Inverted chimeric sRNA molecules and methods of use thereof
Patent Information
- Application Number
- JP2023578074
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-06-21
- Filing Date
- 2022-06-21
- Publication Date
- 2025-06-09
AI Technical Summary
Current therapeutic agents have low efficacy and lack specificity in targeting the KRAS pathway, limiting treatment options for cancers driven by KRAS mutations, while c-Myc is an oncogenic driver with no effective drugs, and simultaneous inhibition of both KRAS and c-Myc shows potential additive or synergistic anticancer effects.
Development of inverted chimeric siRNA molecules that link two chemically modified siRNAs through a metabolically fragile phosphodiester DNA bridge to target and inhibit both c-Myc and KRAS genes simultaneously.
The inverted chimeric siRNA molecules provide superior gene expression inhibition compared to single or tandem siRNAs, effectively reducing c-Myc and KRAS expression, leading to decreased cancer cell viability and spheroid formation.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] Priority statement This application claims priority to U.S. Provisional Application No. 63 / 212,976, filed June 21, 2021, the entire contents of which are incorporated by reference herein.
[0002] The present invention relates to inverted chimeric siRNA molecules and their use in inhibiting the expression of one or more target genes.The present invention further relates to the inhibition of the expression of c-Myc, or the dual inhibition of c-Myc and KRAS, using RNA interference, chemically modified oligonucleotides, and / or multivalent combinations of chimeric siRNAs. [Background technology]
[0003] Although c-Myc protein is well characterized as an oncogenic driver of aggressive cancers, it is generally considered "undruggable" due to its subcellular localization, ubiquitous tissue expression, and lack of enzyme binding sites. Similarly, RAS genes encode a family of small GTPases that act on downstream effector proteins to promote cell survival, growth, and proliferation (Khosravi-Far et al., Cancer Metastasis Rev., 13:67 (1994)). Proper function of RAS proteins depends on their activation via guanine nucleotide exchange factors (GEFs) to their active GTP-bound form and on membrane association of the RAS-GTP complex, both of which have been proposed as targets for KRAS inhibition. However, due to the low efficacy and target specificity of previously proposed therapeutics in directly inhibiting KRAS, current avenues for targeting the KRAS pathway are primarily focused on inhibiting downstream effector proteins (Cox et al., Nat. Rev. Drug Discov., 13:828 (2014)). Nevertheless, despite the challenges in developing small molecules that directly downregulate gene activity, KRAS remains a therapeutically relevant target due to its prevalence as a driving mutation in human cancers. Recent studies have revealed that c-Myc and mutant KRAS are tightly coupled (Vaseva et al., Cancer Cell, 34(5) (2018)), suggesting that the ability to simultaneously silence both targets may have additive and / or synergistic anticancer effects. Summary of the Invention [Problem to be solved by the invention]
[0004] The present invention overcomes the deficiencies in the art by providing compositions and methods using RNA interference for specific inhibition of c-Myc sequence and the combination of c-Myc and KRAS.Furthermore, the present invention provides compositions and methods using novel chimeric siRNA designs, in which two chemically modified siRNAs are linked by metabolically fragile phosphodiester DNA bridges to specifically inhibit one or more target genes simultaneously, for example c-Myc and KRAS or any other gene of interest. [Means for solving the problem]
[0005] The present invention is based on the development of inverted chimeric siRNA molecules. These constructs provide remarkable inhibition of gene expression of one or more target genes, and are unexpectedly superior to single siRNAs and tandem chimeric siRNAs. Thus, one aspect of the present invention is to a) a first RNA comprising a first strand of a first siRNA and a first strand of a second siRNA linked by a linker; b) a second RNA that is substantially complementary to the first strand of the first siRNA; and c) a third RNA that is substantially complementary to the first strand of the second siRNA; and The present invention relates to an inverted chimeric siRNA molecule comprising a first and a second siRNA in opposite orientations, comprising:
[0006] Another aspect of the present invention pertains to compositions, eg, pharmaceutical compositions, comprising one or more of the inverted-chimeric siRNA molecules of the present invention.
[0007] A further aspect of the present invention relates to a method of inhibiting expression of a target gene in a cell comprising contacting the cell with an inverted chimeric siRNA molecule, composition and / or pharmaceutical composition of the present invention, thereby inhibiting expression of the target gene in the cell.
[0008] An additional embodiment of the present invention relates to a method of treating a disorder associated with a target gene in a subject in need thereof, comprising delivering to the subject an inverted chimeric siRNA molecule, composition, and / or pharmaceutical composition of the present invention, thereby treating the disorder in the subject.
[0009] Another embodiment of the present invention relates to a method of treating a cancer that overexpresses the human c-Myc gene in a subject in need thereof, comprising delivering to the subject an inverted chimeric siRNA molecule of the present invention, thereby treating the cancer in the subject.
[0010] The present invention is further based on the identification of an RNA molecule that inhibits the expression of a c-Myc sequence. Thus, one aspect of the present invention relates to a double-stranded RNA molecule comprising an antisense strand and a sense strand, wherein the nucleotide sequence of the antisense strand is complementary to a region of the nucleotide sequence of the human c-Myc gene, the region consisting essentially of about 18 to about 25 contiguous nucleotides, and the double-stranded RNA molecule inhibits the expression of the human c-Myc gene. Recent studies have revealed that c-Myc and mutant KRAS are tightly coupled (Vaseva et al., Cancer Cell, 34(5)(2018)), suggesting that the ability to simultaneously silence both targets may have additive and / or synergistic anti-cancer effects. In one embodiment, multiple siRNAs are used to simultaneously inhibit both c-Myc and KRAS genes.
[0011] Another aspect of the invention pertains to compositions, such as pharmaceutical compositions, comprising one or more of the RNA molecules of the invention.
[0012] A further aspect of the invention relates to a method of inhibiting expression of the human c-Myc gene comprising contacting a cell with an RNA molecule of the invention, thereby inhibiting expression of the human c-Myc gene in the cell.
[0013] An additional embodiment of the present invention relates to a method of treating cancer comprising overexpression of the human c-Myc gene in a subject in need thereof comprising delivering to the subject an RNA molecule of the present invention, thereby treating the cancer in the subject.
[0014] Another aspect of the present invention relates to the use of the RNA molecules of the present invention to inhibit expression of the human c-Myc gene in cells and to treat cancers involving overexpression of the human c-Myc gene in a subject in need thereof.
[0015] Another embodiment of the present invention comprises at least one chemical modification and has the following sequence pair: The sense strand of SEQ ID NO: 37 and the antisense strand of SEQ ID NO: 38, The sense strand of SEQ ID NO: 39 and the antisense strand of SEQ ID NO: 40, The sense strand of SEQ ID NO: 41 and the antisense strand of SEQ ID NO: 42, the sense strand of SEQ ID NO: 43 and the antisense strand of SEQ ID NO: 44, or The sense strand of SEQ ID NO: 45 and the antisense strand of SEQ ID NO: 46, or a sequence at least 90% identical thereto The present invention relates to siRNA molecules targeting naturally occurring human c-Myc mRNA, including one of the following:
[0016] Another aspect of the present invention pertains to compositions, such as pharmaceutical compositions, comprising one or more of the siRNA molecules of the present invention.
[0017] A further aspect of the present invention relates to a method of inhibiting expression of the human c-Myc gene in a cell comprising contacting the cell with a siRNA molecule of the present invention, thereby inhibiting expression of the human c-Myc gene in the cell.
[0018] An additional embodiment of the present invention relates to a method of treating a cancer comprising overexpression of the human c-Myc gene in a subject in need thereof comprising delivering to the subject an antisense oligonucleotide or siRNA molecule of the present invention, thereby treating the cancer in the subject.
[0019] Another aspect of the present invention relates to the use of the siRNA molecules of the present invention for inhibiting expression of the human c-Myc gene in cells and for treating cancer involving overexpression of the human c-Myc gene in a subject in need thereof.
[0020] Another embodiment of the present invention is a double-stranded RNA molecule, wherein a first RNA molecule comprises an antisense strand and a sense strand that target a human c-Myc gene, and a second RNA molecule comprises an antisense strand and a sense strand that target a naturally occurring KRAS sequence that can encode a mutation selected from G12C, G12D, G12V, or G13D, the nucleotide sequence of the first RNA molecule having an antisense strand that is complementary to a region of the nucleotide sequence of the human c-Myc gene, the region consisting essentially of about 18 to about 25 contiguous nucleotides, and the double-stranded RNA molecule comprises a nucleotide sequence that is complementary to a region of the nucleotide sequence of the human c-Myc gene, the region consisting essentially of about 18 to about 25 contiguous nucleotides, The present invention relates to a double-stranded RNA molecule, wherein the first strand inhibits expression of the human c-Myc gene, and the nucleotide sequence of the second RNA molecule has an antisense strand complementary to a region of the nucleotide sequence of a naturally occurring KRAS sequence that can encode a mutation selected from G12C, G12D, G12V, or G13D, wherein the region consists essentially of about 18 to about 25 contiguous nucleotides, and wherein the double-stranded RNA molecule inhibits expression of a naturally occurring KRAS sequence that encodes a mutation selected from G12C, G12D, G12V, G13D, or a KRAS wild-type sequence.
[0021] Another embodiment of the present invention is a siRNA molecule, wherein a first siRNA molecule targets naturally occurring human c-Myc mRNA and contains at least one chemical modification and has the following sequence pair: The sense strand of SEQ ID NO: 37 and the antisense strand of SEQ ID NO: 38, The sense strand of SEQ ID NO: 39 and the antisense strand of SEQ ID NO: 40, The sense strand of SEQ ID NO: 41 and the antisense strand of SEQ ID NO: 42, the sense strand of SEQ ID NO: 43 and the antisense strand of SEQ ID NO: 44, or The sense strand of SEQ ID NO: 45 and the antisense strand of SEQ ID NO: 46, or a sequence at least 90% identical thereto and the second siRNA molecule comprises at least one chemical modification targeting a naturally occurring KRAS sequence, which can encode a mutation selected from G12C, G12D, G12V, G13D, or a wild-type sequence. In some embodiments, the siRNA molecule comprises the following sequence pairs: The sense strand of SEQ ID NO: 47 and the antisense strand of SEQ ID NO: 48, The sense strand of SEQ ID NO: 49 and the antisense strand of SEQ ID NO: 50, or a sequence at least 90% identical thereto Contains one of the following:
[0022] Another aspect of the present invention pertains to compositions, such as pharmaceutical compositions, comprising one or more of the siRNA molecules of the present invention.
[0023] A further aspect of the present invention relates to a method of inhibiting expression in a cell of the human c-Myc gene and a naturally occurring KRAS sequence, which may encode a mutation selected from G12C, G12D, G12V, G13D, or a wild-type sequence, comprising contacting the cell with an siRNA molecule of the present invention, thereby inhibiting expression in the cell of the human c-Myc gene and a naturally occurring KRAS sequence, which may encode a mutation selected from G12C, G12D, G12V, G13D, or a wild-type sequence.
[0024] An additional embodiment of the present invention relates to a method of treating a cancer comprising overexpression of the human c-Myc gene and a naturally occurring KRAS sequence, which can encode a mutation selected from G12C, G12D, G12V, G13D, or a wild-type sequence, in a subject in need thereof comprising delivering to the subject an siRNA molecule of the present invention, thereby treating the cancer in the subject.
[0025] Another aspect of the present invention relates to the use of the siRNA molecules of the present invention for inhibiting expression in a cell of the human c-Myc gene and a naturally occurring KRAS sequence, which can encode a mutation selected from G12C, G12D, G12V, G13D, or a wild-type sequence, and for treating a cancer comprising overexpression of human c-Myc and a naturally occurring KRAS sequence, which can encode a mutation selected from G12C, G12D, G12V, G13D, or a wild-type sequence, in a subject in need thereof.
[0026] These and other aspects of the invention are described in greater detail in the description of the invention below. [Brief description of the drawings]
[0027] [Figure 1A-1C] FIG. 1 shows that synthetic siRNAs ("siRs") can reduce c-Myc mRNA transcript and protein expression in MIA-PaCa2 cells. A) MIA-PaCa2 cells were treated with control siRNA targeting snord90 and eight c-Myc targeting siRNAs at 20 nM for 24 and 48 hours. B) MIA-PaCa2 cells were treated with negative control siRNA targeting snord90, positive control siRNA from a previously published paper, and eight c-Myc targeting siRNAs at 20 nM for 24 hours and then immunoblotted. Vinculin was used as an internal control. C) Quantification of c-Myc band intensity from panel B. [Figure 2A-2B]Figure 1 shows that synthetic chemically modified siRNAs can substantially reduce c-Myc mRNA transcripts. A) MIA-PaCa2 cells were treated with control siRNAs with 2'Ome modifications and five chemically modified (Hi2F) c-Myc targeting siRNAs at 20 nM for 24, 48, and 72 hours. B) A427 cells were treated with control siRNAs with 2'Ome modifications and five chemically modified (Hi2F) c-Myc targeting siRNAs at 20 nM for 24 and 72 hours. [Figure 3A-3D] Figure 1 shows that synthetic, chemically modified siRNAs can reduce c-Myc protein expression. A) MIA-PaCa2 and A427 cells were treated with control siRNAs with 2'Ome modifications and siRNAs targeting chemically modified (Hi2F) c-Myc at 20 nM for 48 (A427) and 72 (MIA-PaCa2) hours and then immunoblotted. Vinculin was used as an internal control. B) Quantification of c-Myc band intensity from panel A. C) A427 cells were treated with control siRNAs with 2'Ome modifications and siRNAs targeting chemically modified (Hi2F and Hi2OMe) c-Myc at 20 nM for 48 hours. D) MIA-PaCa2 cells were treated with control siRNAs with 2'Ome modifications and siRNAs targeting chemically modified (Hi2F and Hi2OMe) c-Myc at 20 nM for 72 hours. [Figure 4A-4B] Synthetic, chemically modified siRNAs reduce in vitro spheroid formation. A) MIA-PaCa2 and A427 cells were treated with control siRNA with 2'Ome modifications and two chemically modified (Hi2F) c-Myc targeting siRNAs at 20 nM for 24 h and then grown in Matrigel for 5 days. Representative phase contrast images were taken using a 5x objective with a confocal microscope. B) Quantification of mean spheroid area from the images in panel A. ****p=<0.0001, ***p=0.0002. [Figure 5A-5D]Dual targeting of c-Myc and KRAS with chemically modified siRNAs in MIA-PaCa2 cells results in a reduction in spheroid area and number. A) MIA-PaCa2 cells were treated with a control siRNA with 2'Ome modification and two chemically modified siRNAs targeting c-Myc (Hi2F) and KRAS (Hi2OMe) at 5 nM for 24 hours and then grown in Matrigel for 5 days. Representative phase contrast images were taken using a confocal microscope with a 5x objective. B) Quantification of spheroid area and number from confocal images using Organoseg. *p=0.0027, **p=0.0147, ***p=0.0022, ****p=0.0113. C) MIA-PaCa2 cells were treated with control siRNA with 2'Ome modification and two chemically modified siRNAs targeting c-Myc (Hi2F) and KRAS (Hi2OMe) at 5 nM for 24 hours, then seeded in 96-well round-bottom plates and imaged for 5 days using an Incucyte. D) After imaging using an Incucyte, cells were mixed with CellTiter Glo 3D from Promega and fluorescence was measured using a plate reader to determine metabolic activity. ****p=<0.0001. [Figure 6A-6F]Dual targeting of c-Myc and KRAS with chemically modified siRNAs in A427 cells results in a reduction in spheroid area and number. A) A427 cells were treated with control siRNA with 2'Ome modification and two chemically modified siRNAs targeting c-Myc (Hi2F) and KRAS (Hi2OMe) at 10 nM for 24 hours and then grown in Matrigel for 5 days. Representative phase contrast images were taken using a confocal microscope with a 5x objective. B) Quantification of spheroid area and number from confocal images using Organoseg. ****p=<0.0001. C) A427 cells were treated with control siRNA with 2'Ome modification and two chemically modified siRNAs targeting c-Myc (Hi2F) and KRAS (Hi2OMe) at 10 nM for 24 hours and then seeded in 96-well round-bottom plates and imaged for 5 days using Incucyte. D) After imaging with Incucyte, cells were mixed with CellTiter Glo 3D (Promega) and fluorescence was measured with a plate reader to determine metabolic activity. E, F) A427 cells were treated with control siRNA with 2'Ome modification and two chemically modified siRNAs targeting c-Myc (Hi2F) and KRAS (Hi2OMe) at 10 nM for 24 hours, then seeded in 96-well round-bottom plates with CellTox Green and imaged for 5 days with Incucyte. Graph shows data up to 84 hours. ****p=<0.0001. [Figure 7] FIG. 1 is a schematic showing phosphodiester-linked, chemically modified siRNAs combining siRNAs targeting KRAS and cMyc in two orientations ("inverted chimera" and "tandem chimera"). [Figure 8]Figure 1 shows that phosphodiester-linked chemically modified siRs combining KRAS and cMyc targeting siRs ("inverse chimeras") are biologically active and can reduce c-Myc and KRAS mRNA transcripts in MIA-PaCa2 cells. MIA-PaCa2 cells were treated with control siRNAs with 2'Ome modifications, one chemically modified (Hi2F) c-Myc targeting siRNA, and one chemically modified (Hi2OMe) KRAS targeting siRNA (either alone or in combination), and one "inverse chimera" siRNA at 5 nM, 10 nM, and 20 nM for 48 and 72 hours. [Figure 9] 1 shows that inverted chimeras are more potent than tandem chimeras in reducing c-Myc and KRAS mRNA transcripts in A427 cells. A427 cells were treated with control siRNA with 2'Ome modification, one chemically modified (Hi2F) siRNA targeting c-Myc, one chemically modified (Hi2OMe) siRNA targeting KRAS, one M2 / K2 "inverted chimera", or one M2 / K2 "tandem chimera" siRNA at 5 nM and 20 nM for 48 and 72 hours. [Figure 10A-10C]Figure 2: Inverted chimeras are more potent than tandem chimeras in reducing c-Myc and KRAS mRNA transcripts in MIA-PaCa2 cells. A) MIA-PaCa2 cells were treated with control siRNA with 2'Ome modification, one chemically modified (Hi2F) siRNA targeting c-Myc, one chemically modified (Hi2OMe) siRNA targeting KRAS, one M2 / K2 "inverted chimera", or one M2 / K2 "tandem chimera" siRNA at 5 nM and 20 nM for 48 and 72 hours. B) MIA-PaCa2 cells were treated with control siRNA with 2'Ome modification, two chemically modified (Hi2F) siRNAs targeting c-Myc, two chemically modified (Hi2OMe) siRNAs targeting c-Myc, one chemically modified (Hi2OMe) siRNA targeting KRAS, one M2 / K2 "inverted chimera", or one M2 / K2 "tandem chimera" siRNA at 20 nM for 72 h and then immunoblotted. Vinculin was used as an internal control. C) Quantification of band intensities of c-Myc and KRAS from B. [Figure 11] Figure 1 shows that inverted chimeras are more stable than tandem chimeras in 50% serum. One chemically modified (Hi2F) siRNA targeting c-Myc, one chemically modified (Hi2OMe) siRNA targeting KRAS, one M2 / K2 "inverted chimera", or one M2 / K2 "tandem chimera" siRNA was incubated at 10 uM in 50% FBS at 37°C for 0, 6, and 24 hours. The reaction was stopped with 0.5 M EDTA. Quantification of siR band intensity is shown on the right. [Figure 12] Figure 1 shows that both chimeras are stable in cytosolic conditions. One chemically modified (Hi2F) siRNA targeting c-Myc, one chemically modified (Hi2OMe) siRNA targeting KRAS, one M2 / K2 "inverted chimera", or one M2 / K2 "tandem chimera" siRNA were incubated in buffered rat liver cytosol at 37°C for 0, 6, and 24 hours. The reaction was stopped with 0.5 M EDTA. Quantification of siR band intensity is shown on the right. [Figure 13] Both chimeras began to dissociate in endosomal conditions. One chemically modified (Hi2F) siRNA targeting c-Myc, one chemically modified (Hi2OMe) siRNA targeting KRAS, one M2 / K2 "inverted chimera", or one M2 / K2 "tandem chimera" siRNA were incubated in acidified rat liver tritosomes at 37° C. for 0, 6, and 24 hours. The reaction was stopped with 0.5 M EDTA. Quantification of siR band intensity is shown on the right. [Figures 14A-14C] Dicer does not cleave either the inverted or tandem chimeras. A) One chemically modified (Hi2F) c-Myc targeting siRNA, one chemically modified (Hi2OMe) KRAS targeting siRNA, one M2 / K2 "inverted chimera", or one M2 / K2 "tandem chimera" siRNA was incubated with buffered recombinant Dicer for 0, 6, and 24 hours at 37°C. Reactions were stopped with 0.5 M EDTA. Quantification of siR band intensity is shown on the right. HEK293T parental (B) and NoDice (C) cell lines were treated with control siRNA with 2'Ome modification, one chemically modified (Hi2F) c-Myc targeting siRNA, one chemically modified (Hi2OMe) KRAS targeting siRNA, one M2 / K2 "inverted chimera", or one M2 / K2 "tandem chimera" siRNA at 5 nM and 20 nM for 48 hours. [Figure 15]Figure 1 shows that inverted chimeras result in increased potency for KRAS-luciferase proteins over tandem chimeras. A431 isogenic cell lines in which endogenous KRAS was ablated by CRISPR / Cas9 and stably integrated KRAS-firefly luciferase and unlabeled Renilla luciferase were treated with control siRNA with 2'Ome modifications, one chemically modified (Hi2F) siRNA targeting c-Myc, one chemically modified (Hi2OMe) siRNA targeting KRAS, one M2 / K2 "inverted chimera", or one M2 / K2 "tandem chimera" siRNA for 96 h at doses ranging from 39 to 0.002 nM. Renilla luciferase was used to normalize the firefly luciferase data. [Figure 16A-16B] FIG. 1 shows that V2 of the inverted chimera provides equivalent potency against c-Myc and KRAS mRNA as V1. MIA-PaCa2 (A) and A427 (B) cells were treated with a control siRNA with 2'Ome modification, one M2 / K2 "inverted chimera" version 1 siRNA, or one M2 / K2 "inverted chimera" version 2 siRNA at 4 nM and 10 nM for 72 hours. [Figure 17A-17B] Figure 2: Inverted chimera V2 results in increased reduction of c-Myc and KRAS proteins in A427 cells compared to single siRNAs. A) A427 cells were treated with control siRNA with 2'Ome modification, one chemically modified (Hi2OMe) c-Myc targeting siRNA, one chemically modified (Hi2OMe) KRAS targeting siRNA, or one M2 / K2 "inverted chimera" version 2 siRNA at 5 nM and 20 nM for 72 hours and then immunoblotted. Vinculin was used as an internal control. B) Quantification of band intensities of c-Myc, KRAS, pERK(1 / 2) / tERK(1 / 2), and pS6 from panel A. All conditions were normalized using the band intensity of vinculin. [Figure 18A-18B]Figure 2: Inverted chimera V2 results in increased reduction of c-Myc and KRAS proteins in MIA-PaCa2 cells compared to single siRNAs. A) MIA-PaCa2 cells were treated with control siRNA with 2'Ome modification, one chemically modified (Hi2OMe) c-Myc targeting siRNA, one chemically modified (Hi2OMe) KRAS targeting siRNA, or one M2 / K2 "inverted chimera" version 2 siRNA at 5 nM and 20 nM for 72 hours and then immunoblotted. Vinculin was used as an internal control. B) Quantification of c-Myc, KRAS, and pERK(1 / 2) / tERK(1 / 2) band intensities from A. All conditions were normalized using vinculin band intensity. [Figure 19] Figure 1: V2 of the inverted chimera provides high potency for KRAS-luciferase protein. A431 KRAS knockout cell lines stably integrated with KRAS-firefly luciferase and unlabeled Renilla luciferase were treated with control siRNA with 2'Ome modification, one chemically modified (Hi2OMe) siRNA targeting c-Myc, one chemically modified (Hi2OMe) siRNA targeting KRAS, or one M2 / K2 "inverted chimera" version 2 siRNA for 96 h at doses ranging from 21 to 0.001 nM. Renilla luciferase was used to normalize the firefly luciferase data. [Figure 20A-20B] Figure 1 shows that inverted chimera V2 synergistically reduces cell viability in multiple cell lines. MIA-PaCa2 (A) and A427 (B) cells were treated with control siRNA with 2'Ome modification, one chemically modified (Hi2OMe) siRNA targeting c-Myc, one chemically modified (Hi2OMe) siRNA targeting KRAS, or one M2 / K2 "inverted chimera" version 2 siRNA for 120 hours at doses ranging from 40 nM to 0.019 nM. [Figures 21A-21D]Figure 1 shows that inverted chimera V2 reduces spheroid viability in multiple cell lines. A427 (A) and MIA-PaCa2 (B) cells were treated with control siRNA with 2'Ome modification, one chemically modified (Hi2OMe) siRNA targeting c-Myc, one chemically modified (Hi2OMe) siRNA targeting KRAS, or one M2 / K2 "inverted chimera" version 2 siRNA at 5 nM for 24 hours and then grown in Matrigel for 5 days. Representative phase contrast images were taken using a confocal microscope with a 5x objective. C) Quantification of spheroid area and number in A427 from confocal images using Organoseg. ***p=0.004, **p=0.0084, ****p=<0.001. D) Quantification of spheroid area and number in A427. *p=0.0435, **p=0.0182, ***p=0.042, ****p=0.0012. [Figure 22] Figure 1 shows the development and validation of specific KRAS mutant (G12V) siRNA using isogenic cell lines expressing KRAS WT or KRAS G12V reporters. A431 cells were deleted of the endogenous KRAS WT allele using CRISPR. They were then allowed to express stable KRAS WT or KRAS G12V expression vectors. Using RT-qPCR, it was found that at the mRNA level, 48 hours after transfection (20 nM), EFTX-3G12V4 (or EFTX-G12V FM4) led to potent silencing of KRAS G12V, but completely spared targeting of KRAS WT. Using luciferase readout, it was found that EFTX-G12V-FM4 potently targeted KRAS G12V, but completely spared targeting of KRAS WT, in comparison with pan-KRAS siRNA. [Diagram 23]Figure 1. Development and validation of specific KRAS mutant (G12V) siRNAs using SKCO1 (colon) and H727 (lung) cell lines carrying the KRAS G12V mutation. SKCO1 and H727 cell lines (carrying the G12V mutation) were treated with control siRNA with 2'Ome modification, one chemically modified (Hi2OMe) KRAS targeting siRNA, or one EFTX-G12V siRNA (Hi2OMe) G12V mutant specific KRAS targeting siRNA for approximately 1 week at doses ranging from 40 nM to 0.01 nM. [Figure 24] Figure 1 shows that specific KRAS mutation (G12V) and c-Myc-targeting inverted chimeras synergistically reduce cell viability in H441. H441 (with G12V mutation) cell line was treated with control siRNA with 2'Ome modification, one chemically modified (Hi2OMe) KRAS-targeting siRNA, one chemically modified (Hi2OMe) G12V mutant-specific KRAS-targeting siRNA, one M2 / K2 inverted chimera version 2 siRNA, or one M2 / G12V-specific inverted chimera at doses ranging from 40 nM to 0.01 nM for 144 hours. [Diagram 25] Figure 1 shows that a specific KRAS mutation (G12V) and an inverted chimera targeting c-Myc synergistically reduce cell viability in SKCO1. SKCO1 (with G12V mutation) cell line was treated with a control siRNA with 2'Ome modification, one chemically modified (Hi2OMe) KRAS targeting siRNA, one chemically modified (Hi2OMe) G12V mutant specific KRAS targeting siRNA, one M2 / K2 inverted chimera version 2 siRNA, or one M2 / G12V specific inverted chimera at doses ranging from 40 nM to 0.01 nM for 216 hours. [Figure 26]Figure 1 shows that inverse chimeras targeting IRF4 and c-Myc synergistically reduce cell viability in RPMI-8226 myeloma cell line. RPMI-8226 cells were treated with various doses of HiOMe siRNA complexed with RNAiMax in a 96-well plate format for 5 days, and 2OMe was used as a negative control. Five days after transfection, Cell Titer Glo 2.0 was added and luminescence was determined. [Figure 27A-27B] Figure 1 shows that inverted chimeras targeting the same gene (c-Myc) are more effective at reducing mRNA than targeting the gene with individual siRNAs. A427 (A) and MIA-PaCa2 (B) cells were treated with a control siRNA with 2'Ome modification, two chemically modified (Hi2OMe) c-Myc-targeting siRNAs, one M2 / M3 inverted chimera siRNA, or one M3 / M2 inverted chimera siRNA at 5 nM for 72 h. [Figure 28] Figure 1 shows that inverted chimeras targeting the same gene (KRAS) are more effective at lowering KRAS-luciferase protein than targeting the gene with individual siRNAs. A431 KRAS knockout cell lines stably integrated with KRAS-firefly luciferase and unlabeled Renilla luciferase were treated with control siRNA with 2'Ome modification, one chemically modified (Hi2OMe) c-Myc targeting siRNA, one chemically modified (Hi2OMe) KRAS targeting siRNA, or one K3 / K2 inverted chimera siRNA for 96 h at doses ranging from 39 to 0.002 nM. Renilla luciferase was used to normalize the firefly luciferase data. [Figure 29] FIG. 1 shows potential conjugation sites of the linker and targeting moiety (black arrows) in both direct and inverted chimeras. [Diagram 30] FIG. 1 is a schematic showing phosphodiester-linked, chemically modified siRs combining up to three unique siRNAs using combined inverted and tandem chimera designs. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0028] The present invention will now be described in more detail with reference to the accompanying drawings, in which preferred embodiments of the invention are shown. However, the present invention may be embodied in various forms and should not be construed as being limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will therefore fully convey the scope of the invention to those skilled in the art.
[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs.Terms used in this specification to describe the present invention are only intended to describe specific embodiments and are not intended to limit the present invention.All publications, patent applications, patents, patent publications, and other references cited herein are incorporated by reference in their entirety for the teachings related to the sentence and / or paragraph in which the reference is presented.
[0030] Nucleotide sequences are presented herein in a single strand only, from left to right in 5' to 3' orientation, unless specifically indicated otherwise. Nucleotides and amino acids are represented herein either in the format recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by their single-letter or three-letter codes, both in accordance with 37 CFR 1.822 and established conventions.
[0031] Unless otherwise indicated, standard methods known to those skilled in the art may be used to clone genes, amplify and detect nucleic acids, etc. Such techniques are known to those skilled in the art. For example, see Green et al., Molecular Cloning: A Laboratory Manual, 4th Edition (Cold Spring Harbor, NY, 2012); Ausubel et al., Current Protocols in Molecular Biology (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York).
[0032] It is specifically contemplated that the various features of the invention described herein can be used in any combination, unless the content indicates otherwise.
[0033] Furthermore, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features described herein may be excluded or omitted.
[0034] To illustrate, if the specification describes a composite as comprising components A, B, and C, it is specifically contemplated that any of A, B, or C, or combinations thereof, singly or in any combination, may be omitted and rejected.
[0035] definition As used in the description of this invention and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the content clearly dictates otherwise.
[0036] Additionally, as used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as the absence of a combination when interpreted in the alternative ("or").
[0037] As used herein, when referring to a measurable value such as an amount of a polypeptide, dosage, time, temperature, enzymatic activity, or other biological activity, the term "about" is meant to encompass variations of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the specified amount.
[0038] As used herein, the transitional phrase "consisting essentially of" (and grammatical variations) is intended to include the recited materials or steps, as well as those that do not materially affect the basic and novel characteristics of the claimed invention. Thus, as used herein, the term "consisting essentially of" should not be construed as the equivalent of "comprising."
[0039] The term "consisting essentially of" (and grammatical variations) as applied to the polynucleotide sequences of the invention means a polynucleotide that consists of both a recited sequence (e.g., SEQ ID NO:) and a total of 10 or less (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional nucleotides on the 5' and / or 3' ends of the recited sequence, such that the function of the polynucleotide is not significantly altered. A total of 10 or less additional nucleotides includes the combined total number of additional nucleotides on the right end. The term "significantly altered" as applied to the polynucleotides of the invention refers to an increase or decrease of at least about 50% or more in the ability to inhibit expression of a target mRNA compared to the expression level of a polynucleotide consisting of the recited sequence.
[0040] The terms "enhance" or "increase" refer to at least about a 1.25-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 12-fold, or even 15-fold increase in the indicated parameter.
[0041] As used herein, the terms "inhibit" or "reduce" or grammatical variations thereof refer to a decrease or attenuation of a designated level or activity by at least about 15%, 25%, 35%, 40%, 50%, 60%, 75%, 80%, 90%, 95%, or more. In certain embodiments, inhibition or reduction results in little or essentially no detectable activity (at most an insignificant amount, e.g., less than about 10% or even 5%).
[0042] As used herein, a "therapeutically effective" amount is an amount that brings about some degree of improvement or benefit to the subject. In other words, a "therapeutically effective" amount is an amount that provides some degree of alleviation, relief, or reduction of at least one clinical symptom in the subject (e.g., in the case of cancer, reduction in tumor burden, prevention of further tumor growth, prevention of metastasis, or increase in survival time). Those skilled in the art will understand that the therapeutic effect does not have to be complete or curative, as long as some degree of benefit is provided to the subject.
[0043] The terms "treat," "treating," or "treatment of" contemplate that the severity of the subject's condition is reduced or at least partially ameliorated or altered, and some degree of alleviation, relief, or reduction of at least one clinical symptom is achieved.
[0044] "Prevent" or "preventing" or "prevention" refers to preventing or delaying the onset of a disorder and / or reducing the severity of a disorder in a subject compared to the severity that would occur in the absence of the methods of the invention. Prevention can be complete, e.g., the complete absence of cancer in a subject. Prevention can also be partial, such as the incidence or severity of cancer in a subject is lower than would have occurred without the invention.
[0045] As used herein, "nucleic acid," "nucleotide sequence," and "polynucleotide" are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA, and chimeras of RNA and DNA. The terms polynucleotide, nucleotide sequence, or nucleic acid refer to a chain of nucleotides, regardless of the length of the chain. A nucleic acid can be double-stranded or single-stranded. If single-stranded, the nucleic acid can be the sense strand or the antisense strand. A nucleic acid can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids with altered base-pairing abilities or increased nuclease resistance. The invention further provides nucleic acids that are complements (which can be either full or partial complements) of the nucleic acids, nucleotide sequences, or polynucleotides of the invention. When dsRNA is produced synthetically, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine, and others can also be used for antisense, dsRNA, and ribozyme pairing. For example, polynucleotides containing C-5 propyne analogs of uridine and cytidine have been shown to bind RNA with high affinity and to be potent antisense inhibitors of gene expression. Other modifications can also be made, such as modifications to the phosphodiester backbone or 2'-hydroxy in the ribose sugar group of RNA.
[0046] An "isolated polynucleotide" is a nucleotide sequence (e.g., DNA or RNA) that is not immediately adjacent to the nucleotide sequences (one at the 5' end and one at the 3' end) that it is immediately adjacent to in the naturally occurring genome of the organism from which it originates. Thus, in one embodiment, an isolated nucleic acid includes some or all of the 5' non-coding (e.g., promoter) sequences that are immediately adjacent to the coding sequence. Thus, the term includes recombinant DNA that exists independently of other sequences, for example, within a vector, an autonomously replicating plasmid or virus, or incorporated into the genomic DNA of a prokaryotic or eukaryotic organism, or as a separate molecule (e.g., a cDNA or genomic DNA fragment generated by PCR or restriction endonuclease treatment). It also includes recombinant DNA that is part of a hybrid nucleic acid that encodes additional polypeptide or peptide sequences. An isolated polynucleotide that includes a gene is not a fragment of a chromosome that contains such a gene, but rather includes the coding and regulatory regions associated with the gene, but does not include additional genes naturally found on the chromosome.
[0047] The term "isolated" can refer to a nucleic acid, nucleotide sequence, or polypeptide that is substantially free of cellular material, viral material, and / or culture medium (if produced by recombinant DNA techniques), or chemical precursors or other chemicals (if chemically synthesized). Additionally, an "isolated fragment" is a fragment of a nucleic acid, nucleotide sequence, or polypeptide that does not naturally occur as a fragment and would not be found in the natural state. "Isolated" does not mean that the preparation is technically pure (homogeneous), but is sufficiently pure to provide the polypeptide or nucleic acid in a form that can be used for its intended purpose.
[0048] "Isolated cells" refers to cells that are separated from other components with which they are normally associated in their natural state. For example, isolated cells can be cells in culture medium and / or in the pharma- ceutically acceptable carriers of the present invention. Thus, isolated cells can be delivered to and / or introduced into a subject. In some embodiments, isolated cells can be cells that are removed from a subject, manipulated ex vivo as described herein, and then returned to the subject.
[0049] The term "fragment" as applied to a polynucleotide should be understood to mean a nucleotide sequence that is shortened in length compared to a reference nucleic acid or nucleotide sequence and comprises, consists essentially of, and / or consists of a nucleotide sequence of contiguous nucleotides that are identical or nearly identical (e.g., 90%, 92%, 95%, 98%, 99% identical) to the reference nucleic acid or nucleotide sequence. Such a nucleic acid fragment according to the invention may, where appropriate, be included in a larger polynucleotide of which it is a component. In some embodiments, such a fragment may comprise, consist essentially of, and / or consist of an oligonucleotide having a length of at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200 or more consecutive nucleotides of a nucleic acid or nucleotide sequence according to the invention.
[0050] The term "fragment" as applied to a polypeptide should be understood to mean an amino acid sequence that is shortened in length compared to a reference polypeptide or amino acid sequence and comprises, consists essentially of, and / or consists of an amino acid sequence of contiguous amino acids that are identical or nearly identical (e.g., 90%, 92%, 95%, 98%, 99% identical) to the reference polypeptide or amino acid sequence. Such a polypeptide fragment according to the invention may, where appropriate, be comprised within a larger polypeptide of which it is a component. In some embodiments, such a fragment may comprise, consist essentially of, and / or consist of a peptide having a length of at least about 4, 6, 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200 or more consecutive amino acids of a polypeptide or amino acid sequence according to the invention.
[0051] A "vector" is any nucleic acid molecule for cloning and / or transfer of a nucleic acid into a cell. A vector can be a replicon to which another nucleotide sequence can be attached to allow replication of the attached nucleotide sequence. A "replicon" can be any genetic element (e.g., plasmid, phage, cosmid, chromosome, viral genome) that functions as an autonomous unit of nucleic acid replication in vivo, i.e., capable of replicating under its own control. The term "vector" includes both viral and non-viral (e.g., plasmid) nucleic acid molecules for inserting nucleic acids into cells in vitro, ex vivo, and / or in vivo. Numerous vectors known in the art can be used to manipulate nucleic acids, incorporate response elements and promoters into genes, etc. For example, insertion of nucleic acid fragments corresponding to response elements and promoters into an appropriate vector can be accomplished by ligating the appropriate nucleic acid fragments into a selected vector having complementary cohesive ends. Alternatively, the ends of the nucleic acid molecule can be enzymatically modified or any site can be generated by ligating nucleotide sequences (linkers) to the nucleic acid termini. Such vectors may be engineered to contain sequences encoding selectable markers that provide for selection of cells that contain the vector and / or have integrated the vector's nucleic acid into the cellular genome. Such markers allow for the identification and / or selection of host cells that have integrated and expressed the protein encoded by the marker. A "recombinant" vector refers to a viral or non-viral vector that contains one or more heterologous nucleotide sequences (i.e., transgenes), e.g., two, three, four, five, or more heterologous nucleotide sequences.
[0052] Viral vectors are used in a wide variety of gene delivery applications in cells and live animal subjects. Viral vectors that can be used include, but are not limited to, retrovirus, lentivirus, adeno-associated virus, poxvirus, alphavirus, baculovirus, vaccinia virus, herpes virus, Epstein-Barr virus, and / or adenovirus vectors. Non-viral vectors include, but are not limited to, plasmids, liposomes, charged lipids (cytofectins), nucleic acid-protein complexes, and biopolymers. In addition to the nucleic acid of interest, vectors can also include one or more regulatory regions and / or selection markers that are useful for selection, measurement, and monitoring of nucleic acid transfer results (delivery to specific tissues, duration of expression, etc.).
[0053] Vectors may be introduced into desired cells by methods known in the art, such as transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosomal fusion), use of a gene gun, or nucleic acid vector transporters (see, e.g., Wu et al., J. Biol. Chem., 267:963 (1992); Wu et al., J. Biol. Chem., 263:14621 (1988); and Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15, 1990).
[0054] In some embodiments, the polynucleotide of the present invention can be delivered to cells in vivo by lipofection.Synthetic cationic lipids designed to limit the difficulties and dangers encountered in liposome-mediated transfection can be used to prepare liposomes for in vivo transfection of the nucleotide sequence of the present invention (Felgner et al., Proc.Natl.Acad.Sci.USA, 84:7413(1987); Mackey et al., Proc.Natl.Acad.Sci.USA, 85:8027(1988); and Ulmer et al., Science, 259:1745(1993)).The use of cationic lipids can promote the encapsulation of negatively charged nucleic acids and also promote fusion with negatively charged cell membranes (Felgner et al., Science, 337:387(1989)). Particularly useful lipid compounds and compositions for nucleic acid transfer are described in International Publication Nos. WO95 / 18863 and WO96 / 17823, and U.S. Patent No. 5,459,127. The use of lipofection to introduce exogenous nucleotide sequences into specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of advantage. It is clear that directing transfection to specific cell types would be particularly preferred in tissues with cellular heterogeneity, such as the pancreas, liver, kidney, and brain. Lipids can be chemically coupled to other molecules for targeting purposes (Mackey et al., 1988, supra). Targeting peptides, such as hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules can be chemically coupled to liposomes.
[0055] In various embodiments, other molecules, such as cationic oligopeptides (e.g., WO 95 / 21931), peptides derived from nucleic acid binding proteins (e.g., WO 96 / 25508), and / or cationic polymers (e.g., WO 95 / 21931), can be used to facilitate in vivo delivery of nucleic acids.
[0056] The vector can also be introduced in vivo as naked nucleic acid (see U.S. Patent Nos. 5,693,622, 5,589,466, and 5,580,859). Receptor-mediated nucleic acid delivery techniques can also be used (Curiel et al., Hum. Gene Ther., 3:147 (1992); Wu et al., J. Biol. Chem., 262:4429 (1987)).
[0057] As used herein, the terms "protein" and "polypeptide" are used interchangeably and include both peptides and proteins, unless otherwise specified.
[0058] A "fusion protein" is a polypeptide that results when two heterologous nucleotide sequences, or fragments thereof, encoding two (or more) different polypeptides not found fused together in nature are fused together in the correct translational reading frame. Exemplary fusion polypeptides include fusions of a polypeptide of the invention (or a fragment thereof) with all or a portion of glutathione-S-transferase, maltose-binding protein, or a reporter protein (e.g., green fluorescent protein, β-glucuronidase, β-galactosidase, luciferase, etc.), hemagglutinin, c-Myc, the FLAG epitope, etc.
[0059] The term "express" or "expression" of a polynucleotide coding sequence means that the sequence is transcribed and, optionally, translated. Typically, according to the present invention, expression of a coding sequence of the present invention results in the production of a polypeptide of the present invention. The entire expressed polypeptide or a fragment can also function in an intact cell without purification.
[0060] As used herein, the term "overexpression" or "overexpressing" refers to increased levels of a polypeptide produced and / or increased time of expression (e.g., constitutive expression) compared to a wild-type cell.
[0061] The term "gene" as used herein refers to a nucleic acid molecule that can be used to generate mRNA, antisense RNA, miRNA, etc. A gene may or may not be used to generate a functional protein. A gene may include both coding and non-coding regions (e.g., introns, regulatory elements, promoters, enhancers, termination sequences, and 5' and 3' untranslated regions). A gene may be "isolated", which means a nucleic acid that is substantially or essentially free from components that are normally found associated with the nucleic acid in its natural state. Such components include other cellular material, culture medium from recombinant production, and / or various chemicals used in the chemical synthesis of the nucleic acid.
[0062] As used herein, a "complementary" polynucleotide is one that is capable of base pairing according to standard Watson-Crick complementarity rules. Specifically, purines base pair with pyrimidines to form either guanine and cytosine pairs (G:C), and adenine and thymine (A:T) in the case of DNA, or adenine and uracil pairs (A:U) in the case of RNA. For example, the sequence "AGT" binds to the complementary sequence "TCA." It will be understood that two polynucleotides can hybridize to each other even if they are not completely complementary to each other, so long as each has at least one region that is substantially complementary to the other.
[0063] The term "complementary" or "complementarity" as used herein refers to the natural binding of polynucleotides by base pairing under permissive salt and temperature conditions. Complementarity between two single-stranded molecules can be "partial", where only a portion of the nucleotides bind, or it can be complete, where complete complementarity exists between the single-stranded molecules. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
[0064] As used herein, the term "substantially complementary" or "partially complementary" means that two nucleic acid sequences are complementary at least about 60%, 70%, 80%, or 90% of their nucleotides. In some embodiments, two nucleic acid sequences can be complementary at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more of their nucleotides. The terms "substantially complementary" and "partially complementary" also mean that two nucleic acid sequences can hybridize under high stringency conditions, such conditions being well known in the art.
[0065] As used herein, "heterologous" refers to either a nucleic acid sequence originating from another species, or a nucleic acid sequence originating from the same species or organism, but modified from either its original form or the form that is primarily expressed in the cell.Thus, a nucleotide sequence originating from an organism or species different from that of the cell into which the nucleotide sequence is introduced is heterologous to the cell and the progeny of the cell.Furthermore, heterologous nucleotide sequences include nucleotide sequences originating from the same native original cell species and inserted therein, but existing in a non-native state, for example, in a different copy number and / or under the control of a regulatory sequence different from that found in nature.
[0066] As used herein, the terms "contacting", "introducing" and "administering" are used interchangeably and refer to the process of delivering the dsRNA of the present invention or the nucleic acid molecule encoding the dsRNA of the present invention to cells to inhibit, alter or modify the expression of target genes.The dsRNA can be administered in several ways, including but not limited to direct introduction into cells (i.e., intracellularly) and / or extracellular introduction into the cavity, interstitial space, or circulation of an organism.
[0067] "Introducing" in the context of a cell or organism means presenting a nucleic acid molecule to an organism and / or cell in such a manner that the nucleic acid molecule is accessible to the interior of the cell. When introducing multiple nucleic acid molecules, these nucleic acid molecules can be assembled as part of a single polynucleotide or nucleic acid construct or as separate polynucleotides or nucleic acid constructs, and can be located on the same or different nucleic acid constructs. Thus, these polynucleotides can be introduced into a cell in a single transformation event or separate transformation events. Thus, the term "transformation" as used herein refers to the introduction of heterologous nucleic acid into a cell. The transformation of a cell can be stable or transient.
[0068] "Transient transformation" in the context of a polynucleotide means that the polynucleotide is introduced into a cell and does not integrate into the genome of the cell.
[0069] By "stably introducing" or "stably introduced" in the context of a polynucleotide introduced into a cell is intended that the introduced polynucleotide is stably integrated into the genome of the cell, thus stably transforming the cell with the polynucleotide.
[0070] As used herein, "stable transformation" or "stably transformed" refers to being introduced into a cell and integrated into the genome of the cell. Thus, the integrated nucleic acid molecule can be inherited by its progeny, more particularly by the progeny of multiple successive generations. As used herein, "genome" includes the nuclear and mitochondrial genomes, and therefore includes integration of a nucleic acid, for example, in the mitochondrial genome. As used herein, stable transformation can also refer to a transgene that is maintained extrachromosomally, for example, as a minichromosome.
[0071] Transient transformation may be detected, for example, by enzyme-linked immunosorbent assay (ELISA) or Western blot, which can detect the presence of peptides or polypeptides encoded by one or more transgenes introduced into the organism. Stable transformation of cells can be detected, for example, by Southern blot hybridization assay of the genomic DNA of the cells, using a nucleic acid sequence that specifically hybridizes with the nucleotide sequence of the transgene introduced into the organism. Stable transformation of cells can be detected, for example, by Northern blot hybridization assay of the RNA of the cells, using a nucleic acid sequence that specifically hybridizes with the nucleotide sequence of the transgene introduced into the organism. Stable transformation of cells can also be detected, for example, by polymerase chain reaction (PCR) or other amplification reactions well known in the art, using specific primer sequences that hybridize with the target sequence(s) of the transgene, resulting in amplification of the transgene sequence, which can be detected according to standard methods. Transformation can also be detected by direct sequencing and / or hybridization protocols well known in the art.
[0072] An embodiment of the present invention is directed to an expression cassette designed to express the nucleic acid of the present invention.As used herein, " expression cassette " refers to a nucleic acid molecule having at least a control sequence operably linked with a nucleotide sequence of interest.In this way, for example, a promoter that is in operable interaction with the nucleotide sequence of the siRNA of the present invention is provided in the expression cassette for expression in organism or cell.
[0073] As used herein, the term "promoter" refers to a region of a nucleotide sequence that incorporates the necessary signals for efficient expression of a coding sequence. It may include, but is not limited to, a sequence to which RNA polymerase binds, and may also include a region to which other regulatory proteins bind together with regions involved in the control of protein translation, and may also include a coding sequence.
[0074] Furthermore, a "promoter" of the present invention is a promoter capable of initiating transcription in the cells of an organism. Such promoters include those that drive the expression of a nucleotide sequence constitutively, those that drive expression upon induction, and those that drive expression in a tissue or developmental specific manner, and various types of these promoters are known in the art.
[0075] For purposes of the present invention, the regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) can be native / analogous to the organism or cell and / or the regulatory regions can be native / analogous to other regulatory regions. Alternatively, the regulatory regions can be heterologous to the organism or cell and / or to each other (i.e., the regulatory regions). Thus, for example, a promoter can be heterologous when operably linked to a polynucleotide from a species different from the species from which the polynucleotide is derived. Alternatively, a promoter can be heterologous to a selected nucleotide sequence when the promoter is from the same / analogous species as the species from which the polynucleotide is derived, but one or both (i.e., the promoter and the polynucleotide) have been substantially altered from their original form and / or genomic locus, or the promoter is not the native promoter of the operably linked polynucleotide.
[0076] The choice of promoter to be used depends on several factors, including but not limited to cell or tissue specific expression, desired expression level, efficiency, inducibility and selectivity.For example, if expression in a specific tissue or organ is desired, tissue specific promoters can be used.In contrast, if expression in response to a stimulus is desired, inducible promoters can be used.If continuous expression is desired throughout the cells of an organism, constitutive promoters can be used.It is a routine matter for those skilled in the art to modulate the expression of a nucleotide sequence by appropriately selecting and arranging promoters and other regulatory regions relative to the sequence.
[0077] In addition to the promoter described above, the expression cassette can also contain other regulatory sequences. As used herein, "regulatory sequence" refers to a nucleotide sequence located upstream (5' non-coding sequence), within, or downstream (3' non-coding sequence) of a coding sequence, which influences the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include, but are not limited to, enhancers, introns, translation leader sequences, and polyadenylation signal sequences.
[0078] The expression cassette can also optionally contain a transcriptional and / or translational termination region (i.e., termination region) functional in the organism. A variety of transcriptional terminators are available for use in the expression cassette, responsible for the termination of transcription beyond the transgene and correct mRNA polyadenylation. The termination region can be native to the transcriptional initiation region, native to the operably linked nucleotide sequence of interest, native to the host, or derived from another source (i.e., foreign or heterologous to the promoter, nucleotide sequence of interest, host, or any combination thereof).
[0079] Signal sequence can be operably linked with the nucleic acid of the present invention to direct the nucleotide sequence into a cellular compartment.In this way, the expression cassette comprises the nucleotide sequence encoding the siRNA operably linked with the nucleic acid sequence of signal sequence.Signal sequence can be operably linked at the N- or C-terminus of siRNA.
[0080] Regardless of the type of regulatory sequence(s) used, they can be operably linked to the nucleotide sequence of these siRNAs. As used herein, "operably linked" means that an element of a nucleic acid construct, such as an expression cassette, is configured to perform its normal function. Thus, a regulatory or control sequence (e.g., a promoter) operably linked to a nucleotide sequence of interest can result in the expression of the nucleotide sequence of interest. A control sequence need not be adjacent to a nucleotide sequence of interest, so long as it functions to direct the expression of the nucleotide sequence of interest. Thus, for example, an intervening non-translated but transcribed sequence can be present between the promoter and the coding sequence, and the promoter sequence can still be considered to be "operably linked" to the coding sequence. The nucleotide sequence of the present invention (i.e., siRNA) can be operably linked to a regulatory sequence, thereby allowing expression in a cell and / or a subject.
[0081] The expression cassette may also include the nucleotide sequence of a selection marker that can be used to select transformed organisms or cells. As used herein, a "selection marker" refers to a nucleic acid that, when expressed, confers a distinct phenotype on the organism or cell expressing the marker, thus allowing such transformed organisms or cells to be distinguished from those that do not possess the marker. Such nucleic acids may encode either a selectable or a screenable marker, depending on whether the marker confers a trait that can be selected for by chemical means, such as by using a selection agent (e.g., an antibiotic), or whether the marker is simply a trait that can be identified through observation or testing, such as by screening. Of course, many examples of suitable selection markers are known in the art and can be used in the expression cassettes described herein.
[0082] In some embodiments of the invention, the expression cassette can include an expression control sequence operably linked to a nucleotide sequence that is a template for one or both strands of a dsRNA. In further embodiments, a promoter can be adjacent to either end of the template nucleotide sequence, where the promoter drives expression of each individual DNA strand, thereby generating two complementary (or substantially complementary) RNAs that hybridize to form the dsRNA. In alternative embodiments, the nucleotide sequence is transcribed into both strands of the dsRNA on a single transcription unit, where the sense strand is transcribed from the 5' end of the transcription unit and the antisense strand is transcribed from the 3' end, the two strands are separated by about 3 to about 500 base pairs, and after transcription, the RNA transcript folds back on itself to form a short hairpin RNA (shRNA) molecule.
[0083] As used herein, "sequence identity" refers to the degree to which two optimally aligned polynucleotide or polypeptide sequences are invariant over the entire alignment window of components, e.g., nucleotides or amino acids. "Identity" can be readily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology (Lesk, AM, ed.) Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects (Smith, DW, ed.) Academic Press, New York (1993), Computer Analysis of Sequence Data, Part I (Griffin, AM and Griffin, HG, eds.) Humana Press, New Jersey (1994), Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987), and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).
[0084] As used herein, the terms "substantially identical" or "corresponding to" mean that two nucleic acid sequences have at least 60%, 70%, 80%, or 90% sequence identity. In some embodiments, two nucleic acid sequences can have at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.
[0085] The "percent identity" of an aligned segment of a test sequence and a reference sequence is the number of identical elements shared by the two aligned sequences divided by the total number of elements in the reference sequence segment, i.e., the entire reference sequence or a smaller defined portion of the reference sequence.
[0086] As used herein, the term "percent sequence identity" or "percent identity" refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference ("query") polynucleotide molecule (or its complementary strand) compared to a test ("subject") polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned (with appropriate nucleotide insertions, deletions, or gaps totaling less than 20 percent of the reference sequence over the comparison window). In some embodiments, "percent identity" can refer to the percentage of identical amino acids in an amino acid sequence.
[0087] Optimal alignment of sequences to align a comparison window is well known to those skilled in the art and can be performed by the Smith and Waterman local homology algorithm, the Needleman and Wunsch homology alignment algorithm, the Pearson and Lipman similarity search method, and optionally computerized implementations of these algorithms, such as tools such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG® Wisconsin Package® (Accelrys Inc., Burlington, Massachusetts). Percent sequence identity is expressed as the identity percentage multiplied by 100. Comparison of one or more polynucleotide sequences can be to full-length polynucleotide sequences or portions thereof, or to longer polynucleotide sequences. For the purposes of the present invention, "percent identity" can also be determined using BLASTX version 2.0 for translated nucleotide sequences, and BLASTN version 2.0 for polynucleotide sequences.
[0088] Percent sequence identity can be determined using the "Best Fit" or "Gap" programs of the Sequence Analysis Software Package™ (Version 10, Genetics Computer Group, Inc., Madison, Wis.). "Gap" utilizes the Needleman and Wunsch algorithm (Needleman and Wunsch, J Mol. Biol., 48:443-453, 1970) to find an alignment of two sequences that maximizes the number of matches and minimizes the number of gaps. "BestFit" optimally aligns the best similarity segments between two sequences and inserts gaps to maximize the number of matches using the Smith and Waterman local homology algorithm (Smith and Waterman, Adv. Appl. Math., 2:482-489, 1981; Smith et al., Nucleic Acids Res., 11:2205-2220, 1983).
[0089] Methods useful for determining sequence identity are also disclosed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)) and in Carillo, H. and Lipton, D. (Applied Math, 48:1073 (1988)). More particularly, preferred computer programs for determining sequence identity include, but are not limited to, the Basic Local Alighnment Search Tool (BLAST) program publicly available from the National Center for Biotechnology Information (NCBI), National Library of Medicine, National Institutes of Health, Bethesda, Md. 20894 (see BLAST Manual, Altschul et al., NCBI, NLM, NIH (Altschul et al., J. Mol. Biol., 215:403-410 (1990))); versions 2.0 and above of the BLAST program allow gaps (deletions and insertions) to be introduced into the alignment; for peptide sequences, BLASTX can be used to determine sequence identity, and for polynucleotide sequences, BLASTN can be used to determine sequence identity.
[0090] As used herein, "RNAi" or "RNA interference" refers to the process of sequence-specific post-transcriptional gene silencing mediated by double-stranded RNA (dsRNA). As used herein, "dsRNA" refers to RNA that is partially or completely double-stranded. Double-stranded RNA is also called small interfering RNA (siRNA), small interfering nucleic acid (siNA), microRNA (miRNA), etc. In the RNAi process, dsRNA is introduced into an organism, comprising a first (antisense) strand that is complementary to a portion of a target gene and a second (sense) strand that is completely or partially complementary to the first antisense strand. After being introduced into an organism, the dsRNA specific to the target gene is processed into relatively small fragments (siRNAs), which can then be distributed throughout the organism, resulting in a phenotype that can become debilitating to the phenotype resulting from the complete or partial deletion of the target gene over the course of a generation.
[0091] MicroRNAs (miRNAs) are non-protein-coding RNAs, generally about 18 to about 25 nucleotides in length. These miRNAs direct the cleavage in trans of target transcripts and negatively regulate the expression of genes involved in various regulatory and developmental pathways (Bartel, Cell, 116:281-297 (2004); Zhang et al., Dev. Biol., 289:3-16 (2006)). Thus, miRNAs have been shown to be involved in various aspects of growth and development, as well as signal transduction and protein degradation. Since the first miRNAs were discovered in plants (Reinhart et al., Genes Dev., 16:1616-1626 (2002); Park et al., Curr. Biol., 12:1484-1495 (2002)), hundreds of species have been identified. A large number of microRNA genes (MIR genes) have been identified and are publicly available in databases (miRBase, microrna.sanger.ac.uk / sequences). miRNAs are also described in U.S. Patent Publication Nos. 2005 / 0120415 and 2005 / 144669A1, the entire contents of which are incorporated herein by reference.
[0092] Genes encoding miRNAs give rise to 70-300 bp long primary miRNAs (termed "pri-miRNAs") that can form imperfect stem-loop structures. A single pri-miRNA can contain one to several miRNA precursors. In animals, pri-miRNAs are processed in the nucleus by the RNase III enzyme Drosha and its cofactor DGCR8 / Pasha into shorter hairpin RNAs (pre-miRNAs) of approximately 65 nt. The pre-miRNAs are then exported to the cytoplasm where they are further processed by another RNase III enzyme Dicer to produce the approximately 22 nt sized miRNA / miRNAs. *Numerous reviews on the biogenesis and function of microRNAs are available, see, for example, Bartel, Cell, 116:281-297 (2004); Murchison et al., Curr. Opin. Cell Biol., 16:223-229 (2004); Dugas et al., Curr. Opin. Plant Biol., 7:512-520 (2004); and Kim Nature Rev. Mol. Cell Biol., 6:376-385 (2005).
[0093] RNA molecule The present invention relates to an RNA molecule that is a multivalent inverted chimeric double-stranded RNA or chemically modified siRNA molecule.The inverted chimera is surprisingly effective in inhibiting gene expression, and is unexpectedly much more potent against both target genes compared with individual siRNA or chimeric siRNA arranged in a tandem manner.The inverted chimeric molecule advantageously simplifies the siRNA delivery process, ensuring equal molar targeting of both gene transcripts.The chimeric molecule design also simplifies the synthesis of two siRNAs, since the linker is a short nucleotide bridge, which has been demonstrated to be cleavable in endosomes.
[0094] As used herein, an inverted chimera is a molecule that contains two siRNAs in tandem with each other, but inverted with respect to sense and antisense orientation (i.e., the first strand is the sense (passenger) strand in a 5' to 3' orientation, followed by a linker (e.g., a phosphodiester DNA bridge), and the second strand is the antisense (guide) strand, also in a 5' to 3' orientation). A tandem chimera is also in tandem, but has the antisense strand of the siRNA in the same 5' to 3' orientation. A chimera is composed of three RNA molecules. The first RNA molecule contains the first strand of each siRNA, optionally connected by a linker. In an inverted chimera, the first RNA molecule contains the sense strand of one siRNA and the antisense strand of a second siRNA. In a tandem chimera, the first RNA molecule contains the antisense strand of one siRNA and the antisense strand of a second siRNA. The second RNA molecule is substantially complementary to the first strand of the first siRNA, and the third RNA molecule is substantially complementary to the first strand of the second siRNA, see, e.g., FIG.
[0095] The inverted chimeric molecule can also have an overall length of about 30-60 nucleotides, e.g., about 35-55 nucleotides, e.g., about 40-50 nucleotides. Each of the siRNAs within the inverted chimeric molecule can have a length of about 15-30 nucleotides, e.g., about 17-25 nucleotides, e.g., about 19-23 nucleotides.
[0096] The two siRNAs can be connected by a linker, such as a metabolically labile linker (i.e., a linker that is cleaved when the inverted chimeric molecule is delivered to a cell or administered to a subject), such as a polynucleotide linker. The linker can be about 2-10 nucleotides in length, such as about 3-8 nucleotides, such as 4-6 nucleotides. The nucleotides in the linker can be DNA or RNA, such as phosphodiester thymine, phosphodiester adenine, phosphodiester thymine / cytosine / adenine (TCA) linkers, and the like.
[0097] One aspect of the present invention relates to the inverted chimeric siRNA molecule of the present invention, the molecule comprises at least one chemical modification.In some embodiments, the molecule is fully chemically modified.The term "fully chemically modified" means that all nucleotides in the molecule contain chemical modification.In some embodiments, each nucleotide in the molecule is modified with 2'-O-methyl group or 2'-fluoro group.
[0098] In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 of the nucleotide linkages in the inverted chimeric siRNA molecule are chemically modified. In some embodiments, the inverted chimeric siRNA molecule comprises at least one phosphorothioate linkage. In some embodiments, siRNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 phosphorothioate linkages.In some embodiments, phosphorothioate linkages are located between the last two nucleotides of each strand of the molecule.In some embodiments, all molecules comprise phosphorothioate linkages.
[0099] Each siRNA in the inverted chimeric molecule can bind to the mRNA of target gene and inhibit the expression of the gene.In some embodiments, each siRNA in the inverted chimeric molecule binds to the same target gene, for example, different parts of the gene.In other embodiments, each siRNA in the inverted chimeric molecule binds to different target genes, for example, to effectively inhibit the expression of two genes at the same time.
[0100] The target gene may be any gene of interest whose expression is desired to be inhibited. In some embodiments, the target gene is one that is being studied for research purposes. In other embodiments, the target gene is one that is overexpressed in a disease state or otherwise associated with the condition, and the inhibition of expression is for therapeutic or prophylactic purposes. In some embodiments, the target gene is one that is expressed by a pathogen, e.g., a bacterium, a virus, a fungus, or a parasite, e.g., a coronavirus, such as SARS-CoV-2. In some embodiments, the target gene is one that is overexpressed in or associated with cancer. In certain embodiments, at least one siRNA targets c-Myc. In one embodiment, one siRNA targets c-Myc and one siRNA targets KRAS.
[0101] Each siRNA in the inverted chimeric molecule can be a known siRNA or one that is later developed. In some embodiments, at least one of the siRNAs is an siRNA disclosed herein.
[0102] In some embodiments, the inverted chimeric molecule may be duplexed with additional tandem siRNAs attached thereto, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more. For example, see FIG. 30, which demonstrates an inverted chimera design duplexed with a tandem chimera, resulting in a total of three possible unique siRNA sequences. Each siRNA may be separated by a linker as described above. Each siRNA in the inverted chimeric molecule may independently bind to and inhibit the same or different target genes. Each additional siRNA may be in direct or inverted orientation with respect to the siRNA in the inverted chimeric molecule. Each pair of additional siRNAs may be in an inverted chimeric format, for example, in a chain of an inverted chimeric molecule.
[0103] In some embodiments, the inverted chimeric molecule may be covalently or non-covalently linked to another molecule, such as a linker (e.g., for binding to a carrier) or a ligand (e.g., for targeting the molecule to a specific cell or binding site). Suitable sites for conjugation are shown in Figure 29.
[0104] In some embodiments, the chimeric molecule comprises: SEQ ID NO:63-65 SEQ ID NO:66-68 SEQ ID NO:69-71 SEQ ID NOs: 71 to 74 SEQ ID NO:75-77 SEQ ID NO:78-80 SEQ ID NO: 81 to 83 SEQ ID NO:84-86 SEQ ID NO: 87-89 SEQ ID NO: 90-92 SEQ ID NO: 93-95 SEQ ID NO: 96-98 SEQ ID NO: 99-101 SEQ ID NO: 102 to 104 In one embodiment, the present invention comprises, consists essentially of, or consists of a set of sequences that are at least 90% identical, e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one of the sequences.
[0105] The second aspect of the present invention represents an alternative therapeutic approach by targeting c-Myc at the transcriptional level. The present invention consists of short interfering RNA (siRNA) that can bind complementary to c-Myc messenger RNA and inhibit the transcription of oncogenes to induce gene knockdown and subsequent apoptosis in cancer cells. Traditionally, siRNAs have faced clinical limitations due to their lack of tissue specificity, rapid degradation in the body, and immune activation. However, the synthetic siRNAs herein contain novel chemical modifications that confer drug-like properties that protect them from in vivo degradation and obviate the need for nanocarriers or other delivery systems.
[0106] Thus, one aspect of the invention relates to a double-stranded RNA molecule comprising an antisense strand and a sense strand, wherein the nucleotide sequence of the antisense strand is complementary to a region of the nucleotide sequence of a c-Myc gene, the region consisting essentially of about 18 to about 25 contiguous nucleotides, and wherein the double-stranded RNA molecule inhibits expression of the c-Myc gene. The RNA molecule results in decreased expression of c-Myc in a cell compared to a cell not having the RNA molecule (e.g., a control cell or a non-transformed cell). In some embodiments, expression of c-Myc is inhibited by at least about 50%, e.g., at least about 50%, 60%, 70%, 80%, 90%, 95%, or more.
[0107] The double-stranded RNA molecule can comprise, consist essentially of, or consist of about 18 to about 25 (e.g., 18, 19, 20, 21, 22, 23, 24, or 25, or any range therein) nucleotides. Additional nucleotides can be added to the 3' end, 5' end, or both the 3' and 5' ends to facilitate manipulation of the RNA molecule but not significantly affect the basic characteristics or function of the double-stranded RNA molecule in RNA interference (RNAi). Additionally, one or two nucleotides can be deleted from one or both ends of any of the sequences disclosed herein that do not significantly affect the basic characteristics or function of the double-stranded RNA molecule in RNAi. The term "significantly affect" as used herein refers to a change of about 50% or less, e.g., about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or less, in the ability to inhibit the expression of the protein encoded by the mRNA. As known to those skilled in the art, such additional nucleotides can be nucleotides that extend the complementarity of the antisense strand along the target sequence and / or can be nucleotides that facilitate the manipulation of the RNA molecule or the nucleic acid molecule encoding the RNA molecule.For example, there can be a TT overhang at the 3' end that is used to stabilize the siRNA duplex and does not affect the specificity of the siRNA.
[0108] The dsRNA of the present invention may optionally contain a single-stranded overhang at one or both ends. The double-stranded structure may be formed by a single self-complementary RNA strand (i.e., forming a hairpin loop) or two complementary RNA strands. RNA duplex formation may be initiated either inside or outside a cell. If the dsRNA of the present invention forms a hairpin loop, it may optionally contain an intron and / or a nucleotide spacer, which is a stretch of nucleotides between the complementary RNA strands to stabilize the hairpin sequence in the cell. The RNA may be introduced in an amount that allows the delivery of at least one copy per cell. Higher doses of double-stranded material may result in more effective inhibition.
[0109] In certain embodiments, the present invention provides double-stranded RNA that contains a nucleotide sequence that is completely complementary to a region of the target gene to be inhibited.However, it is understood that 100% complementarity between the antisense strand of the double-stranded RNA molecule and the target sequence is not required to carry out the present invention.Therefore, it is possible to tolerate sequence variations that may be expected due to gene mutation, strain polymorphism, or evolutionary diversity.The RNA sequence that has insertions, deletions, and single point mutations compared to the target sequence can also be effective for inhibition.
[0110] In some embodiments, the nucleotide sequence of the sense strand comprises a nucleotide sequence that is at least about 80% identical to any of the nucleotide sequences of SEQ ID NOs: 1-9, e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to any of the nucleotide sequences of SEQ ID NOs: 1-9. In some embodiments, the nucleotide sequence of the sense strand comprises, consists essentially of, or consists of any of the nucleotide sequences of SEQ ID NOs: 1-9. SEQ ID NO:1 GAGGAUAUCUGGAAGAAAU SEQ ID NO: 2 GAGAACAGUUGAAACACAA SEQ ID NO:3 AACACAAACUUGAACAGCU SEQ ID NO: 4 AAGAAGAUGAGGAAGAAAU SEQ ID NO: 5 CACAGCCCACUGGUCCUCAAGA SEQ ID NO:6 AAGAGGCGAACACACAACGUC SEQ ID NO:7 CAGAUCAGCAACAACCG SEQ ID NO:8 GAGACCUUCAUCAAAAACAUCAUCA SEQ ID NO:9 GAGCUAAAACGGAGCUUUU
[0111] In some embodiments, the nucleotide sequence of the antisense strand comprises a nucleotide sequence that is at least about 80% identical to any of the nucleotide sequences of SEQ ID NOs: 19-27, e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to any of the nucleotide sequences of SEQ ID NOs: 19-27. In some embodiments, the nucleotide sequence of the antisense strand comprises, consists essentially of, or consists of any of the nucleotide sequences of SEQ ID NOs: 19-27. SEQ ID NO:19 AUUUCUUCCAGAUAUCCUC SEQ ID NO:20 UUGUGUUUCAACUGUUCUC SEQ ID NO:21 AGCUGUUCAAGUUUGUGUU SEQ ID NO:22 AUUUCUUCCUCAUCUUCUU SEQ ID NO:23 UCUUGAGGACCAGUGGGCUGUG SEQ ID NO:24 GACGUUGUGUGUUCGCCUCUU SEQ ID NO:25 CGGUUGUUGCUGAUCUG SEQ ID NO:26 UGAUGAUGUUUUUGAUGAAGGUCUC SEQ ID NO:27: AAAAGCUCCGUUUUAGCUC
[0112] In some embodiments, one or both of the sense strand and the antisense strand comprises a TT overhang at the 3' end. Thus, in some embodiments, the sense strand comprises a nucleotide sequence that is at least about 80% identical to any of the nucleotide sequences of SEQ ID NOs: 10-18, for example, at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identical to any of the nucleotide sequences of SEQ ID NOs: 10-18. In some embodiments, the nucleotide sequence of the sense strand comprises, consists essentially of, or consists of any of the nucleotide sequences of SEQ ID NOs: 10-18. SEQ ID NO: 10 GAGGAUAUCUGGAAGAAAUdTdT SEQ ID NO: 11 GAGAACAGUUGAAACACAAdTdT SEQ ID NO:12 AACACAAACUUGAACAGCUdTdT SEQ ID NO: 13 AAGAAGAUGAGGAAGAAAUdTdT SEQ ID NO: 14 CACAGCCCACUGGUCCUCAAGAdTdT SEQ ID NO: 15 AAGAGGCGAACACACAACGUCdTdT SEQ ID NO: 16 CAGAUCAGCAACAACCGdTdT SEQ ID NO: 17 GAGACCUUCAUCAAAAACAUCAUCAdTdT SEQ ID NO: 18 GAGCUAAAACGGAGCUUUUdTdT
[0113] In some embodiments, the nucleotide sequence of the antisense strand comprises a nucleotide sequence that is at least about 80% identical to any of the nucleotide sequences of SEQ ID NOs: 28-36, e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identical to any of the nucleotide sequences of SEQ ID NOs: 28-36. In some embodiments, the nucleotide sequence of the antisense strand comprises, consists essentially of, or consists of any of the nucleotide sequences of SEQ ID NOs: 28-36. SEQ ID NO:28 AUUUCUUCCAGAUAUCCUCdTdT SEQ ID NO:29 UUGUGUUUCAACUGUUCUCdTdT SEQ ID NO: 30 AGCUGUUCAAGUUUGUGUUdTdT SEQ ID NO:31 AUUUCUUCCUCAUCUUCUUdTdT SEQ ID NO:32 UCUUGAGGACCAGUGGGCUGUGdTdT SEQ ID NO: 33 GACGUUGUGUGUUCGCCUCUUdTdT SEQ ID NO:34 CGGUUGUUGCUGAUCUGdTdT SEQ ID NO: 35 UGAUGAUGUUUUUGAUGAAGGUCUCdTdT SEQ ID NO:36 AAAAGCUCCGUUUUAGCUCdTdT
[0114] In some embodiments of the present invention, the sense strand of the double-stranded RNA molecule can be fully complementary to the antisense strand, or the sense strand can be substantially or partially complementary to the antisense strand.Substantially or partially complementary means that the sense strand and the antisense strand can be mismatched at about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide pairs.Such mismatches can be introduced into the sense strand sequence, for example, near the 3' end, to enhance the processing of the double-stranded RNA molecule by Dicer, to replicate the pattern of mismatches in the siRNA molecule inserted into the chimeric nucleic acid molecule or artificial microRNA precursor molecule of the present invention, etc., as known to those skilled in the art. Such modifications weaken base pairing at one end of the duplex, creating strand asymmetry and thus increasing the likelihood that the antisense strand will be processed rather than the sense strand, silencing the intended gene (Geng and Ding, "Double-mismatched siRNAs enhance selective gene silencing of a mutant ALS-causing Allele1," Acta Pharmacol. Sin., 29:211-216 (2008); Schwarz et al., "Asymmetry in the assembly of the RNAi enzyme complex," Cell, 115:199-208 (2003)).
[0115] The double-stranded RNA molecule of the present invention can be in the form of any type of RNA interference molecule known in the art.In some embodiments, the double-stranded RNA molecule is a small interfering RNA (siRNA) molecule.In other embodiments, the double-stranded RNA molecule is a short hairpin RNA (shRNA) molecule.In other embodiments, the double-stranded RNA molecule is a part of a microRNA precursor molecule.
[0116] Chemically modified siRNA One aspect of the present invention relates to the siRNA molecule of the present invention that targets c-Myc mRNA, and the siRNA comprises at least one chemical modification.In some embodiments, the siRNA molecule is fully chemically modified.The term "fully chemically modified" means that all nucleotides in the siRNA contain chemical modification.In some embodiments, each nucleotide in the siRNA molecule is modified with 2'-O-methyl group or 2'-fluoro group.
[0117] In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 of the nucleotide linkages in siRNA are chemically modified.In some embodiments, siRNA comprises at least one phosphorothioate linkage.In some embodiments, siRNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 phosphorothioate linkages.In some embodiments, all siRNA comprises phosphorothioate linkages.
[0118] In certain embodiments, the siRNA molecule comprising at least one chemical modification comprises a sense strand and an antisense strand, and the siRNA molecule comprises one of the following sequence pairs: The sense strand of SEQ ID NO:1 and the antisense strand of SEQ ID NO:19, The sense strand of SEQ ID NO:2 and the antisense strand of SEQ ID NO:20, The sense strand of SEQ ID NO:3 and the antisense strand of SEQ ID NO:21, The sense strand of SEQ ID NO:4 and the antisense strand of SEQ ID NO:22, The sense strand of SEQ ID NO:5 and the antisense strand of SEQ ID NO:23, The sense strand of SEQ ID NO:6 and the antisense strand of SEQ ID NO:24, The sense strand of SEQ ID NO: 7 and the antisense strand of SEQ ID NO: 25, the sense strand of SEQ ID NO:8 and the antisense strand of SEQ ID NO:26, or The sense strand of SEQ ID NO:9 and the antisense strand of SEQ ID NO:27.
[0119] In some embodiments, the siRNA comprises, consists essentially of, or consists of a sequence that is at least 90% identical to one of SEQ ID NOs: 1-9 and 19-27, e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.
[0120] JPEG2024523424000002.jpg100166
[0121] In certain embodiments, the siRNA molecule is fully chemically modified and comprises a sense strand and an antisense strand, and the siRNA molecule comprises one of the following sequence pairs: The sense strand of SEQ ID NO: 37 and the antisense strand of SEQ ID NO: 38, The sense strand of SEQ ID NO: 39 and the antisense strand of SEQ ID NO: 40, The sense strand of SEQ ID NO: 41 and the antisense strand of SEQ ID NO: 42, the sense strand of SEQ ID NO: 43 and the antisense strand of SEQ ID NO: 44, or The sense strand of SEQ ID NO:45 and the antisense strand of SEQ ID NO:46.
[0122] In some embodiments, the siRNA comprises, consists essentially of, or consists of a sequence that is at least 90% identical to one of SEQ ID NOs: 37-46, e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.
[0123] In some embodiments, the siRNA molecule can be combined in tandem (e.g., administered together by covalent or non-covalent linkage) with a second siRNA molecule targeting human KRAS mRNA (e.g., an siRNA molecule disclosed in U.S. Patent Publication No. 2020 / 0248185, which is incorporated by reference in its entirety). In some embodiments, the siRNA molecule targeting human KRAS mRNA is fully chemically modified and comprises a sense strand and an antisense strand, and the siRNA molecule comprises one of the following sequence pairs: The sense strand of SEQ ID NO: 47 and the antisense strand of SEQ ID NO: 48, The sense strand of SEQ ID NO:49 and the antisense strand of SEQ ID NO:50.
[0124] In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of the nucleotide linkages in the siRNA targeting KRAS are chemically modified.In some embodiments, the siRNA targeting KRAS comprises at least one phosphorothioate linkage.In some embodiments, the siRNA targeting KRAS comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 phosphorothioate linkages.In some embodiments, all of the siRNA targeting KRAS comprises phosphorothioate linkages.
[0125] In some embodiments, the siRNA targeting KRAS comprises, consists essentially of, or consists of a sequence that is at least 90% identical to one of SEQ ID NOs: 47-50, e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.
[0126] Inverted chimeric siRNA molecules, double-stranded RNA molecules, or chemically modified siRNA molecules can be constructed by procedures known in the art using chemical synthesis and enzyme ligation reaction.For example, inverted chimeric siRNA molecules, double-stranded RNA, or chemically modified siRNA molecules can be chemically synthesized using naturally occurring nucleotides or various modified nucleotides designed to increase the biological stability of molecules or increase the physical stability of the duplex formed between inverted chimeric siRNA molecules, double-stranded RNA, or chemically modified siRNA molecules and target nucleotide sequence, for example, phosphorothioate derivatives and acridine-substituted nucleotides can be used.Examples of modified nucleotides that can be used to generate inverted chimeric siRNA molecules, double-stranded RNA, or chemically modified siRNA molecules include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine. , 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, double-stranded RNA can be produced using an expression vector into which a nucleic acid encoding the double-stranded RNA has been cloned.
[0127] The inverted chimeric siRNA molecule, double-stranded RNA, or chemically modified siRNA molecule can further comprise a nucleotide sequence in which at least one or all of the internucleotide bridging phosphate residues are modified phosphate groups, such as methyl phosphonate, methyl phosphonothioate, phosphoromorpholidate, phosphoropiperazidate, and phosphoroamidate.For example, all or every other internucleotide bridging phosphate residues can be modified as described.In another non-limiting example, the inverted chimeric siRNA molecule, double-stranded RNA, or chemically modified siRNA molecule can comprise at least one or all of the nucleotides are modified phosphate groups, such as methyl phosphonate, methyl phosphonothioate, phosphoromorpholidate, phosphoropiperazidate, and phosphoroamidate. 1 ~C 4 , linear or branched, saturated or unsaturated alkyl, e.g., methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl). In another example, one or more of the nucleotides can be a 2'-fluoro nucleotide, a 2-O-methyl nucleotide, or a locked nucleic acid nucleotide. For example, all or every other nucleotide can be modified as described. See also Furdon et al., Nucleic Acids Res., 17:9193 (1989); Agrawal et al., Proc. Natl. Acad. Sci. USA, 87:1401 (1990); Baker et al., Nucleic Acids Res., 18:3537 (1990); Sproat et al., Nucleic Acids Res., 17:3373 (1989); Walder and Walder, Proc. Natl. Acad. Sci. USA, 85:5011 (1988), which are incorporated by reference in their entireties for their teachings of how to make polynucleotide molecules, including those containing modified nucleotide bases.
[0128] The present invention further relates to a nucleic acid construct comprising an RNA molecule of the present invention. The present invention further relates to a nucleic acid construct encoding an RNA molecule of the present invention and a nucleic acid construct comprising a nucleic acid molecule encoding an RNA molecule. In each of these embodiments, the nucleic acid construct can be a vector or a plasmid, for example an expression vector.
[0129] Another aspect of the present invention relates to a composition comprising the inverted chimeric siRNA, molecule, RNA molecule, chemically modified siRNA molecule, or nucleic acid construct of the present invention and another component, such as a suitable carrier.In some embodiments, the composition width comprises two or more of the inverted chimeric siRNA, molecule, RNA molecule, chemically modified siRNA molecule, or nucleic acid construct of the present invention, and two or more inverted chimeric siRNA molecules, RNA molecules, or chemically modified siRNA molecules each comprise different antisense strands.In certain embodiments, two or more RNA molecules are present on the same nucleic acid construct, on different nucleic acid constructs, or any combination thereof.In some embodiments, the composition is a pharmaceutical composition comprising the inverted chimeric siRNA, molecule, RNA molecule, chemically modified siRNA molecule, or nucleic acid construct of the present invention and a pharmaceutically acceptable carrier.
[0130] It is understood that the composition of the present invention can comprise, consist essentially of, or consist of any of the inverted chimeric siRNA molecules, RNA molecules, chemically modified siRNA molecules, and nucleic acid constructs in any combination and in any ratio relative to each other.Furthermore, "two or more" means up to the total number of the inverted chimeric siRNA molecules, RNA molecules, chemically modified siRNA molecules, and nucleic acid constructs of the present invention, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.
[0131] In some aspects of the present invention, the composition or pharmaceutical composition further comprises an additional component that enhances the delivery of the inverted chimeric siRNA molecule, RNA molecule, chemically modified siRNA molecule, or nucleic acid construct of the present invention to a subject, for example, to enhance the stability of the inverted chimeric siRNA molecule, RNA molecule, chemically modified siRNA molecule, or nucleic acid construct. In some embodiments, the additional component can be a particle, for example, a microparticle or nanoparticle. In some embodiments, the particle is a lipid particle, for example, a liposome, for example, a microliposome or nanoliposome. The liposome, microliposome, or nanoliposome can contain any component known in the art to be suitable for preparing liposomes. In some embodiments, the liposome comprises 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC). The liposome can be prepared by methods known in the art, for example, as described in Pecot et al., Mol. Cancer Ther., 13:2876 (2014), which is incorporated by reference in its entirety. In some embodiments, the RNA molecule is formed into a stable nucleic acid-lipid particle (SNALP), for example, using particles such as those provided by Arbutus Biopharma (Doylestown, PA).In certain embodiments, the lipid particle comprises, consists essentially of, or consists of cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), PEG-cDMA or PEG-cDSA, and 1,2-dilinoleyloxy-3-(N,N-dimethyl)aminopropane (DLinDMA) (see Judge et al., J.Clin.Invest., 119:661 (2009)).In some embodiments, the lipid particle comprises two or more of the inverted chimeric siRNA molecule of the present invention, an RNA molecule, or a chemically modified siRNA molecule. In some embodiments, the additional component is a targeted delivery moiety, such as a ligand, an aptamer, or a monoclonal antibody, to which the inverted chimeric siRNA molecule, an RNA molecule, a chemically modified siRNA molecule, or a nucleic acid construct is covalently or non-covalently conjugated.
[0132] The present invention encompasses cells comprising the RNA molecules and / or nucleic acid constructs of the present invention.Thus, in some embodiments, the present invention provides transformed cells comprising the RNA molecules and / or nucleic acid constructs and / or compositions of the present invention, wherein the transformed cells have reduced expression of c-Myc compared to control cells.
[0133] method Various methods are provided herein using the nucleic acid molecule, nucleic acid construct and / or composition of the present invention.Therefore, in one aspect, the present invention provides a method for inhibiting the expression of target gene in cells, by contacting cells with the RNA molecule, the inverted chimeric siRNA molecule, the chemically modified siRNA molecule, the nucleic acid construct, the composition and / or the pharmaceutical composition of the present invention, thereby inhibiting the expression of target gene in cells.
[0134] Another aspect of the present invention relates to a method of treating a target gene-associated disorder in a subject in need thereof, comprising delivering to the subject an RNA molecule, an inverted chimeric siRNA molecule, a chemically modified siRNA molecule, a nucleic acid construct, a composition, and / or a pharmaceutical composition of the present invention, thereby treating the disorder in the subject. A target gene-associated disorder is a disorder in which expression or overexpression of the target gene causes the disorder, or causes one or more symptoms of the disorder, or is expressed by an organism causing the disorder.
[0135] The present invention further provides a method for inhibiting expression of the human c-Myc gene, comprising contacting a cell with an RNA molecule, inverted chimeric siRNA molecule, chemically modified siRNA molecule, nucleic acid construct, composition and / or pharmaceutical composition of the present invention, thereby inhibiting expression of the human c-Myc gene in the cell.
[0136] Also provided herein is a method of treating a cancer comprising overexpression of the human c-Myc gene in a subject in need thereof, comprising delivering to the subject an RNA molecule, an inverted chimeric siRNA molecule, a chemically modified siRNA molecule, a nucleic acid construct, a composition, and / or a pharmaceutical composition of the present invention, thereby treating the cancer in the subject. A cancer comprising overexpression of the human c-Myc gene is a cancer, e.g., a tumor, in which one or more cells overexpress the c-Myc gene.
[0137] In one embodiment of each of these aspects, the subject may be one who has been diagnosed with a disorder, e.g., cancer. In another embodiment, the subject may be one who is at risk for developing a disorder, e.g., cancer (e.g., predisposed due to genetic factors, smoking, viral infection, exposure to chemicals, etc.). In a further embodiment, the subject may be one who has been infected with a pathogen. In a further embodiment, the subject may be one who has been identified as overexpressing a target gene, e.g., the c-Myc gene, and who may or may not have been diagnosed with a disorder, e.g., cancer.
[0138] The double-stranded RNA, the inverted chimeric siRNA molecule, or the chemically modified siRNA molecule of the present invention can be directly delivered into cells by any method known in the art, for example by transfection or microinjection, for example as part of a composition that includes lipid particles.In other embodiments, the double-stranded RNA can be delivered to a subject in the form of a polynucleotide that encodes the RNA, causing the expression of the double-stranded RNA in the cells of the subject.Those skilled in the art will understand that the isolated polynucleotide that encodes the RNA of the present invention will typically be associated with appropriate expression control sequences, for example, transcription / translation control signals and polyadenylation signals.
[0139] It will be further understood that various promoter / enhancer elements can be used depending on the desired level and tissue-specific expression. The promoter can be constitutive or inducible depending on the desired expression pattern. The promoter can be native or foreign, and can be a natural or synthetic sequence. By foreign, it is intended that the transcription initiation region is not found in the wild-type host into which it is introduced. The promoter is selected to function in the intended target cell(s).
[0140] By way of example, the RNA coding sequence can be operably associated with a cytomegalovirus (CMV) major immediate early promoter, an albumin promoter, an elongation factor 1-alpha (EF1-alpha) promoter, a PγK promoter, an MFG promoter, or a Rous sarcoma virus promoter.
[0141] Inducible promoter / enhancer elements include hormone- and metal-inducible elements, as well as other promoters regulated by exogenously supplied compounds, including, but not limited to, the zinc-inducible metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (see WO 98 / 10088), the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. 2003, 143:1311-1323, 2003). Sci. USA, 93:3346 (1996)), tetracycline repression system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547 (1992)), tetracycline inducibility system (Gossen et al., Science, 268:1766 (1995); see also Harvey et al., Curr. Opin. Chem. Biol., 2:512 (1998)), RU486 inducibility system (Wang et al., Nat. Biotech., 15:239 (1997); Wang et al., Gene Ther., 4:432 (1997)), and rapamycin inducibility system (Magari et al., J. Clin. Invest., 100:2865 (1997)).
[0142] Other tissue-specific or regulated promoters include, but are not limited to, promoters that typically confer tissue specificity in neurons. These include, but are not limited to, promoters of synapsin 1, tubulin alpha 1, platelet-derived growth factor B chain, tyrosine hydroxylase, neuron-specific enolase, and neurofilament. Skeletal muscle cell promoters include, but are not limited to, promoters of beta-actin, Pitx3, creatine kinase, and myosin light chain. Cardiomyocyte promoters include, but are not limited to, promoters of cardiac actin, cardiac troponin T, troponin C, myosin light chain-2, and alpha-myosin heavy chain. Islet (beta) cell promoters include, but are not limited to, glucokinase, gastrin, insulin, and islet amyloid polypeptide.
[0143] Moreover, specific initiation signals are generally required for efficient translation of the inserted RNA coding sequence. These translational control sequences, which can include the ATG initiation codon and adjacent sequences, can be of a variety of origins, both natural and synthetic.
[0144] The isolated nucleic acid encoding double-stranded RNA can be incorporated into an expression vector.Expression vectors compatible with various host cells are well known in the art and contain the appropriate elements for transcription and translation of nucleic acid.Typically, expression vectors contain "expression cassettes", which in the 5' to 3' direction, include a promoter, a coding sequence encoding double-stranded RNA, which is operably associated with the promoter, and optionally a termination sequence, which includes a stop signal for RNA polymerase and a polyadenylation signal for polyadenylases.
[0145] Non-limiting examples of animal and mammalian promoters known in the art include, but are not limited to, the SV40 early (SV40e) promoter region, the promoter contained in the 3' long terminal repeat (LTR) of Rous sarcoma virus (RSV), the promoter of the E1A or major late promoter (MLP) genes of adenovirus (Ad), the cytomegalovirus (CMV) early promoter, the herpes simplex virus (HSV) thymidine kinase (TK) promoter, the baculovirus IE1 promoter, the elongation factor 1 alpha (E1A) promoter, the SV40 early (SV40e) promoter ... SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV40e) promoter, the SV40 early (SV EF1) promoter, phosphoglycerate kinase (PGK) promoter, ubiquitin (Ubc) promoter, albumin promoter, mouse metallothionein-L promoter and regulatory sequences of transcription control regions, ubiquitous promoters (HPRT, vimentin, α-actin, tubulin, etc.), promoters of intermediate filaments (desmin, neurofilament, keratin, GFAP, etc.), promoters of therapeutic genes (such as those of MDR, CFTR, or factor VIII), and pathogenic and / or disease-related promoters. Additionally, any of these expression sequences of the present invention can be modified by the addition of enhancers and / or regulatory sequences, etc.
[0146] Enhancers that may be used in embodiments of the present invention include, but are not limited to, SV40 enhancers, cytomegalovirus (CMV) enhancers, elongation factor I (EF1) enhancers, yeast enhancers, viral gene enhancers, and the like.
[0147] Termination control regions, i.e., terminator or polyadenylation sequences, may be derived from various genes native to the preferred host. In some embodiments of the invention, the termination control region may comprise or be derived from synthetic sequences, synthetic polyadenylation signals, SV40 late polyadenylation signals, SV40 polyadenylation signals, bovine growth hormone (BGH) polyadenylation signals, viral terminator sequences, and the like.
[0148] It will be apparent to one of skill in the art that any suitable vector can be used to deliver the polynucleotide to a cell or subject. The vector can be delivered to a cell in vivo. In other embodiments, the vector can be delivered to a cell ex vivo, and then the cells containing the vector are delivered to a subject. The choice of delivery vector can be based on several factors known in the art, including the age and species of the target host, in vitro versus in vivo delivery, the desired level and duration of expression, the intended purpose (e.g., for therapy or screening), the target cell or organ, the delivery route, the size of the isolated polynucleotide, safety concerns, and the like.
[0149] Suitable vectors include, but are not limited to, plasmid vectors, viral vectors (e.g., retroviruses, alphaviruses, vaccinia viruses, adenoviruses, adeno-associated viruses and other parvoviruses, lentiviruses, poxviruses, or herpes simplex viruses), lipid vectors, polylysine vectors, synthetic polyamino polymer vectors, and the like.
[0150] Any viral vector known in the art can be used in the present invention.Protocols for generating recombinant viral vectors and using viral vectors for nucleic acid delivery can be found in Ausubel et al., Current Protocols in Molecular Biology (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York) and other standard laboratory manuals (e.g., Vectors for Gene Therapy, Current Protocols in Human Genetics, John Wiley and Sons, Inc., 1997).
[0151] Non-viral transfer methods can also be used. Many non-viral methods for nucleic acid transfer rely on the normal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules. In certain embodiments, non-viral nucleic acid delivery systems rely on endocytosis pathways for the uptake of nucleic acid molecules by target cells. Exemplary nucleic acid delivery systems of this type include liposome-derived systems, polylysine conjugates, and artificial viral envelopes.
[0152] In certain embodiments, plasmid vectors are used in the practice of the present invention. For example, plasmids can be introduced into muscle cells by injection into tissue. Expression can last for several months, but the number of positive cells is typically low (Wolff et al., Science, 247:247 (1989)). Cationic lipids have been demonstrated to aid in the introduction of nucleic acids into some cultured cells (Felgner and Ringold, Nature, 337:387 (1989)). Injection of cationic lipid-plasmid DNA complexes into the circulation of mice has been shown to result in expression of DNA in the lungs (Brigham et al., Am. J. Med. Sci., 298:278 (1989)). One advantage of plasmid DNA is that it can be introduced into non-replicating cells.
[0153] In a representative embodiment, a nucleic acid molecule (e.g., a plasmid) can be entrapped in a lipid particle that carries a positive charge on its surface and, optionally, tagged with an antibody against a cell surface antigen of the target tissue (Mizuno et al., No Shinkei Geka, 20:547 (1992), PCT Publication No. WO91 / 06309, Japanese Patent Application No. 1047381, and European Patent Publication No. EP-A-43075).
[0154] Liposomes composed of amphiphilic cationic molecules are useful as non-viral vectors for nucleic acid delivery in vitro and in vivo (reviewed in Crystal, Science, 270:404 (1995); Blaese et al., Cancer Gene Ther., 2:291 (1995); Behr et al., Bioconjugate Chem., 5:382 (1994); Remy et al., Bioconjugate Chem., 5:647 (1994); and Gao et al., Gene Therapy, 2:710 (1995)). Positively charged liposomes are believed to complex with negatively charged nucleic acids via electrostatic interactions to form lipid:nucleic acid complexes. Lipid:nucleic acid complexes have several advantages as nucleic acid transfer vectors. Unlike viral vectors, lipid:nucleic acid complexes can be used to transfer expression cassettes of essentially unlimited size. Because the complexes lack proteins, they are less likely to elicit immunogenic and inflammatory responses. Moreover, they cannot replicate or recombine to form infectious agents, and have low integration frequencies.Several publications have demonstrated that amphipathic cationic lipids can mediate nucleic acid delivery in vivo and in vitro (Felgner et al., Proc. Natl. Acad. Sci. USA, 84:7413 (1987); Loeffler et al., Meth. Enzymol., 217:599 (1993); Felgner et al., J. Biol. Chem., 269:2550 (1994)).
[0155] Several groups have reported the use of amphipathic cationic lipid:nucleic acid complexes for in vivo transfection in both animals and humans (reviewed in Gao et al., Gene Therapy, 2:710 (1995); Zhu et al., Science, 261:209 (1993); and Thierry et al., Proc. Natl. Acad. Sci. USA, 92:9742 (1995)). U.S. Patent No. 6,410,049 describes methods for preparing cationic lipid:nucleic acid complexes that have a long shelf life.
[0156] Also, nuclear localization signals can be used to target double-stranded RNA or expression vectors to the vicinity of the nucleus and / or enhance their entry into the nucleus.Such nuclear localization signals can be proteins or peptides, such as SV40 large T antigen NLS or nucleoplasmin NLS.These nuclear localization signals interact with various nuclear transport factors, such as NLS receptor (karyopherin alpha), which then interacts with karyopherin beta.
[0157] The expression vector can be designed for expression of the double-stranded RNA in prokaryotic or eukaryotic cells. For example, the double-stranded RNA can be expressed in bacterial cells such as E. coli, insect cells (e.g., the baculovirus expression system), yeast cells, plant cells, or mammalian cells. Some suitable host cells are described in Goeddel, et al. Gene Expression Technology: Methods in Enzymology, 185, Academic Press, San Diego, Calif. (1990). Examples of bacterial vectors include, but are not limited to, pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene, ptrc99a, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia). Examples of vectors for expression in S. cerevisiae include pYepSecl (Baldari et al., EMBO J., 6:229 (1987)), pMFa (Kurjan and Herskowitz, Cell, 30:933 (1982)), pJRY88 (Schultz et al., Gene, 54:113 (1987)), and pYES2 (Invitrogen). Corporation, San Diego, Calif. Non-limiting examples of baculovirus vectors that can be used to express nucleic acids to produce proteins in cultured insect cells (e.g., Sf9 cells) include the pAc series (Smith et al., Mol. Cell. Biol., 3:2156 (1983)) and the pVL series (Lucklow and Summers Virology, 170:31 (1989)).
[0158] Examples of mammalian expression vectors include pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, PBPV, pMSG, PSVL (Pharmacia), pCDM8 (Seed, Nature, 329:840 (1987)), and pMT2PC (Kaufman et al., EMBO J., 6:187 (1987)). When used in mammalian cells, the control functions of the expression vector are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, and simian virus 40.
[0159] Viral vectors are used in a wide variety of gene delivery applications in cells and live animal subjects. Viral vectors that can be used include, but are not limited to, retrovirus, lentivirus, adeno-associated virus, poxvirus, alphavirus, baculovirus, vaccinia virus, herpes virus, Epstein-Barr virus, adenovirus, geminivirus, and caulimovirus vectors. Non-limiting examples of non-viral vectors include plasmids, liposomes, charged lipids (cytofectins), nucleic acid-protein complexes, and biopolymers. In addition to the nucleic acid of interest, vectors can also include one or more regulatory regions and / or selection markers that are useful for selection, measurement, and monitoring of nucleic acid transfer results (delivery to specific tissues, duration of expression, etc.).
[0160] In addition to the regulatory control sequences described above, the recombinant expression vector can contain additional nucleotide sequences. For example, the recombinant expression vector can encode a selectable marker gene to identify host cells that have taken up the vector.
[0161] Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" refer to various art-recognized techniques for introducing foreign nucleic acid (e.g., DNA and RNA) into host cells, including, but not limited to, calcium phosphate or calcium chloride co-precipitation, DEAE-dextran mediated transfection, lipofection, electroporation, microinjection, DNA-loaded liposomes, lipofectamine-DNA complexes, cell sonication, gene bombardment using high-velocity microparticles, and virus-mediated transfection. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition (Cold Spring Harbor, NY, 1989) and other laboratory manuals.
[0162] When stable integration is desired, often only a small fraction of cells (particularly mammalian cells) will integrate the foreign DNA into their genome. To identify and select integrants, a nucleic acid encoding a selection marker (e.g., resistance to antibiotics) can be introduced into the host cells together with the nucleic acid of interest. Preferred selection markers include those that confer resistance to drugs such as G418, hygromycin, and methotrexate. The nucleic acid encoding the selection marker can be introduced into the host cells on the same vector as that containing the nucleic acid of interest, or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selection marker gene survive while other cells die).
[0163] In one embodiment, the double-stranded RNA, inverted chimeric siRNA molecule, or chemically modified siRNA molecule of the invention is administered directly to the subject. In general, the compounds of the invention are suspended in a pharma- ceutically acceptable carrier (e.g., saline) and administered orally, topically, or by intravenous infusion, or injected subcutaneously, intramuscularly, intracranially, intrathecally, intraperitoneally, intrarectally, intravaginally, intranasally, intragastricly, intratracheally, or intrapulmonary. They are preferably delivered directly to the site of the disease or disorder, e.g., the lungs, intestinal tract, or pancreas. The dosage required depends on the choice of route of administration, the nature of the formulation, the nature of the patient's illness, the size, weight, surface area, age, and sex of the subject, other drugs administered, and the judgment of the attending physician. Suitable dosages are in the range of 0.01-100.0 μg / kg. In view of the differing efficiencies of various routes of administration, a wide variation in the dosage required should be expected. For example, oral administration is expected to require higher dosages (e.g., 2, 3, 4, 6, 8, 10, 20, 50, 100, 150, or more) than administration by iv injection. Variations in these dosage levels can be adjusted using standard empirical routines for optimization, as is well understood in the art. Administration can be single or multiple. Encapsulation of the inhibitor in a suitable delivery vehicle (e.g., polymeric microparticles or implantable devices) can increase the efficiency of delivery, especially for oral delivery.
[0164] According to certain embodiments, double-stranded RNA, inverted chimeric siRNA molecules, or chemically modified siRNA molecules can be targeted to specific cells or tissues in vivo.Targeting delivery vehicles, including liposomes and viral vector systems, are known in the art.For example, liposomes can be targeted to specific target cells or tissues by using targeting agents such as antibodies, soluble receptors, or ligands incorporated into liposomes, to specific target cells or tissues, to which targeting molecules can bind.Targeting liposomes are described, for example, in Ho et al., Biochemistry, 25:5500 (1986), Ho et al., J.Biol.Chem., 262:13979 (1987), Ho et al., J.Biol.Chem., 262:13973 (1987), and U.S. Patent No. 4,957,735 to Huang et al., each of which is incorporated herein by reference in its entirety. Enveloped viral vectors can be modified to deliver nucleic acid molecules to target cells by modifying or replacing envelope proteins so that the virus infects specific cell types. In adenoviral vectors, genes encoding attachment fibers can be modified to encode protein domains that bind to cell-specific receptors. Herpes viral vectors naturally target cells of the central and peripheral nervous system. Alternatively, routes of administration can be used to target specific cells or tissues. For example, intracoronary administration of adenoviral vectors has been shown to be effective in delivering genes to myocardial cells (Maurice et al., J. Clin. Invest., 104:21 (1999)). Intravenous delivery of cholesterol-containing cationic liposomes has been shown to preferentially target lung tissue (Liu et al., Nature Biotechnol., 15:167 (1997)) and effectively mediate gene transfer and expression in vivo. Other examples of successful targeted in vivo delivery of nucleic acid molecules are known in the art.Finally, recombinant nucleic acid molecules can be selectively (i.e., preferentially, substantially exclusively) expressed in target cells by selecting transcriptional control sequences, and preferably promoters, that are selectively induced in target cells and remain substantially inactive in non-target cells.
[0165] The double-stranded RNA, the inverted chimeric siRNA molecule, or the chemically modified siRNA molecule of the present invention can be delivered together with other therapeutic agents optionally.Additional therapeutic agents can be delivered simultaneously with the double-stranded RNA, the inverted chimeric siRNA molecule, or the chemically modified siRNA molecule of the present invention.As used herein, the term "simultaneously" refers to a time that is close enough to produce a combined effect (i.e., concurrently can be at the same time, or can be two or more events that occur within a short period of time before or after each other). In one embodiment, the double-stranded RNA, inverted chimeric siRNA molecule, or chemically modified siRNA molecule of the present invention is selected from the group consisting of 1) vinca alkaloids (e.g., vinblastine, vincristine), 2) epipodophyllotoxins (e.g., etoposide and teniposide), 3) antibiotics (e.g., dactinomycin (actinomycin D), daunorubicin (daunomycin, rubidomycin), doxorubicin, bleomycin, plicamycin (mithramycin), and mitomycin (mitomycin C)), 4) enzymes (e.g., L-asparaginase), 5) biological response modifiers (e.g., interferon-alpha), 6) platinum coordination complexes (e.g., cisplatin and carboplatin), 7) anthracenediones (e.g., mitoxantrone), 8) substituted ureas (e.g., hydroxyurea), 9) methyl and 17) gonadotropin-releasing hormone analogs (e.g., leuprolide), 18) tetracycline derivatives (e.g., procarbazine (N-methylhydrazine, MIH)), 10) adrenal cortex suppressants (e.g., mitotane (o,p'-DDD) and aminoglutethimide), 11) adrenal cortical steroids (e.g., prednisone), 12) progestins (e.g., hydroprogesterone caproate, medroxyprogesterone acetate, and megestrol acetate), 13) estrogens (e.g., diethylstilbestrol and ethinyl estradiol), 14) antiestrogens (e.g., tamoxifen), 15) androgens (e.g., testosterone propionate and fluoxymesterone), 16) antiandrogens (e.g., flutamide), and 17) gonadotropin-releasing hormone analogs (e.g., leuprolide).In another embodiment, the compounds of the invention are used in combination with anti-angiogenic agents, such as antibodies against VEGF (e.g., bevacizumab (AVASTIN), ranibizumab (LUCENTIS)) and other promoters of angiogenesis (e.g., bFGF, angiopoietin-1), antibodies against alpha-v / beta-3 vascular integrin (e.g., VITAXIN), angiostatin, endostatin, dalteparin, ABT-510, CNGRC peptide TNF alpha conjugate, cyclophosphamide, combretastatin A4 phosphate, dimethylxanthenone acetic acid, docetaxel, lenamidomide, Administered in conjunction with enzastaurin, paclitaxel, paclitaxel albumin stabilized nanoparticle formulation (Abraxane), soy isoflavone (genistein), tamoxifen citrate, thalidomide, ADH-1 (EXHERIN), AG-013736, AMG-706, AZD2171, sorafenib tosylate, BMS-582664, CHIR-265, pazopanib, PI-88, vatalanib, everolimus, suramin, sunitinib malate, XL184, ZD6474, ATN-161, cilenigtide, and celecoxib, or any combination thereof.
[0166] As used herein, the term "cancer" refers to any benign or malignant abnormal growth of cells. Examples include, but are not limited to, breast cancer, prostate cancer, lymphoma, skin cancer, pancreatic cancer, colon cancer, melanoma, malignant melanoma, ovarian cancer, brain cancer, primary brain carcinoma, head and neck cancer, glioma, glioblastoma, liver cancer, bladder cancer, non-small cell lung cancer, head or neck carcinoma, breast cancer, uterine cancer, lung cancer, small cell lung cancer, Wilms' tumor, cervical cancer, testicular cancer, bladder cancer, pancreatic cancer, stomach carcinoma, colon cancer, prostate cancer, genitourinary system carcinoma, thyroid cancer, esophageal cancer, myeloma, multiple myeloma, adrenal gland cancer, renal cell carcinoma, endometrial cancer, adrenal cortical carcinoma, malignant In some embodiments, the cancer is selected from the group of tumor-forming cancers.
[0167] Pharmaceutical Compositions In a further aspect, the invention provides pharmaceutical formulations and methods of administering same to achieve any of the above-mentioned therapeutic effects, such as treating cancer. The pharmaceutical formulations may include any of the above-mentioned agents in a pharma- ceutically acceptable carrier.
[0168] "Pharmaceutically acceptable" means a material that is not biologically or otherwise undesirable, i.e., the material can be administered to a subject without causing any undesirable biological effects, such as toxicity.
[0169] The formulations of the present invention may optionally include medicinal agents, pharmaceutical agents, carriers, adjuvants, dispersants, diluents, and the like.
[0170] The double-stranded RNA, inverted chimeric siRNA molecule, chemically modified siRNA molecule, or nucleic acid construct of the present invention can be formulated for administration in a pharmaceutical carrier according to known techniques. See, for example, Remington, The Science And Practice of Pharmacy (9th Edition, 1995). In the manufacture of pharmaceutical formulations according to the present invention, the double-stranded RNA, inverted chimeric siRNA molecule, or chemically modified siRNA molecule (including physiologically acceptable salts thereof) is typically mixed with, inter alia, an acceptable carrier. The carrier can be solid or liquid, or both, and preferably, the double-stranded RNA, inverted chimeric siRNA molecule, or chemically modified siRNA molecule can be formulated as a unit dose formulation, e.g., a tablet, which can contain 0.01 or 0.5% to 95% or 99% by weight of the double-stranded RNA, inverted chimeric siRNA molecule, or chemically modified siRNA molecule. One or more double-stranded RNA, inverted chimeric siRNA molecule, or chemically modified siRNA molecule can be incorporated into the formulation of the present invention, which can be prepared by any of the well-known pharmaceutical techniques.
[0171] Another aspect of the present invention is a method for treating a subject in vivo, comprising administering to the subject a pharmaceutical composition comprising the double-stranded RNA, the inverted chimeric siRNA molecule or the chemically modified siRNA molecule of the present invention in a pharma-ceutically acceptable carrier, and administering the pharmaceutical composition in a therapeutically effective amount.The administration of the double-stranded RNA, the inverted chimeric siRNA molecule or the chemically modified siRNA molecule of the present invention to a human subject or animal in need thereof can be by any means known in the art for administering a compound.
[0172] Non-limiting examples of formulations of the present invention include those suitable for oral, rectal, buccal (e.g., sublingual), vaginal, parenteral (e.g., subcutaneous, intramuscular, including skeletal, cardiac, diaphragm, and smooth muscles, intradermal, intravenous, intraperitoneal), topical (i.e., both cutaneous and mucosal surfaces, including airway surfaces), intranasal, transdermal, intra-articular, intracranial, intrathecal, inhalation administration, administration to the liver by intraportal delivery, and direct organ injection (e.g., intrahepatic, intralimbic, intrabrain or spinal cord for delivery to the central nervous system, intrapancreatic, or into tumor or peritumoral tissue). The most appropriate route in any given case will depend on the nature and severity of the condition to be treated and the nature of the particular compound used. In some embodiments, it may be desirable to deliver the formulation locally to avoid any side effects associated with systemic administration. For example, local administration can be achieved by direct injection at the desired treatment site, by intravenous introduction at a site near the desired treatment site (e.g., into a blood vessel supplying the treatment site). In some embodiments, the formulation can be delivered locally to the ischemic tissue. In certain embodiments, the formulation can be in the form of a sustained release formulation, for example a sustained release depot.
[0173] For injection, the carrier is typically a liquid such as sterile pyrogen-free water, pyrogen-free phosphate-buffered saline, bacteriostatic water, or Cremophor EL® (BASF, Parsippany, NJ). For other methods of administration, the carrier can be either a solid or liquid.
[0174] For oral administration, the compound can be administered in solid dosage forms such as capsules, tablets, and powders, or in liquid dosage forms such as elixirs, syrups, and suspensions. The compound can be encapsulated in gelatin capsules with inactive ingredients and powdered carriers such as glucose, lactose, sucrose, mannitol, starch, cellulose or cellulose derivatives, magnesium stearate, stearic acid, sodium saccharin, talcum, magnesium carbonate, and the like. Examples of additional inactive ingredients that can be added to provide desirable color, taste, stability, buffering capacity, dispersion, or other known desirable features are red oxide, silica gel, sodium lauryl sulfate, titanium dioxide, edible white ink, and the like. Similar diluents can be used to make compressed tablets. Both tablets and capsules can be manufactured as sustained release products to provide continuous release of pharmaceutical agent over a period of time. The compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect from the atmosphere, or enteric coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance.
[0175] Formulations suitable for buccal (sublingual) administration include lozenges which contain the compound in a flavored base, usually sucrose and acacia or tragacanth, and pastilles which contain the compound in an inert base, such as gelatin and glycerin or sucrose and acacia.
[0176] The formulations of the present invention suitable for parenteral administration include sterile aqueous and non-aqueous injection solutions of the compound, the preparations being preferably isotonic with the blood of the intended recipient.These preparations may contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient.Aqueous and non-aqueous sterile suspensions may include suspending agents and thickening agents.The formulations may be presented in unit-dose or multi-dose containers, such as sealed ampoules and vials, and may be stored under freeze-dried conditions, requiring only the addition of sterile liquid carriers, such as saline or water for injection, immediately prior to use.
[0177] Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the type already described. For example, in one aspect of the present invention, a stable sterile composition for injection is provided, which comprises the compound of the present invention in a unit dosage form in a sealed container. The compound or salt is provided in the form of a lyophilizate, which can be reconstituted with a suitable pharmaceutically acceptable carrier to form a liquid composition suitable for its injection into a subject. A unit dosage form typically contains about 10 mg to about 10 grams of the compound or salt. When the compound or salt is substantially water-insoluble, a sufficient amount of a pharmaceutically acceptable emulsifier can be used in an amount sufficient to emulsify the compound or salt in an aqueous carrier. One such useful emulsifier is phosphatidylcholine.
[0178] Formulations suitable for rectal administration are preferably presented as unit-dose suppositories. These may be prepared by admixing the compound with one or more conventional solid carriers, for example, cocoa butter, and then shaping the resulting mixture.
[0179] Formulations suitable for topical application to the skin preferably take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil. Carriers that can be used include petroleum, lanolin, polyethylene glycols, alcohols, transdermal enhancers, and combinations of two or more thereof.
[0180] Formulations suitable for transdermal administration can be presented as separate patches adapted to be held in close contact with the epidermis of the recipient for extended periods of time. Formulations suitable for transdermal administration can also be delivered by iontophoresis (see, for example, Tyle, Pharm.Res., 3:318 (1986)), and typically take the form of an optionally buffered aqueous solution of the compound. Suitable formulations include 0.1-0.2M of the compound in citrate or Bis / Tris buffer (pH 6) or ethanol / water.
[0181] Alternatively, the compound can be formulated for nasal administration or otherwise administered to the subject's lungs by any suitable means, for example, by an aerosol suspension of respirable particles containing the compound, which the subject inhales. The respirable particles can be liquid or solid. The term "aerosol" includes any gas-borne suspended phase that can be inhaled into the bronchioles or nasal passages. Specifically, aerosol includes gas-borne suspensions of droplets that can be produced in metered dose inhalers or nebulizers, or mist sprayers. Aerosol also includes dry powder compositions suspended in air or other carrier gases that can be delivered by insufflation from an inhaler device, see, for example, Ganderton and Jones, Drug Delivery to the Respiratory Tract, Ellis Horwood (1987), Gonda (1990) Critical Reviews in Therapeutic Drug Carrier Systems, 6:273-313, and Raeburn et al., J.Pharmacol.Toxicol.Meth., 27:143 (1992). Aerosols of liquid particles containing the compound can be generated by any suitable means, such as pressure-driven aerosol nebulizers or ultrasonic nebulizers, as known to those skilled in the art. See, for example, U.S. Patent No. 4,501,729. Similarly, aerosols of solid particles containing the compound can be generated by any solid particulate pharmaceutical aerosol generator, using techniques known in the pharmaceutical art.
[0182] Alternatively, the compounds can be administered in a local rather than systemic manner, such as in a depot or sustained release formulation.
[0183] Furthermore, the present invention provides liposomal formulations of the compounds and their salts disclosed herein.Technologies for forming liposomal suspensions are well known in the art.When the compound or its salt is a water-soluble salt, it can be incorporated into lipid vesicles using conventional liposome techniques.In such cases, due to the water solubility of the compound or salt, the compound or salt is substantially entrained in the hydrophilic center or core of the liposome.The lipid layer used can be of any conventional composition and can either contain cholesterol or be cholesterol-free.When the compound or salt of interest is water-insoluble, again conventional liposome formation techniques can be used to substantially entrain the salt in the hydrophobic lipid bilayer that forms the structure of the liposome.In either case, the liposomes produced can be reduced in size, such as through the use of standard sonication and homogenization techniques.
[0184] Liposomal formulations containing the compounds disclosed herein or salts thereof can be lyophilized to produce a lyophilizate that can be reconstituted with a pharma- ceutically acceptable carrier, such as water, to regenerate the liposomal suspension.
[0185] In the case of water-insoluble compounds, pharmaceutical compositions containing the water-insoluble compounds can be prepared, for example, in an aqueous-based emulsion.In such cases, the composition contains a sufficient amount of pharma- ceutically acceptable emulsifier to emulsify the desired amount of the compound.Particularly useful emulsifiers include phosphatidylcholine and lecithin.
[0186] In certain embodiments, the compound is administered to the subject in a therapeutically effective amount as defined above. The dosage of a pharma- ceutical active compound can be determined by methods known in the art, see, for example, Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa.). The therapeutically effective dosage of any particular compound will vary somewhat between compounds and between patients, depending on the condition of the patient and the route of delivery. As a general proposition, a dosage of about 0.001 to about 50 mg / kg has therapeutic effectiveness, all weights being calculated based on the weight of the compound, including when salts are used. Toxicity concerns at higher levels may limit intravenous dosages to lower levels, such as up to about 10 mg / kg, all weights being calculated based on the weight of the compound, including when salts are used. Dosages of about 10 mg / kg to about 50 mg / kg can be used for oral administration. Typically, dosages of about 0.5 mg / kg to 5 mg / kg can be used for intramuscular injection. Specific dosage amounts are from about 1 μmol / kg to 50 μmol / kg, more specifically up to about 22 μmol / kg and up to 33 μmol / kg of the compound for intravenous or oral administration, respectively.
[0187] In certain embodiments of the invention, multiple administrations (e.g., 2, 3, 4 or more administrations) over various time intervals (e.g., hourly, daily, weekly, monthly, etc.) may be used to achieve a therapeutic effect.
[0188] The present invention finds use in veterinary and medical applications. Suitable subjects include both birds and mammals, with mammals being preferred. As used herein, the term "birds" includes, but is not limited to, chickens, ducks, geese, quail, turkeys, and pheasants. As used herein, the term "mammals" includes, but is not limited to, humans, cattle, sheep, goats, equines, felines, canines, lagomorphs, and the like. Human subjects include neonates, infants, adolescents, and adults. In other embodiments, the subject is an animal model of cancer. In certain embodiments, the subject is at risk or at risk for cancer.
[0189] The following examples are not intended to limit the scope of the claims to the present invention, but are rather intended to be illustrative of specific embodiments. Any variation to the illustrated method that occurs to a person skilled in the art is intended to be within the scope of the present invention. As a person skilled in the art will understand, there are several embodiments and elements for each aspect of the claimed invention, and all combinations of various elements are contemplated hereby, so the specific combinations illustrated herein should not be interpreted as limiting the scope of the claimed invention. When a specific element is removed from or added to a group of elements available in a combination, the group of elements should be interpreted as incorporating such changes. EXAMPLES
[0190] Synthetic siRNAs show reduced expression of c-MYC mRNA transcripts and protein MIA-PaCa2 cells were treated with control siRNA targeting snord90 and eight c-Myc-targeting siRNAs at 20 nM for 24 and 48 h (Figure 1A). Control siRNA targeting snord90 and eight c-Myc-targeting siRNAs are shown in Table 1. Relative quantification of c-Myc band intensity was then performed (Figure 1C). MIA-PaCa2 cells were treated with negative control siRNA targeting snord90 (NC), positive control siRNA (PC) from a previously published paper, and eight c-Myc-targeting siRNAs at 20 nM for 24 h and then immunoblotted. Vinculin was used as an internal control (Figure 1B). Positive controls have previously been shown to suppress c-Myc expression (Vaseva et al., KRAS Suppression-Induced Degradation of MYC Is Antagonized by a MEK5-ERK5 Compensatory Mechanism. Cancer cell, 34(5), pp. 807-822.e7, 2018). Several highly potent c-Myc siRNAs were identified, as evidenced by inhibition of c-Myc mRNA and protein expression.
[0191] JPEG2024523424000003.jpg102166 EXAMPLES
[0192] Synthetic, chemically modified siRNAs substantially reduce c-Myc gene transcripts MIA-PaCa2 cells were treated with control siRNA with 2'Ome modification and five chemically modified c-Myc targeting siRNAs (SEQ ID NO: 37 and 38, SEQ ID NO: 39 and 40, SEQ ID NO: 41 and 42, SEQ ID NO: 43 and 44, or SEQ ID NO: 45 and 46) at 20 nM for 24, 48, and 72 hours (Figure 2A). A427 cells were treated with control siRNA with 2'Ome modification and five chemically modified c-Myc targeting siRNAs at 20 nM for 24 and 72 hours (Figure 2B). These siRNAs were fully modified (FM) to minimize nuclease degradation and immune stimulation. Although these types of modifications often attenuate the silencing activity of siRNAs, we developed several fully modified siRNA sequences that retain all or nearly all of their silencing activity compared to unmodified siRNAs. Table 2 lists the fully modified siRNA sequences that were prepared. The Hi2F pattern consists of an approximately 50 / 50 mixture of 2'-fluoro (2'F) and 2'-O-methyl (2'OMe) ribose modifications. The Hi2Ome pattern consists of a majority of 2'OMe ribose modifications and minimal 2'F modifications to improve in vivo stability and avoid nuclease degradation. These RT-qPCR data demonstrate that fully modified c-Myc-targeting siRNAs maintain their potent silencing activity in several cancer cell lines.
[0193] JPEG2024523424000004.jpg210166JPEG2024523424000005.jpg78166 EXAMPLES
[0194] Synthetic, chemically modified siRNA reduces c-MYC protein expression MIA-PaCa2 and A427 cells were treated with control siRNA with 2'Ome modification and chemically modified c-Myc targeting siRNA (SEQ ID NO: 37 and 38, SEQ ID NO: 39 and 40, SEQ ID NO: 41 and 42, SEQ ID NO: 43 and 44, or SEQ ID NO: 45 and 46) at 20 nM for 48 hours and immunoblotted, with vinculin used as an internal control (Figure 3A). Relative quantification of c-Myc band intensity was then plotted in Figure 3B. siRNAs with two different chemical modification patterns (Hi2F and Hi2Ome (SEQ ID NO: 39 and 40, SEQ ID NO: 41 and 42, SEQ ID NO: 51 and 52, SEQ ID NO: 53 and 54)) were tested in A427 and MIA-PaCA2 cells and shown to be essentially equally effective (Figures 3C and 3D). These protein expression data demonstrate that fully modified c-Myc targeting siRNA maintains its potent silencing activity in several cancer cell lines. EXAMPLES
[0195] Synthetic, chemically modified siRNA reduces in vitro spheroid formation MIA-PaCa2 and A427 cells were treated with control siRNA with 2'Ome modification and two chemically modified siRNAs targeting c-Myc (either SEQ ID NOs: 39 and 40 or SEQ ID NOs: 41 and 42) at 20 nM for 24 hours and then grown in Matrigel for 5 days. Representative phase contrast images were taken using a confocal microscope with a 5x objective (Figure 4A). Relative quantification of spheroid mean area from the images in Figure 4A is shown in Figure 4B. The statistics of relative quantification were as follows: **** p=<0.0001, *** p=0.0002. These data demonstrate that siRNA targeting fully modified c-Myc has potent tumor growth inhibitory effects in several cancer cell lines. EXAMPLES
[0196] Dual targeting of c-MYC and KRAS with chemically modified siRNAs results in reduced spheroid area and number in MIA-PaCa2 cells in Matrigel MIA-PaCa2 cells were treated with a control siRNA with 2'Ome modification and two chemically modified siRNAs targeting c-Myc (either SEQ ID NOs: 39 and 40 or SEQ ID NOs: 41 and 42) and KRAS (either SEQ ID NOs: 47 and 48 or SEQ ID NOs: 49 and 50) at 5 nM for 24 hours and then grown in Matrigel for 5 days. Representative phase contrast images were taken using a confocal microscope with a 5x objective (Figure 5A). Relative quantification of spheroid area and number from confocal images was performed using Organoseg software and is shown in Figure 5B. Statistics of relative quantification were as follows: ** p=0.0022~0.0027, * p=0.0113~0.0147.
[0197] MIA-PaCa2 cells were treated with control siRNA with 2'Ome modification and two chemically modified siRNAs targeting c-Myc (either SEQ ID NO: 39 and 40 or SEQ ID NO: 41 and 42) and KRAS (either SEQ ID NO: 47 and 48 or SEQ ID NO: 49 and 50) at 5 nM for 24 hours, then seeded in 96-well round-bottom plates and imaged for 5 days using the Incucyte live cell analysis system (Figure 5C). Post-imaging processing was then performed using Incucyte Cells mixed with CellTiter Glo 3D (Promega) and fluorescence was measured in a plate reader to determine metabolic activity (Figure 5D). These data demonstrate that while targeting mutant KRAS or c-Myc individually with fully modified siRNAs has an anti-tumor growth effect, the combination of KRAS and c-Myc siRNA molecules is even more effective. These data support the dual targeting of mutant KRAS and c-Myc in cancer by inhibiting spheroid formation and growth within the spheroids. EXAMPLES
[0198] Dual targeting of c-MYC and KRAS with chemically modified siRNAs results in reduced spheroid area and number in A427 cells in Matrigel A427 cells were treated with a control siRNA with 2'Ome modification and two chemically modified siRNAs targeting c-Myc (either SEQ ID NO: 39 and 40 or SEQ ID NO: 41 and 42) and KRAS (either SEQ ID NO: 47 and 48 or SEQ ID NO: 49 and 50) at 10 nM for 24 hours and then grown in Matrigel for 5 days. Representative phase contrast images were taken using a confocal microscope with a 5x objective (Figure 6A). Relative quantification of spheroid area and number from confocal images was performed using Organoseg software (Figure 6B). Statistics of relative quantification were as follows: **** p=<0.0001.
[0199] A427 cells were treated with a control siRNA with 2'Ome modification and two chemically modified siRNAs targeting c-Myc (either SEQ ID NO: 39 and 40 or SEQ ID NO: 41 and 42) and KRAS (either SEQ ID NO: 47 and 48 or SEQ ID NO: 49 and 50) at 10 nM for 24 hours, then seeded in 96-well round-bottom plates and imaged for 5 days using the Incucyte live cell analysis system (Figure 6C). Post-imaging processing was then performed using Incucyte Cells mixed with CellTiter Glo 3D (Promega) and fluorescence was measured on a plate reader to determine metabolic activity (Figure 6D).
[0200] Dual targeting of c-MYC and KRAS with chemically modified siRNAs resulted in apoptosis in A427 cells. A427 cells were treated with a control siRNA with 2'Ome modification and two chemically modified siRNAs targeting c-Myc (either SEQ ID NO: 39 and 40 or SEQ ID NO: 41 and 42) and KRAS (either SEQ ID NO: 47 and 48 or SEQ ID NO: 49 and 50) at 10 nM for 24 hours, then seeded in 96-well round-bottom plates with CellTox Green and imaged for 5 days using an Incucyte live cell analysis system. Graphs show data up to 84 hours (Figures 6E and 6F). Statistics were as follows: **** p=<0.0001, *** p=0.0003. These data demonstrate that targeting mutant KRAS or c-Myc individually with fully modified siRNA has an antitumor growth effect, while the combination of KRAS and c-Myc siRNA molecules is even more effective. These data support the dual targeting of mutant KRAS and c-Myc in cancer based on the induction of apoptosis in spheroids. EXAMPLES
[0201] Phosphodiester-linked chemically modified siRNAs combining siRNAs targeting KRAS and cMyc ("chimeras") are biologically active and reduce c-Myc and KRAS mRNA transcripts in MIA-PaCa2 cells MIA-PaCa2 cells were treated with a control siRNA with 2'Ome modifications (SEQ ID NOs: 61 and 62), one chemically modified c-Myc-targeting siRNA (SEQ ID NOs: 39 and 40), and one chemically modified KRAS-targeting siRNA (SEQ ID NOs: 47 and 48), either alone or in combination, and one "chimeric" siRNA (SEQ ID NOs: 63-65) at 5 nM, 10 nM, and 20 nM for 48 or 72 h (Figure 8). A schematic showing a phosphodiester-linked chemically modified siRNA ("chimera") combining siRNAs targeting KRAS and cMyc is shown in Figure 7, which reveals the conceptual design in which the sense strand of one siRNA is synthesized adjacent to contain a phosphodiester nucleotide bridge followed by the antisense strand of another siRNA. Complementary strands to each corresponding siRNA are then duplexed to form multivalent chimeric siRNAs. The chimera can simplify the delivery process of either multiple individual siRNAs or siRNAs targeting multiple targets, and also ensure equimolar targeting of both gene transcripts. This data demonstrates that multivalent chimeric siRNAs are each functional in cells and can potently target multiple different genes at once.
[0202] JPEG2024523424000006.jpg125166JPEG2024523424000007.jpg177166JPEG2024523424 000008.jpg182166JPEG2024523424000009.jpg209166JPEG2024523424000010.jpg95166 EXAMPLES
[0203] Inverted chimeras are more potent than tandem chimeras in reducing c-Myc and KRAS mRNA transcript and protein levels in A427 cells A427 cells were treated with a control siRNA with 2'Ome modification (SEQ ID NOs: 61 and 62), one chemically modified (Hi2F) siRNA targeting c-Myc (SEQ ID NOs: 39 and 40), one chemically modified (Hi2OMe) siRNA targeting KRAS (SEQ ID NOs: 47 and 48), one M2 / K2 "inverted chimera" (SEQ ID NOs: 63-65), or one M2 / K2 "tandem chimera" siRNA (SEQ ID NOs: 66-68) at 5 nM and 20 nM for 48 and 72 h (Figure 9).
[0204] MIA-PaCa2 cells were treated with a control siRNA with a 2'Ome modification (SEQ ID NOs: 61 and 62), one or two chemically modified (Hi2F) siRNAs targeting c-Myc (SEQ ID NOs: 39 and 40, 41 and 42, 51 and 52, 53 and 54), one chemically modified (Hi2OMe) siRNA targeting KRAS (SEQ ID NOs: 47 and 48), one M2 / K2 "inverted chimera" (SEQ ID NOs: 63-65), or one M2 / K2 "tandem chimera" siRNA (SEQ ID NOs: 66-68) at 5 nM and 20 nM for 48 and 72 h (Figures 10A-10C). Taken together, these data demonstrate that in two different cancer types (A427=lung adenocarcinoma, MIA-PaCa2=pancreatic adenocarcinoma) with unique KRAS mutations, the inverted chimera was unexpectedly more potent than the tandem chimera design, and the efficacy of the inverted design exceeds that of individual siRNAs (e.g., KRAS=KSeq2 or Myc=MSeq2). These data demonstrate that the efficacy of the inverted design holds true at the transcript (RT-qPCR) and protein (Western blot) levels. EXAMPLES
[0205] Stability of inverted and tandem chimeras The stability of the inverted and tandem chimeras in serum was tested (Figure 11). The inverted chimeras were shown to be more stable. In contrast, both the inverted and tandem chimeras were stable under cytosolic conditions (Figure 12). When tested under endosomal conditions, both the inverted and tandem chimeras began to dissociate over time (Figure 13). Both the inverted and tandem chimeras were demonstrated to be resistant to cleavage by Dicer (Figures 14A-14C). These data demonstrate that metabolism of the inverted and tandem chimeras occurs predominantly in the endosomal compartment, with very little degradation occurring under serum conditions. Furthermore, the chimeras are highly stable in the cytosol and are not substrates for cleavage by Dicer. Based on this information, it is expected that these chimeric molecules will be stable in circulation, but that upon receptor-mediated endocytosis, they will be cleaved at the DNA bridge. The data indicate that approximately half of the chimeras are cleaved in the endosomal compartment by approximately 24 hours after entry. EXAMPLES
[0206] Increasing the potency of inverted chimeras A431 isogenic cell lines in which endogenous KRAS was ablated by CRISPR / Cas9 and stably integrated KRAS-firefly luciferase and unlabeled Renilla luciferase were treated with control siRNA with 2'Ome modification, one chemically modified (Hi2F) siRNA targeting c-Myc, one chemically modified (Hi2OMe) siRNA targeting KRAS, one M2 / K2 "inverted chimera", or one M2 / K2 "tandem chimera" siRNA for 96 h at doses ranging from 39 to 0.002 nM. Renilla luciferase was used to normalize the firefly luciferase data (Figure 15). The data show that the inverted chimera was unexpectedly much more potent than the tandem chimera and individual KRAS siRNA (KSeq2 Hi2OMe).
[0207] Two different versions of the c-Myc / KRAS inverted chimera (V1 (SEQ ID NO: 63-65) and V2 (SEQ ID NO: 69-71)) were equally potent against MIA-PaCA2 and A427 cells (Figures 16A-16B). These Hi2OMe (V2) designed chimeras are expected to be more stable in vivo due to increased resistance to nuclease degradation. These data demonstrate that the V2 version of the inverted chimera is more effective than single siRNAs in lowering c-Myc and KRAS proteins in A427 cells (Figures 17A-17B) and MIA-PaCa2 cells (Figures 18A-18B). These data demonstrate that downstream MAP kinase signaling and MYC protein expression are substantially attenuated by the inverted chimera design, far superior to the individual contributions seen by the individual siRNA components. Furthermore, the V2 inverted chimera showed unexpectedly high potency against the KRAS-luciferase protein compared to single siRNAs (Figure 19), resulting in a substantial leftward shift in potency. Furthermore, the V2 inverted chimera synergistically reduced cell viability in both MIA-PaCA2 and A427 cells (Figures 20A-20B), demonstrating an approximately 10-fold improvement in potency compared to individual siRNAs. The V2 inverted chimera was able to reduce spheroid viability in both MIA-PaCA2 and A427 cells (Figures 21A-21D). These data demonstrate that the more optimized (V2) design is highly effective at simultaneously targeting two unique targets at once, surprisingly more effective than the individual siRNA components of the chimeric design, and also consistently outperforming the potency of the tandem chimeric design. The improved potency and ability to simultaneously target two different genes results in a significant improvement in inhibitory activity, sometimes more than 10-fold improvement in potency compared to individual siRNAs. EXAMPLES
[0208] Development and validation of specific KRAS mutant (G12V) siRNAs using isogenic cell lines expressing KRAS WT or KRAS G12V reporters To test the specificity of KRAS siRNA, siRNA was tested against A431 isogenic cells expressing wild-type KRAS or G12V KRAS (Figure 22). Based on RT-qPCR, V1-G12V Hi2F or V4-G12V Hi2OMe siRNA led to potent silencing of KRAS G12V but allowed targeting of KRAS WT either partially (V1-G12V) or completely (V4-G12V). Compared to pan-KRAS siRNA, V4-G12V Hi2OMe was found to potently target KRAS G12V but completely allowed targeting of KRAS WT at the protein level using luciferase readout. Similarly, a strong anti-proliferative effect was seen in SKCO1 (colon) and H727 (lung) cell lines carrying KRAS G12V mutation using viability assays (Figure 23). These data demonstrate that both V1-G12V and V4-G12V potently target KRAS G12V while sparing KRAS WT. As a result, the data demonstrate that both of these compositions have potent anti-proliferative effects against KRAS G12V mutant cancer cell lines. EXAMPLES
[0209] Efficacy of inverted chimeras In H441 cells (Figure 24) and SKCO1 cells (Figure 25), the inverted chimera (M2 / V4-G12V) targeting a specific KRAS mutation (G12V) and c-Myc (SEQ ID NOs: 75-77) synergistically reduced cell viability compared to single siRNAs. These data demonstrate that the mutation-specific siRNA (V4-G12V for the KRAS G12V mutation) is also unexpectedly potent in the inverted chimera design, more potent than the components against each target.
[0210] In the RPMI-8226 myeloma cell line, inverted chimeras targeting IRF4 and c-Myc (SEQ ID NOs: 90-92) synergistically reduced cell viability compared to single siRNAs, based on a >5-fold improvement in potency over either individual siRNA. These data indicate that the superior efficacy of the inverted chimeras is independent of the target gene or disease type (Figure 26) and that these designs can be applied to any two targets of interest and across a variety of pathophysiological conditions.
[0211] Notably, an inverted chimera containing two siRNAs (sequence numbers 84-86, 87-89) targeting the same gene (c-Myc) was more effective at reducing mRNA than targeting the gene with individual siRNAs against the same c-Myc target (Figures 27A-27B).
[0212] Similarly, inverted chimeras targeting the same gene (KRAS) were more effective at reducing KRAS-luciferase protein than targeting the gene with individual siRNAs (Figure 28). Together, these data demonstrate that inverted chimeras can also be used to more potently silence the same target gene by using siRNAs that silence at unique locations at the mRNA transcript and protein levels.
[0213] All publications, patents, and patent applications are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
[0214] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be apparent that certain changes and modifications can be practiced within the scope of the foregoing embodiments and the appended claims recited below.
Claims
1. An inverted chimeric siRNA molecule comprising first and second siRNAs with opposite orientations, a) a first RNA molecule comprising the first strand of the first siRNA and the first strand of the second siRNA linked by a linker; b) a second RNA molecule substantially complementary to the first strand of the first siRNA; c) a third RNA molecule substantially complementary to the first strand of the second siRNA comprising an inverted chimeric siRNA molecule.
2. The inverted chimeric siRNA molecule according to claim 1, wherein the first RNA molecule comprises the sense strand of the first siRNA and the antisense strand of the second siRNA.
3. The inverted chimeric siRNA molecule according to claim 1, having a length of about 30 to about 60 nucleotides, such as a length of about 35 to about 55 nucleotides, such as a length of about 40 to about 50 nucleotides, wherein each siRNA may independently have a length of about 15 to about 30 nucleotides, such as a length of about 17 to about 25 nucleotides, such as a length of about 19 to about 23 nucleotides, an inverted chimeric siRNA molecule.
4. The inverted chimeric siRNA molecule according to claim 1, wherein the linker is a metabolically labile linker and / or the linker has a length of about 2 to about 10 nucleotides, such as a length of about 3 to about 8 nucleotides, such as a length of about 4 to about 6 nucleotides, and / or the linker comprises phosphodiester thymine, phosphodiester adenine, or phosphodiester TCA, an inverted chimeric siRNA molecule.
5. The inverted chimeric siRNA molecule according to claim 1, wherein the linker has a length of about 2 to about 10 nucleotides, such as a length of about 3 to about 8 nucleotides, such as a length of about 4 to about 6 nucleotides, an inverted chimeric siRNA molecule.
6. The inverted chimeric siRNA molecule according to claim 1, which is fully chemically modified.
7. The inverted chimeric siRNA molecule according to claim 6, wherein each nucleotide in the molecule is modified with a 2'-O-methyl group or a 2'-fluoro group.
8. The inverted chimeric siRNA molecule according to claim 1, comprising at least one phosphorothioate linkage.
9. The inverted chimeric siRNA molecule according to claim 1, wherein the first and second siRNAs bind to the same target gene.
10. The inverted chimeric siRNA molecule according to claim 1, wherein the first and second siRNAs bind to different target genes.
11. The inverted chimeric siRNA molecule according to claim 10, wherein one of the first and second siRNAs binds to c-Myc.
12. The inverted chimeric siRNA molecule according to claim 10, wherein one of the first and second siRNAs binds to c-Myc and the other binds to KRAS.
13. The inverted chimeric siRNA molecule according to claim 1, comprising one or more additional siRNAs, each separated by a linker, wherein each additional siRNA may independently bind to the same target gene or a different target gene as the first and second siRNAs. Inverted chimeric siRNA molecule.
14. The inverted chimeric siRNA molecule according to claim 1, comprising one of the following sets of sequences: SEQ ID NO: 63-65 SEQ ID NO: 66-68 SEQ ID NO: 69-71 SEQ ID NO: 71-74 SEQ ID NO: 75-77 SEQ ID NO: 78-80 SEQ ID NO: 81-83 SEQ ID NO: 84-86 SEQ ID NO: 87-89 SEQ ID NO: 90-92 SEQ ID NO: 93-95 SEQ ID NO: 96-98 SEQ ID NO: 99-101 SEQ ID NO: 102-104 or a sequence that is at least 90% identical thereto.
15. A pharmaceutical composition comprising the inverted chimeric siRNA molecule according to claim 1 and a pharmaceutically acceptable carrier, wherein the inverted chimeric siRNA molecule may be conjugated to a ligand, antibody, or aptamer. Pharmaceutical composition.
16. An in vitro method of inhibiting the expression of a target gene in a cell, the method comprising contacting the cell with the inverted chimeric siRNA molecule according to claim 1, thereby inhibiting the expression of the target gene in the cell.
17. The inverted chimeric siRNA molecule according to claim 1 for use in the treatment of a disorder associated with a target gene in a subject in need thereof.
18. The inverted chimeric siRNA molecule according to claim 1 for use in the treatment of cancer in a subject in need thereof, wherein the cancer overexpresses the human c-Myc gene. The inverted chimeric siRNA molecule is delivered to the subject, thereby treating cancer in the subject. Inverted chimeric siRNA molecule.
19. The siRNA molecule comprises at least one chemical modification, and the siRNA molecule has the following sequence pairs: Sense strand of SEQ ID NO: 1 and antisense strand of SEQ ID NO: 19, Sense strand of SEQ ID NO: 2 and antisense strand of SEQ ID NO: 20, Sense strand of SEQ ID NO: 4 and antisense strand of SEQ ID NO: 22, Sense strand of SEQ ID NO: 6 and antisense strand of SEQ ID NO: 24, Sense strand of SEQ ID NO: 9 and antisense strand of SEQ ID NO: 27, Or an siRNA molecule targeting human c-Myc mRNA, comprising one of the sequences that is at least 90% identical thereto.
20. The siRNA molecule according to claim 19, which is completely chemically modified.
21. The siRNA molecule according to claim 20, wherein each nucleotide in the siRNA molecule is modified with a 2'-O-methyl group or a 2'-fluoro group.
22. The siRNA molecule according to claim 19, wherein the siRNA molecule comprises at least one phosphorothioate linkage.
23. The siRNA molecule has the following sequence pairs: Sense strand of SEQ ID NO: 37 and antisense strand of SEQ ID NO: 38, Sense strand of SEQ ID NO: 39 and antisense strand of SEQ ID NO: 40, Sense strand of SEQ ID NO: 41 and antisense strand of SEQ ID NO: 42, Sense strand of SEQ ID NO: 43 and antisense strand of SEQ ID NO: 44, or Sense strand of SEQ ID NO: 45 and antisense strand of SEQ ID NO: 46 The siRNA molecule according to claim 22, comprising one of them.
24. A pharmaceutical composition comprising the siRNA molecule according to claim 19 and a pharmaceutically acceptable carrier, wherein the siRNA may be conjugated with a ligand, an antibody, or an aptamer. Pharmaceutical composition.
25. An in vitro method for inhibiting the expression of the human c-Myc gene in a cell, comprising contacting the cell with the siRNA molecule according to claim 19, thereby inhibiting the expression of the human c-Myc gene in the cell.
26. The siRNA molecule according to claim 19, for use in the treatment of cancer in a subject in need thereof, wherein the cancer overexpresses the human c-Myc gene. siRNA molecule.
27. A siRNA molecule comprising a KRAS siRNA molecule targeting wild-type KRAS or a naturally occurring human KRAS encoding a mutation selected from G12C, G12D, G12V, or G13D, and a c-Myc siRNA molecule targeting human c-Myc mRNA, wherein the siRNA molecule comprises at least one chemical modification, and the c-Myc siRNA molecule comprises the following sequence pairs: The sense strand of SEQ ID NO: 1 and the antisense strand of SEQ ID NO: 19, The sense strand of SEQ ID NO: 2 and the antisense strand of SEQ ID NO: 20, The sense strand of SEQ ID NO: 4 and the antisense strand of SEQ ID NO: 22, The sense strand of SEQ ID NO: 6 and the antisense strand of SEQ ID NO: 24, The sense strand of SEQ ID NO: 9 and the antisense strand of SEQ ID NO: 27, Or one of the sequences that is at least 90% identical thereto, the siRNA molecule.
28. The siRNA molecule according to claim 27, which is completely chemically modified.
29. The siRNA molecule according to claim 28, wherein each nucleotide in the siRNA molecule is modified with a 2'-O-methyl group or a 2'-fluoro group.
30. The siRNA molecule according to claim 27, wherein the siRNA molecule comprises at least one phosphorothioate linkage.
31. The c-Myc siRNA molecule comprises the following sequence pairs: The sense strand of SEQ ID NO: 37 and the antisense strand of SEQ ID NO: 38, The sense strand of SEQ ID NO: 39 and the antisense strand of SEQ ID NO: 40, The sense strand of SEQ ID NO: 41 and the antisense strand of SEQ ID NO: 42, The sense strand of SEQ ID NO: 43 and the antisense strand of SEQ ID NO: 44, or The sense strand of SEQ ID NO: 45 and the antisense strand of SEQ ID NO: 46 The c-Myc siRNA molecule according to claim 30, which comprises one of them.
32. The KRAS siRNA molecule comprises the following sequence pairs: The sense strand of SEQ ID NO: 47 and the antisense strand of SEQ ID NO: 48, or The sense strand of SEQ ID NO: 49 and the antisense strand of SEQ ID NO: 50 The KRAS siRNA molecule according to claim 30, which is one of them.
33. A pharmaceutical composition comprising the siRNA according to claim 27 and a pharmaceutically acceptable carrier, wherein the siRNA may be conjugated with a ligand, an antibody, or an aptamer, the pharmaceutical composition.
34. An in vitro method for inhibiting the expression of the human c-Myc gene in a cell, the method comprising contacting the cell with the siRNA according to claim 27, thereby inhibiting the expression of the human c-Myc gene in the cell.
35. The siRNA molecule according to claim 27 for use in the treatment of cancer in a subject in need thereof, wherein the cancer overexpresses the human c-Myc gene, siRNA molecule.
36. A KRAS siRNA targeting a naturally occurring human KRAS encoding a wild-type KRAS or a mutation selected from G12C, G12D, G12V, or G13D, a c-Myc siRNA molecule targeting human c-Myc mRNA, and a phosphodiester linker region connecting the KRAS siRNA and the c-Myc siRNA comprising an siRNA multivalent chimeric molecule.
37. The siRNA multivalent chimeric molecule according to claim 36 having one or more chemical modifications.
38. The siRNA multivalent chimeric molecule according to claim 37, wherein the KRAS siRNA and the c-Myc siRNA are fully chemically modified.
39. The siRNA multivalent chimeric molecule according to claim 38, wherein each nucleotide in the KRAS siRNA and the c-Myc siRNA is modified with a 2'-O-methyl group or a 2'-fluoro group.
40. The siRNA multivalent chimeric molecule according to claim 36, wherein the siRNA molecule comprises at least one phosphorothioate linkage.
41. A pharmaceutical composition comprising the siRNA according to claim 36 and a pharmaceutically acceptable carrier, wherein the siRNA may be conjugated to a ligand, an antibody, or an aptamer, pharmaceutical composition.
42. An in vitro method for inhibiting the expression of the human c-Myc gene in a cell, the method comprising contacting the cell with the siRNA according to claim 36, thereby inhibiting the expression of the human c-Myc gene in the cell.
43. The siRNA molecule according to claim 36 for use in the treatment of cancer in a subject in need thereof, wherein the cancer expresses the human c-Myc gene, siRNA molecule.