Primer sets, reagent compositions and methods for the detection of methicillin-resistant Staphylococcus aureus (MRSA)
Patent Information
- Application Number
- JP2023564624
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-04-22
- Filing Date
- 2022-04-21
- Publication Date
- 2025-07-09
AI Technical Summary
Current methods for detecting methicillin-resistant Staphylococcus aureus (MRSA) are labor-intensive, time-consuming, require specialized equipment, and are costly, making them unsuitable for point-of-care testing (POCT) and often have high detection limits and long analysis times.
A set of primers specific to the mecA gene of MRSA, combined with the LAMP method, allows for rapid and sensitive detection of MRSA bacteria, achieving a detection limit of 10 copies/reaction within 20 minutes, suitable for POCT, using a simplified setup and fluorescent dyes for enhanced sensitivity.
The primer set enables rapid, sensitive, and accurate detection of MRSA with low detection limits, suitable for POCT, reducing equipment needs and analysis time, and allowing for quantitative measurements.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] The present invention relates to a set of primers for detecting Methicillin-resistant Staphylococcus aureus (MRSA), a method for detecting MRSA using the set of primers, and a set of primers for detecting Methicillin-resistant Staphylococcus aureus. The present invention is applicable to medical diagnostics.
[0002] Staphylococcus aureus is a gram-positive, coagulase-positive bacterium belonging to the family Staphylococcus. It belongs to the commensal bacteria that colonize the skin, skin glands and mucous membranes without causing disease symptoms in the host. Studies have shown that approximately 20% of the population are nasopharyngeal carriers of S. aureus. S. aureus is one of the most common pathogenic bacteria in humans. Moreover, S. aureus acquires resistance to many antibiotics commonly used for treatment relatively more frequently than other pathogenic bacteria. For example, the first resistant strain of S. aureus was identified only two years after penicillin treatment was introduced. Also, the first strain of S. aureus resistant to the synthetic antibiotic methicillin (methicillin-resistant S. aureus - MRSA) was identified in 1960, just one year after methicillin was introduced into medicine (1959).
[0003] The molecular basis for S. aureus's resistance to multiple antibiotics is genetic exchange and the ability of the bacterium to transfer mobile parts of its genome between strains and even species.
[0004] In MRSA strains, resistance to methicillin is conditioned by the production of an alternative protein called PBP (penicillin-binding protein) that has affinity for β-lactam antibiotics. This protein is encoded by the mecA gene located on a mobile genetic element (MGE) called SCCmec (Staphylococcal Cassette Chromosome mec). Acquisition of methicillin resistance involves the insertion of the SCCmec cassette into the chromosome of methicillin-susceptible bacteria.
[0005] Infections caused by MRSA strains are characterized by high mortality rates as well as long hospital stays and therefore high costs of treatment. Therefore, the diagnosis of MRSA strains is of great medical interest, mainly to limit their spread.
[0006] Laboratory diagnosis of methicillin-resistant S. aureus is primarily based on detection of the bacteria in biological material, often in the form of a swab taken from a potentially infected body site. Potential methods for detection of MRSA bacteria include bacterial culture on an appropriate medium, together with identification of the S. aureus strain and determination of resistance / susceptibility to available antibiotics (antibiogram). Culture tests, despite their high sensitivity and specificity, are labor-intensive and time-consuming tests. Moreover, the need to perform an antibiogram further extends the time for MRSA diagnosis.
[0007] The methods characterized by the greatest specificity and sensitivity are those that involve the detection of MRSA nucleic acids in biological material (so-called NAAT methods - nucleic acid amplification tests). The most commonly used tests with NAAT technology are assays based on real-time PCR. Many tests using real-time PCR technology are commercially available, but despite the intense competition, these methods are still relatively expensive. Moreover, they require highly specialized personnel, expensive equipment and require the isolation of genetic material from the patient's sample. In addition, the method is time-consuming, as it requires repeated heating and cooling of the reagents, and the equipment used consumes relatively large amounts of energy to carry out this process.
[0008] Isothermal methods, including the LAMP (Loop-mediated isothermal amplification) method, are methods that can accelerate the diagnostic process and reduce the energy costs required to carry out the analysis. Moreover, according to literature data, these methods are characterized by higher sensitivity and specificity than the aforementioned real-time PCR techniques and are much faster. Their isothermal course does not require special equipment.
[0009] As the isothermal method requires less equipment, it is an ideal diagnostic solution for primary care units (POCT: Point-of-Care Testing), allowing the test to be performed at the first patient-physician contact in the general practitioner's or specialist's (gynecologist, urologist) clinic. This solution allows a rapid diagnostic test (within 15 minutes) and a targeted therapy to be selected at the first consultation. This is particularly important in the case of systemic infections with MRSA bacteria (so-called sepsis), which can lead to death in a very short time and for which a rapid diagnosis and early initiation of treatment are crucial. On the other hand, the use of lyophilized reagents means that the diagnostic test samples do not need to be frozen and can be stored at room temperature.
[0010] The use of primers in the LAMP method for the diagnosis of MRSA is known from previously published patent applications: WO2019132444A1; US10370705B2; US20180094292A1; JP2018068315A; US20170114393A1; EP2099936B1; EP2850205B1; CN105671146A; CN111094595A; WO2014073858A1; CN111868258A; JP2006271370A; KR102126429B1. LAMP methods are disclosed, for example, in patent specifications WO0028082, WO0224902. The above-mentioned patent applications in most cases do not describe the sensitivity and detection limit of MRSA bacteria. The detection methods of some of the above mentioned patent applications do not allow quantitative measurements and are end-point type detections using agarose gel electrophoresis or other markers based on the color change of the reaction mixture upon a positive amplification reaction. In some of the above mentioned patent applications, an indirect measurement based on the concentration of magnesium ions is used. Some of the patent applications are implemented with real-time techniques that allow quantitative measurements, but the detection methods are based on molecular probes labeled with fluorescent dyes, which significantly increase the cost of the analysis. Other technical solutions of detection are based on so-called blocked primers. Moreover, in the mentioned patent applications, the analysis time and the time to wait for a positive result are about 60 minutes. Moreover, most of the above mentioned kits developed are not applicable for POCT diagnostics and their main application is for laboratories. DISCLOSURE OF THEINVENTION
[0011] Therefore, there remains a need to provide a diagnostic method that can appropriately refine the primer set used for the diagnosis of MRSA by the LAMP method intended for use in clinical real-time testing, and can detect bacteria in a short time (≦20 min) with a very low detection limit (≧10 copies / reaction). Unexpectedly, the above problem has been solved by the present invention.
[0012] A first subject of the invention is a set of primers for amplifying a nucleotide sequence of the mecA gene of MRSA bacteria, comprising a set of internal primers specific for a selected fragment of the mecA gene of MRSA bacteria, the set of internal primers having the following nucleotide sequences a) and b) and a set of external primers comprising the following nucleotide sequences c) and d): a) 5'GAAGGTGTGCTTACAAGTGCTAATA3' (the nucleic acid sequence of SEQ ID NO: 3 or its reverse and complementary sequences), linked from the 3' end, preferably by a TTTT bridge, to the sequence 5'CAACATGAAAAATGATTATGGCTC3' (the nucleic acid sequence of SEQ ID NO: 4 or its reverse and complementary sequences); b) 5'TGACGTCTATCCATTTATGTATGGC3' (the nucleic acid sequence of SEQ ID NO:5 or its reverse and complementary sequences), linked from the 3' end, preferably by a TTTT bridge, to the sequence 5'AGGTTCTTTTTATCTTCGGTTA3' (the nucleic acid sequence of SEQ ID NO:6 or its reverse and complementary sequences); c) the nucleic acid sequence of SEQ ID NO: 1, 5'TGATGCTAAAGTTCAAAAGAGT3' or its reverse and complementary sequences, and d) the nucleic acid sequence SEQ ID NO: 2, 5'GTAATCTGGAACTTGTTGAGC3' or its reverse and complementary sequences The present invention is characterized by comprising:
[0013] In a preferred embodiment of the invention, the primer set comprises a loop primer sequence comprising the nucleic acid sequence SEQ ID NO: 7-5'CCTGTTTGAGGGTGGATAGCAGTAC3', which is complementary to the mecA gene of MRSA bacteria, or the inverted and complementary sequence thereof.
[0014] A second subject of the invention is a method for detecting MRSA bacteria, characterized in that a selected region of the nucleic acid sequence of the MRSA genome (the mecA gene fragment) is amplified using primers as defined in the first subject of the invention, the amplification method being the LAMP method. In a preferred embodiment, the amplification is carried out with a temperature profile of 62° C. for 40 min. In a first further preferred embodiment of the invention, the end-point reaction is carried out with a temperature profile of 80° C. for 5 min.
[0015] A third subject of the invention is a method for detecting an infection caused by an MRSA bacterium, characterized in that it comprises a detection method as defined in the second subject of the invention.
[0016] A fourth subject of the invention is a kit for detecting an infection caused by an MRSA bacterium, characterized in that it comprises a set of primers as defined in the first subject of the invention.
[0017] In a preferred embodiment of the present invention, the infection detection kit comprises 5.0 μl of WarmStart LAMP master mix.In a further preferred embodiment of the present invention, the infection detection kit comprises individual amplification primers as defined in the first subject of the present invention, which primers have the following concentrations: 0.13 μM F3, 0.13 μM B3, 1.06 μM FIP, 1.06 μM BIP, 0.26 μM Loop F; comprises D-(+)-Trehalose dihydrate-6%; comprises mannitol-1.25%; comprises fluorescent markers that interact with double-stranded DNA-EvaGreen≦1X (Biotium), or a fluorescent dye in an amount of ≦1 μl (New England Biolabs), or Syto-13≦16 μM (ThermoFisher Scientific), or SYTO-82≦16 μM (ThermoFisher Scientific), or another fluorescent dye that interacts with double-stranded DNA at a concentration that does not inhibit the amplification reaction.
[0018] The advantage of the primer set for detecting MRSA and the method for detecting MRSA infection and the method for detecting the amplification product of the present invention is their possible use in medical diagnostics at the point of care (POCT) in targeted applications using portable genetic analysis devices. Lyophilization of the reaction mixture of the present invention allows the diagnostic kit to be stored at room temperature without compromising the diagnostic parameters of the test. Furthermore, the use of fluorescent dyes to detect the amplification product improves the sensitivity of the test method, lowering the detection limit (down to 10 genome copies / reaction) and allowing quantitative measurement of MRSA bacteria in the test sample. [Brief description of the drawings]
[0019] Exemplary embodiments of the invention are illustrated in the drawings. [Figure 1] FIG. 1 shows the sensitivity characteristic of the method, with template: Staphylococcus aureus quantitative DNA (ATCC® 700699DQ™) giving a specific signal in the range of 100-10 copies / μl, whereas no product was seen with NTC (FIG. 1: lane 1: molecular weight marker (Quick-Load® Purple 100 bp DNA ladder, New England Biolabs); lane 2: 100 copies of MRSA; lane 3: 50 copies of MRSA; lane 4: 20 copies of MRSA; lane 5: 10 copies of MRSA; lane 6: NTC). [Diagram 2] Figure 2 shows the sensitivity of the method of the present invention as measured by assaying serial dilutions of Staphylococcus aureus quantitative DNA (ATCC® 700699DQ™) standard from 100-10 copies / DNA standard reaction, with the amplification product measured in real time. Results of real-time MRSA detection are shown in Table 1, showing the minimum time required to detect a fluorescent signal. [Diagram 3-4]Figures 3 and 4 show the specificity of the method of the invention using a standard matrix of numerous pathogens potentially present in the test biological material as natural physiological flora, pathogens that may result from co-infections or pathogens that share similar genomic sequences (Figure 3: Lane 1: molecular weight marker (Quick-Load® Purple 100 bp DNA ladder, New England Biolabs); Lanes 2 and 3: Methicillin-susceptible Staphylococcus aureus (MSSA); Lanes 4 and 5: Borrelia burgdorferi; Lanes 6 and 7: Neisseria meningitidis; Lanes 8 and 9: Klebsiella pneumoniae; Lanes 10 and 11: Bordetella pertussis; Lanes 12 and 13: Streptococcus pyogenes; Lanes 14 and 15: Enterococcus faecalis). faecalis; lanes 16 and 17: Enterococcus faecium; lanes 18 and 19: Pseudomonas aeruginosa; lanes 20 and 21: Moraxella catarrhalis; lanes 22 and 23: Streptococcus pneumoniae; lanes 24 and 25: Streptococcus agalactiae; lanes 26 and 27: Listeria monocytogenes; lanes 28 and 29: Legionella pneumophila; lanes 30 and 31: Haemophilus ducreyi; lanes 32 and 33: HHV5; lanes 34 and 35: Homo sapiens); lanes 36 and 37: Candida albicans; lanes 33 and 39: Escherichia coli; lanes 40 and 41: Influenza B virus;Lanes 42 and 43: Influenza A H1N1 virus; Lanes 44 and 45: Influenza A H3N1 virus; Lanes 46 and 47: Borrelia afzelii; Lanes 48 and 49: Toxoplasma gondi; Lanes 50 and 51: HBV; Lanes 52 and 53: Treponema pallidum; Lanes 54 and 55: Haemophilus influenzae; Lanes 56 and 57: SARS-CoV-2; Lanes 58 and 59: Acinetobacter baumannii; Figure 4: Lane 1: Molecular weight marker (Quick-Load® Purple 100bp DNA ladder, New England Biolabs); Lanes 2 and 3: Methicillin-resistant Staphylococcus aureus (MRSA); Lanes 4 and 5: NTC). ; EXAMPLES
[0020] Example 1. Primer sequences The sequences of the specific oligonucleotides used for the detection of Methicillin-resistant Staphylococcus aureus genetic material using the LAMP technique are presented and characterized below.
[0021] 1. The MRSA mecAF3 oligonucleotide sequence: 5'TGATGCTAAAGTTCAAAAGAGT3' is a sequence identical to the MRSA mecA gene (5'-3' strand) adjacent to the F2 primer at the 3' end. 2. MRSA mecAB3 oligonucleotide sequence: 5'GTAATCTGGAACTTGTTGAGC3' is the complementary fragment of the MRSA mecA gene (5'-3' strand) 167 nucleotides away from the 3' end of oligonucleotide 11. 3. MRSA mecAF2 oligonucleotide sequence: 5'CAACATGAAAAATGATTATGGCTC3' is a sequence identical to the MRSA mecA gene (5'-3' strand) 8 nucleotides away from the 3' end of oligonucleotide 1. 4. MRSA mecAB2 oligonucleotide sequence: 5'AGGTTCTTTTTTATCTTCGGTTA3' is the complementary fragment of the MRSA mecA gene (5'-3' strand) 142 nucleotides away from the 3' end of oligonucleotide 1. 5. MRSA mecAF1c oligonucleotide sequence: 5'GAAGGTGTGCTTACAAGTGCTAATA3' is the complementary fragment of the MRSA mecA gene (5'-3' strand) 64 nucleotides away from the 3' end of oligonucleotide 1. 6. MRSA mecAB1c oligonucleotide sequence: 5'TGACGTCTATCCATTTATGTATGGC3' is a sequence identical to the MRSA mecA gene (5'-3' strand) 92 nucleotides from the 3' end of oligonucleotide 1. 7. MRSA mecA loop F oligonucleotide sequence: 5'CCTGTTTGAGGGTGGATAGCAGTAC3'.
[0022] The sequences of the F1c and F2 oligonucleotides are preferably linked by a TTTT bridge and used as an FIP. The sequences of the B1c and B2 oligonucleotides are preferably linked by a TTTT bridge and used as an BIP.
[0023] Example 2 The oligonucleotides characterized in Example 1 were synthesized using the LAMP technique and a reaction mixture of the following composition: 5.0μl WarmStart LAMP 2X Master Mix 0.13μM F3 0.13μM B3 1.06μM FIP 1.06μM BIP 0.26μM Loop F D-(+)-Trehalose dihydrate-6% Mannitol-1.25% Fluorescent marker that interacts with double-stranded DNA - EvaGreen ≤ 1X or fluorescent dye 50X in a volume of 0.5 μl (New England Biolabs) or green fluorescent dye in a volume of ≤ 1 μl (Lucigen) or Syto-13 ≤ 16 μM or SYTO-82 ≤ 16 μM or another fluorescent dye that interacts with double-stranded DNA at a concentration that does not inhibit the amplification reaction. DNA template ≥ 10 copies / reaction Method for amplifying the mecA MRSA gene using with. Total reaction volume adjusted to 10 μl with DNase- and RNase-free water.
[0024] Example 3 The oligonucleotides characterized in Examples 1 and 2 were used with the LAMP technique and the composition of the reaction mixture characterized in Example 3, following the following temperature profile: 1) 62℃, 40 minutes 2) Preferably, for the end point reaction, 80°C, 5 min. to amplify the MRSA mecA gene.
[0025] Example 4 A method for the amplification and detection of the MRSA mecA gene using the oligonucleotides characterized in Examples 1 and 2, with the LAMP technique and the composition of the reaction mixture characterized in Example 2, with the temperature profile characterized in Example 3 and the detection method described below.
[0026] Fluorescent dyes that can interact with double-stranded DNA are used, and 0.5 μl EvaGreen 20X; green fluorescent dye (Lucigen); SYTO-13 and SYTO-82 are added to the reaction mixture before the start of the reaction, before real-time measurement and / or before the end point measurement. EvaGreen; fluorescent dye 50X (New England Biolabs), green fluorescent dye (Lucigen); excitation wavelength in the same range as FAM dye - 490 to 500 nm (optimally 494 nm) for SYTO-13 dye, and 535 nm (optimally 541 nm) for SYTO-82 dye; EvaGreen; green fluorescent dye (Lucigen); emission wavelength in the range of 509 to 530 nm (optimally 518 nm) for SYTO-13 dye, and 556 nm (optimally 560 nm) for SYTO-82 dye, detection method, change recording time starts from 11 minutes after the start of the reaction of MRSA and negative control.
[0027] Example 5 A method for preparation and lyophilization of reagents for detecting the amplification and detection of the MRSA mecA gene using the oligonucleotides characterized in Examples 1 and 2 with the LAMP technique and the composition of the reaction mixture characterized in Example 2, with the temperature profile characterized in Example 3 and the detection method characterized in Example 4.
[0028] Example 6. Description of the freeze-drying process The template DNA was removed and the reaction components were mixed to a total volume of 10 μl according to the composition described in Example 2. The mixture was transferred to a 0.2 ml test tube and a lyophilization step was carried out according to the following parameters:
[0029] The mixture in the test tube was precooled to -80°C for 2 hours. Then, the freeze-drying process was repeated for 5 minutes. -2 The reaction was carried out at a pressure of 100 mBar and at a temperature of -80°C for 3 hours.
[0030] Example 7. Sensitivity of the method Sensitivity was determined by assaying serial dilutions of S. aureus quantitative DNA (ATCC® 700699DQ™) standard with a minimum of 10 bacterial copies per reaction mixture and product amplification was measured in real time - Figure 2 (Real-time LAMP of serial dilutions).
[0031] The time required to detect the emission fluorescence of each sample is shown in Table 1.
[0032] The characterized primers allow for the detection of MRSA bacteria by detecting mecA gene fragments at a minimum of 10 copies per reaction mixture.
[0033] [Table 1]
[0034] The advantages of the amplification method and oligonucleotides described herein over tests based on real-time LAMP technology are due to the much higher sensitivity shown in FIG. 1 and the reduced analysis time shown in FIG. 2.
[0035] Sequence Listing [Table 2] JPEG2024518750000004.jpg247166 JPEG2024518750000005.jpg247165 JPEG2024518750000006.jpg247160 JPEG2024518750000007.jpg119165
Claims
**Claim 1** A set of primers for amplifying the nucleotide sequence of the mecA gene of methicillin-resistant Staphylococcus aureus (MRSA), comprising a set of internal primers having the following nucleotide sequences a) and b), and a set of external primers comprising the following nucleotide sequences c) and d): a) From the 3'-end, 5'GAAGGTGTGCTTACA AGTGCTAATA3' (the nucleic acid sequence of SEQ ID NO: 3 or its reverse and complementary sequence) linked to the sequence 5'CAACATGAAAAAATGATTATGGCTC3' (the nucleic acid sequence of SEQ ID NO: 4 or its reverse and complementary sequence); b) From the 3'-end, 5'TGACGTCTATCCATT TATGTATGGC3' (the nucleic acid sequence of SEQ ID NO: 5 or its reverse and complementary sequence) linked to the sequence 5'AGGT TTCTTTTTTATCTTCGGTT A3' (the nucleic acid sequence of SEQ ID NO: 6 or its reverse and complementary sequence); c) The nucleic acid sequence 5'TGATGCTAAAGTTCA AAAAGAGT3' of SEQ ID NO: 1 or its reverse and complementary sequence, and d) The nucleic acid sequence 5'GTAATCTGG AACTTGT TGAGC3' of SEQ ID NO: 2 or its reverse and complementary sequence A set of primers, characterized by comprising the same. **Claim 2** The set of primers according to claim 1, comprising a loop F primer of the sequence number 7 - 5'CCTGTTT GAGGGG TG GATAGCAGTAC3' or its reverse and complementary sequence, which is complementary to the MRSA mecA gene. **Claim 3** The set of primers according to claim 1, wherein the nucleotide sequence a) is 5'GAAGGTGTGCTTACA AGTGCTAATA3' (the nucleic acid sequence of SEQ ID NO: 3 or its reverse and complementary sequence) linked to the sequence 5'CAACATGAAAAAATGATTATGGCTC3' (the nucleic acid sequence of SEQ ID NO: 4 or its reverse and complementary sequence) by a TTTT bridge from the 3'-end. **Claim 4** The set of primers according to claim 1, wherein the nucleotide sequence b) is 5'TGACGTCTATCCATT TATGTATGGC3' (the nucleic acid sequence of SEQ ID NO: 5 or its reverse and complementary sequence) linked to the sequence 5'AGGT TTCTTTTTTATCTTCGGTT A3' (the nucleic acid sequence of SEQ ID NO: 6 or its reverse and complementary sequence) by a TTTT bridge from the 3'-end. **Claim 5** A method for detecting MRSA bacteria, wherein a selected region of the nucleic acid sequence of the bacterial genome is amplified using the set of primers defined in any one of claims 1 to 4, and the amplification method is the LAMP method.
6. The method for detecting bacteria according to claim 5, wherein the amplification is performed at a temperature profile of 62 °C for 40 minutes.
7. The method according to claim 6, wherein the end point reaction is performed at a temperature profile of 80 °C for 5 minutes.
8. A method for providing an indicator for detecting an infection caused by MRSA bacteria, comprising the detection method defined in claim 5.
9. A kit for detecting an infection caused by MRSA bacteria, comprising the set of primers defined in any one of claims 1 to 4.
10. The kit for detecting the infection according to claim 9, comprising 5.0 μl of WarmStart LAMP Master Mix (NEB).
11. The primer has the following concentrations: 0.13 μM F3, 0.13 μM B3, 1.06 μM FIP, 1.06 μM BIP, 0.26 μM Loop F; comprises D-(+)-trehalose dihydrate - 6%; comprises mannitol - 1.25%; a fluorescent marker that interacts with double-stranded DNA - EvaGreen (Biotium) ≤ 1X, or a fluorescent dye (New England Biolabs) in an amount ≤ 0.5 μl, or a green fluorescent dye (Lucigen) in an amount ≤ 1 μl, or SYTO-13 (ThermoFisher Scientific) ≤ 16 μM, or SYTO-82 (ThermoFisher Scientific) ≤ 16 μM, or another fluorescent dye that interacts with double-stranded DNA at a concentration that does not inhibit the amplification reaction, and the kit for detecting the infection according to claim 9.