and purification) that conventional approaches rely on. Rather, the prepared samples can be transferred to a PCR plate (96 / 384 well) format where cDNA synthesis by RT and detection by qPCR can be performed. Thus, unlike the widely used approach that includes an RNA extraction step using industrial RNA extraction kits, direct sample testing avoids this process by omitting the extraction. EXAMPLES

[0058] Example 1 - Comparison of mutant primer / probe sets in detecting wild-type and B.1.1.7 mutant controls Primer sets were developed that target various regions mutated in the VOCs. Common SARS-CoV-2 primers targeting the N1 region (e.g., primers shown as COVIDFAST in the mapping in Figure 4) were used for qPCR testing on wild-type and VOC controls (except B.1.429 / 427) and were found to provide detectable signals for each of the wild-type and B.1.1.7, B.1.351, and P.1 variants shown in Figure 3.

[0059] To discriminate between wild type and VOCs, primers were designed targeting some of the common mutation regions shown in Figure 4. For example, in an attempt to discriminate between B.1.1.7 and wild type SARS-CoV-2, four primer sets were designed directed to the ORF1a, S, and N regions. Proxy PCR was performed using both synthetic positive controls (Twist, control 14, and 15). Figures 5-10 show the effectiveness of those four target regions to discriminate between wild type and B.1.1.7 mutant strains. Figures 5-8 show the quantification cycle (Cq) values ​​required to generate a signal using each of the four primer sets at various virus concentrations. As shown in Figure 5, each of the four primer sets (directed to mutations in the N, ORF1a, and S regions) successfully detected the B.1.1.7 positive control. However, as shown in Figure 6, the N region mutation-specific primers also reacted with the wild type positive control. Figure 7 further shows that the N-region mutant primers did not generate differential signals in the presence of wild type and B.1.1.7. Thus, primers targeting N-region mutations are not successful in discriminating between wild type and VOC infections. However, as shown in Figure 8 (primers targeting Orf-mut), Figure 9 (primers targeting S1-mut), and Figure 10 (primers targeting S2-mut), all generated differential signals for wild type and B.1.1.7. Of the three, primers targeting Orf-mut offered the greatest reactivity contrast for detecting the B.1.1.7 mutant strain.

[0060] Example 2 - Validation of ORF1a mutant primers Table 1 shows PCR test results for 59 positive COVID19 samples from November 12, 2020 to February 18, 2021 (samples no. 1–17 from November 12, 2020 to January 10, 2021; samples no. 18–42 from January 18, 2021; and samples no. 43–59 from February 12, 2021 to February 18, 2021). No VOCs (not including B.1.429 / 427) were detected in the samples tested. These results are consistent with the prevalence (or lack thereof) of the tested variants in the general population during those periods. The samples were tested using wild-type primer sets targeting the N1 region as well as variant-specific primer sets targeting variant-specific (B.1.1.7, P.1, and B.1.351) mutations against the ORF1a region. (Table 1) [Table 1-1] [Table 1-2]

[0061] Table 2 shows PCR test results for 149 positive COVID19 samples on March 16, 2021 using wild-type primer sets targeting the N1 region and mutant-specific primer sets targeting the mutant-specific (B.1.1.7, P.1, and B.1.351) mutations to the ORF1a region. A single Orf-mut primer set was able to successfully discriminate between wild-type SARS-CoV-2 and any of the three B.1.1.7, P.1, and B.1.351 mutants, generating threshold qPCR signals only in the presence of those mutants. Of note, primers for detection of B.1.429 / 427 were not used in this experiment. The three variants detected (B.1.1.7, P.1, and B.1.351) were found in approximately 52.2% (72 / 138) of SARS-CoV-2-positive patients tested between March 16 and April 7, consistent with variant infection rates observed in the general population. (Table 2) [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5]

[0062] To validate the rapid PCR detection of SARS-CoV-2 mutant strains using the methods and compositions of the present invention, samples were tested using the primer set of the present invention (Orf-mut primer and S1-mut primer) targeting the mutation in the ORF1a region as well as the mutation in the S region. The lineage of SARS-CoV-2 infection was then confirmed by next-generation sequencing (NGS). The results are shown in Table 3.

[0063] For the first batch, 30 samples were used, consisting of 20 SARS-CoV-2 positive paired nasal-saliva specimens (10 pairs) and 10 SARS-CoV-2 negative (saliva) samples collected at two time points. Samples were collected using DNA Genotek devices (OR-100 for nasal swabs and OM-505 for saliva, current device names ORE-100 and OME-505). The samples were collected between November 12, 2020 and January 10, 2021. No VOCs were detected (except B.1.429 / 427, which was not included).

[0064] A second batch of 11 SARS-CoV-2 positive (7 by rapid saliva PCR and 4 by rapid nasal swab PCR) and 9 SARS-CoV-2 negative (6 by rapid saliva PCR and 3 by rapid nasal swab PCR) samples was tested. The samples were collected from 12 November 2021 to 18 February 2021. No VOCs (except B.1.429 / 427) were detected.

[0065] A third batch of 33 SARS-CoV-2 positive samples (25 by rapid saliva PCR and 8 by rapid nasal swab PCR) was tested. In this batch, 28 had one lineage of VOCs that matched the Orf-mut PCR results. Of the 12 Orf-mut PCR positive cases, 10 were B.1.1.7, 1 was P1, and 1 was B.1.351. Of those 14 Orf-mut PCR negative cases, none of them belonged to the B.1.1.7, P1, or B.1.351 lineages. The results are shown in Table 3 and Figure 11 below. Using the single Orf-mut primer set of the present invention, the detection of the three targeted VOCs (B.1.1.7, P1, or B.1.351) was 100% positive and 100% negative in agreement with the NGS results, validating the detection method of the present invention. (Table 3) [Table 3]

[0066] Example 3 - Saliva and Nasal Swab Examples The following provides an exemplary protocol for detection of viral nucleic acid according to the methods of the present invention: Obtain a biological sample. The biological sample may include a human bodily fluid. The biological sample may be collected in any clinically acceptable manner.

[0067] For many respiratory infections, the biological sample is typically collected by nasal or throat swab, or in some cases saliva, hi other instances, the sample may include an aerosol sample or droplets captured in the air, or more preferably droplets captured by expulsion of droplets by coughing or sneezing. On-site collection of saliva samples

[0068] Saliva samples can be collected from individuals, for example, by having them spit into the sterile container provided.Saliva collection device can include, for example, a screw-capped Nest 1.9ml cryogenic storage vial (or "Nest tube") with a 10-digit one-dimensional barcode pre-printed on the side and a DATAMATRIX two-dimensional code laser-etched on the bottom, which is used as the container for saliva samples.A saliva collection support funnel (Nest) is used in series with the Nest vial. (Receipt and registration of saliva samples in the laboratory)

[0069] The samples are transported to the laboratory. The samples are removed from the bag and visually inspected by the Registration Supervisor at the receiving desk for any leaks or damage. Samples that pass the supervisor's pre-screening step are moved to a desk used by the Registration team. Samples that do not pass the pre-screening step are set aside for further investigation. The Registration Clerk scans the barcode on the Nest tube and looks up the patient information and consent status that are shown on the computer screen by the Laboratory Information Management System (LIMS). Tubes that are free of leaks with complete patient information in the LIMS (i.e., eligible samples) are placed in a barcoded 48-format rack. The sample's location in that rack should match its assigned location in the LIMS. Unqualified samples are placed in a separate barcoded 48-format rack and set aside for further investigation by the Registration Supervisor. The rack of samples may then be placed in a platform locker in a holding position at 60 rpm until a Medical Laboratory Scientist (MLS) from the sample preparation team retrieves the samples.

[0070] (Saliva reaction buffer) As part of the sample preparation, the saliva sample is mixed with a unique buffer composition specifically formulated for saliva (referred to herein as the Saliva Preparation Buffer). Preparation of this Saliva Preparation Buffer involves the use of at least the following equipment: a safety cabinet or laminar flow hood (a work area capable of maintaining a sterile environment); sterile, individually wrapped pipettes, pipette tips (e.g., 10 mL and 25 mL); pipette aid; pipettor (1 mL or 200 μL) and corresponding tips; and 50 mL sterile, nuclease-free Falcon tubes. An exemplary Saliva Preparation Buffer includes the following reagents / components: · 0.5M Bond-Breaker TCEP solution, (Tris(2-carboxyethyl)phosphine hydrochloride, neutral pH), sterile, DNase-free, RNase-free, and protease-free grade, ThermoFisher Scientific, catalog number 77720, 5 mL; ·RNase inhibitor, human placenta, 40,000 units / ml, sterile, DNase-free ·RNase-free grade, New England Biolabs, Catalog No. M0307L, 10,000 units, 250 μl / tube; · Amphotericin B solution, 250 μg / ml in deionized water, sterile, Sigma-Aldrich, Cat. No. A2942, 100 ml (or a similar antifungal agent at an appropriate concentration to prevent fungal contamination and growth); · Penicillin-Streptomycin Solution, 100×, a 100-fold working concentration mixture of penicillin (10,000 IU) and streptomycin (10,000 μg / ml), sterile, Corning, catalog number 30-002-CI (or a similar antibiotic at an appropriate concentration to prevent bacterial contamination and growth); Nuclease-free water, sterile, Millipore / Sigma, W4502, DNase-free, RNase-free and protease-free grade; and Disinfectant (e.g. 70% ethanol).

[0071] Preparation of saliva preparation buffers is performed in a safety cabinet or laminar flow hood according to standard biological and / or clinical laboratory practices and procedures.

[0072] Preparation of the components includes at least the following steps: cleaning the work surface with an appropriate disinfectant; sterilizing reagent bottles before placing them on the work surface; dispensing 40 mL of nuclease-free water into sterile 50 mL Falcon tubes and storing at room temperature; dispensing 4 ml / tube of amphotericin B (into sterile 5 ml Corning tubes) and storing at -20°C; dispensing 1 ml / tube of penicillin / streptomycin (into sterile Eppendorf tubes) and storing at -20°C; recording lot information and preparation in a laboratory maintained notebook.

[0073] The preparation of the saliva preparation buffer includes at least the following steps: 1. Clean the work surface with an appropriate disinfectant; 2. Sterilize reagent bottles before placing them on the work surface (dispensing everything except RNase inhibitor) 3. For example, to prepare 5 mL of buffer (for 1000 tests): 3.1. Add 4.3 mL of nuclease-free water to a sterile 15 mL Falcon tube; 3.2.Add 400 μL of TCEP; 3.3. Using a sterile pipette, add 50 μl of RNase inhibitor; 3.4. Thaw one tube of amphotericin and one tube of penicillin / streptomycin and use a sterile pipette to aseptically add 200 μL of amphotericin and 50 μL of penicillin / streptomycin to the 15 mL Falcon tube; 4. Record lot information and preparation in a laboratory maintained notebook; 5. Assign appropriate laboratory identification (e.g., lot number); 6. Cap the tube tightly and mix thoroughly by inverting the tube; 7. Withdraw 100 μl of medium for QC sample; 8. In that bottle Saliva reaction buffer Laboratory ID: (insert appropriate ID for the laboratory (e.g., STB1 for Summit Buffer 1)) DOM: (insert current manufacturing date) Expiration Date: (insert the date one month after the manufacturing date) Store at 2℃~8℃ and label it; 9. Store at 2°C to 8°C and add 5 μl to each test along with 30 μl saliva and 5 μl proteinase K when performing the salivaFAST test; 10.Perform sterility checks.

[0074] (Preparation of saliva samples) The MLS of the sample preparation team retrieves a rack of registered samples from the locker and brings it to the sample preparation room to prepare them for testing. The MLS brings a prepared 96-well sample preparation plate (SPP) containing 10 μL / well of sample preparation mix (SPM). The SPM contains saliva preparation buffer and protease (proteinase K). Specifically, the 96-well SPP contains 10 μL of SPM per well (5 μL saliva preparation buffer and 5 μL proteinase K (Promega)) that is dispensed into each well using a multichannel equalizer or Viaflow (Integra). The caps of the samples are decapped using a semi-automated 6-channel decapper (Brooks) or an automated 48 format decapper (Brooks) inside a safety cabinet. If the 6-channel decapper is used, the caps are temporarily placed in its cap carrier rack. Using the E1-ClipTip electronic multichannel (8 channel) equalizer, transfer approximately 30 μL of saliva from the tubes in the 48-well rack into a 96-well SPP containing 10 μL of SPM and pipette thoroughly. Two 48-well racks of samples will fill one 96-well SPP. Recap the samples (6 at a time if using a 6-channel decapper, or 48 at a time if using an automated 48 format decapper). Mix the saliva and SPM thoroughly by placing the plate on a digital microplate shaker at 500 RPM for 1 minute. Place the plate in a miniAmp 96-well PCR instrument at 95°C for 5 minutes and hold at 4°C. Then transport all racks of samples to a temporary sample storage area. Any of the samples that require a repeat test are identified from this temporary sample storage area. Only one repeat test is allowed. In case of failure, request a new sample. Any remaining samples are stored at -80°C for future use.

[0075] (Preparation of PCR reagents and construction of plates (saliva test)) A plate containing a PCR master mix (herein referred to as a PCR master mix plate (PMMP)) contains 12.5 μL of PCR master mix dispensed into each well of a 96-well or 384-well plate using a multichannel equalizer or Viaflow (Integra). The PCR master mix is ​​composed of 10 μL of Luna Universal probe one-step reaction mix, 1 μL of Luna Warmstart RT enzyme mix, and 1.5 μL of primer / probe set. The 1.5 μL of primer / probe set is generated by adding 50.25 μL of each 100 μM primer and probe stock to 524 μL of IDTE buffer (pH 7.5) to produce a 6.7 μM working stock of either VOC-specific primers, N primers, and / or RNP primers, and 1.7 μM of FAM-labeled N1 probe, ATTO-647-labeled RNP probe, or one of the VOC-specific labeled probes listed above. Exemplary VOC-specific primers and probes are listed in FIG. 1 and above.

[0076] The molecular team MLS places the 96-well or 384-well PMMP into their individual PCR workstation and adds 7.5 μL of the processed saliva sample from the saliva sample preparation step to each designated well of the PMMP. The processed saliva sample is then mixed with the PCR master mix above by pipetting, taking care to avoid creating bubbles. The MLS then adds 7.5 μL of the positive controls (IDT synthetic 2019-SARS-CoV-N control, 4000 copies / μL or VOC positive control(s)) and negative controls (IDT Hs-RPP30 control, 4000 copies / μL) for SARS-CoV-2 and / or one or more VOCs, as well as no template controls (NTC-water) to the PCR wells designated for those controls (one positive control, one negative control, and NTC per plate), mixing by pipetting, avoiding creating bubbles. The MLS then places a clear plastic qPCR film over the PMMP, seals the film with a plate sealer, and centrifuges briefly in a plate centrifuge to remove any bubbles.

[0077] (PCR temperature profile (amplification region) (saliva test)) Load the plate into a Bio-Rad CFX or QuantStudio PCR instrument, open the master file "ST-COV-PCR protocol" and run the following thermocycling conditions: 1. Step 1: 55°C for 10 min, 1 cycle; 2. Step 2: 95°C for 1 min, 1 cycle; and Step 3: 40 cycles of 95° C. for 10 seconds, 60° C. for 30 seconds (plus reading the plate in both the FAM channel for the N1 target and the Cy5 channel for the RNP target).

[0078] (Data Interpretation (BioRad CFX opus 96-well format) (Saliva Test)) Bio-Rad CFX reports Cq values. This Cq value file (csv file) is then exported from the PCR instrument to OvDx LIMS. The interpretation of this Cq value (DETECTED, NOT DETECTED, and INVALID) is exported to OvDx LIMS. A Cq of 36 or less (as determined by the VOC-specific primer-probe set in that well) is interpreted as positive for the target VOC.

[0079] (On-site collection of nasal swab samples) The nasal swab collection device includes a 1.9 ml Nest tube (used as a container for the nasal swab sample) filled with 1 ml of a unique buffer composition specific for nasal swab samples (hereinafter referred to as Swab Transport Buffer), and a Nest oral / nasal swab is used to swab the patient's nostrils and then placed inside the Nest tube filled with Swab Transport Buffer.

[0080] Nasal swabs should be collected under the supervision of a trained healthcare professional designated by the agency overseeing the collection site. The healthcare professional overseeing the collection should clean their hands with an alcohol-based sanitizer or unscented soap and water and wear appropriate PPE (gown, gloves, face mask, and / or face shield). Prior to collection, the patient is presented with instructions (e.g., these instructions recommended by the FDA (https: / / tinyurl.com / nasalswab1-2)). The healthcare professional ensures that all patient information (including name, date of birth, and any additional information required by state reporting regulations) is properly completed prior to collection. The healthcare professional then asks the patient to review the study consent form (provided by Ovation) to decide to participate or not participate in the study. Finally, the healthcare professional scans the pre-printed barcode indicator, links it to the patient information already collected, and then places the indicator into the Nest tube to be used by the patient.

[0081] The HCW removes the cap of the Nest tube and instructs the patient to swab from their own nostril 10 times for each nostril, breaking the proximal break point of the swab inside the tube. The HCW replaces the cap on the Nest tube, making sure to tighten the cap. If any sample is spilled during this collection process, the HCW uses an alcohol wipe or equivalent to wipe the outside of the tube to prevent contamination. The samples are then placed in individual bags at room temperature before transport to the laboratory.

[0082] Healthcare workers overseeing the swab sample collection should use an alcohol-based hand sanitizer after handling each patient sample.

[0083] (Receipt and registration of swab samples in the laboratory) The samples are transported to the laboratory. The samples are removed from the bag and visually inspected by the Registration Supervisor at the receiving desk for any leaks or damage. Samples that pass the supervisor's pre-screening step are moved to a desk used by the Registration team. Samples that do not pass the pre-screening step are set aside for further investigation. The Registration Clerk scans the barcode on the Nest tube and looks up the patient information and consent status shown on the computer screen by the Laboratory Information Management System (LIMS). Tubes that are free of leaks with complete patient information in the LIMS (i.e., eligible samples) are placed in a rack. The sample's position in the rack should match its assigned position in the LIMS. Unqualified samples are placed in a separate rack and set aside for further investigation by the Registration Supervisor. The rack of samples may then be placed in a platform locker in a holding position at 600 rpm until a Medical Laboratory Scientist (MLS) from the sample preparation team retrieves the samples.

[0084] (swab preparation buffer) As part of sample preparation, the swab sample is mixed with a unique buffer composition (referred to herein as Swab Prep Buffer) specifically formulated for swab samples. Preparation of this Swab Prep Buffer involves the use of at least the following equipment: a safety cabinet or laminar flow hood (a work area capable of maintaining a sterile environment); sterile, individually wrapped pipettes, pipette tips (e.g., 10 mL and 25 mL); pipette aid; pipettor (1 mL or 200 μL) and corresponding tips; 50 mL sterile, nuclease-free Falcon tubes; Eppendorf repeater (50 mL capacity); 1.9 ml Cryovial tubes (Nest); Nest tube rack; and a screw cap tube decapper device (Brooks Life Sciences). The preparation of this swab transport buffer further includes the use of at least the following reagents / components: · 10× TBE buffer (Tris-borate-EDTA, pH 8.2-8.4), sterile, DNase-free, RNase-free, and protease-free grade, Fisher BioReagents, catalog number BP133320, 20 L; ·RNase inhibitor, human placenta, 40,000 units / ml, sterile, DNase-free ·RNase-free grade, New England Biolabs, Catalog No. M0307L, 10,000 units, 250 μl / tube; · Amphotericin B solution, 250 μg / ml in deionized water, sterile, Sigma-Aldrich, Cat. No. A2942, 100 ml (or a similar antifungal agent at an appropriate concentration to prevent fungal contamination and growth); · Penicillin-Streptomycin Solution, 100×, a 100-fold working concentration mixture of penicillin (10,000 IU) and streptomycin (10,000 μg / ml), sterile, Corning, catalog number 30-002-CI (or a similar antibiotic at an appropriate concentration to prevent bacterial contamination and growth); Nuclease-free water, sterile, Millipore / Sigma, W4502, DNase-free, RNase-free and protease-free grade; and Disinfectant (e.g. 70% ethanol).

[0085] Preparation of the components includes at least the following steps: cleaning the work surface with an appropriate disinfectant; sterilizing reagent bottles before placing them on the work surface; dispensing 500 ml / bottle of 10x TBE buffer into sterile 500 ml Corning bottles and storing at room temperature; dispensing 894.95 ml / bottle of nuclease-free water into sterile 1 L Corning bottles and storing at room temperature; dispensing 4 ml / tube of Amphotericin B solution (into sterile 5 ml Corning tubes) and storing at -20°C; dispensing 1 ml / tube of Penicillin / Streptomycin (into sterile Eppendorf tubes) and storing at -20°C; recording lot information and preparation in a laboratory maintained notebook. The preparation of this swab preparation buffer includes at least the following steps: 1. Clean the work surface with an appropriate disinfectant; 2. Sterilize reagent bottles before placing them on the work surface (dispensing everything except RNase inhibitor) 3. For example, to prepare 1IL of viral transport buffer, 3.1. Bring one bottle of nuclease-free water (894.95 ml / bottle); 3.2. Using a sterile 50ml Falcon tube, add 100ml of 10x TBE buffer; 3.3. Using a sterile pipette, add 50 μl of RNase inhibitor; 3.4. Thaw one tube of amphotericin B solution and one tube of penicillin / streptomycin and use a sterile pipette to aseptically add 4 ml of amphotericin and 1 ml of penicillin / streptomycin to the bottles. 4. Record lot information and preparation in a laboratory maintained notebook; 5. Assign appropriate laboratory identification (e.g., lot number); 6. Cap the tube tightly and mix thoroughly by inverting the tube; 7. Withdraw 100 μl of medium for QC sample; 8. In that bottle Swab transport buffer Laboratory ID: (insert appropriate ID for the laboratory (e.g., STB2 for Summit Buffer 2)) DOM: (insert current manufacturing date) Expiration Date: (insert the date one month after the manufacturing date) Store at 2℃~8℃ and label it; 9. Store at 2°C to 8°C until distribution into aliquots; 10. Using an Eppendorf repeater (50 mL capacity) and a Brooks decapper, dispense 1 mL of prepared swab preparation buffer into individual sterile 1.9 mL screw-cap tubes (Nest); 11.Perform sterility checks; 12. Store the tube and any remaining buffer in the bottle at 2°C to 8°C.

[0086] (Swab sample preparation) The MLS from the sample preparation team retrieves a rack of registered samples from the locker and brings the rack to the sample preparation room to prepare them for testing. The MLS brings a prepared 96-well sample preparation plate (SPP) containing 5 μL / well of protease (proteinase K). Specifically, the 96-well SPP contains 5 μL of proteinase K (Promega) per well, dispensed into each well using a multichannel equalizer or Viaflow (Integra). The caps of the samples are decapped using a semi-automated 6-channel decapper (Brooks) or an automated 48-format decapper (Brooks) inside a safety cabinet. If the 6-channel decapper is used, the caps are temporarily placed in the cap carrier rack. Using an E1-ClipTip electronic multichannel (8-channel) equalizer, approximately 35 μL of swab samples are transferred from the tubes in the 48-well rack to the 96-well SPP containing 5 μL of proteinase K and pipetted thoroughly. Two 48-well racks of samples fill one 96-well SPP. Recap the samples (6 at a time if using a 6-channel decapper, or 48 at a time if using an automated 48-format decapper). Mix the swab samples thoroughly with the Proteinase K by placing the plate on a digital microplate shaker at 500 RPM for 1 minute. Place the plate in a miniAmp 96-well PCR instrument at 95°C for 5 minutes and hold at 4°C. Then transport all racks of samples to a temporary sample storage area. Identify any of the samples that require a repeat test from this temporary sample storage area. Only one repeat test is allowed. If unsuccessful, request a new sample. Store the remaining samples at -80°C for future use.

[0087] (Preparation of PCR reagents and construction of plates (swab test)) The plate containing the PCR master mix (herein referred to as the PCR master mix plate (PMMP)) contains 12.5 μL of PCR master mix dispensed into each well of a 96-well or 384-well plate using a multichannel equalizer or Viaflow (Integra). This PCR master mix is ​​composed of 10 μL of Luna Universal probe one-step reaction mix, 1 μL of Luna Warmstart RT enzyme mix, and 1.5 μL of primer / probe set for wild-type or VOC SARS-CoV-2 detection. This 1.5 μL of N1 / RNP primer / probe is generated as a 6.7 μM working stock of primer and 1.7 μM of the labeled probe associated with that primer by adding 50.25 μL of each 100 μM primer and probe stock to 524 μL of IDTE buffer (pH 7.5).

[0088] The molecular team MLS places the 96-well or 384-well PMMP into their individual PCR workstation and adds 7.5 μL of the processed swab sample from the swab sample preparation step to each designated well of the PMMP. The processed swab sample is then mixed with the PCR master mix above by pipetting, taking care to avoid creating bubbles. The MLS then adds 7.5 μL of the positive controls (IDT synthetic 2019-SARS-CoV-N control, 4000 copies / μL or one or more VOC positive controls) and negative controls (IDT Hs-RPP30 control, 4000 copies / μL) for SARS-CoV-2 or its VOCs, as well as no template controls (NTC-water) to the PCR wells designated for those controls (one positive control, one negative control, and NTC per plate), mixing by pipetting to avoid creating bubbles. The MLS then places a clear plastic qPCR film over the PMMP, seals the film with a plate sealer, and centrifuges briefly in a plate centrifuge to remove any bubbles.

[0089] (PCR temperature profile (amplification region) (swab test)) Load the plate into a Bio-Rad CFX or QuantStudio PCR instrument, open the master file "ST-COV-PCR protocol" and run the following thermocycling conditions: 1. Step 1: 55°C for 10 min, 1 cycle; 2. Step 2: 95°C for 1 min, 1 cycle; and Step 3: 40 cycles of 95° C. for 10 seconds, 60° C. for 30 seconds (plus reading the plate in both the FAM channel for the N1 target and the Cy5 channel for the RNP target).

[0090] (Data Interpretation (BioRad CFX opus 96-well format) (Swab test)) Bio-Rad CFX reports Cq values. This Cq value file (csv file) is then exported from the PCR instrument to OvDx LIMS. The interpretation of this Cq value (DETECTED, NOT DETECTED, and INVALID) is exported to OvDx LIMS. A Cq of 36 or less (as determined by the VOC-specific primer-probe set in that well) is interpreted as positive for the target VOC.

[0091] (Incorporated by reference) References and citations to other documents, such as patents, patent applications, patent publications, journals, books, articles, web content, etc., have been made throughout this disclosure, and all such documents are hereby incorporated by reference herein substantially in their entirety.

[0092] (Equivalent) Various modifications of the invention and many further embodiments thereof, in addition to those shown and described herein, will become apparent to those skilled in the art from the entire contents of this specification, including the references to the scientific and patent literature cited herein. The subject matter herein contains important information, exemplification and guidance that can be adapted to the practice of this invention in its various embodiments and equivalents thereof.

Claims

A step of amplifying nucleic acids contained in a biological sample using one or more primers specific to one or more target SARS-CoV-2 variants without amplifying wild-type SARS-CoV-2 nucleic acids; and A step of analyzing the amplicons generated in the step of amplification to detect the presence of the one or more target SARS-CoV-2 variants A method for detecting SARS-CoV-2 variants, comprising:

2. Before the step of amplification, a step of detecting the presence of SARS-CoV-2 infection by using primers that amplify the one or more target SARS-CoV-2 variants and wild-type SARS-CoV-2 The method according to claim 1, further comprising:

3. The method according to claim 1, wherein the one or more target SARS-CoV-2 variants are selected from the group consisting of B.1.1.7, P.1, B.1.351, and B.1.429 / 427.

4. The method according to claim 1, wherein the primers are specific to two or more target SARS-CoV-2 variants.

5. The method according to claim 4, wherein the primers are specific to three or more target SARS-CoV-2 variants.

6. The method according to claim 5, wherein the three or more target SARS-CoV-2 variants are B.1.1.7, P.1, and B.1.

351.

7. The method according to claim 6, wherein the primers target the ORF-1A region.

8. The method according to claim 7, wherein the primers target a deletion at positions 3675 to 35677 in the ORF-1A region compared to wild-type SARS-CoV-2.

9. The method according to claim 8, wherein the primers include SEQ ID NO: 1 and SEQ ID NO:

2.

10. The method according to claim 9, wherein the step of amplification includes quantitative PCR (qPCR) using a probe including SEQ ID NO:

3.

11. The method according to claim 3, wherein the one or more target SARS-CoV-2 variants include B.1.1.7 and the primers target the S region.

12. The method according to claim 11, wherein the primers target a deletion at positions 69 to 70 in the S region compared to wild-type SARS-CoV-2.

13. The method according to claim 12, wherein the primer comprises SEQ ID NO: 4 and SEQ ID NO:

5.

14. The method according to claim 13, wherein the amplifying step comprises quantitative PCR (qPCR) using a probe comprising SEQ ID NO:

6.

15. The method according to claim 3, wherein the one or more target SARS-CoV-2 variant strains comprise B.1.351, and the primer targets a G25563T substitution or a G28887T substitution compared to wild-type SARS-CoV-2.

16. The method according to claim 15, wherein the primer comprises SEQ ID NO: 19 and SEQ ID NO: 20 or comprises SEQ ID NO: 22 and SEQ ID NO:

23.

17. The method according to claim 16, wherein the amplifying step comprises quantitative PCR (qPCR) using a probe comprising SEQ ID NO: 21 or SEQ ID NO:

24.

18. The method according to claim 3, wherein the one or more target SARS-CoV-2 variant strains comprise B.1.429 / 427, and the primer targets a G27890T / G27987T substitution or a G28191T / A28272T substitution compared to wild-type SARS-CoV-2.

19. The method according to claim 18, wherein the primer comprises SEQ ID NO: 25 and SEQ ID NO: 26 or comprises SEQ ID NO: 28 and SEQ ID NO:

29.

20. The method according to claim 19, wherein the amplifying step comprises quantitative PCR (qPCR) using a probe comprising SEQ ID NO: 27 or SEQ ID NO:

30.

21. The step of mixing the biological sample in a buffer composition comprising nuclease-free water, an antifungal agent, an antibiotic, a ribonuclease inhibitor, and a reducing agent further comprising The method according to claim 1, wherein the amplifying step is performed on the nucleic acid in the buffer without prior extraction of the nucleic acid.

22. The method according to claim 1, wherein the biological sample is a body fluid.

23. The method according to claim 22, wherein the body fluid is selected from the group consisting of saliva, sputum, mucus, phlegm, and urine.

24. The method according to claim 21, wherein the reducing agent is a tris(2-carboxyethyl)phosphine hydrochloride solution.

25. The method according to claim 21, wherein the antifungal agent comprises amphotericin B and the antibiotic comprises penicillin-streptomycin. The method according to claim 1, wherein the biological sample is a biological sample obtained by nasal swab or pharyngeal swab.

27. A step of heat-inactivating the biological sample mixed with the buffer composition before the step of amplification The method according to claim 21, further comprising.

28. The method according to claim 27, wherein the mixture of the biological sample and the buffer composition is heated to 95 ° C for 5 minutes.

29. The biological sample is derived from a subject suspected of having SARS-CoV-2 infection, The method according to claim 1, wherein the detected presence of the one or more target SARS-CoV-2 variants indicates a treatment regimen to be selected.

30. The method according to claim 29, wherein the treatment regimen is different from the treatment regimen recommended for wild-type SARS-CoV-2 infection.

31. A primer set that selectively amplifies nucleic acids derived from one or more target SARS-CoV-2 variants without amplifying nucleic acids derived from wild-type SARS-CoV-2.

32. The primer set according to claim 31, wherein the one or more target SARS-CoV-2 variants are selected from the group consisting of B.1.1.7, P.1, B.1.351, and B.1.429 / 427.

33. The primer set according to claim 31, which is specific for two or more target SARS-CoV-2 variants.

34. The primer set according to claim 33, which is specific for three or more target SARS-CoV-2 variants.

35. The primer set according to claim 34, wherein the three or more target SARS-CoV-2 variants are B.1.1.7, P.1, and B.1.

351.

36. The primer set according to claim 35, which targets the ORF-1A region.

37. The primer set according to claim 36, which targets a deletion at positions 3675 to 35677 in the ORF-1A region compared to wild-type SARS-CoV-2.

38. The primer set according to claim 37, comprising SEQ ID NO: 1 and SEQ ID NO:

2.

39. A probe for quantitative PCR (qPCR) comprising SEQ ID NO: 3 The primer set according to claim 38, further comprising.

40. The primer set according to claim 32, wherein the one or more target SARS-CoV-2 variants include B.1.1.7 and the primer set targets the S region.

41. The primer set according to claim 40, which targets the deletion at positions 69-70 in the S region compared to wild-type SARS-CoV-2.

42. The primer set according to claim 41, which includes SEQ ID NO: 4 and SEQ ID NO:

5.

43. A probe for quantitative PCR (qPCR) including SEQ ID NO: 6 further included in the primer set according to claim 42.

44. The primer set according to claim 32, wherein the one or more target SARS-CoV-2 variants include B.1.351 and the primer set targets the G25563T substitution or the G28887T substitution compared to wild-type SARS-CoV-2.

45. The primer set according to claim 44, which includes SEQ ID NO: 19 and SEQ ID NO: 20 or includes SEQ ID NO: 22 and SEQ ID NO:

23.

46. The primer set according to claim 45, further including a probe for quantitative PCR (qPCR) including SEQ ID NO: 21 or SEQ ID NO:

24.

47. The primer set according to claim 32, wherein the one or more target SARS-CoV-2 variants include B.1.429 / 427 and the primer set targets the G27890T / G27987T substitution or the G28191T / A28272T substitution compared to wild-type SARS-CoV-2.

48. The primer set according to claim 47, which includes SEQ ID NO: 25 and SEQ ID NO: 26 or includes SEQ ID NO: 28 and SEQ ID NO:

29.

49. A probe for quantitative PCR (qPCR) including SEQ ID NO: 27 or SEQ ID NO: 30 further included in the primer set according to claim 48.

50. A step of amplifying viral nucleic acid contained in a biological sample using a primer that selectively amplifies only variants of known viruses; A step of detecting the presence of the viral variant by generating an amplicon in the step of amplifying A method for detecting a viral variant, including.

Images