SHORT COMPLEMENTARY NUCLEIC ACIDS, COMPOSITIONS COMPRISING SHORT COMPLEMENTARY NUCLEIC ACIDS, AND METHODS FOR USE AS ANTIVIRAL AGENTS - Patent application

Abstract

The present disclosure provides short complementary RNAs (scRNAs), compositions comprising short complementary RNAs (scRNAs), and methods of using such short complementary RNAs as antiviral agents. In a more specific embodiment, the present disclosure provides a single-stranded, approximately 20-30 nucleotides (nt) in length scRNA that is complementary to an intron of an essential viral gene, such as the major immediate early (MIE) gene of human cytomegalovirus (HCMV). Also provided herein is a pharmaceutical composition further comprising a pharma- ceutical acceptable carrier system, the carrier system comprising a cationic polymer that releases the scRNA in response to endosomal pH.

Description

[Technical field]

[0001] (Statement regarding federally sponsored research or development) This invention was supported in part by Grant No. SC1112785 awarded by the National Institutes of Health. The United States Government has certain rights in this invention.

[0002] (Sequence Listing) This application contains a Sequence Listing, the contents of which are incorporated by reference.

[0003] The present disclosure relates generally to short complementary nucleic acids, including but not limited to RNA (scRNA), compositions comprising short complementary nucleic acids, and methods of using short complementary nucleic acids, including scRNA, as antiviral agents.

[0004] In a more specific embodiment, the present disclosure provides short complementary nucleic acids, including scRNAs, that are single-stranded and have a length of about 20 to 30 nucleotides (nt), and are complementary to an intron of an essential viral gene (e.g., the major immediate early (MIE) gene of human cytomegalovirus (HCMV)).

[0005] Also provided herein are pharmaceutical compositions comprising such short complementary nucleic acids, including scRNA. These pharmaceutical compositions further comprise a pharma- ceutical acceptable delivery system. In a more specific embodiment, such a delivery system comprises a cationic polymer that releases scRNA in response to endosomal pH. [Background technology]

[0006] Human cytomegalovirus (HCMV) infection is a leading infectious cause of congenital disease in newborns. Congenital HCMV infection causes permanent neurological and neurocognitive disorders and represents a significant health problem worldwide. Kirby et al. (“Congenital cytomegalovirus-a neglected health problem,” Lancet Infect.Dis., 2016, 16(8):900-1), Boeckh et al. (“Cytomegalovirus: pathogen, paradigm, and puzzle,” J.Clin.Invest., 2011, 121(5):1673-80), Cannon et al. (Congenital cytomegalovirus (CMV) epidemiology and awareness, J Clin. Virol., 2009, 46 Suppl 4:S6-10), Bale et al. (Fetal infections and brain development,” Clin. Perinatol., 2009, 36(3):639-53), and Britt et al. (“Controversies in the natural history of congenital human cytomegalovirus infection: the paradox of infection and disease in offspring of women with See, “HCMV immunity prior to pregnancy,” Med. Microbiol. Immunol., 2015, 204(3):263-71. In general, HCMV infects many people and is a cause of significant morbidity and mortality in immunocompromised individuals.See Sweet et al. ("The pathogenicity of cytomegaloviruses," FEMS Microbiol. Rev., 1999, 23(4):457-82), Landolfo et al. ("The human cytomegalovirus," Pharmacol. Ther., 2003, 98(3):269-97), and Mocarski et al. ("Cytomegaloviruses," 2006, 5th Edition, DMKnipe and PMHowley (ed.), Philadelphia: Lippincott Williams & Wilkins). Currently, no vaccine is available.

[0007] Common treatments for HCMV infection include synthetic acyclic analogs of 2'-deoxyguanosine (and its derivatives) that target viral DNA replication and low molecular weight compounds that target the CMV terminase complex. See Bowman et al. ("Letermovir for the management of cytomegalovirus infection," Expet Opin. Investig. Drugs., 2017, 6[2];235-41), Chemaly et al. ("Letermovir for cytomegalovirus prophylaxis in hematopoietic-cell transplantation," N. Engl. J. Med., 2014, 370(19):1781-9), and Piret et al. ("Clinical development of letermovir and maribavir: Overview of human cytomegalovirus drug resistance," Antiviral Res., 2019, 163:91-105). However, these therapies often result in the emergence of drug resistance, and furthermore, none of these therapies are suitable for fetal exposure to HCMV. See Chou et al. (“Cytomegalorirus UL97 mutations in the era of ganciclovir and maribavir,” Rev. Med. Virol., 2008, 18(4):233-46), Pass et al. (“Congenital cytomegalovirus infection: impairment and immunization,” J. Infecct. Dis., 2007, 195(6):767-9), and Cherrier et al. (“Emergence of letermovir resistance in a lung transplant recipient with gaciclovir-resistant cytomegalovirus infection,” Am. J. Transplant., 2018, 18(1):3060-4).Therefore, there is an urgent need for new specific HCMV replication inhibitors, especially those that can be used in congenital CMV infection.

[0008] CMV replication in permissive host cells is a well-defined sequence of processes that includes (in chronological order): cell entry, immediate early (IE) gene expression, early (E) gene expression, DNA replication, late (L) gene expression, and virus production. See Mocarski et al. ("Cytomegaloriruses," 2006, 5th Edition, DMKnipe and PMHowley (ed.), Philadelphia: Lippincott Williams & Wilkins). MIE genes are the most highly expressed viral genes during the early stages of infection and result in several nuclear phosphorylated proteins, among which immediate early protein 1 (IE1, also known as IE72) and immediate early protein 2 (IE2, also known as IE86). Tang et al. (“Mouse cytomegalovirus early M112 / 113 pritains control the repressive effect of IE3 on the major immediate-early promoter,” J. Virol., 2005, 79(1):257-63, Tang et al. (“Immiedate Early Interactions and Epigenetic Defense Mechanisms,” in “Cytomegaloriruses: Molecular Biology and Immunology,” Hethersett, Norwich, UK: Horizon Scientific Press, 2005); Hagemeier et al. (“The 72K IE1 and 80K and hsp70 promotoers via basal promoter elements, J.Gen. human cytomegalovirus is required for negative regulation by IE2,” J. Virol.、1991、65(2):897-903、Scully et al.(“The human cytomegalovirus IE2 86-kilodalton protein interacts with an early gene promoter via site-specific DNA binding and protein-protein associations、“J.Virol.、1995、69(10):6533-40)、Awsthi et al.(”Analysis of splice variants of the immediate-early 1 region of human cytomegalovirus、“J.Virol.、2004、78(15):8191-200、Sandanari et al.(”The major immediate-early genes of human cytomegalovirus induce two novel proteins with molecular weights of 91 and 102 kilodaltons、“Argh.Virol.、2000、145(6):1257-66)、Ahn et al.(”The major immediate-early proteins IE1 andIE2 of human cytomegalovirus colocalize with and disrupt PML-associated nuclear bodies at very early times in infected pemissive cells、“J.Virol.、1997、71(6):4599-613)、Meier et al.(”Effect of a modulator deletion ontranscription of the human cytomegalovirus major immediate-ealy genes in infected undifferentiated and differenciaed cells、“J.Virol.、1997、71(2):1246-55)、Stenberg et al.("The human cytomegalovirus major immediate-early gene," Intervirology, 1996, 38(5-6):343-9), and Stenberg et al. ("Structural analysis of the major immediate-early gene of human cytomegalovirus," J. Virol., 1984, 49(1):190-9.

[0009] Both IE1 and IE2 are expressed under the control of the same promoter (MIEP). Each MIE gene consists of five exons and four introns, with IE1 and IE2 sharing the first three exons but differing in the last exon (exon 4 in IE1 and exon 5 in IE2). The first exon does not code for any amino acids and is related to the initiation sequence. See Stenberg et al. ("The human cytomegalovirus major immediate-early gene," Intervirology, 1996, 39(5-6):343-9), and Stenberg et al. ("Structural analysis of the major immidiate early gene of human cytomegalovirus," J. Virol., 1982, 49(1):190-9. The first intron (intron A) is believed to be involved in the regulation of the MIE gene by interacting with NF1 and CTCF. Hennighausen et al. ("Nuclear factor 1 inteacts with five DNA elements in the promoter region of the human cytomegalovirus major immediate early gene," EMBO J., 1986, 5(6):1367-71), and Martinez et al. ("CTCF Binding to the First Intron of the Major Immediate-Early (MIE) Gene of Human Cytomegalorirus (HCMV) See Negatively Regulates MIE Gene Expression and HCMV Replication,” J. Virol., 2014, doi:JVI.00845-14).

[0010] HCMV belongs to the Herpesviridae family, a family of large DNA viruses. Herpesviruses may encode as many as 200 different genes. Some essential genes depend for their expression on post-transcriptional RNA splicing. For example, the MIE gene of human cytomegalovirus (HCMV) has five exons and four introns and must be spliced ​​to produce IE and IE2, which are essential for viral infection and replication.

[0011] RNA splicing requires the interaction of intronic RNA with cellular factors. Regulation of MIE gene expression at the transcriptional level has been extensively studied. Meier et al. (“Effect of a modulator deletion on transcription of the human cytomegalovirus major immediate-early genes in infected undifferentiated and differentiated cells,” J. Virol., 1997, 71(2):1246-55), Adair et al. (“Alteration of cellular RNA splicing and polyadenylation machinery during productive human cytomegalovirus Akter et al. (“Two novel spliced ​​genes in human cytomegalovirus,” J.Gen. Virol., 2003, 84:1117-22), Sourvinos et al. (“Recruitment of human cytomegalovirus immediate-early 2 protein onto parental viral genomes in association with ND10 in live-infected cells, “J. Virol., 2007, 81(18):10123-36,” and Sinclair et al. (“Chromatin structure regulates human cytomegalovirus gene expression during latency, reactivation and lytic infection,” Biochim. Biophys. Acta., 2010, 1799(3-4):286-95). However, the details of splicing regulation of HCMV genes remain unclear.

[0012] Since polypyrimidine tract (Py)-binding protein (PTB) interferes with the splicing of the MIE gene (see Cosme et al. ("Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus," J. Virol., 2009, 83(7):2839-50), and since HCMV infection causes temporal changes in PTB (see Gaddy et al. ("Regulation of the subcellular distribution of key cellular RNA-processing factors during permissive human cytomegalovirus infection," J. Gen. Virol., 2010, 91:1547-59), the present inventors have come up with an antiviral mechanism in which a small nucleic acid (such as RNA) complementary to an intron containing one or more Pys can be used as an antiviral agent that inhibits viral replication (such as HCMV replication). Summary of the Invention

[0013] The major immediate-early (MIE) genes of HCMV are essential for viral replication, and the most abundant products encoded by the MIE genes include IE1 and IE2. Both IE1 and IE2 genes share the MIE promoter (MIEP) as well as the first three exons and the first two introns. IE1 is expressed earlier than IE2 after CMV infection (or transfection of the MIE gene). We identified two polypyrimidine (Py) tracts in intron 4 (between exon 4 and exon 5) that are responsible for transcriptional switching from IE1 to IE2. We further discovered that the first Py is important and the second Py is essential for IE2 splicing and expression.

[0014] More specifically, the inventors of the present application discovered that (1) the second Py is essential for the fourth intron of IE2 to bind to a splicing factor (e.g., U2AF65), and (2) the first Py enhances the binding of U2AF65 to the intron. The inventors of the present application further discovered that, using an HCMV BACmid in which the second Py was mutated, deletion of the second Py completely suppressed virus production (while HCMV in which the first Py was mutated replicated with a defective phenotype).

[0015] In light of these findings, the inventors have conceived of short complementary nucleic acids (such as scRNAs) that are complementary to intronic RNAs containing one or more Pys as antiviral agents. Such molecules are advantageous as antiviral agents because their inhibitory action is virus specific (because they are complementary to intronic sequences, but not to host cell sequences).

[0016] The present disclosure further provides for combining short complementary nucleic acids (such as scRNA) with short interfering RNA (siRNA) to provide synergistic anti-viral compositions and methods.

[0017] The present disclosure further provides a delivery system for efficiently delivering the short complementary nucleic acids (such as scRNA) and compositions of the present disclosure.

[0018] Non-limiting embodiments of the present disclosure include the following.

[0019] [1] A single-stranded nucleic acid molecule having a sequence complementary to all or a portion of an intron sequence of a viral mRNA that contains one or more polypyrimidine (Py) tracts, wherein the nucleic acid molecule is capable of hybridizing to a region of the intron sequence that contains one or more of the polypyrimidine (Py) tracts.

[0020] [2] The nucleic acid molecule described in [1], wherein the viral mRNA is derived from the HCMV MIE gene.

[0021] [3] The nucleic acid molecule according to [2], wherein the intron sequence is the fourth intron of the HCMV MIE gene.

[0022] [4] The nucleic acid molecule described in [3], which, when introduced into an HCMV-infected cell, can inhibit splicing and expression of HCMV IE2.

[0023] [5] The nucleic acid molecule according to [1], wherein the sequence complementary to all or part of the intron sequence is 10 to 100 nucleotides in length.

[0024] [6] The nucleic acid molecule according to [5], wherein the sequence complementary to all or part of the intron sequence is 10 to 50 nucleotides in length.

[0025] [7] The nucleic acid molecule described in [1], wherein the sequence complementary to all or part of the intron sequence has the sequence 5'-cacgccugugaaaccguacuaagucucccgugucuucuuaucaccaucag-3'.

[0026] [8] The nucleic acid molecule described in [1], wherein the sequence complementary to all or part of the intron sequence has a sequence having 90% or more sequence identity with the sequence 5'-cacgccugugaaaccguacuaagucucccgugucuucuuaucaccaucag‐3'.

[0027] [9] A composition comprising the nucleic acid molecule according to any one of [1] to [8], The composition further comprises a delivery vehicle.

[0028]

[10] The composition described in [9], wherein the delivery vehicle comprises a polymer.

[0029]

[11] The composition of

[10] , wherein the polymer comprises a cationic polymer.

[0030]

[12] The composition described in

[10] or

[11] , wherein the delivery vehicle is a delivery particle.

[0031]

[13] The composition described in

[12] , wherein the delivery particle has a core structure comprising the nucleic acid molecule and at least one polymer, and the delivery particle further comprises at least one wrapping layer surrounding the core structure.

[0032]

[14] The composition described in

[13] , wherein the core structure comprises the nucleic acid molecule, polyethyleneimine (PEI), and polyspermine imidazole 4,5-imine (PSI).

[0033]

[15] The composition of

[13] or 14, wherein the at least one wrapping layer comprises a hydrophilic polymer.

[0034]

[16] The composition described in

[15] , wherein the hydrophilic polymer is polyethylene glycol.

[0035]

[17] The composition described in

[12] , wherein the delivery particle comprises a targeting moiety.

[0036]

[18] The composition described in

[17] , wherein the targeting moiety targets the delivery particle to HCMV-infected cells.

[0037]

[19] The composition described in

[18] , wherein the targeting moiety is CX3CL1 or a mutant or derivative thereof.

[0038]

[20] The nucleic acid according to any one of [1] to [8], wherein the nucleic acid molecule contains at least one of a modified base, a base analog, and an abasic site.

[0039]

[21] The nucleic acid according to any one of [1] to [8], wherein the nucleic acid molecule includes DNA, RNA, or both DNA and RNA.

[0040]

[22] The nucleic acid according to

[21] , wherein the nucleic acid molecule is a short complementary RNA (scRNA).

[0041]

[23] The nucleic acid molecule according to any one of [1] to [8] and

[20] to

[22] , wherein the nucleic acid molecule is bound to a heterologous molecule.

[0042]

[24] A method for treating a herpes virus infection, preferably an HCMV infection, comprising administering to a subject in need thereof a nucleic acid molecule according to any one of [1] to [8] and

[20] to

[22] .

[0043]

[25] A method for treating a herpes virus infection, preferably an HCMV infection, comprising administering a composition according to any one of [9] to

[19] to a subject in need thereof.

[0044]

[26] A method for inhibiting transcriptional switching, comprising contacting a nucleic acid according to any one of [1] to [8] and

[20] to

[22] with viral mRNA.

[0045] (Incorporated by reference) All patents, publications, and patent applications cited in this specification are hereby incorporated by reference for all purposes to the same extent as if each individual patent, publication, or patent application was specifically and individually indicated to be incorporated by reference in its entirety herein.

[0046] The features of the invention are set forth with particularity in the appended claims. The features and advantages of the present invention will be better understood by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings, in which: The drawings are not to scale and the location of indicia is approximate. [Brief description of the drawings]

[0047] [Figure 1]Figures 1A-1D show the results of experiments that confirmed the identification of a polypyrimidine tract (Py) for splicing of exon 5. Figure 1A shows the MIE RNA sequence between exon 4 and exon 5. The highlighted aauaaa sequence is the polyA signal of IE1, and two predicted Py sequences are underlined (A-ucuccc and B-ucuucuu). Figure 1B shows the results of a Western blot assay to determine IE1 / IE2 production. HEK293T cells were transfected with pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB for 24 h, and total cell lysates were collected and subjected to SDS-PAGE to examine IE1 / IE2 production using an anti-IEl / 2 antibody (MAB810). The associated bands indicate IEl, SUMO-IE1, IE2, or SUMO-IE2, as indicated. Figure 1C shows the results of a real-time RT-PCR assay to determine IE1 / IE2 expression. HEK293T cells were transfected with pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB for 20 h, and total RNA was isolated. 1 μg of total RNA was used for real-time PCR to examine IE1 / IE2 expression. The data in the graph represent the mean ± standard deviation from three independent experiments. Figure 1D shows the results of an immunofluorescence assay (IFA) to determine the expression and localization of IE1 and IE2. pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB were transfected into MRC-5 cells for 20 h, and then the cells were fixed and permeabilized to stain for IE1 (shown in green), IE2 (shown in red), and DAPI (shown in blue). [Diagram 2]Figures 2A-2B show the results of experiments confirming the interaction of polypyrimidine tracts (Py) with splicing factors. Figure 2A shows the results of an electrophoretic mobility shift assay (EMSA) used to analyze U2AF65 binding to RNA oligonucleotide probes containing PyA and PyB (wt), mutated PyA (dPyA), mutated PyB (dPyB), or both mutants (dPyAB). The positions of free and bound probes are shown on the left side of the image. Figure 2B shows the results of an RNA chromatin immunoprecipitation (RNA ChIP) assay using HEK293T cells transfected with pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB, 24 hours after transfection, with antibodies specific for U2AF65, PTB, or control IgG. Quantitative reverse transcription PCR (qRT-PCR) was used to quantitate ChIP efficiency using primers specific for the indicated regions. Bar graphs represent the mean percent input ± standard deviation for each ChIP from three independent PCRs. [Diagram 3]Figures 3A-3B show experimental results of IE1 / IE2 splicing assay. Figure 3A shows the predicted size of IE2 mRNA or pre-mRNA and the primers (pShort and pIE2) used for RT-PCR. Figure 3B shows the results of IE1 / IE2 splicing assay. For this IE1 / IE2 splicing assay, HEK293T cells were transfected with pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB for 20 hours and total RNA was isolated. RT-PCR was performed using 1 μg of total RNA using SuperScript® III One-Step RT-PCR System (Invitrogen Catalog No. #12574018) with Platinum® Taq DNA polymerase according to the manufacturer's protocol. Controls included: (1) Total RNA was used directly as a template for PCR to exclude possible plasmid DNA contamination. (2) To demonstrate the size of the DNA in the DNA vector, plasmid DNA was used as a PCR template. [Figure 4]Figures 4A-4D show the results of experiments confirming the importance of Py in viral replication. Figure 4A shows the results of immunofluorescence assays (IFA) to examine the production of IE1 and IE2. As indicated, MRC-5 cells were fixed 20 hours after transfection with the BACmid, and IFA assays were performed to examine the production of IE1 (FITC) and IE2 (Texas red). Figure 4B shows the viral growth curves of wild-type, HCMVdPyA, and revertant viruses. Viral growth was determined using plaque assays in MRC-5 cells after infection at a multiplicity of infection (MOI) of 0.1. Each experiment was performed in triplicate. Viral growth was calculated by analyzing plaque formation. The number of infectious viral particles shown in the growth curves is the average of three experiments. Data with error bars show the mean ± standard deviation. Figure 4C shows the results of a Western blot assay to examine viral protein production by HCMVdPyA or its revertants after infection of MRC-5 cells at an MOI of 0.5. Figure 4D shows the results of immunostaining to detect IE1 and IE2. Human fibroblasts (MRC-5) were infected with HCMVdPyA or its revertants at MOI 0.5 for different times, fixed at 12 and 24 h, and subsequently immunostained with antibodies against IE1 (FITC) and IE2 (Texas red). IE1- and IE2-positive cells were counted under a fluorescent microscope. Data with error bars show the mean ± standard deviation. The results confirmed that PyA is important for IE2 production in the virus infection system. [Diagram 5]Figures 5A-5C show the results of experiments confirming the importance of PyA in IE2 splicing, expression, and intron 4 interaction with splicing factors. Figure 5A shows the results of an IE2 splicing assay performed with MRC-5 cells infected with HCMVdPyA or its revertants at an MOI of 0.1 for 16 hours. Figure 5B shows the results of an RNA ChIP assay to determine the interaction of intron 4 with gene splicing factors (PTB and U2AF65) in MRC-5 cells infected with HCMVdPyA or its revertants at an MOI of 1 for 16 hours. Figure 5C shows the results of a real-time RT-PCR assay to determine IE1 / IE2 mRNA levels at different times after infection of MRC-5 cells with HCMVdPyA or its revertants at an MOI of 0.5. [Figure 6]Figures 6A-6F show the results of experiments to determine the effect of short complementary RNA (scRNA) on the expression of the IE2 gene. Figure 6A shows the sequence of the ssRNA probe and the complementary scRNAPy. Figure 6B shows the results of incubation of the ssRNA probe with scRNAPy, which formed double-stranded RNA (indicated by its larger size than ssRNA and scRNAPy). Figure 6C shows the results of an EMSA assay used to determine U2AF65 binding to the RNA oligonucleotide probe in the absence or presence of scRNAPy. Figure 6D shows a model of scRNAPy interference with the splicing of the IE2 gene. scRNAPy forms dsRNA with an intron containing Py, blocking the interaction of U2AF65 with Py. Figure 6E shows the results of a Western blot assay used to determine IE2 production. Co-transfection of scRNA complementary to Py (scRNAPy, RNA sequence shown in Figure 6A), or scRNA complementary upstream of Py (scRNAupPy: gag uag gau uac aga gua uaa cau aga gua uaa uau aga gua uac aau ag), or scrambled RNA (generated from luciferase gene) and pSVH into HEK293T cells for 24 h, and total cell lysates were used to examine IE2 production with anti-IE2 antibody. Tubulin was used as a loading vector. Figure 6F shows the results of real-time RT-PCR to examine IE2 mRNA levels. scRNAPy, or cRNAupPy, or scrambled RNA and pSVH were co-transfected into HEK293T cells, and total RNA was isolated. 1 μg of total RNA was used for real-time RT-PCR to examine IE2 mRNA levels. Bar graphs represent the mean ± standard deviation of three independent experiments. [Figure 7]Figures 7A-7D show the results of Western blot assays used to determine the silencing efficiency of siRNA and scRNA on IE1 / 2 protein from plasmids transfected with Lipofectamine 2000 in 293T cells. Figure 7A shows the results of an experiment in which siRNA IE2 and siRNA IE1 / 2 were transfected with PSVH plasmid. Figure 7B shows the results of an experiment in which scRNA IE2 and plasmids were co-transfected into 293T cells. Figure 7C shows the results of an experiment in which siRNA and scRNA were used in combination to silence IE1 / 2 protein. Figure 7A shows the results of an experiment in which the silencing effect of siRNA and scRNA combinations was measured using plasmids formulated in polyplexes and polyplexes. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0048] The HCMV major immediate early (MIE) gene, which is essential for viral replication, encodes the IE1 and IE2 gene products. The IE1 and IE2 genes share the MIE promoter (MIEP), the first three exons, and the first two introns. As described above, the inventors identified two polypyrimidine (Py) tracts in intron 4 (between exon 4 and exon 5) that are responsible for transcriptional switching from IE1 to IE2. The inventors found that the first Py is important and the second Py is essential for IE2 splicing and expression.

[0049] In light of these findings, the inventors have conceived of short complementary nucleic acids (such as scRNAs) that are complementary to intronic RNAs containing one or more Pys and bind to intronic sequences, thereby inhibiting gene splicing. The nucleic acids are preferably single-stranded or contain at least a single-stranded region to effect complementary binding. Thus, this mechanism can be applied to inhibit various DNA viruses, such as herpes viruses and adenoviruses.

[0050] In certain embodiments, the present disclosure provides short complementary nucleic acids (such as scRNAs) that are complementary to all or a portion of an intronic RNA covering two Pys in intron 4 of the HCMV MIE gene.

[0051] The present disclosure also provides compositions and methods that combine or use short complementary nucleic acids (such as scRNA) in combination with short interfering RNA (siRNA), which may provide synergistic antiviral compositions and methods.

[0052] The present disclosure further provides a delivery system for efficiently delivering the short complementary nucleic acids (such as scRNA) and compositions of the present disclosure.

[0053] It should be understood that the terms used herein are only for describing specific embodiments and are not intended to be limiting. As used herein and in the appended claims, the singular forms "a", "an" and "the" include the plural unless the context clearly dictates otherwise. Thus, for example, a reference to a "polynucleotide" includes one or more polynucleotides, and a reference to a "vector" includes one or more vectors.

[0054] Also, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although other methods and materials similar or equivalent to those described herein may be useful in the present invention, the preferred materials and methods are described herein.

[0055] In light of the teachings herein, one of skill in the art can apply conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant polynucleotides, as taught, for example, by the following standard textbooks: Abbas et al. (Cellular and Molecular Immunology, 2017, 9th Edition, Elsevier, ISBN978-0323479783), Butterfield et al. (Cancer Immunotherapy Principles and Practice, 2017, 1st Edition, Demos Medical, ISBN978-1620700976), Kenneth Murphy (Janeway's Immunobiology, 2016, 9th Edition, Garland Science, ISBN978-0815345053), Stevens et al. (Clinical Immunology and Serology: A Laboratory Perspective, 2016, 4th Edition, Davis Company, ISBN978-0803644663), EA Greenfield (Antibodies: A Laboratory Manual, 2014, Second edition, Cold Spring Harbor Laboratory Press, ISBN978-1-936113-81-1), RIFreshney (Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 2016, 7th Edition, Wiley-Blackwell, ISBN978-1118873656), CAPinkert (Transgenic Animal Technology, Third Edition: A Laboratory Handbook, 2014, Elsevier, ISBN978-0124104907), H.See Hedrich (The Laboratory Mouse, 2012, Second Edition, Academic Press, ISBN978-0123820082), Behringer et al. (Manipulating the Mouse Embryo: A Laboratory Manual, 2013, Fourth Edition, Cold Spring Harbor Laboratory Press, ISBN978-1936113019), McPherson et al. (PCR 2: A Practical Approach, 1995, IRL Press, ISBN978-0199634248), J.M. Walker (Methods in Molecular Biology (Series), Humana Press, ISSN1064-3745), Rio et al. (RNA: A Laboratory Manual, 2010, Cold Spring Harbor Laboratory Press, ISBN978-0879698911), Methods in Enzymology (Series), Academic Press, Green et al. (Molecular Cloning: A Laboratory Manual, 2012, Fourth Edition, Cold Spring Harbor Laboratory Press, ISBN978-1605500560), and G.T. Hermanson (Bioconjugate Techniques, 2013, Third Edition, Academic Press, ISBN978-0123822390).

[0056] "Linker region sequence", "linker sequence", and "linker polynucleotide" are used interchangeably herein to refer to a sequence of one or more nucleotides covalently linked to a first nucleic acid sequence (e.g., 5'-linker nucleotide sequence-first nucleic acid sequence-3'). In some embodiments, the linker nucleotide sequence joins two separate nucleic acid sequences to form a single polynucleotide (e.g., 5'-first nucleic acid sequence-linker nucleotide sequence-second nucleic acid sequence-3'). Other examples of linker sequences include, but are not limited to, 5'-first nucleic acid sequence-linker nucleotide sequence-3' and 5'-linker nucleotide sequence-first nucleic acid sequence-linker nucleotide sequence-3'. In some embodiments, the linker nucleotide sequence can be a single-stranded nucleotide sequence of unpaired nucleobases that do not interact with each other through hydrogen bond formation to form a secondary structure. In some embodiments, the linker element nucleotide sequence has a length of about 100 or less, about 90 or less, about 80 or less, about 70 or less, about 60 or less, about 50 or less, about 40 or less, about 30 or less, about 20 or less, about 15 or less, about 14 or less, about 13 or less, about 12 or less, about 11 or less, about 10 or less, about 9 or less, about 8 or less, about 7 or less, about 6 or less, about 5 or less, about 4 or less, about 3 or less, or about 2 or less bases.

[0057] The terms "wild type," "naturally occurring," and "non-altered" are used herein to mean the typical (or most common) form, appearance, phenotype, or lineage that exists in nature. For example, the typical form of a cell, organism, polynucleotide, protein, macromolecular complex, gene, RNA, DNA, or genome is the form in which it exists in a natural source and from which it can be isolated. The wild type form, appearance, phenotype, or lineage serves as the original parent prior to any deliberate alteration. Thus, mutant, variant, engineered, recombinant, or modified forms are not wild type.

[0058] When referring to a polypeptide, "isolated" means that the indicated molecule is separate and distinct from the whole organism in which it is found in nature or is present in the substantial absence of other biological macromolecules of the same type. With reference to polynucleotides, the term "isolated" refers to a nucleic acid molecule that is lacking all or part of sequences normally associated with it in nature, or a sequence that is found in nature but has heterologous sequences associated with it, or a molecule that is separated from the chromosome.

[0059] As used herein, the term "purified" means that the molecules are preferably at least 75%, more preferably at least 85%, even more preferably at least 95%, and most preferably at least 98%, by weight, identical.

[0060] The terms "engineered," "genetically engineered," "genetically modified," "recombinant," "modified," "non-naturally occurring," and "non-naturally occurring" refer to the deliberate, artificial manipulation of the genome of an organism or cell. These terms encompass genome editing, as defined herein, as well as methods of genome modification, including techniques for altering gene expression or inactivation, enzyme engineering, directed evolution, knowledge-based design, random mutagenesis, gene shuffling, codon optimization, and the like. Methods of genetic engineering are known in the art.

[0061] "Covalent bond," "covalently attached," "covalently bound," "covalently linked," "covalently connected," and "molecular bond" are used interchangeably herein and refer to a chemical bond that involves the sharing of electron pairs between atoms. Examples of covalent bonds include, but are not limited to, phosphodiester bonds and phosphorothioate bonds.

[0062] "Non-covalent bond", "non-covalently attached", "non-covalently bound", "non-covalently linked", "non-covalent interaction", and "non-covalently connected" are used interchangeably herein and refer to any relatively weak chemical bond that does not involve the sharing of a pair of electrons. Non-covalent bonds stabilize the structure of macromolecules and mediate specific interactions between molecules. Examples of non-covalent bonds include hydrogen bonds, ionic interactions (e.g., Na + Cl ― ), van der Waals interactions, hydrophobic bonds, etc., but are not limited to these.

[0063] As used herein, "hydrogen bond," "hydrogen base pairing," and "hydrogen bonded" are used interchangeably and refer to standard and non-standard hydrogen bonds, including but not limited to "Watson-Crick hydrogen bond base pairs" (WC-hydrogen bond base pairs or WC hydrogen bonds), "Hoogsteen hydrogen bond base pairs" (Hoogsteen hydrogen bonds), and "wobble hydrogen bond base pairs" (wobble hydrogen bonds). WC hydrogen bonds, including reversed WC hydrogen bonds, refer to purine-pyrimidine base pairs, i.e., adenine and thymine, guanine and cytosine, and uracil and adenine. Hoogsteen hydrogen bonds, including reversed Hoogsteen hydrogen bonds, are a type of base in nucleic acids in which two nucleobases (one on each strand) are held together by hydrogen bonds in the major groove. This non-WC hydrogen bond allows the third strand to wrap around the second strand to form a triple helix. Wobble hydrogen bonds, including reverse wobble hydrogen bonds, are pairs between two nucleotides in an RNA molecule that do not follow the Watson-Crick base pairing rules. There are four major wobble base pairs: guanine and uracil, inosine (hypoxanthine) and uracil, inosine and adenine, and inosine and cytosine. Wobble base interactions are also known to occur between inosine and thymine, and inosine and guanine. Inosine and deoxyinosine bases can hydrogen bond with standard DNA and RNA bases and can therefore be called "universal pairing bases" (see, for example, Figure 7). See also Watkins et al. [Nucleic Acid Research, 2005, 33(19):6258-67]. Standard and non-standard hydrogen bonds are known to those skilled in the art.For example, RFGesteland (The RNA World, Third Edition (Cold Spring Harbor Monograph Series), 2005, Cold Spring Harbor Laboratory Press, ISBN978-0879697396), RFGesteland (The RNA World, Second Edition (Cold Spring Harbor Monograph Series), 1999, Cold Spring Harbor Laboratory Press, ISBN978-0879695613), and RFGesteland (The RNA World, First Edition (Cold Spring Harbor Monograph Series), 1993, Cold Spring Harbor Laboratory Press, 978-0879694562). See also Appendix 1: Structures of Base Pairs Involving at Least Two Hydrogen Bonds, I. Tinoco), W. Saenger (Principles of Nucleic Acid Structure, 1988, Springer International Publishing AG, ISBN978-0-387-90761-1), and S. Neidle (Principles of Nucleic Acid Structure, 2007, First Edition, Academic Press, ISBN978-01236950791).

[0064] "Connect," "connected," and "connecting" are used interchangeably herein and refer to a covalent or non-covalent bond between two macromolecules (e.g., polynucleotides, proteins, etc.).

[0065] As used herein, the terms "nucleic acid sequence," "nucleotide sequence," and "oligonucleotide" are interchangeable and refer to a polymer of nucleotides. As used herein, the term "polynucleotide" refers to a polymer of nucleotides that has one 5' end and one 3' end and can consist of one or more nucleic acid sequences. The nucleotides can be deoxyribonucleotides (DNA), ribonucleotides (RNA), analogs thereof, or combinations thereof, and can be of any length. Polynucleotides can perform any function and have a variety of secondary and tertiary structures. These terms encompass known analogs of natural nucleotides, as well as nucleotides modified at the base, sugar, and / or phosphate moieties. Analogs of a particular nucleotide have the same base pairing specificity (e.g., an analog of A base pairs with T). A polynucleotide can comprise one modified nucleotide or multiple modified nucleotides. Examples of modified nucleotides include fluorinated nucleotides, methylated nucleotides, and nucleotide analogs. The nucleotide structure can be modified either before or after incorporation into the polymer. Following polymerization, the polynucleotide may be further modified, for example, by conjugation with a labeling component or a target binding component. The nucleotide sequence may incorporate non-nucleotide components. The terms also encompass synthetic, natural and / or non-naturally occurring nucleic acids that contain modified backbone residues or linkages that have similar binding properties as the reference polynucleotide (e.g., DNA or RNA). Examples of such analogs include, but are not limited to, phosphorothioates, phosphoramidates, methyl phosphonates, chiral methyl phosphonates, 2-O-methyl ribonucleotides, peptide nucleic acids (PNAs), locked nucleic acids (LNA™) (Exiqon, Woburn, MA) nucleosides, glycol nucleic acids, bridged nucleic acids, and morpholino structures.

[0066] As used herein, the terms "abasic," "abasic site," "abasic nucleotide," and "apurinic / apyrimidinic site" are used interchangeably and refer to a site in a nucleotide sequence that lacks a purine or pyrimidine base. In certain embodiments, the abasic site comprises a ribose moiety. In other embodiments, the abasic site comprises a ribose moiety. In further embodiments, the abasic site comprises a modified backbone, such as a pentose ring with a 1' hydroxyl group. Because the abasic site does not contain a nitrogenous base, it cannot form a hydrogen base pair bond with a complementary nitrogenous base of a DNA or RNA nucleotide.

[0067] The term "base analog" as used herein refers to a compound that has a structural similarity to a standard purine or pyrimidine base in DNA or RNA. The base analog may contain a modified sugar and / or a modified nucleobase compared to the naturally occurring purine or pyrimidine base in DNA or RNA. In some embodiments, the base analog is inosine or deoxyinosine, such as 2'-deoxyinosine. In other embodiments, the base analog is a 2'-deoxyribonucleoside, 2'-ribonucleoside, 2'-deoxyribonucleotide, or 2'-ribonucleotide, where the nucleobase comprises a modified base (e.g., xanthine, uridine, oxanine (oxanosine), 7-methylguanosine, dihydrouridine, 5-methylcytidine, C3 spacer, 5-methyl dC, 5-hydroxybutyl-2'-deoxyuridine, 5-nitroindole, 5-methyliso-deoxycytosine, isodeoxyguanosine, deoxyuridine, isodeoxycytidine, other O-1 purine analogs, N-6-hydroxylaminopurine, nebularine, 7-deazahypoxanthine, other 7-deazapurines, and 2-methylpurines, etc.). In some embodiments, the base analogue may be selected from the group consisting of 7-deaza-2'-deoxyinosine, 2'-aza-2'-deoxyinosine, PNA-inosine, morpholino-inosine, LNA-inosine, phosphoramidate inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. The term "base analogue" also includes, for example, 2'-deoxyribonucleosides, 2'-ribonucleosides, 2'-deoxyribonucleotides, or 2'-ribonucleotides, where the nucleobase is a substituted hypoxanthine. For example, the substituted hypoxanthine may be substituted with a halogen, such as fluorine or chlorine. In some embodiments, the base analog may be fluoroinosine or chloroinosine, such as 2-chloroinosine, 6-chloroinosine, 8-chloroinosine, 2-fluoroinosine, 6-fluoroinosine, or 8-fluoroinosine, hi other embodiments, the base analog is deoxyuridine.In other embodiments, the base analogs are nucleic acid mimics (such as artificial nucleic acids and xenonucleic acids (XNAs)).

[0068] Peptide nucleic acid (PNA) is a synthetic homologue of nucleic acid in which the phosphate-sugar backbone of polynucleotides is replaced by a flexible pseudopeptide polymer. The nucleobases are linked to the polymer. PNA has the ability to hybridize with high affinity and specificity to complementary sequences of RNA and DNA.

[0069] In phosphorothioate nucleic acids, phosphorothioate (PS) bonds replace non-bridging oxygens with sulfur atoms in the polynucleotide phosphate backbone. This modification renders the internucleotide linkages resistant to nuclease degradation. In some embodiments, phosphorothioate bonds are introduced between the last 3-5 nucleotides at the 5'-end or 3'-end sequence of the polynucleotide sequence to inhibit exonuclease degradation. Placing phosphorothioate bonds throughout the oligonucleotide also helps to reduce endonuclease degradation.

[0070] Threonine nucleic acid (TNA) is an artificial genetic polymer. The backbone structure of TNA consists of repeating threose sugars linked by phosphodiester bonds. TNA polymers are resistant to nuclease degradation. TNA can self-assemble into double-stranded structures by base pair hydrogen bonding.

[0071] Bond inversion can be introduced into a polynucleotide by the use of "reverse phosphoramidites" (see, for example, www.ucalgary.ca / dnalab / synthesis / -modifications / linkages). A 3'-3' bond at the end of a polynucleotide stabilizes the polynucleotide against exonuclease degradation by creating an oligonucleotide that has two 5'-OH ends but lacks a 3'-OH end. Typically, such polynucleotides have a phosphoramidite group at the 5'-OH position and a dimethoxytrityl (DMT) protecting group at the 3'-OH position. Typically, the DMT protecting group is on the 5'-OH and the phosphoramidite is on the 3'-OH.

[0072] Polynucleotide sequences are presented herein in the conventional 5' to 3' orientation unless otherwise indicated.

[0073] "Sequence identity" as used herein generally refers to the percentage of nucleotide base or amino acid identity for comparing a first polynucleotide or a first polypeptide with a second polynucleotide or a second polypeptide using an algorithm with various weighting parameters. Sequence identity between two polynucleotide sequences or between two polypeptide sequences can be determined using sequence alignment by various methods and computer programs available through the Internet from websites (e.g., BLAST, CS-BLAST, FASTA, HMMER, L-ALIGN, etc.). Such websites include, but are not limited to, GENBANK (www.ncbi.nlm.nih.gov / genbank / ) and EMBL-EBI (www.ebi.ac.uk.). Sequence identity between two polynucleotide sequences or between two polypeptide sequences is generally calculated using standard default parameters of various methods or computer programs. High sequence identity between two polynucleotides or two polypeptides is generally between about 90% and about 100%, for example, about 90% or more, preferably about 95% or more, more preferably about 98% or more, over the length of the reference polypeptide. Moderate sequence identity between two polynucleotides or two polypeptides is generally between about 80% and about 85%, for example, about 80% or more, preferably about 85%, over the length of the reference polypeptide. Low sequence identity between two polynucleotides or two polypeptides is generally between about 50% and 75%, for example, about 50%, preferably about 60%, more preferably about 75%, over the length of the reference polypeptide.

[0074] For example, a nucleic acid sequence of the present disclosure may have a particular sequence identity to a reference sequence, which may be, for example, 25% or more, 50% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0075] As used herein, "hybridization", "hybridize" or "hybridizing" refers to the process of combining two complementary single-stranded DNA or RNA molecules to form one double-stranded molecule (DNA / DNA, DNA / RNA, RNA / RNA) by hydrogen pairing. The stringency of hybridization is generally determined by the hybridization temperature and the salt concentration of the hybridization buffer. For example, high temperature and low salt concentration result in high stringency hybridization conditions. Examples of salt concentration and temperature ranges for different hybridization conditions are as follows: High stringency refers to a salt concentration of about 0.01M to about 0.05M, with T m Moderate stringency is a hybridization temperature of about 0.16M to about 0.33M salt concentration, and T m Low stringency refers to a hybridization temperature that is 20° C. to 29° C. lower than T m The hybridization temperature is 40° C. to 48° C. lower than that of the double-stranded nucleic acid sequence. mis calculated by standard methods known in the art. See, e.g., Maniatis et al. (Molecular Cloning: A Laboratory Manual, 1982, Cold Spring Harbor Laboratory Press: New York), Casey et al. (Nucleic Acids Research, 1977, 4:1539-1552); Bodkin et al. (Journal of Virological Methods, 1985, 10(1):45-52), and Wallace et al. (Nucleic Acids Research, 1981, 9(4):879-894). m Algorithm prediction tools that estimate are also widely used.High stringency hybridization conditions generally refer to conditions under which the polynucleotide that is complementary to a target sequence preferentially hybridizes with the target sequence and does not substantially hybridize with non-target sequences.Generally, hybridization conditions are medium stringency, preferably high stringency.

[0076] As used herein, "complementary" refers to the ability of a nucleic acid sequence to form hydrogen bonds with another nucleic acid sequence (e.g., by standard Watson-Crick base pairing). Complementarity indicates the percentage of residues in a nucleic acid sequence that can form hydrogen bonds with a second nucleic acid sequence. If two nucleic acid sequences have 100% complementarity, the two sequences are completely complementary, i.e., every contiguous residue in a first polynucleotide will hydrogen bond with the same number of contiguous residues in a second polynucleotide.

[0077] "Binding" as used herein refers to a non-covalent interaction between macromolecules (e.g., between a protein and a polynucleotide, between a polynucleotide and a polynucleotide, or between a protein and a protein, etc.). Such non-covalent interactions refer to "associating" or "interacting" (e.g., when a first macromolecule interacts with a second macromolecule, the first macromolecule binds non-covalently to the second macromolecule). Some portions of the binding interaction may be sequence specific ("sequence-specific binding", "sequence-specific binding", "site-specific binding", and "site-specific binding" are used interchangeably herein). Binding interactions can be characterized by a dissociation constant (Kd). "Binding affinity" refers to the strength of the binding interaction. High binding affinity correlates with a low Kd.

[0078] As used herein, the terms "regulatory sequence," "regulatory element," and "control element" are used interchangeably and refer to polynucleotide sequences that are upstream (5' non-coding sequences), within, or downstream (3' non-translated sequences) of a polynucleotide target to be expressed. Regulatory sequences affect, for example, the timing of transcription, the amount or level of transcription, RNA processing or stability, and / or translation of associated structural nucleotide sequences. Regulatory sequences may include activator binding sequences, enhancers, introns, polyadenylation recognition sequences, promoters, transcription initiation sites, repressor binding sequences, stem loop structures, translation initiation sequences, internal ribosomal entry sites (IRES), translation leader sequences, transcription termination sequences (e.g., polyadenylation signals and polyU sequences), translation termination sequences, primer binding sites, and the like.

[0079] Regulatory elements include those that direct constitutive, inducible, and repressible expression of a nucleotide sequence in many types of host cells, as well as those that direct expression of a nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). In some embodiments, the vector includes one or more POL III promoters, one or more POL II promoters, one or more POL I promoters, or combinations thereof. Examples of POL III promoters include, but are not limited to, the U6 promoter and the HI promoter. Examples of POL II promoters include, but are not limited to, the retroviral Ras Sarcoma Virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer; see, e.g., Boshart et al. (Cell, 1985, 41:521-530)), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFlα promoter. It will be appreciated by those skilled in the art that the design of the expression vector can depend on factors such as the choice of the host cell to be transformed, the level of expression desired, etc. By introducing the vector into a host cell, a protein or peptide, including a transcript, a fusion protein or a fusion peptide, encoded by a nucleic acid sequence described herein can be produced.

[0080] As used herein, "gene" refers to a polynucleotide sequence consisting of exons and associated regulatory sequences. A gene may further include introns and / or untranslated regions (UTRs).

[0081] The term "operably linked" as used herein refers to polynucleotide sequences or amino acid sequences in a functional relationship to each other. For example, a regulatory sequence (e.g., a promoter or enhancer) is "operably linked" to a polynucleotide encoding a gene product if the regulatory sequence regulates or contributes to the regulation of the transcription of the polynucleotide. An operably linked regulatory element is generally contiguous with the coding sequence. However, an enhancer can function even if it is several kilobases or more away from the promoter. Thus, some regulatory elements may be operably linked to a polynucleotide sequence and not contiguous with the polynucleotide sequence. Similarly, a translational regulatory element contributes to the regulation of protein expression from a polynucleotide.

[0082] As used herein, "expression" refers to the transcription of a polynucleotide from a DNA template, which results in, for example, a messenger RNA (mRNA) or other RNA transcript (e.g., a non-coding RNA such as structural or scaffold RNA). The term further refers to the process by which the transcribed mRNA is translated into a peptide, polypeptide, or protein. The transcript and the encoded polypeptide may be collectively referred to as a "gene product." Expression may also include splicing of the mRNA in eukaryotic cells if the polynucleotide is derived from genomic DNA.

[0083] A "coding sequence" or a sequence "encoding" a selected polypeptide is a nucleic acid molecule that can be transcribed (in the case of DNA) or translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5'-terminus and a translation stop codon at the 3'-terminus. A transcription termination sequence may be located 3' of the coding sequence.

[0084] The term "modulate" as used herein refers to a change in the amount, degree, or magnitude of a function. Thus, "modulation" of gene expression includes both gene activation and gene repression. Modulation can be assayed by determining any property that is directly or indirectly affected by the expression of a target gene. Such properties include, for example, changes in RNA or protein levels, protein activity, product levels, gene expression, or reporter gene activity levels.

[0085] As used herein, "vector" and "plasmid" refer to a polynucleotide delivery vehicle for introducing genetic material into a cell. A vector may be linear or circular. A vector may contain a replication sequence (e.g., an origin of replication) capable of causing replication of the vector in a suitable host cell. Upon transformation of a suitable host, the vector may replicate and function independently of the host genome or may integrate into the host genome. The design of the vector depends, inter alia, on the intended use of the vector and the host cell, and designing the vectors of the present invention for a particular intended use and for a particular host cell is within the level of skill in the art. There are four main types of vectors: plasmids, viral vectors, cosmids, and artificial chromosomes. In general, vectors contain an origin of replication, a multiple cloning site, and / or a selectable marker. An expression vector generally consists of an expression cassette. By "recombinant virus" is meant a virus that has been genetically modified, for example, by the addition or insertion of a heterologous nucleic acid construct into the viral genome or a portion thereof.

[0086] As used herein, an "expression cassette" refers to a polynucleotide construct that is produced using recombinant methods or by synthetic means and contains a regulatory sequence operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell. For example, the regulatory sequence can facilitate transcription of the selected polynucleotide in a host cell, or transcription and translation of the selected polynucleotide in a host cell. The expression cassette can be present in a vector, for example, to integrate into the genome of the host cell or to form an expression vector.

[0087] As used herein, the term "between" includes the end values ​​within a given range (e.g., "between about 1 nucleotide length and about 50 nucleotide length" includes 1 nucleotide length and 50 nucleotide length).

[0088] As used herein, the term "amino acid" refers to natural and synthetic (non-natural) amino acids, including amino acid analogs, modified amino acids, peptidomimetics, glycine, and D or L optical isomers.

[0089] The terms "peptide", "polypeptide" and "protein" as used herein are interchangeable and refer to a polymer of amino acids. A polypeptide may be of any length. A polypeptide may be branched or linear, may be interrupted by non-amino acids, and may contain modified amino acids. The term also refers to an amino acid polymer that has been modified, for example, by acetylation, disulfide bond formation, glycosylation, lipidation, phosphorylation, PGylation, biotinylation, cross-linking, and / or conjugation (e.g., with a labeling moiety or ligand). The sequence of a polypeptide is presented herein in the conventional N-terminal to C-terminal orientation unless otherwise indicated. Polypeptides and polynucleotides can be produced using routine techniques in the field of molecular biology. Furthermore, essentially any polypeptide or polynucleotide is available from a commercial source.

[0090] As used herein, the terms "fusion protein" and "chimeric protein" refer to a single protein created by combining two or more proteins, protein domains, or protein fragments that do not occur together in nature in a single protein.

[0091] As used herein, a "moiety" may refer to a portion of a molecule. A moiety may be a functional group or may refer to a portion of a molecule that has multiple functional groups (e.g., sharing a common structural aspect). The terms "moiety" and "functional group" are generally used interchangeably, but a "functional group" can more specifically refer to a portion of a molecule that has some common chemical behavior. A "moiety" is often used as a structural description. In some embodiments, the 5' end, the 3' end, or the 5' end and the 3' end may contain one or more moieties.

[0092] As used herein, "modified protein," "mutant protein," "protein variant," and "engineered protein" generally refer to a protein that has been modified to comprise a non-native sequence (i.e., the modified protein has a unique sequence as compared to the unmodified protein).

[0093] "Subject", "individual" or "patient" are used interchangeably herein and refer to any member of the phylum Chordata, including humans and non-human primates such as rhesus monkeys, chimpanzees and other monkey and ape species, livestock animals such as cows, sheep, pigs, goats and horses, domestic mammals such as dogs and cats, laboratory animals such as rabbits, mice, rats and guinea pigs, poultry including chickens, turkeys and other galinaceous birds, ducks and geese, and birds such as wild and game birds. Any animal of the phylum Chordata is not limited to the above. The term does not denote a particular age or sex. Thus, the term includes adult, juvenile and newborn individuals, as well as males and females.

[0094] The term "effective amount" or "therapeutically effective amount" of a composition or agent refers to an amount of the composition or agent sufficient to obtain a desired response. Preferably, the effective amount prevents, avoids, or eliminates one or more adverse side effects. The exact amount of treatment required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the condition being treated, the particular therapy used, the mode of administration, and the like. An appropriate "effective" amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.

[0095] "Treatment" or "treating" a particular disease includes (1) preventing the disease, e.g., preventing the onset of the disease, preventing the progression of the disease, or causing the disease to occur at a lower intensity in a subject who may be predisposed to the disease but has not yet experienced or exhibited symptoms of the disease; (2) inhibiting the disease, e.g., slowing the rate of onset, arresting the progression of the disease, or reversing the disease state; and / or (3) alleviating symptoms of the disease, e.g., reducing the number of symptoms experienced by a subject.

[0096] As used herein, "transformation" refers to the insertion of an exogenous polynucleotide into a host cell, regardless of the method of insertion. For example, transformation can be by direct uptake, transfection, infection, etc. Nucleic acids and polynucleotides can be introduced into cells using, for example, viral vectors, nucleofection, gene guns, sonoporation, cell squeezing, lipofection, or chemicals (e.g., cell-penetrating peptides).

[0097] As used herein, "herpes virus" refers to members of the Herpesviridae family and thus includes, but is not limited to, viruses such as herpes simplex virus 1 (HSV-1), herpes simplex virus 2 (HSV-2), varicella zoster virus (VZV), Epstein-Barr virus (EBV), human cytomegalovirus (HCMV), human herpes virus 6, human herpes virus 7, and Kaposi's sarcoma-associated herpes virus (KSHV). Short complementary nucleic acids

[0098] As described herein, short complementary nucleic acids (e.g., scRNAs) of the present disclosure can be designed and synthesized to inhibit DNA virus replication, such as herpesvirus and / or adenovirus replication. In some embodiments, the short complementary nucleic acid (e.g., scRNAs) can be complementary to an intronic RNA in an immediate early gene of a herpesvirus that includes one or more Pys. In certain embodiments, the short complementary nucleic acid (e.g., scRNAs) can be complementary to an intronic RNA in an immediate early gene of HCMV that includes one or more Pys.

[0099] In certain embodiments, the short complementary nucleic acid (e.g., scRNA) may be complementary to all or part of intron 4 (between exon 4 and exon 5) of the HCMV MIE gene, which contains two Py tracts responsible for transcriptional switching from IE1 to IE2.

[0100] In some embodiments, the scRNA complementary to the intron RNA can cover one or both Pys.

[0101] In embodiments, the short complementary nucleic acid (such as scRNA) of the present disclosure may interfere with the interaction of a splicing factor with an intron, preferably thereby suppressing expression of an essential gene. In some such embodiments, the splicing factor is U2AF65 and / or U2AF35. In some such embodiments, the intron is intron 4 of the MIE gene of HCMV.

[0102] In some embodiments, a short complementary nucleic acid (such as a scRNA) of the disclosure consists of the sequence 5'-cacgccugugaaaccguacuaagucucccgugucuucuuaucaccaucag-3', a fragment or portion thereof, or a derivative modification thereof.

[0103] In some embodiments, the short complementary nucleic acid is DNA, RNA, or a mixture of DNA and RNA, and may or may not include, for example, one or more abasic sites, base analogs, and / or modified bases. In some embodiments, the short complementary nucleic acid sequence includes RNA. In some embodiments, the short complementary nucleic acid sequence includes only RNA. Furthermore, the siRNA provided herein may include DNA bases in some embodiments.

[0104] In certain aspects and embodiments, the nucleic acid molecules herein (including, but not limited to, short complementary nucleic acids and siRNAs) may contain one or more modifications (or chemical modifications). Such modifications may be present in the nucleotide sugar, nucleotide base, nucleotide phosphate group, and / or phosphate backbone of the polynucleotide.

[0105] In certain embodiments, the modifications disclosed herein may be used to increase the stability of the nucleic acid molecules (short complementary nucleic acids, scRNAs, and / or siRNAs) in vivo, particularly in serum, and / or to increase the bioavailability of the molecules. Non-limiting examples of modifications include, but are not limited to, internucleotide or internucleoside linkages, deoxynucleotides or dideoxyribonucleotides at any position and strand of the nucleic acid molecule, nucleic acids (e.g., ribonucleic acids) with modifications at the 2'-position, preferably selected from amino, fluoro, methoxy, alkoxy, and alkyl, 2'-deoxyribonucleotides, 2'-O-methylribonucleotides, 2'-deoxy-2'-fluororibonucleotides, "universal base" nucleotides, "acyclic" nucleotides, 5-C-methyl nucleotides, biotin groups, and incorporation of terminal glyceryl and / or inverted deoxy basic residues, steric hindrance molecules such as fluorescent molecules. Other modified nucleotides may include, for example, 3'-deoxyadenosine, 3'-azido-3'deoxythymidine, 2',3'-dideoxyinosine, 2',3'-dideoxy-3'-thiacytidine, 2',3'-didehydro-2',3'-dideoxythymidine, and monophosphate nucleotides of 3'-azido-3'-deoxythymidine, 2',3'-dideoxy-3'-thiacytidine and 2',3'-dideohydro-2',3'-dideoxythymidine.

[0106] Also provided herein are locked nucleic acid (LNA) nucleotides (e.g., 2'-O,4'-C-methylene-(D-ribofuranosyl) nucleotides), 2'-methoxyethoxy (MOE) nucleotides, 2'-methylthioethyl, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy-2'-chloro nucleotides, 2'-azido nucleotides, and 2'-O-methyl nucleotides. Chemical modifications include unlocked nucleic acids, or UNAs, which are non-nucleotides, acyclic analogs, in which the C2'-C3' bond is absent.

[0107] Chemical modifications also include terminal modifications of the 5' and / or 3' portions of the nucleic acid, also known as capping moieties. Such terminal modifications are selected from nucleotides, modified nucleotides, lipids, peptides, and sugars. Chemical modifications also include "six-membered ring nucleotide analogs". Examples of six-membered ring nucleotide analogs include hexitol monomers and altritol nucleotide monomers.

[0108] Chemical modifications also include "mirror" nucleotides that have the opposite chirality compared to normal naturally occurring nucleotides. Mirror nucleotides may further include at least one sugar or base modification and / or backbone modification. Mirror nucleotides include, for example, L-DNA (L-deoxyriboadenosine-3'-phosphate (mirror dA), L-deoxyribocytidine-3'-phosphate (mirror dC), L-deoxyriboguanosine-3'-phosphate (mirror dG), L-deoxyribothymidine-3'-phosphate (mirror dT)) and L-RNA (L-riboadenosine-3'-phosphate (mirror rA), L-ribocytidine-3'-phosphate (mirror-rC), L-riboguanosine-3'-phosphate (mirror rG), and L-ribouracil-3'-phosphate (mirror dU)).

[0109] In some embodiments, modified ribonucleotides include modified deoxyribonucleotides, such as 5'OMe DNA (5-methyldeoxyriboguanosine-3'-phosphate), PACE (deoxyriboadenosine 3' phosphonoacetate, deoxyribocytidine 3' phosphonoacetate, deoxyriboguanosine 3' phosphonoacetate, deoxyribothymidine 3' phosphonoacetate).

[0110] The nucleobases of the nucleic acids (short complementary nucleic acids, scRNAs and / or siRNAs) disclosed herein may comprise unmodified deoxyribonucleotides and unmodified ribonucleotides (purines and pyrimidines), such as adenine, guanine, cytosine, thymidine, uracil. The nucleobases can be modified with natural and synthetic nucleobases, such as thymine, xanthine, hypoxanthine, inosine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, any of the "universal base" nucleotides below. "Universal bases" include 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine, and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, amino, thiol, thioalkyl, hydroxyl, and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine, deazapyridine, 5-isopropyl uracil, and 5-isopropyl uracil. Heterocyclic substituted analogs of phosphorus, purines and pyrimidines, such as aminomethoxyphenoxazines, derivatives of purines and pyrimidines (e.g., 1-alkyl, 1-alkenyl, heteroaromatic and 1-alkynyl derivatives) and their tautomers, 8-oxo-N6-methyladenine, 7-diazaxanthine, 5-methylcytosine, 5-methyluracil, 5-(1-propynyl)uracil, 5-(1-propynyl)cytosine, 4,4-ethanocytosine, etc. Other examples of suitable bases include non-purinyl and non-pyrimidinyl bases, such as 2-aminopyridine and triazines.

[0111] The sugar moiety in the nucleic acids (short chain complementary nucleic acids, scRNAs and / or siRNAs) disclosed herein may not have any modification or may include a 2'-hydroxyl-pentofuranosyl sugar moiety. Alternatively, the sugar moiety may be modified, such as a 2'-deoxy-pentofuranosyl sugar moiety, D-ribose, hexose, etc., at the 2' position of the pentofuranosyl sugar moiety, such as a 2'-O-alkyl (including 2'-O-methyl and 2'-O-ethyl), i.e., 2'-alkoxy, 2'-amino, 2'-O-aryl, 2'-S-alkyl, 2'-halogen (including 2'-fluoro, chloro and bromo), 2'-methoxyethoxy, 2'-O-methoxyethyl, 2'-O-2-methoxyethyl, 2'-propargyl, 2'-propyl, ethynyl, ethenyl, propenyl, CF, cyano, imidazole, carboxylate, thioate, etc.

[0112] In some embodiments, the pentafuranosyl ring may be replaced with an acyclic derivative that lacks the C2'-C3'-linkage of the pentafuranosyl ring. For example, acyclonucleotides may be substituted with a 2-hydroxyethoxymethyl group in place of the 2'-deoxyribofuranosyl sugar normally present in dNMPs.

[0113] The nucleoside subunits of the nucleic acids (short complementary nucleic acids, scRNAs and / or siRNAs) disclosed herein may be linked together by phosphodiester bonds. The phosphodiester bonds may be optionally replaced with other bonds. For example, phosphorothioates, thiophosphate D-ribose forms, triesters, thioates, 2'-5' backbones, PACE, 3'-(or 5')deoxy-3'-(or 5')thiophosphorothioates, phosphorodithioates, phosphoroselenates, 3'-(or 5')deoxyphosphinates, boranophosphinates, 3'-(or 5')deoxy-3'-(or 5')aminophosphoramidates, hydrogen phosphonates, phosphonates, boranophosphinate esters, phosphoramidates, alkyl phosphonates, aryl ... and phosphotriester modifications such as alkyl or aryl phosphonates, alkyl phosphotriesters, phosphotriester-phosphorus linkages, 5'-ethoxy phosphodiesters, P-alkyloxyphosphotonesters, methyl phosphonates, non-phosphorus containing linkages, e.g., carbonate, carbamate, silyl, sulfur, sulfonate, sulfonamide, formate, thioformacetyl, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxymethylimino linkages.

[0114] The nucleic acid molecules (short complementary nucleic acids, scRNAs and / or siRNAs) disclosed herein may comprise a peptide nucleic acid (PNA) backbone. The PNA backbone comprises repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. Various bases, such as purine bases, pyrimidine bases, natural bases and synthetic bases, are linked to the backbone by methylene carbonyl bonds.

[0115] Modifications can be made at the terminal phosphate group. Non-limiting examples of different stabilizing chemical structures can be used to stabilize, for example, the 3'-end of a nucleic acid sequence. For example, (1) [3-3']-reverse deoxyribose, (2) deoxyribonucleotide, (3) [5'-3']-3'-deoxyribonucleotide, (4) [5'-3']-ribonucleotide, (5) [5'-3']-3'-O-methylribonucleotide, (6) 3'-glyceryl, (7) [3'-5']-3'-deoxyribonucleotide, (8) [3'-3']-deoxyribonucleotide, (9) [5'-2']-deoxyribonucleotide, and (10) [5-3']-dideoxyribonucleotide. In addition to unmodified backbone chemical structures, they can be combined with one or more different backbone modifications as described herein.

[0116] The modified nucleotide and nucleic acid molecule provided herein may comprise a complex, for example, a complex covalently linked to a nucleic acid molecule. The complex may be covalently linked to a nucleic acid molecule via a linker. In one embodiment, the complex molecule may comprise a molecule that facilitates the delivery of the nucleic acid molecule into a cell, for example, into a specific type of cell, or into a specific intracellular compartment or vesicle within a cell. The complex may also comprise, for example, a detectable label, or a molecule that facilitates binding or detection by a second molecule.

[0117] In some embodiments, short complementary nucleic acids such as scRNAs have a length of about 500 or less, about 400 or less, about 300 or less, about 200 or less, about 100 or less, about 90 or less, about 80 or less, about 70 or less, about 60 or less, about 50 or less, about 40 or less, about 30 or less, about 25 or less, about 20 or less, about 15 or less, about 14 or less, about 13 or less, about 12 or less, about 11 or less, about 10 or less, about 9 or less, about 8 or less, about 7 or less, about 6 or less, about 5 or less, about 4 or less, about 3 or less, or about 2 or less bases.

[0118] In some embodiments, short complementary nucleic acids (such as scRNAs) of the present disclosure comprise sequences that have a particular sequence identity to a sequence complementary to an intron sequence of interest, in some embodiments, the sequence has at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a sequence complementary to an intron sequence of interest.

[0119] In some embodiments, a short complementary nucleic acid (such as a scRNA) of the disclosure comprises a sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence 5'-cacgccugugaaaccguacuaagucucccgugucuucuuaucaccaucag-3'. Binding of complementary short stranded nucleic acid to siRNA

[0120] siRNAs can be combined, mixed, combined, sequentially, or simultaneously with short complementary nucleic acids (such as scRNAs) of the present disclosure. Short complementary nucleic acids (such as scRNAs) of the present disclosure preferably target introns by fully or partially complementary base pairing (hybridization). In some embodiments, short complementary nucleic acids (such as scRNAs) of the present disclosure hybridize with the Py-containing portion of intron 4 of the MIE gene of HCMV in the nucleus. In contrast, siRNAs targeting mRNAs (e.g., of the MIE gene of HCMV) in the cytoplasm may be used to form RISC complexes and cause mRNA degradation. Because the mechanisms underlying siRNAs and short complementary nucleic acids (such as scRNAs) of the present disclosure are different, the embodiments herein may have additive or synergistic inhibitory effects on viral gene expression and replication.

[0121] The siRNA and short complementary nucleic acid (such as scRNA) of the present disclosure may be delivered at the same time or at different times. The siRNA and short complementary nucleic acid (such as scRNA) of the present disclosure may be delivered using the same delivery mechanism or delivery vehicle or may be delivered using different delivery mechanisms or delivery vehicles. Delivery of Therapeutic Agents and Compositions

[0122] Delivery of the nucleic acids of the present disclosure, such as short complementary nucleic acids (such as scRNA) and / or siRNA, may be accomplished by many methods known to those skilled in the art. In some embodiments, the nucleic acids of the present disclosure, such as short complementary nucleic acids (such as scRNA) and / or siRNA, may be directly introduced into cells. Non-limiting methods of introducing these components into cells include microinjection, electroporation, nucleofection, lipofection, particle gun, and microparticle gun.

[0123] Delivery of the nucleic acids of the present disclosure, such as short complementary nucleic acids (such as scRNA) and / or siRNA, may be accomplished by using a delivery vehicle, such as a particle, lipid vesicle, or carrier. The nucleic acid molecule can be delivered or administered to a subject by directly administering an agent (such as a nucleic acid molecule) along with a carrier or diluent or any other delivery vehicle that acts to aid, promote, or facilitate entry into a cell, including viral sequences, virus-specific liposomal formulations, lipofectin, or precipitating agents, etc.

[0124] Delivery of the nucleic acids of the present disclosure, such as short complementary nucleic acids (such as scRNA) and / or siRNA, may also be achieved by a variety of methods known to those of skill in the art, including, but not limited to, encapsulation in liposomes, iontophoresis, or incorporation into other vehicles such as biodegradable polymers, hydrogels, cyclodextrins, polylactic-co-glycolic acid (PLGA) and PLGA microspheres, biodegradable nanocapsules, bioadhesive microspheres, or proteinaceous vectors.

[0125] The nucleic acids of the present disclosure, such as short complementary nucleic acids (such as scRNA) and / or siRNA, can be complexed with cationic lipids, packaged in liposomes, and otherwise delivered to target cells or tissues. Such nucleic acids, or nucleic acid complexes, with or without incorporation into biopolymers, can be administered locally to relevant tissues ex vivo or in vivo by direct transdermal application, transdermal application, or injection. Delivery systems include surface-modified liposomes (PEG-modified liposomes, retention liposomes, or stealth liposomes) containing poly(ethylene glycol) lipids. These formulations provide a way to increase drug accumulation in target tissues.

[0126] Nucleic acids of the present disclosure, such as short complementary nucleic acids (such as scRNA) and / or siRNA, can be formulated or complexed with polyethyleneimine (e.g., linear or branched PEI) and / or polyethyleneimine derivatives, including, for example, polyethyleneimine-polyethylene glycol N-acetylgalactosamine (PEI-PEG-GAL) or polyethyleneimine-polyethylene glycol-tri-N-acetylgalactosamine (PEI-PEG-triGAL) derivatives, galactose PEI, cholesterol PEI, antibody-derivatized PEI, grafted PEI, such as polyethylene glycol PEI (PEG-PEI), etc.

[0127] In some embodiments, the nucleic acids of the present disclosure, such as short complementary nucleic acids (such as scRNA) and / or siRNA, are formulated in delivery particles, including but not limited to nanoparticles. In some embodiments, the short complementary nucleic acids (such as scRNA) and siRNA are formulated in the same nanoparticle. In other embodiments, the short complementary nucleic acids (such as scRNA) and siRNA are formulated in different and / or separate nanoparticle(s).

[0128] In some embodiments, the particles (such as nanoparticles) comprise one or more cationic polymers. In some embodiments, the one or more polymers may comprise polyamines or polyimines, or derivatives thereof.

[0129] In some embodiments, the particles may comprise a core and one or more shell layers encompassing the core. In some embodiments, the particles, or particle cores, may comprise one or more nucleic acids complexed with polyethyleneimine (PEI) and polyspermine imidazole 4,5-imine (PSI). In some embodiments, network cationic polymers may be used as particles or particle cores (e.g., in the range of 100-400 nm) and are prepared by condensation of spermine imidazole 4,5-aldehyde oligomers with branched polyethyleneimine (PEI-800).

[0130] In some embodiments, the size of the network cationic polymer can be adjusted by changing the pH of the solution (e.g., in which such condensation reactions occur) and / or by adjusting the salt concentration. In some embodiments, a pH of about 9-12 is used and / or a salt concentration of about 0-30 mM is used. In some embodiments, a pH of about 9 is used. In some embodiments, the salt is sodium chloride.

[0131] In some embodiments, the core particle is surrounded by at least one wrapping layer. In some embodiments, the wrapping layer is a polymer. In some embodiments, the polymer is a hydrophilic polymer and / or a water-soluble polymer. In some embodiments, the wrapping polymer is polyethylene glycol (PEG).

[0132] In some embodiments, the particle may be specifically targeted to a particular destination, including, for example, a particular cell or cell type, using a targeting moiety. In some embodiments, the targeting moiety is a molecule, ligand, or protein that binds to a molecule on the surface of the target cell. In some embodiments, the particle may be equipped with a targeting moiety that preferentially targets the particle to HCMV-infected cells (or cells that can be infected by HCMV). In some embodiments, the targeting moiety is a chemokine molecule. In some embodiments, the chemokine molecule is CX3CL1 or a mutant or derivative thereof that binds to the US28 receptor expressed on the surface of HCMV-infected cells.

[0133] Targeting moieties can be attached to particles using a variety of techniques known to those of skill in the art.

[0134] In some embodiments, the targeting moiety may be attached to lysine to generate an extra amino group (e.g., at or toward the N-terminus and / or C-terminus). In some embodiments, lysine is attached to the C-terminus of a targeting moiety such as CX3CL1, or a variant or derivative thereof. In some embodiments, the targeting moiety is immobilized to the particle, core, or wrapping layer by binding. In some embodiments, the targeting moiety (such as CX3CL1) is immobilized to the PEG wrapping layer, such as by using a free or introduced amino group on the targeting moiety.

[0135] In some embodiments, nucleic acid-containing particles, such as particles comprising a nucleic acid-containing core and one or more wrapping layers as described herein, are taken up by cells (such as HCMV-infected cells) into endosomes, and the nucleic acid can be released from the core complex (gaining entry into the cytosol) under the low pH conditions of the endosome.

[0136] In some embodiments, the nucleic acids of the present disclosure, such as short complementary nucleic acids (such as scRNA) and / or siRNA, can be complexed with a membrane disruptive agent. The membrane disruptive agent and nucleic acid molecule may also be complexed with a cationic lipid or a helper lipid molecule.

[0137] Delivery systems may include, for example, aqueous and non-aqueous gels, creams, multiple emulsions, microemulsions, liposomes, ointments, aqueous and non-aqueous solutions, lotions, aerosols, hydrocarbon bases and hydrocarbon powders, and can include excipients such as solubilizers, permeation enhancers (e.g., fatty acids, fatty acid esters, fatty alcohols, and amino acids), hydrophilic polymers (e.g., polycarbophil, and polyvinylpyrrolidone), and the like.

[0138] The compositions, methods, and kits disclosed herein may include an expression vector that comprises a nucleic acid sequence encoding at least one nucleic acid molecule of the invention in a manner that allows expression of the nucleic acid molecule. The method of introducing the nucleic acid molecule or one or more vectors capable of expressing the nucleic acid molecule into the environment of a cell depends on the cell type and the composition of that environment.

[0139] In some embodiments, the nucleic acids of the present disclosure, such as short complementary nucleic acids (such as scRNA) and / or siRNA, may be expressed from transcription units inserted into DNA or RNA vectors. The recombinant vector may be a DNA plasmid or a viral vector. The nucleic acid molecule expressing viral vector may be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus. The recombinant vector capable of expressing the nucleic acid molecule may be delivered and persist in the target cell as described herein. Alternatively, a viral vector that provides transient expression of the nucleic acid molecule may be used. Such vectors may be administered repeatedly as needed. The delivery of the nucleic acid molecule expressing vector may be systemic, such as intravenous or intramuscular administration.

[0140] An expression vector may include one or more of the following: a) a transcription initiation region (e.g., a eukaryotic pol I, II, or III initiation region), b) a transcription termination region (e.g., a eukaryotic pol I, II, or III termination region), c) an intron, and d) a nucleic acid sequence encoding at least one of the nucleic acid molecules, wherein such sequences are operably linked to the initiation and termination regions in a manner that allows for expression and / or delivery of the nucleic acid molecule.

[0141] Transcription of such nucleic acid molecule sequences can be driven from a eukaryotic RNA polymerase I (pol I), RNA polymerase II (pol II), or RNA polymerase III (pol III) promoter.

[0142] As used herein, useful dosages of administered nucleic acids and the particular mode of administration will vary depending on factors such as the cell type, or, in the case of in vivo use, the age, weight, and particular animal and area to be treated, the particular agent (e.g., nucleic acid) and method of delivery used, whether for therapeutic or diagnostic use, and the form of the formulation, for example, suspension, emulsion, micelle, or liposome, as will be apparent to one of skill in the art.

[0143] When lipids are used to deliver nucleic acids, the amount of lipid compound administered can vary and generally depends on the amount of nucleic acid administered. For example, the weight ratio of lipid compound to nucleic acid is preferably about 1:1 to about 30:1, more preferably about 5:1 to about 10:1.

[0144] Suitable dosage units of the nucleic acid molecule may be in the range of 0.001 to 0.25 milligrams per kilogram of recipient body weight per day, or in the range of 0.01 to 20 micrograms per kilogram of body weight per day, or in the range of 0.01 to 10 micrograms per kilogram of body weight per day, or in the range of 0.10 to 5 micrograms per kilogram of body weight per day, or in the range of 0.1 to 2.5 micrograms per kilogram of body weight per day.

[0145] The nucleic acids of the present disclosure, such as short complementary nucleic acids (such as scRNA) and / or siRNA, can be used to treat individuals infected or suspected of being infected with a herpesvirus, such as a herpesvirus like HCMV, or an adenovirus.

[0146] Administration of the nucleic acids of the present disclosure, such as short complementary nucleic acids (such as scRNA) and / or siRNA, may be performed by any convenient method, including aerosol inhalation, injection, ingestion, transfusion, implantation, or transplantation. The compositions described herein may be administered to a patient by subcutaneous, intradermal, intratumoral, intranodal, intramedullary, intramuscular, intravenous or intralymphatic injection, or intraperitoneal administration. The agents or compositions may be administered in one or more separate doses. In some embodiments, an effective amount is administered as a single dose. In other embodiments, an effective amount is administered as two or more doses over a period of time. Determining the optimal range of effective amounts of a cell type for a particular disease or condition is within the skill of one of ordinary skill in the art.

[0147] The treatments of the present disclosure can be provided simultaneously with, prior to, or subsequent to other anti-herpes virus or anti-adenovirus treatments, including, for example, nucleoside analogs, synthetic acyclic analogs of 2'-deoxyguanosine (and their derivatives), and low molecular weight compounds that target the CMV terminase complex. experiment

[0148] Non-limiting embodiments of the present invention are illustrated in the following examples. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, concentrations, rates of change, etc.), but some experimental error and deviations should be accounted for.

[0149] Unless otherwise specified, temperatures are in degrees Celsius and pressures are at or near atmospheric pressure. It should be understood that these examples are given for illustrative purposes only and are not intended to limit the scope of what the inventors regard as various embodiments of the present invention. Not all of the following steps described in each example are required, nor does the order of steps in each example have to be exactly as presented. Example 1 Identification of Py responsible for transcriptional switching from IE1 to IE2

[0150] At the end of exon 4 (Fig. 1A), there is a stop codon and a polyA signal for IE1 gene expression. In addition, as shown in Fig. 1A, there are two Py sequences (ucuccc (A) and ucuucuu (B)) between exon 4 and exon 5 after the polyA signal of IE1. To elucidate how the switch from IE1 to IE2 is regulated, and in particular, whether the DNA sequence after the polyA signal of IE1 is important for the splicing of the IE2 gene, mutants of the Py sequence were generated.

[0151] Using the pSVH plasmid, we created three different mutants, pSVHdPyA (where ucuccc is mutated to ucagcc), pSVHdPyB (where ucuucuu is mutated to ucaaguu), and pSVHdPyAB (where both A and B are mutated). After transfecting these plasmids into HEK293T cells, we examined the production of IE1 and IE2 at both the protein and transcription levels, respectively, using Western blot assays (Figure 1B) and real-time RT PCR assays (Figure 1C). As a result, pSVHdPyB and pSVHdPyAB had no effect on the expression of IE1, but IE2 could not be expressed at a significant level. It was also observed that pSVHdPyA expressed IE2 at a much lower level than pSVH. These results indicated that the second Py(B) is required for splicing of the gene that produces IE2 (because the mutant (ucaaguu) did not express IE2), and that the first Py(A) is important for IE2 splicing and expression.

[0152] Furthermore, immunofluorescence assay (1FA) was performed to examine the production of IE1 / 2 from transfected MRC-5 cells. MRC-5 cells were transfected with pSVHdPyA (top panel in Fig. 1D), pSVH (middle panel in Fig. 1D), or pSVHdPyB (bottom panel in Fig. 1D) for 20 h. These cells were then fixed with 1% paraformaldehyde and permeabilized with 0.2% Triton X-100. These cells were then incubated with anti-IE1 or anti-IE2 antibodies to show the production of IE1 or IE2, respectively. All cells were visualized by DAPI staining. All colors were merged in the first column.

[0153] As shown in Fig. 1D, production of IE1 was not significantly affected, since it was detected in cells regardless of the plasmid used for transfection, but production of IE2 was not detected in cells transfected with pSVHdPyB. Example 2 Polypyrimidine tracts (Py) mediate interactions between introns and splicing

[0154] To determine whether PyA or PyB mediates the interaction between intron 4 and U2AF65, we performed an RNA EMSA assay. Specifically, U2AF65 protein was incubated with a radiolabeled RNA probe (Figure 2A, sequence shown in Table 1) and resolved using non-denaturing PAGE in the following lanes: 1) RNA lacking PysA and PysB (dPyAB), 2) RNA lacking PyB (dPyB), 3) RNA lacking PyA (dPyA), and 4) RNA containing both PysA and PysB (wt). As can be seen by comparing the bound probe with the wt probe (lane 4), U2AF65 did not bind to the RNA probe in which PyB was mutated (first and second lanes) and binding was very weak when PyA was mutated (third lane). [Table 1]

[0155] To further determine whether Pys can affect U2AF-intron 4 binding in vivo, we performed RNA ChIP assays to determine whether splicing regulators (U2AF65 and PTB) can interact with Pys. Specifically, HEK293T cells were transfected with one of four different plasmids (Figure 2B) for 24 h and cross-linked with 1% paraformaldehyde, followed by shearing with a sonicator to degrade RNA. RNA-protein complexes were pulled down using control IgG, anti-PTB, and anti-U2AF65 antibodies. After multiple washes, cross-linking was reversed with SDS at 95 °C. DNA was removed with DNase I digestion, and RNA was purified with columns provided in the RNA ChIP kit. Real-time RT-PCR was performed to determine the amount of specific RNA in each sample after ChIP, and the percentage of RNA compared to input RNA was calculated. Primers used for RT-PCR are listed in Table 2. [Table 2]

[0156] As seen in Fig. 2B, when PyB was mutated, the intron RNA lost the ability to bind to U2AF65 or PTB, and when PyA was mutated, the intron RNA bound to PTB or U2AF significantly less strongly than in the wild type.

[0157] Thus, these experiments indicate that both Pys in intron 4 are important for any splicing factor to bind to intron 4 to promote splicing of the IE2 gene. The second Py (PyB) is essential for the interaction of the splicing factor with the intron, and the first Py (PyA) is important for that interaction. Example 3 PyA and PyB affect splicing of the IE2 gene

[0158] To determine whether PyA or PyB is important for splicing of the IE2 gene, an in vivo gene splicing assay was performed. First, the plasmids (pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB) were transfected into HEK293T cells for 20 h, after which total RNA was harvested. The total RNA was treated with DNase to remove contaminating plasmid DNA. Then, for reverse transcription (RT), RT-PCR was performed using a specific reverse transcription primer (plE2) for exon 5 (Table 2) instead of oligo-dT so that both mRNA and pre-mRNA could be reverse transcribed (Figure 3A). By doing so, both pre-mRNA (*) and mRNA (**) cDNAs could be amplified using a forward primer for exon 3 and a reverse primer (pIE2) for exon 5 (Table 2). PCR was performed using the total RNA (after DNase treatment) as a template.

[0159] As shown in the middle panel of Figure 3B, no DNA was amplified, ruling out the possibility of contamination with plasmid DNA during the total RNA preparation. Furthermore, in PCR experiments using plasmid DNA as a template, larger DNA fragments were amplified (right panel of Figure 3B).

[0160] As shown in the left side of Figure 3B, RT-PCR results showed that two bands were obtained for the pSVH and pSVHdPyA transfected groups, which represent DNA amplified from pre-mRNA (*) and mRNA (**), respectively. No mRNA bands were detected in the pSVHdPyB and pSVHdPyAB groups. It can also be seen that the mRNA band in the pSVHdPyA transfected group was much weaker than that in the pSVH transfected group. These results indicated that PyB is required and PyA is important for IE2 splicing and for efficient mRNA production from abundant pre-mRNA. Example 4 PyB is essential and PyA is important for HCMV replication

[0161] The mutation in Py was introduced into the HCMV BACmid to obtain the following BACmids: HB5dPyA, HB5dPyB, and HB5dPyAB. To determine whether the BACmids could express IE1 / 2 after transfection into MRC-5 cells, MRC-5 cells were fixed 20 hours post-transfection and IFA was performed to examine the production of IE1 / 2.

[0162] As shown in Fig. 4A, only the BACmid HCMVdPyA produced both IE1 and IE2, whereas the other two BACmids produced only IE1 and no IE2. This result was consistent with the results shown in Fig. 1 (after transfection with the plasmids). Furthermore, revertant BACs were generated (HB5dPyARev, HB5dPyBRev, HB5dPyABRev).

[0163] Each BACmid was transfected into MRC-5 cells and allowed for virus formation. HB5dPyA was able to form infectious virus particles. However, the other two BACmids (HB5dPyB and HB5dPyAB) were unable to generate infectious virus. All revertant BACmids were able to form infectious virus and replicated similarly to the wild type.

[0164] By comparing the viral replication of HCMVdPyA with that of wild-type HCMV (or its revertant), we found that HCMVdPyA had a defective phenotype in replication (Fig. 4B). Western blot assays also showed that the production of viral proteins was reduced when the first Py was mutated (Fig. 4C). As expected, the IE2 protein was produced much later in HCMVdPyA than in the revertant HCMV. Thus, we found that the first Py sequence is important for HCMV replication, and the second Py is required for HCMV replication.

[0165] Figure 1 and Figure 4A show that PyA is important for the production of IE2 in the transfection system. To confirm these results in a viral infection system, human fibroblasts (MRC-5) were infected with HCMVdPyA (or its revertant) for different times, and the cells were fixed at 12 and 24 hours postinfection and immunostained (using antibodies against IE1 (FITC) and IE2 (Texas red)). IE1- and IE2-positive cells were counted under a fluorescent microscope.

[0166] At 12 h postinfection, only 55 IE2-positive cells were observed per 100 IEl-positive cells in the HCMVdPyA-infected cells, whereas 87 IE2-positive cells were observed per 100 IEl-positive cells in the revertant-virus-infected cells (Fig. 4D). At 24 h postinfection, the IE2 / IE1 ratio was close to 1 (74% in the HCMVdPyA-infected cells, compared with 99% in the revertant-infected cells). These results indicate that PyA is important for the production of IE2 in the virus-infected cells.

[0167] Furthermore, to determine whether the splicing of the IE2 gene is affected when PyA is mutated under viral infection, MRC-5 cells were infected with HCMVdPyA (or its revertant) at an MOI of 0.1 for 16 h. Total RNA was isolated and treated with DNase I. As shown on the right side of Figure 5A, PCR was negative when total RNA was used as a template, excluding the possibility of viral DNA contamination. The left side of Figure 5A shows RT-PCR products amplified from mRNA (171 bp band) or pre-mRNA (1.7 kb). In revertant infection, the mRNA band was significantly stronger than in HCMVdPyA infection, indicating stronger IE splicing. Therefore, it was determined that the PyA mutation adversely affected the splicing of the IE2 gene.

[0168] Furthermore, to determine whether PyA plays a role in the interaction of splicing factors with intron 4 of MIE, we performed RNA ChIP assays. MRC-5 cells were fixed after infection with HCMVdPyA (or its revertants) at an MOI of 1 for 16 h. RNA ChIP assays were performed as described above using anti-PTB or anti-U2AF65 antibodies. As shown in Figure 5B, in cells infected with HCMVdPyA or its revertants, both PTB and U2AF65 interacted with intron 4 of IE2 RNA. However, the interaction was reduced when PyA was mutated. These results confirmed that PyA enhances the interaction of splicing factors with intron 4.

[0169] The results shown in Fig. 4C indicate that the mutation of PyA reduces viral gene expression at the translational level. To determine whether PyA affects IE1 / IE2 gene expression at the mRNA level, real-time RT-PCR was performed to determine IE1 / IE2 mRNA levels at different times after infection of MRC-5 cells with HCMVdPyA (or its revertant) at an MOI of 0.5.

[0170] As shown in Fig. 5C, IE1 mRNA levels were maintained at a similar level in cells infected with HCMVdPyA, whereas IE2 mRNA levels were significantly decreased in cells infected with the PyA mutant virus. Thus, these results indicate that PyA is not required for HCMV replication but is important for enhancing the interaction of splicing factors with intron 4, enhancing viral gene expression and viral replication. Example 5 Design and synthesis of short complementary nucleic acids targeting introns

[0171] The inventors have thus conceived an antiviral mechanism whereby small nucleic acids (such as RNA) complementary to introns containing one or more Pys can be used as antiviral agents against viral replication (such as HCMV replication) by abolishing the interaction between splicing factors (such as U2AF65) and Py, thereby resulting in inhibition of gene splicing.

[0172] To demonstrate this effect in HCMV, we used the IE2 gene model. First, we generated a small RNA (scRNAPy) complementary to an RNA probe shown to interact with U2AF65. Figures 2A and 6A. This scRNAPy and the probe RNA were shown to form double-stranded RNA when mixed at a 1:1 molar ratio (30 min at room temperature). The single-stranded and single-stranded RNA bands are shown in Figure 6B.

[0173] Furthermore, we performed RNA gel shift assays in the absence or presence of scRNAPy. As shown in Fig. 6C, the binding of the probe to U2AF65 was reduced when scRNAPy was added to the probe-U2AF65 reaction system, and the reduction in probe-U2AF65 binding was related to the amount of scRNAPy.

[0174] As shown in Figure 6D, to determine whether the interference of scRNAPy on the binding of U2AF65 to the Py tract could occur in vivo (whether it would suppress the splicing of the IE2 gene), HEK293T cells were co-transfected with pSVH together with scRNAPy, scRNAPyup (scRNA complementary to the upstream of intron 4), or scrambled RNA (made from luciferase cDNA) for 20 h. Then, total cell lysate samples were prepared for use in Western blot assays to check the production of IE2 protein. In addition, total RNA samples were prepared for use in real-time PCR to examine the mRNA level of IE2. As seen in Figure 6E and 6F, scRNAPy significantly reduced the expression of IE2 at both the protein and transcription levels. This result indicates that, for example, scRNAPy can effectively interfere with the splicing and expression of the IE2 gene.

Claims

1. A single-stranded nucleic acid molecule, comprising a sequence complementary to all or part of the intron sequence of a viral mRNA containing one or more polypyrimidine (Py) tracts, wherein the nucleic acid molecule can hybridize to a region of the intron sequence containing one or more of the polypyrimidine (Py) tracts, a single-stranded nucleic acid molecule.

2. The nucleic acid molecule according to claim 1, wherein the viral mRNA is derived from the HCMV MIE gene.

3. The nucleic acid molecule according to claim 2, wherein the intron sequence is the fourth intron of the HCMV MIE gene.

4. The nucleic acid molecule according to claim 3, wherein when the nucleic acid molecule is introduced into HCMV-infected cells, it can inhibit the splicing and expression of HCMV IE2.

5. The nucleic acid molecule according to claim 1, wherein the sequence complementary to all or part of the intron sequence is 10 to 100 nucleotides in length.

6. The nucleic acid molecule according to claim 5, wherein the sequence complementary to all or part of the intron sequence is 10 to 50 nucleotides in length.

7. The nucleic acid molecule according to claim 1, wherein the sequence complementary to all or part of the intron sequence has the sequence 5'-cacgccugugaaaccguacuaagucucccgugucuucuaaucaccaaucag-3'.

8. The nucleic acid molecule according to claim 1, wherein the sequence complementary to all or part of the intron sequence has a sequence having 90% or more sequence identity with the sequence 5'-cacgccugugaaaccguacuaagucucccgugucuucuaaucaccaaucag-3'.

9. A composition comprising the nucleic acid molecule according to any one of claims 1 to 8, wherein the composition further comprises a delivery vehicle, a composition.

10. The composition according to claim 9, wherein the delivery vehicle comprises a polymer.

11. The composition according to claim 10, wherein the polymer comprises a cationic polymer.

12. The composition according to claim 10, wherein the delivery vehicle is a delivery particle.

13. The delivery particle has a core structure comprising the nucleic acid molecule and at least one polymer, The composition according to claim 12, wherein the delivery particle further comprises at least one wrapping layer that wraps the core structure.

14. The core structure comprises the nucleic acid molecule, polyethyleneimine (PEI), and polyspermine imidazole 4,5-imine (PSI), and the composition according to claim 13.

15. The composition according to claim 13, wherein the at least one wrapping layer comprises a hydrophilic polymer.

16. The composition according to claim 15, wherein the hydrophilic polymer is polyethylene glycol.

17. The composition according to claim 12, wherein the delivery particle comprises a targeting moiety.

18. The composition according to claim 17, wherein the targeting moiety targets the delivery particle to HCMV-infected cells.

19. The composition according to claim 18, wherein the targeting moiety is CX3CL1 or a variant or derivative thereof.

20. The nucleic acid according to any one of claims 1 to 8, wherein the nucleic acid molecule comprises at least one of a modified base, a base analog, and an abasic site.

21. The nucleic acid according to any one of claims 1 to 8, wherein the nucleic acid molecule comprises DNA, RNA, or both DNA and RNA.

22. The nucleic acid according to claim 21, wherein the nucleic acid molecule is short complementary RNA (scRNA).

23. The nucleic acid molecule according to any one of claims 1 to 8, wherein the nucleic acid molecule is bound to a heterologous molecule.

24. A method for treating herpes virus infection, preferably HCMV infection, comprising administering the nucleic acid molecule according to any one of claims 1 to 8 to a subject in need thereof.

25. A method for treating herpes virus infection, preferably HCMV infection, comprising administering the composition according to claim 9 to a subject in need thereof.

26. A method for inhibiting transcriptional switching, comprising contacting the nucleic acid according to any one of claims 1 to 8 with viral mRNA. ​ ​ ​