Efficacy of epigenetic moderators of naltrexone in reducing heavy drinking in individuals diagnosed with alcohol use disorder
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- THE REGENTS OF THE UNIVERSITY OF COLORADO
- Filing Date
- 2022-05-25
- Publication Date
- 2026-04-27
AI Technical Summary
Current treatments for alcohol use disorder, such as naltrexone, do not effectively work for all individuals due to genetic variability, and there is a lack of specific biomarkers predicting individual responses to these treatments.
A method involving methylation assays to determine the methylation status of specific genomic regions of the OPRM1, COMT, and SLC6A3 genes, including their promoters and 3' untranslated regions, to predict naltrexone response in patients with alcohol use disorder.
This approach allows for personalized treatment strategies by identifying individuals likely to respond positively to naltrexone based on specific methylation patterns, improving treatment efficacy.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS The subject matter of this disclosure claims the benefit of U.S. Provisional Patent Application No. 63 / 192,952, filed May 25, 2021, the disclosure of which is incorporated by reference in its entirety herein.
[0002] Reference to Electronically Submitted Sequence Listing The contents of the electronically submitted Sequence Listing in the ASCII text file submitted with this application (Name: 1586_24_PCT_ST25.txt; Size: 285 KB; Creation Date May 25, 2022) are hereby incorporated by reference in their entirety.
[0003] Grant Description This invention was made with Government support under Grant Nos. AA017435 and AA017633 awarded by the National Institute on Alcohol Abuse and Alcoholism of the National Institutes of Health. The Government has certain rights in this invention.
[0004] The subject matter of the present disclosure, in some embodiments, relates to methods for predicting naltrexone response in a patient diagnosed with alcohol use disorder.The subject matter of the present disclosure also, in some embodiments, relates to methods of treating a subject with alcohol use disorder with a treatment strategy for the subject that is predicted based at least in part on the methylation status of subsequences of the OPRM1, COMT and / or SLC6A3 genomic loci in the subject. [Background technology]
[0005] The opioid antagonist, naltrexone, reduces heavy drinking in individuals with alcohol use disorder (AUD; Jonas et al., 2014a), but is not effective for everyone. Genomic factors may explain the variability in its effectiveness. The most widely studied genomic factor is the rs1799971 single nucleotide polymorphism (SNP) in the gene encoding the μ-opioid receptor (MOR) OPRM1, which is an A / G SNP that codes for an aspartic acid or asparagine at amino acid 40 of the human OPRM1 polypeptide in the endorphin-binding domain and is associated with increased MOR binding affinity for β-endorphin (Bond et al., 1998). This gain-of-function SNP can also increase MOR affinity for naltrexone (Weerts et al., 2013), increasing the effect of naltrexone. However, meta-analyses of randomized controlled trials (RCTs) of naltrexone for AUD found only weak evidence supporting moderation of naltrexone response for rs1799971 ( Hartwell et al., 2020 ; Jonas et al., 2014b ).
[0006] Because naltrexone is thought to reduce drinking through opioid-mediated downstream effects on alcohol-induced dopamine release (Benjamin et al., 1993; Gonzales & Weiss, 1998), genomic factors related to dopamine reuptake and inactivation may also moderate its effects. Accordingly, human laboratory studies of short-term naltrexone administration in non-treatment-seeking individuals with AUD have previously reported that variants at OPRM1 rs1799971 and a 40 base pair variable number tandem repeat (VNTR) polymorphism in the 3' untranslated region of SLC6A3, a gene encoding the dopamine transporter (DAT), interact to predict the effects of naltrexone on alcohol self-administration and alcohol cue-induced activation of the ventral striatum (Anton et al., 2012; Schacht et al., 2013; see also U.S. Patent Application Publication No. 2018 / 0371542 A1, each of which is incorporated herein by reference in its entirety). The SLC6A3 VNTR 10 repeat (10R) allele, compared with the 9 repeat (9R) allele, is associated with greater striatal DAT expression in AUD, possibly reducing synaptic dopamine accumulation (Heinz et al., 2000), and naltrexone reduced self-administration and cue-induced ventral striatal activation most in individuals who carried the rs1799971 G allele and were homozygous for the SLC6A3 10R allele, compared with placebo. These findings suggested that the tendency toward greater MOR affinity for naltrexone putatively conferred by the rs1799971 G allele may be beneficial only in the presence of a genetically influenced reduction in synaptic dopamine accumulation.
[0007] This finding was subsequently replicated and expanded in a secondary analysis of a 16-week naltrexone RCT in treatment-seeking AUD patients (Anton et al., 2020; see also U.S. Patent Application Publication No. 2018 / 0369238, each of which is incorporated herein by reference in its entirety). OPRM1 rs1799971 genotype alone did not significantly moderate the effect of naltrexone on heavy drinking, but there was an epistatic interaction between rs1799971 and both the SLC6A3 VNTR and rs4680(val158met) SNP in COMT (COMT; Anton et al., 2020), a gene that encodes the dopamine-inactivating enzyme catechol-O-methyltransferase. The rs4680 val allele was associated with a 3-4 fold increase in COMT efficacy, reducing synaptic dopamine accumulation in a manner similar to the SLC6A3 10 repeat allele (but likely in different brain regions, as DAT and COMT expression varies across the brain) (Chen et al., 2004; Lachman et al., 1996). As disclosed herein, naltrexone reduced heavy drinking most effectively in individuals carrying the rs1799971 G allele and homozygous for either the SLC6A3 10R or rs4680 val allele, compared to placebo. These data again suggested that a combination of enhanced MOR function and reduced synaptic dopamine accumulation due to genetic predisposition is associated with superior naltrexone response.
[0008] Although somatic (genetic / germline) epistatic gene effects can be useful in predicting naltrexone efficacy, a universal mechanism by which genomic factors can affect naltrexone response is epigenetic modification (which can be either genetic or, more likely, postnatally acquired, e.g., through excessive alcohol use). DNA methylation at cytosine residues in CpG (cytosine followed by guanine) dinucleotides is disproportionately clustered in islands within gene promoter regions, influencing transcription factor binding and recruiting histone deacetylase complexes that compact chromatin, thereby reducing gene expression (Jones, 2021). Given naltrexone's neurochemical mechanism of action, and our prior observations of the interplay of specific gene variants that affect naltrexone efficacy in AUD, differences in OPRM1, SLC6A3 and / or COMT methylation may also moderate naltrexone response. Methylation of each gene's promoter was associated with downstream effects on its expression and the function of the protein it encodes. Increased OPRM1 promoter methylation in neurally derived cell lines was associated with decreased MOR expression (Andria & Simon, 1999), increased SLC6A3 promoter methylation in blood was associated with decreased striatal DAT availability (Wiers et al., 2018), and increased COMT promoter methylation in human cell lines was associated with decreased COMT expression (Swift-Scanlan et al., 2014). Importantly, SLC6A3 promoter methylation in blood is highly correlated with methylation in the substantia nigra (Wiers et al., 2018), and COMT promoter methylation in peripheral leukocytes is highly correlated with neural tissue methylation in various brain regions, including the prefrontal cortex (PFC; Ursini et al., 2011) (Murphy et al., 2005), where COMT is a major mechanism of dopamine inactivation (Matsumoto et al., 2003).Although most of this work was performed in animals and some was not replicated in humans, there is some evidence that peripheral SLC6A3 and COMT methylation may be biomarkers of neuronal methylation.
[0009] OPRM1, SLC6A3, and COMT promoter methylation have already been associated with AUD and drinking. OPRM1 promoter methylation was greater in AUD individuals compared to controls (Zhang et al., 2012), and OPRM1 CpG site methylation in several individuals predicted AUD relapse during treatment, although OPRM1 methylation did not independently moderate the effect of naltrexone on drinking (Lin et al., 2020). Similarly, SLC6A3 promoter methylation was greater in AUD individuals than controls (Hillemacher et al., 2009; Wiers et al., 2015), although some studies found no differences between these groups (Jasiewicz et al., 2015; Nieratschker et al., 2014). COMT promoter hypomethylation has been associated with more hazardous drinking, albeit only in rs4680 met allele carriers (Swift-Scanlan et al., 2014), but has not been associated with naltrexone response until now. Thus, there is some evidence that alcohol consumption over a period of time can affect DNA methylation across the genome and in specific genes, but there is considerable variation / discrepancy between individuals. Importantly, until now there have been no indicators of any specific CpG methylation patterns that influence / predict response to naltrexone or any other specific treatment. Summary of the Invention
[0010] This summary lists some embodiments of the subject matter of the present disclosure, and often lists variations and permutations of these embodiments. This summary is merely illustrative of many different embodiments. Mention of one or more representative features of a given embodiment is also exemplary. Such an embodiment can typically exist with or without one or more of the features mentioned. Similarly, those features can be applied to other embodiments of the subject matter of the present disclosure, whether or not they are listed in this summary. To avoid unnecessary repetition, this summary does not list or suggest all possible combinations of such features.
[0011] The subject matter of the present disclosure, in some embodiments, relates to a method for predicting naltrexone response in a subject with alcohol use disorder (AUD). In some embodiments, the method comprises, consists essentially of, or consists of performing or performing one or more methylation assays on a genomic DNA sample isolated from a subject to determine the methylation status of one or more regions of the isolated genomic DNA, wherein the one or more regions of the isolated genomic DNA are subsequences of a gene selected from the group consisting of the mu opioid receptor (OPRM1) gene, the catechol-O-methyltransferase (COMT) gene, and the dopamine transporter (SLC6A3) gene, and further, the determined methylation status of the one or more regions of the isolated genomic DNA predicts naltrexone response in the subject. In some embodiments, one or more regions of the isolated genomic DNA assayed comprise, consist essentially of, or consist of the promoter of the OPRM1 gene, the promoter of the COMT gene, the promoter of the SLC6A3 gene, and a 40 base pair variable number tandem repeat (VNTR) polymorphism in the 3' untranslated region of the SLC6A3 gene. In some embodiments, one or more regions of the OPRM1 gene comprise 130 nucleotides upstream and 600 nucleotides downstream of the OPRM1 transcription start site (TSS), and optionally comprise one or more of SEQ ID NOs: 2-10. In some embodiments, one or more regions of the SLC6A3 gene comprise one or more of SEQ ID NOs: 12-20. In some embodiments, one or more regions of the COMT gene comprise one or more of SEQ ID NOs: 28-38. In some embodiments, the SLC6A3 VNTR comprises one or more of SEQ ID NOs: 22-25.
[0012] In some embodiments of the methods of the present disclosure, the methylation status of at least two, and optionally all three, of 40 base pair variable number tandem repeat (VNTR) polymorphisms in the promoter of the OPRM1 gene, the promoter of the COMT gene, and the 3' untranslated region of the SLC6A3 gene is determined.
[0013] In some embodiments of the method of the present disclosure, the methylation status of at least one region of the OPRM1 gene and at least one region of the SLC6A3 gene and / or the COMT gene is determined. In some embodiments, the at least one region of the OPRM1 gene is selected from the group consisting of nucleotide positions 274, 277, 357 and 419 of SEQ ID NO:1, and further (i) the at least one region of the SLC6A3 gene is selected from the group consisting of nucleotide positions 576 and 1102 of SEQ ID NO:11, nucleotide position 1102 of SEQ ID NO:11 and nucleotide position 46 of SEQ ID NO:21, and / or (ii) the at least one region of the COMT gene is selected from the group consisting of nucleotides 46 and 107 of SEQ ID NO:27. In some embodiments, a positive response to naltrexone is predicted if the subject has the following combination of methylation values: (a) less than 0.147 for nucleotide position 27 and / or less than 0.488 for nucleotide position 419 of SEQ ID NO:1 in combination with less than 0.651 for nucleotide position 576 of SEQ ID NO:11 and / or less than 0.648 for nucleotide position 1102 of SEQ ID NO:11 and / or less than 0.089 for nucleotide position 46 of SEQ ID NO:21; and / or (b) a combination of less than 0.147 for nucleotide position 27 of SEQ ID NO:1 and / or less than 0.157 for nucleotide position 277 of SEQ ID NO:1 and / or less than 0.126 for nucleotide position 357 of SEQ ID NO:1 and / or less than 0.488 for nucleotide position 419 of SEQ ID NO:1, and less than 0.587 for nucleotide position 46 of SEQ ID NO:27 and / or less than 0.546 for position 107 of SEQ ID NO:27.
[0014] In some embodiments of the methods of the present disclosure, genomic DNA is isolated from cells selected from the group consisting of blood cells, optionally peripheral blood mononuclear cells and buccal cells, and / or from a biological sample containing cells, optionally blood, saliva, cerebrospinal fluid, and / or any fraction or component thereof.
[0015] In some embodiments, the methods of the disclosure further comprise, consist essentially of, or consist of bisulfite conversion of the isolated genomic DNA prior to performing or having performed one or more methylation assays.
[0016] In some embodiments, the subject matter of the present disclosure also relates to a method of treating a subject with alcohol use disorder (AUD), comprising: (a) performing or carrying out one or more methylation assays on a genomic DNA sample isolated from the subject to determine a methylation status of one or more regions of the isolated genomic DNA, wherein the one or more regions of the isolated genomic DNA are subsequences of a gene selected from the group consisting of the mu opioid receptor (OPRM1) gene, the catechol-O-methyltransferase (COMT) gene, and the dopamine transporter (SLC6A3) gene; and further, determining the methylation status of the one or more regions of the isolated genomic DNA is a subsequence of a gene selected from the group consisting of the mu opioid receptor (OPRM1) gene, the catechol-O-methyltransferase (COMT) gene, and the dopamine transporter (SLC6A3) gene. and (b1) treating the subject with an effective amount of naltrexone if the methylation status of one or more regions of the isolated genomic DNA predicts that the subject will respond favorably to naltrexone; or (b2) treating the subject with an effective amount of a non-naltrexone agent, which may be selected from the group consisting of acamprosate, topiramate, fluoxetine, ondansetron, or any combination thereof. In some embodiments, the one or more regions of the isolated genomic DNA that are assayed comprise, consist essentially of, or consist of a 40 base pair variable number tandem repeat (VNTR) polymorphism in the promoter of the OPRM1 gene, the promoter of the COMT gene, the promoter of the CSLC6A3 gene, and the 3' untranslated region of the SLC6A3 gene. In some embodiments, one or more regions of the OPRM1 gene include 130 nucleotides upstream and 600 nucleotides downstream of the OPRM1 transcription start site (TSS), and optionally include one or more of SEQ ID NOs: 2-10. In some embodiments, one or more regions of the SLC6A3 gene include one or more of SEQ ID NOs: 12-20. In some embodiments, one or more regions of the COMT gene include one or more of SEQ ID NOs: 28-38.In some embodiments, the SLC6A3 VNTR comprises one or more of SEQ ID NOs: 22-25. In some embodiments, the methylation status of at least two, and possibly all three, 40 base pair variable number tandem repeat (VNTR) polymorphisms in the promoter of the OPRM1 gene, the promoter of the COMT gene, and the 3' untranslated region of the SLC6A3 gene is determined. In some embodiments, the methylation status of at least one region of the OPRM1 gene and at least one region of the SLC6A3 gene and / or the COMT gene is determined. In some embodiments, at least one region of the OPRM1 gene is selected from the group consisting of nucleotide positions 274, 277, 357, and 419 of SEQ ID NO:1, and further (i) at least one region of SLC6A3 is selected from the group consisting of nucleotide positions 576 and 1102 of SEQ ID NO:11, nucleotide position 1102 of SEQ ID NO:11, and nucleotide position 46 of SEQ ID NO:21, and / or (ii) at least one region of the COMT gene is selected from the group consisting of nucleotides 46 and 107 of SEQ ID NO:27. In some embodiments, a positive response to naltrexone is predicted if the subject has the following combination of methylation values: (a) less than 0.147 for nucleotide position 27 and / or less than 0.488 for nucleotide position 419 of SEQ ID NO:1 in combination with less than 0.651 for nucleotide position 576 of SEQ ID NO:11 and / or less than 0.648 for nucleotide position 1102 of SEQ ID NO:11 and / or less than 0.089 for nucleotide position 46 of SEQ ID NO:21; and / or (b) a combination of less than 0.147 for nucleotide position 27 of SEQ ID NO:1 and / or less than 0.157 for nucleotide position 277 of SEQ ID NO:1 and / or less than 0.126 for nucleotide position 357 of SEQ ID NO:1 and / or less than 0.488 for nucleotide position 419 of SEQ ID NO:1 with less than 0.587 for nucleotide position 46 of SEQ ID NO:27 and / or less than 0.546 for position 107 of SEQ ID NO:27. In some embodiments, the genomic DNA is isolated from cells selected from the group consisting of blood cells, optionally peripheral blood mononuclear cells and buccal cells, and / or from a biological sample containing cells, optionally blood, saliva, cerebrospinal fluid and / or any fraction or component thereof.
[0017] In some embodiments, the methods of the disclosure further comprise, consist essentially of, or consist of bisulfite conversion of the isolated genomic DNA prior to performing or having performed one or more methylation assays.
[0018] Accordingly, it is an object of the presently disclosed subject matter to provide methods for predicting naltrexone response in a subject with alcohol use disorder and / or treating a subject with alcohol use disorder with a treatment strategy that is predicted to be appropriate for the subject based, at least in part, on the results of whether the subject is predicted to respond adequately to naltrexone.
[0019] The above-mentioned objects of the subject matter of the present disclosure are achieved, in whole or in part, by the compositions and methods disclosed herein, and other objects will become apparent as the description proceeds, as best described hereinafter in connection with the accompanying drawings.
[0020] The accompanying drawings, which are incorporated by reference and constitute a part of this specification, illustrate several representative embodiments of the disclosed subject matter and together with the disclosed compositions and methods. [Brief description of the drawings]
[0021] [Figure 1] A series of graphs showing the effect of naltrexone (open triangles) on percentage of heavy drinking days (PHDD) during the 16-week study, compared to placebo (filled circles), as a function of SLC6A3 promoter methylation (y-axis) and OPRM1 promoter methylation (x-axis). SLC6A3 and OPRM1 methylation are separated into low and high groups (methylation levels below and above the median) for display purposes. Naltrexone reduced PHDD more in participants with lower SLC6A3 promoter and OPRM1 promoter methylation, compared to placebo. Figures are estimated marginal means (± standard error) from a linear mixed model in which the independent variables are promoter methylation levels (low or high) and naltrexone or placebo treatment, and the dependent variable is percentage of heavy drinking days over treatment period (months). [Diagram 2] A series of graphs showing the effect of naltrexone (open triangles) on percentage of heavy drinking days (PHDD) during the 16-week study, compared with placebo (filled circles), as a function of COMT promoter and OPRM1 promoter methylation. COMT and OPRM1 methylation are divided into low and high groups (methylation levels below and above the median) for display purposes. Naltrexone reduced PHDD more in participants with lower COMT promoter and OPRM1 promoter methylation, compared with placebo. Figures are estimated marginal means (± standard error) from a linear mixed model in which the independent variables are promoter methylation levels (low or high) and naltrexone or placebo treatment, and the dependent variable is percentage of heavy drinking days over treatment period (months). [Diagram 3]A series of graphs showing the effect of naltrexone (open triangles) on percentage of heavy drinking days (PHDD) during the 16-week study, compared to placebo (filled circles), as a function of SLC6A3 VNTR and OPRM1 promoter methylation. SLC6A3 and OPRM1 methylation are divided into low and high groups (methylation levels below and above the median) for display purposes. Naltrexone reduced PHDD more in participants with lower SLC6A3 VNTR and OPRM1 promoter methylation, compared to placebo. Figures are estimated marginal means (± standard error) from a linear mixed model where the independent variables are promoter methylation levels (low or high) and naltrexone or placebo treatment, and the dependent variable is percentage of heavy drinking days over treatment period (months). [Figure 4A] Depiction of the nucleotide sequence of the OPRM1 promoter region (SEQ ID NO:1). Lowercase letters indicate nontranscribed nucleotides and uppercase letters indicate exon sequences. The transcription start site (GAT) is highlighted in dark grey (black and white version of figure) and red (color version of figure) on line 3, and the translation start site (ATG) is highlighted in light grey (black and white version of figure) and blue (color version of figure) on line 6. CpG dinucleotides on the Illumina BeadChip are highlighted in light grey (black and white version of figure) and green (color version of figure), and superscript numbers refer to the unique Illumina ID for each site (see also Figure 4B). [Figure 4B] Table showing Illumina ID and chromosomal location from Genome Reference Consortium Human Build 37; GRCh37. Sites 1-10, highlighted in gray (black and white version of figure) or yellow (color version of figure) in Figure 4B, are the sites that, in combination with other sites, are the most significant predictors of naltrexone response as follows: [Figure 5A]Figure 5C: Nucleotide sequence of the analyzed SLC6A3 promoter (SEQ ID NO: 11) region. Lowercase letters indicate nontranscribed nucleotides, uppercase letters indicate exon sequences. Transcription start sites (GAG) are highlighted in dark grey (black and white version of figure) or red (color version of figure). CpG dinucleotides on the Illumina BeadChip are highlighted in light grey (black and white version of figure) or green (color version of figure), and superscript numbers refer to the unique Illumina ID for each site (see also Figure 5C). [Figure 5B] Figure 5C: Nucleotide sequence of the analyzed 3' untranslated region (UTR; SEQ ID NO:21) region. Lowercase letters indicate non-transcribed nucleotides, uppercase letters indicate exon sequences. Transcription start sites (GAGs) are highlighted in dark grey (black and white version of figure) or red (color version of figure). CpG dinucleotides on the Illumina BeadChip are highlighted in light grey (black and white version of figure) or green (color version of figure), and superscript numbers refer to the unique Illumina ID for each site (see also Figure 5C). [Figure 5C] 5C is a table showing Illumina IDs and chromosomal locations (Genome Reference Consortium Human Build 37; GRCh37). Sites highlighted in light grey (black and white version of figure) or yellow (color version of figure) in FIG. 5C are sites that are the most significant predictors of naltrexone response in combination with other sites listed in the site interaction table. [Figure 6A] 6A is a depiction of the COMT promoter sequences analyzed. The P2 (membrane-bound COMT) promoter (SEQ ID NO: 26) is shown. [Figure 6B]Figure 6B is a depiction of the analyzed COMT promoter sequences. The P1 (soluble COMT) promoter (SEQ ID NO: 27) is shown. Lowercase letters indicate non-transcribed nucleotides, and uppercase letters indicate the first (top) and third (bottom) exons of the gene. The translation start sites (ATG) of the membrane-bound and soluble isoforms are highlighted in light and dark grey (black and white version of the figure) or blue and purple (color version of the figure), respectively, in the second and fourth lines of Figure 6B. CpG dinucleotides on the Illumina BeadChip are highlighted in light grey (black and white version of the figure) or green (color version of the figure), and superscript numbers refer to the unique Illumina ID for each site (see also Figure 6C). [Figure 6C] 6C is a table showing Illumina IDs and chromosomal locations (from Genome Reference Consortium Human Build 37; GRCh37). Sites highlighted in light grey (black and white version of figure) or yellow (color version of figure) in FIG. 6C are sites that are the most significant predictors of naltrexone response in combination with other sites listed in the site interaction table above. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0022] In this study, we tested OPRM1 promoter methylation and its interaction with SLC6A3 promoter and COMT promoter and SLC6A3 VNTR methylation as moderators of naltrexone effects on drinking. We used genomic DNA extracted from peripheral leukocytes of participants in a 16-week naltrexone randomized controlled trial (RCT; Schacht et al., 2017), after which we found that SLC6A3 and COMT polymorphisms interacted with the OPRM1 rs1799971 SNP to predict naltrexone response (Anton et al., 2020). It is hypothesized that OPRM1, SLC6A3, and COMT promoter methylation and SLC6A2 VNTR methylation interact in their effects on naltrexone response in a manner similar to, but distinct from, and not attributable to, these polymorphisms, such that naltrexone-treated individuals with reduced OPRM1 methylation (and possibly increased MOR expression) and reduced methylation of either SLC6A3 or COMT (and possibly increased DAT or COMT expression, reduced development of synaptic dopamine accumulation) may demonstrate the greatest reduction in heavy drinking when treated with naltrexone.
[0023] Numerous clinical trials have investigated genomic factors that may moderate the efficacy of naltrexone in alcohol use disorder (AUD). Epigenetic processes such as DNA methylation (some of which may be acquired by chronic heavy alcohol consumption, for example) regulate gene expression by inhibiting transcription factor binding at gene promoters and / or other relevant genomic sites and may also affect the efficacy of naltrexone. As naltrexone reduces drinking presumptively through direct effects on opioids and indirect effects on dopamine signaling, methylation of opioid- and dopamine-related genes may moderate its effect. This study tested methylation of the promoters of the mu-opioid receptor (OPRM1), dopamine transporter (SLC6A3) and catechol-O-methyltransferase (COMT) genes as well as the SLC6A3 VNTR as moderators of naltrexone's effect on heavy drinking in a 16-week randomized placebo-controlled trial in 145 treatment-seeking AUD patients. OPRM1 methylation did not independently moderate naltrexone effects, but interacted with methylation of both SLC6A3 and COMT (p<0.05 and p<0.01, respectively), such that naltrexone-treated individuals with reduced OPRM1 and SLC6A3 or COMT promoter methylation (presumably associated with increased expression of these genes) had significantly fewer heavy drinking days compared to placebo and individuals with higher OPRM1 and SLC6A3 or COMT methylation. This effect is consistent with previous pharmacogenetic data from this sample (Anton et al., 2020), suggesting that individuals with functional alleles at polymorphisms in OPRM1, SLC6A3, and COMT affect naltrexone response. The methylation effects detailed here persisted even when these genotypes were considered in the statistical models, and thus represent novel findings that were not associated with previously described inherited genetic variants.Taken together, these data suggest that epigenetic modifications of genes related to opioid and dopamine signaling are novel predictors of naltrexone efficacy in AUD.
[0024] Before the present compounds, compositions, articles, devices and / or methods are disclosed and described, it is to be understood that they are not limited to particular synthetic methods, or to particular recombinant biotechnology methods, unless otherwise specified, or to particular reagents, unless otherwise specified, which, as such, can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
[0025] I. Definition All technical and scientific terms used herein are intended to have the same meaning as commonly understood by those skilled in the art, unless otherwise defined below. References to techniques used herein are intended to refer to techniques commonly understood in the art, including modifications of those techniques or equivalent replacements of techniques that would be obvious to those skilled in the art. Although the following terms are believed to be well understood by those skilled in the art, the following definitions are provided to facilitate the description of the subject matter of this disclosure.
[0026] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "pharmaceutical carrier" includes mixtures of two or more such carriers, and the like.
[0027] Ranges can be expressed herein as from "about" one particular value and / or to "about" another particular value. When such a range is expressed, some embodiments include from one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, using the antecedent "about," it will be understood that the particular value forms an embodiment. It will be further understood that the endpoints of each range are significant relative to the other endpoint, and independently of the other endpoint. It is also understood that there are several values disclosed herein, and that each value is also disclosed herein as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also understood that when a value is disclosed, "less than or equal to," "greater than or equal to," and possible ranges between the values are also disclosed, as would be properly understood by one of ordinary skill in the art. For example, if the value "10" is disclosed, then "less than or equal to 10" and "greater than or equal to 10" are also disclosed. It is also understood that throughout this application, data are provided in a number of different formats, which in some embodiments represent endpoints and starting points, and in some embodiments represent ranges of any combination of data points. For example, if a specific data point "10" and a specific data point "15" are disclosed, it is understood that greater than, greater than, less than, less than, and equal to 10 and 15, as well as between 10 and 15, are considered to be disclosed. It is also understood that each unit between two specific units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0028] The term "and / or," when used in the context of a list of elements, refers to the presence of the elements alone or in any combination.
[0029] As used herein, the terms "optional" and "optionally" indicate that a subsequently described event, circumstance, element, and / or method step may or may not occur and / or be present, and that the description includes instances when said event, circumstance, element, or method step occurs and / or is present, as well as instances when it is not.
[0030] A "probe" is a molecule that can interact with a target nucleic acid, typically in a sequence-specific manner, for example, through hybridization. Nucleic acid hybridization is well understood in the art and is discussed herein. Typically, a probe can be made from any combination of nucleotides, nucleotide derivatives and / or their analogs available in the art.
[0031] "Primers" are a subset of probes that can support certain enzymatic manipulations and can hybridize to a target nucleic acid so that the enzymatic manipulation can occur. Primers can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art that do not interfere with the enzymatic manipulation.
[0032] As used herein, the term "COMT" refers to the catechol-O-methyltransferase (COMT) gene or gene product, including, but not limited to, the gene products set forth in the GENBANK® Biosequence Database under Accession Nos. NM_000754.3 (SEQ ID NO: 40) and NP_000745.1 (SEQ ID NO: 41). The human COMT locus is located on chromosome 22 and corresponds to nucleotides 19,929,263-19,957,498 of GENBANK® Accession No. NC_000022.10 (SEQ ID NO: 42).
[0033] As used herein, the term "rs4680" refers to a SNP in the COMT gene. The wild type allele has a G at the nucleotide position corresponding to nucleotide 721 of the human COMT cDNA of SEQ ID NO:40, encoding a valine amino acid at amino acid 158 of the human COMT polypeptide of SEQ ID NO:41. The substitution polymorphism has an A at the nucleotide position corresponding to nucleotide 721 of the human COMT cDNA of SEQ ID NO:40, encoding a methionine amino acid at amino acid 158 of the human COMT polypeptide of SEQ ID NO:41. Thus, this SNP may also be referred to as "Val158Met" or grammatical variations thereof. Similarly, the term "rs4680 genotype" refers to both whether a patient has a G or an A at nucleotide 721 of the human COMT cDNA of SEQ ID NO:40, as well as whether a patient has a valine or a methionine at amino acid 158 of the human COMT polypeptide of SEQ ID NO:41.
[0034] As used herein, the terms "DAT1", "SLC6A3" and "DAT1 / SLC6A3" refer to the solute carrier family 6 member 3 (SLC6A3) gene or gene product, such as, but not limited to, the gene products set forth in the GENBANK® Biosequence Database under accession numbers NM_001044.4 (SEQ ID NO: 43) and NP_001035.1 (SEQ ID NO: 44). The SLC6A3 gene is also referred to as the dopamine transporter 1 (DAT1) gene. The human SLC6A3 locus is located on chromosome 5 and corresponds to the reverse complement of nucleotides 1,392,905-1,445,483 of GENBANK® Accession No. NC_000005.9 (SEQ ID NO: 45).
[0035] As used herein, the term "rs28363170" refers to a polymorphism of 40 nucleotide variable number tandem repeats (VNTR;ACTGGAGCGTGTACTACCCC AGGACGCATGCAGGGCCCCC;SEQ ID NO:39) present in the 3' untranslated region (UTR) of the nucleotide sequence of the dopamine transporter (SLC6A3 / DAT1) gene product. The 10 and 9 repeat alleles are the most common alleles (Doucette-Stamm et al., 1995). Similarly, the term "rs28363170 genotype" refers to which VNTR allele a patient has (e.g., how many copies of SEQ ID NO:39 a patient has in the 3'UTR of SLC6A3 / DAT1).
[0036] As used herein, the term "OPRM1" refers to the receptor mu 1 (OPRM1) gene or gene product, including, but not limited to, the gene products set forth in the GENBANK® Biosequence Database under Accession Nos. NM_000914.5 (SEQ ID NO: 46) and NP_000905.3 (SEQ ID NO: 47). The human OPRM1 locus is located on chromosome 6 and corresponds to nucleotides 154, 360, 375-154, 453, 491 of GENBANK® Accession No. NC_000006.11 (SEQ ID NO: 48).
[0037] As used herein, the term "rs1799971" refers to a SNP in the OPRM1 gene. The wild type allele has an A at the nucleotide position corresponding to nucleotide 423 of the human OPRM1 cDNA of SEQ ID NO:46, encoding an asparagine amino acid at amino acid 40 of the human OPRM1 polypeptide of SEQ ID NO:47. The substitution polymorphism has a G at the nucleotide position corresponding to nucleotide 423 of the human OPRM1 cDNA of SEQ ID NO:46, encoding an aspartic acid amino acid at amino acid 40 of the human OPRM1 polypeptide of SEQ ID NO:47. Thus, this SNP is sometimes referred to as "Asn40Asp" or grammatical variations thereof. Similarly, the term "rs1799971 genotype" refers to both whether a patient has an A or a G at nucleotide 423 of the human OPRM1 cDNA of SEQ ID NO:46, as well as whether a patient has an asparagine or an aspartic acid at amino acid 40 of the human OPRM1 cDNA of SEQ ID NO:47.
[0038] As is known in the art, in some embodiments, multiple gene products can be generated from a particular gene locus, e.g., by alternative transcription start sites, alternative splicing, etc. It is understood that the GENBANK® accession numbers provided herein are intended to be exemplary, and that other gene products whose nucleotide and / or amino acid sequences are not expressly disclosed herein are also intended to be encompassed by the corresponding gene name. Thus, for example, transcript variants of the sequences in the sequence listing are included in the definition of gene set forth herein, as are the amino acid variants encoded thereby.
[0039] II. METHODS FOR PREDICTING NALTREXONE RESPONSE IN SUBJECTS WITH ALCOHOL USE DISORDER (AUD) Alcohol use disorder (AUD) is a chronic, relapsing brain disorder characterized by compulsive alcohol use, loss of control over alcohol intake, and negative emotional states when not using. An estimated 16 million people in the United States alone have been diagnosed with AUD. To be diagnosed with AUD, an individual must meet at least two of the criteria outlined in the Diagnostic and Statistical Manual of Mental Disorders (DSM), including amount or duration of intake, inability to reduce or stop drinking, time spent drinking or in recovery, cravings, interference with work, school, or home due to drinking, maintaining intake despite problems resulting from intake, reducing activities to focus more on intake, increasing risky behaviors while drinking or intoxicated, continuing intake despite feelings of depression or anxiety, an increase in average intake in the past year, and the presence of withdrawal symptoms.
[0040] Treatment for AUD may include counseling, behavioral modification, and pharmacological intervention. Currently, three drugs are approved to treat alcohol use disorder: naltrexone, acamprosate, and disulfiram.
[0041] Both endogenous opiates and dopamine (DA) signaling regulate many aspects of AUD. Alcohol cues and intravenous alcohol self-administration both increase DA release in animals, and human brain imaging implicates the same mechanism in the human ventral striatum (VS). This dopamine release and its effects are blocked by exogenously administered naltrexone in animals and humans.
[0042] Naltrexone has proven efficacy in treating AUD and is approved by the FDA for this purpose. However, naltrexone does not work on all individuals with AUD, and in fact works well on a minority of individuals. This has led to speculation that genetic differences may be the basis for naltrexone's effectiveness. Given that naltrexone specifically binds to mu-opiate receptors in the brain and that binding (in the ventral striatum and elsewhere) is associated with effects on the brain dopamine system, it can be hypothesized that genetic variability (either inherited or acquired) may affect the efficacy of naltrexone. As previously mentioned, a single nucleotide variant (SNP) in the coding region of the mu-opiate receptor gene (OPRM1) at position 118 (A118G) has been reported to predict naltrexone efficacy. However, this was not universally confirmed. However, our previous research has suggested that this OPRM1 SNP is influenced by and / or interacts with some genetic variants in the dopamine system, the VNTR in the dopamine transporter (DAT1) gene, and / or the SNP in the catechol-O-methyltransferase (COMT) gene. These functional variants suggest that other mechanisms that affect these dopamine system genes may also interact with the OPRM1 gene to affect the effectiveness of naltrexone. One such mechanism is epigenetic (probably acquired, not inherited) methylation of specific CpG sites in the gene promoter regions of DAT1 and COMT genes and elsewhere.
[0043] The DA transporter (DAT) is the primary mechanism of striatal DA clearance. A 40 base pair variable number tandem repeat (VNTR) polymorphism (rs28363170;ACTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCC; SEQ ID NO: 39) in the 3' untranslated region of the DAT1 gene (DAT1 / SLC6A3), with the most common allelic variants being 9 and 10 repeats, may affect DAT1 function. Compared with the 10 repeat (10R) allele, the 9 repeat (9R) allele is associated with reduced DAT1 expression and reduced availability of striatal DAT1 in AUD individuals, potentially resulting in relatively increased extrasynaptic DA tone. Consistent with these findings, individuals carrying the 9R allele show greater VS activation during the expectation and receipt of monetary reward compared to 10R homozygotes. Furthermore, nicotine-dependent 9R carriers show greater smoking cue-induced VS activation and greater VS DA release after smoking.
[0044] Thus, in some embodiments, the subject matter of the present disclosure relates to a method for predicting naltrexone response in a subject with alcohol use disorder (AUD).In some embodiments, the method comprises, consists essentially of, or consists of performing or performing one or more methylation assays on a genomic DNA sample isolated from a subject to determine the methylation status of one or more regions of the isolated genomic DNA, wherein the one or more regions of the isolated genomic DNA are subsequences of a gene selected from the group consisting of the mu opioid receptor (OPRM1) gene, the catechol-O-methyltransferase (COMT) gene, and the dopamine transporter (SLC6A3) gene, and further, the determined methylation status of the one or more regions of the isolated genomic DNA predicts naltrexone response in the subject.
[0045] In some embodiments, one or more regions of the isolated genomic DNA assayed comprise, consist essentially of, or consist of a 40 base pair variable number tandem repeat (VNTR) polymorphism in the promoter of the OPRM1 gene, the promoter of the COMT gene, and the 3' untranslated region of the SLC6A3 gene.
[0046] In some embodiments, the one or more regions of the OPRM1 gene include 130 nucleotides upstream and 600 nucleotides downstream of the OPRM1 transcription start site (TSS), and optionally include the following subsequence: TIFF2024521754000002.tif90170
[0047] With reference to the above sequences, the underlined nucleotides correspond to exemplary CpG sites in the OPRM1 promoter identified and numbered in Figures 4A and 4B. The initiator codon ATG is shown in bold italics. In some embodiments, the CpG codons in SEQ ID NOs: 2-10 are 1~10 The methylation status of one or more of the following is determined:
[0048] In some embodiments, one or more regions of the SLC6A3 gene comprise one or more of the following subsequences: TIFF2024521754000003.tif90170
[0049] Referring to the sequence above, the underlined nucleotides correspond to exemplary CpG sites in the SLC6A3 promoter identified and numbered in Figures 5A-5C. The transcription start site GAG is shown in bold italics.
[0050] In some embodiments, the SLC6A3 VNTR comprises one or more of the following subsequences: TIFF2024521754000004.tif44170
[0051] With reference to the above sequences, the underlined nucleotides correspond to exemplary CpG sites of the SLC6A3 VNTR identified and numbered in Figures 5B and 5C. The transcription start site GAG is shown in bold italics. In some embodiments, the CpGs of SEQ ID NOs: 12-20 and 22-25 are 1~11 The methylation status of one or more of the following is determined:
[0052] In some embodiments, one or more regions of the COMT gene comprise one or more of the following subsequences: TIFF2024521754000005.tif109170
[0053] With reference to the above sequences, the underlined nucleotides correspond to exemplary CpG sites in the COMT P2 and P1 promoters identified and numbered in Figures 6A-6C. In some embodiments, the CpG sites in SEQ ID NOs: 12-20 and 22-25 1~12 The methylation status of one or more of the following is determined:
[0054] In some embodiments, the methylation status of at least one, and optionally all four, of 40 base pair variable number tandem repeat (VNTR) polymorphisms in the promoter of the OPRM1 gene, the promoter of the COMT gene, the promoter of SCLC6A3, and the 3' untranslated region of the SLC6A3 gene is determined.
[0055] Genomic DNA can be isolated from any biological sample that is isolated from a subject and contains nucleated cells.Exemplary biological samples include easily obtainable cells, including but not limited to blood cells.In some embodiments, genomic DNA is isolated from blood cells, optionally from cells selected from the group consisting of peripheral blood mononuclear cells and buccal cells, and / or from biological samples that contain cells, optionally from blood, saliva, cerebrospinal fluid and / or any fraction or component thereof.
[0056] As disclosed herein, the disclosed methods for predicting naltrexone response include, consist essentially of, or consist of performing or conducting one or more methylation assays on a genomic DNA sample isolated from a subject to determine the methylation status of one or more regions of the isolated genomic DNA. Methods for determining the methylation status of genomic DNA samples are known and include, but are not limited to, sequencing, methylation-specific PCR (MS-PCR), melting curve methylation-specific PCR (McMS-PCR), MLPA with or without bisulfite treatment, QAMA (Zeschnigk et al., 2004), MSRE-PCR (Melnikov et al., 2005), MethyLight (Eads et al., 2000), ConLight-MSP (Rand et al., 2002), bisulfite conversion specific methylation-specific PCR (BS-MSP; Sasaki et al., 2003), COBRA (which relies on the use of restriction enzymes to reveal methylation-dependent sequence differences in PCR products of sodium bisulfite-treated DNA), methylation-sensitive single-nucleotide primer extension conformational analysis (MS-SNuPE), methylation-sensitive single-strand conformational analysis (MS-SSCA), melting curve combined bisulfite restriction analysis (McCOBRA; Akey et al., 2006). et al., 2002, PyroMethA, HeavyMethyl (Cottrell et al., 2004), MALDI-TOF, MassARRAY, quantitative analysis of methylated alleles (QAMA), enzymatic domain methyl assay (ERMA), QBSUPT, MethylQuant, quantitative PCR sequencing and oligonucleotide-based microarray systems, pyrosequencing, Meth-DOP-PCR, etc. Reviews of some useful techniques for DNA methylation analysis are provided in Rein et al., 1998; Laird, 2003; and Auerkari, 2006, each of which is incorporated herein in its entirety. See also U.S. Patent No. 7,425,415.
[0057] Techniques for assessing methylation status are based on distinct approaches. Some include the use of endonucleases. Such endonucleases can either preferentially cleave methylated versus unmethylated recognition sites, or preferentially cleave unmethylated versus methylated recognition sites. Some examples of the former are Acc III, Ban I, BstN I, Msp I, and Xma I. Examples of the latter are Acc II, Ava I, BssH II, BstU I, Hpa II, and Not I. Differences in cleavage patterns represent the presence or absence of methylated CpG dinucleotides. The cleavage patterns can be detected immediately or after further reactions that generate easily distinguishable products. Means of detecting altered size and / or charge (including but not limited to electrophoresis, chromatography, and mass spectrometry) can be used to detect the modified products.
[0058] Alternatively, the identification of methylated CpG dinucleotides may utilize the ability of the methyl-binding domain (MBD) of the MeCP2 protein to selectively bind to methylated DNA sequences (Cross et al., 1994; Shiraishi et al., 1999). MBDs can also be derived from MBP, MBP2, MBP4, poly-MBD (Jorgensen et al., 2006), or from reagents, such as antibodies, that bind to methylated nucleic acids. MBDs can be immobilized on solid matrices and used in preparative column chromatography to isolate highly methylated DNA sequences. Variant forms, such as an expressed His-tagged methyl-CpG binding domain, can be used to selectively bind to methylated DNA sequences. Finally, restriction endonuclease-digested genomic DNA is contacted with an expressed His-tagged methyl-CpG binding domain. Other methods are well known in the art, including, inter alia, the methylated CpG island recovery assay (MIRA). Another method, MB-PCR, uses recombinant bivalent methyl-CpG binding polypeptides immobilized on the wall of the PCR vessel to capture methylated DNA, followed by detection of bound methylated DNA by PCR.
[0059] Another method for detecting methylated CpG dinucleotide motifs uses chemical reagents that selectively modify either the methylated or unmethylated form of CpG dinucleotide motifs.Suitable chemical reagents include hydrazine and bisulfite ion.The method of the present invention preferably uses bisulfite ion. Bisulfite conversion relies on treating DNA samples with sodium bisulfite, which converts unmethylated cytosines to uracil while maintaining methylated cytosines (Furuichi et al., (1970). This conversion ultimately results in a change in the sequence of the original DNA. The resulting uracil is generally known to have a base pairing behavior of thymidine that is different from the cytosine base pairing behavior. This allows for the discrimination between methylated and unmethylated cytosines. Useful conventional techniques of molecular biology and nucleic acid chemistry for assessing sequence differences are well known in the art and described in the literature. See, for example, Sambrook et al., 2001; Gait, 1984; Hames & Higgins, 1985; and the series, Methods in Enzymology, Academic Press, Inc.
[0060] Several techniques use primers to assess the methylation status at CpG dinucleotides. Two approaches to primer design are possible. First, the primers can be designed so that they do not encompass any potential DNA methylation sites themselves. The sequence difference at the site of differential methylation is located between the two primers, and visualization of the sequence difference requires an additional assay step. Such primers are used in bisulfite genomic sequencing, COBRA, Ms-SnuPE and several other techniques. Second, the primers can be designed to specifically hybridize with either the methylated or unmethylated version of the original processed sequence. After hybridization, an amplification reaction can be performed and the amplification product can be assayed using any detection system known in the art. The presence of an amplification product indicates that the sample has hybridized to the primer. The specificity of the primer indicates whether the DNA is modified, which in turn indicates whether the DNA is methylated. If there is a sufficient complementary region to the target, for example 12, 15, 18 or 20 nucleotides, the primer may also contain additional nucleotide residues that do not interfere with hybridization but may be useful for other operations. Examples of such other residues may be sites for restriction endonuclease cleavage, for ligand binding, or for factor binding, or for linkers or repeats. The oligonucleotide primer may or may not be specific for modified methylated residues.
[0061] A further method of distinguishing between modified and unmodified nucleic acids is to use oligonucleotide probes. Such probes can directly hybridize to modified nucleic acids or to further products of modified nucleic acids, such as products obtained by amplification. Probe-based assays utilize the hybridization of oligonucleotides to specific sequences and subsequent detection of hybrids. Before the amplification products are detected, there may be further purification steps, such as precipitation steps. Oligonucleotide probes can be labeled using any detection system known in the art. These include, but are not limited to, fluorescent moieties, radiolabeled moieties, bioluminescent moieties, luminescent moieties, chemiluminescent moieties, enzymes, substrates, receptors or ligands.
[0062] In some embodiments, the methylation status of at least a subsequence of a locus selected from OPMR1, DAT1 / SLC6A3 and COMT (or a portion thereof, in some embodiments, a CpG island) is determined using methylation-specific PCR (MSP) or an equivalent amplification technique. In the MSP approach, DNA can be amplified using primer pairs designed to distinguish between methylated and unmethylated DNA by exploiting sequence differences resulting from sodium bisulfite treatment (Herman et al., 1996; WO 97 / 46705). For example, bisulfite ions modify unmethylated cytosine bases, changing them to uracil bases. Uracil bases hybridize to adenine bases under hybridization conditions. Thus, oligonucleotide primers containing adenine bases instead of guanine bases hybridize to bisulfite-modified DNA, and oligonucleotide primers containing guanine bases hybridize to unmodified (methylated) cytosine residues in DNA. Amplification with a DNA polymerase and a second primer results in a readily observable amplification product that, in turn, indicates whether the DNA is methylated or not. PCR is the preferred amplification method, although variants on this basic technique, such as nested PCR and multiplex PCR, are also included within the scope of the present invention.
[0063] Bisulfite sequencing provides another alternative for determining the methylation status of at least one gene selected from OPMR1, SLC6A3, and COMT. Primers can be designed for use in sequencing through the critical CpG islands of the relevant genes. Thus, primers can be designed in both sense and antisense orientations to direct sequencing across the region of interest of the selected gene.
[0064] As mentioned above, exemplary techniques for evaluating the methylation status of relevant genes require amplification to obtain amplification products. The presence of amplification products can be directly evaluated using methods well known in the art. They can be easily visualized on a suitable gel, such as an agarose or polyacrylamide gel. Detection can include binding of specific dyes, such as ethidium bromide, that intercalate into double-stranded DNA, and visualization of DNA bands, for example, under a UV illuminator. Another means for detecting amplification products includes hybridization with oligonucleotide probes. Alternatively, fluorescence or energy transfer can be measured to determine the presence of methylated DNA.
[0065] A specific example of MSP technology is called real-time quantitative MSP (QMSP), which allows reliable quantification of methylated DNA in real time or at an end point. Real-time methods are generally based on continuous optical monitoring of the amplification procedure, utilizing fluorescently labeled reagents whose incorporation into the product can be quantified, the quantification indicating the number of copies of that sequence in the template. One such reagent is a fluorescent dye called SYBR Green I, which preferentially binds to double-stranded DNA and whose fluorescence is greatly enhanced by the binding of double-stranded DNA. Alternatively, labeled primers and / or labeled probes can be used for quantification. They refer to the specific use of well-known commercially available real-time amplification technologies, such as TAQMAN®, MOLECULAR BEACONS®, AMPLIFLUOR® and SCORPION® DZYNA®, PLEXOR™, etc.
[0066] In some embodiments, the Infinium Methylation EPIC BeadChip (available from Illumina, San Diego, California) is used to determine the methylation status of one or more of the OPMR1, SLC6A3 and COMT genes, or portions thereof, in some embodiments, CpG islands.
[0067] III. METHODS FOR PREDICTING NALTREXONE RESPONSE AND METHODS FOR TREATING SUBJECTS WITH AUD In some embodiments, the subject of the present disclosure also relates to a method of treating a subject with alcohol use disorder. In some embodiments, the method comprises, consists essentially of, or consists of performing or performing one or more methylation assays on a genomic DNA sample isolated from a subject to determine the methylation status of one or more regions of the isolated genomic DNA, wherein the one or more regions of the isolated genomic DNA are subsequences of genes selected from the group consisting of the mu opioid receptor (OPRM1) gene, the catechol-O-methyltransferase (COMT) gene, and the dopamine transporter (SLC6A3) gene, and further, the determined methylation status of the one or more regions of the isolated genomic DNA predicts naltrexone response in the subject, and then determines the appropriate treatment to be followed. In some embodiments, if the methylation status of the one or more regions of the isolated genomic DNA predicts the subject to respond favorably to naltrexone, the subject is treated with an effective amount of naltrexone. If the methylation status of the one or more regions of the isolated genomic DNA does not predict the subject to respond favorably to naltrexone, an alternative treatment is selected. In some embodiments, such subjects are treated with an effective amount of an active agent other than naltrexone (referred to herein as a "non-naltrexone agent"). A variety of non-naltrexone agents can be used, including but not limited to acamprosate, topiramate, fluoxetine, ondansetron, or any combination thereof.
[0068] For naltrexone to be most effective, the following CpG(cg) sites for the mu opiate gene (OPRM1) with values lower than the listed average must be present in combination with one of the DAT (SCL6A3) gene CpG(cg) sites with values lower than the listed average. If the above criteria are met, it is expected that the patient will have a much greater chance of responding to naltrexone compared to situations where the above criteria are not met (p<0.05). That is, after testing and receiving the specific methylation levels / frequencies for these specific CpG sites, the clinician / prescriber could choose to recommend / prescribe naltrexone if the above criteria are met. TIFF2024521754000006.tif61170*cg16180821 and cg15600751 are present in SEQ ID NO: 11, and cg12882697 is present in SEQ ID NO: 21.
[0069] For naltrexone to be most effective, the following CpG (cg) sites with values lower than the listed averages for the mu opiate gene (OPRM1) must be present in combination with one of the COMT gene CpG (cg) sites with values lower than the listed averages. If the above criteria are met, it is expected that the patient will have a much greater chance (p<0.05) of responding to naltrexone compared to situations where the above criteria are not met. That is, after testing and receiving the specific methylation levels / frequencies for these specific CpG sites, the clinician / prescriber could choose to recommend / prescribe naltrexone if the above criteria are met. TIFF2024521754000007.tif66170
[0070] Thus, in some embodiments, the subject matter of the present disclosure also relates to a method of treating a subject with alcohol use disorder (AUD). In some embodiments, the method of the present disclosure includes (a) performing or carrying out one or more methylation assays on a genomic DNA sample isolated from the subject to determine a methylation status of one or more regions of the isolated genomic DNA, wherein the one or more regions of the isolated genomic DNA are subsequences of a gene selected from the group consisting of the mu opioid receptor (OPRM1) gene, the catechol-O-methyltransferase (COMT) gene, and the dopamine transporter (SLC6A3) gene, and further, the determined methylation status of the one or more regions of the isolated genomic DNA is a subsequence of a gene selected from the group consisting of the mu opioid receptor (OPRM1) gene, the catechol-O-methyltransferase (COMT) gene, and the dopamine transporter (SLC6A3) gene, and (b1) treating the subject with an effective amount of naltrexone if the methylation status of one or more regions of the isolated genomic DNA predicts that the subject will respond favorably to naltrexone; or (b2) treating the subject with an effective amount of a non-naltrexone agent, which may be selected from the group consisting of acamprosate, topiramate, fluoxetine, ondansetron, or any combination thereof. In some embodiments, the one or more regions of the isolated genomic DNA that are assayed comprise, consist essentially of, or consist of a 40 base pair variable number tandem repeat (VNTR) polymorphism in the promoter of the OPRM1 gene, the promoter of the COMT gene, the promoter of the CSLC6A3 gene, and the 3' untranslated region of the SLC6A3 gene. In some embodiments, one or more regions of the OPRM1 gene include 130 nucleotides upstream and 600 nucleotides downstream of the OPRM1 transcription start site (TSS), and optionally include one or more of SEQ ID NOs: 2-10. In some embodiments, one or more regions of the SLC6A3 gene include one or more of SEQ ID NOs: 12-20. In some embodiments, one or more regions of the COMT gene include one or more of SEQ ID NOs: 28-38.In some embodiments, the SLC6A3 VNTR comprises one or more of SEQ ID NOs: 22-25. In some embodiments, the methylation status of at least two, and possibly all three, 40 base pair variable number tandem repeat (VNTR) polymorphisms in the promoter of the OPRM1 gene, the promoter of the COMT gene, and the 3' untranslated region of the SLC6A3 gene is determined. In some embodiments, the methylation status of at least one region of the OPRM1 gene and at least one region of the SLC6A3 gene and / or the COMT gene is determined. In some embodiments, at least one region of the OPRM1 gene is selected from the group consisting of nucleotide positions 274, 277, 357, and 419 of SEQ ID NO:1, and further (i) at least one region of SLC6A3 is selected from the group consisting of nucleotide positions 576 and 1102 of SEQ ID NO:11, nucleotide position 1102 of SEQ ID NO:11, and nucleotide position 46 of SEQ ID NO:21, and / or (ii) at least one region of the COMT gene is selected from the group consisting of nucleotides 46 and 107 of SEQ ID NO:27. In some embodiments, a positive response to naltrexone is predicted if the subject has the following combination of methylation values: (a) less than 0.147 for nucleotide position 27 and / or less than 0.488 for nucleotide position 419 of SEQ ID NO:1 in combination with less than 0.651 for nucleotide position 576 of SEQ ID NO:11 and / or less than 0.648 for nucleotide position 1102 of SEQ ID NO:11 and / or less than 0.089 for nucleotide position 46 of SEQ ID NO:21; and / or (b) a combination of less than 0.147 for nucleotide position 27 of SEQ ID NO:1 and / or less than 0.157 for nucleotide position 277 of SEQ ID NO:1 and / or less than 0.126 for nucleotide position 357 of SEQ ID NO:1 and / or less than 0.488 for nucleotide position 419 of SEQ ID NO:1 with less than 0.587 for nucleotide position 46 of SEQ ID NO:27 and / or less than 0.546 for position 107 of SEQ ID NO:27. In some embodiments, the genomic DNA is isolated from cells selected from the group consisting of blood cells, optionally peripheral blood mononuclear cells and buccal cells, and / or from a biological sample containing cells, optionally blood, saliva, cerebrospinal fluid and / or any fraction or component thereof.
[0071] In some embodiments, the methods of the disclosure further comprise, consist essentially of, or consist of bisulfite conversion of the isolated genomic DNA prior to performing or having performed one or more methylation assays. EXAMPLES
[0072] The following examples are provided to provide those skilled in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and / or methods claimed herein are made and evaluated, and are intended to be purely illustrative and are not intended to limit the disclosure. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless otherwise indicated, parts are parts by weight, temperature is in °C or at ambient temperature, and pressure is at or near atmospheric pressure.
[0073] Materials and Methods for the Examples Summary: Detailed methods of the original RCT, including the CONSORT diagram, are described in Anton et al., 2020 and Schacht et al., 2017. The Medical University of South Carolina Institutional Review Board approved all procedures, and all participants provided informed consent prior to participation. The study consisted of an initial assessment session, a baseline visit, and nine follow-up visits throughout the 16-week treatment period. Briefly, participants seeking AUD treatment were recruited from the community using media advertisements, assessed for inclusion / exclusion criteria, and genotyped for rs1799971. One of the aims of the original RCT was to test the effect of rs1799971 genotype on naltrexone efficacy, and therefore overselected participants carrying the minor (G) allele, such that these individuals ultimately constituted approximately 50% of the 146 participants randomized to medication.
[0074] Participants. Participants were required to be 18–70 years of age; to report heavy drinking (at least 5 / 4 standard drinks per day for men / women) on at least 50% of the days in the 90 days prior to assessment; and to meet the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, revised) diagnostic criteria for alcoholism as assessed by the Structured Clinical Interview for DSM-IV (First et al, 2002). Participants were also required to self-identify as Caucasian or Asian, concomitant with low rs1799971 G allele frequency in African ancestry. We have previously reported that analysis of population allele frequencies for 50 SNPs included in the methylation assay used here showed a high degree of concordance between self-reported and SNP-identified ancestry. Participants who reported cocaine or marijuana use in the 90 days prior to assessment were included as long as they did not meet DSM-IV criteria for dependence on either substance, or on any other substance other than nicotine, and had a negative urine drug screen at the time of medication randomization. Exclusion criteria were current use of psychotropic medications other than antidepressants (requiring stable use for at least 1 month); current DSM-IV Axis I diagnosis or suicidal / homicidal ideation; history of significant medical illness; liver enzyme (ALT or AST) levels >3 times normal; and use of naltrexone, disulfiram, or acamprosate in the previous month. Female participants could not be pregnant or breastfeeding. The following table lists the demographic characteristics of the sample. Medication, Randomization, and Assessment Participants were required to maintain abstinence for at least 4 days prior to medication randomization and were then randomized (Stout et al, 1994) to receive naltrexone (25 mg for 2 days, then 50 mg) or placebo for 16 weeks. Randomization was stratified by rs1799971 genotype, and medication groups were balanced by sex, smoking status (nonsmoker vs. smoker, defined as ≥10 cigarettes per day), cocaine use, antidepressant use, and family history of AUD.Study medication was encapsulated in similar excesses with 100 mg riboflavin (for data on adhesion, which was high and did not change between dosing groups, see (Schacht et al., 2017)) and dispensed into labeled blister packs. Participants and investigators were blinded to genotype and dosing assignment. After randomization, participants returned at weeks 1, 2, 3, 4, 6, 8, 10, 12, and 16 for medical control sessions, during which daily drinking since the last visit was assessed with a calendar-based timeline follow-back interview (Sobell and Sobell, 1992). Participants who dropped out after randomization were compensated to return at week 16 to obtain missing drinking data. At similar rates across dosing groups, 40 participants ultimately dropped out, but complete drinking data were available for 89% of participants. Demographic characteristics and baseline alcohol use TIFF2024521754000008.tif87170*p values are χ2 for the difference between the naltrexone and placebo groups. 2 The significance of the t-test and t-test are shown.
[0075] DNA collection and genotyping. Genomic DNA was extracted from peripheral blood mononuclear cells collected at the first assessment session (Gentra Puragene Blood Kit; Qiagen Inc., Valencia, CA), stored at -80 °C, and used to genotype the rs1799971 and rs4680 SNPs and the SLC6A3 VNTR. Details of these assays have been previously described (Anton et al., 2020).
[0076] Methylation assays. Genomic DNA was quantified using a Qubit fluorometer (Thermo Fisher Scientific, Waltham, MA). The Infinium MethylationEPIC BeadChip (Illumina, San Diego, CA) was used to assay methylation at 866,895 cytosine residues, of which 99.7% are CpG sites, to generate a comprehensive genome-wide profile of DNA methylation. For each subject, 500 ng of genomic DNA was bisulfite converted, denatured, amplified, fragmented, resuspended, and hybridized to BeadChips (8 samples per chip). Each group of eight samples contained four samples from naltrexone-treated participants and four samples from placebo-treated participants to balance across medication groups, age, and nicotine use, with age (median split) and nicotine use (defined as ≥10 cigarettes per day) evenly distributed within each group of four samples. Age and nicotine use were chosen because these characteristics are known to affect global DNA methylation (Horvath et al., 2012; Joehanes et al., 2016). During hybridization, the amplified and fragmented DNA was annealed to fluorophore-conjugated probes specific for each CpG site, one for the methylated site and one for the unmethylated site. The processed BeadChips were then scanned with an Illumina iScan System, which used a laser to excite the fluorophores from each probe and record their fluorescence. Summarizing the probe interrogations, an average signal was obtained for the methylated vs. unmethylated ratio of alleles at each CpG site.
[0077] Quality control. Box plots of the quality of staining, hybridization, extension, target removal, and bisulfite conversion of genomic DNA were examined using the RnBeads R package (Assenov et al., 2014). The distribution and median of the negative control box plots were also examined for each sample. Based on these metrics, one participant's data was determined to be of low quality and was removed from the analysis, leaving 145 participants for analysis. Of the initial 866,895 probes, the RnBeads quality control pipeline removed 17,371 probes from the data because they overlapped with SNPs; 6,105 probes using the Greedycut algorithm, which iteratively removes the most contaminated probes; and 2,899 probes because they were located in certain situations (non-CpG positions), leaving 840,520 CpG sites for analysis. Data were normalized using the method from (Pidsley et al., 2013).
[0078] To further assess data quality and examine convergent validity, participants' age and sex were estimated from the methylation data and methylation differences between smokers (n=57) and non-smokers (n=88) were tested. First, participants' age was predicted using Horvath's DNA Methylation Age Calculator (Horvath, 2013), which estimates age from the methylation of 30,084 CpG sites. These predictions were highly correlated with participants' self-reported age (r=0.882, p<0.001). Second, the Horvath algorithm and RnBeads also predicted sex based on sex chromosome methylation, and both predictions were in accurate agreement with participants' self-reported sex. Finally, we tested genome-wide methylation differences between smokers and non-smokers with RnBeads and compared the 5 most significantly differentially methylated CpG sites between these groups with the 5 CpG sites that most strongly discriminated between smokers and non-smokers in a previous paper (Joehanes et al., 2016). Four of the top 5 sites in our data (Illumina probe IDs, cg05575921, cg21161138, cg21566642, and cg01940273, none of which were associated with OPRM1, SLC6A3, or COMT) were among the top 5 most differentially methylated sites in Joehanes' analysis.
[0079] Regions analyzed. Figures 4-6 show the CpG sites on the BeadChip located in the promoter of each gene. Although 840,520 CpG sites were available for analysis, not all sites in each promoter were represented on the BeadChip. We included all available sites within each promoter. For OPRM1, the promoter was defined as the region within 130 nucleotides upstream and 600 nucleotides downstream of the transcription start site (TSS), consistent with a recent study of the effect of OPRM1 methylation on naltrexone response (Lin et al., 2020). This included 10 CpG sites (Illumina probe IDs cg22370006, cg14262937, cg06649410, cg23143142, cg23706388, cg05215925, cg14348757, cg12838303, cg22719623, cg15085086). For SLC6A3, NCBI AceView listed three possible promoters, one located upstream of the TSS and two located in intronic regions. Seven CpG sites (cg16180821, cg13202751, cg14502484, cg05030481, cg27037018, cg04210284, cg12882697) on the AceView 5' upstream region BeadChip were used as defined in a previous study. COMT has isoforms encoding both soluble and membrane-bound COMT, each with its own promoter (P1 and P2, respectively) (Tenhunen et al., 1994). We included four CpG sites in the P1 promoter (cg06346307, cg22546130, cg23601416, cg01335087) and eight CpG sites in the P2 promoter (cg17810098, cg23268677, cg15834517, cg24899205, cg07019740, cg11032634, cg03205258, cg12175949) on the BeadChip. Finally, exploratory CpG sites in the SLC6A3 VNTR region were also analyzed.The BeadChip contains three CpG sites in this region (cg15600751, cg1632193 and cg10838500), although one (cg10838500) occurs in a type "E" repeat that is only present in the 10R allele (Fuke et al., 2001). Therefore, for this analysis, methylation at sites cg15600751 and cg1632193 was averaged.
[0080] Statistical Analysis. Interactions between methylation levels (averaged across the proportions of methylated alleles at each site in each region) and medication were examined with linear mixed models (SPSS v.25 MIXED), in which methylation and medication (naltrexone vs placebo) were between-subject factors and study time (months 1–4) was a repeated within-subject factor. The dependent variable was the percentage of heavy drinking days (PHDD; i.e., the percentage of study days on which women / men drank ≥4 / 5 times the standard amount of alcohol), as in our previous analyses (Anton et al., 2020; Schacht et al., 2017). A significant methylation by medication interaction indicated that the effects of naltrexone on PHDD across all study months differed as a function of methylation; a significant methylation by medication by time interaction indicated that these effects differed as a function of both methylation and time in the study. For each model, the highest level of significant interaction was interpreted by post hoc testing of the median split methylation level for each gene and the simple effect of medication within each combination of methylation levels (e.g., high vs. low OPRM1, SLC6A3, and COMT methylation). Effect sizes (Cohen's d) were calculated for groups where this simple effect was significant.
[0081] Three primary models were tested: one included OPRM1 promoter methylation, medication, time, and all interactions of these factors, and the second and third added either SLC6A3 promoter methylation or COMT promoter methylation, interacting it with OPRM1 promoter methylation, medication, and time. Alpha for the three primary models was set at a Bonferroni-corrected threshold of p=0.0167 (i.e., 0.05 / 3). Alpha for post-hoc tests was left at p=0.05, as these tests were only performed to interpret higher-level interactions. The fourth exploratory model included SLC6A3 VNTR (non-promoter) methylation, OPRM1 promoter methylation, medication, time, and all interactions. Each model used an unstructured covariance matrix and also included terms for age, and the specific BeadChip on which the sample was loaded, to control for age-related changes in methylation and assay batch effects. To test whether the methylation influence could be explained by previously reported epistatic interactions (Anton et al., 2020), additional statistical models were performed in which germline single nucleotide polymorphisms in OPRM1 rs1799971, SLC6A3 VNTR and COMT rs4680 genotypes (dichotomized as G allele carriers vs. A allele homozygotes, 9R allele carriers vs. 10R allele homozygotes, and met allele carriers vs. val allele homozygotes, respectively), or VNTR polymorphisms, and their interactions with dosing and time, were to evaluate the novel / independent influence of methylation levels on naltrexone response.
[0082] Example 1 SLC6A3 promoter and OPRM1 promoter The highest level of significant interaction was between SLC6A3 promoter methylation, OPRM1 promoter methylation, dose group, and time. When SLC6A3 and OPRM1 methylation were at the median split (Figure 1; medians were SLC6A3 = 0.150, OPRM1 = 0.170), naltrexone significantly reduced PHDD compared to placebo at 2 months (F(1,217.46) = 4.87, mean difference between naltrexone and placebo = 16.2% HDD (95% CI = 1.7 to 30.7%), d = 0.61, p = 0.028) and 3 months (F(1,232.53) = 4.79, mean difference between naltrexone and placebo = 16.5% HDD (95% CI = 1.7 to 31.4%), d = 0.62, p = 0.030) in individuals with lower methylation of both promoters. The simple effect of medication was not significant at any time point in individuals with any other combination of SLC6A3 and OPRM1 methylation, except in individuals with high SLC6A3 and low OPRM1 methylation, among whom this effect was significant at month 3 as a function of the increase in PHDD in the placebo group at that time point (F(1,241.14) = 5.35, mean difference between naltrexone and placebo = 25.7% HDD (95% CI = 3.8 to 47.7%), d = 0.98, p = 0.022). The interactions of SLC6A3 with OPRM1, with medication, and with time remained significant even when rs28363170 (SLC6A3 VNTR variant) genotype, rs1799971 (OPRM1 A118G SNP) genotype, and their interactions with each other and with medication and time were included in the model, suggesting that the methylation by medication interaction is novel / independent of these other effects.
[0083] Example 2 COMT promoter and OPRM1 promoter The highest level of significant interaction was between COMT promoter methylation, OPRM1 promoter methylation, and medication group. Across all study months, naltrexone reduced PHDD more among individuals with lower COMT methylation and lower OPRM1 methylation compared to placebo. When COMT and OPRM1 methylation were at the median split (Figure 2; medians were COMT=0.341, OPRM1=0.170), naltrexone significantly reduced PHDD across all study months compared to placebo only in individuals with lower methylation of both promoters (F(1,154.12)=5.41, mean difference between naltrexone and placebo=19.7% HDD (95% CI=3.0-36.5%), d=0.85, p=0.021). This interaction remained significant even when rs4680 (COMT val158met SNP) genotype, rs1799971 (OPRM1 A118G SNP) genotype and their interactions with each other and with medication and time were included in the statistical model, suggesting that the methylation by medication interaction is novel / independent of these other effects.
[0084] Example 3 SLC6A3 VNTR and OPRM1 promoter The highest level of significant interaction was between SLC6A3 VNTR methylation, OPRM1 promoter methylation, and medication group. Across all study months, naltrexone reduced PHDD more among individuals with lower SLC6A3 VNTR methylation and lower OPRM1 methylation compared to placebo. When SLC6A3 VNTR and OPRM1 promoter methylation were at the median split (Figure 3; medians were SLC6A3=0.618, OPRM1=0.170), naltrexone significantly reduced PHDD across all study months compared to placebo only in individuals with lower methylation of both regions (F(1,146.43)=9.93, mean difference between naltrexone and placebo=28.5% HDD (95% CI=10.6-46.3%), d=1.25, p=0.002). This interaction remained significant even when rs28363170 genotype, rs1799971 genotype, and their interactions with each other, and with medication and time, were included in the model, again suggesting that the methylation by medication interaction was independent of these other effects.
[0085] Discussion of the Examples Taken together, these data suggest that differential methylation of genes underlying opioid signaling and dopamine reuptake and inactivation interact to predict naltrexone treatment efficacy on heavy drinking among AUD outpatients. Specifically, promoter region methylation of SLC6A3 and COMT interacted with OPRM1 promoter methylation to affect naltrexone efficacy, as did SLC6A3 3' UTR VNTR region methylation in exploratory analyses. The effect sizes of naltrexone compared with placebo on heavy drinking in the subpopulations in which it was most effective ranged from medium to large (0.53 to 1.04), larger than the overall small effect of naltrexone on heavy drinking across all AUD individuals (Maisel et al, 2013). These findings suggested novel epigenetic predictors of naltrexone response.
[0086] The finding that OPRM1 methylation did not independently moderate naltrexone response is consistent with a recent secondary analysis of another AUD naltrexone RCT (Lin et al., 2020), as well as a recent meta-analysis that concluded that OPRM1 rs1799971 genotype did not consistently moderate naltrexone effects (Hartwell et al., 2020). This meta-analysis included a primary analysis of the data used in the current study (Schacht et al., 2017), which also did not support this OPRM1-only pharmacogenetic effect. Taken together, these findings suggest that despite the fact that naltrexone directly antagonizes the MOR, the effects of genetic or epigenetic alterations in OPRM1 alone are likely not large enough to consistently affect naltrexone response.
[0087] In contrast, current data suggest that epigenetic changes in genes that may underlie naltrexone's downstream effects on dopamine signaling interact with OPRM1 methylation to predict its effects on alcohol drinking. Alcohol acutely induces striatal dopamine release (Boileau et al, 2003), and naltrexone blocks this phenomenon (Benjamin et al, 1993; Gonzales et al, 1998). DAT and COMT are the primary methods of dopamine inactivation in the striatum (Ciliax et al, 1999) and PFC (Matsumoto et al, 2003), respectively. SLC6A3 VNTR and OPRM1 rs1799971 variants were previously reported to interact in their effects on acute responses to alcohol, such that individuals carrying gain-of-function alleles of each polymorphism exhibited lower hedonic responses (Weerts et al, 2017). Because lower OPRM1, SLC6A3 and COMT promoter methylation is associated with relatively high expression of these genes (Andria et al, 1999; Murphy et al, 2005; Wiers et al, 2018), naltrexone may more effectively reduce heavy drinking in individuals with lower methylation of these regions because this pattern of methylation increases MOR availability following alcohol-induced dopamine release, resulting in more efficient synaptic dopamine clearance. With regard to SLC6A3 3'UTR methylation, CpG methylation outside of gene promoters can also regulate gene expression (Maunakea et al, 2010), and the 3'UTR contains regulator regions that can affect various post-transcriptional modifications that affect gene expression (Barrett et al, 2012). Thus, greater methylation of this region may regulate post-transcriptional functions that affect SLC6A3 expression.Although we previously reported epistatic genetic effects on naltrexone efficacy in this sample, the significance of the methylation effect persisted when these genetic effects were included in the model, suggesting that interactions between OPRM1 methylation and SLC6A3 and COMT methylation independently predicted naltrexone efficacy, even after accounting for variance attributable to epistatic effects.
[0088] Thus, disclosed herein is the discovery that AUD individuals with hypomethylation of the OPRM1 and SLC6A3 or COMT promoters, and the SLC6A3 3'UTR VNTR, are more likely to benefit from naltrexone compared to placebo than individuals with other combinations of methylation in these regions.
[0089] Although there are published studies on how "inherited" genes and their germline mutations may be related to naltrexone response, these genetic differences cannot / do not pick up genetic modifications that may occur due to "environmental exposures" such as heavy alcohol consumption. Thus, the use of epigenetic methylation patterns is a fundamentally different, novel, and biologically meaningful way to understand biological predictors of medication response. Furthermore, although there have been some findings that heavy alcohol consumption may globally alter epigenetic methylation patterns of many genes, there have been few attempts to relate these changes to drug treatment response in alcohol use disorder. It should also be recognized that there are many CpG sites in various genes that may be methylated or not, or highly or hypomethylated due to alcohol exposure, and that discovering which CpG sites are associated with disease and treatment response is not an obvious or trivial matter. This is due in part to the fact that methylation of multiple sites (especially in the regions of gene transcription promoters) is likely required for biological variation. Thus, it is the pattern of these methylation sites that is important. For example, several papers that examined methylation of the OPRM1 gene found that various CpG sites were highly methylated in heavy drinkers compared to non-heavy drinkers (Zhang et al., 2012), and some CpG site methylation levels were associated with "relapse drinking" (Lin et al., 2020), but not specifically with naltrexone response. Thus, the subject matter of this disclosure provides (1) a focus on various combinations of CpG methylation sites; and even more importantly, (2) at the next level, how the methylation sites of several other important genes (DAT (SLC6A3 and COMT) can be added to the methylation pattern of a single gene, e.g., OPRM1 promoter CpG site. It is the directionality of methylation amount / frequency (low or high) at specific CpG sites, as well as the discovery of non-obvious combinations of genes of CpG sites across several genes that predict non-obvious and therefore novel naltrexone responses.This discovery provides clinicians / prescribers with specific new knowledge to select which patients with alcohol use disorder to treat with naltrexone, improving clinical care and reducing patient burden.
[0090] In summary, disclosed herein is the identification of a combination of several from a number of OPRM1 gene CpG methylation sites and several other from a number of COMT and DAT gene CpG methylation sites that are associated with naltrexone response in individuals with alcohol use disorder. Thus, in essence, what is important to the subject matter of this disclosure is not the discovery of these sites, or whether they differ between heavy drinkers (alcohol use disorder) and non-heavy drinkers, but the application of these differences to specific drug therapies, such as to improve treatment outcomes.
[0091] References All references cited in this disclosure, including all references listed below, as well as all patents, patent applications and publications thereof, scientific journal articles, and database entries (e.g., the GENBANK® database entries and all annotations available therein), are incorporated herein by reference in their entirety to the extent they supplement, explain, provide background to, or teach the methodologies, techniques, and / or compositions used herein. Akey et al. (2002) Assaying DNA methylation based on high-throughput melting curve approaches. Genomics 80(4):376-384. Andria&Simon(1999)Localization of promoter elements in the human mu-opioid receptor gene and regulation by DNA methylation.Brain Res Mol Brain Res 70(1):54-65. Anton et al.(2020)Opioid and Dopamine Genes Interact to Predict Naltrexone Response in a Randomized Alcohol Use Disorder Clinical Trial.Alcohol Clin Exp Res 44(10):2084-2096. Anton et al.(2012)Naltrexone modification of drinking effects in a subacute treatment and bar-lab paradigm:influence of OPRM1 and dopamine transporter(SLC6A3)genes.Alcohol Clin Exp Res 36(11):2000-2007. Assenov et al.(2014)Comprehensive analysis of DNA methylation data with RnBeads.Nat Methods 11(11):1138-1140. Auerkari(2006)Methylation of tumor suppressor genes p16(INK4a),p27(Kip1)and E-cadherin in carcinogenesis.Oral Oncology 42:5-13. Barrett et al.(2012)Regulation of eukaryotic gene expression by the untranslated gene regions and other non-coding elements.Cell Mol Life Sci 69(21):3613-3634. Benjamin et al.(1993)Naltrexone reverses ethanol-induced dopamine release in the nucleus accumbens in awake,freely moving rats.Brain Research 621(1):137-140. Boileau et al.(2003)Alcohol promotes dopamine release in the human nucleus accumbens.Synapse(New York,NY)49(4):226-231. Bond et al.(1998)Single-nucleotide polymorphism in the human mu opioid receptor gene alters beta-endorphin binding and activity:possible implications for opiate addiction.Proc Natl Acad Sci U S A 95(16):9608-9613. Chen et al.(2004)Functional analysis of genetic variation in catechol-O-methyltransferase(COMT):effects on mRNA,protein,and enzyme activity in postmortem human brain.Am J Hum Genet 75(5):807-821. Ciliax et al.(1999)Immunocytochemical localization of the dopamine transporter in human brain.The Journal of Comparative Neurology 409(1):38-56. Cottrell et al.(2004)A real-time PCR assay for DNA-methylation using methylation-specific blockers.Nucleic Acids Research 32(1):e10. Cross et al.(1994)Purification of CpG islands using a methylated DNA binding column.Nature Genetics 6:236-244. Doucette-Stamm et al.(1995)Population genetic study of the human dopamine transporter gene(DAT1).Genet Epidemiol 12(3):303-308. Eads et al.(2000)MethyLight:a high-throughput assay to measure DNA methylation.Nucleic Acids Research 28(8):e32. First et al.(2002)Structured Clinical Interview for DSM-IV-TR Axis I Disorders,Research Version,Non-patient Edition.Biometrics Research,New York State Psychiatric Institute:New York. Fuke et al.(2001)The VNTR polymorphism of the human dopamine transporter(DAT1)gene affects gene expression.Pharmacogenom J 1(2):152-156. Furuichi et al.(1970)Chemical modification of tRNA-Tyr-yeast with bisulfite.A new method to modify isopentenyladenosine residue.Biochemical and Biophysical Research Communications 41(5):1185-1191. Gait(ed.)(1984)Oligonucleotide Synthesis,A Practical Approach,IRL Press,Oxford,England,United Kingdom. Gonzales&Weiss(1998)Suppression of ethanol-reinforced behavior by naltrexone is associated with attenuation of the ethanol-induced increase in dialysate dopamine levels in the nucleus accumbens.J Neurosci 18(24):10663-10671. Hames&Higgins(eds.)(1985)Nucleic Acid Hybridization,A Practical Approach,IRL Press,Washington,DC,United States of America. Hartwell et al.(2020)Systematic review and meta-analysis of the moderating effect of rs1799971 in OPRM1,the mu-opioid receptor gene,on response to naltrexone treatment of alcohol use disorder.Addiction 115(8):1426-1437. Heinz et al.(2000)Genotype influences in vivo dopamine transporter availability in human striatum.Neuropsychopharmacology 22(2):133-139. Herman et al.(1996)Methylation-specific PCR:a novel PCR assay for methylation status of CpG islands.Proc Natl Acad Sci U S A 93:9821-9826. Hillemacher et al.(2009)Promoter specific methylation of the dopamine transporter gene is altered in alcohol dependence and associated with craving.J Psychiatr Res 43(4):388-392. Horvath(2013)DNA methylation age of human tissues and cell types.Genome Biol 14(10):R115. Horvath et al.(2012)Aging effects on DNA methylation modules in human brain and blood tissue.Genome Biol 13(10):R97. Illingworth et al.(2008)A novel CpG island set identifies tissue-specific methylation at developmental gene loci.PLoS Biol 6(1):e22. Jasiewicz et al.(2015)DAT1 methylation changes in alcohol-dependent individuals vs.controls.J Psychiatr Res 64:130-133. Joehanes et al.(2016)Epigenetic Signatures of Cigarette Smoking.Circ Cardiovasc Genet 9(5):436-447. Jonas et al.(2014a)Pharmacotherapy for adults with alcohol use disorders in outpatient settings:a systematic review and meta-analysis.JAMA 311(18):1889-1900. Jonas et al.(2014b)Genetic polymorphisms and response to medications for alcohol use disorders:a systematic review and meta-analysis.Pharmacogenomics 15(13):1687-1700. Jones(2012)Functions of DNA methylation:islands,start sites,gene bodies and beyond.Nat Rev Genet 13(7):484-492. Jorgensen et al.(2006)Engineering a high-affinity methyl-CpG-binding protein.Nucleic Acids Research 34:e96. Lachman et al.(1996)Human catechol-O-methyltransferase pharmacogenetics:description of a functional polymorphism and its potential application to neuropsychiatric disorders.Pharmacogenetics 6(3):243-250. Laird(2003)The power and the promise of DNA methylation markers.Nature Reviews 3:253-266. Lin et al.(2020)An analysis of the effect of mu-opioid receptor gene(OPRM1)promoter region DNA methylation on the response of naltrexone treatment of alcohol dependence.Pharmacogenomics J. Maisel et al.(2013)Meta-analysis of naltrexone and acamprosate for treating alcohol use disorders:when are these medications most helpful?Addiction 108(2):275-293. Matsumoto et al.(2003)Catechol O-methyltransferase mRNA expression in human and rat brain:evidence for a role in cortical neuronal function.Neuroscience 116(1):127-137. Maunakea et al.(2010)Conserved role of intragenic DNA methylation in regulating alternative promoters.Nature 466(7303):253-257. Melnikov et al.(2005)MSRE-PCR for analysis of gene-specific DNA methylation.Nucleic Acids Research 33(10):e93. Methods in Enzymology,Academic Press,Inc.,Cambridge,Massachusetts,United States of America. Murphy et al.(2005)Site-specific cytosine methylation in S-COMT promoter in 31 brain regions with implications for studies involving schizophrenia.Am J Med Genet B Neuropsychiatr Genet 133B(1):37-42. Nieratschker et al. (2014) Epigenetic alteration of the dopamine transporter gene in alcohol - dependent patients is associated with age. Addict Biol 19(2):305 - 311. International Publication No. WO 97 / 46705 of PCT International Patent Application. Pidsley et al. (2013) A data - driven approach to preprocessing Illumina 450K methylation array data. BMC Genomics 14:293. Rand et al. (2002) Conversion - specific detection of DNA methylation using real - time polymerase chain reaction (ConLight - MSP) to avoid false positives. Methods 27:114 - 120. Rein et al. (1998) Identifying 5 - methylcytosine and related modifications in DNA genomes. Nucleic Acids Research 26(10):2255 - 2264. Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, United States of America. Sasaki et al.(2003)Bisulfite conversion-specific and methylation-specific PCR:a sensitive technique for accurate evaluation of CpG methylation.Biochemical and Biophysical Research Communications 309:305-309. Schacht et al.(2013)Interacting effects of naltrexone and OPRM1 and DAT1 variation on the neural response to alcohol cues.Neuropsychopharmacology 38(3):414-422. Schacht et al.(2017)Predictors of Naltrexone Response in a Randomized Trial:Reward-Related Brain Activation,OPRM1 Genotype,and Smoking Status.Neuropsychopharmacology 42(13):2640-2653. Shiraishi et al.(1999)Isolation of DNA fragments associated with methylated CpG islands in human adenocarcinomas of the lung using a methylated DNA binding column and denaturing gradient gel electrophoresis.Proceedings of National Academy of Sciences,USA 96:2913-2918. Sobell & Sobell (1992) Timeline follow-back: A technique for assessing self-reported alcohol consumption. In: Allen JP, Litten RZ (eds) Measuring alcohol consumption: Psychosocial and biochemical methods. Humana Press: Totowa, NJ, pp 41-72. Stout et al. (1994) Ensuring balanced distribution of prognostic factors in treatment outcome research. J Stud Alcohol Suppl 12:70-75. Swift-Scanlan et al. (2014) Comprehensive interrogation of CpG island methylation in the gene encoding COMT, a key estrogen and catecholamine regulator. BMC Med Genomics 7:5. Tenhunen et al. (1994) Genomic organization of the human catechol O-methyltransferase gene and its expression from two distinct promoters. Eur J Biochem 223(3):1049-1059. U.S. Patent Application Publication Nos. 2018 / 0369238 and 2018 / 0371542. U.S. Patent No. 7,425,415. Ursini et al. (2011) Stress-related methylation of the catechol-O-methyltransferase Val 158 allele predicts human prefrontal cognition and activity. J Neurosci 31(18):6692-6698. Weerts et al.(2013)Influence of OPRM1 Asn40Asp variant(A118G)on [11C]carfentanil binding potential:preliminary findings in human subjects.Int J Neuropsychopharmacol 16(1):47-53. Weerts et al.(2017)Independent and Interactive Effects of OPRM1 and DAT1 Polymorphisms on Alcohol Consumption and Subjective Responses in Social Drinkers.Alcohol Clin Exp Res 41(6):1093-1104. Wiers et al.(2018)Methylation of the dopamine transporter gene in blood is associated with striatal dopamine transporter availability in ADHD:A preliminary study.Eur J Neurosci 48(3):1884-1895. Wiers et al.(2015)Effects of depressive symptoms and peripheral DAT methylation on neural reactivity to alcohol cues in alcoholism.Translational psychiatry 5:e648. Zeschnigk et al.(2004)A novel real-time PCR assay for quantitative analysis of methylated alleles(QAMA):analysis of the retinoblastoma locus.Nucleic Acids Research 32(16):e125. Zhang et al.(2012)Hypermethylation of OPRM1 promoter region in European Americans with alcohol dependence.J Hum Genet 57(10):670-675.
[0092] It will be understood that various details of the presently disclosed subject matter can be changed without departing from the scope of the presently disclosed subject matter. Further, the foregoing description is by way of example only and not by way of limitation.
Claims
1. A pharmaceutical agent comprising naltrexone for treating an individual having alcohol use disorder (AUD), (a) The following (i) and (ii) are performed, (i) A first methylation assay for determining the methylation status of one or more regions of the mu-opioid receptor (OPRM1) gene, which essentially consists of SEQ ID NO: 1 or SEQ ID NO: 1, in a genomic DNA sample isolated from an individual, (ii) At least one additional methylation assay for determining the methylation status of one or more subsequences of a 40-base pair variable tandem repeat (VNTR) subsequence in the 3' untranslated region of the SLC6A3 gene, corresponding to SEQ ID NO: 27, for a genomic DNA sample isolated from an individual, and (b) The individual has a low methylation status in one or more regions of the OPRM1 gene sequence corresponding to Sequence ID No. 1, The term "low" is defined as a low methylation state where the methylation level is lower than 0.126 with respect to nucleotide position 357 of the OPRM1 gene sequence corresponding to SEQ ID NO: 1, lower than 0.147 with respect to nucleotide position 274 of the OPRM1 gene sequence corresponding to SEQ ID NO: 1, lower than 0.157 with respect to nucleotide position 277 of the OPRM1 gene sequence corresponding to SEQ ID NO: 1, and / or lower than 0.488 with respect to nucleotide position 419 of the OPRM1 gene sequence corresponding to SEQ ID NO: 1, and further: (1) When the methylation status of the partial sequence of the COMT gene corresponding to SEQ ID NO: 27 is low, and low is defined as being lower than 0.587 with respect to nucleotide position 46 of the COMT gene corresponding to SEQ ID NO: 27, and / or being lower than 0.546 with respect to nucleotide position 107 of the COMT gene corresponding to SEQ ID NO: 27, or (2) When the methylation status of the partial sequence of the SLC6A3 gene corresponding to SEQ ID NO: 11 is low, and low is defined as being lower than 0.651 with respect to nucleotide position 576 of the SLC6A3 gene corresponding to SEQ ID NO: 11, and / or being lower than 0.648 with respect to nucleotide position 1102 of the SLC6A3 gene corresponding to SEQ ID NO: 11, or (3) When the methylation status of the 40-base pair VNTR (variable number tandem repeat) subsequence of SLC6A3 in the 3' untranslated region of the SLC6A3 gene sequence corresponding to SEQ ID NO: 21 is low, and low is defined as a methylation status that is lower than 0.089 with respect to nucleotide position 46 of the 40-base pair VNTR of SLC6A3 in the 3' untranslated region of the SLC6A3 gene corresponding to SEQ ID NO:
21. They were treated with an effective dose of naltrexone. In combination with one or more low methylation states of the COMT gene corresponding to SEQ ID NO: 27, the SLC6A3 gene corresponding to SEQ ID NO: 11, and / or the 40-base pair VNTR of SLC6A3 in the 3' untranslated region of the SLC6A3 gene sequence corresponding to SEQ ID NO: 21, individuals with a low methylation state for the OPRM1 gene sequence corresponding to SEQ ID NO: 1 are predicted to respond positively to naltrexone. The aforementioned pharmaceutical.
2. A kit for treating an individual with alcohol use disorder (AUD), Includes means for performing a methylation assay, (a) The following (i) and (ii) are performed, (i) A first methylation assay for determining the methylation status of one or more regions of the mu-opioid receptor (OPRM1) gene, which essentially consists of SEQ ID NO: 1 or SEQ ID NO: 1, in a genomic DNA sample isolated from an individual, (ii) At least one additional methylation assay for determining the methylation status of one or more subsequences of a 40-base pair variable tandem repeat (VNTR) subsequence in the 3' untranslated region of the SLC6A3 gene, corresponding to SEQ ID NO: 27, for a genomic DNA sample isolated from an individual, and (b) The individual has a low methylation status in one or more regions of the OPRM1 gene sequence corresponding to Sequence ID No. 1, The term "low" is defined as a low methylation state where the methylation level is lower than 0.126 with respect to nucleotide position 357 of the OPRM1 gene sequence corresponding to SEQ ID NO: 1, lower than 0.147 with respect to nucleotide position 274 of the OPRM1 gene sequence corresponding to SEQ ID NO: 1, lower than 0.157 with respect to nucleotide position 277 of the OPRM1 gene sequence corresponding to SEQ ID NO: 1, and / or lower than 0.488 with respect to nucleotide position 419 of the OPRM1 gene sequence corresponding to SEQ ID NO: 1, and further: (1) When the methylation status of the partial sequence of the COMT gene corresponding to SEQ ID NO: 27 is low, and low is defined as being lower than 0.587 with respect to nucleotide position 46 of the COMT gene corresponding to SEQ ID NO: 27, and / or being lower than 0.546 with respect to nucleotide position 107 of the COMT gene corresponding to SEQ ID NO: 27, or (2) When the methylation status of the partial sequence of the SLC6A3 gene corresponding to SEQ ID NO: 11 is low, and low is defined as being lower than 0.651 with respect to nucleotide position 576 of the SLC6A3 gene corresponding to SEQ ID NO: 11, and / or being lower than 0.648 with respect to nucleotide position 1102 of the SLC6A3 gene corresponding to SEQ ID NO: 11, or (3) When the methylation status of the 40-base pair VNTR (variable number tandem repeat) subsequence of SLC6A3 in the 3' untranslated region of the SLC6A3 gene sequence corresponding to SEQ ID NO: 21 is low, and low is defined as a methylation status that is lower than 0.089 with respect to nucleotide position 46 of the 40-base pair VNTR of SLC6A3 in the 3' untranslated region of the SLC6A3 gene corresponding to SEQ ID NO:
21. They were treated with an effective dose of naltrexone. In combination with one or more low methylation states of the COMT gene corresponding to SEQ ID NO: 27, the SLC6A3 gene corresponding to SEQ ID NO: 11, and / or the 40-base pair VNTR of SLC6A3 in the 3' untranslated region of the SLC6A3 gene sequence corresponding to SEQ ID NO: 21, individuals with a low methylation state for the OPRM1 gene sequence corresponding to SEQ ID NO: 1 are predicted to respond positively to naltrexone. The aforementioned kit.
3. One or more regions of the OPRM1 gene corresponding to Sequence ID No. 1 include 130 nucleotides upstream of the OPRM1 transcription start site (TSS) and 600 nucleotides downstream, It may include one or more of sequence numbers 2 through 10. The pharmaceutical product according to claim 1 or the kit according to claim 2.
4. The pharmaceutical product or kit according to claim 1, wherein the partial sequence of the SLC6A3 gene corresponding to SEQ ID NO: 11 includes one or more of SEQ ID NOs: 12 to 20.
5. The pharmaceutical product or kit according to claim 1, wherein the partial sequence of the COMT gene corresponding to SEQ ID NO: 27 includes one or more of SEQ ID NOs: 28 to 38.
6. The pharmaceutical product or kit according to claim 1, wherein the partial sequence of SLC6A3 VNTR corresponding to SEQ ID NO: 21 includes one or more of SEQ ID NOs: 22 to 25.
7. The methylation state of at least one nucleotide position of each of the 40 base pairs of VNTR in the 3' untranslated region of the OPRM1 gene corresponding to SEQ ID NO: 1, the COMT gene corresponding to SEQ ID NO: 27, the dopamine transporter (SLC6A3) gene corresponding to SEQ ID NO: 11, and the SLC6A3 gene corresponding to SEQ ID NO: 21 is determined. The pharmaceutical product according to claim 1 or the kit according to claim 2.
8. Genomic DNA is isolated from cells selected from the group consisting of blood cells, optionally peripheral blood mononuclear cells and buccal cells, and / or from a biological sample containing cells, optionally blood, saliva, cerebrospinal fluid and / or any fraction or component thereof. The pharmaceutical product according to claim 1 or the kit according to claim 2.
9. Before performing or completing one or more methylation assays, the isolated genomic DNA is converted with bisulfite. The pharmaceutical product according to claim 1 or the kit according to claim 2.
10. A method for assisting in predicting the naltrexone response in an individual with alcohol use disorder (AUD), The aforementioned method, (i) A first methylation assay for determining the methylation status of one or more regions of the mu-opioid receptor (OPRM1) gene, which essentially consists of SEQ ID NO: 1 or SEQ ID NO: 1, in a genomic DNA sample isolated from an individual, (ii) At least one additional methylation assay for determining the methylation status of one or more subsequences of the catechol-O-methyltransferase (COMT) gene corresponding to SEQ ID NO: 27, the dopamine transporter (SLC6A3) gene corresponding to SEQ ID NO: 11, and / or a subsequence of a 40-base pair variable number tandem repeat (VNTR) in the 3' untranslated region of the SLC6A3 gene corresponding to SEQ ID NO: 21, for genomic DNA samples isolated from an individual. It involves performing or being performed, essentially consisting of or being composed of, In individuals, the methylation status of one or more regions of the OPRM1 gene sequence corresponding to sequence number 1 is low, The term "low" is defined as a low methylation state where the methylation level is lower than 0.126 with respect to nucleotide position 357 of the OPRM1 gene sequence corresponding to SEQ ID NO: 1, lower than 0.147 with respect to nucleotide position 274 of the OPRM1 gene sequence corresponding to SEQ ID NO: 1, lower than 0.157 with respect to nucleotide position 277 of the OPRM1 gene sequence corresponding to SEQ ID NO: 1, and / or lower than 0.488 with respect to nucleotide position 419 of the OPRM1 gene sequence corresponding to SEQ ID NO: 1, and further: (1) When the methylation status of the partial sequence of the COMT gene corresponding to SEQ ID NO: 27 is low, and low is defined as being lower than 0.587 with respect to nucleotide position 46 of the COMT gene corresponding to SEQ ID NO: 27, and / or being lower than 0.546 with respect to nucleotide position 107 of the COMT gene corresponding to SEQ ID NO: 27, or (2) When the methylation status of the partial sequence of the SLC6A3 gene corresponding to SEQ ID NO: 11 is low, and low is defined as being lower than 0.651 with respect to nucleotide position 576 of the SLC6A3 gene corresponding to SEQ ID NO: 11, and / or being lower than 0.648 with respect to nucleotide position 1102 of the SLC6A3 gene corresponding to SEQ ID NO: 11, or (3) When the methylation status of the 40-base pair VNTR (variable number tandem repeat) subsequence of SLC6A3 in the 3' untranslated region of the SLC6A3 gene sequence corresponding to SEQ ID NO: 21 is low, and low is defined as a methylation status that is lower than 0.089 with respect to nucleotide position 46 of the 40-base pair VNTR of SLC6A3 in the 3' untranslated region of the SLC6A3 gene corresponding to SEQ ID NO:
21. It is predicted that it will respond positively to naltrexone. In combination with one or more low methylation states of the COMT gene corresponding to SEQ ID NO: 27, the SLC6A3 gene corresponding to SEQ ID NO: 11, and / or the 40-base pair VNTR of SLC6A3 in the 3' untranslated region of the SLC6A3 gene sequence corresponding to SEQ ID NO: 21, individuals with a low methylation state for the OPRM1 gene sequence corresponding to SEQ ID NO: 1 are predicted to respond positively to naltrexone. The aforementioned method.
11. The one or more regions of the OPRM1 gene corresponding to Sequence ID No. 1 include 130 nucleotides upstream of the OPRM1 transcription start site (TSS) and 600 nucleotides downstream; and may include one or more of Sequence IDs No. 2 to 10. The method according to claim 10.
12. The method according to claim 10, wherein the partial sequence of the SLC6A3 gene corresponding to SEQ ID NO: 11 includes one or more of SEQ ID NOs: 12 to 20.
13. The method according to claim 10, wherein the partial sequence of the COMT gene corresponding to SEQ ID NO: 27 includes one or more of SEQ ID NOs: 28 to 38.
14. The method according to claim 10, wherein the subarray of SLC6A3 VNTR corresponding to sequence number 21 includes one or more of sequence numbers 22 to 25.
15. The methylation state of at least one nucleotide position of each of the 40 base pairs of VNTR in the 3' untranslated region of the OPRM1 gene corresponding to SEQ ID NO: 1, the COMT gene corresponding to SEQ ID NO: 27, the dopamine transporter (SLC6A3) gene corresponding to SEQ ID NO: 11, and the SLC6A3 gene corresponding to SEQ ID NO: 21 is determined. The method according to claim 10.
16. Genomic DNA is isolated from cells selected from the group consisting of blood cells, optionally peripheral blood mononuclear cells and buccal cells, and / or from a biological sample containing cells, optionally blood, saliva, cerebrospinal fluid and / or any fraction or component thereof. The method according to claim 10.
17. Before performing or completing one or more methylation assays, the isolated genomic DNA is converted with bisulfite. The method according to claim 10.