Antibody-protamine fusions as targeting compounds for protamine-based nanoparticles

Abstract

The present invention relates to a method for producing nanoparticles, comprising the steps of contacting (a) a fusion protein (A) comprising an antibody (A1) and a positively charged polypeptide (A2); (b) a positively charged polypeptide (B); and (c) a negatively charged molecule (C), thereby forming nanoparticles. The present invention also relates to nanoparticles obtainable by the method of the present invention, and to nanoparticles comprising (a) a fusion protein (A) comprising an antibody (A1) and a positively charged polypeptide (A2); (b) a positively charged polypeptide (B); and (c) one or more negatively charged molecules (C). The present invention also relates to compositions comprising the nanoparticles of the present invention, and to the nanoparticles or compositions of the present invention for use in therapy.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to European Patent Application No. 21175340.5, filed May 21, 2021, European Patent Application No. 21205455.5, filed October 29, 2021, and European Patent Application No. 21212002.6, filed December 2, 2021, the contents of which are incorporated by reference in their entirety for all purposes.

[0002] FIELD OF THEINVENTION The present invention relates to a method for producing nanoparticles, comprising the steps of contacting (a) a fusion protein (A) comprising an antibody (A1) and a positively charged polypeptide (A2); (b) a positively charged polypeptide (B); and (c) a negatively charged molecule (C), thereby forming nanoparticles. The present invention also relates to nanoparticles obtainable by the method of the present invention, and to nanoparticles comprising (a) a fusion protein (A) comprising an antibody (A1) and a positively charged polypeptide (A2); (b) a positively charged polypeptide (B); and (c) one or more negatively charged molecules (C). The present invention also relates to compositions comprising the nanoparticles of the present invention, and to nanoparticles or compositions of the present invention for use in therapy. [Background technology]

[0003] background The principle of RNA inhibition (RNAi) holds great promise for medical applications and was awarded the Nobel Prize in 2006. This method shows high efficiency in inactivating the mRNA of virtually any gene and silencing its subsequent expression by the selection and synthesis of gene-specific siRNA oligonucleotides. Although this method has revolutionized molecular biology, the translation of this principle into the therapeutic field has proved difficult due to a number of special problems.

[0004] siRNA oligos are attacked by nucleases and show increased immunogenicity and renal clearance, so the half-life and circulation time of "naked siRNA" are often far below expectations. Therefore, siRNA has been complexed with stabilizers such as nanoparticles or capsules. Although these stabilizers have increased the circulation time and bioavailability of siRNA, they still lack the target cell-determining structure that (a) targets cells with specific surface molecules and delivers siRNA to these cells, and (b) allows target-specific translocation of anionic siRNA through anionic cell membranes.

[0005] Although numerous Phase I-III clinical trials have been conducted for the treatment of neurological disorders, viral infections, and cancer, only one siRNA has been approved by the FDA to date. For example, patisiran (trade name Onpattro) is a drug therapy for the treatment of polyneuropathy in people with hereditary transthyretin amyloidosis. Hereditary transthyretin amyloidosis is a fatal rare disease that is estimated to affect 50,000 people worldwide.

[0006] To develop a modular therapeutic approach for the treatment of oncological disorders, we developed a system for coupling siRNA to antibodies against cancer cell-specific surface molecules that are internalized upon binding by a specific cationic peptide, protamine, which delivers siRNA to the intended cancer cells, binds to the respective surface molecules such as receptors, and is internalized in a receptor-dependent manner.

[0007] Protamine is a cationic nucleic acid-binding peptide that transports a complete set of compacted genomic DNA to the sperm head. It can complex with nucleic acids and facilitate the transfer of nucleic acids through cell membranes, so it has attracted the interest of many researchers to study its application in transfection, target-specific delivery, and gene therapy (Choi et al., 2009; Chono et al., 2008; Hansen et al., 1979; He et al., 2014; Liu, B., 2007). Protamine has been tested as a nucleic acid delivery vehicle and connected to various cell-determined targeting moieties. In 2005, Song et al. (Song et al., 2005a) presented a gene fusion protein that connected a Fab fragment (F105) against the human immunodeficiency virus HIV gp 160 envelope protein and a truncated protamine peptide. The fusion protein was complexed with siRNA targeting the HIV gag protein, and the conjugate was able to target difficult-to-transfect HIV-infected T cells and melanoma cells transfected with the HIV envelope. The siRNA-F105 carrier conjugate inhibited HIV replication in infected T cells.

[0008] To validate the targeting principle, the same strategy was applied to integrin lymphocyte function-associated antigen 1 (Peer et al. 2007) and also to target ErbB2 by Erb2 single-chain antibody fused to protamine (Yao et al. 2012). Thus, although the genetic fusion of protamine to cellular determinants has been followed in many high-ranking publications, this concept has not been successfully translated into the clinic. However, consistent with the results of the key publications cited above, the present inventors found that conventional protamine fusion constructs showed little, if any, ability to complex with siRNA (see below).

[0009] It is an object of the present invention to provide further, preferably improved, means and methods for delivering anionic molecules to target cells.It is also an object of the present invention to provide improved means for complexing siRNA with targeting moieties such as antibodies. Summary of the Invention

[0010] overview The present invention relates to a method for producing nanoparticles comprising the steps of: (a) contacting a fusion protein (A) comprising an antibody (A1) and a positively charged polypeptide (A2); (b) a positively charged polypeptide (B); and (c) a negatively charged molecule (C), thereby forming nanoparticles.

[0011] The present invention also relates to nanoparticles obtainable by the method of the invention.

[0012] The present invention also relates to nanoparticles comprising: (a) a fusion protein (A) comprising an antibody (A1) and a positively charged polypeptide (A2); (b) a positively charged polypeptide (B); and (c) one or more negatively charged molecules (C).

[0013] The present invention also relates to compositions comprising the nanoparticles of the present invention.

[0014] The present invention also relates to a nanoparticle of the invention or a composition of the invention for use in therapy. [Brief description of the drawings]

[0015] [Figure 1]Formation of multiple antibody-SMCC-protamine conjugates by application of the conjugation method published in (Baumer, N. et al., 2016). If the excess sulfo-SMCC is not depleted after the reaction (as in Wrong! Reference source not found), the residual crosslinker can form multiple different conjugates from IgG and protamine-SMCC and reactive sulfo-SMCC. An example of an unintended side product that can be observed by SDS-PAGE is an IgG (A and B: anti-EGFR-mAB cetuximab) internally crosslinked by excess sulfo-SMCC and its simultaneous crosslinking to protamine. In addition, non-reducible high molecular weight IgG multimers (A) and its simultaneous crosslinking to protamine, seen in the gel (B), were observed. In extreme cases, the complexity of unintended side reactions can lead to the appearance of a cloud (B), possibly formed by a mixture of all possible conjugates a-d. HC: heavy chain, LC: light chain. Omission of depletion of unreacted SMCC can result in the formation of unwanted by-products that can interfere with the function of the intended product (c). For example, reactive SMCC can result in the cross-linking of light and heavy chains within a given IgG molecule (a) or the cross-linking of two IgG molecules forming an IgG dimer (d). [Diagram 2]Modification of the conjugation method published in (Baumer, N. et al., 2016). A: If the excess sulfo-SMCC is not depleted after coupling of sulfo-SMCC with protamine, the residual crosslinker can form multiple different conjugates from IgG, protamine-SMCC, and reactive sulfo-SMCC. Instead, in the previous protocol, the antibody-SMCC-protamine conjugate was desalted after the coupling process. This step was omitted in the new protocol (C: anti-EGFR antibody cetuximab, D: anti-IGF1R antibody ImcA12). Examples of unintended by-products that can be observed by SDS-PAGE are highlighted with circles. B: The new conjugation protocol now includes a purification step after coupling of sulfo-SMCC with protamine. Unbound sulfo-SMCC is depleted from the SMCC-protamine conjugate using a Zeba spin gel purification column that retains the free sulfo-SMCC and elutes the SMCC-protamine conjugate. As a result, distinct conjugation products of SMCC-protamine with the heavy chain (HC) and light chain (LC) of the IgG antibodies cetuximab (Cet; E) and ImcA12 (A12; F) were formed, which could be observed in Coomassie-stained SDS-PAGE. HC: heavy chain, LC: light chain, P: protamine. [Figure 3-1]Antibody-mediated siRNA targeting KRAS in NSCLC. A: Targeting construct between anti-EGFR monoclonal antibody (mAB) cetuximab and protamine. B: Anti-EGFR-mAB-protamine / free protamine (P / P) complex (α-EGFR-mAB) binds up to 8 moles of siRNA per mole of antibody. C: Cetuximab (anti-EGFR-mAB-)protamine / free SMCC-protamine (P / P) delivers Alexa488-tagged siRNA to endosomes (white dots, top left panel) but not to lysosomes because Alexa488-positive vesicles do not overlap with the lysosomal marker Lysotracker (white dots, top right panel). D: NSCLC cells treated with α-EGFR-mAB-protamine / free protamine / siRNA (α, anti; containing P / P) showed silencing of KRAS expression by KRAS siRNA but not by control siRNA. E: Cells treated with α-EGFR-mAB-protamine / free protamine / siRNA (P / P) showed a significant reduction in colony formation by KRAS siRNA targeting the wt allele and the G12D mutant allele. F: α-EGFR-mAB-protamine / free protamine applied systemically as a complex with control and KRAS-siRNA was well tolerated in CD1-nude mice bearing sc xenografted SKLU1 and A549 cells, and α-EGFR-mAB-protamine / free protamine / KRAS-siRNA significantly inhibited tumor growth in SKLU and A549 tumors. G: A549 tumors were already therapeutically inhibited by cetuximab-P / P carrying control (scrambled) siRNA, but tumors in the KRAS siRNA-treated group were significantly lighter than either control group. Resected tumors are presented in H. Statistics: Mean + / - standard deviation in all experiments except F, where standard error of the mean (SEM) was selected. Significance: *p<0.05, two-tailed t-test. [Figure 3-2] See description of Figure 3-1. [Figure 3-3] See description of Figure 3-1. [Diagram 3-4] See description of Figure 3-1. [Figure 4] Proliferation marker Ki67 is less abundant in NSCLC xenografts that have undergone KRAS knockdown. Immunofluorescence determination of the proliferation marker Ki67 (gray dots in A,C,E and G,I,K) in histological xenograft sections. The number of Ki67-positive nuclei was significantly reduced in tumor histological sections treated with KRAS siRNA in both A549 (A-F) and SK-LU1 (G-L) tumors compared to PBS and control siRNA carrier treated groups. [Diagram 5] NSCLC xenografts show a higher abundance of apoptotic cells. Immunohistological allocation of apoptosis in xenograft tumor sections by TUNEL assay. A-L: In both xenografted cell lines, an increased apoptotic rate was found in tumors treated with KRAS siRNA carrier compared to the control group. M-N: Statistics of TUNEL positive nuclei in sections: In A549 tumors treated with EGFR-mAB-protamine / free protamine (mAB-P / P), the number of TUNEL positive nuclei increased 2-fold compared to PBS treatment, and in tumors treated with KRAS siRNA carrier, it increased 3-fold. In SK-LU1, only EGFR-mAB-protamine / free protamine KRAS siRNA treatment led to a 4-fold increase in apoptotic cells. α, anti; cntr, control. [Figure 6]Rhabdomyosarcoma (RMS) cell lines can be targeted by antibody-siRNA complexes. A: Expression of cell surface receptors EGFR and IGF1R was examined in two RMS cell lines, and IGFR1R and EGFR were expressed in both cell lines. B: Cetuximab-protamine (EGFR-mAB-P( / P / P) containing free SMCC-protamine) shuttled Alexa488-marked control siRNA to the majority of RD cells (>90% in FACS plot C), but was less effective in RH-30 (FACS not shown). RH-30 was instead characterized by shuttle of Alexa488 control siRNA by anti-IGF1R-directed GR11L-protamine (P / P). [Figure 7]Cetuximab-protamine / free SMCC-protamine (P / P)-mediated siRNA knockdown of cmyc / NRAS and KRAS in RD (embryonic RMS, ERMS) and RH30 (alveolar RMS, ARMS) cells reduced colony growth in soft agar assays. Cells were harvested and treated with 30 nM cetuximab-protamine / P (EGFR-mAB-P / P containing free SMCC) coupled to control (scr) siRNA or two effective siRNAs against c-Myc and NRAS as indicated, plated in soft agar in 96-well plates, cultured for 2 weeks, stained, and counted (A). The combination of the two effective siRNAs reduced the number of colonies normalized to the PBS control to 63%, down from 87% in the control group (B). C: Treatment of RD cells with EGFR-mAB-P / P coupled to siRNA specific for either KRAS or NRAS moderately reduced NRAS expression in the respective cells. P<0.001, two-tailed T-test. D: The sequences GGCCTCTCACCTCAGAATTC (siPF1, SEQ ID NO:49), GCCTCTCACCTCAGAATTCA (siPF2, SEQ ID NO:50), CCTCTCACCTCAGAATTCAA (siPF3, SEQ ID NO:51) indicate the respective positions of the siRNAs covering the breakpoint region of the fusion oncogene PAX3-forkhead (FKHR) represented by the sequence TGGCCTCTCACCTCAGAATTCAATTCGTC (SEQ ID NO:48) (PAX3 portion in light grey, FKHR portion in dark grey). E: Cetuximab-protamine / P-mediated siRNA knockdown of PAX3-FKHR in RH30 cells reduced colony growth in soft agar assays. Colony growth could be significantly inhibited by cetuximab-mediated application of siRNA siPF2 against the breakpoint (siRNA walking visualized in D). P<0.05, two-tailed T-test. [Figure 8]Antibody-siRNA-P / P complex formation can be applied to IGF1R targeting. A: A673 Ewing sarcoma cells are shown here by flow cytometry to internalize mouse anti-IGF1R antibody GR11L-sulfo-SMCC-protamine / P complexes, such as uncoupled GR11L antibody, at 37° C., as illustrated by a leftward shift in histogram signal compared to the non-internalized 4° C. control. B: In A673 cells, green fluorescent cytoplasmic vesicular structures consisting of Alexa Fluor 488-siRNA were internalized by GR11L-protamine containing free SMCC-P (arrows, right image), but not in control experiments lacking antibody conjugate (left image). Internalized Alexa Fluor 488-siRNA is seen as white vesicular deposits (white arrows). Hoechst counterstaining of cell nuclei is shown in grey as kidney-shaped structures. Boxed areas illustrate enlargements of indicated cells. Scale bar, 20 μm. C: GSP complexes were then coupled to siRNA against the mRNA of the oncogenic fusion protein EWS-FLI1, and A673 cells were treated with these complexes. As a result, EWS-FLI1 expression was downregulated, as detected here in a Western blot of FLI1 expression. EWS-FLI1 (E / F)-specific siRNA 2 reduced EWS-FLI1 protein expression by 80% compared to control siRNA and PBS control. Other E / F-specific siRNAs (siRNA 1 and FLI1-esiRNA) proved to be much less effective. EWS-FLI1 migrated as a doublet band of approximately 64 kDa, and actin migrated at 43 kDa. (Baumer, N. et al., 2016). [Figure 9]Anti-IGF1R-mAB, A12 and Tepro for targeting Ewing sarcoma cells. A: IGF1R-targeting mABs, A12 (cixutumumab) and Tepro, were expressed and purified in our laboratory and can be conjugated to protamine / P to enable siRNA binding and transport. IgG-protamine / P conjugates show a reasonable molecular weight shift (arrows). HC=heavy chain, LC=light chain, -P=SMCC-protamine. B: Band shift assay using anti-IGF1R-mAB-protamine and different ratios of siRNA. C: Anti-IGF1R-mAB-protamine (containing free SMCC-P) shuttled control siRNA marked by Alexa488 into SKNM-C Ewing cells (white dots). [Figure 10] Breakpoint siRNA significantly reduced colony formation in Ewing SKNM-C cells compared to control. SKNM-C cells were treated with A12 (A) or Tepro (B) conjugated to protamine / P and the indicated siRNAs and subjected to colony formation assay. E / F-siRNA is an siRNA interfering with EWS-Fli1 mRNA, which drives Ewing sarcoma. BCL2 is an siRNA against BCL2. P<0.05, two-tailed T-test. [Figure 11] Cross-sections of examples of nanoparticle-like structures that meet the experimentally inferred criteria for effective antibody-SMCC-protamine / P-siRNA or -SM-1 / RF carrier complexes, with electrostatic bond bridges formed between the mABs and several protamines coupled to the targeting antibody and respective anionic cargo, which includes siRNA (A), an anionic small molecule such as SM-1 / RF (B), or both (C). [Figure 12] The antibody-protamine / free protamine conjugate can bind to single-stranded antisense oligonucleotides (ASOs). Band shift assays reveal that 1 mole of EGFR antibody-protamine conjugate binds to 8-32 moles of ASOs. [Figure 13] Description of the molecular composition of effective siRNA binder.Anti-CD20 mAB is conjugated to SMCC-protamine in molar excess relative to mAB as shown.The resulting conjugate mixture is then tested for its ability to complex siRNA.Regardless of the molar excess of protamine-SMCC provided, the resulting ability to complex siRNA is not significantly different, and is in the range of approximately 16 moles of siRNA per mole of carrier binder. [Figure 14] CD20-mAB rituximab-protamine / P conjugate binds 8 molar siRNA. A: Coomassie stained SDS-PAGE showing anti-CD20-mAB, anti-CD20-mAB coupled to 30x SMCC-protamine, and molecular markers (M). HC=heavy chain, LC=light chain, -P=SMCC-protamine. B: Band shift assay using CD20-mAB-protamine / P and different ratios of siRNA. [Figure 15]Targeting DLBCL cell lines with antibody-P / P-siRNA complexes. Top panel: Selected DLBCL cell lines were tested for expression of CD20 and CD33 by FACS analysis. Middle panel (white dots): Alexa488-tagged siRNA was bound to monoclonal Abs against CD20 (rituximab) and CD33 (gemtuzumab) conjugated to protamine (both containing free SMCC-protamine) and the respective cell lines were treated overnight with these compositions. siRNA was internalized via the respective antibody targeting and condensed into cytoplasmic vesicular structures. Both targeting mABs (left: anti-CD20, right: anti-CD33) were shown to deliver siRNA to the respective cell lines. Bottom panel: DLBCL cell lines were seeded on methylcellulose and treated with the indicated antibody-protamine / P-siRNA conjugates. CD33 is highly expressed in all cell lines, and Rituximab transports siRNA into intracellular vesicles, but responds poorly to key gene knockdown as detected by colony-forming ability, indicating problematic endosomal release. In contrast, Gemtuzumab, which targets the lower expressed CD33, responds much better to gene knockdown: significance *p<0.01. Here, in particular, HBL-1 cells respond well to the knockdown of BTK kinase, and also to the knockdown of the cytoplasmic kinase SYK, as well as further components of the B cell receptor signaling pathway, such as CARD11b, CD79B, and MYD88. [Figure 16] Synthesis of polyanionic small molecule (SM) derivatives for electrostatic transport by monoclonal antibodies. SM-1 was conjugated to a polyanionic red fluorescent chromophore (RF) to form a low molecular weight (1.44 kDa) polyanion. [Figure 17]CD20-mAB rituximab-protamine / P and EGFR-mAB cetuximab-protamine / P conjugates bind to SM-1 / RF. A: Band shift assays with CD20-mAB-protamine / P and EGFR-mAB-protamine / P using different ratios of SM-1 / RF up to 1:32. B: Band shift assays with CD20-mAB-protamine / P and EGFR-mAB-protamine / P using different molecular excesses of SM-1 / RF up to 1:200. At least 100 moles of SM-1 / RF can be complexed by antibody-protamine conjugates that also contain free SMCC-protamine. [Figure 18] CD20-mAB rituximab-protamine / P and EGFR-mAB cetuximab-protamine / P conjugates transport SM-1 / RF. A: CD20-positive HBL-1 DLBCL cells internalize CD20-mAB-protamine / P / SM-1 / RF (containing free SMCC-P) complexes (gray shading, left). B: EGFR-positive A549 NSCLC cells internalize EGFR-mAB-protamine / P / SM-1 / RF / P complexes (white dots, left). [Figure 19] EGFR-mAB cetuximab-protamine conjugates do not bind siRNA efficiently after depletion of free SMCC-protamine by HPLC. A: Coomassie stained SDS-PAGE showing HPLC fractions 25-31 upon depletion of unbound SMCC-protamine for anti-EGFR-mAB, anti-EGFR-mAB coupled to 32x SMCC-protamine, and anti-EGFR-mAB coupled to 32x SMCC-protamine; HC=heavy chain, LC=light chain, -P=SMCC-protamine. B: Band shift assay. [Figure 20]Colony formation assay in soft agar of NSCLC cells treated with different carriers of siRNA, both with and without free protamine. A: A549 cells treated with EGFR-mAB-protamine / P-KRAS-siRNA form significantly fewer colonies in soft agar than cells treated with EGFR-mAB-protamine / P / control (scr) siRNA. B: SK-LU1 cells. When A549 cells (A) or SK-LU1 cells (B) are treated with EGFR-mAB-protamine conjugates without free protamine (see Fig. 19A, fraction 29 / 30) or when using the same amount of SMCC-protamine only, no difference in colony formation is observed compared to cells treated with PBS. Photographs of colony assays and mean values ​​+ / - SD of three independent experiments are shown here. Asterisks indicate significant differences (P<0.05, two-tailed T-test). [Figure 21-1] CD33-mAB gemtuzumab-protamine conjugates do not bind siRNA efficiently after depletion of free SMCC-protamine by HPLC. A: Coomassie stained SDS-PAGE showing HPLC fractions 24-30 upon depletion of unbound SMCC-protamine for anti-CD33-mAB, anti-CD33-mAB coupled to 32x SMCC-protamine, and anti-CD33-mAB coupled to 32x SMCC-protamine; HC=heavy chain, LC=light chain, -P=SMCC-protamine. B: Band shift assay. C: Colony formation assay. OCI-AML2 cells treated with CD33-mAB-protamine / P-DNMT3A-siRNA (containing free SMCC-P) form significantly fewer colonies in soft agar than cells treated with CD33-mAB-protamine / P-control (scr) siRNA (containing free SMCC-P). When OCI-AML2 cells were treated with CD33-mAB-protamine conjugates without free SMCC-protamine, no difference in colony formation was observed compared to cells treated with PBS (see A+B, fraction 30). Mean values ​​± SD of three independent experiments are shown here. *P<0.033, two-tailed T-test. [Figure 21-2]See description of Figure 21-1. [Figure 22] CD20-mAB rituximab-protamine conjugates do not bind SM-1 / RF efficiently after depletion of free SMCC-protamine by HPLC. A: Coomassie stained SDS-PAGE showing HPLC fractions 19-25 / 26 upon depletion of unbound SMCC-protamine for anti-CD20-mAB, anti-CD20-mAB coupled to 32x SMCC-protamine, and anti-CD20-mAB coupled to 32x SMCC-protamine; HC=heavy chain, LC=light chain, -P=SMCC-protamine. B: Band shift assay with protamine-depleted (left) and protamine-containing (right) CD20-mAB preparations. SMCC-protamine-depleted CD20-mAB preparations do not bind >32 molar SM-1 / RF. [Figure 23] Anti-IGF1R monoclonal AB IMCA-12 (A12)-protamine conjugate does not bind siRNA efficiently after depletion of free SMCC-protamine by HPLC. A: Coomassie stained SDS-PAGE showing HPLC fractions 15-21 upon depletion of unbound SMCC-protamine of anti-IGF1R coupled to 32-fold SMCC-protamine and anti-IGF1R-mAB coupled to 32-fold SMCC-protamine; HC=heavy chain, LC=light chain, -P=SMCC-protamine. B: Band shift assay with protamine-depleted IGF1R-mAB preparation (bottom; fraction 20; see A) and SMCC-protamine-containing IGF1R-mAB preparation (top). SMCC-protamine-depleted IGF1R-mAB preparation does not bind 8 molar siRNA. [Figure 24]Colony formation assay in soft agar of SKNM-C Ewing sarcoma cells treated with A12 carrier with and without free protamine. SKNM-C cells treated with IGF1R(A12)-mAB-protamine / P-EWS-FLI1-siRNA containing free SMCC-P form significantly fewer colonies in soft agar than cells treated with IGF1R(A12)-mAB-protamine / P-control (scr) siRNA containing free SMCC-P. No difference in colony formation can be observed when SKNM-C cells are treated with EGFR-mAB-protamine conjugate without free protamine. Mean values ​​+ / - SD of three independent experiments are shown here. Asterisks indicate significant differences (*P<, two-tailed T-test). [Diagram 25] Colony formation assay in soft agar of SKNM-C Ewing sarcoma cells treated with different carriers of siRNA with and without free SMCC-protamine. SKNM-C cells treated with IGF1R(A12)-mAB-protamine / P / EWS-FLI1(E / F)-siRNA containing free SMCC-P form significantly fewer colonies in soft agar than cells treated with IGF1R(A12)-mAB-protamine / P / control (scr) siRNA containing free SMCC-P. When SKNM-C cells are treated with EGFR-mAB-protamine conjugates containing free SMCC-protamine or EGFR-mAB-protamine conjugates without free SMCC-protamine (see FIG. 19, fraction 29 / 30), or when the same amount of SMCC-protamine alone is used, no difference in colony formation can be observed compared to cells treated with scr-siRNA (scr, scramble). The mean values ​​+ / - SD of three independent experiments are shown here, and asterisks indicate significant differences (P<0.05, two-tailed T-test). [Figure 26]Colony formation assay in soft agar of SKNM-C Ewing sarcoma cells, OCI-AML-2 leukemia cells, and A549 NSCLC cells treated with non-depleting A12 anti-IGF1R mAB or SMCC-protamine with no antibody bound at the same concentration as the putative IgG-protamine-SMCC-protamine / / free protamine / siRNA complex. A: SKNM-C cells treated with IGF1R(A12)-mAB-protamine / EWS-FLI1-siRNA / free SMCC-P form significantly fewer colonies in soft agar than cells treated with IGF1R(A12)-mAB-protamine / control (scr) siRNA / free SMCC-P. In contrast, when an effective EWS-FLI1(E / F)-siRNA was complexed to SMCC-protamine alone at a concentration of 1800 nM, it proved to be ineffective (A, right). B: SMCC-protamine was also used in the AML cell line OCI-AML2 with effective DNMT3a siRNA without targeting antibody, which showed no inhibition of colony formation. C: Finally, the same setup was tested in A549 with effective KRAS siRNA bound to free SMCC-protamine, which had no effect and no difference from control siRNA. Mean values ​​+ / - SD of three independent experiments are shown here. Asterisks indicate significant differences (P<0.05, two-tailed T-test). [Figure 27] Vesicle tracking in A549 NSCLC cells. Cells treated with EGFR-mAB-protamine / free SMCC-P-Alexa488 siRNA were subjected to Lysotracker red staining. Vesicles containing Alexa488 (white dots, right panel) barely colocalized with lysotracker (gray dots, center panel) staining. [Figure 28]Internalization of different anti-EGFR-mAB (cetuximab) preparations in EGFR-positive NSCLC cells SK-LU1 treated with different complexes. SK-LU1 cells treated with EGFR-mAB-protamine / P / Alexa488-control siRNA with free SMCC-protamine (white dots in upper panel) and without free SMCC-protamine (lower panel). [Figure 29] Internalization of different anti-EGFR-mAB (cetuximab) preparations in EGFR-positive NSCLC cells A549 treated with different complexes and free SMCC-protamine. A549 cells treated with EGFR-mAB-protamine / P / Alexa488-control siRNA with free SMCC-protamine (nuclear staining in A, siRNA as white dots in D) and EGFR-mAB-protamine / P / Alexa488-control siRNA without free SMCC-protamine (B and E), as well as free SMCC-protamine (C and F). A-C: nuclear staining using Hoechst, D-F: green channel (white dots) illustrating the same cells as in A-C for Alexa488-siRNA internalized vesicles. [Diagram 30] Internalization of different anti-CD33-mAB (gemtuzumab) preparations in CD33-positive AML cells OCI-AML2 treated with different complexes. OCI-AML2 cells treated with anti-CD33-mAB-protamine / P / Alexa488-control siRNA with free SMCC-protamine (A and D) and anti-CD33-mAB-protamine / P / Alexa488-control siRNA without free SMCC-protamine (B and E), as well as free SMCC-protamine (C and F). A-C. Nuclear staining using Hoechst (grey dots). D-F. Green channel illustrating the same cells as A-C for Alexa488-siRNA internalized vesicles (white dots in D). [Diagram 31]Internalization of different anti-IGF1R-mAB (ImcA12) preparations in IGF1R-positive Ewing sarcoma cells SKNM-C treated with different complexes. SKNM-C cells treated with anti-IGF1R-mAB-protamine / P / Alexa488-control siRNA with free SMCC-protamine (A and D) and anti-IGF1R-mAB-protamine / P / Alexa488-control siRNA without free SMCC-protamine (B and E), as well as free SMCC-protamine (C and F). A-C: nuclear staining using Hoechst, D-F: green channel illustrating the same cells as A-C for Alexa488-siRNA internalized vesicles (white dots in D). [Diagram 32] Presence of different anti-EGFR-mAB (cetuximab) preparations in EGFR-negative SKNM-C cell cultures. The lower panel illustrates an enlargement of the inset in the upper panel indicated by the white frame. A: Uncoupled cetuximab does not transport Alexa488-control siRNA into SKNMC cells. B: Cetuximab coupled to protamine does not transport Alexa488-control siRNA into SKNMC cells, and Alexa488-positive vesicular structures are only present next to the cells (white dots, arrows in upper panel) and in cell-free areas of the culture (arrows in lower panel). C: Cetuximab coupled to protamine without free SMCC-protamine (removed by HPLC) no longer forms Alexa488-positive vesicular structures. [Diagram 33]EGFR-mAB cetuximab-protamine conjugates in DLS measurements. Top panel: Coomassie stained PAGE gel illustrating the different conjugates isolated or used for the measurements in the bottom panel. Bottom panel: EGFR-mAB-P with and without free SMCC-protamine, as well as SMCC-protamine alone, were incubated for 2 hours at room temperature and then measured via dynamic light scattering (DLS) in a Zeta counter (MALVERN). The different peaks represent particles of different sizes (nm). The highest peak with EGFR-mAB-P / siRNA with free SMCC-protamine is at about 427 nm, while that without free SMCC-protamine is at about 3.2 nm and free SMCC-protamine / siRNA peaks at 5.7 nm. [Diagram 34] EGFR-mAB cetuximab-protamine / P conjugate in DLS measurements during 0-24 h incubation at room temperature. siRNA monomers (approximately 1.92 nm) assemble after mixing into larger structures by the cetuximab-protamine / unbound protamine carrier system, which are stabilized and further assemble into much larger macrostructures (approximately 500 nm). After 24 h in an unprotected environment in PBS, the macrostructures start to partially disintegrate again. The numbers below indicate the size of the measured particles (nm). [Diagram 35] Antibody-protamine / free SMCC-P(P / P) conjugates (white dots) containing fluorescent Alexa488-siRNA in overnight cell-free incubations on chamber slides. A: EGFR-mAB-P / P, B: CD20-mAB-P / P, C: CD33-mAB-P / P, D: IGF1R-mAB-P / P, magnification 40x, bar = 10 μm. E-H: Enlarged views of A-D, bars are also 10 μm. [Diagram 36]Antibody-protamine conjugates with and without free SMCC-protamine, and SMCC-protamine only, containing fluorescent Alexa488-siRNA (white dots) in overnight cell-free incubations on chamber slides. Antibody complexes with free SMCC-protamine: A-D. A. EGFR-mAB-P, B. CD20-mAB-P, C. CD33-mAB-P, D. IGF1R-mAB-P, E. Free SMCC-protamine. Antibody complexes without free SMCC-protamine: F-I. F. EGFR-mAB-P, G. CD20-mAB-P, H. CD33-mAB-P, I. IGF1R-mAB-P. All magnification x40. [Figure 37] Fluorescence optical micrographs of antibody complexes (A and B) and laser scanning microscopy (LSM) images of one confocal optical section (C and D). Formation of cetuximab anti-EGFR-mAB-protamine / free SMCC_P conjugates (A and C) and anti-CD20-mAB-protamine / free SMCC-P (B and D) containing fluorescent Alexa488-siRNA (white dots) in overnight cell-free incubations on chamber slides. [Figure 38] Anti-EGFR antibody-protamine conjugates with free SMCC-protamine containing fluorescent Alexa488-siRNA (white dots) in overnight cell-free incubations on chamber slides at different temperatures as indicated. [Figure 39] Conjugation of cetuximab with different ratios of antibody to SMCC-protamine. A: Detailed composition of each conjugation process. B: Coomassie stained SDS-PAGE showing the uncoupled anti-EGFR antibody cetuximab compared to the conjugated product coupled as illustrated in A. [Diagram 40]Functional analysis of cetuximab conjugation products with different ratios of antibody to SMCC-protamine. A-F: Band shift assay using the different conjugation products presented in the figure. G-L: Cell-free vesicle formation on slides when different conjugation products were incubated with Alexa488-siRNA (white dots, especially J). M-R: Internalization of different cetuximab-SMCC-protamine / P / Alexa488-siRNA complexes into EGFR-positive A549 cells (white dots, arrows). S-X: Colony formation of A549 cells treated with different cetuximab-SMCC-protamine / P conjugations containing free protamine in complex with control ("scr") siRNA or anti-KRAS siRNA ("KRAS"). The conjugate is nonspecifically toxic when more than 50-fold more SMCC-protamine is used. Mean values ​​+ / - SD of three independent experiments are shown here. Asterisks indicate significant differences (P<0.009, two-tailed T-test). [Diagram 41] Functional analysis of vesicle formation of anti-EGFR-mAB-protamine depleted of free SMCC-protamine by supplementation with different ratios of SMCC-protamine or protamine alone. Cell-free vesicle formation on slides by incubation with Alexa488-siRNA. Anti-EGFR-mAB-protamine without free SMCC-protamine does not form vesicles (white dots) as shown in the figure. When free SMCC-protamine was added stepwise, vesicle formation was absent with 1x SMCC-protamine (A), low with 10x SMCC-protamine (B), and high with 32x SMCC-protamine (C). Upon stepwise addition of free protamine not coupled to sulfo-SMCC, vesicle formation does not occur with 1x SMCC-protamine (D), is low with 10x SMCC-protamine (E), and is high with 32x SMCC-protamine (white dots in F). [Diagram 42]Formation of fluorescent anti-CD20-mAB-protamine / free SMCC-P conjugates containing Alexa488-siRNA and / or SM-1 / RF during overnight cell-free incubation on chamber slides. A-C. Green fluorescent channel (white dots), D-F. Red fluorescent channel (gray dots). A and D. Anti-CD20-mAB-P / P containing Alexa488-siRNA, B and E. Anti-CD20-mAB-P / P containing red fluorescent SM-1 / RF, C and F. Anti-CD20-mAB-P / P containing Alexa488-siRNA and red fluorescent SM-1 / RF, Magnification 40x, bar = 10 μm. [Diagram 43] Formation of fluorescent anti-EGFR-mAB-protamine / free SMCC-P conjugates containing Alexa488-siRNA and / or SM-1 / RF during overnight cell-free incubation on chamber slides. A-D: green fluorescent channel (white dots), E-H: red fluorescent channel (gray dots). A. and E. EGFR-mAB-P / P containing Alexa488-siRNA, B. and F. EGFR-mAB-P / P containing red fluorescent SM-1 / RF, C. and G. EGFR-mAB-P / P containing non-fluorescent control siRNA and red fluorescent SM-1 / RF, D. and H. EGFR-mAB-P / P containing green fluorescent Alexa488-siRNA and red fluorescent SM-1 / RF, magnification 40x, bar = 10 μm. [Diagram 44] Formation of rituximab anti-CD20-mAB-protamine / free SMCC-P conjugates containing fluorescent Alexa488-siRNA combined with SM-1 / RF in overnight cell-free incubations on chamber slides. A-C: green (white dots) and red (gray dots) fluorescent channels at 40x magnification, D-L: equal magnification of details from A-C, bar = 10 μm. In D, G, and L: the gray ring illustrates the Alexa488-siRNA fluorescence (arrows). In E, H, and K: the gray circle illustrates the red fluorescence of SM-1 / RF (arrows). In F, I, and L, the periphery of the green fluorescence (gray) (Alexa488-siRNA, arrow) and the inner red fluorescence (SM-1 / RF) can be distinguished. [Diagram 45] Formation of cetuximab anti-EGFR-mAB-protamine / free SMCC-P conjugates containing green fluorescent Alexa488-siRNA combined with red fluorescent SM-1 / RF in overnight cell-free incubations on chamber slides. A-C: Green fluorescent channel (white and rings in A and C) and red fluorescent channel (grey circles in B and C) at 40x magnification. D: Enlarged view of details from A-C, bar = 10 μm. [Diagram 46] Large micellar structures formed by anti-CD20-mAB / P / free SMCC- / P (grey ring in A) and SM-1 / RF (grey circle in B) with Alexa488-siRNA are visible under phase contrast light microscopy (B and C). Bar = 5 μm. [Figure 47] LSM pictures and Z-stacks of one confocal optical section of the antibody complex. A: Formation of anti-EGFR-mAB (cetuximab)-protamine / free SMCC-P conjugates with fluorescent Alexa488-siRNA (white dots) combined with SM-1 / RF during overnight cell-free incubation on a chamber slide. a: One level across the vesicle, b and c: Z-stacks reconstructing the 3D structure of the vesicle in both axes. B: Formation of anti-CD20-mAB (rituximab)-protamine / P conjugates with fluorescent Alexa488-siRNA (white rings and dots) combined with SM-1 / RF (grey shading) during overnight cell-free incubation on a chamber slide. d: One level across the vesicle, e and f: Z-stacks reconstructing the 3D structure of the vesicle in both axes. [Figure 48]Characterization of the gene fusion of gemtuzumab heavy chain with human protamine as siRNA carrier: Exemplary SDS-PAGE of αCD33-mAB gemtuzumab chemically conjugated at two different molar ratios of protamine-SMCC and gemtuzumab compared to a gene fusion with one protamine C-terminally fused to the heavy chain HC. The resulting fusion protein is 100% protamine decorated in the HC, but the fusion does not bind siRNA (C). In contrast, a regular chemical conjugate with a 1:30 excess of SMCC-protamine to gemtuzumab binds siRNA at a ratio of 1:8 (B). αCD33-mAB-P, anti-CD33 monoclonal antibody gemtuzumab chemically coupled to protamine; αCD33-mAB-hPRM1 fusion, anti-CD33 monoclonal antibody gemtuzumab genetically fused with human protamine 1 (PRM1) cDNA; HC, heavy chain; LC, light chain; HC-P, heavy chain with protamine; LC-P, light chain with protamine. [Figure 49] Characterization of a genetic fusion of gemtuzumab heavy chain with human protamine as an siRNA carrier: siRNA binding was restored as detected by band shift assay when αCD33-mAB-hPRM1 fusion protein was supplemented with different amounts of free protamine sulfate (A: 20-fold, B: 25-fold, C: 30-fold molar excess of free protamine sulfate). [Figure 50]Characterization of the gene fusion of gemtuzumab heavy chain with human protamine as an siRNA complexing agent: Reconstitution of siRNA binding properties by adding free protamine sulfate. Purified gemtuzumab-protamine gene fusion was modified by adding unconjugated protamine as an additional complexing agent comparable to excess SMCC chemical conjugation. Addition of free protamine sulfate reconstituted the ability of the gene fusion to complex Alexa488-siRNA with nanoparticles. Although a 10-fold excess of protamine was not sufficient to fulfill the requirements for complexing with Alexa488, samples with higher protamine sulfate content were suitable as siRNA carriers and formed regular micellar structures. Upper panel: fluorescent photographs at 40x magnification, lower panel: fluorescent photographs at 400x magnification. Grey dots represent green fluorescent Alexa488-siRNA signals observed as vesicular nanostructures. αCD33-mAB-hPRM1 fusion, anti-CD33 monoclonal antibody gemtuzumab genetically fused to human protamine 1 (hPRM1) cDNA; αCD33-mAB-P, anti-CD33 monoclonal antibody gemtuzumab chemically coupled to SMCC-protamine; 32×SMCC-P, protamine coupled to 32-fold excess of free SMCC. [Figure 51]Schematic diagram of an exemplary gemtuzumab-protamine fusion protein. A. The gemtuzumab (anti-CD33-mAB) heavy chain was fused with a linker, followed by fusion with human protamine 1 (hPRM1) cDNA, another linker, and an endosomal escape domain (sequence: GFWFG; "EED1"). An exemplary example of an expression vector for this fusion protein is shown in SEQ ID NO:65. B. The teprotumumab (anti-IGF1R-mAB) heavy chain was fused with a linker, followed by fusion with human protamine (PRM1) cDNA. An exemplary example of an expression vector for this fusion protein is shown in SEQ ID NO:78. C. The light and heavy chains of teprotumumab (anti-IGF1R-mAB) were fused with a linker, followed by fusion with human protamine (PRM1) cDNA. An exemplary example of an expression vector for this fusion protein is shown in SEQ ID NO:80. D. Teprotumumab (anti-IGF1R-mAB) light chain was fused with a linker and then fused with human protamine (PRM1) cDNA. An illustrative example of an expression vector for this fusion protein is shown in SEQ ID NO:82. [Figure 52A] Schematic diagram of an exemplary cetuximab-protamine fusion protein. A. Cetuximab (anti-EGFR-mAB) heavy chain was fused to a linker and then fused to human protamine (PRM1) cDNA. An exemplary example of an expression vector for this fusion protein is shown in SEQ ID NO:70. [Figure 52B] Schematic diagram of an exemplary cetuximab-protamine fusion protein. B. The light and heavy chains of cetuximab (anti-EGFR-mAB) were fused with a linker and then fused with human protamine (PRM1) cDNA. An exemplary example of an expression vector for this fusion protein is shown in SEQ ID NO:72. [Figure 52C]Schematic diagram of an exemplary cetuximab-protamine fusion protein. C. The cetuximab (anti-EGFR-mAB) light chain was fused to a linker and human protamine 1 (PRM1) cDNA, and the cetuximab light chain was fused to a linker and human protamine 2 (PRM2) cDNA. An exemplary example of an expression vector for this fusion protein is shown in SEQ ID NO:74. [Fig. 52D] Schematic diagram of an exemplary cetuximab-protamine fusion protein. D. Cetuximab (anti-EGFR-mAB) light chain was fused to a linker and then fused to human protamine (PRM1) cDNA. An exemplary example of an expression vector for this fusion protein is shown in SEQ ID NO:76. [Figure 52E] Schematic diagram of an exemplary cetuximab-protamine fusion protein. E. Cetuximab (anti-EGFR-mAB) light chain was fused to a linker and then fused to human protamine (PRM2) cDNA. An exemplary example of an expression vector for this fusion protein is shown in SEQ ID NO:77. [Diagram 53] Schematic diagram of exemplary antibody-protamine fusion proteins. Construct 1: The antibody heavy chain is fused to a linker, which is then fused to human protamine (PRM) cDNA. In construct 2, the PRM-cDNA is fused to the antibody light chain (LC). Construct 3: The PRM may be fused to the antibody heavy chain (HC) and light chain (HC) via a linker. The PRM may be human PRM1 or PRM2, or a protamine coding sequence of another species. [Figure 54]αCD33-mAB gemtuzumab-protamine fusion reduces colony formation in the presence of free protamine sulfate. Colony formation assay. In the presence of 20-fold, 25-fold, or 30-fold free protamine sulfate, respectively, OCI-AML2 cells treated with αCD33-mAB-PRM1 / DNMT3A-siRNA (D3A) form significantly fewer colonies in soft agar than cells treated with αCD33-mAB-protamine / control (scr)-siRNA and the same amount of free protamine sulfate. When OCI-AML2 cells are treated with αCD33-mAB-PRM1 fusion protein without free protamine sulfate, no difference in colony formation can be observed compared to cells treated with PBS. Mean values ​​± SD of three independent experiments are shown here. *P<0.05, two-tailed T-test. α, anti. [Figure 55] A: Visualization on SDS-PAGE of the molecular weight shift of the cetuximab heavy chain caused by the gene fusion of linker-hPRM-1. B: The cetuximab-hPRM-1 fusion protein by itself is unable to bind siRNA in any significant amount. C: Addition of a 20-fold molar excess of free protamine to the preparations from A and B allows binding of 8 moles of siRNA per mole of cetuximab fusion. D and E: Increasing the molar excess of protamine to 25- and 30-fold, respectively, allows more siRNA to bind to the resulting complex. α, anti. [Figure 56] Elucidation of optimal conditions for the formation of nanocomplexes from siRNA, free protamine, and αEGFR (cetuximab)-hPRM1 fusion. Here, nanocomplexes were formed with increasing excess concentrations of free protamine and siRNA and cetuximab-hPRM1 fusion in a cell-free environment. Complexes are optimally formed at a 32- to 50-fold molar excess of free protamine. Bottom: Phase contrast microscopy. α, anti. [Figure 57]A proposed model of an ideal nanocomplex consisting of siRNA, free protamine, and anti-receptor IgG-hPRM1 fusion. The IgG-hPRM-1 fusion is observed to self-assemble to form a shell structure that encloses a certain amount of self-stabilizing siRNA and free protamine. The spheroid structures form in a time-dependent manner, with approximate diameters of 50-500 nm being the most predominant fraction. [Figure 58] Internalization of Alexa488-marked siRNA into A549 NSCLC cells driven by cetuximab (αEGFR)-hPRM-1 fusion protein combined with increasing excess concentrations of free protamine. Top panels (A-D): nuclei stained with Hoechst counterstain. E-H: green fluorescence representing Alexa488-siRNA. Here, a preparation lacking free protamine sulfate (E) was unable to transport Alexa488-siRNA into A549 cells, whereas increasing concentrations of protamine sulfate in the mixture increased the number of intracellular vesicles filled with internalized Alexa488-siRNA (white dots in F, G, and H), with the optimal molar excess being approximately 30-fold free protamine sulfate per mole of cetuximab-hPRM-1 fusion protein combined with Alexa488-siRNA. [Figure 59] αEGFR-mAB cetuximab-protamine fusion reduces colony formation in the presence of free protamine sulfate. Colony formation assay. In the presence of 20-fold or 30-fold free protamine sulfate, respectively, A549 cells treated with αEGFR-mAB-PRM1 / KRAS-siRNA form significantly fewer colonies in soft agar than cells treated with αEGFR-mAB-protamine / control (scr)-siRNA and the same amount of free protamine sulfate. When A549 cells are treated with αEGFR-mAB-PRM1 fusion protein without free protamine sulfate, no difference in colony formation can be observed compared to cells treated with PBS. Mean values ​​± SD of three independent experiments are shown here. *P<0.05, two-tailed T-test. α, anti. [Figure 60]Synthesis of polyanionic ibrutinib derivatives for electrostatic transport by monoclonal antibodies. Ibrutinib was conjugated with Cy3.5 chromophore to form a low molecular weight (1.44 kDa) polyanion. Chemical structure of anionic ibrutinib-Cy3.5 (Cy3.5-RMA561) assembled with mAB-stable vesicles linked to cationic protamine by electrostatic interactions. [Figure 61] High resolution mass spectrometry of Cy3.5-RMA561. In the mass spectrometer, the sample was ionized and fragmented by the electron beam, and the resulting fragments were analyzed by mass to charge (m / z) ratio according to the specific deflection. HRMS (ESI, CH3CN / H2O): calculated m / z for C64H62N9O15S4 3-[MH] (z=3): 441.44216; found: 441.44160; calculated m / z for C64H62N9O15S4H2-[MH] (z=2): 662.66687; found: 662.66630; calculated m / z for (C64H62N9O15S4H)2 4-[MH] (z=4): 662.66687; found: 662.66630. [Figure 62] αCD20-mAB rituximab-protamine / free protamine-SMCC conjugates and αEGFR-mAB cetuximab-protamine / free protamine-SMCC conjugates bind ibrutinib-Cy3.5. A. Band shift assays using αCD20-mAB-protamine / P and αEGFR-mAB-protamine / P with different ratios of ibrutinib-Cy3.5 up to 1:32. B. Band shift assays using αCD20-mAB-protamine / free protamine-SMCC and αEGFR-mAB-protamine / free protamine-SMCC with different molecular excesses of ibrutinib-Cy3.5 up to 1:200. At least 100 moles of ibrutinib-Cy3.5 can be complexed by the antibody-protamine conjugate. α, anti. [Figure 63]αCD20-mAB rituximab-protamine / free protamine-SMCC / ibrutinib-Cy3.5 conjugate and αEGFR-mAB cetuximab-protamine / free protamine-SMCC conjugate internalize ibrutinib-Cy3.5. A. CD20-positive HBL-1 DLBCL cells internalize αCD20-mAB-protamine / free protamine-SMCC / ibrutinib-Cy3.5 conjugate. B. EGFR-positive A549 NSCLC cells internalize αEGFR-mAB-protamine / free protamine-SMCC / ibrutinib-Cy3.5 conjugate. α, anti. [Figure 64] Covalent labeling of BTK kinase in vitro with ibrutinib-Cy3.5 conjugate (αCD20-mAB-P / ibrutinib-Cy3.5) delivered by rituximab-protamine / free protamine-SMCC as carrier molecule. 105 cells were treated overnight with the indicated concentrations of compounds, lysed in loading dye, and run on a gel. Gels were exposed to UV light on a SYBR Gold filter for Cy3.5 emission in an INTAS gel imager (left), then blotted and incubated with anti-BTK-mAB for identification (right). Intracellular BTK bound both to free ibrutinib-Cy3.5 and to ibrutinib-Cy3.5 complexed to antibody-protamine. RTX, rituximab. [Figure 65]αCD20-mAB (rituximab)-protamine / free protamine conjugates and αEGFR-mAB cetuximab-protamine / free protamine conjugates transport ibrutinib-Cy3.5 and inhibit colony formation more effectively than ibrutinib-Cy3.5 or antibody alone. A. and B. Colony formation assay. HBL-1 cells treated with αCD20-mAB(rituximab)-protamine / free protamine-SMCC / ibrutinib-Cy3.5 (A), and A549 cells treated with αEGFR mAB-(cetuximab)-protamine / free protamine-SMCC / ibrutinib-Cy3.5 (B) form significantly fewer colonies in methylcellulose than cells treated with PBS, unconjugated ibrutinib-Cy3.5, or αCD20 mAB-(rituximab)-protamine / free protamine-SMCC / ibrutinib-Cy3.5. Mean values ​​± SD of three independent experiments are shown here. Asterisks indicate significant differences (p-values ​​<0.05, two-tailed t-test). α, anti; [Figure 66]αCD20-mAB rituximab-protamine conjugate does not bind ibrutinib-Cy3.5 efficiently after depletion of free protamine-SMCC by HPLC. A. Coomassie stained SDS-PAGE showing HPLC fractions 19-25 / 26 upon depletion of unbound protamine-SMCC for αCD20-mAB, αCD20-mAB coupled to 32x protamine-SMCC, and αCD20-mAB coupled to 32x protamine-SMCC; HC=heavy chain, LC=light chain, -P=protamine-SMCC. B. Band shift assay with protamine-depleted αCD20-mAB preparation (left) and protamine-containing αCD20-mAB preparation (right). Protamine-SMCC-depleted αCD20-mAB-preparations do not bind ibrutinib-Cy3.5 >32 mol. C. Colony formation assay. HBL-1 cells treated with αCD20-mAB-protamine / free protamine-SMCC / ibrutinib-Cy3.5 form significantly fewer colonies in soft agar than cells treated with uncoupled ibrutinib-Cy3.5 alone or uncoupled αCD20-mAB. When HLB-1 cells are treated with αCD20-mAB-protamine conjugates without free protamine-SMCC, no difference in colony formation can be observed compared to cells treated with PBS (see A+B, fraction 25). Mean values ​​± SD of three independent experiments are shown here. *P<0.0003, two-tailed T-test. α, anti. [Figure 67]αCD20-mAB Rituximab-Protamine / Free Protamine-SMCC conjugate efficiently coordinates and transports Ibrutinib-Cy3.5 to tumor sites in vivo, significantly reducing tumor growth. A. Tumor growth and treatment regimen of NSG-HBL1 xenograft model. After implantation, tumors were allowed to grow to 200 mm3, after which intraperitoneal (ip) treatments were initiated twice weekly. B. Treatment with rituximab-protamine / free protamine / ibrutinib-Cy3.5 1:20 complex (4 mg / kg mouse body weight or 0.625 nmol rituximab-protamine and / or 12.5 nmol ibrutinib derivative per dose) (pictured = rituximab-ibrutinib-Cy3.5 (C) or rituximab-P / P / ibrutinib-Cy3.5 (B)) significantly reduced tumor volume and growth. Tumor volumes were assessed by caliper measurement twice weekly on all treatment days. In the group treated with the rituximab-protamine / free protamine / ibrutinib-Cy3.5 1:20 complex, the tumor volume was restricted to well below 1,000 mm3 and began to shrink to 600 mm3 after three treatments, while all other groups showed rapid tumor growth and had to be sacrificed early due to predefined legal regulations. C. Comparison of survival curves between treated and control groups. Groups of 10 mice each were treated with PBS, rituximab, ibrutinib standard, ibrutinib-Cy3.5, and rituximab-protamine / free protamine / ibrutinib-Cy3.5 1:20 complex. Ibrutinib-Cy3.5 did not reduce tumor growth 8 days after the start of treatment and all mice had to be sacrificed due to predefined criteria, while mice treated with PBS and rituximab survived significantly longer, until day 16. The last of the 10 mice treated with ibrutinib had to be sacrificed on day 20, whereas of the 10 mice treated with the rituximab-protamine / free protamine / ibrutinib-Cy3.5 1:20 complex, 5 survived until day 16 and 4 until day 20 after the start of treatment. Differences between the rituximab-protamine / free protamine / ibrutinib-Cy3.5 treated group and the control were assessed as p≦0.03 (ANOVA).α, anti-RTX, rituximab. [Figure 68] Tumors of HBL-1 cells xenografted in NSG mice show a significant enrichment of Cy3.5 fluorescent signal in mice treated with Rituximab-Protamine / Free Protamine-SMCC / Ibrutinib-Cy3.5. Xenografted mice from the experiment shown in Figure 55 were sacrificed after reaching intolerable tumor size, and organs and tumors were prepared and subjected to ex vivo fluorescence detection of Cy3.5 signal with excitation at 530 nm and emission at 600 nm. Tumors from the group treated with Rituximab-P / Free P / Ibrutinib (pictured = Rtx / Ibrutinib-Cy3.5) (bottom row) showed a significant enrichment of Cy3.5-dependent fluorescent signal in all parts of the tumor tissue compared to non-targeted Ibrutinib-Cy3.5 and standard Ibrutinib, while in control organs only necrotic foci showing autofluorescence were detected. The diameter of the tumor preparations shown was similar in all cases, although the fluorescent areas differed. The scale represents arbitrary units of fluorescence. The dotted lines represent the circumference of each tumor. The numbers refer to the identification of individual mice. [Figure 69] Overview of different mouse organs analyzed for Cy3.5 fluorescence from NSG mice xenografted with HBL1 mice. Xenografted mice from the experiments shown in Figures 55 and 56 were sacrificed after reaching intolerable tumor sizes, and organs and tumors were prepared and subjected to ex vivo fluorescence detection for Cy3.5 signal with excitation at 530 nm and emission at 600 nm. Tumors from the group (lower row) treated with Rituximab-P / Free P / Ibrutinib (in the picture, =Rtx / Ibrutinib-Cy3.5) showed a significant enrichment of Cy3.5-dependent fluorescence signal compared to non-targeted Ibrutinib-Cy3.5. The scale represents arbitrary units of fluorescence. Organs are always positioned in the same orientation (illustrated in the scheme on the right) in bright field (upper panel) and red (Cy3.5) fluorescence (lower panel). [Figure 70]Formation of rituximab αCD20-mAB-protamine / free SMCC-protamine nanovesicles with green fluorescent Alexa488-siRNA and / or red fluorescent ibrutinib-Cy3.5 during overnight (o / n) cell-free incubation on chamber slides. A-C. Green fluorescent channel, D-F. Red fluorescent channel. A and D. αCD20-mAB-P / free P with green Alexa488-siRNA, B and E. αCD20-mAB-P / free P with red fluorescent ibrutinib-Cy3.5, C and F. αCD20-mAB-P / free P with green Alexa488-siRNA and red ibrutinib-Cy3.5, magnification 40x, bar=10 μm. All rituximab-protamine preparations contain unbound protamine-SMCC. α, anti. [Figure 71] Formation of cetuximab αEGFR-mAB-protamine / free protamine-SMCC conjugates containing green fluorescent Alexa488-siRNA and / or red fluorescent ibrutinib-Cy3.5 upon overnight (o / n) cell-free incubation on chamber slides. A-D. Green fluorescent channel, E-H. Red fluorescent channel; A and E. Cetuximab αEGFR-mAB-P / free protamine-SMCC with green fluorescent Alexa488-siRNA; B and F. Cetuximab αEGFR-mAB-P / free protamine-SMCC with red fluorescent ibrutinib-Cy3.5; C and G. αEGFR-mAB-P with non-fluorescent control siRNA (scr, scrambled) and red fluorescent ibrutinib-Cy3.5; D and H. αEGFR-mAB-P with non-fluorescent Alexa488-siRNA and red fluorescent ibrutinib-Cy3.5, magnification 40x, bar = 10 μm. All cetuximab protamine preparations contain unbound protamine-SMCC. α, anti. [Figure 72]Formation of cetuximab αEGFR-mAB-protamine / free protamine-SMCC conjugates (A-B) and rituximab anti-CD20-mAB-protamine / free protamine-SMCC conjugates (C-D) containing green fluorescent Alexa488-siRNA combined with red fluorescent ibrutinib-Cy3.5 upon overnight (o / n) cell-free incubation on chamber slides. 40x magnification of green and red fluorescent channels. In A and C, a rim of green fluorescence (Alexa488-siRNA) is visible, in B and D, internal red fluorescence (ibrutinib-Cy3.5) can be seen. All antibody-protamine preparations contain unbound protamine-SMCC. [Figure 73] Particle size determination for different complexations of αCD20-mAB Rituximab / free protamine-SMCC with siRNA and ibrutinib-Cy3.5. Illustration of mean diameter (nm) shown in A-B-E. Zetaview measurements of the indicated complexes were performed 1 and 2 hours after the start of incubation. Shown here is the mean vesicle size (nm) determined by the mean diameter of each particle depicted in the histograms in B-E. All Rituximab-protamine preparations contain unbound protamine-SMCC. α, anti. [Figure 74-1]A: αCD20-mAB rituximab-protamine / free protamine-SMCC (αCD20-mAB-P / P) conjugate binds ibrutinib-Alexa488. Band shift assay with αCD20-mAB-protamine / P with different ratios of ibrutinib-Alexa488 up to 1:2. α, anti. B: Since the anionic charge of the Alexa488 molecule is limited to -2 (arrow), the interaction of the polycationic protamine fusion with Alexa488 was found to be weaker than that with Cy3.5, which has a net charge of -4. Only a 2:1 coupling ratio was achieved with ibrutinib conjugated to Alexa488 and the protamine conjugate. However, the conjugation of ibrutinib-Alexa488 with αCD20-mAB rituximab-protamine / free protamine-SMCC (αCD20-mAB-P / P) was still successful. C-H: Stability after 1 h self-assembly of αCD20-mAB-protamine, free protamine and ibrutinib-Cy3.5 in a 1:20 ratio, followed by 24 h incubation in PBS (C,D) and in challenging conditions such as cell culture media RPMI / 10% FCS (E,F) and PBS / 50% FCS (G,H). C,E,G: Cy3.5 fluorescence, D,F,H: phase contrast. α, anti. [Figure 74-2] See description of Figure 74-1. [Figure 75] Charged ibrutinib-Cy3.5 forms stable nanoparticles with different mABs conjugated to protamine, whereas uncharged ibrutinib (trade name: imbruvica) does not. Charged ibrutinib-Cy3.5 was loaded onto each antibody carrier, conjugated to protamine via SMCC and containing free SMCC-protamine, compared to uncharged ibrutinib. Only the ibrutinib sample conjugated to Cy3.5 showed dense formation of nanoparticles, whereas uncharged ibrutinib did not. Anti-EGFR antibodies (A-D), anti-CD33 antibodies (E-H), and anti-IGF1R antibodies (I-L) were tested in Cy3.5-dependent fluorescence micrographs (top) and phase contrast (bottom). α, anti. [Figure 76] Charged ibrutinib-Cy3.5 forms stable nanoparticles with different protamine-fused mABs, whereas uncharged ibrutinib (trade name: imbruvica) does not. Here, we used hPRM1-protamine fusions of anti-EGFR (A-D) as well as hPRM1 fusions with anti-CD33 to complex with charged ibrutinib-Cy3.5. Stable nanoparticles were formed by ibrutinib-Cy3.5, but not by uncharged ibrutinib. Anti-EGFR antibodies (αEGFR-mAB-PRM1: A-D) and anti-CD33 antibodies (αCD33-mAB-PRM1: E-H) were examined in Cy3.5-dependent fluorescence microscopy (top) and phase contrast (bottom). α, anti. [Figure 77] Cross-sections of idealized examples of nanoparticle-like structures that fulfill the experimentally inferred conditions for effective antibody-protamine-protamine-siRNA or -ibrutinib-Cy3.5 carrier complexes (not drawn to scale). Electrostatic bond bridges are formed between the mABs, and several protamines are coupled to the targeting antibody and the respective anionic cargo, which includes siRNA (A), ibrutinib-Cy3.5 (B), or both (C). [Figure 78] Electrostatic nanoparticle formation with αCD20-mAB-protamine / free protamine-ibrutinib-Cy3.5. Carrier antibody-protamine conjugates were loaded with anionic ibrutinib-Cy3.5 at a ratio of 1:20 and applied to cell culture treated glass slides for fluorescence microscopy (A, B) or copper grids for electron microscopy negatively stained with tungsten phosphate (C). Here, electrostatic loading led to the formation of numerous aggregates, the larger ones showing strong Cy3.5 fluorescence (A) and visible in light microscopy using an embossed dynamic filter to illustrate the 3D structure by contrast enhancement (B). In transmission electron microscopy (C), negative staining led to approximately the same particle size range but revealed the presence of numerous smaller vesicles (C) that were undetectable in light microscopy. α, anti. [Figure 79] Cellular targeting of Bruton's kinase BTK by ibrutinib-Cy3.5 complexed with αCD20-mAB-P / P. A-F: Fluorescence microscopy of HBL1 DLBCL cells treated with targeting conjugates and controls showing significant intracellular enrichment of Cy3.5 signal. G: Lysates from cells treated for 72 h with targeting conjugates and controls were subjected to SDS PAGE and illuminated for Cy3.5 signal. Here, a distinct band at 70 kDa, identified as BTK by parallel immunoblot, is covalently marked by ibrutinib-Cy3.5, indicating binding of the ibrutinib-Cy3.5 derivative and therefore its functionality. H-P: Fluorescence microscopy of HBL1 DLBCL cells pretreated with ibrutinib-bodipy (green, N and P) shows no intracellular enrichment of Cy3.5 signal after αCD20-mAB-P / P-ibrutinib-Cy3.5 treatment (M compared to L). α, anti-. [Figure 80]Physiological and functional significance of BTK inactivation by αCD20-mAB-protamine / free protamine-ibrutinib-Cy3.5 treatment in DLBCL cell lines. A: HBL1 cells were treated with each of the indicated conjugates for 72 h, lysed, and subjected to SDS-PAGE and western blotting for phosphorylated BTK (pBTK), total BTK (tBTK), phosphorylated ERK (p-ERK), total ERK (t-ERK), and actin as a loading control. Here, untargeted ibrutinib-Cy3.5 inhibited BTK phosphorylation slightly less than αCD20-mAB-protamine-ibrutinib-Cy3.5, and the difference in expected downstream phosphorylation targets such as ERK was more obvious: here, only ibrutinib-Cy3.5 treatment mediated by αCD20-mAB-P / P was able to reduce ERK phosphorylation. B: In colony formation assays, untargeted ibrutinib-Cy3.5 moderately reduced colony growth of HBL1 cells, and specific targeting of ibrutinib-Cy3.5 with αCD20-mAB-P / P pushed the colony growth reduction to less than 30%. To prove the importance of free protamine within the conjugate construct, it was depleted from the conjugate mixture, and application of this combination revealed no reduction in colony formation over application of ibrutinib-Cy3.5 alone, thus the antibody conjugate had lost its targeting ability (B, rightmost bar). α, anti. [Figure 81]Induction of BTK-targeted apoptosis by treatment with ibrutinib-Cy3.5 complexed to αCD20-mAB-P / P in DLBCL cell line HBL1. HBL1 cells were treated with each of the indicated conjugates for 72 h and subjected to Annexin V staining. Notably, apoptotic cells were detected by Annexin V expression (upper panel, X-axis) and increased internalized ibrutinib-Cy3.5 fluorescence was seen by fluorescence on the Y-axis (upper panel) by flow cytometry in cells treated with ibrutinib-Cy3.5 complexed to αCD20-mAB-P / P. Values ​​from the top right and bottom right gates were counted. Lower panel: Annexin V positive cells in three independent experiments summarized. P<0.05, two-tailed T-test. α, anti-. [Figure 82] Knockdown of the oncogenic EWS-FLI1 translocation product by systemic treatment with αIGF1R-mAB-protamine / free protamine-siRNA-protamine nanocarriers inhibits the growth of Ewing's sarcoma xenograft tumors. A. Treatment scheme of the in vivo experiment. Nanoparticles were given intraperitoneally as indicated. B-C. Results of systemic in vivo application of targeted nanocarriers to SK-N-MC xenograft tumors. B. Tumor growth curves of SK-N-MC treated with αIGF1R-mAB teprotumumab ("Tepro")-protamine / PsiRNA nanoparticles (mean + / - SEM; two-tailed t-test, *p<0.05). C. Weight statistics of tumors excised at the end of the experiment (mean + SD, two-tailed t-test, *p<0.05). α, anti. [Figure 83] Nanoparticles formed by carrier antibody-protamine / free protamine and siRNA exhibit a nearly neutral surface charge. Nanoparticles were allowed to form for 2 h and subjected to dynamic light scattering (DLS) analysis (Malvern Zeta-sizer) as described elsewhere. Particle sizes ranged from 350 to 750 nm with deviations shown depending on the different antibody conjugation preparations. More importantly, the zeta potential of the particle surface was only slightly negative to neutral. [Figure 84]Deciphering the prerequisites for effective nanoparticle formation between anti-EGFR-mAB-SMCC-protamine conjugates and free SMCC-protamine and siRNA. A-G. Vesicle formation with 60 nM αEGFR-mAB-P in the presence of 32-fold SMCC-protamine and increasing molar ratios (1:0.6 to 1:40) of Alexa488-control siRNA to antibody concentration. Vesicle formation can be observed at a 5- to 10-fold molar excess of siRNA (D-E). Top panel: Fluorescence microscopy of Alexa488-siRNA positive vesicles. Bottom panel: Phase contrast of the same preparation as in the top panel. α, anti. [Figure 85] Nanoparticles formed by αEGFR-protamine / free protamine-Alexa488-siRNA are stable in serum-containing conditions. A-B. Stability after 2 h of self-assembly of αEGFR-mAB-protamine, free protamine, and Alexa488-siRNA in a 1:10 ratio, followed by 24 h of incubation in PBS (A) and PBS / 50% FCS (B). α, anti. [Figure 86] Serum stability of αCD20-mAB-protamine / free P-ibrutinib-Cy3.5 nanocarriers. A-F. Stability after 2 h of self-assembly of αCD20-mAB-protamine, free protamine and ibrutinib-Cy3.5 in a 1:20 ratio, followed by incubation for 24 h (A-C) or 72 h (D-F) in PBS (A, D) and in challenging conditions such as cell culture media RPMI / 10% FCS (B, E) and PBS / 50% FCS (C, F). A-F: Cy3.5 fluorescence microscopy. α, anti-. [Figure 87]pH stability of siRNA nanocarriers constructed with three different targeting antibodies. Nanocarriers formed with αEGFR-mAB-protamine / free protamine (upper panel), αIGF1R-mAB-protamine / free protamine (middle panel), and αCD33-mAB-protamine / free protamine (lower panel), each with a 10-fold molar excess of siRNA, were formed at standard conditions for 2 h at RT and then diluted with 30-fold volumes of the respective buffer for 24 h of each pH stability test in chamber slides. Slides were then washed, mounted, and subjected to fluorescence microscopy. The nanocarriers were shown to be stable at pH values ​​between 5.2 and 8.0, with a tendency to aggregate at lower pH. α, anti. [Figure 88] pH stability of nanocarriers constructed by αCD20-mAB-protamine / free protamine and ibrutinib-Cy3.5. Nanocarriers formed by αCD20-mAB-protamine / free protamine and 20-fold molar excess of ibrutinib-Cy3.5 were formed at standard conditions at RT for 2 h and then diluted with 30-fold volumes of the respective buffer for 24-h pH stability tests in chamber slides. Slides were then washed, mounted, and subjected to fluorescence microscopy. The nanocarriers were shown to be stable at pH values ​​between 5.8 and 8.0 and tended to disintegrate at lower pH. α, anti. [Figure 89] Immunolabeling of targeting IgG antibody within αEGFR-mAB-P / free protamine-siRNA nanocarriers. Nanocarriers were formed by self-assembly for 2 h (αEGFR-P / free protamine+Alexa488-siRNA (green in A and D)), immobilized overnight on treated glass surfaces (A, E), stained with αhIgG-Alexa647 (A-C), rinsed with PBS, mounted with DAKO fluorescent mounting medium, and subjected to fluorescence microscopy. The nanocarrier structures show prominent staining of Alexa647 of the targeting αEGFR antibody only in the surface region (B-C). F. Schematic diagram of the staining procedure. α, anti. [Figure 90]Immunolabeling of targeting IgG antibody within αIGF1R-mAB-P / free protamine siRNA nanocarriers. Nanocarriers were formed by self-assembly for 2 h (teprotumumab-protamine + Alexa488-siRNA (green)), immobilized overnight on treated glass surfaces (A, D), stained with αhIgG-Alexa647 (A-C), rinsed with PBS, mounted with DAKO fluorescent mounting medium, and subjected to fluorescence microscopy. The nanocarrier structures show prominent staining of Alexa647 of the targeting teprotumumab antibody only in the surface region (B-C). F. Schematic diagram of the staining procedure. α, anti. [Figure 91-1] Visualization of free protamine within the nanocarrier complex. Here, we used an αEGFR-mAB-protamine preparation depleted of free protamine by size-exclusion chromatography, and this preparation reconstituted with free protamine tagged with Cy3 chromophore. A: Protamine was conjugated to Cy3-NHS ester and purified by spin column according to the manufacturer's recommendations. The resulting protamine-Cy3 showed strong Cy3-dependent fluorescence and was comparable to the unconjugated material, so we reconstituted it in antibody-protamine at a typical 32-fold molar excess (B). siRNA nanocarriers formed by this reconstituted material and untagged siRNA showed strong Cy3-dependent fluorescence signal of protamine in the lumen of the nanostructure (C). In contrast, the same nanostructures stained for α-human IgG signal by αhIgG-Alexa 647 antibody exhibited a perimeter structure that stained positive for antibody location (D). E: Merge and enlargement of highlighted areas in C and D. F: Enlargement of highlighted area in E. α, anti. [Figure 91-2] See description of Figure 91-1. [Figure 92] Synthesis of cyanine dye-conjugated inhibitors, gefitinib, gemcitabine, and venetoclax. [Figure 93] Extension of the concept to simpler and less expensive polyanionic molecular moieties. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0016] Detailed Description The inventors of the present application have surprisingly found that antibody-protamine fusion proteins, such as those described by Yao et al.2012, perform poorly in complexing negatively charged cargo molecules.However, they have surprisingly found that the addition of free protamine dramatically increases the ability of the fusion protein to complex with negatively charged cargo molecules, such as siRNA.The addition of free protamine results in the formation of nanoparticles that include the antibody-protamine fusion, free protamine, and the negatively charged cargo molecule to be delivered to the target.

[0017] It was also surprisingly found that a modification of the conjugation protocol for antibody-protamine conjugates described in Baumer, N. et al., 2016 Nat. Protoc. 11, 22-36, results in the formation of nanoparticles comprising the antibody-protamine conjugate, free protamine, and a negatively charged cargo molecule to be delivered to the target.

[0018] The formation of composite nanoparticles containing targeting antibodies fused to protamine, free protamine, and negatively charged cargo molecules such as siRNA can be used for cell type-specific therapeutic delivery of siRNA and other effector drugs that can selectively block oncogenic pathways. The same is true for nanoparticles containing targeting moieties chemically conjugated to protamine, free protamine, and negatively charged cargo molecules.

[0019] In the protocol of the present disclosure, for the step of loading siRNA into the antibody-protamine fusion protein, the antibody-protamine fusion protein and the siRNA are contacted with each other in the presence of a certain amount of free protamine. Surprisingly, nanoparticles comprising the antibody-protamine fusion protein, free protamine and siRNA are formed by this modified protocol.

[0020] The present inventors have further surprisingly found that such nanoparticles provide more efficient binding and delivery of siRNA compared to antibody fusion proteins produced according to prior art protocols.

[0021] The nanostructures produced by the method of the present invention are much larger than the linear single antibody-protamine-siRNA complexes and can be detected as vesicular structures by optical microscopy. The inventors of the present application found that a certain amount of unbound protamine is required to form these nanoparticles and efficiently target the respective cells. It was then observed that knockdown of the intended target (cancer) gene can be specifically performed. The positively charged nanostructures (micelles) can also function as carriers for other negatively charged small molecules, as shown in Examples 6 and 15, where small molecules were also efficiently transported to the respective cells in a target-specific manner. With this approach, therapeutic molecules such as siRNA not only function to form electrostatic nanostructures, but are also encapsulated inside the nanostructures.

[0022] Most cancer types in advanced and metastatic stages are not effectively curable at the time of this invention, so there is a strong need for new, more effective, and better tolerated treatment options.Nanoparticles composed of targeting moieties such as cancer cell-specific antibodies fused with protamine and free protamine can transport negatively charged molecules that are not otherwise taken up by eukaryotic cells, such as siRNA and other small molecules.In particular, siRNA can be defined against any gene, so this system may be applicable to many diseases, such as cancer, neurodegeneration, and viral infection.

[0023] Accordingly, the present application relates to a method for producing nanoparticles comprising the steps of: contacting (a) a fusion protein (A) comprising an antibody (A1) and a positively charged polypeptide (A2); (b) a positively charged polypeptide (B); and (c) a negatively charged molecule (C), thereby forming nanoparticles.

[0024] In the method of the present disclosure, a fusion protein (A), a positively charged polypeptide (B), and a negatively charged molecule (C) are brought into contact with each other. Without wishing to be bound by theory, it is observed that the aforementioned three components self-assemble to form nanoparticles.

[0025] When referring to a positively charged polypeptide (B), this expression preferably refers to a free positively charged polypeptide that is not included in a fusion protein that includes a targeting moiety such as an antibody. However, the positively charged polypeptide (B) may include post-translational and / or chemical modifications. The term positively charged polypeptide (B) also includes a mixture of different positively charged polypeptides, for example, a mixture of different types of positively charged polypeptides.

[0026] Preferred positively charged polypeptides for step (d) include, but are not limited to, protamine, histone subunits, or mixtures thereof, with protamine being preferred.

[0027] In some methods of the present disclosure, the positively charged polypeptide is preferably in molar excess compared to the fusion protein (A), i.e., preferably, there are more positively charged polypeptide (B) molecules than fusion protein (A) molecules. In some embodiments, the molar ratio of the positively charged polypeptide (B) to the fusion protein (A) is at least about 10:1, preferably at least about 15:1, preferably at least about 20:1. In some embodiments, the molar ratio of the positively charged polypeptide (B) to the fusion protein (A) is up to about 70:1, preferably up to about 60:1, preferably up to about 50:1. In some embodiments, the molar ratio of the positively charged polypeptide (B) to the fusion protein (A) is in the range of about 10:1 to 50:1, preferably about 15:1 to about 50:1, preferably about 20:1 to about 50:1. In preferred embodiments, the molar ratio of the positively charged polypeptide (B) to the fusion protein (A) is about 20:1, about 21:1, about 22:1, about 23:1, about 24:1, about 25:1, about 26:1, about 27:1, about 28:1, about 29:1, about 30:1, about 31:1, about 32:1, about 33:1, about 34:1, about 35:1, about 36:1, about 37:1, about 38:1, about 39:1, about 40:1, about 41:1, about 42:1, about 43:1, about 44:1, about 45:1, about 46:1, about 47:1, about 48:1, about 49:1, and / or about 50:1.

[0028] In some methods of the present disclosure, the negatively charged molecule (C) is preferably in molar excess compared to the fusion protein (A), i.e., preferably, the negatively charged molecule (C) is present in greater numbers than the fusion protein (A) molecules. In some embodiments, the molar ratio of the negatively charged molecule (C) to the fusion protein (A) is at least about 1:1, at least about 2:1, at least about 3:1, at least about 4:1, at least about 5:1, at least about 6:1, at least about 7:1, at least about 8:1, at least about 9:1, at least about 10:1, at least about 15:1, at least about 20:1, at least about 25:1, at least about 30:1, at least about 40:1, at least about 50:1, at least about 70:1, at least about 100:1, at least about 150:1, at least about 200:1, at least about 250:1, at least about 300:1, at least about 400:1, or at least about 500:1.

[0029] In some methods of the present disclosure, the negatively charged molecules (C) are preferably equimolar or in molar excess compared to the positively charged polypeptides (B), i.e., the negatively charged molecules (B) are preferably present in about the same number or more compared to the positively charged polypeptide molecules (B). In some embodiments, the molar ratio of the negatively charged molecules (C) to the positively charged polypeptides (B) is at least about 1:1, at least about 2:1, at least about 3:1, at least about 4:1, at least about 5:1, at least about 6:1, at least about 7:1, at least about 8:1, at least about 9:1, at least about 100:1, at least about 20:1, at least about 30:1, at least about 40:1, at least about 50:1, at least about 60:1, at least about 70:1, at least about 80:1, at least about 90:1, or at least about 100:1.

[0030] The method of the present disclosure may be carried out at a wide range of temperatures. The examples of the present application show that nanoparticles may be formed at about 4°C, at room temperature, or at 37°C. It is therefore envisioned that the method of the present disclosure may be carried out at a temperature of about 1°C to about 60°C, preferably about 2°C to about 50°C, preferably about 3°C ​​to about 40°C, more preferably about 4°C to about 37°C, inclusive. Thus, at least a part of the method of the present disclosure, for example, the step of contacting the fusion protein (A), the positively charged polypeptide (B), and the negatively charged molecule (C), may be carried out at a temperature of about 1°C to about 60°C, preferably about 2°C to about 50°C, preferably about 3°C ​​to about 40°C, more preferably about 4°C to about 37°C.

[0031] It is envisaged that the step of contacting the fusion protein (A), the positively charged polypeptide (B) and the negatively charged molecule (C) preferably includes an incubation step that allows the formation of nanoparticles. The incubation step is preferably carried out for at least about 1 hour, preferably at least about 1.5 hours, preferably at least about 2 hours. The incubation step is preferably carried out for up to about 48 hours, preferably up to about 24 hours, preferably up to about 18 hours, preferably up to about 12 hours, preferably up to about 10 hours, preferably up to about 9 hours, preferably up to about 8 hours, preferably up to about 7 hours, preferably up to about 6 hours. The incubation step is preferably carried out for about 1 hour to about 48 hours, preferably about 1 hour to about 24 hours, preferably about 1 hour to about 18 hours, preferably about 1 hour to about 12 hours, preferably about 1 hour to about 10 hours, preferably about 1 hour to about 9 hours, preferably about 1.5 hours to about 8 hours, preferably about 1.5 hours to about 7 hours, preferably about 2 hours to about 6 hours. Without wishing to be bound by theory, it is believed that optimal results may be achieved with an incubation time of about 2 hours to about 6 hours. Thus, in a preferred embodiment, the process lasts for about 2 hours to about 6 hours, e.g., about 2 hours, about 2.1 hours, about 2.2 hours, about 2.3 hours, about 2.4 hours, about 2.5 hours, about 2.6 hours, about 2.7 hours, about 2.8 hours, about 2.9 hours, about 3 hours, about 3.1 hours, about 3.2 hours, about 3.3 hours, about 3.4 hours, about 3.5 hours, about 3.6 hours, about 3.7 hours, about 3.8 hours, about The incubation steps include incubation steps of about 3.9 hours, about 4 hours, about 4.1 hours, about 4.2 hours, about 4.3 hours, about 4.4 hours, about 4.5 hours, about 4.6 hours, about 4.7 hours, about 4.8 hours, about 4.9 hours, about 5 hours, about 5.1 hours, about 5.2 hours, about 5.3 hours, about 5.4 hours, about 5.5 hours, about 5.6 hours, about 5.7 hours, about 5.8 hours, about 5.9 hours, and about 6 hours.

[0032] The term "conjugation" or "conjugate" as used herein refers to the joining of two or more molecules by any type of covalent bond, including but not limited to chemical conjugation. Thus, conjugation can include the conjugation of at least a portion of a linker to a polypeptide. This connection can be achieved through different reactive groups or through the same reactive group.

[0033] As used interchangeably herein, the term "fused" or "fusion" refers to the joining of two or more subunits by means including genetic fusion. As used herein, the term "fusion polypeptide" or "fusion protein" refers interchangeably to a polypeptide or protein comprising two or more subunits. In a fusion polypeptide, the subunits may be linked by covalent or non-covalent bonds. Preferably, the fusion polypeptide is a translational fusion of two or more subunits. A translational fusion may be generated by genetically modifying the coding sequence of one subunit in a reading frame with the coding sequence of an additional subunit. A nucleotide sequence encoding a linker may be interposed between the two subunits. The subunits forming the fusion polypeptide or fusion protein are typically linked to each other such that the C-terminus of one subunit is connected to the N-terminus of the other subunit, or the N-terminus of one subunit is connected to the C-terminus of the other subunit. The subunits of a fusion polypeptide may be linked in any order and may include more than one of any of the constituent subunits. When one or more of the subunits is part of a protein (complex) composed of multiple polypeptide chains, such as an antibody, the term "fusion polypeptide" can also refer to the polypeptide comprising the fused sequence and all the other polypeptide chains of that protein (complex).

[0034] The method of the present disclosure may further include a step of separating and / or recovering the nanoparticles from components of their production environment. Preferably, after separation and / or recovery, the nanoparticles are free or substantially free of association with all other components from their production environment. Contaminating components from the production environment are typically materials that interfere with the use of the nanoparticles, particularly their therapeutic use, and may include free fusion protein (A) (i.e., fusion protein (A) that is not included in the nanoparticles), free (i.e., not included in the nanoparticles) positively charged polypeptide (B), or free (i.e., not included in the nanoparticles) negatively charged molecules (C). The nanoparticles may, for example, comprise at least about 5% by weight, at least about 10% by weight, at least about 15% by weight, at least about 20% by weight, at least about 25% by weight, at least about 30% by weight, at least about 35% by weight, at least about 40% by weight, at least about 45% by weight of the total protein in a given sample. In preferred embodiments, the nanoparticles comprise at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% by weight of the total protein in a given sample. In preferred embodiments, the nanoparticles comprise at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% by weight of the total protein in a given sample. It is understood that isolated nanoparticles may comprise from about 5% to about 99.9% or about 100% by weight of the total protein content, depending on the circumstances.

[0035] The term "polypeptide", as used herein, refers to a compound composed of a single chain of amino acid residues linked by peptide bonds. The term "protein", as used herein, may be synonymous with the term "polypeptide" or may further refer to a complex of two or more polypeptides. A polypeptide, as used herein, may comprise at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 600, at least about 700, or even more amino acids.

[0036] Polypeptide, as used herein, is preferably composed of naturally occurring and / or proteinogenic amino acids.However, the present invention also encompasses peptidomimetics, in which amino acids and / or peptide bonds are replaced by functional analogues.The term polypeptide also refers to and does not exclude modifications of polypeptides, such as glycosylation, acetylation, phosphorylation, etc.Such modifications are well described in basic textbooks and more detailed monographs, as well as in the research literature.

[0037] The term "positively charged polypeptide" refers to a polypeptide that has a net positive charge at or near physiological pH (e.g., in a solution having a pH of 4-10, 5-9, or 6-8) and is preferably capable of binding to a nucleic acid or a negatively charged small molecule by electrostatic interactions. This class of carriers includes, but is not limited to, protamine, histone, or histone subunits. Preferably, such positively charged polypeptides have a net charge of at least 2+, preferably at least 3+, preferably at least 4+, preferably at least 5+, preferably at least 6+, preferably at least 7+, preferably at least 8+, preferably at least 9+, preferably at least 10+, preferably at least 11+, preferably at least 12+, preferably at least 13+, preferably at least 14+, preferably at least 15+, preferably at least 16+, preferably at least 17+, preferably at least 18+, preferably at least 19+, preferably at least 20+. The term "positively charged polypeptide" can encompass both free (i.e., unconjugated) polypeptides and conjugated polypeptides, i.e., polypeptides contained in fusion proteins.

[0038] A preferred positively charged polypeptide according to the present disclosure includes protamine. Protamine refers to a small, strongly basic protein, whose positively charged amino acid groups (specifically arginine) are generally arranged in clusters, and due to their polycationic nature, neutralize the negative charge of nucleic acids. The term "protamine" as used herein includes any protamine amino acid sequence obtained or derived from natural or biological sources, such as fragments thereof, and polymeric forms of said amino acid sequence or fragments thereof. Protamine may be of natural origin or may be produced by recombinant methods. The use of recombinant methods may allow the production of multiple copies of protamine, or the molecular size and amino acid sequence of protamine may be modified. The corresponding compound may be chemically synthesized. When artificial protamine is synthesized, the method used may include, for example, the replacement of amino acid residues that have functions of natural protamine that are undesirable for transport function (e.g., DNA condensation) with other suitable amino acids. Generally, the protamine according to the present disclosure can be of any species or derived from any species. The protamine of the present disclosure can be of mammal, bird, amphibian, reptile, or fish. The protamine of the present disclosure can be of or derived from any species selected from the group consisting of human, dog, cat, mouse, rat, horse, cattle, pig, goat, chicken, sheep, donkey, rabbit, alpaca, llama, goose, ox, turkey, salmon, etc., preferably human or salmon. The protamine of the present disclosure can be a mixture of different protamines. Preferred protamines include salmon protamine. Preferred protamines include human protamine. A preferred protamine comprises, or preferably consists of, a sequence having at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95% sequence identity to salmon protamine set forth in SEQ ID NO: 53. A preferred protamine comprises, or preferably consists of, salmon protamine set forth in SEQ ID NO: 53.A preferred protamine comprises, or preferably consists of, a sequence having at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95% sequence identity to human protamine 1 as set forth in SEQ ID NO: 55. A preferred protamine comprises, or preferably consists of, human protamine 1 as set forth in SEQ ID NO: 55.

[0039] As mentioned above, protamine is a strong positively charged protein that also readily interacts with negatively charged nucleic acids such as siRNA.Without wishing to be bound by theory, it is believed that the uptake of the complex into cells is mediated through receptor-mediated endocytosis.Furthermore, it is believed that the antibody binds to the receptor and the nanoparticles are internalized through endocytosis in clathrin-coated pits.Furthermore, it is believed that the vesicles are transported into cells, where siRNA can be released from the nanoparticles and enter the RNAi pathway.

[0040] Further preferred positively charged polypeptides according to the present disclosure include histones or histone subunits. Histones refer to small DNA-binding proteins present in chromatin that have a high percentage of positively charged amino acids (lysine and arginine) that allow them to bind to DNA and fold it into nucleosomes, regardless of nucleotide sequence. The term "histones" as used herein includes any histone amino acid sequence obtained or derived from natural or biological sources, such as histone subunits, fragments thereof, and polymeric forms of said amino acid sequences, or fragments thereof. Histones H2, H3, and H4 are particularly suitable. Generally, the histones according to the present disclosure can be of or derived from any species. The histones of the present disclosure can be from mammals, birds, amphibians, reptiles, or fish. The histones of the present disclosure may be of or derived from any species selected from the group consisting of human, dog, cat, mouse, rat, horse, cow, pig, goat, chicken, sheep, donkey, rabbit, alpaca, llama, goose, bovine, turkey, salmon, etc., preferably human. The histones of the present disclosure may be a mixture of different histones or histone subunits. Preferred histones include human histones. Preferred histones comprise or preferably consist of a sequence having at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity to the human histone H2 set forth in SEQ ID NO:56. Preferred histones comprise or preferably consist of the human histone H2 set forth in SEQ ID NO:56. A preferred histone comprises, or preferably consists of, a sequence having at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95% sequence identity to the human histone H2-derived peptide set forth in SEQ ID NO:57.A preferred histone comprises, or preferably consists of, a human histone H2-derived peptide set forth in SEQ ID NO: 57. A preferred histone comprises, or preferably consists of, a sequence having at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95% sequence identity to the human histone H2-derived peptide set forth in SEQ ID NO: 58. A preferred histone comprises, or preferably consists of, a human histone H2-derived peptide set forth in SEQ ID NO: 58.

[0041] In the method or nanoparticle of the present disclosure, the positively charged polypeptide (B) may be the same positively charged polypeptide as the positively charged polypeptide (A2) contained in the fusion protein (A). In the method or nanoparticle of the present disclosure, the positively charged polypeptide (B) may be different from the positively charged polypeptide (A2) contained in the fusion protein (A). In the method or nanoparticle of the present disclosure, the positively charged polypeptide (B) may comprise the same amino acid sequence as the positively charged polypeptide (A2) contained in the fusion protein (A). In the method or nanoparticle of the present disclosure, the positively charged polypeptide (B) may comprise a different amino acid sequence from the positively charged polypeptide (A2) contained in the fusion protein (A).

[0042] The "linker" as used herein can be included in the fusion protein or fusion polypeptide of the present disclosure, and connects two or more subunits of the fusion polypeptide described herein. For example, the antibody (A1) and the positively charged polypeptide (A2) can be fused through a linker. The bond can be covalent or non-covalent. The preferred covalent bond is a peptide bond, for example, a peptide bond between amino acids. The preferred linker is a peptide linker. The preferred linker is an unstructured linker. Thus, in a preferred embodiment, the linker comprises one or more amino acids, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids. Preferred peptide linkers are described herein and include glycine-serine (GS) linkers, glycosylated GS linkers, and proline-alanine-serine polymer (PAS) linkers. In some preferred embodiments, the GS linker is the (G2S)4 linker described in SEQ ID NO:67 and is used to join the subunits of the fusion polypeptide. The linker may also include a functional element, such as an endosomal escape domain, such as EED1, which is included in the linker of SEQ ID NO:69.

[0043] The definition of the term "antibody" includes embodiments such as monoclonal antibodies, chimeric antibodies, single chain antibodies, humanized antibodies, and human antibodies. In addition to full-length antibodies, the definition also includes antibody derivatives and antibody fragments, such as Fab fragments, among others. Antibody fragments or derivatives further include F(ab')2 fragments, Fv fragments, scFv fragments, or single domain antibodies, such as domain antibodies or nanobodies, single variable domain antibodies, or immunoglobulin single variable domains that contain only one variable domain, which may be a VHH, VH, or VL, that specifically binds to an antigen or epitope independently of other V regions or domains. The term also includes diabodies or Dual-Affinity Re-Targeting (DART) antibodies. Further contemplated are (bispecific) single chain diabodies, tandem diabodies (Tandabs), "minibodies," "Fc DARTs" and "IgG DARTs," exemplified by structures such as (VH-VL-CH3)2, (scFv-CH3)2, or (scFv-CH3-scFv)2, multibodies, e.g., triabodies. Immunoglobulin single variable domains encompass not only isolated antibody single variable domain polypeptides, but also larger polypeptides that include one or more monomers of the antibody single variable domain polypeptide sequence.

[0044] Furthermore, the term "antibody," as used herein, also relates to derivatives or variants of the antibodies described herein that exhibit the same specificity as the described antibody. Examples of "antibody variants" include humanized variants of non-human antibodies, "affinity matured" antibodies, and antibody mutants with altered effector functions (see, e.g., U.S. Patent No. 5,648,260).

[0045] The term "antibody" also includes immunoglobulins (Ig) of different classes (i.e., IgA, IgG, IgM, IgD, and IgE) and subclasses (e.g., IgG1, IgG2, etc.). Derivatives of antibodies included within the definition of the term antibody in the sense of the present invention include modifications of the molecule, such as, for example, glycosylation, acetylation, phosphorylation, disulfide bond formation, farnesylation, hydroxylation, methylation, or esterification.

[0046] Functional fragments of antibodies include domains of the F(ab')2 fragment, Fab fragments, scFv, or constructs containing a single immunoglobulin variable domain, or single domain antibody polypeptides, e.g., a single heavy chain variable domain or a single light chain variable domain, including other antibody fragments as described herein above. The F(ab')2 or Fab may be modified to minimize or completely eliminate intermolecular disulfide interactions that occur between the CH1 and CL domains.

[0047] The term "human" antibody, as used herein, should be understood to mean that the antibody or functional fragment thereof comprises an amino acid sequence contained in the human germline antibody repertoire. Thus, for the purposes of the definition herein, an antibody or a fragment thereof may be considered human if it consists of such a human germline amino acid sequence, i.e., if the amino acid sequence of the antibody or functional fragment thereof is identical to the expressed human germline amino acid sequence. An antibody or a functional fragment thereof may also be considered human if it consists of a sequence that does not deviate from its closest human germline sequence more than would be expected due to somatic hypermutation imprinting. Furthermore, many non-human mammalian, e.g., rodent, e.g., mouse and rat, antibodies contain VH CDR3 amino acid sequences that would also be expected to be present in the expressed human antibody repertoire. Any such sequence of human or non-human origin that would be expected to be present in the expressed human repertoire would also be considered "human" for the purposes of the present invention. Accordingly, the term "human antibody" includes antibodies having variable and constant regions substantially corresponding to human germline immunoglobulin sequences known in the art, such as those described by Kabat et al. (Kabat et al., (1991) 'Sequences of Proteins of Immunological Interest, 5th Ed.', National Institutes of Health).

[0048] The human antibodies of the disclosure can include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo), for example in the CDRs, specifically CDR3. A human antibody can have at least one, two, three, four, five, or more positions substituted with an amino acid residue not encoded by human germline immunoglobulin sequences.

[0049] The non-human and human antibodies or their functional fragments are preferably monoclonal. It is particularly difficult to prepare human antibodies that are monoclonal. In contrast to fusions of mouse B cells with immortalized cell lines, fusions of human B cells with immortalized cell lines are not viable. Thus, human monoclonal antibodies are the result of overcoming a major technical obstacle that is generally recognized to exist in the field of antibody technology. The monoclonal nature of antibodies makes them particularly suitable for use as therapeutic agents, since they exist as a single homogenous molecular species that can be well characterized, reproducibly produced, and purified. These factors result in a product whose biological activity can be predicted with a high degree of accuracy, which is extremely important if such molecules are to obtain regulatory approval for therapeutic administration in humans. The term "monoclonal antibody", as used herein, refers to an antibody obtained from a population of substantially homogenous antibodies, i.e., the individual antibodies that make up the population are identical, except for possible naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amidation), which may be present in minor amounts. Monoclonal antibodies are highly specific for a single antigenic site. Moreover, in contrast to conventional (polyclonal) antibody preparations, which typically contain different antibodies directed against different determinants (epitopes), each monoclonal antibody is specific for a single determinant on the antigen. In addition to their specificity, monoclonal antibodies are advantageous in that they are synthesized by a hybridoma culture, uncontaminated by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies used in accordance with the present invention may be produced by the hybridoma method first described by Kohler et al., Nature, 256:495 (1975), or may be produced by recombinant DNA methods (see, e.g., U.S. Pat. No. 4,816,567).The "monoclonal antibodies" may be isolated from phage antibody libraries using, for example, the techniques described in Clackson et al., Nature, 352:624-628 (1991) and Marks et al., J. Mol. Biol., 222:581-597 (1991).

[0050] It is particularly preferred that the monoclonal antibody or the corresponding functional fragment is a human antibody or the corresponding functional fragment. When designing an antibody drug for therapeutic administration to humans, it is highly advantageous that the antibody is of human origin. After administration to a human patient, the human antibody or its functional fragment is likely not to induce a strong immunogenic response by the patient's immune system, i.e., it is not recognized as a foreign substance that is a non-human protein. That is, no host, i.e., patient, antibodies are generated against the therapeutic antibody, which would block the activity of the therapeutic antibody and / or accelerate the elimination of the therapeutic antibody from the patient's body, thus preventing it from exerting the desired therapeutic effect.

[0051] According to a further aspect of the invention, the antibody may be an immunoglobulin. According to a further aspect of the invention, the antibody may be an IgG antibody. The IgG isotype includes not only the variable antibody regions of the heavy and light chains, which are responsible for highly specific antigen recognition and binding, but also the constant regions of the heavy and light chains of the antibody polypeptide, which are usually present in "naturally" produced antibodies, and in some cases even includes modification at one or more sites with carbohydrates. Such glycosylation is generally characteristic of the IgG format and is located in the constant region, including the so-called Fc region of the complete antibody, which is known to induce various effector functions in vivo. Furthermore, the Fc region mediates the binding of IgG to Fc receptors, and also facilitates the homing of IgG to locations with increased presence of Fc receptors, such as inflamed tissues. Advantageously, the IgG antibody is an IgG1 antibody or an IgG4 antibody, which are preferred since these formats have particularly well understood and characterized mechanisms of action in vivo. This applies in particular to IgG1 antibodies.

[0052] According to a further aspect of the invention, the functional fragment of an antibody may preferably be an scFv, a single domain antibody, an Fv, a VHH antibody, a diabody, a tandem diabody, a Fab, a Fab', or a F(ab)2. These formats can be broadly divided into two subclasses, namely those consisting of a single polypeptide chain and those comprising at least two polypeptide chains. Members of the former subclass include scFv (comprising one VH region and one VL region joined to a single polypeptide chain via a polypeptide linker); single domain antibodies (comprising a single antibody variable region), e.g., VHH antibodies (comprising a single VH region). Members of the latter subclass include Fvs (which contain one VH and one VL region as separate polypeptide chains noncovalently associated with one another); diabodies (which contain two noncovalently associated polypeptide chains, each containing two antibody variable regions (usually one VH and one VL per polypeptide chain), arranged in a head-to-tail conformation to give rise to a bivalent antibody molecule); tandem diabodies (homologous diabodies that contain four covalently linked immunoglobulin variable regions (VH and VL regions) with two different specificities and are twice the size of the previous diabodies). These include bispecific single-chain Fv antibodies that form dimers; Fab (which itself contains the entire antibody light chain, including the entire VL region and light chain constant region, as one polypeptide chain, and a portion of the antibody heavy chain, including the complete VH region and a portion of the heavy chain constant region, as another polypeptide chain, with the two polypeptide chains intermolecularly connected via an interchain disulfide bond); Fab' (similar to Fab above, except that an additional reduced disulfide bond is contained in the antibody heavy chain); and F(ab)2 (which contains two Fab' molecules, each Fab' molecule linked to the other Fab' molecule via an interchain disulfide bond). In general, the above types of functional antibody fragments herein allow great flexibility to customize the pharmacodynamic properties of the antibody desired for therapeutic administration, for example, for the specific emergency at hand.For example, when treating tissues known to be poorly vascularized (e.g., joints), it may be desirable to reduce the size of the antibody administered to increase the degree of tissue penetration. In some situations, it may be desirable to increase the rate at which a therapeutic antibody is cleared from the body, which rate can generally be accelerated by reducing the size of the antibody administered. Antibody fragments are defined as functional antibody fragments in the context of the present invention, so long as they maintain the specific binding characteristics of the parent antibody to its epitope / target, for example, as long as they specifically bind to CD33, EGFR, IGF1R, or CD20, or as long as they are antibodies that target other cell surface structures that have the ability to be internalized upon antibody binding.

[0053] According to a further embodiment of the invention, the antibody may comprise a CL domain. According to a further embodiment of the invention, the antibody may comprise a CH1 domain. According to a further embodiment of the invention, the antibody may comprise a CH2 domain. According to a further embodiment of the invention, the antibody may comprise a CH3 domain. According to a further embodiment of the invention, the antibody may comprise an entire light chain. According to a further embodiment of the invention, the antibody may comprise an entire heavy chain.

[0054] According to a further aspect of the present invention, the antibody or functional fragment thereof may be in the form of monovalent, monospecific; multivalent, monospecific, particularly bivalent, monospecific; or multivalent, multispecific, particularly bivalent, bispecific. Generally, multivalent, monospecific, particularly bivalent, monospecific antibodies, such as the fully human IgG described hereinabove, may have the therapeutic advantage of avidity effect, i.e., the same antibody binds to multiple molecules of the same antigen, here, for example, CD33, EGFR, IGF1R, or CD20, thereby enhancing the neutralization provided by such antibodies. Some types of monovalent, monospecific fragments of antibodies are described above (e.g., scFv, Fv, VHH, or single domain antibodies).

[0055] The antibody or functional fragment thereof may be derivatized, for example, by an organic polymer, for example, by one or more molecules of polyethylene glycol ("PEG") and / or polyvinylpyrrolidone ("PVP"). As is known in the art, such derivatization may be advantageous for modulating the pharmacokinetic properties of the antibody or functional fragment thereof. Particularly preferred are PEG molecules derivatized as PEG-maleimides, which allow site-specific conjugation to the antibody or functional fragment thereof via the sulfhydryl group of the cysteine ​​amino acid. Of these, particularly preferred are 20 kD and / or 40 kD PEG-maleimides, either branched or linear. It may be particularly advantageous to increase the effective molecular weight of smaller human antibody fragments, for example, scFv fragments, by coupling to one or more PEG molecules, in particular PEG-maleimide molecules.

[0056] The antibodies of the present disclosure also include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and / or light chain is identical or homologous to the corresponding sequence of an antibody derived from a particular species or belonging to a particular antibody class or subclass, and the remaining portions of the chain are identical or homologous to the corresponding sequence of an antibody derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Pat. No. 4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)). Chimeric antibodies of interest herein include "primatized" antibodies that contain variable domain antigen-binding sequences derived from a non-human primate (e.g., Old World monkey, ape, etc.) and human constant region sequences.

[0057] "Humanized" forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (e.g., Fv, Fab, Fab', F(ab')2, or other antigen-binding subsequences of antibodies) of mostly human sequences that contain minimal sequences derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from the recipient's hypervariable regions (CDRs) are replaced by residues from a hypervariable region (donor antibody) of a non-human species, such as mouse, rat, or rabbit, having the desired specificity, affinity, and capacity. In some cases, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, "humanized antibodies", as used herein, can also include residues that are not found in the recipient antibody or donor antibody. These modifications are made to further refine and optimize antibody performance. A humanized antibody optimally also comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature, 321:522-525 (1986); Reichmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992).

[0058] Preferred antibodies are those that bind to cell surface molecules, preferably cell surface domains, preferably internalized in a receptor-dependent manner, such as anti-CD33 antibodies, anti-EGFR antibodies, anti-IGF1R antibodies, or anti-CD20 antibodies.Preferred antibodies are selected from the group consisting of cetuximab, gemtuzumab, cixutumumab, teprotumumab, GR11L, and rituximab.Further antibodies that bind to cell surface domains and internalize in a receptor-dependent manner are disclosed in LU 92353 A, which is incorporated by reference.

[0059] A preferred antibody comprises a VH domain comprising the following three heavy chain CDRs and a VL domain comprising the following three light chain CDRs: CDR-H1 having the sequence GFSLTNYG (SEQ ID NO:1), CDR-H2 having the sequence IWSGGNT (SEQ ID NO:2), CDR-H3 having the sequence IWSGGNT (SEQ ID NO:3), CDR-H4 having the sequence IWSGGNT (SEQ ID NO:4), CDR-H5 having the sequence IWSGGNT (SEQ ID NO:5), CDR-H6 having the sequence IWSGGNT (SEQ ID NO:6), CDR-H7 having the sequence IWSGGNT (SEQ ID NO:7), CDR-H8 having the sequence IWSGGNT (SEQ ID NO:8), CDR-H9 having the sequence IWSGGNT (SEQ ID NO:9), CDR-H10 having the sequence IWSGGNT (SEQ ID NO:10), CDR-H21 having the sequence IWSGGNT (SEQ ID NO:1 CDR-H3 having the sequence TIFF2024519084000001.tif5128, CDR-L1 having the sequence QSIGTN (SEQ ID NO:4), CDR-L2 having the sequence YAS, and CDR-L3 having the sequence QQNNNWPTT (SEQ ID NO:5). A preferred antibody comprises a VH domain having the sequence set forth in SEQ ID NO:6 and a VL domain having the sequence set forth in SEQ ID NO:7. A preferred antibody comprises a heavy chain having the sequence set forth in SEQ ID NO:8 and a light chain having the sequence set forth in SEQ ID NO:9.

[0060] A preferred antibody comprises a VH domain comprising the three heavy chain CDRs and a VL domain comprising the three light chain CDRs: CDR-H1 having the sequence GYTITDSN (SEQ ID NO:10), CDR-H2 having the sequence IYPYNGGT (SEQ ID NO:11), CDR-H3 having the sequence VNGNPWLAY (SEQ ID NO:12), CDR-L1 having the sequence ESLDNYGIRF (SEQ ID NO:13), CDR-L2 having the sequence AAS, and CDR-L3 having the sequence QQTKEVPWS (SEQ ID NO:14). A preferred antibody comprises a VH domain having the sequence set forth in SEQ ID NO:15 and a VL domain having the sequence set forth in SEQ ID NO:16. A preferred antibody comprises a heavy chain having the sequence set forth in SEQ ID NO:17 and a light chain having the sequence set forth in SEQ ID NO:18. A preferred antibody comprises a heavy chain having the sequence set forth in SEQ ID NO:66 and a light chain having the sequence set forth in SEQ ID NO:18.

[0061] A preferred antibody comprises a VH domain comprising the following three heavy chain CDRs, and a VL domain comprising the following three light chain CDRs: CDR-H1 having the sequence GGTFSSYAIS (SEQ ID NO:19), the sequence CDR-H2, sequence TIFF2024519084000002.tif4128 CDR-H3 with TIFF2024519084000003.tif4128, sequence CDR-L1 having the sequence GENKRPS (SEQ ID NO:23), and CDR-L3 having the sequence KSRDGSGQHLV (SEQ ID NO:24). A preferred antibody comprises a VH domain having the sequence set forth in SEQ ID NO:25 and a VL domain having the sequence set forth in SEQ ID NO:26. A preferred antibody comprises a heavy chain having the sequence set forth in SEQ ID NO:27 and a light chain having the sequence set forth in SEQ ID NO:28.

[0062] A preferred antibody comprises a VH domain comprising the three heavy chain CDRs and a VL domain comprising the three light chain CDRs: CDR-H1 having the sequence GFTFSSYG (SEQ ID NO:29), CDR-H2 having the sequence IWFDGSST (SEQ ID NO:30), CDR-H3 having the sequence ARELGRRYFDL (SEQ ID NO:31), CDR-L1 having the sequence QSVSSY (SEQ ID NO:32), CDR-L2 having the sequence IWFDGSST (SEQ ID NO:33), and CDR-L3 having the sequence QQRSKWPPWT (SEQ ID NO:34). A preferred antibody comprises a VH domain having the sequence set forth in SEQ ID NO:35 and a VL domain having the sequence set forth in SEQ ID NO:36. A preferred antibody comprises a heavy chain having the sequence set forth in SEQ ID NO:37 and a light chain having the sequence set forth in SEQ ID NO:38.

[0063] A preferred antibody comprises a VH domain comprising the following three heavy chain CDRs and a VL domain comprising the following three light chain CDRs: CDR-H1 having the sequence GYTFTSYN (SEQ ID NO:39), CDR-H2 having the sequence IYPGNGDT (SEQ ID NO:40), CDR-H3 having the sequence IYPGNGDT (SEQ ID NO:41), CDR-H4 having the sequence IYPGNGDT (SEQ ID NO:42), CDR-H5 having the sequence IYPGNGDT (SEQ ID NO:43), CDR-H6 having the sequence IYPGNGDT (SEQ ID NO:44), CDR-H7 having the sequence IYPGNGDT (SEQ ID NO:45), CDR-H8 having the sequence IYPGNGDT (SEQ ID NO:46), CDR-H9 having the sequence IYPGNGDT (SEQ ID NO:47), CDR-H10 having the sequence IYPGNGDT (SEQ ID NO:48), C CDR-H3 having the sequence TIFF2024519084000005.tif4128, CDR-L1 having the sequence SSVSYI (SEQ ID NO:42), CDR-L2 having the sequence ATS, and CDR-L3 having the sequence QQWTSNPPT (SEQ ID NO:43). A preferred antibody comprises a VH domain having the sequence set forth in SEQ ID NO:44 and a VL domain having the sequence set forth in SEQ ID NO:45. A preferred antibody comprises a heavy chain having the sequence set forth in SEQ ID NO:46 and a light chain having the sequence set forth in SEQ ID NO:47.

[0064] "Cell surface domain" as used herein means any protein on cell surface. Cell surface domain also includes cell surface antigen. It further includes any epitope that can be recognized on cell surface of cell. Preferably, epitope or protein is cell type specific, since it only exists on a certain cell type. In one embodiment, cell surface domain is present on cancer cell. Potential cell surface targets include CD19, CD20, CD22, CD25, CD30, CD33, CD40, CD56, CD64, CD70, CD74, CD79, CD105, CD138, CD174, CD205, CD227, CD326, CD340, MUC16, GPNMB, PSMA, Cripto, ED-B, TMEFF2, EphB2, EphA2, FAP Av, integrins, mesothelin, EGFR, TAG-72, GD2, CAIX, and / or 5T4. Other possible cell surface domains include CD52, CD3, CD117, CD99, CD34, CD44, CD117, CA15-3, CA-125, CA27-29, EpCAM, carcinoembryonic antigen, melanoma antigen recognized by T cells 1 (MART1), trophoblast glycoprotein (TPBG). Cell surface molecules according to the invention are preferably those expressed on cells that are sensitive to therapeutic treatment with negatively charged molecules.

[0065] Preferably, such cell surface domains are CD33, EGFR, IGF1R, CD20. The cell surface domain may also provide an epitope to which an antibody according to the invention can bind.

[0066] A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity to SEQ ID NO:65. A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity to SEQ ID NO:65 and 18.

[0067] A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity with SEQ ID NO:71. A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity with SEQ ID NO:71 and 9. A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity with SEQ ID NO:71 and 73. A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence having at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity to SEQ ID NOs:71 and 75.

[0068] A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity to SEQ ID NO: 73. A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity to SEQ ID NO: 8 and 73.

[0069] A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity to SEQ ID NO: 75. A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity to SEQ ID NO: 8 and 75.

[0070] A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity to SEQ ID NO: 79. A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity to SEQ ID NO: 79 and 38. A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence having at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity to SEQ ID NOs:79 and 81.

[0071] A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity to SEQ ID NO: 81. A preferred fusion protein (A) may comprise a polypeptide chain comprising an amino acid sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity or identity to SEQ ID NO: 37 and 81.

[0072] Consistent with the above, the term "epitope" defines an antigenic determinant that is specifically bound / identified by an antibody as defined herein. The antibody may specifically bind / interact with a conformational epitope or a continuous epitope that is unique to the target structure.

[0073] In a preferred embodiment, the antibody of the present disclosure is specific to cancer-associated antigen.As used herein, "cancer-associated antigen" or "tumor-associated antigen", which may be used interchangeably herein, generally refers to any antigen associated with cancer cells or tumor cells, i.e., present to the same extent or greater than normal cells.Such antigens may be relatively tumor-specific, and expression is restricted to the surface of malignant cells, but may also be found on non-malignant cells.In one embodiment, the antibody of the present disclosure binds to cancer-associated antigen.

[0074] The term "internalize" as used in the present invention refers to endocytosis, where a molecule such as a protein is phagocytosed by the cell membrane and drawn into the cell. Specifically, the cell surface domain to which the binding domain binds is internalized. Methods by which this internalization can be measured are disclosed in the examples of the present application. Alternatively, for example, such a process can be observed by time-lapse microscopy, where the receptor of interest and the cell membrane are double-stained. Preferably, nanoparticles comprising an antibody capable of binding to a cell surface molecule are internalized when bound to the cell surface molecule.

[0075] "Fusion protein (A)" as used herein refers to a fusion protein comprising, or preferably consisting of, an antibody as disclosed herein, a positively charged polypeptide as disclosed herein, and preferably a linker as disclosed herein, wherein the positively charged polypeptide and the antibody are preferably interconnected via a (peptidic) linker.

[0076] In general, the antibody (A1) and the positively charged polypeptide (A2) are fused at any position suitable for such fusion, for example, at any N-terminus or C-terminus of the antibody and / or the positively charged polypeptide. In some fusion proteins (A1), the positively charged polypeptide (A2) is fused to the C-terminus of the heavy chain of the antibody (A1). In some fusion proteins (A1), the positively charged polypeptide (A2) is fused to the C-terminus of the light chain of the antibody (A1). In some preferred fusion proteins, the positively charged polypeptide (A2) is fused to the C-terminus of each of the heavy chains of the antibody (A1). In some preferred fusion proteins, the positively charged polypeptide (A2) is fused to the C-terminus of each of the light chains of the antibody (A1). In some preferred fusion proteins, the positively charged polypeptide (A2) is fused to the C-terminus of each of the heavy chains and each of the light chains of the antibody (A1). The fusion is optionally via a linker as disclosed herein, for example, a glycine serine linker.

[0077] The term "negatively charged molecule" refers to a molecule that has a net positive charge at or near physiological pH (e.g., in a solution having a pH of 4-10, 5-9, or 6-8) and can preferably bind to a positively charged polypeptide, e.g., protamine or histone, by electrostatic interaction. Preferred negatively charged molecules are nucleic acids and negatively charged small molecules. Preferably, such negatively charged molecules have a net charge of at least 2-, preferably at least 3-, preferably at least 4-, preferably at least 5-, preferably at least 6-, preferably at least 7-, preferably at least 8-, preferably at least 9-, or preferably at least 10-.

[0078] As referred to herein, the terms "nucleotide sequence", "polynucleotide", "nucleic acid", and "nucleic acid molecule" are used interchangeably and refer to a polymer of any length of unbranched nucleotides, either ribonucleotides or deoxyribonucleotides, or a combination of both. Nucleic acid sequences include both sense and antisense strands of DNA, cDNA, genomic DNA, RNA, e.g., mRNA, siRNA, synthetic, and mixed polymers, or may contain non-natural nucleotide bases or derivatives of nucleotide bases, as will be readily understood by those skilled in the art. Further, non-limiting examples of such nucleic acids include, but are not limited to, any type of RNA interference (RNAi), which may be single-stranded or double-stranded, that performs gene cessation and / or gene knockdown, e.g., gene knockdown of message (mRNA) by mRNA degradation or translation arrest, inhibition of tRNA and rRNA function or epigenetic effects; short (or small) interfering RNA (siRNA), small hairpin RNA (shRNA), endoribonuclease-prepared siRNA (esiRNA), antisense oligonucleotides, microRNA, and non-coding RNA, small RNA activity against DNA, and dicer substrate siRNA. Preferred nucleic acids are siRNA, esiRNA antisense oligonucleotides, or miRNA, with siRNA being most preferred. In some embodiments, preferably, when the nucleic acid is double-stranded, the nucleic acid has about 18 to about 25 bp. In some embodiments, preferably, when the nucleic acid is single-stranded, the nucleic acid has about 18 to about 25 nt.

[0079] The nucleic acid used by the present invention affects a target cell. For example, the expression of a specific molecule or protein is decreased or increased in the target cell through the provision of the nucleic acid molecule. Preferably, the expression of a specific molecule protein is decreased by the use of the nucleic acid molecule.

[0080] Nucleic acids according to the present disclosure include siRNA molecules designed to target and silence or prevent expression of genes or proteins associated with cancer or involved in the development and / or progression of cancer.

[0081] Preferred nucleic acid molecule is preferably selected from siRNA, esiRNA, antisense oligonucleotide or miRNA that is specific to KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1 or FLT3.More preferred is siRNA that is specific to KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1 or FLT3.Such siRNA is known to those skilled in the art, and the illustrative examples of such siRNA are shown in the following table. TIFF2024519084000006.tif53148

[0082] The preferred nucleic acid of the present disclosure also comprises the mixture of different siRNAs for one or more targets, preferably one target.For example, the nucleic acid of the present disclosure can comprise the mixture of siRNAs that are specific for targets selected from the group consisting of KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1 and FLT3.

[0083] The negatively charged molecule according to the present invention may be a molecule that is not a nucleic acid. Such a molecule may be a small molecule, preferably an organic small molecule. The negatively charged molecule may have a molecular weight of about 20 kDa or less, preferably about 15 kDa or less, or about 10 kDa or less. The negatively charged molecule may have a molecular weight of about 9 kDa or less, about 8 kDa or less, about 7 kDa or less, about 6 kDa or less, about 5 kDa or less, about 4 kDa or less, about 3 kDa or less, or about 2 kDa or less. As an illustrative example, the negatively charged molecule may be a drug and / or a prodrug. The drug and / or the prodrug may be conjugated to a negatively charged moiety. For example, the drug may be ibrutinib conjugated to a negatively charged moiety, such as Cy3.5 or Alexa488. However, the drug may be conjugated to other negatively charged moieties. Negatively charged moieties suitable for conjugation are known to those skilled in the art. Illustrative examples of suitable negatively charged moieties include (poly)sulfonated aryls (e.g., as transition metal co-ligands), (poly)sulfonated dyes (e.g., Kanin dyes), mono / di / trisulfates, (poly)sulfates of monosaccharides or branched oligosaccharides, oligopeptides from glutamic acid or aspartic acid. Drugs and / or prodrugs may have a negative net charge without being conjugated to an additional moiety. As an illustrative example, a drug with a negative net charge is remdesivir triphosphate. Those skilled in the art will understand that the above examples are for illustrative purposes only, and that many other negatively charged molecules can be used in the context of the present invention.

[0084] As used herein, "ibrutinib" (IUPAC name: 1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)pyrazolo[3,4-d]pyrimidin-1-yl]piperidin-1-yl]prop-2-en-1-one, CAS number: 936563-96-1) relates to a molecule having (in its free form): TIFF2024519084000007.tif51128

[0085] As used herein, "remdesivir triphosphate" (IUPAC name [[(2R,3S,4R,5R)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-5-cyano-3,4-dihydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]phosphono hydrogen phosphate, CAS number: 1355149-45-9) relates to a molecule having the following structure: TIFF2024519084000008.tif51128

[0086] The present application also relates to nanoparticles. Such nanoparticles can be obtained preferably by the method described herein. The nanoparticles of the present invention can include (a) a fusion protein (A) preferably disclosed herein, comprising an antibody (A1) and a positively charged polypeptide (A2); (b) a positively charged polypeptide (B) preferably disclosed herein; and (c) one or more negatively charged molecules (C) preferably disclosed herein.

[0087] Without wishing to be bound by theory, it is believed that the positively charged polypeptide (B), the fusion protein (A), and the one or more negatively charged molecules (C) are not uniformly distributed within the particle. Instead, in some embodiments, the fusion protein (A) is concentrated in the outer portion of the nanoparticle. In some embodiments, the one or more negatively charged molecules (C) are concentrated in the inner portion of the nanoparticle. In some embodiments, the positively charged polypeptide (B) is concentrated in the outer portion of the nanoparticle. In some embodiments, the positively charged polypeptide (B) is concentrated in the inner portion of the nanoparticle. Thus, the nanoparticles of the present invention can form vesicle-like structures in which the fusion protein (A) is primarily present in the outer portion and the negatively charged molecules (C) are concentrated or encapsulated in the inner portion of the nanoparticle. Without wishing to be bound by theory, it is believed that such structures protect the negatively charged molecules (C) and thus increase their stability. Furthermore, it is believed that at least a portion, or even the entirety, of the nanoparticle can be internalized when bound to a cell via the fusion protein (A).

[0088] In some embodiments, the nanoparticles of the present disclosure have an average diameter that is at least about 0.05 μm. In some embodiments, the nanoparticles of the present disclosure have an average diameter that is at least about 0.1 μm. In some embodiments, the average diameter of the nanoparticles is at least about 0.2 μm. In some embodiments, the nanoparticles of the present disclosure have an average diameter in the range of about 0.05 μm to about 10 μm, preferably about 0.1 μm to about 10 μm, preferably about 0.2 μm to about 5 μm. The average diameter of the nanoparticles of the present disclosure may be in the range of about 0.3 μm to about 4 μm, about 0.4 μm to about 3 μm, or about 0.5 μm to about 2 μm. The average diameter of the nanoparticles may be determined by any method suitable for determining particle size, such as dynamic light scattering and microscopic analysis. A preferred method for determining particle size is by microscopic analysis, preferably by transmitted light microscopy.

[0089] The present invention further relates to compositions comprising the nanoparticles of the invention and / or the nanoparticles obtainable by the method of the invention.

[0090] The present invention further relates to pharmaceutical compositions comprising the nanoparticles of the invention and / or the nanoparticles obtainable by the method of the invention.

[0091] In the composition of the present disclosure, for example, in the pharmaceutical composition of the present disclosure, at least about 10% of the fusion protein (A) contained in the composition may be contained in nanoparticles.In a preferred embodiment, at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%, preferably at least 95%, preferably at least 98%, preferably at least 99% of the fusion protein (A) contained in the composition is contained in nanoparticles.In a preferred embodiment, the composition is essentially free of fusion protein (A) that is not contained in nanoparticles.

[0092] In the composition of the present disclosure, for example, in the pharmaceutical composition of the present disclosure, at least about 10% of the positively charged polypeptide (B) contained in the composition may be contained in nanoparticles.In a preferred embodiment, at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%, preferably at least 95%, preferably at least 98%, preferably at least 99% of the positively charged polypeptide (B) contained in the composition is contained in nanoparticles.In a preferred embodiment, the composition is essentially free of the positively charged polypeptide (B) that is not contained in nanoparticles.

[0093] In the composition of the present disclosure, for example, in the pharmaceutical composition of the present disclosure, at least about 10% of the negatively charged molecules (C) contained in the composition may be contained in nanoparticles.In a preferred embodiment, at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%, preferably at least 95%, preferably at least 98%, preferably at least 99% of the negatively charged molecules (C) contained in the composition are contained in nanoparticles.In a preferred embodiment, the composition is essentially free of negatively charged molecules that are not contained in nanoparticles.

[0094] The term "pharmaceutical composition" refers to a composition for administration to a patient, preferably a human patient. A pharmaceutical composition or formulation is generally in a form that allows the biological activity of the active ingredient to be effective, and thus can be administered to a subject for therapeutic use as described herein. Generally, a pharmaceutical composition contains a suitable (i.e., pharmaceutically acceptable) formulation of carriers, stabilizers, and / or excipients. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by EW Martin. Such compositions contain a therapeutically effective amount of the above molecules, preferably in purified form, together with a suitable amount of carrier to provide the form for proper administration to a patient. The formulation should be compatible with the mode of administration.

[0095] In one embodiment, the pharmaceutical composition is for parenteral, transdermal, intracavitary, intraarterial, intrathecal, and / or intranasal administration, or for direct injection into tissue. Specifically, it is envisaged that the composition is administered to the patient via infusion or injection. The administration of suitable compositions can be carried out by various methods, for example, by intravenous, intraperitoneal, subcutaneous, intramuscular, topical, or intradermal administration. The composition of the present invention can further comprise a pharmaceutically acceptable carrier. Examples of suitable pharmaceutical carriers are well known in the art and include buffered saline solutions, water, emulsions, for example, oil / water emulsions, various types of wetting agents, sterile solutions, liposomes, etc. The composition containing such carriers can be formulated by well-known conventional methods.

[0096] According to an embodiment of the present invention, the term "therapeutically effective amount" refers to an amount of the molecule of the present invention and / or the molecule obtainable by the method of the present invention that is effective for the treatment of a disease related to cancer. The preferred dosage and the preferred administration method are such that after administration, the molecule of the present invention and / or the molecule obtainable by the method of the present invention is present in the blood in an effective amount. The administration schedule can be adjusted accordingly by observing the disease state, analyzing the serum level of the molecule that reduces the expression of the target molecule in a clinical test, and then lengthening the administration interval, for example, from twice a week or once a week to once every two weeks, once every three weeks, once every four weeks, etc., or shortening the administration interval. In the case of cancer, a therapeutically effective amount of the molecule or composition disclosed herein can reduce the number of cancer cells; reduce tumor size; inhibit (i.e., delay and / or stop) the invasion of cancer cells into peripheral organs; inhibit (i.e., delay and / or stop) tumor metastasis; inhibit tumor growth; and / or alleviate one or more of the symptoms related to cancer.

[0097] In another embodiment, the pharmaceutical composition is suitable for administration in combination with an additional drug, i.e. as part of a combination therapy. In a combination therapy, the active agent may optionally be included in the same pharmaceutical composition as the molecule of the invention, or in a separate pharmaceutical composition. In the latter case, the separate pharmaceutical composition is suitable for administration before, simultaneously with, or after the administration of the pharmaceutical composition comprising the molecule of the invention. The additional drug or pharmaceutical composition may be a non-proteinaceous compound or a proteinaceous compound. In the case where the additional drug is a proteinaceous compound, it is advantageous that the proteinaceous compound is capable of providing an activation signal for immune effector cells. Preferably, the proteinaceous compound or non-proteinaceous compound may be administered simultaneously or non-simultaneously with the molecule (or preparation) of the invention as defined herein above, the vector as defined herein above, or the host as defined herein above.

[0098] Pharmaceutical composition can be administered to subject in appropriate dosage.Dosage schedule is determined by attending physician and clinical factors.As is well known in the medical field, dosage for any one patient depends on many factors, such as the size, body surface area, age, specific compound administered, sex, time and route of administration, general health condition, and other drugs administered at the same time.

[0099] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, such as saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose, and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (e.g., based on Ringer's dextrose), and the like. Preservatives and other additives may also be present, such as antimicrobial agents, antioxidants, chelating agents, inert gases, and the like. In addition, pharmaceutical compositions according to the present invention may include proteinaceous carriers, such as serum albumin or immunoglobulin, preferably of human origin. It is envisaged that the pharmaceutical composition according to the invention may contain, in addition to the above-mentioned molecules, further biologically active agents, depending on the intended use of the pharmaceutical composition. Such agents may be drugs acting on the gastrointestinal system, drugs acting as cytostatics, drugs preventing hyperuricemia, drugs inhibiting immune responses (e.g., corticosteroids), drugs modulating inflammatory responses, drugs acting on the cardiovascular system, and / or cytokines, etc., as known in the art.

[0100] Outcome measures for analyzing the effect of the nanoparticles of the invention and / or nanoparticles obtainable by the methods of the invention, for example in cancer treatment, can be selected from, for example, pharmacodynamics, immunogenicity, and the possibility of reducing the size of the cancer, for example by MRI imaging and patient-reported outcomes.

[0101] Another major challenge in the development of drugs, such as pharmaceutical compositions according to the present invention, is the predictable modulation of pharmacodynamic properties. For this purpose, a pharmacodynamic profile of a drug candidate is established, i.e., a profile of pharmacodynamic property parameters that affect the ability of a particular drug to treat a given condition. Pharmacodynamic parameters of a drug that affect the ability of a drug to treat a particular disease entity include, but are not limited to, half-life, volume of distribution, hepatic first-pass metabolism, and the extent of serum binding. The efficacy of a given drug can be influenced by each of the above parameters. "Half-life" refers to the time it takes for 50% of an administered drug to be eliminated by biological processes, such as metabolism, excretion, etc. "Hepatic first-pass metabolism" refers to the tendency of a drug to be metabolized when it first comes into contact with the liver, i.e., when it first passes through the liver. "Volume of distribution" refers to the extent of retention of a drug in various compartments of the body, such as intracellular and extracellular spaces, tissues and organs, and the distribution of the drug in these compartments.

[0102] "Degree of serum binding" refers to the tendency of a drug to interact with and bind to serum proteins, such as albumin, resulting in a reduction or loss of biological activity of the drug.

[0103] Pharmacodynamic parameters also include bioavailability, lag time (Tlag), Tmax, absorption rate, and / or Cmax for a given amount of drug administered. "Bioavailability" refers to the amount of drug in the blood compartment. "Lag time" refers to the delay between when a drug is administered and when it is detectable and measurable in the blood or plasma. "Tmax" is the time to reach the maximum blood concentration of the drug, absorption is defined as the movement of the drug from the site of administration into the systemic circulation, and "Cmax" is the maximum blood concentration attained by a given drug. The time to reach the blood or tissue concentration of the drug required for a biological effect is influenced by all parameters.

[0104] The term "toxicity" as used herein refers to the toxic effects of a drug that manifest as adverse events or serious adverse events. These secondary events may refer to the general lack of tolerance and / or the local lack of tolerance of the drug after administration. Toxicity may also include teratogenic or carcinogenic effects caused by the drug.

[0105] The term "safety", "in vivo safety", or "tolerability", as used herein, defines the administration of a drug without inducing serious adverse events immediately after administration (local tolerance) and during the longer application period of the drug. "Safety", "in vivo safety", or "tolerability" may be evaluated, for example, at regular intervals during the treatment and follow-up period. Measurements include clinical evaluation, for example, organ manifestations, and screening for laboratory abnormalities. Clinical evaluation may be performed for deviations from normal findings that are recorded / coded according to the standards of NCI-CTC and / or MedDRA. Organ manifestations may include, for example, criteria set forth in the Common Terminology Criteria for adverse events v3.0 (CTCAE), such as allergy / immunology, blood / bone marrow, cardiac arrhythmias, coagulation, etc. Laboratory parameters that may be tested include, for example, hematology, clinical chemistry, coagulation profile, and urinalysis, as well as other body fluids, such as serum, plasma, lymph, or spinal fluid, liquor, etc. Thus, safety can be assessed by measuring laboratory parameters and recording adverse events, for example by physical examination, imaging techniques (i.e. ultrasound, X-ray, CT scan, magnetic resonance imaging (MRI), other measures by technical equipment (i.e. electrocardiogram), vital signs. The term "effective and non-toxic dose" as used herein refers to a tolerated dose of the molecule of the invention and / or of the molecule obtainable by the method of the invention, preferably an antibody as defined herein, that is high enough to cure or stabilize the disease of interest without or essentially without major toxic effects. Such an effective and non-toxic dose can be determined, for example, by dose escalation studies as described in the art, and should be below the dose that induces serious adverse side events (dose-limiting toxicity, DLT).

[0106] The pharmaceutical composition of the present invention may have various formulations.The formulation (sometimes referred to herein as "composition of matter", "composition" or "solution") may preferably be in various physical states, such as liquid formulation, frozen formulation, lyophilized formulation, freeze-dried formulation, spray-dried formulation, and reconstituted formulation, with liquid and frozen being preferred.

[0107] "Liquid formulation", as used herein, refers to a composition found as a liquid, characterized by the free movement of the constituent molecules in itself, but not tending to separate at room temperature.Liquid formulations include aqueous and non-aqueous liquids, with aqueous formulations being preferred.Aqueous formulations are formulations in which the solvent or main solvent is water, preferably water for injection (WFI).The dissolution of the molecules of the present invention and / or the molecules obtainable by the method of the present invention in the formulation can be homogeneous or heterogeneous, and as mentioned above, is preferably homogeneous.

[0108] Any suitable non-aqueous liquid can be used, provided that it provides stability to the formulation of the present invention.Preferably, non-aqueous liquid is a hydrophilic liquid.The illustrative examples of suitable non-aqueous liquid include glycerol; dimethylsulfoxide (DMSO); polydimethylsiloxane (PMS); ethylene glycols, such as ethylene glycol, diethylene glycol, triethylene glycol, polyethylene glycol ("PEG") 200, PEG 300, and PEG 400; and propylene glycols, such as dipropylene glycol, tripropylene glycol, polypropylene glycol ("PPG") 425, and PPG 725.

[0109] "Mixed aqueous / non-aqueous liquid formulation", as used herein, refers to a liquid formulation that contains a mixture of water, preferably WFI, and an additional liquid composition.

[0110] As used herein, a "formulation" or "composition" is a mixture of the molecules of the present invention and / or molecules obtainable by the methods of the present invention (i.e., active drug / substance) with further chemicals and / or additives required for a pharmaceutical product, preferably in a liquid state. Formulations of the present invention include pharmaceutical formulations.

[0111] Preparation of a formulation includes processes in which different chemicals, including an active drug, are combined to create a final medicinal product, such as a pharmaceutical composition. The active drug of the formulation of the present invention is the nanoparticles of the present invention and / or the nanoparticles obtainable by the method of the present invention.

[0112] In certain embodiments, the nanoparticles of the present invention and / or the nanoparticles obtainable by the method of the present invention can be formulated essentially pure and / or essentially homogeneous (i.e., substantially free of contaminants, e.g., proteins, etc., which may be product-related and / or process-related impurities). The term "essentially pure" refers to a composition that contains at least about 80% by weight, preferably about 90% by weight, preferably at least about 95% by weight, more preferably at least about 97% by weight, or most preferably at least about 98% by weight of the compound. The term "essentially homogeneous" refers to a composition that contains at least about 99% by weight of the compound, preferably in a monomeric state, excluding the mass of various stabilizers and water in the solution.

[0113] A "stable" formulation is one in which the molecules of the present invention and / or the molecules obtainable by the method of the present invention essentially retain their physical and / or chemical stability and / or biological activity during storage, and / or preferably do not show substantial signs of aggregation, precipitation, fragmentation, degradation, and / or denaturation, as measured by visual inspection of color and / or clarity, or by UV light scattering or size exclusion chromatography, compared to control samples.Various additional analytical techniques for measuring protein stability are available in the art, and are reviewed, for example, in Peptide and Protein Drug Delivery, 247-301, Vincent Lee Ed., Marcel Dekker, Inc., New York, NY, Pubs. (1991) and Jones, A. Adv. Drug Delivery Rev. 10: 29-90 (1993).

[0114] "In storage," as used herein, means that the formulation is not used immediately after preparation, but rather is packaged for storage after preparation, either in liquid form, frozen, or in a dried form for later reconstitution into a liquid or other form.

[0115] A "subject" according to the present invention is a vertebrate, preferably a mammalian, more preferably a human subject.

[0116] "Vertebrate" includes vertebrate fish, birds, amphibians, reptiles, and mammals.

[0117] "Mammals" include dogs, cats, horses, rats, mice, apes, rabbits, cows, pigs, sheep, and preferably, humans. Humans may also be referred to by the term patient.

[0118] The present invention further relates to nanoparticles obtainable by the method of the present invention or nanoparticles of the present invention and / or pharmaceutical compositions of the present invention for use in therapy, preferably in a method for treating cancer in a subject.

[0119] The terms "cancer" and "cancerous", as used according to the present invention, refer to a condition in vertebrates, preferably mammals, and more preferably humans, that is typically characterized by unregulated cell growth.

[0120] Cancers are classified according to the type of cell to which the tumor cells resemble and are therefore presumed to be the origin of the tumor. These types include carcinomas, sarcomas, blood cancers, germ cell tumors, and blastomas.

[0121] "Cell tumors," as referred to herein, can include cancers that originate from epithelial cells.

[0122] "Sarcoma," as referred to herein, can include cancers that arise from cells of mesenchymal (connective tissue) origin.

[0123] "Blood cancer" as referred to herein may include a class of cancers that arise from hematopoietic (blood-forming) cells that tend to leave the bone marrow and mature in lymph nodes and blood, respectively. When referring to leukemia herein, it may include bone marrow-derived cells that normally mature in the bloodstream. When referring to lymphoma herein, it may include bone marrow-derived cells that normally mature in the lymphatic system.

[0124] "Germ cell tumors", as referred to herein, can include cancers that originate from pluripotent cells, most commonly found in the testes or ovaries.

[0125] "Blastoma," as referred to herein, can include cancers that originate from immature "precursor" cells or embryonic tissue.

[0126] The molecule obtainable by the process of the present invention, or the molecule of the present invention, and / or the molecule obtainable by the method of the present invention can be used in the method of treating cancer.Cancer can be a solid tumor.Cancer can be selected from the group consisting of lung cancer, such as non-small cell lung cancer, sarcoma, such as rhabdomyosarcoma or Ewing's sarcoma, colorectal cancer, blood cancer, such as leukemia or lymphoma, such as acute myeloid leukemia (AML) or diffuse large B-cell lymphoma (DLBLC).

[0127] The term "treating" as used herein means alleviating, reducing, stabilizing, or inhibiting the progression of a disease or disorder, such as cancer.

[0128] The present invention further relates to a nanoparticle obtainable by the process of the invention, or a nanoparticle of the invention, or a pharmaceutical composition of the invention, for use in a method of inhibiting and / or modulating tumor growth in a subject.

[0129] A "tumor" or "neoplasm" is a mass of abnormal tissue resulting from the abnormal growth or division of cells. The growth of neoplastic cells exceeds and is uncoordinated with the growth of the surrounding normal tissue. However, tumors in the sense of the present invention also include leukemias and intraepithelial carcinomas. Tumors can be benign, premalignant, or malignant. In preferred embodiments, tumors are premalignant or malignant. Most preferably, tumors are malignant.

[0130] The present invention further relates to a nanoparticle obtainable by the method of the invention, or a nanoparticle of the invention, or a (pharmaceutical) composition of the invention, for delivering a nucleic acid molecule to the site of a tumor in a subject.

[0131] In one embodiment of the present invention, the nanoparticles obtainable by the process of the present invention or the nanoparticles of the present invention or the pharmaceutical composition of the present invention for use in the present invention comprise an siRNA selected from the group consisting of siRNAs against KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1 and FLT3. The siRNA of the present invention can target KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1 or FLT3. Preferably, the siRNA reduces the expression of KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1 or FLT3 in cells. Preferably, the expression of these targets is reduced.

[0132] "siRNA targeting" refers to the target recognized by a particular siRNA. siRNAs can be constructed in various ways. For example, siRNAs can target mRNA.

[0133] Generally, the design of siRNA is known to those skilled in the art.See, for example, Reynolds et al., (Reynolds et al., (2004) "Rational siRNA design for RNA interference" Nature Biotechnology 22, 326-330) or Judge et al., (Judge et al., 2006) "Design of Noninflammatory Synthetic siRNA Mediating Potent Gene Silencing in Vivo" Molecular Therapy (2006) 13, 494-505) or Sioud and Leirdal (Sioud and Leirdal (2004) "Potential design rules and enzymatic synthesis of siRNAs" Methods Mol Biol. 2004; 252: 457-69).

[0134] The term "expression" or "gene expression" refers to the transcription of a particular gene or a particular gene construct. The term "expression" or "gene expression" specifically refers to the transcription of a gene or gene construct into structural RNA (rRNA, tRNA) or mRNA, with or without subsequent translation into a protein. This process includes the transcription of DNA and processing of the resulting mRNA product. The mRNA is then translated into a peptide / polypeptide chain, which is ultimately folded into the final peptide / polypeptide / protein. Protein expression is commonly used by proteomics researchers to indicate the presence and abundance measurement of one or more proteins in a particular cell or tissue. Cellular protein expression can be measured by various means, for example, by immunohistochemistry or Western blot analysis. Here, the results obtained should be evaluated in comparison to healthy cells or a control standard. Lower expressing cells show decreased staining, e.g., in intensity, when compared to control cells. Higher expressing cells show increased staining, e.g., in intensity, when compared to control cells in the same setting. The expression of mRNA can also be measured, for example, by RT-PCR, where lower expressing cells show a higher number of amplification cycles before a detectable signal is observed, for example, when compared to control cells in the same setting. A variety of techniques for determining the expression of cellular proteins, mRNAs are known to those skilled in the art.

[0135] For example, the cell may be present in the subject's blood, liver, stomach, mouth, skin, lung, lymphatic system, spleen, bladder, pancreas, bone marrow, brain, kidney, intestine, gallbladder, brain, larynx, or pharynx.

[0136] In one embodiment, the nanoparticles obtainable by the method of the invention, or the nanoparticles of the invention, or the pharmaceutical composition of the invention, are used according to the invention, wherein the subject is a mammal, preferably a human.

[0137] The present invention also relates to kits containing one or more coupling buffers / reagents and protocols suitable for carrying out the methods of the invention.

[0138] In one embodiment, the kit comprises one or more coupling buffers / reagents and protocols suitable for carrying out the methods of the invention.

[0139] The present invention relates to kits comprising suitable buffers / reagents and protocols for carrying out the methods of the invention, and optionally including means for purifying or concentrating the molecules of the invention or molecules obtained by the methods of the invention, and / or for washing said molecules, and / or for storing said molecules. Thus, the molecules and additional means are preferably packaged together in one sealed package or kit.

[0140] The present invention also relates to a kit comprising the nanoparticles of the invention and / or nanoparticles obtainable by the method of the invention.

[0141] The present invention relates to a kit comprising the nanoparticles of the invention and / or nanoparticles obtainable by the method of the invention and / or optionally comprising means for purifying or concentrating said molecule, and / or means for washing said molecule, and / or means for storing said molecule. Thus, said molecule and additional means are preferably packaged together in one sealed package or kit.

[0142] The parts of the kit (or "kit of parts") of the invention may be packaged individually in vials or bottles, or packaged combined in a container or multi-container unit. The manufacture of the kit preferably follows standard techniques known to those skilled in the art.

[0143] The kit of the present invention may include one or more containers, optionally with a label. Suitable containers include, for example, bottles, vials, and test tubes. The containers may be formed from a variety of materials, such as glass or plastic, and are preferably sterile. The containers hold compositions that have active ingredients or contain buffers that are effective for the method of the present invention. Additional containers may hold appropriate buffers (e.g., reaction buffers) that allow a particular reaction to occur. It is also envisioned that containers are included that hold various buffers, such as reaction buffers and / or buffers for the purification of the molecules of the present invention and / or molecules obtainable by the method of the present invention. The active agent in the composition is preferably a molecule obtainable by the method of the present invention, or a molecule of the present invention, or a pharmaceutical composition of the present invention.

[0144] The kit may also include instructions for carrying out the method of the invention according to the methods and uses of the invention. The kit may further include a label or imprint indicating that the contents can be used for reinforcement of the nanoparticles according to the invention and / or for the nanoparticles of the invention.

[0145] It is also envisioned that the kits of the invention will further comprise, for example, buffers, vials, controls, stabilizers, instructions to aid one of skill in the art in preparing or using the nanoparticles of the invention.

[0146] Furthermore, the present invention also relates to the use of the nanoparticles of the invention, or the nanoparticles obtainable by the method of the invention, or the pharmaceutical composition of the invention, in therapy, preferably in the treatment of cancer in a subject.

[0147] The present invention also relates to a method for treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of the nanoparticles of the invention, or the nanoparticles obtainable by the method of the invention, or the pharmaceutical composition of the invention.

[0148] The term "administration" refers to the administration of a therapeutically or diagnostically effective dose of the nanoparticles of the invention as described above to a subject. Various routes of administration are possible and are described above.

[0149] The present invention also relates to the use of the nanoparticles of the invention, or the nanoparticles obtainable by the method of the invention, or the pharmaceutical composition of the invention, for the preparation of a medicament, e.g. an effective medicament in the treatment of cancer.

[0150] Unless otherwise stated, the following terms used in this specification, including the description and claims, have the definitions given below.

[0151] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein which equivalents are intended to be encompassed by the present invention.

[0152] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to a "reagent" includes one or more of such different reagents, and reference to a "method" includes reference to equivalent steps and methods known to those of skill in the art that may be modified or substituted for the methods described herein.

[0153] Unless otherwise indicated, the term "at least" preceding a series of elements should be understood to refer to every element in the series.

[0154] The term "and / or" when used herein includes the meaning of "and", "or" and "all or any other combination of the components connected by that term".

[0155] The term "about" or "approximately" as used herein means within 20%, preferably within 10%, and more preferably within 5% of a given value or range, however it also includes the specific number, for example, about 20 includes 20.

[0156] In this specification and in the claims that follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to mean the inclusion of a specified integer or step or group of integers or steps, and not the exclusion of any other integer or step or group of integers or steps. As used herein, the term "comprising" can be substituted with the terms "containing" or "including", or, as used herein, may be substituted with the term "having".

[0157] As used herein, "consisting of" excludes any component, step, or ingredient not specified in the claim component. As used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.

[0158] In each instance herein, any of the terms "comprising," "consisting essentially of," and "consisting of" may be replaced with either of the other two terms. Any such substitutions are envisioned by the present disclosure.

[0159] It is to be understood that this invention is not limited to the particular methodology, protocols, materials, reagents, and substances, etc. described herein, as such may vary. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention, which is defined solely by the claims.

[0160] All documents cited in the body of this specification (e.g., all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.) are incorporated herein by reference in their entirety. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such disclosure by virtue of prior invention. In the event that material incorporated by reference contradicts or is inconsistent with the present specification, the present specification takes precedence over such material.

[0161] The present invention is further illustrated by the following clauses.

[0162] Item 1. (a) a fusion protein (A) comprising an antibody (A1) and a positively charged polypeptide (A2); (b) a positively charged polypeptide (B); (c) a negatively charged molecule (C) whereby the nanoparticles are formed.

[0163] Item 2. The method of item 1, further comprising recovering the nanoparticles.

[0164] Item 3. The method of item 1 or 2, wherein the positively charged polypeptide (B) is in molar excess compared to the fusion protein (A).

[0165] Item 4. The method of any one of the preceding items, wherein the negatively charged molecule (C) is in molar excess compared to the fusion protein (A).

[0166] Item 5. The method of any one of the preceding items, wherein the negatively charged molecule (C) is in molar excess compared to the positively charged polypeptide (B).

[0167] Item 6. The method of any one of the preceding items, wherein the molar ratio of the positively charged polypeptide (B) to the fusion protein (A) is at least about 10:1.

[0168] Item 7. The method according to any one of the preceding items, wherein the molar ratio of the positively charged polypeptide (B) to the fusion protein (A) is about 20:1 to about 50:1.

[0169] Item 8. The method of any one of the preceding items, wherein the molar ratio of the negatively charged molecule (C) to the fusion protein (A) is at least about 1:1.

[0170] Item 9. The method of any one of the preceding items, wherein the nanoparticles are formed by self-assembly.

[0171] Item 10. The method of any one of the preceding items, comprising incubation at about 0 to 37°C.

[0172] Item 11. The method of any one of the preceding items, comprising incubation for at least about 1 hour.

[0173] Item 12. The method according to any one of the preceding items, wherein in the fusion protein (A), the antibody (A1) and the positively charged polypeptide (A2) are fused via a linker.

[0174] Item 13. The method of item 12, wherein the linker is an unstructured linker.

[0175] Item 14. The method of item 12 or 13, wherein the linker is a glycine-serine linker.

[0176] Item 15. The method of any one of the preceding items, wherein the antibody (A1) comprises a heavy chain and a light chain.

[0177] Item 16. The method according to any one of the preceding items, wherein in the fusion protein (A), the positively charged polypeptide (A2) is fused to the C-terminus of the heavy chain of the antibody (A1) and / or the C-terminus of the light chain of the antibody (A1).

[0178] Item 17. The method according to any one of the preceding items, wherein in the fusion protein (A), the positively charged polypeptide (A2) is fused to the C-terminus of each heavy chain of the antibody (A1) and / or the C-terminus of each light chain of the antibody (A1).

[0179] Item 18. The method of any one of the preceding items, wherein the antibody (A1) is specific for a cell surface molecule.

[0180] Clause 19. The method of clause 18, wherein the cell surface molecule is capable of being internalized upon binding of the antibody.

[0181] Paragraph 20. The method of paragraph 18 or 19, wherein the cell surface molecule is expressed on a cell that is sensitive to therapeutic treatment with a negatively charged molecule.

[0182] Item 21. The method of any one of the preceding items, wherein the antibody (A1) is specific to a cancer-associated antigen.

[0183] Item 22. The method of any one of the preceding items, wherein the antibody (A1) is specific for CD33, EGFR, IGF1R, or CD20.

[0184] Item 23. The method according to any one of the preceding items, wherein the antibody (A1) is gemtuzumab, cetuximab, cixutumumab, teprotumumab, GR11L, or rituximab.

[0185] Item 24. The antibody (A1), The method of any one of the preceding claims, having a CDR sequence selected from the group consisting of: TIFF2024519084000009.tif128156.

[0186] Item 25. The antibody (A1), a. SEQ ID NO:6 and 7; b. SEQ ID NO:15 and 16; c. SEQ ID NO:25 and 26; d. SEQ ID NOs:35 and 36; and e. SEQ ID NO:44 and 45 The method of any one of the preceding claims, wherein the VH sequence and the VL sequence are selected from the group consisting of:

[0187] Item 26. The method of any one of the preceding items, wherein the antibody (A1) has heavy and light chain sequences selected from the group consisting of: a. SEQ ID NOs:8 and 9; b. SEQ ID NOs:17 and 18; c. SEQ ID NOs:27 and 28; d. SEQ ID NOs:37 and 38; e. SEQ ID NOs:46 and 47; and f. SEQ ID NOs:66 and 18.

[0188] Item 27. The method of any one of the preceding items, wherein the negatively charged molecule (C) is a nucleic acid.

[0189] Item 28. The method of item 27, wherein the nucleic acid is a double-stranded nucleic acid.

[0190] Item 29. The method of item 27, wherein the nucleic acid is a single-stranded nucleic acid.

[0191] Item 30. The method of any one of items 27 to 29, wherein the nucleic acid has about 18 to about 25 bp.

[0192] Item 31. The method of any one of items 27 to 29, wherein the nucleic acid has about 18 to about 25 nt.

[0193] Item 32. The method of any one of the preceding items, wherein the negatively charged molecule (C) is DNA or RNA.

[0194] Item 33. The method of any one of the preceding items, wherein the negatively charged molecule (C) is an siRNA, esiRNA, an antisense oligonucleotide, or an miRNA.

[0195] Clause 34. The method of any one of the preceding clauses, wherein the negatively charged molecule (C) is an siRNA specific for KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3.

[0196] Clause 35. The method of any one of the preceding clauses, wherein the negatively charged molecule (C) is a mixture of siRNAs specific for one or more targets, preferably selected from the group consisting of KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, and FLT3.

[0197] Item 36. The method of any one of the preceding items, wherein the negatively charged molecule (C) has a molecular weight of about 20 kDa or less.

[0198] Item 37. The method of any one of the preceding items, wherein the negatively charged molecule (C) has a charge of at least 2-.

[0199] Item 38. The method according to any one of the preceding items, wherein the positively charged polypeptide (B) comprises the same amino acid sequence as the positively charged polypeptide (A2) contained in the fusion protein (A).

[0200] Item 39. The method of any one of the preceding items, wherein the positively charged polypeptide (B) is protamine or a histone.

[0201] Item 40. The method according to any one of the preceding items, wherein the positively charged polypeptide (A2) contained in the fusion protein (A) is protamine or histone.

[0202] Item 41. Nanoparticles obtainable by the method according to any one of the preceding items.

[0203] Item 42. (a) A fusion protein (A) comprising an antibody (A1) and a positively charged polypeptide (A2); (b) a positively charged polypeptide (B); (c) one or more negatively charged molecules (C); Nanoparticles comprising:

[0204] Item 43. The nanoparticle of item 41 or 42, wherein the positively charged polypeptide (B) is concentrated in the outer portion and / or the inner portion of the nanoparticle.

[0205] Item 44. The nanoparticle of any one of items 41 to 43, wherein the fusion protein (A) is concentrated in the outer portion of the nanoparticle.

[0206] Item 45. The nanoparticle of any one of items 41 to 44, wherein one or more negatively charged molecules (C) are concentrated in an interior portion of the nanoparticle.

[0207] Item 46. The nanoparticles according to any one of items 41 to 45, having an average diameter of about 0.05 μm to about 10 μm.

[0208] Item 47. The nanoparticle according to any one of Items 42 to 47, wherein in the fusion protein (A), the antibody (A1) and the positively charged polypeptide (A2) are fused via a linker.

[0209] Item 48. The nanoparticle of item 47, wherein the linker is an unstructured linker.

[0210] Item 49. The nanoparticles of item 47 or 48, wherein the linker is a glycine-serine linker.

[0211] Item 50. The nanoparticle of any one of items 41 to 49, wherein the antibody (A1) comprises a heavy chain and a light chain.

[0212] Item 51. The nanoparticle of any one of Items 41 to 50, wherein the antibody (A1) is specific for a cell surface molecule.

[0213] Clause 52. The nanoparticle of clause 51, wherein the cell surface molecule is capable of being internalized upon binding of an antibody.

[0214] Clause 53. The nanoparticle of clause 51 or 52, wherein the cell surface molecule is expressed on cells that are sensitive to therapeutic treatment with the negatively charged molecule.

[0215] Item 54. The nanoparticle of any one of Items 41 to 53, wherein the antibody (A1) is specific to a cancer-associated antigen.

[0216] Item 55. The nanoparticle of any one of items 41 to 54, wherein the antibody (A1) is specific for CD33, EGFR, IGF1R, or CD20.

[0217] Item 56. The nanoparticles according to any one of Items 41 to 55, wherein the antibody (A1) is gemtuzumab, cetuximab, cixutumumab, teprotumumab, GR11L, or rituximab.

[0218] Item 57. The antibody (A1), 57. The nanoparticle of any one of items 41 to 56, having a CDR sequence selected from the group consisting of: TIFF2024519084000010.tif128156.

[0219] Clause 58. The nanoparticle of any one of clauses 41 to 57, wherein the antibody (A1) has a VH sequence and a VL sequence selected from the group consisting of: a. SEQ ID NOs: 6 and 7; b. SEQ ID NOs: 15 and 16; c. SEQ ID NOs: 25 and 26; d. SEQ ID NOs: 35 and 36; and e. SEQ ID NOs: 44 and 45.

[0220] Item 59. The nanoparticle of any one of items 41 to 58, wherein the antibody (A1) has heavy and light chain sequences selected from the group consisting of: a. SEQ ID NOs:8 and 9; b. SEQ ID NOs:17 and 18; c. SEQ ID NOs:27 and 28; d. SEQ ID NOs:37 and 38; e. SEQ ID NOs:46 and 47; and f. SEQ ID NOs:66 and 18.

[0221] Item 60. The nanoparticle of any one of items 41 to 59, wherein the negatively charged molecule (C) is a nucleic acid.

[0222] Item 61. The nanoparticle of item 60, wherein the nucleic acid is a double-stranded nucleic acid.

[0223] Item 62. The nanoparticle of item 60, wherein the nucleic acid is a single-stranded nucleic acid.

[0224] Item 63. The nanoparticle of any one of items 60 to 62, wherein the nucleic acid has about 18 to about 25 bp.

[0225] Item 64. The nanoparticle of any one of items 60 to 63, wherein the single-stranded nucleic acid has about 18 to about 25 nt.

[0226] Item 65. The nanoparticle of any one of items 41 to 64, wherein the negatively charged molecule (C) is DNA or RNA.

[0227] Item 66. The nanoparticle of any one of items 41 to 65, wherein the negatively charged molecule (C) is an siRNA, an esiRNA, an antisense oligonucleotide, or an miRNA.

[0228] Clause 67. The nanoparticle of any one of clauses 41 to 66, wherein the negatively charged molecule (C) is an siRNA specific for KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3.

[0229] Clause 68. The nanoparticle of any one of clauses 41 to 67, wherein the negatively charged molecule (C) is a mixture of siRNAs specific for one or more targets, preferably selected from the group consisting of KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, and FLT3.

[0230] Item 69. The nanoparticle of any one of items 41 to 68, wherein the negatively charged molecule (C) has a molecular weight of about 20 kDa or less.

[0231] Item 70. The nanoparticle of any one of items 41 to 69, wherein the negatively charged molecule (C) has a charge of at least 2-.

[0232] Item 71. The nanoparticle of any one of items 41 to 70, wherein the positively charged polypeptide (B) comprises the same amino acid sequence as the positively charged polypeptide (A2) contained in the fusion protein (A).

[0233] Item 72. The nanoparticle of any one of items 41 to 71, wherein the positively charged polypeptide (B) is protamine or histone.

[0234] Item 73. The nanoparticle according to any one of Items 41 to 72, wherein the positively charged polypeptide (A2) contained in the fusion protein (A) is protamine or histone.

[0235] Item 74. A composition comprising the nanoparticles according to any one of items 41 to 73.

[0236] Item 75. The composition of item 74, which is a pharmaceutical composition.

[0237] Item 76. The nanoparticles of any one of items 41 to 73 or the composition of item 74 or 75 for use in therapy.

[0238] Item 77. The nanoparticle or composition for use according to Item 76, wherein the use is in the treatment of cancer.

[0239] Item 78. The nanoparticle or composition for use according to Item 76, wherein the use is in the treatment of solid tumors.

[0240] Item 79. The nanoparticle or composition for use according to Item 76, wherein the use is in the treatment of a cancer selected from the group consisting of lung cancer, sarcoma, colorectal cancer, and blood cancer.

[0241] Item 80. A kit comprising the nanoparticles of any one of items 41 to 73 or the composition of item 74 or 75.

[0242] Clause 81. The method of any one of clauses 1 to 40 or the nanoparticle of any one of clauses 41 to 73, wherein the negatively charged molecule is a drug and / or a prodrug, such as remdesivir triphosphate.

[0243] Clause 82. The method of any one of clauses 1 to 40 or the nanoparticle of any one of clauses 41 to 73, wherein the negatively charged molecule is a drug and / or prodrug, e.g., ibrutinib, conjugated to a moiety having a net negative charge, e.g., Cy3.5 or Alexa488. EXAMPLES

[0244] The following examples illustrate the invention. These examples should not be construed as limiting the scope of the invention. The examples are included for illustrative purposes, and the invention is limited only by the claims.

[0245] Example 1: Modification of conjugation protocol When the inventors carried out chemical conjugation between selected carrier antibodies and sulfo-SMCC and protamine as published in Baumer, N. et al., 2016; Baumer, N. et al., 2018; Baumer, S. et al., 2015, they were puzzled by the resulting conjugates with unintended properties in SDS-PAGE electrophoresis. For example, the phenomenon of IgG conjugates that turned out to be no longer reducible by reducing agents such as DTT, DTE, β-mercaptoethanol, or TCEP was frequently observed (Figure 1, Brief Description of the Figures, Figures A and B, see gel a for illustration). Then, conjugates were observed that showed much higher molecular weights than intended, representing IgG dimers or multimers cross-linked to each other, some of which contained additional protamine and some of which did not (Figure 1, Brief Description of the Figures, Figure C, see gel B for illustration). In extreme cases, the complexity of all these side reactions leads to a cloud-like appearance of the resulting conjugate, probably caused by the mixture of all these conjugates a-d in FIG. 1B.

[0246] Conversely, the contemplated conjugate was a molecule that retained the native disulfide bonds in and around the peptide HC and LC, had no additional internal cross-linking operations, but had multiple protamines cross-linked to the light chain (LC) and heavy chain (HC), the formulation marked C in FIG. 1.

[0247] Therefore, we modified the conjugation protocol by introducing an additional purification step after amino-terminal activation of the protamine peptide with sulfo-SMCC. The resulting product was purified by gel chromatography to separate the activated SMCC-protamine from the excess of free sulfo-SMCC, which still had activity. From this step onwards, antibody conjugation was carried out with a homogenous solution of pure SMCC-protamine, free of residual cross-linker contamination (Figure 2).

[0248] Therefore, all the experiments shown in the following examples were carried out by following the "new" SMCC depletion protocol, and the resulting complexes were significantly improved in terms of electrophoretic homogeneity, targeting performance, and functional efficacy.

[0249] Therefore, all findings presented here were performed with therapeutic agents synthesized by the new production process and not with the formulations published in Baumer, N. et al., 2016; Baumer, N. et al., 2018; Baumer, S. et al., 2015.

[0250] Example 2: Oncogene inactivation in non-small cell lung cancer using an unpublished modified conjugation protocol Next, EGFR-expressing non-small cell lung cancer cell lines (NSCLC) were targeted by cetuximab-protamine. Here, cetuximab-protamine could bind 8 moles of siRNA per mole of cetuximab-protamine (Figure 3A, B) and delivered siRNA to early endosomes in a receptor-dependent manner (Figure 3C). In in vitro treated NSCLC cell lines, KRAS was effectively silenced after treatment with anti-EGFR-mAB-protamine complexed with siRNA against KRAS (Figure 3D). Conjugated cetuximab loaded with control siRNA had a small effect on cell proliferation, colony formation in cetuximab-sensitive A549 cells, tumor growth and tumor weight in CD1 nude mice, which is consistent with randomized clinical trials using cetuximab in NSCLC patients. However, this effect was significantly amplified by the use of KRAS siRNA. See Figure 3E and F (right panel). Cetuximab-resistant SK-LU1 cells tolerated cetuximab-control siRNA much better, but again, colony and tumor growth was significantly inhibited by KRAS siRNA (Fig. 3E and F, left panels).

[0251] We next investigated the effect of systemic anti-EGFR-mAB-siRNA treatment of NSCLC xenograft tumors on the proliferation marker Ki67 expression in immunofluorescence in frozen sections (A549 tumors) and paraffin sections (SK-LU-1 tumors). In A549 (Figure 4A-D) and SK-LU-1 tumors (Figure 4G-J) treated with PBS or anti-EGFR-mAB-control siRNA, Ki67 staining was widespread in the Hoechst-stained nuclei of the respective tumor cells. Conversely, tumors treated with anti-EGFR-mAB-KRAS-siRNA showed much fewer proliferative cells exhibiting Ki67 staining (Figure 4E-F and 2K-L).

[0252] Tumor growth retardation by systemic anti-EGFR-mAB-siRNA application could be induced not only by a decrease in tumor tissue proliferation but also by an increase in apoptosis. Moreover, induction of apoptosis is naturally a desirable effect of cancer therapeutics that may actively reduce tumor size. We aimed to investigate the abundance of apoptotic cells by TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling) staining of the respective tumor tissues ex vivo, which reveals intranuclear DNA fragmentation as a sign of apoptosis. After development of peroxidase staining, control-treated tumor sections showed a doubling of TUNEL-positive nuclei in anti-EGFR-mAB-control siRNA-treated A549 tumors (Figure 5C-D) compared to PBS treatment (Figure 5A-B), and a further doubling when the carrier contained KRAS siRNA (Figure 5E-F for illustration, Figure 5M for statistics). Apoptotic signals were indistinguishable between SK-LU1 tumors treated with PBS (Fig. 5G–H) and those treated with anti-EGFR-mAB-control siRNA (Fig. 5I–J), whereas the number of TUNEL-positive nuclei increased fourfold when KRAS-siRNA was conjugated to an antibody carrier and applied to xenograft tumors (Fig. 5K–L and Fig. 5N).

[0253] Taken together, the strikingly significant reduction in tumor size by treatment with anti-EGFR-mAB-KRAS siRNA can be explained by a combination of reduced proliferation and increased apoptosis in the respective tumors.

[0254] Furthermore, we exploit the fact that EGFR is also surface expressed in sarcomas (see (Herrmann et al., 2010) and next chapter). Because our system utilizes antibodies as components of a shuttle system delivering oncogene-specific effector siRNAs, rather than as active anticancer drugs, the observation that cetuximab was ineffective as a single agent in initial clinical trials in sarcomas (Ha et al., 2013) is not relevant for our purposes.

[0255] Example 3: Targeting oncogenes in rhabdomyosarcoma Rhabdomyosarcoma (RMS) is an aggressive soft tissue sarcoma that originates from immature myoblasts and occurs mainly in children and young adults. Pediatric RMS is divided into two major categories depending on the histological appearance: approximately 2 / 3 is embryonal RMS (ERMS), which has a better prognosis, and 1 / 3 is the more aggressive alveolar RMS (ARMS) (Stevens, 2005). To date, no common genetic lesions of diagnostic value have been found in ERMS, except for the accumulation of loss of heterozygosity at 11p15 (Chen et al., 2013). Targeting the key drivers of ARMS is more likely to have therapeutic impact. The genetic lesion that characterizes alveolar rhabdomyosarcoma (ARMS) is the fusion of PAX3-FKHR or PAX7-FKHR due to chromosomal translocations of t(1;13) or t(2;13). Thus, targeting the PAX-FKHR fusion gene and its transcripts may be a specific and effective means to inhibit malignant growth and induce apoptosis of ARMS cells. Inhibition of oncogenic fusion or mutant proteins has proven difficult: either the proteins were designated "undruggable" or drug treatment led to the selection of resistant versions of the protein and more aggressive recurrences (Verdine and Walensky, 2007).

[0256] Downregulation of fusion protein by RNAi is intended to overcome these problems, since expression is inhibited at the mRNA level. Specifically, in RMS cells, downregulation of the expression of PAX3-FKHR fusion protein by RNAi has a direct effect on malignant phenotype. Silencing of PAX3-FKHR fusion by siRNA against PAX3 or PAX3-FKHR reduces the proliferation, migration and colony formation of RMS cell lines (Kikuchi et al., 2008; Liu, L. et al., 2012). Therefore, the inventors expected that effective downregulation of ARMS-specific fusion protein by RNAi delivered to tumor cells in a stable and specific manner by the established antibody-protamine carrier system would bring about a therapeutic effect in vivo.

[0257] In RMS, IGF1R and epidermal growth factor receptor (EGFR) are candidate targets for our modular carrier. Our technique allows us to distinguish tumor cells from other cells by two independent features: (a) cell surface receptor decoration and (b) cellular oncogenic machinery, thus providing a two-layer specificity. We and others (Herrmann et al., 2010) have identified dense surface expression of EGFR and IGF1R in different alveolar (and fetal) RMS cell lines. Both of these cell surface receptors may serve as targeting components of our system.

[0258] To check the targeting efficiency of the antibody constructs in RMS cell lines, we + The cell line RD was treated with anti-EGFR antibody (cetuximab)-siRNA complex to detect ARMS IGF1R +The cell line RH-30 was treated with anti-IGF1R-siRNA complexes (Fig. 6). Both cell lines express variable levels of IGF1R and EGFR (Fig. 6A), with the highest expression, RD cells preferentially internalize anti-EGFR-Alexa488-siRNA (Fig. 6B and C, upper panels) and RH-30 cells preferentially internalize anti-IGF1R-Alexa488 siRNA complexes (Fig. 6B, lower panel). Alexa488-siRNA inhibited the total EGFR expression by cetuximab-protamine. + Although it was possible for the anti-IGF1R antibody to be internalized by as many as 90% of the RD cells (Fig. 6C, center panel), the anti-IGF1R antibody did not inhibit IGF1R + In RH-30 cells, the effect was less (Fig. 6B , lower panel).

[0259] To perform a proof-of-principle experiment on the specific targeting of PAX3-forkhead fusion oncogenes typical of RMS, we designed various siRNAs spanning the breakpoint region of PAX3-FKHR (Figure 7D) and subjected ARMS RH-30 cells to treatment with siRNAs spanning these breakpoints coupled to cetuximab-protamine in a colony formation assay. Breakpoint siRNAs significantly reduced colony formation in RH-30 compared to controls (Figure 7E), and colony formation in ERMS-type cells RD was impaired by delivery of NRAS combined with cMyc siRNA (Figures 7A and B) (both target genes are well-known oncogenes in ERMS). Accordingly, in RD cells, NRAS oncogene expression was reduced in Western blots after treatment with anti-EGFR / NRAS siRNA (middle row, Figure 7C).

[0260] These results illustrate that it is possible to target RMS cell lines using a modular antibody-siRNA system comprising at least two different monoclonal antibodies to specifically deliver a nucleic acid of choice to induce oncogene inactivation, depending on the receptor decoration of the RMS tumor.

[0261] Example 4: Targeting oncogenes in Ewing's sarcoma Ewing's sarcoma is a bone tumor in children and young adults. Long-term complete remission in metastatic disease is less than 35%, so there is a high need for better treatment options (Paulussen et al., 1998; Paulussen et al., 2008). In these tumor cells, the central genetic event is the occurrence of the chromosomal translocation t(11;22) that leads to the formation of the fusion protein EWS-FLI1 (Arvand and Denny, 2001). Ewing's sarcoma cells express large amounts of IGF1R on their surface. Therefore, we intended to apply a modular therapy using anti-IGF1R antibodies, e.g., clone ImcA12 (cixutumumab) or teprotumumab as SMCC-protamine conjugates to deliver EWS-FLI1 breakpoint-specific siRNA. As a proof of principle, we used the commercially available anti-IGF1R mouse antibody GR11L (Merck) and showed that Ewing's cells were targeted. These results were published in (Baumer, N. et al., 2016) and are illustrated in Figure 8.

[0262] To enable this therapeutic option, two different IGF1R antibodies were cloned, expressed in CHO-S cells, and purified using HPLC. These were clones of cixutumumab (herein referred to as "A12") and teprotumumab (herein referred to as "Tepro"). Both were produced in sufficient quantities and coupled to SMCC-protamine (Figure 9A), and both bound to siRNA (Figure 9B) and delivered siRNA to IGF1R-positive cells SKNM-C (Figure 9C).

[0263] When cells were incubated with these IGF1R-mAB-protamine conjugates in complex with siRNA against EWS-FLI1 and plated in semi-solid soft agar, colony formation was significantly reduced (FIGS. 10A and B).

[0264] Therefore, we conclude that our modular system can be applied for the use of anti-IGF1R antibodies and sarcoma cells, specifically for knockdown of fusion protein-specific siRNA, e.g., EWS-FLI1-siRNA.

[0265] Example 5: Targeting oncogenes in lymphoma models Diffuse large B-cell lymphoma (DLBCL) is a frequent lymphoma subtype. DLBCL cells express CD20 on their surface. The standard first-line treatment for affected patients is a combination of chemotherapy and the anti-CD20 antibody rituximab. Rituximab binds to and blocks the CD20 molecule, resulting in antibody-dependent cellular cytotoxicity (ADCC). Approximately 65% ​​of patients can be cured by this approach. Patients who are refractory to first-line treatment or who relapse after an initial response are characterized by extremely poor survival rates, indicating that novel therapeutic approaches are urgently needed. Therefore, we aimed to combine the first-line drug rituximab as a cell-targeting antibody with siRNAs against different cancer genes identified in genetically highly diverse lymphoma cells (Figure 15).

[0266] We first chemically coupled the CD20 antibody rituximab to SMCC-protamine at different ratios to compare the effectiveness of each conjugate to bind siRNA (Figure 13). Interestingly, despite a high excess of 80 or 120 moles of unbound SMCC-protamine, the binding of siRNA was nearly identical to that of 1 mole of antibody coupled to 40 moles of SMCC-protamine (Figure 13). Therefore, we concluded that a minimal amount of SMCC-protamine was sufficient and reverted to the routine antibody:SMCC-protamine ratio of 1:32 (Figure 14). As previously done, we first checked the binding ability of rituximab-protamine to siRNA and observed a coordinate binding of siRNA to the carrier system (about 8 moles / mole) similar to that found with other carrier antibodies (Figure 14B).

[0267] Subsequently, different DLBCL cell lines tested positive for surface expression of CD20 and CD33 (Figure 15, top panel). Therefore, internalization studies with the anti-CD20 mAB Rituximab and the anti-CD33-mAB Gemtuzumab were performed.

[0268] To obtain additional target molecules other than BTK, DLBCL cell lines were subjected to B cell receptor axis molecule screening by antibody-mediated siRNA knockdown (FIG. 15), which resulted in significant colony growth inhibition, especially in HBL1 cells, using anti-CD33 antibody-siRNA targeting (FIG. 15, lower panel).

[0269] Example 6: Complexes formed by carrier antibody-protamine and low molecular weight polyanionic drugs with chemical structures different from siRNA In another project, the inventors hypothesized that therapeutic monoclonal antibodies, such as rituximab or gemtuzumab, could be utilized as carrier molecules for low molecular weight (lmw) drugs. This strategy is clinically important because the pharmacokinetics and safety of many lmw drugs, such as kinase inhibitors, could be improved by targeted carriers compared to untargeted versions. Therefore, the inventors hypothesized that for the use of such antibody-inhibitor conjugates, (i) they could be applied at lower dosages because the antibody helps concentrate the inhibitor in the intended target cells, and (ii) the antibody prevents the inhibitor from being taken up by unintended cells and inducing unintended toxic reactions.

[0270] In a first set of experiments, we synthesized a negatively charged small molecule with a charge of 4, a derivative of a known growth inhibitor, referred to herein as small molecule 1 (SM-1). Thus, the uncharged small molecule inhibitor was converted into a strongly anionic compound (referred to herein as "SM-1 / RF") by adding a negatively charged emitting red fluorescent RF, and bound to a protamine-based carrier system by electrostatic forces to form an antibody-inhibitor conjugate.

[0271] In addition to the strong polyanionic charge of the red fluorescent dye, this conjugate had the advantage of being easily traceable in vitro and in vivo in red fluorescent form.

[0272] The same experiments were then performed for the binding of SM-1 / RF with two carrier systems, rituximab (CD20)-protamine and the more reliable cetuximab (EGFR)-protamine. Both carriers showed strong co-assembly of SM-1 / RF and extremely high mole / mole electrostatic saturation, over 100 moles of SM-1 / RF per mole of carrier mAB, due to their low molecular weight (approximately 13 kDa) compared to siRNA (Figure 17).

[0273] The corresponding conjugates, rituximab-protamine and cetuximab-protamine, loaded with a subcritical 20-fold excess of SM-1 / RF were incubated with CD20- and EGFR-expressing cell lines and analyzed for intracellular enrichment of SM-1 / RF. In both cases, intracellular enrichment of the fluorescent signal could be demonstrated at typical red fluorescence excitation / emission wavelength combinations (FIG. 18). Thus, the modified SM-1 / RF compounds are internalized into the cells and can therefore exert their effects.

[0274] Example 7: Surprising Features of Effective Antibody-Protamine-siRNA Formulations The exact conjugation procedure for all antibodies used can be divided into two steps: first, amino-terminal conjugation of protamine to sulfo-SMCC, followed by a size-exclusion process to remove excess conjugation cross-linker, and second, cysteine-directed conjugation of activated protamine-SMCC to the IgG backbone. The resulting bioconjugates show a significant molecular weight shift, as seen by SDS-PAGE electrophoresis, in both the heavy and light chains of IgG. Approximately 60-80% of the IgG was converted to contain the protamine tag, and residual amounts of excess protamine were always visible.

[0275] As shown in Figure 19A, for the EGFR-mAB cetuximab-protamine conjugate, the reaction mixture was depleted of unbound protamine by protein G interaction chromatography. The protamine-conjugated antibody was bound to a protein G matrix, and unbound protamine was eluted early, followed by the purified protamine-free IgG-protamine conjugate (see fractions 29-31). Surprisingly, this material, although conjugated to protamine, was unable to bind to siRNA in a classical band shift assay (see the right half of Figure 19B), whereas the unpurified mAB-protamine conjugate bound to siRNA at the typical 1:16 molar ratio.

[0276] To further examine the effectiveness of protamine-containing and protamine-depleted preparations, EGFR-expressing KRAS-dependent NSCLC cell lines, A549 and SK-LU1, were treated with both preparations carrying KRAS-siRNA and control siRNA. Only the preparation containing free protamine (see Figure 19A and B, "anti-EGFR-mAB coupled to 32-fold SMCC-protamine") effectively reduced colony growth of cell lines with KRAS-siRNA, as expected due to oncogene dependency (Figure 20A and B).

[0277] The exact same purification procedure was performed on the anti-CD33 mAB gemtuzumab used for experimental treatment of AML, and the same effect was observed: a conjugate preparation depleted of unbound protamine by HPLC did not bind the desired amount of siRNA (Figure 21B, lower panel), whereas the unpurified one bound correctly (Figure 21B, upper panel).

[0278] Furthermore, in contrast to the unpurified material, the carrier without unbound SMCC-protamine had no residual inhibitory efficacy of anti-DNMT3A-siRNA against OCI-AML2 cells in the colony formation assay (Figure 21C), an observation that was incompatible with the previous molecular assembly hypothesis of the carrier system (Figure 3A) and challenged the previous hypothesis in general.

[0279] To find an explanation for these puzzling and unexpected observations, the inventors carried out multiple experiments.

[0280] Given the results from Figure 19, we hypothesized that the presence of unbound SMCC-protamine in the CD20-mAB-protamine-SM-1 / RF-protamine adduct is as important as in the siRNA adduct, and therefore depleted protamine from a Rituximab-CD20 mAB preparation by affinity chromatography, as previously done. As hypothesized, the depleted preparation (Figure 22A, fraction 25) was unable to bind and coordinate polyanionic SM-1 / RF (Figure 22B, left) to the same extent as the SMCC-protamine-containing preparation (Figure 22B, right).

[0281] Identical findings were obtained using anti-IGF1R monoclonal AB IMCA-12 conjugates (FIG. 23). SMCC-protamine-depleted antibody-protamine conjugates were unable to electrostatically bind to siRNA.

[0282] In Figure 24, the ability of SMCC-protamine depleted A12 carrier antibody (Figure 23) to effectively deliver siRNA to inactivate oncogenes to SKNM-C Ewing sarcoma cells was tested. Non-depleted A12-SMCC-protamine loaded with effective siRNA reduced colony growth, whereas the depleted preparation (see Figure 23, fractions 19-21) did not.

[0283] Example 8: Deciphering the role of free SMCC-protamine in antibody-SMCC-protamine / free SMCC-protamine complexes Previous results have found that in the absence of free SMCC-protamine, targeting does not function.Therefore, the present inventors wish to find out the role that free SMCC-protamine plays in the complex.Naturally, the possibility that the main function is achieved by free SMCC-protamine must be excluded.Therefore, a series of experiments were carried out by free SMCC-protamine and other negative controls.

[0284] First, colony formation assay was performed with IGF1R-positive EGFR-negative Ewing's sarcoma cell line SKNM-C, which depends on EWS-FLI1 translocation products (Figure 25). As a positive control, inhibition of EWS-FLI1 translocation products by treating cells with anti-IGF1R-mAB-protamine complexes conjugated to anti-EWS-FLI1(E / F)-siRNA resulted in a significant decrease in colony growth of SKNM-C cells (Figure 25). Conversely, delivery of anti-EWS-FLI1-siRNA using anti-EGFR-mAB-protamine as a carrier, both in the presence and absence of free SMCC-protamine, did not result in a decrease in colony formation compared to control siRNA (Figure 25), indicating that the targeting mediated by IGF1R is specific and not due to free SMCC-protamine. Furthermore, SMCC-protamine alone at the same concentration (60 nM) as the anti-EGFR antibody also failed to induce inhibition of colony formation (FIG. 25).

[0285] Next, a typical targeting mixture containing an anti-IGF1R antibody conjugated to SMCC-protamine, the same amount of free SMCC-protamine as present in the anti-IGF1R-mAB-protamine complex (60 nM of carrier conjugated to SMCC-protamine in a 30-fold excess is equivalent to ≦1800 nM of potential free SMCC-protamine), and a potent anti-EWS-FLI1-siRNA was administered to SKNM-C Ewing sarcoma cells (FIG. 26A). When the targeting anti-IGF1R-mAB A12 was omitted and SKNM-C cells were treated with only free SMCC-protamine + potent siRNA at the same concentration as the complete mixture, no reduction in colony growth was observed compared to the control scr-siRNA (FIG. 26A). This strategy was also tested in the AML cell line OCI-AML-2 (Figure 26B) and A549 NSCLC cells (Figure 26C), always omitting the targeting mAB (here, anti-CD33 or anti-EGFR, respectively), which usually gave effective siRNA. As in the case of SKNM-C, free SMCC-protamine loaded with effective siRNA remained ineffective, as did control siRNA.

[0286] This led to the hypothesis that while the correct antibody is required for detection of the intended target cell surface molecule, two additional prerequisites must be met to effectively bind and complex with the siRNA and target it to the carcinogenic molecule for therapeutic efficacy: (a) protamine conjugated to the targeting antibody, and (b) sufficient amounts of residual unbound SMCC-protamine present in the mixture. Free SMCC-protamine without the carrier coupled to the antibody could not meet these requirements.

[0287] The next question to be addressed was whether any modified assembly structure of our carrier system could consistently explain all the in vitro and in vivo efficacy results observed in our studies.

[0288] Example 9: Detection and visualization of unexpected electrostatic macrostructures that form stable nanoparticles Intracellular antibody-protamine-siRNA complexes are readily identified in treated cell culture samples if the corresponding cell surface receptor or molecule is expressed, as illustrated in Figure 27, where cetuximab (anti-EGFR)-SMCC-protamine conjugated with siRNA is internalized into EGFR-expressing NSCLC cells and processed internally to early endosomes (white dots, left panel) but not to lysosomes (gray dots, center panel).

[0289] Example 10: Antibody-protamine-siRNA complexes without free SMCC-protamine or free SMCC-protamine-siRNA alone are not internalized into target cells Interestingly, internalization of typical vesicle structures was only seen when residual SMCC-protamine from the conjugation protocol remained in the mixture (Figure 28, right hand), but not when protamine-SMCC was depleted by affinity chromatography (Figure 28, left hand, see also Figure 19 for chromatographic results). Thus, visually too, the presence of unbound protamine-SMCC is important for the efficiency of the conjugate.

[0290] This was also done with other antibody-SMCC-protamine conjugates, compared to counterparts that had been depleted of free SMCC-protamine via HPLC, and with free SMCC-protamine: no internalization into the cell lines was observed with antibody-protamine-siRNA conjugates without free SMCC-protamine, or with free SMCC-protamine alone (Figures 29, 30, and 31).

[0291] Example 11: Formation of vesicular structures in vitro by antibody-protamine-siRNA complexes Although extremely low cell targeting efficiency was observed whenever negative control experiments were performed, i.e., whenever cells not expressing EGF receptor were treated with a valid conjugate targeting EGF receptor (Figure 32B), we were intrigued by the accumulation of fluorescent micellar structures outside the cells. Presumably attached to matrix-like structures on the treated dish surface, these accumulations were only seen when no target was found on the cells to bind and internalize the conjugate. Moreover, these accumulations were all the same size, and must have been much larger than approximately 10-20 nm, which would account for one IgG + several protamines + 8 attached siRNA monomers, because this size would not be detectable as particles in fluorescence optical microscopy. Fluorescence optical microscopy has a resolution of approximately half the emission wavelength, and therefore the particle size would be larger than 200 nm.

[0292] Therefore, we hypothesized three components to form one stable macrostructure required for activity: (1) cetuximab-SMCC-protamine, (2) siRNA, and (3) unbound SMCC-protamine. To verify the presence of such a macrostructure responsible for the efficiency of IgG-protamine-siRNA, we applied particle size detection by dynamic light scattering (DLS) in a zeta counter (MALVERN), which correlates the light diffusion caused by particles in solution. The results were interesting: as a dynamic process, components with a perfectly reasonable size (22 nm for IgG-protamine-protamine-siRNA monomer) spontaneously assembled into nanostructures with a size of more than 400 nm after a few hours, but this process was not detectable in the protamine-depleted preparation (Figure 33).

[0293] This process is time-dependent, with larger structures only forming after a certain incubation time (Figure 34). A time frame of 2-6 hours is sufficient to allow these macrostructures to form, and the macrostructures start to partially disintegrate again after 24 hours in an unprotected PBS environment at room temperature.

[0294] Based on these measurements, we hypothesized that antibody-protamine / free SMCC-protamine / siRNA complexes are formed outside cells and independent of cellular context. To visualize these complexes, we incubated different complex compositions overnight in a cell-free environment on coated chamber slides with Alexa488-siRNA and fixed the developed structures the next day. Fluorescence microscopy revealed that vesicular structures were formed only when the three components (1) antibody-SMCC-protamine, (2) free SMCC-protamine, and (3) siRNA met each other (see FIG. 35).

[0295] All antibody-protamine complexes, including free SMCC-protamine, formed vesicular nanostructures, whereas those without free SMCC-protamine or SMCC-protamine alone did not form nanostructures (FIG. 36).

[0296] In detail, the nanostructure formed by three components, mAB-SMCC-protamine, unconjugated SMCC-protamine, and Alexa488-labeled siRNA, resembles the shape of a micrometer-sized spheroid (Figure 37). The structure is verified by fluorescence microscopy and laser scanning confocal microscopy. It is revealed that the spheroid structure is completely filled with Alexa488 signals from the siRNA compound.

[0297] The results are summarized in the table below. TIFF2024519084000011.tif60161

[0298] Example 12: In vitro vesicle structures develop at different temperatures We also tested whether the formation of vesicular structures depends on a certain temperature: indeed, they form at 4° C., room temperature (approximately 22° C.), and 37° C. (FIG. 38).

[0299] Example 13: In vitro formation of functional vesicular structures by antibody-protamine-siRNA complexes depends on the amount of free SMCC-protamine To further elucidate the function of SMCC-protamine coupled to the antibody in the complex and as a free molecule, the amount of SMCC-protamine added to the antibody (here, the anti-EGFR antibody cetuximab) was titrated. A constant amount of cetuximab was used and SMCC-protamine was added at molar ratios of 1:1 to 1:100 (see Figure 39A for details). The conjugation efficiency was then checked in Coomassie-stained SDS-PAGE, and it was found that the coupling of the antibody light chain (LC) and heavy chain (HC) seemed to be suboptimal when incubating antibody:SMCC-protamine ratios of 1:1 to 1:10 (Figure 39B). The conjugation process seemed to saturate at a molar ratio of antibody:SMCC-protamine of 1:32 and not further enhanced at 1:50 and 1:100 (Figure 39B).

[0300] The siRNA binding ability of these different conjugations was analyzed by routine band shift assay (Figure 40A-F). siRNA binding was detectable at conjugation ratios of 1:32 to 1:100 (Figure 40D-F), and at lower ratios, efficient siRNA binding was undetectable (Figure 40A-C).

[0301] The properties of the different conjugation products were further analyzed by their ability to form vesicle structures in a cell-free state when they were incubated with Alexa488-control siRNA (Figure 40G-L) and with EGFR-positive A459 cells (Figure 40M-R). When cetuximab was conjugated to SMCC-protamine at ratios of 1:1 to 1:10, efficient cell-free vesicle formation was not observed (Figure 40G-I), whereas at a ratio of 1:32, vesicle formation was highly abundant (Figure 40J), and decreased at ratios of 1:50 and 1:100 (Figure 40K-L). The internalization ability of these complexes was highest at conjugation 1:32 (Figure 40P) and decreased at conjugation 1:10 (Figure 40O). No internalization was observed at ratios of 1:1 (Figure 40M), 1:3.2 (Figure 40N), or 1:50 to 1:100 (Figure 40Q-R), suggesting that complexation of cetuximab with SMCC-protamine at 1:32 was optimal, as it resulted in the most efficient conjugation, cell-free vesicle formation, and internalization into cells.

[0302] As a functional assay, the efficiency of the different conjugation products to inhibit colony formation of A549 cells by knockdown of the oncogene KRAS was compared. To elucidate the effect of unconjugated SMCC-protamine alone, it was also compared with an equal amount of free SMCC-protamine not conjugated to cetuximab (Figure 40S-X). Surprisingly, only the conjugation cetuximab:SMCC-protamine 1:32 complexed with KRAS-siRNA leads to a significant reduction in colony formation compared to the scrambled control siRNA (Figure 40V). SMCC-protamine alone is not able to induce inhibition of colony formation via KRAS knockdown at any concentration (Figure 40S-X). The pronounced toxicity of SMCC-protamine as a complex with scr-siRNA and KRAS-siRNA was observed only at the highest concentration (Figure 40W-X).

[0303] Example 14: Free SMCC-protamine can be added back to SMCC-protamine-depleted antibody-protamine conjugates to form vesicle structures in vitro, and free SMCC-protamine can be replaced by free protamine To further elucidate the function of SMCC-protamine coupled to the antibody in the complex and as a free molecule, we titrated the amount of SMCC-protamine added to the antibody-protamine conjugates that had been depleted of free SMCC-protamine by HPLC. These antibody-protamine conjugates cannot form vesicular structures containing fluorescent siRNA, as illustrated in Figure 36F. Therefore, we asked whether free SMCC-protamine could be added again to perform this function, and whether SMCC-protamine could be replaced by protamine without sulfo-SMCC. Different amounts of free SMCC-protamine and protamine alone were added to anti-EGFR-mAB-P (Figure 41). Addition of 1x or 10x SMCC-protamine to antibody was not effective in forming vesicle structures (Figures 41A and B), whereas addition of 32x SMCC-protamine resulted in highly efficient vesicle formation (Figure 41C). The assay showed that it was possible to replace free SMCC-protamine with protamine that did not contain chemically coupled sulfo-SMCC (Figure 41F).

[0304] Example 15: Formation of vesicular structures in vitro by antibody-protamine-siRNA and / or SM-1 / RF complexes To test this new and unexpected nanostructure model, we used a structurally completely different, but electrostatically identically charged molecule, SM-1 / RF (see Example 8), and complexed it with the antibody-protamine conjugate (Figures 42-45).

[0305] When examining the results of cell-free assembly of mAB-protamine-SM-1 / RF-conjugates both with and without additional siRNA, striking differences were observed in the amount and size of the respective nanostructures: those assembled with siRNA complexed by mAB-protamine + free SMCC-protamine and SM-1 / RF were considerably larger and more frequent than those without siRNA (Figure 42C and F, and Figure 43D and H). This phenomenon is explained by the hypothesis that mixed particles consisting of all four components form stable nanostructures. In detailed fluorescence micrographs, the nanostructure of the largest particles can be revealed as siRNA forming the border of the spheroid micelles and SM-1 / RF filling the lumen of the spheres (Figure 44 and Figure 45, see enlarged view).

[0306] This phenomenon, where mixed antibody-protamine particles were more frequent and much larger than those in which only SM-1 / RF was complexed with mAB-protamine, was observed both when the carrier antibody was anti-CD20-mAB rituximab (Figure 44) and when it was anti-EGFR-mAB cetuximab (Figure 45).

[0307] Thus, while negatively charged SM-1 / RF can form small vesicles with antibody-protamine complexes (Figures 42E and 43F), siRNA, a linear, highly negatively charged molecule, can act as a kind of electrostatic "glue" between antibody-protamine / free SMCC-protamine complexes, which can be observed as circular sparkles in much larger vesicles that appear to be filled with red fluorescent SM-1 / RF (Figures 44 and 45).

[0308] The large micellar structures seen in Figures 44 and 37 are also visible in routine optical microscopy analysis under phase contrast conditions (see Figure 46).

[0309] This observation was further confirmed by laser scanning microscopy (LSM, Fig. 47), where confocal analysis of vesicles formed in cell-free conditions showed that the green fluorescent siRNA formed rings (Fig. 47A a-c and Fig. 47B d-f), and for very large vesicles such as those formed by anti-CD20-mAB-P, the lumen of the vesicles was found to be filled with red fluorescent SM-1 / RF (Fig. 47B d and f).

[0310] Example 16: Proposed model Taken together, the principle of conjugation of anionic cargo molecules by carrier-antibody-protamine+unbound protamine can also be applied to cargoes other than siRNA nucleic acids, where it is important to modify the cargo molecules to give them polyanionic characteristics and to leave unbound protamine-SMCC in the preparation to allow strong electrostatic coordination and self-assembly of the reactants.

[0311] This observation strongly supports that the new and unexpected polymeric nanostructures may be necessary and sufficient for the in vitro and in vivo pharmacokinetic efficacy of our carrier system.

[0312] Thus, we hypothesize a completely unexpected observation: the combination of components (1) antibody-protamine, (2) siRNA / anionic small molecule inhibitor, and (3) unbound (SMCC-)protamine to form a nanoparticle-like macrostructure that is responsible for siRNA stability and can effectively deliver siRNA and / or anionic small molecule inhibitor to intended cells. An exemplary idealized model of this nanostructure assembly is shown in FIG. 11.

[0313] In conclusion, experiments using a variety of chemically distinct effector payloads with the minimum common feature requirement being polyanionicity and no other structural similarities provide experimental evidence that our new and unexpected nanostructural model is the basis for the in vitro and in vivo pharmacokinetic characterization of antibody-SMCC linker-protamine siRNA carrier and antibody-SM-1 / RF systems.

[0314] This modular nanostructure system with dual specificity for (1) siRNA / anionic small molecule transport and specific delivery to target cells and (2) specific intracellular oncogene inactivation can be used for a variety of disease groups, e.g., cancer.

[0315] Example 17: Coupling of antisense oligonucleotides to antibody-protamine conjugates To check whether antibody-protamine nanoparticles could also be used to deliver single-stranded oligonucleotides, which are currently used as alternative tools to knock down gene expression. It is hypothesized that these synthetic antisense single-stranded oligonucleotides ("ASOs") are as short as siRNAs and will bind to αEGFR-mAB-protamine conjugates in the same way as siRNAs. Therefore, band shift assays were performed using control ASOs, and it was found that 1 mole of αEGFR-mAB-protamine conjugate can bind to at least 8-32 moles of ASO when incubated at room temperature for 1 hour or at 37°C for 5 minutes (Figure 12).

[0316] Example 18: Examination of the potential of antibody-protamine fusion proteins The principle of gene fusion of cell-determining targeting moieties with electrostatic siRNA binder protamine as presented in Song et al. was evaluated by applying this strategy in a variation for targeting leukemic blasts, for example (Figure 48). Gemtuzumab, a well-known anti-CD33 receptor antibody, was expressed with and without direct gene fusion with protamine as siRNA carrier (Figure 51). To test the ability of this construct to bind and carry siRNA, electrophoretic mobility shift assays ("band shift assays") were performed, and surprisingly, the heavy chain fusion of gemtuzumab with protamine alone did not allow the conjugate to bind siRNA (Figure 48C). As a control, pure gemtuzumab IgG was used that was chemically conjugated to protamine by sulfo-SMCC crosslinker as described herein (Figure 48A). The chemically conjugated molecule contained protamine attachments on both the heavy and light chains, and also contained an amount of unbound protamine-SMCC due to the excess crosslinker introduced. This final conjugate preparation readily complexed with up to 8 moles of siRNA per mole of monoclonal antibody (mAB, FIG. 48B) (see disappearance of bands upon siRNA complexation). The band shift indicates that these complexes are again able to bind siRNA when an amount of free protamine sulfate is added to the αCD33-mAB-PRM1 fusion protein (FIG. 49).

[0317] Furthermore, when we took the ineffective anti-CD33-human protamine fusion protein from Figure 48 and supplemented it with a certain amount of free protamine, it was able to complex with Alexa488-tagged siRNA in a cell-free environment in the form of large nanoparticles that were visible in fluorescence microscopy (Figure 50), whereas the unsupplemented CD33-protamine fusion was unable to form complex structures. These structures were shown in further experiments to be important for therapeutic efficacy.

[0318] Furthermore, these nanocarriers were found to be effective in knocking down DNMT3A in DNMT3A-dependent OCI-AML2 cells, as they mediated a reduction in colony formation of OCI-AML2 cells upon addition of different formulations of free protamine and DNMT3A-siRNA (see also Figure 54).

[0319] As a second example, we cloned and expressed a cetuximab IgG preparation generated by genetic fusion of the cetuximab heavy chain with human protamine illustrated in Figure 52 (see Figure 55 for Coomassie stained PAGE). This αEGFR-mAB-PRM1 fusion protein was shown to be unable to bind siRNA alone (Figure 55B), but stepwise addition of protamine to the preparation restored the ability of the IgG-protamine fusion to bind siRNA at the indicated ratios (Figures 55C-E).

[0320] It was shown that a cetuximab IgG preparation generated by genetic fusion of the cetuximab heavy chain with human protamine alone was unable to form stable nanoparticles with Alexa488-marked siRNA in a cell-free environment, but the stepwise addition of protamine to the preparation restored the ability of the IgG-protamine fusion to form stable nanoparticles. This process was dependent on a molar excess of free protamine relative to the IgG-protamine fusion, and a 50-fold molar excess of free protamine relative to the fusion protein was found to be optimal for nanoparticle stability (Figure 56).

[0321] Here, we present a proposed model of an ideal nanocomplex consisting of siRNA, free protamine, and receptor-IgG-hPRM1 fusion. The IgG-hPRM1 fusion is thought to self-assemble to form a shell structure that encloses a self-stabilizing amount of siRNA and free protamine. The spheroid structures are formed in a time-dependent manner, with an approximate diameter of 50-500 nm being the most predominant fraction (Figure 57).

[0322] The internalization of Alexa488-marked siRNA into A549 NSCLC cells driven by cetuximab-hPRM-1 fusion protein was tested in combination with increasing excess concentrations of free protamine sulfate. Here, a preparation lacking free protamine sulfate (left) was unable to transport Alexa488-siRNA into A549 cells, whereas increasing the protamine sulfate concentration in the mixture led to an increase in the number of intracellular vesicles filled with internalized Alexa488-siRNA, with the optimal molar excess being approximately 30-fold free protamine per mole of cetuximab-hPRM1 fusion protein combined with Alexa488-siRNA (Figure 58).

[0323] Here, we found that αEGFR-mAB cetuximab-protamine fusion reduces colony formation in the presence of free protamine sulfate in a colony formation assay. In the presence of 20-fold or 30-fold free protamine sulfate, respectively, A549 cells treated with αEGFR-mAB-PRM1 / KRAS-siRNA form significantly fewer colonies in soft agar than cells treated with αEGFR-mAB-protamine / control (scr)-siRNA and the same amount of free protamine sulfate (Figure 59). When A549 cells are treated with αEGFR-mAB-PRM1 fusion protein without free protamine sulfate, no difference in colony formation can be observed compared to cells treated with PBS. Mean values ​​± SD of three independent experiments are shown here. * P<0.05, two-tailed T-test. α, anti;

[0324] Example 19: Synthesis of the low molecular weight polyanionic drug Ibrutinib-Cy3.5 ("RMA561") Ibrutinib is a covalent binder of Bruton's kinase. It has been used in several lymphoma subtypes to block downstream signaling of the B cell receptor by covalent attachment to a cysteine ​​in the ATP-binding pocket of soluble Bruton's kinase. Ibrutinib targets BTK not only in lymphoma cells but also in normal cells, and therefore can have severe side effects such as infection, pneumonia, or arrhythmias (Wilson et al. 2015). It leads to higher dosages, interference by unrelated cells, and furthermore, adverse effects that may be partially due to bystander effects on targets other than BTK (Byrd et al. 2013). Secondly, prolonged ibrutinib dosing can lead to the development of resistance (Lenz 2017). Here, we first attempted to conjugate ibrutinib by advanced linker chemistry to a suitable carrier antibody, rituximab, which targets CD20 and is part of the standard treatment for DLBCL. The conjugation, although successful, was found to alter the solubility of the conjugate and therefore render it unable to be further exploited.

[0325] Therefore, uncharged ibrutinib was converted to the strongly anionic compound Cy3.5-RMA561 (herein referred to as ibrutinib-Cy3.5) and coupled to a protamine-based carrier system by electrostatic forces to form an antibody-inhibitor complex. The cyanine dye Cy3.5, as a potential binder, exhibits a strongly anionic character by exhibiting four sulfonic acid groups (Figure 60). From our point of view, to form nanocarriers, it is preferable to concentrate the anionic charge at one site of the molecule and to have an overall linear shape. Moreover, the cyanine dye allows the use of fluorescent readouts at all stages of evaluation. Starting from commercially available pyrazolopyrimidine 1, amino-functionalized ibrutinib derivative 5 was synthesized according to published data (Kim et al. 2015; Turetsky et al. 2014). Pyrazolopyrimidine 1 was iodized and substituted by 4-phenyloxybenzeneboronic acid via Suzuki coupling to form the main part of the ibrutinib core structure 2. (S)-N-Boc-3-hydroxypiperidine, important for high binding affinity, was added via stereocontrolled Mitsunobu reaction to form compound 3. After deprotection of the piperidine moiety, an α,β-unsaturated linker 4 (Michael acceptor) was introduced for irreversible conjugation with the target. The resulting Boc-protected amine 5 represents a lead structure for labeling with different anionic moieties such as the cyanine dye Cy3.5 (Lumiprobe), which, under basic conditions, gives the corresponding amide ibrutinib-Cy3.5 (Cy3.5-RMA561). The final product was purified by C18-SPE cartridge (purity >98% (HPLC)) and verified by high-resolution mass spectrometry.

[0326] The Boc-protected derivative 5 (8.2 mg, 0.014 mmol, 1.05 equiv.) was dissolved in 0.5 mL of anhydrous dichloromethane (dried over molecular sieves 4A), hydrogen chloride 4 M in dioxane (41 μL, 0.166 mmol, 12 equiv.) was added and the reaction mixture was stirred at room temperature until 5 was completely converted to the free amine (TLC: silica, solvent: 10% MeOH / EtOAc, detection: tracking by UV254 and ninhydrin staining). The reaction mixture was evaporated in vacuum while heating to 35° C. The residual white solid was dissolved in 0.5 mL of anhydrous dimethylformamide and to the solution was added the NHS ester of Cy3.5 ("Sulfo-Cy3.5 NHS ester" by Lumiprobe; 15 mg, 0.014 mmol, 1.0 equiv.) dissolved in 0.5 mL of anhydrous dimethylformamide and N,N-diisopropylethylamine (72 μL, 0.414 mmol, 30 equiv.). The reaction mixture was stirred at room temperature, protected from light, until the completion of the reaction, controlled by TLC analysis (RP C-18, solvent: MeOH / H2O / AcOH 10 / 0.5 / 0.2 v / v / v, detection: UV-VIS and ninhydrin staining). The reaction mixture was evaporated in vacuum while heating to 35 °C, the residue was triturated with pentane, diethyl ether, ethyl acetate and dried in vacuum at room temperature, obtaining 21 mg of crude product (Cy3.5-RMA561) in the form of a purple solid.

[0327] An analytically pure sample was prepared by chromatographic purification of the crude product on a 12 g C18 SPE cartridge. The cartridge was preconditioned by washing with water (10 mL). To remove impurities and reaction by-products, the crude product was divided into two portions, each dissolved in 0.5 mL of water, loaded onto the cartridge, then washed with water (10 mL) and further with acetonitrile (10 mL). The product was then eluted with the mixture ACN / H2O 1:1 (v / v) into a small number of fractions that exclusively contained pure Cy3.5-RMA561. After lyophilization, 2 x 8 mg of pure product Cy3.5-RMA561 was obtained as a purple solid.

[0328] In addition to the strongly polyanionic character of the Cy3.5 dye, the conjugate had the advantage of being easily traceable in vitro and in vivo in the form of red fluorescence.

[0329] Example 20: Analysis of antibody-protamine / protamine complex formation with ibrutinib-Cy3.5 in vitro First, experiments were performed in band shift assays to characterize the binding between ibrutinib-Cy3.5 and two carrier systems, both antibodies (rituximab and cetuximab) conjugated to protamine by the bifunctional cross-linker sulfo-SMCC, i.e. rituximab (anti-CD20-mAB)-protamine containing unbound protamine-SMCC and cetuximab (anti-EGFR-mAB)-protamine containing unbound protamine-SMCC. Both carrier-conjugates containing unbound protamine-SMCC showed strong co-assembly of ibrutinib-Cy3.5 derivatives and extremely high mole / mole electrostatic saturation of more than 100 moles of ibrutinib-Cy3.5 per mole of carrier mAB due to their low molecular weight (approximately 13 kDa) compared to siRNA (Figure 62). In all further experiments, the composition of the chemically conjugated antibody-protamine remained unchanged, i.e. the resulting product still contained unbound protamine-SMCC in addition to the antibody-protamine conjugate.

[0330] The corresponding conjugates, rituximab-protamine and cetuximab-protamine, both containing unbound protamine-SMCC and loaded with a subcritical 20-fold excess of ibrutinib-Cy3.5, were incubated with CD20- and EGFR-expressing cell lines and analyzed for intracellular enrichment of ibrutinib-Cy3.5. In both cases, intracellular enrichment of the fluorescent signal could be demonstrated at typical Cy3.5 excitation / emission wavelength combinations (Figure 63). Thus, the modified ibrutinib-Cy3.5 compounds can still be internalized into cells and therefore can act if they still bind to the target BTK.

[0331] Next, the ibrutinib-Cy3.5 derivative coupled to the rituximab carrier antibody was administered to DLBCL cell lines, the cells were lysed, and the lysates were subjected to SDS PAGE analysis.The gel was then irradiated with UV light and scanned for emission from the Cy3.5 chromophore, and indeed, a single protein band of 70 kDa emitting Cy3.5 fluorescence was present, which was later identified as Bruton's kinase BTK by Western blot analysis (Figure 64).

[0332] In conclusion, chemical modification of the ibrutinib core structure into polyanionic derivatives does not alter the efficiency of the conjugate to bind to the Bruton's kinase BTK.

[0333] Next, functional assays were designed to identify the efficacy of the antibody-inhibitor conjugates. DLBCL tumor cells were seeded on methylcellulose to form anchorage-free colony growth as a surrogate marker of tumorigenicity. Assays were performed with antibody-inhibitor conjugate combinations and compared to appropriate controls. It was found that CD20-high expressing HBL-1 cells formed only 30% more colonies when treated with rituximab-protamine / protamine with ibrutinib-Cy3.5 compared to the control group without carrier mAB. In contrast, unconjugated rituximab had only a mild effect on colony growth. Furthermore, in EGFR-high, CD20-low expressing A549 NSCLC cells (Figure 65B), the cetuximab carrier was significantly superior to the rituximab carrier, demonstrating the intended receptor-specific uptake mechanism.

[0334] As seen from the results of the antibody-protamine / free protamine-SMCC / siRNA conjugation experiments, we hypothesized that the presence of unbound / free protamine-SMCC in the αCD20-mAB-protamine-ibrutinib-Cy3.5-protamine adducts may be as important as in the siRNA adducts, and therefore depleted free protamine-SMCC from the Rituximab-αCD20 mAB preparation by affinity chromatography, as was done before. As expected, the depleted preparation (Figure 66A, fraction 25) was unable to bind and coordinate polyanionic ibrutinib-Cy3.5 to the same extent as the protamine-SMCC-containing preparation (Figure 66B, right) (Figure 66B, left). Comparable to the αCD20-mAB-protamine / free protamine-SMCC complex after depletion of free protamine-SMCC, CD20-mAB-P, which does not contain free protamine-SMCC, confers no inhibition of colony formation when complexed with ibrutinib-Cy3.5 (Figure 66C).

[0335] Example 21: Analysis of antibody-protamine / free protamine-SMCC complex formation with ibrutinib-Cy3.5 in vivo To further characterize the in vivo therapeutic efficacy of the Rituximab-Protamine / Free Protamine / Ibrutinib-Cy3.5 carrier compared to all required component controls, an in vivo treatment experiment was performed as shown (see FIG. 67A). For this purpose, immunodeficient NSG mice were subcutaneously implanted with 107 HBL-1 DLBCL cells and 200 mm 3Tumor growth was observed to an average size of 100 mg / kg body weight, mice were assigned to groups of 10 mice each, and treatment was initiated with standard concentrations of 4 mg / kg body weight calculated for rituximab, corresponding to 0.625 nmol rituximab conjugate per dose, rituximab-protamine / free protamine-SMCC / ibrutinib-Cy3.5 (1:20) + 18 μg or 12.5 nmol ibrutinib-Cy3.5, corresponding to 0.625 nmol rituximab conjugate per dose, and equivalent amounts of unconjugated ibrutinib (12.5 nmol) and ibrutinib-Cy3.5 (12.5 nmol), as well as PBS control. Treatment with ibrutinib-Cy3.5 showed no therapeutic effect on tumor growth, but application of an equal amount of ibrutinib-Cy3.5 bound to a rituximab-protamine carrier resulted in significantly slower tumor growth compared to all other groups (Figure 67C). This also translated to animal survival analysis (Figure 67B).

[0336] Thus, the rituximab-protamine / free protamine / ibrutinib-Cy3.5 1:20 complex showed significantly better targeting and therapeutic profile compared to all appropriate component controls in in vivo models. Moreover, the applied ibrutinib single dose was in the range of 20-fold lower (12.5 nmol ibrutinib corresponds to 0.720 mg / kg mouse, whereas the standard dose in Nod-SCID mice is 12 mg / kg (Chen et al. 2016; Zhang et al. 2017)).

[0337] To verify this hypothesis, organs were prepared from sacrificed mice and subjected to ex vivo fluorescence detection of incorporated ibrutinib-Cy3.5 (Figure 68). As a result, tumors derived from mice treated with rituximab-protamine / ibrutinib-Cy3.5 showed a significant accumulation of Cy3.5-derived fluorescence signal, which increased with treatment cycles. In contrast to this finding, there was almost no detectable signal in tumors derived from mice treated with ibrutinib-Cy3.5 given without rituximab co-ordination (Figure 68), and in this group there was a tendency for diffuse background signals seen in most organs (Figure 69).

[0338] Moreover, no specific fluorescence was detected in the analyzed organs (Figure 69). It is concluded that the Rituximab-Protamine / Free Protamine-SMCC / Ibrutinib-Cy3.5 conjugate is specifically enriched in CD20-positive tumors.

[0339] Example 22: Formation of vesicular structures in vitro by antibody-protamine / free protamine-siRNA and / or ibrutinib-Cy3.5 complexes To further characterize the new nanostructures, electrostatically charged green fluorescent siRNA and red fluorescent ibrutinib-Cy3.5 were used and complexed with antibody-protamine / free protamine-SMCC conjugates (Figures 70-72).

[0340] When examining the results of cell-free assembly of mAB-protamine / free protamine / ibrutinib-Cy3.5 conjugates both with and without additional siRNA, striking differences were observed in the amount and size of the respective nanostructures: those assembled with siRNA and ibrutinib-Cy3.5 complexed by mAB-protamine+free protamine-SMCC were significantly larger and more frequent than those without siRNA (Figure 70C and F, and Figure 71D and H). This phenomenon is explained by the hypothesis that mixed particles consisting of all four components form stable nanostructures. In detailed fluorescence micrographs, the nanostructure of the largest particles can be revealed as siRNA forming the outer edge of the spheroid micelles and ibrutinib-Cy3.5 filling more of the lumen of this nanostructure (Figure 72).

[0341] This phenomenon of mixed antibody-protamine particles being more frequent and much larger than those in which only ibrutinib-Cy3.5 was conjugated to the mAB-protamine / protamine carrier was observed both when the carrier antibody was αCD20-mAB rituximab (Figures 72C-D) and when it was anti-EGFR-mAB cetuximab (Figures 72A and B).

[0342] That is, while negatively charged ibrutinib-Cy3.5 can form small vesicles with antibody-protamine complexes (Figure 70E and Figure 71F), siRNA, a linear, highly negatively charged molecule, can act as a kind of electrostatic "glue" between antibody-protamine / free protamine-SMCC complexes, which can be observed as circular sparkles in much larger vesicles that appear to be filled with red fluorescent ibrutinib-Cy3.5 (Figure 72).

[0343] To further characterize this structure, particle size measurements were performed using ZetaView® nanoparticle tracking video microscopy. Here, particles between 1 and 1000 nm were detected and analyzed for their size and number (Figure 73). Stable largest particles were detected 1 hour after the start of complex formation by addition of control (scr) siRNA, ibrutinib-Cy3.5, or both, respectively (Figure 73A, B, C, D). Use of an equal amount of antibody-free protamine-SMCC (=1800 nM=30-fold molar ratio used for coupling of 60 nm anti-CD20-mAB) always resulted in the formation of smaller particles (Figure 73A, lower panel, and Figure 73E). Interestingly, the formation of extremely large mixed particles as seen in Figure 72 was not observed in the Zetaview data due to technical limitations.

[0344] Example 23: Conjugation of anionic small molecule drugs with carrier-antibody-protamine fusions or antibody-protamine conjugates Concerning the conjugation of anionic small molecules, using different ratios of ibrutinib-Alexa488 up to 1:2, and using αCD20-mAB-protamine, the αCD20-mAB rituximab-protamine / free protamine-SMCC (αCD20-mAB-P / P) conjugate was found to bind to ibrutinib-Alexa488 in band shift assays using αCD20-mAB-protamine. Due to the limited anionic charge of the Alexa488 molecule of α, anti (Figure 74, A):-2 (Figure 74, B), the interaction between polycationic protamine fusions and Alexa488 was found to be less intense than that with Cy3.5, which has a net charge of -4 (next example). Thus, only a 2:1 coupling ratio was achieved with ibrutinib conjugated to Alexa488 and the protamine conjugate. However, conjugation of ibrutinib-Alexa488 with αCD20-mAB rituximab-protamine / free protamine-SMCC (αCD20-mAB-P / P) was still successful.

[0345] The assembly of antibody-inhibitor complexes in the form of stable nanoparticles that are stable in serum (Figure 74E, G, F, H), conditions as published for other nanoparticles, could be detected by fluorescence microscopy (Figure 74C-H). Importantly, since ibrutinib-Cy3.5 is detectable by fluorescence, this provides excellent tracking capabilities for all downstream applications.

[0346] When incubated in vitro, αCD20-mAB-P / P loaded with ibrutinib-Cy3.5 led to the assembly of electrostatically stabilized nanoparticles emitting red Cy3.5 fluorescence (Figure 78). In fluorescence microscopy, first, regularly shaped vesicular structures were detected (Figure 74C,D), and later, irregularly shaped aggregates larger than 2 μm were detected in addition to smaller particles, a process that was not seen when unmodified αCD20-mAB was used to conjugate ibrutinib-Cy3.5 or when modified αCD20-mAB-P / free protamine was used to conjugate hydrophobic ibrutinib (trade name: Imbruvica) (not shown). The electrostatic particles seen in optical microscopy (Figures 78A and B) were also confirmed in electron microscopy (Figure 78C), where a large number of smaller particles in the range of <100-200 nm were detected (Figure 78C), leading us to choose the term "nano" carriers.

[0347] With respect to the comparison of anionic charged small molecules and uncharged small molecules for complexation with protamine conjugates or protamine fusions, it was found that charged ibrutinib-Cy3.5 formed stable nanoparticles with mAB conjugated to protamine, but uncharged ibrutinib (trade name: imbruvica) did not. Each antibody carrier conjugated to protamine was loaded with charged ibrutinib-Cy3.5 or uncharged ibrutinib. Notably, only the ibrutinib sample conjugated to Cy3.5 showed high density formation of nanoparticles, whereas uncharged ibrutinib did not (Figure 75), indicating that the net charge of the polyanion as well as a certain structure of the polyanion are important for proper electrostatic interaction with protamine.

[0348] Next, we tested the conjugation ability of protamine ("hPRM1") fused antibody constructs for the coordination of charged ibrutinib-Cy3.5 versus uncharged ibrutinib (trade name: imbruvica). Only ibrutinib conjugated with Cy3.5 formed stable nanoparticles with two protamine fused mABs (Figure 76). Here, we used hPRM1-protamine fusions of anti-EGFR (A-D) as well as hPRM1 fusions with anti-CD33 to conjugate with charged ibrutinib-Cy3.5. Ibrutinib-Cy3.5 formed stable nanoparticles, but uncharged ibrutinib did not.

[0349] Example 24: Proposed model Taken together, the principle of binding anionic cargo molecules with a carrier consisting of antibody-protamine+unbound protamine can also be applied to cargoes other than siRNA nucleic acids, such as small molecules, such as the kinase inhibitor ibrutinib, where it is important to modify the cargo molecule to give it a polyanionic character and to leave unbound protamine-SMCC in the preparation to allow strong electrostatic self-assembly of the components into nanostructures.

[0350] This observation strongly supports that new and unexpected polymeric nanostructures are responsible for the pharmacokinetic efficacy of our carrier system in vitro and in vivo.

[0351] Thus, the inventors predict a completely unexpected observation: a combination of components, (1) antibody-protamine, (2) siRNA / anionic small molecule inhibitor, and (3) unbound protamine (-SMCC), to form a nanoparticle-like macrostructure that is responsible for siRNA stability and can effectively deliver siRNA and / or anionic small molecule inhibitor to intended cells. An idealized model of this nanostructure assembly is shown in Figure 77.

[0352] In conclusion, experiments with a variety of chemically distinct effector payloads with the minimum common feature requirement being polyanionicity and no other structural similarities provide experimental evidence that our new and unexpected nanostructural model is the basis for the in vitro and in vivo pharmacokinetic characterization of nanocarrier-siRNA carrier and nanocarrier-ibrutinib-Cy3.5 systems.

[0353] This modular nanostructure system with dual specificity for (1) siRNA / anionic small molecule transport and specific delivery to target cells and (2) specific intracellular oncogene inactivation or pharmacological activity can be used for a variety of disease groups, e.g., cancer.

[0354] Example 25: In vitro functional analysis of αCD20-mAB-P / P-Ibrutinib-Cy3.5 nanocarriers We then investigated the efficacy of this αCD20-mAB-P / P-ibrutinib-Cy3.5 nanocarrier in different cell model systems.

[0355] First, internalization into CD20-positive DLBCL cells was examined via Cy3.5 fluorescence. Lymphoma cells HBL1 and TMD-8 treated overnight with uncoupled ibrutinib-Cy3.5 showed a reasonable red fluorescent marking of the cells (white in Figure 79E), which was enhanced when ibrutinib-Cy3.5 was complexed and transported with αCD20-mAB-P / P (Figure 79F). This indicated that the process of internalization via CD20 receptors was beneficial compared to the mechanism of untargeted uptake of ibrutinib-Cy3.5 anion without carrier antibody implementation (Figure 79E). Next, treatment of cells with the conjugate for 72 hours showed a single band of covalent Cy3.5 marking of the 70 kDa protein in SDS PAGE electrophoresis, indicating the binding and functionality of the modified ibrutinib-Cy3.5 compound (Figure 79G). Because the gel had to be significantly overloaded for fluorescent detection of BTK to show equal loading of the lanes and identity of BTK, the gel was then blotted for immunodetection of BTK after fluorescent detection. Indeed, a band representing BTK appeared at the same position as seen in Cy3.5 fluorescence, indicating that ibrutinib-Cy3.5 exclusively covalently bound BTK, as expected (Figure 79G).

[0356] Furthermore, HBL1 cells were incubated with ibrutinib-bodipy for 2 hours, washed, and treated with αCD20-mAB-P / P-ibrutinib-Cy3.5. Although the cells took up ibrutinib-bodipy (Figure 79N and P), Cy3.5 fluorescence appeared only in non-pretreated cells (Figure 79L) and not in cells pretreated with ibrutinib-bodipy (Figure 79P). Although some intracellular red vesicles indicate CD20-mediated internalization of ibrutinib-Cy3.5 (Figure 79P), no pattern suggestive of BTK binding occurred (see Figure 79L for ibrutinib-Cy3.5 and Figure 79N and P for ibrutinib-bodipy). This was true after 24 hours of αCD20-mAB-P / P-ibrutinib-Cy3.5 treatment as well as after preincubation with non-fluorescent ibrutinib and subsequent washing.

[0357] The functional effect of covalent targeting of BTK by ibrutinib is the inhibition of BTK autophosphorylation ability. Therefore, the phosphorylation status of BTK in DLBCL cells after ibrutinib-Cy3.5 treatment, both with and without conjugation in αCD20-mAB / P / P nanocarriers, was analyzed (Figure 80A). Cells were treated with PBS, unconjugated ibrutinib-Cy3.5, and αCD20-mAB-P / P / ibrutinib-Cy3.5 conjugate for 72 hours, lysed, and subjected to Western blot analysis. In HBL1 cells (Figure 80A, left panel) and TMD8 cells (data not shown), it was found that the phosphorylation of BTK at tyrosine 223 detected by a specific phospho-BTK antibody was significantly decreased when treated with ibrutinib-Cy3.5, regardless of whether it was conjugated or not. This was consistent with the binding to BTK as illustrated in Figure 79G. The expression of total BTK was only mildly affected (Figure 80A). It was concluded that the synthesized ibrutinib-Cy3.5 conjugate retained full functionality in terms of binding to the target molecule BTK and inactivating BTK autophosphorylation.

[0358] Interestingly, in all lymphoma cell lines tested, the lymphoma-specific αCD20-mAB-P / P / ibru-Cy3.5 nanocarrier system significantly inhibited colony growth in soft agar culture. This was observed to a much lesser extent with ibrutinib or ibrutinib-Cy3.5 as single agents, and not when unmodified rituximab (αCD20-mAB) was used (HBL1: Figure 80B). This colony assay has been used to quantify anchorage-independent clonal cell growth and is a standard in vitro surrogate for in vivo tumor formation. Thus, we argue that the robust therapeutic effect of ibrutinib-Cy3.5 is only seen when the anionic compound is assembled into stable electrostatic nanoparticles composed of cationic αCD20-mAB-protamine / free protamine carrier complexes and anionic cargo effectors.

[0359] Next, the functional significance of BTK inactivation by αCD20-mAB-P / P-ibrutinib-Cy3.5 in DLBCL cell lines was explored in terms of apoptosis induction. Here, αCD20-mAB-P / P-ibrutinib-Cy3.5 treatment showed excellent induction of apoptotic signals in both HBL1 cells (Figure 81) and TMD8 cells (data not shown) (Figure 81, right-most bar), whereas treatment with unconjugated ibrutinib-Cy3.5 showed only a mild effect compared to targeted treatment and free ibrutinib treatment. Therefore, it is hypothesized that targeted treatment with αCD20-mAB-P / P-ibrutinib-Cy3.5 leads to accumulation of active ibrutinib-Cy3.5 in cells and thus leads to a more severe induction of apoptosis than unconjugated ibrutinib-Cy3.5. Also, the anionic molecule ibrutinib-Cy3.5, when unconjugated, appears to be less accessible to cells, or at least less effective, than the hydrophobic free ibrutinib, as judged by the lower induction of apoptosis compared to free ibrutinib.

[0360] Example 26: Knockdown of the oncogenic EWS-FLI1 translocation product by systemic treatment with αIGF1R-mAB-protamine-siRNA-protamine nanocarriers inhibits Ewing sarcoma xenograft tumor growth To test the in vivo efficacy of the Teprotumumab-protamine nanocarrier, 107 human SK-N-MC cells were xenografted subcutaneously (sc) into the flanks of CD1 nude mice, and cohorts of at least seven mice were treated ip with either PBS, or αIGF1R-mAB-P / P complexed with scrambled control siRNA, or αIGF1R-mAB-P / P complexed with EWS-FLI1-siRNA as described above (Figure 82A-C). Treatment was initiated when tumors reached an average size of 100-150 mm3. Tumors in the treatment group that received Tepro-mAB-P / EWS-FLI1-siRNA / P nanoparticles showed significant, almost complete growth inhibition when compared to both control groups (Figure 82B and C). This suggested successful knockdown of EWS-FLI1 via Tepro-mAB-P / siRNA / P nanoparticles after systemic in vivo application.

[0361] Example 27: Nanoparticles formed by carrier antibody-protamine / free protamine and siRNA exhibit a nearly neutral surface charge The formation of nanoparticles from antibody-protamine / free protamine+siRNA was found to be rapid and reproducible, but dependent on the antibody preparation. For example, it was seen by DLS analysis (Figure 83) and microscopic analysis that different α-IGFR-protamine preparations tend to produce larger particles than those formed by αEGFR-protamine or αCD33 preparations. The surface charge then varied only slightly in the weak anionic range, presenting particles with an almost neutral charge. It is concluded that the properties of the antibody itself, as well as the electrostatic balance between the anionic and cationic components, define the nanoparticle attributes in terms of size and surface charge.

[0362] Example 28: Deciphering the prerequisites for effective nanoparticle formation between anti-EGFR-mAB-SMCC-protamine conjugates and free SMCC-protamine and siRNA Furthermore, we assessed whether siRNA was required to form vesicles. A fixed amount of αEGFR-mAB-P and a fixed 32-fold amount of free SMCC-protamine were incubated with different amounts of Alexa488-control siRNA (Figure 84A-G, green fluorescence in upper panels, phase contrast in lower panels). Notably, nanoparticles were efficiently formed at an optimal molar excess of 5-10-fold siRNA over antibody (Figure 84D-E).

[0363] Example 29: Nanoparticles formed by αEGFR-protamine / free protamine-Alexa488-siRNA are stable in serum-containing conditions For systemic therapeutic application of targeted nanoparticles, stability in various harsh conditions is paramount, otherwise the active substance will separate from the nanocarrier due to degradation.Here, αEGFR-mAB-protamine, free protamine, and Alexa488-siRNA were tested for stability in high concentrations of bovine serum albumin, and the nanocarriers were found to be stable even after 24 hours (Figure 85B).

[0364] Example 30: Serum stability of αCD20-mAB-protamine / free P-ibrutinib-Cy3.5 nanocarriers The assembly of αCD20-mAB-protamine / free P-ibrutinib-Cy3.5 antibody-inhibitor complexes in the form of stable nanoparticles, which are stable in serum for 24 hours (Figures 86B-C) and even 72 hours (Figures 86E-F), could be detected by fluorescence microscopy (Figures 86A-F).

[0365] Example 31: pH stability of siRNA nanocarriers constructed with three different targeting antibodies For systemic application of nanocarriers, it is important under what pH conditions the structure is stable to prevent premature degradation and loss of the coordinated siRNA effector molecule. Here, siRNA nanocarriers were formed with three different targeting antibodies and siRNA under standard conditions and tested for integrity under pH conditions ranging from pH 4.8 to 8.0 (Figure 74), thus covering all pH conditions that the nanocarriers may encounter during therapeutic application. The nanocarriers, as judged by Alexa488 fluorescence of the complexed siRNA, were found to be stable under pH conditions from 5.2 to 8.0, with a tendency to structure at lower pH to form larger superstructures.

[0366] Example 32: pH stability of nanocarriers constructed by αCD20-mAB-protamine / free protamine and ibrutinib-Cy3.5 Here, ibrutinib-Cy3.5 nanocarriers were formed by αCD20-mAB-protamine / free protamine under standard conditions and tested for integrity at pH conditions ranging from pH 4.8 to 8.0, thus covering all pH conditions that the nanocarriers may encounter during therapeutic application (Figure 88). The nanocarriers, as judged by Cy3.5 fluorescence of the complexed ibrutinib-Cy3.5, were found to be stable at pH conditions of 5.8 to 8.0, with a tendency to disintegrate structure at lower pH.

[0367] Example 33: Immunolabeling of targeting IgG antibodies within αEGFR-mAB-P / free protamine-siRNA nanocarriers and αIGF1R-mAB-P / free protamine siRNA nanocarriers The self-assembly process of cationic antibody-protamine / free protamine preparations with siRNA results in nanoparticle structures with well-defined configurations: Here, αEGFR-mAB-protamine / free protamine-siRNA nanoparticles (Figure 76) and αIGF1R (teprotumumab) mAB-protamine / free protamine / siRNA nanoparticles (Figure 77) were subjected to immunodetection of human IgG signals. To visualize the position and orientation of human IgG within the nanocarriers, α-human IgG-Alexa647 was used and signals were found only at the outer edge of the nanoparticle micelle structure (Figures 76B and 77B) and not in the lumen. Instead, signals for fluorescently labeled siRNA were found in the lumen of the structure (Figures 76A and 77A). It was therefore concluded that the bulky IgG molecules must be pointing towards the outside of the nanoparticle micelles and therefore ultimately accessible to the extracellular domains of their protein targets, cell surface molecules and receptor tyrosine kinases.

[0368] Example 34: Visualization of free protamine within nanocarrier complexes The location of the critical free protamine within the nanocarrier has remained unclear until now, so we set out to address this issue and replaced the free protamine in a given αEGFR-protamine preparation with protamine conjugated to Cy3-NHS ester (Figure 91A), which was combined with non-fluorescent siRNA to form a nanocarrier structure (Figure 91B). The nanocarrier was then subjected to fluorescence microscopy, revealing a staining pattern in which the protamine-Cy3 was located in the lumen of the nanocarrier (Figure 91C-E), and the IgG moiety stained by anti-human IgG-Alexa647 was located in the peripheral section of the nanocarrier (Figure 91E-F).

[0369] Example 35: Synthesis of cyanine dye-conjugated inhibitors, gefitinib, gemcitabine, and venetoclax For this purpose, the synthesis of three new compounds is carried out, each coupled to two different cyanine dyes, Sulfo-Cy3.5™ (excitation 591 nm / emission 604 nm) and Sulfo-Cy5.5™ (excitation 684 nm, emission 710 nm). Both cyanine dyes share the same core fluorophore structure, displaying four strongly anionic sulfonyl groups required for coordination of the cationic peptide protamine, but differ only in the number of conjugated double bonds, which results in distinguishable fluorescent dye attributes. Similar to ibrutinib, the three different drug-dye conjugates are synthesized with comparable overall molecular geometries. As potential candidates, gefitinib (EGFR inhibitor), gemcitabine (cytostatic drug), and venetoclax (BLCL-2 inhibitor) were selected because in all cases they retained the ability to bind to target molecules after conjugation with the dye, allowing for fluorescence imaging applications (Wu et al. 2020; Zhu et al. 2018; Gonzales et al. 2018). They are conjugated to cyanine dyes by adding a PEG4-spacer and using commercially available reactive NHS-ester or azide-functionalized dyes (see Figure 79).

[0370] First, starting from commercially available gefitinib 1, it is demethylated and the resulting phenol is converted by nucleophilic attack of azide-PEG4-mesylate to synthesize the gefitinib analogue. The resulting azide is reduced to amine 2 and labeled by sulfo-Cy3.5 or sulfo-Cy5.5 to obtain the gefitinib conjugate for further conjugation with nanocarriers.

[0371] For gemcitabine 3, the hydroxyl group is protected and a leaving group is added to the cytosine, giving alkyne 4 after nucleophilic attack of propargylamine (Solanki et al. 2020). A click reaction gives the required conjugate after labeling with the corresponding azide-functionalized cyanine dye.

[0372] For the third example, venetoclax, we start from the synthesis of the known venetoclax core structure 5 (Giedt et al. 2014). Using the already mentioned mesyl-PEG4-azide, in three steps, we reach the sulfonamide 6, which, after coupling with 5, by reduction of the azide and subsequent labeling with a cyanine dye (NHS-ester), gives the corresponding venetoclax conjugate for further evaluation.

[0373] Example 36: The concept can be extended to easier and cheaper polyanionic molecular moieties and also to other therapeutic interventions such as PDT and radiation therapy. After translation and evaluation of the electrostatic binding principle to other anticancer drugs with different binding motifs and targets, to facilitate translation to clinical evaluation, it is intended to change the necessary anionic character from the cyanine dyes used here (which were important for early optical characterization and fluorescence imaging) to (1) more accessible electrostatic connectors in terms of easier and cheaper synthesis. The candidates are polysulfated mono-, di-, and branched oligosaccharides, or mono-, di-, and triphosphates that could pave the way for large-scale synthesis (Figure 93).

[0374] The present invention illustratively described herein may be suitably implemented in the absence of any element or limitation not specifically disclosed herein.Furthermore, the terms and expressions utilized herein are used as terms of description, not of limitation, and the use of such terms and expressions is not intended to exclude the equivalents of the features shown and described or portions thereof, and it is recognized that various modifications are possible within the scope of the present invention described in the claims.Thus, although the present invention has been specifically disclosed by exemplary embodiments and optional features, it should be understood that modifications and variations of the present invention embodied therein disclosed herein may be used by those skilled in the art, and such modifications and variations are considered to be within the scope of the present invention.

[0375] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes generic descriptions of the invention with a condition or negative limitation removing any subject matter from the genus, regardless of whether the omitted material is specifically recited herein.

[0376] Other aspects are within the scope of the following claims.

[0377] Non-patent references TIFF2024519084000012.tif240161TIFF2024519084000013.tif251161TIFF2024519084 000014.tif247161TIFF2024519084000015.tif251161TIFF2024519084000016.tif45160

Claims

1. (a) a fusion protein (A) comprising an antibody (A1) and a positively charged polypeptide (A2); (b) a positively charged polypeptide (B); (c) a negatively charged molecule (C) thereby forming nanoparticles. A method for producing nanoparticles comprising:

2. 2. The method of claim 1, wherein the molar ratio of the positively charged polypeptide (B) to the fusion protein (A) is at least about 10:

1.

3. The method of claim 1, wherein the antibody (A1) comprises a heavy chain and a light chain.

4. The method of claim 1, wherein in the fusion protein (A), the positively charged polypeptide (A2) is fused to the C-terminus of the heavy chain of the antibody (A1) and / or the C-terminus of the light chain of the antibody (A1).

5. The method of claim 1, wherein the antibody (A1) is specific for a cell surface molecule.

6. The method of claim 1, wherein the negatively charged molecule (C) is a nucleic acid.

7. The method of claim 1, wherein the negatively charged molecule (C) has a molecular weight of about 20 kDa or less.

8. 2. The method of claim 1, wherein the positively charged polypeptide (B) is a protamine or a histone.

9. Nanoparticles obtainable by the method according to claim 1.

10. (a) a fusion protein (A) comprising an antibody (A1) and a positively charged polypeptide (A2); (b) a positively charged polypeptide (B); (c) one or more negatively charged molecules (C); The nanoparticles include

11. The nanoparticle of claim 10, wherein the fusion protein (A) is concentrated in the outer portion of the nanoparticle.

12. 11. The nanoparticle of claim 10, having an average diameter of about 0.05 μm to about 10 μm.

13. A composition comprising the nanoparticles of any one of claims 9 to 12.

14. A pharmaceutical composition comprising the nanoparticles of any one of claims 9 to 12 for the treatment of a disease.

15. A kit comprising the nanoparticles of any one of claims 9 to 12.

16. A pharmaceutical composition comprising the composition of claim 13 for the treatment of a disease.

17. A kit comprising the composition of claim 13.

Images