Engineered meganucleases targeting the human mitochondrial genome

Abstract

Disclosed herein are recombinant meganucleases engineered to recognize and cleave recognition sequences present in human mitochondrial DNA (mtDNA). The disclosure further relates to the use of such recombinant meganucleases in combination with mitochondrial transit peptides in methods for producing genetically modified eukaryotic cells, and populations of genetically modified eukaryotic cells in which mtDNA has been modified or edited.

Description

[Technical field]

[0001] The present disclosure relates to the field of molecular biology and recombinant nucleic acid technology.In particular, the present disclosure relates to a recombinant meganuclease that is engineered to recognize and cleave a recognition sequence found in human mitochondrial genome.The present disclosure further relates to the use of such recombinant meganuclease in a method for producing genetically modified eukaryotic cells, and a population of genetically modified eukaryotic cells in which mitochondrial DNA is modified.

[0002] Reference to sequence listing submitted as a text file via EFS-WEB This application contains a Sequence Listing that was submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. The ASCII copy created on April 21, 2022 is named P89339_0137_9_SeqList_4-21-22.txt and is 20.0 kb in size. [Background technology]

[0003] In all organisms, mitochondria regulate cellular energy and metabolism under normal growth and development, and in response to stress. Many of the proteins that function in these roles are encoded in the mitochondrial genome. Therefore, editing of the mitochondrial genome has diverse applications in both animals and plants. In humans, harmful mitochondrial mutations are the cause of several disorders for which gene editing therapy can be applied.

[0004] Pathogenic mitochondrial DNA (mtDNA) mutations include large-scale rearrangements and point mutations in protein-coding, transfer RNA (tRNA) or ribosomal RNA (rRNA) genes. The prevalence of mtDNA-related disease diagnoses is approximately 1 in 5,000, but the population frequency of the 10 most common pathogenic mtDNA mutations is much higher, approaching 1 in 200, meaning that many "normal" individuals carry low levels of mutant genomes (Non-Patent Document 1).

[0005] Mutant mtDNA coexists with wild-type mtDNA in most cases in the patient's cells (mtDNA heteroplasmy). Several studies have shown that wild-type mtDNA has a strong protective effect, and biochemical abnormalities were observed only when the level of mutant mtDNA was higher than 80-90% (Non-Patent Document 1). It has been shown that muscle fibers develop OXPHOS defects only when the mutation load is higher than 80% (Non-Patent Document 2). Therefore, any approach that can shift this balance even by a small percentage towards the wild type has strong therapeutic potential. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Schon et al., Nat Rev Gen 13:878-890 (2012) [Non-Patent Document 2] Sciacco et al., Hum Mol Genet, 3:13-19 (1994) Summary of the Invention [Problem to be solved by the invention]

[0007] However, mtDNA manipulation remains a less-explored area of ​​science due to the inability to target mtDNA with high efficiency and generate precise editing. The mitochondrial genome is difficult to edit because it requires predictable repair mechanisms and delivery of editing technology to this organelle. Given the difficulties and unpredictability associated with mitochondrial genome editing, there is an unmet need for precise editing of mtDNA, which would open up a whole field of investigation and opportunity in life sciences. The ability to target and edit defined regions of the mitochondrial genome (preferably limited to just one gene) in a more predictable manner would be a clear advantage over currently available systems. [Means for solving the problem]

[0008] Compositions and methods are provided herein for precise editing of mitochondrial genome. Up until now, all other attempts in mitochondrial genome editing have resulted in large-scale and unpredictable deletions / rearrangements. The present invention is the first to demonstrate that homing endonucleases allow precise editing of mitochondrial DNA (mtDNA), thereby opening up a whole field of investigation and opportunity in life science. The compositions and methods provided herein can be used to edit one specific mitochondrial gene without affecting the surrounding region.

[0009] In one aspect, the present invention provides a mitochondrially targeted engineered meganuclease (MTEM) that binds to and cleaves a recognition sequence in the mitochondrial genome of a eukaryotic cell, the MTEM comprising an engineered meganuclease linked to a mitochondrial transit peptide (MTP).

[0010] In some embodiments, the engineered meganuclease comprises a first subunit and a second subunit, the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region, and the first subunit and the second subunit each comprise an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO:1. In some embodiments, the first subunit and the second subunit each comprise an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 1. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO:2.

[0011] In some embodiments, the recognition sequence comprises SEQ ID NO:3.

[0012] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 4. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 4. In some embodiments, the HVR1 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 4. In some embodiments, the HVR1 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO:4. In some embodiments, the HVR1 region comprises residues 215-270 of SEQ ID NO:4 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 215-270 of SEQ ID NO:4.

[0013] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:4. In some embodiments, the first subunit comprises a residue corresponding to residue 271 of SEQ ID NO:4. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO:4. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO:4. In some embodiments, the first subunit comprises residues 198-344 of SEQ ID NO:4 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 198-344 of SEQ ID NO:4.

[0014] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO:4. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:4. In some embodiments, the HVR2 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:4. In some embodiments, the HVR2 region comprises a residue corresponding to residue 36 of SEQ ID NO:4. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO:4. In some embodiments, the HVR2 region comprises residues 24-79 of SEQ ID NO:4 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 24-79 of SEQ ID NO:4.

[0015] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:4. In some embodiments, the second subunit comprises residues 7-153 of SEQ ID NO:4 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises a G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:4. In some embodiments, the second subunit comprises an E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:4. In some embodiments, the second subunit comprises residues 7-153 of SEQ ID NO:4.

[0016] In some embodiments, the engineered meganuclease is a single chain meganuclease that includes a linker, where the linker covalently links the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:4.

[0017] In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, the engineered meganuclease is encoded by a nucleotide sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence of SEQ ID NO: 5.

[0018] In some embodiments, the MTP comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in any one of SEQ ID NOs: 6-8. In some embodiments, the MTP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 6-8. In some embodiments, the MTP is attached to the C-terminus of the engineered meganuclease. In some embodiments, the MTP is attached to the N-terminus of the engineered meganuclease. In some embodiments, the MTP is fused to the engineered meganuclease. In some embodiments, the MTP is attached to the engineered meganuclease by a polypeptide linker. In some embodiments, the engineered meganuclease is attached to a first MTP and a second MTP. In some embodiments, the first MTP and / or the second MTP comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in any one of SEQ ID NOs: 6-8. In some embodiments, the first MTP and / or the second MTP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 6-8. In some embodiments, the first MTP and the second MTP are identical. In some embodiments, the first MTP and the second MTP are not identical. In some embodiments, the first MTP and / or the second MTP are fused to the engineered meganuclease. In some embodiments, the first MTP and / or the second MTP are linked to the engineered meganuclease by a polypeptide linker.

[0019] In some embodiments, the MTEM is linked to a nuclear export sequence (NES). In some embodiments, the NES comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO: 9 or 10. In some embodiments, the NES comprises an amino acid sequence set forth in SEQ ID NO: 9 or 10. In some embodiments, the NES is linked to the N-terminus of the MTEM. In some embodiments, the NES is linked to the C-terminus of the MTEM. In some embodiments, the NES is fused to the MTEM. In some embodiments, the NES is linked to the MTEM by a polypeptide linker. In some embodiments, the MTEM comprises a first NES and a second NES. In some embodiments, the first NES is linked to the N-terminus of the MTEM and the second NES is linked to the C-terminus of the MTEM. In some embodiments, the first NES and / or the second NES comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO: 9 or 10. In some embodiments, the first NES and / or the second NES comprises an amino acid sequence set forth in SEQ ID NO: 9 or 10. In some embodiments, the first NES and the second NES are identical. In some embodiments, the first NES and the second NES are not identical. In some embodiments, the first NES and / or the second NES are fused to an MTEM. In some embodiments, the first NES and / or the second NES are bound to an MTEM. In some embodiments, the first NES and / or the second NES are bound to an MTEM.

[0020] In another aspect, the invention provides a polynucleotide comprising a nucleic acid sequence encoding a MTEM as described herein. In some embodiments, the polynucleotide is an mRNA.

[0021] In another aspect, the present invention provides a recombinant DNA construct comprising a polynucleotide comprising a nucleic acid sequence encoding MTEM as described herein. In some embodiments, the recombinant DNA construct encodes a recombinant virus comprising the polynucleotide. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV). In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV2, AAV9, or AAVHSC capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to the nucleic acid sequence encoding MTEM. In some embodiments, the promoter is a constitutive promoter or a tissue-specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter, or the tissue specific promoter is a neuron specific promoter, an astrocyte specific promoter, a microglia specific promoter, a muscle specific promoter, a skeletal muscle specific promoter, a myotube specific promoter, a muscle satellite cell specific promoter, a cardiomyocyte specific promoter, an eye specific promoter, a retina specific promoter, a retinal ganglion cell specific promoter, a retinal pigment epithelium specific promoter, a leukocyte specific promoter, a progenitor cell specific promoter, a blood progenitor cell specific promoter, a pancreas specific promoter, a pancreatic beta cell specific promoter, an endothelial cell specific promoter, an inner ear hair cell specific promoter, a bone marrow cell specific promoter, or a kidney specific promoter.

[0022] In another aspect, the present invention provides a plasmid comprising the recombinant DNA described herein.

[0023] In another aspect, the present invention provides a recombinant virus comprising a polynucleotide comprising a nucleic acid sequence encoding MTEM as described herein. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV). In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV2, AAV9, or AAVHSC capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to the nucleic acid sequence encoding MTEM. In some embodiments, the promoter is a constitutive promoter or a tissue-specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter, or the tissue specific promoter is a neuron specific promoter, an astrocyte specific promoter, a microglia specific promoter, a muscle specific promoter, a skeletal muscle specific promoter, a myotube specific promoter, a muscle satellite cell specific promoter, a cardiomyocyte specific promoter, an eye specific promoter, a retina specific promoter, a retinal ganglion cell specific promoter, a retinal pigment epithelium specific promoter, a leukocyte specific promoter, a progenitor cell specific promoter, a blood progenitor cell specific promoter, a pancreas specific promoter, a pancreatic beta cell specific promoter, an endothelial cell specific promoter, an inner ear hair cell specific promoter, a bone marrow cell specific promoter, or a kidney specific promoter. In another aspect, the present invention provides a lipid nanoparticle composition comprising a lipid nanoparticle comprising a polynucleotide comprising a nucleic acid sequence encoding a MTEM as described herein. In some embodiments, the polynucleotide is an mRNA.

[0024] In another aspect, the invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and a MTEM described herein.

[0025] In another aspect, the invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and any of the polynucleotides described herein.

[0026] In another aspect, the invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and any of the recombinant DNA constructs described herein.

[0027] In another aspect, the invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and any of the recombinant viruses described herein.

[0028] In another aspect, the present invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and any of the lipid nanoparticle compositions described herein.

[0029] In another aspect, the present invention provides a genetically modified eukaryotic cell comprising any of the polynucleotides described herein. In some embodiments, the genetically modified eukaryotic cell is a genetically modified mammalian cell. In some embodiments, the genetically modified eukaryotic cell is a genetically modified human cell. In some embodiments, the genetically modified eukaryotic cell is a genetically modified plant cell.

[0030] In another aspect, the present invention provides a method of making a genetically modified eukaryotic cell, comprising introducing into a eukaryotic cell (a) a polynucleotide comprising a nucleic acid sequence encoding a MTEM as described herein that is expressed in the eukaryotic cell, or (b) a MTEM as described herein that generates a cleavage site at a recognition sequence in the mitochondrial genome of the eukaryotic cell. In some embodiments, the cleavage site is repaired by non-homologous end joining such that the recognition sequence comprises an insertion or deletion. In some embodiments, the mitochondrial genome comprising the recognition sequence is degraded in the genetically modified eukaryotic cell. In some embodiments, the mitochondrial genome is a mutant mitochondrial genome. In some embodiments, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% of the mutant mitochondrial genome comprising the recognition sequence is degraded in the genetically modified eukaryotic cell. In some embodiments, the ratio of wild-type mitochondrial genome to mutant mitochondrial genome containing the recognition sequence is increased in the genetically modified eukaryotic cell. In some embodiments, the ratio is about 5:95, about 10:90, about 15:85, about 20:80, about 25:75, about 30:70, about 35:65, about 40:60, about 45:55, about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 20:1, to about 50:1, about 100:1, about 150:1, about 200:1, about 250:1, about 300:1, about 350:1, about 400:1, about 450:1, about 500:1, about 550:1, about 600:1, about 650:1, about 700:1, about 750:1, about 800:1, about 850:1, about 900:1, about 950:1, about 1000:1 or more. In some embodiments, the percentage of the wild-type mitochondrial genome in the genetically modified eukaryotic cell is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more of the total mitochondrial genome in the genetically modified eukaryotic cell.In some embodiments, the percentage of mutant mitochondrial genomes containing the recognition sequence in the genetically modified eukaryotic cell is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more. In some embodiments, cellular respiration in the genetically modified eukaryotic cell is increased by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or more. In some embodiments, cellular respiration in the genetically modified eukaryotic cells is increased by about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100% or more.

[0031] In another aspect, the present invention provides a method of producing a population of eukaryotic cells comprising a plurality of genetically modified cells, comprising introducing into a plurality of eukaryotic cells in the population (a) a polynucleotide comprising a nucleic acid sequence encoding a MTEM as described herein that is expressed in the plurality of eukaryotic cells, or (b) a MTEM as described herein that generates a cleavage site at a recognition sequence in the mitochondrial genome of the plurality of eukaryotic cells. In some embodiments, the cleavage site is repaired by non-homologous end joining such that the recognition sequence comprises an insertion or deletion. In some embodiments, the mitochondrial genome comprising the recognition sequence is degraded in the plurality of genetically modified eukaryotic cells. In some embodiments, the mitochondrial genome is a mutant mitochondrial genome. In some embodiments, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% of the mutant mitochondrial genomes containing the recognition sequence are degraded in the plurality of genetically modified eukaryotic cells. In some embodiments, the ratio of wild-type mitochondrial genomes to mutant mitochondrial genomes containing the recognition sequence is increased in the plurality of genetically modified eukaryotic cells. In some embodiments, the ratio of wild-type mitochondrial genomes to mutant mitochondrial genomes containing the recognition sequence is increased in the population of eukaryotic cells. In some embodiments, the ratio is about 5:95, about 10:90, about 15:85, about 20:80, about 25:75, about 30:70, about 35:65, about 40:60, about 45:55, about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 20:1, to about 50:1, about 100:1, about 150:1, about 200:1, about 250:1, about 300:1, about 350:1, about 400:1, about 450:1, about 500:1, about 550:1, about 600:1, about 650:1, about 700:1, about 750:1, about 800:1, about 850:1, about 900:1, about 950:1, about 1000:1 or more.In some embodiments, the percentage of wild-type mitochondrial genomes in a plurality of genetically modified eukaryotic cells is increased by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more. In some embodiments, the percentage of wild-type mitochondrial genomes in a population of eukaryotic cells is increased by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more. In some embodiments, the percentage of mutant mitochondrial genomes that contain the recognition sequence in a plurality of genetically modified eukaryotic cells is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more. In some embodiments, the percentage of mutant mitochondrial genomes that contain the recognition sequence in a population of eukaryotic cells is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more. In some embodiments, cellular respiration in the plurality of genetically modified eukaryotic cells is increased by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or more. In some embodiments, cellular respiration in the plurality of genetically modified eukaryotic cells is increased by about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100% or more. In some embodiments, cellular respiration in a population of eukaryotic cells is increased by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or more.In some embodiments, cellular respiration in a population of eukaryotic cells is increased by about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100% or more.

[0032] In some embodiments, the method is performed in vivo. In some embodiments, the method is performed in vitro. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the polynucleotide is any mRNA described herein. In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the polynucleotide is any recombinant DNA construct described herein. In some embodiments, the polynucleotide is introduced into the eukaryotic cell by a lipid nanoparticle. In some embodiments, the polynucleotide is introduced into the eukaryotic cell by a recombinant virus. In some embodiments, the recombinant virus is any recombinant virus described herein. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV2, AAV9, or AAVHSC capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to a nucleic acid sequence encoding MTEM. In some embodiments, the promoter is a constitutive promoter or a tissue-specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1α promoter, or a UbC promoter, or the tissue-specific promoter is a neuron-specific promoter, an astrocyte-specific promoter, a microglia-specific promoter, a muscle-specific promoter, a skeletal muscle-specific promoter, a myotube-specific promoter, a muscle satellite cell-specific promoter, a cardiomyocyte-specific promoter, an eye-specific promoter, a retina-specific promoter, a retinal ganglion cell-specific promoter, a retinal pigment epithelium-specific promoter, a leukocyte-specific promoter, a progenitor cell-specific promoter, a blood progenitor cell-specific promoter, a pancreas-specific promoter, a pancreatic beta cell-specific promoter, an endothelial cell-specific promoter, an inner ear hair cell-specific promoter, a bone marrow cell-specific promoter, or a kidney-specific promoter. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the eukaryotic cell is a human cell.In some embodiments, the eukaryotic cell is a neuron, an astrocyte, a microglial cell, a muscle cell, a skeletal muscle cell, a myotube cell, a muscle satellite cell, a cardiomyocyte, an eye cell, a retinal cell, a retinal ganglion cell, a retinal pigment epithelial cell, a leukocyte, a progenitor cell, a blood progenitor cell, a pancreatic cell, a pancreatic beta cell, an endothelial cell, an inner ear hair cell, a bone marrow cell, or a kidney cell. In some embodiments, the eukaryotic cell is a plant cell.

[0033] In another aspect, the invention provides a genetically modified eukaryotic cell or a population of genetically modified eukaryotic cells produced by any method for producing a genetically modified eukaryotic cell or any method for producing a population of eukaryotic cells comprising a plurality of genetically modified cells.

[0034] In another aspect, the present invention provides a method of degrading a mutant mitochondrial genome in a target cell or a population of target cells of a subject, comprising delivering to the target cell or population of target cells (a) a polynucleotide comprising a nucleic acid sequence encoding a MTEM as described herein that is expressed in the target cell or population of target cells, or (b) a MTEM as described herein, wherein the MTEM generates a cleavage site in the mutant mitochondrial genome at the recognition sequence, and the mutant mitochondrial genome is degraded. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the target cells are neurons, astrocytes, microglial cells, muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, cardiomyocytes, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, leukocytes, progenitor cells, blood progenitor cells, pancreatic cells, pancreatic beta cells, endothelial cells, inner ear hair cells, or kidney cells, or the population of target cells is a population of neurons, astrocytes, microglial cells, muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, cardiomyocytes, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, leukocytes, progenitor cells, blood progenitor cells, pancreatic cells, pancreatic beta cells, endothelial cells, inner ear hair cells, or kidney cells. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the polynucleotide is any mRNA described herein. In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the polynucleotide is any recombinant DNA construct described herein. In some embodiments, the polynucleotide is delivered to the target cell or population of target cells by lipid nanoparticles. In some embodiments, the polynucleotide is delivered to the target cell or population of target cells by recombinant virus. In some embodiments, the recombinant virus is any recombinant virus described herein. In some embodiments, the recombinant virus is recombinant AAV. In some embodiments, the recombinant AAV has an AAV2, AAV9, or AAVHSC capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to a nucleic acid sequence encoding MTEM.In some embodiments, the promoter is a constitutive promoter or a tissue-specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1α promoter, or a UbC promoter, or the tissue-specific promoter is a neuron-specific promoter, an astrocyte-specific promoter, a microglia-specific promoter, a muscle-specific promoter, a skeletal muscle-specific promoter, a myotube-specific promoter, a muscle satellite cell-specific promoter, a cardiomyocyte-specific promoter, an eye-specific promoter, a retina-specific promoter, a retinal ganglion cell-specific promoter, a retinal pigment epithelium-specific promoter, a leukocyte-specific promoter, a progenitor cell-specific promoter, a blood progenitor cell-specific promoter, a pancreas-specific promoter, a pancreatic β cell-specific promoter, an endothelial cell-specific promoter, an inner ear hair cell-specific promoter, a bone marrow cell-specific promoter, or a kidney-specific promoter. In some embodiments, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% of the mutant mitochondrial genomes containing the recognition sequences are degraded in the target cell or population of target cells. In some embodiments, the ratio of wild-type mitochondrial genomes to mutant mitochondrial genomes containing the recognition sequences is increased in the target cell or population of target cells. In some embodiments, the ratio is about 5:95, about 10:90, about 15:85, about 20:80, about 25:75, about 30:70, about 35:65, about 40:60, about 45:55, about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 20:1, to about 50:1, about 100:1, about 150:1, about 200:1, about 250:1, about 300:1, about 350:1, about 400:1, about 450:1, about 500:1, about 550:1, about 600:1, about 650:1, about 700:1, about 750:1, about 800:1, about 850:1, about 900:1, about 950:1, about 1000:1 or more.In some embodiments, the percentage of wild-type mitochondrial genomes in a target cell or population of target cells is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more of the total mitochondrial genomes in the target cell or population of target cells. In some embodiments, the percentage of mutant mitochondrial genomes containing a recognition sequence in the genetically modified eukaryotic cell is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more. In some embodiments, cellular respiration in a target cell or population of target cells is increased by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or more. In some embodiments, cellular respiration in a target cell or population of target cells is increased by about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100% or more.

[0035] In another aspect, the present invention provides a method of treating a condition associated with a mitochondrial disorder in a subject, comprising administering to the subject (a) a therapeutically effective amount of a polynucleotide comprising a nucleic acid sequence encoding a MTEM as described herein, which is delivered to a target cell or population of target cells of the subject and expressed in the target cell or population of target cells, or (b) a therapeutically effective amount of a MTEM as described herein, wherein the MTEM is delivered to the target cell or population of target cells of the subject, and the MTEM generates a cleavage site in the mutant mitochondrial genome at the recognition sequence, and the mutant mitochondrial genome is degraded. In some embodiments, the method comprises administering any of the pharmaceutical compositions described herein. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the target cells are neurons, astrocytes, microglial cells, muscle cells, skeletal muscle cells, myotube cells, muscle satellite cells, cardiomyocytes, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, leukocytes, progenitor cells, blood progenitor cells, pancreatic cells, pancreatic beta cells, endothelial cells, inner ear hair cells, or kidney cells, or the population of target cells is a population of neurons, astrocytes, microglial cells, muscle cells, skeletal muscle cells, myotube cells, muscle satellite cells, cardiomyocytes, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, leukocytes, progenitor cells, blood progenitor cells, pancreatic cells, pancreatic beta cells, endothelial cells, inner ear hair cells, or kidney cells. In some embodiments, the condition is a condition of muscle, heart, central nervous system, eye, bone marrow, kidney, pancreas, leukocyte, blood vessel, or inner ear. In some embodiments, the condition is Pearson syndrome, progressive external ophthalmoplegia, Kearns-Sayre syndrome (KSS), myoclonic epilepsy with ragged red fibers (MERRF), neuropathy, ataxia, retinitis pigmentosa (NARP), Leber's hereditary optic neuropathy (LHON), chronic progressive external ophthalmoplegia (CPEO), maternally inherited Leigh syndrome (MILS), maternally inherited diabetes and deafness (MIDD), or mitochondrial disorder with overlapping symptoms. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the polynucleotide is any mRNA described herein. In some embodiments, the polynucleotide is a recombinant DNA construct.In some embodiments, the polynucleotide is any recombinant DNA construct described herein. In some embodiments, the polynucleotide is delivered to a target cell or a population of target cells by a lipid nanoparticle. In some embodiments, the polynucleotide is delivered to a target cell or a population of target cells by a recombinant virus. In some embodiments, the recombinant virus is any recombinant virus described herein. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV2, AAV9, or AAVHSC capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to a nucleic acid sequence encoding MTEM. In some embodiments, the promoter is a constitutive promoter or a tissue-specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter, or the tissue specific promoter is a neuron specific promoter, an astrocyte specific promoter, a microglia specific promoter, a muscle specific promoter, a skeletal muscle specific promoter, a myotube specific promoter, a muscle satellite cell specific promoter, a cardiomyocyte specific promoter, an eye specific promoter, a retina specific promoter, a retinal ganglion cell specific promoter, a retinal pigment epithelium specific promoter, a leukocyte specific promoter, a progenitor cell specific promoter, a blood progenitor cell specific promoter, a pancreas specific promoter, a pancreatic beta cell specific promoter, an endothelial cell specific promoter, an inner ear hair cell specific promoter, a bone marrow cell specific promoter, or a kidney specific promoter. In some embodiments, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% of the mutant mitochondrial genomes containing the recognition sequences are degraded in the target cell or population of target cells. In some embodiments, the ratio of wild-type mitochondrial genomes to mutant mitochondrial genomes containing the recognition sequences is increased in the target cell or population of target cells.In some embodiments, the ratio is about 5:95, about 10:90, about 15:85, about 20:80, about 25:75, about 30:70, about 35:65, about 40:60, about 45:55, about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 20:1, to about 50:1, about 100:1, about 150:1, about 200:1, about 250:1, about 300:1, about 350:1, about 400:1, about 450:1, about 500:1, about 550:1, about 600:1, about 650:1, about 700:1, about 750:1, about 800:1, about 850:1, about 900:1, about 950:1, about 1000:1 or more. In some embodiments, the percentage of wild-type mitochondrial genomes in a target cell or population of target cells is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more of the total mitochondrial genomes in the target cell or population of target cells. In some embodiments, the percentage of mutant mitochondrial genomes containing a recognition sequence in the genetically modified eukaryotic cell is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more. In some embodiments, cellular respiration in a target cell or population of target cells is increased by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or more. In some embodiments, cellular respiration in a target cell or population of target cells is increased by about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100% or more. [Brief description of the drawings]

[0036] [Figure 1] FIG. 1 shows MTEM constructs and mitochondrial expression. [Figure 1A] FIG. 1 describes the strategy for mitochondrial cleavage detection. To test the recognition sequence cleavage of the engineered nuclease (against the mouse mtDNA tRNA-Ala mutation [MIT 11-12]), a pair of engineered CHO lines were generated with either wild-type (WT) or mutant mtDNA target sites in the nuclear DNA. The target site was placed between direct repeats of the GFP gene such that cleavage of the target site would promote a homologous recombination event between the repeat regions to yield functional GFP. In addition, there is a target site for a positive control nuclease ("CHO 23-24") integrated next to the engineered nuclease target site (left panel). Each of the cell lines was transfected with mRNA encoding MIT 11-12 or CHO 23-24 (control), and 48 hours after transfection, the cells were assayed for the percentage of GFP+ cells by flow cytometry (right panel). [Figure 1B] FIG. 1 shows a diagram of a MTEM gene construct for ex vivo expression, including a CMV promoter, a Cox8 or Cox8 / Su9 mitochondrial transit peptide (MTP), a Flag tag for immunological detection, an engineered meganuclease (MTEM) sequence, and a PolyA tail. [Figure 1C] Immunofluorescence performed on HeLa cells 24 hours after transfection with MitoTracker. MitoTracker stains mitochondria red, Flag stains Mitochondria green, and the merged image shows colocalization of Mitochondria (yellow). Images taken at 40x magnification. [Figure 1D] Figure 1 reports the results of a Western blot showing MTEM expression (FLAG) in HEK293T cells 24 hours after transfection with either CF or CSF constructs. The CF+GFP and CSF+GFP lanes show protein expression in cells transfected with MTEM constructs with the GFP sequence added. The Unt lane represents untransfected cells. The GFP lane represents cells transfected with GFP only. Tubulin (Tub) expression was used as a loading control. [Diagram 2] FIG. 1 shows the effect of MTEM on heteroplasmic cells carrying the tRNAAla mutation (m.5024C>T). [Figure 2A] Figure 1 reports an example of FACS cell sorting gating. Cells were sorted by the presence of GFP co-expression: "black" cells (bottom gate) and "green" cells (top gate). [Figure 2B] FIG. 1 reports RFLP-HOT PCR analysis of two independent transfection and cell sorting experiments of heteroplasmic cells carrying the m.5024C>T mutation in 50%. Mutation levels in the green cell population (Gr) were compared to untransfected cells (U). [Figure 2C] Figure 2 shows quantification of heteroplasmy shift from two cell sorting experiments in cells carrying the 50% mutation described in Figure 2B. Results were compared to heteroplasmy in untransfected cells. [Figure 2D] FIG. 1 shows RFLP "last cycle hot" PCR analysis of heteroplasmic cells with high heteroplasmic mutational burden (90%) transfected with MTEM over time. [Figure 2E] Quantification of the results of Fig. 2D. Values ​​are normalized to non-transfected cells. Black cells are named Blk (n=4). [Figure 2F] Total mtDNA levels checked in highly mutated cells transfected with MTEM and compared with non-transfected cells 24 h after transfection and followed for 3 weeks after transfection are reported (n=3). [Figure 2G] Figure 1 shows the estimated oxygen consumption rate (OCR) in cells with high levels of heteroplasmic mutant mtDNA transfected with MTEM and grown for 3 weeks (n=3-7). Data are mean ± SEM. Statistical analysis was performed using a two-tailed Student's t-test. p≦0.05*, p≦0.01**, p>0.001*** [Diagram 3]FIG. 1 reports the effect of AAV9-MTEM in treated young mice. [Figure 3A] Representative Western blots (WB) of homogenates with Flag antibody for AAV9-MTEM samples and GFP antibody for AAV-GFP samples (upper panel). RFLP "last cycle hot" PCR analysis (RFLP, lower panel) of DNA samples from the same injected animals at 6, 12 and 24 weeks PI. [Figure 3B] Quantification of heteroplasmy shift shown as percent change in heteroplasmy across all tissues at 6, 12, or 24 weeks PI normalized to brain tissue. Heteroplasmy levels in heart (H), tibialis anterior (TA), quadriceps (Q), gastrocnemius (G), kidney (K), liver (L) and spleen (Sp) were compared to brain (B) (negative for MTEM expression). [Figure 3C] Figure 1. Quantification by RT-PCR of total mtDNA levels in skeletal muscle, liver and brain at 6 and 24 weeks PI using ND1 and ND5 mitochondrial primers / probes normalized to 18S (nuclear DNA). Data are mean ± SEM of n = 3-5. Statistical analysis was performed using a two-tailed Student's t-test. p ≤ 0.05*, p ≤ 0.01**, p ≤ 0.001***, p ≤ 0.0001**** [Figure 4] 1 shows the effects of AAV9-MTEM in treated adult mice. [Figure 4A] Representative Western blots (WB) of homogenates (upper panels) with Flag antibody for AAV9-MTEM samples and GFP antibody for AAV-GFP samples are shown. RFLP "last cycle hot" PCR analysis (RFLP, lower panels) of DNA samples from the same injected animals at 6, 12 and 24 weeks PI. [Figure 4B]Quantification of heteroplasmy shift shown as percent change in heteroplasmy across all tissues at 6, 12, and 24 weeks PI normalized to brain tissue. Heteroplasmy in heart (H), tibialis anterior (TA), quadriceps (Q), gastrocnemius (G), kidney (K), liver (L) and spleen (Sp) was compared to brain (negative for MTEM expression). [Figure 4C] Quantification by qPCR of total mtDNA levels was measured in skeletal muscle, liver, and brain (B) at 6 and 24 weeks PI using ND1 and ND5 mitochondrial primers / probes normalized to 18S (nuclear DNA). Data are mean ± SEM of n = 3–4. Statistical analysis was performed using a two-tailed Student's t-test. p ≤ 0.05*, p ≤ 0.01**, p ≤ 0.001***, p ≤ 0.0001**** [Diagram 5] FIG. 13 reports MTEM-induced increase in mt-tRNAAla in the liver. [Figure 5A] FIG. 1 shows Northern blot analysis of young mouse livers at 24 weeks PI probed for mt-tRNAAla and total RNA loading (28S and 18S). [Figure 5B] FIG. 5B shows quantification of mt-tRNAAla in the Northern blot of FIG. 5A normalized to 28S rRNA. [Figure 5C] Quantification of mt-tRNAAla by qPCR compared to levels of mt-tRNAVal in young mouse livers. RNA samples from AAV9-MTEM treated animals were compared to AAV9-GFP control and WT liver samples. [Figure 5D] Figure 1 reports quantification of mt-tRNAAla relative to levels of mt-tRNAVal in adult mouse liver. RNA samples from AAV9-MTEM treated animals were compared to AAV9-GFP control and WT liver samples at 24 weeks PI. Data are mean ± SEM of n=3-4. Statistical analysis was performed using a two-tailed Student's t-test. p<0.05* [Figure 6]Figure 1 shows indel formation by engineered meganucleases fused to the nuclear localization signal (NLS) of SEQ ID NO: 10, the mitochondrial transit peptide (MTP) or MTP and the nuclear export sequence (NES). MRC-5 cells were nucleofected with engineered meganuclease constructs and indel formation at the APC 11-12 binding site was analyzed after 2 days. [Figure 7] Figure 1 shows indel formation by engineered meganucleases fused to the nuclear localization signal (NLS) of SEQ ID NO: 9, the mitochondrial transit peptide (MTP) or MTP and the MVMp NS2 nuclear export sequence (NES). MRC-5 cells were nucleofected with engineered meganuclease constructs and indel formation at the APC 11-12 binding site was analyzed after 2 days.

[0037] A brief description of the sequence SEQ ID NO: 1 shows the wild type I-CreI sequence.

[0038] SEQ ID NO: 2 shows the MTEM meganuclease with the wild-type I-CreI subunit.

[0039] SEQ ID NO:3 shows the MIT 11-12 recognition sequence (sense).

[0040] SEQ ID NO: 4 shows the MIT 11-12x40 meganuclease amino acid sequence.

[0041] SEQ ID NO:5 shows the MIT 11-12x.40 meganuclease nucleic acid sequence.

[0042] SEQ ID NO:6 shows the COX VIII MTP.

[0043] SEQ ID NO: 7 shows the SU9 MTP.

[0044] SEQ ID NO:8 shows the COX VIII-SU9 MTP.

[0045] SEQ ID NO:9 shows the MVMp NS2 NES sequence.

[0046] SEQ ID NO: 10 shows the NES sequence.

[0047] SEQ ID NO: 11 shows the MIT 11-12 recognition sequence (antisense).

[0048] SEQ ID NO: 12 shows the m.5024C>T forward primer.

[0049] SEQ ID NO: 13 shows the m.5024C>T reverse primer.

[0050] SEQ ID NO: 14 shows the ND1 forward primer.

[0051] SEQ ID NO: 15 shows the ND1 reverse primer.

[0052] SEQ ID NO: 16 shows the ND1 probe.

[0053] SEQ ID NO: 17 shows the ND5 forward primer.

[0054] SEQ ID NO: 18 shows the ND5 reverse primer.

[0055] SEQ ID NO: 19 shows the ND5 probe.

[0056] SEQ ID NO: 20 shows the 18s forward primer.

[0057] SEQ ID NO:21 shows the 18s reverse primer.

[0058] SEQ ID NO: 22 shows the 18s probe.

[0059] SEQ ID NO:23 is a mitochondrial tRNA ala 1 shows a biotinylated probe for detecting

[0060] SEQ ID NO:24 represents C57BL6J chromosome 2 site 1.

[0061] SEQ ID NO:25 represents C57BL6J chromosome 2 site 2.

[0062] SEQ ID NO:26 represents C57BL6J chromosome 5 site 3.

[0063] SEQ ID NO:27 represents C57BL6J chromosome 6 site 4.

[0064] SEQ ID NO:28 represents C57BL6J chromosome 2 site 5.

[0065] SEQ ID NO:29 shows a probe for the APC 11-12 binding site.

[0066] SEQ ID NO:30 shows the forward primer for the APC 11-12 binding site.

[0067] SEQ ID NO:31 shows the reverse primer for the APC 11-12 binding site.

[0068] SEQ ID NO: 32 shows the probe for the reference binding site.

[0069] SEQ ID NO: 33 shows the forward primer for the reference binding site.

[0070] SEQ ID NO:34 shows the reverse primer for the reference binding site. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0071] Detailed Description of the Invention 1.1 (Definition) The patents and scientific literature referred to in this specification establish knowledge available to those skilled in the art. References cited in this specification, including issued U.S. patents, granted applications, published foreign applications, and GenBank database sequences, are incorporated herein by reference to the same extent as if each was specifically and individually indicated to be incorporated by reference.

[0072] The present invention may be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. For example, features illustrated with respect to one embodiment can be incorporated in other embodiments, and features illustrated with respect to a particular embodiment can be deleted from that embodiment. Additionally, numerous modifications and additions to the embodiments proposed herein will be apparent to those skilled in the art in light of this disclosure, without departing from the invention.

[0073] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terms used in the description of the present invention in this specification are intended to describe particular embodiments only and are not intended to be limiting of the present invention.

[0074] All publications, patent applications, patents, and other references cited herein are incorporated by reference in their entirety.

[0075] As used herein, "a," "an," or "the" can mean one or more. For example, "a" cell can mean a single cell or a number of cells.

[0076] As used herein, the term "5' cap" (also called RNA cap, RNA 7-methylguanosine cap or RNA m7G cap) is a modified guanine nucleotide that is added to the "front" or 5' end of eukaryotic messenger RNA immediately after the initiation of transcription. The 5' cap consists of a terminal group linked to the first transcribed nucleotide. Its presence is important for recognition by ribosomes and protection from RNases. Capping is coupled to transcription and occurs cotranscriptionally such that each affects the other. Shortly after the initiation of transcription, the 5' end of the mRNA being synthesized is bound by a cap synthesis complex that associates with RNA polymerase. This enzyme complex catalyzes the chemical reactions required for mRNA capping. Synthesis proceeds as a multistep biochemical reaction. The capping moiety can be modified to modulate the functionality of the mRNA, such as its stability or translation efficiency.

[0077] As used herein, the term "allele" refers to one of two or more variant forms of a gene.

[0078] As used herein, the term "constitutive promoter" refers to a nucleotide sequence that, when operably linked to a polynucleotide that encodes or specifies a gene product, causes the gene product to be made in a cell under most or all physiological conditions of the cell.

[0079] As used herein, the term "control" or "control cell" refers to a cell that provides a reference point for measuring changes in the genotype or phenotype of a genetically modified cell. A control cell can include, for example, (a) a wild-type cell, i.e., a wild-type cell of the same genotype as the starting material for the genetic modification that results in the genetically modified cell, (b) a cell of the same genotype as the genetically modified cell but transformed with a null construct (i.e., a construct that has no known effect on the trait of interest), or (c) a cell that is genetically identical to the genetically modified cell but has not been exposed to conditions or stimuli or further genetic modifications that induce the expression of the altered genotype or phenotype. For example, the control or control cell of the present invention can be a cell or cell population that does not contain MTEM or a polynucleotide having an amino acid sequence that encodes MTEM.

[0080] As used herein, the term "corresponding to" in reference to modifications of two proteins or amino acid sequences is used to indicate that a particular modification of a first protein is a substitution of the same amino acid residue as a modification of a second protein, and that when the two proteins are subjected to a standard sequence alignment (e.g., using a BLASTp program), the amino acid position of the modification of the first protein corresponds to or aligns with the amino acid position of the modification of the second protein. Thus, a modification of residue "X" in a first protein to amino acid "A" corresponds to a modification of residue "Y" in a second protein to amino acid "A" when residues X and Y correspond to each other in a sequence alignment, notwithstanding the fact that X and Y may be in different numbers.

[0081] As used herein, the term "disrupted" or "disrupt" or "disrupt expression" or "disrupt target sequence" refers to the introduction of a mutation (e.g., a frameshift mutation) that disrupts gene function and thereby prevents expression and / or function of the encoded polypeptide / expression product. For example, nuclease-mediated disruption of a gene may result in expression of a truncated protein and / or expression of a protein that does not retain wild-type function. Additionally, introduction of a donor template into a gene may not result in expression of the encoded protein, expression of a truncated protein, and / or expression of a protein that does not retain wild-type function.

[0082] As used herein, the term "encode" refers to the inherent property of a particular sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (e.g., rRNA, tRNA, and mRNA) or a defined sequence of amino acids, and the biological properties resulting therefrom. Thus, a gene, cDNA, or RNA codes for a protein when transcription and translation of the mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and is usually provided in a sequence listing, and the non-coding strand, which is used as a template for transcription of a gene or cDNA, can be said to code for the protein or other product of that gene or cDNA.

[0083] As used herein, the term "endogenous" with respect to a nucleotide sequence or protein is intended to mean a sequence or protein that is naturally contained within or expressed by a cell.

[0084] As used herein, the terms "exogenous" or "heterologous" with respect to a nucleotide or amino acid sequence are intended to mean a sequence that is purely synthetic, that originates from a foreign species, or, if originating from the same species, that has been substantially modified in composition and / or genomic locus from its native form by deliberate human intervention.

[0085] As used herein, the term "expression" refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter.

[0086] As used herein, the term "expression vector" refers to a vector that contains a recombinant polynucleotide that includes an expression control sequence operably linked to the nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression, and other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses and adeno-associated viruses) that incorporate recombinant polynucleotides.

[0087] As used herein, the term "genetically modified" refers to a cell or organism whose genomic DNA sequence has been intentionally modified by recombinant technology, or whose ancestors have had their genomic DNA sequence intentionally modified by recombinant technology. As used herein, the term "genetically modified" encompasses the term "transgenic". For example, as used herein, a "genetically modified" cell can refer to a cell whose mitochondrial DNA has been intentionally modified by recombinant technology.

[0088] As used herein, the term "homologous recombination" or "HR" refers to the natural cellular process in which double-stranded DNA breaks are repaired using a homologous DNA sequence as a repair template (see, e.g., Cahill et al. (2006), Front. Biosci. 11:1958-1976). The homologous DNA sequence may be an endogenous chromosomal sequence or an exogenous nucleic acid delivered to the cell.

[0089] As used herein, the term "homologous arms" or "sequences homologous to sequences adjacent to a nuclease cleavage site" refers to sequences adjacent to the 5' and 3' ends of a nucleic acid molecule that facilitate the insertion of the nucleic acid molecule into the cleavage site generated by the nuclease. In general, homologous arms can have a length of at least 50 base pairs, preferably at least 100 base pairs, up to 2000 base pairs or more, and can have at least 90%, preferably at least 95% or more sequence homology with their corresponding sequences in the genome. In some embodiments, the homologous arms are about 500 base pairs.

[0090] As used herein, the term "in vitro transcribed RNA" refers to RNA, preferably mRNA, synthesized in vitro. Generally, in vitro transcribed RNA is produced from an in vitro transcription vector. The in vitro transcription vector contains the template used to generate the in vitro transcribed RNA.

[0091] As used herein, the term "isolated" means changed or removed from the natural state. For example, a nucleic acid or peptide that is naturally present in a living animal is not "isolated," but the same nucleic acid or peptide that is partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein may exist in a substantially purified form or may exist in a non-native environment, such as, for example, a host cell.

[0092] As used herein, the term "lentivirus" refers to a genus of the Retroviridae family. Lentiviruses are unique among retroviruses in that they can infect non-dividing cells, and because they can deliver a significant amount of genetic information to the DNA of host cells, they are one of the most efficient methods of gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses.

[0093] As used herein, the term "lipid nanoparticle" refers to a lipid composition having a typically spherical structure with an average diameter of 10 to 1000 nanometers. In some formulations, the lipid nanoparticles can include at least one cationic lipid, at least one non-cationic lipid, and at least one conjugated lipid. Lipid nanoparticles known in the art that are suitable for encapsulating nucleic acids, such as mRNA, are contemplated for use in the present invention.

[0094] As used herein, the term "modification" with respect to a recombinant protein means any insertion, deletion, or substitution of amino acid residues in the recombinant sequence relative to a reference sequence (e.g., a wild-type or native sequence).

[0095] As used herein, the term "non-homologous end joining" or "NHEJ" refers to a natural cellular process in which double-stranded DNA breaks are repaired by direct joining of two non-homologous DNA segments (see, e.g., Cahill et al. (2006), Front. Biosci. 11:1958-1976). DNA repair by non-homologous end joining is error-prone and frequently results in untemplated addition or deletion of DNA sequences at the repair site. In some instances, cleavage at a target recognition sequence results in NHEJ at the target recognition site. Nuclease-induced cleavage of a target site in the coding sequence of a gene followed by DNA repair by NHEJ can introduce mutations, such as frameshift mutations, into the coding sequence that disrupt gene function. Thus, engineered nucleases can be used to effectively knock out genes in a cell population.

[0096] As used herein, the term "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence encoding a protein or RNA may also include introns to the extent that a nucleotide sequence encoding a protein may, in some versions, contain one or more introns.

[0097] As used herein, the term "operably linked" is intended to mean a functional link between two or more elements. For example, an operably linked between a nucleic acid sequence encoding a nuclease disclosed herein and a regulatory sequence (e.g., a promoter) is a functional link that allows expression of the nucleic acid sequence encoding the nuclease. The operably linked elements may be contiguous or discontinuous. When used to refer to the binding of two protein coding regions, operably linked intends that the coding regions are in the same reading frame.

[0098] As used herein, unless otherwise expressly stated, the word "or" is used in the inclusive sense of "and / or" and not in the exclusive sense of "either / or."

[0099] As used herein, the terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that may make up the sequence of a protein or peptide. A polypeptide includes any peptide or protein that contains two or more amino acids linked together by peptide bonds. As used herein, the term refers to both short chains, also commonly referred to in the art as peptides, oligopeptides and oligomers, for example, and longer chains, commonly referred to in the art as proteins, of which there are many varieties. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, mutants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. A polypeptide includes a natural peptide, a recombinant peptide, or a combination thereof.

[0100] As used herein, the term "reduced" or "reduced" refers to a reduction in the percentage of cells or the ratio of cells in a population of cells that contain a mutant mitochondrial genome compared to a population of control cells. In some embodiments, "reduced" or "reduced" refers to a reduction in the percentage of mutant mitochondrial genomes or the ratio of mutant mitochondrial genomes to wild-type mitochondrial genomes in a single cell or cell population. Such reductions are up to 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or up to 100%. Thus, the term "reduced" encompasses both partial and complete reduction of mutant mtDNA.

[0101] As used herein, the terms "percentage identity", "sequence identity", "percentage similarity", "sequence similarity", and the like, which relate to both amino acid sequence and nucleic acid sequence, refer to a measure of the degree of similarity between two sequences based on the alignment of sequences that maximizes the similarity between aligned amino acid residues or nucleotides, which is a function of the number of identical or similar residues or nucleotides, the total number of residues or nucleotides, and the presence and length of gaps in sequence alignment.Various algorithms and computer programs are available for determining sequence similarity using standard parameters. As used herein, sequence similarity is measured using the BLASTp program for amino acid sequences and the BLASTn program for nucleic acid sequences, both of which are available from the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ) and are described, for example, in Altschul et al. (1990), J.Mol.Biol.215:403-410; Gish and States (1993), Nature Genet.3:266-272; Madden et al. (1996), Meth.Enzymol.266:131-141; Altschul et al. (1997), Nucleic Acids Res.25:33 89-3402); Zhang et al. (2000), J.Comput.Biol.7(1-2):203-14. As used herein, the percent similarity of two amino acid sequences is a score based on the following parameters for the BLASTp algorithm: As used herein, the percent similarity of two nucleic acid sequences is a score based on the following parameters for the BLASTn algorithm: word length=11, gap opening penalty=-5, gap extension penalty=-2, match reward=1, and mismatch penalty=-3.

[0102] As used herein, the term "poly(A)" is a string of adenosines attached to an mRNA by polyadenylation. In a preferred embodiment of a construct for transient expression, the polyA is 50-5000, preferably more than 64, more preferably more than 100, and most preferably more than 300 or 400. The poly(A) sequence can be modified chemically or enzymatically to modulate the functionality of the mRNA, e.g., localization, stability or efficiency of translation.

[0103] As used herein, the term "polyadenylation" refers to the covalent attachment of a polyadenylyl moiety or modified variants thereof to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at the 3' end. The 3' poly(A) tail is a long sequence of adenine nucleotides (often hundreds) added to the pre-mRNA by the action of the enzyme polyadenylate polymerase. In higher eukaryotes, the poly(A) tail is added to transcripts that contain a specific sequence, the polyadenylation signal. The poly(A) tail and the proteins bound to it help protect the mRNA from degradation by exonucleases. Polyadenylation is also important for transcription termination, translocation of mRNA from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after DNA is transcribed into RNA, but can also occur later in the cytoplasm. After transcription is terminated, the mRNA strand is cleaved by the action of an endonuclease complex associated with the RNA polymerase. The cleavage site is usually characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mRNA is cleaved, an adenosine residue is added to the free 3' end of the cleavage site.

[0104] As used herein, the term "promoter / regulatory sequence" refers to a nucleic acid sequence required for expression of a gene product operably linked to the promoter / regulatory sequence. In some instances, this sequence may be a core promoter sequence, and in other instances, this sequence may also include enhancer sequences and other regulatory elements required for expression of the gene product. The promoter / regulatory sequence may, for example, be one that expresses the gene product in a tissue-specific manner.

[0105] As used herein, the term "recombinant" or "engineered" with respect to a protein means having an altered amino acid sequence as a result of the application of genetic engineering techniques to the nucleic acid encoding the protein and the cell or organism expressing the protein. With respect to a nucleic acid, the term "recombinant" or "engineered" means having an altered nucleic acid sequence as a result of the application of genetic engineering techniques. Genetic engineering techniques include, but are not limited to, PCR and DNA cloning techniques, transfection, transformation and other gene transfer techniques, homologous recombination, site-directed mutagenesis and gene fusion. According to this definition, a protein that has an amino acid sequence identical to a naturally occurring protein but is made by cloning and expression in a heterologous host is not considered to be recombinant or engineered.

[0106] As used herein, the terms "recombinant DNA construct", "recombinant construct", "expression cassette", "expression construct", "chimeric construct", "construct" and "recombinant DNA fragment" are used interchangeably herein and are single-stranded or double-stranded polynucleotides. Recombinant constructs include artificial combinations of nucleic acid fragments, including but not limited to regulatory and coding sequences that are not found together in nature. For example, recombinant DNA constructs may include regulatory and coding sequences that are derived from different sources, or regulatory and coding sequences that are derived from the same source and arranged in a manner different from that found in nature. Such constructs may be used alone or in combination with vectors.

[0107] As used herein, the term "tissue-specific promoter" refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specified by a gene, causes a gene product to be made in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

[0108] As used herein, the terms "transfected" or "transformed" or "transduced" or "nucleofected" refer to the process by which exogenous nucleic acid is transferred or introduced into a host cell. A "transfected" or "transformed" or "transduced" cell is one that has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.

[0109] As used herein, the term "transfer vector" refers to a composition of matter that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid to the inside of a cell. Numerous vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids and viruses. Thus, the term "transfer vector" includes autonomously replicating plasmids or viruses. This term should also be construed to further include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, etc. Examples of viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, etc.

[0110] As used herein, the term "transient" refers to expression of a non-integrated transgene over a period of hours, days, or weeks, which is shorter than the period of expression of the gene when integrated into the genome or contained within a stable plasmid replicon in the host cell.

[0111] As used herein, the term "vector" or "recombinant DNA vector" may be a construct that includes a replication system and sequences that allow transcription and translation of a sequence encoding a polypeptide in a given host cell. If a vector is used, the selection of the vector depends on the method used to transform the host cell, as is well known to those skilled in the art. The vector may include, but is not limited to, a plasmid vector and a recombinant AAV vector, or any other vector known in the art that is suitable for delivering genes to a target cell. Those skilled in the art are well aware of the genetic elements that must be present on the vector to successfully transform, select and grow a host cell that contains any of the isolated nucleotides or nucleic acid sequences of the present invention.

[0112] In some embodiments, "vector" also refers to a viral vector (i.e., a recombinant virus). Viral vectors can include, but are not limited to, retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated viral vectors (AAV).

[0113] As used herein, the term "wild type" refers to the most common naturally occurring allele (i.e., polynucleotide sequence) in an allele population of the same type of gene, in which the polypeptide encoded by the wild type allele has its original function. The term "wild type" also refers to the polypeptide encoded by the wild type allele. Wild type alleles (i.e., polynucleotides) and polypeptides are distinguishable from mutant or variant alleles and polypeptides that contain one or more mutations and / or substitutions compared to the wild type sequence. Wild type alleles or polypeptides can confer a normal phenotype in an organism, while mutant or variant alleles or polypeptides can, in some instances, confer an altered phenotype. Wild type nucleases are distinguishable from recombinant or non-naturally occurring nucleases. The term "wild type" can also refer to cells, organisms, and / or subjects that have a wild type allele of a particular gene, or cells, organisms, and / or subjects that are used for comparison purposes.

[0114] As used herein, the term "specifically altered" when referring to a nuclease means that the nuclease binds to and cleaves a recognition sequence that is not bound to and cleaved by a reference nuclease (e.g., wild-type) under physiological conditions, or the rate of cleavage of the recognition sequence is increased or decreased by a biologically significant amount (e.g., at least 2x, or between 2x and 10x) compared to the reference nuclease.

[0115] As used herein, the term "core sequence" refers to the four base pairs that separate the half-sites of a meganuclease recognition sequence. These bases are numbered +1 to +4. The core sequence includes the four bases that become the 3' single-stranded overhang after meganuclease cleavage. "Core sequence" can refer to a sequence in the sense strand or the antisense (opposite) strand. Meganucleases are symmetric and recognize bases equally on both the sense and antisense strands of the core sequence. For example, the sequence A+1A+2A+3A+4 on the sense strand is recognized by the meganuclease as T+1T+2T+3T+4 on the antisense strand, and thus A+1A+2A+3A+4 and T+1T+2T+3T+4 are functionally equivalent (e.g., both can be cleaved by a given meganuclease). Thus, the sequence C+1T+2G+3C+4 is equivalent to its opposite strand sequence G+1C+2A+3G+4 due to the fact that the meganuclease binds to its recognition sequence as a symmetric homodimer. As used herein, the term "cleave" or "cleavage" refers to hydrolysis of a phosphodiester bond in the backbone of a recognition sequence in a target sequence resulting in a double-stranded break in the target sequence, referred to herein as the "cleavage site."

[0116] As used herein, the term "DNA binding affinity" or "binding affinity" refers to the tendency of a nuclease to bind non-covalently to a reference DNA molecule (e.g., a recognition sequence or any sequence). Binding affinity is measured by the dissociation constant Kd. As used herein, a nuclease has "altered" binding affinity if the Kd of the nuclease to a reference recognition sequence increases or decreases by a statistically significant percent change relative to the reference nuclease.

[0117] As used herein, the term "hypervariable region" refers to a localized sequence within a meganuclease monomer or subunit that contains amino acids with relatively high variability. A hypervariable region can comprise about 50-60 consecutive residues, about 53-57 consecutive residues, or preferably about 56 residues. In some embodiments, the hypervariable region residues can correspond to positions 24-79 or 215-270 of any one of SEQ ID NOs: 2 or 4. A hypervariable region can comprise one or more residues that contact DNA bases in a recognition sequence and can be modified to alter the base selectivity of the monomer or subunit. A hypervariable region can also comprise one or more residues that bind to the DNA backbone when the meganuclease associates with a double-stranded DNA recognition sequence. Such residues can be modified to alter the binding affinity of the meganuclease to the DNA backbone and the target recognition sequence. In different embodiments of the invention, a hypervariable region can comprise 1-20 residues that exhibit variability and can be modified to affect base selectivity and / or DNA binding affinity. In certain embodiments, the hypervariable region comprises about 15-20 residues that exhibit variability and can be modified to affect base preference and / or DNA binding affinity. In some embodiments, the variable residues in the hypervariable region correspond to one or more of positions 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:2. In other embodiments, the variable residues in the hypervariable region correspond to one or more of positions 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:2.

[0118] As used herein, the term "linker" refers to an exogenous peptide sequence used to link two nuclease subunits into a single polypeptide. The linker may have a sequence found in a natural protein or may be an artificial sequence not found in a natural protein. The linker may be flexible and lack secondary structure or may have a tendency to form a specific three-dimensional structure under physiological conditions. The linker may include, but is not limited to, those contained in U.S. Patent Nos. 8,445,251, 9,340,777, 9,434,931 and 10,041,053, each of which is incorporated by reference in its entirety.

[0119] As used herein, the term "meganuclease" refers to an endonuclease that binds to double-stranded DNA with a recognition sequence of more than 12 base pairs. In some embodiments, the recognition sequence of the meganuclease of the present disclosure is 22 base pairs. Meganucleases may be endonucleases derived from I-CreI (SEQ ID NO: 1) and may refer to engineered variants of I-CreI that are modified, for example, with respect to native I-CreI in terms of DNA-binding specificity, DNA-cleavage activity, DNA-binding affinity, or dimerization properties. Methods for making such modified variants of I-CreI are known in the art (e.g., International Publication No. WO 2007 / 047859, which is incorporated by reference in its entirety). Meganucleases as used herein bind to double-stranded DNA as heterodimers. Meganucleases may also be "single-chain meganucleases" in which a pair of DNA-binding domains are linked to a single polypeptide using a peptide linker. The term "homing endonuclease" is synonymous with the term "meganuclease". The meganucleases of the present disclosure, when expressed in target cells as described herein, are substantially non-toxic such that the cells can be transfected and maintained at 37°C without observing any adverse effects on cell viability or significant reduction in meganuclease cleavage activity as measured using the methods described herein.

[0120] As used herein, the term "mitochondrially targeted engineered meganuclease" or "MTEM" refers to an engineered meganuclease linked to a peptide or other molecule that can direct the engineered meganuclease to the mitochondria so that it can bind and cleave mitochondrial DNA within the mitochondrial organelle. As used herein, the term MTEM is an example of an MTEN, as defined elsewhere herein.

[0121] As used herein, the term "mitochondrial transit peptide" or "MTP" refers to a peptide or a fragment of amino acids that can bind to a separate molecule to transport the molecule within mitochondria. For example, MTP can bind to a nuclease, such as an engineered meganuclease, to transport the engineered meganuclease to mitochondria. MTP consists of an alternating pattern of hydrophobic and positively charged amino acids, and can form a so-called amphipathic helix.

[0122] As used herein, the terms "nuclease" and "endonuclease" are used interchangeably and refer to naturally occurring or engineered enzymes that cleave phosphodiester bonds within a polynucleotide chain.

[0123] As used herein, the terms "recognition half-site," "recognition sequence half-site," or simply "half-site" refer to a nucleic acid sequence within a double-stranded DNA molecule that is recognized and bound by a monomer of a homodimeric or heterodimeric meganuclease or one subunit of a single-chain meganuclease.

[0124] As used herein, the term "recognition sequence" or "recognition site" refers to a DNA sequence that is bound and cleaved by a nuclease. In the case of meganucleases, the recognition sequence comprises a pair of inverted 9 base pair "half-sites" separated by 4 base pairs. In the case of single-chain meganucleases, the N-terminal domain of the protein contacts the first half-site and the C-terminal domain of the protein contacts the second half-site. Cleavage by a meganuclease results in a 4 base pair 3' overhang. An "overhang" or "sticky end" is a short single-stranded DNA segment that can be created by endonuclease cleavage of a double-stranded DNA sequence. In the case of I-CreI derived meganucleases and single-chain meganucleases, the overhang comprises bases 10-13 of the 22 base pair recognition sequence. As used herein, the term "single-chain meganuclease" refers to a polypeptide that comprises a pair of nuclease subunits joined by a linker. Single-chain meganucleases have the following structure: N-terminal subunit-linker-C-terminal subunit. The two meganuclease subunits generally do not have identical amino acid sequences and bind to non-identical DNA sequences. Thus, single-chain meganucleases typically cleave pseudopalindromic or non-palindromic recognition sequences. Single-chain meganucleases are sometimes referred to as "single-chain heterodimers" or "single-chain heterodimeric meganucleases" even though they are not actually dimers. For clarity, unless otherwise stated, the term "meganuclease" can refer to dimeric or single-chain meganucleases.

[0125] As used herein, the term "specificity" refers to the ability of a nuclease to bind and cut double-stranded DNA molecules only at a specific sequence of base pairs called recognition sequence, or only at a specific set of recognition sequences. A set of recognition sequences may share certain conserved positions or sequence motifs, but may be degenerate at one or more positions. A highly specific nuclease can cut only one or only a few recognition sequences. Specificity can be determined by any method known in the art.

[0126] As used herein, the term "target site" or "target sequence" refers to a region of a cell's chromosomal DNA that contains a recognition sequence for a nuclease.

[0127] As used herein, the term "treatment" or "treating a subject" refers to the administration of an engineered nuclease of the invention, or a nucleic acid encoding an engineered nuclease of the invention. In some embodiments, the engineered nuclease of the invention or a nucleic acid encoding same is administered in the form of a pharmaceutical composition of the invention during treatment.

[0128] As used herein, "vector" can also refer to a viral vector (i.e., a recombinant virus). Viral vectors can include, but are not limited to, retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated viral vectors (AAV).

[0129] As used herein, the term "serotype" or "capsid" refers to a distinct variant within a species of virus that is determined based on viral cell surface antigens. Known serotypes of AAV include, among others, AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAVHSC (Weitzman and Linden (2011) In Snyder and Moullier Adeno-associated virus methods and protocols. Totowa, NJ: Humana Press).

[0130] As used herein, "control" or "control cell" refers to a cell that provides a reference point for measuring the genotype or phenotype change of a genetically modified cell. A control cell can include, for example, (a) a wild-type cell, i.e., a wild-type cell of the same genotype as the starting material for the genetic modification that results in the genetically modified cell, (b) a cell of the same genotype as the genetically modified cell, but transformed with a null construct (i.e., a construct that has no known effect on the trait of interest), or (c) a cell that is genetically identical to the genetically modified cell, but has not been exposed to conditions, stimuli, or further genetic modifications that induce the expression of the altered genotype or phenotype.

[0131] As used herein, the term "effective amount" or "therapeutically effective amount" refers to an amount sufficient to produce beneficial or desired biological and / or clinical results. The therapeutically effective amount varies depending on the formulation or composition used, the disease and its severity, and the age, weight, physical condition and responsiveness of the subject being treated. In some specific embodiments, an effective amount of MTEM is about 1×10 10 gc / kg ~ approx. 1×10 14 gc / kg (e.g., 1×10 10 gc / kg, 1×10 11 gc / kg, 1×10 12 gc / kg, 1×10 13 gc / kg, or 1 × 10 14 gc / kg) of a nucleic acid encoding MTEM or a template nucleic acid. In certain embodiments, an effective amount of a nucleic acid encoding MTEM and / or a template nucleic acid disclosed herein, or a pharmaceutical composition comprising a nucleic acid encoding MTEM and / or a template nucleic acid, reduces at least one symptom of a disease in a subject.

[0132] As used herein, the terms "effective dose," "effective amount," "therapeutically effective dose," or "therapeutically effective amount" refer to an amount sufficient to effect beneficial or desired biological and / or clinical results.

[0133] As used herein, the term "gc / kg" or "gene copies / kilogram" refers to the number of copies of a nucleic acid encoding an MTEM or the number of copies of a template nucleic acid described herein per kilogram of body weight of the subject to whom the nucleic acid encoding an MTEM and / or template nucleic acid is administered.

[0134] As used herein, the term "preventing" refers to the prevention of a disease or condition in a patient.

[0135] As used herein, the term "prophylaxis" means the prevention or protective treatment of a disease or disease state.

[0136] As used herein, the term "reduced" refers to any reduction in the symptoms or severity of a disease. Such reduction may be up to 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or up to 100%. Thus, the term "reduced" encompasses both partial and complete reduction of a disease state.

[0137] As used herein, the recitation of a numerical range for a variable is intended to convey that the present disclosure can be implemented with the variable equal to any of the values ​​within that range. Thus, for a variable that is discrete in nature, the variable can be equal to any integer value within the numerical range, including the end points of the range. Similarly, for a variable that is continuous in nature, the variable can be equal to any real value within the numerical range, including the end points of the range. As an example, a variable described as having a value between 0 and 2 can take on values ​​of 0, 1 or 2 if the variable is discrete in nature, and can take on values ​​of 0.0, 0.1, 0.01, 0.001, or any other real value between 0 and 2, but not limited thereto, if the variable is continuous in nature.

[0138] 2.1 Principles of the invention Mitochondria regulate cellular energy and metabolism under normal growth and development, as well as in response to stress. Thus, editing of the mitochondrial genome has diverse applications in both animals and plants. In humans, deleterious mitochondrial mutations are the cause of several disorders for which gene editing therapy can be applied. However, despite the potential for using mitochondrial genome editing for therapeutic applications, this remains a less explored area of ​​science due to the inability to efficiently target mitochondrial DNA (mtDNA) and generate precise edits. The mitochondrial genome is difficult to edit because the editing technology needs to be delivered to this organelle. Mitochondria also lack predictable repair mechanisms. Previous attempts to edit the mitochondrial genome have resulted in large and unpredictable deletions / rearrangements. Thus, compositions and methods that allow for targeting and editing of defined regions of the mitochondrial genome (preferably limited to just one gene) in a more predictable manner are desired.

[0139] The present disclosure provides compositions and methods for binding and cleaving recognition sequences on mitochondrial genome without affecting surrounding regions in mitochondrial genome.Disclosed herein is an engineered nuclease, such as an engineered meganuclease that is bound to MTP so that DSB can be generated in mtDNA.The present invention demonstrates that engineered meganuclease can be directed to mitochondrial organelles and facilitate precise editing of mtDNA, thus opening up a whole field of prospects and opportunities in life science.

[0140] 2.2 Mitochondria-targeted engineered meganucleases to recognize and cleave recognition sequences within human mitochondrial DNA Mitochondrially targeted engineered meganucleases (MTEMs), constructed from engineered meganucleases bound to mitochondrial transit peptides (MTPs), can be effectively transported from the cytoplasm of eukaryotic cells to mitochondria. Once inside the mitochondrial organelle, MTEMs can bind and cleave recognition sequences within the mitochondrial genome. It is known in the art that site-specific nucleases can be used to make DNA breaks within the genome of living cells, and such DNA breaks can result in permanent modification of the genome via mutagenic NHEJ repair or via homologous recombination with transgenic DNA sequences. NHEJ can cause mutagenesis at the break site, resulting in inactivation of the allele. NHEJ-associated mutagenesis can inactivate the allele through the generation of early stop codons, frameshift mutations that create aberrant non-functional proteins, or can trigger mechanisms such as nonsense mutation-mediated mRNA decay. The use of nucleases that induce mutagenesis via NHEJ can be used to target specific mutations or sequences present in wild-type alleles. Moreover, the use of nucleases to induce double-strand breaks in target loci is known to stimulate homologous recombination of transgenic DNA sequences, particularly those flanked by sequences homologous to genomic targets.In this way, exogenous nucleic acid sequences can be inserted into target loci.Such exogenous nucleic acids can code for any sequence or polypeptide of interest.

[0141] The nuclease used to implement the present invention is a meganuclease. In a particular embodiment, the meganuclease used to implement the present invention is a single-chain meganuclease. The single-chain meganuclease comprises an N-terminal subunit and a C-terminal subunit linked by a linker peptide. Each of the two domains recognizes and binds to half of a recognition sequence (i.e., a recognition half-site), and the site of DNA cleavage is in the middle of the recognition sequence near the interface of the two subunits. The DNA strand cleavage is offset by four base pairs, so that the DNA cleavage by the meganuclease generates a pair of four-base pair 3' single-stranded overhangs.

[0142] In some embodiments, engineered meganucleases of the invention are engineered to bind and cleave the MIT 11-12 recognition sequence (SEQ ID NO:3). Such engineered meganucleases are referred to herein as "MIT 11-12 meganucleases" or "MIT 11-12 nucleases."

[0143] The engineered meganuclease of the present invention can comprise a first subunit comprising a first hypervariable (HVR1) region and a second subunit comprising a second hypervariable (HVR2) region. Furthermore, the first subunit can bind to a first recognition half-site in the recognition sequence, and the second subunit can bind to a second recognition half-site in the recognition sequence. In an embodiment where the engineered meganuclease is a single-chain meganuclease, the first and second subunits can be oriented such that the first subunit comprising the HVR1 region and binding to the first half-site is positioned as an N-terminal subunit, and the second subunit comprising the HVR2 region and binding to the second half-site is positioned as a C-terminal subunit. In an alternative embodiment, the first and second subunits can be oriented such that the first subunit comprising the HVR1 region and binding to the first half-site is positioned as a C-terminal subunit, and the second subunit comprising the HVR2 region and binding to the second half-site is positioned as an N-terminal subunit.

[0144] In various embodiments, the first and / or second subunits of the engineered meganuclease comprised in the MTEM comprise an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO: 1. In certain embodiments, the first and / or second subunits of the engineered meganuclease comprised in the MTEM comprise an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 7-153 of SEQ ID NO: 1. In further embodiments, the engineered meganuclease comprised in the MTEM comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 2. In a particular embodiment of the invention, the engineered meganuclease binds to and cleaves a recognition sequence comprising SEQ ID NO: 3 in the mitochondrial genome, the engineered meganuclease comprising a first subunit and a second subunit, the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region.

[0145] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO:2. In some such embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:2. In some such embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:2. In some such embodiments, the HVR1 region comprises a Y, R, K, or D at the residue corresponding to residue 66 of SEQ ID NO:2. In some such embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 2. In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 2. In some such embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:2. In some such embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:2. In some such embodiments, the HVR2 region comprises a Y, R, K, or D at the residue corresponding to residue 257 of SEQ ID NO:2. In some such embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:2.In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 7-153 of SEQ ID NO:2, and the second subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 198-344 of SEQ ID NO:2. In some such embodiments, the first subunit comprises a G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:2. In some such embodiments, the first subunit comprises an E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:2. In some such embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO:2. In some such embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO:2. In some such embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:2. In some such embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO:2. In some such embodiments, the engineered meganuclease is a single chain meganuclease comprising a linker, the linker covalently linking the first subunit and the second subunit. In some such embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:2. In some such embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO:2.In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 3. In some such embodiments, the engineered meganuclease is encoded by the nucleic acid sequence set forth in SEQ ID NO:3.

[0146] The MTP for directing the engineered meganuclease to mitochondria can be 10-100 amino acids long. In certain embodiments, the MTP is about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100 or more amino acids long. The MTP can contain additional signals that subsequently target the protein to different regions of the mitochondria, such as the mitochondrial matrix. Non-limiting examples of MTPs for use in the compositions and methods disclosed herein include Neurospora crassa F0 ATPase subunit 9 (SU9) MTP, human cytochrome c oxidase subunit VIII (CoxVIII or Cox8) MTP, the P1 isoform of subunit c of human ATP synthase MTP, aldehyde dehydrogenase targeting sequence MTP, glutaredoxin 5 MTP, pyruvate dehydrogenase MTP, peptidyl-prolyl isomerase MTP, acetyltransferase MTP, isocitrate dehydrogenase MTP, cytochrome oxidase MTP, and the subunits of the FA portion of ATP synthase MTP, CPN60 / No Examples of such MTPs include GG linker MTP, superoxide dismutase (SOD) MTP, superoxide dismutase double (2SOD) MTP, superoxide dismutase modified (SODmod) MTP, superoxide dismutase modified (2SODmod) double MTP, L29 MTP, gATPase gamma subunit (FAγ51) MTP, CoxIV twin strep (ABM 97483) MTP, and CoxIV 10xHis MTP.

[0147] In certain embodiments, the MTP comprises at least two MTP combinations. The MTP combinations may be the same MTP combinations or different MTP combinations. In certain embodiments, the MTP comprises CoxVIII MTP (SEQ ID NO:6) and SU9 MTP (SEQ ID NO:7) in a single MTP represented by SEQ ID NO:8.

[0148] To form a MTEM, the MTP can be attached to the engineered meganuclease disclosed herein by any suitable means. In certain embodiments, the MTP can be attached to the N-terminus of the engineered meganuclease. In other embodiments, the MTP can be attached to the C-terminus of the engineered meganuclease. In some embodiments, multiple MTPs can be attached to a single engineered meganuclease to form a MTEM. For example, a first MTP can be attached to the N-terminus of the engineered meganuclease and a second MTP can be attached to the C-terminus of the MTP. In some embodiments, the first and second MTPs are identical, and in other embodiments, the first and second MTPs are not identical. The MTP can be attached by any means that allows the transport of the engineered meganuclease into the mitochondria of a cell. In certain embodiments, the MTP is attached by fusing the MTP to the N-terminus or C-terminus of the engineered meganuclease. The MTP can also be attached to the engineered meganuclease by a peptide linker, which can be, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, or 20 amino acids. In certain embodiments, the MTP is attached to the peptide linker at the N-terminus or C-terminus of the engineered meganuclease.

[0149] In some embodiments, the MTEM for use in the compositions and methods of the present disclosure is linked to a nuclear export sequence (NES) to help prevent the MTEM from cleaving the nuclear genome. In some such embodiments, the NES comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 9 or 10. For example, the NES may comprise the amino acid sequence of SEQ ID NO: 9 or 10. In certain embodiments, the NES is linked to the N-terminus of the engineered meganuclease. In other embodiments, the NES is linked to the C-terminus of the engineered meganuclease. In certain embodiments, the NES is fused to the engineered meganuclease. In certain embodiments, the NES is linked to the engineered meganuclease by a polypeptide linker.

[0150] In certain embodiments, the MTEM is bound to multiple NESs. For example, the engineered meganucleases disclosed herein can include a first NES and a second NES. In some such embodiments, the first NES is bound to the N-terminus of the MTEM, and the second NES is bound to the C-terminus of the MTEM. In some such embodiments, the first NES and / or the second NES comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 9 or 10. For example, the first NES and / or the second NES can comprise the amino acid sequence shown in SEQ ID NO: 9 or 10. In some embodiments, the first NES and the second NES are identical. In other embodiments, the first NES and the second NES are not identical. The NES can be attached to the MTEM by any suitable means known in the art. For example, the first NES and / or the second NES can be fused to the MTEM. In some embodiments, the first NES and / or the second NES is attached to the MTEM by a polypeptide linker.

[0151] MTEMs with a NES may have reduced or decreased transport to the nucleus of a target cell or target cell population (e.g., a eukaryotic cell or eukaryotic cell population) compared to an engineered meganuclease that does not have a NES. For example, nuclear transport of MTEMs with a NES may be about 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100% or more less than MTEMs without a NES (e.g., about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% or more). In some embodiments, engineered meganucleases with a NES may induce fewer nuclear indels (i.e., fewer breaks and resulting deletions in the nuclear genome of a target cell or target cell population) compared to MTEMs that do not contain a NES. For example, nuclear indels induced by MTEMs with a NES may be about 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100% or more fewer than nuclear indels induced by MTEMs without a NES.

[0152] 2.3 Pharmaceutical Compositions In some embodiments, the present invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and a MTEM of the present invention, or a pharma-ceutically acceptable carrier and a polynucleotide comprising a nucleic acid sequence encoding the MTEM of the present invention. In particular, a pharmaceutical composition is provided comprising a pharma-ceutically acceptable carrier and a therapeutically effective amount of a nucleic acid encoding the MTEM, wherein the engineered meganuclease of the MTEM has specificity for a recognition sequence in mtDNA, such as human mtDNA.

[0153] In other embodiments, the invention provides a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and a genetically modified cell of the invention.

[0154] Such pharmaceutical compositions can be prepared according to known techniques. See, for example, Remington, The Science And Practice of Pharmacy (21st ed., Philadelphia, Lippincott, Williams & Wilkins, 2005). In the manufacture of pharmaceutical formulations according to the present invention, the nuclease polypeptide (or the DNA / RNA encoding it or the cells expressing it) is typically mixed with a pharma- ceutically acceptable carrier, and the resulting composition is administered to a subject. The carrier must be acceptable in the sense of being compatible with any other ingredients in the formulation and not deleterious to the subject. In some embodiments, the pharmaceutical compositions of the present invention can further comprise one or more additional agents or biological molecules useful in treating a disease of the subject. Similarly, the additional agents and / or biological molecules can be co-administered as separate compositions.

[0155] In certain embodiments of the invention, the pharmaceutical composition comprises a recombinant virus (i.e., a viral vector) comprising a polynucleotide (e.g., a viral genome) comprising a nucleic acid sequence encoding a MTEM as described herein. Such recombinant viruses are known in the art and include recombinant retroviruses, lentiviruses, adenoviruses, and adeno-associated viruses (AAV) (reviewed in Vannucci et al. (2013 New Microbiol. 36:1-22). Recombinant AAV useful in the invention can have any capsid or serotype that allows for viral transduction into and expression of MTEM by a target cell type. For example, in some embodiments, the recombinant AAV has a serotype of AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAVHSC. In some embodiments, the recombinant virus is injected directly into the target tissue. In alternative embodiments, the recombinant virus is delivered systemically via the circulatory system. It is known in the art that different AAVs tend to localize to different tissues, and appropriate AAV capsids / serotypes can be selected for preferential delivery to specific tissues. Thus, in some embodiments, the AAV serotype is AAV2. In alternative embodiments, the AAV serotype is AAV6. In other embodiments, the AAV serotype is AAV8. In yet other embodiments, the AAV serotype is AAV9. In further embodiments, the AAV serotype is AAHSC. AAV vectors can also be self-complementary so as not to require second strand DNA synthesis in the host cell (McCarty et al. (2001) Gene Ther. 8:1248-54). The nucleic acid delivered by the recombinant AAV vector can include left (5') and right (3') inverted terminal repeats.

[0156] In certain embodiments of the invention, pharmaceutical compositions comprise one or more mRNAs described herein (eg, an mRNA encoding an MTEM) formulated within a lipid nanoparticle.

[0157] The cationic lipid, non-cationic lipid and / or lipid conjugate that comprise lipid nanoparticles, and the relative molar ratio of such lipids to each other are selected based on the characteristics of the selected lipid, the nature of the intended target cell, and the characteristics of the mRNA to be delivered.Further considerations include, for example, the saturation of alkyl chain, and the size, charge, pH, pKa, fusogenicity and toxicity of the selected lipid.Therefore, the molar ratio of each component can be adjusted accordingly.

[0158] Lipid nanoparticles for use in the methods of the present invention can be prepared by a variety of techniques currently known in the art. Nucleic acid-lipid particles and methods for their preparation are described, for example, in U.S. Patent Application Nos. 20040142025 and 20070042031, the disclosures of which are incorporated herein by reference in their entirety for all purposes.

[0159] Selection of the appropriate size of lipid nanoparticles must take into account the site of the target cells and the application for which the lipid nanoparticles are being made. Generally, lipid nanoparticles have a size in the range of about 25 to about 500 nm. In some embodiments, lipid nanoparticles have a size of about 50 nm to about 300 nm or about 60 nm to about 120 nm. The size of lipid nanoparticles can be determined by quasi-electric light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421^150 (1981), which is incorporated herein by reference. Various methods for producing populations of lipid nanoparticles in a particular size range, such as sonication or homogenization, are known in the art. One such method is described in U.S. Pat. No. 4,737,323, which is incorporated herein by reference.

[0160] Some lipid nanoparticles contemplated for use in the present invention include at least one cationic lipid, at least one non-cationic lipid, and at least one conjugated lipid. In a more specific example, the lipid nanoparticles can include about 50 mol% to about 85 mol% cationic lipid, about 13 mol% to about 49.5 mol% non-cationic lipid, and about 0.5 mol% to about 10 mol% lipid conjugate, and are made in such a way that they have a non-lamellar (i.e., non-bilayer) morphology. In another specific example, the lipid nanoparticles can include about 40 mol% to about 85 mol% cationic lipid, about 13 mol% to about 49.5 mol% non-cationic lipid, and about 0.5 mol% to about 10 mol% lipid conjugate, and are made in such a way that they have a non-lamellar (i.e., non-bilayer) morphology.

[0161] The cationic lipid can include, for example, one or more of the following: palmitoyl-oleoyl-nor-arginine (PONA), MPDACA, GUADACA, ((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31tetraen-19-yl 4-(dimethylamino)butanoate) (MC3), LenMC3, CP-LenMC3, γ-LenMC3, CP-γ-LenMC3, MC3MC, MC2MC, MC3 ether, MC4 ether, MC3 amide, Pan-MC3, Pan-MC4, and Pan MC5, 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-K-C2-DMA, "XTC2"), 2,2-dilinoleyl-4-(3-dimethylaminopropyl)-[1,3]-dioxolane (D DLin-K-C3-DMA), 2,2-Dilinoleyl-4-(4-dimethylaminobutyl)-[1,3]-dioxolane (DLin-K-C4-DMA), 2,2-Dilinoleyl-5-dimethylaminomethyl-[1,3]-dioxane (DLin-K6-DMA), 2,2-Dilinoleyl-4-N-methylpepiazino-[1,3]-dioxolane (DLin-K-MPZ), 2,2-Dilinoleyl -4-Dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane ( DLinDAP), 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanediol (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), N,N-Dioleyl N,N-dimethylammonium chloride (DODAC), 1,2-Dioleyloxy-N,N-dimethylaminopropane (DODMA), 1,2-Distearyloxy-N,N- Dimethylaminopropane (DSDMA), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), 3-(N-(N´,N´-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl Ammonium bromide (DMRIE), 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), dioctadecylamidoglycylspermine (DOGS), 3-dimethylamino-2-(cholest-5-ene-3-β-oxybutane-4-oxy)-1-(cis,cis-9,12-octadecadienoxy)propane (C LinDMA), 2-[5´-(cholest-5-en-3-β-oxy)-3´-oxapentoxy)-3-dimethyl(dimethy)-1-(cis,cis-9´,1-2´-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N´-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), 1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP) or mixtures thereof. The cationic lipid may also be DLinDMA, DLin-K-C2-DMA ("XTC2"), MC3, LenMC3, CP-LenMC3, γ-LenMC3, CP-γ-LenMC3, MC3MC, MC2MC, MC3 ether, MC4 ether, MC3 amide, Pan-MC3, Pan-MC4, Pan MC5, or mixtures thereof.

[0162] In various embodiments, the cationic lipid comprises from about 50 mol% to about 90 mol%, from about 50 mol% to about 85 mol%, from about 50 mol% to about 80 mol%, from about 50 mol% to about 75 mol%, from about 50 mol% to about 70 mol%, from about 50 mol% to about 65 mol%, or from about 50 mol% to about 60 mol% of the total lipid present in the particle.

[0163] In other embodiments, the cationic lipid comprises from about 40 mol% to about 90 mol%, from about 40 mol% to about 85 mol%, from about 40 mol% to about 80 mol%, from about 40 mol% to about 75 mol%, from about 40 mol% to about 70 mol%, from about 40 mol% to about 65 mol%, or from about 40 mol% to about 60 mol% of the total lipid present in the particle.

[0164] Non-cationic lipid may, for example, comprise one or more anionic lipids and / or neutral lipids.In certain embodiments, non-cationic lipid comprises one of the following neutral lipid components: (1) cholesterol or its derivatives, (2) phospholipid, or (3) a mixture of phospholipid and cholesterol or its derivatives.Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, and mixtures thereof. Phospholipid can be, but is not limited to, dipalmitoyl phosphatidylcholine (DPPC), distearoyl phosphatidylcholine (DSPC), dioleoyl phosphatidylethanolamine (DOPE), palmitoyl oleoyl-phosphatidylcholine (POPC), palmitoyl oleoyl-phosphatidylethanolamine (POPE), palmitoyl oleoyl-phosphatidylglycerol (POPG), dipalmitoyl-phosphatidylethanolamine (DPPE), dimyristoyl-phosphatidylethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine, dielaidoyl-phosphatidylethanolamine (DEPE), stearoyl oleoyl-phosphatidylethanolamine (SOPE), egg phosphatidylcholine (EPC), and mixtures thereof.In certain embodiments, phospholipid is DPPC, DSPC, or mixtures thereof.

[0165] In some embodiments, the non-cationic lipid (e.g., one or more phospholipids and / or cholesterol) comprises about 10 mol% to about 60 mol%, about 15 mol% to about 60 mol%, about 20 mol% to about 60 mol%, about 25 mol% to about 60 mol%, about 30 mol% to about 60 mol%, about 10 mol% to about 55 mol%, about 15 mol% to about 55 mol%, about 20 mol% to about 55 mol%, about 25 mol% to about 55 mol%, about 30 mol% to about 55 mol%, about 13 mol% to about 50 mol%, about 15 mol% to about 50 mol%, or about 20 mol% to about 50 mol% of the total lipid present in the particle. When the non-cationic lipid is a mixture of phospholipid and cholesterol or a cholesterol derivative, the mixture may comprise up to about 40, 50, or 60 mol% of the total lipid present in the particle.

[0166] The conjugated lipid that inhibits particle aggregation can include, for example, one or more of the following: polyethylene glycol (PEG)-lipid conjugate, polyamide (ATTA)-lipid conjugate, cationic polymer-lipid conjugate (CPL), or mixtures thereof. In one particular embodiment, the nucleic acid-lipid particle includes either a PEG-lipid conjugate or an ATTA-lipid conjugate. In certain embodiments, the PEG-lipid conjugate or the ATTA-lipid conjugate is used together with a CPL. The conjugated lipid that inhibits particle aggregation can include, for example, a PEG-lipid, including PEG-diacylglycerol (DAG), PEG dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), or mixtures thereof. The PEG-DAA conjugate can be PEG-dilauryloxypropyl (C12), PEG-dimyristyloxypropyl (C14), PEG-dipalmityloxypropyl (C16), PEG-distearyloxypropyl (C18), or mixtures thereof.

[0167] Additional PEG-lipid conjugates suitable for use in the present invention include, but are not limited to, mPEG2000-1,2-di-O-alkyl-sn3-carbomoyl glycerides (PEG-C-DOMG).The synthesis of PEG-C-DOMG is described in PCT Application No. PCT / US 08 / 88676.Still further PEG-lipid conjugates suitable for use in the present invention include, but are not limited to, 1-[8'-(1,2-dimyristoyl-3-propanoxy)-carboxamido-3',6'-dioxaoctanyl]carbamoyl-ω-methyl-poly(ethylene glycol) (2KPEG-DMG).The synthesis of 2KPEG-DMG is described in US Patent No. 7,404,969.

[0168] In some cases, the conjugated lipid (e.g., PEG-lipid conjugate) that inhibits particle aggregation may comprise about 0.1 mol% to about 2 mol%, about 0.5 mol% to about 2 mol%, about 1 mol% to about 2 mol%, about 0.6 mol% to about 1.9 mol%, about 0.7 mol% to about 1.8 mol%, about 0.8 mol% to about 1.7 mol%, about 1 mol% to about 1.8 mol%, about 1.2 mol% to about 1.8 mol%, about 1.2 mol% to about 1.7 mol%, about 1.3 mol% to about 1.6 mol%, about 1.4 mol% to about 1.5 mol%, or about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mol% (or any fraction or range thereof) of the total lipid present in the particle. Typically, in such cases, the PEG moiety has an average molecular weight of about 2,000 Daltons. In other cases, the conjugated lipid (e.g., PEG-lipid conjugate) that inhibits particle aggregation may comprise about 5.0 mol% to about 10 mol%, about 5 mol% to about 9 mol%, about 5 mol% to about 8 mol%, about 6 mol% to about 9 mol%, about 6 mol% to about 8 mol%, or about 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, or 10 mol% (or any fraction or range thereof) of the total lipid present in the particle. Typically, in such cases, the PEG moiety has an average molecular weight of about 750 Daltons.

[0169] In another embodiment, the composition comprises amphoteric liposomes containing at least one positive charge carrier and at least one negative charge carrier, different from the positive charge carrier, the isoelectric point of the liposomes being between 4 and 8. This objective is achieved by the fact that the liposomes are prepared with a pH-dependent varying charge.

[0170] Liposomal structures with the desired properties are formed, for example, when the amount of membrane-forming or membrane-based cationic charge carriers exceeds the amount of anionic charge carriers at low pH and the ratio is reversed at high pH. This is always the case when the ionizable components have pKa values ​​between 4 and 9. As the pH of the medium decreases, all cationic charge carriers become more charged and all anionic charge carriers lose charge.

[0171] Cationic compounds useful for amphoteric liposomes include those previously described herein. Strong cationic compounds may include, for example, but are not limited to, DC-Chol 3-β-[N-(N',N'-dimethylmethane)carbamoyl]cholesterol, TC-Chol 3-β-(N',N',N'-trimethylaminoethane)cholesterol, BGSC bis-guanidinium-spermidine-cholesterol, BGTC bis-guanidinium-tren-cholesterol, DOTAP (1,2-dioleoyloxypropyl)-N,N,N-trimethylammonium chloride, DOSPER (1,3-dioleoyloxy-2-(6-carboxy-spermyl)-propylarnide, DOTMA (1,2-dioleoyloxypropyl)-N,N,N-trimethylammonium chloride) (Lipofectin®), DORIE 1,2-Dioleoyloxypropyl)-3-dimethylhydroxyethylammonium bromide, DOSC (1,2-Dioleoyl-3-succinyl-sn-glycerylcholine ester), DOGSDSO (1,2-Dioleoyl-sn-glycero-3-succinyl-2-hydroxyethyl disulfide omithin), DDAB dimethyldioctadecylammonium bromide, DOGS ((C18)2GlySper3+) N,N-Dioctadecylamido-glycol-spermine (Transfectam®) (C18)2Gly+N,N-Dioctadecylamido-glycine, CTAB cetyltrimethylaluminium bromide, CpyC cetylpyridinium chloride, DOEPC, 1,2-Dioleoyl-sn-glycero-3-ethylphosphocholine or other O-alkyl-phosphatidylcholines or ethanolamines, amides and phosphatidylethanolamines from lysine, arginine or ornithine.

[0172] Examples of weak cationic compounds include, but are not limited to, His-Chol (histaminyl-cholesterol hemisuccinate), Mo-Chol (morpholine-N-ethylamino-cholesterol hemisuccinate), or histidinyl-PE.

[0173] Examples of neutral compounds include, but are not limited to, cholesterol, ceramide, phosphatidylcholine, phosphatidylethanolamine, tetraether lipids, or diacylglycerol.

[0174] Anionic compounds useful for amphoteric liposomes include the non-cationic compounds described hereinabove. Examples of weak anionic compounds include, but are not limited to, CHEMS (cholesterol hemisuccinate), alkyl carboxylic acids with 8 to 25 carbon atoms, or diacylglycerol hemisuccinate. Further weak anionic compounds can include the amides of aspartic acid or glutamic acid and PE, and PS and its amides with glycine, alanine, glutamine, asparagine, serine, cysteine, threonine, tyrosine, glutamic acid, aspartic acid, or other amino acids or amino dicarboxylic acids. By the same principle, esters of hydroxycarboxylic acids or hydroxydicarboxylic acids with PS are also weak anionic compounds.

[0175] In some embodiments, amphoteric liposome contains conjugated lipid such as those described hereinabove.Specific examples of useful conjugated lipid include, but are not limited to, PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugate (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine and PEG-modified 1,2-diacyloxypropan-3-amine.Some specific examples are PEG-modified diacylglycerol and dialkylglycerol.

[0176] In some embodiments, the neutral lipid comprises about 10 mol% to about 60 mol%, about 15 mol% to about 60 mol%, about 20 mol% to about 60 mol%, about 25 mol% to about 60 mol%, about 30 mol% to about 60 mol%, about 10 mol% to about 55 mol%, about 15 mol% to about 55 mol%, about 20 mol% to about 55 mol%, about 25 mol% to about 55 mol%, about 30 mol% to about 55 mol%, about 13 mol% to about 50 mol%, about 15 mol% to about 50 mol%, or about 20 mol% to about 50 mol% of the total lipid present in the particle.

[0177] In some cases, the conjugated lipid (e.g., PEG-lipid conjugate) that inhibits particle aggregation comprises about 0.1 mol% to about 2 mol%, about 0.5 mol% to about 2 mol%, about 1 mol% to about 2 mol%, about 0.6 mol% to about 1.9 mol%, about 0.7 mol% to about 1.8 mol%, about 0.8 mol% to about 1.7 mol%, about 1 mol% to about 1.8 mol%, about 1.2 mol% to about 1.8 mol%, about 1.2 mol% to about 1.7 mol%, about 1.3 mol% to about 1.6 mol%, about 1.4 mol% to about 1.5 mol%, or about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mol% (or any fraction or range thereof) of the total lipid present in the particle. Typically, in such cases, the PEG moiety has an average molecular weight of about 2,000 daltons. In other cases, the conjugated lipid (e.g., PEG-lipid conjugate) that inhibits particle aggregation may comprise about 5.0 mol% to about 10 mol%, about 5 mol% to about 9 mol%, about 5 mol% to about 8 mol%, about 6 mol% to about 9 mol%, about 6 mol% to about 8 mol%, or about 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, or 10 mol% (or any fraction or range thereof) of the total lipid present in the particle. Typically, in such cases, the PEG moiety has an average molecular weight of about 750 Daltons.

[0178] Considering the total amount of neutral lipids and conjugated lipids, the remaining balance of the amphoteric liposomes can contain a mixture of cationic and anionic compounds formulated in various ratios. The ratio of cationic to anionic lipids can be selected to achieve the desired properties of nucleic acid encapsulation, Zeta potential, pKa, or other physicochemical properties that depend at least in part on the presence of charged lipid components.

[0179] In some embodiments, lipid nanoparticles have a composition that specifically enhances delivery and uptake in eukaryotic cells, such as mammalian cells (e.g., human cells).In certain embodiments, lipid nanoparticles have a composition that specifically enhances delivery and uptake in liver or in particular hepatic cells.In certain embodiments, lipid nanoparticles have a composition that specifically enhances delivery and uptake in neuronal cells.

[0180] 2.4 Methods for producing recombinant viruses In some embodiments, the present invention provides recombinant viruses (e.g., recombinant AAV) for use in the methods of the present invention. Recombinant AAV is typically produced in a mammalian cell line, such as HEK-293. The viral cap and rep genes are removed from the vector to prevent its self-replication and make room for the delivery of therapeutic genes (e.g., nuclease genes), so they need to be provided in trans to the packaging cell line. In addition, the "helper" (e.g., adenovirus) components required to support replication need to be provided (Cots et al. (2013), Curr. Gene Ther. 13(5):370-81). In many cases, recombinant AAV is produced using triple transfection, where a cell line is transfected with a first plasmid encoding the "helper" components, a second plasmid containing the cap and rep genes, and a third plasmid containing the viral ITRs that contain the intervening DNA sequence to be packaged into the virus. The viral particles containing the encapsidated genome (ITRs and intervening genes of interest) are then isolated from the cells by freeze-thaw cycles, sonication, detergents, or other means known in the art.The particles are then purified using cesium chloride density gradient centrifugation or affinity chromatography, and the gene of interest is then delivered to cells, tissues, or organisms, such as human patients.

[0181] Since recombinant AAV is typically made (manufactured) in cells, care must be taken when carrying out the present invention to ensure that MTEM is not expressed in the packaging cell. Since the viral genome of the present invention may contain a recognition sequence for a nuclease, any nuclease expressed in the packaging cell line may be able to cleave the viral genome before it can be packaged into a viral particle. This results in reduced packaging efficiency and / or packaging of fragmented genomes. Several approaches can be used to prevent nuclease expression in the packaging cell.

[0182] MTEM can be under the control of any promoter suitable for the expression of MTEM.In some embodiments, the promoter is a constitutive promoter, or the promoter is a tissue-specific promoter, such as a muscle cell-specific promoter, a skeletal muscle-specific promoter, a myotube-specific promoter, a muscle satellite cell-specific promoter, a neuron-specific promoter, an astrocyte-specific promoter, a microglia-specific promoter, an eye cell-specific promoter, a retinal cell-specific promoter, a retinal ganglion cell-specific promoter, a retinal pigment epithelium-specific promoter, a pancreatic cell-specific promoter, or a pancreatic beta cell-specific promoter.In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1α promoter, or a UbC promoter.

[0183] In certain embodiments, MTEM can be under the control of a tissue-specific promoter that is not active in packaging cells. For example, when developing a viral vector for delivery of nuclease genes to muscle tissue, a muscle-specific promoter can be used. Examples of muscle-specific promoters include C5-12 (Liu et al., (2004) Hum Gene Ther. 15:783-92), muscle-specific creatine kinase (MCK) promoter (Yuasa et al., (2002) Gene Ther. 9:1576-88), or smooth muscle 22 (SM22) promoter (Haase et al., (2013) BMC Biotechnol. 13:49-54). Examples of CNS (neuron) specific promoters include NSE, synapsin and MeCP2 promoters (Lentz et al., (2012) Neurobiol Dis. 48:179-88). Examples of liver-specific promoters include albumin promoters (such as Palb), human alpha 1-antitrypsin (such as Pa1AT) and hemopexin (such as Phpx) (Kramer et al., (2003) Mol. Therapy 7:375-85), hybrid liver-specific promoters (hepatic locus control region from the ApoE gene (ApoE-HCR) and liver-specific alpha 1-antitrypsin promoter), human thyroxine-binding globulin (TBG) promoter and apolipoprotein A-II promoter. Examples of eye-specific promoters include opsin, and the corneal epithelium-specific K12 promoter (Martin et al., (2002) Methods (28):267-75) (Tong et al., (2007) J Gene Med, 9:956-66). These promoters, or other tissue-specific promoters known in the art, are not highly active in HEK-293 cells and therefore are not expected to result in significant levels of nuclease gene expression in packaging cells when incorporated into the viral vectors of the present invention. Similarly, the viral vectors of the present invention contemplate the use of other cell lines with the use of incompatible tissue-specific promoters (i.e., the well-known HeLa cell line (human epithelial cells) and the liver-specific hemopexin promoter).Other examples of tissue-specific promoters include synovial sarcoma PDZD4 (cerebellum), C6 (liver), ASB5 (muscle), PPP1R12B (heart), SLC5A12 (kidney), cholesterol-regulated APOM (liver), ADPRHL1 (heart), and monogenic malformation syndrome TP73L (muscle) (Jacox et al., (2010), PLoS One v.5(8):e12274).

[0184] Alternatively, recombinant viruses can be packaged in cells from different species where nucleases are unlikely to be expressed. For example, viral particles can be produced in microbial, insect or plant cells using mammalian promoters such as the well-known cytomegalovirus or SV40 virus early promoters that are not active in non-mammalian packaging cells. In certain embodiments, viral particles are produced in insect cells using the baculovirus system described by Gao et al. (Gao et al., (2007), J. Biotechnol. 131(2):138-43). Nucleases under the control of mammalian promoters are unlikely to be expressed in these cells (Airenne et al. (2013), Mol. Ther. 21(4):739-49). In addition, insect cells utilize different mRNA splicing motifs than mammalian cells. Thus, it is possible to incorporate mammalian introns, such as the human growth hormone (HGH) intron or the SV40 large T antigen intron, into the coding sequence of the nuclease. These introns are not efficiently spliced ​​out of the pre-mRNA transcript in insect cells, so the insect cells do not express functional nucleases and package the full-length genome. In contrast, the mammalian cells into which the resulting recombinant AAV particles are delivered properly splice the pre-mRNA and express functional nuclease proteins. Haifeng Chen has reported the use of HGH and SV40 large T antigen introns to attenuate the expression of the toxic proteins barnase and diphtheria toxin fragment A in insect packaging cells, allowing the creation of recombinant AAV vectors carrying these toxin genes (Chen, H et al. (2012) Mol Ther Nucleic Acids. 1(11):e57). The MTEM gene may be operably linked to an inducible promoter such that a small molecule inducer is required for nuclease expression. Examples of inducible promoters include the Tet-On system (Clontech, Chen et al., (2015), BMC Biotechnol. 15(1):4)) and the RheoSwitch system (Intrexon, Sowa et al. (2011), Spine, 36(10):E 623-8). Both systems, as well as similar systems known in the art, rely on ligand-inducible transcription factors (mutants of the Tet repressor and ecdysone receptor, respectively) that activate transcription in response to a small molecule activator (doxycycline or ecdysone, respectively). Using such ligand-inducible transcription activators to practice the invention involves 1) placing a nuclease gene having a binding site(s) for the transcription factor under the control of a promoter that responds to the corresponding transcription factor, and 2) including a gene encoding the transcription factor in the packaged viral genome. The latter step is necessary because the nuclease will not be expressed in target cells or tissues after recombinant AAV delivery unless the transcription activator is also provided to the same cells. The transcription activator then induces nuclease gene expression only in cells or tissues that have been treated with the cognate small molecule activator. This approach is advantageous because it allows for spatiotemporal regulation of nuclease gene expression by selecting when and to which tissues the small molecule inducer is delivered. However, the need to include the inducer in the viral genome severely limits the carrying capacity, posing a drawback to this approach.

[0185] In another specific embodiment, recombinant AAV is made in a mammalian cell line that expresses a transcriptional repressor that prevents the expression of nuclease. Transcriptional repressors are known in the art and include Tet repressors, Lac repressors, Cro repressors and lambda repressors. Many nuclear hormone receptors, such as ecdysone receptors, also act as transcriptional repressors in the absence of their cognate hormone ligands. To carry out the present invention, packaging cells are transfected / transduced with a vector that codes for a transcriptional repressor, and the nuclease gene in the viral genome (packaging vector) is operably linked to a promoter that has been modified to contain a binding site for the repressor, so that the repressor silences the promoter. The gene that codes for the transcriptional repressor can be placed in various locations. It can be coded on a separate vector, can be integrated into the packaging vector outside the ITR sequence, can be integrated into the cap / rep vector or adenovirus helper vector, or can be stably integrated into the genome of the packaging cell so that it is constitutively expressed. Methods for modifying common mammalian promoters to incorporate transcriptional repressor sites are known in the art. For example, Chang and Roninson modified the strong constitutive CMV and RSV promoters to include Lac repressor operators and showed that gene expression from the modified promoters was greatly attenuated in cells expressing the repressor (Chang and Roninson (1996), Gene 183:137-42). The use of a non-human transcriptional repressor ensures that the transcription of the nuclease gene is only repressed in packaging cells expressing the repressor, and not in target cells or tissues transduced with the resulting recombinant AAV vector.

[0186] 2.5 Methods for producing genetically modified cells The present invention provides methods for generating genetically modified cells both in vitro and in vivo using MTEMs that contain engineered meganucleases that bind to and cleave recognition sequences found within mtDNA, such as human mtDNA. Cleavage at such recognition sequences can allow for NHEJ at the cleavage site, insertion of exogenous sequences by homologous recombination, or degradation of the mtDNA.

[0187] The present invention includes that the MTEM of the present invention, or a nucleic acid encoding the MTEM, can be delivered (ie, introduced) into a cell, such as a eukaryotic cell (eg, a human cell).

[0188] The MTEM of the present invention can be delivered to cells in the form of protein or preferably as a nucleic acid encoding the MTEM. Such nucleic acid can be DNA (e.g., circular or linear plasmid DNA or PCR product) or RNA (e.g., mRNA). Thus, a polynucleotide comprising a nucleic acid sequence encoding the MTEM disclosed herein is provided herein. In certain embodiments, the polynucleotide is an mRNA. The polynucleotide encoding the MTEM disclosed herein can be operably linked to a promoter. In certain embodiments, an expression cassette is provided comprising a promoter operably linked to a polynucleotide having a nucleic acid sequence encoding the MTEM disclosed herein.

[0189] In the case of an embodiment delivered in DNA form, the MTEM coding sequence should be operably linked to a promoter to promote transcription of the MTEM coding sequence. Mammalian promoters suitable for the present invention include constitutive promoters such as the cytomegalovirus early (CMV) promoter (Thomsen et al., (1984), Proc Natl Acad Sci USA. 81(3):659-63), the SV40 early promoter (Benoist and Chambon (1981), Nature. 290(5804):304-10), the CAG promoter, the EF1α promoter, or the UbC promoter, as well as inducible promoters such as the tetracycline-inducible promoter (Dingermann et al., (1992), Mol Cell Biol. 12(9):4038-45). The MTEM of the present invention can also be operably linked to a synthetic promoter. Synthetic promoters can include, but are not limited to, JeT promoter (WO 2002 / 012514).In certain embodiments, the nucleic acid sequence encoding the MTEM of the present invention is operably linked to a tissue-specific promoter, such as a muscle cell-specific promoter, a skeletal muscle-specific promoter, a myotube-specific promoter, a muscle satellite cell-specific promoter, a neuron-specific promoter, an astrocyte-specific promoter, a microglia-specific promoter, an eye cell-specific promoter, a retinal cell-specific promoter, a retinal ganglion cell-specific promoter, a retinal pigment epithelium-specific promoter, a pancreatic cell-specific promoter, or a pancreatic beta cell-specific promoter.

[0190] In certain embodiments, the nucleic acid sequence encoding MTEM is delivered on a recombinant DNA construct or expression cassette. For example, the recombinant DNA construct can include an expression cassette (i.e., a "cassette") that includes a promoter and a nucleic acid sequence encoding the engineered nuclease described herein.

[0191] In some embodiments, mRNA encoding METM is delivered to the cell, as this reduces the likelihood that the gene encoding the engineered nuclease will become integrated into the cell's genome.

[0192] Such mRNAs encoding METMs can be made using methods known in the art, such as in vitro transcription. In some embodiments, the mRNAs are 5' capped with 7-methyl-guanosine, anti-reverse cap analog (ARCA) (U.S. Pat. No. 7,074,596), CLEANCAP® analogs, such as Cap 1 analog (Trilink, San Diego, CA), or enzymatically capped, such as with vaccinia capping enzyme. In some embodiments, the mRNAs can be polyadenylated. The mRNAs can contain various 5' and 3' untranslated sequence elements to enhance expression of the encoded MTEM and / or the stability of the mRNA itself. Such elements can include post-translational regulatory elements, such as, for example, woodchuck hepatitis virus post-translational regulatory elements. The mRNAs can contain nucleoside analogs or naturally occurring nucleosides, such as pseudouridine, 5-methylcytidine, N 6-methyladenosine, 5-methyluridine, or 2-thiouridine. Additional nucleoside analogs include, for example, those described in US Pat. No. 8,278,036.

[0193] Purified MTEM can be delivered to cells to cleave mitochondrial DNA by a variety of different mechanisms known in the art, including those further detailed herein.

[0194] In another specific embodiment, the nucleic acid encoding MTEM of the present invention is introduced into cells using single-stranded DNA template.Single-stranded DNA can further comprise 5' and / or 3' AAV inverted terminal repeat (ITR) upstream and / or downstream of the sequence encoding MTEM.Single-stranded DNA can further comprise 5' and / or 3' homology arms upstream and / or downstream of the sequence encoding MTEM.

[0195] In another specific embodiment, the gene encoding the MTEM of the present invention is introduced into cells using linearized DNA template.Such linearized DNA template can be prepared by methods known in the art.For example, the plasmid DNA encoding nuclease can be digested by one or more restriction enzymes, so that circular plasmid DNA is linearized before being introduced into cells.

[0196] Purified MTEM, or a nucleic acid encoding MTEM, can be delivered to cells to cleave mitochondrial DNA by a variety of different mechanisms known in the art, including those further detailed herein below.

[0197] In some embodiments, MTEM, DNA / mRNA encoding MTEM, or cells expressing MTEM are formulated in a pharmaceutically acceptable carrier for systemic administration or administration to target tissue according to known techniques.See, for example, Remington, The Science And Practice of Pharmacy (21st ed., Philadelphia, Lippincott, Williams&Wilkins, 2005).In the manufacture of pharmaceutical preparations according to the present invention, protein / RNA / mRNA / cells are typically mixed with a pharmaceutically acceptable carrier.The carrier must, of course, be acceptable in the sense of being compatible with any other ingredients in the preparation and must not be harmful to the patient.The carrier can be solid or liquid, or both, and can be formulated with the compound as a unit dose preparation.

[0198] In some embodiments, MTEM, or DNA / mRNA encoding MTEM, is conjugated to a cell-penetrating peptide or targeting ligand to facilitate cellular uptake. Examples of cell-penetrating peptides known in the art include polyarginine (Jearawiriyapaisarn et al. (2008) Mol Ther. 16:1624-9), the TAT peptide from the HIV virus (Hudecz et al. (2005), Med. Res. Rev. 25:679-736), MPG (Simeoni et al. (2003) Nucleic Acids Res. 31:2717-2724), Pep-1 (Deshayes et al. (2004) Biochemistry 43:7698-7706), and HSV-1 VP-22 (Deshayes et al. (2005) Cell Mol Life Sci. 62:1839-49. In an alternative embodiment, MTEM, or DNA / mRNA encoding MTEM, is covalently or non-covalently linked to an antibody that recognizes a specific cell surface receptor expressed on a target cell, such that the MTEM protein / DNA / mRNA binds to and is internalized by the target cell. Alternatively, the MTEM protein / DNA / mRNA can be covalently or non-covalently linked to a natural ligand (or a portion of a natural ligand) of such a cell surface receptor. (McCall et al. (2014) Tissue Barriers. 2(4):e 944449, Dinda et al. (2013) Curr Pharm Biotechnol. 14:1264-74, Kang et al. (2014) Curr Pharm Biotechnol. 15(3):220-30, Qian et al. (2014) Expert Opin Drug Metab Toxicol.\10(11):1491-508).

[0199] In some embodiments, MTEM, or DNA / mRNA encoding MTEM, is encapsulated in a biodegradable hydrogel. Hydrogels can provide sustained and tunable release of therapeutic payloads to desired areas of target tissues without the need for frequent injections, and stimuli-responsive materials (e.g., temperature and pH-responsive hydrogels) can be designed to release payloads in response to environmental or externally applied cues (Kang Derwent et al. (2008) Trans Am Ophthalmol Soc. 106:206-214).

[0200] In some embodiments, MTEMs, or DNA / mRNAs encoding MTEMs, are covalently or preferably non-covalently attached to nanoparticles or encapsulated within such nanoparticles using methods known in the art (Sharma et al. (2014) Biomed Res Int. 2014). Nanoparticles are nanoscale delivery systems with length scales less than 1 μm, preferably less than 100 nm. Such nanoparticles can be designed with cores composed of metals, lipids, polymers, or biological macromolecules, and multiple copies of nuclease proteins, mRNA, or DNA can be attached or encapsulated into the nanoparticle core. This increases the number of copies of protein / mRNA / DNA delivered to each cell, thus increasing the intracellular expression of each MTEM to maximize the chances of the target recognition sequence being cleaved. The surface of such nanoparticles may be further modified with polymers or lipids (e.g., chitosan, cationic polymers or cationic lipids) to form core-shell nanoparticles whose surfaces impart additional functionality for enhancing cellular delivery and uptake of payloads (Jian et al. (2012) Biomaterials. 33(30):7621-30). Nanoparticles may be further advantageously conjugated to targeting molecules to direct the nanoparticles to the appropriate cell type and / or to increase the likelihood of cellular uptake. Examples of such targeting molecules include antibodies specific for cell surface receptors and natural ligands (or portions of natural ligands) of cell surface receptors.

[0201] In some embodiments, MTEM or DNA / mRNA encoding MTEM is encapsulated in liposomes or complexed using cationic lipids (e.g., LIPOFECTAMINE™, Life Technologies Corp., Carlsbad, CA, see Zuris et al. (2015) Nat Biotechnol. 33:73-80; Mishra et al. (2011), J Drug Deliv., 2011:863734). Liposome and lipoplex formulations can protect the payload from degradation, enhance accumulation and retention at the target site, and promote cellular uptake and delivery efficiency through fusion with and / or disruption of the cell membrane of the target cell.

[0202] In some embodiments, MTEM, or DNA / mRNA encoding MTEM, is encapsulated within a polymer scaffold (e.g., PLGA) or complexed using cationic polymers (e.g., PEI, PLL) (Tamboli et al. (2011), Ther Deliv. 2(4):523-536). Polymeric carriers can be designed to provide tunable drug release rates through control of polymer erosion and drug diffusion, and high drug encapsulation efficiency can provide protection of the therapeutic payload until intracellular delivery to the desired target cell population.

[0203] In some embodiments, MTEM, or DNA / mRNA encoding MTEM, is combined with amphiphilic molecules that self-assemble into micelles (Tong et al. (2007) J Gene Med. 9(11):956-66). Polymeric micelles may contain a micellar shell formed of a hydrophilic polymer (e.g., polyethylene glycol) that can prevent aggregation, mask charge interactions, and reduce non-specific interactions.

[0204] In some embodiments, MTEM, or DNA / mRNA encoding MTEM, is formulated into an emulsion or nanoemulsion (i.e., having an average particle size of less than 1 nm) for administration and / or delivery to target cells. The term "emulsion" refers to, but is not limited to, any oil-in-water, water-in-oil, water-in-oil-in-water, or oil-in-water-in-oil dispersion or droplets that contain lipid structures that can form when a water-immiscible phase is mixed with an aqueous phase as a result of hydrophobic forces that direct non-polar residues (e.g., long hydrocarbon chains) away from water and polar head groups toward water. These other lipid structures include, but are not limited to, monolamellar, paucilamellar, and multilamellar lipid vesicles, micelles, and lamellar phases. Emulsions are composed of an aqueous phase and a lipophilic phase (typically containing oil and organic solvent). Emulsions also often contain one or more surfactants. Nanoemulsion formulations are well known, as described, for example, in U.S. Pat. Nos. 6,015,832, 6,506,803, 6,635,676, 6,559,189, and 7,767,216, each of which is incorporated by reference herein in its entirety.

[0205] In some embodiments, MTEM, or DNA / mRNA encoding MTEM, is covalently or non-covalently linked to multifunctional polymer conjugates, DNA dendrimers, and polymer dendrimers (Mastorakos et al. (2015) Nanoscale. 7(9):3845-56; Cheng et al. (2008) J Pharm Sci. 97(1):123-43). Dendrimer generation can control payload capacity and size and can provide high payload capacity. Additionally, display of multiple surface groups can be utilized to improve stability, reduce non-specific interactions, and enhance cell-specific targeting and drug release.

[0206] In some embodiments, the polynucleotide having a nucleic acid sequence encoding MTEM is introduced into cells using a recombinant virus. Such recombinant viruses are known in the art and include recombinant retroviruses, recombinant lentiviruses, recombinant adenoviruses, and recombinant AAVs (reviewed in Vannucci et al. (2013) New Microbiol. 36:1-22). The recombinant AAV useful in the present invention can have any capsid or serotype that allows the virus to transduce the target cell type and the target cell to express MTEM. For example, in some embodiments, the recombinant AAV has a serotype of AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAVHSC. In some embodiments, the recombinant virus is directly injected into the target tissue. In an alternative embodiment, the recombinant virus is delivered systemically via the circulatory system. It is known in the art that different AAVs tend to localize in different tissues, and appropriate AAV capsid / serotypes can be selected for preferential delivery to specific tissues. Thus, in some embodiments, the AAV serotype is AAV2. In alternative embodiments, the AAV serotype is AAV6. In other embodiments, the AAV serotype is AAV8. In yet other embodiments, the AAV serotype is AAV9. AAV can also be self-complementary so that it does not require second strand DNA synthesis in host cells (McCarty et al. (2001) Gene Ther. 8:1248-54). The polynucleotide delivered by recombinant AAV vector can include left (5') and right (3') inverted terminal repeats.

[0207] In one embodiment, the recombinant virus used to deliver the polynucleotide having a nucleic acid sequence encoding the MTEM is a self-limiting recombinant virus. The self-limiting recombinant virus can have a limited duration in a cell or organism due to the presence of a recognition sequence for the engineered meganuclease in the viral genome. Thus, the self-limiting recombinant virus can be engineered to provide a promoter, a MTEM as described herein, and a code for a meganuclease recognition site in the ITR. The self-limiting recombinant virus delivers the meganuclease gene to a cell, tissue, or organism so that the MTEM can be expressed and cleave the genome of the cell at the endogenous recognition sequence in the genome. The delivered meganuclease also finds its target site within the self-limiting recombinant virus itself and cleaves the viral genome at this target site. Once cleaved, the 5' and 3' ends of the viral genome are exposed and degraded by exonucleases, thus killing the virus and stopping the creation of MTEM.

[0208] When polynucleotides having nucleic acid sequences encoding MTEM are delivered in DNA form (e.g., plasmid) and / or via viral vector (e.g., AAV), they must be operably linked to a promoter. In some embodiments, this can be a viral promoter, such as an endogenous promoter from a viral vector (e.g., the LTR of a lentiviral vector) or a constitutive or tissue-specific promoter described elsewhere herein. In certain embodiments, polynucleotides having nucleic acid sequences encoding MTEM are operably linked to a promoter that preferentially drives gene expression in target cells, such as nerve cells, muscle cells, pancreatic cells, and eye cells. In some embodiments, the target cells are muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells; or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells.

[0209] In some embodiments, methods are provided herein for producing genetically modified eukaryotic cells or genetically modified eukaryotic cell populations by introducing a polynucleotide of the present disclosure, for example a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease described above, into a eukaryotic cell or eukaryotic cell population. When expressed in a eukaryotic cell or eukaryotic cell population, the engineered meganuclease localizes to mitochondria, binds to a recognition sequence in the mitochondrial genome, and generates a cleavage site. The cleavage site generated by the engineered meganuclease can be repaired by an NHEJ repair pathway, which can result in the insertion or deletion of nucleic acid at the cleavage site. Additionally or alternatively, the cleavage site generated by the engineered meganuclease in the mitochondrial genome of a eukaryotic cell or eukaryotic cell population can be repaired by alternative non-homologous end joining (Alt-NHEJ) or microhomology-mediated end joining (MMEJ). NHEJ or Alt-NHEJ / MMEJ can result in the insertion and / or deletion of nucleic acid at the cleavage site. In particular, NHEJ or Alt-NHEJ / MMEJ may be performed by adding 1 to 1000 (e.g., 1 to 10, 10 to 100, 100 to 200, 200 to 300, 300 to 400, 400 to 500, 500 to 600, 600 to 700, 700 to 80, 800 to 900, or 900 to 1000) nucleotides to the cleavage site, for example about 1, 5, 10, 15, 20, 25, 50, 75, 100, 125, This may result in insertions and / or deletions of 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975 or 1000 nucleotides. In some embodiments, the mitochondrial genome in a genetically modified eukaryotic cell disclosed herein or a population of genetically modified eukaryotic cells disclosed herein may be degraded.In some such embodiments, the percentage of mitochondrial genomes containing the recognition sequence can be reduced by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% or degraded by about 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100% or more compared to control cells. In certain embodiments, mutant mitochondrial genomes containing the MTEM recognition sequence of SEQ ID NO:3 are degraded. By degrading mutant mitochondrial genomes having MTEM recognition sequences, the overall ratio of wild-type mitochondrial genomes to mutant mitochondrial genomes is increased following administration or expression of the MTEMs disclosed herein. In some embodiments, the ratio of wild type mitochondrial genome to mutant mitochondrial genome in a single genetically modified eukaryotic cell or in a population of genetically modified eukaryotic cells disclosed herein is about 5:95, about 10:90, about 15:85, about 20:80, about 25:75, about 30:70, about 35:65, about 40:60, about 45:55, about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75: 25, about 80:20, about 85:15, about 90:10, about 95:5, about 20:1, about 50:1, about 100:1, about 150:1, about 200:1, about 250:1, about 300:1, about 350:1, about 400:1, about 450:1, about 500:1, about 550:1, about 600:1, about 650:1, about 700:1, about 750:1, about 800:1, about 850:1, about 900:1, about 950:1, about 1000:1 or more.

[0210] In certain embodiments, the percentage of wild-type genomes in a single genetically modified eukaryotic cell disclosed herein or in a population of genetically modified eukaryotic cells disclosed herein may increase as mutant mitochondrial genomes comprising SEQ ID NO:3 are recognized, cleaved, and degraded by MTEM. The percentage of wild-type mitochondrial genomes in a genetically modified eukaryotic cell or population of genetically modified cells disclosed herein may be about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more of the total mitochondrial genome in the genetically modified eukaryotic cell or population of genetically modified cells disclosed herein, when compared to a eukaryotic cell or population of eukaryotic cells that does not express MTEM as disclosed herein. Similarly, the percentage of mutant mitochondrial genomes containing the recognition sequence of SEQ ID NO:3 in a genetically modified eukaryotic cell or genetically modified cell population may be reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more when compared to a eukaryotic cell or eukaryotic cell population that does not express a MTEM disclosed herein.

[0211] In some embodiments, mitochondrial respiration in a genetically modified eukaryotic cell or genetically modified eukaryotic cell population disclosed herein may be increased by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or more when compared to a eukaryotic cell that does not express a MTEM as disclosed herein. Mitochondrial respiration in a genetically modified eukaryotic cell or genetically modified eukaryotic cell population disclosed herein may be increased by about 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100% or more when compared to a eukaryotic cell or eukaryotic cell population that does not express a MTEM as disclosed herein.

[0212] In certain cases, the recognition sequence is within a region of the mitochondrial genome that is associated with a mitochondrial disorder.

[0213] Both normal and mutated mtDNA can be present in the same cell, a situation known as heteroplasmy. The number of defective mitochondria may be greater than the number of normal mitochondria. Symptoms may not appear in a given generation until the mutation affects a significant proportion of mtDNA. The uneven distribution of normal and mutated mtDNA in different tissues may affect different organs in members of the same family. This may result in a variety of symptoms in affected families.

[0214] In certain embodiments, the recognition sequence disclosed herein in the mitochondrial genome of a eukaryotic cell or eukaryotic cell population is located between nucleotides 8470 and 13,447 of the mitochondrial genome. In certain embodiments, the recognition sequence in the mitochondrial genome of a eukaryotic cell or eukaryotic cell population is located between nucleotides 8460 and 8580 or between nucleotides 13,437 and 13,457. In certain embodiments, the recognition sequence of SEQ ID NO: 3 is located only on the mutant mitochondrial genome. When expressed in a genetically modified eukaryotic cell or genetically modified eukaryotic cell population, MTEM can localize to mitochondria, bind to the recognition sequence in the mitochondrial genome, and generate a cleavage site. Thus, by targeting the recognition sequence located only on the mutant genome, the genome can be cleaved and subsequently degraded. This specific degradation of the mutant mitochondrial genome can be used to help treat or alleviate symptoms of mitochondrial disorders (e.g., mitochondrial common deletion disorder or MELAS).

[0215] Thus, provided herein are methods for degrading mutant mitochondrial genomes in a target cell or population of target cells by delivering to the target cell or population a nucleic acid sequence encoding or a polynucleotide comprising a MTEM as disclosed herein. In certain embodiments, the target cell or population of target cells comprises a mutant mitochondrial genome, and the MTEM recognizes and cleaves the MTEM recognition sequence (e.g., SEQ ID NO: 3). The target cell or population of target cells can be a mammalian subject, such as a human subject. In some embodiments, the target cell is a muscle cell, a skeletal muscle cell, a myotube cell, a muscle satellite cell, a neuron, an astrocyte, a microglial cell, an ocular cell, a retinal cell, a retinal ganglion cell, a retinal pigment epithelial cell, a pancreatic cell, or a pancreatic beta cell, or the population of target cells is a population of muscle cells, skeletal muscle cells, myotube cells, a muscle satellite cell, a neuron, an astrocyte, a microglial cell, an ocular cell, a retinal cell, a retinal ganglion cell, a retinal pigment epithelial cell, a pancreatic cell, or a pancreatic beta cell. or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells; or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells.

[0216] Disclosed herein is a method for treating a condition associated with a mitochondrial disorder in a subject. Such a method includes administering to a subject a therapeutically effective amount of a polynucleotide having a nucleic acid sequence encoding a MTEM as disclosed herein, or a therapeutically effective amount of a MTEM, wherein the MTEM generates a cleavage site for the recognition sequence of SEQ ID NO: 3 in a mutant mitochondrial genome having a mitochondrial deletion. The cleavage site generated in the mutant mitochondrial genome can result in degradation of the mutant mitochondrial genome. In certain embodiments, treating includes reducing or alleviating at least one symptom of a condition associated with a mitochondrial disorder. For example, symptoms of mtDNA common deletions include, but are not limited to, any symptom of myopathy, Alzheimer's disease, Pearson's syndrome, cutaneous photoaging, Kearns-Sayre syndrome (KSS), or chronic progressive external ophthalmoplegia (CPEO). Specifically, symptoms of mtDNA common deletions may include pigmentary retinopathy, and PEO, cerebellar ataxia, intellectual disability (intellectual disability, dementia, or both), sensorineural hearing loss, ptosis, oropharyngeal and esophageal dysfunction, exercise intolerance, muscle weakness, cardiac conduction block, endocrine disorders, sideroblastic anemia, and pancreatic exocrine dysfunction, ptosis, eye movement disorders due to paralysis of the extraocular muscles (ophthalmoplegia), oropharyngeal weakness, or proximal limb weakness of various severity with exercise intolerance. In some embodiments, the condition is a condition of the bone marrow, pancreas, muscle, skeletal muscle, central nervous system, eye, or ear. In some embodiments, the condition is Pearson syndrome, Kearns-Sayre syndrome (KSS), progressive external ophthalmoplegia (PEO), diabetes, or renal dysfunction.

[0217] In some embodiments, a subject is administered about 1×10 10 gc / kg ~ approx. 1×10 14 gc / kg (e.g., 1×10 10 gc / kg, 1×10 11 gc / kg, 1×10 12 gc / kg, 1×10 13 gc / kg, or 1 × 10 14In some embodiments, the subject is administered a pharmaceutical composition disclosed herein at a dose of at least about 1×10 6 of a nucleic acid encoding MTEM. 10 gc / kg, at least about 1 × 10 11 gc / kg, at least about 1 × 10 12 gc / kg, at least about 1 × 10 13 gc / kg, or at least about 1 × 10 14 The pharmaceutical composition is administered at a dose of about 1×10 6 of a nucleic acid encoding MTEM. 10 gc / kg ~ approx. 1×10 11 gc / kg, approximately 1×10 11 gc / kg ~ approx. 1×10 12 gc / kg, approximately 1×10 12 gc / kg ~ approx. 1×10 13 gc / kg, or approximately 1 × 10 13 gc / kg ~ approx. 1×10 14 The pharmaceutical composition is administered at a dose of about 1×10 6 of a nucleic acid encoding MTEM. 12 gc / kg ~ approx. 9×10 13 gc / kg (e.g., about 1 × 10 12 gc / kg, approx. 2×10 12 gc / kg, approx. 3×10 12 gc / kg, approx. 4×10 12 gc / kg, approx. 5×10 12 gc / kg, approximately 6×10 12 gc / kg, approximately 7×10 12 gc / kg, approximately 8×10 12 gc / kg, approx. 9×10 12 gc / kg, approximately 1×10 13 gc / kg, approx. 2×10 13 gc / kg, approx. 3×10 13 gc / kg, approx. 4×10 13 gc / kg, approx. 5×10 13 gc / kg, approximately 6×10 13 gc / kg, approximately 7×10 13 gc / kg, approximately 8×10 13 gc / kg, or approximately 9 × 10 13 The pharmaceutical composition is administered at a dose of 0.01 mg / kg.

[0218] In some embodiments, the subject is administered a lipid nanoparticle formulation at a dose of about 0.1 mg / kg to about 3 mg / kg of mRNA encoding MTEM. In some embodiments, the subject is administered a lipid nanoparticle formulation at a dose of at least about 0.1 mg / kg, at least about 0.25 mg / kg, at least about 0.5 mg / kg, at least about 0.75 mg / kg, at least about 1.0 mg / kg, at least about 1.5 mg / kg, at least about 2.0 mg / kg, at least about 2.5 mg / kg, or at least about 3.0 mg / kg of mRNA encoding MTEM. In some embodiments, the subject is administered a lipid nanoparticle formulation at a dose within about 0.1 mg / kg to about 0.25 mg / kg, about 0.25 mg / kg to about 0.5 mg / kg, about 0.5 mg / kg to about 0.75 mg / kg, about 0.75 mg / kg to about 1.0 mg / kg, about 1.0 mg / kg to about 1.5 mg / kg, about 1.5 mg / kg to about 2.0 mg / kg, about 2.0 mg / kg to about 2.5 mg / kg, or about 2.5 mg / kg to about 3.0 mg / kg of mRNA encoding MTEM.

[0219] Target tissues for delivery of the MTEMs of the present invention or nucleic acids encoding the MTEMs of the present invention include, but are not limited to, nerve tissue, muscle tissue, neuromuscular tissue, pancreatic tissue, and eye / retinal tissue. In some embodiments, the target cells for delivery are muscle cells, skeletal muscle cells, myotube cells, muscle satellite cells, neurons, astrocytes, microglial cells, eye cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of target cells is a population of muscle cells, skeletal muscle cells, myotube cells, muscle satellite cells, neurons, astrocytes, microglial cells, eye cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells; or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells.

[0220] In various embodiments of the methods described herein, one or more MTEMs described herein, polynucleotides encoding such MTEMs, or recombinant viruses comprising one or more polynucleotides encoding such MTEMs can be administered via any suitable administration route known in the art. Thus, one or more MTEMs described herein, polynucleotides encoding such MTEMs, or recombinant viruses comprising one or more polynucleotides encoding such MTEMs can be administered by administration routes including intravenous, intramuscular, intraperitoneal, subcutaneous, intrahepatic, transmucosal, transdermal, intraarterial, and sublingual. In some embodiments, MTEMs, or mRNA, or DNA vector MTEMs are delivered to target cells (e.g., neural cells, muscle cells, pancreatic cells, ocular cells, etc.) via direct injection into target tissue. In some embodiments, the eukaryotic cells are stem cells, CD34+HSCs, muscle cells, skeletal muscle cells, myotube cells, muscle satellite cells, neurons, astrocytes, microglial cells, ocular cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, pancreatic beta cells, kidney cells, bone marrow cells, or ear hair cells. Other suitable routes of administration of MTEMs, polynucleotides encoding such MTEMs, or recombinant viruses comprising one or more polynucleotides encoding such MTEMs can be readily determined by the treating physician as appropriate.

[0221] In some embodiments, a therapeutically effective amount of MTEM as described herein is administered to a subject in need thereof. If necessary, the dosage or frequency of administration of MTEM may be adjusted over the course of treatment based on the administering physician's judgment. The appropriate dose depends on the details of any AAV selected (e.g., serotype, etc.), the route of administration, the subject being treated (i.e., the subject's age, weight, sex, and general condition), and the mode of administration, among other factors. Thus, the appropriate dosage may vary from patient to patient. The appropriate effective amount can be easily determined by those skilled in the art. The dosing treatment may be a single dose schedule or a multiple dose schedule. Furthermore, the subject may be administered the appropriate number of doses. The appropriate number of doses can be easily determined by those skilled in the art. The dosage may need to be adjusted to take into account alternative routes of administration or to balance the therapeutic benefits with any side effects.

[0222] The exogenous nucleic acid molecule of the present invention can be introduced into cells and / or delivered to a subject by any of the aforementioned means. In certain embodiments, the exogenous nucleic acid molecule is introduced by a recombinant virus, such as a lentivirus, a retrovirus, an adenovirus, or a recombinant AAV. The recombinant AAV useful for introducing the exogenous nucleic acid molecule can have any serotype that allows the virus to transduce cells and insert the exogenous nucleic acid molecule sequence into the cell genome, including the serotypes / capsids previously described herein. The recombinant AAV can also be self-complementary so as not to require second strand DNA synthesis in the host cell. The exogenous nucleic acid molecule introduced using the recombinant AAV can be flanked by 5' (left) and 3' (right) inverted terminal repeats.

[0223] In another specific embodiment, exogenous nucleic acid molecule can be introduced into cell using single-stranded DNA template. Single-stranded DNA can include exogenous nucleic acid molecule, and in a specific embodiment, can include 5' and 3' homology arms to facilitate insertion of nucleic acid sequence into nuclease cleavage site by homologous recombination. Single-stranded DNA can further include 5' AAV inverted terminal repeat (ITR) sequence 5' upstream of 5' homology arm, and 3' AAV ITR sequence 3' downstream of 3' homology arm.

[0224] In another specific embodiment, the polynucleotide comprising the nucleic acid sequence encoding the MTEM of the present invention and / or the exogenous nucleic acid molecule of the present invention can be introduced into cells by transfection with a linearized DNA template. The plasmid DNA encoding the MTEM and / or the exogenous nucleic acid molecule can be digested with one or more restriction enzymes, for example, so that the circular plasmid DNA is linearized before transfection into cells.

[0225] When delivered to a cell, the exogenous nucleic acid of the present invention can be operably linked to any promoter suitable for expressing the encoded polypeptide in the cell, including the above-mentioned mammalian promoter and inducible promoter.The exogenous nucleic acid of the present invention can also be operably linked to a synthetic promoter.Synthetic promoters can include, but are not limited to, the JeT promoter (WO2002 / 012514).

[0226] 2.6 Mutants The present invention includes variants of the polypeptide and polynucleotide sequences described herein.

[0227] As used herein, "variant" is intended to mean a substantially similar sequence. A "variant" polypeptide is intended to mean a polypeptide derived from a "natural" polypeptide by deletion or addition of one or more amino acids at one or more internal sites of the native protein, and / or substitution of one or more amino acids at one or more sites of the native polypeptide. As used herein, a "natural" polynucleotide or polypeptide includes the parent sequence from which the variant is derived. The variant polypeptides encompassed by the embodiments are biologically active. That is, they retain the desired biological activity of the native protein, for example, the ability to bind and cleave a recognition sequence found in mtDNA (e.g., human mtDNA), such as the MIT 11-12 recognition sequence (SEQ ID NO: 3). Such variants may result, for example, from human manipulation. In some embodiments, a biologically active variant of a native polypeptide of the embodiments (e.g., SEQ ID NO: 2 or 4), or a biologically active variant of a recognition half-site binding subunit described herein, has at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the amino acid sequence of a native polypeptide, native subunit, native HVR1, or native HVR2, as determined by sequence alignment programs and parameters described elsewhere herein. A biologically active variant of a polypeptide or subunit of the embodiments may differ from the polypeptide or subunit by as few as about 1-40 amino acid residues, as few as about 1-20 amino acid residues, as few as about 1-10 amino acid residues, as few as about 5 amino acid residues, as few as 4 amino acid residues, 3 amino acid residues, 2 amino acid residues, or even 1 amino acid residue.

[0228] The polypeptide of the embodiment may be altered in various ways, including amino acid substitution, deletion, truncation and insertion. Methods for such manipulations are generally known in the art. For example, amino acid sequence mutants can be prepared by mutations in DNA. Methods for mutagenesis and polynucleotide alterations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492, Kunkel et al. (1987) Methods in Enzymol. 154:367-382, U.S. Patent No. 4,873,192, Walker and Gaastra (eds.) (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and references cited therein. Guidance regarding suitable amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC), which is incorporated herein by reference. Conservative substitutions, such as exchanging one amino acid for another with similar properties, may be optimal.

[0229] In some embodiments, engineered meganucleases of the invention can comprise variants of the HVR1 and HVR2 regions disclosed herein. The parent HVR region can comprise, for example, residues 24-79 or residues 215-270 of an exemplary engineered meganuclease. Thus, a variant HVR can comprise an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 or residues 215-270 of an exemplary engineered meganuclease herein, such that the variant HVR region maintains the biological activity (i.e., binding to and cleavage of a recognition sequence) of the engineered meganuclease. Furthermore, in some embodiments of the invention, a variant HVR1 region or variant HVR2 region can comprise residues that correspond to amino acid residues found at specific positions in the parent HVR. In this context, "corresponding to" means that the amino acid residue in the variant HVR is the same amino acid residue (i.e. a separate and identical residue) that is present in the parent HVR sequence at the same relative position (i.e. with respect to the remaining amino acids in the parent sequence). By way of example, if a parent HVR sequence contains a serine residue at position 26, then a variant HVR that "contains a residue corresponding to" residue 26 will also contain a serine at a position relative to (i.e. corresponding to) position 26 in the parent.

[0230] In certain embodiments, an engineered meganuclease of the invention comprises an HVR1 having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO:2 or 4.

[0231] In certain embodiments, an engineered meganuclease of the invention comprises an HVR2 having 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO:2 or 4.

[0232] A significant number of amino acid modifications to the DNA recognition domain of wild-type I-CreI meganuclease have been previously identified (e.g., U.S. Pat. No. 8,021,867), which, alone or in combination, result in engineered meganucleases with altered specificity at individual bases within the DNA recognition sequence half-sites, such that the resulting rationally designed meganucleases have half-site specificity that differs from the wild-type enzyme. Table 1 provides potential substitutions that can be made in engineered meganuclease monomers or subunits to increase specificity based on the bases present at each half-site position (-1 to -9) of the recognition half-site. Such substitutions are incorporated into the mutants of meganucleases disclosed herein.

[0233] [Table 1]

[0234] Entries in bold are wild-type contact residues and do not constitute a "modification" as used herein. An asterisk indicates that the residue contacts a base on the antisense strand.

[0235] Certain modifications can be made in engineered meganuclease monomers or subunits to modulate DNA binding affinity and / or activity. For example, engineered meganuclease monomers or subunits described herein can contain G, S or A at the residue corresponding to position 19 of I-CreI in SEQ ID NO: 1 (WO2009001159), Y, R, K or D at the residue corresponding to position 66 of I-CreI, and / or E, Q or K at the residue corresponding to position 80 of I-CreI (US Pat. No. 8,021,867).

[0236] In the case of polynucleotides, "variants" include deletions and / or additions of one or more nucleotides at one or more sites within a native polynucleotide. One skilled in the art will recognize that variants of the nucleic acids of the embodiments are constructed such that the open reading frame is maintained. In the case of polynucleotides, conservative variants include sequences that, due to the degeneracy of the genetic code, code for one amino acid sequence of a polypeptide of the embodiments. Variant polynucleotides include synthetically derived polynucleotides, such as those generated, for example, by using site-directed mutagenesis, but still code for an engineered meganuclease of the embodiments or an exogenous nucleic acid molecule or template nucleic acid. Generally, variants of a particular polynucleotide of the embodiments have at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to the particular polynucleotide as determined by sequence alignment programs and parameters described elsewhere herein. Variants of a particular polynucleotide of the embodiments (i.e., a reference polynucleotide) can also be assessed by comparison of the percent sequence identity between the polypeptides encoded by the variant polynucleotides and the polypeptides encoded by the reference polynucleotides.

[0237] The deletions, insertions and substitutions of the protein sequences encompassed herein are not expected to result in fundamental changes to the characteristics of the polypeptide. However, if it is difficult to predict the exact effect of the substitution, deletion or insertion before doing so, those skilled in the art will understand that the effect can be evaluated by screening the polypeptide for its ability to preferentially bind and cleave a recognition sequence found in human mtDNA, such as the MIT 11-12 recognition sequence (SEQ ID NO:3).

[0238] Table 2 is a summary of the sequences disclosed herein.

[0239] [Table 2] TIFF2024517655000003.tif255147TIFF2024517655000004.tif76156 EXAMPLES

[0240] The present disclosure is further illustrated by the following examples, which should not be construed as limiting. Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are intended to be encompassed within the scope of the claims that follow the following examples.

[0241] Example 1: Mitochondrial Targeted Engineered Meganuclease (MTEM) Construct Design

[0242] Using in silico prediction and directed evolution methods, I-CreI was engineered to recognize the m.5024C>T point mutation (see, e.g., U.S. Patent No. 8,445,251 and U.S. Patent Application No. 20200109383, each of which is incorporated herein by reference in its entirety). Both homodimers were fused to a monomeric structure using a peptide linker. The specificity of the mitochondrially targeted engineered meganuclease (MTEM) was first confirmed in Chinese Hamster Ovary (CHO) cells using the engineered split GFP assay described in FIG. 1A.

[0243] Engineered meganucleases were generated that recognize the mutant (m.5024C>T) mouse mtDNA sequence (ATAAGGATTGTAAGACTTCATC, SEQ ID NO: 3). Analysis of the engineered meganucleases using a green fluorescent protein (GFP)-based double-strand break (DSB) recombination assay in CHO cells showed that the particular engineered meganuclease (referred to herein as MIT 11-12) yielded approximately 80% GFP+ cells when tested against the intended (mutated) target site, but less than 5% GFP+ cells when tested against the wild-type target site (Figure 1A).

[0244] For ex vivo expression, two variants (CF and CSF) with different mitochondrial localization sequences (MLS) were designed. Cox8 [CF construct as described in Candas et al. (2016) J Vis Exp 108, p. 53417] or Cox8 / Su9 [CSF construct as described in Bacman (2018) Nat Med. 24(11): p. 1696-1700 and Pereira et al. (2018) EMBO Mol Med. 10(9)] were constructed with a mitochondrial transit peptide (MTP) at the 5´ end of the construct. A FLAG tag was also added between the MTP and the engineered meganuclease (Figure 1B).

[0245] HeLa cells were seeded on coverslips and transfected with MTEM for 24 hours. Cells were incubated with 200 nM MITOTRACKER™ Red CMXRos (M7512, Invitrogen) for 1 hour at 37°C and protected from light. Cells were fixed with 2% paraformaldehyde (PFA) for 15 minutes at room temperature (RT). Cells were permeabilized with 0.2% Triton X-100 in phosphate-buffered saline (PBS) for 2 minutes at RT. A 3% BSA / PBS solution was used as a blocking agent for 1 hour at RT. A primary antibody against FLAG (F3165, Sigma-Aldrich) at a concentration of 1:200 in 2% BSA / PBS was incubated for 1 hour at RT. After washing, cells were incubated with a goat anti-rabbit IgG (A-11008, Invitrogen) secondary antibody at a concentration of 1:200 in 3% BSA / PBS for 1 hour at RT and protected from light. The coverslips were then washed with PBS and mounted on slides with DAPI-containing mounting medium (EVERBRITE mounting medium, Biotium). Images were taken using a Zeiss LSM510 confocal microscope.

[0246] Transient transfection in HeLa cells showed that both MTEM constructs synthesized proteins localized to mitochondria (representative cells of the CSF construct are shown, FIG. 1C). Western blot confirmed that both CF and CSF constructs expressed proteins of the expected size after transfection of HEK293T cells (FIG. 1D). Western blot patterns showed no spurious bands in CSF-transfected cells, so the CSF mutant was selected for subsequent experiments.

[0247] Example 2: Animal models and fibroblasts

[0248] tRNA AlaThe efficacy of the MTEM construct was evaluated using a heteroplasmic mouse model carrying the m.5024C>T point mutation in the gene. This mouse model has been previously characterized (Bacman et al. (2018) Nat Med. 24(11): p.1696-1700, Kauppila et al. (2016) Cell Rep. 16(11): p.2980-2990, and Gammage et al. (2018) Nat Med. 24(11): p.1691-1695) and demonstrated mild cardiomyopathy at age 2 years, as well as reduced mt-tRNA expression when the mutation level was >50% in tissues. Ala Levels are shown. Mouse embryonic fibroblasts (MEFs) derived from this mouse were characterized for levels of mutant mtDNA and immortalized with the E6-E7 genes of human papillomavirus (Bacman, 2018, supra). Wild-type animals and wild-type lung fibroblasts used as controls were derived from mice with a C57BL / 6J background. To generate MEF lines with high levels of mutations, mitoTALENs were designed to target WT mtDNA. MEFs were transfected with mitoTALENs, selected, and clones were grown and tested for high levels of mutant mtDNA (Bacman, 2018, supra).

[0249] Heteroplasmic MEFs were transfected using GENJET™ DNA in vitro transfection reagent (edition II, SL 100489, SignaGen Laboratories) using the manufacturer's protocol. Cells seeded in T75 flasks at 80% confluence were transfected with 30 μg of a 2:1 ratio of MTEM CF or CSF plasmid (20 μg) and green fluorescent protein (GFP) plasmid (10 μg). 24 hours after transfection, sorting was performed using a FACS Aria IIU and gated on single cell fluorescence using a 488 nm laser and 505LP, 530 / 30 filter set for GFP expression. Cells were sorted based on the population showing no GFP expression, shown here as black, and the population showing GFP expression, shown here as green. Untransfected cells were used as controls.

[0250] Because transfection efficiency was relatively low, the MTEM-expressing plasmid was co-transfected with a plasmid expressing GFP (2 MTEM:1 GFP ratio). GFP-positive cells constituted 11-20% of the total cell population after transfection. Co-transfected cells were FACS sorted into untransfected (black) and transfected (green) populations after 24 h (Figure 2A). PCR / RFLP was used to determine mtDNA heteroplasmy changes in untransfected and transfected cell populations of two independent experiments (Figure 2B). Quantification showed that there was a large shift in heteroplasmy (50-60%) in the transfected populations when compared to the untransfected populations. Cells transfected with the GFP plasmid alone did not show any change in heteroplasmy. There was a small shift in the untransfected cell population (10-20%) that could be attributed to populations that did not integrate the GFP co-transfectant plasmid but may have integrated the MTEM plasmid (Figure 2C).

[0251] To determine the biological significance of the heteroplasmy changes, a MEF cell line with high levels (90%) of mutant mtDNA was used (Bacman, 2018, supra). Cells were co-transfected with plasmids expressing MTEM and GFP and sorted as described below. mtDNA was analyzed by PCR / RFLP 1, 7, 14 and 21 days after transfection. GFP-positive cells constituted 11-20% of the total cell population after transfection. At 24 hours post-transfection, there was a significant shift in heteroplasmy (approximately 25%) in the transfected cells that was maintained over a 2-week period (Figure 2D and Figure 2E). At 24 hours post-transfection, total mtDNA levels in the transfected population were depleted, then returned to baseline after 21 days (Figure 2F). The untransfected population had a very mild decrease, likely due to some cells undergoing MTEM as discussed previously.

[0252] Cells grown for 3 weeks were analyzed for their oxygen consumption rate (OCR). OCR was measured using a Seahorse XFp Extracellular Flux Analyzer (Seahorse Bioscience). The day before the assay, cells were seeded at a density of 20,000 cells / well in wells B-G (wells A and H contained medium only). The XFp sensor cartridge was calibrated overnight at 37°C with calibration buffer. The next day, cell culture medium was replaced with low-buffered Seahorse medium supplemented with 10 mM glucose, 1 mM pyruvate and 2 mM glutamine and incubated at 37°C for at least 1 h. Measurements of endogenous respiration were taken after each addition of 1 μM oligomycin, 0.5 μM FCCP, and 1 μM rotenone + antimycin A. Results were normalized to μg protein per well after the Seahorse test, and protein was quantified using the DC protein assay (Pereira 2018, supra).

[0253] Untransfected cells had respiratory impairment compared to wild-type controls. The transfected cell population significantly improved OCR (Figure 2G). A slight improvement in OCR in untransfected cells was also observed (Figure 2G), which may be due to mild alterations in heteroplasmy as discussed elsewhere herein.

[0254] Example 3: Expression of MTEM in mice

[0255] DNA encoding MTEM was cloned into an AAV2 / 9 plasmid and sent to the University of Iowa Viral Core Facility, where it was found that AAV-MTEM produced 1.6 × 10 13 vg / ml titer, and 5.9 × 10 13 Virus with 10 ... 13 vgs / kg AAV9-MTTEM or 6.15 × 10 13 vgs / kg of AAV9-GFP was administered into the left retroorbital sinus. 13 vgs / kg AAV9-MT or 3.69 × 10 13 vgs / kg of AAV9-GFP was administered into the left retro-orbital sinus. Control animals were injected with similar titers of AAV9-GFP as age-matched experimental animals, respectively. Toe biopsies were collected at 6 days of age to determine basal heteroplasmy levels. At 6, 12 and 24 weeks post-injection (PI), mice were anesthetized with ketamine and xylazine and perfused with PBS. Heart, tibialis anterior, quadriceps, gastrocnemius, kidney, liver and spleen were collected. Samples were snap frozen in liquid nitrogen and then stored at -80°C until further use.

[0256] AAV9-MTEM-injected animals showed consistent expression of MTEM in the heart, skeletal muscle, and in some animals, the liver, as shown by Western blot analysis using an anti-Flag antibody against the construct at all time points, 6, 12, and 24 weeks post-injection (PI) (Figure 3A). AAV9-GFP-injected animals showed GFP expression in the same tissues, but higher expression in the liver at 6 and 12 weeks post-injection (Figure 3A). Corresponding RFLP analysis showed a significant reduction in mutant mtDNA in liver and tibialis anterior muscle samples at 6 weeks PI in AAV9-MTEM-injected animals (Figure 3A). The heteroplasmy shift became larger over time, with a significant reduction in mutant mtDNA in the heart, skeletal muscle, kidney, liver, and spleen at 24 weeks PI (Figure 3B). AAV9-GFP-injected controls had similar levels of mutations across all tissues after injection (Figure 3A-B). As no expression was observed in the brain following injection of either AAV9-MTEM or AAV9-GFP (Figure 3A), brain tissue was used as a negative control to normalize for changes in heteroplasmy. No significant depletion of mtDNA levels was found in any of the tissues analyzed at 6, 12, or 24 weeks PI (Figure 3C), suggesting minimal or no nonspecific mtDNA effects. Mouse body weight did not differ between MTEM-treated and control animals at all time points.

[0257] Heteroplasmic m.5024C>T mice were also systemically injected with AAV9-MTEM at 6 weeks of age, which is not permissive for AAV-mediated expression compared to 2.5 weeks of age. Nevertheless, strong expression was observed in the heart and liver, with weaker expression in skeletal muscle (Figure 4A). AAV9-GFP-injected mice showed strong expression in the heart, tibialis anterior, and liver, and weaker expression in the quadriceps and gastrocnemius (Figure 4A). RFLP analysis showed essentially complete elimination of mutant mtDNA in the liver as early as 6 weeks post-injection in MTEM-treated animals, which persisted over time (Figure 4B). Some skeletal muscles showed a trend toward decreased mutant mtDNA (tibialis anterior, gastrocnemius at 24 weeks PI), but the results did not reach significance (Figure 4B). AAV9-GFP-injected animals showed no change in heteroplasmy levels across all tissues (Figure 4A and Figure 4B). Brain was used to normalize the changes. Total mtDNA levels were slightly decreased in the livers of AAV9-MTEM-treated animals at 6 weeks PI, but not at 12 or 24 weeks PI ( Fig. 4C ).

[0258] MTEM was not detected at 6, 12, or 24 weeks PI. In animals injected at 2.5 weeks and sacrificed at 5 and 10 days PI, MTEM expression was detected only in the liver. However, GFP expression was visible in the heart, skeletal muscle, and liver, likely due to higher expression of this construct. Heteroplasmic changes at 5 and 10 days PI were only observed in the liver. There was an average of 22% reduction in mutant mtDNA at 5 days PI, which increased to 55% at 10 days PI. To determine whether apoptosis played a role in these changes, expression of PCNA (a marker of liver regeneration), caspase 3, and cleaved caspase 3 were analyzed in liver samples. No differences were observed between MTEM-treated and control animals at any time point. Similar levels of uncleaved caspase 3, but not cleaved caspase 3, were observed in treated and control animals. Furthermore, no depletion of total mtDNA levels was observed in the liver or tibialis anterior muscle at 5 or 10 days PI. Furthermore, liver H&E staining did not show any morphological differences between AAV9-MTEM-injected, AAV9-GFP-injected, and non-injected controls.

[0259] Results showed that MTEM was localized exclusively to mitochondria, but nuclear off-target editing was assessed. To do so, targeted amplicon sequencing was performed on a selection of sites identified from an in vitro, genome-wide, unbiased off-targeting assay based on GUIDESeq. DNA from tibialis anterior (TA) and liver (L) tissues of young mice at 24 weeks PI was assessed by targeted amplicon sequencing. This analytical method detects any genetic variation within the amplicon, such as insertions / deletions (indels). No indels were detected in any of the sites analyzed for any of the animals.

[0260] Mt-tRNA Ala The level of m.5024C>T tRNA AlaIn mice, mt-tRNA in the liver of 24-week-old mice is reduced in tissues with high levels of mutant mtDNA (Bacman 2018 and Kauppila et al. (2016) Cell Rep. 16(11):p.2980-2990). Ala Levels were measured by Northern blot. Results showed increased amounts of mt-tRNA in AAV9-MTEM-injected animals compared to AAV9-GFP-injected controls when normalized to 28S rRNA. Ala Quantitative PCR was used to detect mt-tRNA Val mt-tRNA for Ala The ratio of mt-tRNA to mtRNA was determined. These results confirmed the Northern blot results (Figure 5C and Figure 5D). qPCR demonstrated that AAV9-MTEM-treated juvenile animals had significantly higher levels of mt-tRNA compared to control (AAV9-GFP) and even wild-type animals. Ala Adult animals injected with AAV9-MTEM also showed significantly lower levels of hepatic mt-tRNA expression compared to controls (AAV9-GFP) (Figure 5C). Ala levels increased (Fig. 5D).

[0261] Example 4: Nuclease activity with the addition of mitochondrial localization and nuclear export sequences

[0262] The purpose of this experiment was to determine whether the addition of a nuclear export signal (NES) to the engineered meganuclease would eliminate nuclear indels. The NES used in Figure 6 was rationally designed based on data from Kosugi et al. 2008 Traffic 12:2053-62. The NES amino acid sequence fused to the C-terminus of the engineered meganuclease was LGAGLGALGL (SEQ ID NO: 10). The NES used in Figure 7 was taken from Minczuk et al. 2006 Proc Natl Acad Sci USA 103(52):19689-19694. The NES amino acid sequence fused to the C-terminus of the engineered meganuclease was VDEMTKKFGTLTIHDTEK (SEQ ID NO: 9).

[0263] The engineered meganuclease used in Figures 6 and 7 was APC 11-12L.330 with a nuclear targeting site. 6e5 MRC-5 cells were nucleofected with the same number of engineered meganuclease mRNA copies using a Lonza 4D-Nucleofector (SE buffer, condition CM-150). Four meganuclease constructs were compared in Figure 6. One with an NLS, one without a targeting sequence, one with a mitochondrial transit peptide (MTP), and one with an MTP and an NES. Four engineered meganuclease constructs were compared in Figure 7. One with an NLS, one with an MTP, one with an MTP and an NES, and one with an MTP and an MVMp NS2 NES. The NLS and MTP were both fused to the N-terminus of their respective proteins, and the NES was fused to the C-terminus. Since these different constructs yield mRNAs of different lengths, the mRNA copy number was kept constant between transfections (5.8e11 copies for data in Figure 6 and 2.88e11 copies for data in Figure 7). Cells were harvested 2 days after nucleofection for gDNA extraction and assessed for transfection efficiency using a Beckman Coulter CytoFlex S cytometer. Transfection efficiency was greater than 95%. gDNA was isolated using the Macherey Nagel NucleoSpin Blood QuickPure kit.

[0264] Digital droplet PCR (ddPCR) was utilized to determine the indel frequency at the APC 11-12 binding site using P1, F1 and R1 (SEQ ID NOs: 29, 30 and 31, respectively) to generate an amplicon surrounding the binding site, and P2, F2, R2 (SEQ ID NOs: 32, 33 and 34, respectively) to generate a reference amplicon to act as a genomic counter. The ratio of the two amplicons should be equal in the untreated population and reduced for indel formation at the binding site in treated samples. Amplification was multiplexed in 24 μL reactions containing 1x ddPCR Supermix for probes (no dUTP, BioRad), 250 nM of each probe, 900 nM of each primer, 20 U / μL Hind-III HF (NEB) and 120 ng of cellular gDNA. Droplets were generated using a QX100 droplet generator (BioRad). Cycling conditions were as follows: 1 cycle of 95° C. (2° C. / s ramp) 10 min, 45 cycles of 94° C. (2° C. / s ramp) 10 s, 57.5° C. (2° C. / s ramp) 30 s, 72° C. (2 / s ramp) 1 min, 1 cycle of 98° C. 10 min, hold at 4° C. Droplets were analyzed using a QX 200 droplet reader (BioRad) and data were acquired and analyzed using QuantaSoft analysis software (BioRad).

[0265] P1: AGCCCCGGGTACTCCTTGTT (SEQ ID NO: 14) F1: TTCCTTGCAGGAACAGAG (SEQ ID NO: 15) R1: CTGCTTGACCACCCATT (SEQ ID NO: 16) P2: CCAGCAGGCCAGGTACACC (SEQ ID NO: 17) F2: ACCGCCAAGGATGCAC (SEQ ID NO: 18) R2: GCGGGTGGGAATGGAG (SEQ ID NO: 19)

[0266] Addition of an NES to APC 11-12L.330 appeared to slightly reduce the prevalence of nuclear indels (Figure 6), and addition of the MVMp NS2 NES appeared to completely eliminate nuclear indels (Figure 7).

[0267] The MVMp NS2 NES is a highly effective addition to mitochondrially targeted engineered meganucleases that mitigates potentially problematic nuclear off-target editing.

[0268] General methodology MTEM expression Total protein homogenates were prepared from flash frozen tissues and protein was quantified using the DC Protein Assay (5000116, BioRad) according to the manufacturer's instructions. Forty micrograms of total protein per sample was loaded onto a 10% Mini-PROTEAN TGX Stain-Free protein gel (4568034, BioRad) and then transferred to a polyvinylidene difluoride membrane (1620260, BioRad) using the TransBlot Turbo system (1704155, BioRad) according to the manufacturer's instructions. The TGX Stain-Free protein gel allows visualization of total protein loading by gel activation using the BioRad Chemidoc system. Blots were blocked with 5% milk for 1 h at RT. The antibodies used were mouse monoclonal Flag (F 3165, Sigma-Aldrich) (1:1000), mouse monoclonal GFP (75-131, UC Davis) (1:1000), mouse monoclonal MTCO1 (ab 14705, abcam) (1:1000), mouse monoclonal NDUFB8 (ab110242, abcam) (1:750), mouse monoclonal Tubulin (T9026, Sigma-Aldrich) (1:20,000), rabbit polyclonal caspase-3 (#9662, Cell Signaling) (1:1000), and mouse monoclonal PCNA (PC10#2586, Cell Signaling) (1:2000). Secondary antibodies utilized were IgG horseradish peroxidase (HRP)-conjugated mouse (7076, Cell Signaling) (1:5000) or rabbit (7074, Cell Signaling) (1:5000). Primary antibodies were incubated overnight at 4°C and secondary antibodies were incubated for 1 hour at RT. Membranes were developed with SUPERSIGNAL™ West Pico Chemiluminescent Substrate (34080, Thermo Scientific) and imaged on a BioRad CHEMIDOC™ Imager.

[0269] DNA extraction, quantification by "last-cycle HOT" PCR, and RFLP

[0270] Total DNA was extracted from snap-frozen tissues using phenol-chloroform and from FACS-sorted cells using the NucleoSpin Tissue XS kit (740901.50, Takara). DNA concentrations were determined spectrophotometrically (BioTek Synergy H1 Hybrid). The level of the m.5024C>T mutation was determined by "last cycle hot" PCR, where the last cycle of PCR is carried out using radiolabeled nucleotides. This method eliminates interference from heteroduplexes formed by previous melting and annealing steps by only allowing visualization of the initial amplicon. PCR amplicons were obtained using the following primers: F-5'CCACCCTAGCTATCATAAGCACA-3' (SEQ ID NO: 12) and B-5'-AAGCAATTGATTTGCATTCAATAGATGTAGGATGAAGTCCTGCA-3' (SEQ ID NO: 13). RFLP analysis was performed by digesting the amplicons with PstI-HF (R3140S, New England BioLabs), which digests wild-type mtDNA but not mutant mtDNA carrying the m.5024C>T point mutation. After digestion, the products were run in a 12% polyacrylamide gel and signals were detected using a Cyclone phosphor imaging system (Perkin Elmer) and OptiQuant software version 5.0 (Perkin Elmer).

[0271] Quantitative PCR to determine total mtDNA levels To determine the total levels of mtDNA present in the samples, quantitative PCR (qPCR) using TaqMan reagents (PrimeTime Std qPCR Assay, Integrated DNA Technologies) was performed as described below in Bacman 2018. Samples were run on a Bio-Rad CFX 96 / C1000 qPCR instrument. Relative readouts were determined using the comparative cycle threshold (Ct) method, and total mtDNA levels were determined by comparing mtDNA (ND1 and ND5) to genomic DNA (18S). The following primer / probe sets were used:

[0272] mtDNA ND1 = forward: GCC TGA CCC ATA GCC ATA AT (NC_005089; mtDNA 3282-3301; SEQ ID NO: 14), reverse: CGG CTG CGT ATT CTA CGT TA (mtDNA 3402-3383; SEQ ID NO: 15.

[0273] Probe: / 56-FAM / TCT CAA CCC / ZEN / TAG CAG AAA CAA CCG G / 3IABkFQ / (mtDNA 3310-3334; SEQ ID NO: 16).

[0274] ND5 = Forward: CCC ATG ACT ACC ATC AGC AAT AG (mtDNA 12432-12454; SEQ ID NO: 17); Reverse: TGG AAT CGG ACC AGT AGG AA (mtDNA 12533-12514; SEQ ID NO: 18).

[0275] Probe: / 5 TET / AGT GCT / ZEN / GAA CTG GTG TAG GGC / 3 IABkFQ / (mtDNA 12482-12458; SEQ ID NO: 19).

[0276] Genomic DNA 18s = Forward: GCC GCT AGA GGT GAA ATT CT (RefSeq NR_046233.2; chr 17:39984253-39984272; SEQ ID NO:20; Reverse: TCG GAA CTA CGA CGG TAT CT (RefSeq NR_046233.2; chr 17:39984432-39984412; SEQ ID NO:21).

[0277] Probe: / 5Cy5 / AAG ACG GAC CAG AGC GAA AGC AT / 3IAbRQSp / (RefSeq NR_046233.2; chr17:39984285-39984305; SEQ ID NO:22)

[0278] RNA extraction, Northern blot analysis, and quantification of mt-tRNA RNA was isolated from snap-frozen tissues using TRIzol (Ambion) according to the manufacturer's standard protocol. Samples were treated with DNase (AM 1907, Invitrogen) prior to spectrophotometric quantification. Northern blot analysis was performed by running 4 μg of total liver RNA per sample in a 1.2% agarose gel containing 20% ​​formaldehyde and 1× MOPS. Electrophoresis was performed in 1× MOPS solution at 80 V for 15 min followed by 120 V for 2.5 h. At this point, the gel was stained with ethidium bromide (EtBr) to visualize total RNA loading. The gel was then washed twice in water for 10 min to remove EtBr. RNA was transferred onto nylon membranes (Amersham Hybond-NX, #RPN203T) overnight. Transcripts of interest were detected with non-radioactive biotinylated probes overnight at 50°C. The next day, the membrane was washed and the signal was detected with IRDye 800CW streptavidin (926-32230, Li-COR). Mitochondrial tRNA was detected by Northern blot using a biotinylated probe. Ala Detected:

[0279] [Btn]GACTTCATCCTACATCTATTG (SEQ ID NO: 23)

[0280] mt-tRNA was analyzed using a Custom TaqMan Small RNA Assay (4398987, ThermoFisher) according to the manufacturer's instructions. Ala and mt-tRNA Val The Ct value was calculated by the level of mt-tRNA. Val mt-tRNA Ala The relative levels were calculated.

[0281] Nuclear off-target detection This assay is a modification of GUIDE-seq [Tsai et al. (2015) Nature Biotechnology 33(2):187-197] known as "oligo capture", which is more sensitive in detecting engineered meganuclease-induced double-strand breaks. Five C57BL6J nuclear genomic sequences were identified as putative off-target sites for this nuclease and tested for the presence of indels, as shown in Table 3. FL83B mouse cells were electroporated with MTEMs and analyzed by oligo capture x days after transformation.

[0282] [Table 3]

[0283] statistical analysis All data analyses were performed using GraphPad Prism 7 and 8. All statistics are presented as mean ± SEM. Pairwise comparisons were performed using unpaired two-tailed Student's t-tests. Comparisons between more than two groups were performed by one-way ANOVA. A P value of 0.05 or less was considered significant. N=4 mice were injected per condition (treated vs. control, and at each time point). All measurements were obtained from separate samples.

Claims

1. A mitochondrial-targeted engineered meganuclease (MTEM) that binds to and cleaves a recognition sequence in the mitochondrial genome of a eukaryotic cell, the MTEM comprises an engineered meganuclease linked to a mitochondrial transit peptide (MTP); the engineered meganuclease comprises a first subunit and a second subunit, the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region; the engineered meganuclease is a single-chain meganuclease comprising a linker, the linker covalently linking the first subunit and the second subunit; the MTP is fused to the N-terminus of the engineered meganuclease and comprises the amino acid sequence of SEQ ID NO:8; A nuclear export sequence (NES) is fused to the C-terminus of the MTEM, and the MTEM comprises the amino acid sequence of SEQ ID NO:

9.

2. A polynucleotide comprising a nucleic acid sequence encoding the MTEM of claim 1.

3. The polynucleotide of claim 2 , wherein the polynucleotide is an mRNA.

4. A recombinant DNA construct comprising a polynucleotide comprising a nucleic acid sequence encoding the MTEM of claim 1.

5. A recombinant virus comprising a polynucleotide comprising a nucleic acid sequence encoding the MTEM of claim 1.

6. The recombinant virus described in claim 5, wherein the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV).

7. The recombinant virus of claim 6 which is a recombinant AAV.

8. The recombinant virus described in claim 7, wherein the recombinant AAV has an AAV9 capsid.

9. 9. The recombinant virus of claim 5, wherein the polynucleotide comprises a promoter operably linked to the nucleic acid sequence encoding the MTEM.

10. The recombinant virus of claim 9, wherein the promoter is a constitutive promoter or a tissue-specific promoter.

11. The recombinant virus of claim 10, wherein the constitutive promoter is a CMV promoter, a CAG promoter, an EF1α promoter, or a UbC promoter, or the tissue-specific promoter is a neuron-specific promoter, an astrocyte-specific promoter, a microglia-specific promoter, a muscle-specific promoter, a skeletal muscle-specific promoter, a myotube-specific promoter, a muscle satellite cell-specific promoter, a cardiomyocyte-specific promoter, an eye-specific promoter, a retina-specific promoter, a retinal ganglion cell-specific promoter, a retinal pigment epithelium-specific promoter, a leukocyte-specific promoter, a progenitor cell-specific promoter, a blood progenitor cell-specific promoter, a pancreas-specific promoter, a pancreatic beta cell-specific promoter, an endothelial cell-specific promoter, an inner ear hair cell-specific promoter, a bone marrow cell-specific promoter, or a kidney-specific promoter.

12. A pharmaceutical composition comprising a pharma- ceutically acceptable carrier and the polynucleotide of claim 2 or claim 3.

13. A pharmaceutical composition comprising a pharma- ceutically acceptable carrier and the recombinant AAV of claim 7, wherein the polynucleotide comprises a promoter operably linked to the nucleic acid sequence encoding the MTEM.

14. A genetically modified eukaryotic cell comprising a polynucleotide according to claim 2 or claim 3.

15. The genetically modified eukaryotic cell of claim 14, wherein the genetically modified eukaryotic cell is a genetically modified human cell.

Images