Antisense oligonucleotides for the treatment of neurodegenerative disorders and uses thereof - Patents.com

JP2024518780A5Pending Publication Date: 2025-05-08EISAI R&D MANAGEMENT CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023566601
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-04-25
Filing Date
2022-04-28
Publication Date
2025-05-08

AI Technical Summary

Technical Problem

There is a need for antisense oligonucleotides (ASOs) that can effectively induce exon-2 skipping during pre-mRNA splicing of the CD33 gene to treat neurodegenerative diseases, particularly late-onset Alzheimer's disease, as current therapies do not adequately address the role of CD33 in inhibiting amyloid-β protein uptake by microglia.

Method used

Development of specific ASOs, including phosphorodiamidate morpholino oligomers (PMO) and methoxyethyl ribose oligomers (MOE), that are complementary to the CD33 gene and induce exon-2 skipping, thereby modulating CD33 expression to enhance amyloid-β uptake by microglia.

Benefits of technology

The ASOs demonstrate exon-2 skipping efficiency of 30% or more, potentially reducing the progression of neurodegenerative diseases by enhancing microglial clearance of amyloid-β plaques.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Novel antisense oligonucleotides that induce exon-2 skipping in the CD33 gene during pre-mRNA splicing and their use in the treatment of neurodegenerative diseases such as Alzheimer's disease are disclosed.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 181,023, filed April 28, 2021; U.S. Provisional Patent Application No. 63 / 320,651, filed March 16, 2022; and U.S. Provisional Patent Application No. 63 / 334,496, filed April 25, 2022; the contents of each of which are incorporated by reference in their entirety herein.

[0002] Disclosed herein are novel antisense oligonucleotides ("ASOs") capable of inducing exon skipping during pre-mRNA splicing, pharmaceutical compositions comprising same, and methods of use thereof. [Background technology]

[0003] Neurodegenerative disorders are a group of disorders characterized by the decline of the structure and function of the central and peripheral nervous systems. Although neurodegenerative disorders have heterogeneous symptoms, they may share similar features. Alzheimer's disease, a neurodegenerative disorder characterized by the accumulation of amyloid-β plaques and neurofibrillary tangles. It is also a leading cause of dementia. Some rare familial cases of Alzheimer's disease involve autosomal dominant mutations in the amyloid-β precursor protein, but the majority are caused by late-onset Alzheimer's disease (LOAD), which does not follow a Mendelian inheritance pattern. Although the mechanism of LOAD is not fully understood, genome-wide association studies have identified genetic risk factors for LOAD. Scientists have shown that these genes may affect the production, condensation, or clearance of amyloid-β plaques. One such gene is CD33, also known as Siglec-3. Griciuc et al., "Alzheimer's Disease Risk Gene CD33 Inhibits Microglial Uptake of Amyloid Beta," 78NEURON631 (2013).

[0004] CD33 is expressed on myeloid-derived cells, including macrophages such as microglia, and encodes the CD33 protein. Microglia represent approximately 10% of cells in the brain and are the first line of immunological defense. Microglia regulate several important activities in the brain, including homeostasis, cognition, and neurogenesis. Augusto-Oliveira et al., "What Do Microglia Really Do in Healthy Adult Brain?", 8 CELLS1293 (2019). Microglial cells are known to contribute to neurodegeneration by releasing proinflammatory substances in the central nervous system. Wojtera et al., "Microglial cells in neurodegenerative disorders", 43 FOLIA NEUROPATHOLOGY311 (2005).

[0005] CD33 is a transmembrane receptor protein with an extracellular receptor that binds the ligand sialic acid. An intracellular immunoreceptor inhibitory tyrosine motif recruits phosphatases upon phosphorylation of its tyrosine residues, leading to inhibition of immune cell activity, including phagocytosis. CD33 has been shown to inhibit microglial uptake of amyloid beta protein, suggesting that CD33-targeted therapies may potentially be a therapeutic option for LOAD. Griciuc et al., "Alzheimer's Disease Risk Gene CD33 Inhibits Microglial Uptake of Amyloid Beta," 78 NEURON 631 (2013).

[0006] Two single nucleotide polymorphisms (SNPs) in the promoter region of the CD33 gene, rs3826656 and rs3865444, are associated with LOAD. The rs3865444 SNP has two forms, rs3865444-C and rs3865444-A. The first form results in normal-length CD33 protein. The second form, rs3865444-A, modulates splicing of the CD33 pre-mRNA, resulting in skipping of exon-2 and resulting in a CD33 protein lacking the sialic acid-binding domain. Malik et al., "CD33 Alzheimer's Risk-Altering Polymorphism, CD33 Expression, and Exon2 Splicing," 33 J. NEUROSCIENCE 13320 (2013).

[0007] In eukaryotic genes that have coding (exon) and non-coding (intron) sequences, the non-coding introns are excised from the pre-mRNA transcript and the coding exons are spliced ​​together to form the mRNA. If introns are retained in the final mRNA transcript or exons are omitted, the mRNA reading frame may be disrupted during translation of the mRNA. This may result in non-functional polypeptide sequences or premature stop codons. The splicing process is further complicated by alternative splicing, where the same pre-mRNA sequence may be spliced ​​into different combinations of exons, resulting in the formation of multiple mRNA sequences.

[0008] Splicing of pre-mRNA is an intricate process involving a multi-megadalton ribonucleoprotein complex called the spliceosome. The spliceosome recognizes specific sequences in the pre-mRNA to precisely excise introns and ligate exons. The spliceosome catalyzes intron excision in two transesterification reactions using three conserved RNA sequences: the 5' splice site, the 3' splice site, and the branch site. Will & Luhrmann, "Spliceosome Structure and Function", 3 COLD SPRING HARB. PERSPECT. BIOL. 1 (2011).

[0009] Splicing begins with nucleophilic attack, when the 2'OH group of the branch site binds to the 5' splice site, leading to cleavage of the 5' exon at the 5' splice site and the formation of a lariat. The 3'OH group of the 5' exon then attacks the 3' exon at the 3' splice site, ligating the 5' and 3' exons and cleaving the intron lariat. Will & Luhrmann, "Spliceosome Structure and Function", 3 COLD SPRING HARB. PERSPECT. BIOL. 1 (2011). The splicing process involves the spliceosome recognition site, the 5' and 3' splice sites, and the branch site, so mutations in any one of these sites can disrupt the splicing process.

[0010] ASOs are polynucleotides designed to affect one or more aspects of gene expression, such as transcription, splicing, stability, and / or translation, by binding specifically to a target nucleotide sequence. ASOs can be directed to either RNA or DNA. ASOs directed to RNA bind to target mRNA sequences and cause mRNA stability or translation in the ribosome.

[0011] ASOs that bind to target sequences in pre-mRNA transcripts can affect the splicing process. In some cases, ASOs can be used to induce exon skipping during pre-mRNA splicing. For example, Duchenne muscular dystrophy (DMD) is caused by a mutation that alters the reading frame of dystrophin mRNA during translation, resulting in a premature stop codon and a truncated dystrophin protein. ASOs can be used to correct the reading frame by inducing exon skipping during splicing. Removal of the correct number of exons can result in a shorter mRNA transcript but a corrected reading frame. Since dystrophin RNA consists of 79 exons, the protein can still be partially functional even if one or several exons are skipped during splicing. Echigoya et al., "Multiple Exon Skipping in the Duchenne Muscular Dystrophy Hot Spots: Prospects and Challenges", 8 J.PERS.MED.41 (2018). The FDA approved an exon skipping drug called Exondys 51 (eteplirsen) for the treatment of DMD in 2016. Dowling, "Eteplirsen therapy for Duchenne muscular dystrophy: skipping to the front of the line", 12 NATURE REV.NEUROLOGY 675 (2016). Summary of the Invention [Problem to be solved by the invention]

[0012] In other cases, ASOs can be used to prevent or reduce exon skipping during pre-mRNA splicing. As an example, the ASO drug nusinersen (Spinraza®) reduces exon-7 skipping during splicing of the SMN2 gene to treat spinal muscular atrophy. Son & Yokota, "Recent Advances and Clinical Applications of Exon Inclusion for Spinal Muscular Atrophy", in EXON SKIPPING & INCLUSION THERAPIES, 57-68 (2018). The rs3865444-A variant, which induces exon-2 skipping of CD33, confers protection from LOAD. Malik et al., "CD33 Alzheimer's Risk-Altering Polymorphism, CD33 Expression, and Exon 2 Splicing," 33 J. NEUROSCIENCE 13320 (2013). However, there remains a need for ASOs that successfully induce exon-2 skipping during pre-mRNA splicing of CD33 and their use in the treatment of neurodegenerative diseases. [Means for solving the problem]

[0013] Disclosed herein are ASOs, methods of using such ASOs to induce exon skipping during pre-mRNA splicing, pharmaceutical compositions comprising such ASOs, and methods of using such compositions to treat neurodegenerative diseases.

[0014] In some embodiments, disclosed herein is an antisense oligonucleotide of 16-30, e.g., 18-30 nucleotides in length, complementary to a portion of SEQ ID NO:1. In some embodiments, the antisense oligonucleotide is complementary to a portion of SEQ ID NO:213; SEQ ID NO:214; SEQ ID NO:215; SEQ ID NO:216; SEQ ID NO:217; SEQ ID NO:218; SEQ ID NO:219; and / or SEQ ID NO:220. In some embodiments, the antisense oligonucleotide has a CD33 exon-2 skipping efficiency of 35% or more. In some embodiments, the antisense oligonucleotide has a CD33 exon-2 skipping efficiency of 30% or more. In some embodiments, the exon-2 skipping efficiency of the antisense oligonucleotide is 30% or more according to a standard exon skipping efficiency assay for ASO. In some embodiments, the antisense oligonucleotide has a CD33 exon-2 skipping efficiency of 30% or greater according to a standard exon skipping efficiency assay for PMO ASOs when the antisense oligonucleotide comprises a phosphorodiamidate morpholino oligomer, or a standard exon skipping efficiency assay for MOE ASOs when the antisense oligonucleotide comprises a methoxyethyl ribose oligomer.

[0015] In some embodiments, the antisense oligonucleotide comprises: a.PMO-002 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO:2); b. PMO-003 (5'-CCTGTCACATGCACAGAGAGCTGGG-3') (SEQ ID NO:3); c. PMO-036 (5'-TTGTAACTGTATTTGGTACTTCCTC-3') (SEQ ID NO: 36); d. PMO-037 (5'-ACTGTATTTGGTACTTCCTCTCTCC-3') (SEQ ID NO:37); e.PMO-004 (5'-ATTTGGTACTTCCTCTCTCCATCCG-3') (SEQ ID NO:4); f.PMO-038 (5'-GTACTTCCTCTCTCCATCCGAAAGA-3') (SEQ ID NO:38); g. PMO-039 (5'-TCCTCTCTCCATCCGAAAGAAGTAT-3') (SEQ ID NO:39); h.PMO-005 (5'-TCTCCATCCGAAAGAAGTATGAACC-3') (SEQ ID NO:5); i.PMO-082 (5'-TAGTAGGGTATGGGATGGAAGAAAG-3') (SEQ ID NO:82); j.PMO-083 (5'-GGGTATGGGATGGAAGAAAGTGCAG-3') (SEQ ID NO:83); k.PMO-006 (5'-TGGGATGGAAGAAAGTGCAGGGCAC-3') (SEQ ID NO:6); l.PMO-096 (5'-ACTTGCAGCCAGAAATTTGGATCCA-3') (SEQ ID NO: 96); m.PMO-007 (5'-CAGCCAGAAATTTGGATCCATAGCC-3') (SEQ ID NO: 7); n.PMO-097 (5'-AGAAATTTGGATCCATAGCCAGGGC-3') (SEQ ID NO: 97); o.PMO-008 (5'-CCCTGTGGGGAAACGAGGGTCAGCT-3') (SEQ ID NO:8); p.MOE-009(5'-CACATGCACAGAGAGCTGGG-3') (SEQ ID NO:9); q.MOE-128 (5'-GCACAGAGAGCTGGGGAGAT-3') (SEQ ID NO: 128); r.MOE-010 (5'-GAGAGCTGGGGAGATTTGTA-3') (SEQ ID NO: 10); s.MOE-132 (5'-ACTGTATTTGGTACTTCCTC-3') (SEQ ID NO: 132); t.MOE-135 (5'-TCCTCTCTCCATCCGAAAGA-3') (SEQ ID NO: 135); u.MOE-011 (5'-TCTCCATCCGAAAGAAGTAT-3') (SEQ ID NO:11); v.MOE-012 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); w.MOE-136 (5'-AAAGAAGTATGAACCATTAT-3') (SEQ ID NO: 136) x.MOE-013 (5'-ATGCTCAGGGAGCAGTTGTT-3') (SEQ ID NO: 13); y.MOE-014 (5'-GAGTCTCCTCCTGTACTTCT-3') (SEQ ID NO: 14); z.MOE-015 (5'-CGCACAAACCCTCCTGTACC-3') (SEQ ID NO: 15); aa.MOE-183 (5'-AAACCCTCCTGTACCGTCAC-3') (SEQ ID NO: 183); bb.MOE-184 (5'-CTCCTGTACCGTCACTGACT-3') (SEQ ID NO: 184); cc.MOE-190 (5'-CAGCCAGAAATTTGGATCCA-3') (SEQ ID NO: 190); dd.MOE-196 (5'-CCCTGTGGGGAAACGAGGGT-3') (SEQ ID NO: 196); or ee.MOE-197 (5'-TGGGGAAACGAGGGTCAGCT-3') (SEQ ID NO: 197) Includes all or part of.

[0016] In some embodiments, the antisense oligonucleotide comprises: a. PMO-221 (5'-CCTCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 221); b. PMO-222 (5'-TCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 222); c. PMO-223 (5'-CTCACCTGTCACATGCACAGAGA-3') (SEQ ID NO: 223); d. PMO-224 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); e.PMO-225 (5'-ACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 225); f.PMO-226 (5'-TCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 226); g. PMO-227 (5'-TCACCTGTCACATGCACAGAGAGCT-3') (SEQ ID NO: 227); h.PMO-228 (5'-CCTGTGCCTCACCTGTCACATGCAC-3') (SEQ ID NO: 228); i.PMO-229 (5'-GTGCCTCACCTGTCACATGCACAGA-3') (SEQ ID NO: 229); j.PMO-230 (5'-TGCCTCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 230); k.PMO-231 (5'-CTCACCTGTCACATGCACAGAGAGC-3') (SEQ ID NO:231); l. PMO-232 (5'-CACCTGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 232); m.PMO-233 (5'-ACCTGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 233); n.PMO-234 (5'-CTGTCACATGCACAGAGAGCTGGGG-3') (SEQ ID NO: 234); o.PMO-235 (5'-CCTGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 235); p.PMO-236 (5'-TGTCACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 236); q.PMO-237 (5'-CTGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 237); r.PMO-238 (5'-TGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO:238); s.PMO-239 (5'-TCACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 239); t.PMO-240 (5'-TGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 240); u.PMO-241 (5'-CTGTATTTGGTACTTCCTCTCTCCA-3') (SEQ ID NO:241); v.PMO-242 (5'-TGTATTTGGTACTTCCTCTCTCCAT-3') (SEQ ID NO:242); w.PMO-243 (5'-GTATTTGGTACTTCCTCTCTCCATC-3') (SEQ ID NO:243); x.PMO-244 (5'-TATTTGGTACTTCCTCTCTCCATCC-3') (SEQ ID NO:244); y.PMO-324 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); 3D pattern: RRRRRRRRRRRRRRRRRRRR z.PMO-424 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); 3D pattern: SSSSSSSSSSSSSSSSSSSS aa.PMO-402 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 002); 3D pattern: RRRRRRRRRRRRRRRRRRRRRRRRRR; or bb.PMO-502 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 002); 3D pattern: SSSSSSSSSSSSSSSSSSSSSSSSSS Includes all or part of.

[0017] In some embodiments, the antisense oligonucleotide comprises: a.MOE-245 (5'-CTCCATCCGAAAGAAGTATG-3') (SEQ ID NO:245); b. MOE-246 (5'-TCCATCCGAAAGAAGTATGA-3') (SEQ ID NO: 246); c. MOE-247 (5'-CCATCCGAAAGAAGTATGAA-3') (SEQ ID NO: 247); d. MOE-248 (5'-CATCCGAAAGAAGTATGAAC-3') (SEQ ID NO: 248); e.MOE-249 (5'-TCCGAAAGAAGTATGAACCA-3') (SEQ ID NO:249); f. MOE-250 (5'-CCGAAAGAAGTATGAACCAT-3') (SEQ ID NO: 250); g.MOE-251 (5'-ATCCGAAAGAAGTATGAA-3') (SEQ ID NO:251); h.MOE-252 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); i.MOE-253 (5'-TCCGAAAGAAGTATGAAC-3') (SEQ ID NO: 253); j.MOE-254 (5'-CCATCCGAAAGAAGTATG-3') (SEQ ID NO:254); k.MOE-255 (5'-TCCATCCGAAAGAAGTAT-3') (SEQ ID NO:255); l. MOE-256 (5'-GAAAGAAGTATGAACCAT-3') (SEQ ID NO: 256); m.MOE-257 (5'-ATC-CGAAAGAAGTATGA-ACC-3') (SEQ ID NO:012); n.MOE-258 (5'-ATCC-GAAAGAAGTATG-AACC-3') (SEQ ID NO: 012); o.MOE-259 (5'-ATCCG-AAAGAAGTAT-GAACC-3') (SEQ ID NO:012); p.MOE-260 (5'-ATCCG-AAAGAAGTA-TGAACC-3') (SEQ ID NO: 012); q.MOE-261 (5'-ATCC-GAAAGA-AGTATG-AACC-3') (SEQ ID NO:012); r.MOE-262 (5'-ATCC-gAAAGAAGTATG-aACC-3') (SEQ ID NO:012); s.MOE-263 (5'-ATCC-gAAAGAAGTATG-aACC-3') (SEQ ID NO: 012); t.MOE-264 (5'-ATCC-gAAAGAaGTATG-aACC-3') (SEQ ID NO:012); u.MOE-265 (5'-CCGA-aAGAAGTATGAACC-3') (SEQ ID NO:252); v.MOE-266 (5'-CCGA-aAGAAGTATG-aACC-3') (SEQ ID NO: 252); w.MOE-267 (5'-CCGA-aAGAAGtATG-aACC-3') (SEQ ID NO: 252); x.MOE-268 (5'-CCG-AAAGAAGTATGA-ACC-3') (SEQ ID NO:252); y.MOE-269 (5'-CCGA-AAGAAGTATG-AACC-3') (SEQ ID NO:252); z.MOE-270 (5'-CCGAA-AGAA-GTATG-AACC-3') (SEQ ID NO:252); aa.MOE-271 (5'-CCGAA-AGAAGTAT-GAACC-3') (SEQ ID NO: 252); bb.MOE-272 (5'-CCG-A-AAGAAGTATGAACC-3') (SEQ ID NO:252); cc.MOE-273 (5'-CCG-AA-AGAAGTATGAACC-3') (SEQ ID NO:252); dd.MOE-274 (5'-CCGAAAGAAGTATG-A-ACC-3') (SEQ ID NO: 252); ee.MOE-275 (5'-mAmTfCfCfGfAfAfAfGfAfAfGfTfAfTfGfAfAmCmC-3') (SEQ ID NO:012); ff.MOE-276 (5'-fAfTfCfCfGmAmAmAmGmAmAmGmTmAfTfGfAfAfCfC-3') (SEQ ID NO: 012); gg.MOE-277 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSSSSSSSSSSSSSSSSSS; hh.MOE-278 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: RRRRRRRRRRRRRRRRRRRR; ii.MOE-279 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSSSRSSSRSSSRSSS; jj.MOE-280 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSSRSSRSSRSSSS; kk.MOE-281 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSRSRSRSRSRSRSSS; ll.MOE-282 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSSSSRRRRRRRSSSSSS; mm.MOE-283 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRRSRRSRRSRRSRSSS; nn.MOE-284 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSRRSRRRSRRRSRRSSS; oo.MOE-285 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSSSRRRRRRRRRSSSSS; pp.MOE-286(5'-ATCCGAAAGAAGTATGAACC-3')(SEQ ID NO:012);stereo pattern:SSSRRRRRRRRRRRRRSSS; qq.MOE-287(5'-ATCCGAAAGAAGTATGAACC-3')(SEQ ID NO:012);stereo pattern:SSRSSSSSSSSRSRSSSSS; rr.MOE-288(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSSSSSSSSSSSSSSS; ss.MOE-289 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: RRRRRRRRRRRRRRRRRR; tt.MOE-290 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252; stereo pattern: SSSRRRRRRRRRRRSSS; uu.MOE-291 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: RRRRRRRRSSSSSSSSS; vv.MOE-292 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSSSSSSSRRRRRRRR; ww.MOE-293(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSSRSSRSSSRSSSS; xx.MOE-294 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SSSRSRSRSRSRSRSSS; yy.MOE-295(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); steric pattern: SRSSSRSSSRSSSRSSS; zz.MOE-296 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SSSOSSRSSSRSSOSSS; aaa.MOE-297 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSSOSRSRSRSSSOSSS; bbb.MOE-298 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SOSSSRSSSRSSSOSSS; ccc.MOE-299 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); 3D pattern: SSSOSSSRSSSRSSSOSSS; ddd.MOE-300(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: RRRORRROSSSSSSSSS; eee.MOE-301 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SRRORRROSSSSSSSSS; fff.MOE-303 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSOOOSSSSSSSSSSSS; ggg.MOE-304 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); 3D pattern: OOOOOSSSSSSSSSSSS; hhh.MOE-305 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); 3D pattern: SSOSSSOSSOSSSOSSS; iii.MOE-306 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SOSSSSOSSSSSSOSSS; jjj.MOE-307 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSOSSSSSSSSSSOSSS; kkk.MOE-308(5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO:12);stereo pattern: SSSOSSSSSSSSSSSSOSSS; lll.MOE-309 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); stereo pattern: SSSOSSSSOSSOSSSOSSS; mmm.MOE-310 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSORRRRRSSSSSOSSS; or nnn.MOE-311(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252). Three-dimensional pattern: RRRRROSSSSSSSSOSSS Includes all or part of.

[0018] In some embodiments, the antisense oligonucleotide comprises a modified sugar moiety. In some embodiments, the modified sugar moiety comprises 2'-O-methoxyethyl ribose (2'-O-MOE). In some embodiments, the modified sugar moiety comprises a phosphorodiamidate morpholino oligomer (PMO). In some embodiments, the antisense oligonucleotide comprises a non-natural internucleotide linkage. In some embodiments, the non-natural internucleotide linkage is stereochemically pure. In some embodiments, the non-natural internucleotide linkage is all Sp. In some embodiments, the non-natural internucleotide linkage is all Rp. In some embodiments, the non-natural internucleotide linkage is independently selected from Sp and Rp, i.e., each internucleotide linkage is independently selected to be Sp or Rp. In some embodiments, the non-natural internucleotide linkage is stereochemically random. In some embodiments, the antisense oligonucleotide comprises a modified nucleobase.

[0019] Also provided herein are compositions comprising an antisense oligonucleotide, and optionally a pharma- ceutically acceptable carrier or excipient.

[0020] In some embodiments, the present disclosure provides a method for inducing exon-2 skipping in the CD33 gene during pre-mRNA splicing, comprising introducing a nucleic acid molecule into a cell, wherein the nucleic acid molecule is an antisense oligonucleotide complementary to a portion of SEQ ID NO: 1, wherein the oligonucleotide hybridizes to a target region of the CD33 gene, wherein the oligonucleotide induces exon-2 skipping during pre-mRNA splicing of the CD33 gene. In some embodiments, the antisense oligonucleotide is complementary to a portion of SEQ ID NO: 213; SEQ ID NO: 214; SEQ ID NO: 215; SEQ ID NO: 216; SEQ ID NO: 217; SEQ ID NO: 218; SEQ ID NO: 219; and / or SEQ ID NO: 220. In some embodiments, the exon-2 skipping efficiency of the antisense oligonucleotide is 30% or more. In some embodiments, the exon-2 skipping efficiency of the antisense oligonucleotide is 30% or more according to a standard exon skipping efficiency assay for ASO. In some embodiments, the standard exon skipping efficiency assay is a standard exon skipping efficiency assay for a PMO ASO when the antisense oligonucleotide comprises a phosphorodiamidate morpholino oligomer, or a standard exon skipping efficiency assay for a MOE ASO when the antisense oligonucleotide comprises a methoxyethyl ribose oligomer.

[0021] In some embodiments, the present disclosure provides a method for inducing exon-2 skipping in the CD33 gene described above, wherein the antisense oligonucleotide comprises: a.PMO-002 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO:2); b. PMO-003 (5'-CCTGTCACATGCACAGAGAGCTGGG-3') (SEQ ID NO:3); c. PMO-036 (5'-TTGTAACTGTATTTGGTACTTCCTC-3') (SEQ ID NO: 36); d. PMO-037 (5'-ACTGTATTTGGTACTTCCTCTCTCC-3') (SEQ ID NO:37); e.PMO-004 (5'-ATTTGGTACTTCCTCTCTCCATCCG-3') (SEQ ID NO:4); f.PMO-038 (5'-GTACTTCCTCTCTCCATCCGAAAGA-3') (SEQ ID NO:38); g. PMO-039 (5'-TCCTCTCTCCATCCGAAAGAAGTAT-3') (SEQ ID NO:39); h.PMO-005 (5'-TCTCCATCCGAAAGAAGTATGAACC-3') (SEQ ID NO:5); i.PMO-082 (5'-TAGTAGGGTATGGGATGGAAGAAAG-3') (SEQ ID NO:82); j.PMO-083 (5'-GGGTATGGGATGGAAGAAAGTGCAG-3') (SEQ ID NO:83); k.PMO-006 (5'-TGGGATGGAAGAAAGTGCAGGGCAC-3') (SEQ ID NO:6); l.PMO-096 (5'-ACTTGCAGCCAGAAATTTGGATCCA-3') (SEQ ID NO: 96); m.PMO-007 (5'-CAGCCAGAAATTTGGATCCATAGCC-3') (SEQ ID NO: 7); n.PMO-097 (5'-AGAAATTTGGATCCATAGCCAGGGC-3') (SEQ ID NO: 97); o.PMO-008 (5'-CCCTGTGGGGAAACGAGGGTCAGCT-3') (SEQ ID NO:8); p.MOE-009(5'-CACATGCACAGAGAGCTGGG-3') (SEQ ID NO:9); q.MOE-128 (5'-GCACAGAGAGCTGGGGAGAT-3') (SEQ ID NO: 128); r.MOE-010 (5'-GAGAGCTGGGGAGATTTGTA-3') (SEQ ID NO: 10); s.MOE-132 (5'-ACTGTATTTGGTACTTCCTC-3') (SEQ ID NO: 132); t.MOE-135 (5'-TCCTCTCTCCATCCGAAAGA-3') (SEQ ID NO: 135); u.MOE-011 (5'-TCTCCATCCGAAAGAAGTAT-3') (SEQ ID NO:11); v.MOE-012 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); w.MOE-136 (5'-AAAGAAGTATGAACCATTAT-3') (SEQ ID NO: 136); x.MOE-013 (5'-ATGCTCAGGGAGCAGTTGTT-3') (SEQ ID NO: 13); y.MOE-014 (5'-GAGTCTCCTCCTGTACTTCT-3') (SEQ ID NO: 14); z.MOE-015 (5'-CGCACAAACCCTCCTGTACC-3') (SEQ ID NO: 15); aa.MOE-183 (5'-AAACCCTCCTGTACCGTCAC-3') (SEQ ID NO: 183); bb.MOE-184 (5'-CTCCTGTACCGTCACTGACT-3') (SEQ ID NO: 184); cc.MOE-190 (5'-CAGCCAGAAATTTGGATCCA-3') (SEQ ID NO: 190); dd.MOE-196 (5'-CCCTGTGGGGAAACGAGGGT-3') (SEQ ID NO: 196); or ee.MOE-197 (5'-TGGGGAAACGAGGGTCAGCT-3') (SEQ ID NO: 197) Includes all or part of.

[0022] In some embodiments, the present disclosure provides a method for inducing exon-2 skipping in the CD33 gene described above, wherein the antisense oligonucleotide comprises: a. PMO-221 (5'-CCTCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 221); b. PMO-222 (5'-TCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 222); c. PMO-223 (5'-CTCACCTGTCACATGCACAGAGA-3') (SEQ ID NO: 223); d. PMO-224 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); e.PMO-225 (5'-ACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 225); f.PMO-226 (5'-TCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 226); g. PMO-227 (5'-TCACCTGTCACATGCACAGAGAGCT-3') (SEQ ID NO: 227); h.PMO-228 (5'-CCTGTGCCTCACCTGTCACATGCAC-3') (SEQ ID NO: 228); i.PMO-229 (5'-GTGCCTCACCTGTCACATGCACAGA-3') (SEQ ID NO: 229); j.PMO-230 (5'-TGCCTCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 230); k.PMO-231 (5'-CTCACCTGTCACATGCACAGAGAGC-3') (SEQ ID NO:231); l. PMO-232 (5'-CACCTGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 232); m.PMO-233 (5'-ACCTGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 233); n.PMO-234 (5'-CTGTCACATGCACAGAGAGCTGGGG-3') (SEQ ID NO: 234); o.PMO-235 (5'-CCTGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 235); p.PMO-236 (5'-TGTCACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 236); q.PMO-237 (5'-CTGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 237); r.PMO-238 (5'-TGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO:238); s.PMO-239 (5'-TCACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 239); t.PMO-240 (5'-TGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 240); u.PMO-241 (5'-CTGTATTTGGTACTTCCTCTCTCCA-3') (SEQ ID NO:241); v.PMO-242 (5'-TGTATTTGGTACTTCCTCTCTCCAT-3') (SEQ ID NO:242); w.PMO-243 (5'-GTATTTGGTACTTCCTCTCTCCATC-3') (SEQ ID NO:243); x.PMO-244 (5'-TATTTGGTACTTCCTCTCTCCATCC-3') (SEQ ID NO:244); y.PMO-324 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); 3D pattern: RRRRRRRRRRRRRRRRRRRR z.PMO-424 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); 3D pattern: SSSSSSSSSSSSSSSSSSSS aa.PMO-402 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 002); 3D pattern: RRRRRRRRRRRRRRRRRRRRRRRRRR; or bb.PMO-502 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 002); 3D pattern: SSSSSSSSSSSSSSSSSSSSSSSSSS Includes all or part of.

[0023] In some embodiments, the present disclosure provides a method for inducing exon-2 skipping in the CD33 gene described above, wherein the antisense oligonucleotide comprises: a.MOE-245 (5'-CTCCATCCGAAAGAAGTATG-3') (SEQ ID NO:245); b. MOE-246 (5'-TCCATCCGAAAGAAGTATGA-3') (SEQ ID NO: 246); c. MOE-247 (5'-CCATCCGAAAGAAGTATGAA-3') (SEQ ID NO: 247); d. MOE-248 (5'-CATCCGAAAGAAGTATGAAC-3') (SEQ ID NO: 248); e.MOE-249 (5'-TCCGAAAGAAGTATGAACCA-3') (SEQ ID NO:249); f.MOE-250 (5'-CCGAAAGAAGTATGAACCAT-3') (SEQ ID NO: 250); g.MOE-251 (5'-ATCCGAAAGAAGTATGAA-3') (SEQ ID NO:251); h.MOE-252 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); i.MOE-253 (5'-TCCGAAAGAAGTATGAAC-3') (SEQ ID NO: 253); j.MOE-254 (5'-CCATCCGAAAGAAGTATG-3') (SEQ ID NO:254); k.MOE-255 (5'-TCCATCCGAAAGAAGTAT-3') (SEQ ID NO:255); l. MOE-256 (5'-GAAAGAAGTATGAACCAT-3') (SEQ ID NO: 256); m.MOE-257 (5'-ATC-CGAAAGAAGTATGA-ACC-3') (SEQ ID NO:012); n.MOE-258 (5'-ATCC-GAAAGAAGTATG-AACC-3') (SEQ ID NO: 012); o.MOE-259 (5'-ATCCG-AAAGAAGTAT-GAACC-3') (SEQ ID NO:012); p.MOE-260 (5'-ATCCG-AAAGAAGTA-TGAACC-3') (SEQ ID NO: 012); q.MOE-261 (5'-ATCC-GAAAGA-AGTATG-AACC-3') (SEQ ID NO:012); r.MOE-262 (5'-ATCC-gAAAGAAGTATG-aACC-3') (SEQ ID NO:012); s.MOE-263 (5'-ATCC-gAAAGAAGTATG-aACC-3') (SEQ ID NO: 012); t.MOE-264 (5'-ATCC-gAAAGAaGTATG-aACC-3') (SEQ ID NO:012); u.MOE-265 (5'-CCGA-aAGAAGTATGAACC-3') (SEQ ID NO:252); v.MOE-266 (5'-CCGA-aAGAAGTATG-aACC-3') (SEQ ID NO: 252); w.MOE-267 (5'-CCGA-aAGAAGtATG-aACC-3') (SEQ ID NO: 252); x.MOE-268 (5'-CCG-AAAGAAGTATGA-ACC-3') (SEQ ID NO:252); y.MOE-269 (5'-CCGA-AAGAAGTATG-AACC-3') (SEQ ID NO:252); z.MOE-270 (5'-CCGAA-AGAA-GTATG-AACC-3') (SEQ ID NO:252); aa.MOE-271 (5'-CCGAA-AGAAGTAT-GAACC-3') (SEQ ID NO: 252); bb.MOE-272 (5'-CCG-A-AAGAAGTATGAACC-3') (SEQ ID NO:252); cc.MOE-273 (5'-CCG-AA-AGAAGTATGAACC-3') (SEQ ID NO:252); dd.MOE-274 (5'-CCGAAAGAAGTATG-A-ACC-3') (SEQ ID NO: 252); ee.MOE-275 (5'-mAmTfCfCfGfAfAfAfGfAfAfGfTfAfTfGfAfAmCmC-3') (SEQ ID NO:012); ff.MOE-276 (5'-fAfTfCfCfGmAmAmAmGmAmAmGmTmAfTfGfAfAfCfC-3') (SEQ ID NO: 012); gg.MOE-277 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSSSSSSSSSSSSSSSSSS; hh.MOE-278 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: RRRRRRRRRRRRRRRRRRRR; ii.MOE-279 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSSSRSSSRSSSRSSS; jj.MOE-280 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSSRSSRSSRSSSS; kk.MOE-281 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSRSRSRSRSRSRSSS; ll.MOE-282 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSSSSRRRRRRRSSSSSS; mm.MOE-283 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRRSRRSRRSRRSRSSS; nn.MOE-284 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSRRSRRRSRRRSRRSSS; oo.MOE-285 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSSSRRRRRRRRRSSSSS; pp.MOE-286(5'-ATCCGAAAGAAGTATGAACC-3')(SEQ ID NO:012);stereo pattern:SSSRRRRRRRRRRRRRSS; qq.MOE-287(5'-ATCCGAAAGAAGTATGAACC-3')(SEQ ID NO:012);stereo pattern:SSRSSSSSSSSRSRSSSSS; rr.MOE-288(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSSSSSSSSSSSSSSSSS; ss.MOE-289 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: RRRRRRRRRRRRRRRRRR; tt.MOE-290 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252; stereo pattern: SSSRRRRRRRRRRRSSS; uu.MOE-291 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: RRRRRRRRSSSSSSSSS; vv.MOE-292 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSSSSSSSRRRRRRRR; ww.MOE-293 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSSRSSRSSSRSSSS; xx.MOE-294 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SSSRSRSRSRSRSRSSS; yy.MOE-295(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); steric pattern: SRSSSRSSSRSSSRSSS; zz.MOE-296 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SSSOSSRSSSRSSOSSS; aaa.MOE-297 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSSOSRSRSRSSSOSSS; bbb.MOE-298 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SOSSSRSSSRSSSOSSS; ccc.MOE-299 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); 3D pattern: SSSOSSSRSSSRSSSOSSS; ddd.MOE-300(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: RRRORRROSSSSSSSSS; eee.MOE-301 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SRRORRROSSSSSSSSS; fff.MOE-303 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSOOOSSSSSSSSSSSS; ggg.MOE-304 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); 3D pattern: OOOOOSSSSSSSSSSSS; hhh.MOE-305 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); 3D pattern: SSOSSSOSSOSSSOSSS; iii.MOE-306 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SOSSSSOSSSSSSOSSS; jjj.MOE-307 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSOSSSSSSSSSSOSSS; kkk.MOE-308(5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO:12);stereo pattern: SSSOSSSSSSSSSSSSOSSS; lll.MOE-309 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); stereo pattern: SSSOSSSSOSSOSSSOSSS; mmm.MOE-310 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSORRRRRSSSSSOSSS; or nnn.MOE-311(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252). Three-dimensional pattern: RRRRROSSSSSSSSOSSS Includes all or part of.

[0024] In some embodiments, the present disclosure provides a method for inducing exon-2 skipping in the CD33 gene described above, wherein the cell is an animal cell. In some embodiments, the cell is a human cell.

[0025] In some embodiments, the disclosure provides a method of treating a subject having a neurodegenerative disease, the method comprising administering a therapeutically effective amount of an antisense oligonucleotide of 16-30 nucleotides in length, where the antisense oligonucleotide is complementary to a portion of SEQ ID NO:1, and where the antisense oligonucleotide has a CD33 exon-2 skipping efficiency of 30% or greater according to a standard exon skipping efficiency assay for antisense oligonucleotides.

[0026] In some embodiments, the present disclosure provides a method of treating a subject having a neurodegenerative disease as described above, wherein the antisense oligonucleotide comprises: a.PMO-002 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO:2); b. PMO-003 (5'-CCTGTCACATGCACAGAGAGCTGGG-3') (SEQ ID NO:3); c. PMO-036 (5'-TTGTAACTGTATTTGGTACTTCCTC-3') (SEQ ID NO: 36) d. PMO-037 (5'-ACTGTATTTGGTACTTCCTCTCTCC-3') (SEQ ID NO: 37) e.PMO-004 (5'-ATTTGGTACTTCCTCTCTCCATCCG-3') (SEQ ID NO:4); f. PMO-038 (5'-GTACTTCCTCTCTCCATCCGAAAGA-3') (SEQ ID NO: 38) g. PMO-039 (5'-TCCTCTCTCCATCCGAAAGAAGTAT-3') (SEQ ID NO: 39) h.PMO-005 (5'-TCTCCATCCGAAAGAAGTATGAACC-3') (SEQ ID NO:5); i.PMO-082 (5'-TAGTAGGGTATGGGATGGAAGAAAG-3') (SEQ ID NO: 82) j.PMO-083 (5'-GGGTATGGGATGGAAGAAAGTGCAG-3') (SEQ ID NO: 83) k.PMO-006 (5'-TGGGATGGAAGAAAGTGCAGGGCAC-3') (SEQ ID NO:6); l.PMO-096 (5'-ACTTGCAGCCAGAAATTTGGATCCA-3') (SEQ ID NO: 96); m.PMO-007 (5'-CAGCCAGAAATTTGGATCCATAGCC-3') (SEQ ID NO: 7); n.PMO-097 (5'-AGAAATTTGGATCCATAGCCAGGGC-3') (SEQ ID NO: 97); o.PMO-008 (5'-CCCTGTGGGGAAACGAGGGTCAGCT-3') (SEQ ID NO:8); p.MOE-009(5'-CACATGCACAGAGAGCTGGG-3') (SEQ ID NO:9); q.MOE-128 (5'-GCACAGAGAGCTGGGGAGAT-3') (SEQ ID NO: 128); r.MOE-010 (5'-GAGAGCTGGGGAGATTTGTA-3') (SEQ ID NO: 10); s.MOE-132 (5'-ACTGTATTTGGTACTTCCTC-3') (SEQ ID NO: 132); t.MOE-135 (5'-TCCTCTCTCCATCCGAAAGA-3') (SEQ ID NO: 135); u.MOE-011 (5'-TCTCCATCCGAAAGAAGTAT-3') (SEQ ID NO:11); v.MOE-012 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); w.MOE-136 (5'-AAAGAAGTATGAACCATTAT-3') (SEQ ID NO: 136); x.MOE-013 (5'-ATGCTCAGGGAGCAGTTGTT-3') (SEQ ID NO: 13); y.MOE-014 (5'-GAGTCTCCTCCTGTACTTCT-3') (SEQ ID NO: 14); z.MOE-015 (5'-CGCACAAACCCTCCTGTACC-3') (SEQ ID NO: 15); aa.MOE-183 (5'-AAACCCTCCTGTACCGTCAC-3') (SEQ ID NO: 183); bb.MOE-184 (5'-CTCCTGTACCGTCACTGACT-3') (SEQ ID NO: 184); cc.MOE-190 (5'-CAGCCAGAAATTTGGATCCA-3') (SEQ ID NO: 190); dd.MOE-196 (5'-CCCTGTGGGGAAACGAGGGT-3') (SEQ ID NO: 196); or ee.MOE-197 (5'-TGGGGAAACGAGGGTCAGCT-3') (SEQ ID NO: 197) Includes all or part of.

[0027] In some embodiments, the present disclosure provides a method of treating a subject having a neurodegenerative disease as described above, wherein the antisense oligonucleotide comprises: a. PMO-221 (5'-CCTCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 221); b. PMO-222 (5'-TCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 222); c. PMO-223 (5'-CTCACCTGTCACATGCACAGAGA-3') (SEQ ID NO: 223); d. PMO-224 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); e.PMO-225 (5'-ACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 225); f.PMO-226 (5'-TCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 226); g. PMO-227 (5'-TCACCTGTCACATGCACAGAGAGCT-3') (SEQ ID NO: 227); h.PMO-228 (5'-CCTGTGCCTCACCTGTCACATGCAC-3') (SEQ ID NO: 228); i.PMO-229 (5'-GTGCCTCACCTGTCACATGCACAGA-3') (SEQ ID NO: 229); j.PMO-230 (5'-TGCCTCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 230); k.PMO-231 (5'-CTCACCTGTCACATGCACAGAGAGC-3') (SEQ ID NO:231); l. PMO-232 (5'-CACCTGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 232); m.PMO-233 (5'-ACCTGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 233); n.PMO-234 (5'-CTGTCACATGCACAGAGAGCTGGGG-3') (SEQ ID NO: 234); o.PMO-235 (5'-CCTGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 235); p.PMO-236 (5'-TGTCACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 236); q.PMO-237 (5'-CTGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 237); r.PMO-238 (5'-TGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO:238); s.PMO-239 (5'-TCACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 239); t.PMO-240 (5'-TGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 240); u.PMO-241 (5'-CTGTATTTGGTACTTCCTCTCTCCA-3') (SEQ ID NO:241); v.PMO-242 (5'-TGTATTTGGTACTTCCTCTCTCCAT-3') (SEQ ID NO:242); w.PMO-243 (5'-GTATTTGGTACTTCCTCTCTCCATC-3') (SEQ ID NO:243); x.PMO-244 (5'-TATTTGGTACTTCCTCTCTCCATCC-3') (SEQ ID NO:244); y.PMO-324 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); 3D pattern: RRRRRRRRRRRRRRRRRRRR z.PMO-424 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); 3D pattern: SSSSSSSSSSSSSSSSSSSS aa.PMO-402 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 002); 3D pattern: RRRRRRRRRRRRRRRRRRRRRRRRRR; or bb.PMO-502 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 002); 3D pattern: SSSSSSSSSSSSSSSSSSSSSSSSSS Includes all or part of.

[0028] In some embodiments, the present disclosure provides a method of treating a subject having a neurodegenerative disease as described above, wherein the antisense oligonucleotide comprises: a.MOE-245 (5'-CTCCATCCGAAAGAAGTATG-3') (SEQ ID NO:245); b. MOE-246 (5'-TCCATCCGAAAGAAGTATGA-3') (SEQ ID NO: 246); c. MOE-247 (5'-CCATCCGAAAGAAGTATGAA-3') (SEQ ID NO: 247); d. MOE-248 (5'-CATCCGAAAGAAGTATGAAC-3') (SEQ ID NO: 248); e.MOE-249 (5'-TCCGAAAGAAGTATGAACCA-3') (SEQ ID NO:249); f.MOE-250 (5'-CCGAAAGAAGTATGAACCAT-3') (SEQ ID NO: 250); g.MOE-251 (5'-ATCCGAAAGAAGTATGAA-3') (SEQ ID NO:251); h.MOE-252 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); i.MOE-253 (5'-TCCGAAAGAAGTATGAAC-3') (SEQ ID NO: 253); j.MOE-254 (5'-CCATCCGAAAGAAGTATG-3') (SEQ ID NO:254); k.MOE-255 (5'-TCCATCCGAAAGAAGTAT-3') (SEQ ID NO:255); l. MOE-256 (5'-GAAAGAAGTATGAACCAT-3') (SEQ ID NO: 256); m.MOE-257 (5'-ATC-CGAAAGAAGTATGA-ACC-3') (SEQ ID NO:012); n.MOE-258 (5'-ATCC-GAAAGAAGTATG-AACC-3') (SEQ ID NO: 012); o.MOE-259 (5'-ATCCG-AAAGAAGTAT-GAACC-3') (SEQ ID NO:012); p.MOE-260 (5'-ATCCG-AAAGAAGTA-TGAACC-3') (SEQ ID NO: 012); q.MOE-261 (5'-ATCC-GAAAGA-AGTATG-AACC-3') (SEQ ID NO:012); r.MOE-262 (5'-ATCC-gAAAGAAGTATG-aACC-3') (SEQ ID NO:012); s.MOE-263 (5'-ATCC-gAAAGAAGTATG-aACC-3') (SEQ ID NO: 012); t.MOE-264 (5'-ATCC-gAAAGAaGTATG-aACC-3') (SEQ ID NO:012); u.MOE-265 (5'-CCGA-aAGAAGTATGAACC-3') (SEQ ID NO:252); v.MOE-266 (5'-CCGA-aAGAAGTATG-aACC-3') (SEQ ID NO: 252); w.MOE-267 (5'-CCGA-aAGAAGtATG-aACC-3') (SEQ ID NO: 252); x.MOE-268 (5'-CCG-AAAGAAGTATGA-ACC-3') (SEQ ID NO:252); y.MOE-269 (5'-CCGA-AAGAAGTATG-AACC-3') (SEQ ID NO:252); z.MOE-270 (5'-CCGAA-AGAA-GTATG-AACC-3') (SEQ ID NO:252); aa.MOE-271 (5'-CCGAA-AGAAGTAT-GAACC-3') (SEQ ID NO: 252); bb.MOE-272 (5'-CCG-A-AAGAAGTATGAACC-3') (SEQ ID NO:252); cc.MOE-273 (5'-CCG-AA-AGAAGTATGAACC-3') (SEQ ID NO:252); dd.MOE-274 (5'-CCGAAAGAAGTATG-A-ACC-3') (SEQ ID NO: 252); ee.MOE-275 (5'-mAmTfCfCfGfAfAfAfGfAfAfGfTfAfTfGfAfAmCmC-3') (SEQ ID NO:012); ff.MOE-276 (5'-fAfTfCfCfGmAmAmAmGmAmAmGmTmAfTfGfAfAfCfC-3') (SEQ ID NO: 012); gg.MOE-277 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSSSSSSSSSSSSSSSSSS; hh.MOE-278 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: RRRRRRRRRRRRRRRRRRRR; ii.MOE-279 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSSSRSSSRSSSRSSS; jj.MOE-280 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSSRSSRSSRSSSS; kk.MOE-281 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSRSRSRSRSRSRSSS; ll.MOE-282 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSSSSRRRRRRRSSSSSS; mm.MOE-283 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRRSRRSRRSRRSRSSS; nn.MOE-284 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSRRSRRRSRRRSRRSSS; oo.MOE-285 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSSSRRRRRRRRRSSSSS; pp.MOE-286(5'-ATCCGAAAGAAGTATGAACC-3')(SEQ ID NO:012);stereo pattern:SSSRRRRRRRRRRRRRSSS; qq.MOE-287(5'-ATCCGAAAGAAGTATGAACC-3')(SEQ ID NO:012);stereo pattern:SSRSSSSSSSSRSRSSSSS; rr.MOE-288(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSSSSSSSSSSSSSSS; ss.MOE-289 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: RRRRRRRRRRRRRRRRRR; tt.MOE-290 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252; stereo pattern: SSSRRRRRRRRRRRSSS; uu.MOE-291 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: RRRRRRRRSSSSSSSSS; vv.MOE-292 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSSSSSSSRRRRRRRR; ww.MOE-293 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSSRSSRSSSRSSSS; xx.MOE-294 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SSSRSRSRSRSRSRSSS; yy.MOE-295(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); steric pattern: SRSSSRSSSRSSSRSSS; zz.MOE-296 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SSSOSSRSSSRSSOSSS; aaa.MOE-297 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSSOSRSRSRSSSOSSS; bbb.MOE-298 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SOSSSRSSSRSSSOSSS; ccc.MOE-299 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); 3D pattern: SSSOSSSRSSSRSSSOSSS; ddd.MOE-300(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: RRRORRROSSSSSSSSS; eee.MOE-301 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SRRORRROSSSSSSSSS; fff.MOE-303 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSOOOSSSSSSSSSSSS; ggg.MOE-304 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); 3D pattern: OOOOOSSSSSSSSSSSS; hhh.MOE-305 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); 3D pattern: SSOSSSOSSOSSSOSSS; iii.MOE-306 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SOSSSSOSSSSSSOSSS; jjj.MOE-307 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSOSSSSSSSSSSOSSS; kkk.MOE-308(5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO:12);stereo pattern: SSSOSSSSSSSSSSSSOSSS; lll.MOE-309 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); stereo pattern: SSSOSSSSOSSOSSSOSSS; mmm.MOE-310 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSORRRRRSSSSSOSSS; or nnn.MOE-311(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252). Three-dimensional pattern: RRRRROSSSSSSSSOSSS Includes all or part of.

[0029] In some embodiments, the present disclosure provides a method of treating a subject having a neurodegenerative disease as described above, where the neurodegenerative disease is Alzheimer's disease.

[0030] In some embodiments, the present disclosure provides the above-mentioned antisense oligonucleotide for use in a method of inducing exon-2 skipping in CD33 gene during pre-mRNA splicing, comprising introducing a nucleic acid molecule into a cell, wherein the nucleic acid molecule is an antisense oligonucleotide that hybridizes to a target region of CD33 gene, complementary to a portion of SEQ ID NO: 1, and induces exon-2 skipping during pre-mRNA splicing of CD33 gene. In some embodiments, the antisense oligonucleotide is complementary to a portion of SEQ ID NO: 213; SEQ ID NO: 214; SEQ ID NO: 215; SEQ ID NO: 216; SEQ ID NO: 217; SEQ ID NO: 218; SEQ ID NO: 219; and / or SEQ ID NO: 220. In some embodiments, the exon-2 skipping efficiency of the antisense oligonucleotide is 30% or more. In some embodiments, the exon-2 skipping efficiency of the antisense oligonucleotide is 30% or more according to a standard exon skipping efficiency assay for ASO. In some embodiments, the standard exon skipping efficiency assay is a standard exon skipping efficiency assay for a PMO ASO when the antisense oligonucleotide comprises a phosphorodiamidate morpholino oligomer, or a standard exon skipping efficiency assay for a MOE ASO when the antisense oligonucleotide comprises a methoxyethyl ribose oligomer.

[0031] In some embodiments, the present disclosure provides an antisense oligonucleotide as described above for use in a method of inducing exon-2 skipping in the CD33 gene as described above, wherein the antisense oligonucleotide comprises: a.PMO-002 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO:2); b. PMO-003 (5'-CCTGTCACATGCACAGAGAGCTGGG-3') (SEQ ID NO:3); c. PMO-036 (5'-TTGTAACTGTATTTGGTACTTCCTC-3') (SEQ ID NO: 36); d. PMO-037 (5'-ACTGTATTTGGTACTTCCTCTCTCC-3') (SEQ ID NO:37); e.PMO-004 (5'-ATTTGGTACTTCCTCTCTCCATCCG-3') (SEQ ID NO:4); f.PMO-038 (5'-GTACTTCCTCTCTCCATCCGAAAGA-3') (SEQ ID NO:38); g. PMO-039 (5'-TCCTCTCTCCATCCGAAAGAAGTAT-3') (SEQ ID NO:39); h.PMO-005 (5'-TCTCCATCCGAAAGAAGTATGAACC-3') (SEQ ID NO:5); i.PMO-082 (5'-TAGTAGGGTATGGGATGGAAGAAAG-3') (SEQ ID NO:82); j.PMO-083 (5'-GGGTATGGGATGGAAGAAAGTGCAG-3') (SEQ ID NO:83); k.PMO-006 (5'-TGGGATGGAAGAAAGTGCAGGGCAC-3') (SEQ ID NO:6); l.PMO-096 (5'-ACTTGCAGCCAGAAATTTGGATCCA-3') (SEQ ID NO: 96); m.PMO-007 (5'-CAGCCAGAAATTTGGATCCATAGCC-3') (SEQ ID NO: 7); n.PMO-097 (5'-AGAAATTTGGATCCATAGCCAGGGC-3') (SEQ ID NO: 97); o.PMO-008 (5'-CCCTGTGGGGAAACGAGGGTCAGCT-3') (SEQ ID NO:8); p.MOE-009(5'-CACATGCACAGAGAGCTGGG-3') (SEQ ID NO:9); q.MOE-128 (5'-GCACAGAGAGCTGGGGAGAT-3') (SEQ ID NO: 128); r.MOE-010 (5'-GAGAGCTGGGGAGATTTGTA-3') (SEQ ID NO: 10); s.MOE-132 (5'-ACTGTATTTGGTACTTCCTC-3') (SEQ ID NO: 132); t.MOE-135 (5'-TCCTCTCTCCATCCGAAAGA-3') (SEQ ID NO: 135); u.MOE-011 (5'-TCTCCATCCGAAAGAAGTAT-3') (SEQ ID NO:11); v.MOE-012 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); w.MOE-136 (5'-AAAGAAGTATGAACCATTAT-3') (SEQ ID NO: 136); x.MOE-013 (5'-ATGCTCAGGGAGCAGTTGTT-3') (SEQ ID NO: 13); y.MOE-014 (5'-GAGTCTCCTCCTGTACTTCT-3') (SEQ ID NO: 14); z.MOE-015 (5'-CGCACAAACCCTCCTGTACC-3') (SEQ ID NO: 15); aa.MOE-183 (5'-AAACCCTCCTGTACCGTCAC-3') (SEQ ID NO: 183); bb.MOE-184 (5'-CTCCTGTACCGTCACTGACT-3') (SEQ ID NO: 184); cc.MOE-190 (5'-CAGCCAGAAATTTGGATCCA-3') (SEQ ID NO: 190); dd.MOE-196 (5'-CCCTGTGGGGAAACGAGGGT-3') (SEQ ID NO: 196); or ee.MOE-197 (5'-TGGGGAAACGAGGGTCAGCT-3') (SEQ ID NO: 197) Includes all or part of.

[0032] In some embodiments, the present disclosure provides an antisense oligonucleotide as described above for use in a method of inducing exon-2 skipping in the CD33 gene as described above, wherein the antisense oligonucleotide comprises: a. PMO-221 (5'-CCTCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 221); b. PMO-222 (5'-TCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 222); c. PMO-223 (5'-CTCACCTGTCACATGCACAGAGA-3') (SEQ ID NO: 223); d. PMO-224 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); e.PMO-225 (5'-ACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 225); f.PMO-226 (5'-TCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 226); g. PMO-227 (5'-TCACCTGTCACATGCACAGAGAGCT-3') (SEQ ID NO: 227); h.PMO-228 (5'-CCTGTGCCTCACCTGTCACATGCAC-3') (SEQ ID NO: 228); i.PMO-229 (5'-GTGCCTCACCTGTCACATGCACAGA-3') (SEQ ID NO: 229); j.PMO-230 (5'-TGCCTCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 230); k.PMO-231 (5'-CTCACCTGTCACATGCACAGAGAGC-3') (SEQ ID NO:231); l. PMO-232 (5'-CACCTGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 232); m.PMO-233 (5'-ACCTGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 233); n.PMO-234 (5'-CTGTCACATGCACAGAGAGCTGGGG-3') (SEQ ID NO: 234); o.PMO-235 (5'-CCTGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 235); p.PMO-236 (5'-TGTCACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 236); q.PMO-237 (5'-CTGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 237); r.PMO-238 (5'-TGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO:238); s.PMO-239 (5'-TCACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 239); t.PMO-240 (5'-TGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 240); u.PMO-241 (5'-CTGTATTTGGTACTTCCTCTCTCCA-3') (SEQ ID NO:241); v.PMO-242 (5'-TGTATTTGGTACTTCCTCTCTCCAT-3') (SEQ ID NO:242); w.PMO-243 (5'-GTATTTGGTACTTCCTCTCTCCATC-3') (SEQ ID NO:243); x.PMO-244 (5'-TATTTGGTACTTCCTCTCTCCATCC-3') (SEQ ID NO:244); y.PMO-324 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); 3D pattern: RRRRRRRRRRRRRRRRRRRR z.PMO-424 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); 3D pattern: SSSSSSSSSSSSSSSSSSSS aa.PMO-402 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 002); 3D pattern: RRRRRRRRRRRRRRRRRRRRRRRRRR; or bb.PMO-502 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 002); 3D pattern: SSSSSSSSSSSSSSSSSSSSSSSSSS Includes all or part of.

[0033] In some embodiments, the present disclosure provides an antisense oligonucleotide as described above for use in a method of inducing exon-2 skipping in the CD33 gene as described above, wherein the antisense oligonucleotide comprises: a.MOE-245 (5'-CTCCATCCGAAAGAAGTATG-3') (SEQ ID NO:245); b. MOE-246 (5'-TCCATCCGAAAGAAGTATGA-3') (SEQ ID NO: 246); c. MOE-247 (5'-CCATCCGAAAGAAGTATGAA-3') (SEQ ID NO: 247); d. MOE-248 (5'-CATCCGAAAGAAGTATGAAC-3') (SEQ ID NO: 248); e.MOE-249 (5'-TCCGAAAGAAGTATGAACCA-3') (SEQ ID NO:249); f.MOE-250 (5'-CCGAAAGAAGTATGAACCAT-3') (SEQ ID NO: 250); g.MOE-251 (5'-ATCCGAAAGAAGTATGAA-3') (SEQ ID NO:251); h.MOE-252 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); i.MOE-253 (5'-TCCGAAAGAAGTATGAAC-3') (SEQ ID NO: 253); j.MOE-254 (5'-CCATCCGAAAGAAGTATG-3') (SEQ ID NO:254); k.MOE-255 (5'-TCCATCCGAAAGAAGTAT-3') (SEQ ID NO:255); l. MOE-256 (5'-GAAAGAAGTATGAACCAT-3') (SEQ ID NO: 256); m.MOE-257 (5'-ATC-CGAAAGAAGTATGA-ACC-3') (SEQ ID NO:012); n.MOE-258 (5'-ATCC-GAAAGAAGTATG-AACC-3') (SEQ ID NO: 012); o.MOE-259 (5'-ATCCG-AAAGAAGTAT-GAACC-3') (SEQ ID NO:012); p.MOE-260 (5'-ATCCG-AAAGAAGTA-TGAACC-3') (SEQ ID NO: 012); q.MOE-261 (5'-ATCC-GAAAGA-AGTATG-AACC-3') (SEQ ID NO:012); r.MOE-262 (5'-ATCC-gAAAGAAGTATG-aACC-3') (SEQ ID NO:012); s.MOE-263 (5'-ATCC-gAAAGAAGTATG-aACC-3') (SEQ ID NO: 012); t.MOE-264 (5'-ATCC-gAAAGAaGTATG-aACC-3') (SEQ ID NO:012); u.MOE-265 (5'-CCGA-aAGAAGTATGAACC-3') (SEQ ID NO:252); v.MOE-266 (5'-CCGA-aAGAAGTATG-aACC-3') (SEQ ID NO: 252); w.MOE-267 (5'-CCGA-aAGAAGtATG-aACC-3') (SEQ ID NO: 252); x.MOE-268 (5'-CCG-AAAGAAGTATGA-ACC-3') (SEQ ID NO:252); y.MOE-269 (5'-CCGA-AAGAAGTATG-AACC-3') (SEQ ID NO:252); z.MOE-270 (5'-CCGAA-AGAA-GTATG-AACC-3') (SEQ ID NO:252); aa.MOE-271 (5'-CCGAA-AGAAGTAT-GAACC-3') (SEQ ID NO: 252); bb.MOE-272 (5'-CCG-A-AAGAAGTATGAACC-3') (SEQ ID NO:252); cc.MOE-273 (5'-CCG-AA-AGAAGTATGAACC-3') (SEQ ID NO:252); dd.MOE-274 (5'-CCGAAAGAAGTATG-A-ACC-3') (SEQ ID NO: 252); ee.MOE-275 (5'-mAmTfCfCfGfAfAfAfGfAfAfGfTfAfTfGfAfAmCmC-3') (SEQ ID NO:012); ff.MOE-276 (5'-fAfTfCfCfGmAmAmAmGmAmAmGmTmAfTfGfAfAfCfC-3') (SEQ ID NO: 012); gg.MOE-277 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSSSSSSSSSSSSSSSSSS; hh.MOE-278 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: RRRRRRRRRRRRRRRRRRRR; ii.MOE-279 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSSSRSSSRSSSRSSS; jj.MOE-280 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSSRSSRSSRSSSS; kk.MOE-281 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSRSRSRSRSRSRSSS; ll.MOE-282 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSSSSRRRRRRRSSSSSS; mm.MOE-283 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRRSRRSRRSRRSRSSS; nn.MOE-284 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSRRSRRRSRRRSRRSSS; oo.MOE-285 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSSSRRRRRRRRRSSSSS; pp.MOE-286(5'-ATCCGAAAGAAGTATGAACC-3')(SEQ ID NO:012);stereo pattern:SSSRRRRRRRRRRRRRSSS; qq.MOE-287(5'-ATCCGAAAGAAGTATGAACC-3')(SEQ ID NO:012);stereo pattern:SSRSSSSSSSSRSRSSSSS; rr.MOE-288(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSSSSSSSSSSSSSSS; ss.MOE-289 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: RRRRRRRRRRRRRRRRRR; tt.MOE-290 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252; stereo pattern: SSSRRRRRRRRRRRSSS; uu.MOE-291 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: RRRRRRRRSSSSSSSSS; vv.MOE-292 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSSSSSSSRRRRRRRR; ww.MOE-293 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSSRSSRSSSRSSSS; xx.MOE-294 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SSSRSRSRSRSRSRSSS; yy.MOE-295(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); steric pattern: SRSSSRSSSRSSSRSSS; zz.MOE-296 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SSSOSSRSSSRSSOSSS; aaa.MOE-297 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSSOSRSRSRSSSOSSS; bbb.MOE-298 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SOSSSRSSSRSSSOSSS; ccc.MOE-299 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); 3D pattern: SSSOSSSRSSSRSSSOSSS; ddd.MOE-300(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: RRRORRROSSSSSSSSS; eee.MOE-301 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SRRORRROSSSSSSSSS; fff.MOE-303 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSOOOSSSSSSSSSSSS; ggg.MOE-304 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); 3D pattern: OOOOOSSSSSSSSSSSS; hhh.MOE-305 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); 3D pattern: SSOSSSOSSOSSSOSSS; iii.MOE-306 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SOSSSSOSSSSSSOSSS; jjj.MOE-307 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSOSSSSSSSSSSOSSS; kkk.MOE-308(5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO:12);stereo pattern: SSSOSSSSSSSSSSSSOSSS; lll.MOE-309 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); stereo pattern: SSSOSSSSOSSOSSSOSSS; mmm.MOE-310 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSORRRRRSSSSSOSSS; or nnn.MOE-311(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252). Three-dimensional pattern: RRRRROSSSSSSSSOSSS Includes all or part of.

[0034] In some embodiments, the cell is an animal cell. In some embodiments, the animal cell is a human cell.

[0035] In some embodiments, the method of inducing exon-2 skipping is performed in vitro. In some embodiments, the method of inducing exon-2 skipping is performed in vivo.

[0036] In some embodiments, the disclosure provides an antisense oligonucleotide as described above for use in a method of treating a subject having a neurodegenerative disease, the method comprising administering a therapeutically effective amount of an antisense oligonucleotide of 16-30 nucleotides in length, wherein the antisense oligonucleotide is complementary to a portion of SEQ ID NO:1, and wherein the antisense oligonucleotide has a CD33 exon-2 skipping efficiency of 30% or greater according to a standard exon skipping efficiency assay for antisense oligonucleotides.

[0037] In some embodiments, the present disclosure provides an antisense oligonucleotide as described above for use in a method of treating a subject having a neurodegenerative disease as described above, wherein the antisense oligonucleotide comprises: a.PMO-002 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO:2); b. PMO-003 (5'-CCTGTCACATGCACAGAGAGCTGGG-3') (SEQ ID NO:3); c. PMO-036 (5'-TTGTAACTGTATTTGGTACTTCCTC-3') (SEQ ID NO: 36); d. PMO-037 (5'-ACTGTATTTGGTACTTCCTCTCTCC-3') (SEQ ID NO:37); e.PMO-004 (5'-ATTTGGTACTTCCTCTCTCCATCCG-3') (SEQ ID NO:4); f.PMO-038 (5'-GTACTTCCTCTCTCCATCCGAAAGA-3') (SEQ ID NO:38); g. PMO-039 (5'-TCCTCTCTCCATCCGAAAGAAGTAT-3') (SEQ ID NO:39); h.PMO-005 (5'-TCTCCATCCGAAAGAAGTATGAACC-3') (SEQ ID NO:5); i.PMO-082 (5'-TAGTAGGGTATGGGATGGAAGAAAG-3') (SEQ ID NO:82); j.PMO-083 (5'-GGGTATGGGATGGAAGAAAGTGCAG-3') (SEQ ID NO:83); k.PMO-006 (5'-TGGGATGGAAGAAAGTGCAGGGCAC-3') (SEQ ID NO:6); l.PMO-096 (5'-ACTTGCAGCCAGAAATTTGGATCCA-3') (SEQ ID NO: 96); m.PMO-007 (5'-CAGCCAGAAATTTGGATCCATAGCC-3') (SEQ ID NO: 7); n.PMO-097 (5'-AGAAATTTGGATCCATAGCCAGGGC-3') (SEQ ID NO: 97); o.PMO-008 (5'-CCCTGTGGGGAAACGAGGGTCAGCT-3') (SEQ ID NO:8); p.MOE-009(5'-CACATGCACAGAGAGCTGGG-3') (SEQ ID NO:9); q.MOE-128 (5'-GCACAGAGAGCTGGGGAGAT-3') (SEQ ID NO: 128); r.MOE-010 (5'-GAGAGCTGGGGAGATTTGTA-3') (SEQ ID NO: 10); s.MOE-132 (5'-ACTGTATTTGGTACTTCCTC-3') (SEQ ID NO: 132); t.MOE-135 (5'-TCCTCTCTCCATCCGAAAGA-3') (SEQ ID NO: 135); u.MOE-011 (5'-TCTCCATCCGAAAGAAGTAT-3') (SEQ ID NO:11); v.MOE-012 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); w.MOE-136 (5'-AAAGAAGTATGAACCATTAT-3') (SEQ ID NO: 136); x.MOE-013 (5'-ATGCTCAGGGAGCAGTTGTT-3') (SEQ ID NO: 13); y.MOE-014 (5'-GAGTCTCCTCCTGTACTTCT-3') (SEQ ID NO: 14); z.MOE-015 (5'-CGCACAAACCCTCCTGTACC-3') (SEQ ID NO: 15); aa.MOE-183 (5'-AAACCCTCCTGTACCGTCAC-3') (SEQ ID NO: 183); bb.MOE-184 (5'-CTCCTGTACCGTCACTGACT-3') (SEQ ID NO: 184); cc.MOE-190 (5'-CAGCCAGAAATTTGGATCCA-3') (SEQ ID NO: 190); dd.MOE-196 (5'-CCCTGTGGGGAAACGAGGGT-3') (SEQ ID NO: 196); or ee.MOE-197 (5'-TGGGGAAACGAGGGTCAGCT-3') (SEQ ID NO: 197) Includes all or part of.

[0038] In some embodiments, the present disclosure provides an antisense oligonucleotide as described above for use in a method of treating a subject having a neurodegenerative disease as described above, wherein the antisense oligonucleotide comprises: a. PMO-221 (5'-CCTCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 221); b. PMO-222 (5'-TCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 222); c. PMO-223 (5'-CTCACCTGTCACATGCACAGAGA-3') (SEQ ID NO: 223); d. PMO-224 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); e.PMO-225 (5'-ACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 225); f.PMO-226 (5'-TCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 226); g. PMO-227 (5'-TCACCTGTCACATGCACAGAGAGCT-3') (SEQ ID NO: 227); h.PMO-228 (5'-CCTGTGCCTCACCTGTCACATGCAC-3') (SEQ ID NO: 228); i.PMO-229 (5'-GTGCCTCACCTGTCACATGCACAGA-3') (SEQ ID NO: 229); j.PMO-230 (5'-TGCCTCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 230); k.PMO-231 (5'-CTCACCTGTCACATGCACAGAGAGC-3') (SEQ ID NO:231); l. PMO-232 (5'-CACCTGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 232); m.PMO-233 (5'-ACCTGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 233); n.PMO-234 (5'-CTGTCACATGCACAGAGAGCTGGGG-3') (SEQ ID NO: 234); o.PMO-235 (5'-CCTGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 235); p.PMO-236 (5'-TGTCACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 236); q.PMO-237 (5'-CTGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 237); r.PMO-238 (5'-TGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO:238); s.PMO-239 (5'-TCACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 239); t.PMO-240 (5'-TGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 240); u.PMO-241 (5'-CTGTATTTGGTACTTCCTCTCTCCA-3') (SEQ ID NO:241); v.PMO-242 (5'-TGTATTTGGTACTTCCTCTCTCCAT-3') (SEQ ID NO:242); w.PMO-243 (5'-GTATTTGGTACTTCCTCTCTCCATC-3') (SEQ ID NO:243); x.PMO-244 (5'-TATTTGGTACTTCCTCTCTCCATCC-3') (SEQ ID NO:244); y.PMO-324 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); 3D pattern: RRRRRRRRRRRRRRRRRRRR z.PMO-424 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); 3D pattern: SSSSSSSSSSSSSSSSSSSS aa.PMO-402 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 002); 3D pattern: RRRRRRRRRRRRRRRRRRRRRRRRRR; or bb.PMO-502 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 002); 3D pattern: SSSSSSSSSSSSSSSSSSSSSSSSSS Includes all or part of.

[0039] In some embodiments, the present disclosure provides an antisense oligonucleotide as described above for use in a method of treating a subject having a neurodegenerative disease as described above, wherein the antisense oligonucleotide comprises: a.MOE-245 (5'-CTCCATCCGAAAGAAGTATG-3') (SEQ ID NO:245); b. MOE-246 (5'-TCCATCCGAAAGAAGTATGA-3') (SEQ ID NO: 246); c. MOE-247 (5'-CCATCCGAAAGAAGTATGAA-3') (SEQ ID NO: 247); d. MOE-248 (5'-CATCCGAAAGAAGTATGAAC-3') (SEQ ID NO: 248); e.MOE-249 (5'-TCCGAAAGAAGTATGAACCA-3') (SEQ ID NO:249); f.MOE-250 (5'-CCGAAAGAAGTATGAACCAT-3') (SEQ ID NO: 250); g.MOE-251 (5'-ATCCGAAAGAAGTATGAA-3') (SEQ ID NO:251); h.MOE-252 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); i.MOE-253 (5'-TCCGAAAGAAGTATGAAC-3') (SEQ ID NO: 253); j.MOE-254 (5'-CCATCCGAAAGAAGTATG-3') (SEQ ID NO:254); k.MOE-255 (5'-TCCATCCGAAAGAAGTAT-3') (SEQ ID NO:255); l. MOE-256 (5'-GAAAGAAGTATGAACCAT-3') (SEQ ID NO: 256); m.MOE-257 (5'-ATC-CGAAAGAAGTATGA-ACC-3') (SEQ ID NO:012); n.MOE-258 (5'-ATCC-GAAAGAAGTATG-AACC-3') (SEQ ID NO: 012); o.MOE-259 (5'-ATCCG-AAAGAAGTAT-GAACC-3') (SEQ ID NO:012); p.MOE-260 (5'-ATCCG-AAAGAAGTA-TGAACC-3') (SEQ ID NO: 012); q.MOE-261 (5'-ATCC-GAAAGA-AGTATG-AACC-3') (SEQ ID NO:012); r.MOE-262 (5'-ATCC-gAAAGAAGTATG-aACC-3') (SEQ ID NO:012); s.MOE-263 (5'-ATCC-gAAAGAAGTATG-aACC-3') (SEQ ID NO: 012); t.MOE-264 (5'-ATCC-gAAAGAaGTATG-aACC-3') (SEQ ID NO:012); u.MOE-265 (5'-CCGA-aAGAAGTATGAACC-3') (SEQ ID NO:252); v.MOE-266 (5'-CCGA-aAGAAGTATG-aACC-3') (SEQ ID NO: 252); w.MOE-267 (5'-CCGA-aAGAAGtATG-aACC-3') (SEQ ID NO: 252); x.MOE-268 (5'-CCG-AAAGAAGTATGA-ACC-3') (SEQ ID NO:252); y.MOE-269 (5'-CCGA-AAGAAGTATG-AACC-3') (SEQ ID NO:252); z.MOE-270 (5'-CCGAA-AGAA-GTATG-AACC-3') (SEQ ID NO:252); aa.MOE-271 (5'-CCGAA-AGAAGTAT-GAACC-3') (SEQ ID NO: 252); bb.MOE-272 (5'-CCG-A-AAGAAGTATGAACC-3') (SEQ ID NO:252); cc.MOE-273 (5'-CCG-AA-AGAAGTATGAACC-3') (SEQ ID NO:252); dd.MOE-274 (5'-CCGAAAGAAGTATG-A-ACC-3') (SEQ ID NO: 252); ee.MOE-275 (5'-mAmTfCfCfGfAfAfAfGfAfAfGfTfAfTfGfAfAmCmC-3') (SEQ ID NO:012); ff.MOE-276 (5'-fAfTfCfCfGmAmAmAmGmAmAmGmTmAfTfGfAfAfCfC-3') (SEQ ID NO: 012); gg.MOE-277 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSSSSSSSSSSSSSSSSSS; hh.MOE-278 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: RRRRRRRRRRRRRRRRRRRR; ii.MOE-279 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSSSRSSSRSSSRSSS; jj.MOE-280 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSSRSSRSSRSSSS; kk.MOE-281 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSRSRSRSRSRSRSSS; ll.MOE-282 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSSSSRRRRRRRSSSSSS; mm.MOE-283 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); stereo pattern: SSSRRSRRSRRSRRSRSSS; nn.MOE-284 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSRRSRRRSRRRSRRSSS; oo.MOE-285 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 012); 3D pattern: SSSSSRRRRRRRRRSSSSS; pp.MOE-286(5'-ATCCGAAAGAAGTATGAACC-3')(SEQ ID NO:012);stereo pattern:SSSRRRRRRRRRRRRRSSS; qq.MOE-287(5'-ATCCGAAAGAAGTATGAACC-3')(SEQ ID NO:012);stereo pattern:SSRSSSSSSSSRSRSSSSS; rr.MOE-288(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSSSSSSSSSSSSSSSSS; ss.MOE-289 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: RRRRRRRRRRRRRRRRRR; tt.MOE-290 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252; stereo pattern: SSSRRRRRRRRRRRSSS; uu.MOE-291 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: RRRRRRRRSSSSSSSSS; vv.MOE-292 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSSSSSSSRRRRRRRR; ww.MOE-293 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSSRSSRSSSRSSSS; xx.MOE-294 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SSSRSRSRSRSRSRSSS; yy.MOE-295(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); steric pattern: SRSSSRSSSRSSSRSSS; zz.MOE-296 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SSSOSSRSSSRSSOSSS; aaa.MOE-297 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSSOSRSRSRSSSOSSS; bbb.MOE-298 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SOSSSRSSSRSSSOSSS; ccc.MOE-299 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); 3D pattern: SSSOSSSRSSSRSSSOSSS; ddd.MOE-300(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: RRRORRROSSSSSSSSS; eee.MOE-301 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SRRORRROSSSSSSSSS; fff.MOE-303 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSOOOSSSSSSSSSSSS; ggg.MOE-304 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); 3D pattern: OOOOOSSSSSSSSSSSS; hhh.MOE-305 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); 3D pattern: SSOSSSOSSOSSSOSSS; iii.MOE-306 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SOSSSSOSSSSSSOSSS; jjj.MOE-307 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); 3D pattern: SSOSSSSSSSSSSOSSS; kkk.MOE-308(5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO:12);stereo pattern: SSSOSSSSSSSSSSSSOSSS; lll.MOE-309 (5'-ATCCGAAAGAAGTATGAACC-3') (SEQ ID NO: 12); stereo pattern: SSSOSSSSOSSOSSSOSSS; mmm.MOE-310 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252); stereo pattern: SSORRRRRSSSSSOSSS; or nnn.MOE-311(5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252). Three-dimensional pattern: RRRRROSSSSSSSSOSSS Includes all or part of.

[0040] In some embodiments, the present disclosure provides a method of treating a subject having a neurodegenerative disease as described above, where the neurodegenerative disease is Alzheimer's disease.

[0041] BRIEF DESCRIPTION OF THE DRAWINGS The application file contains color drawings. Copies of this patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee. [Brief description of the drawings]

[0042] [Figure 1] 1 shows CD33 mRNA levels in patient plasma and cerebrospinal fluid for rs3865444 SNP, C=rs3865444-C, A=rs3865444-A. [Diagram 2] Various cognitive outcomes are shown for patients with the rs3865444-A allele compared to patients with the rs201074739 indel frameshift allele. [Diagram 3] Various physiological outcomes are shown comparing patients with the rs3865444-A allele with those with the rs201074739 indel allele. [Figure 4] 1 shows CD33 mRNA levels in patient plasma and cerebrospinal fluid for rs201074739 indels. [Figure 5A] 1 shows the exon skipping efficiency of several PMO sequences at different concentrations. [Figure 5B] 1 shows the exon skipping efficiency of several PMO sequences at different concentrations. [Figure 6A] 1 shows the exon skipping efficiency of several MOE sequences at different concentrations. [Figure 6B] 1 shows the exon skipping efficiency of several MOE sequences at different concentrations. [Figure 6C] 1 shows the exon skipping efficiency of several MOE sequences at different concentrations. [Figure 7]Fold change (ability to increase exon-2 skipped CD33 mRNA in vivo) of two ASOs over control (PBS) in mouse hippocampus at two dose levels is shown. D2-CD33=exon-2 skipped CD33 mRNA, PMO-002=SEQ ID NO:2, MOE-012=SEQ ID NO:12. [Figure 8] Fold change (ability to increase exon-2 skipped CD33 mRNA in vivo) of two ASOs over control (PBS) in mouse cortex at two dose levels is shown. D2-CD33=exon-2 skipped CD33 mRNA, PMO-002=SEQ ID NO:2, MOE-012=SEQ ID NO:12. [Figure 9] Percent exon-2 skipping rate of CD33 mRNA in mouse cortex and hippocampus for PMO-221, PMO-224, PMO-232, PMO-233, PMO-237, PMO-238, PMO-002, and PMO-003. D2-CD33 = exon-2 skipped CD33 mRNA. [Figure 10] Fold change (ability to increase exon-2 skipped CD33 mRNA in vivo) of (i) PMO-224 versus control (PBS) in mouse cortex and hippocampus at three dose levels and (ii) PMO-002 versus control (PBS) in mouse cortex and hippocampus at one dose level is shown. D2-CD33 = exon-2 skipped CD33 mRNA. [Figure 11] HPLC chromatogram and HRMS trace of PMO-424 are shown. [Figure 12] HPLC chromatogram and HRMS trace of PMO-324 are shown. [Figure 13] The Tm of PMO-324, PMO-424, and PMO-224 are shown. [Figure 14] HPLC chromatogram and HRMS trace of PMO-502 are shown. [Figure 15] HPLC chromatogram and HRMS trace of PMO-402 are shown. [Figure 16]The Tm of PMO-402, PMO-502, and PMO-002 are shown. [Figure 17] A chromatogram of PMO-424 (cleaved resin) bearing an N3'-trityl group is shown. [Figure 18] Fold change (ability to increase exon-2 skipped CD33 mRNA in vivo) of PMO-324 and PMO-424 versus control (PBS) in mouse cortex and hippocampus at two dose levels is shown. D2-CD33 = exon-2 skipped CD33 mRNA. [Figure 19] Fold change (ability to increase exon-2 skipped CD33 mRNA in vivo) of PMO-402 and PMO-502 over control (PBS) in mouse cortex and hippocampus at two dose levels is shown. D2-CD33 = exon-2 skipped CD33 mRNA. [Figure 20] The melting temperatures of MOE-012, MOE-277, and MOE-278 are shown. [Figure 21] HPLC elution profiles of stereochemically pure ASOs MOE-288 to MOE-292 and stereochemically random ASO MOE-252 are shown. [Figure 22] Shows the in vivo activity of ASO MOE-012 and MOE-246 to MOE-256 at the 100 μg dose setting. [Figure 23] Shows the in vivo activity of ASO MOE-012 and MOE-257 to MOE-261 at the 100 μg dose setting. [Figure 24] Shows the in vivo activity of ASOs MOE-262 to MOE-267 and MOE-252 at the 30 μg dose setting. [Diagram 25] Shows the in vivo activity of ASO MOE-277 and MOE-279 to MOE-284 at the 30 μg dose setting. [Figure 26] 1 shows the in vivo activity of ASOs MOE-252, MOE-288, MOE-291, and MOE-292 at the 30 μg and 100 μg dose settings, and MOE-289 and MOE-290 at the 30 μg dose setting. [Figure 27] The in vivo activity of ASO MOE-293 to MOE-299 at 30 μg and 100 μg dose settings is shown. [Figure 28] Showing the in vivo activity of ASO MOE-300, MOE-301, and MOE-303 to MOE-311 at a dose of 100 μg [Figure 29] The in vivo activity of MOE-279 at dose levels of 10 μg, 30 μg, 60 μg, and 100 μg is shown. [Diagram 30] The duration of skipping effect of a single 100 μg ICV dose of MOE-277 is shown (up to 150 days). [Diagram 31] Brain MOE-277 concentrations following a single 100 μg ICV dose are shown (up to 150 days). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0043] definition The term "oligonucleotide" is used herein to refer to a nucleotide sequence containing at least 10 DNA or RNA nucleotides.

[0044] The term "antisense oligonucleotide", abbreviated as "ASO", is used herein to refer to a nucleotide sequence that comprises an antisense sequence that is sufficiently complementary to a target nucleotide sequence to form a stable double-stranded hybrid with the target nucleotide sequence.In some embodiments, the target nucleotide sequence is an RNA nucleotide sequence.Unless otherwise specified, the ASOs depicted herein are depicted in 5' to 3' orientation.

[0045] The term "nucleobase" is used herein to refer to a base that is a component of a nucleoside. Exemplary nucleobases include adenine, guanine, thymine, cytosine, and uracil.

[0046] The term "nucleoside" is used herein to refer to a nucleobase covalently linked to a sugar. Examples of naturally occurring and non-naturally occurring nucleosides are provided below.

[0047] The term "nucleotide" is used herein to refer to a nucleoside covalently linked to a phosphate group. Examples of naturally occurring nucleotides include adenosine, thymidine, uridine, cytidine, 5-methylcytidine, and guanosine. Descriptions and examples of non-naturally occurring nucleotides are provided below.

[0048] Within the ASO structure, the phosphate groups are commonly referred to as forming the "internucleotide linkage" of the ASO. The naturally occurring internucleotide linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. A "phosphoramidate" group contains phosphorus with three oxygen atoms and one nitrogen atom, while a "phosphorodiamidate" group contains phosphorus with two oxygen atoms and two nitrogen atoms. A "phosphorotriamidate" group (or phosphate triamide group) contains phosphorus with one oxygen atom and three nitrogen atoms. In the uncharged or cationic internucleotide linkage of the morpholino-based ASOs described herein, there is always one nitrogen pendant to the linking chain. The second nitrogen, in a phosphorodiamidate linkage, is typically a ring nitrogen of the morpholino ring structure.

[0049] The term "non-natural" is used herein to refer to a molecule that has an artificial modification compared to its naturally occurring counterpart. In some embodiments, "non-natural" may refer to one or more nucleotide subunits that have at least one modification selected from (i) a modified internucleotide linkage, e.g., an internucleotide linkage other than the standard phosphodiester linkage found in naturally occurring oligonucleotides, (ii) a modified sugar moiety, e.g., a moiety other than a ribose or deoxyribose moiety found in naturally occurring oligonucleotides, (iii) a modified nucleobase, e.g., a base other than those found in naturally occurring oligonucleotides, or (iv) any combination of the foregoing. In some embodiments, the ASO is selected from ASOs that do not have a phosphorus atom in the internucleotide linkage (backbone). In some embodiments, the ASO has a phosphorodiamidate or phosphorothioate modified internucleotide linkage (backbone).

[0050] The term "morpholino" is used herein to refer to a nucleotide that has a morpholinyl ring in place of ribose.

[0051] The term "morpholino-based ASO" is used herein to refer to an ASO that contains at least one nucleotide that has a morpholinyl ring in place of ribose.

[0052] The term "stereocontrolled" is used herein to describe when a nucleotide and / or oligonucleotide is designed or selected to have a specific stereochemistry. In some embodiments, the nucleobase portion of the nucleotide or oligonucleotide is stereocontrolled, including any and all non-natural modifications. In some embodiments, the nucleoside portion of the nucleotide or oligonucleotide is stereocontrolled, including any and all non-natural modifications. In some embodiments, the internucleotide linkage portion of the nucleotide or oligonucleotide is stereocontrolled, including any and all non-natural modifications. In some embodiments, a nucleotide can include one or a combination of these stereocontrolled portions. In some embodiments, an oligonucleotide can include a combination of nucleotides, including a combination of stereocontrolled nucleotides. In some embodiments, an oligonucleotide can include a combination of stereocontrolled and non-stereocontrolled nucleotides. In some embodiments, the ratio of stereoregulated nucleotides is 15% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 50% to 90%, 50% to 95%, 60% to 100%, 60% to 90%, 60% to 95%, 70% to 100%, 70% to 90%, 70% to 95%, 80% to 100%, 80% to 90%, 80% to 95%, 90% to 100%, 90% to 95%, 90% to 96%, 90% to 97%, 90% to 98%, 90% to 99%, 95 ...5% to 98%, 95 In some embodiments, the nucleotide sequence may be in the range of 10% to 100%, such as 5% to 99%, 95% to 100%, 50% to 90%, or 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0053] The term "sterically pure" as applied to nucleotides is used herein to describe when at least 90% of the nucleotides in an oligonucleotide are stereoregulated. In some embodiments, the percentage of stereoregulated nucleotides in a stereoregulated ASO is in the range of 90-100%, 95-100%, 90%-95%, 90%-96%, 90%-97%, 90%-98%, 90%-99%, 95%-98%, 95%-99%, or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the nucleotides. In some embodiments, all or a portion of the nucleotides in an oligonucleotide are stereocontrolled so that they are equally stereochemically pure, i.e., all or a portion of the nucleotides are stereocontrolled and are designed or selected to have the same stereochemistry. In some embodiments, all or a portion of the nucleotides in an oligonucleotide are stereocontrolled so that they are not equally stereochemically pure, i.e., all or a portion of the nucleotides are stereocontrolled but are designed or selected to have different stereochemistry. When applied to the internucleotide linkage portion of an oligonucleotide, the term "sterically pure" is used to describe when at least 90% of the internucleotide linkages are stereocontrolled. In some embodiments, the percentage of stereocontrolled internucleotide linkages in the stereochemically pure ASO is in the range of 90-100%, 95-100%, 90%-95%, 90%-96%, 90%-97%, 90%-98%, 90%-99%, 95%-98%, 95%-99%, or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% internucleotide linkages.In some embodiments, all or a portion of the internucleotide linkages in the oligonucleotide are stereocontrolled so that they are equally sterically pure, i.e., all or a portion of the internucleotide linkages are stereocontrolled and are designed or selected to have the same stereochemistry. In some embodiments, all or a portion of the internucleotide linkages in the oligonucleotide are stereocontrolled so that they are equally non-sterically pure, i.e., all or a portion of the internucleotide linkages are stereocontrolled but are designed or selected to have different stereochemistry. In some embodiments, the internucleotide linkages are phosphorodiamidate linkages. In some embodiments, the internucleotide linkages are phosphorothioate linkages.

[0054] The stereochemistry of the (Rp, Sp) and phosphate (PO) internucleotide bonds is depicted as follows: [ka] The stereochemistry of the Rp, Sp, and PO internucleotide linkages is also designated as follows: S=Sp, R=Rp, O=phosphate.

[0055] For example, the stereochemistry of the internucleotide bond of MOE-298 can be depicted using either of the following notations: [ka] or (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereopattern: SOSSSRSSSRSSSOSSS.

[0056] When applied to nucleotides, the term "sterically random" is used herein to describe when the nucleotides in an oligonucleotide are not sterically controlled. When applied to internucleotide linkages, the term "sterically random" is used herein to describe when the internucleotide linkages in an oligonucleotide are not sterically controlled. In some embodiments, the internucleotide linkages are phosphorodiamidate linkages. In some embodiments, the internucleotide linkages are phosphorothioate linkages.

[0057] The term "complementary" is used herein to describe when corresponding portions of at least two nucleotide sequences are occupied by nucleotides that are capable of hydrogen bonding with one another.

[0058] The term "hybridize" is used herein to describe two complementary nucleotide sequences that bind to form a double-stranded molecule.When a sufficient number of corresponding nucleotides in two sequences can hydrogen bond with each other, that is, when they are sufficiently complementary, they can form a stable hybrid.It is understood in the art that 100% complementarity is not necessarily required for ASO to hybridize with target sequence.

[0059] The term "sufficient complementarity" is used herein to refer to a level of complementarity sufficient for the ASO to bind to its target sequence and form a stable hybrid. In some embodiments, the complementarity of the ASO and the target sequence is at least 99%, or 98%, or 97%, or 96%, or 95%, or 94%, or 93%, or 92%, or 91%, or 90%, or 89%, or 88%, or 87%, or 86%, or 85%, or 84%, or 83%, or 82%, or 81%, or 80%, or 79%, or 78%, or 77%, or 76%, or 75%, or 74%, or 73%, or 72%, or 71%, or 70%.

[0060] The term "sequence similarity" is used herein to describe the similarity of two ASOs. Sequence similarity is expressed as the percentage of nucleotides shared between two ASOs. It is understood that identical sequences have 100% sequence similarity.

[0061] The terms "target region" and "target sequence" are used interchangeably herein to designate a nucleotide sequence to which an ASO will hybridize under physiological conditions. It is not necessary for the ASO and the target region to be 100% complementary, so long as there is sufficient complementarity for the ASO to hybridize to the target sequence and form a stable hybrid. The ASO may hybridize to all or a portion of the target sequence.

[0062] The terms "treat", "treating", or "treatment" are used herein to refer to ameliorating a disease or disorder (i.e., slowing or arresting or reducing the onset of a disease or at least one of its clinical symptoms). These terms also refer to alleviating or improving at least one physical parameter, including those that may not be discernible to the patient. These terms also refer to either physically modulating a disease or disorder (e.g., through stabilization of discernible symptoms), physiologically modulating a disease or disorder (e.g., through stabilization of a physical parameter), or both.

[0063] The terms "prevent," "preventing," or "prevention" are used herein to refer to inhibiting or delaying the onset of a disease or disorder.

[0064] The term "therapeutically effective amount" is used herein to refer to an amount of a therapeutic agent or composition effective to prevent or treat a disorder or disease, in some embodiments, this includes an amount of a therapeutic agent or composition effective to prevent or treat a neurodegenerative disease.

[0065] The term "pharmaceutically acceptable" is used herein to refer to a molecular entity or composition that is pharma- ceutical useful and that is not biologically or otherwise undesirable.

[0066] The term "carrier" is used herein to refer to a diluent, adjuvant, excipient, or vehicle with which the compound is administered.

[0067] The term "excipient" as used herein refers to any ingredient, other than an active ingredient, that is in a pharmaceutical composition.

[0068] As used herein, the "skipping efficiency" of an oligonucleotide is calculated using the following formula:

number

[0069] A standard exon skipping efficiency assay for PMO ASOs involves using U-188MG cells cultured and maintained using the appropriate medium (Dulbecco's modified Eagle's medium containing 10% fetal bovine serum) as suggested in the vendor's protocol. The assay is performed in a 96-well plate format, seeding approximately 20,000 cells per well and treating with PMO ASOs at a concentration of 0.5 μM using the Endo-Porter protocol. After the cells are incubated at 37° C. in a cell culture incubator for 48 hours, total RNA is isolated. Total RNA is isolated and converted to cDNA according to the vendor's protocol, and exon-2 skipped CD33 (forward primer: CGCTGCTGCTACTGCTG (SEQ ID NO: 207); reverse primer: TTCTAGAGTGCCAGGGATGA (SEQ ID NO: 208); and probe: TGTGGGCAGACTTGACCCACAG (SEQ ID NO: 209)) and non-skipped CD33 (forward primer: GGATGGAGAGAGGAAGTA (SEQ ID NO: 210); reverse primer: GTGCCAGGGATGAGGATTT (SEQ ID NO: 211); and probe: TGCATGTGACAGACTTGACCCACA (SEQ ID NO: 212)) mRNA transcripts are quantified using Taqman gene expression assays. Target transcript expression is normalized using the expression of human housekeeping genes such as HPRT1 (Assay ID: Hs02800695_m1; ThermoFisher Scientific) or GAPDH1 (Hs99999905_m1; ThermoFisher Scientific).

[0070] The standard exon skipping efficiency assay for MOE ASO involves using U-188MG cells cultured and maintained using the appropriate medium (Dulbecco's modified Eagle's medium containing 10% fetal bovine serum) as suggested in the vendor's protocol. The assay is performed in a 96-well plate format, seeding approximately 20,000 cells per well and treating with MOE ASO at a concentration of 10 nM using the Lipofectamine protocol. After the cells are incubated at 37° C. in a cell culture incubator for 48 hours, total RNA is isolated. Total RNA is isolated and converted to cDNA according to the vendor's protocol, and exon-2 skipped CD33 (forward primer: CGCTGCTGCTACTGCTG (SEQ ID NO: 207); reverse primer: TTCTAGAGTGCCAGGGATGA (SEQ ID NO: 208); and probe: TGTGGGCAGACTTGACCCACAG (SEQ ID NO: 209)) and non-skipped CD33 (forward primer: GGATGGAGAGAGGAAGTA (SEQ ID NO: 210); reverse primer: GTGCCAGGGATGAGGATTT (SEQ ID NO: 211); and probe: TGCATGTGACAGACTTGACCCACA (SEQ ID NO: 212)) mRNA transcripts are quantified using Taqman gene expression assays. Target transcript expression is normalized using the expression of human housekeeping genes such as HPRT1 (Assay ID: Hs02800695_m1; ThermoFisher Scientific) or GAPDH1 (Hs99999905_m1; ThermoFisher Scientific).

[0071] For ASOs that are neither PMO nor MOE, the standard exon skipping efficiency assay for non-PMO and non-MOE involves using U-188MG cells cultured and maintained using the appropriate medium (Dulbecco's modified Eagle's medium containing 10% fetal bovine serum) as suggested in the vendor's protocol. The assay is performed in a 96-well plate format, seeding approximately 20,000 cells per well and treating with ASO at a concentration of 10 nM using the Lipofectamine protocol. After the cells are incubated at 37° C. in a cell culture incubator for 48 hours, total RNA is isolated. Total RNA is isolated and converted to cDNA according to the vendor's protocol, and exon-2 skipped CD33 (forward primer: CGCTGCTGCTACTGCTG (SEQ ID NO: 207); reverse primer: TTCTAGAGTGCCAGGGATGA (SEQ ID NO: 208); and probe: TGTGGGCAGACTTGACCCACAG (SEQ ID NO: 209)) and non-skipped CD33 (forward primer: GGATGGAGAGAGGAAGTA (SEQ ID NO: 210); reverse primer: GTGCCAGGGATGAGGATTT (SEQ ID NO: 211); and probe: TGCATGTGACAGACTTGACCCACA (SEQ ID NO: 212)) mRNA transcripts are quantified using Taqman gene expression assays. Target transcript expression is normalized using the expression of human housekeeping genes such as HPRT1 (Assay ID: Hs02800695_m1; ThermoFisher Scientific) or GAPDH1 (Hs99999905_m1; ThermoFisher Scientific).

[0072] For standard exon skipping efficiency assays, a free uptake method (without transfection reagent) may be used instead of the Lipofectamine protocol.

[0073] In some embodiments, the antisense oligonucleotide has a CD33 exon-2 skipping efficiency of 25%-99%, such as 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, the antisense oligonucleotide has a CD33 exon-2 skipping efficiency of 50%-99%. In some embodiments, the antisense oligonucleotide has a CD33 exon-2 skipping efficiency of at least 30%.

[0074] Unless otherwise defined, all other scientific and technical terms have the same meaning as commonly understood by those skilled in the art. Such scientific and technical terms are explained in the literature, for example, in J. Sambrook, EF Fritsch, and T Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press (1989); Martin, Remington's Pharmaceutical Sciences, 18th Edition, Mack Publishing Co (1990); Glover, DNA Cloning: A Practical Approach, Volumes I and II, MRL Press, Ltd. (1985); and Ausubel, F et al., Current Protocols in Molecular Biology, Greene Publishing Associates / Wiley Intersciences (2002).

[0075] Disclosed herein are novel ASOs. In some embodiments, the ASOs are directed to a target sequence in the CD33 pre-mRNA. In some embodiments, the ASO is a sequence similar to SEQ ID NO:1 (5'-GGGCAGGTGA GTGGCTGTGG GGAGAGGGGT TGTCGGGCTG GGCCGAGCTG ACCCTCGTTT CCCCACAGGG GCCCTGGCTA TGGATCCAAA TTTCTGGCTG CAAGTGCAGG AGTCAGTGAC GGTACAGGAG GGTTTGTGCG TCCTCGTGCC CTGCACTTTC TTCCATCCCA TACCCTACTA CGACAAGAAC TCCCCAGTTC ATGGTTACTG GTTCCGGGAA GGAGCCATTA TATCCAGGGA CTCTCCAGTG GCCACAAACA AGCTAGATCA AGAAGTACAG GAGGAGACTC AGGGCAGATT CCGCCTCCTT GGGGATCCCA GTAGGAACAA CTGCTCCCTG AGCATCGTAG ACGCCAGGAG GAGGGATAAT GGTTCATACT TCTTTCGGAT GGAGAGAGGA AGTACCAAAT The CD33 pre-mRNA is directed to all or part of a 16-30 nucleotide target sequence in the CD33 pre-mRNA represented by the sequence ACAGTTACAA ATCTCCCCAG CTCTCTGTGC ATGTGACAGG TGAGGCACAG GCTTCAGAAG TGGCCGCAAG GGAAGTTCAT GGGTACTGCA GGGCAGGGCT GGGATGGGAC CCTGGTACTG-3'). SEQ ID NO: 1 includes exon-2 and a portion of the border intron of the CD33 gene. This 16-30 nucleotide target sequence is involved in exon-2 skipping, which also occurs when the CD33 mRNA contains the rs3865444-A SNP. When this exon-2 skipping occurs, the pre-mRNA carrying this SNP is spliced ​​in such a way that exon-2 is not included in the final transcript.

[0076] In some embodiments, the ASO is 16-30 nucleotides in length. In some embodiments, the nucleotide is 20-30 nucleotides in length. In some embodiments, the ASO is 25-30 nucleotides in length. In some embodiments, the ASO is 21-30 nucleotides in length. In some embodiments, the ASO is 21-25 nucleotides in length. In some embodiments, the ASO is 18-21 nucleotides in length. In some embodiments, the ASO is 18-25 nucleotides in length. In some embodiments, the ASO is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

[0077] In some embodiments, the antisense oligonucleotide comprises 16 to 30 nucleotides, such as 18 to 30 nucleotides. In some embodiments, the antisense oligonucleotide consists of 16 to 30 nucleotides, such as 18 to 30 nucleotides.

[0078] Also disclosed herein are novel ASOs that are complementary to all or a portion of a 10-16 nucleotide target sequence in CD33 pre-mRNA that includes exon-2 and a portion of the border intron of the CD33 gene, as set forth in SEQ ID NO: 1. In some embodiments, the ASO is 10-14 nucleotides in length. In some embodiments, the ASO is 10, 11, 12, 13, 14, 15, or 16 nucleotides in length.

[0079] In some embodiments, the ASO is directed to a 16-30 nt target sequence, is sufficiently complementary to the target sequence to form a stable hybrid, and is 16-30 nucleotides in length, hi some embodiments, such an ASO is sufficiently complementary to all or a portion of a 25 nt target sequence.

[0080] In some embodiments, the ASO has one of the specific sequences disclosed in Table 3 or Table 4. In some embodiments, the ASO may share sequence similarity with one of the ASOs disclosed in Table 3 or Table 4. In some embodiments, the ASO shares at least 99%, or 98%, or 97%, or 96%, or 95%, or 94%, or 93%, or 92%, or 91%, or 90%, or 89%, or 88%, or 87%, or 86%, or 85%, or 84%, or 83%, or 82%, or 81%, or 80%, or 79%, or 78%, or 77%, or 76%, or 75%, or 74%, or 73%, or 72%, or 71%, or 70% sequence similarity with one of the ASOs disclosed in Table 3 or Table 4.

[0081] In some embodiments, at least some of the nucleobases of the ASO will have thymine instead of uracil, or uracil instead of thymine, in some embodiments, at least some of the nucleosides of the ASO will have a ribose replacing a deoxyribose, or a ribose replacing a deoxyribose.

[0082] In some embodiments, the ASO comprises at least one chemically modified nucleotide. In some embodiments, the at least one chemical modification of the nucleotide is selected from at least one chemical modification of the nucleic acid base, at least one chemical modification of the sugar moiety, at least one chemical modification of the phosphate, and any combination of these modifications. In some embodiments, the at least one chemical modification improves the ability of the nucleotide to resist nuclease degradation.

[0083] Non-limiting examples of chemical modifications useful in the present disclosure include chemical modifications of the phosphate backbone of the ASO and one or more chemically modified (i.e., non-natural) internucleoside linkages. In some embodiments, the ASO is selected from ASOs having a chemically modified phosphate backbone. In some embodiments, the ASO is selected from ASOs that do not have a phosphorus atom in the backbone. In some embodiments, the ASO has a phosphorodiamidate or phosphorothioate modified backbone. In some embodiments, the modified backbone is stereocontrolled.

[0084] Further non-limiting examples of chemical modifications useful in the present disclosure include chemical modification of at least one sugar moiety in an ASO. In some embodiments, the ASO comprises at least one chemically modified sugar moiety. In some embodiments, the chemically modified sugar moiety is selected from a sugar moiety that is substituted at least at one moiety on the sugar moiety in the ASO. In some embodiments, the ASO is selected from an ASO that is substituted at at least one position on the sugar selected from the 2', 3', and 5' positions. In some embodiments, at least one substituent on the sugar moiety of the ASO is selected from hydroxyl; fluoro; and substituted or unsubstituted, linear or branched C1-C 10 Alkyl groups, substituted or unsubstituted, linear or branched, C2-C 10 Alkenyl groups, substituted or unsubstituted, linear or branched, C2-C 10 Alkynyl groups, substituted or unsubstituted, linear or branched, C7-C 17 Alkaryl groups, substituted or unsubstituted, linear or branched, C3-C 10 Allyl groups, and substituted or unsubstituted, linear or branched C7-C 17aralkyl groups, each of which may optionally further comprise at least one heteroatom. In some embodiments, the sugar moiety comprises at least one substituent selected from methoxy, aminopropoxy, methoxyethoxy, dimethylaminoethoxy, and dimethylaminoethoxyethoxy. In some embodiments, the sugar moiety is selected from pyranose, derivatives of pyranose, deoxypyranose, derivatives of deoxypyranose, ribose, derivatives of ribose, deoxyribose, and derivatives of deoxyribose. In some embodiments, the substituted sugar moiety is selected from methoxyethyl substituted sugar moieties, including 2'-O-methoxyethyl. In some embodiments, the sugar moiety is stereocontrolled.

[0085] In some embodiments, the sugar moiety is modified in a manner to create a bicyclic sugar moiety. In some embodiments, the bicyclic sugar moiety is formed with a bridging modification between the 4' and 2' furanose ring atoms. In some embodiments, the bridging modification comprises at least one group that forms a bridge between the 4' and 2' furanose ring atoms. In some embodiments, at least one nucleotide in a given ASO has a bridging modification.

[0086] In some embodiments, the sugar moiety comprises fewer than five ring atoms, such as four ring atoms. In some embodiments, the sugar moiety comprises more than five ring atoms, such as six ring atoms. In some embodiments, the sugar moiety is modified to include a morpholino. A morpholino-based ASO refers to an ASO that comprises a morpholino subunit that supports a nucleobase and has a morpholinyl ring instead of a ribose. Non-limiting examples of internucleotide linkages of such morpholino-based ASOs include, for example, phosphoramidate or phosphorodiamidate internucleotide linkages that link the morpholinyl ring nitrogen of one morpholino subunit to the 4' exocyclic carbon of an adjacent morpholino subunit. Each morpholino subunit comprises a purine or pyrimidine nucleobase that can be bound to a nucleobase in an oligonucleotide by base-specific hydrogen bonding. In some embodiments, the morpholino-based ASO can include at least one further modification.

[0087] In some embodiments, both the sugar moiety and the internucleoside linkage between the nucleobase and the sugar moiety of at least one nucleotide unit in the ASO are replaced with non-natural groups. In some embodiments, the nucleobase unit is maintained for hybridization with an appropriate nucleic acid target compound. In some embodiments, the ASO is selected from peptide nucleic acids (PNAs). In some embodiments, the sugar backbone of at least one oligonucleotide in the PNA is replaced with an amide-containing backbone, for example, an aminoethylglycine backbone. In some embodiments, the nucleobase is retained and is directly or indirectly bound to the aza nitrogen atom of the amide portion of the backbone.

[0088] In some embodiments, the ASO may further comprise at least one nucleobase (often referred to as a "base") modification or substitution, such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. Certain nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the present disclosure. For example, 5-methylcytosine substitutions have been shown to increase the stability of nucleic acid duplexes by 0.6-1.2°C. In some embodiments, the modified nucleobases are stereocontrolled.

[0089] It is not necessary that all positions in a given ASO be uniformly modified, and in fact more than one of the foregoing modifications may be incorporated into a single nucleoside within the ASO. The ASO may have at least one region in which the ASO is modified to confer upon it an additional region for increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity for the target nucleic acid.

[0090] Because sugar moieties, nucleobases, and internucleotide bonds can exhibit three-dimensional variation, some nucleotides may share the same molecular formula but have different spatial arrangements, i.e., some nucleotides may be stereoisomers. In some embodiments, the stereochemistry of the nucleotides in a given ASO is not controlled, so that the ASO is sterically random. In some embodiments, the nucleotides in a given ASO are stereocontrolled. In some embodiments, the nucleotides in a given ASO are stereocontrolled so that the ASO is sterically pure. In some embodiments, a given ASO is a combination of stereocontrolled and stereorandom nucleotides.

[0091] In some ASOs, it is possible for some modifications to sugar moieties, nucleobases, internucleotide linkages and / or stereoregulated nucleotides to be arranged in regions that create a particular motif in the ASO. In some embodiments, the ASO comprises at least two regions. In some embodiments, the ASO comprises three regions: one region near the 5' end of the ASO, one region near the 3' end of the ASO, and a gap region between these two other regions. This type of arrangement is known as a gapmer motif. The length of each motif may be equal to the length of other motifs in the ASO, or the length of each motif may be independent of the length of other motifs in the ASO. In some embodiments, one or more sugar moieties in the ASO are modified such that a block of sugar moieties in one region of the ASO is different from a block of sugar moieties in a different region of the ASO. In some embodiments, the ASO comprises modified sugar moieties arranged in a gapmer motif. In some embodiments, one or more nucleobases in the ASO are modified such that a block of nucleobases in one region of the ASO is different from a block of nucleobases in a different region of the ASO. In some embodiments, the ASO comprises modified nucleobases arranged in a gapmer motif. In some embodiments, one or more internucleotide linkages in the ASO are modified such that a block of internucleotide linkages in one region of the ASO is different from a block of internucleotide linkages in a different region of the ASO. In some embodiments, a given ASO comprises modified internucleotide linkages arranged in a gapmer motif. In some embodiments, one or more stereoregulated nucleotides in the ASO are modified such that a block of stereoregulated nucleotides in one region of the ASO is different from a block of stereoregulated nucleotides in a different region of the ASO. In some embodiments, the ASO comprises stereoregulated nucleotides arranged in a gapmer motif. In some embodiments, the ASO has two or more motifs. In some embodiments, the ASO has two or more motifs that are independent of each other.

[0092] Production of antisense oligonucleotides The antisense molecules used in this disclosure may be made by well-known solid phase synthesis techniques. Equipment for such synthesis is available from several sources, including, for example, Applied Biosystems (Foster City, Calif.). One method for synthesizing oligonucleotides on modified solid supports is described in U.S. Patent No. 4,458,066.

[0093] Additionally or alternatively, any other method for such synthesis known in the art may be utilized.It is well known to use similar techniques for preparing oligonucleotides, such as phosphorothioates and alkylated derivatives.In one such automated embodiment, diethyl phosphoramidite is used as starting material and can be synthesized as described by Beaucage, et al., Tetrahedron Letters, 22:1859-1862 (1981).

[0094] In some embodiments, the ASO is synthesized in a manner such that all nucleotides of the ASO are stereochemically pure.

[0095] In some embodiments, ASO is synthesized in vitro and does not include antisense compositions of biological origin.In some embodiments, ASO can also be mixed, encapsulated, conjugated, or otherwise linked with other molecules, molecular structures, or mixtures of compounds, such as liposomes, lipids, receptor targeting molecules, to aid in uptake, distribution, and / or absorption.More information on the synthesis of certain ASOs according to some embodiments is included in the following examples.

[0096] A method to induce exon-2 skipping during pre-mRNA splicing In some embodiments, an ASO is used to induce exon-2 skipping during processing of CD33 pre-mRNA. In some embodiments, at least one ASO disclosed herein is used to induce exon-2 skipping in CD33 pre-mRNA during pre-mRNA splicing. In some embodiments, at least one ASO is introduced into a cell, wherein the at least one ASO comprises all or a portion of SEQ ID NO: 1, wherein the ASO hybridizes to a target region of the CD33 gene, and wherein the ASO induces exon-2 skipping during pre-mRNA splicing of the CD33 gene. In some embodiments, the ASO administered to induce exon-2 skipping during pre-mRNA splicing comprises one of SEQ ID NOs: 2-15, 36-39, 82, 83, 96, 97, 128, 132, 135, 136, 183, 184, 190, 196, or 197.

[0097] In some embodiments, at least one ASO is administered as it is, so-called "naked" ASO. In some embodiments, at least one naked ASO is synthesized in vitro. In some embodiments, at least one naked ASO is directly hybridized to the target region of CD33 gene when introduced into cells, and induces exon-2 skipping during pre-mRNA splicing.

[0098] Certain methods of introducing "naked" ASO or expression vectors encoding ASO into cells are well known in the art. In some embodiments, ASO or expression vectors encoding ASO can be introduced by transfection using known transfection agents. In some embodiments, the use of excipients or transfection agents aids in the delivery of ASO or expression vectors encoding ASO as defined herein to and / or within cells. In some embodiments, the excipients or transfection agents have the ability to form complexes, nanoparticles, micelles, vesicles, and / or liposomes that deliver the respective ASO or expression vectors encoding ASO as defined herein complexed or entrapped in the vesicles or liposomes through the cell membrane. Many of these excipients are known in the art. Suitable excipients or transfection agents include LipofectAMINE™ 2000 (Invitrogen), endoporter peptides, polyethyleneimine (PEI; ExGen500 (MBI Fermentas)) or derivatives thereof, or similar cationic polymers including polypropyleneimine or polyethyleneimine copolymers (PEC) and derivatives, synthetic amphiphiles (SAINT-18), Lipofectin™, DOTAP and / or viral capsid proteins capable of self-assembling into particles capable of delivering respective ASOs as defined herein to cells. Such excipients have been shown to efficiently deliver oligonucleotides, such as ASOs, to a wide variety of cultured cells. Their high potential transfection capacity is combined with low to moderate expected toxicity in terms of total cell survival. The ease of structural modification may allow for further modification and analysis of their (in vivo) nucleic acid transfer properties and toxicity.

[0099] In some embodiments, the ASO is administered in the form of an expression vector, where the expression vector encodes an RNA transcript comprising the sequence of the ASO. When the expression vector is placed under conditions that induce expression of the encoded ASO, it can express the encoded ASO, which can hybridize to a target region of the CD33 gene and induce exon-2 skipping during pre-mRNA splicing. The expression vector can be a viral or non-viral vector. In some embodiments, a plasmid-based expression vector is provided that includes an expression cassette or transcription cassette that drives the expression or transcription of the ASO to redirect splicing.

[0100] In some embodiments, cells can be provided with splicing redirecting ASOs by plasmid-derived ASO expression or viral expression provided by cytolomegalovirus-based, adenovirus-based, or adeno-associated virus-based vectors. In some embodiments, expression can be driven by an RNA polymerase II promoter (Pol II), such as the U7 RNA promoter, or an RNA polymerase III (Pol III) promoter, such as the U6 RNA promoter. In some embodiments, the delivery vehicle is an expression vector. In some embodiments, plasmids and artificial chromosomes can be used for targeted homologous recombination for delivery of splicing redirecting ASOs, and can be applied for integration into the human genome of cells.

[0101] Treatment method Disclosed herein are methods of treating a subject having a neurodegenerative disease, comprising administering at least one ASO disclosed herein. In some embodiments, the method comprises administering a therapeutically effective amount of at least one ASO disclosed herein. In some embodiments, the method comprises administering a therapeutically effective amount of at least one ASO that hybridizes to all or a portion of SEQ ID NO: 1. In some embodiments, the method comprises administering a therapeutically effective amount of at least one ASO that comprises one of SEQ ID NOs: 2-10. In some embodiments, the neurodegenerative disease is characterized by a mutation in the CD33 gene. In some embodiments, the neurodegenerative disease is characterized by an abnormality in the microglial phenotype. In some embodiments, the neurodegenerative disease is Alzheimer's disease, fibromyalgia, or multiple sclerosis.

[0102] In some embodiments, the ASO administered to a subject with a neurodegenerative disease may be administered in a pharmaceutical composition. In some embodiments, the amount of ASO administered in a pharmaceutical composition may depend on the subject under treatment, the subject's weight, the method of administration, and the judgment of the prescribing physician. For example, in some embodiments, the dosing schedule may involve once-daily or twice-daily administration of the pharmaceutical composition at a recognized dosage of about 1 μg to about 1000 mg. In some embodiments, intermittent administration, such as on a monthly or yearly basis, of a dose of the pharmaceutical composition may be utilized. By following standard titration regimens, in some embodiments, a physician will be able to easily determine the optimal dosage and easily modify the administration to achieve such dosage.

[0103] The therapeutically effective amount of the compound or composition disclosed herein can be measured by the therapeutic efficacy of the compound. In some embodiments, however, dosage may vary depending on the patient's requirements, the severity of the condition being treated, and the compound used. In some embodiments, the therapeutically effective amount of the disclosed compound is sufficient to establish a maximum plasma concentration. In some embodiments, preliminary doses, for example as determined by animal testing, and scaling of dosages to human administration are performed according to art-accepted practices.

[0104] In some embodiments, toxicity and therapeutic efficacy can be evaluated, for example, by LD 50 (the dose that is lethal to 50% of the population) and ED 50 The dose that is therapeutically effective in 50% of the population can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio between toxic and therapeutic effects is the therapeutic index, which is defined as the ratio LD 50 / ED 50 In some embodiments, compositions that exhibit large therapeutic indices are desirable.

[0105] In some embodiments, the data obtained from cell culture assays or animal studies can be used in formulating a range of dosages for use in humans. In some embodiments, a therapeutically effective dosage achieved in one animal model can be converted for use in other animals, including humans, using conversion factors known in the art (see, e.g., Freireich et al., Cancer Chemother. Reports 50(4):219 244 (1966)).

[0106] ASO herein may be administered in a pharmaceutical composition comprising a therapeutically effective amount of ASO in combination with pharma- ceutically acceptable excipients, diluents, preservatives, solubilizers, emulsifiers, adjuvants and / or carriers. In some embodiments, such compositions include diluents of various buffer contents (e.g., Tris-HCl, acetate, phosphate), pH, and ionic strength, as well as additives such as surfactants and solubilizers (e.g., Tween 80, polysorbate 80), antioxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol), and bulking agents (e.g., lactose, mannitol). In some embodiments, the material may be incorporated into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc., or incorporated into liposomes. In some embodiments, hyaluronic acid may also be used. Such compositions may influence the physical state, stability, rate of in vivo release, and / or rate of in vivo clearance of the ASOs and derivatives. In some embodiments, the compositions may be prepared in liquid form or may be in a dry powder form, such as lyophilized form.

[0107] Administration In some embodiments, pharmaceutical compositions comprising the ASO and a pharma- ceutically acceptable carrier or excipient can be prepared for administration by techniques well known in the pharmaceutical industry, which in some embodiments include combining the ASO with one or more carriers and / or excipients into a unit dosage form.

[0108] In some embodiments, compositions suitable for oral administration may be provided in discrete units, such as capsules, cachets, lozenges, or tablets, each containing a predetermined amount of the disclosed compound as a powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; or as an oil-in-water or water-in-oil emulsion. In some embodiments, such formulations may be prepared by any suitable method, including the step of bringing into association at least one embodiment of the present disclosure as an active compound with at least one carrier or excipient, which may constitute one or more accessory ingredients. In some embodiments, the at least one carrier is acceptable in the sense of being compatible with the other ingredients of the formulation and not harmful to the recipient. In some embodiments, the carrier may be solid or liquid, or both, and may be formulated into a unit dose formulation, e.g., a tablet, which may contain about 0.05% to about 95% by weight of at least one active compound, together with at least one compound described herein as an active compound. In some embodiments, other pharmacologically active substances may also be present, including other compounds. In some embodiments, the formulations of the present disclosure may be prepared by any of the well-known techniques of pharmacy which consist essentially of mixing the ingredients.

[0109] For solid compositions, in some embodiments, conventional non-toxic solid carriers include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate, and the like. In some embodiments, liquid pharmacologically administrable compositions may be prepared, for example, by dissolving or dispersing at least one active compound of the present disclosure as described herein and optional pharmaceutical auxiliary in an excipient, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like, thereby forming a solution or suspension. In general, in some embodiments, suitable formulations may be prepared by uniformly and intimately mixing at least one active compound of the present disclosure with a liquid or finely divided solid carrier, or both, and then, if necessary, shaping the product. For example, in some embodiments, a tablet may be prepared by compressing or shaping a powder or granules of at least one embodiment of the present disclosure, which may be optionally combined with one or more accessory ingredients. In some embodiments, compressed tablets may be prepared by compressing in a suitable machine at least one embodiment of the present disclosure in a free-flowing form, such as a powder or granules, optionally mixed with one or more binders, lubricants, inert diluents and / or surfactants / dispersants. In some embodiments, molded tablets may be made by molding in a suitable machine, in which at least one embodiment of the present disclosure in powdered form is moistened with an inert liquid diluent.

[0110] In some embodiments, formulations suitable for buccal (sublingual) administration include lozenges comprising at least one embodiment of the present disclosure in a flavored base, such as sucrose and acacia or tragacanth, and pastilles comprising at least one compound in an inert base, such as gelatin and glycerin or sucrose and acacia.

[0111] In some embodiments, formulations suitable for parenteral administration include a sterile aqueous preparation of at least one embodiment of the present disclosure, which is approximately isotonic with the blood of the intended recipient. In some embodiments, such preparations are administered intravenously, but administration can also be effected by subcutaneous, intramuscular, intraperitoneal, intracerebroventricular, or intradermal injection. In some embodiments, these preparations are administered by osmotic pump. In some embodiments, such preparations can be conveniently prepared by mixing at least one embodiment described herein with water and making the resulting solution sterile and isotonic with blood. In some embodiments, the injectable composition according to the present disclosure can contain about 0.1 to about 5% w / w of the active compound.

[0112] In some embodiments, formulations suitable for rectal administration are provided in unit dose suppositories, which in some embodiments can be prepared by mixing at least one embodiment as described herein with one or more conventional solid carriers, such as cocoa butter, and then shaping the resulting mixture.

[0113] In some embodiments, formulations suitable for topical application to the skin may take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil. In some embodiments, carriers and excipients that may be used include petrolatum, lanolin, polyethylene glycols, alcohols, and combinations of two or more thereof. In some embodiments, the ASO is generally provided at a concentration of about 0.1% to about 15%, e.g., about 0.5 to about 2%, w / w of the composition. EXAMPLES

[0114] The following examples are provided to further illustrate the present invention. The examples are intended for illustrative purposes and are not intended to limit the invention in any manner.

[0115] Abbreviation ASO: Antisense oligonucleotide DNA: Deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid RNA: Ribonucleic acid mRNA: messenger ribonucleic acid PMO: phosphorodiamidate morpholino oligomer MOE: Methoxyethyl LOAD: Late-onset Alzheimer's disease SNP: Single Nucleotide Polymorphism PNA: peptide nucleic acid DOTAP: 1,2 dioleoyl 3 trimethylammoniopropane PEI: Polyethyleneimine PEC: Polyethyleneimine copolymer HRMS: High resolution mass spectrometry MW: molecular weight SP: sterically pure UPLC: Ultra-performance liquid chromatography MS: Mass spectrometry MTBE: Methyl tert-butyl ether DCM: dichloromethane TFA: Trifluoroacetic acid RT: room temperature H: Time Min: Minutes EtOAc: ethyl acetate HPRT1: Hypoxanthine phosphoribosyltransferase 1 GAPDH1: glyceraldehyde-3-phosphate dehydrogenase 1 NTC: non-targeting control WP: Well plate Bz-Benzoyl CE-2-Cyanoethyl Trt-Trityl iPr-Isopropyl Sar-Sarcosine ESI-TOF-MS - Electrospray ionization-time of flight mass spectrometry

[0116] Example 1: Reduction or interference with full-length CD33 SNP rs3865444 was reported to be associated with increased skipping of exon-2 of CD33 and reduced full-length CD33 levels on the surface of monocytes. This allele was found to be associated with reduced full-length CD33 levels in human cerebrospinal fluid (CSF) and plasma as measured using Somascan technology (Figure 1). A study by the Alzheimer's Disease Neuroimaging Initiative (ADNI) found this allele to be associated with reduced ventricular volume and increased midtemporal volume, both of which are consistent with protection from Alzheimer's disease (Figure 2). Moreover, in longitudinal analyses, this allele was associated with reduced cerebral ventricular volume and increased midtemporal volume, both of which are consistent with protection from Alzheimer's disease (Figure 3). Moreover, in longitudinal analyses, this allele was associated with reduced cerebral ventricular volume and increased midtemporal volume, both of which are consistent with protection from Alzheimer's disease (Figure 4). 18 There was an association with improved trends for F-fluorodeoxyglucose-positron emission tomography (FDG PET), ventricular volumes, fusiform gyrus, and midtemporal volumes ( Fig. 3 ), pointing to protection from the disease.

[0117] On the other hand, rs201074739 is a 4-base pair deletion in exon 3 of the CD33 gene. It causes a frameshift of the open reading frame and a premature translation termination. This indel was associated with a decrease in full-length CD33 levels in human CSF and plasma as measured using SomaScan technology (Figure 4). However, this indel has not been associated with a reduced disease risk so far. Moreover, it was associated with an increase in ventricular volume and a worse Functional Activities Questionnaire (FAQ) score, suggesting a deleterious effect (Figure 2).

[0118] Thus, successful induction of CD33 exon-2 skipping may be associated with therapeutic benefit.

[0119] Example 2: General formula for ASO PMO oligonucleotides for screening were designed. The designed oligonucleotides listed in Tables 1 and 3 below were generated by GeneTools LLC (www.gene-tools.com). Table 1 lists the top PMO oligonucleotides along with their deconvoluted MS data. Table 3 includes the top PMO oligonucleotides in Table 1, as well as other PMO oligonucleotides. All PMO oligonucleotides listed in Tables 1 and 3 below have a sarcosine linker (Sar) attached to a phosphorodiamidate at the 5' end. All PMO oligonucleotides in Tables 1 and 3 below were synthesized with an unmodified cytosine PMO nucleotide. All PMO oligonucleotides listed in Tables 1 and 3 below have sterically random internucleotide linkages and are therefore referred to as sterically random PMO oligonucleotides. The general formula for the PMO oligonucleotides listed in Tables 1 and 3 below is: [ka]

[0120] [Table 1]

[0121] MOE oligonucleotides for screening were designed. The designed oligonucleotides listed in Tables 2 and 4 below were generated by either Integrated DNA Technologies (www.idtdna.com) or GeneDesign (Ajinomoto Bio Pharma, https: / / ajibio-pharma.com / ). Table 2 lists the top MOE sequences along with their deconvoluted MS data. All MOE oligonucleotides listed in Tables 2 and 4 below have a hydroxyl at the 5' end. All MOE oligonucleotides listed in Tables 2 and 4 below have a 2'-O-MOE modified ribonucleotide with a phosphorothioate backbone, except where noted. All MOE oligonucleotides listed in Tables 2 and 4 below were synthesized with 5-methylcytosine 2'-O-MOE ribonucleotide. All MOE oligonucleotides listed in Tables 2 and 4 below have sterically random internucleotide linkages and are therefore referred to as sterically random MOE oligonucleotides. The general formula for the MOE oligonucleotides listed in Tables 2 and 4, depicted in free form, is: [ka]

[0122] [Table 2]

[0123] Example 3: Synthesis of PMO-302 (stereopure internucleotide bond (Sp)) Synthesis of stereochemically pure PMO-302 oligonucleotide (CCTCACCTGTCACATGCACAGAGAG (SEQ ID NO:2)) with an unfunctionalized 5'-OH. The monomers used in the synthesis of PMO-302 are as follows (as reported in WO2017024264A2): [ka]

[0124] Synthesis of PMO-302 with a 5'-OH and a stereopure internucleotide linkage: 2mer synthesis: [ka] All liquid components were added via appropriately sized syringes unless otherwise noted. All reactions were carried out under a N2 atmosphere. Filtrations and workups were carried out open to the atmosphere. Filtrations were carried out with sintered glass funnels.

[0125] The flask containing the amine ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)morpholin-2-yl)methyl benzoate (130 mg) was equipped with a stir bar and a rubber septum. The atmosphere was exchanged for nitrogen and sparged. After 5 minutes at room temperature, 1,3-dimethyl-2-imidazolidinone (2.2 mL) was added via syringe followed by 1,2,2,6,6-pentamethylpiperidine (164 μL) and the mixture was allowed to form a solution. Solid ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethylphosphoramidochloridate (219 mg) was added all at once and the flask was sealed with a rubber septum. Stirring was continued for 3 hours and the reaction was monitored by UPLC MS. Upon completion, MTBE (11.7 mL) was added over 1 minute with stirring. A precipitate formed as the addition was completed. n-Heptane (10 mL) was added. The oily mixture was allowed to stand for 10 minutes. The heavy oil was allowed to settle whilst the cloudy supernatant was decanted into a 30 mL vial and centrifuged. This resulted in the formation of an additional oily residue at the bottom. The solvent was removed by decantation and the two oily residues were combined by dissolving in 1 mL DCM and purified by flash chromatography 0-5% MeOH in DCM. Fractions containing the desired product were dried under vacuum to give ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (270 mg) as a white foam. MS(ESI) m / z: [M+H] + C 60 H 58 N9O 10 Calculated P: 1096.40; Found: 1096.53.

[0126] Deprotection of the 2mer: [ka] DCM (3.5 mL) was added to a flask containing ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-tritylmorpholin-2yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (350 mg). Ethanol (186 μL) was added via syringe at room temperature. TFA (160 μL) was added dropwise over 30 seconds at room temperature. Stirred for 30 minutes and monitored by UPLC-MS. Upon completion, MTBE (14 mL) was added via syringe over 1 minute. The suspension was stirred for 10 minutes and then sonicated. Filter through a sintered filter funnel and rinse with 10 mL MTBE (2 x 5 mL). The solid was dried and transferred to a new flask and then dissolved by adding DCM (3.5 mL). 1,2,2,6,6-Pentamethylpiperidine (292 μL) was added via syringe. After 10 min at room temperature, MTBE (15.8 mL) was added over 1 min. A white solid formed. After 10 min the slurry was sonicated, filtered and rinsed with MTBE (e.g. 2 x 10 mL). Drying under airflow for 20 min and under vacuum for 1 h gave ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (243 mg). MS(ESI) m / z: [M+H] + C 41 H 44 N9O 10 Calculated P: 854.29; Found: 854.65.

[0127] 3mer synthesis: [ka] To a flask containing ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (215 mg) was added 1,3-dimethyl-2-imidazolidinone (2 mL) and 1,2,2,6,6-pentamethylpiperidine (138 μL) under nitrogen. After 2 minutes, ((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl-(R)-dimethylphosphoramidochloridate (169 mg) was added and the reaction was stirred at room temperature for 3 hours. Upon completion, ethyl acetate (2.6 mL) was added followed by MTBE (14 mL). The resulting white precipitate was filtered, rinsed with MTBE (2 x 5 mL) and dried under vacuum to give ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(dimethylamino)(((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methoxy)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (350 mg). MS (ESI) m / z: [M+H] + C 72 H 77 N 13 O 15 Calculated value of P2: 1426.51; Observed value: 1427.74.

[0128] Deprotection of the 3mer: [ka] A flask was charged with ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(dimethylamino)(((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methoxy)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (350 mg) and DCM (4.2 mL). Ethanol (143 μL) was added followed by slow addition of TFA (95 μL) at room temperature. The reaction mixture was stirred at room temperature for 2 hours. Upon completion, MTBE (15 mL) was added. The solid was filtered and rinsed with MTBE (10 mL). The solid was dried and then transferred to a flask and dissolved by adding DCM (2.7 mL). 1,2,2,6,6-Pentamethylpiperidine (224 μL) and room temperature were added and the reaction mixture was stirred at room temperature for 10 minutes. MTBE (15 mL) was added and the resulting slurry was stirred for 10 minutes and sonicated. Filtered and rinsed with MTBE (10 mL). The trimer was obtained as the free base (297 mg). MS (ESI) m / z: [M+H] + C 53 H 63 N 13 O 15 Calculated P2: 1184.40; Observed: 1185.

[0129] 4mer synthesis: [ka] To the flask was added ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(dimethylamino)(((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (292 mg) and the flask was purged with nitrogen. 1,3-Dimethyl-2-imidazolidinone (2.9 mL) was added followed by 1,2,2,6,6-pentamethylpiperidine (135 μL). ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethylphosphoramidochloridate (207 mg) was added all at once and the reaction was stirred at room temperature for at least 1 hour while being monitored for completion by HPLC-MS. Ethyl acetate (2.9 mL) was charged followed by MTBE (14 mL). The slurry was stirred for 15 minutes, filtered and washed with 2×5 mL MTBE. The resulting solid was dried under vacuum for 10 minutes, then collected in a new flask and dried under vacuum to give 430 mg of the 4mer. MS (ESI) m / z: [M+H] + C 90 H 99 N 18 O 20 P3 calculated value: 1846.65; observed value: 1847.

[0130] Deprotection of the 4mer: [ka] Into a flask was added ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-trimethylsilyl) C.)ethylmorpholin-2-yl)methoxy)(dimethylamino)phosphoryl)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (430 mg) was added. DCM (4.3 mL) and ethanol (272 .mu.L) were added. After a solution formed, TFA (135 .mu.L) was added. The reaction mixture was stirred for 2.5 hours when it was deemed complete by HPLC analysis. Ethyl acetate (3.0 mL) and MTBE (10.8 mL) were added over 1 minute. A solid precipitate formed during the MTBE addition. Once the MTBE addition was complete, the solid was stirred for 10 minutes and sonicated 3 times. Filtered and rinsed with 2.5 mL MTBE. The solid was then dried and then dissolved in DCM (4.3 mL) and treated with 1,2,2,6,6-pentamethylpiperidine (319 μL). After 5 min, the desired product was precipitated by the addition of ethyl acetate (3.0 mL) and MTBE (10.8 mL) over 1 min.The solid was filtered, rinsed with MTBE, and dried under vacuum overnight to give ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin The compound was obtained as follows: pyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (330 mg). MS (ESI) m / z: [M+H]. + C 71 H 85 N 18 O 20 Calculated P3: 1603.54; Observed: 1605.

[0131] 5mer synthesis: [ka] ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)-6-(5- To a flask containing methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methylbenzoate (330 mg), 1,3-dimethyl-2-imidazolidinone (3.3 mL) and 1,2,2,6,6-pentamethylpiperidine (113 μL) were added. After the residue was completely dissolved, ((2S,6R)-6-(6-benzamido-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl(R)-dimethylphosphoramidochloridate (178 mg) was added at room temperature. The reaction mixture was stirred at room temperature for 5 hours, and then ethyl acetate (6.6 mL) and MTBE (13.2 mL) were added. The white precipitate was filtered and dried. The solid was dissolved in 2 mL of DCM and purified by automated silica gel chromatography on a 25 g cartridge with 0-20% MeOH in DCM. 345 mg of the desired product 5mer was obtained. MS (ESI) m / z: C 109 H 121 N 25 O 24 Calculated value of P4: [(M+2H) / 2] + 1145.4;Actual value: 1145.6.

[0132] Deprotection of the 5mer: [ka] Into a flask was added ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(6-benzamido-9H-purin-9-yl) -4-tritylmorpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (328 mg) was added. DCM (3.1 mL) and then ethanol (167 μL) were added. TFA (66.2 μL) was added at room temperature and stirred for 3 hours at room temperature. Three more drops (approximately 15 μL) of TFA were added. The reaction was monitored by HPLC-MS and after completion (disappearance of starting material peak) ethyl acetate (11.8 mL) was added followed by stirring for 5 minutes. Filtered and rinsed with EtOAc (2 mL) and MTBE (5 mL). Additional solid formed in the mother liquor and was also collected by a second filtration. The combined solids were placed in a reaction flask. DCM (2.3 mL) and 1,2,2,6,6-pentamethylpiperidine (209 μL) were added. Stirred for 15 minutes, then EtOAc (2.6 mL) and MTBE (10.5 mL) were added. The resulting solid was filtered, rinsed with 2×3 mL MTBE, then dried under vacuum and collected to give 280 mg of the deprotected 5-mer. MS (ESI) m / z: C 90 H 107 N 25 O 24 Calculated value of P4: [(M+2H) / 2] + 1023.8;Actual value: 1024.12.

[0133] 6mer synthesis: [ka] ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(6-benzamido-9H-purin-9-yl)morpholin-2-yl)methoxy)( To a flask containing 265 mg of dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate, 1,3-dimethyl-2-imidazolidinone (2.7 mL) was added. 71.0 μL of 1,2,2,6,6-pentamethylpiperidine was added. 108 mg of ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl(R)-dimethylphosphoramidochloridate was added as a solid at room temperature. After 3 h at room temperature and completion as judged by HPLC analysis, EtOAc (5.3 mL) and MTBE (10.6 mL) were added over 2-3 min each. Filtered and rinsed with 2 x 3 mL MTBE. After drying with a stream of air for 2-3 min, the solid turned into a sticky mass. The solid was transferred to the same flask containing 10 mL DCM and concentrated under vacuum.((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl) Methoxy)(dimethylamino)phosphoryl)-6-(6-benzamido-9H-purin-9-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (354 mg) was isolated. MS (ESI) m / z: C. 127 H 143 N 30 O 29 Calculated value of P5: [M+2H / 2] + 1354.97;Actual value: 1354.73.

[0134] Deprotection of the 6mer: [ka] To the flask containing the dried evaporated solid (6mer) from the previous step was added DCM (3.2 mL) and ethanol (155 μL). After the solid was completely dissolved, TFA (71.7 μL) was added. The mixture was stirred for 2 h and HPLC analysis showed that the reaction was not complete. An additional 50 μL TFA was added and stirring was continued for an additional 6 h. EtOAc (2.9 mL) was added followed by MTBE (11 mL). The resulting solid was filtered and rinsed with 4:1 MTBE / EtOAc (12 mL). ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)morpholin-2-yl)methoxy )(dimethylamino)phosphoryl)-6-(6-benzamido-9H-purin-9-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (295 mg) was isolated. MS (ESI) m / z: C 108 H 129 N 30 O 29 Calculated value of P5: [(M+2H) / 2] + 1233.92;Actual value: 1233.68.

[0135] Synthesis of 7mer: [ka] ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)-6-(6-benzamido-9H-purine To a flask containing 1,3-dimethyl-2-imidazolidinone (2.9 mL), followed by 1,2,2,6,6-pentamethylpiperidine (65.6 μL), was added at room temperature. ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate was added as a solid (100 mg) at room temperature. The reaction was stirred at room temperature for 3 hours. After completion by HPLC analysis, EtOAc (5.9 mL) and MTBE (11.8 mL) were added over 2-3 minutes each. The solid was filtered and rinsed with 2×5 mL of MTBE. After drying with a stream of air for 2-3 minutes, the solid was transferred to a flask and dried under vacuum for 1 hour to give the 7mer (430 mg). MS (ESI) m / z: C 145 H 165 N 35 O 34 Calculated value of P6: [(M+2H) / 2] + 1564.85;Actual value: 1564.77.

[0136] Deprotection of the 7mer: [ka] ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1 (2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methoxy)(di To a flask containing 6-(6-benzamido-9H-purin-9-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (374 mg) was added DCM (3.0 mL) and ethanol (140 μL). TFA (138 μL) was added dropwise over 30 seconds at room temperature. After 30 minutes, EtOAc (7.5 mL) was added, and MTBE (7.5 mL) was added. Filtered and rinsed with 2×3 mL of MTBE. The solid was dried on the filter funnel under a stream of air and then transferred to a flask. Dissolved in DCM (3.9 mL) and EtOH (140 μL) and added 1,2,2,6,6-pentamethylpiperidine (109 μL). After 10 min, the solution was treated with EtOAc (7.5 mL) and MTBE (7.5 mL). The resulting solid was filtered and rinsed with 2×3 mL of MTBE.The solid was dried in the funnel and then transferred to a flask and dried under vacuum to give all ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4- ((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-((S)-(((2S,6R)-6-(4-benzamido-2-oxopyrimidin Pyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)-6-(6-benzamido-9H-purin-9-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methoxy)(dimethylamino)phosphoryl)morpholin-2-yl)methyl benzoate (345 mg) was obtained. MS (ESI) m / z: C. 126 H 151 N 35 O 34 Calculated value of P6: [(M+2H) / 2] + 1443.48;Actual value:1444.

[0137] From the 8mer to the 25mer, a general procedure was used for coupling, deprotection and freebasing:

[0138] General coupling procedure A: To a flask containing dried PMO oligonucleotide (free base PMO oligonucleotide) (1 wt, 1 eq.) was added 1,3-dimethyl-2-imidazolidinone (6-10 volumes compared to the free base PMO oligonucleotide) followed by 1,2,2,6,6-pentamethylpiperidine (3-5 eq.). The mixture was stirred and sonicated until all solids were dissolved. Activated monomer (R)-dimethyl phosphoramidochloridate (1.3-2.5 eq.) was added all at once as a solid under N2 atmosphere. The reaction mixture was stirred for a minimum of 3 hours (18-24 hours for stages 15-25mer) and monitored for completion (>99.5% target or starting material mass undetectable by UV) by UPLC MS. Additional (R)-dimethyl phosphoramidochloridate may be added if the target conversion criterion is not reached. Upon completion, the reaction mixture was charged with EtOAc (10-40 vol) and MTBE (10-40 vol when compared to the free base PMO oligonucleotide), resulting in the formation of a white precipitate. This solid was filtered through a sintered funnel, purified with 1:1 EtOAc / MTBE, dried under vacuum and collected to give the "trityl protected PMO oligonucleotide" for the next step. Overall yield 90-100%.

[0139] General Procedure B for Trityl Deprotection and Freebasing:

[0140] A trityl deblocking solution was prepared as follows: a flask was charged with DCM (8 mL), 2,2,2-trifluoroethanol (2 mL), 4-cyanopyridine (100 mg), ethanol (100 μL) and trifluoroacetic acid (105 mg) in that order. The solution was mixed until all components were dissolved and then used directly for deprotection.

[0141] Step 1 - Trityl Deprotection: To the flask containing the "trityl protected PMO oligonucleotide" (1 wt, 1 eq.) was added the trityl deblocking solution (8 volumes relative to the trityl protected PMO oligonucleotide mass). The reaction mixture was stirred for 5-30 min and monitored by UPLC MS. Upon completion (>99.5% of target), EtOAc (10-40 volumes) and MTBE (10-40 volumes) were added, resulting in the formation of a white precipitate. The solid was filtered through a sintered funnel, rinsed with 1:1 EtOAc / MTBE, dried under vacuum and collected to give the "TFA salt PMO oligonucleotide" for the next step.

[0142] Step 2 - Freebasing: To a flask containing the "TFA salt PMO oligonucleotide" (1 wt, 1 eq) was added DCM (7-10 volumes relative to the TFA salt PMO oligonucleotide mass) and EtOH (0.3-0.5 volumes). This solution was treated with 1,2,2,6,6-pentamethylpiperidine (5 eq). The reaction mixture was stirred for 5-10 minutes and then treated with EtOAc (10-40 volumes) and MTBE (10-40 volumes), forming a white precipitate. The solid was rinsed with 1:1 EtOAc / MTBE, dried under vacuum, and collected for the next step.

[0143] Coupling to 8mer: [ka] Using general procedure A: the 7mer (340 mg) was reacted with ((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (86 mg) to give the 8mer (403 mg). MS (ESI) m / z: C 157 H 184 N 39 O 39 Calculated value of P7: [M+2H / 2] + 1730.09;Actual value:1730.

[0144] Deprotection of the 8mer: [ka] Using general procedure B: the trityl protected 8mer (380 mg) was reacted to give the free base 8mer (353 mg). MS (ESI) m / z: C 138 H 170 N 39 O 39 Calculated value of P7: [M+2H / 2] + 1608.53;Actual value:1609.

[0145] Coupling to 9mer: [ka] Using general procedure A: the 8mer (370 mg) was reacted with ((2S,6R)-6-(6-(2-cyanoethoxy)-2-isobutyramido-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (105 mg) to give the 9mer (453 mg).

[0146] Deprotection of the 9mer: [ka] Using general procedure B: the trityl protected 9mer (453 mg) was reacted to give the free base 9mer (411 mg).

[0147] Coupling to 10mer: [ka] Using general procedure A: the 9mer (405 mg) was reacted with ((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (80 mg) to give the 10mer (469 mg). MS (ESI) m / z: C 188 H 230 N 51 O 49 Calculated value of P9: [M+3H / 3] + 1422.8;Actual value: 1423.3.

[0148] Deprotection of the 10mer: [ka] Using general procedure B: The trityl protected 10mer (450 mg) was reacted to give the free base 10mer (435 mg).

[0149] Coupling to 11mer: [ka] Using general procedure A: the 10mer (435 mg) was reacted with ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (98 mg) to give the 11mer (512 mg).

[0150] Deprotection of the 11mer: [ka] Using general procedure B: the trityl protected 11mer (500 mg) was reacted to give the free base 11mer (481 mg).

[0151] Coupling to 12mer: [ka] Using general procedure A: the 11mer (481 mg) was reacted with ((2S,6R)-6-(6-benzamido-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (102 mg) to give the 12mer (525 mg).

[0152] Deprotection of the 12mer: [ka] Using general procedure B: the trityl protected 12mer (525 mg) was reacted to give the free base 12mer (490 mg).

[0153] Coupling to 13mer: [ka] Using general procedure A: the 12mer (484 mg) was reacted with ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (86 mg) to give the 13mer (550 mg).

[0154] Deprotection of the 13mer: [ka] Using general procedure B: the trityl protected 13mer (550 mg) was reacted to give the free base 13mer (550 mg).

[0155] Coupling to 14mer: [ka] Using general procedure A: the 13mer (550 mg) was reacted with ((2S,6R)-6-(6-benzamido-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (94 mg) to give the 14mer (621 mg).

[0156] Deprotection of the 14mer: [ka] Using general procedure B: the trityl protected 14mer (621 mg) was reacted to give the free base 14mer (596 mg).

[0157] Coupling to 15mer: [ka] Using general procedure A: 14mer (596 mg) was reacted with ((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (84 mg) to give 15mer (655 mg). MS (ESI) m / z: C 274 H 337 N 79 O 72 P 14 Calculated value: [M+4H / 4] + 1581.28;Actual value:1582.

[0158] Deprotection of the 15mer: [ka] Using general procedure B: the trityl protected 15mer (650 mg) was reacted to give the free base 15mer (613 mg). MS (ESI) m / z: C 255 H 323 N 79 O 72 P 14Calculated value: [M+4H / 4] + 1520.76;Actual value:1521.

[0159] Coupling to 16mer: [ka] Using general procedure A: the 15mer (613 mg) was reacted with ((2S,6R)-6-(6-(2-cyanoethoxy)-2-isobutyramido-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (103 mg) to give the 16mer (680 mg).

[0160] Deprotection of the 16mer: [ka] Using general procedure B: The trityl protected 16mer (680 mg) was reacted to give the free base 16mer (623 mg).

[0161] Coupling to 17mer: [ka] Using general procedure A: the 16mer (623 mg) was reacted with ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (93 mg) to give the 17mer (690 mg).

[0162] Deprotection of the 17mer: [ka] Using general procedure B: the trityl protected 17mer (690 mg) was reacted to give the free base 17mer (670 mg).

[0163] Coupling to 18mer: [ka] Using general procedure A: the 17mer (673 mg) was reacted with ((2S,6R)-6-(6-benzamido-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (98 mg) to give the 18mer (740 mg).

[0164] Deprotection of the 18mer: [ka] Using general procedure B: the trityl protected 18mer (739 mg) was reacted to give the free base 18mer (675 mg).

[0165] Coupling to 19mer: [ka] Using general procedure A: the 18mer (675 mg) was reacted with ((2S,6R)-6-(4-benzamido-2-oxopyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (127 mg) to give the 19mer (735 mg).

[0166] Deprotection of the 19mer: [ka] Using general procedure B: The trityl protected 19mer (735 mg) was reacted to give the free base 19mer (732 mg).

[0167] Coupling to 20mer: [ka] Using general procedure A: the 19mer (732 mg) was reacted with ((2S,6R)-6-(6-benzamido-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (135 mg) to give the 20mer (790 mg). MS (ESI) m / z: C 367 H 452 N 111 O 95 P 19 Calculated value: [M+5H / 5] + 1706;Actual value: 1707.

[0168] Deprotection of the 20mer: [ka] Using general procedure B: The trityl protected 20mer (790 mg) was reacted to give the free base 20mer (743 mg). MS (ESI) m / z: C 348 H 438 N 111 O 95 P 19 Calculated value: [M+5H / 5] + 1657.6;Actual value:1658.

[0169] Coupling to 21mer: [ka] Using general procedure A: the 20mer (743 mg) was reacted with ((2S,6R)-6-(6-(2-cyanoethoxy)-2-isobutyramido-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (129 mg) to give the 21mer (795 mg).

[0170] Deprotection of the 21mer: [ka] Using general procedure B: the trityl protected 21mer (800 mg) was reacted to give the free base 21mer (756 mg).

[0171] Coupling to 22mer: [ka] Using general procedure A: the 21mer (753 mg) was reacted with ((2S,6R)-6-(6-benzamido-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (137 mg) to give the 22mer (806 mg).

[0172] Deprotection of the 22mer: [ka] Using general procedure B: the trityl protected 22mer (806 mg) was reacted to give the free base 22mer (785 mg).

[0173] Coupling to 23mer: [ka] Using general procedure A: 22mer (780 mg) was reacted with ((2S,6R)-6-(2-isobutylamido-6-oxo-1,6-dihydro-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (161 mg) to give 23mer (837 mg).

[0174] Deprotection of the 23mer: [ka] Using general procedure B: the trityl protected 23mer (837 mg) was reacted to give the free base 23mer (830 mg).

[0175] Coupling to 24mer: [ka] Using general procedure A: the 23mer (830 mg) was reacted with ((2S,6R)-6-(6-benzamido-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (177 mg) to give the 24mer (800 mg).

[0176] Deprotection of the 24mer: [ka] Using general procedure B: the trityl protected 24mer (800 mg) was reacted to give the free base 24mer (793 mg).

[0177] Coupling to 25mer: [ka] Using general procedure A: 24mer (793 mg) was reacted with ((2S,6R)-6-(2-isobutylamido-6-oxo-1,6-dihydro-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl (R)-dimethyl phosphoramidochloridate (150 mg) to give 25mer (818 mg). MS (ESI) m / z: C 456 H 571 N 147 O 118 P 24 Calculated value: [M+7H / 7] + 1535.53;Actual value: 1535.56.

[0178] 25mer base deprotection: [ka] To a 100 mL flask containing the 25mer (710 mg) was added methanol (19.5 mL) and 28% aqueous ammonium hydroxide (19.5 mL) under nitrogen atmosphere. The reaction mixture was stirred at 50° C. for 2 days to give a clear solution. The solution was then evaporated under vacuum at 35° C. to a volume of approximately 20 mL. The slightly cloudy mixture was filtered through a plastic fritted funnel and rinsed with approximately 5-10 mL of water to a total volume of 25 mL. The resulting solution was used for purification by reverse phase HPLC using the following conditions: Evaporation of the desired peak fractions gave a total of 148 mg of the deprotected trityl-tagged 25mer as a white solid. MS(ESI) m / z: C 308 H 464 N 144 O 96 P 24 Calculated value: [M+1H] + 8462.97; Found: 8463.00 (HRMS spectrum after deconvolution).

[0179] [Table 3]

[0180] Trityl deprotection of the 25mer: [ka] To the vial containing the trityl protected 25mer (3.7 mg) was added 0.1 M phosphoric acid (250 μL). The vial was stirred at room temperature for 4 hours when the reaction was deemed complete (two consecutive checks by UPLC MS showed that the starting material peak had been converted to an early eluting peak). 0.1 M ammonium hydroxide (250 μL) was added and filtered through a 0.2 μM syringe filter. The filter was rinsed with 0.4 mL of water and collected in a vial. The sample was purified by reverse phase HPLC using the method in the table below. The desired fractions were combined, evaporated under vacuum, and then lyophilized to give 1.2 mg of the desired product, 25mer PMO (PMO-302). MS (ESI) m / z: C 289 H450 N 144 O 96 P 24 Calculated value: [M+1H] + 8220.86; Found: 8220.87 (HRMS spectrum after deconvolution).

[0181] [Table 4]

[0182] Example 4: Determination of splice regulatory properties of CD33 exon-2 targeting oligonucleotides: A variety of techniques can be used to assess the activity / properties of CD33-targeting oligonucleotides using a variety of human, mouse, and non-human primate cell lines.

[0183] In vitro assay method: For screening of CD33 exon-2 skipping ASOs (CD33 oligonucleotides), U-188MG (human glioblastoma cell line) and human iCell microglial cells were used. U-118MG cell line was purchased from ATCC. iCell microglial cells were purchased from Fujifilm (Cellular Dynamics). Both cell models were cultured and maintained using the appropriate medium suggested in the vendor's protocol. Screening was performed by seeding approximately 20,000 cells per well in 96WP format and treating with the indicated concentrations of modified ASOs using Endoporter or Lipofectamine reagents. Cells were further incubated for 48 hours at 37°C in a cell culture incubator before total RNA was isolated. Various experiments were performed in biological duplicates. Total RNA was isolated and converted to cDNA according to the vendor's protocol, and then exon-2 skipped and non-skipped CD33 mRNA transcripts were quantified using Taqman gene expression assays. Target transcript expression was normalized using the expression of human housekeeping genes such as HPRT1 or GAPDH1.

[0184] PMO-ASO sequence determination PMO ASOs were tested for their efficacy in inducing exon-2 skipping in CD33 gene transcripts in U-118MG glioblastoma cells in vitro. PMO ASOs were designed to cover CD33 exon-2 and the surrounding intron (SEQ ID NO:1) in 25 nucleotide segments shifted 5 nucleotides at a time from 5' to 3' of SEQ ID NO:1. Oligonucleotides were tested using two concentrations (0.5 μM and 0.167 μM) and delivered using Endoporter reagent. Cells were harvested 48 hours after treatment and RNA was isolated. Total RNA was converted to cDNA according to the vendor's protocol and CD33 mRNA transcripts with and without exon-2 skipping were quantified using Taqman gene expression assays. Human housekeeping gene HPRT1 expression was used as a loading control for each experiment. Each oligonucleotide was tested in duplicate at each concentration.

[0185] The skipping efficiency of an oligonucleotide was calculated using the following formula:

number

[0186] The skipping efficiency is expressed on a scale of 0 to 100, where 100 represents 100% skipping of CD33 exon-2. A negative control oligonucleotide, NTC (non-targeting control), not targeting CD33 was used in every experiment.

[0187] The results are shown in Table 3.

[0188] [Table 5]

[0189] [Table 6]

[0190] [Table 7]

[0191] [Table 8]

[0192] [Table 9]

[0193] [Table 10]

[0194] [Table 11]

[0195] MOE-ASO sequence determination MOE ASO was tested for its efficacy in inducing exon-2 skipping in CD33 gene transcripts in U-118MG glioblastoma cells in vitro. MOE ASO was designed to encompass CD33 exon-2 and the surrounding intron (SEQ ID NO: 1) in 20 nucleotide segments shifted 5 nucleotides at a time from 5' to 3' of SEQ ID NO: 1. Oligonucleotides were tested using different concentrations (10 nM and 3.3 nM) and delivered using a lipofectamine protocol. Cells were harvested 48 hours after treatment and RNA was isolated. Total RNA was converted to cDNA according to the vendor's protocol and CD33 mRNA transcripts with and without exon-2 skipping were quantified using Taqman gene expression assays. Human housekeeping gene HPRT1 expression was used as a loading control for each experiment. Each oligonucleotide was tested in duplicate at each concentration.

[0196] The skipping efficiency of an oligonucleotide was calculated using the following formula:

number

[0197] The skipping efficiency is expressed on a scale of 0 to 100, where 100 represents 100% skipping of CD33 exon-2. In every experiment, a negative control oligonucleotide, NTC (non-targeting control), that does not target CD33 was used. The results are reported in Table 4 below.

[0198] [Table 12]

[0199] [Table 13]

[0200] [Table 14]

[0201] [Table 15]

[0202] [Table 16]

[0203] [Table 17]

[0204] [Table 18]

[0205] Identification of CD33 regions with increased exon-2 skipping activity using ASOs The PMO and MOE ASOs were designed to cover CD33 exon-2 and the surrounding intron (SEQ ID NO:1) in 20-25 nucleotide segments shifted 5 nucleotides at a time from 5' to 3' of SEQ ID NO:1. These PMO and MOE ASOs produced the exon-2 skipping activity shown in Tables 3 and 4, respectively. Regions that exhibit increased exon-2 skipping activity were identified when two or more consecutive PMO or MOE ASOs complementary to a segment of SEQ ID NO:1 showed increased exon-2 skipping activity. These regions were as follows: Region 1: (SEQ ID NO: 213) (5'-TCTCCCCAGCTCTCTGTGCATGTGACAGGTGAGGCACA-3') (see, e.g., PMO-002 and PMO-003) b. Region 2: (SEQ ID NO:214) (5'-TAATGGTTCATACTTCTTTCGGATGGAGAGGAAGTACCAAATACAGTTACAAATCT-3') (see, e.g., PMO-036, PMO-037, PMO-004, PMO-038, PMO-039, and PMO-005) c. Region 3: (SEQ ID NO:215) (5'-CCTCGTGCCCTGCACTTTCTTCCATCCCATACCCTACTACGAC-3') (see, e.g., PMO-082, PMO-083, and PMO-006) d. Region 4: (SEQ ID NO:216) (5'-AGGGGCCCTGGCTATGGATCCAAATTTCTGGCTGCAAGTGCAG-3') (see, e.g., PMO-096, PMO-007, and PMO-097) e. Region 5: (SEQ ID NO: 217) (5'-ACAGTTACAAATCTCCCCAGCTCTCTGTGCATGTGACAGGTGAGG-3') (see, e.g., MOE-009, MOE-128, and MOE-010) f. Region 6: (SEQ ID NO: 218) (5'-GGTTCATACTTCTTTCGGATGGAGAGGAAGTACCAAAT-3') (see, e.g., MOE-135, MOE-011, and MOE-012) g. Region 7: (SEQ ID NO: 219) (5'-GCAGGAGTCAGTGACGGTACAGGAGGGTTTGTGCG-3') (see, e.g., MOE-015, MOE-183, and MOE-184) h. Region 8: (SEQ ID NO: 220) (5'-GGCCGAGCTGACCCTCGTTTCCCCACAGGGGCCC-3') (see, e.g., MOE-196 and MOE-197).

[0206] Evaluation of PMO-ASO sequences at multiple concentrations Oligonucleotides were tested for their efficacy in inducing exon-2 skipping in CD33 gene transcripts in U-118MG glioblastoma cells in vitro. Oligonucleotides were tested using various concentrations (0.156, 0.313, 0.625, 1.25, 2.5, 5.0, 10.0 and 20.0 μM) and delivered using the endoporter protocol. Cells were harvested 48 hours after treatment and RNA was isolated.

[0207] The skipping efficiency of an oligonucleotide was calculated using the following formula:

number

[0208] The skipping efficiency is expressed on a scale of 0 to 100, where 100 represents 100% skipping of CD33 exon-2. A negative control oligonucleotide, NTC (non-targeting control), not targeting CD33 was used in every experiment. The skipping efficiency (% CD33-D2 transcript level (after normalization)) is shown in Figure 5.

[0209] Evaluation of MOE-ASO sequences at multiple concentrations Oligonucleotides were tested for their efficacy in inducing exon-2 skipping in CD33 gene transcripts in U-118MG glioblastoma cells in vitro. Oligonucleotides were tested using various concentrations (0.082, 0.205, 0.512, 1.28, 3.2, 8.0, 20.0, and 50.0 nM) and delivered using a lipofectamine protocol. Cells were harvested 48 hours after treatment and RNA was isolated.

[0210] The skipping efficiency of an oligonucleotide was calculated using the following formula:

number

[0211] The skipping efficiency is expressed on a scale of 0 to 100, where 100 represents 100% skipping of CD33 exon-2. A negative control oligonucleotide, NT (non-targeting control), not targeting CD33 was used in every experiment. The skipping efficiency (% CD33-D2 transcript level (after normalization)) is shown in Figure 6.

[0212] Example 5: Determination of in vivo activity of PMO-002 (SEQ ID NO: 2) and MOE-012 (SEQ ID NO: 12) A variety of techniques can be used to assess the activity / properties of CD33-targeting oligonucleotides using a variety of human, mouse, and non-human primate cell lines.

[0213] In vivo assay method: A humanized CD33 mouse model was used to study the CD33 exon-2 skipping ASO. CRISPR / Cas9-mediated gene editing was used to replace mouse CD33 with human genomic CD33, including the signal peptide. The mouse 3' and 5' untranslated regions were retained. For in vivo experiments, a mixed male and female cohort of human CD33 mouse strains on a C57BL / 6 background was used, and mice were 12-24 weeks old at the time of treatment.

[0214] On day 1, 30 μg or 100 μg of PMO-002 (SEQ ID NO: 2) and MOE-012 (SEQ ID NO: 12) were administered in a 3 μL bolus via intraventricular injection into the right lateral ventricle. One week after injection, mice were autopsied. At autopsy, mice were perfused transcardially with PBS under Avertin anesthesia. Brains were quickly removed from the skull, and the cortex and hippocampus were dissected from the injected hemisphere for exon skipping determination. For RNA isolation, frozen tissues were added with 9 volumes of Trizol and homogenized for 3 min. 500 μL of Trizol lysate was transferred to a 1 mL deep-well plate. Each sample was added with 100 μL of chloroform, shaken vigorously, and centrifuged at 4000×g for 5 min. Supernatants (250 μL) were transferred to a binding plate from the SV96 Total RNA Extraction Kit (Promega), and RNA was extracted following the same protocol. Total RNA was isolated and converted to cDNA following the SV96 protocol (Promega), and then exon-2 skipped CD33 mRNA transcripts were quantified using Taqman gene expression assays. Expression of mouse housekeeping genes such as HPRT1 or GAPDH1 was used to normalize target transcript expression. Fold change of exon-2 skipped CD33 mRNA in mouse hippocampus is presented in Figure 7 (n=4, technical duplicates shown in figure). Fold change of exon-2 skipped CD33 mRNA in mouse cortex is presented in Figure 8 (n=4, technical duplicates shown in figure). In both hippocampus and cortex, each ASO increased the amount of exon-2 skipped CD33 mRNA in vivo for both doses compared to PBS control.

[0215] Example 6: Additional Exemplary PMO-ASOs PMO oligonucleotides for screening were designed. The designed oligonucleotides were made by solid-phase method by GeneTools LLC (website: www.gene-tools.com). Table 5 below lists the synthesized PMO oligonucleotides along with their deconvoluted MS data. These PMO oligonucleotides are complementary to the section of SEQ ID NO:1 that shows increased exon-2 skipping activity. In particular, PMO-221 to PMO-240, PMO-324, PMO-424, PMO-402 and PMO-502 are complementary to region 1; and PMO-241 to PMO-244 are complementary to region 2. All PMO oligonucleotides listed in Table 5 below contain a sarcosine (Sar) linker at the 5' end to which a phosphorodiamidate is attached. All PMO oligonucleotides listed in Table 5 below were synthesized with unmodified cytosine PMO nucleotides. All of the PMO oligonucleotides listed in Table 5 below have sterically random internucleotide linkages and are therefore referred to as sterically random PMO oligonucleotides. The structure of PMO-224 is as follows: [ka]

[0216] [Table 19]

[0217] [Table 20]

[0218] [Table 21]

[0219] Example 7: Determination of in vivo activity of PMO-002, PMO-003, PMO-224, PMO-232, PMO-233, PMO-237, and PMO-238 To investigate the in vivo efficacy of the five PMO sequences in Tables 1 and 5, a study was performed in hCD33 mice with a 30 μg dose administered ICV in the same manner as in Example 5, except that the injection volume was 2.5 μL. Skipping efficacy was assessed after 7 days. Data expressed as % exon-2 CD33 skipping are shown in FIG. 9.

[0220] The skipping effect of PMO-224 was evaluated in a separate in vivo study at 30 μg, 100 μg, and 300 μg doses and 10 μL injection volume. PMO-002 was also evaluated at a 100 μg dose. Data expressed as fold change relative to PBS control are shown in FIG. 10.

[0221] Example 8: Synthesis of PMO oligonucleotides containing stereopure internucleotide linkages and 5'-sarcosine linkers

[0222] [Table 22]

[0223] Solution-phase synthesis of stereopure PMO oligonucleotides: Solution phase synthesis of the 5'-sarcosine capped stereopure oligonucleotides in Table 6 was carried out using a method similar to that described in Example 3 (using general procedures A and B) except that step 1 begins with coupling of sarcosine benzyl ester to stereopure cytosine dimethylphosphoramidochloridate. Briefly, the synthesis involves repeated deprotection / freebasing / coupling steps as depicted here for all Sp internucleotide linkages: [ka]

[0224] General scheme for the synthesis of PMO-424 and PMO-502 by solution phase. Briefly, the synthesis involves repeated deprotection / freebasing / coupling steps as depicted here for all Rp internucleotide linkages): [ka]

[0225] General scheme for the synthesis of PMO-324 and PMO-402 by solution phase. At the end of each individual step, precipitation of the oligonucleotides was achieved by adding a non-polar solvent such as MTBE and / or EtOAc. For the elongation steps up to the 6mer, purification of the 3'-N-trityl protected oligonucleotides was performed by silica gel chromatography using DCM / MeOH as eluent.

[0226] Once the desired oligonucleotide length was reached (21 mer for PMO-324, PMO-424, and 25 mer for PMO-402 and PMO-502), the 3'-N-trityl protected sequences were subjected to base deprotection as follows.

[0227] Base deprotection for solution phase synthesis: The 3'-N-trityl protected PMO oligonucleotide residue (1 wt.) from the final coupling step was dissolved in MeOH (8 volumes) and then 7N NH3 in MeOH (20 volumes) was added. The reaction mixture was heated to 50-55°C for at least 48 hours. The solution was filtered to remove any solids and rinsed with 1:1 MeOH / 7N NH3 in MeOH. Purification by preparative scale chromatography using a reverse phase gradient as outlined in Table 7 afforded the 3'-N-trityl protected PMO after solvent evaporation.

[0228] [Table 23]

[0229] Final trityl deprotection: 0.1 N phosphoric acid (at least 20 equivalents) was added to the base-protected PMO oligonucleotide from the HPLC purification and the reaction was monitored by HPLC. After completion of the trityl deprotection was assessed by two consecutive HPLC runs, the reaction mixture was basified by adding ammonium hydroxide (at least 40 equivalents). The solution was filtered and the final PMO oligonucleotide was purified by HPLC under the conditions in Table 8.

[0230] [Table 24]

[0231] Example 9: Analytical Data for Stereopure PMO Oligonucleotides Melting temperature (Tm) of PMO oligonucleotide: Tm measurement device: Shimadzu UV-2700 UV-visible spectrophotometer ASO samples were prepared by dissolving approximately 0.6-0.8 mg of solids to approximately 3.2 ug / mL using nuclease-free water. Reverse complementary RNA (obtained from IDT Technologies Inc.) was dissolved at 400 μM in nuclease-free water. A 10 μL aliquot of each stock solution was diluted to 1 mL using nuclease-free water and the concentration was determined by UV-Visible Spectrophotometer (Spectrophotomer). Test samples (500 μL) were prepared containing 4.0 μM PMO with 4.0 μM reverse complementary RNA in buffer (100 mM NaCl, 10 mM Na phosphate pH 7.0, containing 0.1 mM EDTA). Test samples were incubated in 1 mL cuvettes and heated from 15°C to 105°C at 0.5°C / min. The increase in UV absorbance due to melting of the strands was monitored at 260 nm. Prior to this experiment, samples were melted and reannealed by heating from 25° C. to 95° C. at 5° C. / min and cooling to the starting temperature to ensure complete annealing. Shimadzu Tm analysis software was used to calculate the Tm using the derivative (curve inflection point: 50% melting).

[0232] Analytical data for stereochemically pure PMO oligonucleotides. PMO-424: [ka]

[0233] PMO-324: [ka]

[0234] PMO-502: [ka]

[0235] PMO-402: [ka]

[0236] Example 10: Solid-phase synthesis of stereopure PMOs using a peptide synthesizer Deprotection of Fmoc on Sar-Wang resin: [ka] Fmoc-SAR-Wang resin (purchased from Aapptec, RWG103, Lot No. 9953380, 0.65 mmol / g, 110-200 mesh) (1 g, 650 mmol) was treated with DMF (8 mL), the resin was allowed to swell for 2 h, and the DMF was drained. The resin was treated with 20% piperidine in DMF (6 mL), shaken for 3 min, the solvent was removed, and dried under N2 gas for 1 min (the same procedure was repeated 4 times). Finally, the resin was washed with DMF (5 mL x 5 times), washed with CHCl (5 mL x 5 times), and dried under vacuum using N2 gas overnight to give 0.8 g of resin.

[0237] Calculation of resin loading: The collected piperidine solution was adjusted to a final volume of 40 mL with 20% piperidine in DMF, where 0.1 mL of the solution was diluted 100-fold with DMF and the UV absorbance at 301 nm of Fmoc groups per gram was measured. The resin loading was >700 μmol / g.

[0238] UV measurement conditions Solvent: 20% piperidine in DMF Wavelength: 301nm ε=7800 General procedure for solid phase synthesis of PMOs: [ka] The Fmoc-deprotected resin (1.10 g, loading: 0.650 mmol / g) was transferred to a peptide synthesizer reaction vessel, washed with CHCl (20 mL x 5), acetonitrile (20 mL x 5), and dried. Stereopure cytosine dimethylphosphoramidochloridate (1 equiv.) was added as a solid to the flask. The vessel was then charged with 1,2,2,6,6-pentamethylpiperidine (PMP, 10.0 equiv.) and anhydrous 1,3-dimethyl-2-imidazolidinone (DMI, 5.0 mL) and shaken at room temperature for 20 h. LCMS of a reaction aliquot showed no monomer in solution (indicating that all monomer was loaded onto the resin). Steps 5-9 of Table 9 were then carried out.

[0239] [Table 25]

[0240] Preparation of detritylation solution: To a solution of 4-cyanopyridine (10.1 g; 1.055 eq.) in dichloromethane (790 mL) is added trifluoroacetic acid (10.5 g; 1.0 eq.), followed by 2,2,2-trifluoroethanol (198 mL) and ethanol (10 mL) and the solution is stirred for 3 h.

[0241] After the first loading of monomer onto the resin, a synthesis cycle (as shown in Table 9) was started. The synthesis involved a series of repeated steps including deprotection / neutralization / coupling / capping. The required monomers (the purity of the monomers was characterized by HPLC-Mass before use) were added every cycle to obtain the title nucleotide sequence.

[0242] In each synthesis cycle, after the coupling reaction (Step 4, Table 9), a small amount of resin was subjected to cleavage conditions (0.1 mL of 7N NH3 / MeOH, 55°C, 4 hours) and RP HPLC-Mass was recorded for coupling efficiency (RP HPLC-Mass showed two peaks of methyl ester and amide in about 2:1 ratio. To ensure complete conversion of methyl ester to amide, the cleavage reaction was left stirring at 55°C overnight). The cleavage protocol was repeated from the 2mer to the 21mer for PMO-324 and PMO-424, and up to the 25mer for PMO-402 and PMO-502. RP HPLC-Mass was recorded using the conditions in Table 10.

[0243] [Table 26]

[0244] For example, FIG. 17 shows the UV chromatogram of the trityl-protected 21-mer (all-Sp-Sar-CCTCACCTGTCACATGCACAG-Tr) after cleavage from the resin.

[0245] Cleavage from the resin and base deprotection: After reaching the desired oligonucleotide length, the synthesized PMO-loaded resin was dried and transferred to a centrifuge bottle and charged with 7N NH3 / MeOH (approximately 0.5 mL / 1 μmol). The mixture was stirred at 50-55 °C for 60 h. The reaction was cooled to room temperature, the solids were filtered, and washed with methanol. The resulting filtrate was concentrated under reduced pressure to an approximate final volume of approximately 20 mL, and then any solids were filtered through a 0.4 micron membrane filter. The filtrate was concentrated to dryness and weighed. The resulting crude residue was dissolved in 60 mL of a solvent mixture of 50 mM Et3NHOAc (using cell culture water) / MeCN (1 / 1) in water containing Et3N (0.1%). The filtrate was purified by reverse phase HPLC conditions as shown in Table 11.

[0246] [Table 27]

[0247] Final detritylation: Freshly prepared 0.1 M aqueous phosphoric acid (20 eq.) was added to the flask containing the recovered 3'-N-Tr-PMO (1 eq.) and the mixture was stirred at room temperature for 2 h (a cloudy white solution formed within 10 min). Two consecutive LCMS runs confirmed the reaction was complete (showing that the starting material peak was converted to an early eluting peak; HPLC samples were prepared in water only). The reaction was basified by adding 28% ammonium hydroxide (40 eq.), stirred for 30 min, and the solid was filtered through a membrane filter (0.45 μm) and washed with water. The resulting filtrate was purified by reverse phase HPLC (Table 12).

[0248] [Table 28]

[0249] Each fraction was analyzed (by HPLC) and the fractions containing the product were dried using a Genevac. The final product was dissolved in endotoxin-free water and the solution was filtered through an Amicon 3K filter to remove any inorganic salt impurities. The resulting aqueous solution was freeze-dried to give the title compound as a white, cotton-like solid.

[0250] Analytical data for stereo-pure PMOs prepared by solid phase synthesis: PMO-424: P 31 NMR (D2O, 162MHz) δ21.5,18.7,18.6,18.5,18.4,18.3,18.3,18.1,18.0,17.9. LRMS:C 246 H 390 N 119 O 84 P 21 (m / z=7009.02) [M+5H] 5+ Calculated m / z for ion: 1402.80; Found: 1402.62

[0251] PMO-324: LRMS:C 246 H 390 N 119 O 84 P 21 (m / z=7009.02) [M+5H] 5+ Calculated m / z for ion: 1402.80; Found: 1403.4

[0252] PMO-402: LRMS:C 294 H 462 N 147 O 98 P 25 (m / z=8396.92) [M+6H] 6+ Calculated m / z for ion: 1400.66; Found: 1401.2

[0253] Example 11: Determination of in vivo activity of PMO-402, PMO-502, PMO-324, and PMO-424 To investigate the in vivo effects of PMO-402, PMO-502, PMO-324, and PMO-424 prepared in Example 8, a study was conducted in hCD33 mice administered ICV at 100 μg and 300 μg doses. The study was performed in the same manner as in Example 5, except that the administration volume was 10 μL. The skipping effect was evaluated after 7 days. The data, expressed as fold change relative to the PBS control, are shown in Figures 18 and 19.

[0254] Example 12: Additional Exemplary MOE-ASOs Phosphorothioate oligonucleotides were designed for screening. All oligonucleotides listed in Table 13 below contain phosphorothioate backbone ribonucleotides, except where noted (e.g. solid line (-) = phosphodiester (PO) linkage). All oligonucleotides listed in Table 13 below were synthesized with 5-methylcytosine ribonucleotides. All oligonucleotides listed in Table 13 below have sterically random phosphorothioate internucleotide linkages, and are therefore referred to as sterically random oligonucleotides. All oligonucleotides listed in Table 13 below are complementary to region 6: (SEQ ID NO: 218).

[0255] [Table 29]

[0256] [Table 30]

[0257] All of the oligonucleotides listed in Table 14 below contain 2'-O-MOE modified ribonucleotides and a 5'-terminal hydroxyl group. The oligonucleotides in Table 14 contain stereochemically pure phosphorothioate internucleotide linkages and are therefore referred to as stereochemically pure MOE oligonucleotides. All of the oligonucleotides listed in Table 14 are complementary to Region 6: (SEQ ID NO: 218).

[0258] [Table 31]

[0259] [Table 32]

[0260] [Table 33]

[0261] Example 13: Preparation of stereochemically pure 2'-MOE phosphorothioate oligonucleotides Protected 2'-O-MOE-3'-OH monomer [ka] (1) 2,2-Diethoxy-1-methylpyrrolidine: A mixture of NMP (100 mL, 1039.008 mmol) and dimethyl sulfate (99 mL, 1039.008 mmol) was stirred and heated to 80 °C (sand bath) overnight, then allowed to cool to room temperature. After cooling, the homogeneous liquid was washed with ether (2 x 100 mL) and residual solvent was removed in vacuo. The resulting residue was dissolved in CHCl (400 mL), dried over anhydrous MgSO, filtered, washed with CHCl (100 mL), and concentrated under reduced pressure to give 5-methoxy-1-methyl-3,4-dihydro-2H-pyrrol-1-ium as a brown viscous liquid (solidified upon storage at -20 °C); 1 H NMR(400MHz,CDCl3)δ 4.35-4.40(m,3H),3.98-4.05(m,2H),3.69-3.73(m,3H),3.31-3.38(m,2H),3.19-3.22(m,3H),2.37-2.48(m,2H).

[0262] The crude product (obtained above) was added to a solution of sodium ethanolate (370 g, 1142.909 mmol, 21% sodium ethoxide in ethanol) via cannula or dropping funnel over 1 h at 50-55 °C under N2 atmosphere. After stirring at the same temperature for 3 h, the reaction was cooled to room temperature. The precipitated white solid was filtered, washed with ethanol (50 mL) and the filtrate was concentrated (water bath temperature was maintained at about 30 °C). The crude residue was fractionally distilled at 55-65 °C under house vacuum to give 2,2-diethoxy-1-methylpyrrolidine (115 g, 66% yield) as a pale yellow or colorless liquid. The pure product was stored at -20 °C; 1 H NMR(400MHz,CDCl3)δ 3.44-3.60(m,4H),2.83-2.91(m,3H),2.33-2.40(m,4H),1.90-1.98(m,2H),1.72-1.87(m,2H),1.15-1.22(m,6H).

[0263] General Procedure 1: Pya (N-methylpyrrolidine) protection of 2'-O-MOE G, A, and mC [ka] (2-1) 9-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-2-(1-methylpyrrolidin-2-ylidene)amino)-1,9-dihydro-6H-purin-6-one:

[0264] 2-Amino-9-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-1,9-dihydro-6H-purin-6-one (13.8 g, 40.431 mmol) was chased twice with anhydrous pyridine (100 mL) under vacuum. To the concentrated residue was added anhydrous pyridine (114 mL, 1418.073 mmol) followed by 2,2-diethoxy-1-methylpyrrolidine (14.01 g, 80.862 mmol) slowly at room temperature. The reaction was stirred overnight at room temperature and changed from a white cloudy solution to a brown clear solution. Water (0.1 mL / 6 mmol) was added and the mixture was concentrated under vacuum and then chased three times with pyridine and MeCN. To the resulting residue, pyridine (105 mL, 1298.197 mmol) and 1-[chloro-(4-methoxyphenyl)-phenylmethyl]-4-methoxybenzene (15.62 g, 46.108 mmol) were added at room temperature. After stirring at room temperature overnight, the reaction mixture was worked up with saturated NaHCO3 (150 mL) and EtOAc (300 mL x 2), and the residue was purified by silica gel column chromatography (100 g Star silica, EtOAc / Hept 30 to 100%, then EtOAc / MeOH 0 to 30%) to give 2-1 as a foamy solid in 77% yield; 1 H NMR(400MHz,CDCl3)δ 9.28-9.36(m,1H),7.67-7.72(m,1H),7.32-7.39(m,2H),7.16-7.28(m,6H),7.08-7.16(m ,1H),6.69-6.78(m,4H),5.92-5.96(m,1H),4.29-4.37(m,2H),4.11-4.17(m,1H),3.74-3 .82(m,1H),3.68-3.73(m,7H),3.55-3.63(m,1H),3.45-3.52(m,1H),3.34-3.41(m,3H),3 .25-3.33(m,5H),3.01-3.09(m,2H),2.92-2.96(m,3H),1.90-2.00(m,2H);MS(ESI,m / z)[C 39 H 44 N5O8+H + ] Calculated value: 725.33, measured value: 725.4.

[0265] [ka] (2-2) (2R,3R,4R,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(6-1-methylpyrrolidin-2-ylidene)amino)-9H-purin-9-yl)tetrahydrofuran-3-ol: Prepared according to general procedure 1, foamy solid, 89% yield; 1 H NMR(400MHz,DMSO-d6)δ 8.36(d,J=8.0Hz,2H),7.40-7.31(m,2H),7.29-7.16(m,7H),6.87-6.77(m,4H),6.07(d,J=4.8Hz ,1H),5.18(d,J=6.0Hz,1H),4.69(t,J=5.2Hz,1H),4.44(q,J=5.2Hz,1H),4.11-4.05(m,1H),3.76 -3.71(m,7H),3.62(dt,J=11.2,4.8Hz,1H),3.49(t,J=7.2Hz,2H),3.42(t,J=4.8Hz,2H),3.23(d, J=4.8Hz,2H),3.14(s,3H),3.04(s,3H),2.85(t,J=8.0Hz,2H),2.02-1.93(m,2H);MS(ESI,m / z)[C 39 H 44 N6O7+H + ] Calculated value: 709.33, observed value: 709.20.

[0266] [ka] (2-3) 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methyl-4-(1-methylpyrrolidin-2-ylidene)amino)pyrimidin-2(1H)-one: Prepared according to general procedure 1, 87% yield; foamy solid; 1H NMR(400MHz,CDCl3)δ 7.77-7.81(m,1H),7.46-7.51(m,2H),7.34-7.41(m,4H),7.27-7.33(m,2H),7.20-7.27(m,1H),6.82-6 .88(m,4H),5.99-6.04(m,1H),4.34-4.43(m,1H),4.25-4.33(m,1H),4.08-4.15(m,1H),3.99-4.05(m, 1H),3.90-3.99(m,1H),3.74-3.83(m,6H),3.54-3.64(m,3H),3.42-3.50(m,3H),3.42(s,3H),3.29-3. 34(m,1H),3.07-3.29(m,2H),3.03-3.07(m,3H),2.00-2.11(m,2H),1.53-1.58(m,3H);MS(ESI,m / z)[C 39 H 44 N6O8+H + ] Calculated value 699.33, observed value 699.25.

[0267] Pivaloylmethyl (POM) protection of T: [ka] (2-4) (3-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methyl-2,6-dioxo-3,6-dihydropyrimidin-1(2H)-yl)methyl pivalate:

[0268] Step 1: To 1-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione (14.2 g, 44.893 mmol) in pyridine (99 mL, 1228.96 mmol) was added 1-[chloro-(4-methoxyphenyl)-phenylmethyl]-4-methoxybenzene (18.25 g, 53.871 mmol) at room temperature. Upon completion as monitored by UPLC-MS, the mixture was added with saturated NaHCO3 (80 mL), extracted with EtOAc (200 mL x 2), and purified by silica gel column chromatography (100 g, Star silica, EtOAc / Hept 10 to 100%) to give 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione (25 g, 40.408 mmol) in 90% yield. 1 H NMR(400MHz,DMSO-d6)δ 11.37(s,1H),7.49(s,1H),7.39(d,J=7.6Hz,2H),7.35-7.21(m,8H),6.90(d,J=8.8Hz,4H),5.85(d,J=4.8Hz,1H),5.12(d,J=6.0Hz,1H), 4.23(q,J=5.2Hz,1H),4.09(t,J=4.8Hz,1H),4.02-3.95(m,1H),3.79-3.67(m,8H),3.48(t,J=4.7Hz,2H),3.26-3.20(m,5H),1.40(s,3H).

[0269] Step 2: To an aqueous solution of Na2CO3 (242 mL, 121.225 mmol) was added 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione (25 g, 40.408 mmol), tetrabutylammonium hydrogen sulfate (5.49 g, 16.163 mmol), and chloromethyl pivalate (7.30 g, 48.49 mmol) in DCM (250 mL, 3885.69 mmol) at room temperature. The reaction mixture was stirred at room temperature for 16 h. UPLC-Mass analysis showed that some starting material remained unreacted, so 700 mg of chloromethyl pivalate was added at room temperature. After stirring at room temperature for an additional 2 days, the mixture was worked up with saturated NaHCO3 (50 mL) and extracted with EtOAc (100 mL x 3) and purified by column chromatography (100 g snap, EtOAc / Hept 10 to 60%) to give (3-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methyl-2,6-dioxo-3,6-dihydropyrimidin-1(2H)-yl)methyl pivalate (23 g, 31.4 mmol, 78% yield) along with recovered starting material (3.25 g). 1 H NMR (400MHz, DMSO-d6) δ 7.62(s,1H),7.40(d,J=7.6Hz,2H),7.36-7.20(m,7H),6.90(d,J=8.8Hz,4H) ,5.89(d,J=4.8Hz,1H),5.84-5.73(m,2H),5.17(d,J=6.0Hz,1H),4.26(q,J= 5.6Hz,1H),4.12(t,J=4.8Hz,1H),4.02-3.98(m,1H),3.78-3.70(m,8H),3.5 1-3.40(m,2H),3.28-3.20(m,5H),1.44(s,3H),1.10(s,9H);MS(ESI,m / z)[C 40 H 48 N2O 11 +Na+ ] Calculated value: 755.32, observed value: 755.1.

[0270] 2'-O-MOE-3'-PSI activated monomer General Procedure 2 1 :PSI activation [ka] (3-1) (3-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2R,3aS,6R,7aS)-3a-methyl-6-(prop-1-en-2-yl)-2-sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-5-methyl-2,6-dioxo-3,6-dihydropyrimidin-1(2H)-yl)methyl pivalate:

[0271] (2S,3aS,6R,7aS)-3a-Methyl-2-((perfluorophenyl)thio)-6-(prop-1-en-2-yl)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-sulfide (3.70 g, 8.29 mmol) ((-)-PSI Reagent) and (3-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl )-4-Hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methyl-2,6-dioxo-3,6-dihydropyrimidin-1(2H)-yl)methyl pivalate (4.50 g, 6.141 mmol) was dissolved in THF (20.47 mL, 6.141 mmol) and acetonitrile (20.47 mL, 6.141 mmol) and the solution was cooled in an ice bath. DBU (1.203 mL, 7.983 mmol) was added to the mixture and it was stirred at 0° C. until the reaction was complete (0.5-2 h) as monitored by UPLC-MS. The reaction mixture was diluted with EtOAc, washed with saturated NaH2PO4 (aq) solution, then saturated NaHCO3 (aq), dried over Na2SO4, and purified by silica gel chromatography (50 g Star, Hept:EtOAc gradient up to 70%) to give 3-1 as a white solid (5.3 g, 88% yield). CD3CN)δ ppm 7.46-7.54(3H,m),7.33-7.39(6H,m),7.26-7.32(1H,m),6.91(4H,d,J=8.75Hz), 5.97(1H,d,J=6.38Hz),5.86-5.93(2H,m),5.45-5.52(1H,m),5.02(1H,s),4.93(1 H,s),4.45-4.54(2H,m),4.26(1H,d,J=2.88Hz),3.77-3.84(8H,m),3.47-3.62(2 H,m),3.42(1H,dd,J=11.01,2.88Hz),3.29-3.33(1H,m),3.28(3H,s),2.64(1H,br s),2.25-2.32(1H,m),2.12-2.14(3H,m),2.07(1H,br dd,J=13.70,4.44Hz),1.99-1.99(1H,m),1.81-1.95(2H,m),1.80(3H,s),1.69(3H,s),1.44(3H,s),1.18(9H,s); 31 P NMR(162MHz,CD3CN)δ ppm 101.69;MS(ESI,m / z)[C 50 H 63 N2O 12 P.S. 2+ Na + ]Calculated value: 1001.35, measured value: 1001.4.

[0272] [ka] (3-2) (2R,3aS,6R,7aS)-2-(((2R,3R,4R,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(6-(((E)-1-methylpyrrolidin-2-ylidene)amino)-9H-purin-9-yl)tetrahydrofuran-3-yl)oxy)-3a-methyl-6-(prop-1-en-2-yl)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-sulfide: Prepared according to general procedure 2 with (-)-PSI reagent, 78% yield; foamy solid; 1H NMR(400MHz, CDCl3)δ 8.40-8.46(m,1H),8.00-8.03(m,1H),7.36-7.41(m,2H),7.24-7.30(m,4H),7.17-7.22(m,2H),7.08-7.16(m,1H),6.69-6.78(m, 4H),6.05(d,J=7.5Hz,1H),5.45-5.59(m,1H),5.04(dd,J=7.5,4.7Hz,1H),4.95(s,1H),4.78-4.93(m,1H),4.50(dt,J=12.6,3.3H z,1H),4.27-4.33(m,1H),3.59-3.79(m,10H),3.31-3.46(m,5H),3.10-3.15(m,3H),3.06-3.10(m,3H),2.83-2.97(m,2H),2.47-2 13C NMR(101MHz,CDCl3)δ 166.9,160.9,158.6,158.5,152.8,151.6,144.8,144.5,140.1,135.6,135.6,130.2,130.1,128.2,128.0,126.9,126.6,113.3,112.2,86.8,85.4,85.4, 83.6,83.5,80.1,80.0,77.3,76.9,72.3,70.6,68.0,65.7,63.0,58.9,55.2,51.6,38.9,33.7,33.7,32.0,30.1,27.8,27.6,25.6,23.5,22.7,21.8,19.7; 31 P NMR (162MHz, CDCl3) δ 101.34; MS (ESI, m / z) [C 49 H 59 N6O8PS 2+ H + ]についての calculated value is 955.36 and measured value is 956.3.

[0273]

change

[0274] [ka] (3-4) 9-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2R,3aS,6R,7aS)-3a-methyl-6-(prop-1-en-2-yl)-2-sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-2-((-1-methylpyrrolidin-2-ylidene)amino)-1,9-dihydro-6H-purin-6-one: Prepared according to general procedure 2 with (-)-PSI reagent, foamy solid, 80% yield; 1 H NMR(400MHz,CD3CN)δ ppm 9.18(1H,br s),7.74(1H,s),7.43(2H,d,J=7.38Hz),7.22-7.33(7H,m),6.85(4H,dd,J=9.01,2.63Hz),5.89(1 H,d,J=5.50Hz),5.48(1H,dt,J=13.54,4.80Hz),4.98(1H,s),4.92(1H,s),4.85(1H,t,J=5.38Hz), 4.50(1H,dt,J=12.69,3.22Hz),4.23(1H,q,J=4.09Hz),3.79(6H,s),3.67-3.77(2H,m),3.43-3.5 1(4H,m),3.32(2H,qd,J=10.94,4.06Hz),3.21(3H,s),3.03(3H,s),2.99-3.02(1H,m),2.63(1H,br s),2.27(1H,br d,J=13.13Hz),2.12-2.15(1H,m),2.01-2.06(1H,m),1.99-1.99(4H,m),1.79-1.93(2H,m),1.77(3H,s),1.68(3H,s); 31 P NMR(162MHz,CD3CN)δ ppm 101.36;MS(ESI,m / z)[C 49 H 59 N6O9PS 2+ H + ] Calculated value: 971.35, measured value: 971.4.

[0275] [ka] (3-5) 9-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2S,3aR,6S,7aR)-3a-methyl-6-(prop-1-en-2-yl)-2-sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-2-((1-methylpyrrolidin-2-ylidene)amino)-1,9-dihydro-6H-purin-6-one: A white foamy solid, prepared according to general procedure 2 with (+)-PSI reagent; 1 H NMR(400MHz,CD3CN,296K)δ(ppm)=9.56(br s,1H),7.74(s,1H),7.44(d,J=7.5Hz,2H),7.34-7.28(m,6H),7.28-7.21(m,1H),6.86(dd,J=2. 4,8.9Hz,4H),5.89(d,J=6.4Hz,1H),5.44-5.36(m,1H),4.99(s,1H),4.89(s,1H),4.78(t,J=5. 8Hz,1H),4.45(td,J=3.0,12.7Hz,1H),4.27(q,J=3.9Hz,1H),3.78(s,6H),3.75-3.70(m,1H),3 .67-3.57(m,1H),3.47-3.40(m,2H),3.39-3.32(m,4H),3.12(s,3H),3.09-2.92(m,5H),2.63(br s,1H),2.30-2.15(m,2H),2.04(br dd,J=4.0,12.9Hz,1H),2.00-1.90(m,4H),1.82(br s,1H),1.79-1.75(m,3H),1.68(s,3H); 13C NMR (101MHz, CD3CN, 298 K)δ(ppm)=170.8,160.1,159.3,158.3,152.1,147.2,146.2,137.9,136 .9,136.9,131.5,131.4,129.4,129.3,128.3,114.5,112.4,87.9,87.6 ,87.3,83.5,83.4,81.8,78.2,78.1,73.1,72.3,66.4,64.4,59.4,56.3 ,52.4,40.2,34.9,34.8,32.5,32.4,28.7,28.6,24.2,23.2,22.3,20.8; 31 P NMR(162MHz,CD3CN)δ 101.9;MS(ESI,m / z)[C 49 H 59 N6O9PS 2+ H + ] Calculated value: 971.35, measured value: 971.1.

[0276] [ka] (3-6) 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2S,3aR,6S,7aR)-3a-methyl-6-(prop-1-en-2-yl)-2-sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-5-methyl-4-(((E)-1-methylpyrrolidin-2-ylidene)amino)pyrimidin-2(1H)-one: white foamy solid, prepared according to general procedure 2 with (+)-PSI reagent; 1H NMR(400MHz,CD3CN,296 K)δ(ppm)=7.57(s,1H),7.50(d,J=7.5Hz,2H),7.40-7.31(m,6H),7.31-7.23(m,1H),6.90(d,J=8.9Hz,4H),6.05(d,J= 5.8Hz,1H),5.49-5.40(m,1H),4.99(s,1H),4.88(s,1H),4.43(td,J=3.1,12.6Hz,1H),4.34(t,J=5.4Hz,1H),4.26(br d,J=3.4Hz,1H),3.85-3.72(m,8H),3.54-3.45(m,4H),3.38(d,J=2.8Hz,2H),3.26(s,3H),3.11-3.05(m,2H),3.03(s,4H),2.62(br s,1H),2.22(br d,J=12.3Hz,1H),2.13-2.01(m,3H),2.01-1.92(m,2H),1.92-1.79(m,2H),1.76(s,3H),1.68(s,3H),1.56(s,3H); 13 C NMR (101MHz, CD3CN, 298 K)δ(ppm)=172.6,170.0,160.2,147.2,146.1,138.4,137.0,136.8,131.5,131.5,129.5,129.4,128.4,114.6,112.5,88.7,88.2,87.8,82. 9,82.9,82.3,82.2,77.7,77.6,73.3,71.8,66.7,63.9,59.5,56.3,5 2.5,40.2,34.9,34.8,32.4,31.8,28.7,28.6,24.2,23.2,22.3,20.8; 31 P NMR(162MHz,CD3CN)δ 101.8;MS(ESI,m / z)[C 49 H 61 N4O9PS 2+ H + ]についての calculated value is 945.36 and measured value is 946.5.

[0277]

change

[0278] [ka] (3-8) (3-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2S,3aR,6S,7aR)-3a-methyl-6-(prop-1-en-2-yl)-2-sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-5-methyl-2,6-dioxo-3,6-dihydropyrimidin-1(2H)-yl)methyl pivalate: (+)-PSI reagent, prepared according to general procedure 2, foamy solid; 1H NMR(400MHz,CD3CN)δ ppm 7.53(1H,s),7.48(2H,d,J=7.63Hz),7.33-7.39(6H,m),7.26-7.32(1H,m),6.92(4H,d,J=8.76Hz),6.01(1H,d,J=6.88H z),5.86-5.92(2H,m),5.45(1H,ddd,J=11.60,4.78,2.75Hz),5.01(1H,s),4.90(1H,s),4.44-4.49(2H,m),4.29(1H,br d,J=2.63Hz),3.80(6H,s),3.76-3.79(1H,m),3.32-3.54(4H,m),3.23(3H,s),2.60-2.66(1H,m),2.24(2H,br d,J=12.76Hz),2.07(1H,br dd,J=13.01,3.75Hz),1.99-2.01(2H,m),1.80-1.92(2H,m),1.78(3H,s),1.68(3H,s),1.46(3H,s),1.18(9H,s); 31 P NMR(162MHz,CD3CN)δ ppm 102.18;MS(ESI,m / z)[C 50 H 63 N2O 12 P.S. 2+ Na + ]Calculated value: 1001.35, measured value: 1001.1.

[0279] General Procedure 3: PS-PSI Monomer to PO-PSI Monomer [ka] (4-1) N-(9-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2S,3aR,6S,7aR)-3a-methyl-2-oxido-6-(prop-1-en-2-yl)hexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-6-oxo-6,9-dihydro-1H-purin-2-yl)isobutyramide:

[0280] To N-(9-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2S,3aR,6S,7aR)-3a-methyl-6-(prop-1-en-2-yl)-2-sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-6-oxo-6,9-dihydro-1H-purin-2-yl)isobutyramide (1 g, 1.042 mmol) in MeCN (15.00 mL, 15 vol) was added SeO2 (1.0 equiv, 0.116 g, 1.042 mmol) in an ice bath. Additional SeO2 (0.116 g, 1.042 mmol) was added at 0 °C until the reaction was complete at 0 °C. A total of 3 equivalents of SeO2 were used. After completion as monitored by UPLC-MS, the mixture was filtered through Celite and dry SiO2 (EtOAc / THF). The filtrate was washed with saturated NaHCO3 (10 mL), dried over Na2SO4, filtered (dry SiO2), and concentrated. The residue was purified by silica gel column chromatography (50 g, Hept / EtOAc, 20 to 100, then EtOAc / THF 0 to 100%) to give 4-1 (0.55 g, 56% yield). MS (ESI, m / z) [C 48 H 58 N5O 11 PS-H + ] Calculated value: 942.36; observed value: 942.53.

[0281] [ka] (4-2) N-(1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2R,3aS,6R,7aS)-3a-methyl-2-oxido-6-(prop-1-en-2-yl)hexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-5-methyl-2-oxo-1,2-dihydropyrimidin-4-yl)benzamide: Prepared according to general procedure 3, white foamy solid; 59% yield; 31 P NMR (162 MHz, acetonitrile-d3) δ 40.36; MS (ESI, m / z) [C 51 H 58 N3O 11 P.S. + H + ]Calculated value: 952.35 Observed value: 952.35.

[0282] [ka] (4-3) 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2R,3aS,6R,7aS)-3a-methyl-2-oxido-6-(prop-1-en-2-yl)hexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione: Prepared according to general procedure 3, white foamy solid; 46% yield; 31 P NMR (162 MHz, acetonitrile-d3) δ 40.42; MS (ESI, m / z) [C 44 H 53 N2O 11 P.S. + Na + ] Calculated value: 871.30, observed value: 871.28.

[0283] PO-PSI Reagents from Cyclohexyl Epoxides: [ka] (5) rac-2-((4-bromophenyl)thio)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-sulfide:

[0284] A solution of triethylamine bis(4-bromophenyl) phosphorotetrathioate (50.0 g, 87.2 mmol) and cyclohexene oxide (13.2 mL, 131 mmol) in chloroform (175 mL) was treated with dibutyl phosphate (16.2 mL, 87.2 mmol) and dichloroacetic acid (10.8 mL, 131 mmol). After stirring at room temperature for 15 h, the mixture was concentrated in vacuo. The residue was diluted with water (125 mL) and n-heptane (125 mL), cooled in an ice bath, and stirred at 0° C. for 2 h. The resulting precipitate was filtered and subsequently washed with water (100 mL) and n-heptane (125 mL). The filter cake was dissolved in CHCl (200 mL) and the aqueous layer was removed. The organic layer was concentrated in vacuo to approximately 50 mL and treated with n-heptane (75 mL). The mixture was stirred at room temperature for 20 min and concentrated in vacuo to approximately 50 mL The resulting precipitate was filtered, washed with n-heptane (20 mL), and dried with a N2 purge for 2 h to give the title compound (30.1 g, 91%). 1 H NMR (400MHz, CDCl3, 296 K) (1:2 mixture of diastereomers) δ(ppm)=7.58-7.51(m,8H),7.47-7.41(m,4H),4.04(dt,J=3.9,10.7Hz,1H),3.65-3.56(m,4H),2.27-2.12(m ,6H),1.89(m,3H),1.81(m,3H),1.75-1.58(m,3H),1.49-1.25(m,8H),1.23-1.16(m,1H),1.07-0.86(m,1H); 31 P NMR(162MHz,CDCl3,296 K)δ(ppm)=107.01(s,1P),103.23(s,2P);MS(ESI)m / z:[M+H] + C 12 H 15 Calculated for BrOPS3 380.91; found 380.84.

[0285] [ka] (6) rac-2-((4-bromophenyl)thio)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-oxide:

[0286] A solution of (3aR,7aR)-2-((4-bromophenyl)thio)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-sulfide (10.0 g, 26.2 mmol) in CHCl (170 mL) was treated with SeO (2.91 g, 26.2 mmol) and stirred at room temperature for 2 h. Additional SeO (2.91 g, 26.2 mmol) was added and stirring was continued at room temperature for another 19 h. The reaction mixture was filtered through a pad of dry silica gel and rinsed with CHCl. ​​The filtrate was washed with 10% NaHPO (70.0 mL), dried over MgSO, and concentrated in vacuo. The residue was treated with n-heptane (46 mL) and the resulting slurry was stirred at room temperature for 20 min. The precipitate was filtered, washed with n-heptane (20 mL), and dried with a N2 purge to give the title compound (6.18 g, 64.5%). 1 H NMR (400MHz, CDCl3,296 K) (approximately 1:2 mixture of two diastereomers) δ(ppm)=7.58-7.48(m,12H),4.10(dt,J=4.1,10.8Hz,1H),3.60(dt,J=3.6,10.8Hz,2H),3.37(dt,J=3.9,10.8Hz,2H),2.43-2 .36(m,1H),2.25-2.07(m,5H),1.98-1.83(m,4H),1.83-1.73(m,3H),1.63-1.48(m,3H),1.46-1.23(m,8H),1.11-0.99(m,1H); 31 P NMR(162MHz,CDCl3,297 K)δ(ppm)=62.54(s,1P),56.98(s,2P);MS(ESI)m / z:[M+H] + C 12 H 15 BrO2PS2 calculated 364.94; measured 364.97.

[0287] General Procedure 4: PO-PSI Monomer [ka] (7-1) 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((3aR,7aR)-2-oxidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-5-methyl-4-(((E)-1-methylpyrrolidin-2-ylidene)amino)pyrimidin-2(1H)-one:

[0288] 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methyl-4-(((E)-1-methylpyrrolidin-2-ylidene)amino)pyrimidin-2(1H)-one (4.30 g, 6.15 mmol) and (3aR,7aR)-2-((4-bromophenyl)thio)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-oxide (3.15 g, 8.62 mmol) were azeotroped three times with acetonitrile (43 mL). The residue was dissolved in acetonitrile (43 mL), cooled to 0° C., and treated with DBU (1.6 mL, 8.3 mmol). The mixture was stirred at 0° C. for 2 h, quenched with saturated NaH2PO4 (40 mL), and diluted with ethyl acetate (50 mL). The organic layer was separated and the aqueous layer was extracted twice with ethyl acetate (50 mL). The organic layers were combined, washed with saturated NaHCO3 (20 mL), dried over MgSO4, and concentrated in vacuo. The residue was purified by silica gel column chromatography (ethyl acetate in n-heptane = 17% to 100% and then THF in ethyl acetate = 0% to 100%) to give the title compound (3.07 g, 57.1%) as a foamy solid. MS(ESI)m / z:[M+H] + C 45 H 56 N4O 10 Calculated PS 875.3; measured 875.1.

[0289] [ka] (7-2) (3aR,7aR)-2-(((2R,3R,4R,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(6-(((E)-1-methylpyrrolidin-2-ylidene)amino)-9H-purin-9-yl)tetrahydrofuran-3-yl)oxy)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-oxide:

[0290] (2R,3R,4R,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(6-(((E)-1-methylpyrrolidin-2-ylidene)amino)-9H-purin-9-yl)tetrahydrofuran-3-ol (2.70 g, 3.81 mmol) and (3aR,7aR)-2-((4-bromophenyl)thio)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-oxide (1.95 g, 5.33 mmol) were azeotroped three times with acetonitrile (25.4 mL) on a rotary evaporator. The residue was dissolved in acetonitrile (25.4 mL), cooled to 0° C., and treated with DBU (0.78 mL, 5.1 mmol). The mixture was stirred at 0° C. for 2 h, quenched with saturated NaH2PO4 (30 mL) and diluted with ethyl acetate (30 mL). The organic layer was separated and the aqueous layer was extracted twice with ethyl acetate (30 mL). The organic layers were combined, washed with saturated NaHCO3 (20 mL), dried over MgSO4 and concentrated in vacuo. The residue was purified by column chromatography (ethyl acetate in n-heptane = 17% to 100%, then THF in ethyl acetate = 0% to 100%) to give the title compound (2.10 g, 62.3%) as a foamy solid. MS(ESI)m / z:[M+H] + C 45 H 54 Calculated value of N6O9PS: 884.33, measured value: 884.45.

[0291] [ka] (7-3) 9-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((3aR,7aR)-2-oxidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-2-((1-methylpyrrolidin-2-ylidene)amino)-1,9-dihydro-6H-purin-6-one:

[0292] Prepared according to general procedure 4; white foamy solid; 80% yield; MS (ESI, m / z) [C 45 H 53 NO 10 P.S. + H + ]Calculated value: 901.33, measured value: 901.1.

[0293] General Procedure 5: Synthesis of Succinic Acid Monomers To the protected nucleoside (1.0 equiv.) and succinic anhydride (1.5 equiv.), DCM (8 vol.) and Et3N (3.0 equiv.) were added at room temperature. The mixture was stirred at room temperature overnight. Phosphate buffer (pH 7, 6 vol.) was added to the mixture and extracted three times with DCM (8 vol.). The organic layer was then concentrated and purified by column chromatography (heptane / EtOAc, 10 to 100%).

[0294] (5-Methyl succinate-C-MOE): [ka] (8) 4-(((2R,3R,4R,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(5-methyl-4-(((E)-1-methylpyrrolidin-2-ylidene)amino)-2-oxopyrimidin-1(2H)-yl)tetrahydrofuran-3-yl)oxy)-4-oxobutanoic acid:

[0295] To 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methyl-4-(((E)-1-methylpyrrolidin-2-ylidene)amino)pyrimidin-2(1H)-one (5 g, 7.155 mmol) and succinic anhydride (1.074 g, 10.732 mmol) in DCM (40.0 mL, 621.71 mmol) was added EtN (2.99 mL, 21.465 mmol) at room temperature. The mixture was stirred at room temperature overnight. To the mixture was added phosphate buffer (pH 7, 30 mL) and extracted with DCM (50 mL x 3). The organic layer was then concentrated and purified by column chromatography (Hept / EtOAc, 10 to 100%) to give 4-(((2R,3R,4R,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(5-methyl-4-(((E)-1-methylpyrrolidin-2-ylidene)amino)-2-oxopyrimidin-1(2H)-yl)tetrahydrofuran-3-yl)oxy)-4-oxobutanoic acid (4.92 g, 6.16 mmol, 86% yield). 1 H NMR(400MHz,CD3CN)δ ppm 7.59(1H,s),7.47(2H,d,J=7.50Hz),7.31-7.39(6H,m),7.24-7.31(1H,m),6.91(4H,d,J=8.63Hz),6.04 (1H,d,J=5.25Hz),5.35(1H,t,J=5.13Hz),4.35(1H,t,J=5.32Hz),4.14-4.25(1H,m),3.79(6H,s),3.74- 3.78(1H,m),3.66(1H,dt,J=11.44,4.28Hz),3.44-3.52(4H,m),3.33-3.40(2H,m),3.26(3H,s),3.05-3 .11(2H,m),3.04(3H,s),2.50-2.65(4H,m),2.00-2.08(2H,m),1.99(1H,s),1.61(3H,s);MS(ESI,m / z)[C 43 H 50 N4O 11 +H +] Calculated value 799.35; observed value 799.9.

[0296] General procedure 6: Solid-phase synthesis of stereocontrolled PS MOE ASOs A general procedure for automated solid-phase synthesis of stereocontrolled PS-oligonucleotides was modified from previously reported procedures in Knouse et al., "Unlocking P(V): Reagents for chiral phosphorothioate synthesis," Science 2018, 361(6408), 1234-1238; and Huang et al., "AP(V) platform for oligonucleotide synthesis," Science 2021, 373(6560), 1265-1270.

[0297] Automated Solid Phase Oligonucleotide Synthesis: Part 1. Loading onto the resin: Preparation of 1mer [ka] TentaGel S-NH2 (AC354610050, ACROS Organics, loading 0.2-0.3 mmol / g) (4 g, ca. 1 mmol) was placed in a 50 mL solid-phase reaction flask and washed with DMF (10 mL × 3), DCM (10 mL × 3) and DMF (10 mL × 3). To this resin was added N-(((9H-fluoren-9-yl)methoxy)carbonyl)-N-methylglycine (3.11 g, 10.00 mmol) in DMF (5.00 mL) and ((3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)oxy)tri(pyrrolidin-1-yl)phosphonium hexafluorophosphate (V) (5.21 g, 10.00 mmol) in DMF (5 mL) followed by N-4-methylmorpholine (2199 mL, 20.00 mmol) at room temperature. It was shaken at 400 rpm. After 24 hours, the liquid was drained and the resin was rinsed with DMF (10 mL x 3), DCM (10 mL x 3) and DMF (10 mL x 3). To this resin was added premixed pyridine (4.85 mL, 60.00 mmol) and Ac2O (0.944 mL, 10.00 mmol) at room temperature. After 3 min, the solution was drained and premixed pyridine (4.85 mL, 60.00 mmol) and Ac2O (0.944 mL, 10.00 mmol) were added at room temperature. After 3 min, the liquid was drained and the resin was washed with DMF (10 mL x 3), DCM (10 mL x 3) and DMF (10 mL x 3).

[0298] The resin was then treated with 30 mL of 20% piperidine in DMF and the solution was collected after 3 min. This procedure was repeated 5 times and the resin was washed with DMF (10 mL x 3), DCM (10 mL x 3) and DMF (10 mL x 3). In a volumetric flask, the collected solution was made up to 300 mL with a solution of 20% piperidine in DMF. An aliquot of this solution was diluted 10-fold with 20% piperidine in DMF and the UV absorbance of the piperidine-fulvene adduct was measured (λ = 301 nm, ε = 7800 M). -1 cm -1 , A = 2.41), and an estimated loading of 230 μmol / g was obtained.

[0299] The resin was washed with DMF (10 mL x 3), DCM (10 mL x 3) and DMF (10 mL x 3). The resin was added with 4-(((2R,3R,4R,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(5-methyl-4-(((E)-1-methylpyrrolidin-2-ylidene)amino)-2-oxopyrimidin-1(2H)-yl)tetrahydrofuran-3-yl)oxy)-4-oxobutanediol in DMF (5 mL). Acid (1.5 equiv., 1.198 g, 1.5 mmol)), followed by ((3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)oxy)tri(pyrrolidin-1-yl)phosphonium hexafluorophosphate (V) (1.7 equiv., 0.886 g, 1.7 mmol) and N-4-methylmorpholine (2 equiv., 0.258 g, 2 mmol) in DMF (5 mL). The mixture was shaken at room temperature for 3 days and washed with DMF (10 mL x 3), DCM (10 mL x 3) and DMF (10 mL x 3).

[0300] The resin was washed with DMF (10 mL x 3), DCM (10 mL x 3). It was treated with 3% dichloroacetic acid (DCA) in DCM (20 mL) for 2 min, followed by a DCM (20 mL) wash to remove the DMTr groups. This procedure was repeated (5 more times) until no color was observable. The resin was then washed with DCM (10 mL x 3), DMF (10 mL x 3) and MeCN (10 mL x 3).

[0301] The combined deprotection solution was diluted with 3% DCA in DCM. The UV absorbance of the DMTr cation was measured (λ = 410 nm, ε = 30,400 M -1 cm -1 ), and the loading was quantified (0.2 mmol / g).

[0302] Part 2. Automated synthesis on the K&A H-8-SE oligosynthesizer The prepared 5'-O-DMTr-nucleotide loaded TentaGel-SAR (20 μmol, 200 μmol / g) was loaded into an empty 6 mL syringe column (Biocomma Limited, Cat. No. RSSC-6) and washed with MeCN. Stereopure oligonucleotides were synthesized after cycles shown in Table 15 using stereopure PSI and PO-PSI monomers on a K&A H-8-SE oligosynthesizer. As shown in the following scheme: Sp phosphorothioate bond was obtained using Rp-PSI-monomer prepared from (-)-PSI reagent; Rp phosphorothioate bond was obtained using Sp-PSI-monomer synthesized from (+)-PSI, and PO internucleotide bond was obtained using PO-PSI monomer. 1 . [ka]

[0303] Monomer in the synthesis of Sp, Rp phosphorothioate and PO (phosphodiester) internucleotide linkages.

[0304] [Table 34]

[0305] Analytical HPLC Method 1-RP HPLC-Mass: Column: Acquity UPLC BEH C18 1.7 μm 2.1 × 50 mm (Part number: 186002350); Solvent: Buffer A (10 mM ammonium bicarbonate in water), Buffer B (100 mM ammonium bicarbonate / MeOH / MeCN = 10 / 10 / 80); Temperature: 60 °C; Flow rate: 0.8 mL / min; Gradient: 5 to 99% B gradient (6 min).

[0306] Part 3. Cleavage from the resin and deprotection: After the completion of the last cycle (DMTr on), the resin in cleavage solution (28% NH4OH / NH4OAc / EtOH (10 / 1 / 1, approximately 1 mL / 1 μmol) was heated at 65 °C for 2 days in a closed bottle. It was cooled to room temperature, filtered, and then concentrated. Failed sequences were removed and the DMTr group was deprotected by the following C18 cartridge protocol. The collected fractions were concentrated and purified by ion-pairing reversed-phase (IR-RP) HPLC.

[0307] C18 Column Protocol: A Sep-Pak cartridge [Waters, Sep-Pak Vac 35 cc (10 g) C18 cartridge] was equilibrated with MeOH (2 CV), MeCN (2 CV) followed by 2N Et3NHOAc (2 column volumes (CV)). The crude sample in 0.1N Et3NHOAc was loaded onto the cartridge. The truncated sequence was eluted by washing the cartridge with 2N NaCl / MeCN (5 / 1, v / v), 3% TFA in water (150 mL), then water (50 mL). The crude DMTr-off PS-oligonucleotide was eluted with 50 mL of acetonitrile-water (1:1, v / v) containing 0.5% of 28% NH4OH. The solution containing the DMTr-off oligonucleotide was dried under vacuum. The weight was measured by Nanodrop (RNA-40) and 31 P NMR was taken and analyzed by RP-HPLC, IEX-HPLC and UPLC / MS.

[0308] Analytical HPLC Method 2 - Ion Pairing RP HPLC-Mass: Column: XBridge Premier BEH C18 (2.5 μm, 150 × 2.1 mm); Temperature: 60 °C; Flow rate: 1 mL / min; Detection wavelength: 260 nm; Solvents: Buffer A: 100 mM HFIP / 8.6 mM Et3N(H2O), Buffer B: 100% MeOH; Gradient: 5% to 30% B gradient (15 min).

[0309] Analytical HPLC Method 3 - Ion Pairing RP HPLC-Mass: Column: XBridge Premier BEH C18 (300 Å, 2.5 μm, 150 × 2.1 mm); Temperature: 60 °C, Flow rate: 0.5 mL / min; Detection wavelength: 260 nm; Solvent: Buffer A: 100 mM n-C6H 13 NH3OAc(H2O / MeCN 9 / 1) Buffer B: 100mM C6H 13 NH3OAc (H2O / MeCN 1 / 1); Gradient: 80% to 100% B gradient (15 min).

[0310] Analytical HPLC Method 4 - Ion Pairing RP HPLC-Mass: Column: XBridge Premier BEH C18 (300 Å, 2.5 μm, 150 × 2.1 mm); Temperature: 60 °C, Flow rate: 0.5 mL / min. Detection wavelength: 260 nm; Solvents: Buffer A: 10 mM n-hexylamine / 50 mM HFIP in water, Buffer B: MeCN; Gradient: 23-28% Buffer B gradient (15 min).

[0311] Part 4. HPLC purification and desalting: The crude material after SepPak treatment was purified by ion-pairing RP HPLC using sterile water (WFI from Baxter, VWR, catalog 68000-955) according to the following method.

[0312] Preparative HPLC method 1: Column: XBridge Prep C18 OBD Prep (10 μm, 19 x 250 mm); flow rate: 30 mL / min. Detection wavelength: 260 nm; Solvent: Buffer A: 8.6mM TEA / 100mM HFIP in water, Buffer B: MeOH; Gradient: 10-37% Buffer B gradient (30 min).

[0313] Preparative HPLC Method 2: Column: Xbridge BEH C18 (10 μm, 10×250 mm); Flow rate: 14 mL / min. Detection wavelength: 260 nm; Solvent: Buffer A: 100 mM C6H 13 NH3OAc(H2O / MeCN 9 / 1), Buffer B: 100mM C6H 13NH3OAc (H2O / MeCN 1 / 1); Gradient: 50% to 75% gradient (26 min)

[0314] Preparative HPLC method 3: Column: XBridge C18 OBD Prep (300 Å, 5 μm, 19 × 250 mm); flow rate: 30 mL / min; detection wavelength: 260 nm; solvent: Buffer A: 10 mM HA / 50 mM HFIP in water, Buffer B: MeCN; Gradient: 23–28% Buffer B gradient (30 min).

[0315] Fractions containing the desired compound were concentrated and dissolved in 0.2N NaCl in EtOH / water (1 / 4). The resulting solution was desalted by membrane filtration using a 3000 MW cutoff (3K centrifuge membrane tubes, Amicon Ultra-15, Ultracel-3K (3400 rpm, 45 min) (catalog UFC900396 from Sigma-Aldrich) or Macrosep Devices (catalog MAP003C38) from PALL, 3400 rpm, 40 min, 15 mL WFI x 3). The final desalted solution was filtered (0.2 micron sterile syringe filter). The absorbance of the diluted solution was measured at 260 nm on a Nanodrop UV-Visible spectrophotometer to determine the yield (7-15% yield) and the endotoxin level was confirmed to be less than 0.06 EU / mg by the kinetic chromogenic LAL method (Charles River, Endosafe® nexgen-PTS).

[0316] Part 5. Reverse complementary RNA and Tm measurement by NMR Tm measurement device: Shimadzu UV-2700 UV-visible spectrophotometer

[0317] Protocol 1: ASO samples were prepared at a concentration of 400 μM using deionized water. Reverse complementary RNA (rcRNA) from IDT was dissolved at 400 μM using ultrapure distilled water. A 10 μL aliquot of each stock solution was diluted to 1 mL using ultrapure distilled water, and the actual concentration was measured by UV-Visible Spectrophotometer. Test samples (500 μL) were prepared containing 4.0 μM ASO with 4.0 μM rcRNA in buffer (100 mM NaCl, 10 mM Na phosphate pH 7.0, containing 0.1 mM EDTA). Test samples were incubated in 1 mL cuvettes and heated from 15°C to 105°C at 0.5°C / min. The increase in UV absorbance due to strand melting was monitored at 260 nm. Prior to this experiment, samples were melted and reannealed by heating from 25° C. to 95° C. at 5° C. / min and cooling to the starting temperature to ensure complete annealing. Shimadzu Tm analysis software was used to calculate the Tm using the derivative (curve inflection point: 50% melting).

[0318] Protocol 2: Prepare ASO samples at a concentration of 200 µM using PBS, then follow the same procedure as in Protocol 1 with adjusted volumes.

[0319] In stock phosphate buffer (100 mM, pD=7.4) prepared with 135.5 mg K2DPO4 and 31.2 mg KD2PO4 in 10 mL D2O after C18 purification and DMTr deprotection. 31 P NMR (162MHz) 3 See Evstigneev et al., "Hexamer oligonucleotide topology and assembly under solution phase NMR and theoretical modeling scrutiny," Biopolymers 2010, 93(12), 1023-1038.

[0320] Exemplary Compounds All nucleotides are 2'-MOE unless otherwise specified, and "C" represents 5'-methylcytosine.

[0321] A. Compound MOE-277:20mer, all Sp [ka] Purified by preparative HPLC method 1: C 260 H 372 N 83 O 133 P 19 S 19 Mw=7985.47 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1995.36, but was detected by low resolution mass spectrometry at m / z 1995.05; Tm=57.8° C. using Protocol 1 (sterically random Tm=66.5° C.). The Tm of MOE-277 is shown in FIG.

[0322] B. Compound MOE-278:20mer, all Rp [ka] Purified by preparative HPLC method 2: C 260 H 372 N 83 O 133 P 19 S 19 Mw=7985.47 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1995.36, but was detected by low resolution mass spectrometry at m / z 1995.492; Tm=71.5° C. using Protocol 1 (sterically random Tm=66.5° C.). The Tm of MOE-278 is shown in FIG.

[0323] C. Compound MOE-279:20mer, 4Rp [ka] Purified by preparative HPLC method 1: C 260 H 372 N 83 O 133 P 19 S 19 Mw=7985.47 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1995.36, but it was detected by low-resolution mass spectrometry at m / z 1995.25. Tm=61.4°C by protocol 1 (sterically random Tm=66.5°C).

[0324] D. Compound MOE-280:20mer, 5Rp [ka] Purified by preparative HPLC method 1: C 260 H 372 N 83 O 133 P 19 S 19 Mw=7985.47 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1995.36, but it was detected by low-resolution mass spectrometry at m / z 1994.88. Tm=62.7°C by protocol 1 (sterically random Tm=66.5°C).

[0325] E. Compound MOE-281:20mer, 7Rp [ka] Purified by preparative HPLC method 1: C 260 H 372 N 83 O 133 P 19 S 19 Mw=7985.47 was used, the most abundant natural isotope [M-4H] 4-The theoretical ion value was m / z 1995.36, but it was detected by low-resolution mass spectrometry at m / z 1995.06. Tm=62.3°C by protocol 1 (sterically random Tm=66.5°C).

[0326] F. Compound MOE-282:20mer, 7Rp [ka] Purified by preparative HPLC method 1: C 260 H 372 N 83 O 133 P 19 S 19 Mw=7985.47 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1995.36, but it was detected by low-resolution mass spectrometry at m / z 1994.81. Tm=63.5°C by protocol 1 (sterically random Tm=66.5°C).

[0327] G. Compound MOE-283:20mer, 9Rp [ka] Purified by preparative HPLC method 1: C 260 H 372 N 83 O 133 P 19 S 19 Mw=7985.47 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1995.36, but it was detected by low-resolution mass spectrometry at m / z 1995.43. Tm=64.8°C by protocol 1 (sterically random Tm=66.5°C).

[0328] H. Compound MOE-284:20mer, 10Rp [ka] Purified by preparative HPLC method 1: C 260 H 372 N 83 O 133 P 19 S 19 Mw=7985.47 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1995.36, but was detected by low resolution mass spectrometry at m / z 1994.96; Tm=66.2° C. using protocol 1 (sterically random Tm=66.5° C.).

[0329] I. Compound MOE-285:20mer, 9Rp [ka] Purified by preparative HPLC method 1: C 260 H 372 N 83 O 133 P 19 S 19 Mw=7985.47 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1995.36, but was detected by low resolution mass spectrometry at m / z 1995.50; Tm=63.4° C. using protocol 1 (sterically random Tm=66.5° C.).

[0330] J. Compound MOE-286:20mer, 13Rp [ka] Purified by preparative HPLC method 2: C 260 H 372 N 83 O 133 P 19 S 19 Mw=7985.47 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1995.36, but it was detected at m / z 1994.55 by low-resolution mass spectrometry.

[0331] K. Compound MOE-287:20mer, 3Rp [ka] Purified by preparative HPLC method 2: C 260 H 372 N 83 O 133 P 19 S 19 Mw=7985.47 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1995.36, but was detected by low resolution mass spectrometry at m / z 1995.08; Tm=59.7° C. using protocol 1 (sterically random Tm=66.5° C.).

[0332] Figure 20 shows the Tm of MOE-012, MOE-277, and MOE-278. Figure 21 shows the Tm of MOE-277 to MOE-287.

[0333] L. Compound MOE-288:18mer, all Sp [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 119 P 17 S 17 Mw=7186.34 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1795.59, but was detected by low resolution mass spectrometry at m / z 1795.45; Tm=58.4° C. with protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 56.09,55.82,55.78,55.56,55.52,55.32,55.21,55.15,55.06

[0334] M. Compound MOE-289:18mer, all Rp [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 119 P 17 S 17 Mw=7186.34 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1795.59, but was detected by low resolution mass spectrometry at m / z 1795.38; Tm=70.4° C. using protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 56.09,55.82,55.78,55.56,55.52,55.32,55.21,55.15,55.06

[0335] N. Compound MOE-290:18mer, 11Rp [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 119 P 17 S 17 Mw=7186.34 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1795.59, but was detected by low resolution mass spectrometry at m / z 1795.57; Tm=66.6° C. with protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 58.53,58.22,58.08,57.82,57.60,57.40,57.12,55.67,55.54,55.30,55.12

[0336] O. Compound MOE-291:18mer, 8Rp [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 119 P 17 S 17 Mw=7186.34 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1795.59, but was detected by low resolution mass spectrometry at m / z 1795.31; Tm=62.5° C. using protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 57.07,56.83,56.71,56.54,56.31,55.16,54.81,54.33,54.24,54.12,54.23

[0337] P. Compound MOE-292:18mer, 8Rp [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 119 P 17 S 17 Mw=7186.34 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1795.59, but was detected by low resolution mass spectrometry at m / z 1794.95; Tm=62.6° C. with protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 60.01,59.40,59.36,58.87,58.50,58.14,57.67,57.37,57.15,56.66,56.48,55.83,55.55,55.26

[0338] Figure 22 shows the TM of MOE-288 to MOE-292. Figure 23 shows an example of an overlay HPLC chromatogram (MOE-252 and MOE-288 to MOE-292 by analytical HPLC method 4.

[0339] Q. Compound MOE-293: 18mer, 4Rp [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 119 P 17 S 17 Mw=7186.34 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1795.59, but was detected by low resolution mass spectrometry at m / z 1795.95; Tm=59.5° C. with protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 56.79,56.19,55.09,54.93,54.85,54.67,54.53

[0340] R. Compound MOE-294:18mer, 6Rp [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 119 P 17 S 17 Mw=7186.34 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1795.59, but was detected by low resolution mass spectrometry at m / z 1795.54; Tm=59.7° C. using protocol 2 (sterically random Tm=65.9° C.). 31P NMR(162MHz)δ ppm 57.84,57.43,57.17,56.92,56.80,55.98,55.86,55.62,55.58,55.46,55.27,55.11,55.06,55.00

[0341] S. Compound MOE-295:18mer, 4Rp [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 119 P 17 S 17 Mw=7186.34 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1795.59, but was detected by low resolution mass spectrometry at m / z 1795.82; Tm=60.6° C. with protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 57.71,57.25,57.06,56.11,55.79,55.68,55.48,55.35,55.21,55.11

[0342] T. Compound MOE-296:18mer, 2Rp / 2PO [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 121 P 17 S 15 Mw=7154.38 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1787.59, but was detected by low resolution mass spectrometry at m / z 1787.56; Tm=61.3° C. with protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 58.26,58.20,57.84,57.65,57.49,57.40,57.16,56.97,0.33

[0343] U. Compound MOE-297:18mer, 4Rp / 2PO [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 121 P 17 S 15 Mw=7154.38 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1787.59, but was detected by low resolution mass spectrometry at m / z 1787.35; Tm=62.7° C. with protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 57.24,57.04,56.42,56.36,55.83,55.69,55.56,55.36,55.17,55.07,54.64,-1.03,-1.13

[0344] V. Compound MOE-298:18mer, 2Rp / 2PO [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 121 P 17 S 15 Mw=7154.38 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1787.59, but was detected by low resolution mass spectrometry at m / z 1787.40; Tm=61.6° C. with protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 57.20,57.08,56.77,56.55,56.17,56.10,-0.72

[0345] W. Compound MOE-299:20mer, 2Rp / 2PO [ka] Purified by preparative HPLC method 3: C 260 H 372 N 83 O 135 P 19 S 17 Mw=7950.51 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1986.62, but was detected by low resolution mass spectrometry at m / z 1987.01; Tm=61.5° C. using protocol 1 (sterically random Tm=69.6° C.). 31 P NMR(162MHz)δ ppm 57.48,57.22,56.14,55.90,55.65,55.77,55.38,55.30,55.25,55.21,55.06,54.94,-0.95,-0.99

[0346] Figure 24 shows the TM of MOE-252 and MOE-293 to MOE-298. Figure 25 shows the TM of MOE-029 and MOE-299.

[0347] X. Compound MOE-300:18mer, 6Rp / 2PO [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 121 P 17 S 15 Mw=7154.38 was used, the most abundant natural isotope [M-4H] 4-The theoretical ion value was m / z 1787.59, but was detected by low resolution mass spectrometry at m / z 1787.49; Tm=63.2° C. with protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 58.39,58.07,57.85,57.69,56.36,56.06,55.78,55.70,55.57,55.38,55.33,55.29,-0.97

[0348] Y. Compound MOE-301:18mer, 5Rp / 2PO [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 121 P 17 S 15 Mw=7154.38 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1787.59, but was detected by low resolution mass spectrometry at m / z 1787.66; Tm=62.2° C. using protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 58.57,58.02,57.81,57.65,56.31,56.02,55.73,55.64,55.52,55.33,55.27,55.25,55.11,-1.00

[0349] Z. Compound MOE-303:18mer, 3PO [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 122 P 17 S 14Mw=7137.40 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1783.25, but was detected by low resolution mass spectrometry at m / z 1782.76; Tm=59.5° C. using protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 56.36,56.11,55.93,55.84,55.69,55.64,55.53,55.38,-0.88,-0.97

[0350] AA. Compound MOE-304: 18mer, 5PO [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 124 P 17 S 12 Mw=7106.45 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1775.61, but was detected by low resolution mass spectrometry at m / z 1775.83; Tm=61.6° C. using protocol 2 (sterically random Tm=65.9° C.). 31 P NMR (162MHz, solvent) δ ppm 56.29,55.75,55.71,55.65,55.53,55.42,-0.62,-0.79,-0.89,-0.98

[0351] BB. Compound MOE-305: 18mer, 4PO [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 123 P 17 S 13Mw=7122.43 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1779.50, but was detected by low resolution mass spectrometry at m / z 1779.42; Tm=61.4° C. with protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 55.54,55.49,55.72,55.26,55.14,55.11,54.98,-1.02,-1.06,-1.14,-1.47

[0352] CC. Compound MOE-306:18mer, 3PO [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 122 P 17 S 14 Mw=7137.40 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1783.25, but was detected by low resolution mass spectrometry at m / z 1783.54; Tm=60.3° C. with protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 56.18,55.88,55.53,55.37,55.30,55.64,55.16,55.07,-0.84,-0.90,-0.95

[0353] DD. Compound MOE-307:18mer, 2PO [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 121 P 17 S 15Mw=7154.38 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1787.59, but was detected by low resolution mass spectrometry at m / z 1788.19; Tm=59.0° C. using protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 56.03,55.84,55.70,55.56,55.45,55.27,55.24,55.11,54.95,-1.10,-1.20

[0354] EE. Compound MOE-308: 20mer, 2PO [ka] Purified by preparative HPLC method 3: C 260 H 372 N 83 O 135 P 19 S 17 Mw=7950.51 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1986.62, but was detected by low resolution mass spectrometry at m / z 1986.92; Tm=58.5° C. using protocol 1 (sterically random Tm=69.6° C.). 31 P NMR(162MHz)δ ppm 55.91,55.76,55.52,55.20,55.10,54.99,54.89,-0.99,-1.05,-1.09

[0355] FF. Compound MOE-309:20mer, 4PO [ka] Purified by preparative HPLC method 3: C 260 H 372 N 83 O 137 P 19 S 15Mw=7919.50 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1978.87, but was detected by low resolution mass spectrometry at m / z 1978.66; Tm=62.8° C. using protocol 1 (sterically random Tm=69.6° C.). 31 P NMR(162MHz)δ ppm 55.83,55.65,55.50,55.41,55.19,55.02,55.11,54.77,-1.04,-1.11,-1.15,-1.55

[0356] GG. Compound MOE-310:18mer, 5R / 2PO [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 121 P 17 S 15 Mw=7154.38 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1787.59, but was detected by low resolution mass spectrometry at m / z 1787.64; Tm=63.4° C. with protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 58.22,57.54,56.08,55.88,55.41,55.26,55.17,55.10,55.04,54.95,-1.02

[0357] HH. Compound MOE-311:18mer, 4R / 2PO [ka] Purified by preparative HPLC method 3: C 234 H 335 N 76 O 121 P 17 S15 Mw=7154.38 was used, the most abundant natural isotope [M-4H] 4- The theoretical ion value was m / z 1787.59, but was detected by low resolution mass spectrometry at m / z 1787.34; Tm=61.0° C. using protocol 2 (sterically random Tm=65.9° C.). 31 P NMR(162MHz)δ ppm 58.21,57.66,56.05,55.89,55.57,55.48,55.38,55.28,55.26,55.05,54.96,-1.03,-1.25

[0358] Example 14: In vitro assay to evaluate the skipping efficiency of phosphorothioate (PS) oligonucleotides in mouse BMDMs. Freshly isolated mouse BMDM cells were cultured and maintained using appropriate medium (Dulbecco's modified Eagle's medium containing 10% fetal bovine serum) + recombinant mouse CSF. The assay was performed in a 96-well plate format, seeded at approximately 30,000 cells per well, and treated with ASO at concentrations of 1 μM, 3 μM, and 10 μM without the addition of lipofectamine. Cells were incubated at 37° C. in a cell culture incubator for 48 hours before isolating total RNA. Total RNA was isolated and converted to cDNA according to the vendor's protocol, and then Taqman gene expression assays were used to quantify CD33 with exon-2 skipping (forward primer: CGCTGCTGCTACTGCTG (SEQ ID NO: 207); reverse primer: TTCTAGAGTGCCAGGGATGA (SEQ ID NO: 208); and probe: TGTGGGCAGACTTGACCCACAG (SEQ ID NO: 209)) and CD33 without exon-2 skipping (forward primer: GGATGGAGAGAGGAAGTA (SEQ ID NO: 210); reverse primer: GTGCCAGGGATGAGGATTT (SEQ ID NO: 211); and probe: TGCATGTGACAGACTTGACCCACA (SEQ ID NO: 212)) mRNA transcripts. Target transcript expression was normalized using mouse housekeeping gene HPRT1 (Assay ID: Hs02800695_m1; ThermoFisher Scientific) expression. The non-targeting (NTC) MOE sequence CCTTCCCTGAAGGTTCCTCC (SEQ ID NO: 257) was used (Mullick et al. (2011) J. Lipid Res. 52, 885). In vitro skipping data for selected ASOs listed in Tables 13 and 14 are shown in Tables 16, 17, 18, 19, 20, and 21.

[0359] [Table 35]

[0360] [Table 36]

[0361] [Table 37]

[0362] [Table 38]

[0363] [Table 39]

[0364] [Table 40]

[0365] Selected ASO sequences were tested for their efficacy in inducing exon-2 skipping in CD33 gene transcripts in U-118MG glioblastoma cells in vitro. The experimental details were the same as those used in Example 4 (Determination of splice regulatory properties of CD33 exon-2 targeting oligonucleotides / In vitro assay method / Determination of MOE-ASO sequences). In this experiment, MOE-ASO was assayed at 3.33 nM, 10 nM and 30 nM concentrations. The data are shown in Table 22.

[0366] [Table 41]

[0367] Example 15: In vivo assay methods. A humanized CD33 mouse model was used to study the CD33 exon-2 skipping ASO. CRISPR / Cas9-mediated gene editing was used to replace mouse CD33 with human genomic CD33, including the signal peptide. The mouse 3' and 5' untranslated regions were retained. For in vivo experiments, a mixed male and female cohort of human CD33 mouse strains on a C57BL / 6 background was used, and mice were 12-24 weeks old at the time of treatment.

[0368] On day 1, the appropriate dose of ASO was administered as a 10 μL bolus into the right lateral ventricle by intracerebroventricular injection. Mice were necropsied 14 days after injection unless otherwise noted. At necropsy, mice were perfused transcardially with PBS under Avertin anesthesia. Brains were rapidly removed from the skull, and the cortex and hippocampus were dissected from the injected hemisphere for exon skipping assessment. For RNA isolation, frozen tissues were added with 9 volumes of Trizol and homogenized for 3 min. 500 μL of Trizol lysate was transferred to a 1 mL deep-well plate. Each sample was added with 100 μL of chloroform, shaken vigorously, and centrifuged at 4000 × g for 5 min. Supernatants (250 μL) were transferred to a binding plate from the SV96 Total RNA Extraction Kit (Promega), and RNA was extracted following the same protocol. Total RNA was isolated and converted to cDNA following the SV96 protocol (Promega), then Taqman gene expression assays were used to quantify exon-2 skipped CD33 mRNA transcripts. Mouse housekeeping gene HPRT1 expression was used to normalize target transcript expression. Data can be expressed as fold change in exon-2 skipped CD33 mRNA compared to PBS treatment group. Alternatively, data can be expressed as the relative amount (%) of exon-2 skipped CD33 mRNA in vivo compared to PBS control. In vivo skipping data for selected sequences listed in Tables 13 and 14 are shown in Figures 22-28. In vivo dose response of MOE-279 is shown in Figure 29. Duration of effect of MOE-277 after a single ICV dose of 100 μg is shown in Figure 30.

[0369] Example 16: Hybridization ELISA to determine ASO concentrations in brain tissue. The concentration of ASO in mouse cortex and hippocampus was quantified using a hybridization-based immunoassay method (HELISA). Two single-stranded DNA oligonucleotides with complementary sequences to MOE-277 were designed as a detection probe: TCTTTCGGAT / 3'-Bio (TCTTTCGGAT (SEQ ID NO: 258)); and a capture probe: 5'-DigN / GGTTCATACT (GGTTCATACT (SEQ ID NO: 259)) (Integrated DNA Technologies, Coralville, IA).

[0370] Tissues were lysed in TRIzol, 1:10 (Thermo Fisher Scientific, Waltham, MA) and diluted in hybridization buffer (1:100, 1M NaCl and 0.1% Tween20 in TE buffer). Calibrators and quality control (QC) samples were prepared by spiking MOE-277 in the diluted tissue homogenates. 35 μL of diluted samples, calibrators and QCs were transferred to a 96-well PCR plate. 35 ul of detection probe solution (100 nM in hybridization buffer) was added to the PCR plate containing calibrators and samples. Samples and detection probes were hybridized in a thermal cycler under the following conditions: 95°C for 10 min, 37°C for 60 min, and a final hold at 4°C.

[0371] MSD Gold 96-well streptavidin SECTOR plates (Meso Scale Diagnostics, LLC., Rockville, MD) were blocked with 150 μL of casein in TBS blocker (Thermo Fisher Scientific, Waltham, MA) for 1.5 hours at room temperature. After washing, 25 μL of capture probe (200 nM in hybridization buffer) was added to the MSD plate and incubated for 1 hour at 37° C. and 300 rpm. After a washing step, 25 μL of samples, calibrators and QCs were transferred in duplicate to the MSD plate and incubated for 1 hour at 37° C. on a shaking platform (300 rpm). The plate was then washed three times and incubated for 1 hour with 50 μL of 1 μg / mL ruthenium-labeled anti-digoxigenin antibody in TBS blocking buffer and casein in 0.05% Tween 20.

[0372] After the final wash, 150 μL of 2× MSD Read Buffer T (Meso Scale Diagnostics, LLC., Rockville, MD) was added and the plate was read on an MSD Sector S 600 instrument (Meso Scale Diagnostics, LLC., Rockville, MD). The concentration of the reference compound was calculated from the signal intensity by interpolation from the calibration curve using a four-parameter logistic (4PL) model (weighting factor = 1 / Y2) by performing nonlinear regression analysis in Discovery Workbench 4.012.1 (Meso Scale Diagnostics, LLC., Rockville, MD). The PK data analysis of MOE-277 duration is shown in FIG. 31.

[0373] Those skilled in the art will appreciate that the present disclosure may be modified in ways not specifically described herein. The present disclosure is not limited in scope by the specific embodiments described herein, which are for illustrative purposes only. The present disclosure includes any modifications and variations, including all functionally equivalent products, compositions, and methods.

[0374] The entire disclosures of all publications cited herein are hereby incorporated by reference without any admission that any such publication constitutes prior art or is part of the common general knowledge of those skilled in the art.

Claims

1. 1. An antisense oligonucleotide of 16-30 nucleotides in length, wherein said antisense oligonucleotide is complementary to a portion of SEQ ID NO:1, and said antisense oligonucleotide has a CD33 exon-2 skipping efficiency of 30% or greater according to a standard exon skipping efficiency assay for said antisense oligonucleotide.

2. 2. The antisense oligonucleotide of claim 1, which is 18 to 30 nucleotides in length, 21 to 30 nucleotides in length, 21 to 25 nucleotides in length, 18 to 21 nucleotides in length, 18 to 25 nucleotides in length, 25 to 30 nucleotides in length, 21 nucleotides in length, 25 nucleotides in length, or 18 nucleotides in length.

3. a. SEQ ID NO:213; b. SEQ ID NO:214; c. SEQ ID NO:215; d. SEQ ID NO:216; e. SEQ ID NO:217; f. SEQ ID NO:218; g. SEQ ID NO:219; and / or h. SEQ ID NO: 220 The antisense oligonucleotide of claim 1 which is complementary to a portion of

4. The antisense oligonucleotide of claim 1, comprising at least one non-natural sugar moiety, at least one non-natural internucleotide linkage, or at least one non-natural sugar moiety and at least one non-natural internucleotide linkage.

5. The antisense oligonucleotide of claim 4, comprising at least one unnatural sugar moiety, wherein the unnatural sugar moiety comprises 2'-O-methoxyethyl ribose (2'-O-MOE) and has a CD33 exon-2 skipping efficiency of 30% or greater according to a standard exon skipping efficiency assay for MOE ASO.

6. The antisense oligonucleotide of claim 4, comprising a phosphorodiamidate morpholino oligomer (PMO) and having a CD33 exon-2 skipping efficiency of 30% or greater according to a standard exon skipping efficiency assay for PMO ASO. 。

7. The antisense oligonucleotide of claim 4, comprising a non-natural internucleotide bond, wherein the non-natural internucleotide bond is sterically pure.

8. The antisense oligonucleotide of claim 7 , wherein the non-natural internucleotide linkages are all Sp.

9. The antisense oligonucleotide of claim 7 , wherein the non-natural internucleotide linkages are all Rp.

10. The antisense oligonucleotide of claim 7, wherein the non-natural internucleotide linkages are independently selected from Sp and Rp.

11. The antisense oligonucleotide of claim 4, comprising a non-natural internucleotide bond, wherein the non-natural internucleotide bond is spatially random.

12. The antisense oligonucleotide of claim 1, comprising at least one modified nucleobase, wherein the modified nucleobase is a 5-substituted pyrimidine, a 6-azapyrimidine, an N-2 substituted purine, an N-6 substituted purine, an O-6 substituted purine, a 2-aminopropyladenine, a 5-propynyluracil, a 5-propynylcytosine, or a 5-methylcytosine.

13. a. PMO-002 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO:2); b. PMO-003 (5'-CCTGTCACATGCACAGAGAGCTGGG-3') (SEQ ID NO:3); c. PMO-036 (5'-TTGTAACTGTATTTGGTACTTCCTC-3') (SEQ ID NO:36); d. PMO-037 (5'-ACTGTATTTGGTACTTCCTCTCTCC-3') (SEQ ID NO:37); e. PMO-004 (5'-ATTTGGTACTTCCTCTCTCCATCCG-3') (SEQ ID NO: 4); f. PMO-038 (5'-GTACTTCCTCTCTCCATCCGAAAGA-3') (SEQ ID NO:38); g. PMO-039 (5'-TCCTCTCTCCATCCGAAAGAAGTAT-3') (SEQ ID NO:39); h. PMO-005 (5'-TCTCCATCCGAAAGAAGTATGACC-3') (SEQ ID NO:5); i. PMO-082 (5'-TAGTAGGGTATGGGATGGAAGAAAAG-3') (SEQ ID NO:82); j. PMO-083 (5'-GGGTATGGGATGGAAGAAAGTGCAG-3') (SEQ ID NO: 83); k. PMO-006 (5'-TGGGATGGAAGAAAAGTGCAGGGCAC-3') (SEQ ID NO: 6); l. MOE-009 (5'-CACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 9); m. MOE-128 (5'-GCACAGAGAGCTGGGGAGAT-3') (SEQ ID NO: 128); n. MOE-010 (5'-GAGAGCTGGGGAGATTTGTA-3') (SEQ ID NO: 10); o. MOE-132 (5'-ACTGTATTTGGTACTTCCTC-3') (SEQ ID NO: 132); p.MOE-135 (5'-TCCTCTCTCCATCCGAAAGA-3') (SEQ ID NO: 135); q. MOE-011 (5'-TCTCCATCCGAAAGAAGTAT-3') (SEQ ID NO: 11); r. MOE-012 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO: 12); s. MOE-136 (5'-AAAGAAGTATGAAACCATTAT-3') (SEQ ID NO: 136); t. MOE-013 (5'-ATGCTCAGGGAGCAGTTGTT-3') (SEQ ID NO: 13); u. MOE-014 (5'-GAGTCTCCTCCTGTACTTCT-3') (SEQ ID NO: 14); v. MOE-015 (5'-CGCACAAACCCTCCCTGTACC-3') (SEQ ID NO: 15); w. MOE-183 (5'-AAACCCTCCTGTACCGTCAC-3') (SEQ ID NO: 183); x. MOE-184 (5'-CTCCTGTCCGTCACTGACT-3') (SEQ ID NO: 184); y. MOE-190 (5'-CAGCCAGAAATTTGGATCCA-3') (SEQ ID NO: 190); z. MOE-196 (5'-CCCTGTGGGGAAACGAGGGT-3') (SEQ ID NO: 196); aa. MOE-197 (5'-TGGGGGAAACGAGGGTCAGCT-3') (SEQ ID NO: 197); bb. PMO-221 (5'-CCTCACCTGTCACATGCACAGAG-3') (SEQ ID NO:221); cc. PMO-222 (5'-TCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 222); dd. PMO-223 (5'-CTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 223); ee. PMO-224 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); ff. PMO-225 (5'-ACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 225); gg.PMO-226 (5'-TCACCTGTCACATGCACAGAG-3') (SEQ ID NO:226); hh. PMO-227 (5'-TCACCTGTCACATGCACAGAGAGCT-3') (SEQ ID NO: 227); ii. PMO-228 (5'-CCTGTGCCTCACCTGTCACATGCAC-3') (SEQ ID NO: 228); jj. PMO-229 (5'-GTGCCTCACCTGTCACATGCACAGA-3') (SEQ ID NO: 229); kk.PMO-230 (5'-TGCCTCACCTGTCACATGCACAGAG-3') (SEQ ID NO: 230); ll. PMO-231 (5'-CTCACCTGTCACATGCACAGAGAGC-3') (SEQ ID NO: 231); mm. PMO-232 (5'-CACCTGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 232); nn. PMO-233 (5'-ACCTGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 233); oo. PMO-234 (5'-CTGTCACATGCACAGAGAGCTGGGG-3') (SEQ ID NO: 234); pp. PMO-235 (5'-CCTGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 235); qq. PMO-236 (5'-TGTCACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 236); rr. PMO-237 (5'-CTGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 237); ss. PMO-238 (5'-TGTCACATGCACAGAGAGCTGG-3') (SEQ ID NO: 238); tt. PMO-239 (5'-TCACATGCACAGAGAGCTGGG-3') (SEQ ID NO: 239); uu.PMO-240 (5'-TGTCACATGCACAGAGAGCTG-3') (SEQ ID NO: 240); vv.PMO-241 (5'-CTGTATTTGGTACTTCCTCTCTCCA-3') (SEQ ID NO:241); www.PMO-242 (5'-TGTATTTGGTACTTCCTCTCTCCAT-3') (SEQ ID NO:242); xx. PMO-243 (5'-GTATTTGGTACTTCCTCTCTCCATC-3') (SEQ ID NO: 243); yy. PMO-244 (5'-TATTTGGTACTTCCTCTCTCCATCC-3') (SEQ ID NO: 244); zz. PMO-324 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); stereo pattern: RRRRRRRRRRRRRRRRRRRRRRRRR aaa. PMO-424 (5'-CCTCACCTGTCACATGCACAG-3') (SEQ ID NO: 224); stereo pattern: SSSSSSSSSSSSSSSSSSSSSSSSS bbb. PMO-402 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 002); stereo pattern: RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR; ccc. PMO-502 (5'-CCTCACCTGTCACATGCACAGAGAG-3') (SEQ ID NO: 002); stereo pattern: SSSSSSSSSSSSSSSSSSSSSSSSSSSSS; ddd. MOE-245 (5'-CTCCATCCGAAAGAAGTATG-3') (SEQ ID NO:245); eee. MOE-246 (5'-TCCATCCGAAAGAAGTATGA-3') (SEQ ID NO: 246); fff.MOE-247 (5'-CCATCCGAAAGAAGTATGAA-3') (SEQ ID NO:247); ggg.MOE-248 (5'-CATCCGAAAGAAGTATGAACA-3') (SEQ ID NO:248); hhh.MOE-249 (5'-TCCGAAAGAAGTATGAAACCA-3') (SEQ ID NO: 249); iii. MOE-250 (5'-CCGAAAGAAGTATGAAACCAT-3') (SEQ ID NO: 250); jjj.MOE-251 (5'-ATCCGAAAGAAGTATGAA-3') (SEQ ID NO:251); kkk.MOE-252 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO:252); lll. MOE-253 (5'-TCCGAAAGAAGTATGAACA-3') (SEQ ID NO: 253); mmm.MOE-254 (5'-CCATCCGAAAGAAGTATG-3') (SEQ ID NO:254); nnn. MOE-255 (5'-TCCATCCGAAAGAAGTAT-3') (SEQ ID NO: 255); ooo. MOE-256 (5'-GAAAGAAGTATGAAACCAT-3') (SEQ ID NO: 256); ppp. MOE-257 (5'-ATC-CGAAAGAAGTATGA-ACC-3') (SEQ ID NO: 012); qqq. MOE-258 (5'-ATCC-GAAAGAAGTATG-AACC-3') (SEQ ID NO: 012); rr. MOE-259 (5'-ATCCG-AAAGAAGTAT-GAACC-3') (SEQ ID NO: 012); sss.MOE-260 (5'-ATCCG-AAAGAAGTA-TGAACC-3') (SEQ ID NO:012); ttt. MOE-261 (5'-ATCC-GAAAGA-AGTATG-AACC-3') (SEQ ID NO: 012); uuu.MOE-262 (5'-ATCC-gAAAGAAGTATG-aACC-3') (SEQ ID NO:012); vvv.MOE-263 (5'-ATCC-gAAAGAAGTATG-aACC-3') (SEQ ID NO:012); www.MOE-264 (5'-ATCC-gAAAGAaGTATG-aACC-3') (SEQ ID NO:012); xxx. MOE-265 (5'-CCGA-aAGAAGTATGAACC-3') (SEQ ID NO: 252); yyy. MOE-266 (5'-CCGA-aAGAAGTATG-aACC-3') (SEQ ID NO: 252); zzz. MOE-267 (5'-CCGA-aAGAAGtATG-aACC-3') (SEQ ID NO: 252); aaaa. MOE-268 (5'-CCG-AAAGAAGTATGA-ACC-3') (SEQ ID NO: 252); bbb. MOE-269 (5'-CCGA-AAGAAGTATG-AACC-3') (SEQ ID NO: 252); cccc. MOE-270 (5'-CCGAA-AGAA-GTATG-AACC-3') (SEQ ID NO: 252); dddd. MOE-271 (5'-CCGAA-AGAAGTAT-GAACC-3') (SEQ ID NO: 252); eeee. MOE-272 (5'-CCG-A-AAGAAGTATGACC-3') (SEQ ID NO: 252); ffff. MOE-273 (5'-CCG-AA-AGAAGTATGAACC-3') (SEQ ID NO: 252); gggg.MOE-274 (5'-CCGAAAGAAGTATG-A-ACC-3') (SEQ ID NO:252); hhhh. MOE-275 (5'-mAmTfCfCfGfAfAfAfGfAfAfGfTfAfTfGfAfAmCmC-3') (SEQ ID NO: 012); iii. MOE-276 (5'-fAfTfCfCfGmAmAmAmGmAmAmGmTmAfTfGfAfAfCfC-3') (SEQ ID NO: 012); jjjj.MOE-277 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO:012); stereo pattern: SSSSSSSSSSSSSSSSSSSSSSS; kkkk.MOE-278 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO:012); stereo pattern: RRRRRRRRRRRRRRRRRRRRRRRRR; llll. MOE-279 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSSSRSSSRSSSRSSSRSSS; mmmm.MOE-280 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO:012); stereo pattern: SSSRSSRSSRSSRSSSRSSSRSSS; nnnn. MOE-281 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO: 012); stereo pattern: SSSRSRSRSRSRSRSRSRSSSS; oooo. MOE-282 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO: 012); stereo pattern: SSSSSSRRRRRRRRRSSSSSS; pppp. MOE-283 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO: 012); stereo pattern: SSSRRSRRSRRSRRSRRSSSS; qqqq.MOE-284 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO:012); stereo pattern: SSSRRSRRRSRRRSRRRSSS; rrrr.MOE-285 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO:012); stereo pattern: SSSSSRRRRRRRRRRRSSSSSS; ssss.MOE-286 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO:012); stereo pattern: SSSRRRRRRRRRRRRRRRRRRSSS; tttt. MOE-287 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO: 012); stereo pattern: SSRSSSSSSSSRSSSSSSS; uuuu. MOE-288 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO:252); stereo pattern: SSSSSSSSSSSSSSSSSSSSS; vvvv.MOE-289 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO:252); stereo pattern: RRRRRRRRRRRRRRRRRRRRR; www.MOE-290 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO: 252; stereo pattern: SSSRRRRRRRRRRRRRRRSSS; xxxx.MOE-291 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: RRRRRRRRRSSSSSSSSSS; yyyy.MOE-292 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO:252); stereo pattern: SSSSSSSSSSRRRRRRRRR; zzzz. MOE-293 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO: 252); stereo pattern: SSSRSSSRSSSRSSSRSSS; aaaaa. MOE-294 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO: 252); stereo pattern: SSSRSRSRSRSRSRSSSS; bbbbb. MOE-295 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SRSSSRSSSRSSRSSSSS; ccccc. MOE-296 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO: 252); stereo pattern: SSSOSSRSSSRSSSOSSS; dddddd. MOE-297 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SSSOSRSRSRSSSOSSS; eeeee. MOE-298 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO:252); stereo pattern: SOSSSRSSSSRSSSOSSSS; fffff.MOE-299 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO:12); stereo pattern: SSSOSSRSSSRSSSSSSS; MOE-300 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO: 252); stereo pattern: RRRORRROSSSSSSSSSS; hhhhh. MOE-301 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO: 252); stereo pattern: SRRORRROSSSSSSSSSS; iii. MOE-303 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO: 252); stereo pattern: SSOOOSSSSSSSSSSSSSS; jjjjj. MOE-304 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO:252); stereo pattern: OOOOOSSSSSSSSSSSSSS; kkkkk. MOE-305 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO:252); stereo pattern: SSOSSSOSSOSSOSSOSSS; llllll. MOE-306 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO:252); stereo pattern: SOSSSSOSSSSSSSSOSSSS; mmmmm. MOE-307 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO: 252); stereo pattern: SSOSSSSSSSSSSSSSSOSS; nnnnn. MOE-308 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO: 12); stereo pattern: SSSOSSSSSSSSSSSSSSSSSS; oooooo. MOE-309 (5'-ATCCGAAAGAAGTATGACC-3') (SEQ ID NO: 12); stereo pattern: SSSOSSSSOSSOSSOSSOSSS; pppppp. MOE-310 (5'-CCGAAAGAAGTATGACC-3') (SEQ ID NO: 252); stereo pattern: SSORRRRRRSSSSSSOSSS; or qqqqq. MOE-311 (5'-CCGAAAGAAGTATGAACC-3') (SEQ ID NO: 252). Three-dimensional pattern: RRRRROSSSSSSSSOSSSS An antisense oligonucleotide comprising all or a portion of the above.

14. The antisense oligonucleotide of claim 13, comprising any one of PMO-002, PMO-424, and MOE-307.

15. 14. The antisense oligonucleotide of claim 13, having a CD33 exon-2 skipping efficiency of 30% or greater according to a standard exon skipping efficiency assay for PMO ASOs when the antisense oligonucleotide comprises a phosphorodiamidate morpholino oligomer, or a standard exon skipping efficiency assay for MOE ASOs when the antisense oligonucleotide comprises a methoxyethyl ribose oligomer.

16. A composition comprising the antisense oligonucleotide of any one of claims 1 to 15 and a pharma- ceutically acceptable carrier or excipient.

17. 16. A method for inducing exon-2 skipping in the CD33 gene during pre-mRNA splicing, said method being carried out in vitro and comprising introducing into a cell an antisense oligonucleotide according to any one of claims 1 to 15, wherein said antisense oligonucleotide hybridizes to a target region of the CD33 gene and induces exon-2 skipping during pre-mRNA splicing of the CD33 gene.

18. The method of claim 17 , wherein the cell is an animal cell.

19. 18. The method of claim 17, wherein the cell is a human cell.

20. The composition according to claim 16 for inducing exon-2 skipping in the CD33 gene during pre-mRNA splicing.

21. The composition described in claim 20, wherein the induction is performed in animal cells.

22. The composition of claim 21 , wherein the animal cell is a human cell.

23. The composition according to claim 16 for treating a neurodegenerative disease.

24. 24. The composition of claim 23, wherein the neurodegenerative disease is Alzheimer's disease.

25. Use of an antisense oligonucleotide described in any one of claims 1 to 15 for the manufacture of a therapeutic agent for a neurodegenerative disease.

26. The use described in claim 25, wherein the neurodegenerative disease is Alzheimer's disease.