Circular RNA Compositions and Methods

JP2024521444A5Pending Publication Date: 2025-06-06ORNA THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023576064
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-02-18
Filing Date
2022-06-10
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

Traditional DNA-based gene therapy methods face risks of genomic integration, immune responses, and challenges in targeted delivery, while RNA-based therapies offer safer alternatives but are limited by existing methodologies for producing circular RNA.

Method used

The development of circular RNA compositions and methods involving enhanced intronic and exonic elements, along with core functional elements, to enhance stability and expression, using DNA templates to produce circular RNA polynucleotides that can encode therapeutic proteins.

Benefits of technology

The circular RNA polynucleotides exhibit increased stability and extended half-life, enabling effective therapeutic protein expression and immune system induction, addressing the limitations of DNA-based therapies.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

Circular RNAs are described herein along with related compositions and methods. In some embodiments, the circular RNAs of the invention comprise a group I intron fragment, a spacer, an IRES, a duplex forming region, and an expression sequence. In some embodiments, the expression sequence encodes an antigen. In some embodiments, the circular RNAs of the invention have improved expression, functional stability, immunogenicity, ease of manufacture, and / or half-life when compared to linear RNA. In some embodiments, the methods and constructs of the invention provide improved circularization efficiency, splicing efficiency, and / or purity when compared to existing RNA circularization approaches.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 209,271, filed June 10, 2021, and U.S. Provisional Application No. 63 / 311,923, filed February 18, 2022, the contents of each of which are incorporated by reference in their entirety for all purposes.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on June 9, 2022, is named OBS_017_SL.txt and is 3,370,624 bytes in size. [Background technology]

[0003] Traditional gene therapy involves the use of DNA to insert desired genetic information into host cells. DNA introduced into cells typically integrates to some degree into the genome of one or more transfected cells, allowing for long-term function of the introduced genetic material within the host. While such long-lasting function can have substantial benefits, integration of exogenous DNA into the host genome can also have many adverse effects. For example, the introduced DNA may insert into an intact gene, resulting in a mutation that interferes with or even completely eliminates the function of the endogenous gene. Thus, DNA-based gene therapy can result in fatal impairment of gene function in the treated host, such as the elimination or harmful reduction of production of essential enzymes or the interference with genes critical for cell growth control, leading to uncontrolled or cancerous cell proliferation. In addition, traditional DNA-based gene therapy requires the inclusion of strong promoter sequences for effective expression of the desired gene product, which can also result in undesirable changes in the control of normal gene expression within the cell. DNA-based genetic material can also induce unwanted anti-DNA antibodies, which can trigger potentially fatal immune responses. Gene therapy approaches using viral vectors can also lead to harmful immune responses. In some situations, viral vectors can even be integrated into the host genome. In addition, the production of clinical grade viral vectors is costly and time-consuming. Targeted delivery of introduced genetic material using viral vectors can also be difficult to control. Therefore, although DNA-based gene therapy has been evaluated for the delivery of secreted proteins using viral vectors (U.S. Patent No. 6,066,626; U.S. Publication No. 2004 / 0110709), these approaches can be limited for these various reasons.

[0004] In contrast to DNA, the use of RNA as a gene therapy agent is substantially safer, since there is no risk of RNA being stably integrated into the genome of the transfected cell, thus eliminating the concern that the introduced genetic material will disrupt the normal function of essential genes or cause mutations that result in harmful or oncogenic effects; and exogenous promoter sequences are not required for the effective translation of the encoded protein, again avoiding possible harmful side effects.In addition, mRNA does not need to enter the nucleus to perform its function, whereas DNA must overcome this major barrier.

[0005] Circular RNA is useful for designing and producing stable forms of RNA. Circularization of RNA molecules provides advantages for studying RNA structure and function, especially for molecules that tend to fold into inactive conformations (Wang and Ruffner, 1998). Circular RNA is also particularly interesting and may be useful for in vivo applications, especially in the research field of RNA-based control of gene expression and therapeutic agents, including protein replacement therapy and vaccination. Prior to the present invention, there were three major techniques for generating circularized RNA in vitro: splint-mediated, intron-exon permutation, and RNA ligase-mediated. However, existing methodologies are limited by the size of the RNA that can be circularized, thereby limiting their therapeutic applications. The present invention addresses this need by providing methods and compositions for the production and optimization of circular RNA through manipulation of the DNA template, linear RNA precursor, and ultimately the sequence of the circular RNA, as well as methods for treating subjects in need using the invented circular RNA. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] U.S. Patent No. 6,066,626 [Patent Document 2] US Patent Application Publication No. 2004 / 0110709 Summary of the Invention

[0007] Described herein are RNA precursors, circular RNAs, and related compositions and methods.

[0008] In one aspect, provided herein is an RNA precursor polynucleotide comprising, in the following order: a. a 5'-enhanced intronic element; b. a 5'-enhanced exon element; c. a core functional element; d. a 3'-enhanced exon element; and e. a 3'-enhanced intron element, wherein the core functional element comprises, in the following order: i. a translation initiation element (TIE); ii. a coding element; and iii. optionally, a stop codon or termination cassette.

[0009] In one aspect, provided herein is an RNA precursor polynucleotide comprising, in the following order: a. a 5'-enhanced intronic element; b. a 5'-enhanced exon element; c. a core functional element; d. a 3'-enhanced exon element; and e. a 3'-enhanced intron element, wherein the core functional element comprises, in the following order: i. a coding region; ii. optionally, a stop codon or termination cassette; and iii. a translation initiation element (TIE).

[0010] In one aspect, provided herein is an RNA precursor polynucleotide comprising, in the following order: a. 5'-enhanced intronic elements; b. 5'-enhanced exonic elements; c. core functional elements; d. 3'-enhanced exonic elements; and e. 3'-enhanced intronic elements, wherein the core functional elements comprise non-coding elements.

[0011] In some embodiments, the TIE comprises an untranslated region (UTR) or a fragment thereof, an aptamer complex or a fragment thereof, or a combination thereof.

[0012] In some embodiments, the UTR or fragment thereof is derived from a viral or eukaryotic messenger RNA. In some embodiments, the UTR or fragment thereof comprises a viral internal ribosome entry site (IRES) or a eukaryotic IRES. In some embodiments, the core functional elements comprise two or more IRES. In some embodiments, the core functional elements comprise a TIE, a coding element, a termination sequence, optionally a spacer, a TIE, a coding element, and a termination sequence, wherein the TIE comprises an IRES. In some embodiments, the IRES comprises a sequence selected from SEQ ID NOs: 1-2983 and 3282-3287, or a fragment thereof. In some embodiments, the IRES is selected from the group consisting of SEQ ID NOs: 75, 77, 137, 532, 566, 582, 648, 680, 693, 752, 785, 787, 791, 793, 820, 823, 839, 840, 843, 852, 857, 861, 862, 863, 864, 871, 874, 876, 922, 959, 983, 984, 1015, 1017, 1023, 1026, 1031, 1041, 1047, 1059, 1068, 1134, 1168, 1169, 1171, 1177, 1178, 1179 , 1180, 1189, 1192, 1193, 1198, 1216, 1218, 1230, 1263, 1276, 1280, 1282, 1284, 1287, 1346, 1354, 1364, 1367, 1370, 1432, 1438, 1440, 2285, 2465, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2742, 2746, 2758, 2777, 2778, 3282, 3283, 3286, and 3287, or a fragment thereof. In some embodiments, the IRES comprises one or more modified nucleotides compared to a wild-type viral or eukaryotic IRES.

[0013] In some embodiments, the IRES can promote expression of a protein encoded by the RNA precursor in a cell. In some embodiments, the IRES can promote expression of the protein such that the expression level of the protein is equal to or higher than when a control IRES is used. In some embodiments, the control IRES comprises the sequence of SEQ ID NO: 3282. In some embodiments, the IRES is derived from an enterovirus, a kobuvirus, a parechovirus, or a cardiovirus. In some embodiments, the IRES is derived from an enterovirus or a kobuvirus.

[0014] In some embodiments, the cell is a myotube. In some embodiments, the IRES is derived from a bopivirus, an oshivirus, a hanivirus, a parsleyvirus, a mishivirus, a kobuvirus, an enterovirus, a cardiovirus, a sarivirus, a rabovirus, a parechovirus, a gallivirus, or a sissinivirus. In some embodiments, the IRES is derived from a hanivirus, a parsleyvirus, a kobuvirus, a bopivirus, or an enterovirus. In some embodiments, the IRES is derived from an enterovirus I, an enterovirus F, an enterovirus E, an enterovirus J, an enterovirus C, an enterovirus A, an enterovirus B, an Aichivirus B, a parechovirus A, a cardiovirus F, a cardiovirus B, or a cardiovirus E. In some embodiments, the IRES comprises a sequence selected from SEQ ID NOs: 137, 580, 785, 791, 820, 922, 1041, 1047, 1068, 1168, 1169, 1171, 1177, 1178, 1179, 1180, 1189, 1192, 1263, 1276, 1280, 1282, 1284, 1287, 1354, 1356, 1432, 1436, 1439, 1440, 2285, 2667, 2746, 2777, 2778, 3283, and 3284.

[0015] In some embodiments, the cell is a hepatocyte. In some embodiments, the IRES is derived from an enterovirus, bopivirus, miscivirus, gallivirus, osivirus, cardiovirus, kobuvirus, rabovirus, salivirus, parechovirus, hanivirus, tottorivirus, parsleyvirus, cosavirus, or sisinivirus. In some embodiments, the IRES is derived from an enterovirus, miscivirus, kobuvirus, bopivirus, or gallivirus. In some embodiments, the IRES is derived from enterovirus B, enterovirus A, enterovirus D, enterovirus J, enterovirus C, rhinovirus B, enterovirus H, enterovirus I, enterovirus E, enterovirus F, aichivirus B, aichivirus A, parechovirus A, cardiovirus F, cardiovirus E, or cardiovirus B. In some embodiments, the IRES is selected from the group consisting of SEQ ID NOs: 137, 580, 648, 693, 752, 785, 791, 793, 820, 823, 839, 840, 861, 862, 863, 876, 922, 959, 983, 984, 1015, 1017, 1023, 1026, 1031, 1041, 1047, 1059, 1068, 1134, 1168, 1169, 1170, 1171, 1172, 1173, 1174, 1175, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1187, 1188, 1189, 1190, 1191, 1192, 1193, 1200, 1201, 1202, 1203, 1204, 1205, 1206, 1207, 1208, 1210, 1211, 1212, 1213, 1214, 1215, 1216, 1217, 1218, 1219, 1220, 1221, 1222, 1223, 1224, 1225, 1226, 1227, 1228, 1229, 9, 1171, 1177, 1178, 1179, 1180, 1189, 1192, 1193, 1198, 1216, 1263, 1276, 1280, 1282, 1284, 1287, 1346, 1354, 1356, 1432, 1436, 1438, 1439, 1440, 2285, 2777, 2778, 3283, and 3284.

[0016] In some embodiments, the cell is a T cell. In some embodiments, the IRES is derived from a Parsleyvirus, Bopivirus, Hanivirus, Miscivirus, Enterovirus, Kobuvirus, Labovirus, Tottorivirus, Salivirus, Cardiovirus, Parechovirus, Megrivirus, Allexivirus, Ocivirus, or Shanbavirus. In some embodiments, the IRES is derived from a Parsleyvirus, Hanivirus, Miscivirus, Enterovirus, or Kobuvirus. In some embodiments, the IRES is derived from Enterovirus I, Enterovirus D, Enterovirus C, Enterovirus A, Enterovirus J, Enterovirus H, Aichivirus B, Parechovirus A, or Cardiovirus B. In some embodiments, the IRES comprises a sequence selected from SEQ ID NOs: 77, 787, 793, 820, 839, 840, 843, 852, 857, 861, 862, 863, 864, 871, 874, 876, 959, 1193, 1216, 1284, 1287, 1346, 1356, 1364, 1432, 1438, 1440, 2667, 2681, 2742, 2746, 2758, 3283, and 3284.

[0017] In some embodiments, the aptamer complex or fragment thereof comprises a natural or synthetic aptamer sequence. In some embodiments, the aptamer complex or fragment thereof comprises a sequence selected from SEQ ID NOs: 3266-3268. In some embodiments, the aptamer complex or fragment thereof comprises more than one aptamer.

[0018] In some embodiments, the TIE comprises a UTR and an aptamer complex. In some embodiments, the UTR is located upstream of the aptamer complex. In some embodiments, the TIE further comprises an accessory element. In some embodiments, the accessory element comprises an miRNA binding site or fragment thereof, a restriction site or fragment thereof, an RNA editing motif or fragment thereof, a ZIP code element or fragment thereof, an RNA transport element or fragment thereof, or a combination thereof. In some embodiments, the accessory element comprises an IRES transactivator (ITAF) binding domain. In some embodiments, the binding domain comprises a polyA tract, a polyC tract, a polyAC tract, a polypyrimidine tract, or a combination or variant thereof. In some embodiments, the ITAF comprises poly(rC)-binding protein 1 (PCBP1), PCBP2, PCBP3, PCBP4, poly(A)-binding protein 1 (PABP1), polypyrimidine tract-binding protein (PTB), an Argonaute protein family member, HNRNPK (heterogeneous nuclear ribonucleoprotein K), or La protein, or a fragment or combination thereof.

[0019] In some embodiments, the coding element comprises a sequence encoding a therapeutic protein. In some embodiments, the therapeutic protein comprises a chimeric protein. In some embodiments, the chimeric protein comprises a chimeric antigen receptor (CAR), a T cell receptor (TCR), a B cell receptor (BCR), an immune cell activating or inhibitory receptor, a recombinant fusion protein, a chimeric mutant protein, or a fusion protein, or a combination thereof. In some embodiments, the therapeutic protein comprises an antibody, a nanobody, a non-antibody protein, an immunomodulatory ligand, a receptor, a structural protein, a growth factor ligand or receptor, a hormone or hormone receptor, a transcription factor, a checkpoint inhibitor or agonist, an Fc fusion protein, an anticoagulant, a blood clotting factor, a chaperone protein, an antimicrobial protein, a structural protein, a biochemical enzyme, a tight junction component protein, a mitochondrial stress response, a cytoskeletal protein, a metal-binding protein, or a small molecule. In some embodiments, the immunomodulatory ligand comprises an interferon, a cytokine, a chemokine, or an interleukin. In some embodiments, the structural protein is a channel protein or a nuclear pore protein.

[0020] In some embodiments, the non-coding element comprises more than one non-coding element, hi some embodiments, the non-coding element comprises between 50 and 15,000 nucleotides in length.

[0021] In some embodiments, the core functional element comprises a termination sequence. In some embodiments, the termination sequence is located at the 5' end of the 3'-enhancing exon element. In some embodiments, the termination sequence is a stop codon. In some embodiments, the termination sequence is a termination cassette. In some embodiments, the termination cassette comprises one or more stop codons in one or more frames. In some embodiments, each frame comprises a stop codon. In some embodiments, each frame comprises two or more stop codons.

[0022] In some embodiments, the 5'-enhanced intron element comprises a 3' intron fragment. In some embodiments, the 3' intron fragment further comprises the first nucleotide, or the first and second nucleotides, of a 3' Group I intron splice site dinucleotide. In some embodiments, the 3' intron fragment is located at the 3' end of the 5'-enhanced intron element. In some embodiments, the Group I intron comprises one derived from a bacterial phage, a viral vector, an organelle genome, or a nuclear rDNA gene. In some embodiments, the nuclear rDNA gene comprises a nuclear rDNA gene, or a fragment thereof, derived from a fungus, a plant, or an algae.

[0023] In some embodiments, the 5'-enhancing intron element comprises a leading untranslated sequence located at the 5' end. In some embodiments, the leading untranslated sequence comprises a spacer. In some embodiments, the leading untranslated sequence comprises the last nucleotide of the transcription start site. In some embodiments, the leading untranslated sequence comprises 1 to 100 additional nucleotides.

[0024] In some embodiments, the 5'-enhancing intron element comprises a 5' affinity sequence. In some embodiments, the 5' affinity sequence comprises a polyA, polyAC, or polypyrimidine sequence. In some embodiments, the 5' affinity sequence comprises 10-100 nucleotides. In some embodiments, the 5'-enhancing intron element comprises a 5' external spacer sequence. In some embodiments, the 5' external spacer sequence is located between the 5' affinity sequence and the 3' intron fragment. In some embodiments, the 5' external spacer sequence has a length of about 6-60 nucleotides. In some embodiments, the 5' external spacer sequence comprises or consists of a sequence selected from SEQ ID NOs: 3094-3152.

[0025] In some embodiments, the 5' enhancing intron element comprises, in the following order: a. a leading untranslated sequence; b. a 5' affinity sequence; c. a 5' external spacer sequence; and d. a 3' intron fragment comprising the first nucleotide of the 3' Group I intron splice site, wherein the leading untranslated sequence comprises the last nucleotide and 1-100 nucleotides of the transcription start site.

[0026] In some embodiments, the 5' enhancing intron element comprises, in the following order: a. a leading untranslated sequence; b. a 5' external spacer sequence; c. a 5' affinity sequence; and d. a 3' intron fragment comprising the first nucleotide of the 3' Group I intron splice site, wherein the leading untranslated sequence comprises the last nucleotide and 1-100 nucleotides of the transcription start site.

[0027] In some embodiments, the 5' enhancing intron element comprises, in the following order: a. a leading untranslated sequence; b. a 5' affinity sequence; c. a 5' external spacer sequence; and d. a 3' intron fragment comprising the first and second nucleotides of a 3' Group I intron splice site, wherein the leading untranslated sequence comprises the last nucleotide of the transcription start site and nucleotides 1-100 thereof; and the 5' enhancing exon element comprises the 3' exon fragment lacking the second nucleotide of the 3' Group I splice site dinucleotide.

[0028] In some embodiments, the 5' enhancing intron element comprises, in the following order: a. a leading untranslated sequence; b. a 5' external spacer sequence; c. a 5' affinity sequence; and d. a 3' intron fragment comprising the first and second nucleotides of a 3' Group I splice site, wherein the leading untranslated sequence comprises the last nucleotide of the transcription start site and nucleotides 1-100 thereof; and the 5' enhancing exon element comprises the 3' exon fragment lacking the second nucleotide of the 3' Group I splice site dinucleotide.

[0029] In some embodiments, the 5'-enhancing exon element comprises a 3' exon fragment. In some embodiments, the 3' exon fragment further comprises the second nucleotide of a 3' Group I intron splice site dinucleotide. In some embodiments, the 3' exon fragment comprises 1 to 100 naturally occurring nucleotides derived from a naturally occurring exon. In some embodiments, the naturally occurring exon is derived from a Group I intron-containing gene or a fragment thereof. In some embodiments, the naturally occurring exon is derived from Anabaena bacteria, T4 phage virus, Twort bacteriophage, Tetrahymena, or Azoarcus bacteria.

[0030] In some embodiments, the 5'-enhancing exon element comprises a 5' internal spacer sequence located downstream of the 3' exon fragment. In some embodiments, the 5' internal spacer sequence is about 6-60 nucleotides in length. In some embodiments, the 5' internal spacer sequence comprises or consists of a sequence selected from SEQ ID NOs: 3094-3152.

[0031] In some embodiments, the 5'-enhancing exon element comprises, in the following order: a. a 3' exon fragment comprising the second nucleotide of the 3' Group I intron splice site dinucleotide; and b. a 5' internal spacer sequence, wherein the 3' exon fragment comprises between 1 and 100 naturally occurring nucleotides derived from the naturally occurring exon.

[0032] In some embodiments, the 5'-enhanced exon element comprises, in the following order: a. a 3' exon fragment; and b. a 5' internal spacer sequence, wherein the 3' exon fragment comprises 1 to 100 naturally occurring nucleotides from a naturally occurring exon; and the 5'-enhanced intron element comprises a 3' intron fragment comprising the first and second nucleotides of a 3' Group I splice site dinucleotide.

[0033] In some embodiments, the 3'-enhancing exon element comprises a 5' exon fragment. In some embodiments, the 5' exon fragment comprises the first nucleotide of a 5' Group I intron fragment. In some embodiments, the 5' exon fragment comprises 1 to 100 nucleotides derived from a naturally occurring exon. In some embodiments, the naturally occurring exon is derived from a Group I intron-containing gene or a fragment thereof.

[0034] In some embodiments, the 3'-enhancing exon element comprises a 3' internal spacer sequence. In some embodiments, the 3' internal spacer sequence is located between the termination sequence and the 5' exon fragment. In some embodiments, the 3' internal spacer is about 6-60 nucleotides in length. In some embodiments, the 3' internal spacer comprises or consists of a sequence selected from SEQ ID NOs: 3094-3152.

[0035] In some embodiments, the 3'-enhancing exon element comprises: a. a 3' internal spacer sequence; and b. a 5' exon fragment comprising the first nucleotide of a 5' Group I intron splice site dinucleotide, wherein the 5' exon fragment comprises between 1 and 100 nucleotides derived from the native exon.

[0036] In some embodiments, the 3'-enhancing exon element comprises: a. a 3' internal spacer sequence; and b. a 5' exon fragment, wherein the 5' exon fragment comprises 1 to 100 nucleotides derived from a naturally occurring exon; and the 3'-enhancing intron element comprises a 5' intron fragment comprising the first and second nucleotides of a 5' Group I intron splice site dinucleotide.

[0037] In some embodiments, the 3'-enhancing intron element comprises a 5' intron fragment. In some embodiments, the 5' intron fragment comprises the second nucleotide of the 5' Group I intron splice site dinucleotide.

[0038] In some embodiments, the 3'-enhancing intron element comprises a trailing untranslated sequence located at the 3' end of the 5' intron, hi some embodiments, the trailing untranslated sequence comprises 3 to 12 nucleotides.

[0039] In some embodiments, the 3'-enhanced intron fragment comprises a 3' external spacer sequence. In some embodiments, the 3' external spacer sequence is located between the 5' intron fragment and the trailing untranslated sequence. In some embodiments, the 3' external spacer sequence has a length of 6 to 60 nucleotides. In some embodiments, the 3' external spacer sequence comprises or consists of a sequence selected from SEQ ID NOs: 3094-3152.

[0040] In some embodiments, the 3'-enhancing intron element comprises a 3' affinity sequence. In some embodiments, the 3' affinity sequence is located between the 3' external spacer sequence and the trailing untranslated sequence. In some embodiments, the 3' affinity sequence comprises a polyA, polyAC, or polypyrimidine sequence. In some embodiments, the affinity sequence comprises 10 to 100 nucleotides.

[0041] In some embodiments, the 5'-enhanced intron element further comprises a 5' exo duplex sequence, and the 3'-enhanced intron element further comprises a 3' exo duplex sequence. In some embodiments, the 5' exo duplex sequence and the 3' exo duplex sequence are fully or partially complementary to each other. In some embodiments, the 5' exo duplex sequence comprises fully synthetic or partially synthetic nucleotides. In some embodiments, the 3' exo duplex sequence comprises fully synthetic or partially synthetic nucleotides. In some embodiments, the 3' exo duplex sequence is about 6 to about 50 nucleotides. In some embodiments, the 5' exo duplex sequence is about 6 to about 50 nucleotides.

[0042] In some embodiments, the 5'-enhancing exon element further comprises a 5' internal duplex sequence, and the 3'-enhancing exon element further comprises a 3' internal duplex sequence. In some embodiments, the 5' internal duplex sequence and the 3' internal duplex sequence are fully or partially complementary to each other. In some embodiments, the 5' internal duplex sequence comprises fully synthetic or partially synthetic nucleotides. In some embodiments, the 3' internal duplex sequence comprises fully synthetic or partially synthetic nucleotides. In some embodiments, the 3' internal duplex sequence is from about 6 to about 19 nucleotides. In some embodiments, the 5' internal duplex sequence is from about 6 to about 19 nucleotides.

[0043] In some embodiments, the 3'-enhancing intron fragment comprises, in the following order: a. a 5' intron fragment comprising the second nucleotide of the 5' Group I intron splice site dinucleotide; b. a 3' external spacer sequence; and c. a 3' affinity sequence.

[0044] In some embodiments, the 3'-enhanced intron fragment comprises, in the following order: a. a 5' intron fragment comprising the first and second nucleotides of a 5' Group I intron splice site dinucleotide; b. a 3' external spacer sequence; and c. a 3' affinity sequence; and the 3'-enhanced exon element comprises a 5' exon fragment lacking the first nucleotide of the 5' Group I intron splice site dinucleotide.

[0045] In some embodiments, the provided RNA precursor polynucleotide comprises, in the following order: a. leading untranslated sequence, b. 5' affinity sequence, c. 5' external duplex sequence, d. 5' spacer sequence, e. 3' intron fragment, f. 3' exon fragment, g. 5' internal duplex sequence, h. 5' internal spacer sequence, i. translation initiation element, j. coding element, k. termination sequence, l. 3' internal spacer sequence, m. 3' internal duplex sequence, n. 5' exon fragment, o. 5' intron fragment, p. 3' external duplex sequence, q. 3' affinity sequence, and r. trailing untranslated sequence.

[0046] In some embodiments, the provided RNA precursor polynucleotide comprises, in the following order: a. leading untranslated sequence, b. 5' affinity sequence, c. 5' external spacer sequence, d. 3' intron fragment, e. 3' exon fragment, f. 5' internal duplex sequence, g. 5' internal spacer sequence, h. non-coding element, i. 3' internal spacer sequence, j. 3' internal duplex sequence, k. 5' exon fragment, l. 5' intron fragment, m. 3' external spacer sequence, n. 3' affinity sequence, and o. trailing untranslated sequence.

[0047] In some embodiments, the provided RNA precursor polynucleotide comprises, in the following order: a. leader untranslated sequence, b. 5' affinity sequence, c. 5' external spacer sequence, d. 3' intron fragment, e. 3' exon fragment, f. 5' internal duplex sequence, g. 5' internal spacer sequence, h. translation initiation element, i. coding element, j. termination sequence, k. 3' internal spacer sequence, l. 3' internal duplex sequence, m. 5' exon fragment, n. 5' intron fragment, o. 3' external spacer sequence, and p. 3' affinity sequence.

[0048] In some embodiments, the provided RNA precursor polynucleotide comprises, in the following order: a. leader untranslated sequence, b. 5' affinity sequence, c. 5' external spacer sequence, d. 3' intron fragment, e. 3' exon fragment, f. 5' internal spacer sequence, g. translation initiation element, h. coding element, i. termination sequence, j. 3' internal spacer sequence, k. 5' exon fragment, l. 5' intron fragment, m. 3' external spacer sequence, and n. 3' affinity sequence.

[0049] In some embodiments, the provided RNA precursor polynucleotide comprises, in the following order: a. leading untranslated sequence, b. 5' affinity sequence, c. 5' external spacer sequence, d. 3' intron fragment, e. 3' exon fragment, f. 5' internal spacer sequence, g. non-coding element, h. 3' internal spacer sequence, i. 5' exon fragment, j. 5' intron fragment, k. 3' external spacer sequence, l. 3' affinity sequence, and m. trailing untranslated sequence.

[0050] In some embodiments, the provided RNA precursor polynucleotide comprises, in the following order: a. leading untranslated sequence, b. 5' affinity sequence, c. 5' external duplex sequence, d. 5' spacer sequence, e. 3' intron fragment, f. 3' exon fragment, g. 5' internal duplex sequence, h. 5' internal spacer sequence, i. termination sequence, j. coding element, k. translation initiation element, l. 3' internal spacer sequence, m. 3' internal duplex sequence, n. 5' exon fragment, o. 5' intron fragment, p. 3' external duplex sequence, q. 3' affinity sequence, and r. trailing untranslated sequence.

[0051] In some embodiments, the coding element comprises two or more protein coding regions. In some embodiments, the RNA precursor polynucleotide comprises a polynucleotide sequence encoding a protein cleavage site or a ribosome stuttering element between the first expressed sequence and the second expressed sequence. In some embodiments, the ribosome stuttering element is a self-cleaving spacer. In some embodiments, the RNA precursor polynucleotide comprises a polynucleotide sequence encoding a 2A ribosome stuttering peptide.

[0052] In some embodiments, the core functional element comprises two or more internal ribosome entry sites (IRES). In some embodiments, the core functional element comprises a TIE, a coding element, a termination sequence, optionally a spacer, a TIE, a coding sequence, and a termination sequence, wherein the TIE comprises an IRES.

[0053] Also provided herein are circular RNA polynucleotides generated from the precursor RNA polynucleotides provided herein. In some embodiments, the RNA precursor polynucleotide is transcribed from a vector or DNA, including a PCR product, a linear plasmid, a non-linear plasmid, a linear minicircle, a non-linear minicircle, a viral vector, a cosmid, ceDNA, or an artificial chromosome. In some embodiments, the circular RNA polynucleotide is composed of naturally occurring nucleotides. In some embodiments, the protein-coding or non-coding sequence is codon-optimized. In some embodiments, the circular RNA polynucleotide is about 0.1 to about 15 kilobases in length. In some embodiments, the circular RNA polynucleotide is optimized to lack at least one microRNA-binding site present in an equivalent pre-optimized polynucleotide. In some embodiments, the circular RNA polynucleotide is optimized to lack at least one RNA editing-sensitive site present in an equivalent pre-optimized polynucleotide. In some embodiments, the circular RNA polynucleotide has a duration of therapeutic effect in vivo of at least 20 hours in humans. In some embodiments, the circular RNA polynucleotide has a functional half-life of at least 6 hours. In some embodiments, the circular RNA polynucleotide has a longer or equivalent duration of therapeutic effect in a human cell than an equivalent linear RNA polynucleotide comprising the same expression sequence, hi some embodiments, the circular RNA polynucleotide has a longer in vivo duration of therapeutic effect in a human than an equivalent linear RNA polynucleotide with the same expression sequence.

[0054] Also provided herein are methods for generating translation initiation elements (TIEs), comprising: (a) obtaining a viral untranslated region (UTR); (b) determining functional units of the UTR that can bind initiation factors and / or initiate translation by progressively deleting sequences; (c) removing non-functional units of the UTR; and (d) optionally modifying the ends of the UTR. In some embodiments, the modifications to the ends of the UTR are about 1% to 75% of the viral UTR. In some embodiments, the functional units of the UTR are determined by deletion scanning from the 5' and 3' ends of the UTR or mutation scanning along the length of the UTR to identify important regions.

[0055] Also provided herein are pharmaceutical compositions comprising a circular RNA polynucleotide provided herein, a nanoparticle, and, optionally, a targeting moiety operably linked to the nanoparticle. In some embodiments, the nanoparticle is a lipid nanoparticle, a core-shell nanoparticle, a biodegradable nanoparticle, a biodegradable lipid nanoparticle, a polymeric nanoparticle, a polyplex, or a biodegradable polymeric nanoparticle. In some embodiments, the pharmaceutical composition comprises a targeting moiety, which mediates receptor-mediated endocytosis, endosomal fusion, or direct fusion to selected cells of a selected cell population or tissue in the absence of cell isolation or purification. In some embodiments, the pharmaceutical composition comprises a targeting moiety operably linked to a nanoparticle. In some embodiments, the targeting moiety is a small molecule, scFv, nanobody, peptide, cyclic peptide, bicyclic or tricyclic peptide, minibody, polynucleotide aptamer, engineered scaffold protein, heavy chain variable region, light chain variable region, or fragments thereof. In some embodiments, less than 1% by weight of the polynucleotide in the composition is double-stranded RNA, a DNA splint, a DNA template, or triphosphorylated RNA. In some embodiments, less than 1% by weight of the polynucleotides and proteins in the pharmaceutical composition are double-stranded RNA, DNA splints, DNA templates, triphosphorylated RNA, phosphatase proteins, protein ligases, RNA polymerases, and capping enzymes.

[0056] Also provided herein is a pharmaceutical composition comprising a circular RNA polynucleotide provided herein and a liposome, a dendrimer, a carbohydrate carrier, a glycan nanomaterial, a fusome, an exosome, or a combination thereof.

[0057] Also provided herein is a pharmaceutical composition comprising a circular RNA polynucleotide provided herein and a pharmaceutical salt, buffer, diluent, or combination thereof.

[0058] Also provided herein are methods of treating a subject in need thereof, comprising administering a therapeutically effective amount of a composition comprising a circular RNA polynucleotide provided herein, a nanoparticle, and, optionally, a targeting moiety operably linked to the nanoparticle. In some embodiments, the targeting moiety is a small molecule, an scFv, a nanobody, a peptide, a cyclic peptide, a bicyclic or tricyclic peptide, a minibody, a heavy chain variable region, an engineered scaffold protein, a light chain variable region, or a fragment thereof. In some embodiments, the nanoparticle is a lipid nanoparticle, a core-shell nanoparticle, or a biodegradable nanoparticle. In some embodiments, the nanoparticle comprises one or more cationic lipids, ionizable lipids, or poly-β-aminoesters. In some embodiments, the nanoparticle comprises one or more non-cationic lipids. In some embodiments, the nanoparticle comprises one or more PEG-modified lipids, polyglutamic acid lipids, or hyaluronic acid lipids. In some embodiments, the nanoparticle comprises cholesterol. In some embodiments, the nanoparticle comprises arachidonic acid, leukotrienes, or oleic acid. In some embodiments, the composition comprises a targeting moiety, wherein the targeting moiety mediates receptor-mediated endocytosis selectively into cells of a selected cell population in the absence of cell selection or purification. In some embodiments, provided nanoparticles comprise more than one circular RNA polynucleotide.In some embodiments, the subject is diagnosed with acute myeloid leukemia (AML), alveolar rhabdomyosarcoma, B-cell malignancies, bladder cancer (e.g., bladder carcinoma), bone cancer, brain cancer (e.g., medulloblastoma and glioblastoma multiforme), breast cancer, cancer of the anus, anal canal, or anorectum, eye cancer, cancer of the intrahepatic bile duct, cancer of the joints, neck cancer, gallbladder cancer, pleural cancer, cancer of the nose, nasal cavity, or middle ear, cancer of the oral cavity, cancer of the vulva, chronic lymphocytic leukemia, chronic myeloid carcinoma, colon cancer, esophageal cancer, cervical cancer, fibrosarcoma, gastrointestinal carcinoid tumor, head and neck cancer (e.g., head and neck squamous cell carcinoma), Hodgkin's lymphoma, sarcoma ... The patient has cancer selected from the group consisting of pharyngeal cancer, kidney cancer, laryngeal cancer, leukemia, liquid tumor, lipoma, liver cancer, lung cancer (e.g., non-small cell lung cancer, lung adenocarcinoma, and small cell lung cancer), lymphoma, mesothelioma, mast cell tumor, melanoma, multiple myeloma, nasopharyngeal cancer, non-Hodgkin's lymphoma, B-chronic lymphocytic leukemia, hairy cell leukemia, Burkitt lymphoma, ovarian cancer, pancreatic cancer, peritoneal cancer, omental cancer, mesenteric cancer, pharyngeal cancer, prostate cancer, rectal cancer, renal cancer, skin cancer, small intestine cancer, soft tissue cancer, solid tumor, synovial sarcoma, gastric cancer, teratoma, testicular cancer, thyroid cancer, and ureteral cancer. In some embodiments, the subject has an autoimmune disorder selected from scleroderma, Graves' disease, Crohn's disease, Schoergen's disease, multiple sclerosis, Hashimoto's disease, psoriasis, myasthenia gravis, autoimmune polyendocrine deficiency syndrome, type 1 diabetes mellitus (TIDM), autoimmune gastritis, autoimmune uveoretinitis, polymyositis, colitis, thyroiditis, and systemic autoimmune diseases typified by human lupus.

[0059] Also provided herein are eukaryotic cells comprising the circular RNA polynucleotide or pharmaceutical composition provided herein. In some embodiments, the eukaryotic cells are human cells. In some embodiments, the eukaryotic cells are immune cells. In some embodiments, the eukaryotic cells are T cells, dendritic cells, macrophages, B cells, neutrophils, or basophils.

[0060] Also provided herein are prokaryotic cells comprising the circular RNA polynucleotides provided herein.

[0061] In another aspect, provided herein is a method for purifying circular RNA, the method comprising hybridizing an oligonucleotide conjugated to a solid surface with an affinity sequence.

[0062] In some embodiments, one or more copies of the affinity sequence are present in the RNA precursor. In some embodiments, the RNA precursor is a precursor described herein. In some embodiments, the circular RNA is a circular RNA described herein. In some embodiments, the affinity sequence is removed during the formation of the circular RNA. In some embodiments, the method includes separating the circular RNA from the RNA precursor.

[0063] In some embodiments, the affinity sequence comprises a polyA sequence. In some embodiments, the oligonucleotide that hybridizes to the affinity sequence is a deoxythymidine oligonucleotide. In some embodiments, the affinity sequence comprises a dedicated binding site (DBS). In some embodiments, the DBS comprises the nucleotide sequence TATAATTCTACCCTATTGAGGCATTGACTA (SEQ ID NO: 3269). In some embodiments, the oligonucleotide that hybridizes to the affinity sequence comprises a sequence complementary to the DBS.

[0064] In another aspect, provided herein is a method of purifying circular RNA, the method comprising: a. contacting a composition comprising linear RNA and circular RNA with a binding agent that preferentially binds linear RNA over circular RNA; and b. separating the RNA bound to the binding agent from RNA that is not bound to the binding agent.

[0065] In some embodiments, the binding agent is conjugated to a solid support. In some embodiments, the solid support comprises agarose, an agarose-derived resin, cellulose, cellulose fibers, magnetic beads, a high-throughput microtiter plate, a non-agarose resin, a glass surface, a polymer surface, or a combination thereof. In some embodiments, the solid support comprises agarose or cellulose.

[0066] In some embodiments, the binding agent comprises an oligonucleotide that is complementary to a sequence present in the linear RNA but absent from the circular RNA. In some embodiments, the binding agent comprises an oligonucleotide that is 100% complementary to a sequence present in the linear RNA but absent from the circular RNA. In some embodiments, the sequence present in the linear RNA but absent from the circular RNA is an affinity sequence. In some embodiments, the sequence present in the linear RNA but absent from the circular RNA comprises a polyA sequence. In some embodiments, the binding agent comprises an oligonucleotide that comprises a polydeoxythymidine sequence. In some embodiments, the sequence present in the linear RNA but absent from the circular RNA comprises a DBS sequence. In some embodiments, the DBS sequence comprises the nucleotide sequence TATAATTCTACCCTATTGAGGCATTGACTA (SEQ ID NO: 3269). In some embodiments, the sequence present in the linear RNA but absent from the circular RNA is 10 to 150 nucleotides in length. In some embodiments, the sequence present in the linear RNA but absent from the circular RNA is 10 to 70 nucleotides in length. In some embodiments, the sequence present in the linear RNA but absent from the circular RNA is 20 to 30 nucleotides in length. In some embodiments, the sequence present in the linear RNA but absent in the circular RNA is present at two positions in the linear RNA. In some embodiments, the sequence present in the linear RNA but absent in the circular RNA is encoded in the linear RNA during transcription of the linear RNA. In some embodiments, the sequence present in the linear RNA but absent in the circular RNA is enzymatically added to the linear RNA. In some embodiments, the linear RNA does not contain a methylguanylate cap. In some embodiments, the linear RNA comprises an RNA precursor or a fragment thereof.

[0067] In some embodiments, the RNA precursor is an RNA precursor described herein or a fragment thereof. In some embodiments, the RNA precursor is produced using in vitro transcription (IVT). In some embodiments, the fragment comprises an intron. In some embodiments, the linear RNA comprises prematurely terminated RNA or RNA formed by incomplete transcription.

[0068] In some embodiments, the circular RNA comprises the circular RNA described herein. In some embodiments, the circular RNA is produced using a method comprising splicing RNA precursors. In some embodiments, sequences present in linear RNA but absent in circular RNA are excised during splicing. In some embodiments, the circular RNA is less than 6 kilobases in size.

[0069] In some embodiments, the separating comprises removing the unbound RNA from the solid support, hi some embodiments, the removing comprises eluting the unbound RNA from the solid support.

[0070] In some embodiments, the method includes heating the composition. In some embodiments, the method includes buffer exchange. In some embodiments, buffer exchange is performed before contacting. In some embodiments, buffer exchange is performed after separating. In some embodiments, buffer exchange is performed before contacting, and the resulting buffer contains more than 1 mM monovalent salt. In some embodiments, the monovalent salt is NaCl or KCl. In some embodiments, the resulting buffer contains Tris. In some embodiments, the resulting buffer contains EDTA. In some embodiments, buffer exchange is performed after separating into a storage buffer, and the storage buffer contains 1 mM sodium citrate, pH 6.5. In some embodiments, the method includes filtering the circular RNA after separating. [Brief explanation of the drawings]

[0071] [Figure 1A] 1 shows luminescence in the supernatant of HEK293 cells 24 hours after transfection with circular RNAs containing a Gaussia luciferase expression sequence and various IRES sequences. [Figure 1B] 1 shows luminescence in the supernatant of HepG2 cells 24 hours after transfection with circular RNAs containing a Gaussia luciferase expression sequence and various IRES sequences. [Figure 1C] 1 shows luminescence in the supernatant of 1C1C7 cells 24 hours after transfection with circular RNAs containing a Gaussia luciferase expression sequence and various IRES sequences. [Figure 1D] 1 shows luminescence in the supernatant of HEK293 cells 24 hours after transfection with circular RNAs containing a Gaussia luciferase expression sequence and various IRES sequences. [Figure 1E] 1 shows luminescence in the supernatant of HEK293 cells 24 hours after transfection with circular RNAs containing a Gaussia luciferase expression sequence and various IRES sequences. [Figure 2] Luminescence in the supernatant of HEK293 (A), HepG2 (B), or 1C1C7 (C) cells 24 hours after transfection with circular RNAs containing a Gaussia luciferase expression sequence and various IRES sequences of different lengths is shown. [Figure 3] Stability of selected IRES constructs in HepG2 (A) or 1C1C7 (B) cells over a 3 day period as measured by luminescence. [Figure 4] 1 shows protein expression from selected IRES constructs in Jurkat cells as measured by luminescence from secreted Gaussia luciferase in the cell supernatant. [Figure 5] 1 shows the stability of selected IRES constructs in Jurkat cells over a 3 day period as measured by luminescence. [Figure 6A] A comparison of the 24-hour luminescence of modified linear, unpurified circular, or purified circular RNA encoding Gaussia luciferase is shown. [Figure 6B] A comparison of the relative luminescence over a 3-day period of modified linear, unpurified circular, or purified circular RNA encoding Gaussia luciferase is shown. [Figure 7A] Figure 1 shows the transcription induction of IFNγ after electroporation of Jurkat cells with modified linear, unpurified circular, or purified circular RNA. [Figure 7B] Figure 1 shows the induction of IL-6 transcripts after electroporation of Jurkat cells with modified linear, unpurified circular, or purified circular RNA. [Figure 7C] Figure 1 shows the induction of IL-2 transcripts after electroporation of Jurkat cells with modified linear, unpurified circular, or purified circular RNA. [Figure 7D] Figure 1 shows the transcription induction of RIG-I after electroporation of Jurkat cells with modified linear, unpurified circular, or purified circular RNA. [Figure 7E] Figure 1 shows the induction of IFN-β1 transcripts after electroporation of Jurkat cells with modified linear, unpurified circular, or purified circular RNA. [Figure 7F] Figure 1 shows the induction of TNFα transcripts after electroporation of Jurkat cells with modified linear, unpurified circular, or purified circular RNA. [Figure 8A] 1 shows a comparison of the luminescence of circular and modified linear RNAs encoding Gaussia luciferase in human primary monocytes. [Figure 8B] 1 shows a comparison of the luminescence of circular and modified linear RNAs encoding Gaussia luciferase in macrophages. [Figure 8C] 1 shows a comparison of the luminescence of circular and modified linear RNAs encoding Gaussia luciferase in macrophages. [Figure 9] Relative luminescence over 3 days (A) or 24-hour luminescence (B) in supernatants of primary T cells after transduction with circular RNAs containing a Gaussia luciferase expression sequence and various IRES sequences. [Figure 10A]24-hour luminescence in supernatants of primary T cells after transduction with circular or modified linear RNA containing a Gaussia luciferase expression sequence is shown. [Figure 10B] Relative luminescence over 3 days in supernatants of primary T cells after transduction with circular or modified linear RNA containing a Gaussia luciferase expression sequence is shown. [Figure 10C] 24-hour luminescence in PBMCs of primary T cells after transduction with circular or modified linear RNA containing a Gaussia luciferase expression sequence is shown. [Figure 11] HPLC chromatograms (A) and circularization efficiencies (B) of RNA constructs with different permutation sites are shown. [Figure 12] HPLC chromatograms (A) and circularization efficiencies (B) of RNA constructs with different introns and / or permutation sites are shown. [Figure 13A] HPLC chromatograms of three RNA constructs with and without homology arms are shown. [Figure 13B] Circularization efficiencies of three RNA constructs with and without homology arms are shown. [Figure 14] Circularization efficiencies of three RNA constructs with no homologous arms or with homologous arms of various lengths and GC content are shown. [Figure 15A] HPLC chromatograms showing the contribution of strong homology arms to improved splicing efficiency, the relationship between circularization efficiency and nicking in selected constructs, and combinations of permutation sites and homology arms hypothesized to show improved circularization efficiency are shown. [Figure 15B] HPLC chromatograms showing the contribution of strong homology arms to improved splicing efficiency, the relationship between circularization efficiency and nicking in selected constructs, and combinations of permutation sites and homology arms hypothesized to show improved circularization efficiency are shown. [Figure 16]Fluorescence images of mock-electroporated (left) or CAR-encoding circular RNA (right) T cells co-cultured with Raji cells expressing GFP and firefly luciferase are shown. [Figure 17] Brightfield (left), fluorescent (center), and overlay (right) images of T cells mock-electroporated (top) or electroporated with circular RNA encoding CAR (bottom) and co-cultured with Raji cells expressing GFP and firefly luciferase are shown. [Figure 18] Specific lysis of Raji target cells by T cells mock-electroporated or electroporated with circular RNAs encoding different CAR sequences is shown. [Figure 19] Luminescence in the supernatant of Jurkat cells (left) or resting primary human CD3+ T cells (right) 24 hours after transduction with linear or circular RNAs containing a Gaussia luciferase expression sequence and various IRES sequences (A) and relative luminescence over 3 days (B) are shown. [Figure 20A] Figure 1 shows the induction of IFN-β1 transcripts after electroporation of human CD3+ T cells with modified linear, unpurified circular, or purified circular RNA. [Figure 20B] Figure 1 shows transcript induction of RIG-I after electroporation of human CD3+ T cells with modified linear, unpurified circular, or purified circular RNA. [Figure 20C] Figure 1 shows the transcription induction of IL-2 after electroporation of human CD3+ T cells with modified linear, unpurified circular, or purified circular RNA. [Figure 20D] Figure 1 shows the transcript induction of IL-6 after electroporation of human CD3+ T cells with modified linear, unpurified circular, or purified circular RNA. [Figure 20E] Figure 1 shows the transcript induction of IFNγ after electroporation of human CD3+ T cells with modified linear, unpurified circular, or purified circular RNA. [Figure 20F]Figure 1 shows the transcription induction of TNFα after electroporation of human CD3+ T cells with modified linear, unpurified circular, or purified circular RNA. [Figure 21A] Figure 1 shows specific lysis of Raji target cells by human primary CD3+ T cells electroporated with circRNA encoding a CAR, as determined by detection of firefly luminescence. [Figure 21B] IFNγ transcript induction 24 hours after electroporation with different amounts of circular or linear RNA encoding the CAR sequence is shown. [Figure 22] Specific lysis of target or non-target cells by human primary CD3+ T cells electroporated with circular or linear RNA encoding a CAR at different E:T ratios (A and B) as determined by detection of firefly luminescence. [Figure 23] Specific lysis of target cells by human CD3+ T cells electroporated with RNA encoding a CAR at 1, 3, 5, and 7 days after electroporation. [Figure 24] Specific lysis of target cells by human CD3+ T cells electroporated with circular RNA encoding CD19- or BCMA-targeted CARs is shown. [Figure 25] 1 shows total flux from organs harvested from CD-1 mice dosed with circular RNA encoding FLuc formulated with 50% lipid 10b-15, 10% DSPC, 1.5% PEG-DMG, and 38.5% cholesterol. [Figure 26] 1 shows luminescence-enhancing images of organs taken from CD-1 mice dosed with circular RNA encoding FLuc formulated in 50% lipid 10b-15, 10% DSPC, 1.5% PEG-DMG, and 38.5% cholesterol. [Figure 27A] 1 shows the molecular characterization of lipids 10a-26 and 10a-27. FIG. 2 shows the proton nuclear magnetic resonance (NMR) spectrum of lipid 10a-26. [Figure 27B]Molecular characterization of lipids 10a-26 and 10a-27. Retention time of lipid 10a-26 measured by liquid chromatography-mass spectrometry (LC-MS) is shown. [Figure 27C] 1 shows the molecular characterization of lipids 10a-26 and 10a-27. FIG. 2 shows the mass spectrum of lipid 10a-26. [Figure 27D] 1 shows the molecular characterization of lipids 10a-26 and 10a-27. FIG. 2 shows the proton NMR spectrum of lipid 10a-27. [Figure 27E] 1 shows the molecular characterization of lipids 10a-26 and 10a-27. The retention time of lipid 10a-27 measured by LC-MS is shown. [Figure 27F] 1 shows the molecular characterization of lipids 10a-26 and 10a-27. FIG. 2 shows the mass spectrum of lipid 10a-27. [Figure 28A] Molecular characterization of lipid 22-S14 and its synthetic intermediates. NMR spectrum of 2-(tetradecylthio)ethan-1-ol. [Figure 28B] Molecular characterization of lipid 22-S14 and its synthetic intermediates. NMR spectrum of 2-(tetradecylthio)ethyl acrylate. [Figure 28C] Molecular characterization of lipid 22-S14 and its synthetic intermediates. NMR spectrum of bis(2-(tetradecylthio)ethyl) 3,3'-((3-(2-methyl-1H-imidazol-1-yl)propyl)azanedyl)dipropionate (lipid 22-S14). [Figure 29] Figure 1 shows the NMR spectrum of bis(2-(tetradecylthio)ethyl) 3,3'-((3-(1H-imidazol-1-yl)propyl)azanedyl)dipropionate (lipid 93-S14). [Figure 30A] Molecular characterization of heptadecan-9-yl 8-((3-(2-methyl-1H-imidazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (lipid 10a-54). Proton NMR spectrum of lipid 10a-54. [Figure 30B]Molecular characterization of heptadecan-9-yl 8-((3-(2-methyl-1H-imidazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (lipid 10a-54). Retention times of lipid 10a-54 measured by LC-MS are shown. [Figure 30C] Molecular characterization of heptadecan-9-yl 8-((3-(2-methyl-1H-imidazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (lipid 10a-54). Mass spectrum of lipid 10a-54. [Figure 31A] Molecular characterization of heptadecan-9-yl 8-((3-(1H-imidazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (lipid 10a-53). Proton NMR spectrum of lipid 10a-53. [Figure 31B] Molecular characterization of heptadecan-9-yl 8-((3-(1H-imidazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (lipid 10a-53). Retention times of lipid 10a-53 measured by LC-MS are shown. [Figure 31C] Molecular characterization of heptadecan-9-yl 8-((3-(1H-imidazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (lipid 10a-53). Mass spectrum of lipid 10a-53. [Figure 32] (A) shows the total flux of spleen and liver from CD-1 mice dosed with circular RNA encoding firefly luciferase (FLuc) and formulated with the ionizable lipids of interest, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) at a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. (B) shows the mean brightness for the biodistribution of protein expression. [Figure 33](A) shows luminescence-enhancing images of organs from CD-1 mice administered circular RNA encoding FLuc formulated with the ionizable lipid 22-S14, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) at a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. (B) shows whole-body IVIS images of CD-1 mice administered circular RNA encoding FLuc formulated with the ionizable lipid 22-S14, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) at a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. [Figure 34] (A) shows luminescence-enhancing images of organs from CD-1 mice administered circular RNA encoding FLuc formulated with ionizable lipids 93-S14, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) at a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. (B) shows whole-body IVIS images of CD-1 mice administered circular RNA encoding FLuc formulated with ionizable lipids 93-S14, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) at a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. [Figure 35] (A) shows luminescence-enhanced images of organs from CD-1 mice administered circular RNA encoding FLuc formulated with ionizable lipid 10a-26, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) at a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. (B) shows whole-body IVIS images from CD-1 mice administered circular RNA encoding FLuc formulated with ionizable lipid 10a-26, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) at a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. [Figure 36A]Images highlighting luminescence of organs harvested from c57BL / 6J mice dosed with circular RNA encoding FLuc and encapsulated in lipid nanoparticles formed with lipid 10b-15 (A), lipid 10a-53 (B), or lipid 10a-54 (C). PBS was used as a control (D). [Figure 36B] Images highlighting luminescence of organs harvested from c57BL / 6J mice dosed with circular RNA encoding FLuc and encapsulated in lipid nanoparticles formed with lipid 10b-15 (A), lipid 10a-53 (B), or lipid 10a-54 (C). PBS was used as a control (D). [Figure 36C] Images highlighting luminescence of organs harvested from c57BL / 6J mice dosed with circular RNA encoding FLuc and encapsulated in lipid nanoparticles formed with lipid 10b-15 (A), lipid 10a-53 (B), or lipid 10a-54 (C). PBS was used as a control (D). [Figure 36D] Images highlighting luminescence of organs harvested from c57BL / 6J mice dosed with circular RNA encoding FLuc and encapsulated in lipid nanoparticles formed with lipid 10b-15 (A), lipid 10a-53 (B), or lipid 10a-54 (C). PBS was used as a control (D). [Figure 37] 1 shows the relative luminescence in lysates of human PBMCs after 24 hours of incubation with test lipid nanoparticles containing circular RNA encoding firefly luciferase. [Figure 38] Shown is the expression of GFP (A) and CD19 CAR (B) in human PBMCs after incubation with test lipid nanoparticles containing circular RNA encoding either GFP or CD19 CAR. [Figure 39] 1 shows the expression of anti-murine CD19 CAR in 1C1C7 cells lipotransfected with circular RNAs containing the anti-murine CD19 CAR expression sequence and various IRES sequences. [Figure 40]1 shows the cytotoxicity of anti-murine CD19 CAR against murine T cells. The CD19 CAR is encoded by circular RNA electroporated into and expressed in murine T cells. [Figure 41A] 1 shows B cell counts in peripheral blood in C57BL / 6J mice injected every other day with test lipid nanoparticles encapsulating circular RNA encoding an anti-murine CD19 CAR. [Figure 41B] 1 shows B cell counts in peripheral blood in C57BL / 6J mice injected every other day with test lipid nanoparticles encapsulating circular RNA encoding an anti-murine CD19 CAR. [Figure 41C] 1 shows the number of B cells in the spleen in C57BL / 6J mice injected every other day with test lipid nanoparticles encapsulating circular RNA encoding an anti-murine CD19 CAR. [Figure 42] Expression levels of anti-human CD19 CAR expressed from circular RNA are compared to those expressed from linear mRNA. [Figure 43] The cytotoxic effect of anti-human CD19 CAR expressed from circular RNA is compared to that expressed from linear mRNA. [Figure 44] Shows the cytotoxicity of two CARs (anti-human CD19 CAR and anti-human BCMA CAR) expressed from a single circular RNA in T cells. [Figure 45A] Representative FACS plots are shown with the frequency of tdTomato expression in various splenic immune cell subsets following treatment with LNPs formed with lipid 10a-27 or 10a-26 or lipid 10b-15. [Figure 45B] Quantification of the percentage of myeloid, B, and T cells expressing tdTomato, equivalent to the percentage of each cell population successfully transfected with Cre circular RNA, is shown (mean + standard deviation, n = 3). [Figure 45C] The percentage of additional splenic immune cell populations, including NK cells, classical monocytes, non-classical monocytes, neutrophils, and dendritic cells, that express tdTomato after treatment with lipids 27 and 26 are shown (mean + standard deviation, n=3). [Figure 46A] 1 shows an exemplary RNA construct design with a built-in polyA sequence in an intron. [Figure 46B] Chromatography trace of unpurified circular RNA is shown. [Figure 46C] Chromatography trace of affinity purified circular RNA is shown. [Figure 46D] Immunogenicity of circular RNAs prepared using various in vitro transcription (IVT) conditions and purification methods is shown (Commercial = commercial IVT mix; Custom = customized IVT mix; Aff = affinity purified; Enz = enzyme purified; GMP:GTP ratio = 8, 12.5, or 13.75). [Figure 47] A shows an exemplary RNA construct design with a dedicated binding sequence of TATAATTCTACCCTATTGAGGCATTGACTA (SEQ ID NO: 3269) as an alternative to polyA for hybridization purification. B shows a chromatographic trace of unpurified circular RNA. C shows a chromatographic trace of affinity-purified circular RNA. [Figure 48] A shows a chromatographic trace of unpurified circular RNA encoding dystrophin. B shows a chromatographic trace of enzyme-purified circular RNA encoding dystrophin. [Figure 49] Comparison of the expression (A) and stability (B) of purified circRNAs with different 5' spacers between the 3' intron fragment / 5' internal duplex region and the IRES in Jurkat cells (AC = only A and C were used in the spacer sequence; UC = only U and C were used in the spacer sequence). [Figure 50] Luminescence expression levels and stability of expression in primary T cells from circular RNAs containing the indicated original or modified IRES elements are shown. [Figure 51] Figure 1 shows the luminescence expression levels and stability of expression in HepG2 cells from circular RNAs containing the original or modified IRES elements as indicated. [Figure 52]Figure 1 shows the luminescence expression levels and stability of expression in 1C1C7 cells from circular RNAs containing the original or modified IRES elements as indicated. [Figure 53] Figure 1 shows the luminescence expression level and stability in HepG2 cells from circular RNAs containing an IRES element or a hybrid IRES element with an inserted untranslated region (UTR). "Scr" means scrambled, which was used as a control. [Figure 54] 1 shows the luminescence expression level and stability of expression in 1C1C7 cells from circular RNAs containing an IRES and a variable stop codon cassette operably linked to a sequence encoding Gaussia luciferase. [Figure 55] 1 shows the luminescence expression level and stability of expression in 1C1C7 cells from circular RNAs containing an IRES and a variable untranslated region (UTR) inserted before the start codon of the Gaussia luciferase-encoding sequence. [Figure 56] 1 shows the expression levels of human erythropoietin (hEPO) in Huh7 cells from circular RNA containing two miR-122 target sites downstream of the hEPO coding sequence. [Figure 57] Luminescence expression levels in SupT1 cells (derived from a human T cell tumor line) and MV4-11 cells (derived from a human macrophage line) from LNPs transfected in vitro with circular RNA encoding firefly luciferase are shown. [Figure 58] 1 shows a comparison of ApoE-dependence of transfected primary human T cell LNPs containing circular RNA based on different helper lipid, PEG-lipid, and ionizable lipid:phosphate ratio formulations. [Figure 59] 1 shows the uptake of LNPs containing circular RNA encoding eGFP into activated primary human T cells with or without the assistance of ApoE3. [Figure 60] Figure 1 shows immune cell expression from LNPs containing circular RNA encoding Cre fluorescent protein in a Cre reporter mouse model. [Figure 61]1 shows immune cell expression of mOX40L in wild-type mice after intravenous injection of LNPs transfected with circular RNA encoding mOX40L. [Figure 62A] A single dose of mOX40L in LNPs transfected with circular RNA capable of expressing mOX40L is shown. The percentage of mOX40L expression in splenic T cells, CD4+ T cells, CD8+ T cells, B cells, NK cells, dendritic cells, and other myeloid cells is provided. [Figure 62B] A single dose of mOX40L in LNPs transfected with circular RNA capable of expressing mOX40L is shown. The percentage of mOX40L expression in splenic T cells, CD4+ T cells, CD8+ T cells, B cells, NK cells, dendritic cells, and other myeloid cells is provided. [Figure 62C] 1 shows a single dose of mOX40L in LNPs transfected with circular RNA capable of expressing mOX40L, and shows changes in mouse weight 24 hours after transfection. [Figure 63] Figure 1 shows B cell depletion in mice after intravenous transfection of circular RNA with LNP. (A) Quantifies B cell depletion of live CD45+ immune cells by B220+ B cells. (B) Compares B cell depletion of live CD45+ immune cells by B220+ B cells compared to luciferase-expressing circular RNA. (C) B cell mass increase in transfected cells. [Figure 64] The figures show the CAR expression levels in peripheral blood (A) and spleen (B) after treatment with LNPs encapsulating circular RNA expressing anti-CD19 CAR. Anti-CD20 (aCD20) and luciferase-encoding circular RNA (oLuc) were used for comparison. [Figure 65]Figure 1 shows the overall frequency of anti-CD19 CAR expression, the frequency of anti-CD19 CAR expression on the cell surface, and the effect of IRES-specific circular RNA encoding anti-CD19 CAR on T cells on the anti-tumor response. A shows the geometric mean fluorescence intensity of the anti-CD19 CAR, B shows the percentage of anti-CD19 CAR expression, and C shows the percentage of target cell lysis performed by the anti-CD19 CAR. (CK = caprine kobuvirus; AP = apodemus picornavirus; CK* = codon-optimized caprine kobuvirus; PV = parabovirus; SV = salivirus). [Figure 66] CAR expression levels in A20 FLuc target cells upon treatment with IRES-specific circular RNA constructs are shown. [Figure 67] Luminescent expression levels of cytoplasmic (A) and surface (B) proteins from circular RNA in primary human T cells are shown. [Figure 68A] Figure 1 shows luminescence expression in human T cells when treated with an IRES-specific circular construct. Expression in circular RNA constructs was compared to linear mRNA. Gaussia luciferase expression in multiple donor cells is provided. [Figure 68B] Figure 1 shows luminescence expression in human T cells when treated with an IRES-specific circular construct. Expression in circular RNA constructs was compared to linear mRNA. Gaussia luciferase expression in multiple donor cells is provided. [Figure 68C] Figure 1 shows luminescence expression in human T cells when treated with an IRES-specific circular construct. Expression in circular RNA constructs was compared to linear mRNA. Firefly luciferase expression in multiple donor cells is provided. [Figure 68D] Figure 1 shows luminescence expression in human T cells when treated with an IRES-specific circular construct. Expression in circular RNA constructs was compared to linear mRNA. Firefly luciferase expression in multiple donor cells is provided. [Figure 68E]Figure 1 shows luminescence expression in human T cells when treated with an IRES-specific circular construct. Expression in circular RNA constructs was compared to linear mRNA. Firefly luciferase expression in multiple donor cells is provided. [Figure 68F] Figure 1 shows luminescence expression in human T cells when treated with an IRES-specific circular construct. Expression in circular RNA constructs was compared to linear mRNA. Firefly luciferase expression in multiple donor cells is provided. [Figure 68G] Figure 1 shows luminescence expression in human T cells when treated with an IRES-specific circular construct. Expression in circular RNA constructs was compared to linear mRNA. Gaussia luciferase expression in multiple donor cells is provided. [Figure 69] Expression of anti-CD19 CAR (A and B) and anti-BCMA CAR (B) in human T cells after treatment with lipid nanoparticles containing circular RNA encoding either anti-CD19 or anti-BCMA CAR on K562 cells expressing firefly luciferase. [Figure 70] 1 shows anti-CD19 CAR expression levels resulting from in vitro electroporation delivery of circular RNA encoding the anti-CD19 CAR in a specific antigen-dependent manner. A shows Nalm6 cell lysis by the anti-CD19 CAR. B shows K562 cell lysis by the anti-CD19 CAR. [Figure 71A] Transfection of LNPs expressing green fluorescent protein (GFP) and circular RNA in a solution containing LNPs via the use of ApoE3. Live / dead results are shown. [Figure 71B] 1 shows transfection of LNPs via the use of ApoE3 in a solution containing LNPs expressing green fluorescent protein (GFP) and circular RNA. Expression frequencies for multiple donors are provided. [Figure 71C] 1 shows transfection of LNPs via the use of ApoE3 in a solution containing LNPs expressing green fluorescent protein (GFP) and circular RNA. Expression frequencies for multiple donors are provided. [Figure 71D]1 shows transfection of LNPs via the use of ApoE3 in a solution containing LNPs expressing green fluorescent protein (GFP) and circular RNA. Expression frequencies for multiple donors are provided. [Figure 71E] 1 shows transfection of LNPs via the use of ApoE3 in a solution containing LNPs expressing green fluorescent protein (GFP) and circular RNA. Expression frequencies for multiple donors are provided. [Figure 72A] The total flux and expression rate of various lipid formulations are shown. See Example 74. [Figure 72B] The total flux and expression rate of various lipid formulations are shown. See Example 74. [Figure 72C] The total flux and expression rate of various lipid formulations are shown. See Example 74. [Figure 72D] The total flux and expression rate of various lipid formulations are shown. See Example 74. [Figure 72E] The total flux and expression rate of various lipid formulations are shown. See Example 74. [Figure 72F] The total flux and expression rate of various lipid formulations are shown. See Example 74. [Figure 72G] The total flux and expression rate of various lipid formulations are shown. See Example 74. [Figure 72H] The total flux and expression rate of various lipid formulations are shown. See Example 74. [Figure 72I] The total flux and expression rate of various lipid formulations are shown. See Example 74. [Figure 72J] The total flux and expression rate of various lipid formulations are shown. See Example 74. [Figure 72K] The total flux and expression rate of various lipid formulations are shown. See Example 74. [Figure 72L] The total flux and expression rate of various lipid formulations are shown. See Example 74. [Figure 73A]Figure 1 shows the circularization efficiency of an RNA molecule encoding a stabilized (double proline mutant) SARS-CoV2 spike protein. Figure 2 shows the in vitro transcription product of a circRNA encoding the approximately 4.5 kb SARS-CoV2 spike. [Figure 73B] Figure 1 shows the circularization efficiency of RNA molecules encoding the stabilized (double proline mutant) SARS-CoV2 spike protein. Figure 2 shows a histogram of spike protein surface expression by flow cytometry after transfection of spike-encoding circRNA into 293 cells. Transfected 293 cells were stained with CR3022 primary antibody and APC-labeled secondary antibody 24 hours after transfection. [Figure 73C] Figure 1 shows the circularization efficiency of RNA molecules encoding the stabilized (double proline mutant) SARS-CoV2 spike protein. Figure 2 shows flow cytometry plots of spike protein surface expression on 293 cells after transfection with spike-encoding cricRNA. Transfected 293 cells were stained with CR3022 primary antibody and APC-labeled secondary antibody 24 hours after transfection. [Figure 74] We offer multiple, controlled adjuvant strategies. The circRNA shown in the figure involves an in vitro unpurified sense circular RNA splicing reaction using GTP as an indicator molecule. 3p-circRNA involves purified sense circular RNA and a mixed, purified antisense circular RNA containing a triphosphorylated 5' end. (A) shows in vitro IFN-β induction in wild-type and MAVS knockout A549 cells, and (B) shows the in vivo cytokine response to formulated circRNAs generated using the indicated strategy. [Figure 75A] Figure 1 shows intramuscular delivery of LNPs containing circular RNA constructs. Live systemic IVIS is provided 6 hours after a 1 μg dose of LNP circular RNA construct. [Figure 75B] Figure 1 shows intramuscular delivery of LNPs containing circular RNA constructs followed by systemic IVIS 6 hours later. [Figure 75C]1 shows intramuscular delivery of LNPs containing circular RNA constructs and provides ex vivo expression profiles over a 24-hour period. [Figure 76] Figure 1 shows the expression of multiple circular RNAs from a single lipid formulation. A provides the hEPO titer from single and mixed sets of LNPs containing circular RNA constructs, and B provides the total flux of bioluminescence expression from single or mixed sets of LNPs containing circular RNA constructs. [Figure 77A] SARS-CoV2 spike protein expression of circular RNA encoding spike SARS-CoV2 protein. Frequency of spike CoV2 expression is shown. [Figure 77B] SARS-CoV2 spike protein expression is shown. Geometric mean fluorescence intensity (gMFI) of spike CoV2 expression is shown. [Figure 77C] Figure 1 shows SARS-CoV2 spike protein expression for circular RNAs encoding spike SARS-CoV2 proteins, comparing gMFI expression and expression frequency of constructs. [Figure 78] The general sequence structure of a linear RNA polynucleotide precursor (10) is shown. The sequence provided shows, in 5' to 3' order, a 5'-enhanced intronic element (20), a 5'-enhanced exonic element (30), a core functional element (40), a 3'-enhanced exonic element (50), and a 3'-enhanced intronic element (60). [Figure 79] Various exemplary repeats of the 5'-enhancing exon element (20) are shown. As shown, one repeat of the 5'-enhancing exon element (20) includes, from 5' to 3', the following order: leading untranslated sequence (21), 5' affinity tag (22), 5' external duplex region (24), 5' external spacer (26), and 3' intron fragment (28). [Figure 80] Various exemplary repeats of the 5'-enhancing exon element (30) are shown. As shown, one repeat of the 5'-enhancing exon element (30) includes, in 5' to 3' order, a 3' exon fragment (32), a 5' internal duplex region (34), and a 5' internal spacer (36). [Figure 81]Various exemplary repeats of a core functional element (40) are shown. As shown, one repeat of the core functional element (40) includes a TIE (42), a coding region (46), and a termination region (e.g., a stop codon or stop cassette) (48). Another repeat is shown to illustrate a core functional element (47) that includes a non-coding region (47). [Figure 82] Various exemplary repeats of the 3'-enhancing exon element (50) are shown. As shown, one repeat of the 3'-enhancing exon element (50) includes, in 5' to 3' order, a 3' internal spacer (52), a 3' internal duplex region (54), and a 5' exon fragment (56). [Figure 83] Various exemplary repeats of the 3'-enhanced intron element (60) are shown. As shown, one repeat of the 3'-enhanced intron element (60) includes, in the following order: a 5' intron fragment (62), a 3' external spacer (64), a 3' external duplex region (66), a 3' affinity tag (68), and terminal untranslated sequence (69). [Figure 84] Various exemplary repeats of a translation initiation element (TIE) (42) are shown. In one repeat, the TIE (42) sequence as exemplified is an IRES (43) only. In another repeat, the TIE (42) is an aptamer (44). In two different repeats, the TIE (42) is a combination of an aptamer (44) and an IRES (43). In another repeat, the TIE (42) is an aptamer complex (45). [Figure 85] The following is an example of a linear RNA polynucleotide precursor (10), including, in 5' to 3' order: a leading untranslated sequence (21), a 5' affinity tag (22), a 5' external duplex region (24), a 5' external spacer (26), a 3' intron fragment (28), a 3' exon fragment (32), a 5' internal duplex region (34), a 5' internal spacer (36), a TIE (42), a coding element (46), a termination region (48), a 3' internal spacer (52), a 3' internal duplex region (54), a 5' exon fragment (56), a 5' intron fragment (62), a 3' external spacer (64), a 3' external duplex region (66), a 3' affinity tag (68), and a terminal untranslated sequence (69). [Figure 86]The following is an example of a linear RNA polynucleotide precursor (10), including, in 5' to 3' order: a leading untranslated sequence (21), a 5' affinity tag (22), a 5' external duplex region (24), a 5' external spacer (26), a 3' intron fragment (28), a 3' exon fragment (32), a 5' internal duplex region (34), a 5' internal spacer (36), a coding element (46), a termination region (48), a TIE (42), a 3' internal spacer (52), a 3' internal duplex region (54), a 5' exon fragment (56), a 5' intron fragment (62), a 3' external spacer (64), a 3' external duplex region (66), a 3' affinity tag (68), and a terminal untranslated sequence (69). [Figure 87] The following is an example of a linear RNA polynucleotide precursor (10), including, in 5' to 3' order: a leading untranslated sequence (21), a 5' affinity tag (22), a 5' external duplex region (24), a 5' external spacer (26), a 3' intron fragment (28), a 3' exon fragment (32), a 5' internal duplex region (34), a 5' internal spacer (36), a non-coding element (47), a 3' internal spacer (52), a 3' internal duplex region (54), a 5' exon fragment (56), a 5' intron fragment (62), a 3' external spacer (64), a 3' external duplex region (66), a 3' affinity tag (68), and a terminal untranslated sequence (69). [Figure 88] The general circular RNA (8) structure formed after splicing is shown. The circular RNA shown contains 5' exon elements (30), core functional elements (40), and 3' exon elements (50). [Figure 89A] Illustrating various ways in which accessory elements (70) (e.g., miRNA binding sites) can be included in linear RNA polynucleotides, a linear RNA polynucleotide is shown containing accessory elements (70) in the spacer region. [Figure 89B] Illustrating various ways in which accessory elements (70) (e.g., miRNA binding sites) can be included in a linear RNA polynucleotide, a linear RNA polynucleotide is shown that includes accessory elements (70) located between each of the outer duplex regions and an exon fragment. [Figure 89C]1 illustrates various ways in which an accessory element (70) (e.g., a miRNA binding site) can be included in a linear RNA polynucleotide. An accessory element (70) within a spacer is shown. [Figure 89D] 1 illustrates various ways in which accessory elements (70) (e.g., miRNA binding sites) can be included in a linear RNA polynucleotide. Various iterations of accessory elements (70) located within a core functional element are shown. [Figure 89E] 1 illustrates various ways in which accessory elements (70) (e.g., miRNA binding sites) can be included in a linear RNA polynucleotide. An accessory element (70) located within an internal ribosome entry site (IRES) is shown. [Figure 90A] 1 shows in vitro screening of LNPs formulated with circular RNA encoding firefly luciferase and bearing a TIE at various doses in primary human hepatocytes. [Figure 90B] 1 shows in vitro screening of LNPs formulated with circular RNA encoding firefly luciferase and bearing a TIE at various doses in mouse hepatocytes. [Figure 90C] 1 shows in vitro screening of LNPs formulated with circular RNA encoding firefly luciferase and bearing a TIE at various doses in cynomolgus monkey hepatocytes. [Figure 91A] 1 shows in vitro screening of LNPs formulated with circular RNA encoding firefly luciferase and bearing a TIE at various doses in primary human hepatocytes from three different donors. [Figure 91B] 1 shows in vitro screening of LNPs formulated with circular RNA encoding firefly luciferase and bearing a TIE at various doses in primary human hepatocytes from three different donors. [Figure 91C] 1 shows in vitro screening of LNPs formulated with circular RNA encoding firefly luciferase and bearing a TIE at various doses in primary human hepatocytes from three different donors. [Figure 92]1 shows the in vitro expression of LNPs formulated with circular RNA encoding GFP and bearing a TIE in HeLa, HEK293, and HUH7 human cell models. [Figure 93] 1 shows the in vitro expression of LNPs encoding GFO protein and formulated with circular RNA bearing a TIE in primary human hepatocytes. [Figure 94A] 1 shows the in vitro expression of a circular RNA encoding firefly luciferase and carrying a TIE in mouse myoblasts. [Figure 94B] 1 shows the in vitro expression of a circular RNA encoding firefly luciferase and carrying a TIE in primary human myoblasts. [Figure 95A] 1 shows the in vitro expression of a circular RNA encoding firefly luciferase and carrying a TIE in myoblasts and differentiated primary human skeletal muscle myotubes. Data related to cells obtained from human donor 1 is provided. [Figure 95B] 1 shows the in vitro expression of a circular RNA encoding firefly luciferase and carrying a TIE in myoblasts and differentiated primary human skeletal muscle myotubes. Data related to cells obtained from human donor 2 is provided. [Figure 96A] 1 shows cell-free in vitro translation of circular RNAs of variable sizes. Expression of circular RNA encoding firefly luciferase and linear mRNA encoding firefly luciferase was examined. [Figure 96B] Figure 1 shows cell-free in vitro translation of circular RNAs of variable sizes. Human and mouse cells were loaded with circular RNAs encoding the ATP7B protein. Some of the tested circular RNAs were codon-optimized. A circular RNA expressing firefly luciferase was used for comparison. [Figure 97A]

[0013] Figure 1 illustrates an exemplary RNA circularization process. The schematic diagram shown illustrates the autocatalytic circularization process. Briefly, an RNA precursor molecule containing an intron segment and accessory elements that enhance circularization efficiency undergoes splicing, resulting in a synthetic circular RNA and two excised intron / accessory sequence segments (spliced ​​intron segments / fragments). Some circular RNAs (oRNAs) are nicked during synthesis. [Figure 97B] 1 shows an exemplary RNA circularization process. 2 shows exemplary chromatograms illustrating peak retention of different species after size-exclusion HPLC analysis. [Figure 98] An exemplary negative selection purification method for circular RNA molecules, such as oRNA, is shown. Oligonucleotides complementary to sequences present in the RNA precursor (e.g., intron segments or external accessory regions) but not in the oRNA are bound to a solid support, such as beads. The oRNA preparation is washed onto the beads, and the RNA precursor, partially spliced ​​RNA, incomplete transcripts, and spliced ​​intron segments bind to the oligonucleotides under specific buffer conditions, while the oRNA and nicked oRNA pass through. The flow-through is collected for further processing. [Figure 99A]

[0023] An exemplary negative selection purification method for circular RNA molecules, such as oRNA, is shown. The schematic diagram shows the enzymatic polyadenylation of an in vitro transcription reaction product containing oRNA and linear RNA, resulting in polyadenylation of only the linear RNA. The mixture of linear and circular RNA is washed over beads conjugated with deoxythymidine oligonucleotides ("oligo-dT") under specific buffer conditions. The polyadenylated linear RNA anneals to the beads, while the oRNA passes through for collection. [Figure 99B]1 shows an exemplary negative selection purification method for circular RNA molecules, such as oRNA. Exemplary SEC-HPLC chromatograms are shown of the in vitro transcription (IVT) reaction product before polyadenylation and purification (left panel) and the eluate after polyadenylation using E. coli polyA polymerase and purification with oligo-dT beads in binding buffer (right panel). [Figure 100A] An exemplary circular RNA enzymatic purification method is shown. In this method, oRNA is synthesized by IVT in the presence of excess GMP and autocatalytically spliced ​​during the process. The resulting reaction product is digested with Xrn1 (a 5' to 3' exonuclease that requires a 5'-terminal monophosphate) and RNase R (a 3' to 5' exonuclease) to remove non-circular RNA molecules. Such Xrn1 and RNase R digestion of linear RNA is shown. [Figure 100B] An exemplary circular RNA enzymatic purification method is shown. In this method, oRNA is synthesized by IVT in the presence of excess GMP and autocatalytically spliced ​​during the process. The resulting reaction product is digested with Xrn1 (a 5'-to-3' exonuclease that requires a 5'-terminal monophosphate) and RNase R (a 3'-to-5' exonuclease) to remove non-circular RNA molecules. Exemplary SEC-HPLC chromatograms of the IVT reaction product before enzymatic digestion (left panel) and the final enzymatically purified material (right panel) are shown. [Figure 101]Figure 1 shows the induction of expression of RIG-1 and IFNB1 RNA, markers of immune stimulation, after transfection of cells with various RNA preparations as indicated. All RNA preparations, except for the commercially available 3phpRNA, were produced using in vitro transcription and circularization of RNA containing an Anabaena replacement intron, a GLuc reading frame, strong homology arms, 5' and 3' spacers, and a CVB3 IRES. Expression of RIG-1 and IFNB1 RNA was measured using RT-qPCR. "IVT" indicates the crude reaction mixture; "+GMP" indicates the crude reaction mixture in which in vitro transcription was performed in the presence of 12.5x GMP relative to GTP; "+HPLC" indicates the reaction mixture purified by HPLC; "+HPLC / GMP" indicates the reaction mixture in which in vitro transcription was performed in the presence of 12.5x GMP relative to GTP and purified by HPLC; "3phpRNA" indicates a positive control containing triphosphate hairpin RNA (tlrl-hprna, Invivogen); and "mock" indicates a preparation without RNA. A shows the immunostimulation of HeLa cells, and B shows the immunostimulation of A594 cells. [Figure 102A] Figure 1 shows anti-CD19 CAR expression levels resulting from in vitro delivery of various circular RNAs encoding chimeric antigen receptors in human T cells via electroporation. Representative dot plots from FAC analysis of human T cell expression of CD19-41BBζ, CD19-CD28ζ, HER2-41BBζ, and HER2-CD28ζ CARs are provided. [Figure 102B] Figure 1 shows anti-CD19 CAR expression levels resulting from in vitro delivery of various circular RNAs encoding chimeric antigen receptors in human T cells via electroporation. Cumulative data for MFI of CD19-41BBζ, CD19-CD28ζ, HER2-41BBζ, and HER2-CD28ζ expression collected via fluorescence-activated cell sorting (FACS) are shown. [Figure 103A]Electroporation of T cells with circular RNA encoding CD19-41BBζ and bCD19-CD28ζ, and subsequent cytotoxic response against tumor cells upon co-culture with the tumor cells are shown. Percent specific lysis of tumor cells following co-culture with T cells expressing oRNA encoding CD19-41BBζ, CD19-CD28ζ, HER2-41BBζ, and HER2-CD28ζ CARs is provided compared to T cells expressing circular RNA encoding mOX40L. [Figure 103B] Figure 1 shows electroporation of T cells with circular RNA encoding CD19-41BBζ and bCD19-CD28ζ, followed by the cytotoxic response against tumor cells upon co-culture with tumor cells. IFN-γ cytokines secreted by T cells expressing the listed oRNAs compared to circular RNA encoding mOX40L after co-culture with tumor cells are shown in pg / mL. [Figure 103C] Electroporation of T cells with circular RNA encoding CD19-41BBζ and bCD19-CD28ζ and subsequent cytotoxic response against tumor cells upon co-culture with tumor cells is shown. IL-2 cytokine secreted by T cells expressing the listed oRNAs compared to circular RNA encoding mOX40L after co-culture with tumor cells is shown in pg / mL. [Figure 104A] Figure 1 shows in vivo mOX40L expression in spleens and peripheral blood T cells of humanized mice after intravenous administration of LNPs formulated with circular RNA encoding mOX40L. LNPs were formulated with either PBS (shown as "vehicle" in the figure) or LNP-oRNA constructs formulated with lipid 10b-15 (Table 10b, lipid 15), 10a-27 (Table 10a, lipid 27), or 10a-26 (Table 10a, lipid 26). Detection of mOX40L in T cells in the spleens of humanized mice is shown. [Figure 104B]Figure 1 shows in vivo mOX40L expression in spleen and peripheral blood T cells of humanized mice after intravenous administration of LNPs formulated with circular RNA encoding mOX40L. LNPs were formulated with either PBS (shown as "vehicle" in the figure) or LNP-oRNA constructs formulated with lipid 10b-15 (Table 10b, lipid 15), 10a-27 (Table 10a, lipid 27), or 10a-26 (Table 10a, lipid 26). Detection of mOX40L in T cells in the peripheral blood of humanized mice is shown. [Figure 105] Figure 1 shows B cell aplasia in humanized mice after intravenous administration of LNPs formulated with circular RNA encoding an anti-CD19 chimeric antigen receptor (CAR). Representative FACS dot plots from peripheral blood of untreated (left) and treated (right) animals show the percentage of B cells 6 days after intravenous administration. [Figure 106] Figure 1 shows the % killing of Nalm6 tumor cells after coculture with LNP-oRNA encoding a CAR or control (A), and chimeric antigen receptor (CAR) surface expression after in vitro transfection with LNP-circular RNA (oRNA) encoding the CD19-41BBζ or CD19-CD28ζ CAR (B). Figure 1 shows the killing of Nalm6 tumor cells after coculture of T cells transfected with LNP-oRNA constructs encoding the CD19-41BBζ and CD19-CD28ζ CARs with HER2-41BBz, HER2-CD28z, or control LNP-oRNA mOX40L. Figure 1 shows the mean fluorescence intensity (MFI) of CAR surface expression on T cells treated with LNP-oRNA CAR constructs. [Figure 107]

[0033] Figure 1 shows antigen-dependent tumor regression as measured by total flux (photons / second) following administration with PBS, PBMCs, LNP-oRNA encoding mOx40L, LNP-oRNA encoding CD19-41BBζ ("CD19-41BBζ isCAR"), oRNA encoding CD19-CD28ζ ("CD19-CD28ζ isCAR"), LNP-oRNA encoding HER2-41BBz CAR ("HER2-41BBz isCAR"), or LNP-oRNA encoding HER2-CD28z CAR ("HER2-CD28z isCAR"). PBS and PBMC solutions lacking oRNA were used as negative controls. [Figure 108A] Correlation between IRES activity in myotubes and hepatocytes or myotubes and T cells is shown. Each data point represents the average expression value of a circular RNA containing an IRES preceding the Gaussia luciferase coding region, where each IRES comprises a sequence selected from SEQ ID NOS: 1-2983 and 3282-3287, or a fragment thereof. IRES-containing circular RNAs were synthesized in an array format, formulated into LNPs, and then transfected into activated primary human T cells, primary human myotubes, and primary human hepatocytes. All data points were normalized to a positive control IRES (SEQ ID NOS: 3282). [Figure 108B] Correlation between IRES activity in myotubes and hepatocytes or myotubes and T cells is shown. Each data point represents the average expression value of a circular RNA containing an IRES preceding the Gaussia luciferase coding region, where each IRES comprises a sequence selected from SEQ ID NOS: 1-2983 and 3282-3287, or a fragment thereof. IRES-containing circular RNAs were synthesized in an array format, formulated into LNPs, and then transfected into activated primary human T cells, primary human myotubes, and primary human hepatocytes. All data points were normalized to a positive control IRES (SEQ ID NOS: 3282). [Figure 108C]Correlation between IRES activity in myotubes and hepatocytes or myotubes and T cells is shown. Each data point represents the average expression value of a circular RNA containing an IRES preceding the Gaussia luciferase coding region, where each IRES comprises a sequence selected from SEQ ID NOS: 1-2983 and 3282-3287, or a fragment thereof. IRES-containing circular RNAs were synthesized in an array format, formulated into LNPs, and then transfected into activated primary human T cells, primary human myotubes, and primary human hepatocytes. All data points were normalized to a positive control IRES (SEQ ID NOS: 3282). [Figure 109A] Figure 1 shows IRES activity in hepatocytes compared to commonly used IRESs (EMCV, CVB3). Each data point represents the average expression value of a circular RNA containing an IRES preceding the Gaussia luciferase coding region, where each IRES comprises a sequence selected from SEQ ID NOS: 1-2983 and 3282-3287, or a fragment thereof. IRES-containing circular RNAs were synthesized in an array format, formulated into LNPs, and then transfected into activated primary human T cells, primary human myotubes, and primary human hepatocytes. All data points were normalized to a positive control IRES (SEQ ID NOS: 3282). [Figure 109B] Figure 1 shows IRES activity in myotubes compared to commonly used IRESs (EMCV, CVB3). Each data point represents the average expression value of a circular RNA containing an IRES preceding the Gaussia luciferase coding region, where each IRES comprises a sequence selected from SEQ ID NOS: 1-2983 and 3282-3287, or a fragment thereof. IRES-containing circular RNAs were synthesized in an array format, formulated into LNPs, and then transfected into activated primary human T cells, primary human myotubes, and primary human hepatocytes. All data points were normalized to a positive control IRES (SEQ ID NOS: 3282). [Figure 109C]Figure 1 shows IRES activity in T cells compared with commonly used IRESs (EMCV, CVB3). Each data point represents the average expression value of a circular RNA containing an IRES preceding the Gaussia luciferase coding region, where each IRES comprises a sequence selected from SEQ ID NOS: 1-2983 and 3282-3287, or a fragment thereof. IRES-containing circular RNAs were synthesized in an array format, formulated into LNPs, and then transfected into activated primary human T cells, primary human myotubes, and primary human hepatocytes. All data points were normalized to a positive control IRES (SEQ ID NOS: 3282). DETAILED DESCRIPTION OF THE INVENTION

[0072] The present invention provides, inter alia, methods and compositions for treating autoimmune disorders, deficiency diseases, or cancer based on circular RNA therapy. In particular, the present invention provides a method of treating an autoimmune disorder, deficiency disease, or cancer by administering to a subject in need of treatment a composition comprising a circular RNA encoding at least one therapeutic protein at an effective dose and at an interval such that at least one symptom or characteristic of the associated disease or disorder is reduced in intensity, severity, or frequency, or the onset is delayed.

[0073] As disclosed herein, improved circular RNA therapeutics, along with related compositions and methods, enable, among other things, circular RNA stability, increased expression, and prolonged half-life. In some embodiments, the circular RNA of the present invention is transcribed from a linear RNA polynucleotide construct comprising enhanced intronic elements, enhanced exonic elements, and core functional elements. In some embodiments, the enhanced intronic elements comprise a group I intron fragment, a spacer, a duplex sequence, an affinity sequence, and a unique untranslated sequence that enables optimal circularization after splicing. In some embodiments, the enhanced exonic elements comprise an exonic fragment, a spacer, and a duplex sequence to aid in the circularization process and maintain the stability of the circular RNA after circularization. Within the same embodiment, the core functional elements comprise essential elements for protein translation: a translation initiation element (TIE), coding or non-coding elements, and a termination sequence (e.g., a stop codon or termination cassette). Together, the core functional elements, including enhanced intronic elements, enhanced exonic elements, and coding elements, provide an optimal circular RNA polynucleotide for encoding a therapeutic protein. In one embodiment, the core functional elements, including enhanced intronic elements, enhanced exonic elements, and non-coding elements, provide an optimal circular RNA polynucleotide for triggering the immune system as an adjuvant.

[0074] Also disclosed herein are DNA templates (e.g., vectors) for generating circular RNA. In some embodiments, the DNA template comprises a 3'-enhanced intron fragment, a 3'-enhanced exon fragment, a core functional element, a 5'-enhanced exon fragment, and a 5'-enhanced intron fragment. In some embodiments, these elements are arranged in the DNA template in the above order.

[0075] Further embodiments include circular RNA polynucleotides comprising circular RNA polynucleotides generated using the DNA templates provided herein (e.g., circular RNAs comprising 3'-enhanced exonic elements, core functional elements, and 5'-enhanced exonic elements), compositions comprising such circular RNAs, cells comprising such circular RNAs, and methods of using and generating such DNA templates, circular RNAs, compositions, and cells.

[0076] In some embodiments, provided herein are methods comprising administering a circular RNA polynucleotide provided herein to a cell for therapeutic or useful protein production. In some embodiments, the methods are advantageous in providing for the production of a desired polypeptide in eukaryotic cells with a longer half-life than linear RNA due to the resistance of circular RNA to ribonucleases.

[0077] Circular RNA polynucleotides lack the free ends required for exonuclease-mediated degradation, which makes them resistant to some mechanisms of RNA degradation and increases their half-life compared to comparable linear RNA.Circularization can stabilize RNA polynucleotides that generally have short half-lives, and can improve the overall effectiveness of exogenous mRNA in various applications.In some embodiments, the functional half-life of the circular RNA polynucleotides provided herein in eukaryotic cells (e.g., mammalian cells such as human cells) is at least 20 hours (e.g., at least 80 hours), as assessed by protein synthesis.

[0078] Various aspects of the present invention are described in detail in the following sections. The use of sections is not meant to limit the invention. Each section may be applicable to any aspect of the present invention. In this application, the use of "or" means "and / or" unless otherwise specified.

[0079] 1.Definition Linear nucleic acid molecules are said to have a "5'-terminus" (or "5' end") and a "3'-terminus" (or "3' end") because the nucleic acid phosphodiester linkages occur at the 5' and 3' carbons of the sugar moieties of the substituent mononucleotides. The terminal nucleotide of a polynucleotide in which the new linkage is at the 5' carbon is its 5'-terminal nucleotide. The terminal nucleotide of a polynucleotide in which the new linkage is at the 3' carbon is its 3'-terminal nucleotide. As used herein, a "terminal nucleotide" is the nucleotide at the end position of either the 3' or 5' end.

[0080] As used herein, the term "3' Group I intron fragment" refers to a sequence having 75% or greater similarity to the 3'-proximal end of a native Group I intron, including a splice site dinucleotide and, optionally, a stretch of native exon sequence. As used herein, the term "5' Group I intron fragment" refers to a sequence having 75% or greater similarity to the 5'-proximal end of a native Group I intron, including a splice site dinucleotide and, optionally, a stretch of native exon sequence. As used herein, the term "permutation site" refers to the site within a Group I intron where cleavage occurs prior to intron permutation. This cleavage generates 3' and 5' Group I intron fragments, which are permuted onto either side of the stretch of RNA precursor to be circularized.

[0081] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "cell" includes a combination of two or more cells or an entire culture of cells; reference to a "polynucleotide" includes, as a practical matter, many copies of that polynucleotide.

[0082] Unless specifically stated or clear from the context, the term "about" as used herein is understood to mean within a normal range of tolerance in the art, for example, within two standard deviations of the mean. "About" can be understood to mean within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values ​​provided herein are modified by the term "about."

[0083] As used herein, an "affinity sequence" or "affinity tag" is a region of a polynucleotide sequence, ranging from one (1) nucleotide to hundreds or thousands of nucleotides, that contains a repeating set of nucleotides for the purpose of aiding in the purification of the polynucleotide sequence. For example, an affinity sequence can include, but is not limited to, a polyA or polyAC sequence. In some embodiments, affinity tags are used in purification methods referred to herein as "affinity purification," in which selective binding of a binder to molecules containing the affinity tag facilitates their separation from molecules that do not contain the affinity tag. In some embodiments, the affinity purification method is a "negative selection" purification method, in which undesired species, such as linear RNA, are selectively bound and removed, and desired species, such as circular RNA, are eluted and separated from the undesired species.

[0084] As used herein, "anti-tumor effect" refers to a biological effect that can manifest as a reduction in tumor volume, a reduction in tumor cell number, a reduction in tumor cell proliferation, a reduction in the number of metastases, an increase in overall survival or progression-free survival, an increase in lifespan, or an improvement in various physiological symptoms associated with tumors.Anti-tumor effect can also refer to the prevention of tumor development, for example, a vaccine.

[0085] "Antigen" refers to any molecule that can elicit an immune response or be bound by an antibody or antigen-binding molecule. The immune response can involve the production of antibodies, the activation of specific immunocompetent cells, or both. Those skilled in the art will readily understand that virtually any macromolecule, including any protein or peptide, can function as an antigen. An antigen can be endogenously expressed, i.e., expressed by genomic DNA, or recombinantly expressed. An antigen can be specific to a particular tissue, such as a cancer cell, or it can be widely expressed. In addition, fragments of larger molecules can act as antigens. In some embodiments, the antigen is a tumor antigen.

[0086] An "antigen-binding molecule," "antigen-binding portion," or "antibody fragment" refers to any molecule that specifically binds to a desired antigen. In some embodiments, an antigen-binding molecule comprises an antigen-binding portion (e.g., CDR) of an antibody or antibody-like molecule. An antigen-binding molecule may comprise an antigen complementarity-determining region (CDR). Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, dAbs, linear antibodies, scFv antibodies, and multispecific antibodies formed from antigen-binding molecules. Peptibodies (i.e., Fc fusion molecules containing a peptide-binding domain) are another example of a suitable antigen-binding molecule. In some embodiments, an antigen-binding molecule binds to an antigen on a tumor cell. In some embodiments, an antigen-binding molecule binds to an antigen on a cell involved in a hyperproliferative disease, or to a viral or bacterial antigen. In some embodiments, an antigen-binding molecule binds to BCMA. In further embodiments, an antigen-binding molecule is an antibody fragment comprising one or more of its complementarity-determining regions (CDRs) that specifically bind to the antigen. In further embodiments, the antigen-binding molecule is a single-chain variable fragment (scFv). In some embodiments, the antigen-binding molecule comprises or consists of an avimer.

[0087] The term "antibody" (Ab) includes, but is not limited to, a glycoprotein immunoglobulin that specifically binds to an antigen. Generally, an antibody may comprise at least two heavy (H) chains and two light (L) chains, or antigen-binding molecules thereof, interconnected by disulfide bonds. Each H chain may comprise a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region may comprise three constant domains, CH1, CH2, and CH3. Each light chain may comprise a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region may comprise one constant domain, CL. The VH and VL regions may be further subdivided into regions of hypervariability, termed complementarity-determining regions (CDRs), interspersed with more conserved regions, termed framework regions (FRs). Each VH and VL can contain three CDRs and four FRs arranged from amino terminus to carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable regions of the heavy and light chains contain binding domains that interact with antigens. The constant regions of the Abs can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system. Antibodies can include, for example, monoclonal antibodies, recombinantly produced antibodies, monospecific antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, engineered antibodies, humanized antibodies, chimeric antibodies, immunoglobulins, synthetic antibodies, tetrameric antibodies comprising two heavy chain molecules and two light chain molecules, antibody light chain monomers, antibody heavy chain monomers, antibody light chain dimers, antibody heavy chain dimers, antibody light chain-antibody heavy chain pairs, intrabodies, antibody fusions (sometimes referred to herein as "antibody conjugates"), heteroconjugate antibodies, single domain antibodies, monovalent antibodies, single chain antibodies or single chain variable fragments (scFv), camelized antibodies, affibodies, Fab fragments, F(ab')2 fragments, disulfide-linked variable fragments (sdFv), anti-idiotypic (anti-id) antibodies (including, for example, anti-anti-Id antibodies), minibodies, domain antibodies, synthetic antibodies (sometimes referred to herein as "antibody mimetics"), and antigen-binding fragments of any of the above. In some embodiments, the antibodies described herein refer to polyclonal antibody populations.

[0088] Immunoglobulins can be derived from any of the commonly known isotypes, including, but not limited to, IgA, secretory IgA, IgG, and IgM. IgG subclasses are also well known to those skilled in the art and include, but are not limited to, human IgG1, IgG2, IgG3, and IgG4. "Isotype" refers to the Ab class or subclass (e.g., IgM or IgG1) encoded by the heavy chain constant region genes. The term "antibody" includes, by way of example, both naturally occurring and non-naturally occurring Abs, monoclonal and polyclonal Abs, chimeric and humanized Abs, human or non-human Abs, fully synthetic Abs, and single-chain Abs. Non-human Abs can be humanized by recombinant methods to reduce their immunogenicity in humans. Unless explicitly stated and unless the context dictates otherwise, the term "antibody" also includes antigen-binding fragments or portions of any of the aforementioned immunoglobulins, including monovalent and bivalent fragments or portions, and single-chain Abs.

[0089] Some definitions of CDRs are commonly used: Kabat numbering, Chothia numbering, AbM numbering, or contact numbering. The AbM definition is intermediate between the two used by Oxford Molecular's AbM antibody modeling software. The contact definition is based on an analysis of available complex crystal structures. The term "Kabat numbering" and similar terms are recognized in the art and refer to a system of numbering amino acid residues in the heavy and light chain variable regions of an antibody or its antigen-binding molecule. In certain embodiments, the CDRs of an antibody can be determined according to the Kabat numbering system (see, e.g., Kabat EA & Wu TT (1971) Ann NY Acad Sci 190:382-391 and Kabat EA et al., (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, USDapartment of Health and Human Services, NIH Publication No. 91-3242). Using the Kabat numbering system, the CDRs in an antibody heavy chain molecule are typically located at amino acid positions 31-35, which may optionally include one or two additional amino acids following 35 (referred to as 35A and 35B in the Kabat numbering scheme) (CDR1), amino acid positions 50-65 (CDR2), and amino acid positions 95-102 (CDR3). Using the Kabat numbering system, the CDRs in an antibody light chain molecule are typically located at amino acid positions 24-34 (CDR1), amino acid positions 50-56 (CDR2), and amino acid positions 89-97 (CDR3). In certain embodiments, the CDRs of the antibodies described herein are determined according to the Kabat numbering scheme.In certain aspects, the CDRs of an antibody may be determined according to the Chothia numbering scheme, which refers to the location of the immunoglobulin structural loops (see, e.g., Chothia C & Lesk AM, (1987), J Mol Biol 196:901-917; Al-Lazikani B et al, (1997) J Mol Biol 273:927-948; Chothia C et al., (1992) J Mol Biol 227:799-817; Tramontano A et al, (1990) J Mol Biol 215(1):175-82; and U.S. Patent No. 7,709,226). Typically, using the Kabat numbering convention, the Chothia CDR-H1 loop is located at heavy chain amino acids 26-32, 33, or 34, the Chothia CDR-H2 loop is located at heavy chain amino acids 52-56, and the Chothia CDR-H3 loop is located at heavy chain amino acids 95-102, while the Chothia CDR-L1 loop is located at light chain amino acids 24-34, the Chothia CDR-L2 loop is located at light chain amino acids 50-56, and the Chothia CDR-L3 loop is located at light chain amino acids 89-97. The end of the Chothia CDR-HI loop, when numbered using the Kabat numbering convention, varies between H32 and H34 depending on the length of the loop (this is because the Kabat numbering scheme places the insertion at H35A and H35B; if 35A and 35B are absent, the loop ends at 32; if only 35A is present, the loop ends at 33; and if both 35A and 35B are present, the loop ends at 34). In certain embodiments, the CDRs of the antibodies described herein are determined according to the Chothia numbering scheme.

[0090] As used herein, the terms "variable region" and "variable domain" are used interchangeably and are common in the art. A variable region typically refers to a portion of an antibody, generally a portion of either the light or heavy chain, typically the amino-terminal 110-120 amino acids in a mature heavy chain and approximately 90-115 amino acids in a mature light chain, which vary significantly in sequence among antibodies and are used to determine the binding and specificity of a particular antibody to a particular antigen. Sequence variability is concentrated in those regions called complementarity-determining regions (CDRs), while the more highly conserved regions within the variable domain are called framework regions (FRs). While not wishing to be bound by any particular mechanism or theory, it is believed that the CDRs of the light and heavy chains are primarily responsible for the interaction and specificity of the antibody with the antigen. In some embodiments, the variable region is a human variable region. In some embodiments, the variable region comprises rodent or mouse CDRs and human framework regions (FRs). In certain embodiments, the variable region is a primate (e.g., non-human primate) variable region. In some embodiments, the variable region comprises rodent or mouse CDRs and primate (e.g., non-human primate) framework regions (FRs). The terms "VL" and "VL domain" are used interchangeably to refer to the light chain variable region of an antibody or antigen-binding molecule thereof. The terms "VH" and "VH domain" are used interchangeably to refer to the heavy chain variable region of an antibody or antigen-binding molecule thereof.

[0091] As used herein, the terms "constant region" and "constant domain" are interchangeable and have their common meaning in the art. The constant region is the portion of an antibody, e.g., the carboxyl-terminal portion of the light and / or heavy chain, that is not directly involved in binding the antibody to an antigen, but may exhibit various effector functions, such as interaction with Fc receptors. The constant region of an immunoglobulin molecule generally has a more conserved amino acid sequence compared to the immunoglobulin variable domain.

[0092] As used herein, "aptamer" generally refers to either a single oligonucleotide of a defined sequence or a mixture of such nucleotides, which mixture retains the property of specifically binding to a target molecule (e.g., eukaryotic initiation factors, 40S ribosomes, poly C-binding protein, poly A-binding protein, polypyrimidine tract-binding protein, Argonaute protein family, heterogeneous nuclear ribonucleoproteins K and La, and related RNA-binding proteins). Therefore, as used herein, "aptamer" refers to both a single or multiple sequences of nucleotides as defined above. The term "aptamer" is intended to refer to a single- or double-stranded nucleic acid capable of binding to a protein or other molecule. Generally, aptamers preferably contain about 10 to about 100 nucleotides, preferably about 15 to about 40 nucleotides, and more preferably about 20 to about 40 nucleotides, and oligonucleotides within these ranges of length are readily prepared by conventional techniques. Optionally, aptamers can further contain at least about 6 nucleotides, preferably 10 nucleotides, more preferably 14 or 15 nucleotides, necessary to achieve specific binding.

[0093] As used herein, "autoimmunity" is defined as a persistent and progressive immune response to non-infectious self-antigens, distinct from infectious non-self-antigens derived from bacteria, viruses, fungi, or parasites, that invade and persist in mammals and humans. Autoimmune diseases include scleroderma, Graves' disease, Crohn's disease, Schoergen's disease, multiple sclerosis, Hashimoto's disease, psoriasis, myasthenia gravis, autoimmune polyendocrine deficiency syndrome, type 1 diabetes mellitus (TIDM), autoimmune gastritis, autoimmune uveoretinitis, polymyositis, colitis, and thyroiditis, as well as systemic autoimmune diseases typified by human lupus. As used herein, "autoantigen" or "self-antigen" refers to an antigen or epitope that is unique to a mammal and immunogenic in that mammal.

[0094] The term "autologous" refers to any material derived from the same individual that is subsequently reintroduced. For example, the engineered autologous cell therapy (eACT™) method described herein involves the collection of lymphocytes from a patient, which are then engineered to express, for example, a CAR construct, and then administered to the same patient. The term "allogeneic" refers to any material derived from one individual that is then introduced into another individual of the same species, for example, allogeneic T cell transplantation.

[0095] "Binding affinity" generally refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless otherwise indicated, as used herein, "binding affinity" refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen). The affinity of a molecule X for its partner Y is generally determined by the dissociation constant (K D or K d Affinity can be expressed as the equilibrium dissociation constant (K D ) and the equilibrium association constant K A or K a ) can be measured and / or expressed in many ways known in the art, including, but not limited to, K D is k off / k on It is calculated from the quotient of K A is k on / k off It is calculated from the quotient of k on refers to the association rate constant of, for example, an antibody to an antigen, and k off refers to, for example, the dissociation of an antibody against an antigen. on and k off can be determined by techniques known to those skilled in the art, such as BIACORE® or KiNExA.

[0096] As used herein, the terms "immunospecifically bind," "immunospecifically recognize," "specifically bind," and "specifically recognize" are similar terms in the context of antibodies and refer to a molecule that binds to an antigen (e.g., an epitope or immune complex) as such binding is understood by one of skill in the art. For example, a molecule that specifically binds to an antigen may generally bind to other peptides or polypeptides with lower affinity as determined, for example, by immunoassay, BIACORE®, KinExA 3000 instrument (Sapidyne Instruments, Boise, ID), or other assays readily known in the art. In certain embodiments, a molecule that specifically binds to an antigen has a K A K that is at least 2 log, 2.5 log, 3 log, 4 log or more A It binds to the antigen.

[0097] As used herein, "bicistronic RNA" refers to a polynucleotide containing two expressed sequences encoding two different proteins. These expressed sequences may be separated by a nucleotide sequence encoding a cleavable peptide, such as a protease cleavage site. They may also be separated by a ribosomal skipping element.

[0098] "Cancer" refers to a broad group of diseases characterized by the uncontrolled growth of abnormal cells in the body. Uncontrolled cell division and growth can lead to the formation of malignant tumors that invade neighboring tissues and may metastasize to distant parts of the body via the lymphatic system or bloodstream. "Cancer" or "cancerous tissue" can include tumors. Examples of cancers that can be treated by the methods disclosed herein include, but are not limited to, cancers of the immune system, including lymphoma, leukemia, myeloma, and other white blood cell malignancies. In some embodiments, the methods disclosed herein are used to treat cancers of the esophagus, small intestine, endocrine system, thyroid gland, parathyroid gland, adrenal gland, urethra, urethra, urethral canal ... may be used to reduce tumor size in tumors resulting from acute leukemia, acute myeloid leukemia, chronic myeloid leukemia, acute lymphocytic leukemia (ALL) (including non-T-cell ALL), chronic lymphocytic leukemia (CLL), childhood solid tumors, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, neoplasms of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brain stem glioma, pituitary adenoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers including those induced by asbestos, other B-cell malignancies, and combinations of these cancers.In some embodiments, the methods disclosed herein are useful for treating tumors of, for example, sarcomas and carcinomas, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, Kaposi's sarcoma, soft tissue sarcoma, other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, hepatocellular carcinoma, lung cancer, colorectal cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma (e.g., of the pancreas, colon, ovary, lung, breast, stomach, prostate, cervix, or esophagus), sweat gland carcinoma, and the like. It can be used to reduce the size of tumors derived from sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, liver cancer, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, bladder cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, renal pelvis cancer, CNS tumors (glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma, etc.). Certain cancers may respond to chemotherapy or radiation therapy, or the cancer may be refractory. Refractory cancers refer to cancers that are not amenable to surgical intervention, do not respond initially to chemotherapy or radiation therapy, or become unresponsive over time.

[0099] As used herein, the terms "circRNA," "circular polyribonucleotide," "circular RNA," "circularized RNA," and "oRNA" are used interchangeably and refer to polyribonucleotides that form circular structures through covalent bonds. As used herein, such terms also include preparations containing circRNA.

[0100] As used herein, the term "circularization efficiency" refers to a measure of the rate of formation of the amount of resulting circular polyribonucleotide compared to its linear starting material.

[0101] Expression sequences in a polynucleotide construct may be separated by a "cleavage site" sequence that allows the polypeptides encoded by the expression sequences to be separately expressed by a cell upon translation. A "self-cleaving peptide" refers to a peptide that is translated without a peptide bond between two adjacent amino acids, or that functions such that when a protein and a polypeptide comprising the self-cleaving peptide are produced, they are readily cleaved or separated into separate first and second polypeptides without the need for any external cleavage activity.

[0102] As used herein, a "coding element," "coding sequence," "coding nucleic acid," or "coding region" is a region located within an expressed sequence that encodes one or more proteins or polypeptides (e.g., therapeutic proteins). As used herein, a "non-coding element," "non-coding sequence," "non-coding nucleic acid," or "non-coding nucleic acid" is a region located within an expressed sequence that does not itself encode a protein or polypeptide, but may have other regulatory functions, including, but not limited to, enabling the entire polynucleotide to function as a biomarker or adjuvant for specific cells.

[0103] As used herein, a "conservative amino acid substitution" refers to an amino acid residue being replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid, etc.), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). In some embodiments, one or more amino acid residues within the CDR(s) or framework region(s) of an antibody or antigen-binding molecule thereof may be replaced with an amino acid residue having a similar side chain.

[0104] As used herein, a "costimulatory ligand" includes a molecule on an antigen-presenting cell that specifically binds to a cognate costimulatory molecule on a T cell. Binding of the costimulatory ligand provides a signal that mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, etc. The costimulatory ligand induces a signal in addition to the primary signal provided by the stimulatory molecule, for example, by binding of the T cell receptor (TCR) / CD3 complex to a peptide-loaded major histocompatibility complex (MHC) molecule. Costimulatory ligands include, but are not limited to, Toll-like receptors, B7-1 (CD80), B7-2 (CD86), CD30 ligand, CD40, CD7, CD70, CD83, herpesvirus entry mediator (HVEM), human leukocyte antigen G (HLA-G), ILT4, immunoglobulin-like transcript (ILT) 3, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), a ligand that specifically binds to B7-H3, lymphotoxin beta receptor, MHC class I chain-related protein A (MICA), MHC class I chain-related protein B (MICB), OX40 ligand, PD-L2, or programmed death (PD)1 / 3 / TR6, 4-IBB ligands, agonists, or antibodies. Costimulatory ligands include, but are not limited to, antibodies that specifically bind to costimulatory molecules present on T cells, such as 4-1BB, B7-H3, CD2, CD27, CD28, CD30, CD40, CD7, ICOS, a ligand that specifically binds to CD83, lymphocyte function-associated antigen-1 (LFA-1), natural killer cell receptor C (NKG2C), OX40, PD-1, or tumor necrosis factor superfamily member 14 (TNFSF14 or LIGHT).

[0105] A "costimulatory molecule" is a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation.Costimulatory molecules include 4-1BB / CD137, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD33, CD45, CD100 (SEMA4D), CD103, CD134, CD137, CD154, CD16, CD160 (BY55), CD18, CD19, CD19a, CD2, CD22, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 (alpha, beta, delta, epsilon, gamma, zeta), CD30, CD37, CD4, CD4, CD40, CD49a, CD49D, CD49f, CD5, CD64, CD69, CD7, CD80, and CD83. Ligand, CD84, CD86, CD8 alpha, CD8 beta, CD9, CD96 (Tactile), CD1-la, CD1-lb, CD1-lc, CD1-ld, CDS, CEACAM1, CRT AM, DAP-10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, ICAM-1, ICOS, Ig alpha (CD79a), IL2R beta, IL2R gamma, IL7R alpha, integrin, ITGA4, ITGA6, ITGA7 GAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, LFA-1, LIGHT, LIGHT (tumor necrosis factor superfamily member 14; TNFSF14), LTBR, ​​Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1(CD1 la / CD18), MHC class I molecules, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX40, PAG / Cbp, PD-1, PSGL1, SELPLG (CD162), signaling lymphocyte activation molecule, SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Lyl08), SLAMF7, SLP-76, TNF, TNFr, TNFR2, Toll ligand receptor, TRANCE / RANKL, VLA1, or VLA-6, or fragments, truncations, or combinations thereof.

[0106] As used herein, a "costimulatory signal" refers to, but is not limited to, a signal that, in combination with a primary signal, such as TCR / CD3 ligation, results in a T cell response, such as proliferation and / or upregulation or downregulation of key molecules.

[0107] As used herein, an antigen-binding molecule, antibody, or antigen-binding molecule thereof "cross-competes" with a reference antibody or antigen-binding molecule thereof if the interaction between the antigen and the first binding molecule, antibody, or antigen-binding molecule thereof blocks, limits, inhibits, or otherwise reduces the ability of the reference binding molecule, reference antibody, or antigen-binding molecule thereof to interact with the antigen. Cross-competition can be complete, e.g., binding of the binding molecule to the antigen completely blocks the ability of the reference binding molecule to bind to the antigen, or it can be partial, e.g., binding of the binding molecule to the antigen reduces the ability of the reference binding molecule to bind to the antigen. In some embodiments, an antigen-binding molecule that competes with a reference antigen-binding molecule binds to the same or overlapping epitope as the reference antigen-binding molecule. In other embodiments, an antigen-binding molecule that cross-competes with a reference antigen-binding molecule binds to a different epitope than the reference antigen-binding molecule. To determine whether one antigen-binding molecule competes with another antigen-binding molecule, for example, solid-phase direct or indirect radioimmunoassay (RIA), solid-phase direct or indirect enzyme immunoassay (EIA), sandwich competition assay (Stahli et al., 1983, Methods in Enzymology 9:242-253), solid-phase direct biotin-avidin EIA (Kirkland et al., 1986, J. Immunol. 137:3614-3619), solid-phase direct labeling assay, solid-phase direct labeling sandwich assay (Harlow and Lane, 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Press), solid-phase direct labeling RIA using 1-125 label (Morel et al., 1988, Molec. Immunol. 25:7-15), solid-phase direct biotin-avidin EIA (Cheung, et al., 1990, Virology Many types of competitive binding assays can be used, including direct label RIA (Moldenhauer et al., 1990, Scand. J. Immunol. 32:77-82), and direct label RIA (Moldenhauer et al., 1990, Scand. J. Immunol. 32:77-82).

[0108] As used herein, "cytokine" refers to a non-antibody protein released by one cell in response to contact with a specific antigen, where the cytokine interacts with a second cell and mediates a response in the second cell. Cytokines can be endogenously expressed by cells or administered to a subject. Cytokines can be released by immune cells, including macrophages, B cells, T cells, neutrophils, dendritic cells, eosinophils, and mast cells, to propagate an immune response. Cytokines can induce various responses in recipient cells. Cytokines can include homeostatic cytokines, chemokines, pro-inflammatory cytokines, effector proteins, and acute-phase proteins. For example, homeostatic cytokines, including interleukin (IL) 7 and IL-15, can promote immune cell survival and proliferation, and pro-inflammatory cytokines can promote inflammatory responses. Examples of homeostatic cytokines include, but are not limited to, IL-2, IL-4, IL-5, IL-7, IL-10, IL-12p40, IL-12p70, IL-15, and interferon (IFN) gamma. Examples of pro-inflammatory cytokines include, but are not limited to, IL-1a, IL-1b, IL-6, IL-13, IL-17a, IL-23, IL-27, tumor necrosis factor (TNF)-alpha, TNF-beta, fibroblast growth factor (FGF)2, granulocyte-macrophage colony-stimulating factor (GM-CSF), soluble intercellular adhesion molecule 1 (sICAM-1), soluble vascular adhesion molecule 1 (sVCAM-1), vascular endothelial growth factor (VEGF), VEGF-C, VEGF-D, and placental growth factor (PLGF). Examples of effectors include, but are not limited to, granzyme A, granzyme B, soluble Fas ligand (sFasL), TGF-beta, IL-35, and perforin. Examples of acute phase proteins include, but are not limited to, C-reactive protein (CRP) and serum amyloid A (SAA).

[0109] "Co-administered" means that a therapeutic agent provided herein is administered in conjunction with one or more additional therapeutic agents sufficiently close in time that the therapeutic agent provided herein can enhance the effect of the one or more additional therapeutic agents, or vice versa.

[0110] As used herein, the term "co-formulation" refers to a nanoparticle formulation containing two or more nucleic acids or a nucleic acid and another active agent. Typically, the ratio is defined as an equimolar or ratiometric amount of the two or more nucleic acids or a nucleic acid and another active agent.

[0111] As used herein, the terms "deoxyribonucleic acid" and "DNA" refer to a polymer composed of deoxyribonucleotides. As used herein, the terms "ribonucleic acid" and "RNA" refer to a polymer composed of ribonucleotides.

[0112] As used herein, the term "DNA template" refers to a DNA sequence from which a linear RNA polynucleotide can be transcribed. For example, but not intended to be limiting, a DNA template can include a DNA vector, a PCR product, or a plasmid.

[0113] As used herein, the terms "duplex," "double-stranded," and "hybridized" are used interchangeably and refer to a double-stranded nucleic acid formed by hybridization of two single-stranded nucleic acids containing complementary sequences. The sequences of the two single-stranded nucleic acids can be fully complementary or partially complementary. In some embodiments, the nucleic acids provided herein can be fully double-stranded or partially double-stranded. In most cases, genomic DNA is double-stranded.

[0114] As used herein, two "duplex sequences," "duplex-forming sequences," "duplex regions," "duplex-forming regions," "homologous arms," ​​or "homologous regions" are complementary to each other, or fully or partially complementary, if the two regions share a sufficient level of sequence identity to each other's reverse complement to act as substrates for a hybridization reaction. In some embodiments, two duplex-forming sequences are thermodynamically favored to cross-pair in a sequence-specific interaction. As used herein, polynucleotide sequences have "homology" if they are identical to or share sequence identity with their reverse complements or "complementary" sequences. The percent sequence identity between a homologous region and the reverse complement of the corresponding homologous region can be any percentage of sequence identity that allows hybridization to occur. In some embodiments, an internal duplex-forming region of a polynucleotide disclosed herein can form a duplex with another internal duplex-forming region but not with an external duplex-forming region.

[0115] As used herein, the term "encoding" broadly refers to any process that uses information in a polymeric macromolecule to direct the production of a second molecule that differs from the first molecule. The second molecule may have a chemical structure that differs from the chemical nature of the first molecule. For example, a DNA template (e.g., a DNA vector) may encode an RNA polynucleotide, and an RNA precursor polynucleotide (e.g., a linear RNA precursor polynucleotide) may encode a mature RNA polynucleotide (e.g., a circular RNA polynucleotide).

[0116] As used herein, "endogenous" means a material that is native to a biological system (e.g., an organism, tissue, or cell), i.e., that is derived from nature. For example, in some embodiments, an "endogenous polynucleotide" is one that is normally expressed in a cell or tissue. In some embodiments, a polynucleotide is still considered endogenous even if a control sequence, such as a promoter or enhancer sequence that activates transcription or translation, has been modified by recombinant technology. As used herein, the term "heterologous" means derived from any source other than the naturally occurring sequence.

[0117] As used herein, an "endonuclease site" refers to a stretch of nucleotides within a polynucleotide that can be recognized and cleaved by an endonuclease protein.

[0118] "Eukaryotic initiation factor" or "eIF" refers to a protein or protein complex used in the assembly of initiator tRNA, 40S and 60S ribosomal subunits required for the initiation of eukaryotic translation.

[0119] As used herein, "epitope" is a term used in the art and refers to a localized region of an antigen to which an antibody can specifically bind. An epitope can be, for example, consecutive amino acids of a polypeptide (a linear or continuous epitope), or an epitope can be, for example, composed of a polypeptide or two or more non-contiguous regions of a polypeptide (a conformational, non-linear, discontinuous, or discontinuous epitope). In some embodiments, the epitope to which an antibody binds can be determined by, for example, NMR spectroscopy, X-ray diffraction crystallography, ELISA assays, hydrogen / deuterium exchange coupled with mass spectrometry (e.g., liquid chromatography electrospray mass spectrometry), array-based oligopeptide scanning assays, and / or mutagenesis mapping (e.g., site-directed mutagenesis mapping). For X-ray crystallography, crystallization can be achieved using any of the methods known in the art (e.g., Giege R et al., (1994) Acta Crystallogr D Biol Crystallogr 50(Pt 4):339-350; McPherson A (1990) Eur J Biochem 189:1-23; Chayen NE (1997) Structure 5:1269-1274; McPherson A (1976) J Biol Chem 251:6300-6303).Antibody:antigen crystals can be studied using well-known X-ray diffraction techniques and refined using computer software such as X-PLOR (Yale University, 1992, popularized by Molecular Simulations, Inc.; e.g., Meth Enzymol (1985) volumes 114 & 115, eds. Wyckoff HW et al., U.S. Patent Publication No. 2004 / 0014194) and BUSTER (Bricogne G (1993) Acta Crystallogr D Biol Crystallogr 49(Pt 1):37-60; Bricogne G (1997) Meth Enzymol 276A:361-423, ed. Carter CW, Roversi P et al., (2000) Acta Crystallogr D Biol Crystallogr 56(Pt 10):1316-1323).

[0120] As used herein, the term "expressed sequence" refers to a nucleic acid sequence that encodes a product, such as a peptide or polypeptide, a regulatory nucleic acid, or a non-coding nucleic acid. An exemplary expressed sequence that encodes a peptide or polypeptide can include multiple nucleotide triads, each of which can encode an amino acid, and are referred to as a "codon."

[0121] As used herein, a "fusion protein" is a protein having at least two domains encoded by separate genes that are linked to transcribe a single peptide.

[0122] The term "genetic engineering" or "engineering" refers to a method of modifying the genome of a cell, including, but not limited to, deleting a coding or non-coding region or a portion thereof, or inserting a coding region or a portion thereof. In some embodiments, the modified cell is a lymphocyte, such as a T cell, which can be obtained from either a patient or a donor. The cell can be modified to express an exogenous construct, such as a chimeric antigen receptor (CAR) or a T cell receptor (TCR), which is integrated into the genome of the cell.

[0123] "Immune response" refers to the actions of cells of the immune system (e.g., T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells, and neutrophils) and soluble macromolecules (including Abs, cytokines, complement) produced by either these cells or the liver that result in the selective targeting, binding, damaging, destroying, and / or eliminating from the vertebrate body invading pathogens, pathogen-infected cells or tissues, cancerous or other abnormal cells, or, in the case of autoimmunity or pathological inflammation, normal human cells or tissues.

[0124] As used herein, the terms "immunogenic" or "immunostimulatory" refer to the potential for inducing an immune response to a substance. An immune response, which refers to the potential for inducing an immune response, can be induced when an organism's immune system or a specific type of immune cell is exposed to an immunogenic substance. The term "non-immunogenic" refers to an immune response that exceeds a detectable threshold against a substance. An immune response, which refers to the lack or absence of an immune response, is not detected when an organism's immune system or a specific type of immune cell is exposed to a non-immunogenic substance. In some embodiments, non-immunogenic cyclic polyribonucleotides as provided herein do not induce an immune response above a predetermined threshold as measured by an immunogenicity assay. In some embodiments, an innate immune response is not detected when an organism's immune system or a specific type of immune cell is exposed to a non-immunogenic cyclic polyribonucleotide as provided herein. In some embodiments, an adaptive immune response is not detected when an organism's immune system or a specific type of immune cell is exposed to a non-immunogenic cyclic polyribonucleotide as provided herein.

[0125] As used herein, "internal ribosome entry site" or "IRES" refers to an RNA sequence or structural element ranging in size from 10 nt to over 1000 nt that can initiate translation of a polypeptide in the absence of a typical RNA cap structure. IRESs are typically about 500 nt to about 700 nt in length.

[0126] "Isolated" or "purified" generally refers to the isolation of a substance (e.g., in some embodiments, a compound, polynucleotide, protein, polypeptide, polynucleotide composition, or polypeptide composition) such that the substance constitutes a significant percentage (e.g., greater than 1%, greater than 2%, greater than 5%, greater than 10%, greater than 20%, greater than 50%, or more, usually up to about 90%-100%) of the sample in which it is present. In certain embodiments, a substantially purified component constitutes at least 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% of the sample. In further embodiments, a substantially purified component constitutes about 80%-85%, or 90%-95%, 95-99%, 96-99%, 97-99%, or 95-100% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are well known in the art and include, for example, ion exchange chromatography, affinity chromatography, and sedimentation according to density. Generally, a substance is purified when it is present in a sample in an amount greater than that found in nature relative to other components of the sample.

[0127] As used herein, a "leading untranslated sequence" is a region of a polynucleotide sequence located at the 5' end of the top of a polynucleotide sequence, ranging from one nucleotide to several hundred nucleotides. The sequence can be defined or can be random. Leading untranslated sequences are non-coding. As used herein, a "terminal untranslated sequence" is a region of a polynucleotide sequence located at the 3' end of the bottom of a polynucleotide sequence, ranging from one nucleotide to several hundred nucleotides. The sequence can be defined or can be random. Terminal untranslated sequences are non-coding.

[0128] As used herein, the term "lymphocyte" includes natural killer (NK) cells, T cells, or B cells. NK cells are a type of cytotoxic (cell-destroying) lymphocyte that is a major component of the innate immune system. NK cells reject tumor- and virus-infected cells. They function through the process of apoptosis, or programmed cell death. They were called "natural killers" because they do not require activation to kill cells. T cells play a major role in cell-mediated immunity (without the involvement of antibodies). T cell receptors (TCRs) distinguish T cells from other lymphocyte types. The thymus, a specialized organ of the immune system, is the primary site for T cell maturation. Helper T cells (e.g., CD4+ cells), cytotoxic T cells (TCs, also known as cytotoxic T lymphocytes, CTLs, T killer cells, cytolytic T cells, CD8+ T cells, or killer T cells), memory T cells ((i) stem memory T cells (TSCM) are CD45RO-, CCR7+, CD45RA+, CD62L+ (L-selectin), CD27+, CD28+, and IL-7Ra+, similar to naive T cells, but also express high amounts of CD95, IL-2R, CXCR3, and LFA-1, and exhibit many functional attributes characteristic of memory cells), (ii) sentinel T cells (T cells, also known as stem memory T cells, are CD45RO-, CCR7+, CD45RA+, CD62L+ (L-selectin), CD27+, CD28+, and IL-7Ra+, similar to naive T cells, but also express high amounts of CD95, IL-2R, CXCR3, and LFA-1, and exhibit many functional attributes characteristic of memory cells), and (iii) sentinel T cells (T cells, also known as stem memory T cells, are CD45RO-, CCR7+, CD45RA+, CD62L+ (L-selectin), CD27+, CD28+, and IL-7Ra+, similar to naive T cells, but also express high amounts of CD95, IL-2R, CXCR3, and LFA-1, and exhibit many functional attributes characteristic of memory cells). There are many types of T cells, including (iii) TCMs (transverse memory cells) that express L-selectin and CCR7 and secrete IL-2 but not IFNγ or IL-4; (iv) effector memory cells (TCMs) that do not express L-selectin or CCR7 but produce effector cytokines such as IFNγ and IL-4; (v) regulatory T cells (Tregs, suppressor T cells, or CD4+CD25+ or CD4+FoxP3+ regulatory T cells), natural killer T cells (NKTs), and gamma delta T cells. On the other hand, B cells play a major role in humoral immunity (involving antibodies). B cells produce antibodies, function as antigen-presenting cells (APCs), and, after activation by antigen interaction, can transform into both short-lived and long-lived memory B cells and plasma cells. In mammals, immature B cells are formed in the bone marrow.

[0129] As used herein, an "miRNA site" refers to a stretch of nucleotides within a polynucleotide that can form a duplex with a native miRNA sequence of at least 8 nucleotides.

[0130] As used herein, "neoantigen" refers to a class of tumor antigens that arise from tumor-specific mutations in expressed proteins.

[0131] The term "nucleotide" refers to ribonucleotides, deoxyribonucleotides, modified forms thereof, or analogs thereof. Nucleotides include species containing purines, such as adenine, hypoxanthine, and guanine, and derivatives and analogs thereof, and pyrimidines, such as cytosine, uracil, and thymine, and derivatives and analogs thereof. Nucleotide analogs include nucleotides with modifications in the chemical structure of the base, sugar, and / or phosphate, including 5'-position pyrimidine modifications, 8'-position purine modifications, cytosine exocyclic amine modifications, and 5-bromo-uracil substitutions; and 2'-position sugar modifications, including, but not limited to, sugar-modified ribonucleotides in which the 2'-OH is replaced with a group such as H, OR, R, halo, SH, SR, NH, NHR, NR, or CN (where R is an alkyl moiety as defined herein). Nucleotide analogs are also intended to include nucleotides with bases such as inosine, queosine, and xanthine; sugars such as 2'-methylribose; and non-natural phosphodiester linkages such as methylphosphonate, phosphorothioate, and peptide linkages. Nucleotide analogs include 5-methoxyuridine, 1-methylpseudouridine, and 6-methyladenosine.

[0132] All nucleotide sequences disclosed herein may represent RNA sequences or the corresponding DNA sequences. It is understood that deoxythymidine (dT or T) in DNA is transcribed to uridine (U) in RNA. Thus, "T" and "U" are used interchangeably in nucleotide sequences herein.

[0133] The terms "nucleic acid" and "polynucleotide" are used interchangeably herein to describe a polymer composed of nucleotides, e.g., deoxyribonucleotides or ribonucleotides, of any length, e.g., greater than about 2 bases, greater than about 10 bases, greater than about 100 bases, greater than about 500 bases, greater than 1000 bases, or up to about 10,000 bases or more, which can be produced enzymatically or synthetically (e.g., as described in U.S. Pat. No. 5,948,902 and references cited therein), which can hybridize with naturally occurring nucleic acids in a sequence-specific manner similar to that of two naturally occurring nucleic acids, e.g., participate in Watson-Crick base pairing interactions. An "oligonucleotide" is a polynucleotide containing fewer than 1000 nucleotides, e.g., fewer than 500 nucleotides or fewer than 100 nucleotides. Naturally occurring nucleic acids are composed of nucleotides containing guanine, cytosine, adenine, thymine, and uracil (G, C, A, T, and U, respectively). As used herein, "poly A" refers to a polynucleotide or a portion of a polynucleotide consisting of nucleotides containing adenine. As used herein, "poly T" refers to a polynucleotide or a portion of a polynucleotide consisting of nucleotides containing thymine. As used herein, "poly AC" refers to a polynucleotide or a portion of a polynucleotide consisting of nucleotides containing adenine or cytosine.

[0134] As used herein, the term "ribosomal skipping element" refers to a nucleotide sequence that encodes a short peptide sequence capable of triggering the production of two peptide chains from the translation of one RNA molecule. Without wishing to be bound by theory, it is hypothesized that a ribosomal skipping element functions by (1) terminating translation of a first peptide chain and reinitiating translation of a second peptide chain, or (2) cleaving a peptide bond in the peptide sequence encoded by the ribosomal skipping element, either by the intrinsic protease activity of the encoded peptide or by another protease in the environment (e.g., the cytosol).

[0135] The term " sequence identity " used herein refers to the degree to which sequences are identical nucleotide by nucleotide or amino acid by amino acid across comparison window.Therefore, " sequence identity percentage " can be calculated by comparing two optimally aligned sequences across comparison window, determining the number of positions where the same nucleic acid base (for example, A, T, C, G, I) or the same amino acid residue (for example, Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) exists in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions within comparison window (i.e., window size), and multiplying the result by 100 to obtain the percentage of sequence identity. Included are nucleotides and polypeptides having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of the reference sequences described herein, and typically the polypeptide variant retains at least one biological activity of the reference polypeptide.

[0136] As used herein, a "spacer" refers to a region of a polynucleotide sequence ranging from one nucleotide to hundreds or thousands of nucleotides that separates two other elements along the polynucleotide sequence. The sequence can be defined or can be random. Spacers are typically non-coding. In some embodiments, a spacer comprises a duplex region.

[0137] As used herein, the term "splice site" refers to a dinucleotide that is partially or completely contained within a Group I intron and between which the phosphodiester bond is cleaved during RNA circularization.

[0138] As used herein, "structured," with respect to RNA, refers to an RNA sequence that is predicted by RNAFold software or similar prediction tools to form a structure (e.g., a hairpin loop) with itself or with other sequences within the same RNA molecule. As used herein, "unstructured," with respect to RNA, refers to an RNA sequence that is not predicted by RNA structure prediction tools to form a structure (e.g., a hairpin loop) with itself or with other sequences within the same RNA molecule. In some embodiments, unstructured RNAs can be functionally characterized using nuclease protection assays.

[0139] As used herein, the term "therapeutic protein" refers to any protein that has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect when administered directly or indirectly in the form of a translated nucleic acid to a subject.

[0140] "Transcription" refers to the formation or synthesis of an RNA molecule by an RNA polymerase using a DNA molecule as a template. The present invention is not limited by the RNA polymerase used for transcription. For example, in some embodiments, T7-type RNA polymerase can be used.

[0141] "Translation" refers to the formation of a polypeptide molecule by ribosomes based on an RNA template. As used herein, the term "translation efficiency" refers to the rate or amount of protein or peptide production from a ribonucleotide transcript. In some embodiments, translation efficiency can be expressed as the amount of protein or peptide produced per given amount of transcript encoding the protein or peptide.

[0142] As used herein, the term "transfect" or "transfection" refers to the intracellular introduction of one or more encapsulated substances (e.g., nucleic acids and / or polynucleotides) into a cell, or preferably into a target cell. The term "transfection efficiency" refers to the relative amount of such encapsulated substances (e.g., polynucleotides) taken up by, introduced into, and / or expressed by a target cell subject to transfection. In some embodiments, transfection efficiency can be estimated by the amount of reporter polynucleotide product produced by a target cell after transfection. In some embodiments, the delivery vehicle has a high transfection efficiency. In some embodiments, the delivery vehicle has a transfection efficiency of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.

[0143] As used herein, "transport vehicle" includes any of the standard pharmaceutical carriers, diluents, excipients, etc. generally intended for use in connection with the administration of biologically active agents, including nucleic acids. In certain embodiments of the present invention, a transport vehicle (e.g., lipid nanoparticles) is prepared to encapsulate one or more substances or therapeutic agents (e.g., circRNA). The process of incorporating a desired therapeutic agent (e.g., circRNA) into a transport vehicle is referred to herein as "loading" or "encapsulating" (Lasic, et al., FEBS Lett., 312:255-258, 1992). The substance (e.g., circRNA) loaded or encapsulated in the transport vehicle may be located completely or partially in the interior space of the transport vehicle, within the bilayer membrane of the transport vehicle, or attached to the outer surface of the transport vehicle.

[0144] As used herein, the terms "treat" and "prevent," and words derived therefrom, do not necessarily mean 100% or complete treatment or prevention. Rather, varying degrees of treatment or prevention that one of skill in the art would recognize as having potential benefit or therapeutic effect are provided by the methods disclosed herein. Treatment or prevention can include treating or preventing one or more conditions or symptoms of a disease. For purposes of this specification, "prevention" can also encompass delaying the onset of a disease, or its symptoms or conditions.

[0145] The α and β chains of the αβ TCR are generally considered to each have two domains or regions: a variable domain and a constant domain / region. The variable domain consists of the linkage of the variable region and the binding region. Thus, in this specification and claims, the term "TCR alpha variable domain" refers to the linkage of the TRAV and TRAJ regions, and the term TCR alpha constant domain refers to the extracellular TRAC region or a C-terminal truncated TRAC sequence. Similarly, the term "TCR beta variable domain" refers to the linkage of the TRBV and TRBD / TRBJ regions, and the term TCR beta constant domain refers to the extracellular TRBC region or a C-terminal truncated TRBC sequence.

[0146] As used herein, the terms "upstream" and "downstream" refer to the relative positions of genetic code, e.g., nucleotides, sequence elements, in a polynucleotide sequence. In some embodiments, in an RNA polynucleotide, upstream is toward the 5' end of the polynucleotide and downstream is toward the 3' end. In some embodiments, in a DNA polynucleotide, upstream is toward the 5' end of the coding strand of the gene in question and downstream is toward the 3' end.

[0147] As used herein, "vaccine" refers to a composition for generating immunity for the prevention and / or treatment of disease. A vaccine is thus a drug that contains an antigen and is intended for use in humans or animals to generate specific defenses and protection upon administration to humans or animals.

[0148] A. Definition of Lipids As used herein, the phrase "biodegradable lipid" or "degradable lipid" refers to any of a number of lipid species that degrade in the host environment within minutes, hours, or even days, ideally making them less toxic and less likely to accumulate within the host over time. Common modifications to lipids include ester bonds and, particularly, disulfide bonds, which enhance the biodegradability of the lipid.

[0149] As used herein, the phrase "biodegradable PEG lipid" or "degradable PEG lipid" refers to any of a number of lipid species in which the PEG molecule is cleaved from the lipid within minutes, hours, or even days in the host environment, ideally resulting in low immunogenicity. Common modifications to PEG lipids include ester bonds and, among others, disulfide bonds, which enhance the biodegradability of the lipid.

[0150] As used herein, the term "cationic lipid" or "ionizable lipid" refers to any of a number of lipid species that carry a net positive charge at a selected pH, such as physiological pH 4, and a neutral charge at other pHs, such as physiological pH 7.

[0151] As used herein, the term "PEG" means any polyethylene glycol or other polyalkylene ether polymer.

[0152] As generally defined herein, a "PEG-OH lipid" (also referred to herein as a "hydroxy-PEGylated lipid") is a PEGylated lipid having one or more hydroxyl (-OH) groups on the lipid.

[0153] As used herein, a "phospholipid" is a lipid that includes a phosphate moiety and one or more carbon chains, such as unsaturated fatty acid chains.

[0154] As used herein, the term "structured lipid" refers to sterols and also to lipids containing a sterol moiety. As defined herein, "sterols" are a subgroup of steroids consisting of steroid alcohols.

[0155] The terms "head group" and "tail group," when used herein to describe compounds (e.g., lipids) of the present invention, particularly functional groups contained in such compounds, are used for ease of reference to describe the orientation of one or more functional groups relative to such compounds or other functional groups. For example, in certain embodiments, a hydrophilic head group (e.g., guanidinium) is attached (e.g., by one or more of hydrogen bonding, van der Waals forces, ionic interactions, and covalent bonding) to a cleavable functional group (e.g., a disulfide group), which is then attached to a hydrophilic tail group (e.g., cholesterol). In certain embodiments, the compounds disclosed herein, for example, comprise at least one hydrophilic head group and at least one hydrophobic tail group, each attached to at least one cleavable group, thereby rendering such compounds amphiphilic.

[0156] As used herein, the term "amphiphilic" refers to the ability to dissolve in both polar (e.g., water) and non-polar (e.g., lipid) environments. For example, in certain embodiments, the compounds (e.g., lipids) disclosed herein contain at least one lipophilic tail group (e.g., cholesterol or C6-C 20 alkyl) and at least one hydrophilic head group (e.g., imidazole), each linked to a cleavable group (e.g., disulfide).

[0157] As used herein, the term "hydrophilic" is used qualitatively to indicate that a functional group prefers water and is typically water-soluble. For example, disclosed herein are compounds (e.g., ionizable lipids) that contain a cleavable group (e.g., a disulfide (SS) group) attached to one or more hydrophilic groups (e.g., hydrophilic head groups), where the hydrophilic groups include or are selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl.

[0158] As used herein, the term "hydrophobic" is used qualitatively to indicate that a functional group dislikes water, typically such groups are not water-soluble. In certain embodiments, at least one of the functional groups of a moiety comprising a compound disclosed herein is hydrophobic in nature (e.g., a hydrophobic tail group comprising a naturally occurring lipid such as cholesterol). For example, compounds (e.g., ionizable lipids) are disclosed herein that comprise a cleavable functional group (e.g., a disulfide (SS) group) attached to one or more hydrophobic groups, such as one or more naturally occurring lipids, e.g., cholesterol, optionally substituted, variably saturated or unsaturated C6-C 20 Alkyl and / or optionally substituted, variably saturated or unsaturated C-C 20 It may comprise or be selected from acyl.

[0159] As used herein, the term "liposome" generally refers to a vesicle composed of lipids (e.g., amphipathic lipids) arranged in one or more spherical bilayers. Such liposomes can be unilamellar or multilamellar vesicles with a membrane formed from a lipophilic substance and an aqueous interior containing encapsulated circRNA to be delivered to one or more target cells, tissues, and organs.

[0160] As used herein, the phrase "lipid nanoparticle" refers to a delivery vehicle comprising one or more cationic or ionizable lipids, stabilizing lipids, structural lipids, and helper lipids.

[0161] In certain embodiments, the compositions described herein comprise one or more liposomes or lipid nanoparticles. Examples of suitable lipids (e.g., ionizable lipids) that can be used to form the contemplated liposomes and lipid nanoparticles include one or more of the compounds disclosed herein (e.g., HGT4001, HGT4002, HGT4003, HGT4004, and / or HGT4005). Such liposomes and lipid nanoparticles may also include additional ionizable lipids, such as C12-200, DLin-KC2-DMA, and / or HGT5001, helper lipids, structural lipids, PEG-modified lipids, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE, HGT5000, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA, DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof.

[0162] In some embodiments, the lipids disclosed herein, e.g., ionizable lipids, comprise one or more cleavable groups. The terms "cleavage" and "cleavable," as used herein, mean that one or more chemical bonds (e.g., one or more of covalent bonds, hydrogen bonds, van der Waals forces, and / or ionic interactions) between atoms within or adjacent to the functional group of interest can be broken (e.g., hydrolyzed) or broken upon exposure to selected conditions (e.g., upon exposure to enzymatic conditions). In certain embodiments, the cleavable group is a disulfide functional group, and in certain embodiments, a disulfide group that can be cleaved upon exposure to selected biological conditions (e.g., intracellular conditions). In certain embodiments, the cleavable group is an ester functional group that can be cleaved upon exposure to selected biological conditions. For example, disulfide groups can be cleaved enzymatically or by hydrolysis, oxidation, or reduction reactions. Upon cleavage of such a disulfide functional group, one or more functional moieties or groups (e.g., one or more of the head group and / or tail group) attached thereto can be released. Exemplary cleavable groups may include, but are not limited to, disulfide groups, ester groups, ether groups, and any derivatives thereof (e.g., alkyl and aryl esters). In certain embodiments, the cleavable group is not an ester or ether group. In some embodiments, the cleavable group is attached (e.g., attached by one or more of hydrogen bonds, van der Waals forces, ionic interactions, and covalent bonds) to one or more functional moieties or groups (e.g., at least one head group and at least one tail group). In certain embodiments, at least one of the functional moieties or groups is hydrophilic (e.g., a hydrophilic head group comprising one or more of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino, and pyridyl).

[0163] B. Chemical definition In describing the present invention, which may include compounds and pharmaceutically acceptable salts thereof, pharmaceutical compositions containing such compounds, and methods of using such compounds and compositions, the following terms, when present, have the following meanings unless otherwise indicated. As described herein, it is also understood that any of the moieties defined below may be substituted with various substituents, and that each definition is intended to include such substituted moieties within their scope as set forth below. Unless otherwise indicated, the term "substituted" is defined as set forth below. It is further understood that the terms "group" and "radical" can be considered interchangeable as used herein.

[0164] The compounds described herein may also contain one or more isotopic substitutions. For example, H may be: 1 H, 2 H (D or deuterium), and 3 H (T or tritium) and C can be in any isotopic form; 12 C. 13 C, and 14 C can be in any isotopic form; O can be 16 O and 18 F can be in any isotopic form, including O; 18 F and 19 It can be any isotopic form, including F.

[0165] When a range of values ​​is listed, it is intended to encompass each value and subrange within the range. For example, "C 1-6 "Alkyl" refers to C1, C2, C3, C4, C5, C6, C 1-6 , C 1-5 , C 1-4 , C 1-3 , C 1-2 , C 2-6 , C 2-5 , C 2-4 , C 2-3 , C 3-6 , C 3-5 , C 3-4 , C 4-6 , C 4-5 , and C 5-6Alkyl is intended to be included.

[0166] As used herein, the term "alkyl" refers to both straight and branched chain C 1-40 Hydrocarbons (e.g., C 6-20 "Alkyl" refers to a hydrocarbon, including both saturated and unsaturated hydrocarbons. In certain embodiments, alkyl can include one or more cyclic alkyls and / or one or more heteroatoms, such as oxygen, nitrogen, or sulfur, and can be optionally substituted with substituents (e.g., one or more of alkyl, halo, alkoxyl, hydroxy, amino, aryl, ether, ester, or amide). In certain embodiments, contemplated alkyls include (9Z,12Z)-octadeca-9,12-diene. For example, "C 6-20 Use of a designation such as " is intended to refer to an alkyl (e.g., straight or branched chain, including alkenes and alkyls) having the stated range of carbon atoms. In some embodiments, the alkyl group has 1 to 10 carbon atoms ("C 1-10 In some embodiments, an alkyl group has 1 to 9 carbon atoms ("C 1-9 In some embodiments, the alkyl group has 1 to 8 carbon atoms ("C 1-8 In some embodiments, the alkyl group has 1 to 7 carbon atoms ("C 1-7 In some embodiments, an alkyl group has 1 to 6 carbon atoms ("C 1-6 In some embodiments, an alkyl group has 1 to 5 carbon atoms ("C 1-5 In some embodiments, an alkyl group has 1 to 4 carbon atoms ("C 1-4 In some embodiments, the alkyl group has 1 to 3 carbon atoms ("C 1-3 In some embodiments, the alkyl group has 1 to 2 carbon atoms ("C 1-2 In some embodiments, the alkyl group has one carbon atom ("C alkyl"). 1-6Examples of alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, pentyl, hexyl, and the like.

[0167] As used herein, "alkenyl" refers to the radical of a straight-chain or branched hydrocarbon group having 2 to 20 carbon atoms, one or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 carbon-carbon double bonds), and optionally one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 carbon-carbon triple bonds) ("C 2-20 In certain embodiments, the alkenyl does not contain any triple bonds. In some embodiments, the alkenyl has 2 to 10 carbon atoms ("C 2-10 In some embodiments, an alkenyl group has 2 to 9 carbon atoms ("C 2-9 In some embodiments, an alkenyl group has 2 to 8 carbon atoms ("C 2-8 In some embodiments, an alkenyl group has 2 to 7 carbon atoms ("C 2-7 In some embodiments, an alkenyl group has 2 to 6 carbon atoms ("C 2-6 In some embodiments, an alkenyl group has 2 to 5 carbon atoms ("C 2-5 In some embodiments, an alkenyl group has 2 to 4 carbon atoms ("C 2-4 In some embodiments, the alkenyl group has 2 to 3 carbon atoms ("C 2-3 In some embodiments, the alkenyl group has two carbon atoms ("C2 alkenyl"). The one or more carbon-carbon double bonds can be internal (such as in 2-butenyl) or terminal (such as in 1-butenyl). C 2-4 Examples of alkenyl groups include ethenyl (C2), 1-propenyl (C3), 2-propenyl (C3), 1-butenyl (C4), 2-butenyl (C4), butadienyl (C4), and the like. 2-6 Examples of alkenyl groups include the aforementioned C 2-4Alkenyl groups include pentenyl (C5), pentadienyl (C5), hexenyl (C6), etc. Additional examples of alkenyl include heptenyl (C7), octenyl (C8), octatrienyl (C8), etc.

[0168] As used herein, "alkynyl" refers to the radical of a straight-chain or branched hydrocarbon group having 2 to 20 carbon atoms, one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 carbon-carbon triple bonds), and optionally one or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 carbon-carbon double bonds) ("C 2-20 In certain embodiments, alkynyl does not contain any double bonds. In some embodiments, alkynyl groups have 2 to 10 carbon atoms ("C 2-10 In some embodiments, an alkynyl group has 2 to 9 carbon atoms ("C 2-9 In some embodiments, an alkynyl group has 2 to 8 carbon atoms ("C 2-8 In some embodiments, an alkynyl group has 2 to 7 carbon atoms ("C 2-7 In some embodiments, an alkynyl group has 2 to 6 carbon atoms ("C 2-6 In some embodiments, an alkynyl group has 2 to 5 carbon atoms ("C 2-5 In some embodiments, an alkynyl group has 2 to 4 carbon atoms ("C 2-4 In some embodiments, an alkynyl group has 2 to 3 carbon atoms ("C 2-3 In some embodiments, the alkynyl group has two carbon atoms ("C2 alkynyl"). The one or more carbon-carbon triple bonds can be internal (such as in 2-butynyl) or terminal (such as in 1-butynyl). C 2-4 Examples of alkynyl groups include, but are not limited to, ethynyl (C2), 1-propynyl (C3), 2-propynyl (C3), 1-butynyl (C4), 2-butynyl (C4), and the like.2-6 Examples of alkenyl groups include the aforementioned C 2-4 Alkynyl groups include pentynyl (C5), hexynyl (C6), etc. Additional examples of alkynyl include heptynyl (C7), octynyl (C8), etc.

[0169] As used herein, "alkylene," "alkenylene," and "alkynylene" refer to the divalent radical of an alkyl, alkenyl, and alkynyl group, respectively. When a range or number of carbons is provided for a particular "alkylene," "alkenylene," or "alkynylene" group, it is understood that the range or number refers to the range or number of carbons in a linear divalent chain of carbons. "Alkylene," "alkenylene," and "alkynylene" groups can be substituted or unsubstituted with one or more substituents described herein.

[0170] As used herein, the term "alkoxy" refers to an alkyl group attached to another moiety through an oxygen atom (-O(alkyl)). Non-limiting examples include, for example, methoxy, ethoxy, propoxy, and butoxy.

[0171] As used herein, the term "aryl" refers to aromatic groups (e.g., monocyclic, bicyclic, and tricyclic structures) containing 6 to 10 carbons in the ring portion. Aryl groups may be optionally substituted through available carbon atoms and, in certain embodiments, may contain one or more heteroatoms such as oxygen, nitrogen, or sulfur. In some embodiments, an aryl group has 6 ring carbon atoms ("C6 aryl," e.g., phenyl). In some embodiments, an aryl group has 10 ring carbon atoms ("C6 aryl," e.g., phenyl). 10 Aryl, for example, naphthyl, such as 1-naphthyl and 2-naphthyl).

[0172] The term "cycloalkyl" refers to a monovalent saturated cyclic, bicyclic, or bridged cyclic (e.g., adamantyl) hydrocarbon group of 3 to 12, 3 to 8, 4 to 8, or 4 to 6 carbons, and is used herein, for example, to refer to "C" derived from a cycloalkane.4-8 Exemplary cycloalkyl groups include, but are not limited to, cyclohexane, cyclopentane, cyclobutane, and cyclopropane.

[0173] As used herein, "cyano" refers to --CN.

[0174] As used herein, "heteroaryl" refers to the radical of a 5- to 10-membered monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having 6 or 10 electrons shared in a cyclic arrangement) having ring carbon atoms and 1 to 4 ring heteroatoms provided in the aromatic ring system, each heteroatom being independently selected from nitrogen, oxygen, and sulfur ("5- to 10-membered heteroaryl"). In heteroaryl groups containing one or more nitrogen atoms, the point of attachment may be at a carbon or nitrogen atom, valence permitting. Heteroaryl bicyclic ring systems may contain one or more heteroatoms in one or both rings. "Heteroaryl" includes ring systems in which the heteroaryl ring, as defined above, is fused with one or more carbocyclyl or heterocyclyl groups, and the point of attachment is on the heteroaryl ring; in such instances, the number of ring members continues to designate the number of ring members in the heteroaryl ring system. "Heteroaryl" also includes ring systems in which the heteroaryl ring defined above is fused to one or more aryl groups, and the point of attachment is on either the aryl or heteroaryl ring; in such instances, the number of ring members designates the number of ring members in the fused (aryl / heteroaryl) ring system. In bicyclic heteroaryl groups in which one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl, etc.), the point of attachment can be on either ring, i.e., either the ring with a heteroatom (e.g., 2-indolyl) or the ring without a heteroatom (e.g., 5-indolyl).

[0175] As used herein, "heterocyclyl" or "heterocyclic" refers to the radical of a 3- to 10-membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, each independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon (a "3- to 10-membered heterocyclyl"). For heterocyclyl groups containing one or more nitrogen atoms, the point of attachment may be at a carbon or nitrogen atom, where valence permits. Heterocyclyl groups may be either monocyclic (a "monocyclic heterocyclyl") or fused, bridged, or spiro ring systems, such as bicyclic systems (a "bicyclic heterocyclyl"), and may be saturated or partially unsaturated. Heterocyclyl bicyclic ring systems may contain one or more heteroatoms in one or both rings. "Heterocyclyl" also includes ring systems in which a heterocyclyl ring as defined above is fused to one or more carbocyclyl groups and the point of attachment is on either the carbocyclyl or heterocyclyl ring or ring system, or a heterocyclyl ring as defined above is fused to one or more aryl or heteroaryl groups and the point of attachment is on the heterocyclyl ring, in such instances the number of ring members continues to designate the number of ring members in the heterocyclyl ring system. The terms "heterocycle," "heterocyclyl," "heterocyclyl ring," "heterocyclic group," "heterocyclic moiety," and "heterocyclic radical" may be used interchangeably.

[0176] As used herein, the terms "halo" and "halogen" refer to an atom selected from fluorine (fluoro, F), chlorine (chloro, Cl), bromine (bromo, Br), and iodine (iodo, I). In certain embodiments, a halo group is either fluoro or chloro.

[0177] As used herein, "oxo" refers to -C=O.

[0178] In general, the term "substituted," whether preceded by the term "optionally," means that at least one hydrogen present on the group (e.g., a carbon or nitrogen atom) is replaced with an acceptable substituent, e.g., a substituent that, upon substitution, results in a stable compound, e.g., a compound that does not undergo spontaneous transformation by rearrangement, cyclization, elimination, or other reaction. Unless otherwise indicated, a "substituted" group has a substituent at one or more substitutable positions of the group; when more than one position in any given structure is substituted, the substituent is either the same or different at each position.

[0179] As used herein, "pharmaceutically acceptable salts" refers to those salts that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods used in the art, such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lanthanide ... Pharmaceutically acceptable salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and N(C1-4 alkyl) salts.Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. Further pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed, where appropriate, using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkylsulfonates, and arylsulfonates.

[0180] In typical embodiments, the invention is intended to encompass the compounds disclosed herein, as well as pharmaceutically acceptable salts, pharmaceutically acceptable esters, tautomeric forms, polymorphs, and prodrugs of such compounds. In some embodiments, the invention includes pharmaceutically acceptable addition salts, pharmaceutically acceptable esters, solvates (e.g., hydrates) of addition salts, tautomeric forms, polymorphs, enantiomers, mixtures of enantiomers, stereoisomers, or mixtures of stereoisomers (either pure or as racemic or non-racemic mixtures) of the compounds described herein.

[0181] The compounds described herein may contain one or more asymmetric centers and therefore may exist in various isomeric forms, such as enantiomers and / or diastereomers. For example, the compounds described herein may be in the form of individual enantiomers, diastereomers, or geometric isomers, or may be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomers. Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high-pressure liquid chromatography (HPLC) and the formation and crystallization of chiral salts, or preferred isomers can be prepared by asymmetric synthesis. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw-Hill, NY, 1962); and Wilen, Tables of Resolving Agents and Optical Resolutions p. 268 (EL Eliel, Ed., University of Notre Dame Press, Notre Dame, IN 1972). The present invention additionally encompasses the compounds described herein as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers.

[0182] In certain embodiments, compounds (e.g., ionizable lipids) and delivery vehicles (e.g., lipid nanoparticles) of which such compounds are components exhibit improved (e.g., increased) ability to transfect one or more target cells. Accordingly, methods of transfecting one or more target cells are also provided herein. Such methods generally include contacting one or more target cells with a compound and / or pharmaceutical composition disclosed herein, such that the one or more target cells are transfected with the circular RNA encapsulated therein.

[0183] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. Unless specifically stated or clear from the context, the term "or" as used herein is to be understood as inclusive. Unless defined herein and the rest of the specification below, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0184] 2. DNA templates, RNA precursors, and circular RNA According to the present invention, transcription of a DNA template provided herein (e.g., comprising a 3'-enhanced intron element, a 3'-enhanced exon element, a core functional element, a 5'-enhanced exon element, and a 5'-enhanced intron element) results in the formation of a precursor linear RNA polynucleotide that can be circularized. In some embodiments, the DNA template comprises a vector, a PCR product, a plasmid, a minicircle DNA, a cosmid, an artificial chromosome, a complementary DNA (cDNA), an extrachromosomal DNA (ecDNA), or a fragment thereof. In certain embodiments, the minicircle DNA may be linear or non-linear. In certain embodiments, the plasmid may be linear or non-linear. In some embodiments, the DNA template may be single-stranded. In other embodiments, the DNA template may be double-stranded. In some embodiments, the DNA template consists, in whole or in part, of a viral, bacterial, or eukaryotic vector.

[0185] The present invention, as provided herein, includes a DNA template that shares the same sequence as a linear RNA precursor polynucleotide (e.g., 3'-enhanced intronic elements, 3'-enhanced exonic elements, core functional elements, and 5'-enhanced exonic elements, 5'-enhanced intronic elements) before the linear RNA precursor polynucleotide is spliced. In some embodiments, the linear RNA precursor polynucleotide undergoes splicing during the circularization process, leading to the removal of the 3'-enhanced intronic elements and 5'-enhanced intronic elements. In some embodiments, the resulting circular RNA polynucleotide lacks the 3'-enhanced intronic fragments and 5'-enhanced intronic fragments, but maintains the 3'-enhanced exonic fragments, core functional elements, and 5'-enhanced exonic elements.

[0186] In some embodiments, the linear RNA precursor polynucleotide comprises one or more guanosine nucleotides or nucleosides (e.g., GTP) and divalent cations (e.g., Mg 2+ In some embodiments, the 3'-enhancing exon elements, 5'-enhancing exon elements, and / or core functional elements, in whole or in part, promote circularization of the linear RNA precursor polynucleotide to form a circular RNA polynucleotide provided herein.

[0187] In certain embodiments, the circular RNAs provided herein are produced inside the cell. In some embodiments, RNA precursors are transcribed using a DNA template (e.g., in some embodiments, using a vector provided herein) in the cytoplasm by a bacteriophage RNA polymerase or in the nucleus by host RNA polymerase II, and then circularized.

[0188] In certain embodiments, the circular RNAs provided herein are injected into an animal (e.g., a human) such that the polypeptide encoded by the circular RNA molecule is expressed inside the animal.

[0189] In some embodiments, the DNA (e.g., vectors), linear RNA (e.g., RNA precursors), and / or circular RNA polynucleotides provided herein are 300 to 10,000, 400 to 9,000, 500 to 8,000, 600 to 7,000, 700 to 6,000, 800 to 5,000, 900 to 5,000, 1,000 to 5,000, 1,100 to 5,000, 1,200 to 5,000, 1,300 to 5,000, 1,400 to 5,000, and / or 1,500 to 5,000 nucleotides in length. In some embodiments, a polynucleotide is at least 300nt, 400nt, 500nt, 600nt, 700nt, 800nt, 900nt, 1000nt, 1100nt, 1200nt, 1300nt, 1400nt, 1500nt, 2000nt, 2500nt, 3000nt, 3500nt, 4000nt, 4500nt, or 5000nt in length, In some embodiments, a polynucleotide is no more than 3000nt, 3500nt, 4000nt, 4500nt, 5000nt, 6000nt, 7000nt, 8000nt, 9000nt, or 10000nt in length. In some embodiments, the length of the DNA, linear RNA, and / or circular RNA polynucleotides provided herein is about 300 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1000 nt, 1100 nt, 1200 nt, 1300 nt, 1400 nt, 1500 nt, 2000 nt, 2500 nt, 3000 nt, 3500 nt, 4000 nt, 4500 nt, 5000 nt, 6000 nt, 7000 nt, 8000 nt, 9000 nt, or 10000 nt.

[0190] In some embodiments, the circular RNAs provided herein have greater functional stability than mRNAs comprising the same expressed sequence, hi some embodiments, the circular RNAs provided herein have greater functional stability than mRNAs comprising the same expressed sequence, 5moU modifications, optimized UTRs, caps, and / or polyA tails.

[0191] In some embodiments, the circular RNA polynucleotides provided herein have a functional half-life of at least 5, 10, 15, 20, 30, 40, 50, 60, 70, or 80 hours. In some embodiments, the circular RNA polynucleotides provided herein have a functional half-life of 5-80, 10-70, 15-60, and / or 20-50 hours. In some embodiments, the circular RNA polynucleotides provided herein have a longer (e.g., at least 1.5-fold longer, at least 2-fold longer) functional half-life than an equivalent linear RNA polynucleotide encoding the same protein. In some embodiments, the functional half-life can be assessed through detection of functional protein synthesis.

[0192] In some embodiments, the circular RNA polynucleotides provided herein have a half-life of at least 5, 10, 15, 20, 30, 40, 50, 60, 70, or 80 hours. In some embodiments, the circular RNA polynucleotides provided herein have a half-life of 5 to 80, 10 to 70, 15 to 60, and / or 20 to 50 hours. In some embodiments, the circular RNA polynucleotides provided herein have a longer half-life (e.g., at least 1.5-fold longer, at least 2-fold longer) than an equivalent linear RNA polynucleotide encoding the same protein. In some embodiments, the circular RNA polynucleotide, or pharmaceutical composition thereof, has a functional half-life in human cells that is longer than or equal to a predetermined threshold value. In some embodiments, the functional half-life is determined by a functional protein assay. For example, in some embodiments, the functional half-life is determined by an in vitro luciferase assay, where Gaussia luciferase (GLuc) activity is measured in the culture medium of human cells (e.g., HepG2) expressing the circular RNA polynucleotide every 1, 2, 6, 12, or 24 hours for 1, 2, 3, 4, 5, 6, 7, or 14 days. In other embodiments, the functional half-life is determined by an in vivo assay, where the level of the protein encoded by the expressed sequence of the circular RNA polynucleotide is measured in patient serum or tissue samples every 1, 2, 6, 12, or 24 hours for 1, 2, 3, 4, 5, 6, 7, or 14 days. In some embodiments, the predetermined threshold is the functional half-life of a reference linear RNA polynucleotide comprising the same expressed sequence as the circular RNA polynucleotide.

[0193] In some embodiments, the circular RNAs provided herein may have a higher degree of expression than a comparable linear mRNA, e.g., a higher degree of expression 24 hours after administration of the RNA to a cell. In some embodiments, the circular RNAs provided herein have a higher degree of expression than an mRNA that includes the same expression sequence, 5moU modification, optimized UTR, cap, and / or polyA tail.

[0194] In some embodiments, the circular RNAs provided herein may be less immunogenic than equivalent mRNAs when exposed to an organism's immune system or a particular type of immune cell. In some embodiments, the circular RNAs provided herein are associated with modulating cytokine production when exposed to an organism's immune system or a particular type of immune cell. For example, in some embodiments, the circular RNAs provided herein are associated with reduced production of IFN-β1, RIG-I, IL-2, IL-6, IFNγ, and / or TNFα when exposed to an organism's immune system or a particular type of immune cell, compared to mRNA containing the same expression sequence. In some embodiments, the circular RNAs provided herein are associated with less induction of IFN-β1, RIG-I, IL-2, IL-6, IFNγ, and / or TNFα transcripts when exposed to an organism's immune system or a particular type of immune cell, compared to mRNA containing the same expression sequence. In some embodiments, the circular RNAs provided herein are less immunogenic than mRNA containing the same expression sequence. In some embodiments, the circular RNAs provided herein are less immunogenic than mRNAs containing the same expression sequence, 5moU modifications, optimized UTRs, caps, and / or polyA tails.

[0195] In certain embodiments, the circular RNA provided herein can be directly transfected into cells, or can be transfected in the form of a DNA vector and transcribed in cells. The transcription of the circular RNA from the transfected DNA vector can be mediated by an additional polymerase or a polymerase encoded by a nucleic acid transfected into the cell, or preferably by an endogenous polymerase.

[0196] A. Enhanced Intronic and Exonic Elements The polynucleotides provided herein may contain one or more enhanced intronic elements and / or one or more enhanced exonic elements. In some embodiments, the enhanced intronic and exonic elements may contain spacers, duplex regions, affinity sequences, intron fragments, exon fragments, and / or various untranslated elements. These sequences within the enhanced intronic or exonic elements are positioned to optimize circularization or protein expression.

[0197] a.Spacer In some embodiments, a provided polynucleotide (e.g., a DNA template, an RNA precursor polynucleotide, or a circular RNA polynucleotide) comprises one or more spacers. In certain embodiments, the polynucleotide comprises a first (5') and / or a second (3') spacer. In some embodiments, the polynucleotide (e.g., a DNA template or a linear RNA precursor polynucleotide) comprises one or more spacers at the enhanced intron element. In some embodiments, the polynucleotide (e.g., a DNA template, a linear RNA precursor polynucleotide, or a circular RNA polynucleotide) comprises one or more spacers at the enhanced exon element. In certain embodiments, the polynucleotide comprises a spacer at the 3' enhanced intron fragment and a spacer at the 5' enhanced intron fragment. In certain embodiments, the polynucleotide comprises a spacer at the 3' enhanced exon fragment and another spacer at the 5' enhanced exon fragment to aid in circularization or protein expression due to the symmetry created in the overall sequence.

[0198] In some embodiments, including a spacer between the 3' Group I intron fragment and the core functional element may preserve secondary structure in those regions by preventing them from interacting, thus increasing splicing efficiency. In some embodiments, the first (between the 3' Group I intron fragment and the core functional element) and second (between the two expression sequences and the core functional element) spacers contain additional base-paired regions that are predicted to base pair with each other and not with the first and second duplex regions. In other embodiments, the first (between the 3' Group I intron fragment and the core functional element) and second (between one of the core functional elements and the 5' Group I intron fragment) spacers contain additional base-paired regions that are predicted to base pair with each other and not with the first and second duplex regions. In some embodiments, such spacer base-pairing brings the Group I intron fragments into close proximity with each other, further increasing splicing efficiency. Additionally, in some embodiments, the combination of base pairing between the first and second duplex regions, and separately between the first and second spacers, promotes the formation of a splicing bubble containing a group I intron fragment bordered by adjacent regions of base pairing. Typical spacers have the following qualities: 1) are predicted to avoid interference with proximal structures, such as an IRES, expression sequence, aptamer, or intron; 2) are at least 7 nt in length and no more than 100 nt; 3) are located after and adjacent to the 3' intron fragment and / or before and adjacent to the 5' intron fragment; and 4) are contiguous sequences with one or more of the following: a) an unstructured region at least 5 nt in length, b) a region of base pairing at least 5 nt in length to a distal sequence comprising another spacer, and c) a structured region at least 7 nt in length bounded by the sequence of the spacer. Spacers can have several regions, including unstructured regions, base-paired regions, hairpin / structured regions, and combinations thereof. In some embodiments, the spacer has a structured region with high GC content. In some embodiments, a region within a spacer base is paired with another region within the same spacer.In some embodiments, a region within a spacer base pairs with a region within another spacer. In some embodiments, the spacer comprises one or more hairpin structures. In some embodiments, the spacer comprises one or more hairpin structures with a 4-12 nucleotide stem and a 2-10 nucleotide loop. In one embodiment, an additional spacer is present between the 3' Group I intron fragment and the core functional element. In one embodiment, this additional spacer prevents or reduces the extent to which the structured region of the IRES or TIE aptamer interferes with folding of the 3' Group I intron fragment. In some embodiments, the 5' spacer sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, the 5' spacer sequence is no longer than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments, the 5' spacer sequence is between 5 and 50, 10 and 50, 20 and 50, 20 and 40, and / or 25 and 35 nucleotides in length. In certain embodiments, the 5' spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In one embodiment, the 5' spacer sequence is a polyA sequence. In another embodiment, the 5' spacer sequence is a polyAC sequence. In one embodiment, the spacer comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polyAC content. In one embodiment, the spacer comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polypyrimidine (C / T or C / U) content.

[0199] b.Double-stranded region In some embodiments, a polynucleotide provided herein (e.g., a DNA template, linear RNA precursor polynucleotide, or circular RNA polynucleotide provided herein) comprises one or more duplex regions. In some embodiments, the polynucleotide comprises a first (5') duplex region and a second (3') duplex region. In certain embodiments, the polynucleotide comprises a 5' external duplex region located within the 3'-enhanced intron fragment and a 3' external duplex region located within the 5'-enhanced intron fragment. In some embodiments, the polynucleotide comprises a 5' internal duplex region located within the 3'-enhanced exon fragment and a 3' internal duplex region located within the 5'-enhanced exon fragment. In some embodiments, the polynucleotide comprises a 5' external duplex region, a 5' internal duplex region, a 3' internal duplex region, and a 3' external duplex region.

[0200] In certain embodiments, the first and second duplex regions can form a perfect or imperfect duplex. Thus, in certain embodiments, at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the first and second duplex regions can be base-paired to each other. In some embodiments, the duplex region is predicted to have less than 50% (e.g., less than 45%, less than 40%, less than 35%, less than 30%, or less than 25%) base-pairing with unintended sequences (e.g., non-duplex region sequences) within the RNA. In some embodiments, including such duplex regions at the ends of the RNA precursor strands and adjacent to or closely adjacent to group I intron fragments brings the group I intron fragments into close proximity to each other, increasing splicing efficiency. In some embodiments, the duplex region is 3 to 100 nucleotides in length (e.g., 3 to 75 nucleotides in length, 3 to 50 nucleotides in length, 20 to 50 nucleotides in length, 35 to 50 nucleotides in length, 5 to 25 nucleotides in length, 9 to 19 nucleotides in length). In some embodiments, the duplex region is about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some embodiments, the duplex region has a length of about 9 to about 50 nucleotides. In some embodiments, the duplex region has a length of about 9 to about 19 nucleotides. In some embodiments, the duplex region has a length of about 20 to about 40 nucleotides. In certain embodiments, the duplex region has a length of about 30 nucleotides.

[0201] In other embodiments, the polynucleotide does not contain a double-stranded region to optimize translation or circularization.

[0202] c. affinity sequence As provided herein, a provided polynucleotide (e.g., a DNA template, a linear RNA precursor polynucleotide, or a circular RNA polynucleotide) can comprise an affinity sequence (or affinity tag). In some embodiments, the affinity tag is located in the 3'-enhanced intron element. In some embodiments, the affinity tag is located in the 5'-enhanced intron element. In some embodiments, both (3' and 5') enhanced intron elements each comprise an affinity tag. In one embodiment, the affinity tag in the 3'-enhanced intron element is the same length as the affinity tag in the 5'-enhanced intron element. In some embodiments, the affinity tag in the 3'-enhanced intron element is the same sequence as the affinity tag in the 5'-enhanced intron element. In some embodiments, the affinity sequence is positioned to optimize oligo-dT purification.

[0203] In some embodiments, one or more affinity tags present on the linear RNA precursor polynucleotide are removed during circularization. See, e.g., Figures 97A and 97B. In some embodiments, after RNA circularization, affinity tags are added to the remaining linear RNA. In some such embodiments, affinity tags are enzymatically added to the linear RNA. Because one or more affinity tags are present on the linear RNA and no affinity tags are present on the circular RNA, purification of the circular RNA may be facilitated. In some embodiments, such purification is performed using negative selection or affinity purification methods. In some embodiments, such purification is performed using a binding agent that preferentially or specifically binds to the affinity tag.

[0204] In some embodiments, the affinity tag comprises a polyA sequence. In some embodiments, the polyA sequence is at least 15, 30, or 60 nucleotides in length. In some embodiments, the affinity tag comprising a polyA sequence is present at two locations within the linear RNA precursor. In some embodiments, one or both polyA sequences are 15-50 nucleotides in length. In some embodiments, one or both polyA sequences are 20-25 nucleotides in length. In some embodiments, the polyA sequence is removed upon circularization. Thus, oligonucleotides that hybridize to polyA sequences, such as deoxythymidine oligonucleotides (oligo(dT)) conjugated to a solid surface (e.g., a resin), can be used to separate the circular RNA from its RNA precursor.

[0205] In some embodiments, the affinity tag comprises a sequence that is not present in the circular RNA product. In some such embodiments, the sequence that is not present in the circular RNA product is a dedicated binding site (DBS). In some embodiments, the DBS is an unstructured sequence, i.e., a sequence that does not form a defined structural element such as a hairpin loop, a continuous dsRNA region, or a triple helix. In some embodiments, the DBS sequence forms a random coil. In some embodiments, the DBS comprises at least 25% GC content, at least 50% GC content, at least 75% GC content, or at least 100% GC content. In some embodiments, the DBS comprises at least 25% AC content, at least 50% AC content, at least 75% AC content, or 100% AC content. In some embodiments, the DBS is at least 15, 30, or 60 nucleotides in length. In some embodiments, the affinity tag comprising a DBS is present at two locations within the linear RNA precursor. In some embodiments, the DBS sequences are each independently 15 to 50 nucleotides in length. In some embodiments, the DBS sequences are each independently 20-25 nucleotides in length.

[0206] In some embodiments, DBS sequence is removed during circularization.Therefore, a binder comprising an oligonucleotide comprising a sequence complementary to DBS can be used to facilitate the purification of circular RNA.For example, the binder can comprise an oligonucleotide complementary to DBS that is conjugated to a solid surface (e.g., resin).

[0207] In some embodiments, affinity sequences or other types of affinity handles, such as biotin, are added to the linear RNA by ligation. In some embodiments, oligonucleotides containing affinity sequences are ligated to the linear RNA. In some embodiments, oligonucleotides conjugated with affinity handles are ligated to the linear RNA. In some embodiments, a solution containing linear RNA ligated to an affinity sequence or handle and circular RNA without an affinity sequence or handle is contacted with a binder comprising a solid support conjugated with an oligonucleotide complementary to the binding partner of the affinity sequence or affinity handle, allowing the linear RNA to bind to the binder and the circular RNA to be eluted or separated from the solid support.

[0208] Any of the methods for purifying circular RNA described herein may include one or more buffer exchange steps. In some embodiments, buffer exchange is performed after in vitro transcription (IVT) and before any additional purification steps. In some such embodiments, the IVT reaction solution is buffer exchanged into a buffer containing Tris. In some embodiments, the IVT reaction solution is buffer exchanged into a buffer containing greater than 1 mM or greater than 10 mM of one or more monovalent salts, such as NaCl or KCl, and optionally, EDTA. In some embodiments, buffer exchange is performed after circular RNA purification is complete. In some embodiments, buffer exchange is performed after IVT and after circular RNA purification. In some embodiments, buffer exchange performed after circular RNA purification includes exchanging the circular RNA into water or a storage buffer. In some embodiments, the storage buffer contains 1 mM sodium citrate, pH 6.5.

[0209] In certain embodiments, the 3'-enhanced intron element comprises a leader untranslated sequence. In some embodiments, the leader untranslated sequence is at the 5' end of the 3'-enhanced intron fragment. In some embodiments, the leader untranslated sequence comprises the last nucleotide of a transcription start site (TSS). In some embodiments, the TSS is selected from a viral, bacterial, or eukaryotic DNA template. In one embodiment, the leader untranslated sequence comprises the last nucleotide of the TSS and 0 to 100 additional nucleotides. In some embodiments, the TSS is a terminal spacer. In one embodiment, the leader untranslated sequence comprises a guanosine at the 5' end upon translation by RNA T7 polymerase.

[0210] In certain embodiments, the 5'-enhanced intron element comprises a trailing untranslated sequence. In some embodiments, the 5'-enhanced intron element is located at the 3' end of the 5'-enhanced intron element. In some embodiments, the trailing untranslated sequence is a partial restriction digest sequence. In one embodiment, the trailing untranslated sequence is, in whole or in part, a restriction digest site used to linearize a DNA template. In some embodiments, the restriction digest site is, in whole or in part, derived from a naturally occurring viral, bacterial, or eukaryotic DNA template. In some embodiments, the trailing untranslated sequence is a terminal restriction site fragment.

[0211] d. Enhanced intron fragment In some embodiments, the 3'-enhanced intron element and the 5'-enhanced intron element each comprise an intron fragment. In certain embodiments, the 3' intron fragment is a contiguous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous) to the 3'-proximal fragment of a naturally occurring Group I intron that includes the 3' splice site dinucleotide. Typically, the 5' intron fragment is a contiguous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous) to the 5'-proximal fragment of a naturally occurring Group I intron that includes the 5' splice site dinucleotide. In some embodiments, the 3' intron fragment comprises the first nucleotide of a 3' Group I splice site dinucleotide. In some embodiments, the 5' intron fragment comprises the first nucleotide of a 5' Group I splice site dinucleotide. In other embodiments, the 3' intron fragment comprises the first and second nucleotides of a 3' Group I intron fragment splice site dinucleotide, and the 5' intron fragment comprises the first and second nucleotides of a 3' Group I intron fragment dinucleotide.

[0212] e. Enhanced exon fragment In certain embodiments, the provided polynucleotide (e.g., a DNA template, a linear RNA precursor polynucleotide, or a circular RNA polynucleotide) comprises an enhanced exon fragment. In some embodiments, the 3'-enhanced exon element is located upstream of the core functional element in 5' to 3' order. In some embodiments, the 5'-enhanced intron element is located downstream of the core functional element in 5' to 3' order.

[0213] According to the present invention, the 3'-enhanced exonic element and the 5'-enhanced exonic element each comprise an exon fragment. In some embodiments, the 3'-enhanced exonic element comprises a 3'-exon fragment. In some embodiments, the 5'-enhanced exonic element comprises a 5'-exon fragment. In certain embodiments, as provided herein, the 3'-exon fragment and the 5'-exon fragment each comprise a Group I intron fragment and 1-100 nucleotides of exon sequence. In certain embodiments, the 3'-intron fragment is a contiguous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous) to the 3'-proximal fragment of a naturally occurring Group I intron that includes the 3'-splice site dinucleotide. Typically, the 5' Group I intron fragment is a contiguous sequence at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous) to the 5'-proximal fragment of a naturally occurring Group I intron that includes the 5' splice site dinucleotide. In some embodiments, the 3' exon fragment includes the second nucleotide of the 3' Group I intron splice site dinucleotide and 1-100 nucleotides of exon sequence. In some embodiments, the 5' exon fragment includes the first nucleotide of the 5' Group I intron splice site dinucleotide and 1-100 nucleotides of exon sequence. In some embodiments, the exon sequence is composed partially or entirely of naturally occurring exon sequence from a viral, bacterial, or eukaryotic DNA vector. In other embodiments, the exon sequences further comprise synthetic, genetically modified (eg, containing modified nucleotides), or other engineered exon sequences.

[0214] In one embodiment, the 3' intron fragment comprises both nucleotides of the 3' Group I splice site dinucleotide, the 5' intron fragment comprises both nucleotides of the 5' Group I splice site dinucleotide, and the exon fragments located within the 5' enhanced exon element and the 3' enhanced exon element do not comprise the Group I splice site dinucleotide.

[0215] f. Exemplary Permutations of Enhanced Intronic and Exonic Elements By way of example and not limitation, in some embodiments, the 3'-enhanced intron element comprises, in 5' to 3' order, a leading untranslated sequence, a 5' affinity tag, an optional 5' external duplex region, a 5' external spacer, and a 3' intron fragment. In some embodiments, the 3'-enhanced exon element comprises, in 5' to 3' order, a 3' exon fragment, an optional 5' internal duplex region, an optional 5' internal duplex region, and a 5' internal spacer. In some embodiments, the 5'-enhanced exon element comprises, in 5' to 3' order, a 3' internal spacer, an optional 3' internal duplex region, and a 5' exon fragment. In some embodiments, the 3'-enhanced intron element comprises, in 5' to 3' order, a 5' intron fragment, a 3' external spacer, an optional 3' external duplex region, a 3' affinity tag, and a trailing untranslated sequence.

[0216] B. Core Functional Elements In some embodiments, the provided polynucleotide (e.g., a DNA template, a linear RNA precursor polynucleotide, or a circular RNA polynucleotide) comprises a core functional element. In some embodiments, the core functional element comprises a coding element or a non-coding element. In certain embodiments, the core functional element can include both coding and non-coding elements. In some embodiments, the core functional element further comprises a translation initiation element (TIE) upstream of the coding or non-coding element. In some embodiments, the core functional element comprises a termination element. In some embodiments, the termination element is located downstream of the TIE and the coding element. In some embodiments, the termination element is located downstream of the coding element but upstream of the TIE. In certain embodiments, when the coding element includes a non-coding region, the core functional element lacks a TIE and / or a termination element.

[0217] a. Code or non-code element In some embodiments, the polynucleotides provided herein comprise coding elements or non-coding elements, or a combination of both. In some embodiments, the coding elements comprise expression sequences. In some embodiments, the coding elements encode at least one therapeutic protein.

[0218] In some embodiments, the provided circular RNA encodes two or more polypeptides. In some embodiments, the circular RNA is bicistronic. The sequences encoding the two or more polypeptides may be separated by a nucleotide sequence encoding a ribosome skipping element or a protease cleavage site. In certain embodiments, the ribosome skipping element encodes the Tosea asignavirus 2A peptide (T2A), the porcine teschovirus-1 2A peptide (P2A), the foot-and-mouth disease virus 2A peptide (F2A), the equine rhinitis A virus 2A peptide (E2A), the cytoplasmic polyhedrosis virus 2A peptide (BmCPV 2A), or the B. mori flacherie virus 2A peptide (BmIFV 2A).

[0219] b. Translation initiation element (TIE) In some embodiments, as provided herein, a core functional element comprises at least one translation initiation element (TIE). The TIE is designed to enable efficient translation of the encoded protein. Thus, an optimal core functional element that comprises only non-coding elements lacks any TIE. In some embodiments, a core functional element that comprises one or more coding elements further comprises one or more TIEs.

[0220] In some embodiments, the TIE comprises an untranslated region (UTR). In certain embodiments, the TIE provided herein comprises an internal ribosome entry site (IRES). The inclusion of an IRES allows for the translation of one or more open reading frames (e.g., open reading frames forming an expression sequence) from the circular RNA. The IRES element attracts the eukaryotic ribosomal translation initiation complex and promotes translation initiation. See, e.g., Kaufman et al., Nuc. Acids Res. (1991) 19:4485-4490; Gurtu et al., Biochem. Biophys. Res. Comm. (1996) 229:295-298; Rees et al., BioTechniques (1996) 20:102-110; Kobayashi et al., BioTechniques (1996) 21:399-402; and Mosser et al., BioTechniques 1997 22 150-161).

[0221] i. Natural TIEs: viral and eukaryotic / intracellular ribosome entry sites (IRES) Numerous IRES sequences are available, including those derived from a wide variety of viruses, including picornavirus leader sequences such as the encephalomyocarditis virus (EMCV) UTR (Jang et al. J. Virol. (1989) 63:1651-1660), polio leader sequences, hepatitis A virus leader, hepatitis C virus IRES, human rhinovirus type 2 IRES (Dobrikova et al., Proc. Natl. Acad. Sci. (2003) 100(25):15125-15130), IRES elements from foot-and-mouth disease virus (Ramesh et al., Nucl. Acid Res. (1996) 24:2697-2700), and giardia virus IRES (Garlapati et al., J. Biol. Chem. (2004) 279(5):3389-3397).

[0222] Different IRES sequences have varying abilities to drive protein expression, and the ability of any particular identified or predicted IRES sequence to drive protein expression from linear mRNA or circular RNA constructs is unknown and unpredictable. In certain embodiments, potential IRES sequences can be biologically identified based on their sequence location within the viral sequence. However, the activity of such sequences has not previously been characterized. As shown herein, such IRES sequences may have different protein expression capabilities in cell types, such as T cells, hepatocytes, or muscle cells. In some embodiments, the novel IRES sequences described herein may have at least 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 20-, 50-, or 100-fold increased expression in a particular cell type compared to the previously described EMCV IRES sequence.

[0223] In some embodiments, the provided circular RNA comprises an IRES operably linked to a protein-coding sequence to drive protein expression. In some embodiments, the IRES comprises a sequence selected from SEQ ID NOs: 1-2983 and 3282-3287, or a fragment thereof. In some embodiments, the IRES comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from SEQ ID NOs: 1-2983 and 3282-3287. In some embodiments, the circular RNA disclosed herein comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from SEQ ID NOs: 1-2983 and 3282-3287. In some embodiments, the circular RNAs disclosed herein comprise an IRES sequence, or a fragment thereof, selected from SEQ ID NOs: 1-2983 and 3282-3287. Modifications of the IRES and accessory sequences are disclosed herein to increase or decrease IRES activity, for example, by truncating the 5' and / or 3' end of the IRES, adding a spacer 5' to the IRES, modifying the 6 nucleotides 5' of the translation start site (Kozak sequence), modifying alternative translation start sites, and generating chimeric / hybrid IRES sequences. In some embodiments, the IRES sequence in the circular RNAs disclosed herein comprises one or more of these modifications relative to a naturally occurring IRES (e.g., SEQ ID NOs: 1-2983 and 3282-3287).

[0224] In some embodiments, the IRES is selected from the group consisting of Aalivirus, Ailurivirus, Ampivirus, Anativirus, Aphthovirus, Aquamavirus, Avihepatovirus, Avizivirus, Boosepivirus, Bopivirus, Caecilivirus, Cardiovirus, , Cosavirus, Crahelivirus, Crohivirus, Danipivirus, Dicipivirus, Diresapivirus, Enterovirus, Erbovirus, Felipivirus, Fipivirus, Gallivirus, Gruhelivirus, Grusopivirus, Harkavirus Harkavirus, Hemipivirus, Hepatovirus, Hanivirus, Kobuvirus, Kunsagivirus, Limnipivirus, Livupivirus, Ludopivirus, Malagasivirus, Marsupivirus, Megrivirus, Missivirus, Mosavirus, Mupivirus virus, Myrropivirus, Orivirus, Ocivirus, Parabovirus, Parechovirus, Pasivirus, Parsleyvirus, Pemapivirus, Poecivirus, Potamipivirus, Pygoscepivirus, Rabovirus, Rafivirus, Rajidapivirus,These include Rohelivirus, Rosavirus, Sakobuvirus, Sarivirus, Sapelovirus, Senecavirus, Shambavirus, Sisinivirus, Symapivirus, Teschovirus, Torchivirus, Tottorivirus, Tremovirus, Tropivirus, Hepacivirus, Pegivirus, Pestivirus, and Flavivirus IRES.

[0225] In some embodiments, the IRES is selected from the group consisting of Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, Simian virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, Human poliovirus 1, Plautia stali enterovirus, Kashmir wasp virus, Human rhinovirus 2, Homalodisca coagulata virus-1, Human immunodeficiency virus type 1, Himetobi P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, Foot and mouth disease virus, Human enterovirus 71, Equine rhinitis virus, Ectropis obliqua picorna-like virus, encephalomyocarditis virus, Drosophila C virus, human coxsackievirus B3, crucifer tobamovirus, cricket paralysis virus, bovine viral diarrhea virus 1, black queen cell virus, aphid lethal paralysis virus, avian encephalomyelitis virus, acute honeybee paralysis virus, hibiscus chlorotic ringspot virus, classical swine fever virus, human FGF2, human SFTPA1, human AML1 / RUNX1, Drosophila antennapedia, human AQP4, human mouse AT1R, human BAG-1, human BCL2, human BiP, human c-IAPl, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1alpha, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, dog Scamper, Drosophila Ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP, Drosophila hairless, S. cerevisiae TFIID, S.cerevisiae YAP1, tobacco etch virus, turnip crinkle virus, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCV pEC9, picobirnavirus, HCV QC64, human cosavirus E / D, human cosavirus F, human cosavirus JMY, rhinovirus NAT001, HRV14, HRV89, HRVC-02, HRV-A21, sarivirus A SH1, sarivirus FHB, sarivirus NG-J1, human parechovirus 1, Kurohivirus B, Yc-3, rosavirus M-7, shambavirus A, pasivirus A, pasivirus A 2, echovirus E14, human parechovirus 5, Aichi virus, hepatitis A virus HA16, fopivirus, CVA10, enterovirus C, enterovirus D, enterovirus J, human pegivirus 2, GBV-C GT110, GBV-C The sequences are the IRES sequences of K1737, GBV-C Iowa, Pegivirus A 1220, Pasivirus A 3, Sapelovirus, Rosavirus B, Bakunsavirus, Tremovirus A, Swine Pasivirus 1, PLV-CHN, Pasivirus A, Sisinivirus, Hepacivirus K, Hepacivirus A, BVDV1, Border disease virus, BVDV2, CSFV-PK15C, SF573 dicistrovirus, Hupeii picorna-like virus, CRPV, Sarivirus A BN5, Sarivirus A BN2, Sarivirus A 02394, Sarivirus A GUT, Sarivirus A CH, Sarivirus A SZ1, Sarivirus FHB, CVB3, CVB1, Echovirus 7, CVB5, EVA71, CVA3, CVA12, EV24, or an aptamer against eIF4G.

[0226] In some embodiments, the IRES includes those derived, in whole or in part, from eukaryotic or cellular IRESs. In certain embodiments, the IRES is derived from a human gene, such as ABCF1, ABCG1, ACAD10, ACOT7, ACSS3, ACTG2, ADCYAP1, ADK, AGTR1, AHCYL2, AHI1, AKAP8L, AKR1A1, ALDH3A1, ALDOA, ALG13, AMMECR1L, ANGPTL4, ANK3, AOC3, AP4B1, AP4E1, APAF1, APBB1, APC, APH1A, APOBEC3D, APOM, APP, AQP4, ARHGAP36, ARL13B, AR MC8, ARMCX6, ARPC1A, ARPC2, ARRDC3, ASAP1, ASB3, ASB5, ASCL1, ASMTL, ATF2, ATF3, ATG4A, ATP5B, ATP6V0A1, ATXN3, AURKA, AURKA, AURKA, AURK A, B3GALNT1, B3GNTL1, B4GALT3, BAAT, BAG1, BAIAP2, BAIAP2L2, BAZ2A, BBX, BCAR1, BCL2, BCS1L, BET1, BID, BIRC2, BPGM, BPIFA2, BRINP2, BSG, BTN3A2, C12orf43, C14orf93, C17orf62, C1orf226, C21orf62, C2orf15, C4BPB, C4orf22, C9orf84, CACNA1A, CALCOCO2, CAPN11, CASP12, CASP8 AP2, CAV1, CBX5, CCDC120, CCDC17, CCDC186, CCDC51, CCN1, CCND1, CCNT1, CD2BP2, CD9, CDC25C, CDC42, CDC7, CDCA7L, CDIP1, CDK1, CDK11A, CDK N1B, CEACAM7, CEP295NL, CFLAR, CHCHD7, CHIA, CHIC1, CHMP2A, CHRNA2, CLCN3, CLEC12A, CLEC7A, CLECL1, CLRN1, CMSS1, CNIH1, CNR1, CNTN5, CO G4, COMMD1, COMMD5, CPEB1, CPS1, CRACR2B, CRBN, CREM, CRYBG1, CSDE1, CSF2RA, CSNK2A1, CSTF3, CTCFL, CTH, CTNNA3, CTNNB1, CTNNB1, CTNND1,CTSL、CUTA、CXCR5、CYB5R3、CYP24A1、CYP3A5、DAG1、DAP3、DAP5、DAXX、DCAF4、DCAF7、DCLRE1A、 DCP1A、DCTN1、DCTN2、DDX19B、DDX46、DEFB123、DGKA、DGKD、DHRS4、DHX15、DIO3、DLG1、DLL4、DMD UTR、DMD ex5、DMKN、DNAH6、DNAL4、DUSP13、DUSP19、DYNC1I2、DYNLRB2、DYRK1A、ECI2、ECT2、EIF1AD、EIF2B4、EIF4G1、EIF4G2、EIF4G3、E LANE、ELOVL6、ELP5、EMCN、ENO1、EPB41、ERMN、ERVV-1、ESRRG、ETFB、ETFBKMT、ETV1、ETV4、EXD1、EXT1、EZH2、FAM111B、FAM157A 、FAM213A、FBXO25、FBXO9、FBXW7、FCMR、FGF1、FGF1、FGF1A、FGF 2、FGF2、FGF-9、FHL5、FMR1、FN1、FOXP1、FTH1、FUBP1、G3BP1、GA BBR1、GALC、GART、GAS7、gastrin、GATA1、GATA4、GFM2、GHR、GJB2、GLI1、GLRA2、GMNN、GPAT3、GPATCH3、GPR137、GPR34、GPR55、G PR89A、GPRASP1、GRAP2、GSDMB、GSTO2、GTF2B、GTF2H4、GUCY1B2、HAX1、HCST、HIGD1A、HIGD1B、HIPK1、HIST1H1C、HIST1H3H、HK1 、HLA-DRB4、HMBS、HMGA1、HNRNPC、HOPX、HOXA2、HOXA3、HPCAL1、HR、HSP90AB1、HSPA1A、HSPA4L、HSPA5、HYPK、IFFO1、IFT74、IFT 81、IGF1、IGF1R、IGF1R、IGF2、IL11、IL17RE、IL1RL1、IL1RN、IL32、IL6、ILF2、ILVBL、INSR、INTS13、IP6K1、ITGA4、ITGAE、KCNE4、KERA、KIAA0355、KIAA0895L、KIAA1324、KIAA1522、KIAA1683、KIF2C、KIZ、KLHL31、KLK7、KRR1、KRT14、KRT17、KRT33A、KRT6A、KRTAP10-2、KRTAP13-3、KRTAP13-4、KRTAP5-11、KRTCAP2、LACRT、LAMB1、LA MB3、LANCL1、LBX2、LCAT、LDHA、LDHAL6A、LEF1、LINC-PINT、LMO3、LRRC4C、LR RC7、LRTOMT、LSM5、LTB4R、LYRM1、LYRM2、MAGEA11、MAGEA8、MAGEB1、MAGEB1 6、MAGEB3、MAPT、MARS、MC1R、MCCC1、METTL12、METTL7A、MGC16025、MGC16025 、MIA2、MIA2、MITF、MKLN1、MNT、MORF4L2、MPD6、MRFAP1、MRPL21、MRPS12、MS I2、MSLN、MSN、MT2A、MTFR1L、MTMR2、MTRR、MTUS1、MYB、MYC、MYCL、MYCN、MYL1 0、MYL3, MYLK, MYO1A, MYT2, MZB1, NAP1L1, NAV1, NBAS, NCF2, NDRG1, NDST2 NDUFA7、NDUFB11、NDUFC1、NDUFS1、NEDD4L、NFAT5、NFE2L2、NFE2L2、NFIA、NH EJ1、NHP2、NIT1、NKRF、NME1-NME2、NPAT、NR3C1、NRBF2、NRF1、NTRK2、NUDCD 1、NXF2、NXT2、ODC1、ODF2、OPTN、OR10R2、OR11L1、OR2M2、OR2M3、OR2M5、OR2T 10、OR4C15、OR4F17、OR4F5、OR5H1、OR5K1、OR6C3、OR6C75、OR6N1、OR7G2、p5 3、P2RY4、PAN2、PAQR6、PARP4、PARP9、PC、PCBP4、PCDHGC3、PCLAF、PDGFB、PDZ RN4、HAIR、PEMT、PEX2、PFKM、PGBD4、PGLYRP3、PHLDA2、PHTF1、PI4KB、PIGC、 PIM1、PKD2L1、PKM、PLCB4、PLD3、PLAKHA1、PLKHB1、PLS3、PML、PNMA5、PNN、P OC1A、POC1B、POLD2、POLD4、POU5F1、PPIG、PQBP1、PRAME、PRPF4、PRR11、PRRT 1、PRSS8、PSMA2、PSMA3、PSMA4、PSMD11、PSMD4、PSMD6、PSME3、PSMG3、PTBP3、PTCH1, PTHLH, PTPRD, PUS7L, PVRIG, QPRT, RAB27A, RAB7B, RABGGTB, RAET1E, RALGDS, RALYL, RARB, RCVRN, REG3G, RFC5, RGL4, RGS19, RGS3, RHD, RINL, R IPOR2, RITA1, RMDN2, RNASE1, RNASE4, RNF4, RPA2, RPL17, RPL21, RPL26L1, RPL28, RPL29, RPL41, RPL9, RPS11, RPS13, RPS14, RRBP1, RSU1, RTP2, RUNX1, RUNX1T1、RUNX1T1、RUNX2、RUSC1、RXRG、S100A13、S100A4、SAT1、SCHIP1、SCMH1、SEC14L1、SEMA4A、SERPINA1、SERPINB4、SERTAD3、SFTPD、SH3D19、SHC1、 SHMT1, SHPRH, SIM1, SIRT5, SLC11A2, SLC12A4, SLC16A1, SLC25A3, SLC26A9, SLC5A11, SLC6A12, SLC6A19, SLC7A1, SLFN11, SLIRP, SMAD5, SMARCAD1, SMN 1、SNCA、SNRNP200、SNRPB2、SNX12、SOD1、SOX13、SOX5、SP8、SPARCL1、SPATA12、SPATA31C2、SPN、SPOP、SQSTM1、SRBD1、SRC、SREBF1、SRPK2、SSB、SSB、SSBP1、ST3GAL6、STAB1、STAMBP、STAU1、STAU1、STAU1、STAU1、STAU1、STK16、STK24、STK38、STMN1、STX7、SULT2B1、SYK、SYNPR、TAF1C、TAGLN、TANK、TAS2R40 、TBC1D15、TBXAS1、TCF4、TDGF1、TDP2、TDRD3、TDRD5、TESK2、THAP6、THBD、THTPA、TIAM2、TKFC、TKTL1、TLR10、TM9SF2、TMC6、TMCO2、TMED10、TMEM116、TM EM126A, TMEM159, TMEM208, TMEM230, TMEM67, TMPRSS13, TMUB2, TNFSF4, TNIP3, TP53, TP53, TP73, TRAF1, TRAK1, TRIM31, TRIM6, TRMT1, TRMT2B, TRPM7,TRPM8, TSPEAR, TTC39B, TTLL11, TUBB6, TXLNB, TXNIP, TXNL1, TXNRD1, TYROBP, U2AF1, UBA1, UBE2D3, UBE2I, UBE2 L3, UBE2V1, UBE2V2, UMPS, UNG, UPP2, USMG5, USP18, UTP14A, UTRN, UTS2, VDR, VEGFA, VEGFA, VEPH1, VIPAS39, VPS2 9, VSIG10L, WDHD1, WDR12, WDR4, WDR45, WDYHV1, WRAP53, XIAP, XPNPEP3, YAP1, YWHAZ, YY1AP1, ZBTB32, ZNF146, ZNF250, ZNF385A, ZNF408, ZNF410, ZNF423, ZNF43, ZNF502, ZNF512, ZNF513, ZNF580, ZNF609, ZNF707, or ZNRD1.

[0227] ii. Synthetic TIEs: Aptamer conjugates, modified nucleotides, IRES variants, and other engineered linkages As contemplated herein, in certain embodiments, a translation initiation element (TIE) comprises a synthetic TIE. In some embodiments, the synthetic TIE comprises an aptamer complex, a synthetic IRES, or other engineered TIE capable of initiating translation of a linear or circular RNA polynucleotide.

[0228] In some embodiments, one or more aptamer sequences can bind to components of eukaryotic initiation factors to enhance or initiate translation. In some embodiments, aptamers can be used to enhance translation in vivo and in vitro by promoting specific eukaryotic initiation factors (eIFs) (e.g., the aptamer of WO2019 / 081383 A1 can bind to eukaryotic initiation factor 4F (eIF4F)). In some embodiments, an aptamer or aptamer complex can be capable of binding to EIF4G, EIF4E, EIF4A, EIF4B, EIF3, EIF2, EIF5, EIF1, EIF1A, 40S ribosome, PCBP1 (poly C-binding protein), PCBP2, PCBP3, PCBP4, PABP1 (poly A-binding protein), PTB, the Argonaute protein family, HNRNPK (heterogeneous nuclear ribonucleoprotein K), or La protein.

[0229] c.Terminal sequence In certain embodiments, the core functional element comprises a termination sequence. In some embodiments, the termination sequence comprises a stop codon. In one embodiment, the termination sequence comprises a stop cassette. In some embodiments, the termination cassette comprises at least two stop codons. In some embodiments, the termination cassette comprises at least two in-frame stop codons. In some embodiments, the frames of the stop codons in the termination cassette each comprise one, two, or more stop codons. In some embodiments, the termination cassette comprises a LoxP or RoxStopRox, or frt-flanked termination cassette. In some embodiments, the termination cassette comprises a lox-stop-lox termination cassette.

[0230] C. Variant In certain embodiments, provided polynucleotides (e.g., DNA templates, RNA precursor polynucleotides, or circular RNA polynucleotides) comprise modified nucleotides and / or modified nucleosides. In some embodiments, the modified nucleosides are 5In another embodiment, the modified nucleoside is m 5 U (5-methyluridine). In another embodiment, the modified nucleoside is m 6 A(N 6 In another embodiment, the modified nucleoside is s 2 In another embodiment, the modified nucleoside is U (2-thiouridine). In another embodiment, the modified nucleoside is Ψ (pseudouridine). In another embodiment, the modified nucleoside is Um (2'-O-methyluridine). In another embodiment, the modified nucleoside is m 1 A(1-methyladenosine);m 2 A(2-methyladenosine); Am(2'-O-methyladenosine); ms 2 m 6 A(2-methylthio-N 6 -methyladenosine);i 6 A(N 6 -Isopentenyladenosine);ms 2 i6A(2-methylthio-N 6 Isopentenyladenosine);io 6 A(N 6 -(cis-hydroxyisopentenyl)adenosine);ms 2 io 6 A(2-methylthio-N 6 -(cis-hydroxyisopentenyl)adenosine);g 6 A(N 6 -glycinylcarbamoyl adenosine);t 6 A(N 6 -threonylcarbamoyl adenosine);ms 2 t 6 A(2-methylthio-N 6 -threonylcarbamoyl adenosine);m 6 t 6 A(N 6 -methyl-N 6 -threonylcarbamoyl adenosine);hn 6 A(N 6 -hydroxynorvalylcarbamoyl adenosine);ms 2 hn 6 A(2-methylthio-N6 -Hydroxynorvalylcarbamoyl adenosine; Ar(p)(2'-O-ribosyladenosine (phosphate)); I(inosine); m 1 I(1-methylinosine);m 1 Im(1,2'-O-dimethylinosine);m 3 C(3-methylcytidine); Cm(2'-O-methylcytidine); s 2 C(2-thiocytidine);ac 4 C(N 4 -acetylcytidine);f 5 C(5-formylcytidine);m 5 Cm(5,2'-O-dimethylcytidine);ac 4 Cm(N 4 -acetyl-2'-O-methylcytidine);k 2 C(lycidin);m 1 G(1-methylguanosine);m 2 G(N 2 -methylguanosine);m 7 G(7-methylguanosine); Gm(2'-O-methylguanosine); m 2 2G(N 2 ,N 2 -dimethylguanosine);m 2 Gm(N 2 ,2'-O-dimethylguanosine);m 2 2Gm(N 2 ,N 2 ,2'-O-trimethylguanosine;Gr(p)(2'-O-ribosylguanosine(phosphate));yW(wybutosine);o2yW(peroxywybutosine);OHyW(hydroxywybutosine);OHyW*(unmodified hydroxywybutosine);imG(wybutosine);mimG(methylwybutosine);Q(keuosine);oQ(epoxykeuosine);galQ(galactosyl-keuosine);manQ(mannosyl-keuosine);preQ0(7-cyano-7-deazaguanosine);preQ1(7-aminomethyl-7-deazaguanosine);G + (Archaeosin); D(Dihydrouridine); m 5 Um(5,2'-O-dimethyluridine);s 4 U(4-thiouridine);m5 s 2 U(5-methyl-2-thiouridine);s 2 Um(2-thio-2'-O-methyluridine); acp 3 U(3-(3-amino-3-carboxypropyl)uridine);ho 5 U(5-hydroxyuridine);mo 5 U(5-methoxyuridine); cmo 5 U(uridine 5-oxyacetic acid);mcmo 5 U(uridine 5-hydroxyacetic acid methyl ester);chm 5 U(5-(carboxyhydroxymethyl)uridine));mchm 5 U(5-(carboxyhydroxymethyl)uridine methyl ester);mcm 5 U(5-methoxycarbonylmethyluridine); mcm 5 Um (5-methoxycarbonylmethyl-2'-O-methyluridine); mcm 5 s 2 U(5-methoxycarbonylmethyl-2-thiouridine);nm 5 S 2 U(5-aminomethyl-2-thiouridine);mnm 5 U(5-methylaminomethyluridine); mnm 5 s 2 U(5-methylaminomethyl-2-thiouridine);mnm 5 se 2 U(5-methylaminomethyl-2-selenouridine);ncm 5 U(5-carbamoylmethyluridine);ncm 5 Um(5-carbamoylmethyl-2'-O-methyluridine);cmnm 5 U(5-carboxymethylaminomethyluridine);cmnm 5 Um (5-carboxymethylaminomethyl-2'-O-methyluridine); cmnm 5 s 2 U(5-carboxymethylaminomethyl-2-thiouridine);m 6 2A(N 6 ,N 6 -dimethyladenosine; Im (2'-O-methylinosine); m 4C(N 4 -methylcytidine);m 4 Cm(N 4 ,2'-O-dimethylcytidine);hm 5 C(5-hydroxymethylcytidine);m 3 U(3-methyluridine); cm 5 U(5-carboxymethyluridine);m 6 Am(N 6 ,2'-O-dimethyladenosine);m 6 2Am(N 6 ,N 6 ,O-2'-trimethyladenosine);m 2,7 G(N 2 ,7-dimethylguanosine);m 2,2,7 G(N 2 ,N 2 ,7-trimethylguanosine);m 3 Um(3,2'-O-dimethyluridine);m 5 D(5-methyldihydrouridine);f 5 Cm(5-formyl-2'-O-methylcytidine);m 1 Gm(1,2'-O-dimethylguanosine);m 1 Am(1,2'-O-dimethyladenosine);τm 5 U(5-taurinomethyluridine);τm 5 s 2 U(5-taurinomethyl-2-thiouridine)); imG-14(4-demethylwyosine); imG2(isowyosine); or ac 6 A(N 6 -acetyladenosine).

[0231] In some embodiments, modified nucleosides include pyridin-4-one ribonucleosides, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine , 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio- Pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine Zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-Diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, 2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wyobutosine, 7-deaza-guanosine In another embodiment, the modifications are independently selected from the group consisting of 5-methylcytosine, pseudouridine, and 1-methylpseudouridine.

[0232] In some embodiments, modified ribonucleosides include 5-methylcytidine, 5-methoxyuridine, 1-methyl-pseudouridine, N6-methyladenosine, and / or pseudouridine, hi some embodiments, such modified nucleosides provide additional stability and resistance to immune activation.

[0233] In certain embodiments, polynucleotides may be codon-optimized. A codon-optimized sequence can be a sequence in which codons in a polynucleotide encoding a polypeptide have been substituted to increase the expression, stability, and / or activity of the polypeptide. Factors that influence codon optimization include, but are not limited to, one or more of the following: (i) variation in codon bias between two or more organisms or genes or synthetically constructed bias tables; (ii) variation in the degree of codon bias within an organism, gene, or set of genes; (iii) systematic variation of codons containing context; (iv) variation of codons according to their decoding tRNAs; (v) variation of codons according to GC % either globally or at a single position in a triplet; (vi) variation in similarity to a reference sequence, such as a naturally occurring sequence; (vii) variation in codon frequency cutoff; (viii) structural properties of mRNA transcribed from a DNA sequence; (ix) prior knowledge of the function of the DNA sequence based on which the codon substitution set is designed; and / or (x) systematic variation of the codon set for each amino acid. In some embodiments, codon-optimized polynucleotides may minimize ribozyme conflicts and / or limit structural interference between the expressed sequence and core functional elements.

[0234] 3. Payload In some embodiments, the expressed sequence encodes a therapeutic protein, hi some embodiments, the therapeutic protein is selected from the proteins listed in the table below. [Table 1A-1] [Table 1A-2] [Table 1A-3] [Table 1A-4] [Table 1A-5]

Table 1A-6

Table 1A-7

Table 1A-8

Table 1A-9

Table 1A-10

Table 1A-11

Table 1A-12

Table 1A-13

Table 1A-14

Table 1A-15

[0235] In some embodiments, the expression sequence encodes a therapeutic protein. In some embodiments, the expression sequence encodes a cytokine, e.g., IL-12p70, IL-15, IL-2, IL-18, IL-21, IFN-α, IFN-β, IL-10, TGF-beta, IL-4, or IL-35, or a functional fragment thereof. In some embodiments, the expression sequence encodes an immune checkpoint inhibitor. In some embodiments, the expression sequence encodes an agonist (e.g., a TNFR family member, e.g., CD137L, OX40L, ICOSL, LIGHT, or CD70). In some embodiments, the expression sequence encodes a chimeric antigen receptor. In some embodiments, the expression sequence encodes an inhibitory receptor agonist (e.g., PDL1, PDL2, galectin-9, VISTA, B7H4, or MHCII) or an inhibitory receptor (e.g., PD1, CTLA4, TIGIT, LAG3, or TIM3). In some embodiments, the expressed sequence encodes an inhibitory receptor antagonist. In some embodiments, the expressed sequence encodes one or more TCR chains (alpha and beta chains or gamma and delta chains). In some embodiments, the expressed sequence encodes a secretory T cell or immune cell engager (e.g., a bispecific antibody such as a BiTE that targets CD3, CD137, or CD28 and a tumor-expressed protein, e.g., CD19, CD20, or BCMA). In some embodiments, the expressed sequence encodes a transcription factor (e.g., FOXP3, HELIOS, TOX1, or TOX2). In some embodiments, the expressed sequence encodes an immunosuppressive enzyme (e.g., IDO or CD39 / CD73). In some embodiments, the expressed sequence encodes a GvHD (e.g., anti-HLA-A2 CAR-Treg).

[0236] In some embodiments, the polynucleotide encodes a protein that is composed of subunits encoded by more than one gene.For example, the protein can be a heterodimer, with each chain or subunit of the protein being encoded by a separate gene.More than one circRNA molecule can be delivered in a transport vehicle, with each circRNA encoding a separate subunit of the protein.Alternatively, a single circRNA can be engineered to encode more than one subunit.In certain embodiments, separate circRNA molecules encoding each subunit can be administered in separate transport vehicles.

[0237] A. Antigen-remodeling receptor a. Chimeric antigen receptor (CAR) In some embodiments, the provided RNA polynucleotides encode one or more chimeric antigen receptors (CARs or CAR-Ts). CARs are genetically engineered receptors. These engineered receptors can be inserted into and expressed by immune cells, including T cells, via circular RNA as described herein. CARs allow a single receptor to be programmed to both recognize and bind to a specific antigen, activating the immune cell to attack and destroy cells bearing that antigen. If these antigens are present on tumor cells, the immune cells expressing the CAR can target and kill the tumor cells. In some embodiments, the CAR encoded by the polynucleotide comprises (i) an antigen-binding molecule that specifically binds to a target antigen, (ii) a hinge domain, a transmembrane domain, and an intracellular domain, and (iii) an activation domain.

[0238] In some embodiments, a CAR orientation according to the present disclosure comprises an antigen-binding domain (such as an scFv) in tandem with a costimulatory domain and an activation domain. The costimulatory domain may comprise one or more of an extracellular portion, a transmembrane portion, and an intracellular portion. In other embodiments, multiple costimulatory domains may be utilized in tandem.

[0239] i. antigen-binding domain CARs can be engineered to bind to antigens (such as cell surface antigens) by incorporating an antigen-binding molecule that interacts with the target antigen. In some embodiments, the antigen-binding molecule is an antibody fragment thereof, such as one or more single-chain antibody fragments (scFvs). scFvs are single-chain antibody fragments that contain the variable regions of the heavy and light chains of an antibody linked to each other. See U.S. Patent Nos. 7,741,465 and 6,319,494, and Eshhar et al., Cancer Immunol Immunotherapy (1997) 45:131-136. scFvs retain the ability of the parent antibody to specifically interact with the target antigen. scFvs are useful in chimeric antigen receptors because they can be engineered to be expressed as part of a single chain together with other CAR components. See also Id. Krause et al., J. Exp. Med., Volume 188, No. 4, 1998 (619-626); Finney et al., Journal of Immunology, 1998, 161:2791-2797. It will be understood that an antigen-binding molecule is typically contained within the extracellular portion of the CAR so that it can recognize and bind to the antigen of interest. Bispecific and multispecific CARs are contemplated within the scope of the present invention, with specificity for more than one target of interest.

[0240] In some embodiments, the antigen-binding molecule comprises a single chain, and the heavy chain variable region and the light chain variable region are connected by a linker. In some embodiments, the VH is located at the N-terminus of the linker, and the VL is located at the C-terminus of the linker. In other embodiments, the VL is located at the N-terminus of the linker, and the VH is located at the C-terminus of the linker. In some embodiments, the linker comprises at least about 5, at least about 8, at least about 10, at least about 13, at least about 15, at least about 18, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 amino acids.

[0241] In some embodiments, the antigen-binding molecule comprises a nanobody. In some embodiments, the antigen-binding molecule comprises a DARPin. In some embodiments, the antigen-binding molecule comprises an anticalin or other synthetic protein capable of specifically binding to a target protein.

[0242] In some embodiments, the CAR is selected from the group CD19, CD123, CD22, CD30, CD171, CS-1, C-type lectin-like molecule-1, CD33, epidermal growth factor receptor variant III (EGFRvIII), ganglioside G2 (GD2), ganglioside GD3, TNF receptor family member B-cell maturation (BCMA), Tn antigen ((Tn Ag) or (GaINAca-Ser / Thr)), prostate-specific membrane antigen (PSMA), receptor tyrosine kinase-like orphan receptor 1 (ROR1), Fms-like tyrosine kinase 3 (FLT3), tumor-associated glycoprotein 72 (TAG72), CD38, CD44v6, carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EPCAM), B7H3 (CD276), KIT (CD117), interleukin-13 receptor subunit alpha-2, mesothelin, ... Interleukin-11 receptor alpha (IL-11Ra), prostate stem cell antigen (PSCA), protease serine 21, vascular endothelial growth factor receptor 2 (VEGFR2), Lewis (Y) antigen, CD24, platelet-derived growth factor receptor beta (PDGFR-beta), stage-specific embryonic antigen-4 (SSEA-4), CD20, folate receptor alpha, HER2, HER3, mucin 1, cell surface associated (MUC1), epidermal growth factor receptor (EGFR), neural cell adhesion molecule (NCAM), prostacyclin prostatic acid phosphatase (PAP), elongation factor 2 mutated (ELF2M), ephrin B2, fibroblast activation protein alpha (FAP), insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX), proteasome (prosome, macropenetran) subunit, beta type 9 (LMP2), glycoprotein 100 (gp100), breakpoint cluster region (BCR), and Abelson murine leukemia virus oncogene Oncogene fusion protein consisting of homolog 1 (Abl) (bcr-abl), tyrosinase, ephrin type A receptor 2 (EphA2), fucosyl GM1, sialyl Lewis adhesion molecule (sLe), ganglioside GM3, transglutaminase 5 (TGS5), high molecular weight melanoma-associated antigen (HMWMAA), o-acetyl-GD2 ganglioside (OAcGD2), folate receptor beta, tumor endothelial marker 1 (TEM1 / CD248), tumor endothelial marker 7-related (TEM7R),Claudin 6 (CLDN6), thyroid-stimulating hormone receptor (TSHR), G protein-coupled receptor class C group 5, member D (GPRC5D), chromosome X open reading frame 61 (CXORF61), CD97, CD179a, anaplastic lymphoma kinase (ALK), polysialic acid, placenta-specific 1 (PLAC1), hexasaccharide moiety of globoH glycoceramide (GloboH), mammary differentiation antigen (NY-BR-1), uroplakin 2 (UPK2), hepatitis A virus cellular receptor 1 (HAVCR1), adrenergic receptor beta 3 (ADRB3), pannexin 3 (PANX3), G protein-coupled receptor 20 (GPR20), lymphocyte antigen 6 complex, locus K9 (LY6K), olfactory receptor 51E2 (OR51E2), TCR gamma alternative reading frame protein (TARP), Wilms tumor protein (WT1), cancer / testis antigen 1 (NY-ESO-1), cancer / testis antigen 2 (LAGE-1a), MAGE family members (including MAGE-A1, MAGE-A3, and MAGE-A4), ETS translocation variant gene 6, located on chromosome 12p (ETV6-AML), sperm protein 17 (SPA17), X antigen family, member 1A (XAGE1), angiopoietin-binding cell surface receptor 2 (Tie 2), melanoma cancer testis antigen-1 (MAD-CT-1), melanoma cancer testis antigen-2 (MAD-CT-2), Fos-related antigen 1, tumor protein p53 (p53), p53 mutant, prostein, survivin, telomerase, prostate cancer tumor antigen-1, melanoma antigen recognized by T cells 1, rat sarcoma (Ras) mutant, human telomerase reverse transcriptase (hTERT), sarcoma translocation breakpoint, melanoma inhibitor of apoptosis (ML-IAP), ER G (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene), N-acetylglucosaminyltransferase V (NA17), paired box protein Pax-3 (PAX3), androgen receptor, cyclin B1, v-myc avian myelocytomatosis viral oncogene neuroblastoma-derived homolog (MYCN), Ras homolog family member C (RhoC), tyrosinase-related protein 2 (TRP-2), cytochrome P450 1B1 (CYP1B1), CCCTC-binding factor (zinc finger protein)-like,Squamous cell carcinoma antigen recognized by T cells 3 (SART3), paired box protein Pax-5 (PAX5), proacrosin-binding protein sp32 (OY-TES1), lymphocyte-specific protein tyrosine kinase (LCK), A-kinase anchoring protein 4 (AKAP-4), synovial sarcoma, X-breakpoint 2 (SSX2), receptor for advanced glycation end products (RAGE-1), renal ubiquitous 1 (RU1), renal ubiquitous 2 (RU2), legumain, human papillomavirus E6 (HPV E6), human papillomavirus E7 (HPV E7), intestinal carboxylesterase, heat shock protein 70-2 mutant (mutated ... hsp70-2), CD79a, CD79b, CD72, leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), Fc fragment of IgA receptor (FCAR or CD89), leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2), CD300 molecule-like family member f (CD300LF), C-type lectin domain family 12 member A (CLEC12A), bone marrow stromal cell antigen 2 (BST2), EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2), lymphocyte antigen 75 (LY75), glypican-3 (GPC3), Fc receptor-like 5 (FCRL5), MUC16, 5T4, 8H9, ανβθ integrin, ανβ6 integrin, alpha-fetoprotein (AFP), B7-H6, ca-1 25, CA9, CD44, CD44v7 / 8, CD52, E-cadherin, EMA (epithelial membrane antigen), epithelial glycoprotein-2 (EGP-2), epithelial glycoprotein-40 (EGP-40), ErbB4, epithelial tumor antigen (ETA), folate-binding protein (FBP), kinase insert domain receptor (KDR), k-light chain, L1 cell adhesion molecule, MUC18, NKG2D, carcinoembryonic antigen (h5T4), tumor / testis antigen 1B, GAGE, GAGE-1, BAGE, SCP-1, CTZ9, SAGE, CAGE, CT10, MART-1, immunoglobulin lambda-like polypeptide 1 (IGLL1), hepatitis B surface antigen-binding protein (HBsAg), viral capsid antigen (VCA), early antigen (EA), EBV nuclear antigen (EBNA), HHV-6 p41 early antigen, HHV-6B U94 latent antigen, HHV-6B p98 late antigen, cytomegalovirus (CMV) antigen, large T antigen,The antigen-binding domain comprises an antigen specific for an antigen selected from small T antigen, adenovirus antigen, respiratory syncytial virus (RSV) antigen, hemagglutinin (HA), neuraminidase (NA), parainfluenza type 1 antigen, parainfluenza type 2 antigen, parainfluenza type 3 antigen, parainfluenza type 4 antigen, human metapneumovirus (HMPV) antigen, hepatitis C virus (HCV) core antigen, HIV p24 antigen, human T-cell lymphotropic virus (HTLV-1) antigen, Merkel cell polyomavirus small T antigen, Merkel cell polyomavirus large T antigen, and Kaposi's sarcoma-associated herpesvirus (KSHV) lytic nuclear antigen and KSHV latent nuclear antigen. In some embodiments, the antigen-binding domain comprises an amino acid sequence selected from SEQ ID NOs: 3165-3176.

[0243] ii. Hinge / spacer domain In some embodiments, a CAR of the present disclosure comprises a hinge or spacer domain. In some embodiments, the hinge / spacer domain can comprise a truncated hinge / spacer domain (THD), which is a shortened version of the complete hinge / spacer domain ("CHD"). In some embodiments, the extracellular domain comprises ErbB2, glycophorin A (GpA), CD2, CD3 delta, CD3 epsilon, CD3 gamma, CD4, CD7, CD8a, CD8 [T CDl 1a (IT GAL), CDl 1b (IT GAM), CDl 1c (IT GAX), CDl 1d (ITGAD), CD18(ITGB2), CD19(B4), CD27(TNFRSF7), CD28, CD28T, CD29(ITGB1), CD30(TNFRSF8), CD40(TNFRSF5), CD48( SLAMF2), CD49a(ITGA1), CD49d(ITGA4), CD49f(ITGA6), CD66a(CEACAM1), CD66b(CEACAM8), CD66c(CEACAM6), CD66d (CEACAM3), CD66e (CEACAM5), CD69 (CLEC2), CD79A (B cell antigen receptor complex-associated alpha chain), CD79B (B cell antigen receptor complex-associated beta chain), CD84 (SLAMF5), CD96 (Tactile), CD100 (SEMA4D), CD103 (ITGAE), CD134 (0X40), CD137 (4-1BB), CD150 (SLAMF1), CD158A (KIR2D) L1), CD158B1(KIR2DL2), CD158B2(KIR2DL3), CD158C(KIR3DP1), CD158D(KIRDL4), CD158F1(KIR2DL5A), CD158F2(K IR2DL5B), CD158K(KIR3DL2), CD160(BY55), CD162(SELPLG), CD226(DNAM1), CD229(SLAMF3), CD244(SLAMF4), CD247 (CD3-zeta), CD258(LIGHT), CD268(BAFFR), CD270(TNFSF14), CD272(BTLA), CD276(B7-H3), CD279(PD-1), CD314(NKG 2D), CD319(SLAMF7), CD335(NK-p46), CD336(NK-p44), CD337(NK-p30), CD352(SLAMF6), CD353(SLAMF8), CD355(CRT AM), CD357 (TNFRSF18), inducible T cell costimulatory factor (ICOS), LFA-1 (CDl1a / CD18), NKG2C, DAP-10, ICAM-1, NKp80 (KLRF1), IL-2R beta, IL-2R gamma, IL-7R alpha, LFA-1, SLAMF9, LAT, GADS (GrpL), SLP-76 (LCP2), PAG1 / CBP, CD83 ligand, Fc gamma receptor, MHC class 1 molecule, MHC class 2 molecule, TNF receptor protein, immunoglobulin protein, cytokine receptor, integrin, activating NK cell receptor, Toll ligand receptor, and fragments or combinations thereof (e.g., including all or fragments thereof). Hinge or spacer domains can be derived from either natural or synthetic sources.

[0244] In some embodiments, the hinge or spacer domain is positioned between the antigen-binding molecule (e.g., scFv) and the transmembrane domain. In this orientation, the hinge / spacer domain provides distance between the antigen-binding molecule and the surface of the cell membrane on which the CAR is expressed. In some embodiments, the hinge or spacer domain is from or derived from an immunoglobulin. In some embodiments, the hinge or spacer domain is selected from the hinge / spacer region of IgG1, IgG2, IgG3, IgG4, IgA, IgD, IgE, IgM, or a fragment thereof. In some embodiments, the hinge or spacer domain comprises, is from, or is derived from the hinge / spacer region of CD8 alpha. In some embodiments, the hinge or spacer domain comprises, is from, or is derived from the hinge / spacer region of CD28. In some embodiments, the hinge or spacer domain comprises a fragment of the hinge / spacer region of CD8alpha or a fragment of the hinge / spacer region of CD28, wherein the fragment is any fragment smaller than the entire hinge / spacer region. In some embodiments, the fragment of the CD8alpha hinge / spacer region or the fragment of the CD28 hinge / spacer region comprises an amino acid sequence that excludes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 amino acids at the N-terminus, C-terminus, or both, of the CD8alpha hinge / spacer region or CD28 hinge / spacer region.

[0245] iii. Transmembrane domain The CAR of the present disclosure may further comprise a transmembrane domain and / or an intracellular signaling domain. The transmembrane domain may be designed to be fused to the extracellular domain of the CAR. Similarly, it may be fused to the intracellular domain of the CAR. In some embodiments, a transmembrane domain naturally associated with one of the domains in the CAR is used. In some examples, the transmembrane domain may be selected or modified (e.g., by amino acid substitution) to avoid binding of such domain to the transmembrane domain of the same or a different surface membrane protein to minimize interaction with other members of the receptor complex. The transmembrane domain may be derived from either a natural or synthetic source. If the source is natural, the domain may be derived from any membrane-bound or transmembrane protein.

[0246] Transmembrane regions include receptor tyrosine kinases (e.g., ErbB2), glycophorin A (GpA), 4-1BB / CD137, activating NK cell receptors, immunoglobulin proteins, B7-H3, BAFFR, BFAME (SEAMF8), BTEA, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8 alpha, CD8 beta, CD96 (Tactile), CD1 la, CD1 lb, CD1 lc, CD1 ld, CDS, CEACAM1, CRT AM, cytokine receptor, DAP-10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (EIGHTR), IA4, ICAM-1, ICAM-1, Ig alpha (CD79a), IE-2R beta, IE-2R gamma, IE-7R alpha, inducible T cell costimulator (ICOS), integrin, ITGA4, ITGA4, ITGA6, IT GAD, ITGAE, ITGAE, IT GAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, EAT, LFA-1, LFA-1, ligand specifically binding to CD83, LIGHT, LIGHT, LTBR, ​​Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1; CD1-1a / CD18), MHC class 1 molecule, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed cell death-1 (PD-1), PSGL1, SELPL G (CD162), signaling lymphocyte activation molecule (SLAM protein), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Lyl08), SLAMF7, SLP-76, TNF receptor protein, TNFR2, TNFSF14, Toll ligand receptor, TRANCE / RANKL, VLA1, or VLA-6, or a fragment, truncation, or combination thereof.

[0247] In some embodiments, suitable intracellular signaling domains include, but are not limited to, activated macrophage / myeloid cell receptor CSFR1, MYD88, CD14, TIE2, TLR4, CR3, CD64, TREM2, DAP10, DAP12, CD169, DECTIN1, CD206, CD47, CD163, CD36, MARCO, TIM4, MERTK, F4 / 80, CD91, C1QR, LOX-1, CD68, SRA, BAI-1, ABCA7, CD36, CD31, lactoferrin, or fragments, truncations, or combinations thereof.

[0248] In some embodiments, the receptor tyrosine kinase is selected from the group consisting of insulin receptor (InsR), insulin-like growth factor I receptor (IGF1R), insulin receptor-related receptor (IRR), platelet-derived growth factor receptor alpha (PDGFRa), platelet-derived growth factor receptor beta (PDGFRfi), KIT proto-oncogene receptor tyrosine kinase (Kit), colony-stimulating factor 1 receptor (CSFR), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 1 (VEGFR-1), kinase insert domain receptor (VEGFR-2), fms-related tyrosine kinase 2 (FLT3), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 1 (VEGFR-1), fms-related tyrosine kinase 2 (VEGFR-2), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 1 (VEGFR-2), fms-related tyrosine kinase 2 (FLT3), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 1 (VEGFR-1), fms-related tyrosine kinase 2 (VEGFR-2), fms-related tyrosine kinase 3 ...3 (FLT3), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine s-related tyrosine kinase 4 (VEGFR-3), fibroblast growth factor receptor 1 (FGFR1), fibroblast growth factor receptor 2 (FGFR2), fibroblast growth factor receptor 3 (FGFR3), fibroblast growth factor receptor 4 (FGFR4), protein tyrosine kinase 7 (CCK4), neurotrophic receptor tyrosine kinase 1 (trkA), neurotrophic receptor tyrosine kinase 2 (trkB), neurotrophic receptor tyrosine kinase 3 (trkC), receptor tyrosine kinase-like orphan receptor 1 (ROR1), receptor tyrosine kinase-like orphan receptor 2 ( ROR2), muscle-associated receptor tyrosine kinase (MuSK), MET proto-oncogene, receptor tyrosine kinase (MET), macrophage-stimulating 1 receptor (Ron), AXL receptor tyrosine kinase (Axl), TYR03 protein tyrosine kinase (Tyro3), MER proto-oncogene, tyrosine kinase (Mer), tyrosine kinase with immunoglobulin-like and EGF-like domains 1 (TIE1), TEK receptor tyrosine kinase (TIE2), EPH receptor A1 (EphA1), EPH receptor A2 (EphA2), Eph receptor A3 (EPH receptor A4), A3, EPH receptor A4 (EphA4), EPH receptor A5 (EphA5), EPH receptor A6 (EphA6), EPH receptor A7 (EphA7), EPH receptor A8 (EphA8), EPH receptor A10 (EphAl0), EPH receptor B1 (EphBl), EPH receptor B2 (EphB2), EPH receptor B3 (EphB3), EPH receptor B4 (EphB4), EPH receptor B6 (EphB6), ret proto-oncogene (Ret), receptor-like tyrosine kinase (RYK), discoidin domain receptor tyrosine kinase 1 (DDR1),The discoidin domain may be derived from (e.g., comprise) discoidin domain receptor tyrosine kinase 2 (DDR2), c-ros oncogene 1, receptor tyrosine kinase (ROS), apoptosis-related tyrosine kinase (Lmrl), Lemur tyrosine kinase 2 (Lmr2), Lemur tyrosine kinase 3 (Lmr3), leukocyte receptor tyrosine kinase (LTK), ALK receptor tyrosine kinase (ALK), or serine / threonine / tyrosine kinase 1 (STYK1).

[0249] iv. Costimulatory domain In certain embodiments, the CAR comprises a costimulatory domain. In some embodiments, the costimulatory domain includes 4-1BB (CD137), CD28, or both, and / or an intracellular T cell signaling domain. In preferred embodiments, the costimulatory domain is human CD28, human 4-1BB, or both, and the intracellular T cell signaling domain is human CD3 zeta (ζ). Less than the entire 4-1BB, CD28, or CD3 zeta may be included, respectively. Chimeric antigen receptors may incorporate costimulatory (signaling) domains to increase their potency. See U.S. Patent Nos. 7,741,465 and 6,319,494, as well as Krause et al. and Finney et al. (supra), Song et al., Blood 119:696-706 (2012); Kalos et al., Sci Transl. Med. 3:95 (2011); Porter et al., N. Engl. J. Med. 365:725-33 (2011), and Gross et al., Amur. Rev. Pharmacol. Toxicol. 56:59-83 (2016).

[0250] In some embodiments, the costimulatory domain comprises the amino acid sequence of SEQ ID NO: 3162 or 3164.

[0251] v. Intracellular signaling domain The intracellular (signaling) domain of the engineered T cells disclosed herein can provide signaling to the activation domain, which in turn activates at least one of the normal effector functions of an immune cell. For example, the effector function of a T cell can be cytolytic activity or a helper activity, such as the secretion of cytokines.

[0252] In some embodiments, suitable intracellular signaling domains include 4-1BB / CD137, activating NK cell receptor, immunoglobulin proteins, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD 19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8alpha, CD8beta, CD96 (tactile), CD1 la, CD1 lb, CD1 lc, CD1 ld, CDS, CEACAM1, CRT AM, cytokine receptor, DAP-10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, Ig alpha (CD79a), IL-2R beta, IL-2R gamma, IL-7R alpha, inducible T cell costimulator (ICOS), integrin, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, ligand specifically binding to CD83, LIGHT, LTBR, ​​Ly9 (CD229), Ly08, lymphocyte function-associated antigen-1 (LFA-1; CD1-la / CD18), MHC class 1 molecule, NKG2C, NKG 2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death-1 (PD-1), PSGL1, SELPLG (CD162), signaling lymphocytic activation molecule (SLAM protein), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A), SLAMF7, SLP-76, TNF receptor protein, TNFR2, TNFSF14, Toll ligand receptor, TRANCE / RANKL, VLA1, or VLA-6, or a fragment, truncation, or combination thereof.

[0253] CD3 is a component of the T cell receptor on native T cells and has been shown to be an important intracellular activation component in CARs. In some embodiments, the CD3 is CD3 zeta. In some embodiments, the activation domain comprises an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the polypeptide sequence of SEQ ID NO: 3163.

[0254] bT cell receptor (TCR) In some embodiments, the provided circular RNA polynucleotide encodes a T cell receptor. TCRs are designated using the International Immunogenetics (IMGT) TCR nomenclature and a link to the IMGT public database of TCR sequences. Native alpha-beta heterodimeric TCRs have an alpha chain and a beta chain. Generally, each chain may contain a variable, binding, and constant region; the beta chain also typically contains a short diversity region between the variable and binding regions, although this diversity region is often considered part of the binding region. Each variable region may contain three CDRs (complementarity-determining regions) embedded in a framework sequence, one of which is a hypervariable region designated CDR3. There are several types of alpha chain variable (Vα) regions and several types of beta chain variable (Vβ) regions, distinguished by their framework, CDR1 and CDR2 sequences, and by a partially defined CDR3 sequence. Vα types are designated by unique TRAV numbers in the IMGT nomenclature. Thus, "TRAV21" defines a TCR Vα region with unique framework and CDR1 and CDR2 sequences, and a CDR3 sequence that is partially defined by amino acid sequences conserved among TCRs but also includes amino acid sequences that vary among TCRs. Similarly, "TRBV5-1" defines a TCR Vβ region with unique framework and CDR1 and CDR2 sequences, but with a CDR3 sequence that is only partially defined.

[0255] The binding regions of the TCR are similarly defined by the unique IMGT TRAJ and TRBJ nomenclature, and the constant regions are defined by the IMGT TRAC and TRBC nomenclature.

[0256] The beta chain diversity region is referred to by the abbreviation TRBD in the IMGT nomenclature, and as mentioned, the linked TRBD / TRBJ region is often together referred to as the junction region.

[0257] The unique sequences defined by the IMGT nomenclature are widely known and accessible to those working in the field of TCRs. For example, they can be found in the IMGT public database. "T cell Receptor Factsbook," (2001) LeFranc and LeFranc, Academic Press, ISBN 0-12-441352-8, also discloses sequences defined by the IMGT nomenclature, but due to its publication date and the resulting time lag, the information therein must be confirmed by reference to the IMGT database.

[0258] Native TCRs exist in heterodimeric αβ or γδ forms. However, recombinant TCRs consisting of αα or ββ homodimers have previously been shown to bind peptide-MHC molecules. Therefore, the TCRs of the present invention can be heterodimeric αβ TCRs, or αα or ββ homodimeric TCRs.

[0259] For use in adoptive therapy, αβ heterodimeric TCRs may be transfected, for example, as full-length chains having both cytoplasmic and transmembrane domains. In certain embodiments, the TCRs of the invention may have disulfide bonds introduced between residues of their respective constant domains, for example, as described in WO2006 / 000830.

[0260] TCRs of the present invention, particularly alpha-beta heterodimeric TCRs, may comprise an alpha chain TRAC constant domain sequence and / or a beta chain TRBC1 or TRBC2 constant domain sequence. The alpha and beta chain constant domain sequences may be modified by truncation or substitution to delete the native disulfide bond between Cys4 of exon 2 of TRAC and Cys2 of exon 2 of TRBC1 or TRBC2. The alpha and / or beta chain constant domain sequence(s) may also be modified by substitution of Thr 48 of TRAC and Ser 57 of TRBC1 or TRBC2 with cysteine ​​residues, which form the disulfide bond between the alpha and beta constant domains of the TCR.

[0261] Binding affinity (equilibrium constant K D The binding half-life (expressed as T1 / 2, which is inversely proportional to K) and binding half-life (expressed as T1 / 2) can be determined by any suitable method. Doubling the affinity of the TCR D It is understood that T1 / 2 is halved. T1 / 2 is calculated as ln2 divided by the off rate (koff). Therefore, doubling T1 / 2 halves koff. K for TCR D and koff values ​​are typically measured for soluble forms of TCRs, i.e., those forms truncated to remove cytoplasmic and transmembrane domain residues. It will therefore be understood that a given TCR will have improved binding affinity and / or binding half-life relative to the parent TCR if the soluble form of that TCR possesses those characteristics. Preferably, the binding affinity or binding half-life of a given TCR is measured several times, for example, three or more times, using the same assay protocol and an average of the results is taken.

[0262] Because the TCRs of the present invention have utility in adoptive therapy, the present invention includes non-naturally occurring and / or purified and / or engineered cells, particularly T cells, that display the TCRs of the present invention. Numerous suitable methods exist for transfecting T cells with nucleic acids (such as DNA, cDNA, or RNA) encoding the TCRs of the present invention (see, e.g., Robbins et al., (2008) J Immunol. 180:6116-6131). T cells expressing the TCRs of the present invention are suitable for use in adoptive therapy-based treatment of cancers (such as those of the pancreas and liver). As known to those skilled in the art, numerous suitable methods exist by which adoptive therapy may be performed (see, e.g., Rosenberg et al., (2008) Nat Rev Cancer 8(4):299-308).

[0263] As is well known in the art, the TCRs of the present invention may be subject to post-translational modifications when expressed by transfected cells. Glycosylation is one such modification, which may involve the covalent attachment of oligosaccharide moieties to defined amino acids in the TCR chain. For example, asparagine residues or serine / threonine residues are well-known positions for oligosaccharide attachment. The glycosylation status of a particular protein depends on numerous factors, including the protein sequence, protein conformation, and availability of certain enzymes. Furthermore, the glycosylation status (i.e., oligosaccharide type, covalent linkages, and total number of linkages) can affect protein function. Therefore, when producing recombinant proteins, it is often desirable to control glycosylation. Glycosylation of transfected TCRs can be controlled by mutations in the transfected gene (Kuball J et al. (2009), J Exp Med 206(2):463-475). Such mutations are also encompassed by the present invention.

[0264] TCR is MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-A11, MAGE-A12, MAGE-A13, GAGE-1, GAGE -2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, BAGE-1, RAGE-1, LB33 / MUM-1, PRAME, NAG, MAGE-Xp2(MAGE-B2), MAGE-Xp3(MAGE-B3), MAGE-Xp4( AGE-B4), tyrosinase, brain glycogen phosphorylase, Melan-A, MAGE-C1, MAGE-C2, NY-ESO-1, LAGE-1, SSX-1, SSX-2 (HOM-MEL-40), SSX-1, SSX-4, SSX-5, SCP-1, CT-7, alpha-actinin-4, Bcr-Abl fusion protein, Casp-8, beta-catenin, cdc27, cdk4, cdkn2a, coa-1, dek-can fusion protein, EF2, ETV6-AML1 fusion protein, LDLR-fucosyltransferase AS fusion protein Proteins, HLA-A2, HLA-A11, hsp70-2, KIAAO205, Mart2, Mum-2 and 3, neo-PAP, myosin class I, OS-9, pml-RARa fusion protein, PTPRK, K-ras, N-ras, triosephosphate isomerase, GnTV, Herv-K-mel, Lage-1, Mage-C2, NA-88, Lage-2, SP17, and TRP2-Int2, (MART-I), gp100(Pmel17), TRP-1, TRP-2, MAGE-1, MAGE-3, p15(58), CEA, NY-ESO (LAGE), SCP-1, Hom / Mel-40, p53, H-Ras, HER-2 / neu, BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein-Barr virus antigen, EBNA, human papillomavirus (HPV) antigens E6 and E7, TSP-180, MAGE-4, MAGE-5, MAGE-6, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72-4, CA19-9, CA72-4, CAM17.1, NuMa, K-ras, beta.It may be specific for antigens in the following group: -catenin, CDK4, Mum-1, p16, TAGE, PSMA, PSCA, CT7, telomerase, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, 13HCG, BCA225, BTAA, CA125, CA15-3 (CA27.29\BCAA), CA195, CA242, CA-50, CAM43, CD68\KP1, CO-029, FGF-5, G250, Ga733 (EpCAM), HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB\170K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein\cyclophilin C-related protein), TAAL6, TAG72, TLP, and TPS.

[0265] cB cell receptor (BCR) In some embodiments, the provided circular RNA polynucleotide encodes one or more B cell receptors (BCRs). BCRs (or B cell antigen receptors) are immunoglobulin molecules that form a type I transmembrane protein on the surface of B cells. BCRs can transmit activation signals to B cells after recognizing a specific antigen. Before a B cell binds an antigen, the BCR remains in an unstimulated or "resting" state. Binding of an antigen to the BCR results in signal transduction that initiates a humoral immune response.

[0266] BCRs are expressed by mature B cells. These B cells work with immunoglobulins (Ig) to recognize and tag pathogens. A typical BCR contains membrane-bound immunoglobulins (e.g., mIgA, mIgD, mIgE, mIgG, and mIgM) and the related Igα / Igβ (CD79a / CD79b) heterodimer (α / β). These membrane-bound immunoglobulins are tetramers consisting of two identical heavy chains and two light chains. Within the BCR, membrane-bound immunoglobulins can respond to antigen binding by signaling across the plasma membrane, leading to B cell activation and subsequent clonal expansion and specific antibody production (Friess M et al. (2018), Front. Immunol. 2947(9)). The Igα / Igβ heterodimer is responsible for signaling to the cell interior.

[0267] Signaling of Igα / Igβ heterodimers depends on the presence of immunoreceptor tyrosine-based activation motifs (ITAMs) located in each of the cytoplasmic tails of the heterodimer. ITAMs contain two tyrosine residues separated by 9–12 amino acids (e.g., tyrosine, leucine, and / or valine). Upon antigen binding, the tyrosines of the ITAMs of the BCR are phosphorylated by the Src family tyrosine kinases Blk, Fyn, or Lyn (Janeway C et al., Immunobiology: The Immune System in Health and Disease (Garland Science, 5th ed. 2001)).

[0268] d. Other chimeric proteins In addition to the chimeric proteins provided above, the circular RNA polynucleotide can encode a variety of other chimeric proteins available in the art. Chimeric proteins can include recombinant fusion proteins, chimeric mutant proteins, or other fusion proteins.

[0269] B. Immunomodulatory Ligands In some embodiments, the circular RNA polynucleotide encodes an immunomodulatory ligand. In certain embodiments, the immunomodulatory ligand may be immunostimulatory, while in other embodiments, the immunomodulatory ligand may be immunosuppressive.

[0270] a. Cytokines: interferons, chemokines, interleukins, growth factors, etc. In some embodiments, the circular RNA polynucleotide encodes a cytokine. In some embodiments, the cytokine includes chemokines, interferons, interleukins, lymphokines, and tumor necrosis factors. Chemokines are chemotactic cytokines produced by various types of cells in acute and chronic inflammation and recruit and activate leukocytes. Interferons comprise a family of secreted alpha-helical cytokines that are induced in response to specific extracellular molecules via stimulation of TLRs (Borden, Molecular Basis of Cancer (Fourth Edition) 2015). Interleukins are cytokines expressed by leukocytes.

[0271] Descriptions and / or amino acid sequences of IL-2, IL-7, IL-10, IL-12, IL-15, IL-18, IL-27β, IFNγ, and / or TGFβ1 are provided herein and in the www.uniprot.org database under accession numbers: P60568 (IL-2), P29459 (IL-12A), P29460 (IL-12B), P13232 (IL-7), P22301 (IL-10), P40933 (IL-15), Q14116 (IL-18), Q14213 (IL-27β), P01579 (IFNγ), and / or P01137 (TGFβ1).

[0272] C. Transcription factors Regulatory T cells (Tregs) are important in maintaining homeostasis, controlling the magnitude and duration of inflammatory responses, and preventing autoimmune and allergic reactions.

[0273] Tregs are generally thought to be primarily involved in suppressing immune responses, functioning in part as a "self-check" for the immune system to prevent excessive responses. In particular, Tregs are involved in maintaining tolerance to harmless substances such as self-antigens, pollen, or food, thus thwarting autoimmune diseases.

[0274] Tregs are found throughout the body, including but not limited to the intestine, skin, lungs, and liver. Treg cells can also be found in certain compartments of the body that are not directly exposed to the external environment, such as the spleen, lymph nodes, and even adipose tissue. Each of these Treg cell populations is known or suspected to have one or more unique characteristics; additional information can be found in Lehtimaki and Lahesmaa, "Regulatory T cells control immune responses through their non-redundant tissue-specific features," 2013, FRONTIERS IN IMMUNOL., 4(294):1-10, the disclosure of which is incorporated herein in its entirety.

[0275] Typically, Tregs are known to require TGF-β and IL-2 for proper activation and development. Tregs express abundant amounts of the IL-2 receptor (IL-2R) and are dependent on IL-2 produced by activated T cells. Tregs are known to produce both IL-10 and TGF-β, both of which are potent immunosuppressive cytokines. Tregs are also known to inhibit the ability of antigen-presenting cells (APCs) to stimulate T cells. One proposed mechanism for APC inhibition is via CTLA-4, which is expressed by Foxp3+ Tregs. CTLA-4 is thought to bind to B7 molecules on APCs, blocking or internalizing them, thereby reducing the availability of B7 and preventing them from providing adequate costimulation for immune responses. Additional discussion of the origin, differentiation, and function of Tregs can be found in Dhamne et al., Peripheral and thymic Foxp3+ regulatory T cells in search of origin, distinction, and function, 2013, Frontiers in Immunol., 4(253):1-11.

[0276] D. Checkpoint Inhibitors and Agonists As provided herein, in certain embodiments, the coding element of the circular RNA encodes one or more checkpoint inhibitors or agonists.

[0277] In some embodiments, the immune checkpoint inhibitor is an inhibitor of programmed death-ligand 1 (PD-L1, also known as B7-H1, CD274), programmed death 1 (PD-1), CTLA-4, PD-L2 (B7-DC, CD273), LAG3, TIM3, 2B4, A2aR, B7H1, B7H3, B7H4, BTLA, CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD137, CD160, CD226, CD276, DR3, GAL9, GITR, HAVCR2, HVEM, IDO1, IDO2, ICOS (inducible T-cell costimulator), KIR, LAIR1, LIGHT, MARCO (macrophage receptor with collagen structure), PS (phosphatidylserine), OX-40, SLAM, TIGHT, VISTA, VTCN1, or a combination thereof. In some embodiments, the immune checkpoint inhibitor is an inhibitor of IDO1, CTLA4, PD-1, LAG3, PD-L1, TIM3, or a combination thereof. In some embodiments, the immune checkpoint inhibitor is an inhibitor of PD-L1. In some embodiments, the immune checkpoint inhibitor is an inhibitor of PD-1. In some embodiments, the immune checkpoint inhibitor is an inhibitor of CTLA-4. In some embodiments, the immune checkpoint inhibitor is an inhibitor of LAG3. In some embodiments, the immune checkpoint inhibitor is an inhibitor of TIM3. In some embodiments, the immune checkpoint inhibitor is an inhibitor of IDO1.

[0278] As described herein, in at least one aspect, the present invention encompasses the use of immune checkpoint antagonists, including antagonists of immune checkpoint molecules such as cytotoxic T lymphocyte antigen 4 (CTLA-4), programmed cell death protein 1 (PD-1), programmed death ligand 1 (PDL-1), lymphocyte activation gene 3 (LAG-3), and T-cell immunoglobulin and mucin domain 3 (TIM-3). Antagonists of CTLA-4, PD-1, PDL-1, LAG-3, or TIM-3 interfere with the function of CTLA-4, PD-1, PDL-1, LAG-3, or TIM-3, respectively. Such antagonists of CTLA-4, PD-1, PDL-1, LAG-3, and TIM-3 can include antibodies that specifically bind to CTLA-4, PD-1, PDL-1, LAG-3, and TIM-3, respectively, and inhibit and / or block the biological activity and function.

[0279] E. Other In some embodiments, the payload encoded within the one or more coding elements is a hormone, an FC fusion protein, an anticoagulant, a blood clotting factor, a protein associated with deficiency and genetic diseases, a chaperone protein, an antimicrobial protein, an enzyme (e.g., a metabolic enzyme), a structural protein (e.g., a channel or nuclear pore protein), a protein variant, a small molecule, an antibody, a nanobody, an engineered non-specific antibody, or a combination thereof.

[0280] 4. Additional accessory elements (array elements) As described herein, polynucleotides (e.g., circular RNA polynucleotides, linear RNA polynucleotides, and / or DNA templates) can further comprise accessory elements. In certain embodiments, these accessory elements can be included within the sequence of the circular RNA, linear RNA polynucleotide, and / or DNA template to enhance circularization, translation, or both. In certain embodiments, accessory elements are sequences that are specifically located between or within enhanced intronic elements, enhanced exonic elements, or core functional elements of the respective polynucleotides. By way of example, and not intended to be limiting, accessory elements include IRES transactivator regions, miRNA binding sites, restriction sites, RNA editing regions, structural or sequence elements, granule sites, ZIP code elements, RNA transport elements, or other specialized sequences found in the art that facilitate circularization and / or translation of proteins encoded within the circular RNA polynucleotide.

[0281] A. IRES Transactivators In certain embodiments, the accessory element comprises an IRES transactivator (ITAF) region. In some embodiments, the IRES transactivator region regulates translation initiation through binding with PCBP1-PCBP4 (polyC binding proteins), PABP1 (polyA binding protein), PTB (polypyrimidine tract binding), the Argonaute protein family, HNRNPK (heterogeneous nuclear ribonucleoprotein K), or La proteins. In some embodiments, the IRES transactivator region comprises a polyA, polyC, polyAC, or polypyrimidine tract.

[0282] In some embodiments, the ITAF region is located within a core functional element. In some embodiments, the ITAF region is located within a TIE.

[0283] B. miRNA binding site In certain embodiments, the accessory element comprises an miRNA binding site, hi some embodiments, the miRNA binding site is located within a 5'-enhanced intron element, a 5'-enhanced exon element, a core functional element, a 3'-enhanced exon element, and / or a 3'-enhanced intron element.

[0284] In some embodiments, the miRNA binding site is located within a spacer within an enhanced intronic or exonic element. In certain embodiments, the miRNA binding site comprises the entire spacer region.

[0285] In some embodiments, the 5'-enhanced intron element and the 3'-enhanced intron element each comprise the same miRNA binding site. In another embodiment, the miRNA binding site of the 5'-enhanced intron element comprises an miRNA binding site that differs in length or nucleotides from the 3'-enhanced intron element. In one embodiment, the 5'-enhanced exon element and the 3'-enhanced exon element comprise the same miRNA binding site. In other embodiments, the 5'-enhanced exon element and the 3'-enhanced exon element comprise miRNA binding sites that differ in length or nucleotides.

[0286] In some embodiments, the miRNA binding sites are located adjacent to each other within the circular RNA polynucleotide, the linear RNA polynucleotide precursor, and / or the DNA template. In certain embodiments, the first nucleotide of one of the miRNA binding sites follows the last nucleotide of the first nucleotide of the second miRNA binding site.

[0287] In some embodiments, the miRNA binding site is located within the translation initiation element (TIE) of the core functional element. In one embodiment, the miRNA binding site is located before, after, or inside the internal ribosome entry site (IRES). In another embodiment, the miRNA binding site is located before, after, or inside the aptamer complex.

[0288] The incorporation of miRNA sequence into circular RNA molecule can enable tissue-specific expression of coding sequence in core functional element.For example, in circular RNA intended to express protein in immune cells, it may be desirable to have miRNA binding sequence that suppresses expression in tissues such as liver or kidney.Such miRNA binding sequence can be selected based on the cell or tissue expression of miRNA.

[0289] The unique sequences defined by the miRNA nomenclature are widely known and accessible to those working in the field of microRNAs: for example, they can be found in the miRDB public database.

[0290] 5. Polynucleotide Production The DNA templates provided herein can be produced using standard techniques of molecular biology. For example, various elements of the vectors provided herein can be obtained using recombinant methods, such as by screening cDNA and genomic libraries from cells, or by deriving the polynucleotide from a DNA template known to contain the polynucleotide.

[0291] Various elements of the DNA templates provided herein can also be synthetically generated, rather than cloned, based on known sequences. Complete sequences can be assembled from overlapping oligonucleotides prepared by standard methods and then assembled into complete sequences. See, e.g., Edge, Nature (1981) 292:756; Nambair et al., Science (1984) 223:1299; and Jay et al., J. Biol. Chem. (1984) 259:631 1.

[0292] Thus, a specific nucleotide sequence can be obtained from a DNA template bearing the desired sequence, or can be synthesized, in whole or in part, using various oligonucleotide synthesis techniques known in the art, such as site-directed mutagenesis and polymerase chain reaction (PCR) techniques, as appropriate. One method for obtaining a nucleotide sequence encoding a desired DNA template element is by annealing a complementary set of overlapping synthetic oligonucleotides produced in a conventional automated polynucleotide synthesizer, followed by ligation with an appropriate DNA ligase, and amplifying the ligated nucleotide sequence via PCR. See, for example, Jayaraman et al., Proc. Natl. Acad. Sci. USA (1991) 88:4084-4088. Additionally, oligonucleotide-directed synthesis (Jones et al., Nature (1986) 54:75-82), oligonucleotide-directed mutagenesis of existing nucleotide regions (Riechmann et al., Nature (1988) 332:323-327 and Verhoeyen et al., Science (1988) 239:1534-1536), and enzymatic filling of gapped oligonucleotides using T4 DNA polymerase (Queen et al., Proc. Natl. Acad. Sci. USA (1989) 86:10029-10033) can be used.

[0293] The RNA precursors provided herein can be produced by incubating a DNA template provided herein under conditions that allow transcription of the RNA precursor encoded by the DNA template. For example, in some embodiments, the RNA precursor is synthesized by incubating a DNA template provided herein that includes an RNA polymerase promoter upstream of its 5' duplex sequence and / or expression sequence with a compatible RNA polymerase enzyme under conditions that allow in vitro transcription. In some embodiments, the DNA template is incubated inside a cell with a bacteriophage RNA polymerase or in the nucleus of a cell with host RNA polymerase II.

[0294] In certain embodiments, provided herein are methods for generating RNA precursors by in vitro transcription using a vector provided herein as a template (e.g., a DNA template provided herein having an RNA polymerase promoter positioned upstream of the 5' duplex region).

[0295] In certain embodiments, the resulting RNA precursor can be used to generate circular RNA (e.g., a circular RNA polynucleotide provided herein) by incubating it in the presence of magnesium ions and a guanosine nucleotide or nucleoside at a temperature at which RNA circularization occurs (e.g., 20°C to 60°C).

[0296] Thus, in certain embodiments, methods for producing circular RNA are provided herein. In certain embodiments, the methods include synthesizing an RNA precursor by transcription (e.g., run-off transcription) using a vector provided herein (e.g., a 5'-enhanced intron element, a 5'-enhanced exon element, a core functional element, a 3'-enhanced exon element, and a 3'-enhanced exon element) as a template, and incubating the resulting RNA precursor in the presence of a divalent cation (e.g., magnesium ion) and GTP to circularize it to form a circular RNA. In some embodiments, the RNA precursors disclosed herein can be circularized in the absence of magnesium ions and GTP and / or without the incubation step with magnesium ions and GTP. It has been discovered that circular RNAs have reduced immunogenicity compared to the corresponding mRNAs, at least in part because the mRNAs contain an immunogenic 5' cap. When transcribing a DNA vector from a predetermined promoter (e.g., a T7 promoter) to produce an RNA precursor, it is understood that the 5' end of the RNA precursor is G. To reduce the immunogenicity of circular RNA compositions containing low levels of contaminating linear mRNA, an excess of GMP relative to GTP can be provided during transcription so that most transcripts contain 5' GMP, which cannot be capped. Thus, in some embodiments, transcription is performed in the presence of excess GMP. In some embodiments, transcription is performed at a ratio of GMP concentration to GTP concentration within the range of about 3:1 to about 15:1, e.g., about 3:1 to about 10:1, about 3:1 to about 5:1, about 3:1, about 4:1, or about 5:1.

[0297] In some embodiments, the composition comprising circular RNA is purified. Circular RNA can be purified by any known method commonly used in the art, such as column chromatography, gel filtration chromatography, and size exclusion chromatography. In some embodiments, purification includes one or more of the following steps: phosphatase treatment, HPLC size exclusion purification, and RNase R digestion. In some embodiments, purification includes the following steps in order: RNase R digestion, phosphatase treatment, and HPLC size exclusion purification. In some embodiments, purification includes reverse-phase HPLC. In some embodiments, the purified composition contains less double-stranded RNA, DNA splints, triphosphorylated RNA, phosphatase protein, protein ligase, capping enzyme, and / or nicked RNA than unpurified RNA. In some embodiments, purification of circular RNA includes affinity purification or negative selection methods described herein. In some embodiments, purification of circular RNA includes separating linear RNA from circular RNA using oligonucleotides complementary to sequences in linear RNA but not to sequences in circular RNA. In some embodiments, the purified composition is less immunogenic than the unpurified composition. In some embodiments, immune cells exposed to the purified composition produce less TNFα, RIG-I, IL-2, IL-6, IFNγ, and / or type 1 interferon, e.g., IFN-β1, than immune cells exposed to the unpurified composition.

[0298] 6. Overview of Transport Vehicles and Other Delivery Mechanisms A. Ionizable lipids In certain embodiments, disclosed herein are ionizable lipids that can be used as components of transport vehicles to facilitate or enhance the delivery and release of circular RNA into one or more target cells (e.g., by penetrating or fusing with the lipid membranes of such target cells). In certain embodiments, the ionizable lipids contain one or more cleavable functional groups (e.g., disulfides), which, for example, allow the hydrophilic functional head group of the compound to dissociate from the lipophilic functional tail group (e.g., upon exposure to oxidative, reductive, or acidic conditions), thereby facilitating a phase transition in the lipid bilayer of one or more target cells.

[0299] In some embodiments, the ionizable lipid is a lipid described in International Patent Application No. PCT / US2018 / 058555.

[0300] In some embodiments, the cationic lipid has the formula: [ka] During the ceremony, R1 and R2 are the same or different and independently represent optionally substituted C 10 -C 24 Alkyl, optionally substituted C 10 -C 24 Alkenyl, optionally substituted C 10 -C 24 Alkynyl, or optionally substituted C 10 -C 24 It is acyl, R3 and R4 are the same or different and independently represent optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, or optionally substituted C2-C6 alkynyl, or R3 and R4 together can form an optionally substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2 heteroatoms selected from nitrogen and oxygen; R5 is absent or present, and if present, is hydrogen or C1-C6 alkyl; m, n, and p are the same or different and independently either 0 or 1, with the proviso that m, n, and p are not simultaneously 0; q is 0, 1, 2, 3, or 4; Y and Z are the same or different and are independently O, S, or NH.

[0301] In one embodiment, R1 and R2 are each linoleyl and the amino lipid is a dilinoleyl amino lipid.

[0302] In one embodiment, the amino lipid is a dilinoleyl amino lipid.

[0303] In various other embodiments, the cationic lipid has the structure: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof, wherein: R1 and R2 are each independently selected from the group consisting of H and C1-C3 alkyl; R3 and R4 are each independently an alkyl group having from about 10 to about 20 carbon atoms, and at least one of R3 and R4 contains at least two sites of unsaturation.

[0304] In some embodiments, R3 and R4 are each independently selected from dodecadienyl, tetradecadienyl, hexadecadienyl, linoleyl, and icosadienyl. In some embodiments, R3 and R4 are both linoleyl. In some embodiments, R3 and / or R4 can include at least three sites of unsaturation (e.g., R3 and / or R4 can be, for example, dodecatrienyl, tetradectrienyl, hexadecatrienyl, linolenyl, and icosatrienyl).

[0305] In some embodiments, the cationic lipid has the structure: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof, wherein: R1 and R2 are each independently selected from H and C1-C3 alkyl; R3 and R4 are each independently an alkyl group having from about 10 to about 20 carbon atoms, and at least one of R3 and R4 contains at least two sites of unsaturation.

[0306] In one embodiment, R3 and R4 are the same, for example, in some embodiments, R3 and R4 are both linoleyl (C 18 -alkyl). In other embodiments, R3 and R4 are different, for example, in some embodiments, R3 is tetradectrienyl (C 14 -alkyl), and R4 is linoleyl (C 18 -alkyl). In preferred embodiments, the cationic lipid(s) of the present invention are symmetrical, i.e., R3 and R4 are the same. In another preferred embodiment, both R3 and R4 comprise at least two unsaturated sites. In some embodiments, R3 and R4 are each independently selected from dodecadienyl, tetradecadienyl, hexadecadienyl, linoleyl, and icosadienyl. In certain embodiments, R3 and R4 are both linoleyl. In some embodiments, R3 and / or R4 comprise at least three unsaturated sites, each independently selected from dodecatrienyl, tetradectrienyl, hexadecatrienyl, linolenyl, and icosatrienyl.

[0307] In various embodiments, the cationic lipid has the formula: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof, wherein: X aa is the formula -NR N-CR 1 R 2 D- or L-amino acid residues having the formula -C(C=O)-, or -{NR N -CR 1 R 2 -C(C=O)} n - (n is an integer from 2 to 20), R 1 is independently, for each occurrence, a non-hydrogen or a substituted or unsubstituted side chain of an amino acid; R 2 and R N independently, for each occurrence, consists of hydrogen, carbon, oxygen, nitrogen, sulfur, and hydrogen atoms or any combination of the foregoing, and has 1 to 20 carbon atoms, C (1-5) Alkyl, cycloalkyl, cycloalkylalkyl, C (1-5) Alkenyl, C (1-5) Alkynyl, C (1-5) Alkanoyl, C (1-5) Alkanoyloxy, C (1-5) Alkoxy, C (1-5) Alkoxy-C (1-5) Alkyl, C (1-5) Alkoxy-C (1-5) Alkoxy, C (1-5) Alkyl-amino-C (1-5) Alkyl-, C (1-5) Dialkyl-amino-C (1-5) Alkyl-, nitro-C (1-5) Alkyl, Cyano-C (1-5) Alkyl, aryl-C (1-5) Alkyl, 4-biphenyl-C (1-5) an organic group having alkyl, carboxyl, or hydroxyl; Z is -NH-, -O-, -S-, -CHS-, -CHS(O)-, or an organic linker consisting of 1 to 40 atoms selected from hydrogen, carbon, oxygen, nitrogen, and sulfur atoms (preferably, Z is -NH- or -O-); R x and R yare independently (i) a lipid-soluble tail derived from a lipid (which may be naturally occurring or synthetic), such as a phospholipid, glycolipid, triacylglycerol, glycerophospholipid, sphingolipid, ceramide, sphingomyelin, cerebroside, or ganglioside (the tail optionally comprises a steroid); (ii) an amino acid terminal group selected from hydrogen, hydroxyl, amino, and an organic protecting group; or (iii) a substituted or unsubstituted C (3-22) Alkyl, C (6-12) Cycloalkyl, C (6-12) Cycloalkyl-C (3-22) Alkyl, C (3-22) Alkenyl, C (3-22) Alkynyl, C (3-22) Alkoxy, or C (6-12) -Alkoxy C (3-22) It is alkyl.

[0308] In some embodiments, R x and R y One of R is a lipophilic tail as defined above, and the other is an amino acid terminal group. x and R y Both are lipid-soluble tails.

[0309] In some embodiments, R x and R y At least one of the groups may contain one or more biodegradable groups (e.g., -OC(O)-, -C(O)O-, -SC(O)-, -C(O)S-, -OC(S)-, -C(S)O-, -SS-, -C(O)(NR 5 )-, -N(R 5 )C(O)-, -C(S)(NR 5 )-, -N(R 5 )C(O)-, -N(R 5 )C(O)N(R 5 )-, -OC(O)O-, -OSi(R 5 )2O-, -C(O)(CR 3 R 4 )C(O)O-, -OC(O)(CR 3 R 4 )C(O)-, or [ka] are separated by

[0310] In some embodiments, R 11 is a C2-C8 alkyl or alkenyl.

[0311] In some embodiments, R 5 Each occurrence of is independently H or alkyl.

[0312] In some embodiments, R 3 and R 4 each occurrence of is independently H, halogen, OH, alkyl, alkoxy, —NH, alkylamino, or dialkylamino; or R and R taken together with the carbon atom to which they are directly attached form a cycloalkyl group. In some particular embodiments, R 3 and R 4 Each occurrence of is independently H or C1-C4 alkyl.

[0313] In some embodiments, R x and R y each independently has one or more carbon-carbon double bonds.

[0314] In some embodiments, the cationic lipid is one of the following: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof, wherein: R1 and R2 are each independently alkyl, alkenyl, or alkynyl, each of which may be optionally substituted; R3 and R4 are each independently C1-C6 alkyl, or R3 and R4 together form an optionally substituted heterocyclic ring.

[0315] Representative useful dilinoleyl amino lipids have the formula: [ka] wherein n is 0, 1, 2, 3, or 4.

[0316] In one embodiment, the cationic lipid is DLin-K-DMA. In one embodiment, the cationic lipid is DLin-KC2-DMA (the DLin-K-DMA described above where n is 2).

[0317] In one embodiment, the cationic lipid has the structure: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof, wherein: R and R are each independently, for each occurrence, an optionally substituted C 10 -C 30 Alkyl, optionally substituted C 10 -C 30 Alkenyl, optionally substituted C 10 -C 30 Alkynyl or optionally substituted C 10 -C 30 It is acyl, R3 is H, optionally substituted C2-C 10 Alkyl, optionally substituted C-C 10 Alkenyl, optionally substituted C-C 10 R3 is an alkylyl, alkyl heterocycle, alkyl phosphate, alkyl phosphorothioate, alkyl phosphorodithioate, alkyl phosphonate, alkylamine, hydroxyalkyl, ω-aminoalkyl, ω-(substituted) aminoalkyl, ω-phosphoalkyl, ω-thiophosphoalkyl, optionally substituted polyethylene glycol (PEG, mw 100-40K), optionally substituted mPEG (mw 120-40K), heteroaryl, or heterocycle, or linker ligand, e.g., in some embodiments, R3 is (CH3)2N(CH2) n - (n is 1, 2, 3 or 4), E is O, S, N(Q), C(O), OC(O), C(O)O, N(Q)C(O), C(O)N(Q), (Q)N(CO)O, O(CO)N(Q), S(O), NS(O)N(Q), S(O), N(Q)S(O), SS, O=N, aryl, heteroaryl, cyclic or heterocycle, e.g., -C(O)O, where - is the point of attachment to R; Q is H, alkyl, ω-aminoalkyl, ω-(substituted)aminoalkyl, ω-phosphoalkyl, or ω-thiophosphoalkyl.

[0318] In one particular embodiment, the cationic lipid of embodiment 1, 2, 3, 4, or 5 has the structure: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof; During the ceremony, E is O, S, N(Q), C(O), N(Q)C(O), C(O)N(Q), (Q)N(CO)O, O(CO)N(Q), S(O), NS(O)2N(Q), S(O)2, N(Q)S(O)2, SS, O=N, aryl, heteroaryl, cyclic or heterocycle; Q is H, alkyl, ω-aminoalkyl, ω-(substituted)aminoalkyl, ω-phosphoalkyl, or ω-thiophosphoalkyl; R1 and R2 and R x are each independently, for each occurrence, H, optionally substituted C-C 10 Alkyl, optionally substituted C 10 -C 30 Alkyl, optionally substituted C 10 -C 30 Alkenyl, optionally substituted C 10 -C 30 Alkynyl, optionally substituted C 10 -C 30 acyl, or linker-ligand, where R, R, and R x At least one of them is not H, R3 is H, optionally substituted C1-C 10 Alkyl, optionally substituted C-C 10 Alkenyl, optionally substituted C-C 10 alkynyl, alkyl heterocycle, alkyl phosphate, alkyl phosphorothioate, alkyl phosphorodithioate, alkyl phosphonate, alkylamine, hydroxyalkyl, ω-aminoalkyl, ω-(substituted) aminoalkyl, ω-phosphoalkyl, ω-thiophosphoalkyl, optionally substituted polyethylene glycol (PEG, mw 100-40K), optionally substituted mPEG (mw 120-40K), heteroaryl, or heterocycle, or linker ligand; wherein n is 0, 1, 2, or 3.

[0319] In one embodiment, the cationic lipid of embodiment 1, 2, 3, 4, or 5 has the structure of Formula I: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof; During the ceremony, L 1 or L 2 One of the following is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x -, -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -, or -NR a C(=O)O-, and L 1 or L 2 The other is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x -, -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a-, -OC(=O)NR a -,or -NR a C(=O)O-, or a direct bond, R a is H or C1-C 12 is alkyl, R 1a and R 1b is, in each occurrence, independently: (a) H or C1-C 12 alkyl, or (b) R 1a But H or C1-C 12 alkyl, and R 1b together with the carbon atom to which it is attached, form an adjacent R 1b and together with the carbon atom to which it is attached form a carbon-carbon double bond, R 2a and R 2b is, in each occurrence, independently: (a) H or C1-C 12 alkyl, or (b) R 2a But H or C1-C 12 alkyl, and R 2b together with the carbon atom to which it is attached, form an adjacent R 2b and together with the carbon atom to which it is attached form a carbon-carbon double bond, R 3a and R 3b is, in each occurrence, independently: (a) H or C1-C 12 alkyl, or (b) R 3a But H or C1-C 12 alkyl, and R 3b together with the carbon atom to which it is attached, form an adjacent R 3b and together with the carbon atom ...

Claims

1. A circular RNA polynucleotide comprising a translation initiation element (TIE), wherein the TIE comprises a sequence selected from SEQ ID NOs: 1284, 2278, 650, 799, or SEQ ID NOs: 1068, 1180, 1181, 1078, 1131, 1136, 1141, 917, 1065, 1163, 1212, or SEQ ID NOs: 1216, 1215, 1210, 2779, 842, 849, 1164, or a sequence having at least 85% sequence identity to a fragment thereof.

2. A circular RNA polynucleotide comprising a translation initiation element (TIE), wherein the TIE comprises a sequence having at least 85% sequence identity to a sequence selected from SEQ ID NOs: 1-2983 and 3282-3287, or a fragment thereof.

3. The circular RNA polynucleotide described in claim 1, wherein the TIE comprises at least one internal ribosome entry site (IRES) or a fragment thereof.

4. The IRES or a fragment thereof is selected from the group consisting of SEQ ID NOs: 75, 77, 137, 532, 566, 582, 648, 680, 693, 752, 785, 787, 791, 793, 820, 823, 839, 840, 843, 852, 857, 861, 862, 863, 864, 871, 874, 876, 922, 959, 983, 984, 1015, 1017, 1023, 1026, 1031, 1041, 1047, 1059, 1068, 1134, 1168, 1169, 1171, 1177, 1178, 1179, 1180, 1189, 1192, 1193, 1198, 1210 3. The circular RNA polynucleotide of claim 2, comprising a sequence having at least 85% sequence identity to a sequence selected from the group consisting of: 1216, 1218, 1230, 1263, 1276, 1280, 1282, 1284, 1287, 1346, 1354, 1364, 1367, 1370, 1432, 1438, 1440, 2278, 2285, 2465, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2742, 2746, 2758, 2777, 2778, 3282, 3283, 3286, and 3287, or a fragment thereof.

5. The TIE fragment, a. SEQ ID NO: 2278 GGGTGAAGGATGCCCAGAAGGTACCCGTAGGTAACCTTAAGAGACTATGGATCTGATCTGGGGG; b. SEQ ID NO: 1180, TTAAAACAGCTCTGGGGTTGTTCCCACCCCAGAGGCCCACGCGGCGGCCAGTACACCGGTATCACGGTACCCTTGTACGCCTGTTTTATACTCCCTTCCCCGTAACTTAGAAG, or a sequence having 4 or less mismatches thereto; or c. SEQ ID NO: 1210, CGATGAGTCTGGACGATCTCACTGGCGACAGTGGTCCAGGCTGCGTTGGCGGCCTACCTATGGCCCAAAGCCATAGGACGCTAGTTGTGAACAAGGTGTGAAGAGCCTATTGAGCTAC, or a sequence having 5 or fewer mismatches thereto 2. The circular RNA polynucleotide of claim 1, comprising a sequence selected from:

6. The circular RNA polynucleotide described in claim 5, wherein the TIE comprises at least one natural or synthetic aptamer sequence or a fragment thereof.

7. The circular RNA polynucleotide described in claim 5, wherein the aptamer sequence or a fragment thereof comprises a sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 3266 to 3268.

8. The circular RNA polynucleotide described in claim 5, wherein the TIE comprises at least one natural or synthetic UTR sequence.

9. The circular RNA polynucleotide of claim 5, comprising a binding domain with an IRES transactivating factor (ITAF), optionally wherein the binding domain is selected from a polyA region, a polyC region, a polyAC region, a polypyrimidine tract, or a combination or variant thereof, and optionally wherein the ITAF is selected from poly(rC) binding protein 1 (PCBP1), PCBP2, PCBP3, PCBP4, poly(A) binding protein 1 (PABP1), polypyrimidine tract binding protein (PTB), an Argonaute protein family member, HNRNPK (heterogeneous nuclear ribonucleoprotein K protein), or La protein, or a fragment or combination thereof.

10. The circular RNA polynucleotide of claim 5, further comprising a sequence encoding a therapeutic protein selected from a chimeric antigen receptor (CAR), a T cell receptor (TCR), a B cell receptor (BCR), an immune cell activating or inhibitory receptor, a recombinant fusion protein, a chimeric mutant protein, or a fusion protein, an antibody, a nanobody, a non-antibody protein, an immunomodulatory ligand, a receptor, a structural protein, a growth factor ligand or receptor, a hormone or hormone receptor, a transcription factor, a checkpoint inhibitor or agonist, an Fc fusion protein, an anticoagulant, a blood clotting factor, a chaperone protein, an antibacterial protein, a structural protein, a biochemical enzyme, a tight junction component protein, a mitochondrial stress response, a cytoskeletal protein, a metal binding protein, or a small molecule.

11. The circular RNA polynucleotide of claim 5, comprising at least one non-coding element.

12. The circular RNA polynucleotide of claim 5, further comprising a post-splicing fragment of an autocatalytic intron optionally derived from a bacterial phage, a viral vector, an organellar genome, a nuclear rDNA gene, an Anabaena bacterium, a T4 phage virus, a Twort bacteriophage, a Tetrahymena, or an Azoarcus bacterium, wherein the fragment is optionally an exon fragment.

13. The circular RNA polynucleotide of claim 5, comprising at least one modified nucleotide selected from 5-methylcytidine, 5-methoxyuridine, 1-methyl-pseudouridine, N6-methyladenosine, and / or pseudouridine. (a) a duration of therapeutic effect in vivo in humans of at least 20 hours; (b) a functional half-life of at least 6 hours; (c) a duration of therapeutic effect in human cells that is longer or equivalent to that of a comparable linear RNA polynucleotide containing the same expression sequence; and / or (d) a longer duration of therapeutic effect in humans in vivo than that of a comparable linear RNA polynucleotide having the same expression sequence.

14. The circular RNA polynucleotide according to any one of claims 1 to 13, comprising:

15. A pharmaceutical composition comprising a circular RNA polynucleotide according to any one of claims 1 to 13, a pharma- ceutically acceptable salt, buffer, diluent, or combination thereof, and optionally a delivery vehicle, wherein the delivery vehicle optionally comprises nanoparticles, wherein the nanoparticles optionally comprise one or more cationic lipids, non-cationic lipids, ionizable lipids, or poly-β-amino esters, and / or are lipid nanoparticles, core-shell nanoparticles, biodegradable nanoparticles, biodegradable lipid nanoparticles, polymeric nanoparticles, polyplexes, or biodegradable polymer nanoparticles, and / or comprise one or more PEG-modified lipids, polyglutamic acid lipids, or hyaluronic acid lipids, and / or cholesterol, and / or arachidonic acid, leukotrienes, or oleic acid.

16. A pharmaceutical composition for use in a method for expressing a therapeutic protein in a cell, said pharmaceutical composition comprising a circular RNA polynucleotide according to any one of claims 1 to 13, said method comprising contacting said cell with said circular RNA polynucleotide, optionally wherein said cell is selected from an immune cell, a liver cell, or a muscle cell.

17. A pharmaceutical composition for treating a subject in need thereof, comprising a circular RNA polynucleotide according to any one of claims 1 to 13.

18. The object, (a) acute myeloid leukemia (AML), alveolar rhabdomyosarcoma, B-cell malignancies, bladder cancer (e.g., bladder carcinoma), bone cancer, brain cancer (e.g., medulloblastoma and glioblastoma multiforme), breast cancer, cancer of the anus, anal canal, or anorectum, eye cancer, cancer of the intrahepatic bile duct, cancer of the joints, cancer of the neck, cancer of the gallbladder, cancer of the pleura, cancer of the nose, nasal cavity, or middle ear, cancer of the oral cavity, cancer of the vulva, chronic lymphocytic leukemia, chronic myeloid cancer, colon cancer, cancer of the esophagus, cancer of the cervix, fibrosarcoma, gastrointestinal carcinoid tumor, head and neck cancer (e.g., head and neck squamous cell carcinoma), Hodgkin's lymphoma, hypopharyngeal cancer, kidney cancer, laryngeal cancer, leukemia, liquid tumor, lipoma, liver cancer, lung cancer (e.g., non-small cell lung cancer, lung adenocarcinoma, and small cell lung cancer), lymphoma, mesothelioma, mast cell tumor, melanoma, multiple myeloma, nasopharyngeal cancer, non-Hodgkin's lymphoma, B chronic lymphocytic leukemia, hairy cell leukemia, Burkitt's lymphoma, ovarian cancer, pancreatic cancer, peritoneal cancer, omental cancer, mesenteric cancer, pharyngeal cancer, prostate cancer, rectal cancer, renal cancer, skin cancer, small intestine cancer, soft tissue cancer, solid tumor, synovial sarcoma, gastric cancer, teratoma, testicular cancer, thyroid cancer, and ureteral cancer; or (b) an autoimmune disorder selected from scleroderma, Graves' disease, Crohn's disease, Sjogren's disease, multiple sclerosis, Hashimoto's disease, psoriasis, myasthenia gravis, autoimmune polyendocrine deficiency syndrome, type I diabetes mellitus (TIDM), autoimmune gastritis, autoimmune uveoretinitis, polymyositis, colitis, thyroiditis, and a systemic autoimmune disease typified by human lupus; 18. The pharmaceutical composition of claim 17, having the formula:

19. A method for purifying a circular RNA polynucleotide according to any one of claims 1 to 13, comprising: (a)(i) contacting a composition comprising linear RNA and circular RNA with a binding agent that preferentially binds the linear RNA over the circular RNA; (ii) separating RNA bound to said binding agent from RNA not bound to said binding agent; or (b) hybridizing the oligonucleotides conjugated to the solid surface with affinity sequences present in the RNA precursor polynucleotides; A method comprising:

20. A method for producing a circular RNA polynucleotide according to any one of claims 1 to 13, comprising circularizing an RNA precursor polynucleotide formed by transcribing a vector or DNA, including a PCR product, a linear plasmid, a non-linear plasmid, a linear minicircle, a non-linear minicircle, a viral vector, a cosmid, ceDNA, or an artificial chromosome.

21. An RNA precursor polynucleotide for use in the method of claim 20, comprising: a. a 5' enhancing intron element; b. a 5' enhancing exon element; c. Core Functionality Elements; d. a 3' enhancing exon element; e. a 3' enhancing intron element; The core functional element comprises: i. a translation initiation element (TIE) comprising a sequence having at least 85% sequence identity to a sequence selected from SEQ ID NOs: 1-2983 and 3282-3287, or a fragment thereof; ii. A code or non-code element; iii. Optionally, a stop codon or a stop cassette.

22. A method for producing a translation initiation element (TIE), comprising: a. obtaining a viral untranslated region (UTR); b. By progressive deletion of sequences, determining the functional units of said UTR that are capable of binding initiation factors and / or initiating translation; c. removing non-functional units of the UTR; d. optionally modifying the ends of the UTRs.