AAV virions encoding neurotrophic factors and uses thereof

Abstract

Provided are recombinant adeno-associated virus (rAAV) virions, methods of treating ocular diseases, pharmaceutical compositions, and other compositions and methods, where the rAAV virions contain a polynucleotide encoding a neurotrophic factor, such as nerve growth factor (NGF) or glial derived neurotrophic factor (GDNF). Methods of treatment can include administration to the lacrimal gland.

Description

[Technical field]

[0001] Cross-related Applications This application claims the benefit of U.S. Provisional Patent Application No. 63 / 185,889, filed May 7, 2021, the entire contents of which are incorporated herein by reference.

[0002] Sequence Listing Reference This application contains a Sequence Listing that has been submitted electronically in ASCII format via EFS-Web, which is incorporated by reference in its entirety. Said ASCII copy was created on April 29, 2022, is named OYST_015_03 WO_SeqList_ST 25, and is 72,019 bytes in size. [Background technology]

[0003] Medical treatments are known for eye diseases that affect the ocular surface, such as neurotrophic keratopathy, chemical burns, corneal wounds, persistent epithelial defects, dry eye disease, trigeminal and / or ocular herpes simplex virus infections, trigeminal and / or ocular varicella zoster virus infections, and diabetic complications of the corneal nerves. Additionally, medical treatments are known for glaucoma, presbyopia, myopia, and other anterior chamber disorders. These medical treatments include topical eye drops, oral medications, and the like.

[0004] Despite the available treatments, these eye diseases remain a challenge for ophthalmologists and treatment strategies are focused on the severity of the disease. Treatments for less severe cases include bandage contact lenses and lubricating eye drops. For more severe cases, amniotic membrane transplants, blood derivatives with specific concentrations in serum tears, tarsorrhaphy, and topically applied autologous serum eye drops are widely used (Non-Patent Document 1). An emerging treatment strategy comes from the efficacy of autologous serum eye drops. Autologous serum eye drops are prepared by diluting serum taken from the patient's blood with saline (Non-Patent Document 2). Preparation is done on an individual basis and is believed to be effective in treating eye diseases due to the presence of growth factors, including neurotrophic factors such as NGF and glial cell line derived neurotrophic factor (GDNF).

[0005] Delivery of neurotrophic factors for the treatment of the ocular surface currently relies on repeated application of autologous serum eye drops or eye drops containing purified recombinant neurotrophic factors. Autologous serum eye drops can vary due to differences in serum composition between patients, the possibility of contamination during preparation of the eye drops, and special storage conditions required to minimize degradation of the neurotrophic factors. Similarly, eye drops containing recombinant neurotrophic factors require expression and purification conditions that result in active neurotrophic factors, have limited stability, and require special storage conditions. Furthermore, recombinant human neurotrophic factors such as NGF must be administered to patients six times a day at two-hour intervals for eight weeks to achieve a therapeutic effect. Thus, there is a need for a method of delivering neurotrophic factors to the ocular surface without the need for repeated topical application, which may be challenging or impossible for some patients.

[0006] Improved medical treatments for ocular surface disorders would be desirable. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] U.S. Patent No. 10,308,957

Non-licensed documents

[0008]

Non-patent document 1

Non-patent document 2

Non-patent document 3

Non-patent document 4

Non-patent document 5

Non-patent document 6

Non-patent document 7

Non-patent document 8

Non-patent document 9

Non-patent document 10

Non-patent document 11

Non-Patent Document 12

Non-Patent Document 13

Non-Patent Document 14

Non-Patent Document 15

Non-Patent Document 16

Non-Patent Document 17

Non-Patent Document 18

Non-Patent Document 19

Non-Patent Document 20

Non-Patent Document 21

Summary of the Invention

[0009] The present disclosure generally relates to the expression of neurotrophic factors in the eye using adeno-associated virus (AAV) vectors. For example, the present disclosure provides vectors for expressing nerve growth factor (NGF) or glial derived neurotrophic factor (GDNF), and their medical uses.

[0010] In one aspect, the disclosure provides a method of treating an ocular disease in a subject in need thereof, comprising administering a rAAV virion to the eye of the subject or to the lacrimal gland of the eye of the subject, the rAAV virion comprising an expression cassette comprising an AAV capsid and a polynucleotide encoding a neurotrophic factor operably linked to a promoter. In some embodiments, the rAAV virion is administered to at least one eye and / or lacrimal gland of the subject to transduce cells of at least one eye and / or lacrimal gland of the subject. The transduced cells in the at least one eye and / or lacrimal gland express the neurotrophic factor. The neurotrophic factor expressed by the transduced cells of the at least one eye and / or lacrimal gland expresses the neurotrophic factor in the tear film and / or ocular surface of the subject. The expressed neurotrophic factor can be, for example, human nerve growth factor (NGF) protein or glial derived neurotrophic factor (GDNF) protein. Expression of the gene product results in a reduction of symptoms associated with the ocular disease of the subject.

[0011] In some embodiments, the disclosure provides a method of treating an ocular disease in a subject in need thereof, comprising administering a recombinant adeno-associated virus (rAAV) virion, wherein the rAAV virion comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter, wherein the rAAV virion is administered to at least one eye of the subject or at least one lacrimal gland of the eye of the subject, thereby treating the ocular disease in a subject in need thereof.

[0012] In some embodiments, the rAAV virion is administered to at least one lacrimal gland of the subject. In some embodiments, the lacrimal gland is the main lacrimal gland. In some embodiments, the at least one lacrimal gland is either the main lacrimal gland or a Wolfring's gland or a Clauss' gland of the subject. In some embodiments, cells in the at least one lacrimal gland are transduced with rAAV virions. In some embodiments, the transduced cells in the at least one lacrimal gland express a therapeutically effective amount of a neurotrophic factor in the tear film and optionally the ocular surface of the subject. In some embodiments, the transduced cells in the at least one lacrimal gland express an effective amount of a neurotrophic factor in the tear film and optionally the ocular surface of the subject.

[0013] In some embodiments, the neurotrophic factor is a nerve growth factor (NGF) protein. In some embodiments, the polynucleotide encoding the NGF protein comprises a sequence that shares at least 95% identity with (SEQ ID NO:2). In some embodiments, the NGF protein comprises a sequence that shares at least 95% identity with (SEQ ID NO:1). In some embodiments, the NGF protein comprises SEQ ID NO:1. In some embodiments, the polynucleotide encoding the NGF protein comprises SEQ ID NO:2.

[0014] In some embodiments, the neurotrophic factor is a glial derived neurotrophic factor (GDNF) protein. In some embodiments, the polynucleotide encoding the GDNF protein comprises a sequence that shares at least 95% identity with (SEQ ID NO:4). In some embodiments, the GDNF protein comprises a sequence that shares at least 95% identity with (SEQ ID NO:3). In some embodiments, the GDNF protein comprises SEQ ID NO:3. In some embodiments, the polynucleotide encoding the GDNF protein comprises SEQ ID NO:4.

[0015] In some embodiments, the AAV capsid comprises a capsid that shares at least 95%, 98%, or 100% identity with the capsid of AAV2 VP1, AAV2 VP3, AAV5, AAV8, or AAV9.

[0016] In some embodiments, the promoter is the CMV enhancer, chicken beta-actin (CAG) promoter (SEQ ID NO:5).

[0017] In some embodiments, the ocular disease is chemical burns of the ocular surface, corneal wounds, persistent epithelial defects, dry eye disease, neurotrophic keratitis, herpes simplex virus infections of the trigeminal nerve and / or eye, varicella zoster virus infections of the trigeminal nerve and / or eye, and diabetic complications of the corneal nerve.

[0018] In some embodiments, the ocular disease is chemical burns of the ocular surface, corneal wounds, corneal ulcers, persistent epithelial defects, dry eye disease, neurotrophic keratitis, herpes simplex virus infections of the trigeminal nerve and / or eye, varicella zoster virus infections of the trigeminal nerve and / or eye, and diabetic complications of the corneal nerve.

[0019] In some embodiments, the eye disease is characterized by clinical signs defined based on the Mackie classification.

[0020] In some embodiments, one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease before administration of the rAAV virion. In some embodiments, one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease in an untreated control subject. In some embodiments, one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease in the contralateral eye.

[0021] In another aspect, the present disclosure provides a method for the production of a nucleic acid sequence that is operably linked to an AAV capsid and promoter. A rAAV virion is provided that contains an expression cassette that includes a polynucleotide encoding a transtrophic factor.

[0022] In some embodiments, the neurotrophic factor is a nerve growth factor (NGF) protein. In some embodiments, the polynucleotide encoding the NGF protein comprises a sequence that shares at least 95% identity with (SEQ ID NO:2). In some embodiments, the NGF protein comprises a sequence that shares at least 95% identity with (SEQ ID NO:1). In some embodiments, the NGF protein comprises SEQ ID NO:1. In some embodiments, the polynucleotide encoding the NGF protein comprises SEQ ID NO:2.

[0023] In some embodiments, the neurotrophic factor is a glial derived neurotrophic factor (GDNF) protein. In some embodiments, the polynucleotide encoding the GDNF protein comprises a sequence that shares at least 95% identity with (SEQ ID NO: 4). In some embodiments, the GDNF protein comprises a sequence that shares at least 95% identity with (SEQ ID NO: 3). In some embodiments, the GDNF protein comprises SEQ ID NO: 3. In some embodiments, the polynucleotide encoding the GDNF protein comprises SEQ ID NO: 4.

[0024] In some embodiments, the AAV capsid comprises a capsid that shares at least 95%, 98%, or 100% identity with the capsid of AAV2 VP1, AAV2 VP3, AAV5, AAV8, or AAV9.

[0025] In some embodiments, the promoter is a CAG promoter (SEQ ID NO:5).

[0026] In one aspect, the disclosure relates to a pharmaceutical composition comprising a rAAV virion disclosed herein and a pharma- ceutical acceptable carrier. In some embodiments, the pharmaceutical composition comprises about 1 x 10 virions per milliliter of rAAV virions. 9 ~Approx. 1×10 14 In some embodiments, the pharmaceutical composition comprises about 1 x 10 genome copies per milliliter of rAAV virions. 7 ~Approx. 1×10 14In some embodiments, the pharmaceutical composition comprises about 1 x 10 genome copies per milliliter of rAAV virions. 12 ~Approx. 6.2×10 12 Contains a genome copy.

[0027] In one aspect, the present disclosure relates to a method of treating an ocular disease in a subject in need thereof, the method comprising administering a therapeutically effective amount of a pharmaceutical composition disclosed herein to the eye of the subject or to an ocular gland of the subject.In one aspect, the present disclosure relates to a method of treating an ocular disease in a subject in need thereof, the method comprising administering an effective amount of a pharmaceutical composition disclosed herein to the eye of the subject or to an ocular gland of the subject.

[0028] In some embodiments, rAAV virions are administered to at least one eye and / or lacrimal gland of a subject. In some embodiments, cells in at least one eye and / or lacrimal gland are transduced with the rAAV virion. In some embodiments, the transduced cells in at least one eye and / or lacrimal gland express a therapeutically effective amount of a neurotrophic factor in the tear film and optionally the ocular surface of the subject's ocular gland. In some embodiments, the transduced cells in at least one eye and / or lacrimal gland express an effective amount of a neurotrophic factor in the tear film and optionally the ocular surface of the subject's ocular gland.

[0029] In some embodiments, rAAV virions can be administered repeatedly to at least one eye and / or lacrimal gland of a subject to ensure that the gland secretes an adequate amount of the target (protein, peptide, enzyme, etc.) into the tear film. In some embodiments, cells within at least one eye and / or lacrimal gland are transduced with rAAV virions. In embodiments, the transduced cells in at least one eye and / or lacrimal gland express a therapeutically effective amount of a neurotrophic factor in the tear film and optionally the ocular surface of a subject. In some embodiments, the transduced cells in at least one eye and / or lacrimal gland express an effective amount of a neurotrophic factor in the tear film and optionally the ocular surface of a subject.

[0030] In some embodiments, the ocular disease is neurotrophic keratitis. In some embodiments, one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease before administration of the rAAV virion. In some embodiments, one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease in an untreated control subject. In some embodiments, one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease in the contralateral eye.

[0031] Further provided are the rAAV virions and pharmaceutical compositions described herein for use in the preparation of a medicament for the treatment of an ocular disease.

[0032] In some aspects, the disclosure provides a method of treating an ocular disease in a subject in need thereof, comprising administering to at least one eye of the subject or to at least one lacrimal gland of the subject's eye a recombinant adeno-associated virus (rAAV) virion, wherein the rAAV virion comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter.

[0033] In embodiments described herein, the rAAV virion is administered to the lacrimal gland of a subject. In some embodiments, the lacrimal gland is either the main lacrimal gland or one of the Wolfring's glands or the Claus' glands of a subject. In some embodiments, the lacrimal gland is the main lacrimal gland.

[0034] In embodiments described herein, cells in the lacrimal gland are transduced with rAAV virions. In some embodiments, the transduced cells in the lacrimal gland express an effective amount of a neurotrophic factor in the tear film and optionally the ocular surface of the subject. In some embodiments, the neurotrophic factor is a nerve growth factor (NGF) protein. In some embodiments, the polynucleotide encoding the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:2. In some embodiments, the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:1. In some embodiments, the NGF protein comprises SEQ ID NO:1. In some embodiments, the polynucleotide encoding the NGF protein comprises SEQ ID NO:2.

[0035] In embodiments described herein, the neurotrophic factor is a glial derived neurotrophic factor (GDNF) protein. In some embodiments, the polynucleotide encoding the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:4. In some embodiments, the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:3. In some embodiments, the GDNF protein comprises SEQ ID NO:3. In some embodiments, the polynucleotide encoding the GDNF protein comprises SEQ ID NO:4.

[0036] In embodiments described herein, the AAV capsid shares at least 95%, 98%, or 100% identity with AAV2 VP1 (SEQ ID NO:6), AAV2 VP3 (SEQ ID NO:8), AAV5 (SEQ ID NO:10), AAV8 (SEQ ID NO:12), or AAV9 (SEQ ID NO:14).

[0037] In the embodiment described herein, the promoter is a CAG promoter (SEQ ID NO:5).

[0038] In embodiments described herein, the ocular disease is a chemical burn of the ocular surface, a corneal wound, a corneal ulcer, a persistent epithelial defect, dry eye disease, neurotrophic keratitis, a herpes simplex virus infection of the trigeminal nerve and / or eye, a varicella zoster virus infection of the trigeminal nerve and / or eye, or a diabetic complication of the corneal nerve.

[0039] In the embodiments described herein, one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease before administration of the rAAV virion. In some embodiments, one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease in an untreated control subject. In some embodiments, one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease in the contralateral eye.

[0040] In some embodiments, the disclosure provides a recombinant adeno-associated virus (rAAV) virion comprising an AAV capsid and an expression cassette, the expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter.

[0041] In embodiments described herein, the neurotrophic factor is a nerve growth factor (NGF) protein. In some embodiments, the polynucleotide encoding the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:2 or SEQ ID NO:17. In some embodiments, the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:1. In some embodiments, the NGF protein comprises SEQ ID NO:1. In some embodiments, the polynucleotide encoding the NGF protein is SEQ ID NO:2 or SEQ ID NO:17.

[0042] In embodiments described herein, the neurotrophic factor is a glial derived neurotrophic factor (GDNF) protein. In some embodiments, the polynucleotide encoding the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:4 or SEQ ID NO:18. In some embodiments, the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:3. In some embodiments, the GDNF protein comprises SEQ ID NO:3. In some embodiments, the polynucleotide encoding the GDNF protein is SEQ ID NO:4 or SEQ ID NO:18.

[0043] In embodiments described herein, the AAV capsid comprises a VP3 that shares at least 95%, 98%, or 100% identity with AAV2 VP1 (SEQ ID NO:6), AAV2 VP3 (SEQ ID NO:8), AAV5 (SEQ ID NO:10), AAV8 (SEQ ID NO:12), or AAV9 (SEQ ID NO:14).

[0044] In embodiments described herein, the promoter is a CAG promoter (SEQ ID NO:5) or a CMV promoter (SEQ ID NO:16).

[0045] In embodiments described herein, the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:23.

[0046] In embodiments described herein, the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:24.

[0047] In embodiments described herein, the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:25. .

[0048] In some embodiments, the disclosure provides a recombinant adeno-associated virus (rAAV) virion comprising an expression cassette comprising a polynucleotide of SEQ ID NO:25.

[0049] In the embodiments described herein, the rAAV comprises an AAV capsid.

[0050] In embodiments described herein, the AAV capsid shares at least 95%, 98%, or 100% identity with AAV2 VP1 (SEQ ID NO:6), AAV2 VP3 (SEQ ID NO:8), AAV5 (SEQ ID NO:10), AAV8 (SEQ ID NO:12), or AAV9 (SEQ ID NO:14).

[0051] In some embodiments, the disclosure provides a composition comprising a rAAV virion, the rAAV virion comprising: (a) AAV capsid, and (b) an expression cassette, wherein the expression cassette comprises a polynucleotide that shares at least 95% identity with SEQ ID NO:2 or SEQ ID NO:17, wherein the polynucleotide is linked to a promoter; A composition is provided.

[0052] In some embodiments, the disclosure provides a composition comprising a rAAV virion, the rAAV virion comprising: (a) AAV capsid, and (b) an expression cassette, wherein the expression cassette comprises a polynucleotide that shares at least 95% identity with SEQ ID NO:4 or SEQ ID NO:18, wherein the polynucleotide is linked to a promoter; A composition is provided.

[0053] In some embodiments, the disclosure provides a composition comprising a rAAV virion, the rAAV virion comprising: (a) an AAV2, AAV5, AAV8, or AAV9 capsid, and (b) an expression cassette, wherein the expression cassette comprises a polynucleotide that shares at least 95% identity with SEQ ID NO:2 or SEQ ID NO:17, wherein the polynucleotide is linked to a promoter; A composition is provided.

[0054] In some embodiments, the disclosure provides a composition comprising a rAAV virion, the rAAV virion comprising: (a) an AAV2, AAV5, AAV8, or AAV9 capsid, and (b) an expression cassette, wherein the expression cassette comprises a polynucleotide that shares at least 95% identity with SEQ ID NO:4 or SEQ ID NO:18, wherein the polynucleotide is linked to a promoter. A composition is provided.

[0055] In embodiments described herein, the AAV capsid shares at least 95%, 98%, or 100% identity with AAV2 VP1 (SEQ ID NO:6), AAV2 VP3 (SEQ ID NO:8), AAV5 (SEQ ID NO:10), AAV8 (SEQ ID NO:12), or AAV9 (SEQ ID NO:14). In some embodiments, the AAV capsid is AAV2. In some embodiments, the AAV capsid is AAV5. In some embodiments, the AAV capsid is AAV9.

[0056] In some embodiments, the disclosure provides a composition comprising a rAAV virion, the rAAV virion comprising: (a) AAV2 capsid, and (b) an expression cassette, wherein the expression cassette comprises a polynucleotide that shares at least 95% identity with SEQ ID NO: 25; A composition is provided.

[0057] In some embodiments, the disclosure provides a composition comprising a rAAV virion, the rAAV virion comprising: (a) AAV5 capsid, and (b) an expression cassette, wherein the expression cassette comprises a polynucleotide that shares at least 95% identity with SEQ ID NO: 25; A composition is provided.

[0058] In some embodiments, the disclosure provides a composition comprising a rAAV virion, the rAAV virion comprising: (a) AAV9 capsid, and (b) an expression cassette, wherein the expression cassette comprises a polynucleotide that shares at least 95% identity with SEQ ID NO: 25; A composition is provided.

[0059] In some embodiments, the disclosure provides a pharmaceutical composition comprising a rAAV virion or composition described herein and a pharma- ceutically acceptable carrier.

[0060] In the embodiments described herein, the compositions comprise about 1×10 virions per milliliter of rAAV virions. 7 ~Approx. 1×10 14 Contains a genome copy.

[0061] In the embodiments described herein, the compositions comprise about 1×10 virions per milliliter of rAAV virions. 12 ~Approx. 6.2×10 12 Contains a genome copy.

[0062] In embodiments described herein, the compositions are formulated for administration to the lacrimal gland. In some embodiments, the compositions are formulated for administration to the ocular surface.

[0063] In the embodiments described herein, the compositions are formulated for use, or are suitable for use, in the treatment of an ophthalmic disease, disorder, or condition.

[0064] In some embodiments, the present disclosure provides a method of treating an ocular disease in a subject in need thereof, comprising administering an effective amount of a pharmaceutical composition described herein to the eye of the subject or to an ocular gland of the subject.

[0065] In embodiments described herein, rAAV virions are administered to the lacrimal gland of a subject. In some embodiments, cells within the lacrimal gland are transduced with the rAAV virions. In some embodiments, the transduced cells within the lacrimal gland express an effective amount of a neurotrophic factor in the tear film and optionally the ocular surface of the subject.

[0066] In embodiments described herein, the eye disease is neurotrophic keratitis.

[0067] In the embodiments described herein, one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease prior to administration of the rAAV virion. The symptoms are alleviated as compared to symptoms of the ocular disease in an untreated control subject.

[0068] In the embodiments described herein, one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease in the contralateral eye.

[0069] In some embodiments, the disclosure provides for use of the rAAV virion, composition, or pharmaceutical composition of any one of the preceding or related aspects for use in a method of any one of the preceding or related aspects.

[0070] In some embodiments, the disclosure provides for the use of a rAAV or composition of any of the preceding or related aspects in the manufacture of a medicament for use in a method of any one of the preceding or related aspects.

[0071] In some embodiments, the disclosure provides a kit comprising the rAAV virion, composition, or pharmaceutical composition of any of the preceding or related aspects and instructions for use in a method of any one of the preceding or related aspects.

[0072] In some embodiments, the disclosure provides a recombinant adeno-associated virus (rAAV) virion for use in a method of treating an ocular disease in a subject in need thereof, the method comprising administering the recombinant adeno-associated virus (rAAV) virion to at least one eye of the subject or to at least one lacrimal gland of the eye of the subject, the rAAV virion comprising an AAV capsid and an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter.

[0073] In the embodiments described herein, rAAV virions are administered to the lacrimal gland of a subject.

[0074] In the embodiments described herein, cells within the lacrimal gland are transduced with rAAV virions.

[0075] In embodiments described herein, the neurotrophic factor is a nerve growth factor (NGF) protein. In some embodiments, the neurotrophic factor is a glial derived neurotrophic factor (GDNF) protein.

[0076] In embodiments described herein, the ocular disease is a chemical burn of the ocular surface, a corneal wound, a persistent epithelial defect, dry eye disease, neurotrophic keratitis, a herpes simplex virus infection of the trigeminal nerve and / or eye, a varicella zoster virus infection of the trigeminal nerve and / or eye, or a diabetic complication of the corneal nerve. [Brief description of the drawings]

[0077] [Figure 1A] FIG. 1A shows an exemplary plasmid containing an rAAV expression cassette of the invention with inverted terminal repeats (ITRs), a CAG promoter, and a glial-derived neurotrophic factor (GDNF) transgene polynucleotide element. [Figure 1B] FIG. 1B shows an exemplary plasmid containing an rAAV expression cassette of the invention with an inverted terminal repeat (ITR), a CAG promoter, and a nerve growth factor (NGF) transgene polynucleotide element. [Figure 1C]FIG. 1C shows an exemplary plasmid containing an rAAV expression cassette of the invention with inverted terminal repeats (ITRs), a CAG promoter, and an enhanced green fluorescent protein (eGFP) transgene polynucleotide element. [Figure 2A] FIG. 2A shows an example of viral vector delivery to the lacrimal gland of a human subject. [Figure 2B] FIG. 2B shows an example of viral vector delivery to the lacrimal gland of a human subject. [Diagram 3] FIG. 3 shows an example of a visual analog scale used in eye dryness testing where subjects record the severity of their symptoms. [Figure 4] FIG. 4 is a grading diagram of corneal surface divisions based on the NEI / Industry Workshop scale. [Diagram 5] FIG. 5 shows the Mackie classification of neurotrophic keratitis. [Figure 6A] Figure 6A shows images of lacrimal gland tissue stained with anti-eGFP antibody. rAAV virions carrying an expression cassette with an eGFP transgene were administered to the lacrimal gland by intralacrimal injection. Lacrimal gland tissue was stained with anti-eGFP antibody to assess eGFP expression. The black arrows point to the staining indicating eGFP expression. [Figure 6B] Figure 6B shows images of lacrimal gland tissue stained with anti-eGFP antibody. rAAV virions carrying an expression cassette with an eGFP transgene were administered to the lacrimal gland by intralacrimal injection. Lacrimal gland tissue was stained with anti-eGFP antibody to assess eGFP expression. Black arrows point to the staining indicating eGFP expression. [Figure 6C] Figure 6C shows images of lacrimal gland tissue stained with anti-eGFP antibody. rAAV virions carrying an expression cassette with an eGFP transgene were administered to the lacrimal gland via intralacrimal injection. Lacrimal gland tissue was stained with anti-eGFP antibody to assess eGFP expression. The black arrows point to the staining indicating eGFP expression. [Figure 6D]Figure 6D shows images of lacrimal gland tissue stained with anti-eGFP antibody. rAAV virions carrying an expression cassette with an eGFP transgene were administered to the lacrimal gland via intralacrimal injection. Lacrimal gland tissue was stained with anti-eGFP antibody to assess eGFP expression. The black arrows point to the staining indicating eGFP expression. [Figure 6E] Figure 6E shows images of lacrimal gland tissue stained with anti-eGFP antibody. rAAV virions carrying an expression cassette with the eGFP transgene were administered to the lacrimal gland by intralacrimal injection. Lacrimal gland tissue was stained with anti-eGFP antibody to assess eGFP expression. The black arrows point to the staining indicating eGFP expression. [Figure 6F] Figure 6F shows images of lacrimal gland tissue stained with anti-eGFP antibody. rAAV virions carrying an expression cassette with an eGFP transgene were administered to the lacrimal gland via intralacrimal injection. Lacrimal gland tissue was stained with anti-eGFP antibody to assess eGFP expression. The black arrows point to the staining indicating eGFP expression. [Figure 6G] Figure 6G shows images of lacrimal gland tissue stained with anti-eGFP antibody. rAAV virions carrying an expression cassette with an eGFP transgene were administered to the lacrimal gland via intralacrimal injection. Lacrimal gland tissue was stained with anti-eGFP antibody to assess eGFP expression. The black arrows point to the staining indicating eGFP expression. [Figure 6H] Figure 6H shows images of lacrimal gland tissue stained with anti-eGFP antibody. rAAV virions carrying an expression cassette with an eGFP transgene were administered to the lacrimal gland via intralacrimal injection. Lacrimal gland tissue was stained with anti-eGFP antibody to assess eGFP expression. The black arrows point to the staining indicating eGFP expression. [Figure 6I] Figure 6I shows images of lacrimal gland tissue stained with anti-eGFP antibody. rAAV virions carrying an expression cassette with an eGFP transgene were administered to the lacrimal gland via intralacrimal injection. Lacrimal gland tissue was stained with anti-eGFP antibody to assess eGFP expression. The black arrows point to the staining indicating eGFP expression. [Figure 6J]Figure 6J shows images of lacrimal gland tissue stained with anti-eGFP antibody. rAAV virions carrying an expression cassette with an eGFP transgene were administered to the lacrimal gland via intralacrimal injection. Lacrimal gland tissue was stained with anti-eGFP antibody to assess eGFP expression. The black arrows point to the staining indicating eGFP expression. [Figure 6K] Figure 6K shows an image of lacrimal gland tissue stained with anti-eGFP antibody. rAAV virions carrying an expression cassette with an eGFP transgene were administered to the lacrimal gland by intralacrimal injection. Lacrimal gland tissue was stained with anti-eGFP antibody to assess eGFP expression. The black arrows point to the staining indicating eGFP expression. [Figure 7A] Figure 7A shows images of lacrimal gland tissue stained with anti-hNGF antibody. rAAV virions (AAV9 serotype) genetically engineered to deliver an expression cassette carrying the hNGF transgene were administered to the lacrimal gland via intralacrimal injection. Lacrimal gland tissue was stained with anti-hNGF antibody to assess hNGF expression. Black arrows point to staining indicating hNGF expression. [Figure 7B] Figure 7B shows images of lacrimal gland tissue stained with anti-hNGF antibody. rAAV virions (AAV9 serotype) genetically engineered to deliver an expression cassette carrying the hNGF transgene were administered to the lacrimal gland via intralacrimal injection. Lacrimal gland tissue was stained with anti-hNGF antibody to assess hNGF expression. Black arrows point to staining indicating hNGF expression. [Figure 7C] Figure 7C shows an image of lacrimal gland tissue stained with anti-hNGF antibody. rAAV virions (AAV9 serotype) genetically engineered to deliver an expression cassette carrying the hNGF transgene were administered to the lacrimal gland via intralacrimal injection. Lacrimal gland tissue was stained with anti-hNGF antibody to assess hNGF expression. Black arrows point to staining indicating hNGF expression. [Figure 7D] Figure 7D shows an image of lacrimal gland tissue stained with anti-hNGF antibody. rAAV virions (AAV9 serotype) genetically engineered to deliver an expression cassette carrying the hNGF transgene were administered to the lacrimal gland via intralacrimal injection. Lacrimal gland tissue was stained with anti-hNGF antibody to assess hNGF expression. Black arrows point to staining indicating hNGF expression. [Figure 7E]Figure 7E shows images of lacrimal gland tissue stained with anti-hNGF antibody. rAAV virions (AAV9 serotype) genetically engineered to deliver an expression cassette carrying the hNGF transgene were administered to the lacrimal gland via intralacrimal injection. Lacrimal gland tissue was stained with anti-hNGF antibody to assess hNGF expression. Black arrows point to staining indicating hNGF expression. [Figure 8] 8 is a plot showing the concentration of hNGF in the tear film of animals administered AAV.hNGF. Protein concentrations were measured using Schirmer test strips in tear film samples from Dutch-belted rabbits after intralacrimal administration of AAV2.hNGF, AAV5.hNGF, AAV9.hNGF, or control (no AAV injection) on the days indicated. [Figure 9] Figure 9 is a schematic showing the elements between the ITRs of the AAV plasmid. The plasmid encodes EGFP linked to an N-terminal secretion signal ("secEGFP") under the control of a CMV promoter. The Woodchuck Hepatitis Virus post-translational regulatory element (WPRE) serves to increase transgene expression and is adjacent to the bovine growth hormone polyadenylation (pA) signal. [Figure 10] Figure 10 shows images of porcine lacrimal glands injected with AAV-secEGFP (AAV2 or AAV9 serotypes), harvested on day 103, and fixed in paraffin. IHC was performed on 5 μM sections using anti-GFP antibody and DAPI (nuclear) counterstaining. Images were taken at 100x magnification using a confocal microscope. Negative control animals received no injection. [Figure 11] Figure 11 shows images of porcine lacrimal glands injected with AAV9-secEGFP, harvested on day 103, and fixed in paraffin. IHC was performed on 5 μM sections using anti-GFP antibody and DAPI (nuclear) counterstain. In addition to lacrimal acinar cells, ductile epithelial cells also appear to be transduced with AAV9 (white arrows). [Figure 12]Figure 12 shows images of porcine lacrimal glands injected with AAV, harvested and fixed in paraffin on day 103. No inflammatory infiltrates, macro- or micro-abnormalities are observed in H&E staining of 5 μM paraffin sections at 100×. [Figure 13A] Figure 13A is a plot showing the concentration of hNGFβ (pg / mL) in the tear film of pigs. Tears were collected from the left eyes of pigs (n=4) on days 7, 14, 21, 28, and 35 after transduction with an adeno-associated viral vector (AAV) encoding human nerve growth factor (AAV-hNGFβ). AAV2-hNGFβ had detectable levels of hNGFβ within the standard curve range of the MSD assay 7 days after transduction. [Figure 13B] Figure 13B is a plot showing the concentration (pg / mL) of hNGFβ in the tear film of pigs. Tears were collected from the left eyes of pigs (n=4) on days 7, 14, 21, 28, and 35 after transduction with an adeno-associated viral vector (AAV) encoding human nerve growth factor (AAV-hNGFβ). AAV5-hNGFβ had detectable levels of hNGFβ within the standard curve range of the MSD assay 7 days after transduction. [Figure 13C] Figure 13C is a plot showing the concentration of hNGFβ (pg / mL) in the tear film of pigs. Tears were collected from the left eyes of pigs (n=4) on days 7, 14, 21, 28, and 35 after transduction with an adeno-associated viral vector (AAV) encoding human nerve growth factor (AAV-hNGFβ). AAV9-hNGFβ had tear levels of hNGFβ that exceeded the upper limit of quantification of the MSD assay 7 days after transduction. [Figure 14] FIG. 14 shows an exemplary plasmid containing the rAAV expression cassette of SEQ ID NO:25 with inverted terminal repeats (ITRs), a CAG promoter, and a nerve growth factor (NGF) transgene polynucleotide element. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0078] overview The present disclosure provides a method of treating an ocular disease in a subject in need thereof. In healthy subjects, neurotrophic factors provide maintenance and repair to the cornea. Corneal epithelial cells release the soluble neurotrophic factors NGF and GDNF to the ocular surface, promoting corneal cell survival and healing through activation of TrkA and GFRα-1 receptors, respectively. NGF and GDNF are constitutively present in the tear film and are abundant during response to irritation or injury to the cornea.

[0079] As disclosed herein, AAV-based ocular transgene delivery provides a method for treating ocular disorders. rAAV virions have distinct advantages for transgene delivery. Transgenes delivered by rAAV virions are more likely to be integrated into the genome of transduced cells, allowing for long-term expression of the transgene product. In addition, rAAV virions are less immunogenic than other viral delivery vectors, such as adenovirus. AAV-based delivery vectors using subretinal and intravitreal injections to transduce cells in the posterior segment of the eye have been reported and have shown efficacy in vivo (Patent Document 1; Non-Patent Document 3; Non-Patent Document 4).

[0080] AAV serotypes used for AAV-based ocular transgene delivery include AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9 used to deliver transgenes (Non-Patent Document 5). AAV serotypes used for AAV-based lacrimal gland transgene delivery include AAV2, AAV4, AAV5, AAV5w8, AAV x5, AAV9, AAV12, and BAAV (Non-Patent Document 6).

[0081] Viral vector-based delivery of transgenes encoding protein products by injection into the lacrimal gland (i.e., intralacrimal delivery, intralacrimal injection, or intralacrimal administration) can be advantageous for treating ocular diseases and conditions. Proteins produced in the lacrimal gland and secreted into the subject's tears can be improved with post-translational modifications (PTMs) (covalent, generally enzymatic, protein modifications following protein biosynthesis), whereby proteins are synthesized by ribosomes translating mRNA into polypeptide chains and can then undergo PTM to form mature protein products. PTMs can confer important properties in cell signaling that are not normally present with local delivery of recombinant human proteins, often made in bacteria such as Escherichia coli. Additionally, when secreted with natural tear film components, which may include cofactors, chaperones, enzymes, or other proteins, administration via the tears can confer biologic activity not achievable with locally administered proteins alone.

[0082] In one aspect, rAAV virions are provided for expression of neurotrophic factors. In some embodiments, at least one cell of the eye and / or lacrimal gland is transduced with an rAAV virion of the present disclosure. The lacrimal gland is responsible for promoting a healthy ocular surface and maintaining normal visual function. It is the main source of tears. The main lacrimal gland includes the palpebral lobe and the orbital lobe, which are continuous with each other at the lateral edge of the aponeurosis of the levator palpebrae superioris. The lobules contain many acinar ducts and intralobular ducts, which form ducts that open into the fornix of the conjunctiva. The main lacrimal gland is composed of acinar cells, ductal cells, and / or myoepithelial cells (Non-Patent Document 7). The main lacrimal gland secretes the aqueous layer of the tear film onto the ocular surface of the subject's eye. As used herein, the term "lacrimal gland" refers to the main lacrimal gland of a subject as well as the Wolfring's gland and the gland of Claus. The accessory glands, known as the Wolfring's gland and the gland of Claus, are located in the eyelid. The upper eyelid contains about 2-5 Wolfring's glands and about 40 Claus's glands. The lower eyelid contains about 6-8 Claus's glands. The specific location and anatomical structure of the lacrimal functional unit are well known (Non-Patent Document 8).

[0083] Expression cassette The rAAV virion of the present disclosure can include an expression cassette. As used herein, the term "expression cassette" refers to a polynucleotide that includes at least one polynucleotide sequence encoding a protein or transgene of interest, such as a neurotrophic factor, flanked by inverted terminal repeats. The expression cassette can further include other polynucleotide sequences, such as a promoter, regulatory elements (e.g., one or more promoters or enhancers), translation initiation sequences, coding sequences, and termination sequences (Figures 1A-1C and Figure 14). The regulatory elements can be operably linked to the transgene to facilitate expression.

[0084] In some embodiments, the expression cassette of the present disclosure comprises a polynucleotide sequence encoding a neurotrophic factor. In some embodiments, the expression cassette results in increased expression of the neurotrophic factor in at least one eye and / or lacrimal gland. In some embodiments, the expression of the neurotrophic factor may be increased by 5%, 10%, 15%, 20%, or 25% compared to the expression of the neurotrophic factor in an untreated subject or in the contralateral eye of a treated subject. As used herein, "subject" refers to any mammal, including, for example, mice, rabbits, pigs, dogs, non-human primates (NHPs), and humans. In some embodiments, the subject is a human or NHP. Additionally, "individual" or "patient" can be used interchangeably with "subject." In some embodiments, the expression of the neurotrophic factor may be increased by 1-fold, 2-fold, 3-fold, 4-fold, or 5-fold compared to the expression of the neurotrophic factor in an untreated subject or in the contralateral eye of a treated subject. In some embodiments, expression of the neurotrophic factor may be increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% compared to expression of the neurotrophic factor in the contralateral eye of an untreated or treated subject. In some embodiments, expression of the neurotrophic factor may be increased by 1-fold, 2-fold, 3-fold, 4-fold, or 5-fold, 6-fold, 7-fold, 8-fold, or 9-fold compared to expression of the neurotrophic factor in the contralateral eye of an untreated or treated subject. In some embodiments, the neurotrophic factor may be expressed at any detectable level in the treated eye, whereas the neurotrophic factor may not be expressed or may be expressed at an undetectable level in the contralateral eye of an untreated or treated subject. In other words, an eye or lacrimal gland into which rAAV virions are administered may express greater amounts of the neurotrophic factor compared to an eye or lacrimal gland that has only endogenous (i.e., native) neurotrophic factor expression or an eye that has low or impaired secretion of endogenous (i.e., native) neurotrophic factor expression.

[0085] In some embodiments, the neurotrophic factor is a nerve growth factor (NGF) protein or a functional variant thereof. As used herein, "NGF", "NGFβ", or "nerve growth factor beta" refers to nerve growth factor, a gene that encodes a protein that homodimerizes to exert nerve growth stimulating activity. NGF is also involved in the regulation and differentiation of neurons. As used herein, "NGF protein" refers to The term "functional variant" refers to an NGF protein derived from any species. The term "functional variant" refers to a variant having sequence substitutions, insertions, deletions, and / or N- or C-terminal truncations, where the functional variant retains one or more functions of the reference protein, e.g., the native NGF protein. NGF is a 26 kDa polypeptide that is primarily involved in the growth, maintenance, proliferation, and survival of nerve cells. In the cornea, NGF binds to its receptor trkA NGFR and p75 NTRand induces signaling pathways related to healing of both the cornea and the conjunctiva (Non-Patent Document 9). In some embodiments, the NGF protein comprises SEQ ID NO:1. In some embodiments, the NGF protein comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:1. In some embodiments, the NGF protein shares a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:1. In some embodiments, the polynucleotide encoding the NGF protein comprises SEQ ID NO:2. In some embodiments, the polynucleotide encoding the NGF protein comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:2. In some embodiments, the polynucleotide encoding the NGF protein is encoded by a sequence that shares at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with SEQ ID NO:2. In some embodiments, the polynucleotide encoding the NGF protein is codon optimized. In some embodiments, the polynucleotide encoding the NGF protein comprises SEQ ID NO:17. In some embodiments, the polynucleotide encoding the NGF protein comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:17. In some embodiments, the polynucleotide encoding the NGF protein is encoded by a sequence that shares at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:17.

[0086] >Codon-optimized NGF (SEQ ID NO:17)

[0087] In some embodiments, the NGF protein is a human NGF protein.

[0088] In some embodiments, the neurotrophic factor is a glial-derived neurotrophic factor (GDNF) protein. As used herein, the term "GDNF protein" refers to a GDNF protein derived from any species. The term "functional variant" refers to a variant having sequence substitutions, insertions, deletions, and / or N- or C-terminal truncations, where the functional variant retains one or more functions of the reference protein, e.g., the native GDNF protein. GDNF is a 21 kDa protein that aids in the growth, maintenance, and differentiation of a wide variety of nervous systems through GDNF acting on its receptor GFRα-1. (Non-Patent Document 10). In some embodiments, the GDNF protein comprises SEQ ID NO:3. In some embodiments, the GDNF protein comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:3. In some embodiments, the GDNF protein shares a sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:3. In some embodiments, the polynucleotide encoding the GDNF protein comprises SEQ ID NO:4. In some embodiments, the polynucleotide encoding the GDNF protein comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:4. In some embodiments, the GDNF protein is encoded by a sequence that shares at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO:4. In some embodiments, the polynucleotide encoding the GDNF protein comprises SEQ ID NO:18. In some embodiments, the polynucleotide encoding the GDNF protein comprises at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18. In some embodiments, the polynucleotide encoding the GDNF protein is codon optimized. In some embodiments, the polynucleotide encoding the GDNF protein is encoded by a sequence that shares at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO:18.

[0089] >Codon-optimized GDNF atgaactgtgggacgttgtggccgtgtgcctggtcctcctgcacaccgcctccgcctttccactgcctgctggaaagcggcctcctgaggcccctgctgaagatagaagcctgggcagaagaagagcccccttcgccctgagctctgatagcaacatgcctgaggactaccccgaccagttcgacgacgtgatggactttatccaggccaccatcaagagactgaaacggagccctgacaagcagatggccgtgctgcctagacgggaaagaaatagacaggccgcagctgccaaccccgagaacagcagaggcaaaggccggagaggccagaggggaaaaaacagaggatgtgtgctgaccgccatccatctgaacgtgacagatctgggcctgggctatgagaccaaggaagagctgatcttcagatactgcagcggcagctgcgacgccgccgagacaacctacgacaagatcctgaagaacctgtcccggaatcggcggctggtgtctgacaaggtgggccaagcttgctgcagaccaattgccttcgacgatgatctgtctttcctggatgacaacctggtgtaccacatcctgagaaagcacagcgccaagcgctgcggctgtatctag(seq Sequence number 18)

[0090] In some embodiments, GDNF is human GDNF.

[0091]

Table 1

[0092] In some embodiments, the expression cassette of the present disclosure comprises a promoter. As used herein, the term "promoter" refers to a DNA sequence that directs the binding of RNA polymerase, thereby facilitating RNA synthesis, i.e., a minimal sequence sufficient to direct transcription. The promoter can be operably linked to a transgene, e.g., a neurotrophic factor. Transcription of a transgene can be initiated and regulated by the promoter to which it is operably linked. For example, an expression cassette that includes a promoter operably linked to a transgene will express the transgene when RNA synthesis is initiated at the promoter. Expression of the promoter and the corresponding protein or polypeptide is ubiquitous. Promoters may be "constitutive", i.e., strongly active in a wide range of cells, tissues and species, or may be cell type-, tissue- or species-specific. Promoters may be "constitutive", i.e., always active, or "inducible", i.e., can be activated or inactivated by the presence or absence of a biotic or abiotic factor. The nucleic acid construct or vector of the invention may also include enhancer sequences, which may or may not be contiguous with the promoter sequence. Enhancer sequences affect promoter-dependent gene expression and may be located in the 5' or 3' region of the native gene.

[0093] Any suitable promoter region or promoter sequence therein can be used in the polynucleotide cassette of interest, so long as the promoter region promotes expression of a polynucleotide sequence encoding an NGF or GNDF protein in at least one eye and / or lacrimal gland. In some embodiments, the promoter promotes expression of a gene in a mammalian eye and / or lacrimal gland. In some embodiments, the expression cassette comprises a cell type specific promoter. The promoter can specifically promote transcription in cells of the eye and / or cells of the lacrimal gland.

[0094] In some embodiments, the promoter is a CAG promoter. In some embodiments, the promoter comprises SEQ ID NO:5. In some embodiments, the promoter comprises a sequence at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:5. In some embodiments, the promoter shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the CAG promoter sequence (SEQ ID NO:5).

[0095] >CAG promoter (SEQ ID NO:5)

[0096] In some embodiments, the promoter is a CMV promoter. In some embodiments, the promoter comprises SEQ ID NO: 16. In some embodiments, the promoter comprises a sequence that is at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 16. In some embodiments, the promoter shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the CMV promoter sequence (SEQ ID NO: 16).

[0097] >CMV promoter (SEQ ID NO:16)

[0098] In some embodiments, the expression cassette comprises a nucleotide sequence operably linked to a polyadenylation sequence. Suitable polyadenylation sequences include the bovine growth hormone polyA signal (bGH polyA) and the short polyA signal. In some embodiments, the polyadenylation sequence comprises SEQ ID NO: 21. Optionally, the rAAV vector of the present disclosure comprises a woodchuck post-transcriptional regulatory element (WPRE). In some embodiments, the rAAV vector comprises a WPRE comprising SEQ ID NO: 22.

[0099] >bGH polyA sequence cgactgtgccttctagttgccagccatctgttgtttgccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgca ttgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgg (SEQ ID NO: 21)

[0100] >WPRE sequence tcctgttaatcaacctctggattacaaaatttgtgaaagattgactgatattcttaactatgttgctccttttacgctgtgtggatatgctgctttaatgcctc tgtatcatgctattgcttcccgtacggctttcgtttctctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtccgtcaacgtg gcgtggtgtgctctgtgtttgctgacgcaacccccactggctggggcattgccaccacctgtcaactcctttctgggactttcgctttccccctccctatcgcca cggcagaactcatcgccgcctgccttgcccgctgctggacaggggctaggttgctgggcactgataattccgtggtgttgtcggggaagctgacgtc (SEQ ID NO: 22)

[0101] In some embodiments, the expression cassette comprises SEQ ID NO: 23. In some embodiments, the expression cassette comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 23. In some embodiments, the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 23.

[0102] >An expression cassette containing a sequence encoding GDNF

[0103] In some embodiments, the expression cassette comprises SEQ ID NO: 24. In some embodiments, the expression cassette comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 24. In some embodiments, the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 24.

[0104] >An expression cassette containing the sequence encoding NGF

[0105] In some embodiments, the rAAV virion comprises the nucleotide sequence of SEQ ID NO: 25. In some embodiments, the rAAV virion comprises the expression cassette depicted in the plasmid of Figure 14. In some embodiments, the expression cassette comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 25. In some embodiments, the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 25.

[0106] [Table 2]

[0107] [Table 3]

[0108] [Table 4]

[0109] Recombinant AAV virions In some aspects of the invention, the subject expression cassettes are used to deliver a neurotrophic factor to at least one eye and / or lacrimal gland of a subject, e.g., to treat an ocular disorder. Thus, in some embodiments of the invention, a composition that provides expression of a neurotrophic factor in at least one eye and / or lacrimal gland of a subject is a gene delivery vector, which gene delivery vector comprises a polynucleotide cassette of the present disclosure.

[0110] In some embodiments, the gene delivery vector is a rAAV virion. In such embodiments, the expression cassette of interest comprises an AAV inverted terminal repeat sequence. In some embodiments, the expression cassette is flanked at the 5' and 3' ends by functional AAV inverted terminal repeat (ITR) sequences. By "functional AAV ITR sequence" is meant that the ITR sequence functions as intended for the rescue, replication and packaging of AAV virions. Thus, the AAV ITRs for use in the gene delivery vectors of the present disclosure need not have a wild-type nucleotide sequence, but may be modified by nucleotide insertion, deletion or substitution, or the AAV ITRs may be derived from any of several AAV serotypes, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10. In some embodiments, the AAV ITRs are derived from AAV1. In some embodiments, the AAV ITRs are derived from AAV2. In some embodiments, the AAV ITRs are derived from AAV3. In some embodiments, the AAV ITRs are derived from AAV4. In some embodiments, the AAV ITRs are derived from AAV5. In some embodiments, the AAV ITRs are derived from AAV6. In some embodiments, the AAV ITRs are derived from AAV7. In some embodiments, the AAV ITRs are derived from AAV9. In some embodiments, the AAV ITRs are derived from AAV1. In some embodiments, the AAV ITRs are derived from AAV10. Certain rAAV virions lack all or a portion of the wild-type REP and CAP genes but retain functional flanking ITR sequences. In some embodiments, the 5'ITR comprises SEQ ID NO:19. In some embodiments, the 5'ITR is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:19. In some embodiments, the 5'ITR shares a sequence with at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:19.

[0111] Exemplary 5'ITR Sequences gcgcgctcgctcgctcactgaggccgcccggggcaaagcccggggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttccttgtagttaatgattaac(SEQ ID NO: 19 )

[0112] In some embodiments, the 5' ITR comprises SEQ ID NO: 20. In some embodiments, the 5' ITR comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 20. In some embodiments, the 5' ITR shares a sequence with at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 20.

[0113] Exemplary 3'ITR Sequences gttaatcattaactacaaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgc (SEQ ID NO: 20 )

[0114] In such embodiments, the rAAV virion comprises an AAV capsid derived from an adeno-associated virus serotype known in the art or discovered in the future, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, etc. For example, the AAV capsid can be a wild-type (or "native") capsid. In some embodiments, the rAAV virion comprises an AAV capsid derived from AAV1. In some embodiments, the rAAV virion comprises an AAV capsid derived from AAV2. In some embodiments, the rAAV virion comprises an AAV capsid derived from AAV3. In some embodiments, the rAAV virion comprises an AAV capsid derived from AAV4. In some embodiments, the rAAV virion comprises an AAV capsid derived from AAV5. In some embodiments, the rAAV virion comprises an AAV capsid derived from AAV6. In some embodiments, the rAAV virion comprises an AAV capsid from AAV7. In some embodiments, the rAAV virion comprises an AAV capsid from AAV8. In some embodiments, the rAAV virion comprises an AAV capsid from AAV9. In some embodiments, the rAAV virion comprises an AAV capsid from AAV10. AAV capsids of particular interest include AAV2, AAV5, AAV8, and AAV9 (Table 3).

[0115] However, like the ITRs, the capsid need not have a wild-type nucleotide sequence, but rather can be altered by insertion, deletion, or substitution of nucleotides in the VP1, VP2, or VP3 sequences, so long as the capsid is capable of transducing cells of the eye and / or lacrimal gland. In other words, the AAV capsid can be a variant AAV capsid. In some embodiments, the rAAV virion is a "pseudotyped" AAV made by using the capsid (cap) gene of one AAV and the rep gene and ITRs of a different AAV, such as a pseudotyped AAV2 made by using the rep of AAV2 and the cap of AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 together with a plasmid containing an AAV2-based vector. For example, the rAAV virion can be rAAV2 / 1, rAAV2 / 3, rAAV2 / 4, rAAV2 / 5, rAAV2 / 6, rAAV2 / 7, rAAV2 / 8, rAAV2 / 9, etc. In some embodiments, the rAAV is rAAV2 / 1. In some embodiments, the rAAV is rAAV2 / 3. In some embodiments, the rAAV is In some embodiments, the rAAV is rAAV2 / 4. In some embodiments, the rAAV is rAAV2 / 5. In some embodiments, the rAAV is rAAV2 / 6. In some embodiments, the rAAV is rAAV2 / 7. In some embodiments, the rAAV is rAAV2 / 8. In some embodiments, the rAAV is rAAV2 / 9.

[0116] In some embodiments, rAAV is replication-deficient in that the rAAV virion cannot independently further replicate and package its genome. For example, when the eye and / or lacrimal gland are transduced with rAAV virion, genes are expressed in the transduced eye and / or lacrimal gland, but the rAAV cannot replicate due to the fact that the transduced eye and / or lacrimal gland lacks the AAV rep and cap genes and accessory function genes.

[0117] The rAAV virions of the present disclosure encapsulating the expression cassettes described in the present invention can be produced using helper-free production. rAAV is a replication-defective virus and typically requires components from a live helper virus, such as adenovirus, in the host cell to package infectious rAAV virions. The rAAV helper-free production system allows for the production of infectious rAAV virions without the use of a live helper virus. In the helper-free system, the host packaging cell line is transfected with three plasmids. The first plasmid contains the adenovirus gene products (i.e., E2A, E4, and VA RNA genes) required for packaging of rAAV virions. The second plasmid contains the required AAV genes (i.e., REP and CAP genes). The third plasmid contains a polynucleotide sequence encoding a protein of interest and a promoter flanked by ITRs. The host packaging cell line can be, for example, an AAV-293 host cell. Suitable host cells contain additional components necessary for packaging infectious rAAV virions that are not provided by the plasmid. In some embodiments, the CAP gene can code for, for example, the AAV capsid protein described herein. In some embodiments, the promoter is a promoter sequence described herein. In some embodiments, the promoter sequence is a CAG sequence. In some embodiments, the protein of interest is a neurotrophic factor. In some embodiments, the neurotrophic factor is NGF. In some embodiments, the neurotrophic factor is GDNF.

[0118] AAV serotypes that have been shown to infect the eye and / or lacrimal gland include AAV2, AAV5, AAV5w8, and AAV9 (Rocha et al., supra). In some embodiments, the AAV serotype used to infect the eye and / or lacrimal gland is AAV2. In some embodiments, the AAV capsid protein comprises SEQ ID NO:6. In some embodiments, the AAV capsid protein comprises a sequence that is at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:6. In some embodiments, the AAV capsid protein shares at least 95%, 98%, or 100% identity with the AAV2 VP1 protein (SEQ ID NO:6). In some embodiments, the polynucleotide sequence encoding the AAV2 VP1 protein comprises SEQ ID NO:7. In some embodiments, the polynucleotide sequence encoding the AAV2 VP1 protein comprises a sequence at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:7. In some embodiments, the polynucleotide sequence encoding the AAV2 VP1 protein shares at least 95%, 98%, or 100% identity to SEQ ID NO:7. In some embodiments, the AAV capsid protein comprises SEQ ID NO:8. In some embodiments, the AAV capsid protein comprises a sequence at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:8. In some embodiments, the AAV capsid protein shares at least 95%, 98%, or 100% identity to the AAV2 VP3 protein (SEQ ID NO:8). In some embodiments, the polynucleotide sequence encoding the AAV2 VP3 protein comprises SEQ ID NO:9. In some embodiments, the polynucleotide sequence encoding the AAV capsid protein comprises a sequence at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:9. In some embodiments, the polynucleotide sequence encoding the AAV2 VP3 protein shares at least 95%, 98%, or 100% identity to SEQ ID NO:9. In some embodiments, the AAV serotype used to infect the eye and / or lacrimal gland is AAV5. In some embodiments, the AAV capsid protein comprises SEQ ID NO:10. In some embodiments, the AAV capsid protein comprises a sequence at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:10. In some embodiments, the AAV capsid protein shares at least 95%, 98%, or 100% identity to the AAV5 capsid protein (SEQ ID NO:10). In some embodiments, the polynucleotide sequence encoding the AAV5 capsid protein comprises SEQ ID NO: 11. In some embodiments, the polynucleotide sequence encoding the AAV capsid protein comprises a sequence at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11. In some embodiments, the polynucleotide sequence encoding the AAV5 capsid protein shares at least 95%, 98%, or 100% identity to SEQ ID NO: 11. In some embodiments, the AAV serotype used to infect the eye and / or lacrimal gland is AAV8. In some embodiments, the capsid protein comprises SEQ ID NO: 12. In some embodiments, the AAV capsid protein comprises a sequence at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 12. In some embodiments, the AAV capsid protein shares at least 95%, 98%, or 100% identity to the AAV8 capsid protein (SEQ ID NO: 12). In some embodiments, the polynucleotide encoding the AAV8 capsid protein comprises SEQ ID NO:13.In some embodiments, the polynucleotide sequence encoding the AAV capsid protein comprises a sequence at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13. In some embodiments, the polynucleotide sequence encoding the AAV8 capsid protein shares at least 95%, 98%, or 100% identity to SEQ ID NO: 13. In some embodiments, the AAV serotype used to infect the eye and / or lacrimal gland is AAV9. In some embodiments, the AAV capsid protein comprises SEQ ID NO: 14. In some embodiments, the AAV capsid protein comprises a sequence at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14. In some embodiments, the AAV capsid protein shares at least 95%, 98%, or 100% identity to the AAV9 capsid protein (SEQ ID NO: 14). In some embodiments, the polynucleotide sequence encoding the AAV9 capsid protein comprises SEQ ID NO: 15. In some embodiments, the polynucleotide sequence encoding the AAV capsid protein comprises a sequence at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 15. In some embodiments, the polynucleotide sequence encoding the AAV9 capsid protein shares at least 95%, 98%, or 100% identity with SEQ ID NO:15.

[0119] [Table 5]

[0120] [Table 6]

[0121] [Table 7]

[0122] [Table 8]

[0123] [Table 9]

[0124] [Table 10]

[0125] [Table 11]

[0126] Exemplary rAAVs In some embodiments, the rAAV comprises an AAV capsid. In some embodiments, the rAAV described herein comprises an expression cassette comprising a polynucleotide encoding a neurotrophic factor. In some embodiments, the rAAV comprises an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter. In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter. In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a CAG promoter.

[0127] In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding NGF operably linked to a promoter. In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding an NGF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with SEQ ID NO:2, the polynucleotide being operably linked to a promoter. In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding an NGF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89% identity with SEQ ID NO:17, the polynucleotide being operably linked to a promoter. The rAAV comprises an expression cassette comprising a polynucleotide encoding an NGF protein comprising a sequence that shares at least 9%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with SEQ ID NO: 1, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding an NGF protein comprising an amino acid sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with SEQ ID NO: 1, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding an NGF protein operably linked to a CAG promoter.

[0128] In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding GDNF operably linked to a promoter. In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding a GDNF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:4, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding a GDNF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:18, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding a GDNF protein comprising an amino acid sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 3, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding GDNF operably linked to a CAG promoter.

[0129] In some embodiments, the rAAV comprises an AAV2 capsid and an expression cassette comprising a polynucleotide encoding NGF operably linked to a promoter. In some embodiments, the rAAV comprises an AAV2 capsid and an expression cassette comprising a polynucleotide encoding an NGF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with SEQ ID NO:2, the polynucleotide being operably linked to a promoter. In some embodiments, the rAAV comprises an AAV2 capsid and an expression cassette comprising a polynucleotide encoding an NGF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, or at least 99% identity with SEQ ID NO:17. In some embodiments, the rAAV comprises an AAV2 capsid and an expression cassette comprising a polynucleotide encoding an NGF protein comprising an amino acid sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with SEQ ID NO:1, wherein the polynucleotide is operably linked to a promoter.

[0130] In some embodiments, the rAAV comprises an AAV2 capsid and an expression cassette comprising a polynucleotide encoding GDNF operably linked to a promoter. In some embodiments, the rAAV comprises an AAV2 capsid and an expression cassette comprising a polynucleotide encoding a GDNF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:4, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an AAV2 capsid and an expression cassette comprising a polynucleotide encoding a GDNF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:18, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an AAV2 capsid and an expression cassette comprising a polynucleotide encoding a GDNF protein comprising an amino acid sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:3, wherein the polynucleotide is operably linked to a promoter.

[0131] In some embodiments, the rAAV comprises an AAV5 capsid and an expression cassette comprising a polynucleotide encoding NGF operably linked to a promoter. In some embodiments, the rAAV comprises an AAV5 capsid and an expression cassette comprising a polynucleotide encoding an NGF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:2, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an AAV5 capsid and an expression cassette comprising a polynucleotide encoding an NGF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 17, the polynucleotide being operably linked to a promoter. In some embodiments, the rAAV comprises an AAV5 capsid and an expression cassette comprising a polynucleotide encoding an NGF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least The expression cassette comprises a polynucleotide encoding an NGF protein comprising an amino acid sequence sharing at least 97%, at least 98%, or at least 99% identity thereto, the polynucleotide being operably linked to a promoter.

[0132] In some embodiments, the rAAV comprises an AAV5 capsid and an expression cassette comprising a polynucleotide encoding GDNF operably linked to a promoter. In some embodiments, the rAAV comprises an AAV5 capsid and an expression cassette comprising a polynucleotide encoding a GDNF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:4, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an AAV5 capsid and an expression cassette comprising a polynucleotide encoding a GDNF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:18, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an AAV5 capsid and an expression cassette comprising a polynucleotide encoding a GDNF protein comprising an amino acid sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:3, wherein the polynucleotide is operably linked to a promoter.

[0133] In some embodiments, the rAAV comprises an AAV9 capsid and an expression cassette comprising a polynucleotide encoding NGF operably linked to a promoter. In some embodiments, the rAAV comprises an AAV9 capsid and an expression cassette comprising a polynucleotide encoding an NGF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:2, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an expression cassette comprising an AAV9 capsid and a polynucleotide encoding an NGF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:17, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an expression cassette comprising an AAV9 capsid and a polynucleotide encoding an NGF protein comprising an amino acid sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:1, wherein the polynucleotide is operably linked to a promoter.

[0134] In some embodiments, the rAAV comprises an AAV9 capsid and an expression cassette comprising a polynucleotide encoding GDNF operably linked to a promoter. In some embodiments, the rAAV comprises an expression cassette comprising an AAV9 capsid and a polynucleotide encoding a GDNF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:4, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an expression cassette comprising an AAV9 capsid and a polynucleotide encoding a GDNF protein comprising a sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:18, wherein the polynucleotide is operably linked to a promoter. In some embodiments, the rAAV comprises an AAV9 capsid and an expression cassette comprising a polynucleotide encoding a GDNF protein comprising an amino acid sequence that shares at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:3, wherein the polynucleotide is operably linked to a promoter.

[0135] In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide sequence comprising SEQ ID NO:23.

[0136] In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide sequence comprising SEQ ID NO:24.

[0137] In some embodiments, the rAAV comprises an AAV capsid and an expression cassette comprising a polynucleotide sequence comprising SEQ ID NO:25.

[0138] How to use The methods and compositions described herein can treat ocular diseases and alleviate symptoms associated with ocular diseases. As used herein, the terms "treatment", "treating" and the like generally refer to obtaining a desired pharmacological and / or physiological effect. The effect can be prophylactic, in that it completely or partially prevents the disease or its symptoms, e.g., reduces the likelihood of the disease or its symptoms occurring in a subject, and / or it can be therapeutic, in that it partially or completely cures the disease and / or side effects caused by the disease. As used herein, "treatment" encompasses any treatment of a disease in a mammal, including: (a) inhibiting the progression of the disease; (b) alleviating, reducing, or reducing the increase of one or more symptoms of the disease; (c) alleviating, reducing, or reducing the increase of one or more signs of the disease; (d) causing regression of the disease. Therapeutic agents can be administered before, during, or after the onset of the disease or injury. Treatment of ongoing diseases, where the treatment stabilizes or reduces the undesirable clinical symptoms of the patient, is of particular interest. Such treatment would desirably occur before complete loss of function of the affected tissue. The subject therapy would desirably be administered during, and optionally after, the symptomatic stage of the disease.

[0139] As used herein, "administer," "administering," "administration," and the like, refer to providing a substance (e.g., a rAAV virion) to a subject in a manner that is pharmacologically useful (e.g., to treat a disease, disorder, or condition in the subject).

[0140] The disclosed methods and compositions can support, maintain, and / or repair the ocular surface of a subject with an ocular disease. The ocular disease can be, for example, neurotrophic keratitis, chemical burns of the ocular surface, corneal wounds, persistent epithelial defects, dry eye disease, herpes simplex virus infection of the trigeminal nerve and / or eye, varicella zoster virus infection of the trigeminal nerve and / or eye, and diabetic complications of the corneal nerve. In some embodiments, the ocular disease is neurotrophic keratitis, chemical burns of the ocular surface, corneal wounds, corneal ulcers, persistent epithelial defects, dry eye disease, herpes simplex virus infection of the trigeminal nerve and / or eye, varicella zoster virus infection of the trigeminal nerve and / or eye, or diabetic complications of the corneal nerve. In some embodiments, the ocular disease is neurotrophic keratitis. In some embodiments, the ocular disease is chemical burns of the ocular surface. In some embodiments, the ocular disease is a corneal wound. In some embodiments, the ocular disease is a corneal ulcer. In some embodiments, the eye disease is persistent epithelial defect. In some embodiments, the eye disease is dry eye disease. In some embodiments, the eye disease is herpes simplex virus infection of the trigeminal nerve and / or eye. In some embodiments, the eye disease is varicella zoster virus infection of the trigeminal nerve and / or eye. In some embodiments, the eye disease is diabetic complications of the corneal nerve.

[0141] Neurotrophic keratitis, or neurotrophic keratopathy, presents with epithelial keratopathy, ulceration, and perforation of the cornea. Neurotrophic keratitis is a degenerative disease of the corneal epithelium caused by impaired corneal innervation. Symptoms include reduced or complete loss of corneal sensation. Neurotrophic keratitis is diagnosed and staged using one or more of the following eye examinations described herein: combined observation of Rose Bengal staining of the lower palpebral conjunctiva, tear viscosity, tear breakup time, fluorescein staining, observation of non-healing corneal defects, swelling and edematous stroma in Descemet's membrane, corneal ulceration, corneal perforation, and corneal stromal melting (Non-Patent Document 11).

[0142] In some embodiments, the present disclosure provides a method for maintaining and / or repairing the ocular surface of a subject with ocular surface chemical burns. Ocular surface chemical burns typically manifest as sudden onset of severe pain, epiphoria, and blepharospasm. Ocular surface chemical burns can be diagnosed by ophthalmologic examination. Acute periocular signs of injury include periorbital edema and erythema, deepithelialized skin, and loss of eyelashes and eyebrows. Other signs include corneal and conjunctival epithelial defects, chemical reactions, conjunctival inflammation, limbal ischemia, corneal opacity, sterile ulcers, edema, and occasional perforation. High intraocular pressure is also a symptom and can result from trabecular meshwork damage and / or inflammation (Non-Patent Document 12).

[0143] In some embodiments, the present disclosure provides a method for maintaining and / or repairing the ocular surface of a subject with a corneal wound. Corneal wounds typically present with symptoms of ocular pain, tearing, sensitivity to light, and foreign body sensation. Diagnosis is made using one or more of the following: ophthalmic examination, assessment of visual impairment, identification of corneal infiltrate or ulcer, identification of hypopyon or hyphema, evidence of penetrating ocular injury, identification of pupil irregularity, and dilation of ocular contents. Diagnosis is made using one or more of the following: ophthalmic examination, assessment of visual impairment, identification of corneal infiltrate or ulcer, identification of hypopyon or hyphema, evidence of penetrating ocular injury, presence or absence of foreign body in any ocular structure, identification of pupil irregularity, and dilation of ocular contents. Additionally, fluorescein staining can be used to help identify any corneal abrasions (Non-Patent Document 13).

[0144] In some embodiments, the present disclosure provides a method for maintaining and / or repairing the ocular surface of a subject with a corneal ulcer. A corneal ulcer occurs when the corneal epithelium does not heal after injury to the ocular surface, usually within two weeks. Diagnosis is performed using the ophthalmic tests described herein.

[0145] Persistent epithelial defects are caused by the failure of the corneal epithelium to heal within the usual 2 weeks following injury to the ocular surface. Diagnosis is made using the ophthalmic tests described herein.

[0146] In some embodiments, the present disclosure provides a method for maintaining and / or repairing the ocular surface of a subject with dry eye disease. Dry eye disease presents with blurred vision, eye irritation, gritty or foreign body sensation, burning sensation, tearing, photophobia, stinging, or intermittent sharp pain. Dry eye disease can be diagnosed using one or more of the following eye examinations as described herein: Schirmer's test or tear function index analysis to evaluate tear production, fluorescein staining, rose bengal staining, lissamine green staining, tear breakup time, functional visual acuity test, and tear meniscus assessment to identify corneal epithelial defects (Non-Patent Document 14).

[0147] In some embodiments, the present disclosure provides a method of maintaining and / or repairing the ocular surface in a subject with a herpes simplex virus infection. Herpes simplex virus infection of the trigeminal nerve and / or eye, also known as herpes simplex keratitis, can cause redness, discharge, watery eyes, inflammation, irritation, pain, photophobia, and / or coarse granular spots forming punctate lesions. The symptoms include glaucoma, glaucoma, and glaucoma. Diagnosis is performed using one or more of the following assays: ophthalmologic examination, slit lamp examination, Lissamine Green staining, Rose Bengal staining, PCR, immunofluorescent antibody assay, and ELISA assay as described herein (Non-Patent Document 15).

[0148] In some embodiments, the present disclosure provides a method for maintaining and / or repairing the ocular surface of a subject with Varicella Zoster Virus infection. Varicella Zoster Virus infection of the trigeminal nerve (also called ophthalmic zoster) presents with corneal complications with varying degrees of vision loss, pain, and photosensitivity. Diagnosis includes identification of punctate epithelial keratitis, elevated dendritic plaques, granular infiltrates, or other abnormalities using slit lamp examination, rose bengal staining, and fluorescein staining (Non-Patent Document 16).

[0149] In some embodiments, the present disclosure provides a method for maintaining and / or repairing the ocular surface in a subject with diabetic complications of the corneal nerves, which manifest as corneal changes such as increased corneal thickness, epithelial defects, epithelial fragility and recurrent erosions, ulcers, edema, superficial punctate keratitis, delayed and impaired wound repair, endothelial changes, low tear production, dry eye syndrome, and reduced corneal sensitivity over time (Non-Patent Document 17).

[0150] As used herein, the term "subject" refers to mammals, including, but not limited to, humans and non-human primates, including apes and humans; mammalian sport animals (e.g., horses); mammalian farm animals (e.g., sheep, goats, etc.); mammalian pets (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.).

[0151] The subject can have, for example, any of the conditions or eye disorders described herein.

[0152] In some embodiments, the methods described herein result in one or more symptoms of an ocular disease being alleviated compared to the symptoms of the ocular disease prior to administration of the rAAV virion. As used herein, "symptoms" includes any of the diagnostic criteria or symptoms associated with a given ocular disease, including those described herein. In some embodiments, the symptoms may be alleviated following administration of a composition of the present disclosure and rAAV. In some embodiments, one or more symptoms of an ocular disease are alleviated compared to the symptoms of the ocular disease in an untreated control subject. In some embodiments, one or more symptoms of an ocular disease are alleviated compared to the symptoms of the ocular disease in a contralateral eye. "Contralateral eye" refers to the eye of the subject opposite the eye treated with a composition according to the present disclosure. As long as the subject is afflicted with bilateral disease or in a model As long as the animal is subject to an experimental protocol leading to treatment of both eyes, the contralateral eye can be used as a treatment control.

[0153] In some embodiments, expression of human NGF is increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% compared to expression of human NGF in the contralateral eye of an untreated or treated subject. In some embodiments, expression of human NGF may be increased by 1-fold, 2-fold, 3-fold, 4-fold, or 5-fold, 6-fold, 7-fold, 8-fold, or 9-fold compared to expression of human NGF in the contralateral eye of an untreated or treated subject.

[0154] In some embodiments, expression of human NGF is increased for about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 1 year compared to expression of human NGF in an untreated subject or in the contralateral eye of a treated subject.

[0155] As used herein, "approximately" or "about" when applied to one or more values ​​of interest means a value similar to a stated reference value. In certain embodiments, "about" means a range of values ​​that falls within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater or less) of the stated reference value (except where such number would exceed 100% of possible values), unless otherwise stated or clear from the context.

[0156] In some embodiments, a subject is administered an rAAV comprising a nucleotide encoding human NGF as described herein, and expression of human NGF in the subject is increased compared to expression of human NGF in an untreated subject or in the contralateral eye of a treated subject.

[0157] In some embodiments, the disclosure provides a method of treating a subject having an ocular disease or disorder, comprising administering to the subject an rAAV comprising nucleotides encoding a human NGF protein, wherein expression of human NGF in the subject is increased compared to expression of human NGF in an untreated subject or in the contralateral eye of the treated subject.

[0158] In some embodiments, expression of human GDNF is increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% compared to expression of human GDNF in the contralateral eye of an untreated or treated subject. In some embodiments, expression of human GDNF may be increased by 1-fold, 2-fold, 3-fold, 4-fold, or 5-fold, 6-fold, 7-fold, 8-fold, or 9-fold compared to expression of human GDNF in the contralateral eye of an untreated or treated subject.

[0159] In some embodiments, expression of human GDNF is increased for about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 1 year compared to expression of human GDNF in an untreated subject or the contralateral eye of a treated subject.

[0160] In some embodiments, a subject is administered an rAAV comprising a nucleotide encoding human GDNF as described herein, and expression of human GDNF in the subject is increased compared to expression of human GDNF in an untreated subject or in the contralateral eye of a treated subject.

[0161] In some embodiments, the present disclosure is a method of treating a subject with an ophthalmic disease or disorder. The present invention provides a method for increasing expression of human GDNF in a subject, the method comprising administering to the subject an rAAV comprising a nucleotide encoding the human GDNF protein, wherein expression of human GDNF in the subject is increased compared to expression of human GDNF in an untreated subject or in the contralateral eye of a treated subject.

[0162] In some embodiments, the present disclosure provides a rAAV virion for use in a method of treating an ocular disease in a subject in need thereof, the method comprising administering a recombinant adeno-associated virus (rAAV) virion to at least one eye of the subject or at least one lacrimal gland of the subject's eye, the rAAV virion comprising an AAV capsid and an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter. In some embodiments, the rAAV virion for use is administered to the lacrimal gland of the subject. In some embodiments, the rAAV virion for use comprises an expression cassette encoding an NGF protein. In some embodiments, the rAAV virion for use comprises an expression cassette encoding a GDNF protein.

[0163] In some embodiments, the disclosure provides a rAAV virion for use or adapted for use in treating a subject with an ocular disease, disorder, or condition, hi some embodiments, the rAAV virion for use or adapted for use comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter.

[0164] In some embodiments, the disclosure provides an rAAV virion for use in a method of treating an ocular disease in a subject in need thereof, the method comprising administering a recombinant adeno-associated virus (rAAV) virion described herein to at least one eye of the subject or at least one lacrimal gland of the eye of the subject. In some embodiments, the disclosure provides an rAAV virion for use in a method of treating an ocular disease in a subject in need thereof, the method comprising administering a recombinant adeno-associated virus (rAAV) virion comprising an expression cassette comprising a nucleic acid sequence of SEQ ID NO: 25 to at least one eye of the subject or at least one lacrimal gland of the eye of the subject. In some embodiments, the disclosure provides an rAAV virion for use in a method of treating an ocular disease in a subject in need thereof, the method comprising administering a recombinant adeno-associated virus (rAAV) virion comprising an expression cassette comprising a nucleic acid sequence of SEQ ID NO: 24 to at least one eye of the subject or at least one lacrimal gland of the eye of the subject. In some embodiments, the disclosure provides an rAAV virion for use in a method of treating an ocular disease in a subject in need thereof, the method comprising administering a recombinant adeno-associated virus (rAAV) virion comprising an expression cassette comprising a nucleic acid sequence of SEQ ID NO:23 to at least one eye of the subject, or to an eye and at least one lacrimal gland of the eye of the subject.

[0165] Mode of Administration In some aspects, the disclosure provides a method comprising administering an rAAV virion to an eye of a subject or to a lacrimal gland of the eye of a subject, wherein the rAAV virion comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter.

[0166] As mentioned above, the lacrimal functional unit is composed of the main and accessory lacrimal glands, the ocular surface, and the interconnecting nerve innervation. In each eye, the main lacrimal gland is located in the superior temporal region at the orbit within the lacrimal fossa of the frontal bone. The accessory glands, known as Wolfring's glands and Clauss' glands, are located in the eyelids. The upper eyelid contains approximately 2-5 Wolfring's glands and approximately 40 Clauss' glands. The lower eyelid contains approximately 6-8 Clauss' glands. The specific location and anatomical structure of the lacrimal functional unit are well known (Non-Patent Document 18). In summary, the lacrimal glands deliver ocular fluid to the ocular surface through the lacrimal ducts. The lacrimal gland also expresses and secretes into the tear film proteins and products required for corneal regeneration and transparency promotion, such as transforming growth factor-β and retinol (Non-Patent Document 18; Non-Patent Document 19).

[0167] Administration of the viral vector to the lacrimal gland can be accomplished by topical administration to the ocular surface, direct injection into the lacrimal gland, and / or local administration to the lacrimal gland. In some embodiments, rAAV is administered to the lacrimal gland by topical administration. In some embodiments, rAAV is administered to the lacrimal gland by direct injection. The lacrimal gland may be accessed by surgery or manipulation of the eyelid. Access to the tissue for administration can be gained locally by manipulating the eyelid (e.g., by washing the tissue with a pharmaceutical composition containing the viral vector). Direct injection into the lacrimal gland can be achieved by penetrating the skin above the lacrimal gland (FIG. 2A) or by manipulating the eyelid to access the lacrimal gland (FIG. 2B). In some embodiments, rAAV is administered to the lacrimal gland by direct injection, as shown in FIG. 2A. In some embodiments, rAAV is administered to the lacrimal gland by manipulation of the eyelid, as shown in FIG. 2B.

[0168] In some embodiments, cells in the eye and / or lacrimal gland are transduced with rAAV virions. Cells in the eye and / or lacrimal gland include, but are not limited to, acinar cells, ductal cells, and / or myoepithelial cells. In some embodiments, acinar cells, ductal cells, and myoepithelial cells are transduced with rAAV virions. In some embodiments, acinar cells are transduced with rAAV virions. In some embodiments, ductal cells are transduced with rAAV virions. In some embodiments, myoepithelial cells are transduced with rAAV virions. In some embodiments, the transduced cells in the eye and / or lacrimal gland express a therapeutically effective amount of a neurotrophic factor in the tear film and optionally the ocular surface of the subject. In some embodiments, the transduced cells in the eye and / or lacrimal gland express an effective amount of a neurotrophic factor in the tear film and optionally the ocular surface of the subject. As used herein, an "effective amount" refers to an amount or dosage of a rAAV, treatment, or composition described herein that is sufficient to alleviate the symptoms and / or signs of an ocular disease described herein. As used herein, the term "amount" refers to an absolute amount (e.g., absolute amount of protein or rAAV particles) or concentration (e.g., concentration of a protein in a solution), and it will be clear to one of skill in the art based on the context set forth herein whether the amount referred to in a given example refers to an absolute amount, concentration, or both.

[0169] Delivery of rAAV virions to the eye and / or lacrimal gland to express transgenes in the tear film has been demonstrated in vivo. In one example, the primary lacrimal gland of a mouse was directly injected with rAAV virions encoding a luciferase transgene with serotypes AAV2, AAV4, AAV5, AAV5w8, AAV x5, AAV9, AAV12, and bovine AAV (BAAV). AAV9, AAV5w8, AAV5, and AAV2 can transduce lacrimal duct cells and acinar cells of the lacrimal gland, respectively (Non-Patent Document 6).

[0170] In some embodiments, the rAAV virion is administered to the lacrimal gland of the subject. In some embodiments, the lacrimal gland is the main lacrimal gland. In some embodiments, the lacrimal gland is one of the Wolfring's gland or the Claus's gland of the subject.

[0171] The compositions and rAAV virions of the present disclosure can be administered to the lacrimal gland of a subject by any suitable method. For example, the subject compositions can be administered by direct injection into the main or accessory lacrimal gland.

[0172] Access to the lacrimal gland in human subjects can be achieved, for example, by manually lifting the upper eyelid (elevation). Lacrimal irritation can be accomplished by exposing the palpebral lobe of the lacrimal gland and delivering the therapeutic agent using, for example, a syringe with a 30G needle.

[0173] The viral vectors of the present disclosure are generally delivered to a subject as a pharmaceutical composition. The pharmaceutical composition comprises a pharma- ceutical acceptable solvent (e.g., water) and one or more excipients. In some embodiments, the pharmaceutical composition comprises a buffer at about neutral pH (pH 5, 6, 7, 8, or 9). In some embodiments, the pharmaceutical composition comprises phosphate buffered saline (e.g., PBS at a pH of about 7). The pharmaceutical composition can include a pharma- ceutical acceptable salt. The concentration of the salt can be selected to make the pharmaceutical composition isotonic or nearly isotonic with respect to the target tissue.

[0174] In various embodiments, the pharmaceutical compositions of the present disclosure comprise about 1×10 8 Genome copies / milliliter (GC / mL), approximately 5 × 10 8 GC / mL, approximately 1×10 9 GC / mL, approximately 5×10 9 GC / mL, approximately 1×10 10 GC / mL, approximately 5×10 10 GC / mL, approximately 1×10 11 GC / mL, approximately 5×10 11 GC / mL, approximately 1×10 12 GC / mL, approximately 5×10 12GC / mL, approximately 5×10 13 GC / mL, or approximately 1 x 10 14 GC / mL of viral vector (e.g., rAAV virion). In various embodiments, the pharmaceutical composition of the present disclosure comprises about 1×10 8 Genome copies / milliliter (GC / mL), approximately 5 × 10 8 GC / mL ~ approx. 1×10 9 GC / mL, approximately 1×10 9 GC / mL ~ approx. 5×10 9 GC / mL, approximately 5×10 9 GC / mL ~ approx. 1×10 10 GC / mL, approximately 1×10 10 GC / mL ~ approx. 5×10 10 GC / mL, approximately 5×10 10 GC / mL ~ approx. 1×10 11 GC / mL, approximately 1×10 11 GC / mL ~ approx. 5×10 11 GC / mL, approximately 5×10 11 GC / mL ~ approx. 1×10 12 GC / mL, approximately 1×10 12 GC / mL ~ approx. 5×10 12 GC / mL, approximately 5×10 12 GC / mL ~ approx. 5×10 13 GC / mL, or approximately 5 x 10 13 GC / mL ~ approx. 1×10 14 In various further embodiments, the pharmaceutical compositions of the present disclosure comprise about 5×10 8 GC / mL ~ approx. 5×10 9 GC / mL, approximately 5×10 9 GC / mL ~ approx. 5×10 10 GC / mL, approximately 5×10 10 GC / mL ~ approx. 5×10 11 GC / mL, approximately 5×10 11 GC / mL ~ approx. 5×10 12 GC / mL, or approximately 5 x 10 12 GC / mL ~ approx. 1×10 14 GC / mL of viral vector (e.g., rAAV virion). In yet a further embodiment, the pharmaceutical composition of the present disclosure comprises about 5×10 8 GC / mL ~ approx. 5×1010 GC / mL, approximately 5×10 10 GC / mL ~ approx. 5×10 12 GC / mL, or approximately 5 x 10 12 GC / mL ~ approx. 1×10 14 GC / mL of viral vector (e.g., rAAV virion).

[0175] In some embodiments, the pharmaceutical compositions of the present disclosure comprise about 1×10 12 GC / mL ~ approx. 6.2×10 12 In some embodiments, the pharmaceutical composition of the present disclosure comprises about 1×10 12 GC / mL or approximately 6.2 x 10 12 GC / mL of viral vector (e.g., rAAV virion).

[0176] In some embodiments, the pharmaceutical compositions of the present disclosure are administered in a total volume of about 10 μL, about 20 μL, about 30 μL, about 40 μL, about 50 μL, about 60 μL, about 70 μL, about 80 μL, about 90 μL, about 100 μL, 110 μL, about 120 μL, about 130 μL, about 140 μL, about 150 μL, about 160 μL, about 170 μL, about 180 μL, about 190 μL, or about 200 μL. In some embodiments, the pharmaceutical composition of the present disclosure may be administered in a total volume of about 10 μL to about 20 μL, about 20 μL to about 30 μL, about 30 μL to about 40 μL, about 40 μL to about 50 μL, about 50 μL to about 60 μL, about 60 μL to about 70 μL, about 70 μL to about 80 μL, about 80 μL to about 90 μL, about 90 μL to about 100 μL, about 1 00μL to 110μL, 110μL to about 120μL, about 120μL to about 130μL, about 130μL to about 140μL, about 140μL to about 150μL, about 150μL to about 160μL, about 160μL to about 170μL, about 170μL to about 180μL, about 180μL to about 190μL, or about 190μL to about 200μL is administered.

[0177] Genome copies per milliliter can be determined by quantitative polymerase chain reaction (qPCR) using a standard curve generated with a reference sample of known concentration of the viral polynucleotide genome. In the case of AAV, the reference sample used is often the transfer plasmid used to generate the rAAV virions, although other reference samples can also be used.

[0178] Alternatively, or in addition, the concentration of the viral vector can be determined by titrating the vector in a cell line. Viral titers are typically expressed in viral particles per unit volume (vp), such as vp / mL. In various embodiments, the pharmaceutical compositions of the present disclosure contain a concentration of about 1×10 8 Virus particles / milliliter (vp / mL), approximately 5 x 10 8 vp / mL, approximately 1×10 9 vp / mL, approximately 5×10 9 vp / mL, approximately 1×10 10 vp / mL, approximately 5×10 10 vp / mL, approximately 1×10 11 vp / mL, approximately 5×10 11 vp / mL, approximately 1×10 12 vp / mL, approximately 5×10 12 vp / mL, approximately 5×10 13 vp / mL, or approximately 1 × 10 14 vp / mL of viral vector (e.g., rAAV virion). In various further embodiments, the pharmaceutical composition of the present disclosure comprises about 1×10 8 Virus particles / milliliter (vp / mL) ~ approx. 5 x 10 8 vp / mL, approximately 5×10 8 vp / mL ~ approx. 1×10 9 vp / mL, approximately 1×10 9 vp / mL ~ approx. 5×10 9 vp / mL, approximately 5×10 9 vp / mL ~ approx. 1×10 10 vp / mL, approximately 1×10 10 vp / mL ~ approx. 5×10 10 vp / mL, approximately 5×1010 vp / mL ~ approx. 1×10 11 vp / mL, approximately 1×10 11 vp / mL ~ approx. 5×10 11 vp / mL, approximately 5×10 11 vp / mL ~ approx. 1×10 12 vp / mL, approximately 1×10 12 vp / mL ~ approx. 5×10 12 vp / mL, approximately 5×10 12 vp / mL ~ approx. 5×10 13 vp / mL, or approximately 5 × 10 13 vp / mL ~ approx. 1×10 14 vp / mL of viral vector (e.g., rAAV virion).

[0179] A variety of tests are available to assess a subject's eye disease before, during, and after treatment with any of the methods or compositions disclosed herein. In some of the embodiments disclosed herein, effective treatment for a subject is indicated by one or more tests, which can be, for example, a) an Eye Dryness score test on a visual analog scale, b) a Schirmer test, c) a corneal fluorescein staining test, and d) an Ocular Surface Disease Index test. Tests to assess signs and symptoms of eye disease can be administered under standardized or reproducible conditions to obtain a subject's test score. Conditions include exposing the subject to an environment that is artificially created to adversely challenge the subject, or where the environment (temperature, humidity, airflow) is monitored and carefully controlled.

[0180] The following sections provide further details on the visual analog scale eye dryness score test, the Schirmer test, the corneal staining test, and the ocular surface disease index test.

[0181] Eye dryness score test A visual analog scale eye dryness score test can be used to assess a subject's eye disease, tearing levels, or eye discomfort. This test uses a visual analog scale that includes a 100 mm horizontal line with one end point of 0 labeled "no discomfort" and the other end point of 100 labeled "maximum discomfort." Figure 3 shows an example of a visual analog scale (not shown to scale). The subject is asked to assess their eye symptoms of dry eyes by making a vertical mark on the horizontal line that indicates their level of discomfort. The subject's response is then determined by determining where on the 100 mm scale the subject's response lies. The eye dryness score is calculated based on the above.

[0182] The eye dryness score, measured in mm, can be used to assess the severity of the ocular condition and the effectiveness of a particular treatment for a subject. The test has the advantage that it can be administered to the subject as frequently as every 5 minutes, allowing the test administrator to closely monitor the change in the subject's condition over time. Higher numbers indicate greater discomfort with the ocular condition compared to lower numbers indicating a relatively lower level of discomfort. A decrease in the eye dryness score is evidence that the treatment is effective in treating the ocular condition, increasing tear production, or improving ocular discomfort. A decrease in the eye dryness score over time is evidence of a reduction or alleviation of the ocular condition and generally indicates an improvement in the subject's condition.

[0183] In some of the embodiments disclosed herein, effective treatment is indicated by a statistically significant decrease in the subject's eye dryness score, where the statistically significant decrease in the subject's eye dryness score is determined after administering to the subject a first administration, or optionally one or more subsequent administrations, of an rAAV virion and a first administration, or optionally one or more subsequent administrations, of a treatment that increases tear production, and the subject's eye dryness score is compared to: a) the subject's eye dryness score before administering the first administration of the rAAV virion and the first administration of the treatment that increases tear production; b) the eye dryness score of the subject administered a control; c) the eye dryness score of the subject administered a control drug compound; or d) the eye dryness score of the contralateral eye.

[0184] As used herein, the term "statistically significant" refers to a method of analysis selected by one of skill in the art based on the study design and the data type generated to assess an observed difference between two or more groups, and the analysis determines whether the difference is not random or is strictly due to chance.

[0185] In some of the embodiments disclosed herein, the subject's eye dryness score is compared to the subject's eye dryness score before receiving the first administration of the rAAV virion and the first administration of the treatment that increases tear production.

[0186] In some of the embodiments disclosed herein, the eye dryness score of a subject is compared to the eye dryness score of a subject administered a control.

[0187] In some of the embodiments disclosed herein, the subject's eye dryness score is compared to the eye dryness score of a subject administered a control drug compound.

[0188] In some of the embodiments disclosed herein, the subject's eye dryness score is compared to the eye dryness score of the contralateral eye.

[0189] In some embodiments, a statistically significant decrease in subject eye dryness score is observed in subjects administered the rAAV virions described herein compared to controls. In some of the embodiments described herein, the statistically significant decrease in subject eye dryness score is at least 5%, 10%, 15%, 20%, 25%, 50%, 75%, 80%, 90%, 95%, 100%, 125%, 150%, 200%, 250%, 300%, or 350%. In some embodiments, a statistically significant decrease in a subject's eye dryness score is observed in subjects administered the rAAV virions described herein compared to controls, where the statistically significant decrease in a subject's eye dryness score is at least 5%, 10%, 15%, 20%, 25%, 50%, 75%, 80%, 90%, 95%, 100%, 125%, 150%, 200%, 250%, 300%, or 350%.

[0190] In some of the embodiments described herein, the statistically significant decrease in the subject's eye dryness score is at least 3 mm, at least 5 mm, at least 10 mm, at least 15 mm, at least 20 mm, at least 25 mm, at least 30 mm, at least 35 mm, at least 40 mm, at least 45 mm, or at least 50 mm. In some embodiments, a statistically significant decrease in the subject's eye dryness score is observed in subjects administered a rAAV virion described herein compared to a control, and the statistically significant decrease in the subject's eye dryness score is at least 3 mm, at least 5 mm, at least 10 mm, at least 15 mm, at least 20 mm, at least 25 mm, at least 30 mm, at least 35 mm, at least 40 mm, at least 45 mm, or at least 50 mm.

[0191] In some of the embodiments described herein, a statistically significant decrease in a subject's eye dryness score is 3mm to 10mm, 3mm to 20mm, 3mm to 25mm, 3mm to 30mm, 3mm to 35mm, 3mm to 40mm, 3mm to 45mm, 3mm to 50mm, 5mm to 10mm, 5mm to 20mm, 5mm to 25mm, 5mm to 30mm, 5mm to 35mm, 5mm to 40mm, 5mm to 45mm, 5mm to 50mm, 10mm to 15mm, 10mm to 20mm, 10mm to 25mm, 10mm to 30mm, 10mm to 35mm, 10mm to 40mm, 10mm to 45mm, 10mm to 50mm, 15mm to 20mm, 20mm to 30mm, 25mm to 35mm, 30mm to 40mm, 30mm to 45mm, or 30mm to 50mm.

[0192] In some of the embodiments described herein, a statistically significant decrease in a subject's eye dryness score is characterized by a p-value of 0.05 or less, 0.01 or less, 0.005 or less, or 0.001 or less. In some of the embodiments described herein, a statistically significant decrease in a subject's eye dryness score is characterized by a p-value of 0.05 or less. In some of the embodiments described herein, a statistically significant decrease in a subject's eye dryness score is characterized by a p-value of 0.01 or less.

[0193] In some of the embodiments described herein, a subject experiences a statistically significant decrease in eye dryness score within 1 day, 2 days, 3 days, 4 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months after treatment with any of the disclosed methods or compositions.

[0194] In some embodiments, the reduction in the subject's eye dryness score persists for about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, or 1 year after treatment with any of the methods or compositions disclosed herein.

[0195] In some of the embodiments described herein, the statistically significant decrease in the subject's eye dryness score is based on the subject's eye dryness score determined after administration of an initial dose of rAAV virions.

[0196] In some of the embodiments described herein, the statistically significant reduction is based on the subject's eye dryness score determined after treatment with any of the methods or compositions disclosed herein.

[0197] Schirmer score test Ocular diseases can affect tear volume and tear production. The Schirmer test can be used to assess tear production and evaluate the severity of dry eye disease, tear deficiency, or ocular discomfort in a subject. This test measures the amount of tears produced in each eye. This test is typically performed The Schirmer test involves first placing an anesthetic in one or both eyes of the subject. These drops prevent the eye from watering in response to the test strip. Filter paper is then placed inside one or both lower eyelids and the person closes their eyes. After five minutes, the test administrator removes the filter paper and assesses how much tears have been transferred over it. The Schirmer test can be performed on one or both eyes.

[0198] Generally, the less moisture there is on the paper, the less tears the person produces. Healthy eyes typically contain more than 10 millimeters of moisture on each paper strip. A Schirmer score of less than 10 millimeters of moisture may indicate one or more conditions, including eye diseases described herein, abnormally low tear flow, or eye discomfort.

[0199] The Schirmer test can be used to evaluate the effectiveness of a particular treatment in a subject, and may be administered multiple times to monitor the change in the severity of the subject's condition over a period of time.An increase in Schirmer score over time in a subject receiving treatment for eye disease, insufficient tear flow, or eye discomfort as described herein is evidence of an increase in tear volume or tear production, and generally indicates an improvement in the subject's condition.An increase in Schirmer score over time is evidence that the treatment is effective in treating eye disease as described herein, increasing tear production, or improving eye discomfort.

[0200] In some of the embodiments disclosed herein, effective treatment is indicated by a statistically significant increase in the subject's Schirmer score, where the statistically significant increase in the subject's Schirmer score is determined following treatment with any of the methods or compositions disclosed herein, and the subject's Schirmer score is compared to: a) the subject's Schirmer score prior to administration of the first administration of rAAV virions and the first administration of the treatment that increases tear production; b) the Schirmer score of the subject administered a control; c) the Schirmer score of the subject administered a control drug compound; or d) the contralateral eye.

[0201] In some embodiments disclosed herein, the Schirmer score of the subject is compared to the Schirmer score of the subject before administration of the pharmaceutical composition described herein. In some embodiments disclosed herein, the Schirmer score of the subject is compared to the Schirmer score of the subject administered a control. In some embodiments disclosed herein, the Schirmer score of the subject is compared to the Schirmer score of the subject administered a control drug compound. In some embodiments disclosed herein, the Schirmer score of the subject is compared to the contralateral eye.

[0202] In some embodiments, a statistically significant increase in subject Schirmer scores is observed in subjects administered the rAAV virions described herein compared to controls.

[0203] In some of the embodiments described herein, the statistically significant increase in the subject's Schirmer score is at least 5%, 10%, 15%, 20%, 25%, 50%, 75%, 80%, 90%, 95%, 100%, 125%, 150%, 200%, 250%, 300%, or 350%. In some of the embodiments described herein, the increase in the subject's Schirmer score is at least 100%, 200%, or 300%. In some embodiments, a statistically significant increase in a subject's Schirmer score is observed in a subject administered an rAAV virion described herein compared to a control, where the statistically significant increase in the subject's Schirmer score is at least 5%, 10%, 15%, 20%, 25%, 50%, 75%, 80%, 90%, 95%, 100%, 125%, 150%, 200%, 250%, 300%, or 350%.

[0204] In some of the embodiments described herein, a statistically significant increase in a subject's Schirmer score is at least 3 mm, at least 5 mm, at least 10 mm, at least 15 mm, at least 20 mm, at least 25 mm, at least 30 mm, at least 35 mm. , at least 40 mm, at least 45 mm, or at least 50 mm.

[0205] In some of the embodiments described herein, a statistically significant increase in a subject's Schirmer score is between 3mm and 5mm, between 3mm and 10mm, between 3mm and 15mm, between 3mm and 20mm, between 3mm and 25mm, between 3mm and 30mm, between 5mm and 10mm, between 5mm and 15mm, between 5mm and 20mm, between 5mm and 25mm, between 5mm and 30mm, between 10mm and 15mm, between 10mm and 20mm, between 10mm and 25mm, between 10mm and 30mm, between 15mm and 20mm, between 15mm and 25mm, between 15mm and 30mm, between 20mm and 25mm, or between 20mm and 30mm.

[0206] In some embodiments, a statistically significant increase in a subject's Schirmer score is observed in a subject administered an rAAV virion described herein compared to a control, where the statistically significant increase in the subject's Schirmer score is at least 3 mm, at least 5 mm, at least 10 mm, at least 15 mm, at least 20 mm, at least 25 mm, at least 30 mm, at least 35 mm, at least 40 mm, at least 45 mm, or at least 50 mm.

[0207] In some of the embodiments described herein, a statistically significant increase in a subject's Schirmer score is characterized by a p-value of 0.05 or less, 0.01 or less, 0.005 or less, or 0.001 or less.

[0208] In some of the embodiments described herein, a statistically significant increase in a subject's Schirmer score is within 1 day, 2 days, 3 days, 4 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months after treatment with a method or composition disclosed herein. In some of the embodiments described herein, a statistically significant increase in a subject's Schirmer score is within 1 minute, 2 minutes, or 5 minutes when measured acutely, or within 1 day, 2 days, 3 days, 4 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months after treatment with a method or composition disclosed herein.

[0209] In some embodiments, the increase in the subject's Schirmer score persists for 1 minute, 2 minutes, 3 minutes, or for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, or 1 year after treatment with any of the methods or compositions disclosed herein.

[0210] In some of the embodiments described herein, a statistically significant increase in a subject's Schirmer score is based on the subject's Schirmer score determined after treatment with a method or composition disclosed herein.

[0211] In some of the embodiments described herein, the statistically significant increase is based on the subject's Schirmer score determined after treatment with any of the methods or compositions disclosed herein.

[0212] Corneal staining test Changes in the corneal surface are associated with insufficient tear flow and excessive dryness, as well as with the ocular diseases and ocular discomfort described herein. Changes in the corneal surface can include disruption of the mucin coating that protects the surface epithelial cells and / or damage to the epithelial cell walls.

[0213] Corneal staining tests, including fluorescein staining, Lissamine green staining, and rose bengal staining, are diagnostic tests to determine the health of the corneal surface and to indicate areas of corneal surface damage. A normal corneal surface does not take up the water-soluble dye instilled in the tear film. However, damaged epithelial cells allow the water-soluble dye to diffuse into the surface cells. The dye that stains damaged epithelial cells can be visualized at the corneal surface, indicating corneal surface damage.

[0214] To perform the corneal staining test, a staining dye is applied to one or both eyes. The dye penetrates and stains the areas between the surface cells. Using this test, devitalized cells and filaments of necrotic surface tissue can be visualized. The test administrator then uses a corneal surface scoring system that has been developed to assess the severity of the damage observed. This scoring system is useful for treating eye diseases over time. Figure 4 shows the NEI / Industry Workshop Scale used in the scoring system. Other equivalent standardized scoring systems can also be used. The test administrator assesses and scores the areas of corneal surface damage and calculates a corneal score that reflects the severity of the corneal surface damage.

[0215] The test administrator can use the corneal score to evaluate the effectiveness of a particular treatment in a subject. The test can be performed multiple times to monitor changes in the severity of the subject's ocular surface over a period of time. Generally, higher numbers indicate greater corneal surface damage compared to lower numbers indicating lower levels of corneal surface damage. A decrease in the corneal score over time is evidence of a decrease in corneal surface damage. A decrease in the corneal score generally indicates an improvement in the subject's condition. A decrease in the corneal score over time is also evidence of the effectiveness of a treatment in treating dry eye disease, increasing tear production, or improving ocular discomfort.

[0216] In some of the embodiments disclosed herein, effective treatment is indicated by a statistically significant decrease in the subject's corneal score, which is determined after administering to the subject an initial administration of a composition described herein, or optionally one or more subsequent administrations, and the subject's corneal score is compared to: a) the subject's corneal score prior to administration of the initial administration of rAAV virions and the initial administration of the treatment that increases tear production; b) the corneal score of a subject administered a control; c) the corneal score of a subject administered a control drug compound; or d) the contralateral eye.

[0217] In some embodiments disclosed herein, the subject's corneal score is compared to the subject's corneal score before administration of a pharmaceutical composition according to the methods described herein. In some embodiments disclosed herein, the subject's corneal score is compared to the corneal score of a subject administered a control. In some embodiments disclosed herein, the subject's corneal score is compared to the corneal score of a subject administered a control drug compound. In some embodiments disclosed herein, the subject's corneal score is compared to the contralateral eye.

[0218] In some of the embodiments disclosed herein, a subject's corneal score can be used to measure a definition of corneal healing, defined as less than 0.5 mm of fluorescein staining or no (zero) fluorescein staining (Non-Patent Document 20).

[0219] In some embodiments, a statistically significant decrease in subject corneal healing scores is observed in subjects administered the rAAV virions described herein compared to controls.

[0220] In some of the embodiments described herein, the subject's statistically significant decrease in corneal healing score is at least 5%, 10%, 15%, 20%, 25%, 50%, 75%, 80%, 90%, 95%, 100%, 125%, 150%, 200%, 250%, 300%, or 350%.

[0221] In some embodiments, a statistically significant decrease in the corneal healing score in a subject compared to a control. In subjects administered the rAAV virions described herein, a statistically significant decrease in the subject's corneal healing score is observed of at least 5%, 10%, 15%, 20%, 25%, 50%, 75%, 80%, 90%, 95%, 100%, 125%, 150%, 200%, 250%, 300%, or 350%.

[0222] In some of the embodiments described herein, a statistically significant decrease in a subject's corneal score is characterized by a p-value of 0.05 or less, 0.01 or less, 0.005 or less, or 0.001 or less.

[0223] In some of the embodiments described herein, a subject experiences a statistically significant decrease in corneal score within 1 day, 2 days, 3 days, 4 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months after treatment with a method or composition disclosed herein.

[0224] In some embodiments, the reduction in the subject's corneal score persists for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, or 1 year after treatment with any of the methods or compositions disclosed herein.

[0225] In some of the embodiments described herein, the statistically significant reduction is based on the subject's corneal score determined after administration of one or more subsequent administrations of rAAV virions, and optionally, an initial or one or more subsequent administrations of a treatment that increases tear production.

[0226] Ocular Surface Disease Index Test Subjects receiving treatment for eye diseases and related conditions can provide important information used to diagnose conditions and determine the severity of symptoms through questionnaires. A well-designed questionnaire should be reproducible and comprised of appropriate questions that elicit responsive answers. One example of a questionnaire is the Ocular Surface Disease Index (OSDI), a 12-question survey of subjects with eye diseases that has been shown to be a reliable and valid instrument for directly assessing the frequency of symptoms. Ocular symptoms assessed include, but are not limited to, burning / stinging, itching, foreign body sensation, eye discomfort, eye dryness, photophobia, and pain. Most people are familiar with questionnaires and find them to be an efficient way for health providers to gather information. Questionnaires also reduce bias because there are no verbal or visual cues that may inadvertently influence respondents. The test administrator collects responses from the subjects and calculates the OSDI based on the subjects' responses to the questions.

[0227] OSDI score can be used to evaluate the severity of ocular symptoms and the effectiveness of a particular treatment of a subject. Higher values ​​indicate greater severity of ocular disease. Reduction of OSDI score over time is evidence of the reduction or alleviation of ocular symptoms, and generally indicates improvement of the subject's condition. Reduction of OSDI score is also evidence that treatment is effective in treating ocular disease and alleviating symptoms.

[0228] In some of the embodiments disclosed herein, effective treatment is indicated by a statistically significant decrease in the subject's OSDI score, where the statistically significant decrease in the subject's corneal score is determined after administering to the subject a first administration, or optionally one or more subsequent administrations, of a rAAV virion and a first administration, or optionally one or more subsequent administrations, of a treatment that increases tear production, and the subject's OSDI score is determined based on: a) the subject's OSDI score before administering the first administration of a rAAV virion and the first administration of a treatment that increases tear production; b) the OSDI score of the subject administered a control. DI score; c) OSDI score of subjects receiving a control compound; or d) compared to the contralateral eye.

[0229] In some of the embodiments disclosed herein, the OSDI score of the subject is compared with the OSDI score of the subject before treatment according to the disclosed method described herein.In some of the embodiments disclosed herein, the OSDI score of the subject is compared with the OSDI score of the subject administered with a control.In some of the embodiments disclosed herein, the OSDI score of the subject is compared with the OSDI score of the subject administered with a control drug compound.In some of the embodiments disclosed herein, the OSDI score of the subject is compared with the OSDI score of the contralateral eye.

[0230] In some embodiments, a statistically significant decrease in subject OSDI scores is observed in subjects administered the rAAV virions described herein compared to controls.

[0231] In some embodiments described herein, a statistically significant decrease in a subject's OSDI score is at least 5%, 10%, 15%, 20%, 25%, 50%, 75%, 80%, 90%, 95%, 100%, 125%, 150%, 200%, 250%, 300%, or 350%. In some embodiments, a statistically significant decrease in a subject's OSDI score is observed in a subject administered a rAAV virion described herein compared to a control, and the statistically significant decrease in a subject's OSDI score is at least 5%, 10%, 15%, 20%, 25%, 50%, 75%, 80%, 90%, 95%, 100%, 125%, 150%, 200%, 250%, 300%, or 350%.

[0232] In some of the embodiments described herein, a statistically significant decrease in a subject's OSDI score is characterized by a p-value of 0.05 or less, 0.01 or less, 0.005 or less, or 0.001 or less.

[0233] In some of the embodiments described herein, a statistically significant decrease in a subject's OSDI score occurs within 1 day, 2 days, 3 days, 4 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months after treatment with a method or composition disclosed herein.

[0234] In some embodiments, the reduction in a subject's OSDI score persists for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, or 1 year after treatment with any of the methods or compositions disclosed herein.

[0235] In some of the embodiments described herein, the statistically significant decrease in the subject's OSDI score is based on the subject's OSDI score determined after administration of an initial dose of rAAV virions.

[0236] In some of the embodiments described herein, the statistically significant reduction is based on the subject's OSDI score determined after treatment with a method or composition disclosed herein.

[0237] Maintaining effective treatment over the long term The present disclosure can provide an effective treatment over a period of time during which a statistically significant improvement in a subject's score is maintained. As used in the present disclosure, the term "maintained" in relation to maintaining a statistically significant improvement in a subject's score (EDS, Schirmer, Corneal Staining Examination, or OSDI) means that the statistically significant improvement does not decrease below a certain threshold over time. The statistically significant improvement can be maintained even if the subject's score changes at a later time point. The improvement following treatment with the disclosed method can be maintained without additional administration. or may be maintained after one or more subsequent administrations.

[0238] For example, a corneal staining test score of 0.5 mm or 0 mm can be defined as corneal healing, representing significant improvement 30 or 60 days after the start of treatment (Non-Patent Document 20).

[0239] For example, an eye dryness score being "maintained within 10%" means that the subject's eye dryness score does not decrease by more than 10% over a particular period of time. Further improvement in the subject's eye dryness score will also be considered a statistically significant maintenance of improvement (e.g., if the eye dryness score improves by an additional 15% over a particular period of time, this will be considered "maintained within 10%).

[0240] In another example, if there is a statistically significant decrease (improvement) in a subject's eye dryness score 30 days after treatment with the methods described herein, and the subject's score is the same or less (indicating benefit to the subject) at a later time point, the statistically significant improvement is said to be maintained. Alternatively, if the subject's eye dryness score at the later time point is greater than the eye dryness score 30 days after treatment with the methods described herein, the subject may still be benefiting from the treatment, and the score determined at the later time point may still be a statistically significant improvement compared to the baseline score before the first dose was administered or before treatment.

[0241] In another example, if there is a statistically significant decrease (improvement) in a subject's eye dryness score 60 days after treatment with the methods described herein, and the subject's score is the same or smaller at a later time point (indicating benefit to the subject), the statistically significant improvement is said to be maintained. Alternatively, if the subject's eye dryness score at the later time point is greater than the eye dryness score 60 days after treatment with the methods described herein, the subject may still be benefiting from the treatment, and the score determined at the later time point may still be a statistically significant improvement compared to before treatment with the methods described herein.

[0242] Note that what constitutes an improvement varies depending on the score being measured. For example, improvement in eye dryness scores, corneal scores, and OSDI scores is a decrease in the numerical value of the score. In the Schirmer test, improvement is typically a numerical increase in the Schirmer score.

[0243] In some of the embodiments described herein, maintaining a statistically significant improvement in a subject's score (e.g., EDS, Schirmer, Corneal Stain Test, or OSDI) means that the statistically significant improvement does not decrease by more than 10%, 20%, 30%, 40%, 50%, or 60%.

[0244] In some embodiments described herein, the statistically significant improvement in the subject's score (e.g., EDS, Schirmer, Cornea, or OSDI) is maintained for at least 1 week, at least 1 month, at least 3 months, at least 6 months, at least 9 months, or at least 12 months. In some embodiments described herein, the statistically significant improvement in the subject's score is maintained for at least 30 days after treatment according to the methods described herein, and the statistically significant improvement does not decrease by more than 30%. In some embodiments, the statistically significant improvement in the subject's score is maintained for at least 1 month after administration of the first dose of rAAV virions and, optionally, the first dose of a treatment that increases tear production, and the statistically significant improvement does not decrease by more than 30%.

[0245] In some of the embodiments described herein, a statistically significant improvement in a subject's score (e.g., EDS, Schirmer, Corneal, or OSDI) is observed at least one week, at least one month, at least three months, at least six months, or at least one year after treatment according to the methods described herein. or maintained for at least 9 months, or for at least 12 months, and the statistically significant improvement does not decrease by more than 10%, 20%, 30%, 40%, 50%, or 60% compared to the subject's score within 60 days after treatment according to the methods described herein.

[0246] In some of the embodiments described herein, a statistically significant improvement in a subject's score (e.g., EDS, Schirmer, Corneal Stain Test, or OSDI) is maintained for at least 1 week, at least 1 month, at least 3 months, at least 6 months, at least 9 months, or at least 12 months following treatment in accordance with the methods described herein, and the statistically significant improvement does not decrease by more than 20% compared to the subject's corresponding eye dryness score, corneal score, or OSDI score within 60 days following treatment in accordance with the methods described herein.

[0247] Timing and method of administration The schedule of administration to a subject depends on various considerations, including the duration of effectiveness of each administration, the transduction efficiency of the rAAV virion, and the effect of administration on the body. For example, at the discretion of a medical provider if the patient's condition does not improve, the method of treating an ocular disease described herein can be adjusted in dosage or repeatedly administered to improve or otherwise control or limit the symptoms of the subject's ocular disease. For example, the period between administration of one or more administrations is extended, or the period between the number of days a subject is administered one or more administrations is extended. As a non-limiting example, administration of one or more administrations is changed to administration of one or more administrations after measuring symptoms of the ocular disease.

[0248] As used herein, "dosage" can refer to the dosage of a pharmaceutical composition of the disclosure or the dosage of a treatment that relieves symptoms in an ocular disorder.

[0249] In some of the embodiments described herein, the dose of rAAV virions is a dose of rAAV virions carrying an expression cassette. In such cases, delivery of an appropriate dose (e.g., an effective amount) of a gene product is achieved by administering to a target site an appropriate amount / potency of a viral vector that allows expression of a therapeutically effective amount of the gene product over a period of time. In such cases, delivery of an appropriate dose (e.g., an effective amount) of a gene product is achieved by administering to a target site an appropriate amount / potency of a viral vector that allows expression of an effective amount of the gene product over a period of time. In some embodiments, the viral vector is a rAAV virion. In some embodiments, the viral vector is administered to the lacrimal gland. In some embodiments, administration of the viral vector results in stable production of the gene product for a period of time (e.g., about 1 day, about 2 days, about 4 days, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 9 months, about 12 months, or longer). In some embodiments, administration of rAAV results in steady production of the gene product for about 1 week. In some embodiments, administration of rAAV results in steady production of the gene product for about 2 weeks. In some embodiments, administration of rAAV results in steady production of the gene product for about 3 weeks. In some embodiments, administration of rAAV results in steady production of the gene product for about 4 weeks. In some embodiments, administration of rAAV results in steady production of the gene product for about 1 month. In some embodiments, administration of rAAV results in steady production of the gene product for about 2 months. In some embodiments, administration of rAAV results in steady production of the gene product for about 3 months. In some embodiments, administration of rAAV results in steady production of the gene product for about 4 months. In some embodiments, administration of rAAV results in steady production of the gene product for about 5 months. In some embodiments, administration of rAAV results in steady production of the gene product for about 6 months. In some embodiments, administration of rAAV results in steady production of the gene product for about 9 months. In some embodiments, administration of the rAAV results in stable production of the gene product for about 12 months.

[0250] In some embodiments, the rAAV is administered in multiple doses. In some embodiments, the rAAV is administered in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses. In some embodiments, the rAAV is administered in 2 doses. In some embodiments, the rAAV is administered in 3 doses. In some embodiments, the rAAV is administered in 4 doses. In some embodiments, the rAAV is administered in 5 doses. In some embodiments, the rAAV is administered in 6 doses. In some embodiments, the rAAV is administered in 7 doses. In some embodiments, the rAAV is administered in 8 doses. In some embodiments, the rAAV is administered in 9 doses. In some embodiments, the rAAV is administered in 10 doses.

[0251] In some embodiments, the method includes delivering an effective amount of a gene product by administering rAAV. In some embodiments, the method includes delivering an initial administration of rAAV and one or more subsequent administrations. The one or more subsequent administrations are administered a period of time after the initial administration. In some embodiments, the period between the initial administration and the next subsequent administration is at least 1 day, at least 3 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 9 months, at least 12 months, or longer. In some embodiments, the period between the initial administration and the next subsequent administration is 1-7 days, 1-4 weeks, 2-6 weeks, 4-8 weeks, 1-3 months, 2-4 months, 3-6 months, 4-12 months, 6-24 months. In some embodiments, the period between one or more subsequent administrations is at least 1 day, at least 3 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 9 months, at least 12 months, or longer, In some embodiments, the period between one or more subsequent administrations is 1-7 days, 1-4 weeks, 2-6 weeks, 4-8 weeks, 1-3 months, 2-4 months, 3-6 months, 4-12 months, 6-24 months.

[0252] In some embodiments, the administration is of the same concentration of rAAV, hi some embodiments, the administration is of different concentrations of rAAV.

[0253] In some embodiments, the repeated doses are administered to the same eye or lacrimal gland, hi some embodiments, the repeated doses are administered to at least one eye or lacrimal gland.

[0254] Pharmaceutical Compositions and Kits In some embodiments, the disclosure provides a pharmaceutical composition comprising a rAAV virion described herein. In some embodiments, the pharmaceutical composition comprises a rAAV virion described herein and a pharma- ceutically acceptable carrier, delivery agent, or excipient.

[0255] In some embodiments, the disclosure provides for the use of a rAAV virion or pharmaceutical composition described herein in the manufacture of a medicament for treating an ophthalmic disease, disorder, or condition. In some embodiments, the disclosure relates to the use of a rAAV virion or pharmaceutical composition described herein for use or adapted for use in treating an ophthalmic disease, disorder, or condition.

[0256] In some embodiments, the pharma- ceutically acceptable carrier comprises phosphate buffered saline. In some embodiments, the pharmaceutical composition is formulated to be compatible with its intended route of administration (e.g., into the lacrimal gland). In some embodiments, the pharmaceutical composition is formulated for administration to the lacrimal gland. In some embodiments, the pharmaceutical composition is formulated for administration to the ocular surface.

[0257] Any suitable concentration of viral particles can be prepared for contact with cells of the eye and / or lacrimal gland in vitro or in vivo to effectively transduce cells of the eye and / or lacrimal gland. For example, viral particles can be at least 10 8 Vector genomes / ml or greater, e.g., 5 x 10 8 Vector genomes / mL; 10 9 Vector genomes / mL: 5×10 9 Vector genomes / mL, 10 10 Vector genomes / mL, 5 × 10 10 Vector genomes / mL; 10 11 Vector genomes / mL: 5×10 11 Vector genomes / mL; 10 12 Vector genomes / mL: 5×10 12 Vector genomes / mL; 10 13 Vector genomes / mL; 1.5×10 13Vector genomes / mL; 3×10 13 Vector genomes / mL: 5×10 13 Vector genomes / mL: 7.5×10 13 Vector genomes / mL: 9×10 13 Vector genome / mL; 1×10 14 Vector genomes / mL, 5 × 10 14 Vector genomes / mL or greater, but typically 1×10 15 The vector may be formulated at a concentration of up to 10 vector genomes / mL. Similarly, any total number of viral particles may be administered to the mammalian or primate eye suitable to provide the appropriate transduction of cells of the eye and / or lacrimal gland to impart a desired effect or treat a disease. In various embodiments, at least 10 7 ;5×10 7 ;10 8 ;5×10 8 ;10 9 ;5×10 9 , 10 10 , 5×10 10 ;10 11 ;5×10 11 ;10 12 ;5×10 12 ;10 13 ;1.5×10 13 ;3×10 13 ;5×10 13 ;7.5×10 13 ;9×10 13 , 1×10 14 viral particles, or 5 x 10 14 or more virus particles, but typically 1×10 15 The following viral particles are injected: In various embodiments, at least 10 8 ;5×10 8 ;10 9 ;5×10 9 , 10 10 , 5×10 10 ;10 11 ;5×10 11 ;10 12 ;5×10 12 ;10 13 ;1.5×10 13 ;3×1013 ;5×10 13 ;7.5×10 13 ;9×10 13 , 1×10 14 viral particles, or 5 x 10 14 or more virus particles, but typically 1×10 15 The following viral particles are injected: Administration of the vector to the mammalian or primate eye can be done any suitable number of times. In one embodiment, the method includes a single administration, while in other embodiments, multiple administrations are done over time as deemed appropriate by the attending clinician.

[0258] The subject viral vector may be, but is not limited to, 1×10 8 Vector genome or more, e.g., 1 × 10 9 , 1×10 10 , 1×10 11 , 1×10 12 , or 1 × 10 13 Vector genomes or more, in one particular example, 1 × 10 14 Vector genome, typically 4 × 10 15 The viral vector can be formulated into any suitable unit dosage that contains no more than 1×10 vector genome. In some embodiments, the viral vector can be formulated into any suitable unit dosage that contains no more than 1×10 7 , 1×10 8 , 1×10 9 , 1×10 10 , 1×10 11 , 1×10 12 , or 1 × 10 13 The vector can be formulated into any suitable unit dosage that contains at least about 5×10 genomes. In some cases, the unit dosage is at most about 5×10 15 Vector genome, e.g., 1 x 10 14 Vector genome or less, e.g. 1 × 10 13 , 1×10 12 , 1×10 11 , 1×10 10 , or 1 × 10 9 In one particular example, the vector genome is 1 x 10 8 Vector genome or less, typically 1 × 108 More than the vector genome. In some cases, the unit dose is at most about 5×10 15 Vector genome, e.g., 1 x 10 14 Vector genome or less, e.g. 1 × 10 13 , 1×10 12 , 1×10 11 , 1×10 10 , 1×10 9 , 1×10 8 , or 1 × 10 7 The unit dose is 1×10 10 ~1×10 11 In some cases, the unit dose is 1×10 10 ~3×10 12 In some cases, the unit dose is 1×10 9 ~3×10 13 In some cases, the unit dose is 1×10 8 ~3×10 14 The vector genome.

[0259] In some cases, the unit dose of the pharmaceutical composition can be measured using the multiplicity of infection (MOI). MOI refers to the ratio (fold) of vector or virus genome to cells to which the nucleic acid can be delivered. In some cases, the MOI is 1×10 6 It may be possible. So, the MOI is 1×10 5 ~1×10 7 In some cases, the MOI can be 1×10 4 ~1×10 8 In some cases, the MOI of the recombinant virus of the present disclosure may be at least about 1 x 10 1 , 1×10 2 , 1×10 3 , 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 , 1×10 9 , 1×10 10 , 1×10 11 , 1×1012 , 1×10 13 , 1×10 14 , 1×10 15 , 1×10 16 , 1×10 17 , and 1 × 10 18 In some cases, the MOI of the recombinant virus of the present disclosure is 1×10 8 ~3×10 14 In some cases, the MOI of the recombinant virus of the present disclosure is at most about 1 x 10 1 , 1×10 2 , 1×10 3 , 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 , 1×10 9 , 1×10 10 , 1×10 11 , 1×10 12 , 1×10 13 , 1×10 14 , 1×10 15 , 1×10 16 , 1×10 17 , and 1 × 10 18 It is.

[0260] In some embodiments, the amount of the pharmaceutical composition is about 1×10 8 ~Approx. 1×10 15 of recombinant virus, approximately 1 × 10 9 ~Approx. 1×10 14 of recombinant virus, approximately 1 × 10 10 ~Approx. 1×10 13 of recombinant virus, or approximately 1 × 10 11 ~Approx. 3×10 12 This includes recombinant viruses.

[0261] In preparing the subject rAAV compositions, any host cell for producing rAAV virions can be used, including mammalian cells (e.g., 293 cells), insect cells (e.g., SF9 cells), microorganisms, and yeast. The host cell can also be a packaging cell in which the AAV rep and cap genes are stably maintained in the host cell, or a producer cell in which the rAAV virion genome is stably maintained and packaged. Exemplary packaging and producer cells are derived from SF-9, 293, A549, or HeLa cells. The rAAV virions are purified and formulated using standard techniques known in the art.

[0262] In some embodiments, the disclosure provides for the use of a rAAV virion described herein in the manufacture of a medicament. In some embodiments, the disclosure provides for the use of a rAAV virion described herein in the manufacture of a medicament for use in the methods described herein.

[0263] In some embodiments, the disclosure provides a kit comprising a rAAV as described herein and instructions for use. In some embodiments, the kit comprises a rAAV as described herein, a package insert comprising instructions for using the kit. In some embodiments, the kit comprises a rAAV as described herein, and a pharma- ceutically acceptable carrier, or a pharmaceutical composition comprising the rAAV, and instructions for treating or slowing the progression of a disease, disorder, or condition described herein in a subject in need thereof.

[0264] Exemplary embodiments The present disclosure relates to the following embodiments. Throughout this section, the term embodiment is abbreviated to "E" followed by an ordinal number. For example, EI-1 corresponds to embodiment I-1.

[0265] Embodiment I-1. A method of treating an ocular disease in a subject in need thereof, comprising administering a recombinant adeno-associated virus (rAAV) virion to at least one eye of the subject or to at least one lacrimal gland of the subject's eye, wherein the rAAV virion comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter.

[0266] Embodiment I-2. The method of embodiment I-1, wherein the rAAV virion is administered to the lacrimal gland of the subject.

[0267] Embodiment I-3. The method of embodiment I-2, wherein the lacrimal gland is either the main lacrimal gland or one of the Wolfring's gland or the Clauss' gland of the subject.

[0268] Embodiment I-4. The method of embodiment I-2, wherein the lacrimal gland is the primary lacrimal gland.

[0269] Embodiment I-5. The method of any one of embodiments I-2 to I-4, wherein cells within the lacrimal gland are transduced with rAAV virions.

[0270] Embodiment I-6. The method of embodiment I-5, wherein the transduced cells in the lacrimal gland express an effective amount of the neurotrophic factor to the tear film and optionally the ocular surface of the subject.

[0271] Embodiment I-7. The method of any one of embodiments I-1 to I-6, wherein the neurotrophic factor is a nerve growth factor (NGF) protein.

[0272] Embodiment I-8. The method of embodiment I-7, wherein the polynucleotide encoding the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:2.

[0273] Embodiment I-9. The method of embodiment I-7, wherein the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:1.

[0274] Embodiment I-10. The method of embodiment I-7, wherein the NGF protein comprises SEQ ID NO:1.

[0275] Embodiment I-11. The method of embodiment I-7, wherein the polynucleotide encoding the NGF protein comprises SEQ ID NO:2.

[0276] Embodiment I-12. The method of any one of embodiments I-1 to I-6, wherein the neurotrophic factor is a glial-derived neurotrophic factor (GDNF) protein.

[0277] Embodiment I-13. The method of embodiment I-12, wherein the polynucleotide encoding the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:4.

[0278] Embodiment I-14. The method of embodiment I-12, wherein the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:3.

[0279] Embodiment I-15. The method of embodiment I-12, wherein the GDNF protein comprises SEQ ID NO:3.

[0280] Embodiment I-16. The method of embodiment I-12, wherein the polynucleotide encoding the GDNF protein comprises SEQ ID NO:4.

[0281] Embodiment I-17. The AAV capsid is AAV2 VP1 (SEQ ID NO:6), AAV2 The method of any one of embodiments I-1 to I-16, wherein the nucleic acid shares at least 95%, 98%, or 100% identity with VP3 (SEQ ID NO: 8), AAV5 (SEQ ID NO: 10), AAV8 (SEQ ID NO: 12), or AAV9 (SEQ ID NO: 14).

[0282] Embodiment I-18. The method of any one of embodiments I-1 to I-17, wherein the promoter is a CAG promoter (SEQ ID NO:5).

[0283] Embodiment I-19. The eye disease is a chemical burn of the ocular surface, a corneal wound, a corneal ulcer, a persistent epithelial The method of any one of embodiments I-1 to I-18, wherein the causes of the corneal nerve deficiency are glaucoma, dry eye disease, neurotrophic keratitis, herpes simplex virus infection of the trigeminal nerve and / or eye, varicella zoster virus infection of the trigeminal nerve and / or eye, and diabetic complications of the corneal nerve.

[0284] Embodiment I-20. The method of any one of embodiments I-1 to I-19, wherein one or more symptoms of the ocular disease are alleviated compared to a symptom of the ocular disease prior to administration of the rAAV virion.

[0285] Embodiment I-21. The method of any one of embodiments I-1 to I-20, wherein one or more symptoms of the ocular disease are alleviated compared to symptoms of the ocular disease in an untreated control subject.

[0286] Embodiment I-22. The method of any one of embodiments I-1 to I-21, wherein one or more symptoms of the ocular disease are alleviated relative to the symptoms of the ocular disease in the contralateral eye.

[0287] Embodiment I-23. A recombinant adeno-associated virus (rAAV) virion comprising an AAV capsid and an expression cassette, the expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter.

[0288] Embodiment I-24. The rAAV virion of embodiment I-23, wherein the neurotrophic factor is a nerve growth factor (NGF) protein.

[0289] Embodiment I-25. The rAAV virion of embodiment I-24, wherein the polynucleotide encoding the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:2 or SEQ ID NO:17.

[0290] Embodiment I-26. The rAAV virion of embodiment I-24, wherein the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:1.

[0291] Embodiment I-27. The rAAV virion of embodiment I-24, wherein the NGF protein comprises SEQ ID NO:1.

[0292] Embodiment I-28. The rAAV virion of embodiment I-24, wherein the polynucleotide encoding the NGF protein is SEQ ID NO:2 or SEQ ID NO:17.

[0293] Embodiment I-29. The rAAV virion of embodiment I-23, wherein the neurotrophic factor is a glial-derived neurotrophic factor (GDNF) protein.

[0294] Embodiment I-30. The rAAV virion of embodiment I-29, wherein the polynucleotide encoding the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:4 or SEQ ID NO:18.

[0295] Embodiment I-31. The rAAV virion of embodiment I-29, wherein the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:3.

[0296] Embodiment I-32. The rAAV virion of embodiment I-29, wherein the GDNF protein comprises SEQ ID NO:3.

[0297] Embodiment I-33. The rAAV virion of embodiment I-29, wherein the polynucleotide encoding the GDNF protein is SEQ ID NO:4 or SEQ ID NO:18.

[0298] Embodiment I-34. The AAV capsid is AAV2 VP1 (SEQ ID NO:6), AAV2 The rAAV virion of any one of embodiments I-23 to I-33, comprising a VP3 that shares at least 95%, 98%, or 100% identity with VP3 (SEQ ID NO:8), AAV5 (SEQ ID NO:10), AAV8 (SEQ ID NO:12), or AAV9 (SEQ ID NO:14).

[0299] Embodiment I-35. The rAAV virion of any one of embodiments I-23 to I-34, wherein the promoter is a CAG promoter (SEQ ID NO:5) or a CMV promoter (SEQ ID NO:16).

[0300] Embodiment I-36. The rAAV virion of embodiment I-23, wherein the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:23.

[0301] Embodiment I-37. The rAAV virion of embodiment I-23, wherein the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:24.

[0302] Embodiment I-38. The rAAV virion of embodiment I-23, wherein the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:25.

[0303] Embodiment I-39. A recombinant adeno-associated virus (rAAV) virion comprising an expression cassette comprising the polynucleotide of SEQ ID NO:25.

[0304] Embodiment I-40. The rAAV of embodiment I-39, wherein the rAAV comprises an AAV capsid.

[0305] Embodiment I-41. The AAV capsid is AAV2 VP1 (SEQ ID NO:6), AAV2 The rAAV of embodiment I-40, which shares at least 95%, 98%, or 100% identity with VP3 (sequence number 8), AAV5 (sequence number 10), AAV8 (sequence number 12), or AAV9 (sequence number 14).

[0306] Embodiment I-42. A composition comprising a rAAV virion, wherein the rAAV virion comprises: (a) AAV capsid, and (b) an expression cassette, the expression cassette comprising a polynucleotide that shares at least 95% identity with SEQ ID NO:2 or SEQ ID NO:17, wherein the polynucleotide is linked to a promoter.

[0307] Embodiment I-43. A composition comprising a rAAV virion, wherein the rAAV virion comprises: (a) AAV capsid, and (b) an expression cassette, the expression cassette comprising a polynucleotide that shares at least 95% identity with SEQ ID NO:4 or SEQ ID NO:18, wherein the polynucleotide is linked to a promoter.

[0308] Embodiment I-44. A composition comprising a rAAV virion, wherein the rAAV virion comprises: (a) an AAV2, AAV5, AAV8, or AAV9 capsid, and (b) an expression cassette, the expression cassette comprising a polynucleotide that shares at least 95% identity with SEQ ID NO:2 or SEQ ID NO:17, the polynucleotide being linked to a promoter (concatenated)

[0309] Embodiment I-45. A composition comprising a rAAV virion, wherein the rAAV virion comprises: (a) an AAV2, AAV5, AAV8, or AAV9 capsid, and (b) an expression cassette, the expression cassette comprising a polynucleotide that shares at least 95% identity with SEQ ID NO:4 or SEQ ID NO:18, wherein the polynucleotide is linked to a promoter.

[0310] Embodiment I-46. The AAV capsid is AAV2 VP1 (SEQ ID NO:6), AAV2 The composition of any one of embodiments I-42 to I-45, sharing at least 95%, 98%, or 100% identity with VP3 (sequence number 8), AAV5 (sequence number 10), AAV8 (sequence number 12), or AAV9 (sequence number 14).

[0311] Embodiment I-47. The composition of any one of embodiments I-42 to I-45, wherein the AAV capsid is AAV2.

[0312] Embodiment I-48. The composition of any one of embodiments I-42 to I-45, wherein the AAV capsid is AAV5.

[0313] Embodiment I-49. The composition of any one of embodiments I-42 to I-45, wherein the AAV capsid is AAV9.

[0314] Embodiment I-50. A composition comprising a rAAV virion, wherein the rAAV virion comprises: (a) AAV2 capsid, and (b) an expression cassette, the expression cassette comprising a polynucleotide that shares at least 95% identity with SEQ ID NO:25.

[0315] Embodiment I-51. A composition comprising a rAAV virion, wherein the rAAV virion comprises: (a) AAV5 capsid, and (b) an expression cassette, the expression cassette comprising a polynucleotide that shares at least 95% identity with SEQ ID NO:25.

[0316] Embodiment I-52. A composition comprising a rAAV virion, wherein the rAAV virion comprises: (a) AAV9 capsid, and (b) an expression cassette, the expression cassette comprising a polynucleotide that shares at least 95% identity with SEQ ID NO:25.

[0317] Embodiment I-53. A pharmaceutical composition comprising the rAAV virion of any one of embodiments I-23 to I-41, or the composition of any one of embodiments I-42 to I-52, and a pharma- ceutically acceptable carrier.

[0318] About 1 x 10 per milliliter of rAAV virions 7 ~Approx. 1×10 14The pharmaceutical composition of embodiment I-53, comprising a genomic copy.

[0319] About 1 x 10 per milliliter of rAAV virions 12 ~Approx. 6.2×10 12 The pharmaceutical composition of embodiment I-53, comprising a genomic copy.

[0320] Embodiment I-56. The pharmaceutical composition of any one of embodiments I-53 to I-55, which is formulated for administration to the lacrimal gland.

[0321] Embodiment I-57. The pharmaceutical composition of any one of embodiments I-53 to I-55, which is formulated for administration to the ocular surface.

[0322] Embodiment I-58. The pharmaceutical composition of any one of Embodiments I-53 to I-57, formulated for use, or adapted for use, in the treatment of an ophthalmic disease, disorder, or condition.

[0323] Embodiment I-59. A method for treating an eye disease in a subject in need thereof, comprising administering an effective amount of the pharmaceutical composition of any one of embodiments I-53 to I-58 to the eye of the subject or to an ocular gland of the subject.

[0324] Embodiment I-60. The method of embodiment I-59, wherein the rAAV virion is administered to the lacrimal gland of the subject.

[0325] Embodiment I-61. The method of embodiment I-60, wherein cells within the lacrimal gland are transduced with rAAV virions.

[0326] Embodiment I-62. The method of embodiment I-61, wherein the transduced cells in the lacrimal gland express an effective amount of the neurotrophic factor to the tear film and optionally the ocular surface of the subject.

[0327] Embodiment I-63. The method of any one of embodiments I-59 to I-62, wherein the eye disease is neurotrophic keratitis.

[0328] Embodiment I-64. The method of any one of embodiments I-59 to I-63, wherein one or more symptoms of the ocular disease are alleviated compared to a symptom of the ocular disease prior to administration of the rAAV virion.

[0329] Embodiment I-65. The method of any one of embodiments I-59 to I-64, wherein one or more symptoms of the ocular disease are alleviated compared to symptoms of the ocular disease in an untreated control subject.

[0330] Embodiment I-66. The method of any one of embodiments I-59 to I-65, wherein one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease in the contralateral eye.

[0331] Embodiment I-67. The rAAV virion of any one of embodiments I-23 to I-41, the composition of any one of embodiments I-42 to I-52, or the pharmaceutical composition of any one of embodiments I-53 to I-58, for use in the method of any one of embodiments I-1 to I-22.

[0332] Embodiment I-68. Use of the rAAV virion of any one of embodiments I-23 to I-41 or the composition of any one of embodiments I-42 to I-52 in the manufacture of a medicament for use in the method of any one of embodiments I-1 to I-22.

[0333] Embodiment I-69. A kit comprising a rAAV virion of any one of embodiments I-23 to I-41, a composition of any one of embodiments I-42 to I-52, or a pharmaceutical composition of any one of embodiments I-53 to I-58, for use in a method of any one of embodiments I-1 to I-22, and instructions.

[0334] Embodiment I-70. Use in a method for treating an ocular disorder in a subject in need thereof 1. A method for administering to at least one eye of a subject or to at least one lacrimal gland of an eye of a subject, the method comprising administering a recombinant adeno-associated virus (rAAV) virion to at least one eye of a subject or to at least one lacrimal gland of the eye of a subject, the rAAV comprising an AAV capsid and an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter.

[0335] Embodiment I-71. The rAAV virion for use in embodiment I-70, wherein the rAAV virion is administered to the lacrimal gland of a subject.

[0336] Embodiment I-72. The rAAV virion for use in embodiment I-71, wherein cells in the lacrimal gland are transduced with the rAAV virion.

[0337] Embodiment I-73. The rAAV virion for use in any one of embodiments I-70 to I-72, wherein the neurotrophic factor is a nerve growth factor (NGF) protein.

[0338] Embodiment I-74. The rAAV virion for use in any one of embodiments I-70 to I-72, wherein the neurotrophic factor is a glial-derived neurotrophic factor (GDNF) protein.

[0339] Embodiment I-75. The rAAV virion for use in any one of embodiments I-70 to I-74, wherein the ocular disease is selected from chemical burns of the ocular surface, corneal wounds, persistent epithelial defects, dry eye disease, neurotrophic keratitis, herpes simplex virus infection of the trigeminal nerve and / or eye, varicella zoster virus infection of the trigeminal nerve and / or eye, and diabetic complications of the corneal nerve.

[0340] Some embodiments of the present disclosure relate to the following embodiment II.

[0341] Embodiment II-1. A method of treating an ocular disease in a subject in need thereof, comprising administering a recombinant adeno-associated virus (rAAV) virion to at least one eye of the subject or to at least one lacrimal gland of the subject's eye, wherein the rAAV virion comprises an AAV capsid and an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter.

[0342] The method of embodiment II-1, wherein the rAAV virion is administered to the lacrimal gland of the subject.

[0343] Embodiment II-3. The method of embodiment II-2, wherein the lacrimal gland is the main lacrimal gland.

[0344] Embodiment II-4. The method of embodiment II-2, wherein the lacrimal gland is either the main lacrimal gland or one of the Wolfring's gland or the Claus's gland of the subject.

[0345] Embodiment II-5. The method of any one of embodiments II-2 to II-4, wherein cells within the lacrimal gland are transduced with rAAV virions.

[0346] Embodiment II-6. The method of embodiment II-5, wherein the transduced cells in the lacrimal gland express a therapeutically effective amount of the neurotrophic factor to the tear film and optionally the ocular surface of the subject.

[0347] Embodiment II-7. The method of any one of embodiments II-1 to II-6, wherein the neurotrophic factor is a nerve growth factor (NGF) protein.

[0348] Embodiment II-8. The polynucleotide encoding the NGF protein is SEQ ID NO:2 The method of embodiment II-7, comprising a sequence that shares at least 95% identity with

[0349] Embodiment II-9. The method of embodiment II-7, wherein the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:1.

[0350] Embodiment II-10. The method of embodiment II-7, wherein the NGF protein comprises SEQ ID NO:1.

[0351] Embodiment II-11. The method of embodiment II-7, wherein the polynucleotide encoding the NGF protein comprises SEQ ID NO:2.

[0352] Embodiment II-12. The method of any one of embodiments II-1 to II-6, wherein the neurotrophic factor is a glial-derived neurotrophic factor (GDNF) protein.

[0353] Embodiment II-13. The method of embodiment II-12, wherein the polynucleotide encoding the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:4.

[0354] Embodiment II-14. The method of embodiment II-12, wherein the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:3.

[0355] Embodiment II-15. The method of embodiment II-12, wherein the GDNF protein comprises SEQ ID NO:3.

[0356] Embodiment II-16. The method of embodiment II-12, wherein the polynucleotide encoding the GDNF protein comprises SEQ ID NO:4.

[0357] Embodiment II-17. The method of any one of embodiments II-1 to II-6, wherein the AAV capsid shares at least 95%, 98%, or 100% identity with AAV2 VP1 (SEQ ID NO:6), AAV2 VP3 (SEQ ID NO:8), AAV5 (SEQ ID NO:10), AAV8 (SEQ ID NO:12), or AAV9 (SEQ ID NO:14).

[0358] Embodiment II-18. The method of any one of embodiments II-1 to II-16, wherein the promoter is a CAG promoter (SEQ ID NO:5).

[0359] Embodiment II-19. The method of any one of embodiments II-1 to II-18, wherein the ocular disease is a chemical burn of the ocular surface, a corneal wound, a corneal ulcer, a persistent epithelial defect, dry eye disease, neurotrophic keratitis, a herpes simplex virus infection of the trigeminal nerve and / or eye, a varicella zoster virus infection of the trigeminal nerve and / or eye, and a diabetic complication of the corneal nerve.

[0360] Embodiment II-20. The method of any one of embodiments II-1 to II-19, wherein one or more symptoms of the ocular disease are alleviated compared to a symptom of the ocular disease prior to administration of the rAAV virion.

[0361] Embodiment II-21. The method of any one of embodiments II-1 to II-20, wherein one or more symptoms of the ocular disease are alleviated compared to symptoms of the ocular disease in an untreated control subject.

[0362] Embodiment II-22. The method of any one of embodiments II-1 to II-21, wherein one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease in the contralateral eye.

[0363] Embodiment II-23. A recombinant adeno-associated virus (rAAV) virion comprising an AAV capsid and an expression cassette comprising a polynucleotide encoding a neurotrophic factor operably linked to a promoter.

[0364] Embodiment II-24. The rAAV virion of embodiment II-23, wherein the neurotrophic factor is a nerve growth factor (NGF) protein.

[0365] Embodiment II-25. The rAAV virion of embodiment II-24, wherein the polynucleotide encoding the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:2 or SEQ ID NO:17.

[0366] Embodiment II-26. The rAAV virion of embodiment II-24, wherein the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:1.

[0367] Embodiment II-27. The rAAV virion of embodiment II-24, wherein the NGF protein comprises SEQ ID NO:1.

[0368] Embodiment II-28. The rAAV virion of embodiment II-24, wherein the polynucleotide encoding the NGF protein is SEQ ID NO:2 or SEQ ID NO:17.

[0369] Embodiment II-29. The rAAV virion of embodiment II-23, wherein the neurotrophic factor is a glial-derived neurotrophic factor (GDNF) protein.

[0370] Embodiment II-30. The rAAV virion of embodiment II-29, wherein the polynucleotide encoding the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:4 or SEQ ID NO:18.

[0371] Embodiment II-31. The rAAV virion of embodiment II-29, wherein the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:3.

[0372] Embodiment II-32. The rAAV virion of embodiment II-29, wherein the GDNF protein comprises SEQ ID NO:3.

[0373] Embodiment II-33. The rAAV virion of embodiment II-29, wherein the polynucleotide encoding the GDNF protein is SEQ ID NO:4 or SEQ ID NO:19.

[0374] Embodiment II-34. The rAAV virion of any one of embodiments II-23 to II-33, wherein the AAV capsid comprises a VP3 that shares at least 95%, 98%, or 100% identity with AAV2 VP1 (SEQ ID NO:6), AAV2 VP3 (SEQ ID NO:8), AAV5 (SEQ ID NO:10), AAV8 (SEQ ID NO:12), or AAV9 (SEQ ID NO:14).

[0375] Embodiment II-35. The rAAV virion of any one of embodiments II-23 to II-34, wherein the promoter is a CAG promoter (SEQ ID NO:5) or a CMV promoter (SEQ ID NO:16).

[0376] Embodiment II-36. The rAAV virion of embodiment II-23, wherein the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:23.

[0377] Embodiment II-37. The rAAV virion of embodiment II-23, wherein the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:24.

[0378] Embodiment II-38. A pharmaceutical composition comprising the rAAV virion of any one of embodiments II-23 to II-37 and a pharma- ceutical acceptable carrier.

[0379] About 1 x 10 per milliliter of rAAV virions 9 ~Approx. 1×10 14 The pharmaceutical composition of embodiment II-38, comprising a genomic copy.

[0380] About 1 x 10 per milliliter of rAAV virions 12 ~Approx. 6.2×10 12 The pharmaceutical composition of embodiment II-38, comprising a genomic copy.

[0381] Embodiment II-41. A method for treating an eye disease in a subject in need thereof, comprising administering a therapeutically effective amount of a pharmaceutical composition of any one of embodiments II-38 to II-40 to the eye of the subject or to an ocular gland of the subject.

[0382] Embodiment II-42. The method of embodiment II-41, wherein the rAAV virion is administered to the lacrimal gland of the subject.

[0383] Embodiment II-43. The method of embodiment II-42, wherein cells within the lacrimal gland are transduced with rAAV virions.

[0384] Embodiment II-44. The method of embodiment II-43, wherein the transduced cells in the lacrimal gland express a therapeutically effective amount of the neurotrophic factor to the tear film and optionally the ocular surface of the subject.

[0385] Embodiment II-45. The method of any one of embodiments II-41 to II-44, wherein the eye disease is neurotrophic keratitis.

[0386] Embodiment II-46. The method of any one of embodiments II-41 to II-45, wherein one or more symptoms of the ocular disease are alleviated compared to a symptom of the ocular disease prior to administration of the rAAV virion.

[0387] Embodiment II-47. The method of any one of embodiments II-41 to II-46, wherein one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease in an untreated control subject.

[0388] Embodiment II-48. The method of any one of embodiments II-41 to II-46, wherein one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease in the contralateral eye.

[0389] Embodiment II-49. The rAAV virion of any one of embodiments II-23 to II-34 or the pharmaceutical composition of any one of embodiments II-35 to II-38 for use in the method of any one of embodiments II-1 to II-22.

[0390] Embodiment II-50. Use of the rAAV virion of any one of embodiments II-23 to II-37 in the manufacture of a medicament for use in the method of any one of embodiments II-1 to II-22.

[0391] Embodiment II-51. A rAAV virion or a virion according to any one of embodiments II-23 to II-37 for use in the method according to any one of embodiments II-1 to II-22. A kit comprising the pharmaceutical composition of any one of Forms II-38 to II-40, and instructions. EXAMPLES

[0392] The specific examples below are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

[0393] Example 1: Expression of rAAV-delivered GFP transgene in lacrimal glands via intralacrimal injection This example illustrates a 9-day pilot study of a single intralacrimal injection of rAAV virions in Dutch Belted rabbits. The efficacy and tolerability of a panel of rAAV virion embodiments administered once via injection into the lacrimal gland are evaluated. Each rAAV virion composition in the panel is administered at two concentrations (1×10 12 GC / mL and 6.2×10 12 The panel of rAAV virions included embodiments comprising capsid proteins with AAV2, AAV5, AAV8, and AAV9 serotypes. The expression cassette delivered by the rAAV virion encodes an enhanced green fluorescent protein (eGFP) transgene operably linked to a CMV promoter (as shown in FIG. 1C). This approach assessed the feasibility of capsid protein serotypes AAV2, AAV5, AAV8, and AAV9 to deliver a transgene to cells of the lacrimal gland and result in measurable CAG promoter-driven expression of the transgene within the cells.

[0394] Animal studies were performed at Charles River Laboratories (CRL) facilities by CRL staff scientific personnel.

[0395] Animal Testing Systems, Husbandry, and In-life Monitoring The animals used in this study were male Dutch Belted rabbits, 4-5 months old and weighing 1.3-2.3 kg. The animals were allowed to acclimate for 10 days before treatment began. Each animal was housed individually and managed using standard caregiving protocols, including normal environmental conditions, feeding schedules, and veterinary care.

[0396] rAAV Virion Compositions and Formulations In this study, a panel of compositions comprising rAAV virions containing an expression cassette encoding an eGFP transgene operably linked to a CAG promoter are prepared for intralacrimal injection under the conditions in Table 4. Each composition contains rAAV virions with a different AAV capsid protein serotype. The compositions are labeled OC-100a-d, each corresponding to a different AAV capsid protein serotype. Dosage formulations for intralacrimal injection were prepared using a clean procedure at the target concentrations listed in Table 4 below by dilution with phosphate buffered saline solution.

[0397] [Table 12]

[0398] Intralacrimal injection of rAAV compositions On study day 1, animals were dosed via intralacrimal injection. A summary of the formulation concentration, dose, dose times, and number of animals and lacrimal glands for each composition tested is provided in Table 5. Prior to injection, animals were anesthetized with an intramuscular injection of dexmedetomidine (0.25 mg / kg), followed by administration of an isoflurane / oxygen mixture via mask to maintain anesthesia as needed. After dosing, each eye was given a topical antibiotic.

[0399] [Table 13]

[0400] Bioanalysis All animals were bled pre-dose on day 1 and again from an ear vein on days 8 and 9. Blood samples were placed on ice until plasma was separated by centrifugation. Plasma samples were divided into 250 μL aliquots and frozen at −80° C. for subsequent analysis.

[0401] Schirmer tear test was performed to collect ocular fluid from the animals on days 8 and 9. The strip was placed on the inside of the lower eyelid for approximately 1 minute. The paper was removed, placed in a separate tube, and frozen at -80°C for subsequent analysis.

[0402] Plasma samples and Schirmer test strips were analyzed for eGFP and eGFP mRNA concentrations using validated procedures at Syneos analytical laboratories. Analysis of plasma samples did not detect eGFP protein or eGFP mRNA, indicating that intralacrimal delivery of rAAV did not induce cell lysis. This result suggests that the lacrimal administration route can be safely used for rAAV delivery.

[0403] Immunohistochemistry of lacrimal gland tissue After blood and ocular fluid collection on day 9, animals were euthanized by intravenous injection of sodium pentobarbital. Five left eye sagittal sections and sections of the left and right lacrimal glands were prepared for immunohistochemistry (IHC) according to standard operating procedures at Charles River Laboratories. Lacrimal gland IHC samples were stained for eGFP and subjected to microscopic evaluation.

[0404] Microscopic evaluation was performed to determine the efficiency of eGFP expression in lacrimal gland tissue administered in vivo with the rAAV composition. Isolated positive acinar cells in IHC samples had pink to red cytoplasmic staining indicative of GFP expression (Figure 6A-6K; exemplary staining indicated by black arrows). 12 rAAV composition containing AAV2 capsid protein (OC-100a) at 1 × 10 GC / mL (Figure 6A) 12 GC / mL (Figure 6B) and 6.2 × 10 12Both rAAV compositions containing AAV5 capsid protein at 6.2 × 10 GC / mL (Figures 6C-6H) and 12 Positive eGFP expression was observed for rAAV compositions containing AAV9 capsid protein at GC / mL (Figures 6I-6K).

[0405] conclusion These results of this example demonstrate that rAAV virions can be used to deliver an expression cassette to the lacrimal gland by direct injection. The results also demonstrate that rAAV virions containing capsid proteins with at least AAV2, AAV5, or AAV9 serotypes can be used to deliver an expression cassette to cells in the lacrimal gland. Furthermore, these results demonstrate that delivery of an expression cassette comprising a transgene operably linked to a CAG promoter sequence results in expression of the transgene in cells of the lacrimal gland.

[0406] Example 2 Expression of neurotrophic factors in the lacrimal gland delivered by rAAV via intralacrimal injection This example describes a 7-day single-dose study of AAV vectors administered by intralacrimal injection followed by varenicline administered as a single intranasal dose in Dutch-belted rabbits. Tolerability and efficacy of various AAV vectors were evaluated at two dose levels (1 × 10 as a 100 μL injection). 12 GC / mL or 6.2 x 10 12 The study will evaluate a single dose of varenicline nasal solution (1.2 mg / mL as a 50 μL spray) administered to each nostril of subjects. Specifically, the primary objective of this study design is twofold: (1) To evaluate transduction of the lacrimal gland using adeno-associated viral vectors of serotype 2, 5, or 9 (AAV2, AAV5, AAV9) containing expression cassettes encoding either human nerve growth factor (hNGF) or human glial-derived neurotrophic factor (hGDNF) administered via intralacrimal gland injection. hNGF and hGDNF proteins are neutrophilic factors involved in the maintenance and health of the corneal surface. (2) To evaluate the increase in the relative amount of proteins present on the ocular surface by stimulating tear production with varenicline nasal spray.

[0407] [ka]

[0408] In this study, experimental viral vectors or control vectors are administered into the lacrimal glands of Dutch-belted rabbits. The AAVx.hNGF and AAVx.hGDNF (x is 2, 5, or 9) vectors contain transgenes encoding hNGF and hGDNF proteins, respectively. hNGF and hGDNF are exemplary therapeutic proteins that demonstrate the feasibility of AAV-delivered transgene expression in tears, and their secretion into the tear film can be increased using a tear inducing agent such as varenicline. AAVx.nNGF and AAVx.hGDNF were administered at 6.2 × 10 11 The dose is given in GC / mL. A vehicle control is used for comparison.

[0409] Animals are evaluated under anesthesia by slit lamp biomicroscopy using blue light and appropriate filters on day 7. The evaluations are documented along with slit lamp photographs.

[0410] On day 8, animals were administered a single 50 μL nasal spray of 1.2 mg / mL varenicline in each nostril. Immediately or within minutes of administration, animals are evaluated under anesthesia by slit lamp biomicroscopy using blue light and appropriate filters. The evaluation is recorded along with slit lamp photographs.

[0411] method Administration (route): intralacrimal injection, 100 μL in each lacrimal gland. Administration frequency: single injection in each lacrimal gland. Procedure: Under anesthesia, approximately 100 μL of Reference Product 1 (PBS + 0.001% F68), AAVx.hNGF (6.2 × 10 11 GC / mL), or AAVx.hNGF (6.2 × 10 11Administer 0.1 mL of Reference 1, AAVx.hNGF (6.2x10 GC / mL) to each lacrimal gland under direct vision. The lacrimal gland injection procedure is as follows: (1) make a vertical incision under the right (OD) upper eyelid; (2) extend blunt dissection to the superior orbital rim until the lacrimal gland is visible; (3) inject 0.1 mL of Reference 1, AAVx.hNGF (6.2x10 GC / mL) into the lacrimal gland. 12 GC / mL), or AAVx.hNGF (6.2 × 10 12 (GC / mL) is injected using a 1 mL sterile syringe with a 27G x ½ inch sterile needle; (4) the incision is closed with suture / cyanoacrylate glue; and (5) the procedure is repeated for the left (OS) lacrimal gland. Gene therapy administration is summarized in Table 6.

[0412] [Table 14]

[0413] Nasal drops tear irritation Administration (route): intranasal spray, both nostrils. Administration frequency: one single dose; one spray of 50 μL to each nostril; day 8. Procedure: Animals receive 50 μL sprays to each nostril using an Aptar preservative-free nasal pump filled with 1.2 mg / ml varenicline solution. Termination: day 8. Nasal spray tear irritation is summarized in Table 7.

[0414] [Table 15]

[0415] Quantification of transgene mRNA in lacrimal gland tissue The required sections of lacrimal gland (0.005 g to ~0.025 g) should be immediately placed in RNAlater® (completely immersed) and stored at room temperature, with a minimum of 8 hours at 4°C. The samples were then transferred to a refrigerator set to -80°C and stored overnight. The next day, the RNAlater® was removed and the samples were frozen and stored in a freezer set to -80°C. Samples were analyzed for hNGF expression using RT-qPCR.

[0416] Samples of 0.005g to 0.01g will be taken from the right side from the dural glands, optic nerve, trigeminal nerve, nasal cavity by epithelial cell scraping, nictitating membrane, and extraocular muscles, placed in RNAlater (completely immersed), stored at room temperature, and within 8 hours transferred to a refrigerator set to maintain a temperature of 4°C and stored overnight. The next day, the RNAlater® will be removed and the samples will be frozen and stored in a freezer set to keep at -80°C for vgDNA and mRNA analysis.

[0417] Immunohistochemistry (IHC) Histology Appropriate sections of the left and right lacrimal glands were taken for morphological and immunohistochemical evaluation. The samples were embedded in 4% paraformaldehyde and fixed in 70% ethanol. After paraffin blocking, 5-μm-thick sections were obtained and mounted on slides. One section per sample was stained with H&E and also subjected to immunohistochemical staining. hNGF staining was performed using anti-hNGF antibody. Slides were observed and hNGF protein expression was evaluated from images taken under a microscope.

[0418] Schirmer test On days 7, 14, 21, 28, 41, and 42, Schirmer tear test was performed to collect ocular fluid from the animals. The strip was placed inside the lower eyelid for approximately 1 minute. The paper was removed and placed in a separate tube and frozen at -80°C for later analysis. Schirmer test strips were collected after intranasal administration of varenicline on days 21, 28, and 41. The strip was placed inside the lower eyelid for approximately 1 minute. The paper was removed and placed in a separate tube and frozen at -80°C for later analysis. The protein content absorbed by the Schirmer test strips was analyzed for the concentration of hNGF by ELISA assay.

[0419] result Quantitation of transgene mRNA in lacrimal gland tissue is shown in Table 8.

[0420] [Table 16]

[0421] All tissues from vehicle control animals were negative for bGH gene expression, indicating that cross-contamination from animal dosing, sample collection, RNA extraction, and RT-qPCR analysis was well controlled. rAAV vector-derived hGDNF mRNA was detected in all injected lacrimal gland tissues. In groups 3-6, some injected lacrimal gland tissues had hNGF or hGDNF mRNA with ss copy numbers ranging from 1151 to 585,401 per μg of total RNA, while others had no detectable vector-derived mRNA.

[0422] The lacrimal gland tissue was further evaluated for hNGF expression using immunohistochemistry (FIGS. 7A-7E). After intralacrimal injection, the animals were euthanized and sections of the injected lacrimal gland were prepared for immunohistochemistry (IHC). Lacrimal gland IHC samples were stained for hNGF and subjected to microscopic evaluation. Microscopic evaluation was performed to determine the efficiency of hNGF expression in lacrimal gland tissue administered in vivo with rAAV compositions. FIG. 7A and FIG. 7D-7E show exemplary examples of IHC staining in lacrimal glands of rabbits injected with rAAV having the AAV9 serotype (exemplary staining is indicated by black arrows). The hNGF stained tissue shows strong expression of the hNGF transgene. Results are confirmed by comparison with negative control samples (FIGS. 7B and 7C), which show little staining, thus ruling out background staining. These results demonstrate that intralacrimal injection of rAAV can be used to deliver and express neurotrophic factor transgenes, such as hNGF, in lacrimal gland tissue.

[0423] On days 7 and 14 after administration of rAAV, Schirmer tear test was performed to collect ocular fluid from the animals. The strip was placed inside the lower eyelid for approximately 1 minute. The paper was removed and placed in a separate tube and frozen at -80°C for later analysis. The strip was placed inside the lower eyelid for approximately 1 minute. The paper was removed and placed in a separate tube and frozen at -80°C for later analysis. The amount of protein absorbed by the Schirmer test strip was analyzed for the concentration of hNGF by ELISA assay.

[0424] Schirmer test strips were analyzed for the concentration of hNGF in the collected tear film (Figure 8). A normal NGF concentration in tears is expected to be approximately 50 pg / mL. Following intralacrimal administration of rAAV9.hNGF or rAAV2.hNGF, the hNGF concentration was more than 100-fold above normal. By day 14, the hNGF concentration in rabbits administered rAAV9.hNGF was normal. hNGF concentrations in rabbits treated with rAAV2.hNGF decreased but remained much higher than in the no-rAAV control group. Rabbits treated with rAAV5.hNGF showed an increase in hNGF concentrations on day 7, which decreased back to control levels by day 14.

[0425] Collectively, these results demonstrate that neurotrophic factors such as hNGF and hGDNF are expressed as transgenes when delivered via intralacrimal injection of rAAV, including AAV2, AAV5, and AAV9 serotypes, with the AAV9 serotype showing the best results.

[0426] Example 3: Expression of EGFP transgene delivered by rAAV via intralacrimal injection in porcine lacrimal glands The goal of this study was to evaluate whether the lacrimal gland could be exploited as a method to modify or enrich the tear film with a protein of interest in pigs. We then performed in vivo studies to determine whether EGFP is produced in the acinar cells of the lacrimal gland and secreted into the tear film after delivery of an adenoviral vector consisting of a plasmid encoding eGFP. To obtain cDNA encoding EGFP in acinar cells, our approach involved delivering an adeno-associated virus (AAV) containing a cDNA encoding secreted EGFP (secEGFP) into the lacrimal gland. To generate AAVs of two different serotypes (2 and 9) for secEGFP, we generated AAV transfer plasmids that contain the elements essential for secEGFP expression between the inverted terminal repeats (ITRs). The DNA sequence between the ITRs was packaged into the generated AAVs (Figure 9).

[0427] Eleven serotypes of AAV have been identified, with AAV2 being the best characterized. AAV pseudotyping is the mixing of capsids and genomes of different serotypes to improve transduction efficiency, and these serotypes are indicated with a slash. For example, AAV2 / 5 indicates a virus containing serotype 2 packaged in a capsid from serotype 5. It has been reported that AAV5 and AAV9 can deliver a luciferase reporter gene to the lacrimal gland of mice (Non-Patent Document 6). Mouse lacrimal gland transduction with GFP and mouse nerve growth factor (mNGF) has been observed with pseudotypes AAV2 / 5 and AAV2 / 9 and has been recently reported on a pre-print server site (Non-Patent Document 21).

[0428] Design Analysis and Methodology Research grade AAV secreting EGFP (serotypes 2 and 9) was synthesized at Sirion and was expressed in 5 × 10 12 The AAV was supplied at a stock concentration of 100 mg / kg / day. The produced AAV was tested in vitro by CJ Solutions using HEK293T cells and ELISA to confirm that the AAV would transform the cells. At Texas A&M University, eight domestic pigs were given a single intralacrimal injection of EGFP, with a low dose in the right (OD; right eye) gland and a high dose in the left (OS; left eye) gland. Six weeks after the first injection, a second injection of AAV2 and AAV9 high dose was given. The study assessed EGFP expression on day 35. After checking tear EGFP levels, the study was terminated 8 weeks after the second injection to evaluate the presence or absence of EGFP in the lacrimal gland and to evaluate any possible inflammation or gland abnormalities (Tables 9 and 10). In this study, nasal drops were administered at weeks 3-4 (Table 11).

[0429] [Table 17]

[0430] [Table 18]

[0431] [Table 19]

[0432] After the second AAV-secEGFP injection, tears were collected from each eye via Schirmer test strips on day 82. Tears were collected by placing a Schirmer tear test strip into the inferior conjunctival fornix and leaving it there for 2 minutes. Tear proteins were extracted from the Schirmer tear test strips and subjected to Mesoscale Discovery (MSD) analysis to detect the presence of EGFP protein in the tears.

[0433] On day 103, lacrimal glands were harvested for ocular histopathology and samples were sent to Zyagen for EGFP immunohistochemistry (IHC).

[0434] ELISA results showed that the engineered AAV serotypes were able to transduce HEK293T cells and produce secreted EGFP in vitro. EGFP expression in tear samples was confirmed by MSD analysis and IHC 82 days after AAV transduction, with some levels >400 pg / mL of eGFP (Figure 10). IHC showed that EGFP expression was located in acinar cells, and greater acinar cell infectivity was observed with AAV2 compared to AAV9. Furthermore, transduction of ductile epithelial cells was observed in AAV9-injected lacrimal glands (Figure 11). Hematoxylin and eosin staining of porcine lacrimal glands after repeated AAV injections did not show any inflammatory infiltrate, atrophy, or edema (Figure 12).

[0435] Pig lacrimal glands injected with either AAV2-secEGFP or AAV9-secEGFP expressed the EGFP transgene product in acinar cells and ductile epithelial cells. EGFP expressed in the lacrimal glands was found to be secreted into the tear film. Furthermore, no safety signals or inflammatory infiltrates were observed in any animals after repeated administration of AAV2 or AAV9 during the first injection, regardless of whether they received a low or high dose of AAV first. The results of this study indicate that the acinar cells of the lacrimal gland are targets for gene therapy approaches to modify and / or enrich the tear film.

[0436] Example 4. Detection of human nerve growth factor β protein in porcine tears after transduction Tear fluid was collected from 12 pigs (Sus scrofa domesticus) 7 (7), 14 (14), 21 (21), 28 (28), and 35 (35) days after transduction of the lacrimal gland (by intralacrimal injection) with a single dose (2e11vg / mL) of adeno-associated viral vector (AAV) encoding human nerve growth factor (AAV-hNGFβ) utilizing adeno-associated viral serotypes 2 (n=4), 5 (n=4), and 9 (n=4) vectors. Tear sample collection was performed on days 7, 14, 21, 28, and 35 using Schirmer tear test strips placed under the lower eyelids of both the right (OD) and left (OS) eyes of anesthetized animals for approximately 120 seconds, respectively. On days 22-27, 0.03 mg of varenicline solution was administered to each nostril twice daily (BID). For tear collection on day 28, 0.03 mg of varenicline solution was administered to each nostril via a nasal pump 2 min prior to tear collection. On all collection days, Schirmer tear test strips were cut just above the fluid migration line, and the liquid-saturated portion of the test strip was immediately placed in a microcentrifuge on ice. Collected samples were stored at -20°C before shipping to the testing facility on dry ice.

[0437] Proteins were extracted from Schirmer tear test strips from the left eye, and a mesoscale discovery assay detecting human nerve growth factor protein (hNGFβ) was performed on each sample. The minimum and maximum of the standard curve for the MSD assay for human NGF were 0.104-427 pg / mL, respectively. Introduction of AAV9-hNGFβ (containing an expression cassette of SEQ ID NO:25; shown in Figure 14) resulted in hNFGβ in the tears (Figures 13A-13C, respectively). AAV9-hNGFβ transduction resulted in such high expression that samples had to be diluted 16-128-fold for detection (Table 12). The calculated average tear film level of hNGFβ for AAV9-hNGFβ transduced pigs obtained from dilution testing is 5,612.84 pg / mL. It should be noted that based on hNGF MSD data collected from previous studies utilizing AAV vectors encoding various proteins, hNGFβ was not detected in the tear film of non-transduced pigs. Thus, any hNGFβ protein detected in extracts of Schirmer strip tear samples was readily identified during the MSD assay and was due to transduction of the lacrimal gland with the AAV-hNGFβ construct. The AAV2-hNGFβ sample taken on day 21 (Figure 13A) contained an outlier that was omitted from the analysis (p determined by Grubbs test). <0.05). As shown in Figure 13(c), no significant decrease was observed between days 7 and 28 for AAV9-hNGFβ. Furthermore, hNGF protein levels were compared between samples from animals administered AAV9-hNGFβ taken on days 21 (no nasal spray), 28 (nasal spray administered), and 35 (no nasal spray administered). Administration of the nasal spray increased tear hNGFβ protein concentrations when nasal spray was administered compared to AAV administration alone (data not shown).

[0438] Taken together, this data shows that transduction of porcine lacrimal glands with an adenoviral-associated vector encoding hNGFβ resulted in the expression, secretion, and transport of detectable amounts of hNGFβ into the tear film. Expression was detectable within 7 days of lacrimal gland transduction, and significant variability in expression levels was dependent on the AAV serotype used. AAV9 showed the highest levels of expression within 7 days, and AAV2 showed the lowest levels, but still within the range of the analytical assay used to detect human nerve growth factor β protein. AAV2 protein levels in tears steadily increased until 28 days, whereas AAV5 appeared to decrease after the first 7 days, reaching a steady state between days 14 and 28, and further decreasing by day 35. In AAV9-transduced animals, significant levels of hNGF were detected in the tear film at day 7, which remained constant until day 35.

[0439] [Table 20]

[0440] While embodiments of the present invention have been shown and described herein, those skilled in the art will understand that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will be possible for those skilled in the art without departing from the present invention. It should be understood that various alternatives to the embodiments of the present invention described herein may be used in carrying out the present invention. The following claims define the scope of the present invention, and it is intended that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

1. A recombinant adeno-associated virus (rAAV) virion comprising an AAV capsid and an expression cassette, The expression cassette comprises a polynucleotide encoding a neurotrophic factor operably linked to a promoter. Recombinant rAAV virions.

2. The rAAV virion of claim 1 , wherein the neurotrophic factor is a nerve growth factor (NGF) protein.

3. 3. The rAAV virion of claim 2, wherein the polynucleotide encoding the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:2 or SEQ ID NO:

17.

4. 3. The rAAV virion of claim 2, wherein the NGF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:

1.

5. The rAAV virion of claim 2 , wherein the NGF protein comprises SEQ ID NO:

1.

6. 3. The rAAV virion of claim 2, wherein the polynucleotide encoding the NGF protein comprises SEQ ID NO:2 or SEQ ID NO:

17.

7. 2. The rAAV virion of claim 1, wherein the neurotrophic factor is a glial-derived neurotrophic factor (GDNF) protein.

8. 8. The rAAV virion of claim 7, wherein the polynucleotide encoding the GDNF protein comprises a sequence that shares at least 95% identity with SEQ ID NO:4 or SEQ ID NO:

18.

9. The GDNF protein has a sequence that shares at least 95% identity with SEQ ID NO:

3. The rAAV virion of claim 7 .

10. The rAAV virion of claim 7 , wherein the GDNF protein comprises SEQ ID NO:

3.

11. The rAAV virion of claim 7 , wherein the polynucleotide encoding the GDNF protein comprises SEQ ID NO:4 or SEQ ID NO:

18.

12. 2. The rAAV virion of claim 1, wherein the AAV capsid comprises a VP3 that shares at least 95%, 98%, or 100% identity with AAV2 VP1 (SEQ ID NO:6), AAV2 VP3 (SEQ ID NO:8), AAV5 (SEQ ID NO:10), AAV8 (SEQ ID NO:12), or AAV9 (SEQ ID NO:14).

13. 2. The rAAV virion of claim 1, wherein the promoter is a CAG promoter (SEQ ID NO:5) or a CMV promoter (SEQ ID NO:16).

14. 2. The rAAV virion of claim 1, wherein the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

23.

15. 2. The rAAV virion of claim 1, wherein the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

24.

16. 2. The rAAV virion of claim 1, wherein the expression cassette comprises a sequence that shares at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

25.

17. A recombinant adeno-associated virus (rAAV) virion comprising an expression cassette comprising the polynucleotide of SEQ ID NO:

25.

18. The rAAV virion of claim 17, wherein the rAAV comprises an AAV capsid.

19. 19. The rAAV virion of claim 18, wherein the AAV capsid shares at least 95%, 98%, or 100% identity with AAV2 VP1 (SEQ ID NO:6), AAV2 VP3 (SEQ ID NO:8), AAV5 (SEQ ID NO:10), AAV8 (SEQ ID NO:12), or AAV9 (SEQ ID NO:14).

20. A composition comprising a rAAV virion, the rAAV virion comprising: (a) an AAV capsid, and (b) (i) an expression cassette, wherein the expression cassette comprises a polynucleotide that shares at least 95% identity with SEQ ID NO:2 or SEQ ID NO:17, wherein the polynucleotide is linked to a promoter; or (ii) an expression cassette, wherein the expression cassette comprises a polynucleotide that shares at least 95% identity with SEQ ID NO:4 or SEQ ID NO:18, wherein the polynucleotide is linked to a promoter. composition.

21. The composition of claim 20, wherein the rAAV virion comprises an AAV2, AAV5, AAV8, or AAV9 capsid.

22. The AAV capsid is selected from the group consisting of AAV2 VP1 (SEQ ID NO: 6), AAV2 VP3 (SEQ ID NO:

21. The composition of claim 20, which shares at least 95%, 98%, or 100% identity with AAV5 (SEQ ID NO: 8), AAV5 (SEQ ID NO: 10), AAV8 (SEQ ID NO: 12), or AAV9 (SEQ ID NO: 14).

23. 21. The composition of claim 20, wherein the AAV capsid is AAV2.

24. 21. The composition of claim 20, wherein the AAV capsid is AAV5.

25. 21. The composition of claim 20, wherein the AAV capsid is AAV9.

26. The rAAV virion, (a) an AAV2, AAV5, or AAV9 capsid, and 21. The composition of claim 20, comprising: (b) an expression cassette, wherein the expression cassette comprises a polynucleotide that shares at least 95% identity with SEQ ID NO:

25.

27. A pharmaceutical composition comprising an rAAV virion according to any one of claims 1 to 19, or a composition according to any one of claims 20 to 26, and a pharma- ceutically acceptable carrier.

28. 1 x 10 per milliliter of rAAV virions ７ ~1×10 １４ 28. The pharmaceutical composition of claim 27, comprising a genomic copy.

29. 1 x 10 per milliliter of rAAV virions １２ ~6.2 x 10 １２ 28. The pharmaceutical composition of claim 27, comprising a genomic copy.

30. 28. The pharmaceutical composition of claim 27, formulated for administration to the lacrimal gland.

31. 28. The pharmaceutical composition of claim 27, formulated for administration to the ocular surface.

32. 28. The pharmaceutical composition of claim 27, formulated for use, or adapted for use, in the treatment of an ophthalmic disease, disorder, or condition.

33. The pharmaceutical composition of claim 32, wherein the rAAV virion is administered to the lacrimal gland of a subject.

34. The pharmaceutical composition of claim 33, wherein the lacrimal gland is one of the subject's main lacrimal gland, Wolfring's gland, or Clauss' gland.

35. The pharmaceutical composition of claim 33, wherein the lacrimal gland is the primary lacrimal gland of the subject.

36. The pharmaceutical composition described in claim 33, wherein cells in the lacrimal gland are transduced with the rAAV virion.

37. The pharmaceutical composition of claim 36, wherein the transduced cells in the lacrimal gland express an effective amount of the neurotrophic factor in the tear film and optionally the ocular surface of the subject.

38. The pharmaceutical composition described in claim 32, wherein the eye disease is a chemical burn of the ocular surface, a corneal wound, a corneal ulcer, a persistent epithelial defect, dry eye disease, neurotrophic keratitis, herpes simplex virus infection of the trigeminal nerve and / or the eye, varicella zoster virus infection of the trigeminal nerve and / or the eye, or a diabetic complication of the corneal nerve.

39. The method of claim 39, wherein one or more symptoms of the eye disease are present prior to administration of the rAAV virion. The pharmaceutical composition of claim 32, wherein the symptoms are alleviated compared to those described above.

40. The pharmaceutical composition of claim 32, wherein one or more symptoms of the eye disease are alleviated compared to the symptoms of the eye disease in an untreated control subject.

41. The pharmaceutical composition of claim 32, wherein one or more symptoms of the eye disease are alleviated compared to the symptoms of the eye disease in the contralateral eye.

42. A composition according to any one of claims 20 to 26 for use in treating an eye disease, disorder, or condition.

43. The composition described in claim 42, wherein the rAAV virion is administered to the lacrimal gland of a subject.

44. The composition of claim 43, wherein the lacrimal gland is one of the subject's main lacrimal gland or a Wolfring's gland or a Clauss' gland.

45. The composition described in claim 43, wherein the lacrimal gland is the primary lacrimal gland of the subject.

46. The composition described in claim 43, wherein cells in the lacrimal gland are transduced with the rAAV virion.

47. The composition described in claim 46, wherein the transduced cells in the lacrimal gland express an effective amount of the neurotrophic factor in the tear film and optionally the ocular surface of the subject.

48. The composition described in claim 42, wherein the eye disease is a chemical burn of the ocular surface, a corneal wound, a corneal ulcer, a persistent epithelial defect, dry eye disease, neurotrophic keratitis, herpes simplex virus infection of the trigeminal nerve and / or the eye, varicella zoster virus infection of the trigeminal nerve and / or the eye, or a diabetic complication of the corneal nerve.

49. The composition described in claim 42, wherein one or more symptoms of the ocular disease are alleviated compared to the symptoms of the ocular disease before administration of the rAAV virion.

50. The composition described in claim 42, wherein one or more symptoms of the eye disease are alleviated compared to the symptoms of the eye disease in an untreated control subject.

51. The composition described in claim 42, wherein one or more symptoms of the eye disease are alleviated compared to the symptoms of the eye disease in the contralateral eye.

52. A kit comprising an rAAV virion of any one of claims 1 to 19, or a composition of any one of claims 20 to 26, and instructions for use in treating an ocular disease, disorder, or condition.

53. A kit comprising the pharmaceutical composition of claim 27 and instructions for use in treating an eye disease, disorder, or condition.

Images