Compositions and methods for enzymatic nucleic acid synthesis

JP2024522217A5Pending Publication Date: 2025-06-16PRIMROSE BIO INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023577185
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-06-14
Filing Date
2022-06-13
Publication Date
2025-06-16

AI Technical Summary

Technical Problem

The current chemical oligonucleotide synthesis (COS) methods are limited by high costs, inefficiency, and the inability to produce long nucleic acid molecules, requiring large facilities and sophisticated equipment, and enzymatic oligonucleotide synthesis (EOS) faces challenges with 3'-blocked nucleotides that are inefficient, sequence-specific, and require complex deblocking steps.

Method used

A novel enzymatic nucleic acid synthesis approach using unblocked nucleoside triphosphates and template-independent DNA polymerases (TINAPs) that add single nucleotides without the need for blocking groups, allowing for controlled nucleotide addition through enzyme dissociation and washing, reducing costs and simplifying the process.

Benefits of technology

This method enables the efficient and cost-effective synthesis of long nucleic acids, potentially reducing synthesis costs by a factor of 10 to 100 times compared to COS, and allows for the production of diverse nucleic acid sequences and structures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

This disclosure describes compositions and methods useful for the template-independent enzymatic synthesis of nucleic acids.
Need to check novelty before this filing date? Find Prior Art

Description

[Background technology]

[0001] Government Licensing Rights This invention was made with Government support under Award Number 1R43HG010995-01A1 and Unique Federal Award Identification Number (FAIN) R43HG010995 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0002] Incorporating sequence tables The contents of the sequence listing submitted electronically in an ASCII text file entitled (PG0020 Sequence Listing Revision 10-28-21_ST25.txt), approximately 173KB in size, was created on October 28, 2021 and submitted electronically via ePCT on June 13, 2022.

[0003] Chemical oligonucleotide synthesis (COS), the current method for producing synthetic DNA and RNA, is nearly 40 years old and is becoming limited due to new discoveries in areas such as functional genomics, synthetic biology, DNA-based data storage, and medical applications that rely on fast and cheap DNA synthesis. The cost of COS has only improved 20-fold over the last quarter century (see, for example, the data displayed in the Bioeconomy Dashboard of the Bioeconomy website) and has not kept up with the growing demand for synthetic DNA. Furthermore, COS is limited to nucleic acid chains with a maximum of or about 200 nucleotides, requiring large, intensive facilities that use advanced equipment and manufacturing processes. The rapidly growing demand for synthetic nucleic acids requires new, fast, and cheap synthetic routes that can deliver long nucleic acid molecules. Due to the abundance of DNA and RNA polymerases in nature, enzymatic nucleic acid synthesis routes have attracted much attention.

[0004] Enzymatic oligonucleotide synthesis (EOS) has been pursued by various commercial groups for several years (Efcavitch 2016, Hiatt 1995, Hiatt 1995a), with recent interesting discoveries and advances (Palluk 2018, Perkel 2019, Hoff 2020, Lee 2020). Such strategies can be aimed at the creation of RNA or DNA oligonucleotides, or RNA-DNA chimeras.

[0005] Most EOS strategies use terminal deoxynucleotidyl transferase (TdT), a template-independent DNA polymerase (TIDP) that can add nucleotides to the 3' end of single-stranded DNA in vitro (Deibel 1980, Fowler 2006, Motea 2010, Jensen 2018, Loc'h 2018, Deshpande 2019, Sarac 2019). Known TdTs polymerize DNA hundreds of nucleotides long (Deibel 1980, Delarue 2002, Fowler 2006, Motea 2010, Jensen 2018, Loc'h 2018, Sarac 2019) either due to high processivity or the high on-off rate of the enzyme (Gouge 2013). Other DNA polymerases, particularly those involved in DNA repair processes, have also been shown to have template-independent DNA polymerase (TIDP) activity in vitro (Clark 1988; Dominguez 2000; Ruiz 2001; Juarez 2006; Moon 2007; Moon 2007a; Hogg 2012; Moon 2014; Kent 2016; Frank 2017; Yang 2018; Chang 2019), but the TIDP activity of non-TdT enzymes has not been widely studied.

[0006] To generate polynucleotides of defined length and sequence, current EOS processes use 3'-blocked nucleotides with removal of the blocking group after each addition cycle (Figure 1A). The 3' blocking group prevents the addition of multiple nucleotides per addition cycle.

[0007] However, 3'-blocked nucleotides have several drawbacks that limit progress in this field. First, most native DNA polymerases incorporate nucleotides with 3' modifications very inefficiently, also exhibiting remarkable base preference and sequence specificity. Second, the chemistry of the 3' blocking group is critical, as it must be stable enough to avoid spontaneous or enzyme-catalyzed removal during the addition step, while at the same time being completely removable in preparation for the next addition step. Striking this balance is difficult, and the field is limited to a small number of blocking group chemistries that have the desired qualities. Third, enzymes must accommodate the 3' blocking group, creating interconnected challenges of nucleotide chemistry and enzyme optimization. Fourth, the deblocking step of this strategy adds a chemical reaction step to what would otherwise be an enzymatic synthesis process, increasing process complexity and potentially involving the use of expensive and toxic chemicals.

[0008] An alternative approach to oligonucleotide synthesis using natural or unblocked nucleoside triphosphates has been described (Schott 1984). Due to the processive addition of multiple nucleotides by template-independent nucleic acid polymerase, this method requires that after each addition cycle, oligonucleotide molecules that have undergone single nucleotide addition are separated from oligonucleotides that have undergone zero, two or more nucleotides. The need for oligonucleotide purification after each addition cycle limits the usefulness of this method.

[0009] To simplify the problem of enzymatic oligonucleotide synthesis and create a differentiated approach for an efficient enzymatic oligonucleotide synthesis process, we developed the strategy shown in Figure 1B, which uses only natural nucleotides. After efficiently adding a nucleotide, the TIDP, which cannot translocate and remains associated with the DNA template, reliably adds only a single nucleotide per synthesis cycle. The enzyme thereby prevents the addition of more than one nucleotide to the 3' end of the oligonucleotide substrate, eliminating the need for modified nucleotides. Before starting a new cycle, the nucleotides are removed and the enzyme is dissociated by washing, heating and / or chaotropic salts. Evolution of a TIDP suitable for this process is greatly streamlined, and DNA synthesis costs are greatly reduced. Cost models of primitive genetics indicate that such an EOS process has a 10- to 100-fold cost advantage over COS at small (fmol) and medium (nmol-μmol) synthesis scales.

[0010] The present disclosure demonstrates the feasibility of this unique DNA synthesis approach using a set of first-generation DNA polymerases capable of incorporating a single nucleotide onto the end of a single-stranded oligonucleotide.

[0011] As synthetic DNA applications are expanding rapidly, the commercial opportunities in this field are enormous. The global oligonucleotide synthesis market size was $4.3 billion in 2018 and is projected to reach over $8 billion by 2025, growing at a compound annual growth rate (CAGR) of 10-12.5% ​​(Global Oligonucleotide Synthesis Market Size 2018). Key applications of synthetic DNA include molecular and synthetic biology R&D, genomics (target enrichment), therapeutics, diagnostics (DNA microarrays, PCR and FISH), CRISPR / Cas9 systems, nanotechnology, as well as emerging technologies such as DNA-based data storage and DNA computing (Global Oligonucleotide Synthesis Market Size 2018, Lee 2018, Jensen 2018, Lee 2019).

[0012] This disclosure describes a novel enzymatic route to oligonucleotide synthesis using nucleoside triphosphates with a free or unblocked 3' hydroxyl group as substrates, hereafter referred to as "unblocked nucleoside triphosphates". Previously described DNA polymerases with TIDP activity typically exhibit processive addition of nucleotides to single-stranded oligonucleotide or polynucleotide ends when reacted in vitro with triphosphates. This disclosure describes DNA polymerases that have the ability to add a single nucleotide to the 3' end of an oligonucleotide when used with unblocked nucleoside triphosphates.

[0013] This disclosure is firmly rooted in known DNA polymerase mechanisms. Briefly, all DNA polymerases are known to undergo six key mechanistic steps: 1) polymerase binding to a DNA substrate, 2) formation of an initial ternary complex with a nucleoside triphosphate, 3) conformational changes resulting in a productive ternary substrate complex, 4) catalysis resulting in a post-chemical reaction product ternary complex, 5) conformational changes resulting in product (PPi) release, and 6) polymerase translocation in preparation for the next series of nucleotide additions or polymerase dissociation from the DNA substrate (Berdis 2009, Beard 2014, Berdis 2014). These various mechanistic steps are mediated by different domains of the polymerase (Kaminsky 2020).

[0014] Polymerase translocation is known to be associated with specific DNA polymerase sequences and domains (Samkurashvili 1996; Rechkoblit 2006; Golosov 2010; Dahl 2014; Ren 2016; Yang 2018; Hoitsma 2020), and polymerases with widely differing rates of dissociation from the substrate have been reported (Andrade 2009; Zahn 2011). Mutations have been identified in both DNA and RNA polymerases that affect translocation rates (Samkurashvili 1996, Dahl 2014, Ren 2016), and polymerase translocation is associated with specific domains and sequence motifs found in DNA and RNA polymerases (Samkurashvili 1996, Rechkoblit 2006, Golosov 2010, Dahl 2014, Hoitsma 2020). It is therefore possible to develop nucleic acid polymerases that add a single unblocked nucleotide and are unable to translocate and therefore cannot add other nucleotides.

[0015] Nucleic acid polymerases are classified into different classes, and polymerases within a class exhibit specific sequences or properties that distinguish them from polymerases within another class. For example, DNA polymerases are classified into families A, B, C, D, X, Y and RT (Bebenek 2002, Ramadan 2004, Jarosz 2007, Guo 2009, Uchiyama 2009, Yamtich 2010, Berdis 2014, Maxwell 2014, Moon 2014, Trakselis 2014, Yang 2014, Vaisman 2017, Yang 2018, Hoitsma 2020, Kazlauskas 2020). Polymerases from different families have different biological functions in the replication, repair and recombination of nucleic acids. Purified polymerases from different families often have different sets of activities in vitro, as exemplified in the references above.

[0016] Nucleic acid polymerases are also known to exhibit strong sequence specificity or preference for certain sequences when polymerizing nucleic acids. Nucleic acid polymerases have also been shown to exhibit base specificity when polymerizing nucleic acids (Fiala 2007, Hoitsma 2020).

[0017] Based on the known qualities of DNA polymerases, there are various potential methods to achieve the addition of a single nucleotide to the 3' end of a single stranded nucleic acid molecule without the risk of processive addition of multiple nucleotides, including, but not limited to, 1) the use of a polymerase with high sequence specificity for the 3' end sequence of the modified nucleic acid molecule (this end sequence specificity may or may not be coupled to base specificity in terms of the polymerase's preference for incorporating a particular type of nucleotide (i.e., A, C, G, T, U or I)); 2) the use of a DNA polymerase that cannot translocate after nucleotide addition (step 6 above) and remains associated with the 3' end of the nucleic acid molecule after nucleotide addition; 3) combinations thereof; and 4) other mechanisms that allow TIDPs to act non-processively on nucleic acid substrates and add only a single unblocked nucleotide in a template-independent manner. Summary of the Invention

[0018] The present disclosure describes a novel approach for enzymatic de novo synthesis of nucleic acids, involving the addition of a single nucleotide to a nucleic acid substrate by a template-independent nucleic acid polymerase (TINAP) without the use of a 3' blocking group on the nucleoside triphosphate monomer. The present disclosure also describes an enzyme capable of adding a single nucleotide to the 3' end of a nucleic acid in a template-independent manner. This surprising discovery contradicts the stepwise manner in which DNA polymerases are known and believed to operate. As a result, such enzymes or modified derivatives thereof find utility in the development of EOS processes that require the controlled addition of nucleotides to the 3' end of a nucleic acid, one nucleotide at a time. The present disclosure describes the use of such enzymes in processes used to synthesize nucleic acids for industrial, medical, diagnostic, agricultural and / or R&D uses. [Brief description of the drawings]

[0019] [Figure 1A] Schematic diagram of enzymatic oligonucleotide synthesis by cycloaddition of 3'-blocked nucleotides to an oligonucleotide (see Jensen 2018). An oligonucleotide coupled to a bead (top left) is combined with a 3'-blocked nucleoside triphosphate (top) and an enzyme that catalyzes the addition of the nucleotide to the bead (top right). After removal of the enzyme and excess nucleoside triphosphate (not shown), the 3' protecting group is cleaved (bottom) leaving a free 3' end that is a substrate for another addition. Once synthesis is complete, the deprotected oligonucleotide can be cleaved from the bead (bottom left). The diagram shows the addition of a C residue to a DNA oligo, but applies equally to any nucleotide added to any RNA or DNA oligonucleotide, or modified forms or chimeras thereof.

[0020] [Figure 1B] FIG. 1 is a schematic diagram of enzymatic oligonucleotide synthesis by cycloaddition of nucleotides to an oligonucleotide, showing how removal of protecting groups can simplify the nucleic acid synthesis cycle.

[0021] [Figure 1C] Schematic diagram of enzymatic oligonucleotide synthesis by cycloaddition of unblocked nucleotides to an oligonucleotide. An oligonucleotide coupled to a bead (top left) is combined with a nucleoside triphosphate (top) with a free 3' end and an enzyme (top right) that catalyzes the addition of a single nucleotide to the bead. After removal of the enzyme (bottom left) and excess nucleoside triphosphate (not shown), the cycle can be repeated. Once synthesis is complete, the oligonucleotide can be cleaved from the bead (bottom left). The diagram shows the addition of a C residue to a DNA oligo, but applies equally to any nucleotide added to any RNA or DNA oligonucleotide, or modified forms or chimeras thereof.

[0022] [Figure 1D] Schematic of enzymatic oligonucleotide synthesis by cycloaddition of unblocked nucleotides to an oligonucleotide, showing one possible mechanism by which a single nucleotide is added per addition cycle. An oligonucleotide coupled to a bead (top left) is combined with a nucleoside triphosphate with a free 3' end (top) and an enzyme (top right) that catalyzes the addition of a single nucleotide to the bead. After nucleotide addition, the enzyme remains attached to the 3' end of the oligonucleotide, preventing further nucleic acid polymerization. After removal of the enzyme (bottom left) and excess nucleoside triphosphate (not shown), the cycle can be repeated. Once synthesis is complete, the oligonucleotide can be cleaved from the bead (bottom left). The diagram shows the addition of a C residue to a DNA oligo, but applies equally to any nucleotide added to any RNA or DNA oligonucleotide, or modified forms or chimeras thereof.

[0023] [Diagram 2]Results of nucleotide addition reactions involving mixing oligonucleotide substrates (SEQ ID NOs: 42-45) with mixed nucleoside triphosphates (equimolar mixture of dATP, dCTP, dGTP and dTTP). A single-stranded DNA ladder with molecular sizes indicated by labels on the left side of the gel image is shown in the "M" lane. The EDS numbers (see Table 1 for details), which are identifiers used for all enzymes listed in this disclosure, of the enzymes tested are shown below the gel image. The enzymes tested demonstrate the addition of sequences of various lengths to the substrate. [Table 1]

[0024] [Diagram 3] Results of controlled addition of single nucleotides to oligonucleotide substrates terminating at different bases. A. Addition of single nucleotides to different oligonucleotide substrates assayed by gel after reaction. A single-stranded DNA ladder with molecular sizes indicated by the labels on the left side of the gel image is shown in the left lane. B. Sequential addition of two nucleotides to an oligonucleotide substrate with purification of the oligonucleotide after the first addition step. A single-stranded DNA ladder with molecular sizes indicated by the labels on the left side of the gel image is shown in the left of lane 1 and in the left of lane 6. The column in the table below labeled "3' Terminal Base" lists the 3' terminal base of the major oligonucleotides present in each lane. [Table 2] [Figure 4]Representative capillary electrophoretic separation chromatograms of oligonucleotides before and after enzymatic nucleotide addition performed on an Oligo Pro II capillary electrophoresis instrument (Agilent Technologies, Santa Clara, CA). All reactions shown in the chromatograms used dTTP and the oligo: PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45). Duplicate analyses of samples with and without oligonucleotide standards were performed for unambiguous assignment of length to the oligonucleotides present in each sample. The oligonucleotide standards used were PG1350 (GCGTCACGCTACCAACCA, SEQ ID NO: 41), PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45), PG5870 (GTCCTCAATCGCACTGGAAACATCAAGGTC, SEQ ID NO: 51) and PG5871 (GTCCTCAATCGCACTGGAAACATCAAGGTCATACGGAACG, SEQ ID NO: 52). A: oligonucleotide PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45) unreacted (i.e. without enzyme). B: oligonucleotide PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45) unreacted (i.e. without enzyme) combined with oligonucleotide standard. C: oligonucleotide PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45) reacted with dTTP and enzyme EDS082. D: oligonucleotide PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45) reacted with dTTP and enzyme EDS082 combined after reaction with oligonucleotide standard. E: oligonucleotide PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45) reacted with dTTP and enzyme EDS054 combined after reaction with oligonucleotide standard. F: oligonucleotide PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45) reacted with dTTP and enzyme EDS054 combined after reaction with oligonucleotide standard. G: oligonucleotide PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45) reacted with dTTP and the enzyme EDS066.H: Oligonucleotide PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45) reacted with dTTP and the enzyme EDS066, combined after reaction with oligonucleotide standards.

[0025] [Diagram 5] Results of nucleotide addition reactions showing the addition of sequences of various lengths to the substrate. A: Oligonucleotide substrates (SEQ ID NOs: 42-45) containing an equimolar mixture of ATP, CTP, GTP and UTP and enzymes EDS015, EDS017, EDS029, EDS048, EDS053, EDS054 or EDS066. A single-stranded DNA ladder containing molecular sizes indicated by labels on the left side of the gel image is shown in the "M" lane. B: Single oligonucleotide substrates (SEQ ID NO: 45) containing an equimolar mixture of ATP, CTP, GTP and UTP and enzymes EDS017, EDS024, EDS029, EDS030, EDS053, EDS054, EDS066 or EDS082. A single-stranded DNA ladder containing molecular sizes indicated by labels on the left side of the gel image is shown in the "M" lane. [Table 3-1] [Table 3-2] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0026] The following abbreviations and definitions are to be used in interpreting the specification and claims.

[0027] As used herein, the terms "comprises," "includes," "including," "including," "including," "having," "containing," or "comprising," or any other variations thereof, are intended to cover non-exclusive inclusions. For example, a composition, mixture, process, method, article, or device that includes a list of elements is not necessarily limited to only those elements and may include other elements not expressly listed or inherent to such composition, mixture, process, method, article, or device. Furthermore, unless expressly stated otherwise, "or" refers to an inclusive "or," not an exclusive "or." For example, a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or absent), A is false (or absent) and B is true (or present), and both A and B are true (or present).

[0028] Addition cycle: As used herein, this phrase refers to one nucleotide addition in a nucleic acid synthesis process that includes two or more such additions. In each addition cycle, the single-stranded nucleic acid being synthesized is combined with a nucleoside triphosphate and a nucleic acid polymerase and incubated under reaction conditions in which the nucleic acid polymerase is active, resulting in the addition of a nucleotide to the single-stranded nucleic acid.

[0029] Base specificity of nucleic acid polymerase: This phrase refers to the preference of nucleic acid polymerase to add nucleotides containing specific bases compared to different bases.For example, DNA polymerase with dTTP preference will add dTMP (deoxythymidine monophosphate) residues to the 3' end of nucleic acid more efficiently than nucleotides containing other bases such as A, C or G.In another example, in a mixed reaction containing equimolar amounts of nucleoside triphosphates dATP, dCTP, dGTP and dTTP, DNA polymerase with dTTP preference will add more dTMP residues to the 3' end of nucleic acid than nucleotides containing the other three bases A, C or G.

[0030] Chimeric Nucleic Acid: As used herein, a chimeric nucleic acid refers to a nucleic acid molecule that contains a mixture of ribonucleotide and deoxyribonucleotide residues. A mixture means that any number of ribonucleotide residues are present in the same nucleic acid strand along with any number of deoxynucleotide residues.

[0031] Complementary nucleotide sequence: As used herein, a complementary nucleotide sequence is a polynucleotide sequence in which all bases can form base pairs with another polynucleotide sequence of opposite 5' to 3' polarity, such that all bases in each polynucleotide strand pair with their counterparts to form base pairs.

[0032] Control element: The term "control element" refers to a nucleotide sequence located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence that influences the transcription, RNA processing, stability, or translation of the associated coding sequence. Regulatory sequences include, but are not limited to, promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, and stem-loop structures.

[0033] Degenerate sequence: In this application, a degenerate sequence is defined as a population of sequences in which a particular sequence position differs between different molecules or clones in the population. The sequence difference can be any number of single nucleotides or multiple nucleotides, examples being 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 nucleotides, or any number in between. The sequence difference in a degenerate sequence can include the presence of 2, 3, or 4 different nucleotides at that position in a population of sequences, molecules, or clones. Examples of degenerate nucleotides at a particular position of a sequence are A or C; A or G; A or T; C or G; C or T; G ​​or T; A, C or G; A, C or T; A, G or T; C, G or T; A, C, G or T.

[0034] DNA: DNA is a nucleic acid that is a polymer of deoxyribonucleotides. DNA exists in single-stranded or double-stranded form. As used herein, DNA comprises nucleotide residues each having a 2' carbon in the form of CH2.

[0035] Enzymatic Oligonucleotide Synthesis (EOS): as used herein, refers to a controlled enzymatic process that synthesizes nucleic acids using the stepwise enzymatic addition of single nucleotides to the ends of a nucleic acid, thus creating new nucleic acids one nucleotide at a time.

[0036] Expression: As used herein, the term "expression" refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the disclosed nucleic acids, and the accumulation of a polypeptide as the product of translation of mRNA.

[0037] Free nucleotides: as used herein refers to monomeric nucleotides, typically in solution.

[0038] Full-length open reading frame: As used herein, full-length open reading frame refers to the open reading frame that encodes a full-length protein that extends from its natural initiation codon to its natural final amino acid-encoding codon as expressed in a cell or organism.If a particular open reading frame sequence gives rise to multiple different full-length proteins that are expressed in a cell or organism, each open reading frame in this sequence encodes one of the multiple different proteins and is considered full-length.Full-length open reading frames can be continuous or interrupted by introns.

[0039] Full-length protein: As used herein, a full-length protein is a polypeptide extending from its first naturally occurring amino acid to its final naturally occurring amino acid as encoded in the genome of a cell or organism and expressed in the cell or organism.

[0040] Gene: The term "gene" refers to a nucleic acid fragment capable of being expressed as a specific protein, optionally including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence. "Native gene" refers to a gene as found in nature in its natural host organism. "Native gene" refers to a gene with its natural control sequences, such as promoter and terminator. "Chimeric gene" refers to any gene that contains regulatory sequences and coding sequences that are not found together in nature. Thus, a chimeric gene may contain regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences that are derived from the same source but arranged in a manner different from that found in nature. Similarly, a "foreign" gene refers to a gene that is not normally found in the host organism but is introduced into the host organism by gene transfer. Foreign genes include native genes inserted into a non-native organism, or chimeric genes. A "transgene" is a gene that has been introduced into a genome by a transformation procedure.

[0041] In frame: The term "in frame" in this application, and particularly in the phrase "in frame fusion polynucleotide", refers to a reading frame of the codons in an upstream or 5' polynucleotide or ORF that is the same reading frame as the reading frame of the codons in a polynucleotide or ORF located downstream or 3' of the upstream polynucleotide or ORF that is fused to the upstream or 5' polynucleotide or ORF. Such an in frame fusion polynucleotide encodes a fusion protein or fusion peptide that is encoded by both the 5' and 3' polynucleotides.

[0042] In vitro transcription reaction: As used herein, an "in vitro transcription reaction" is a reaction designed to produce RNA by transcribing a DNA template in vitro. An in vitro transcription reaction includes one or more DNA template molecules encoding the RNA to be transcribed, one or more fully or partially purified single-subunit RNA polymerases, at least four nucleoside triphosphates as substrates for the single-subunit RNA polymerase required for the reaction, a buffer, divalent cations and salts.

[0043] Iterative / iterative: In this application, iterative means repeatedly applying a method or procedure to a material or sample. Typically, the treated, altered or modified material or sample produced from each round of treatment, alteration or modification is used as starting material for the next round of treatment, alteration or modification. Iterative selection refers to a selection process in which the selection is repeated or repeated two or more times, using the survivors of one selection as starting material for the subsequent round.

[0044] Library: A library of genes or polynucleotide sequences is a collection of sequences that are different from each other and are cloned into a vector for propagation of the sequences. In different libraries, the sequences differ by sequence content, origin, organism of origin, length, structure, association with other sequences, and / or any other property of the polynucleotide sequence. For example, a library of amino acid repeat fusion genes is generated by cloning a starting ORF collection containing multiple different ORFs encoded by the E. coli genome into a bacterial cloning and expression vector that contains a promoter, a sequence encoding an amino acid repeat oriented so that the sequence is directly and in frame linked to the ORF, a terminator, a plasmid backbone, and an antibiotic resistance gene. The starting ORF collection can include any number of ORFs, from 5 or more, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000 or more, or any number in between. In certain embodiments of the present disclosure, the ORF collection used to generate the library lists a sufficient number of ORFs to provide a high probability of encoding a particular desirable property of E. coli, e.g., more than 50% of the ORFs encoded by the E. coli genome, or a total of 4148 ORFs. The genome annotation of the E. coli strain MG1655 prepared by the University of Wisconsin (Madison) contains more than 2074 ORFs.

[0045] Linker sequence: This term refers to a polynucleotide or polypeptide sequence that separates two polynucleotides or polypeptides in a fusion polynucleotide or fusion polypeptide. For example, a fusion polynucleotide contains two or more ORFs separated by a linker sequence that codes for a peptide that separates the two parts of the polypeptide resulting from the expression and translation of the fusion polynucleotide. The linker can also separate an epitope tag from a protein or enzyme. The linker sequence can have a variety of lengths and / or sequence compositions.

[0046] Non-homologous: In this application, the term "non-homologous" is defined as having less than 50% sequence identity at the nucleotide level.

[0047] Nucleic Acid: The term nucleic acid refers to a biopolymer consisting of nucleotides linked together via phosphodiester, phosphorothioate or other bonds. "Nucleic acid" or "nucleic acid molecule" can be used interchangeably with polynucleotide. As used herein, the term nucleic acid refers to a single strand of nucleic acid. A nucleic acid can be composed of deoxyribonucleotide residues if it is DNA, ribonucleotide residues if it is RNA, or can contain both deoxyribonucleotide and ribonucleotide residues if it is a chimeric nucleic acid.

[0048] Nucleic acid substrate or substrate nucleic acid molecule: This is a nucleic acid molecule present in an enzymatic nucleotide addition reaction or enzymatic nucleic acid synthesis reaction that is catalyzed by a nucleic acid polymerase and serves as a nucleotide acceptor in the reaction using a nucleoside triphosphate as a nucleotide source. For example, a single-stranded DNA oligonucleotide that reacts in the presence of an enzyme and one or more deoxynucleoside triphosphates is a substrate nucleic acid molecule in this reaction.

[0049] Nucleic acid polymerase: It is an enzyme that catalyzes the polymerization of nucleic acids using nucleoside triphosphates and unblocked nucleic acids as substrates, successively adding single nucleotides to the 3' end of the unblocked nucleic acid. Nucleic acid polymerases described in the scientific literature are typically classified into the classes of DNA polymerases and RNA polymerases, with DNA polymerases capable of polymerizing DNA and RNA polymerases capable of polymerizing RNA. However, certain enzymes may have the dual ability to catalyze the synthesis of both DNA and RNA. For example, DNA polymerases may have the ability to add ribonucleotides to the 3' end of DNA or RNA molecules, and RNA polymerases may have the ability to add deoxyribonucleotides to the 3' end of DNA or RNA molecules.

[0050] Nucleic acid synthesis: This is the process by which nucleic acids are produced by nature or by humans, minimally requiring a nucleic acid polymerase, one or more nucleoside triphosphates as monomer building blocks, and a nucleic acid substrate.

[0051] De novo nucleic acid synthesis: This is used to refer to the synthesis of artificial DNA and involves the controlled addition of specific nucleotides to a nucleic acid substrate to create a specific sequence and structure of the nucleic acid.

[0052] Nucleotides: These are the monomeric building blocks of nucleic acids that consist of three components: a five-carbon sugar, a phosphate group, and a nitrogenous base. The two major classes of nucleotides are deoxyribonucleotides, which are the building blocks of DNA, and ribonucleotides, which are the building blocks of RNA. If the sugar is ribose, the nucleic acid is RNA, and if the sugar is the ribose derivative deoxyribose, the nucleic acid is DNA. As used herein, deoxyribonucleotides have the group CH2 as the 2' carbon in the ribose sugar. All other structures of the 2' carbon are classified under the term ribonucleotide. As used herein, nucleotides can refer to the nucleotide residues present within nucleic acids, nucleoside monophosphates, nucleoside diphosphates, nucleoside triphosphates, or any derivatives or modifications thereof.

[0053] Nucleoside triphosphate: In this application, "nucleoside triphosphate" is defined as any of the ribonucleoside triphosphates used in RNA synthesis, such as ATP, CTP, GTP, ITP, UTP, and XTP, or any of the deoxyribonucleoside triphosphates used in DNA synthesis, such as dATP, dCTP, dGTP, dITP, dTTP, and dXTP, or any modified analogs, derivatives, or variants thereof, including derivatives containing phosphorothioate bonds. The mixture of the four canonical nucleoside triphosphates used in DNA synthesis (dATP, dCTP, dGTP, and dTTP) is represented by the abbreviation "dNTP", and the mixture of the four canonical nucleoside triphosphates used in RNA synthesis (ATP, CTP, GTP, and UTP) is represented by the abbreviation "NTP".

[0054] Oligonucleotide: The term oligonucleotide refers to a single-stranded nucleic acid consisting of two or more nucleotides.

[0055] Open Reading Frame (ORF): An ORF is defined as any sequence of nucleotides in a nucleic acid that encodes a protein or peptide as a string of codons in a particular reading frame. Within this particular reading frame, an ORF can contain any codon that specifies an amino acid, but does not include a stop codon. ORFs in a starting collection do not have to start or end with a particular amino acid. ORFs can be continuous or interrupted by one or more introns.

[0056] Operably linked: The term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment such that the function of one is affected by the other. For example, a promoter is operably linked to a coding sequence if it is capable of effecting expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation.

[0057] Peptide bond: A "peptide bond" is a covalent bond between a first amino acid and a second amino acid in which the alpha-amino group of the first amino acid is joined to the alpha-carboxyl group of the second amino acid.

[0058] Percentage of sequence identity: The term "percent sequence identity" refers to the degree of identity between any given query sequence, e.g., SEQ ID NO: 10, and a subject sequence. The subject sequence typically has a length of about 80% to 200% of the length of the query sequence, e.g., 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 93, 95, 97, 99, 100, 105, 110, 115, 120, 130, 140, 150, 160, 170, 180, 190 or 200% of the length of the query sequence. The percent identity of any subject nucleic acid or polypeptide to a query nucleic acid or polypeptide is determined as follows: A query sequence (e.g., a nucleic acid or amino acid sequence) is aligned to one or more subject nucleic acid or amino acid sequences using the computer program ClustalW (version 1.83, default parameters), which allows alignment of nucleic acid or protein sequences to be performed over their entire length (global alignment, Chenna 2003).

[0059] To determine the percent identity of a subject or nucleic acid or amino acid sequence to a query sequence, align the sequences using ClustalW, divide the number of identical matches in the alignment by the query length, and multiply the result by 100. Note that the percent identity value can be rounded to the nearest tenth. For example, 78.11, 78.12, 78.13, and 78.14 are rounded down to 78.1, and 78.15, 78.16, 78.17, 78.18, and 78.19 are rounded up to 78.2.

[0060] ClustalW calculates the best match between a query and one or more target sequences and aligns them so that identity, similarity and difference can be determined. To maximize sequence alignment, gaps of one or more residues can be inserted into the query sequence, the target sequence, or both. For fast pairwise alignment of nucleic acid sequences, the following default parameters are used: word size: 2; window size: 4; scoring method: percentage; number of top diagonals: 4; gap penalty: 5. For multiple alignment of nucleic acid sequences, the following parameters are used: gap opening penalty: 10.0; gap extension penalty: 5.0; and weight transition: Yes. For fast pairwise alignment of protein sequences, the following default parameters are used: word size: 1; window size: 5; scoring method: percentage; number of top diagonals: 5; gap penalty: 3. For multiple alignment of protein sequences, the following parameters are used: weight matrix: BLOSSOM; gap opening penalty: 10.0; gap extension penalty: 0.05; hydrophilic gaps: ON; hydrophilic residues: Gly, Pro, Ser, Asn, Asp, Gln, Glu, Arg and Lys; residue-specific gap penalties: ON. The ClustalW output is a sequence alignment that reflects the relationships between sequences. ClustalW can be run, for example, at the Baylor College of Medicine Search Launcher website and the European Bioinformatics Institute website on the World Wide Web.

[0061] Plasmids and Vectors: The terms "plasmid" and "vector" refer to genetic elements used to carry genes that are not a natural part of a cell or organism. Plasmids typically replicate extrachromosomally as autonomous episomal genetic elements, while vectors can be integrated into a genome or maintained extrachromosomally as linear or circular DNA fragments. Plasmids and vectors can be linear or circular and can consist of single-stranded and / or double-stranded DNA or RNA from any source. Plasmids and vectors often contain multiple nucleotide sequences from different sources combined or recombined into a unique structure useful for introducing polynucleotide sequences into a cell or organism and expressing genes within the organism. Sequences present on a plasmid or vector include, but are not limited to, autonomously replicating sequences; centromere sequences; genome integration sequences; origins of replication; control sequences such as promoters and / or terminators; open reading frames; selectable marker genes such as antibiotic resistance genes; visible marker genes such as genes encoding fluorescent proteins; restriction endonuclease recognition sites; recombination sites; and / or sequences with no apparent or known function.

[0062] Polypeptide or Protein: The term "polypeptide" or "protein" refers to a polymer made up of multiple amino acid monomers joined by peptide bonds. A polymer may contain 10 or more monomers, including 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or any number in between.

[0063] Promoter: The term "promoter" refers to a DNA sequence that can control the expression of a coding sequence or functional RNA. Generally, the coding sequence is located 3' to the promoter sequence. A promoter can be derived entirely from a natural gene and / or be composed of various elements derived from various promoters found in nature, or can include synthetic DNA segments. It is understood by those skilled in the art that various promoters direct the expression of a gene in various tissues or cell types, or at various developmental stages, or in response to various environmental or physiological conditions. A promoter that causes a gene to be expressed in most cell types in many cases is generally referred to as a "constitutive promoter". It is further recognized that in most cases, the exact boundaries of a regulatory sequence are not fully defined, so that DNA fragments of different lengths can have identical promoter activity.

[0064] Random / Randomized: As used herein, means made or selected without method or conscious decision.

[0065] RNA: RNA is a nucleic acid that is a polymer of ribonucleotides. RNA exists in single-stranded or double-stranded form. As used herein, RNA includes nucleotide residues each having a 2' carbon in a form other than CH2.

[0066] Sequence: As known to those skilled in the art, "sequence", when used in a biological context, can refer to a sequence of nucleotides in a nucleic acid or a sequence of amino acids in a protein. As used herein, the term "sequence" has a meaning that depends on the context in which it is used. When used in a context suggesting a nucleic acid, such as a genomic sequence, a gene sequence, or an ORF, a sequence refers to a nucleotide sequence. In a context suggesting a protein or polypeptide, such as a proteome, a protein, or an enzyme, a sequence refers to an amino acid sequence.

[0067] Sequence-specific nucleotide addition: as used herein, this is a characteristic of nucleic acid polymerases that exhibit sequence specificity in their activity. For example, template-independent DNA polymerases may have sequence specificity that allows them to only add nucleotides to the 3' end of nucleic acid that terminates with a dT residue, but not to the 3' end that terminates with other nucleotides. Such sequence specificity of nucleic acid polymerases may be partial or complete. If partial, the DNA polymerase in the above example adds nucleotides more efficiently to nucleic acid that terminates with a 3'dT residue, but also modifies nucleic acid that terminates with a 3'dA, dC or dG residue, but less efficiently. If complete, the DNA polymerase in the above example adds nucleotides only to nucleic acid that terminates with a 3'dT residue, but cannot modify nucleic acid that terminates with a 3'dA, dC or dG residue.

[0068] Non-templated nucleic acid polymerase: A "non-templated nucleic acid polymerase" is an enzyme that catalyzes the incorporation of a nucleotide at the 3'-hydroxyl end of a nucleic acid, with the release of inorganic phosphate, in the absence of another nucleic acid strand that base pairs with the growing strand and serves as a template for the growing strand. Specifically, non-templated DNA polymerases catalyze the polymerization of DNA strands without the use of a template, and non-templated RNA polymerases catalyze the polymerization of RNA strands without the use of a template.

[0069] Template-independent nucleic acid synthesis: This is the process by which a nucleic acid polymerase catalyzes the polymerization of nucleic acids without the use of a template strand that base-pairs with the nucleic acid being synthesized and serves as a template for the strand being synthesized.

[0070] Transformation: The term "transformation" refers to genetic modification by the introduction of a polynucleotide sequence.

[0071] Transformation: As used herein, the term "transformation" refers to the transfer of a nucleic acid fragment into a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic" or "recombinant" or "transformed" organisms.

[0072] Transformed organism: A transformed organism is an organism that has been genetically altered by the introduction of a polynucleotide sequence into the genome of the organism.

[0073] Translocating: "Translocating" a nucleic acid polymerase refers to the movement of the enzyme along the nucleic acid template in the direction of nucleic acid polymerization (5' to 3') after addition of a nucleotide to the nucleic acid substrate. A nucleic acid polymerase translocates along a template or nucleic acid substrate after addition of a nucleotide to the substrate.

[0074] Unfavorable conditions: As used herein, this phrase refers to any portion of physical or chemical growth conditions that result in slower growth than under normal growth conditions or that reduce the viability of cells compared to normal growth conditions.

[0075] Unblocked nucleic acid: This term refers to a nucleic acid that has a free 3' hydroxyl group.

[0076] Unblocked nucleotide or unblocked nucleoside triphosphate or unblocked dNTP or unblocked NTP: These phrases are used interchangeably and refer to a nucleotide or nucleoside triphosphate that has a free 3' hydroxyl group.

[0077] The term "in frame" in this disclosure, particularly the phrase "in frame fusion polynucleotides", refers to a reading frame of codons in an upstream or 5' polynucleotide, gene or ORF that is the same as the reading frame of codons in a polynucleotide, gene or ORF located downstream or 3' of the upstream polynucleotide or ORF that is fused to the upstream or 5' polynucleotide, gene or ORF. A collection of such in frame fusion polynucleotides may differ from each other in the percentage of fusion polynucleotides that include upstream and downstream polynucleotides that are in frame. The percentage of the total collection is at least 10% and can be 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% or any number in between.

[0078] XTP or dXTP: The term "XTP" or "dXTP" refers to any modified form of any ribonucleoside triphosphate or naturally occurring ribonucleoside triphosphate used to synthesize RNA or modified forms of RNA, or any modified form of any deoxyribonucleoside triphosphate or naturally occurring deoxyribonucleoside triphosphate used to synthesize DNA or modified forms of DNA, respectively.

[0079] The present disclosure provides compositions and methods for synthesizing nucleic acid in a template-independent manner.Certain nucleic acid polymerases have the ability to add nucleotides to the free 3' end of nucleic acid without a template to guide the addition or the type of nucleotide to be added.In the present disclosure, such polymerases are said to have template-independent nucleic acid polymerase (TINAP) activity.

[0080] Polymerases with TINAP activity have utility for creating artificial nucleic acids in vitro. For example, nucleic acid polymerases with TINAP activity can be combined with one or more substrate nucleic acids containing one or more nucleoside triphosphates and a free 3' hydroxyl group under experimental conditions that allow nucleic acid synthesis (e.g., incubation at a temperature that allows nucleic acid polymerization at physiological pH, in the presence of a buffer and divalent cation cofactors). The polymerase catalyzes the addition of nucleotides to the 3' end such that the 3' end of the substrate nucleic acid is extended by a single nucleotide in a single addition cycle. The nucleic acid molecule is then separated from the enzyme and / or the nucleoside triphosphate, and the cycle is repeated. In this manner, any specific nucleic acid sequence can be cyclically synthesized, one nucleotide at a time.

[0081] The ability to synthesize a specific nucleic acid sequence in the above strategies depends on the ability of a nucleic acid polymerase with TINAP activity to extend the substrate nucleic acid by a single nucleotide per addition cycle. A small subset of nucleic acid polymerases have this ability.

[0082] To date, other efforts to develop EOS strategies capable of synthesizing nucleic acids one nucleotide at a time have involved the use of 3' blocked nucleotides, which contain a chemical group covalently attached to the 3' hydroxyl of the nucleotide being added to the nucleic acid. The chemical blocking group modifies the 3' hydroxyl, preventing the addition of multiple nucleotides to the free 3' hydroxyl group of the substrate nucleic acid molecule. After a series of additions, the nucleic acid substrate molecule is separated from the enzyme and nucleoside triphosphate, and the chemical blocking group is removed by a treatment that does not alter the remainder of the substrate nucleic acid molecule. The 3' hydroxyl is exposed during this deblocking step, preparing the substrate nucleic acid molecule for another addition cycle. This strategy is illustrated in Figure 1A.

[0083] The EOS strategy described in this disclosure differs from the above that uses 3' blocked nucleotide by using a natural nucleotide with unblocked or free 3' hydroxyl. The addition of a single nucleotide per addition cycle in this disclosure relies on the specific quality of the nucleic acid polymerase with TINAP activity that allows it to extend the substrate nucleic acid molecule with a single nucleotide per addition cycle. The EOS strategy described in this disclosure is shown in Figure 1C.

[0084] A nucleic acid synthesis process based on the strategy described in this disclosure minimally involves combining a substrate nucleic acid molecule, a nucleic acid polymerase (TINAP) and one or more nucleoside triphosphates in a reaction mixture suitable for polymerase activity (minimally containing buffers and divalent cations at or near physiological pH), allowing the reaction to proceed for a time sufficient for completion, and then separating the substrate nucleic acid molecule modified by the addition of a single nucleotide from the nucleic acid polymerase and unincorporated nucleoside triphosphates, and repeating the cycle.

[0085] The present disclosure includes the use of any unblocked nucleoside triphosphate to synthesize nucleic acid.Nucleoside triphosphate can be ribonucleoside triphosphate, such as ATP, CTP, GTP, ITP, UTP or XTP or any modified form thereof, used to synthesize RNA or modified form of RNA.Nucleoside triphosphate can be deoxyribonucleoside triphosphate, such as dATP, dCTP, dGTP, dITP, dUTP or dXTP or any modified form thereof, used to synthesize DNA or modified form of DNA.

[0086] Modified forms of nucleotides include, but are not limited to, nucleotides modified by the covalent attachment of methyl groups, O-methyl groups, hydroxyl groups, amino groups, phosphates, chlorine or fluorine atoms, monosaccharides, disaccharides or polysaccharides, dyes, fluorescent groups, phosphorothioate groups (replacing the oxygen atom on the phosphodiester bond with a sulfur atom), linking groups (such as biotin or digoxigenin), reactive groups such as azides, aldehydes, ketones, thiols, disulfides or amines, or molecules containing one or more of the above. The modifying group can be added to the nitrogenous base of the nucleotide or to the 2' or 5' carbon of the ribose sugar (e.g., 2'-fluoro or 2'-O-methyl substitutions), but any carbon, nitrogen or oxygen atom found in the nucleotide can be modified, except for the 3'-hydroxyl group. Multiple modifying groups can be added to a single nucleotide molecule. The purpose of the modification group added to a nucleotide is to allow for specific detection, purification, targeting (to a tissue or cell type of an organism) or stabilization, or a combination thereof, of the molecule to which the modified nucleotide is covalently attached.

[0087] The present disclosure can be used to synthesize any nucleic acid molecule of any sequence. The synthesized nucleic acid molecule can be DNA or RNA or modified forms thereof, or a chimeric nucleic acid or modified forms thereof containing both ribonucleotides and deoxyribonucleotides. The synthesized sequence can include a canonical ribose or deoxyribose backbone or modified forms thereof, with any of several modifications to the ribose sugar, including but not limited to 2'-fluoro or 2'-O-methyl substitutions. The synthesized sequence can include any of the canonical bases found in DNA and RNA (adenine, cytidine, guanine, thymine, uracil) or uncommon bases (e.g. hypoxanthine, xanthine) or modified forms of any such base, or any mixture of natural or modified bases. Modified forms of nitrogenous bases include, but are not limited to, bases modified by the covalent attachment of reactive groups such as methyl groups, O-methyl groups, hydroxyl groups, amino groups, phosphate, chlorine or fluorine atoms, mono-, di- or polysaccharides, dyes, fluorescent groups, phosphorothioate groups (which replace phosphate), linking groups (such as biotin or digoxigenin), azides, aldehydes, ketones, thiols, disulfides or amines, or molecules containing one or more of the above.

[0088] Substrate nucleic acid molecules used as nucleotide acceptors in enzymatic nucleic acid synthesis reactions can be of any length or sequence. For example, substrate nucleic acid molecules can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000 or 100000 nucleotides in length, or more, or any length in between.

[0089] The substrate nucleic acid molecule used as a nucleotide acceptor in an enzymatic nucleic acid synthesis reaction may be free in solution or immobilized on a solid support such as agarose beads, polystyrene beads or magnetic beads. The immobilization of the substrate nucleic acid molecule may occur via covalent attachment to the solid support or by non-covalent attachment to the solid support.

[0090] Substrate nucleic acid molecules used as nucleotide acceptors in enzymatic nucleic acid synthesis reactions can be either single-stranded or partially single-stranded. The 3' end of the substrate nucleic acid molecule that serves as a nucleotide acceptor is single-stranded, meaning that it does not base pair with a homologous nucleotide, but any nucleotide in the substrate nucleic acid molecule that is 5' to the 3' end can be single-stranded or double-stranded.

[0091] Substrate nucleic acid molecules used as nucleotide acceptors in enzymatic nucleic acid synthesis reactions can be of any length, including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 40000, 50000, 60000, 70000, 80000, 90000 or 100000 nucleotides in length, or more, or any length in between.

[0092] Substrate nucleic acid molecules used as nucleotide acceptors in enzymatic nucleic acid synthesis reactions can contain deoxyribonucleotide or ribonucleotide residues, or a mixture of both deoxyribonucleotide and ribonucleotide residues. The nucleotide residues in the substrate nucleic acid molecule can contain any modification, including modifications to the ribose sugar, or modifications to the base, or modifications to the backbone.

[0093] Substrate nucleic acid molecules used as nucleotide acceptors in enzymatic nucleic acid synthesis reactions can be pure molecules of specific sequence and structure, or can be a mixed population of different sequences or structures.

[0094] Nucleic acid sequences synthesized using the compositions and methods described in this disclosure can contain all bases commonly found in the type of nucleic acid synthesized (i.e., A, C, G, and T for DNA) or a subset of these bases. The synthesized sequences can be complex and non-repetitive, or repetitive, in which one or more specific sequences are repeated. The synthesized sequences can be homopolymeric (containing only a single nucleotide) or can contain simple repeats of two or more nucleotides per repeat length, or complex repeats of five or more nucleotides in length.

[0095] Nucleic acid molecules synthesized using the compositions and methods described in this disclosure can be any length of 2 or more nucleotides, including 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 40000, 50000, 60000, 70000, 80000, 90000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, or 100000 nucleotides or more, or any length in between.

[0096] The efficiency of nucleotide addition when synthesizing nucleic acid using the compositions and methods described in the present disclosure can range from 1% to 100%. This means that only a subset of nucleic acid substrate molecules can be extended by additional nucleotides by nucleic acid polymerase during a single addition cycle. For example, the efficiency of addition of any particular nucleotide to any particular nucleic acid substrate molecule can be 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 115, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, or any percentage therebetween.

[0097] Nucleotide addition efficiency by nucleic acid polymerase can be affected by many factors or variables in the reaction, including but not limited to the concentration of each nucleoside triphosphate present in the addition reaction, enzyme concentration, and reaction conditions that affect enzyme activity.For example, increasing the concentration of a particular nucleoside triphosphate can increase the incorporation efficiency of that nucleoside triphosphate.Similarly, increasing the concentration of the enzyme that catalyzes the incorporation of a particular nucleoside triphosphate can increase the incorporation frequency of that nucleoside triphosphate. The same can be accomplished by modifying the reaction mixture and reaction conditions, for example, by changing the presence of buffers (e.g., Tris, sodium or potassium phosphate, sodium or potassium acetate, or sodium or potassium cacodylate), salts, divalent cations, and reaction additives or stabilizers, including but not limited to molecules that affect or modify nucleic acid polymerase activity, such as polyethylene glycol, polyvinylpyrrolidone, glycerol, polyamines, detergents, surfactants, bovine serum albumin, DNA binding proteins, formamide, or peptides or small molecules, or by changing the concentrations of buffers, salts, divalent cations, nucleoside triphosphates, and other reaction components, including but not limited to molecules that affect or modify nucleic acid polymerase activity, such as polyethylene glycol, polyvinylpyrrolidone, glycerol, polyamines, detergents, surfactants, bovine serum albumin, DNA binding proteins, formamide, or peptides or small molecules.

[0098] The reaction pH of the nucleic acid synthesis process may vary by a few pH units around physiological pH, for example, pH 4.0, 5.0, 6.0, 7.0, 8.0, 9.0 or 10.0, or any pH in between.

[0099] Based on the known mechanism of nucleotide addition by nucleic acid polymerases, there are various possible mechanisms by which TINAP can catalyze the addition of a single nucleotide to the 3' end of an unblocked nucleic acid without undergoing processive addition of multiple nucleotides. These include, but are not limited to: 1) The nucleic acid polymerase may be specific for a particular nucleic acid sequence, including the terminal base on the nucleic acid substrate, and only adds nucleotides to substrate molecules that contain this particular sequence. Once a nucleotide has been added, the terminal sequence may be different and the polymerase may not be able to add another nucleotide to the substrate. 2) The nucleic acid polymerase may be defective in the translocation step of its nucleotide addition mechanism, which stalls the enzyme after the catalytic step of nucleotide addition and release of pyrophosphate, allowing the polymerase to add only a single nucleotide. 3) The nucleic acid polymerase may remain tightly associated with the end of the nucleic acid molecule in a covalent or non-covalent manner, preventing dissociation of the polymerase after nucleotide addition and preventing access to the 3' end of the nucleic acid by another molecule of polymerase. 4) Nucleic acid polymerases can lose catalytic activity after the addition of a single nucleotide, thereby rendering them unable to add additional nucleotides. These mechanisms and enzymatic properties can exist individually or in combination in a particular nucleic acid polymerase.

[0100] Nucleic acid polymerases that exhibit sequence specificity in the addition of nucleotides to the 3' end of nucleic acid (the first mechanism of single nucleotide addition described above) can recognize and be specific to different numbers of nucleotides located at different parts of nucleic acid. For example, nucleic acid polymerases can be specific to sequences that are present at the 3' end of nucleic acid or internal sequences that do not include nucleotides present at the 3' end. Polymerases can be specific to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nucleotides that are present at the 3' end or internally of nucleic acid. When recognizing a specific sequence within a nucleic acid, the distance from the 3' end of the nucleic acid can be different lengths from the 3' end of the nucleic acid, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nucleotides. The recognition sequence that governs the sequence specificity of the nucleic acid polymerase can also be present in two or more discontinuous sequences within the nucleic acid.

[0101] Nucleic acid polymerase that loses catalytic activity after adding a single nucleotide to the 3' end of nucleic acid can do so reversibly or irreversibly. If it is reversible, it can be treatment such as pH change; change in concentration of salt, divalent cation, pyrophosphate, nucleoside monophosphate, nucleoside diphosphate, nucleoside triphosphate, reducing agent, or any combination of the above; change in polymerase concentration; treatment with chaotropic agents such as guanidine, urea or alcohol; partial or complete unfolding followed by refolding or any other treatment known to those skilled in the art that restores the activity of polymerase. If the loss of activity is irreversible, these treatments do not restore polymerase activity.

[0102] The nucleic acid polymerase used in industrial nucleic acid synthesis process can be discarded after one use, or can be reused between nucleotide addition cycles for continued use.Nucleic acid polymerase can be used for any number of nucleotide addition cycles, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100 cycles, or any number in between.Between cycles, the nucleic acid polymerase can be desalted, concentrated, or separated from other reaction components by any of several protein purification methods, including, but not limited to, affinity chromatography, anion exchange chromatography, cation exchange chromatography, gel filtration chromatography, reverse phase chromatography, or ultrafiltration, to prepare it for the next nucleotide addition cycle.

[0103] Between nucleotide addition cycles, nucleic acid polymerases used in industrial nucleic acid synthesis processes may be partially or completely unfolded or denatured (meaning partially or completely transitioning the protein from its characteristic three-dimensional structure into a random coil) and refolded into its native three-dimensional structure to prepare it for the next nucleotide addition cycle.

[0104] Single nucleotide addition reactions can use different stoichiometries of substrate to enzyme and fall into three general categories: 1) molar excess of enzyme; 2) equimolar amounts of enzyme and substrate ends; and 3) molar excess of nucleic acid substrate 3' end. In the case of molar excess of enzyme, the enzyme can be present at a concentration corresponding to a fold excess compared to the concentration of the nucleic acid substrate 3' end, for example, 1.01x, 1.1x, 1.2x, 1.3x, 1.4x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 20, 30x, 40x, 50x, 60x, 70x, 80x, 90x, 100x, or any number / fold excess in between. In the case of a molar excess of a nucleic acid substrate 3' end, the nucleic acid substrate or the 3' end of the substrate (e.g., in the case of a covalently immobilized substrate) can be present at a concentration corresponding to a fold excess relative to the concentration of the enzyme, for example, 1.01x, 1.1x, 1.2x, 1.3x, 1.4x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 20, 30x, 40x, 50x, 60x, 70x, 80x, 90x, 100x, 200x, 300x, 400x, 500x, 600x, 700x, 800x, 900x, 1000x, or any number / fold excess in between.

[0105] The ability to synthesize nucleic acid by controlled addition of single nucleotides can be exploited to create industrial processes for nucleic acid synthesis.Such industrial processes typically include a specific composition of materials related to the nucleic acid that is synthesized either in solution or on solid support, a dedicated container or vessel (e.g., flow column) in which synthesis is carried out, a specific technique for adding and removing enzymes and nucleoside triphosphates (e.g., including dedicated delivery systems or microfluidics), a specific technique for removing excess enzymes and nucleoside triphosphates after each nucleotide addition step, and a specific method for removing enzymes from reaction vessels after synthesis and separating them from materials present during synthesis, such as solid support, buffers, salts and other solutes.

[0106] Industrial processes for nucleic acid synthesis can be developed at different reaction temperatures, such as 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or 120° C., or any temperature in between. The reaction temperature may be constant or may vary in any manner during the course of the reaction, such as by a linear or nonlinear increase from the starting temperature, or a linear or nonlinear decrease from the starting temperature, or by a cyclic temperature change, or any combination thereof.

[0107] Industrial nucleic acid synthesis processes can use different reaction times for each nucleotide addition cycle, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 or 60 seconds / cycle or any time in between, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 or 60 minutes / cycle or any time in between, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 hours / cycle or any time in between.

[0108] Industrial processes for nucleic acid synthesis can be set up at various scales to allow efficient synthesis of different amounts of nucleic acid. The scale can vary from fmolar amounts to molar amounts or more of nucleic acid synthesized. For example, a particular process can be set up to synthesize 1x10 -16 , 2x10 -16 , 3x10 -16 , 4x10 -16 , 5x10 -16 , 6x10 -16 , 7x10 -16 , 8x10 -16 , 9x10 -16 , 1x10 -15 , 2x10 -15 , 3x10 -15 , 4x10 -15 , 5x10-15 、6x10 -15 、7x10 -15 、8x10 -15 、9x10 -15 、1x10 -14 、2x10 -14 、3x10 -14 、4x10 -14 、5x10 -14 、6x10 -14 、7x10 -14 、8x10 -14 、9x10 -14 、1x10 -13 、2x10 -13 、3x10 -13 、4x10 -13 、5x10 -13 、6x10 -13 、7x10 -13 、8x10 -13 、9x10 -13 、1x10 -12 、2x10 -12 、3x10 -12 、4x10 -12 、5x10 -12 、6x10 -12 、7x10 -12 、8x10 -12 、9x10 -12 、1x10 -11 、2x10 -11 、3x10 -11 、4x10 -11 、5x10 -11 、6x10 -11 、7x10 -11 、8x10 -11 、9x10 -11 、1x10 -10 、2x10 -10 、3x10 -10 、4x10 -10 、5x10 -10 、6x10 -10 、7x10 -10 、8x10 -10 、9x10 -10 、1x10 -9 、2x10 -9 、3x10 -9 、4x10 -9 、5x10 -9 、6x10 -9、7x10 -9 、8x10 -9 、9x10 -9 、1x10 -8 、2x10 -8 、3x10 -8 、4x10 -8 、5x10 -8 、6x10 -8 、7x10 -8 、8x10 -8 、9x10 -8 、1x10 -7 、2x10 -7 、3x10 -7 、4x10 -7 、5x10 -7 、6x10 -7 、7x10 -7 、8x10 -7 、9x10 -7 、1x10 -6 、2x10 -6 、3x10 -6 、4x10 -6 、5x10 -6 、6x10 -6 、7x10 -6 、8x10 -6 、9x10 -6 、1x10 -5 、2x10 -5 、3x10 -5 、4x10 -5 、5x10 -5 、6x10 -5 、7x10 -5 、8x10 -5 、9x10 -5 、1x10 -4 、2x10 -4 、3x10 -4 、4x10 -4 、5x10 -4 、6x10 -4 、7x10 -4 、8x10 -4 、9x10 -4 、1x10 -3 、2x10 -3 、3x10 -3 、4x10 -3 、5x10 -3 、6x10 -3 、7x10 -3 、8x10-3 , 9x10 -3 , 1x10 -2 , 2x10 -2 , 3x10 -2 , 4x10 -2 , 5x10 -2 , 6x10 -2 , 7x10 -2 , 8x10 -2 , 9x10 -2 , 1x10 -1 , 2x10 -1 , 3x10 -1 , 4x10 -1 , 5x10 -1 , 6x10 -1 , 7x10 -1 , 8x10 -1 , 9x10 -1 , 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90 or 100 moles of nucleic acid, or any scale in between.

[0109] Industrial processes for nucleic acid synthesis may rely on a single enzyme that has all the activities necessary to add any nucleotide with any structure to the 3' end of any nucleic acid, or the process may rely on specialized enzymes to catalyze the addition of specific nucleotides to specific nucleic acids. For example, the nucleic acid polymerase used to add ribonucleotides may be different from the nucleic acid polymerase used to add deoxyribonucleotides. Different nucleic acid polymerases can be used to add nucleotides containing different bases or different modifications. Different nucleic acid polymerases can be used to add nucleotides to nucleic acids that differ in the sequence present at the nucleic acid '3' end or in the sequence present within the nucleic acid. Different nucleic acid polymerases can be used to add nucleotides with different linkages, for example, canonical phosphodiester linkages compared to phosphorothioate linkages. An industrial process may use 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 different nucleic acid polymerases, or any number in between, to allow synthesis of different sequences and / or structures of nucleic acids.

[0110] For each cycle of nucleic acid synthesis, a nucleic acid polymerase is added to catalyze the specific addition reaction required for this cycle. The nucleic acid polymerase can be a single enzyme or a mixture of two or more enzymes.

[0111] Enzymatic oligonucleotide synthesis can allow the incorporation of degenerate or mixed nucleotides at specific positions in an oligonucleotide. This involves the addition of multiple nucleoside triphosphates for a particular addition cycle in an enzymatic addition reaction. Depending on the structure of the nucleotide to be incorporated at the mixed position, one or more nucleic acid polymerases are added to catalyze the incorporation reaction.

[0112] When synthesizing nucleic acids with degenerate or mixed nucleotides at a particular position, multiple enzymes can be added to add multiple nucleotides to a single position of the nucleic acid in a particular addition cycle.

[0113] The ratio of nucleotides incorporated at degenerate positions can be influenced by the concentration of each nucleoside triphosphate present in the addition reaction, the enzyme concentration, and the reaction conditions that affect the relative rate of different enzymes.For example, increasing the concentration of a particular nucleoside triphosphate in a mixture of two or more nucleoside triphosphates typically increases the incorporation efficiency of that nucleoside triphosphate.Similarly, increasing the concentration of the enzyme that catalyzes the incorporation of a particular nucleoside triphosphate in the mixture increases the incorporation frequency of that nucleoside triphosphate. The same can be accomplished by modifying the reaction conditions (presence of reaction additives or stabilizers including, but not limited to, buffers, salts, divalent cations and polyethylene glycol, polyvinylpyrrolidone, glycerol, polyamines, detergents, bovine serum albumin, DNA binding proteins or formamide; concentrations of other reaction components including, but not limited to, buffers, salts, divalent cations, nucleoside triphosphates and polyethylene glycol, polyvinylpyrrolidone, glycerol, polyamines, detergents, bovine serum albumin, DNA binding proteins or formamide; pH; temperature) to optimize the activity of a nucleic acid polymerase or to favor the activity of one nucleic acid polymerase over other nucleic acid polymerases present in the mixture.

[0114] Enzymatically synthesized oligonucleotides can contain any number of degenerate nucleotides, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 40000, 50000, 60000, 70000, 80000, 90000, or 100000 or more degenerate nucleotides, up to the full length of the oligonucleotide. Degenerate positions in an oligonucleotide can consist of mixtures of all four canonical nucleotides A, C, G and T, or any subset of bases (e.g., A+C, A+G, A+T, C+G, C+T, G+T, A+C+G, A+C+T, A+G+T, C+G+T), or any mixture of canonical nucleotides with any type of non-natural or modified nucleotides.

[0115] In an enzymatic nucleic acid synthesis process, the nucleic acid to be synthesized can be in solution, bound to a solid support, or a combination thereof. When a solid support is used, the nucleic acid can be covalently or non-covalently bound to the solid support.

[0116] A variety of solid supports can be used to immobilize nucleic acids during synthesis and are known to those of skill in the art. These include, but are not limited to, controlled pore glass (CPG) beads, agarose beads or resins, polystyrene beads or resins, PEG beads or resins, silica gel beads, and many other specialized materials developed for the immobilization of chemical groups, enzymes, or nucleic acids. Solid supports can have a variety of bead sizes ranging from 0.01 to 1000 microns and pore sizes ranging from 0.01 to 1000 microns.

[0117] The nucleic acid polymerase used in the enzymatic nucleic acid synthesis reaction may be free in solution or immobilized on a solid support, including but not limited to agarose beads, polystyrene beads or magnetic beads. The immobilization of the nucleic acid polymerase may occur via covalent binding to the solid support or by non-covalent binding to the solid support. The solid support used to immobilize the nucleic acid polymerase may be the same solid support used to immobilize the nucleic acid substrate, or may be a different support.

[0118] The nucleic acid polymerase used in the enzymatic nucleic acid synthesis reaction can be a DNA polymerase or an RNA polymerase based on its natural function. In the case of a DNA polymerase, the polymerase can belong to any of the various known families of DNA polymerases, including but not limited to family A, B, C, D, X, Y and RT.

[0119] The nucleic acid polymerase used in an enzymatic nucleic acid synthesis reaction can be a naturally occurring enzyme or an engineered enzyme, meaning that its sequence or structure has been modified by the hand of man to enhance its utility for de novo nucleic acid synthesis.

[0120] This disclosure describes seven novel nucleic acid polymerases that can add a single nucleotide to the 3' end of a nucleic acid molecule. The SEQ ID NOs for these enzymes are shown in Table 1 below, and their activities are described in Example 1. [Table 4] The SEQ ID NOs in column A are the native sequences (amino acids). The SEQ ID NOs in column B are the cloned gene sequences (nucleic acids). The SEQ ID NOs in column C are the expressed protein sequences (amino acids). The SEQ ID NOs in column D are the expression plasmid sequences (nucleic acids).

[0121] As mentioned above, a nucleic acid polymerase can have a partial ability to add a single nucleotide to the 3' end of a nucleic acid substrate, meaning that the efficiency of adding a single nucleotide to a nucleic acid substrate during a reaction may be less than 100%. To increase this efficiency, a nucleic acid polymerase can be engineered to be more efficient. This means that a mutant of the original enzyme is generated that has a higher addition efficiency in a reaction than the parent enzyme. A nucleic acid polymerase can also be engineered to change its substrate specificity. For example, a nucleic acid polymerase that efficiently adds a nucleotide to the 3' end of a nucleic acid that ends with a T can be engineered to efficiently add a nucleotide to a nucleic acid that ends with any nucleotide. As another example, a nucleic acid polymerase that efficiently adds an A to the 3' end of a nucleic acid can be engineered for broader substrate specificity so that the mutant enzyme can efficiently add any nucleotide to the 3' end of a nucleic acid molecule. In yet another example, a nucleic acid polymerase that processively adds multiple nucleotides to the 3' end of a nucleic acid during a reaction can be engineered to only add a single nucleotide to the 3' end during a reaction. In a further example, a nucleic acid polymerase that efficiently adds deoxyribose nucleotides to the 3' end of a nucleic acid can be engineered to efficiently add ribonucleotides. In a further example, a nucleic acid polymerase that efficiently adds deoxyribose nucleotides to the 3' end of a DNA molecule can be engineered to efficiently add deoxyribonucleotides to an RNA molecule. In a final example, a nucleic acid polymerase that efficiently adds ribonucleotides to the 3' end of a DNA molecule can be engineered to efficiently add ribonucleotides to the 3' end of an RNA molecule. These examples are not exhaustive, and in fact it is possible to engineer any particular desired nucleic acid polymerase activity by engineering a starting enzyme that lacks this activity or exhibits this activity with low efficiency.

[0122] Many approaches and methods for protein engineering have been described in the literature, including but not limited to those listed in the following review articles: Leatherbarrow 1986, Zoller 1991, Lutz 2000, Leisola 2007, Eisenbeis 2010, O'Fagain 2011, Foo 2012, Zawaira 2012, Marcheschi 2013, Woodley 2013, Johnson 2014, Packer 2015, Shin 2015, Chen 2016, Kaushik 2016, Swint-Kruse 2016, Wrenbeck 2017, Bornscheuer 2018, Lutz 2018, Singh 2018, Sinha 2019, Wilding 2019, Yang 2019.

[0123] Generally, protein engineering uses one or more methods to diversify the gene sequence encoding the enzyme of interest, followed by one or more selection or screening methods used to select genes encoding mutant enzymes with one or more improved qualities of interest.Qualities of interest include, but are not limited to, nucleotide addition efficiency in a particular reaction condition or when modifying a particular substrate; substrate specificity for nucleic acid substrates; inhibitor resistance; substrate specificity for nucleoside triphosphates; stability when exposed to high temperatures; stability under conditions that may inactivate the parent enzyme, such as the presence of salts, pyrophosphates or other reaction products, or any other chemicals or compounds in the reaction; high concentrations in any of the above reactions; or any other quality of the enzyme that may improve its suitability for enzymatic nucleic acid synthesis processes.

[0124] Methods for diversifying a gene encoding a nucleic acid polymerase of interest include, but are not limited to, mutation, meaning the introduction of point mutations; introduction of insertions and deletions of various lengths within the enzyme coding sequence; fusion with other sequences at either the 5' or 3' end of the coding sequence; homologous sequence exchange with related coding sequences resulting in reassortment of polymorphisms; and any other means of generating sequence diversity.

[0125] A subset of template-independent nucleic acid polymerases contain BRCT domains that are not essential for nucleic acid polymerase activity and may mediate interactions with other proteins involved in DNA synthesis or repair (Callebaut 1997, Repasky 2004). Truncation of the protein to remove the BRCT domain has been reported to stimulate DNA polymerase activity in terminal deoxynucleotidyl transferase (Mueller 2009). Similar targeted truncations that remove the BRCT domain can be used to alter the activity of other TINAPs.

[0126] Methods and approaches used to select genes encoding one or more improved quality enzymes of interest include approaches using in vitro compartmentalization in microdroplets or emulsions, which allow efficient processing of small amounts of many enzyme variants. Such approaches have been described in the literature in a general manner and with specific application to nucleic acid processing enzymes (Tawfik 1998, Ghadessy 2001, Diehl 2006, Griffiths 2006, Miller 2006, Ghadessy 2007, Tay 2010, Takeuchi 2014).

[0127] example Example 1: Single nucleotide addition to an oligonucleotide in solution DNA polymerase, enzyme expression and purification: Genes encoding the DNA polymerases listed in Table 1, each with a 6-histidine tag (SEQ ID NOs: 21-30) at the N-terminus, are designed as nucleic acid sequences (SEQ ID NOs: 11-20), synthesized by a commercial gene synthesis supplier, and cloned into bacterial expression plasmids with MB1 plasmid replicon conferring high copy number in Escherichia coli (E. coli). The insertion sites for the DNA polymerase genes on the plasmid are flanked by an arabinose-inducible promoter and lambda T1 terminator, allowing for arabinose-inducible expression of each polymerase. The expression constructs are sequence verified after cloning. The complete sequences of the expression constructs for the DNA polymerases included in this disclosure are shown in SEQ ID NOs: 31-40.

[0128] The coding sequence of the gene encoding EDS082 was obtained by truncating the sequence encoding EDS030: the sequence encoding the BRCT domain present at the N-terminus of EDS030 was removed as described for other polymerases (Mueller 2009) and a methionine codon inserted at the start of the truncated coding sequence was removed.

[0129] The expression plasmid is transformed into E. coli strain BL21 and a single colony is picked for cultivation and protein expression. The bacterial cells are grown in LB medium at 37°C to log phase culture and induced by addition of L-arabinose. After 18 hours of incubation at 15°C, the culture is harvested by centrifugation and the harvested E. coli cells are lysed. The DNA polymerase is purified by nickel affinity chromatography according to the manufacturer's instructions. The DNA polymerase is eluted with an imidazole solution, concentrated on an AMICON™ ultracentrifugal filter sold by Millipore (Darmstadt) and exchanged into a storage buffer consisting of 50 mM KPO4, pH 7.3, 100 mM NaCl, 1.43 mM beta-mercaptoethanol, 0.05% Triton-X100 and 50% glycerol.

[0130] In vitro nucleotide addition assay using oligonucleotides and dNTP pools Enzyme activity is assayed by carrying out reactions in a buffer consisting of 50 mM potassium acetate and 20 mM Tris acetate at pH 7.5. The reaction buffer is supplemented with 10 mM magnesium acetate and 250 μM cobalt chloride. Reactions are carried out in the presence of 500 μM dNTPs, 10 μM single-stranded DNA oligonucleotides and 1 μg enzyme / 10 μl reaction. Reactions are incubated with a temperature gradient starting at 15° C. and increasing to 50° C. at a rate of 1° C. / min. Reactions are carried out in a 10 μl volume and set up on ice.

[0131] For activity screening, an equimolar mixture of single-stranded DNA oligonucleotides is used: PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45); PG5859 (GTCCTCAATCGCACTGGAAG, SEQ ID NO: 43); PG5860 (GTCCTCAATCGCACTGGAAC, SEQ ID NO: 44); PG5858 (GTCCTCAATCGCACTGGAAA, SEQ ID NO: 42). The mixture of single-stranded oligonucleotides is combined with an equimolar mixture of dATP, dTTP, dGTP and dCTP. Oligonucleotides are synthesized by Eurofins Genomics (Louisville, Kentucky) and dNTPs are purchased from New England Biolabs (Beverly, Massachusetts).

[0132] The reaction is stopped by adding an equal volume of 2x NOVEX™ TBE-Urea Sample Buffer (ThermoFisher, Waltham, MA) and heated to 70°C for 3 min. Samples are cooled and 15 μl is added to a NOVEX™ TBE-Urea polyacrylamide gel (15%, ThermoFisher, Waltham, MA), electrophoresed at 150 V, stained with methylene blue, destained with deionized water, and imaged under white light using an AZURE™ 200 Gel Imaging Workstation (Azure Biosystems, Dublin, CA).

[0133] An example of the evaluation of the activity of ten DNA polymerases is shown in Figure 2. Various enzymes show a propensity to add one or several nucleotides to a single-stranded oligonucleotide, which may indicate their suitability for an enzymatic nucleic acid synthesis process.

[0134] Assay of single nucleotide addition by gel electrophoresis Enzyme activity using individual dNTPs is assayed by carrying out reactions in a buffer consisting of 50 mM potassium acetate and 20 mM Tris acetate at pH 7.5. The reaction buffer is supplemented with 10 mM magnesium acetate and 250 μM cobalt chloride. Reactions are carried out in the presence of 500 μM dNTPs, 10 μM single-stranded DNA oligonucleotide and 1 μg enzyme / 10 μl reaction. Reactions are incubated at 30° C. for 15 min. Reactions were carried out in 10 μl volumes and set up on ice.

[0135] The following individual dNTP and DNA oligonucleotide pairs are used for each reaction: dTTP+PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45); dGTP+PG5864 (GTCCTCAATCGCACTGGAATT, SEQ ID NO: 46); dATP+PG5865 (GTCCTCAATCGCACTGGAATTG, SEQ ID NO: 47); dCTP+PG5866 (GTCCTCAATCGCACTGGAATTGA, SEQ ID NO: 48). Standard oligonucleotides are also used for the analysis: PG5867 (GTCCTCAATCGCACTGGAATTGAC, SEQ ID NO: 54).

[0136] The reaction is stopped by adding an equal volume of 2x NOVEX™ TBE-Urea Sample Buffer (ThermoFisher, Waltham, MA) and heated to 70°C for 3 min. Samples are cooled and 15 μl is added to a NOVEX™ TBE-Urea polyacrylamide gel (15%, ThermoFisher, Waltham, MA), electrophoresed at 150 V, stained with methylene blue, destained with deionized water, and imaged under white light using an AZURE™ 200 Gel Imaging Workstation (Azure Biosystems, Dublin, CA).

[0137] FIG. 3A shows the efficient addition of a single nucleotide to the four different oligonucleotide substrates listed above.

[0138] Assay for sequential nucleotide addition Sequential nucleotide addition reactions are carried out in a buffer consisting of 50 mM potassium acetate and 20 mM tris acetate at pH 7.5. The reaction buffer is supplemented with 10 mM magnesium acetate and 250 μM cobalt chloride. The reactions are carried out in the presence of 500 μM dNTPs, 10 μM single-stranded DNA oligonucleotide and 1 μg enzyme / 10 μl reaction. The reactions are incubated at 30° C. for 15 minutes. If sequential reactions are carried out to add multiple dNTPs, the reaction volume is expanded to 100 μl. The first reaction is carried out using a single-stranded DNA oligonucleotide with the following sequence PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45) and dTTP as the nucleoside triphosphate.

[0139] The reaction is stopped by boiling at 100°C for 3 minutes, and the oligonucleotide is purified from the reaction components on a silica column using the Oligonucleotide Clean and Concentrator kit from Zymo Research (Irvine, CA) according to the manufacturer's instructions, and eluted in distilled water. The concentration of the purified oligonucleotide is measured using a NANODROP™ One spectrophotometer from Thermo Scientific (Waltham, MA) and an aliquot is reserved for gel electrophoresis. The remaining purified oligonucleotide is then used in an addition reaction using dGTP in the same process as the starting oligonucleotide.

[0140] The following oligonucleotides were added to the samples and used as standards by performing a duplex analysis (see Figures 4B, 4D, 4F and 4H): PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45); PG5864 (GTCCTCAATCGCACTGGAATT, SEQ ID NO: 46); PG5865 (GTCCTCAATCGCACTGGAATTG, SEQ ID NO: 47); PG5866 (GTCCTCAATCGCACTGGAATTGA, SEQ ID NO: 48); and PG5867 (GTCCTCAATCGCACTGGAATTGAC, SEQ ID NO: 54).

[0141] For analysis by gel electrophoresis, samples are diluted by adding an equal volume of 2x NOVEX™ TBE-Urea Sample Buffer (ThermoFisher, Waltham, MA) and heated to 70°C for 3 min. Samples are cooled and 15 μl is added to a NOVEX™ TBE-Urea polyacrylamide gel (15%, ThermoFisher, Waltham, MA), electrophoresed at 150 V, stained with methylene blue, destained with deionized water, and imaged under white light using an AZURE™ 200 Gel Imaging Workstation (Azure Biosystems, Dublin, CA).

[0142] FIG. 3B shows the efficient sequential addition of two nucleotides to an oligonucleotide substrate having the sequence shown in SEQ ID NO:45.

[0143] Assay of single nucleotide addition by capillary electrophoresis Enzyme activity using individual dNTP oligonucleotide pairs is assayed by carrying out reactions in a buffer consisting of 50 mM potassium acetate and 20 mM Tris acetate at pH 7.5. The reaction buffer is supplemented with 10 mM magnesium acetate and 250 μM cobalt chloride. Reactions are carried out in the presence of 500 μM dNTPs, 10 μM single-stranded DNA oligonucleotides and 1 μg enzyme / 10 μl reaction. Reactions are incubated at 30° C. for 15 min. Reactions are carried out in 10 μl volumes and set up on ice.

[0144] Oligonucleotides used: PG5861 (GTCCTCAATCGCACTGGAAT, sequence number 45); PG5864 (GTCCTCAATCGCACTGGAATT, sequence number 46); PG5872 (GTCCTCAATCGCACTGGAATG, sequence number 53); PG5859 (GTCCTCAATCGCACTGGAAG, sequence number 43); PG5868 (GTCCTCAATCGCACTGGAAGT, sequence number 49); PG5869 (GTCCTCAATCGCACTGGAAGC, sequence number 50); PG5858 (GTCCTCAATCGCACTGGAAA, sequence number 42).

[0145] Enzymatic addition to each oligonucleotide is evaluated separately with dATP, dTTP, dGTP and dCTP in individual reactions. The reactions are stopped by boiling at 100 °C for 3 min and the oligonucleotides are purified from the reaction components on a silica column using the Oligonucleotide Clean and Concentrator kit from Zymo Research (Irvine, CA) according to the manufacturer's instructions and eluted in distilled water. The purified oligonucleotides are then analyzed on an Agilent Oligo Pro II capillary electrophoresis system from Agilent Technologies (Santa Clara, CA) using a 24-capillary array. The purified oligonucleotides in water are diluted to approximately 0.5-2 μM for analysis using an injection method ranging from 9-12 kV for 10 s followed by separation at 15 kV for 70 min. Data is analyzed using Agilent Oligo Pro II Data Analysis Software 2.0.0.3 (Agilent Technologies, Santa Clara, CA). Analysis of reactions is performed by performing two independent runs for each sample. One run includes only the pure sample on the Agilent Oligo Pro II to assess the purity and conversion of the starting oligonucleotides (Figure 4A, Figure 4C, Figure 4E, and Figure 4G). After the reactions are performed, a second run is performed with standards spiked into each sample to accurately size the purified oligonucleotides (Figure 4B, Figure 4D, Figure 4F, and Figure 4H).

[0146] Spike in the following oligo nucleotide standards at a final concentration of approximately 1 μM: PG1350 (GCGTCACGCTACCAACCA, SEQ ID NO: 41); PG5870 (GTCCTCAATCGCACTGGAAACATCAAGGTC, SEQ ID NO: 51); PG5871 (GTCCTCAATCGCACTGGAAACATCAAGGTCATACGGAACG, SEQ ID NO: 52). The oligo nucleotides used in each specific reaction are also spiked in at approximately 1 μM along with the standards.

[0147] Profiles from representative capillary electrophoresis runs on an Agilent Oligo Pro II instrument are shown in FIGS. 4A - H. FIGS. 4A and 4B show capillary electrophoresis runs of control oligo nucleotides not treated with the enzyme reaction. FIGS. 4C and 4D show the partial addition of single nucleotides to single - stranded oligo nucleotides after reaction of oligo nucleotide PG5861 (SEQ ID NO: 45) with dTTP and enzyme EDS082 (see Table 1). FIGS. 4E and 4F show the efficient addition of single nucleotides to single - stranded oligo nucleotides after reaction of oligo nucleotide PG5861 (SEQ ID NO: 45) with dTTP and enzyme EDS054 (see Table 1). FIGS. 4G and 4H show the addition of 1, 2, 3, 4, and 5 nucleotides to single - stranded oligo nucleotides after reaction of oligo nucleotide PG5861 (SEQ ID NO: 45) with dTTP and enzyme EDS066 (see Table 1).

[0148] The results of 50 representative reactions showing single nucleotide addition are summarized in Table 2 below. N means the nucleotide length of the oligo nucleotide that serves as a substrate in these reactions. %<N means the percentage of products shorter than N (e.g., degradation products of the oligo nucleotide substrate). %N means the percentage of products having the length of N (e.g., unreacted oligo nucleotide substrate). %N + 1 means the percentage of products one nucleotide longer than N (e.g., the desired elongation product). %N+>1 refers to the percent of products that are 2 or more nucleotides longer than N (eg, extension products of an oligonucleotide substrate that have received 2 or more additional nucleotides). The table clearly shows the yield of the desired N+1 extension product in each example, with single nucleotide addition efficiencies ranging from 36% to 100%. [Table 5-1] [Table 5-2]

[0149] Assay for ribonucleotide addition Enzyme activity using an equimolar mixture of four NTPs is assayed by carrying out the reaction in a buffer consisting of 50 mM potassium acetate and 20 mM tris acetate at pH 7.5. The reaction buffer was supplemented with 10 mM magnesium acetate and 250 μM cobalt chloride. The reaction is carried out in the presence of 500 μM NTPs, 10 μM single-stranded DNA oligonucleotide and 1 μg enzyme / 10 μl reaction. The reaction is incubated over a temperature range starting at 15° C. and increasing to 37° C. at a rate of 1° C. / min. The reaction is carried out in a 10 μl volume and set up on ice.

[0150] For initial activity screening (Figure 5A), an equimolar mixture of single-stranded DNA oligonucleotides is used: PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45); PG5859 (GTCCTCAATCGCACTGGAAG, SEQ ID NO: 43); PG5860 (GTCCTCAATCGCACTGGAAC, SEQ ID NO: 44); PG5858 (GTCCTCAATCGCACTGGAAA, SEQ ID NO: 42). To assay the addition of NTPs to single-stranded DNA oligonucleotides (Figure 5B), PG5861 (GTCCTCAATCGCACTGGAAT, SEQ ID NO: 45) is used in each reaction.

[0151] The reaction is stopped by adding an equal volume of 2× NOVEX™ TBE-Urea Sample Buffer (ThermoFisher, Waltham, MA) and heated to 70° C. for 3 min. Samples are cooled and 15 μl is loaded onto a NOVEX™ TBE-Urea polyacrylamide gel (15%, ThermoFisher, Waltham, MA), electrophoresed at 150 V, stained with methylene blue, destained with water, and imaged under white light using an AZURE™ 200 gel imaging workstation.

[0152] Examples of results from the addition of ribonucleotides to DNA oligonucleotides are shown in Figure 5. Enzymes EDS017, EDS024, EDS029, EDS030, EDS066, EDS082, EDS048 and EDS015 all demonstrated the ability to incorporate ribonucleotides. In most cases, this incorporation was limited to 1-3 nucleotides.

[0153] The ability of different enzymes to add ribonucleotides to the ends of DNA oligonucleotides is summarized in Table 3. [Table 6]

[0154] References Andrade P,Martin MJ,Juarez R,Lopez de Saro F,Blanco L(2009).Limited terminal transferase in human DNA polymerase mu defines the required balance between accuracy and efficiencyin NHEJ.Proc Natl Acad Sci USA 106(38):16203-16208.

[0155] Beard WA, Wilson SH(2014).Structure and mechanism of DNA polymerase beta.Biochemistry 53(17):2768-2780.

[0156] Bebenek K, Kunkel TA (2002) Family growth: the eukaryotic DNA polymerase revolution. Cell Mol Life Sci. 59(1):54-57.

[0157] Berdis AJ(2009).Mechanisms of DNA polymerases.Chem Rev.109(7):2862-2879.

[0158] Berdis AJ(2014).DNA polymerases that perform template-independent DNA synthesis.Nucl.Acids Mol.Biol.30:109-137.

[0159] Bornscheuer UT, Hohne M, Eds. (2018). Protein Engineering: Methods and Protocols. Methods Mol Biol. 1685. Humana Press, New York, NY.

[0160] Callebaut I, Mornon JP (1997). From BRCA1 to RAP1: a widespread BRCT module closely associated with DNA repair. FEBS Lett. 400(1):25-30.

[0161] Chang YK, Huang YP, Liu XX, Ko TP, Bessho Y, Kawano Y, Maestre-Reyna M, Wu WJ, Tsai MD(2019). Human DNA Polymerase mu Can Use a Noncanonical Mechanism for Multiple Mn(2+)-Mediated Functions. J Am Chem Soc.141(21):8489-8502.

[0162] Chen Z, Zeng AP(2016).Protein engineering approaches to chemical biotechnology.Curr Opin Biotechnol.42:198-205.

[0163] Clark JM(1988).Novel non-templated nucleotide addition reactions catalyzed by prokaryotic and eucaryotic DNA polymerases.Nucl Acids Res 16(20):9677-9686.

[0164] Dahl JM,Wang H,Lazaro JM,Salas M,Lieberman KR(2014).Dynamics of translocation and substrate binding in individual complexes formed with active site mutants of {phi}29 DNA polymerase.J Biol Chem.289(10):6350-6361.

[0165] Deibel MR Jr, Coleman MS (1980). Biochemical properties of purified human terminal deoxynucleotidyltransferase. J Biol Chem. 255(9):4206-4212.

[0166] Delarue M, Boule JB, Lescar J, Expert-Bezancon N, Jourdan N, Sukumar N, Rougeon F, Papanicolaou C (2002). Crystal structures of a template-independent DNA polymerase: murine terminal deoxynucleotidyltransferase. EMBO J. 21(3):427-439.

[0167] Deshpande S, Yang Y, Chilkoti A, Zauscher S(2019).Enzymatic synthesis and modification of high molecular weight DNA using terminal deoxynucleotidyl transferase.Methods Enzymol.627:163-188.

[0168] Diehl F, Li M, He Y, Kinzler KW, Vogelstein B, Dressman D(2006).BEAMing: single-molecule PCR on microparticles in water-in-oil emulsions. Nat Methods 3(7):551-559.

[0169] Dominguez O, Ruiz JF, Lain de Lera T, Garcia-Diaz M, Gonzalez MA, Kirchhoff T, Martinez-A C, Bernad A, Blanco L (2000). DNA polymerase mu (Pol mu), homologous to TdT, could act as a DNA mutant in eukaryotic cells. as a DNA mutator in eukaryotic cells).EMBO J.19(7):1731-1742.

[0170] Efcavitch, WJ, Sylvester JE(2016).Modified template-independent enzymes for deoxynucleotide synthesis.World Intellectual Property Organization patent application WO 2016 / 064880 Al.

[0171] Eisenbeis S,Hocker B(2010).Evolutionary mechanism as a template for protein engineering.J Pept Sci.16(10):538-544.

[0172] Fiala KA,Brown JA,Ling H,Kshetry AK,Zhang J,Taylor JS,Yang W,Suo Z(2007).Mechanism of template-independent nucleotide incorporation catalyzed by a template-dependent DNA polymerase.J Mol Biol.365(3):590-602.

[0173] Foo JL, Ching CB, Chang MW, Leong SS(2012). The imminent role of protein engineering in synthetic biology. Biotechnol Adv.30(3):541-549.

[0174] Fowler JD, Suo Z(2006).Biochemical, structural, and physiological characterization of terminal deoxynucleotidyl transferase.Chem Rev.106(6):2092-2110.

[0175] Frank EG, McLenigan MP, McDonald JP, Huston D, Mead S, Woodgate R (2017). DNA polymerase iota: The long and the short of it! DNA Repair (Amst). 58: 47-51.

[0176] Ghadessy FJ, Ong JL, Holliger P(2001). Directed evolution of polymerase function by compartmentalized self-replication. Proc Natl Acad Sci USA 98(8):4552-4557.

[0177] Ghadessy FJ, Holliger P(2007). Compartmentalized self-replication: a novel method for the directed evolution of polymerases and other enzymes. Methods Mol Biol.352:237-248.

[0178] Global Oligonucleotide Synthesis Market Size, Industry Report, 2025. Grand View Research, San Francisco, CA, Oct 2018.

[0179] Golosov AA,Warren JJ,Beese LS,Karplus M(2010).The mechanism of the translocation step in DNA replication by DNA polymerase I:a computer simulation analysis.Structure 18(1):83-93.

[0180] Gouge J,Rosario S,Romain F,Beguin P,Delarue M(2013).Structures of intermediates along the catalytic cycle of terminal deoxynucleotidyltransferase:dynamical aspects of the two-metal ion mechanism.J Mol Biol.425(22):4334-4352.

[0181] Griffiths AD, Tawfik DS (2006). Miniaturising the laboratory in emulsion droplets. Trends Biotechnol. 24(9):395-402.

[0182] Guo C, Kosarek-Stancel JN, Tang TS, Friedberg EC(2009). Y-family DNA polymerases in mammalian cells. Cell Mol Life Sci.66(14):2363-2381.

[0183] Hiatt AC, Rose F (1995). 3' protected nucleotides for enzyme catalyzed template-independent creation of phosphodiester bonds. US patent 5,763,594 and related patents.

[0184] Hiatt AC, Rose F (1995). Compositions for enzyme catalyzed template-independent creation of phosphodiester bonds using protected nucleotides. US patent 5,808,045 and related patents.

[0185] Hoff K, Halpain M, Garbagnati G, Edwards JS, Zhou W(2020). Enzymatic Synthesis of Designer DNA Using Cyclic Reversible Termination and a Universal Template. ACS Synth Biol.9(2):283-293.

[0186] Hogg M, Sauer-Eriksson AE, Johansson E(2012). Promiscuous DNA synthesis by human DNA polymerase teta. Nucleic Acids Res.40(6):2611-22.

[0187] Hoitsma NM, Whitaker AM, Schaich MA, Smith MR, Fairlamb MS, Freudenthal BD (2020). Structure and function relationships in mammalian DNA polymerases. Cell Mol Life Sci. 77(1): 35-59.

[0188] Jarosz DF, Beuning PJ, Cohen SE, Walker GC (2007). Y-family DNA polymerases in Escherichia coli. Trends Microbiol. 15(2):70-77.

[0189] Jensen MA, Davis RW(2018).Template-Independent Enzymatic Oligonucleotide Synthesis(TiEOS):Its History, Prospects, and Challenges.Biochemistry 57(12):1821-1832.

[0190] Jensen MA,Griffin P,Davis RW(2018a).Free-running enzymatic oligonucleotide synthesis for data storage applications.bioRxiv June 2018.https: / / doi.org / 10.1101 / 355719.

[0191] Johnson LB, Huber TR, Snow CD (2014). Methods for library-scale computational protein design. Methods Mol Biol. 1216:129-59.

[0192] Juarez R, Ruiz JF, Nick McElhinny SA, Ramsden D, Blanco L(2006).A specific loop in human DNA polymerase mu allows switching between creative and DNA-instructed synthesis.Nucleic Acids Res.34(16):4572-4582.

[0193] Kaminski AM, Bebenek K, Pedersen LC, Kunkel TA (2020). DNA polymerase mu: An inflexible scaffold for substrate flexibility. DNA Repair (Amst). 93:102932.

[0194] Kaushik M, Sinha P, Jaiswal P, Mahendru S, Roy K, Kukreti S(2016).Protein engineering and de novo designing of a biocatalyst.J Mol Recognit.29(10):499-503.

[0195] Kazlauskas D, Krupovic M, Guglielmini J, Forterre P, Venclovas C (2020). Diversity and evolution of B-family DNA polymerases. Nucleic Acids Res. 48(18):10142-10156.

[0196] Kent T, Mateos-Gomez PA, Sfeir A, Pomerantz RT (2016). Polymerase teta is a robust terminal transferase that oscillates between three different mechanisms during end-joining. Elife 5: e13740.

[0197] Leatherbarrow RJ, Fersht AR (1986). Protein engineering. Protein Eng. 1(1):7-16.

[0198] Lee H, Wiegand DJ, Griswold K, Punthambaker S, Chun H, Kohman RE, Church GM(2020).Photon-directed multiplexed enzymatic DNA synthesis for molecular digital data storage.Nat Commun.11(1):5246.

[0199] Leisola M, Turunen O(2007).Protein engineering: opportunities and challenges.Appl Microbiol Biotechnol.75(6):1225-1232.

[0200] Loc'h J, Delarue M(2018).Terminal deoxynucleotidyltransferase: the story of an untemplated DNA polymerase capable of DNA bridging and templated synthesis across strands.Curr Opin Struct Biol.53:22-31.

[0201] Lutz S, Benkovic SJ (2000). Homology-independent protein engineering. Curr Opin Biotechnol. 11(4):319-324.

[0202] Lutz S, Iamurri SM (2018). Protein Engineering: Past, Present, and Future. Methods Mol Biol. 1685:1-12.

[0203] Lee HH, Kalhor R, Goela N, Bolot J, Church GM(2018). Enzymatic DNA synthesis for digital information storage. bioRxiv June 2018.

[0204] Lee HH, Kalhor R, Goela N, Bolot J, Church GM(2019).Terminator-free template-independent enzymatic DNA synthesis for digital information storage.Nat Commun.10(1):2383.

[0205] Marcheschi RJ, Gronenberg LS, Liao JC(2013). Protein engineering for metabolic engineering: current and next-generation tools. Biotechnol J.8(5):545-55.

[0206] Maxwell BA, Suo Z(2014).Recent insight into the kinetic mechanisms and conformational dynamics of Y-Family DNA polymerases.Biochemistry 3(17):2804-2814.

[0207] Miller OJ, Bernath K, Agresti JJ, Amitai G, Kelly BT, Mastrobattista E, Taly V, Magdassi S, Tawfik DS, Griffiths AD (2006). Directed evolution by in vitro compartmentalization. Nat Methods 3(7):561-570.

[0208] Moon, AF, Garcia-Diaz, M, Bebenek, K, Davis, BJ, Zhong, X, Ramsden, DA, Kunkel TA, Pedersen, LC (2007). Structural insight into the substrate specificity of DNA Polymerase mu. Nat. Struct. Mol. Biol. 2007, 14(1), 45-53.

[0209] Moon AF, Garcia-Diaz M, Batra VK, Beard WA, Bebenek K, Kunkel TA, Wilson SH, Pedersen LC (2007a). The X family portrait: structural insights into biological functions of X family polymerases. DNA Repair (Amst). 6(12):1709-1725.

[0210] Moon AF, Pryor JM, Ramsden DA, Kunkel TA, Bebenek K, Pedersen LC (2014). Sustained active site rigidity during synthesis by human DNA polymerase mu. Nat Struct Mol Biol. 21(3): 253-260.

[0211] Motea EA, Berdis AJ(2010).Terminal deoxynucleotidyl transferase: the story of a misguided DNA polymerase.Biochim Biophys Acta 1804(5):1151-1166.

[0212] Mueller R, Pajatsch M, Curdt I, Sobek H, Schmidt M, Suppmann B, Sonn K, Schneidinger B (2009). Recombinant terminal deoxynucleotidyl transferase with improved functionality. United States Patent 7,494,797.

[0213] Oligonucleotide Synthesis Market. MarketsandMarkets™ Research Private Ltd., Pune, India, April 2019.

[0214] O'Fagain C. Engineering protein stability (2011). Methods Mol Biol.681:103-36.

[0215] Packer MS, Liu DR(2015).Methods for the directed evolution of proteins.Nat Rev Genet.16(7):379-394.

[0216] Palluk S,Arlow DH,de Rond T,Barthel S,Kang JS,Bector R,Baghdassarian HM,Truong AN,Kim PW,Singh AK,Hillson NJ,Keasling JD(2018).De novo DNA synthesis using polymerase-nucleotide conjugates.Nat Biotechnol.36(7):645-650.

[0217] Perkel JM(2019).The race for enzymatic DNA synthesis heats up.Nature 566(7745):565.

[0218] Ramadan K, Shevelev I, Hubscher U (2004). The DNA-polymerase-X family: controllers of DNA quality? Nat Rev Mol Cell Biol. 5(12):1038-1043.

[0219] Rechkoblit O, Malinina L, Cheng Y, Kuryavyi V, Broyde S, Geacintov NE, Patel DJ (2006). Stepwise translocation of Dpo4 polymerase during error-free bypass of an oxoG lesion. PLoS Biol. 4(1):e11.

[0220] Ren Z(2016).Molecular events during translocation and proofreading extracted from 200 static structures of DNA polymerase.Nucleic Acids Res.44(15):7457-7474.

[0221] Repasky JA, Corbett E, Boboila C, Schatz DG (2004). Mutational analysis of terminal deoxynucleotidyltransferase-mediated N-nucleotide addition in V(D)J recombination. J Immunol. 172(9):5478-5488.

[0222] Ruiz JF, Dominguez O, Lain de Lera T, Garcia-Diaz M, Bernad A, Blanco L (2001). DNA polymerase mu, a candidate hypermutase? (DNA polymerase mu, a candidate hypermutase?) Philos Trans R Soc Lond B Biol Sci. 356(1405):99-109.

[0223] Samkurashvili I, Luse DS(1996).Translocation and transcriptional arrest during transcript elongation by RNA polymerase II.J Biol Chem.1996 Sep 20;271(38):23495-23505.

[0224] Sarac I, Hollenstein M(2019).Terminal Deoxynucleotidyl Transferase in the Synthesis and Modification of Nucleic Acids.Chembiochem 20(7):860-871.

[0225] Schott H, Schrade H(1984). Single-step elongation of oligodeoxynucleotides using terminal deoxynucleotidyl transferase. Eur J Biochem.143(3):613-620.

[0226] Shin H, Cho BK(2015).Rational Protein Engineering Guided by Deep Mutational Scanning.Int J Mol Sci.16(9):23094-23110.

[0227] Singh RK, Lee JK, Selvaraj C, Singh R, Li J, Kim SY, Kalia VC(2018). Protein Engineering Approaches in the Post-Genomic Era. Curr Protein Pept Sci. 19(1):5-15.

[0228] Sinha R, Shukla P(2019). Current Trends in Protein Engineering: Updates and Progress. Curr Protein Pept Sci. 20(5):398-407.

[0229] Swint-Kruse L(2016).Using Evolution to Guide Protein Engineering:The Devil IS in the Details.Biophys J.111(1):10-18.

[0230] Takeuchi R, Choi M, Stoddard BL(2014).Redesign of extensive protein-DNA interfaces of meganucleases using iterative cycles of in vitro compartmentalization.Proc Natl Acad Sci US A.111(11):4061-4066.

[0231] Tawfik DS, Griffiths AD (1998). Man-made cell-like compartments for molecular evolution. Nature Biotechnol. 16(7):652-656.

[0232] Tay Y,Ho C,Droge P,Ghadessy FJ(2010).Selection of bacteriophage lambda integrases with altered recombination specificity by in vitro compartmentalization.Nucleic Acids Res.38(4):e25.

[0233] Trakselis MA, Murakami KS(2014). Introduction to Nucleic Acid Polymerases: Families, Themes, and Mechanisms. Nucl. Acids Mol. Biol. 30:1-15.

[0234] Uchiyama Y, Takeuchi R, Kodera H, Sakaguchi K(2009).Distribution and roles of X-family DNA polymerases in eukaryotes.Biochimie 91(2):165-170.

[0235] Vaisman A, Woodgate R(2017).Translesion DNA polymerases in eukaryotes:what makes them tick?Crit Rev Biochem Mol Biol.2017 Jun;52(3):274-303.

[0236] Wilding M, Hong N, Spence M, Buckle AM, Jackson CJ (2019). Protein engineering: the potential of remote mutations. Biochem Soc Trans. 47(2):701-711.

[0237] Woodley JM(2013).Protein engineering of enzymes for process applications.Curr Opin Chem Biol.17(2):310-316.

[0238] Wrenbeck EE, Faber MS, Whitehead TA(2017).Deep sequencing methods for protein engineering and design.Curr Opin Struct Biol.45:36-44.

[0239] Yamtich J, Sweasy JB (2010). DNA polymerase family X: function, structure, and cellular roles. Biochim Biophys Acta 1804(5):1136-1150.

[0240] Yang W(2014).An overview of Y-Family DNA polymerases and a case study of human DNA polymerase eta.Biochemistry 53(17):2793-2803.

[0241] Yang W, Gao Y(2018).Translesion and Repair DNA Polymerases:Diverse Structure and Mechanism.Annu Rev Biochem.87:239-261.

[0242] Yang KK,Wu Z,Arnold FH(2019).Machine-learning-guided directed evolution for protein engineering.Nat Methods 16(8):687-694.

[0243] Zahn KE,Wallace SS,Doublie S(2011).DNA polymerases provide a canon of strategies for translesion synthesis past oxidatively generated lesions.Curr Opin Struct Biol.21(3):358-369.

[0244] Zawaira A,Pooran A,Barichievy S,Chopera D(2012).A discussion of molecular biology methods for protein engineering.Mol Biotechnol.51(1):67-102.

[0245] Zoller MJ(1991).New molecular biology methods for protein engineering.Curr Opin Biotechnol.2(4):526-531.

[0246] All publications, databases, GenBank sequences, patents, and patent applications cited in this specification are herein incorporated by reference as if each was specifically and individually indicated to be incorporated by reference. [Sequence List Free Text]

[0247] Sequence Listing 11 <223> His6-tagged clone EDS017 sequence Sequence Listing 12 <223> His6-tagged clone EDS024 sequence Sequence Listing 13 <223> His6-tagged clone EDS029 sequence Sequence Listing 14 <223> His6-tagged clone EDS030 sequence Sequence Listing 15 <223> His6-tagged clone EDS053 sequence Sequence Listing 16 <223> His6-tagged clone EDS054 sequence Sequence Listing 17 <223> His6-tagged clone EDS066 sequence Sequence Listing 18 <223> His6-tagged clone EDS082 sequence Sequence Listing 19 <223> His6-tagged clone EDS048 sequence Sequence Listing 20 <223> His6-tagged clone EDS015 sequence Sequence Listing 21 <223> His6-tagged EDS017 expressed protein sequence Sequence Listing 22 <223> His6-tagged EDS024 expressed protein sequence Sequence Listing 23 <223> His6-tagged EDS029 expressed protein sequence Sequence Listing 24 <223> His6-tagged EDS030 expressed protein sequence Sequence Listing 25 <223> His6-tagged EDS053 expressed protein sequence Sequence Listing 26 <223> His6-tagged EDS054 expressed protein sequence Sequence Listing 27 <223> His6-tagged EDS066 expressed protein sequence Sequence Listing 28 <223> His6-tagged EDS082 expressed protein sequence Sequence Listing 29 <223> His6-tagged EDS048 expressed protein sequence Sequence Listing 30 <223> His6-tagged EDS015 expressed protein sequence Sequence Listing 31 <223> PP1077 expression vector complete sequence Sequence Listing 32 <223> Complete sequence of PP1084 expression vector Sequence Listing 33 <223> PP1089 expression vector complete sequence Sequence Listing 34 <223> Complete sequence of PP1090 expression vector Sequence Listing 35 <223> PP1113 expression vector complete sequence Sequence Listing 36 <223> PP1114 expression vector complete sequence Sequence Listing 37 <223> Complete sequence of PP1126 expression vector Sequence Listing 38 <223> PP1142 expression vector complete sequence Sequence Listing 39 <223> PP1108 expression vector complete sequence Sequence Listing 40 <223> PP1075 expression vector complete sequence Sequence Listing 41 <223> PG1350 Oligonucleotides Sequence Listing 42 <223> PG5858 Oligonucleotide Sequence Listing 43 <223> PG5859 Oligonucleotide Sequence Listing 44 <223> PG5860 Oligonucleotide Sequence Listing 45 <223> PG5861 Oligonucleotide Sequence Listing 46 <223> PG5864 Oligonucleotide Sequence Listing 47 <223> PG5865 Oligonucleotide Sequence Listing 48 <223> PG5866 Oligonucleotide Sequence Listing 49 <223> PG5868 Oligonucleotide Sequence Listing 50 <223> PG5869 Oligonucleotide Sequence Listing 51 <223> PG5870 Oligonucleotide Sequence Listing 52 <223> PG5871 Oligonucleotide Sequence Listing 53 <223> PG5872 Oligonucleotide Sequence Listing 54 <223> PG5867 Oligonucleotide

Claims

1. (a) combining in a single container a nucleic acid substrate, an excess of free unblocked nucleoside triphosphates, and at least one template-independent nucleic acid polymerase; (b) reacting the mixture of step (a) under conditions such that the at least one template-independent nucleic acid polymerase is active and adds only single nucleotides to the nucleic acid substrate present in the reaction to form a novel nucleic acid molecule without inducing or inducing a change to the at least one template-independent nucleic acid polymerase or to the activity of the at least one template-independent nucleic acid polymerase; (c) separating the novel nucleic acid molecule from free unblocked nucleoside triphosphates and optionally from the at least one template-independent nucleic acid polymerase; (d) repeating steps (a) to (c) to obtain the desired synthesized nucleic acid, wherein the novel nucleic acid molecule of step (c) serves as the nucleic acid substrate of step (a) until the desired nucleic acid is synthesized. A process for synthesizing a desired nucleic acid, comprising:

2. The process of claim 1, wherein the nucleic acid substrate is RNA.

3. The process of claim 1, wherein the nucleic acid substrate is DNA.

4. The process of claim 1, wherein the nucleic acid substrate is a chimeric nucleic acid containing both ribonucleotides and deoxyribonucleotides.

5. The process according to any one of claims 1 to 4, wherein the desired synthesized nucleic acid is RNA.

6. The process according to any one of claims 1 to 4, wherein the desired synthesized nucleic acid is DNA.

7. The process according to any one of claims 1 to 4, wherein the desired synthesized nucleic acid is a chimeric molecule containing both ribonucleotides and deoxyribonucleotides.

8. The process according to any one of claims 1 to 4, wherein the at least one template-independent nucleic acid polymerase is an RNA polymerase.

9. The process according to any one of claims 1 to 4, wherein the at least one template-independent nucleic acid polymerase is a DNA polymerase.

10. The process according to any one of claims 1 to 4, wherein the at least one template-independent nucleic acid polymerase is an X-family DNA polymerase.

11. The process according to any one of claims 1 to 4, wherein the at least one template-independent nucleic acid polymerase is a Y-family DNA polymerase.

12. The process according to any one of claims 1 to 4, wherein the nucleic acid substrate is immobilized on a solid support.

13. The process according to any one of claims 1 to 4, wherein the at least one template-independent nucleic acid polymerase is 36 to 100% efficient in adding only single nucleotides to the nucleic acid substrate.

14. The process according to any one of claims 1 to 4, wherein the at least one template-independent nucleic acid polymerase is 60 to 100% efficient in adding only single nucleotides to the nucleic acid substrate.

15. The process according to any one of claims 1 to 4, wherein the at least one template-independent nucleic acid polymerase is 80 to 100% efficient in adding only single nucleotides to the nucleic acid substrate.

16. The process according to any one of claims 1 to 4, wherein the at least one template-independent nucleic acid polymerase is 90 to 100% efficient in adding only single nucleotides to the nucleic acid substrate.

17. The process according to any one of claims 1 to 4, wherein the at least one template-independent nucleic acid polymerase is 100% efficient in adding only a single nucleotide to the nucleic acid substrate.

18. The process according to any one of claims 1 to 4, wherein there is a molar excess of the at least one template-independent nucleic acid polymerase relative to the nucleic acid substrate or the 3' end of the nucleic acid substrate.

19. The process according to any one of claims 1 to 4, wherein an equimolar amount of the at least one template-independent nucleic acid polymerase and the nucleic acid substrate or the 3' end of the nucleic acid substrate is present.

20. The process according to any one of claims 1 to 4, wherein there is a molar excess of the nucleic acid substrate or the 3' end of the nucleic acid substrate relative to the at least one template-independent nucleic acid polymerase.

21. The process according to any one of claims 1 to 4, wherein the at least one template-independent nucleic acid polymerase used in step (d) is different from the at least one template-independent nucleic acid polymerase used in step (a).

22. The process according to any one of claims 1 to 4, wherein the at least one template-independent nucleic acid polymerase is immobilized on a solid support.