Regulated viral delivery systems and uses thereof

Abstract

Provided herein is a recombinant virus system that comprises two or more coordinately regulated virus vectors.Also provided is a method for treating cell proliferation disorder using these systems.The compositions and methods provided herein provide more efficient and coordinated delivery of larger transgenes and / or higher amounts of transgenes than previous methods, by avoiding receptor interference and / or superinfection resistance, thereby allowing the progressive replication of both vectors and efficient gene delivery by each vector. TIFF2024526878000010.tif228151

Description

[Technical field]

[0001] Related prior applications This application claims the benefit of U.S. Provisional Application No. 63 / 224,330, filed July 21, 2021. U.S. Provisional Application No. 63 / 224.330 is incorporated herein by reference in its entirety. [Background technology]

[0002] background Although progress has been made in viral gene therapy, it is often difficult to deliver large amounts of genetic information that are stably and persistently expressed throughout solid tumor mass.Existing technologies often only utilize one non-replicating or replicating viral vector to deliver transgene.Even when two or more vectors are combined, they are not coordinated and regulated in a way that allows for synchronous replication and transgene expression.Therefore, there is a need for compositions and methods for efficiently and coordinately delivering larger transgenes and / or larger amounts of transgenes. Summary of the Invention

[0003] overview Provided herein is a recombinant virus system that comprises two or more kinds of virus vectors that are coordinately regulated.In some embodiments, the recombinant virus system is a recombinant retrovirus system that comprises two or more kinds of retrovirus vectors that are coordinately regulated.The present inventors have discovered that coordinately regulated virus vectors, such as retrovirus vectors, can avoid receptor interference and / or superinfection resistance, thereby allowing the progressive replication of both vectors and efficient gene delivery by each vector.

[0004] Provided herein is a recombinant virus system comprising: (a) a first virus that (i) encodes a first regulatory element operably linked to a nucleic acid encoding a first activator, and (ii) lacks a coding sequence for at least one viral protein required for replication, such that the first virus is a replication-deficient virus; and (b) a second virus that comprises a nucleic acid comprising a first polynucleotide encoding one or more viral proteins required for viral replication that are lacking in the first virus, wherein the first polynucleotide is expressed only when the first activator activates expression of the first polynucleotide and / or its encoded viral protein.

[0005] In some embodiments, the recombinant virus system is a recombinant retrovirus system.Therefore, a recombinant retrovirus system is provided herein, comprising: (a) a first retrovirus, (i) encoding a first regulatory element operably linked to a nucleic acid encoding a first activator, (ii) lacking a coding sequence of at least one viral protein required for replication, such that the first retrovirus is a replication-deficient retrovirus (RDV); and (b) a second retrovirus, comprising a nucleic acid comprising a first polynucleotide encoding one or more viral proteins required for viral replication that are lacking in the first retrovirus, wherein the first polynucleotide is expressed only when the first activator activates the expression of the first polynucleotide and / or its encoded viral protein.

[0006] In some embodiments, the activator activates expression by increasing the transcription or translation of the first polynucleotide.In some embodiments, the second virus, e.g., retrovirus, comprises a second regulatory element functionally linked to the first polynucleotide that encodes a viral protein required for viral replication, and the first activator activates the transcription of the first polynucleotide by binding to the second regulatory element.In some embodiments, the activator activates transcription by binding to the second regulatory element, and the second regulatory element is a promoter, enhancer, or repressor binding sequence.

[0007] In some embodiments, the first activator is a derepressor, and the first polynucleotide sequence encoded by the second virus, e.g., a retrovirus, is expressed only when the derepressor activates expression by derepressing expression of the first polynucleotide and / or viral protein. In some embodiments, derepression occurs at the transcriptional or translational level.

[0008] In some embodiments, the first and / or second regulatory elements are selected from the group consisting of promoters, enhancers, promoter / enhancer combinations, internal ribosome entry sites, epigenetic regulators, and translation regulators. In some embodiments, the promoter is a constitutive promoter or an inducible promoter. In some embodiments, the second virus is a replicating virus, e.g., a replicating retrovirus (RRV), that encodes all proteins required for viral replication. In some embodiments, the first and / or second virus, e.g., a retrovirus, further comprises a heterologous expression cassette comprising a payload promoter operably linked to a payload polynucleotide sequence.

[0009] In some embodiments, the viral protein required for replication is selected from the group consisting of gag, env, pol, rev, and tat. In some embodiments, the retrovirus is selected from the group consisting of lentivirus, murine leukemia virus (MLV), Moloney murine leukemia virus (MoMLV), foamy virus. In some embodiments, the payload polynucleotide encodes a polypeptide selected from the group consisting of a therapeutic protein, a prodrug activator, a cytotoxic protein, and a reporter protein. In some embodiments, the prodrug activator is thymidine kinase, cytidine deaminase, or purine nucleoside phosphorylase (PNP).

[0010] In some embodiments, the first activator is selected from the group consisting of HIV-1 transactivator protein (Tat), HIV-1 Rev, Gal4-VP16, GAL4FF, GAL4-VP64, and VP16-E2, and tetracycline transactivator protein.

[0011] In some embodiments, the second virus is a replication-deficient virus, e.g., a replication-deficient retrovirus (RDV), and encodes a third regulatory element operably linked to a nucleic acid encoding a second activator. The first virus, e.g., a retrovirus, comprises a nucleic acid comprising a second polynucleotide encoding a viral protein required for viral replication, and the second polynucleotide is expressed only when the second activator activates the expression of the second polynucleotide, and the first and second viruses, e.g., retroviruses, can replicate only when the first and second activators are expressed.

[0012] In some embodiments, the first virus, e.g., retrovirus, comprises a fourth regulatory element functionally linked to a second polynucleotide that encodes a viral protein required for viral replication, and the first activator activates the transcription of the second polynucleotide by binding to the fourth regulatory element.In some embodiments, the third regulatory element or the fourth regulatory element is selected from the group consisting of a promoter, an enhancer, a promoter / enhancer combination, an internal ribosome entry site, an epigenetic regulator, and a translation regulator.In some embodiments, the promoter is a constitutive promoter or an inducible promoter.

[0013] In some embodiments, the first or second virus (e.g., the first or second retrovirus), or both, comprises a heterologous expression cassette comprising a payload promoter operably linked to a payload polynucleotide. In some embodiments, the payload polynucleotide encodes a polypeptide selected from the group consisting of a therapeutic protein, a prodrug activator, a cytotoxic protein, and a reporter protein.

[0014] In some embodiments, the viral proteins required for replication are selected from the group consisting of gag, env, pol, rev, and tat. In some embodiments, the retrovirus is selected from the group consisting of lentivirus, murine leukemia virus (MLV), Moloney murine leukemia virus (MoMLV), and foamy virus.

[0015] In some embodiments, the payload polynucleotide encodes a polypeptide selected from the group consisting of a therapeutic protein, a prodrug activator, a cytotoxic protein, and a reporter protein. In some embodiments, the prodrug activator is a thymidine kinase, a cytidine deaminase, or a purine nucleoside phosphorylase (PNP).

[0016] In some embodiments, the third regulatory element or the fourth regulatory element is selected from the group consisting of a constitutive promoter, an inducible promoter, and a tissue-specific promoter. In some embodiments, the activator is selected from the group consisting of HIV-1 transactivator protein (Tat), HIV-1 Rev, Gal4-VP16, and VP16-E2, and tetracycline transactivator protein.

[0017] In some embodiments, the vectors described herein include one or more long terminal repeat (LTR) sequences. In any of the vectors described herein, any LTR sequence, for example, the 3'LTR and / or 5'LTR, may include a deletion, for example, a deletion in the U3 region of the LTR. In some embodiments, the 3'LTR and / or 5'LTR includes a heterologous promoter (e.g., a CMV promoter). In some embodiments, the 3'LTR sequence is a retroviral 3'LTR sequence (e.g., an MMLV 3'LTR sequence) that has been modified to reduce or destroy the native promoter function of the 3'LTR. The native promoter function can be reduced or destroyed, for example, by deleting one or more sequences in the 3'LTR and / or by inserting one or more sequences. In some embodiments, one or more nucleic acid sequences are inserted into the LTR that include binding sites for an activator, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more GAL4 binding sites. In some embodiments, the 3'LTR sequence of any vector described herein comprises a nucleic acid sequence having at least 60%, 70%, 80%, 90%, 95%, or 99% identity to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.

[0018] Provided herein is a method for producing a recombinant viral system, e.g., a retroviral system, comprising: (a) transfecting a first suitable host cell with a first viral vector of any of the systems described herein; (b) transfecting a second suitable host cell with a second viral vector of any of the systems provided herein; and (c) recovering the first and second viruses.

[0019] Provided herein is a method for transducing a target cell with a replicating retroviral system, the method comprising contacting the target cell with a first and a second virus of any one of the systems described herein.

[0020] In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is contacted in vitro, ex vivo, or in vivo.

[0021] Also provided is a pharmaceutical composition comprising (a) the first virus and / or the second virus of any of the systems provided herein, and (b) a pharmaceutical carrier.

[0022] Also provided is a method of treating a disease in a subject in need thereof, comprising administering any system or pharmaceutical composition provided herein to the subject.In some methods, the disease is a cell proliferation disorder.In some embodiments, the cell proliferation disorder is selected from the group consisting of lung cancer, breast cancer, ovarian cancer, uterine cancer, prostate cancer, testicular cancer, kidney cancer, urinary tract cancer, oral cancer, head and neck cancer, esophageal cancer, gastric cancer, pancreatic cancer, colorectal cancer, skin cancer, melanoma, sarcoma, lymphoma, leukemia, and brain cancer, including glioblastoma, anaplastic astrocytoma, oligodendroglioma, and medulloblastoma.In some embodiments, the cancer is glioblastoma.

[0023] In some embodiments, the first or second polynucleotide encodes a prodrug activator, and the method further comprises administering a prodrug to the subject, such that when the prodrug activator is expressed, the prodrug activator converts the prodrug into a toxic drug.In some embodiments, the first and / or second viral vector, for example, the first and / or second retroviral vector, is administered to the subject as a plasmid or as an infectious viral particle.In some embodiments, the subject is a mammal.In some embodiments, the subject is a human.

[0024] In some embodiments, the administration is systemic, local, or local. In some embodiments, the first and second retroviruses of the system are administered to the subject simultaneously or sequentially. [Brief description of the drawings]

[0025] This application includes the following drawings, which are intended to illustrate certain aspects and / or features of the compositions and methods and to supplement any description of the compositions and methods, and do not limit the scope of the compositions and methods, except to the extent that the written description clearly indicates that the drawings do so.

[0026] [Figure 1] FIG. 1 is a schematic diagram of an exemplary replication-defective retrovirus (RDV) containing a GAL4 / VP16 activator (GAL4FF), plXIX GAL4 IRES EMD retroviral vector, as described in the Examples. [Diagram 2] FIG. 2 is a schematic diagram of the pAC3_P2A_Stb_GAL4BS_minimal deletion retrovirus vector, an exemplary replicating retrovirus (RRV) described in the Examples. [Diagram 3] FIG. 3 is a schematic diagram of the pAC3_P2A_Stb_GAL4BS_maximally deleted retrovirus vector, an exemplary replicating retrovirus (RRV) described in the Examples. [Figure 4]FIG. 4 is a schematic diagram of an exemplary RDV, the pLXIX Tat IRES EMD retroviral vector, described in the Examples. [Diagram 5] FIG. 5 is a schematic diagram of an exemplary RRV, the pAC3 TIN IRES EMD retroviral vector, described in the Examples. [Figure 9] Figure 9A is a graph showing that the pAC3_P2A_Stb_GAL4BS_minimal deletion retroviral vector does not replicate in wild type SB28 tumor cells after 9 days. Figure 9B is a graph showing that pAC3_P2A_Stb_GAL4BS_minimal deletion replicates efficiently when stably expressing GAL4 / VP16 in SB28 tumor cells. [Figure 10A] FIG. 10A is a graph showing that addition of pLXIX GAL4 IRES EMD retroviral vector and pAC3_P2A_Stb_GAL4BS_minimal deleted retroviral vector (minimal Strawberry vector) together into SB28 glioblastoma tumor cells allowed robust viral replication and spread of both viruses. [Figure 10B] Figure 10B shows that coinfected cells demonstrated greater expression of Strawberry expression, highlighting the synergistic nature of the binary replication system. [Figure 10C] FIG. 10C shows that addition of the pLXIX GAL4 IRES EMD retroviral vector and the pAC3_P2A_Stb_GAL4BS_maximal deleted retroviral vector (maximal Strawberry vector) together into SB28 glioblastoma tumor cells allowed robust viral replication and spread of both viruses to a high percentage of double positive cells. [Figure 11A] FIG. 11A is a graph showing the percentage of intracranial tumors infected with each viral construct, as well as the percentage double infected for pAC3_P2A_Stb_GAL4BS_Minimal deletion premix (Min-P) and pAC3_P2A_Stb_GAL4BS_Maximal deletion premix (Max-P). [Figure 11B]FIG. 8B is a graph showing the breakdown of virus-infected subgroups as a percentage of all infected SB28 tumor cells for Min-P and Max-P. [Figure 11C] FIG. 11C is a representative flow cytometry analysis of Max-P. [Figure 11D] FIG. 11D is a representative flow cytometry analysis of Min-P. [Figure 12A] FIG. 12A is a graph showing the percentage of intracranial tumors infected with each viral construct, as well as the percentage that was dually infected for pAC3_P2A_Stb_GAL4BS_Minimal deletion injection (Min-I). [Figure 12B] FIG. 12B is a graph showing the breakdown of virus-infected subgroups as a percentage of all infected SB28 tumor cells for Min-I. [Figure 12C] FIG. 12C is a representative flow cytometry analysis of Min-I. [Figure 13] FIG. 13 is an exemplary retroviral vector system comprising a Tat-dependent competent virus and an exemplary replication-defective retrovirus (RDV) encoding Tat. [Figure 14] Figure 14 is an exemplary retroviral vector system for delivery of immunomodulators. In this exemplary vector, there are three immunomodulatory transcripts delivered within a defective virus. FLT3L aids in dendritic cell recruitment and development. IL-7 aids in T cell proliferation and activation. 4-1BBL is a costimulatory molecule that can aid in sustained T cell activation. IL-15 superagonist (RLI) will be delivered within the coordinately regulated competent virus. This cytokine also aids in T cell activation and proliferation. [Figure 15]Figure 15 is an exemplary retroviral vector system for delivering Cas9 to cells. This system can be used to deliver Cas9 in defective viruses. Cognate guide RNA (gRNA) for a gene of interest is delivered in a coordinately regulated competent virus. This system can knock out any gene for which functional gRNA is present in tumor cells. [Figure 16] Figure 16A is an exemplary replication-defective retrovirus (RDV) (pLXIX_GAL4_P2A_EGFP_T2A_Cas9) encoding Gal4 and Cas9. Figure 16B is a line diagram of the expression cassettes in pLXIX_GAL4_P2A_EGFP_T2A_Cas9 encoding Gal4 and Cas9. [Figure 17] Figures 17A-C are diagrams of exemplary replication-competent retroviruses (RRVs). Figure 17A is a diagram of the U6-B2 MsgRNA expression vector that served as a template for inserting the U6-B2 MsgRNA expression cassette into the Not1 site of the minimally deleted RRV vector (Figure 17B) and the maximally deleted RRV vector (Figure 17C) using Gibson assembly. [Figure 18A] FIG. 18A is an exemplary minimally deleted replication-competent retrovirus (pgalAC3_P2A_strb_U6_B2M) encoding an sgRNA targeting beta-2-microglobulin. [Figure 18B] FIG. 18B is an exemplary maximal deletion replication-competent retrovirus (pgallargeAC3_P2A_STRB_U6_B2M) encoding an sgRNA targeting beta-2-microglobulin. [Figure 19]FIG. 19 is a graph showing in vitro propagation of a replication-deficient retrovirus (RDV) (pLXIX_GAL4_P2A_EGFP_T2A_Cas9) and a minimally deleted replication-competent retrovirus encoding an sgRNA targeting beta-2-microglobulin (pgalAC3_P2A_strb_U6_B2M) in U87vIII cells, as described in the Examples. [Figure 20] FIG. 20 is a graph showing confirmation of B2M knockdown in the entire cell population or specifically in the co-transfected population using LXIX-GAL4-P2A-EGFP-T2A-Cas9 and the minimally deleted AC3-P2A-Strb-U6-B2M sgRNA. [Figure 21A] FIG. 21A is a schematic diagram of an exemplary replication-defective retrovirus (RDV), plXIX_GAL4_immunomodulator retroviral vector, containing a GAL4 / VP16 activator (GAL4FF), as described in the Examples. [Figure 21B] FIG. 21B is a schematic diagram of the pAC3_GAL4BS_IL15 superagonist retroviral vector described in the Examples. [Figure 22] FIG. 22 is a graph showing that infection of SB28 with plXIX_GAL4_immunomodulator and pAC3-GAL4BS-IL-15 in T75 plates containing 10 mL of medium efficiently secretes IL-7, RLI, and FLT3L at concentrations of 75 ng / mL or 0.09 pg / cell / 48 hr. [Figure 23A] Figure 23A is a graph showing that treatment with pLXIX-GAL4-IM and pAC3-GAL4BS-RLI treatment reduces tumor growth, as described in the Examples. Circles: PBS control; Squares: empty RRV; Triangles: binary-IM (administration of pLXIX-GAL4-IM and pAC3-GAL4BS-RLI). [Figure 23B]Figure 23B is a survival curve showing increased survival following treatment with pLXIX-GAL4-IM and pAC3-GAL4BS-RLI as described in the Examples. The line above 100% corresponds to binary-IM (administration of pLXIX-GAL4-IM and pAC3-GAL4BS-RLI). [Figure 24] FIG. 24 is a graph showing that pLXIX-GAL4-IM and pAC3-GAL4BS-RLI increased lymphocyte tumor infiltration, including CD3+ immune cell infiltration (3.0% vs. 20.0%, p=0.001) and CD8 T cell infiltration (0.8% vs. 8.0%, p=0.01), at day 14, as described in the Examples. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0027] Detailed Description The following description lists various aspects and embodiments of the present compositions and methods. Specific embodiments are not intended to define the scope of the compositions and methods. Rather, the embodiments merely provide at least non-limiting examples of various compositions and methods that fall within the scope of the disclosed compositions and methods. The description must be interpreted from the perspective of a person skilled in the art. Therefore, it does not necessarily include information that is well known to a person skilled in the art.

[0028] Introduction Replication-competent viral vectors, such as retroviral vectors (RRVs), have the ability to replicate and spread throughout dividing cells, including tumor cells. In addition, RRVs can be stably integrated into infected cells, leading to the persistent expression of RRV genetic information by infected cells. Additional non-viral genes can be placed into the RRV genetic information, and these genes can be stably expressed in addition to the viral genes required for replication.

[0029] Replication-defective viral vectors, such as retroviral vectors (RDV), lack some or all of the viral genes required for replication, and as a result can deliver larger non-viral gene payloads to tumor cells.However, replication-defective viral vectors cannot replicate and lack the ability to spread through tumors, and therefore are ineffective in clinical trials to achieve therapeutic benefit due to insufficient gene delivery levels to tumors.

[0030] Infecting cells with replication-competent and replication-deficient viral vectors, e.g., RRV and RDV, either simultaneously or sequentially (but only if cells are first infected with RDV and then with RRV), allows both viruses to be produced and spread, because the viral proteins produced by RRV also allow RDV to spread. However, RDV spread is limited. In general, RRV quickly outcompetes RDV and spreads throughout the tumor faster than RDV.

[0031] Furthermore, any cell that is initially infected with an RRV subsequently loses the ability to be infected by another RDV derived from the same virus, a phenomenon known as superinfection resistance. This occurs because when an RRV first infects a cell, the virus naturally produces its envelope (env) proteins as it replicates and assembles more virus particles inside the infected cell. These envelope proteins endogenously bind to and sequester cellular proteins that act as cell surface receptors that are also required for RDV to infect cells. This mechanism prevents RDV from entering cells that are already infected with an RRV.

[0032] Alternatively, replicative spread can be achieved by using two RDVs that are trans-complementary or semi-replicative, i.e., the viral genome is split between two vectors, with each RDV providing the components that the other lacks. However, even in this case, if an RDV expressing the env protein is the first to infect a cell, this will prevent the other RDV from entering the same cell and replicating further.

[0033] The novel, coordinately regulated viral gene delivery system provided herein addresses these problems. For example, the compositions and methods provided herein can be used to engineer RRV to be dependent on RDV so that RRV can spread throughout tumors. This is accomplished by incorporating a nucleic acid encoding an activator into RDV, which acts as an activator for RRV when both vectors infect the same cell. Thus, RRV can only replicate if RDV is also present, and as a result, also helps RDV to replicate. This combination prevents RRV from outcompeting RDV, since RRV is dependent on RDV to replicate. In another embodiment, two RDVs that can trans-complement each other's replication gene function are coordinately regulated, such that the RDV expressing the env gene (which normally monopolizes the cellular receptor for the virus in infected cells) is dependent on an activator, for example, the second RDV, which provides a transcription factor that binds to the promoter in the first RDV and only then allows env gene transcription to proceed. Thus, superinfection resistance is circumvented and both RDVs are able to jointly express all viral genes, thus enabling both to replicate and spread through the tumor.

[0034] definition As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0035] "About" is used to provide flexibility to the endpoints of the numerical ranges by indicating that a particular value may be "slightly more" or "slightly less" than the endpoint without affecting the desired result.

[0036] Use of the terms "including," "comprising," or "having" and variations thereof herein is intended to encompass the elements listed thereafter and equivalents thereof as well as additional elements. Embodiments recited as "including," "comprising," or "having" certain elements are also intended to "consist essentially of" and "consist of" the certain elements. As used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

[0037] As used herein, the transitional phrase "consisting essentially of" (and grammatical variations) should be construed to include the recited materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention. See In re Herz, 537 F.2d 549, 551-52, 190 USPQ 461,463 (CCPA 1976) (emphasis in original). See also MPEP § 2111.03. Thus, as used herein, the term "consisting essentially of" should not be construed as the same as "comprising."

[0038] The recitation of ranges of values ​​herein is intended to serve merely as a shorthand for referring individually to each separate value within the range, unless otherwise specified herein, and each separate value is incorporated herein as if recited individually herein. For example, if a concentration range is specified as 1%-50%, values ​​such as 2%-40%, 10%-30%, or 1%-3% are intended to be expressly recited herein. These are merely examples of what is expressly intended, and all possible combinations of numerical values ​​between and including the minimum and maximum values ​​recited must be considered to be expressly specified in this disclosure.

[0039] As used herein, "retrovirus" refers to an RNA virus whose viral genome is RNA. When a host cell is infected with a retrovirus, the genomic RNA is reverse transcribed into a DNA intermediate, which is highly efficiently integrated into the chromosomal DNA of the infected cell. The integrated DNA intermediate is called a provirus. Retroviruses are typically enveloped single-stranded RNA viruses that infect mammals, such as, for example, cattle, monkeys, sheep, and humans, as well as avian species. Retroviruses are unique among RNA viruses in that a DNA copy of the RNA is synthesized and then integrated into the infected cell genome for their propagation.

[0040] The Retroviridae family consists of three groups: spumaviruses (or foamy viruses), such as human foamy virus (HFV); lentiviruses, and ovine visna virus; and oncoviruses (although not all viruses in this group are oncogenic). The term "retrovirus" is used in the conventional sense to describe a genus of viruses that contain reverse transcriptase. Retroviruses include lentiviruses. Lentiviruses include the "immunodeficiency viruses," including human immunodeficiency virus (HIV) types 1 and 2 (HIV-1 and HIV-2) and simian immunodeficiency virus (SIV). Oncoviruses are further subdivided into groups A, B, C, and D based on particle morphology as seen under an electron microscope during viral maturation.

[0041] Retroviruses are defined by the way they replicate their genetic material. During replication, RNA is converted to DNA. After infecting a cell, a molecular process known as reverse transcription creates a double-stranded molecule of DNA from two RNA molecules carried in the viral particle. The DNA form is covalently integrated into the host cell genome as a provirus, from which viral RNA is expressed with the help of cellular and / or viral factors. The expressed viral RNA is packaged into particles and released as infectious virions.

[0042] Retroviral particles consist of two identical RNA molecules. Each wild-type genome has a positive-sense single-stranded RNA molecule that is capped at the 5' end and polyadenylated at the 3' tail. The diploid virus particle contains two RNA strands complexed with the gag protein, a viral enzyme (the pol gene product), and a host tRNA molecule in a "core" structure of the gag protein. This capsid is surrounded and protected by a lipid bilayer derived from the host cell membrane and containing the viral envelope (env) protein. The env protein binds to a cellular receptor for the virus, and the particle typically enters the host cell via receptor-mediated endocytosis and / or membrane fusion. After the outer envelope is shed, the viral RNA is copied into DNA by reverse transcription. This is catalyzed by the reverse transcriptase enzyme encoded by the pol region, which uses the host cell tRNA packaged in the virion as a primer for DNA synthesis. In this way, the RNA genome is converted into a more complex DNA genome. The double-stranded linear DNA generated by reverse transcription may or may not have to be circularized in the nucleus. Now the provirus has two identical repeat sequences at both ends, known as long terminal repeats (LTRs). The ends of the two LTR sequences generate sites that are recognized by the pol product, an integrase protein that catalyzes integration, so that the provirus is always ligated to the host DNA at a location two base pairs (bp) from the end of the LTR. Overlapping cellular sequences are found at the ends of both LTRs. Integration is thought to occur essentially randomly within the target cell genome. However, retroviral genome integration can be controlled by modifying the long terminal repeats.

[0043] Transcription, RNA splicing, and translation of integrated viral DNA are mediated by host cell proteins. Although viruses may use receptor-independent, nonspecific entry routes with low efficiency, efficient infectious spread of retroviruses requires that receptors that specifically recognize viral envelope proteins are expressed on the target cell. Furthermore, after virus binding and entry, the target cell type must be able to support all steps of the replication cycle.

[0044] As used herein, "viral vector" refers to a gene therapy vector that is used to deliver a polynucleotide construct to a cell. The term viral vector is understood to include recombinant vector particles or virions (i.e., viral particles that contain at least one capsid or envelope protein and an encapsulated recombinant viral vector) and recombinant vector plasmids.

[0045] As used herein, "recombinant viral vector" refers to a viral vector, e.g., a retroviral vector, that contains a nucleic acid sequence not normally present in the viral vector (i.e., a polynucleotide heterologous to the viral vector). Other vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, and herpes simplex vectors. Generally, the heterologous nucleic acid is flanked by at least one, and generally two, long terminal repeats (LTRs), e.g., 5'LTR and 3'LTR. Retroviral vectors as used herein may be derivatives of murine, simian, or human retroviruses. Examples of retroviral vectors into which a transgene (e.g., a heterologous polynucleotide sequence) can be inserted include, but are not limited to, lentivirus, Moloney murine leukemia virus (MoMuLV), Harvey murine sarcoma virus (HaMuSV), mouse mammary tumor virus (MuMTV), Rous sarcoma virus (RSV), and foamy virus.

[0046] The term "nucleic acid" or "nucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), and polymers thereof, e.g., polynucleotides, in either single-stranded or double-stranded form. Nucleic acid molecules may be derived from a variety of sources, including DNA, cDNA, synthetic DNA, RNA, or combinations thereof. Such nucleic acid sequences may include genomic DNA, which may or may not contain natural introns. Furthermore, such genomic DNA may be obtained in conjunction with promoter regions, introns, or polyA sequences. Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses its conservatively modified variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions can be achieved by creating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).

[0047] The term "gene" or "transgene" may refer to a DNA segment (e.g., a polynucleotide sequence) involved in or encoding the production of a polypeptide chain. The term may include regions preceding and following the coding region (leaders and trailers) as well as intervening sequences (introns) between individual coding segments (exons). Alternatively, the term "gene" or "transgene" may refer to a DNA segment involved in or encoding the production of a non-translated RNA, such as rRNA, tRNA, guide RNA (e.g., single guide RNA), or microRNA.

[0048] The phrase "heterologous" as used herein refers to something that is not normally found in nature. The term "heterologous nucleotide sequence" refers to a nucleotide sequence that is not normally found in a given wild-type viral genome or cell in nature. Thus, a heterologous nucleotide sequence may be (a) foreign to the host cell or viral genome (i.e., exogenous to the cell), (b) naturally found in the host cell (i.e., endogenous) but present in the cell in a non-native amount (i.e., greater or less than the amount naturally found in the host cell), or (c) naturally found in the host cell or viral genome but located outside its natural locus.

[0049] The term "activator" as used herein refers to a molecule, e.g., a polypeptide sequence or a polynucleotide sequence, that activates the expression of any polynucleotide sequence from a viral vector, e.g., a retroviral vector, described herein. In the compositions and methods provided herein, the activator activates the expression of a polynucleotide on a vector other than the vector encoding the activator, i.e., a trans-acting activator. In some embodiments, the activator activates the expression of a polynucleotide by activating the transcription or translation of the polynucleotide sequence. When the activator activates the transcription of a polynucleotide sequence, the transcription activation may be achieved through the binding of the activator to a regulatory element, e.g., a cis-acting regulatory element that controls the expression of the polynucleotide. Cis-acting regulatory elements include, but are not limited to, promoter sequences, enhancer sequences, and repressor binding sequences.

[0050] In some instances, the activator is a transcriptional activator that binds to a promoter that controls the expression of a polynucleotide sequence, thus activating the transcription of the polynucleotide sequence. In some embodiments, the activator is a derepressor that activates the expression of a polynucleotide sequence by derepressing the transcription or translation of the polynucleotide sequence in the viral vector, or by removing the repression of the transcription or translation.

[0051] "Promoter" is defined as one or more nucleic acid control sequences that induce nucleic acid transcription. As used herein, promoter includes the necessary nucleic acid sequence near the transcription start site, for example, in the case of polymerase II type promoter, TATA element. Promoter also includes optional distal enhancer or repressor elements, which may be located several thousand base pairs away from the transcription start site.

[0052] A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence. Or, a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.

[0053] "Polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. As used herein, these terms encompass amino acid chains of any length, including full-length proteins, in which the amino acid residues are linked by covalent peptide bonds.

[0054] The phrase "introducing" as used herein in the context of introducing a nucleic acid or viral vector refers to the transfer of a nucleic acid sequence or viral vector from the outside of a cell to the inside of a cell. In some cases, introducing refers to the infection of a cell or cell population with a viral vector or viral particle carrying one or more non-viral nucleic acids. In some cases, the transfer of nucleic acid from the outside of a cell to the inside of the cell nucleus occurs. Various methods of such transfer are contemplated, including, but not limited to, viral infection, electroporation, transfection, transduction, contact with nanowires or nanotubes, receptor-mediated internalization, cell-penetrating peptide-mediated transfer, liposome-mediated transfer, and the like.

[0055] The term "selection marker" as used herein refers to a gene that allows the selection of host cells that contain a marker. Selection markers can include, but are not limited to, fluorescent markers, luminescent markers, and drug selection markers, cell surface receptors, and the like. In some embodiments, the selection can be positive selection. That is, cells expressing the marker are isolated from the population, for example, to produce an enriched population of cells expressing the selection marker. Separation can be performed by any convenient separation method that is suitable for the selection marker used. For example, if a fluorescent marker is used, cells can be separated by fluorescence-activated cell sorting. In contrast, if a cell surface marker is inserted, cells can be separated from a heterogeneous population by affinity separation methods, such as magnetic separation, affinity chromatography, "panning" with affinity reagents attached to a solid matrix, fluorescence-activated cell sorting, or other convenient techniques.

[0056] As used herein, a "cell" may be in vivo, ex vivo, or in vitro, and includes any cell or cell population that can be infected by a virus, e.g., a retrovirus, e.g., a human cell. As used herein, the term "cell" includes non-dividing cells, dividing cells, and cells that exhibit uncontrolled proliferation. As used herein, a non-dividing cell refers to a cell that has not undergone mitosis. A dividing cell is a cell that is undergoing active mitosis or meiosis. Such dividing cells include stem cells, skin cells (e.g., fibroblasts and keratinocytes), gametes, and other dividing cells known in the art. Dividing cells include cells associated with cell proliferative disorders, e.g., neoplastic cells.

[0057] Other cells that can be infected include peripheral blood dendritic cells, follicular dendritic cells, B cells, natural killer cells, primary cells, hematopoietic cells, stem cells, eosinophils, and precursor CD4 + These include, but are not limited to, bone marrow cells, immature thymic progenitor cells, T cells, Langerhans cells, megakaryocytes, neurons, astrocytes, oligodendroglia, renal epithelial cells, cervical cells, rectal cells, and intestinal mucosal cells. Other cells and tissues derived from organs such as the brain, liver, lung, breast, ovary, esophagus, skin, salivary gland, eye, prostate, testis, and adrenal gland can also be infected.

[0058] The term "stem cell" as used herein includes pluripotent stem cells, multipotent stem cells, and totipotent stem cells. In some embodiments, the stem cell is a hematopoietic stem cell. As used herein, the phrase "hematopoietic stem cell" refers to a type of stem cell that can give rise to blood cells. Hematopoietic stem cells can give rise to cells of myeloid or lymphoid lineages, or a combination thereof.

[0059] The phrase "hematopoietic cells" as used herein refers to cells derived from hematopoietic stem cells. Hematopoietic cells can be obtained or provided by isolation from an organism, system, organ, or tissue (e.g., blood or a fraction thereof). Alternatively, hematopoietic stem cells can be isolated and hematopoietic cells can be obtained or provided by differentiation of stem cells. Hematopoietic cells include cells that have limited ability to differentiate into more advanced cell types. Such hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common myeloid progenitor cells, granulocyte-macrophage progenitor cells, or megakaryocyte-erythroid progenitor cells. Hematopoietic cells include cells of lymphoid and myeloid lineages, e.g., lymphocytes, erythrocytes, granulocytes, monocytes, and platelets. In some embodiments, the hematopoietic cells are immune cells, e.g., T cells, B cells, macrophages, natural killer (NK) cells, or dendritic cells. In some embodiments, the cells are innate immune cells.

[0060] The phrase "primary" used herein in the context of primary cells refers to cells that are neither transformed nor immortalized. Such primary cells can be cultured, subcultured, or passaged a limited number of times (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times). In some cases, primary cells are adapted to in vitro culture conditions. In some cases, primary cells are isolated from organisms, systems, organs, or tissues, and optionally selected and directly utilized without culture or subculture. In some cases, primary cells are stimulated, activated, or differentiated. For example, primary T cells can be activated by contacting them with CD3, a CD28 agonist, IL-2, IFN-γ, or a combination thereof (e.g., by culturing them in the presence of CD3, a CD28 agonist, IL-2, IFN-γ, or a combination thereof).

[0061] The term "identity" or "substantial identity," when used in the context of polynucleotide sequences described herein (e.g., SEQ ID NOs:1-13), refers to a sequence having at least 60% sequence identity to a reference sequence. Alternatively, the percent identity can be any integer between 60% and 100%. Exemplary embodiments include at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% compared to a reference sequence using the programs described herein, preferably using BLAST with standard parameters as described below.

[0062] In sequence comparison, typically, a sequence serves as a reference sequence to compare with test sequence.When using sequence comparison algorithm, test sequence and reference sequence are input into computer, and if necessary, coordinates of subsequence are designated, and sequence algorithm program parameters are designated.Default program parameters can be used, or alternative parameters can be designated.The sequence comparison algorithm then calculates the percent sequence identity of test sequence to reference sequence based on program parameters.

[0063] As used herein, a "comparison window" includes reference to any one segment of a number of consecutive positions selected from the group consisting of 20 to 600, about 20 to 50, about 20 to 100, about 50 to about 200, or about 100 to about 150. In this segment, two sequences can be compared after optimal alignment of a sequence with a reference sequence of the same number of consecutive positions. Methods for aligning sequences for comparison are well known in the art. Optimal sequence alignment for comparison can be achieved by the local homology algorithm of Smith and Waterman Add. APL. Math. 2:482 (1981), the homology alignment algorithm of Needleman and Wunsch J. Mol. Biol. 48:443 (1970), the search for similarity method of Pearson and Lipman Proc. Natl. Acad. Sci. (USA) 85: 2444 (1988), computerized implementations of these algorithms (e.g., BLAST), or by manual alignment and visual inspection.

[0064] Suitable algorithms for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1990) J. Mol. Biol. 215: 403-410, and Altschul et al. (1977) Nucleic Acids Res. 25: 3389-3402, respectively. Software for performing BLAST analyses is publicly available from the National Center for Biotechnology Information (NCBI) website. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that match or match a positive threshold score T when aligned with words of length W in the database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. The cumulative score is calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). Extension of the word hits in each direction stops when the cumulative alignment score has fallen by an amount X from its achieved maximum value; when the cumulative score becomes 0 or below due to the accumulation of one or more negative-scoring residue alignments; or when the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word size (W) of 28, an expectation (E) of 10, M=1, N=-2, and a comparison of both strands.

[0065] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which indicates the probability that a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability when comparing the test nucleic acid to the reference nucleic acid is less than about 0.01, more preferably less than about 10-5, and most preferably less than about 10-20.

[0066] composition Provided herein is a recombinant virus system that comprises two or more kinds of virus vectors that are coordinately regulated.For example, in the system provided herein, two or more kinds of virus vectors, three or more kinds of virus vectors, four or more kinds of virus vectors, five or more kinds of virus vectors, etc. can be used.In some embodiments, two or more kinds, three or more kinds, four or more kinds, five or more kinds of virus vectors, etc. are adenovirus vectors or retrovirus vectors, and they are coordinately regulated.

[0067] In some embodiments, infectious spread of a fully replication-competent retroviral vector (RRV) carrying a heterologous polynucleotide is regulated by a replication-defective retroviral (RDV) vector expressing an activator, e.g., a transcriptional activator that activates expression of the heterologous polynucleotide by activating transcription or translation of the heterologous polynucleotide.

[0068] In other exemplary embodiments, a first RDV expressing a viral gene required for replication and a heterologous polynucleotide encoding a payload polypeptide is regulated by (i) an activator; (ii) optionally, a second heterologous polynucleotide encoding a payload polypeptide; and (iii) a second RDV expressing a complementary viral gene required for replication of both vectors (i.e., complementary to a viral gene required for replication carried by the RDV).

[0069] Provided herein is a recombinant retrovirus system comprising: (a) a first retrovirus that (i) encodes a first regulatory element operably linked to a nucleic acid encoding a first activator, and (ii) lacks a coding sequence for at least one viral protein required for replication, such that the first retrovirus is a replication-deficient retrovirus (RDV); and (b) a second retrovirus that comprises a nucleic acid comprising a first polynucleotide encoding one or more viral proteins required for viral replication that are lacking in the first virus, wherein the first polynucleotide is expressed only when the first activator activates expression of the first polynucleotide and / or its encoded viral protein.

[0070] In some embodiments, the second retrovirus comprises a second regulatory element operably linked to a first polynucleotide encoding a viral protein required for viral replication, and the first activator activates transcription of the first polynucleotide by binding to the second regulatory element, e.g., a promoter.

[0071] Also provided herein is a system wherein the second retrovirus is a replication-defective retrovirus (RDV) and encodes a third regulatory element operably linked to a nucleic acid encoding a second activator, and the first retrovirus comprises a nucleic acid comprising a second polynucleotide encoding a viral protein required for viral replication, wherein the second polynucleotide is expressed only when the second activator activates expression of the second polynucleotide, and wherein the first and second retroviruses can replicate only when the first and second activators are expressed.

[0072] In some embodiments, the first retrovirus comprises a fourth regulatory element operably linked to a second polynucleotide encoding a viral protein required for viral replication, and the first activator activates transcription of the second polynucleotide by binding to the fourth regulatory element.

[0073] In any of the systems described herein, the regulatory element can be selected from the group consisting of a promoter, an enhancer, a promoter / enhancer combination, or an epigenetic regulator. In some embodiments, an epigenetic regulator can be used to regulate protein expression based on an epigenetic marker. See, for example, Park et al. "Engineering epigenetic regulation using synthetic read-write modules," Cell 176(1-2): 227-238 (2019), which describes the use of M6a as an epigenetic marker. M6A is an epigenetic marker that is not normally found in humans. However, as described in Park et al., a synthetic "writer" can place an m6A mark on a specific DNA sequence, and then a synthetic "reader" can specifically bind to the m6A sequence to induce gene expression.

[0074] In any system described herein, the activator can activate the expression of the polynucleotide sequence through transcriptional or translational regulation (e.g., miRNA). In some embodiments, the activator activates expression by activating, i.e., increasing, the transcription or translation of the polynucleotide sequence (e.g., the first polynucleotide sequence). It is understood that in the absence of the activator, the polynucleotide sequence is not expressed at all, or is not expressed to an appreciable extent such that the activator turns on polynucleotide expression.

[0075] In some embodiments, the activator is a transcription activator that binds to a promoter operably linked to the polynucleotide sequence to activate the expression of the polynucleotide sequence. In some embodiments, the activator that binds to the promoter is a transcription factor. Exemplary activators include, but are not limited to, HIV-1 transactivator protein (Tat), HIV-1 Rev, Gal4 or fragments thereof, Gal4-VP16, and VP16-E2, and tetracycline transactivator protein. In some embodiments, Tat-dependent replication-competent viruses stimulate or activate the expression of the polynucleotide sequence through an RNA target sequence (TAR) contained on the RDV (see, for example, FIG. 13). Exemplary activator sequences are shown in Table 1. Sequences having at least 60%, 70%, 80%, 90%, 95%, or 99% identity to any sequence shown in Table 1 are also provided. It is understood that any activator described herein expressed from a first vector can bind to a corresponding site in a second vector of any of the viral vector systems described herein and activate expression of one or more polynucleotides in the second vector.

[0076] Table 1. Exemplary activator sequences TIFF2024526878000002.tif74150TIFF2024526878000003.tif222150TIFF2024526878000004.tif91150

[0077] In some embodiments, the activator is a derepressor that activates the expression of a polynucleotide sequence by derepressing or inhibiting a repressive biological event. For example, the derepressor may be, but is not limited to, a miRNA sponge encoded by a first retroviral vector that interacts with (e.g., binds to) the miRNA expressed by the second retroviral vector, which represses the expression and / or replication of the second retroviral vector. In the absence of the miRNA sponge, the expression of the miRNA encoded by the second retroviral vector represses the replication of the second retroviral vector. However, when the miRNA sponge is expressed from the first retroviral vector, the sponge acts to bind to the miRNA that normally represses the expression from the second retroviral vector, so that the expression and replication of the second retroviral vector can proceed in addition to the replication from the first retroviral vector. See, e.g., Ebert and Sharp "MicroRNA sponges: Progress and possibilities" RNA 16(11): 2043-2050 (2010); and Tay et al. "Using artificial microRNA sponges to achieve microRNA loss-of-function in cancer cells", Advanced Drug Delivery Reviews 81: 117-127 (2015).

[0078] In the compositions provided herein, when a viral vector, e.g., a retroviral vector, lacks at least one viral protein required for replication, the virus, e.g., a retrovirus, can only replicate when combined with a viral vector, e.g., a retroviral vector, that contains one or more viral proteins required for replication. In some embodiments, a first viral vector contains one or more viral proteins required for viral replication, and a second viral vector contains one or more viral proteins required for viral replication that are not contained in the first viral vector. As used herein, "viral protein required for replication" can be Gag, Env, Pol, Rev, or Tat viral protein. In some embodiments, this term refers to Gag, Env, or Pol retroviral protein. For example, in some embodiments, the first retroviral vector (RDV) comprises a nucleic acid sequence encoding a Gag protein, and the second retroviral vector comprises (i) a nucleic acid sequence encoding an envelope (Env) protein, and (ii) a nucleic acid sequence encoding a retroviral Pol protein, such that when the vectors are combined, all of the viral proteins required for replication are present to enable the replication of the first retrovirus and the second retroviral vector. In another example, the first retrovirus is an RDV that does not contain the viral proteins required for viral replication, and the second retrovirus is an RRV that encodes all of the viral proteins required for viral replication (i.e., Gal, Pol, and Env proteins). Also contemplated herein are modified viral proteins required for viral replication that can be used to target the retrovirus to a certain cell or tissue type. For example, the Env protein sequence can be modified to include a target-specific ligand (i.e., an antibody, a receptor, or a receptor ligand) that binds to a certain cell or tissue type.Additionally, tissue-specific synthetic signaling proteins, such as SynNotch (Morsut et al. "Engineered Customized Cell Sensing and Response Behaviors using Synthetic Note Receptors", Cell 164: 780-791 (2016)), may be used to control replication of the system and ensure tissue / target-specific replication.

[0079] In any of the compositions provided herein, a promoter (e.g., a first, second, third, or fourth promoter in any of the vectors provided herein) can be a constitutive promoter (e.g., SV40, EF1A, RSV, CMV, etc.) or an inducible promoter (e.g., tetracycline (Iida et al. J. Virol., 70(9): 6054-9), GAL4 target upstream activating sequence (Osterwalder et al., PNAS 98(22): 12596-12601 (2001), Cumate inducible expression system (Seo and Dannert, Appl. Microbiol. Biotechnol. 103(1): 303-313 (2002)). (2019)). In any of the retroviral vectors provided herein, the promoter may be placed in the LTR sequence, e.g., in the 5' or 3' LTR sequence, adjacent to a heterologous polynucleotide sequence, e.g., adjacent to the 3' end of a polynucleotide sequence (e.g., a first polynucleotide sequence, a second polynucleotide sequence, a third polynucleotide sequence, etc.). Any of the 3' LTR sequences described herein, e.g., retroviral 3' LTR sequences (e.g., MMLV 3' LTR sequences), can be modified to reduce or disrupt native promoter function in the 3' LTR, e.g., by deleting one or more sequences in the 3' LTR and / or by inserting one or more sequences into the 3' LTR, e.g., one or more nucleic acid sequences that include a GAL4 binding site. An exemplary GAL4 binding site is the consensus sequence (CGGN 11CCG) or as made in SEQ ID NO:2 and SEQ ID NO:3, SEQ ID NO:4 (cggagtactgtcctccgagcgg). Exemplary sequences comprising one or more GAL4 binding sites are set forth herein as SEQ ID NO:2 and SEQ ID NO:3. In some embodiments, one or more LTRs of a vector, e.g., the 3'LTR and / or 5'LTR, may comprise one, two, three, four, five, six, seven, eight, nine, ten or more binding sites, e.g., GAL4 binding sites, for one activator, depending on the desired expression level of one or more polynucleotides in a particular cell, tissue, or organ. As described in the Examples, in some embodiments, once an infectious particle comprising a viral vector is produced, the 3'LTR and 5'LTR comprise the same sequence.

[0080] The promoter may also be a cell-specific promoter or tissue-specific promoter. When using a cell-specific promoter or tissue-specific promoter, viral replication occurs primarily in a particular cell or tissue, but not exclusively in a particular cell or tissue. For example, viral replication may occur in at least 90%, 95%, or 99% of targeted cells or tissues. However, it is understood that tissue-specific promoters may have a detectable amount of background or basal activity in tissues in which they are generally silent. The degree to which a promoter is selectively activated in a target tissue can be expressed as a selectivity ratio (activity in target tissue / activity in control tissue). In this regard, tissue-specific promoters useful in the practice of the present invention typically have a selectivity ratio greater than about 5. Preferably, the selectivity ratio is greater than about 15.

[0081] Examples of tissue-specific promoters include liver-specific promoters (e.g., APOA2, SERPINA1, CYP3A4, MIR122), pancreatic-specific promoters (e.g., insulin, insulin receptor substrate 2, pancreatic and duodenal homeobox 1, aristas-like homeobox 3, and pancreatic polypeptide), cardiac-specific promoters (e.g., myosin, heavy chain 6, myosin, light chain 2, troponin type I 3, natriuretic peptide precursor A, solute carrier family 8, and mitogen-activated protein 1 (MCI)). 8), central nervous system promoters (e.g., glial fibrillary acidic protein, internexin neuronal intermediate filament protein, nestin, myelin-associated oligodendrocyte basic protein, myelin basic protein, tyrosine hydroxylase, and forkhead box A2), skin-specific promoters (e.g., filaggrin, keratin 14, and transglutaminase 3), pluripotency promoters and embryonic germ layer promoters (e.g., POU class 5 homeobox 1, Nanog homeobox, nestin, and microRNA 122). In some embodiments, tissue-specific promoters include, for example, cell-specific or tissue-specific promoters and enhancers for neoplastic cells (e.g., tumor cell-specific enhancers and promoters) and inducible promoters (e.g., tetracycline), located in the U3 region of the LTR of the retroviral genome.

[0082] In some embodiments, the first and / or second retrovirus further comprises a heterologous expression cassette comprising a payload promoter operably linked to a payload polynucleotide sequence. In some embodiments, the RDV comprises a heterologous expression cassette sequence comprising a payload promoter operably linked to a payload polynucleotide, since the RDV can comprise a larger insert compared to the RRV. In the systems provided herein, the defective virus may comprise an insert as large as about 8 to about 10 kb, and the replication-competent virus may comprise an insert as large as about 1.3 kb to 1.5 kb. In some embodiments, the payload polynucleotide sequence encodes an antisense molecule, a ribozyme, a therapeutic protein, an immunomodulator, an antibody, an enzyme, a prodrug activator, or a cytotoxic protein. Other proteins of interest include, but are not limited to, Cas activator proteins, Cas phi, immunomodulatory proteins (e.g., CD40L, 4-1BBL, OX40L, GITRL, IL-15, IL-12, scFvs (anti-PD1, anti-lag3, anti-Tim3, etc.), FLT3L, GMCSF, or VEGF-C), synthetic immunomodulators (BiTEs, surface T cell engagers, etc.), suicide genes (e.g., γ-CD, NAO, and thymidine kinase), and synthetic signaling molecules. For example, SynNotch can also be expressed.

[0083] In some embodiments, the prodrug activator is encoded by a suicide gene, such as thymidine kinase, cytidine deaminase, or purine nucleoside phosphorylase (PNP). An example of a system that can be used to deliver an immunomodulator is shown in Figure 15. In this example, IL-15 is encoded by a replication-competent viral vector and the immunomodulator is encoded by a replication-deficient viral vector. The viral vector system described herein can also be used to edit the genome of any host or target cell.

[0084] An example of a system that can be used to deliver guide RNA and guided gene editing nuclease (e.g., Cas9) as part of a CRISPR / Cas system is shown in FIG. 15. In this example, guide RNA is encoded by a replication-competent viral vector (e.g., a replication-competent retroviral vector) of the system, and Cas9 is encoded by a replication-defective viral vector (e.g., a replication-defective retroviral vector) of the system. In some embodiments, multiple gRNAs are used to target multiple sites in the genome of a cell. For example, multiple guide RNAs can be expressed by encoding each gRNA under the control of an individual promoter (e.g., U6, H1). These gRNA expression cassettes can be incorporated into RDV and / or RRV.

[0085] Alternative methods can be used to multiplex gRNA sequences within individual vectors. These include, but are not limited to, the creation of crRNA or gRNA arrays flanked by different sequences (e.g., direct repeat sequences required for processing of pre-crRNA, self-cleaving sequences such as HDV ribozymes, Csy4 recognition sites, tRNA). These gRNA / crRNA arrays are then processed by endogenous (RNaseIII, RNaseP, RNaseZ) or exogenous (Csy4) proteins, allowing for simultaneous editing of multiple loci. See, e.g., Feng and Yang, "Efficient expression of multiple guide RNAs for CRISPR / Cas Genome Editing," aBIOTECH 1: 123-134 (2020)).

[0086] In some embodiments, multiple gRNA configurations could be used for sequential and coordinated regulation of RDV / RRV expression. For example, the gRNA sequence contained in RDV together with the Cas9 coding sequence could be used to knock out an endogenous gene encoding a transcriptional repressor protein, and its cognate binding site sequence could be integrated into the RRV 3'LTR promoter (and thus copied to the 5'LTR). Thus, thanks to RDV, any RRV could be introduced into the same target cell (e.g., after being expressed from an adjacent cell) only when the repressor protein already present in the target cell is first knocked out, and then expressed by itself, thereby relieving superinfection resistance, i.e., relieving superinfection resistance by relieving transcriptional repression.

[0087] "CRISPR / Cas" system refers to a broad class of bacterial systems for defense against foreign nucleic acids. CRISPR / Cas systems are found in a wide range of eubacterial and archaeal organisms. CRISPR / Cas systems include type I, type II, and type III subtypes. Wild-type type II CRISPR / Cas systems utilize RNA-mediated nucleases, such as Cas9, that form a complex with guide and activator RNA to recognize and cleave foreign nucleic acids. Guide RNAs that have both guide RNA and activator RNA activity are also known in the art. In some cases, such dual-activity guide RNAs are called single guide RNAs (sgRNAs).

[0088] Cas9 homologs are found in a wide variety of eubacteria, including but not limited to bacteria from the following taxonomic groups: Actinobacteria, Aqmficae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chloroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and their homologues are described, for example, in Chylinksi, et al., RNA Biol. 2013 May 1; 10(5): 726-737; Nat. Rev. Microbiol. 2011 June; 9(6): 467-477; Hou, et al., Proc Natl Acad Sci US A. 2013 Sep 24; 110(39): 15644-9; Sampson et al., Nature. 2013 May 9; 497(7448): 254-7; and Jinek, et al., Science. 2012 Aug 17; 337(6096): 816-21. Any Cas9 nuclease variant provided herein can be optimized for efficient activity or improved stability in host cells. Thus, engineered Cas9 nucleases are also contemplated. See, e.g., Slaymaker et al., "Rationally engineered Cas9 nucleases with improved specificity," Science 351 (6268): 84-88 (2016)).

[0089] The term "Cas9" as used herein refers to an RNA-mediated nuclease (e.g., of or derived from bacterial or archaeal origin). Exemplary RNA-mediated nucleases include the aforementioned Cas9 protein and its homologs. Other RNA-mediated nucleases include Cpf1 (see, e.g., Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015) and its homologs. The term "ribonucleoprotein" complex, etc. as used herein refers to a targeted nuclease, e.g., a complex between Cas9 and a crRNA (e.g., a guide RNA or a single guide RNA), a Cas9 protein and a trans-activating crRNA (tracrRNA), a Cas9 protein and a guide RNA, or a combination thereof (e.g., a complex containing a Cas9 protein, a tracrRNA, and a crRNA guide RNA). It is understood that in any of the embodiments described herein, the Cas9 nuclease can be replaced with a Cpf1 nuclease or any other guided nuclease.

[0090] In some embodiments, CRISPR-associated endonuclease is catalytically impaired nuclease.As used throughout, "catalytically impaired" refers to the reduction of CRISPR-associated endonuclease enzyme activity that cuts one or both strands of DNA.Examples of catalytically impaired CRISPR-associated endonuclease include, but are not limited to, catalytically impaired Cas9, catalytically impaired Cpf1, and catalytically impaired C2c2.In some cases, catalytically impaired CRISPR-associated endonuclease is catalytically impaired Cas9, for example, Cas9 D10A, which only cuts one strand of DNA or only makes a nick in one strand of DNA. In some cases, the CRISPR-associated endonuclease may be a catalytically impaired CRISPR-associated endonuclease, in which the endonuclease is unable to cleave both strands of a double-stranded DNA molecule, i.e., unable to create a double-stranded break. Modifications include, but are not limited to, one or more amino acid changes to inactivate the nuclease activity or nuclease domain. For example, but not limited to, Cas9 from Streptococcus pyogenes may be mutated with D10A and / or H840A to reduce or inactivate Cas9 nuclease activity. Other modifications include removing all or part of the nuclease domain of Cas9, such that Cas9 lacks sequences that exhibit nuclease activity. Thus, catalytically impaired Cas9 may include a polypeptide sequence modified to reduce nuclease activity or may include the removal of one or more polypeptide sequences to reduce nuclease activity. Even though the nuclease activity is inactivated, catalytically impaired Cas9 retains the ability to bind to DNA. Thus, a catalytically impaired Cas9 contains one or more polypeptide sequences required for DNA binding, but contains an altered nuclease sequence, or lacks the nuclease sequence responsible for nuclease activity.It is understood that similar modifications can be made to reduce the nuclease activity of other site-specific nucleases, such as Cpf1 or C2c2. In some examples, the Cas9 protein is a full-length Cas9 sequence from S. pyogenes that lacks the polypeptide sequence of the RuvC nuclease domain and / or the HNH nuclease domain and retains DNA binding function. In other examples, the Cas9 protein sequence has at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identity to the Cas9 polypeptide sequence that lacks the RuvC nuclease domain and / or the HNH nuclease domain and retains DNA binding function. Any catalytically impaired RNA-guided nuclease described herein can be used to inhibit gene transcription. In some embodiments, dCas9 is fused to a transcriptional repressor or activator for transcriptional repression or activation of genes targeted by one or more gRNAs.

[0091] In some embodiments, viral vectors, e.g., retroviral vectors, contain an IRES that includes a cloning site for inserting one or more payload polynucleotide sequences. Thus, a heterologous polynucleotide sequence encoding a desired polypeptide may be operably linked to the IRES. An example of a polynucleotide sequence that may be operably linked to the IRES includes green fluorescent protein (GFP) or a selection marker gene. Marker genes are utilized to assay for the presence of a vector, thus confirming infection and integration. Representative selection genes encode proteins that confer resistance to antibiotics and other toxic substances, e.g., histidinol, puromycin, hygromycin, neomycin, methotrexate, and other reporter genes known in the art. Other polynucleotide sequences that may be linked to the IRES include, for example, polynucleotide sequences that encode polypeptides selected from the group consisting of therapeutic proteins, prodrug activators, enzymes, antibodies, and cytotoxic proteins. In some embodiments, the prodrug activator is thymidine kinase, cytidine deaminase, or purine nucleoside phosphorylase (PNP).

[0092] In some embodiments, components of a viral vector, e.g., a retroviral vector, are expressed in a multicistronic manner by including one or more self-cleaving peptides between two or more nucleic acids to be expressed as a multicistronic, e.g., bicistronic, arrangement. Examples of self-cleaving peptides include, but are not limited to, self-cleaving viral 2A peptides, e.g., porcine teschovirus-1 (P2A) peptide, Thosea asigna virus (T2A) peptide, equine rhinitis A virus (E2A) peptide, or foot and mouth disease virus (F2A) peptide. Self-cleaving 2A peptides allow for the expression of multiple gene products from one construct (see, e.g., Chng et al. "Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells", MAbs 7(2): 403-412 (2015)). In some embodiments, the nucleic acid construct includes two or more self-cleaving peptides. In some embodiments, the two or more self-cleaving peptides are all the same. In other embodiments, at least one of the two or more auto-cleaving peptides is different.

[0093] The first and / or second viruses of any of the systems described herein, either as a nucleic acid vector or a viral particle, can be formulated as a pharmaceutical composition. In some embodiments, the pharmaceutical composition may further comprise a carrier. The term carrier refers to a compound, composition, substance, or structure that, when combined with a compound or composition, aids or facilitates the preparation, storage, administration, delivery, efficacy, selectivity, or any other characteristic of the compound or composition for its intended use or purpose. For example, the carrier can be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject. The composition comprises a therapeutically effective amount of one or more retroviruses described herein in combination with a pharma-ceutically acceptable carrier, and may additionally include other medicinal agents, pharmaceutical agents, carriers, or diluents. Pharmaceutically acceptable refers to a material that is not biologically or otherwise undesirable that can be administered to an individual with a selected agent without causing unacceptable biological effects or adversely interacting with other components of the pharmaceutical composition in which it is contained. Such pharma- ceutically acceptable carriers include sterile, biocompatible pharmaceutical carriers, including, but not limited to, saline, buffered saline, artificial cerebrospinal fluid, dextrose, and water.

[0094] Methods for making retroviral systems Provided herein is a method for producing a recombinant virus system, comprising: (a) transfecting a first suitable host cell with a first virus vector of any of the virus systems described herein; (b) transfecting a second suitable host cell with a second virus vector of any of the virus systems described herein; and (c) recovering the first and second viruses.In some embodiments, the first and second viruses are transfected into the same suitable host cell.In some embodiments, the first and second viruses are retroviruses.

[0095] method Also provided is a method of using any of the coordinately regulated viral vector systems provided herein to efficiently deliver transgenes to tumors in vivo for therapeutic, diagnostic and theranostic purposes.In some embodiments, any of the systems described herein can be used for diagnostic purposes by introducing transgenes that are only expressed under certain conditions (e.g., in the presence of a large amount of tumor-infiltrating T cells).These transgenes may provide non-invasively detectable signals (e.g., fluorescent protein expression).In theranostic situations, viral systems may be engineered to sense specific changes in tumor microenvironment (e.g., increased myeloid cell infiltration) and express therapeutic genes (e.g., myelotoxic genes).

[0096] Provided herein is a method for transducing a replicative viral system into a target cell, comprising contacting the target cell with a first and a second virus of any of the viral systems provided herein. In some embodiments, the viral system is a retroviral system, and the first and the second virus are retroviruses. In any of the methods for transfecting a target cell, the viral DNA can be delivered to the cell, which can produce viral particles (e.g., recombinant retroviral polynucleotides or viral particles containing recombinant retroviral polynucleotides) in the transfected cell. In some embodiments, the cell is infected with the first and the second viral particles of any of the viral systems provided herein. In some embodiments, the cell is a mammalian cell. In any of the methods provided herein, the cell can be contacted in vitro, ex vivo, or in vivo.

[0097] Also provided is a method for treating a disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of any system or pharmaceutical composition provided herein.In some methods, cells are removed from the subject, modified ex vivo using any recombinant virus system described herein, and administered to the patient after modification.In some methods, modified cells are expanded before administration to the patient.

[0098] In any of the methods provided herein, the subject may be a subject diagnosed with a disease, such as a cell proliferation disorder. In any of the treatment methods provided herein, the first and second viruses of the system are administered to the subject simultaneously or sequentially. Any of the treatment methods provided herein can be used to deliver a polynucleotide encoding any of the payload polypeptides described herein to the subject. The polypeptide can be selected from the group consisting of a therapeutic protein, a prodrug activator, an enzyme, an antibody, and a cytotoxic protein. In some embodiments, the prodrug activator is a thymidine kinase, a cytidine deaminase, or a purine nucleoside phosphorylase (PNP). When a prodrug activator is used, a non-toxic prodrug can be administered to the subject so that the non-toxic prodrug is converted into a toxic drug, i.e., a cell-killing drug, when the activator is expressed.

[0099] In some methods, the viral system is a recombinant retroviral system comprising: (a) a first retrovirus that (i) encodes a first regulatory element operably linked to a nucleic acid encoding a first activator, and (ii) lacks a coding sequence for at least one viral protein required for replication, such that the first retrovirus is a replication-deficient retrovirus (RDV); and (b) a second retrovirus that comprises a nucleic acid comprising a first polynucleotide encoding one or more viral proteins required for viral replication that are lacking in the first retrovirus, wherein the first polynucleotide is expressed only when the first activator activates expression of the first polynucleotide and / or its encoded viral protein.

[0100] In some embodiments, the second retrovirus comprises a second regulatory element operably linked to a first polynucleotide encoding a viral protein required for viral replication, and the first activator activates transcription of the first polynucleotide by binding to the second regulatory element, e.g., a promoter.

[0101] In some embodiments, the second retrovirus is a replication-defective retrovirus (RDV) and encodes a third regulatory element operably linked to a nucleic acid encoding a second activator, the first retrovirus comprises a nucleic acid comprising a second polynucleotide encoding a viral protein required for viral replication, the second polynucleotide is expressed only when the second activator activates expression of the second polynucleotide, and the first and second retroviruses can replicate only when the first and second activators are expressed. In some embodiments, the first retrovirus comprises a fourth regulatory element operably linked to a second polynucleotide encoding a viral protein required for viral replication, and the first activator activates transcription of the second polynucleotide by binding to the fourth regulatory element.

[0102] In some embodiments, the first and / or second retrovirus further comprises a heterologous expression cassette comprising a payload promoter operably linked to the payload polynucleotide sequence. In some embodiments, the payload polynucleotide sequence encodes an antisense molecule, a ribozyme, a therapeutic protein, an immunomodulator, an antibody, an enzyme, a prodrug activator, or a cytotoxic protein. Other proteins of interest include, but are not limited to, Cas proteins, Cas activator proteins, Cas phi, immunomodulatory proteins (e.g., CD40L, 4-1BBL, OX40L, GITRL, IL-15, IL-12, scFv (such as anti-PD1, anti-lag3, anti-Tim3), FLT3L, GMCSF, or VEGF-C), synthetic immunomodulators (such as BiTEs, surface T cell engagers), suicide genes (e.g., γ-CD, NAO, and thymidine kinase), and synthetic signaling molecules. For example, SynNotch can also be expressed.

[0103] In some embodiments, the prodrug activator is encoded by a suicide gene, such as thymidine kinase, cytidine deaminase, or purine nucleoside phosphorylase (PNP).

[0104] "Treating" refers to any indication of success in treating or curing or preventing a disease, condition, or disorder, including any objective or subjective parameter, such as alleviation; remission; reduction of symptoms or increased tolerance of the patient to the disease state; slowing down the rate of degeneration or decline; prevention of recurrence, or reduced debilitating end point of degeneration. For example, a method for treating cancer is considered to be treating if one or more symptoms of cancer in a subject are reduced by 10% compared to a control. Thus, reduction may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage reduction between 10% and 100% compared to the natural or control level. It is understood that treatment does not necessarily refer to a cure or complete disappearance of the disorder or symptoms of the disorder.

[0105] Any of the methods provided herein can be used to treat cell proliferation disorder. The term "cell proliferation disorder" refers to a condition characterized by an abnormal number of cells. This condition can include both hypertrophic cell proliferation (continuous cell proliferation that causes abnormal proliferation of cell populations in tissue) and hypoplastic cell proliferation (lack of or loss of cells in tissue), and can include excessive influx or migration of cells into an area of ​​the body. Cell populations are not necessarily transformed, tumorigenic, or malignant cells, but can also include normal cells.

[0106] In some cases, the cell proliferative disorder is cancer. As used herein, cancer is a disease characterized by rapid and uncontrolled proliferation of abnormal cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. The cancer may be a solid tumor. In some embodiments, the cancer is a blood or hematological cancer, such as leukemia (e.g., acute leukemia; acute lymphocytic leukemia; acute myeloid leukemia, e.g., myeloblastic leukemia, promyelocytic leukemia, myelomonocytic leukemia, monocytic leukemia, erythroleukemia, leukemias), and myelodysplastic syndromes; chronic myeloid (granulocytic) leukemia; chronic lymphocytic leukemia; hairy cell leukemia), polycythemia vera, or lymphomas (e.g., Hodgkin's disease or non-Hodgkin's disease lymphomas (e.g., diffuse anaplastic lymphoma kinase (ALK)-negative, large B-cell lymphoma (DLBCL); diffuse anaplastic lymphoma kinase (ALK)-positive, large B-cell lymphoma (DLBCL); anaplastic lymphoma Examples of tumors include ALK-positive, ALK+ anaplastic large cell lymphoma (ALCL), acute myeloid lymphoma (AML), multiple myeloma (e.g., smoldering myeloma, nonsecretory myeloma, osteosclerotic myeloma, plasma cell leukemia, solitary plasmacytoma, and extramedullary plasmacytoma), Waldenstrom's macroglobulinemia, monoclonal gammopathy of undetermined significance, benign monoclonal gammopathy, and heavy chain disease. Solid tumors include, by way of example, sarcomas of bone and connective tissue (e.g., osteosarcoma,sarcoma), osteosarcoma, chondrosarcoma, Ewing's sarcoma, malignant giant cell tumor, fibrosarcoma of bone, chordoma, periosteal sarcoma, soft tissue sarcoma, angiosarcoma (hemangiosarcoma), fibrosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, schwannoma, rhabdomyosarcoma, synovial sarcoma), brain tumors (e.g., glioma, glioblastoma, astrocytoma, brain stem glioma, ependymoma, oligodendroglioma, non-glioma, tumors, acoustic neuroma, craniopharyngioma, medulloblastoma, meningioma, pinealocytoma, pineoblastoma, primary brain lymphoma), breast cancer (e.g., adenocarcinoma, lobular (small cell) carcinoma, intraductal carcinoma, medullary breast carcinoma, mucinous breast carcinoma, tubular breast carcinoma, papillary breast carcinoma, Paget's disease, and inflammatory breast carcinoma), adrenal gland cancer (e.g., pheochromocytoma and adrenocortical carcinoma), thyroid cancer (e.g., papillary or follicular thyroid carcinoma, medullary thyroid carcinoma, and anaplastic thyroid carcinoma), pancreatic cancer (e.g., insulinoma, gastrinoma, glucagonoma, vipoma, somatostatin-secreting tumors, and carcinoid or islet cell tumors), pituitary cancer (e.g., Cushing's disease, prolactin-secreting tumors, acromegaly, and diabetes insipidus), eye cancer (e.g., ocular melanoma, e.g., iris melanoma, choroidal melanoma, and ciliary body melanoma, and retinoblastoma), vaginal cancer (e.g., squamous cell carcinoma, adenocarcinoma, and melanoma), vulvar cancer (e.g., squamous cell carcinoma, melanoma, adenocarcinoma, basal cell carcinoma, sarcoma, and Paget's disease) , cervical cancer (e.g., squamous cell carcinoma and adenocarcinoma), uterine cancer (e.g., endometrial carcinoma and uterine sarcoma), ovarian cancer (e.g., ovarian epithelial carcinoma, borderline malignant tumors, germ cell tumors, and stromal tumors), esophageal cancer (e.g., squamous cell carcinoma, adenocarcinoma, adenoid cystic carcinoma, mucoepidermoid carcinoma, adenosquamous carcinoma, sarcoma, melanoma, plasmacytoma, verrucous carcinoma, and oat cell (small cell) carcinoma), gastric cancer (e.g., adenocarcinoma, fungating (polypoid), ulcerating, superficial spreading, diffuse ...spreading), malignant lymphoma, liposarcoma, fibrosarcoma, and carcinosarcoma), colon cancer, rectal cancer, liver cancer (e.g., hepatocellular carcinoma and hepatoblastoma), gallbladder cancer (e.g., adenocarcinoma), cholangiocarcinoma (papillary, nodular, and diffuse), lung cancer (e.g., non-small cell lung cancer, squamous cell carcinoma (epidermoid carcinoma), adenocarcinoma, large cell carcinoma, and small cell lung cancer), testicular cancer (e.g., germinal tumor, seminoma, undifferentiated, classical (normal), spermatocytic, non-seminomatous, embryonal carcinoma, teratocarcinoma, choriocarcinoma (yolk sac tumor)), prostate cancer (e.g., adenocarcinoma, leiomyosarcoma, and rhabdomyosarcoma), penile cancer, oral cancer (e.g., squamous cell carcinoma), basal carcinoma, salivary gland cancer (e.g., adenocarcinoma, mucoepidermoid carcinoma, and adenoid cystic carcinoma), nasopharyngeal carcinoma (e.g., squamous cell carcinoma and verrucous carcinoma), skin cancer (e.g., basal cell carcinoma, squamous cell carcinoma, and melanoma, superficial spreading melanoma, nodular melanoma, lentigo maligna melanoma, acral lentigo melanoma), kidney cancer (e.g., renal cell carcinoma, adenocarcinoma, adrenal nephroma, fibrosarcoma, transitional cell carcinoma (renal pelvis and / or ureter), Wilms' tumor), bladder cancer (e.g., transitional cell carcinoma, squamous cell carcinoma, adenocarcinoma, and carcinosarcoma). Additionally, carcinomas include myxosarcoma, osteogenic sarcoma, endotheliosarcoma, lymphangio endothelio sarcoma, mesothelioma, synovium, hemangioblastoma, epithelial carcinoma, cystadenocarcinoma, bronchogenic carcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, and papillary adenocarcinoma.

[0107] The term "cell proliferative disorder" as used throughout also includes rheumatoid arthritis and other autoimmune disorders that are often characterized by inappropriate proliferation of immune system cells.

[0108] The subject used throughout may be a vertebrate, more specifically a mammal (e.g., human, horse, cat, dog, cow, pig, sheep, goat, mouse, rabbit, rat, and guinea pig). The term does not imply a particular age or sex. Thus, adult, neonatal, and pediatric subjects, both male and female, are intended to be included as subjects. As used herein, patient or subject may be used interchangeably and may refer to a subject having a disorder or at risk of developing a disorder. The term patient or subject includes human and veterinary subjects. In any of the methods provided herein, the subject may be a subject diagnosed with cancer, an infectious disease, or an autoimmune disease.

[0109] Any method provided herein may further comprise administering a second therapeutic agent to the subject.The second therapeutic agent may be selected from the group consisting of a chemotherapeutic agent, an adjuvant, an immunomodulatory agent, a vaccine, a tumor antigen, or a combination thereof.In some cases, the second therapeutic agent is a prodrug that can be converted into a toxic drug by a prodrug activator encoded by a retroviral system.When the second therapeutic agent is a nucleic acid sequence that encodes a therapeutic polypeptide, the second therapeutic agent may be delivered by viral or non-viral means.

[0110] Representative chemotherapeutic agents include amsacrine, bleomycin, busulfan, capecitabine, carboplatin, carmustine, chlorambucil, cisplatin, cladribine, clofarabine, crisantaspase, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin, docetaxel, doxorubicin, epirubicin, etoposide, fludarabine, fluorouracil, gemcitabine, hydroxycarbamide, idarubicin, ifosfamide, irinotecan, leucovorin, and liposomal doxorubicin. Representative pro-apoptotic agents include, but are not limited to, liposomal daunorubicin, lomustine, melphalan, mercaptopurine, mesna, methotrexate, mitomycin, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, pentostatin, procarbazine, raltitrexed, satraplatin, streptozocin, tegafur-uracil, temozolomide, teniposide, thiotepa, thioguanine, topotecan, treosulfan, vinblastine, vincristine, vindesine, vinorelbine, or combinations thereof. Representative pro-apoptotic agents include, but are not limited to, fludarabinetaurosporine, cycloheximide, actinomycin D, lactosylceramide, 15d-PGJ(2), and combinations thereof.

[0111] It is understood that combinations, e.g., compositions, comprising one or more of the viral vectors described herein and a second therapeutic agent can be administered simultaneously (e.g., as an admixture), separately but simultaneously (e.g., through separate intravenous lines into the same subject), or sequentially (e.g., one of the compositions or agents is given first, followed by the second). Any of the methods provided herein may further include radiation therapy or surgery.

[0112] The term "therapeutically effective amount" or "effective amount" as used herein refers to the amount of a composition that is effective when administered to a subject, either alone or in combination with additional agents, by one dose or over the course of multiple doses, to treat a disease or disorder.The appropriate dose may depend on a variety of factors, including the specific composition or system used, and whether it is used simultaneously with other therapeutic agents.Other factors that affect the dose administered to a subject include, for example, the type or severity of the disease.For example, a subject with pancreatic cancer may require administration of a different dosage than a subject with brain cancer.

[0113] Effective amounts of the compounds described herein (e.g., chemotherapeutic agents or immunomodulators) or pharma- ceutically acceptable salts or prodrugs thereof can be determined by one of skill in the art, and include exemplary dosages of active compound in a mammal of about 0.5 to about 200 mg / kg body weight per day, which may be administered in a single dose or in individual divided doses, such as 1 to 4 times daily. Alternatively, the dosage may be from about 0.5 to about 150 mg / kg of body weight of active compound per day, from about 0.5 to about 100 mg / kg of body weight of active compound per day, from about 0.5 to about 75 mg / kg of body weight of active compound per day, from about 0.5 to about 50 mg / kg of body weight of active compound per day, from about 0.5 to about 25 mg / kg of body weight of active compound per day, from about 1 to about 20 mg / kg of body weight of active compound per day, from about 1 to about 10 mg / kg of body weight of active compound per day, from about 20 mg / kg of body weight of active compound per day, from about 10 mg / kg of body weight of active compound per day, or from about mg / kg of body weight of active compound per day. Other factors influencing the dosage may include, for example, other medical disorders concurrently affecting or previously affecting the subject, the subject's general health, the subject's genetic predisposition, diet, time of administration, rate of excretion, drug combinations, and any other additional therapeutic agents administered to the subject. It should also be understood that the specific dosage and treatment regimen for any particular subject will depend on the judgment of the treating medical practitioner.

[0114] When administering a viral vector (i.e., a recombinant vector plasmid, a recombinant vector virion, an infectious viral particle, or a recombinant vector particle), the effective amount of any of the viral vectors described herein will vary and can be determined by one of skill in the art through experimentation and / or clinical trials. For example, for in vivo injection, an effective dose is about 10 6 ~about 10 15 For example, about 10 recombinant vectors or recombinant vector virions. 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 In another example, about 10 recombinant vectors or recombinant vector virions (e.g., viral particles), or any amount in between, can be administered. 6 ~about 10 7 , about 10 6 ~about 10 8 , about 10 6 ~about 10 9 , about 10 6 ~about 10 10 , about 10 6 ~about 10 11 , about 10 6 ~about 10 12 , about 10 6 ~about 10 13 , or about 10 6 ~about 10 14 Individual recombinant vectors or recombinant vector virions are administered. Effective doses for any of the administration methods described herein can be extrapolated from dose-response curves derived from in vitro or animal model test systems.

[0115] As used herein, administering or administration refers to the act of introducing, injecting or otherwise physically delivering a substance (e.g., a retroviral system as described herein) to a subject when the substance is present outside the body, for example, by mucosal delivery, intradermal delivery, intravenous delivery, intratumoral delivery, intramuscular delivery, intrarectal delivery, oral delivery, subcutaneous delivery, and / or any other physical delivery method as described herein or known in the art.When a disease or its symptoms are being treated, administration of the substance is typically performed after the onset of the disease or its symptoms.When a disease or its symptoms are being prevented, administration of the substance is typically performed before the onset of the disease or its symptoms.

[0116] Recombinant viral systems, e.g., retroviral systems, are administered via any of a number of routes of administration, including oral, parenteral, intramucosal, intravenous, intratumoral, intraperitoneal, intracerebroventricular, intramuscular, subcutaneous, intracranial, intracavitary, or transdermal. Administration may be accomplished, for example, by topical administration, local infusion, injection, or by implantation.

[0117] Disclosed are materials, compositions, and components that can be used for, can be used with, can be used in preparation for, or are products of the disclosed methods and compositions. When these and other materials are disclosed herein, and when combinations, subsets, interactions, groups, etc. of these materials are disclosed, it is understood that each of the various individual and collective combinations, and permutations of these compounds, are expressly intended and described herein, although specific references may not be explicitly disclosed. For example, when a method is disclosed and discussed, and a number of modifications that can be made to a number of molecules, including those in the method, are discussed, any and all combinations and permutations of the method and possible modifications are expressly intended, unless expressly indicated to the contrary. Similarly, any subset or combination of these is expressly intended and disclosed. This concept applies to all aspects of this disclosure, including, but not limited to, steps in the method of using the disclosed compositions. Thus, if there are various additional steps that may be performed, it is understood that each of these additional steps may be performed with any particular method step or combination of method steps of the disclosed methods, and that each such combination or subset of combinations is specifically contemplated and must be considered as disclosed.

[0118] Publications cited herein and the material for which they are cited are expressly incorporated herein by reference in their entireties.

[0119] Exemplary Aspects Exemplary aspects of the present invention include: 1. A recombinant viral system comprising: (a) a first virus, the first virus encoding (i) a first regulatory element operably linked to a nucleic acid encoding a first activator, and (ii) lacking a coding sequence for at least one viral protein required for replication, such that the first virus is a replication-deficient virus; and (b) a second virus, the second virus comprising a nucleic acid comprising a first polynucleotide encoding one or more viral proteins required for viral replication that are lacking in the first virus, the first polynucleotide being expressed only when the first activator activates expression of the first polynucleotide and / or its encoded viral protein. 2. The recombinant virus system of embodiment 1, wherein the first and second viruses are retroviruses or adenoviruses. 3. The recombinant viral system of embodiment 1 or 2, wherein the activator activates expression by increasing transcription or translation of the first polynucleotide. 4. The recombinant virus system of any one of aspects 1 to 3, wherein the second virus comprises a second regulatory element operably linked to a first polynucleotide encoding a viral protein required for viral replication, and the first activator activates transcription of the first polynucleotide by binding to the second regulatory element. 5. The recombinant virus system according to any one of aspects 1 to 4, wherein the activator binds to a second regulatory element to activate transcription, and the second regulatory element is a promoter, an enhancer, or a repressor binding sequence. 6. The recombinant viral system of embodiment 1, wherein the first activator is a derepressor, and the first polynucleotide sequence encoded by the second retrovirus is expressed only when the derepressor activates expression by derepressing expression of the first polynucleotide and / or viral protein. 7. The recombinant viral system of embodiment 6, wherein derepression occurs at the transcriptional or translational level. 8. The recombinant virus system of any one of aspects 1 to 7, wherein the first regulatory element and / or the second regulatory element is selected from the group consisting of a promoter, an enhancer, a promoter / enhancer combination, an internal ribosome entry site, an epigenetic regulator, and a translation regulator. 9. The recombinant viral system of embodiment 8, wherein the promoter is a constitutive promoter or an inducible promoter. 10. The recombinant virus system of any one of aspects 1 to 9, wherein the second virus is a replicating virus that encodes all viral proteins required for viral replication. 11. The recombinant virus system of any one of aspects 1 to 10, wherein the first and / or second virus further comprises a heterologous expression cassette comprising a payload promoter operably linked to the payload polynucleotide sequence. 12. The recombinant virus system of any one of aspects 1 to 11, wherein the viral proteins required for replication are selected from the group consisting of gag, env, pol, rev, and tat. 13. The recombinant virus system according to any one of aspects 2 to 12, wherein the retrovirus is selected from the group consisting of lentivirus, murine leukemia virus (MLV), Moloney murine leukemia virus (MoMLV), and foamy virus. 14. The recombinant virus system of any one of aspects 11 to 13, wherein the payload polynucleotide encodes a polypeptide selected from the group consisting of a therapeutic protein, a prodrug activator, a cytotoxic protein, and a reporter protein. 15. The recombinant viral system of embodiment 14, wherein the prodrug activator is thymidine kinase, cytidine deaminase, or purine nucleoside phosphorylase (PNP). 16. The recombinant virus system of any one of aspects 1 to 15, wherein the first activator is selected from the group consisting of HIV-1 transactivator protein (Tat), HIV-1 Rev, Gal4-VP16, GAL4FF, GAL4-VP64, and VP16-E2, and tetracycline transactivator protein. 17. The recombinant virus system of embodiment 1 or 2, wherein the second virus is a replication-deficient virus and encodes a third regulatory element operably linked to a nucleic acid encoding a second activator, the first virus comprises a nucleic acid comprising a second polynucleotide encoding a viral protein required for viral replication, the second polynucleotide is expressed only when the second activator activates expression of the second polynucleotide, and the first and second viruses can replicate only when the first and second activators are expressed. 18. The recombinant viral system of embodiment 17, wherein the first virus comprises a fourth regulatory element operably linked to a second polynucleotide encoding a viral protein required for viral replication, and the first activator activates transcription of the second polynucleotide by binding to the fourth regulatory element. 19. The recombinant virus system of embodiment 17 or 18, wherein the third regulatory element or the fourth regulatory element is selected from the group consisting of a promoter, an enhancer, a promoter / enhancer combination, an internal ribosome entry site, an epigenetic regulator, and a translation regulator. 20. The recombinant viral system of embodiment 19, wherein the promoter is a constitutive promoter or an inducible promoter. 21. The recombinant virus system of any one of aspects 18-20, wherein the first or second virus, or both, comprise a heterologous expression cassette comprising a payload promoter operably linked to a payload polynucleotide. 22. The recombinant virus system of embodiment 21, wherein the payload polynucleotide encodes a polypeptide selected from the group consisting of a therapeutic protein, a prodrug activator, a cytotoxic protein, and a reporter protein. 23. The recombinant virus system according to any one of aspects 17 to 22, wherein the viral protein required for replication is selected from the group consisting of gag, env, pol, rev, and tat. 24. The recombinant virus system according to any one of aspects 17 to 23, wherein the retrovirus is selected from the group consisting of lentivirus, murine leukemia virus (MLV), Moloney murine leukemia virus (MoMLV), and foamy virus. 25. The recombinant virus system of any one of aspects 17 to 24, wherein the payload polynucleotide encodes a polypeptide selected from the group consisting of a therapeutic protein, a prodrug activator, a cytotoxic protein, and a reporter protein. 26. The recombinant viral system of embodiment 25, wherein the prodrug activator is thymidine kinase, cytidine deaminase, or purine nucleoside phosphorylase (PNP). 27. The recombinant virus system of any one of aspects 17 to 26, wherein the third regulatory element or the fourth regulatory element is selected from the group consisting of a constitutive promoter, an inducible promoter, and a tissue-specific promoter. 28. The recombinant virus system of any one of aspects 17 to 27, wherein the activator is selected from the group consisting of HIV-1 transactivator protein (Tat), HIV-1 Rev, Gal4-VP16, and VP16-E2, and tetracycline transactivator protein. 29. The recombinant virus system of any one of aspects 17 to 28, wherein the activator is selected from the group consisting of HIV-1 transactivator protein (Tat), HIV-1 Rev, Gal4-VP16, and VP16-E2, and tetracycline transactivator protein. 30. The recombinant virus system of any one of aspects 17 to 29, wherein one or more LTRs (e.g., the 3'LTR and / or the 5'LTR) of the first and / or second vector comprise a deletion, optionally comprising a deletion in the U3 region of the LTR. 31. The recombinant virus system of any one of aspects 17 to 30, wherein one or more LTRs of the first and / or second vector comprise an insertion, optionally wherein the insertion is a promoter (e.g., a CMV promoter), optionally wherein the insertion is one or more binding sites for an activator, optionally wherein the binding site is a GAL4 binding site. 32. A method for producing a recombinant viral system, comprising the steps of: (a) transfecting a first suitable host cell with a first viral vector according to any one of aspects 1-31; (b) transfecting a second suitable host cell with a second viral vector according to any one of aspects 1-31; and (c) recovering the first and second retroviruses. 33. A method for transfecting a target cell with a replicating viral system, the method comprising the step of contacting the target cell with a first and a second virus according to any one of aspects 1 to 31. 34. The method of embodiment 33, wherein the cell is a mammalian cell. 35. The method of any one of embodiments 32 to 34, wherein the cell is contacted in vitro, ex vivo, or in vivo. 36. A pharmaceutical composition comprising: (a) the first virus and / or the second virus of the system described in any one of aspects 1 to 31; and (b) a pharmaceutical carrier. 37. A method for treating a disease in a subject in need thereof, comprising administering to the subject a system described in any one of aspects 1 to 31 or a pharmaceutical composition described in aspect 36. 38. The method of embodiment 37, wherein the disease is a cell proliferative disorder. 39. The method of embodiment 38, wherein the cell proliferative disorder is selected from the group consisting of lung cancer, breast cancer, ovarian cancer, uterine cancer, prostate cancer, testicular cancer, kidney cancer, urinary tract cancer, oral cancer, head and neck cancer, esophageal cancer, gastric cancer, pancreatic cancer, colorectal cancer, skin cancer, melanoma, sarcoma, lymphoma, leukemia, and brain cancer, including glioblastoma, anaplastic astrocytoma, oligodendroglioma, and medulloblastoma. 40. The method of embodiment 39, wherein the cancer is glioblastoma. 41. The method of any one of aspects 37-40, wherein the first or second polynucleotide encodes a prodrug activator, and the method further comprises the step of administering a prodrug to a subject, such that when the prodrug activator is expressed, the prodrug activator converts the prodrug into a toxic drug. 42. The method of any one of aspects 37 to 41, wherein the first and / or second viral vector is administered to the subject as a plasmid or as an infectious retroviral particle. 43. The method of any one of aspects 37 to 42, wherein the subject is a mammal. 44. The method of embodiment 43, wherein the subject is a human. 45. The method of any one of aspects 37-44, wherein administration is systemic, local, or topical. 46. ​​The method of any one of aspects 37 to 45, wherein the first and second viruses of the system are administered to the subject simultaneously or sequentially. EXAMPLES

[0120] Example I Construction of pLXlX-GAL4, pAC3-min, and pAC3-max plasmids Using Gibson assembly cloning, the codon- and stability-optimized gene sequence for GALFFF (i.e., GAL4 / VP16 fusion protein containing GAL fused to a portion of VP16) was inserted into pLXSN (Takara Bio Inc., Shiga, Japan) followed by an internal ribosome entry site (Fig. 1). Gibson assembly cloning was also used to generate pAC3-minimum and pAC3-maximum. In these plasmids, the U3 region of the MMLV 5'LTR was exchanged with the CMV promoter to drive initial gene expression upon transfection. A deletion was made in U3 of the native MMLV 3'LTR to disrupt the native promoter function. During the reverse transcription process, the U3 region of the 3'LTR is replaced by the U3 region of the 5'LTR in the proviral DNA. This results in an infectious vector with identical modified LTR sequences at the 5' and 3' ends. pAC3-minimum (Fig. 2) contained a deletion in the native enhancer sequence. pAC3-max (Figure 3) contained a deletion in this enhancer sequence and the viral CCAAT box. The deleted sequence was replaced with a GAL4 binding site. Strawberry fluorescent protein and emerald fluorescent protein were placed in the viral construct downstream of P2A or the internal ribosome entry site, respectively.

[0121] Construction of pLXIX Tat and pAC3-TIN plasmids Using Gibson assembly, the codon- and stability-optimized gene sequence of the HIV-1 Tat sequence was inserted into pLXSN (Takara Bio Inc.), followed by an internal ribosome entry site (Figure 4). pAC3-TIN was generated by replacing the MMLV 3'LTR with the HIV-1 U3, R, and U5 sequences derived from the pHR plasmid (Addgene) (Figure 5). The 5'LTR native MMLV R sequence was also replaced with the HIV-1 R sequence.

[0122] Cell lines and culture Human embryonic kidney 293T cells with stable gag-pol expression (Retro-X cells purchased from Takara, Inc.) were cultured in Dulbecco's modified Eagle's medium-nutrient mixture supplemented with 10% fetal bovine serum and 1X Gibco GlutaMAX (Gibco, Inc.). Mouse glioblastoma SB28 (provided by Dr. Hideho Okada, University of California San Francisco, San Francisco, CA) was cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, Gibco GlutaMAX (Gibco, Inc., Waltham, MA), non-essential amino acids (Gibco, Inc.), hydroxyethylpiperazineethanesulfonic acid (Gibco, Inc.), penicillin-streptomycin (Gibco, Inc.), and 0.1% β-mercaptoethanol.

[0123] Virus production and concentration Virus was produced by transient transfection of Retro-X producer cells. Reverse transfection was performed using Fugene HD (Promega) with 10 micrograms of viral plasmid DNA and VSV-G envelope-containing plasmid DNA. Virus-containing supernatants were collected approximately 36–48 hours after the initial transfection. For in vivo studies, virus was concentrated using column-based retroviral purification with buffer exchange against phosphate buffered solution (PBS) (Bioland Scientific LLC.). Functional virus titers in units of transducing units / mL (TU / mL) were determined by flow cytometry.

[0124] In vitro virus replication and stability Briefly, a specific multiplicity of infection (MOI) was added to SB28 tumor cells in vivo and allowed to replicate for a period of time. Transduction levels were periodically measured by flow cytometry for fluorescent protein transgenes. Azidothymidine, which inhibits viral propagation, was used as a control. An MOI of 0.3 was usually used for in vitro viral propagation experiments.

[0125] mouse Eight to twelve week old C57BL / 6 mice were purchased from Jackson Laboratories and housed at the University of California, San Francisco.

[0126] Animal testing SB28 mouse glioblastoma tumor cells were used for in vivo experiments. All cells stably expressed luciferase to allow bioluminescence imaging and LSSmOrange to allow tumor cell identification by flow cytometry. 10,000 tumor cells were implanted intracranially on day 0. Cells were implanted at the following coordinates from bregma using a stereotactic frame: anterior-posterior (AP), 0 mm; mediolateral (ML), 1.9 mm; and dorsoventral (DV), 3.0 mm. Four days after tumor implantation, mice were treated with 5x10 3 We injected TU with pLXIX-GAL4-EMD and pAC-minimalStrawberry or pLXIX-GAL4-EMD and pAC-maximalStrawberry. Premix experiments were also performed using a mix of pre-transduced coinfection-positive cells and uninfected tumor cells, up to a total of 4% coinfected cells and 96% uninfected tumor cells.

[0127] Analysis of viral transmission After tumor injection, mice were sacrificed at days 4, 15, and 18. The 15 and 18 time points were combined during analysis. Brain tumors were minced and placed in a solution of collagenase type IV (Thermo Fisher Scientific #17104019) and deoxyribonuclease I (Worthington Biochemical Corporation) for processing with shaking at 37C. The tumors were then filtered through a 70um filter and red blood cells were lysed using ammonium-chloride-potassium (ACK) lysis buffer (Lonza). Flow cytometry analysis was then performed. Acquisition was performed by an Attune NxT Flow Cytometer (Thermo Fisher Scientific, Waltham, MA). Analysis of flow cytometry results was performed using FlowJo software.

[0128] result Minimal and maximal insertions of GAL4 binding sites differentially alter replication of replicating retroviruses and expression of viral transgenes. Insertions / deletions were made in U3 of the 3'MMLV LTR to differentially modify viral replication and expression, resulting in two replicating viruses (RRVs) with different amounts of dependency on GAL4 / VP16 expression. An exemplary unmodified 3'MMLV LTR sequence for the pAC3-Strawberry vector is shown in FIG. 6 (SEQ ID NO:1). This 3'MMLV LTR sequence was modified by making a deletion in U3 of the native MMLV 3'LTR to disrupt the native promoter function. pAC3-minimum (FIG. 2) contained a deletion in the native enhancer sequence. pAC3-maximum (FIG. 3) contained a deletion in this enhancer sequence and in the viral CCAAT box. The deleted sequence was replaced with a GAL4 binding site, as shown in FIG. 7 and FIG. 8. FIG. 7 and FIG. 8 show the 3'MMLV LTR sequences SEQ ID NO:2 and SEQ ID NO:3, respectively, used in the minimally and maximally deleted vectors described herein. By varying the number of GAL4 binding sites in the vector, viral replication and expression of the binary vectors of the system described herein can be tuned. When applied to SB28 tumor cells, the strawberry transgene carrying the RRV and minimal deletion (pAC-minimal-Strawberry) showed robust expression, but the virus did not replicate over 9 days in culture (Figure 9A). The RRV and maximal deletion (pAC-maximal-Strawberry) showed no expression in a similar experiment. Stable expression of GAL4 / VP16 in SB28 tumor cells allowed pAC-minimal-Strawberry virus replication (Figure 9B).

[0129] In vitro addition of defective retroviruses carrying GAL4 / VP16 allows expression and replication of replicating retroviruses with minimal and maximal insertions of GAL4 binding sites After confirming that replication did not occur in pAC-minimal-Strawberry and pAC-maximal-Strawberry without the simultaneous expression of GAL4 / VP16, experiments were performed to evaluate the ability of GAL4 to enable viral replication. First, pAC-minimal-Strawberry and pLXIX-GAL4-EMD were added to SB28 cells at an MOI of 0.3 per virus. Viral propagation was then monitored by flow cytometry for EMD and Strawberry at timed intervals. In contrast to pAC-minimal-Strawberry alone, the addition of pLXIX-GAL4-EMD and pAC-minimal-Strawberry together to SB28 glioblastoma tumor cells allowed robust viral replication and propagation of both viruses (Figure 10A). Furthermore, coinfected cells demonstrated greater expression of Strawberry expression, highlighting the synergistic nature of the binary replication system (Figure 10B). Similar experiments were then performed with pAC-maximal-Strawberry. Similarly, addition of pLXIX-GAL4-EMD and pAC-max-Strawberry together to SB28 glioblastoma tumor cells allowed robust viral replication and spread of both viruses to a very high percentage of double-positive cells ( Fig. 10C ).

[0130] In vivo evaluation of minimal and maximal binary systems demonstrates robust coinfection and replication Following successful in vitro experiments with both the minimal and maximal binary systems, the two systems were tested in intracranial mouse tumors. In one set of experiments, the systems were evaluated by implanting premixed tumors (4% co-infected cells and 96% uninfected tumors). The premix experiments demonstrated robust replication and expansion of the co-infected tumor cell population (Figure 11A-D). Similar in vivo experiments performed using virus injections with lower virus titers to challenge the system also demonstrated good replication and a significant co-infected tumor cell population (Figure 12A-C). No fluorescent protein expression was detected 4 days after virus injection, further proving the robust propagation and replication capabilities of the system.

[0131] Example II Regulated retroviral vectors for gene editing As described below, a vector system containing a defective virus encoding Cas9 and a replication-competent virus encoding a cognate guide RNA (gRNA) for a gene of interest can be used to edit the genome of a cell. This system can be used to knock out any gene for which a functional gRNA is present in the tumor cell.

[0132] Plasmid construction Using Gibson assembly cloning, EGFP-T2A-Cas9 from pRubiG-T2A-Cas9 (Williams et al., Sci Rep 2016, 6, 25611, doi:10.1038 / srep2561) (Addgene plasmid #75348; http: / / n2t.net / addgene:75348; RRID:Addgene_75348) was placed immediately downstream of the P2A sequence of pLXIX-GAL4 (described above) to generate a replication-defective retrovirus expressing Gal4 and Cas9 (pLXIX-Gal4-P2A-EGFP-T2A-Cas9) (Figure 16), allowing both Cas9 and EGFP to be expressed in infected cells, thus allowing for easy identification and detection.

[0133] gRNA vector The human β2-microglobulin gene target sequence was used to generate the sgRNA spacer sequence by inserting it into two 60-mer oligonucleotides as shown below (sequences are 5'→3', and the regions shown in bold are the reverse complement of each other): TIFF2024526878000005.tif44145

[0134] The two oligos were annealed and extended to a 100bp double-stranded DNA fragment using Phusion flash polymerase (NEB). The gRNA cloning vector (Addgene plasmid #41824; http: / / n2t.net / addgene:41824; RRID:Addgene_41824) was linearized with AflII, and the 100bp DNA fragment was assembled using Gibson assembly (Mali et al., Science 2013, 339, 823-826, doi: 10.1126 / science.1232033). The resulting virus was the U6-B2MsgRNA virus (Figure 17A). This vector served as a template to insert the U6-B2MsgRNA expression cassette into the NotI site of the minimal (Figure 17B and Figure 18A) and maximal deleted RRV vectors (Figure 17C and Figure 18B) using Gibson assembly.

[0135] Cell lines and culture Human embryonic kidney 293T cells (ATCC) were cultured in Dulbecco's modified Eagle's medium-nutrient mixture supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin (Corning, Inc.). U87EGFRvIII cells were cultured in DMEM medium supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin (Corning, Inc.).

[0136] Virus production and concentration Replication-deficient (vector encoding Cas9) viral vectors were generated by transient calcium phosphate cotransfection of 293T cells with plasmid DNA containing the viral plasmid DMA, the pHIT60 packaging plasmid, and the VSV-G envelope.

[0137] Minimal (i.e., small deletion) and maximal (i.e., large deletion) deletion vectors were generated by transient calcium phosphate cotransfection of 293T cells with viral plasmid DNA and plasmid DNA containing the GAL4 gene. Virus-containing supernatants were collected approximately 36–48 h after the initial transfection. For in vivo studies, viruses were concentrated using a RetroX concentrator (Takara) according to the manufacturer's protocol and resuspended in PBS. Functional virus titers in units of transducing units / mL (TU / mL) were determined by flow cytometry.

[0138] Assessment of in vitro viral replication and β2-microglobulin knockdown Briefly, a specific multiplicity of infection (MOI) was added to U87EGFRvIII tumor cells in vitro and allowed to replicate for a period of time. Transduction levels were measured periodically by flow cytometry for a fluorescent protein transgene. MOIs of 0.01–0.1 were typically utilized for in vitro virus propagation experiments. B2M knockdown was assessed by cell surface staining of transduced cells. Briefly, cells were harvested and washed twice with staining buffer (PBS with 0.2% BSA). Up to 1x106 cells per 100 μl were dispensed into FACS tubes. 5 μl of APC-conjugated anti-human β2-microglobulin antibody (Biolegend) or isotype control (IgG1κ, Biolegend) was added and cells were incubated for 30 min at 4°C with agitation. Cells were washed twice with PBS containing 0.2% BSA, fixed with 4% PFA for 15 min, washed two more times, and resuspended in 300 μl staining buffer for FACS analysis.

[0139] Retroviral replication and β2-microglobulin knockdown in U87vIII cells pAC-minimal (i.e., small deletion)-strawberry-U6-B2MsgRNA vector and pLXIX-GAL4-EGFP-CAS9 were added to U87vIII cells at a multiplicity of infection (moi) of 0.01 and 0.1, respectively. Viral propagation was then monitored by flow cytometry for EMD and strawberry at intervals of time points. In contrast to pLXIX-GAL4-EGFP-CAS9 alone, addition of pAC-minimal-strawberry-U6-B2MsgRNA allowed viral replication and propagation of both viruses (Figure 19). In cells receiving both pAC-minimal-strawberry-U6-B2MsgRNA and pLXIX-GAL4-EGFP-CAS9, β2-microglobulin knockdown was also assessed by cell surface antibody staining. By day 20 post-transduction, up to 50% of the co-transfected (ie, GFP-positive, strawberry-positive) cells were not APC / β2M positive (FIG. 20).

[0140] Similar experiments can be performed with pACmax (i.e., large deletion)-strawberry-U6-B2MsgRNA vector and pLXIX-GAL4-EGFP-CAS9 by adding these vectors to U87vIII cells at a multiplicity of infection (moi) of 0.01 and 0.1, respectively. Viral propagation can be monitored by flow cytometry for EMD and strawberry at timed intervals. In contrast to pLXIX-GAL4-EGFP-CAS9 alone, addition of pAC-max-strawberry-U6-B2MsgRNA is expected to allow viral replication and propagation of both viruses. In cells receiving both pAC-max-strawberry-U6-B2MsgRNA and pLXIX-GAL4-EGFP-CAS9, β2-microglobulin knockdown can also be assessed by cell surface antibody staining. Infection with pAC-max-strawberry-U6-B2M sgRNA and pLXIX-GAL4-EGFP-CAS9 is expected to result in >85% co-infected cells. Analysis of cell surface B2M expression in total and co-transfected cell populations, as described above, should result in knockdown of B2M in >50% of U87vIII cells.

[0141] Inhibition of tumor growth in glioblastoma animal models The human tumor-specific EGFR deletion variant, EGFRvIII target sequence, is used to generate the sgRNA spacer sequence by inserting it into two 60-mer oligonucleotides as shown below (sequences are 5'→3', and the regions shown in bold are the reverse complement of each other): TIFF2024526878000006.tif37144

[0142] These oligos are used to generate the U6-EGFRvIIIgRNA expression vector, which is used as a template to generate the minimally deleted U6-EGFRvIIIgRNA vector and the maximally deleted U6-EGFRvIIIgRNA vector as described above.

[0143] These minimally or maximally deleted vectors carrying both the EGFRvIII gRNA and strawberry fluorescent marker gene are co-administered with pLXIX-GAL4-EGFP-CAS9 into U87vIII cells in vitro at a specific multiplicity of infection. The levels of propagation and co-transduction are assessed as described herein, and the effect on EGFRvIII expression is also assessed. Co-transduced U87EGFRvIII cells are expected to show similar levels of propagation and co-transduction to those seen with previous iterations of these vectors. It is also expected that EGFRvIII expression is significantly reduced upon co-transduction using flow cytometry to detect EGFRvIII cell surface expression or by Western blot to assay EGFRvIII protein levels in cell lysates.

[0144] Stable for firefly luciferase gene, 1e 5 U87vIII human glioma cells are surgically implanted into athymic nude mice by stereotactic injection. Minimal or maximal deletion vectors carrying both EGFRvIII gRNA and strawberry fluorescent marker gene are co-administered with pLXIX-GAL4-EGFP-CAS9 by intratumoral stereotactic injection. The vectors are allowed to propagate. Tumor growth is monitored at weekly intervals by bioluminescence imaging of the tumors. A decrease in bioluminescence signal is expected over time in CRISPR / CAS9-treated animals compared to untreated control animals, indicating significant tumor growth inhibition.

[0145] Example III method Construction of pLXIX-GAL4-IM and pAC3-GAL4BS-RLI Using Gibson Assembly Cloning, the codon- and stability-optimized gene sequences of the following genes: IL-7, FLT3L, and 4-1BBL were inserted into the pLXIX-GAL4 plasmid to generate pLXIX-GAL4-IM (Figure 21A). The IL-15 superagonist RLI was similarly cloned into the pAC-max-Strawberry vector (replacing Strawberry) to generate pAC3-GAL4BS-RLI (also called GAL4BS-IL-15) (Figure 21B).

[0146] Cell lines and culture Human embryonic kidney 293T with stable gag-pol expression (Retro-X cells purchased from Takara, Inc.) were cultured in Dulbecco's modified Eagle's medium-nutrient mixture supplemented with 10% fetal bovine serum and 1X Gibco GlutaMAX (Gibco, Inc.). Mouse glioblastoma SB28 (generously provided by Dr. Hideho Okada, University of California San Francisco, San Francisco, CA) was cultured in RPM11640 medium supplemented with 10% fetal bovine serum, Gibco GlutaMAX (Gibco, Inc.), non-essential amino acids (Gibco, Inc.), hydroxyethylpiperazineethanesulfonic acid (Gibco, Inc.), penicillin-streptomycin (Gibco, Inc.), and 0.1% β-mercaptoethanol.

[0147] Virus production and concentration Virus was produced by transient transfection of Retro-X producer cells. Reverse transfection was performed using Fugene HD (Promega) and 10 micrograms of viral plasmid DNA and VSV-G envelope-containing plasmid DNA. Virus-containing supernatants were collected approximately 36–48 hours after the initial transfection. For in vivo studies, virus was concentrated using column-based retrovirus purification and buffer exchange against phosphate-buffered saline (PBS) (Bioland Scientific LLC.). Functional virus titers in units of transducing units / mL (TU / mL) were determined by flow cytometry.

[0148] In vitro expression of therapeutic transgenes Plasmids pLXIX-GAL4-IM and pAC3-GAL4BS-RLI were added to cultured SB28 cells at an MOI of 0.3. At 96 h postinfection, cell culture supernatants were collected and enzyme-linked immunosorbent assays (ELISAs) were performed to assess the levels of RL1, IL-7, and FLT3L. Flow cytometry using anti-4-1BBL antibodies was also performed to confirm 4-1BBL expression on virus-infected cells.

[0149] mouse Eight to twelve week old C57BL / 6 mice were purchased from Jackson Laboratories and housed at the University of California, San Francisco.

[0150] Animal studies - virus transmission SB28 mouse glioblastoma tumor cells were used for in vivo experiments. All cells stably expressed luciferase to allow bioluminescence imaging and LSSmOrange to allow tumor cell identification by flow cytometry. 10,000 tumor cells were implanted intracranially on day 0. Cells were implanted at the following coordinates from bregma using a stereotaxic frame: anterior-posterior (AP), 0 mm; mediolateral (ML), 1.9 mm; and dorsoventral (DV), 3.0 mm. Four days after tumor implantation, mice were injected with 5x103TU of pLXIX-GAL4-EMD and pAC-minimalStrawberry or pLXIX-GAL4-EMD and pAC-maximalStrawberry. Premix experiments were also performed using a mix of pre-transduced coinfected positive cells and non-infected tumor cells, up to a total of 4% coinfected cells and 96% non-infected tumor cells.

[0151] Animal Testing - Therapeutic Testing As above, SB28 mouse glioblastoma tumor cells were used for in vivo experiments testing the therapeutic efficacy of virally expressed immune genes. All SB28 cells stably expressed luciferase, which allows bioluminescence imaging. 10,000 tumor cells were implanted intracranially on day 0. Cells were implanted using a stereotaxic frame at the following coordinates from bregma: anterior-posterior (AP), 0 mm; mediolateral (ML), 1.9 mm; and dorsoventral (DV), 3.0 mm. Four days after tumor implantation, mice were treated with 2.5x10 6 TU of pLXIX-GAL4-IM and pAC3-GAL4BS-RLI were injected. Bioluminescence imaging was then monitored biweekly. Mouse survival was also recorded. The endpoint was considered to be >15% weight loss or the onset of neurological symptoms.

[0152] Analysis of viral transmission Mice were sacrificed at 4, 15, and 18 days after tumor injection. The 15 and 18 day time points were combined during analysis. Brain tumors were minced and placed in a solution of collagenase type IV (Thermo Fisher Scientific #17104019) and deoxyribonuclease I (Worthington Biochemical Corporation) for processing with shaking at 37C. The tumors were then filtered through a 70um filter and red blood cells were lysed using ammonium-chloride-potassium (ACK) lysis buffer (Lonza). Flow cytometry analysis was then performed. Acquisition was performed by an Attune NxT Flow Cytometer (Thermo Fisher Scientific). Analysis of flow cytometry results was performed using FlowJo software.

[0153] Analysis of immune changes Mice were sacrificed at the end point or 14 days after tumor injection. The following tissues were collected: spleen, bone marrow, blood, and brain tumor. Brain tumor was minced and placed in a solution of collagenase type IV (Thermo Fisher Scientific #17104019) and deoxyribonuclease I (Worthington Biochemical Corporation) for processing with shaking at 37C. Tumor was then filtered through a 70um filter and red blood cells were lysed using ammonium-chloride-potassium (ACK) lysis buffer (Lonza). Spleen was pulverized through a 40um filter and then subjected to ACK lysis. Bone marrow was filtered through a 40um filter and then subjected to ACK lysis as well. Flow cytometry analysis and staining were then performed. Briefly, cells were first exposed to mouse Fc block dissolved in PBS containing 2% bovine serum albumin. After Fc blocking, cells were washed and then stained with Zombie Aqua fixable viability dye (BioLegend # 423101) dissolved in PBS. Cells were then washed again and then stained for surface markers in PBS containing 2% bovine serum albumin. After surface marker staining, cells were stained for intracellular markers using eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set (Thermo Fisher Scientific # 00-5523-00). Acquisition was performed by Attune NxT Flow Cytometer (Thermo Fisher Scientific). Analysis of flow cytometry results was performed using FlowJo software.

[0154] result Minimal and maximal insertions of GAL4 binding sites differentially alter replication of replicating retroviruses and expression of viral transgenes. As described above, insertions / deletions were made in U3 of the 3' MMLV LTR to differentially modify viral replication and expression, resulting in two replicating viruses (RRVs) with different amounts of dependency on GAL4 / VP16 expression. When applied to SB28 tumor cells, RRV and the strawberry transgene carrying the minimal deletion (pAC-minimal-Strawberry) showed robust expression, but the virus did not replicate over 9 days in culture (Fig. 9A). RRV and the maximal deletion (pAC-maximal-Strawberry) showed no expression in a similar experiment. Stable expression of GAL4 / VP16 in SB28 tumor cells allowed the replication of pAC-minimal-Strawberry virus (Fig. 9B).

[0155] In vitro addition of defective retroviruses carrying GAL4 / VP16 allows expression and replication of replicating retroviruses with minimal and maximal insertions of GAL4 binding sites. After confirming that replication does not occur in pAC-minimal-Strawberry and pAC-maximal-Strawberry without the simultaneous expression of GAL4 / VP16, we then performed experiments to evaluate the ability of GAL4 to enable viral replication. First, we added pAC-minimal-Strawberry and pLXIX-GAL4-EMD to SB28 cells at an MOI of 0.3 per virus. We then monitored viral propagation by flow cytometry for EMD and Strawberry at timed intervals. In contrast to pAC-minimal-Strawberry alone, the addition of pLXIX-GAL4-EMD and pAC-minimal-Strawberry together to SB28 glioblastoma tumor cells allowed robust viral replication and propagation of both viruses (Figure 10A). Furthermore, coinfected cells demonstrated greater expression of Strawberry expression, highlighting the synergistic nature of the binary replication system (Figure 10B). We then performed a similar experiment with pAC-max-Strawberry.Similarly, addition of pLXIX-GAL4-EMD and pAC-max-Strawberry together to SB28 glioblastoma tumor cells enabled robust viral replication and spread of both viruses to a very high percentage of double-positive cells (Figure 1OC).

[0156] In vivo evaluation of minimal and maximal binary systems demonstrates robust coinfection and replication After the successful in vitro experiments of both the minimal and maximal binary systems, we then sought to test the two systems in intracranial mouse tumors. In one set of experiments, the systems were evaluated by implanting premixed tumors (4% co-infected cells and 96% uninfected tumors). The premix experiments demonstrated robust replication and expansion of the co-infected tumor cell population (Figures 11A-11D). To challenge this system, similar in vivo experiments performed with virus injections of low virus titers also demonstrated good replication and a significant co-infected tumor cell population (Figures 12A-C). No fluorescent protein expression was detected 4 days after virus injection, further proving the robust propagation and replication capabilities of the system.

[0157] Binary-IM transduction leads to expression of IL-7, FLT3L, and 4-1BBL in vitro 100% of binary-IM (pLXIX-GAL4-IM and pAC3-GAL4BS-RLI) infected SB28 in 10 mL medium in T75 plates efficiently secreted IL-7, RLI, and FLT3L at concentrations of 75 ng / mL or 0.09 pg / cell / 48 hours (Figure 22). Furthermore, all infected cells expressed 4-1BBL.

[0158] Binary-IM treatment reduces tumor growth and increases survival in two hypoimmunogenic mouse models of glioblastoma Treatment with binary-IM (pLXIX-GAL4-IM and pAC3-GAL4BS-RLI) in SB28 and Tu2449 mouse GBM models reduces tumor growth as measured by bioluminescence and viability (i.e., BLI signal) (Figures 23A and 23B). Treatment with binary-IM completely eradicates transplanted cells in treated SB28 and Tu2449 (Figures 23A and 23B).

[0159] Binary-IM treatment increases tumor infiltration of lymphocytes and dendritic cells in SB28-treated mice Subsequent flow cytometry analysis of binary-IM SB28-treated mice revealed a significant change in the tumor immune microenvironment system compared to control mice. Treatment with binary-IM increased lymphocyte tumor infiltration, including CD3+ immune cell infiltration (3.0% vs. 20.0%, p=0.001) and CD8 T cell infiltration (0.8% vs. 8.0%, p=0.01) at 14 days (Binary-IM (i.e., treatment with pLXIX-GAL4-IM and pAC3-GAL4BS-RLI) is the middle column in each set of three columns for each cell type (left: PBS control, middle: binary-IM; right: empty RRV)). There was no significant difference in Treg (CD3+, CD4+, CD25+, FOXP3+) infiltration (Figure 24). Plasmacytoid dendritic cell (pDC) infiltration was similarly increased at day 14 (3.0% vs. 15.0%, p=0.001).

[0160] Exemplary 3'LTR and / or 5'LTR Sequences Wild-type (unmodified) MMLV LTR sequence (SEQ ID NO:1) TIFF2024526878000007.tif70146

[0161] Minimal deletion MMLV LTR sequence (SEQ ID NO:2) TIFF2024526878000008.tif58146

[0162] Maximum deleted MMLV LTR sequence (SEQ ID NO:3) TIFF2024526878000009.tif46146

Claims

**Claim 1** (a)(i) Encoding a first regulatory element operably linked to a nucleic acid encoding a first activator, and (ii) Lacking a coding sequence for at least one viral protein required for replication such that the first retrovirus becomes a replication-defective retrovirus (RDV), A first retrovirus, and (b) A nucleic acid comprising a first polynucleotide encoding one or more viral proteins required for viral replication, which is lacking in the first retrovirus, wherein the first polynucleotide is expressed only when the first activator activates the expression of the first polynucleotide and / or the viral protein encoded thereby, A recombinant retroviral system comprising a second retrovirus. **Claim 2** The recombinant retroviral system according to claim 1, wherein the activator activates expression by increasing the transcription or translation of the first polynucleotide. **Claim 3** The second retrovirus comprises a second regulatory element operably linked to a first polynucleotide encoding a viral protein required for viral replication, The first activator activates the transcription of the first polynucleotide by binding to the second regulatory element, The recombinant retroviral system according to claim 1. **Claim 4** The recombinant retroviral system according to claim 3, wherein the activator binds to the second regulatory element to activate transcription, and the second regulatory element is a promoter, enhancer, or repressor binding sequence. **Claim 5** The first activator is a derepressor, The first polynucleotide sequence encoded by the second retrovirus is expressed only when the derepressor activates expression by relieving the suppression of the expression of the first polynucleotide and / or the viral protein, The recombinant retroviral system according to claim 1. **Claim 6** The recombinant retroviral system according to claim 5, wherein derepression occurs at the transcriptional or translational level. **Claim 7** The recombinant retroviral system according to claim 3, wherein the first regulatory element and / or the second regulatory element is selected from the group consisting of a promoter, an enhancer, a promoter / enhancer combination, an internal ribosome entry site, an epigenetic regulator, and a translation regulator.

8. The recombinant retroviral system according to claim 7, wherein the promoter is a constitutive promoter or an inducible promoter.

9. The recombinant retroviral system according to claim 1, wherein the second retrovirus is a replication-competent retrovirus (RRV) encoding all viral proteins necessary for viral replication.

10. The recombinant retroviral system according to claim 1, wherein the first and / or the second retrovirus further comprises a heterologous expression cassette comprising a payload promoter operably linked to a payload polynucleotide sequence.

11. The recombinant retroviral system according to claim 1, wherein the viral proteins required for replication are selected from the group consisting of gag, env, pol, rev, and tat.

12. The recombinant retroviral system according to claim 1, wherein the retrovirus is selected from the group consisting of a lentivirus, a murine leukemia virus (MLV), a Moloney murine leukemia virus (MoMLV), and a foamy virus.

13. The recombinant retroviral system according to claim 10, wherein the payload polynucleotide encodes a polypeptide selected from the group consisting of a therapeutic protein, a prodrug activator, a cytotoxic protein, and a reporter protein.

14. The recombinant retroviral system according to claim 13, wherein the prodrug activator is thymidine kinase, cytidine deaminase, or purine nucleoside phosphorylase (PNP).

15. The recombinant retroviral system according to claim 1, wherein the first activator is selected from the group consisting of the HIV-1 transactivator protein (Tat), HIV-1 Rev, Gal4-VP16, GAL4FF, GAL4-VP64, and VP16-E2, and the tetracycline transactivator protein.

16. The first activator is GAL4-VP16, GAL4-VP16 binds to one or more GAL4 binding sites in a second retrovirus, The recombinant retroviral system according to claim 15.

17. The second retrovirus is a replication-defective retrovirus (RDV) and encodes a third regulatory element operably linked to a nucleic acid encoding a second activator, and the first retrovirus comprises a nucleic acid comprising a second polynucleotide encoding a viral protein necessary for viral replication, The second polynucleotide is expressed only when the second activator activates the expression of the second polynucleotide, and The first and second retroviruses can replicate only when the first and second activators are expressed, The recombinant retroviral system according to claim 1.

18. The first retrovirus comprises a fourth regulatory element operably linked to a second polynucleotide encoding a viral protein necessary for viral replication, The first activator activates the transcription of the second polynucleotide by binding to the fourth regulatory element, The recombinant retroviral system according to claim 17.

19. The recombinant retroviral system according to claim 18, wherein the third regulatory element or the fourth regulatory element is selected from the group consisting of a promoter, an enhancer, a promoter / enhancer combination, an internal ribosome entry site, an epigenetic regulator, and a translation regulator.

20. The recombinant retroviral system according to claim 19, wherein the promoter is a constitutive promoter or an inducible promoter.

21. The recombinant retroviral system according to claim 18, wherein the first retrovirus or the second retrovirus or both comprise a heterologous expression cassette comprising a payload promoter operably linked to a payload polynucleotide.

22. The recombinant retroviral system according to claim 21, wherein the payload polynucleotide encodes a polypeptide selected from the group consisting of a therapeutic protein, a prodrug activator, a cytotoxic protein, and a reporter protein.

23. The recombinant retroviral system according to claim 17, wherein the viral protein required for replication is selected from the group consisting of gag, env, pol, rev, and tat.

24. The recombinant retroviral system according to claim 17, wherein the retrovirus is selected from the group consisting of lentivirus, murine leukemia virus (MLV), Moloney murine leukemia virus (MoMLV), and foamy virus.

25. The recombinant retroviral system according to claim 17, wherein the payload polynucleotide encodes a polypeptide selected from the group consisting of a therapeutic protein, a prodrug activator, a cytotoxic protein, and a reporter protein.

26. The recombinant retroviral system according to claim 25, wherein the prodrug activator is thymidine kinase, cytidine deaminase, or purine nucleoside phosphorylase (PNP).

27. The recombinant retroviral system according to claim 18, wherein the third or fourth regulatory element is selected from the group consisting of a constitutive promoter, an inducible promoter, and a tissue-specific promoter.

28. The recombinant retroviral system according to claim 17, wherein the activator is selected from the group consisting of HIV-1 transactivator protein (Tat), HIV-1 Rev, Gal4-VP16, and VP16-E2, and tetracycline transactivator protein.

29. (a) Transfecting a first suitable host cell with the first retroviral vector according to any one of claims 1 to 28; (b) Transfecting a second suitable host cell with the second retroviral vector according to any one of claims 1 to 28; and (c) Recovering the first and second retroviruses A method for producing a recombinant retroviral system, comprising:

30. A composition for transfecting a target cell with a replication-competent retroviral system, comprising the first retrovirus and the second retrovirus according to any one of claims 1 to 28.

31. The composition according to claim 30, wherein the cell is a mammalian cell.

32. The composition according to claim 30 for contacting cells with a first retrovirus and a second retrovirus in vitro, ex vivo, or in vivo.

33. (a) A first retrovirus and / or a second retrovirus of the system according to any one of claims 1 to 28, (b) and a pharmaceutical carrier A pharmaceutical composition comprising.

34. A pharmaceutical composition for treating a disease in a subject in need thereof, comprising the system according to any one of claims 1 to 28.

35. The pharmaceutical composition according to claim 34, wherein the disease is a cell proliferative disorder.

36. The pharmaceutical composition according to claim 35, wherein the cell proliferative disorder is selected from the group consisting of lung cancer, breast cancer, ovarian cancer, uterine cancer, prostate cancer, testicular cancer, kidney cancer, urinary tract cancer, oral cancer, head and neck cancer, esophageal cancer, gastric cancer, pancreatic cancer, colorectal cancer, skin cancer, melanoma, sarcoma, lymphoma, leukemia, and brain cancer including glioblastoma, anaplastic astrocytoma, oligodendroglioma, and medulloblastoma.

37. The pharmaceutical composition according to claim 36, wherein the brain cancer is glioblastoma.

38. The first or second polynucleotide encodes a prodrug activator, the pharmaceutical composition further comprises a prodrug, and the prodrug activator converts the prodrug into a toxic drug when the prodrug activator is expressed. The pharmaceutical composition according to claim 34.

39. The pharmaceutical composition according to claim 34 for administering the first and / or second retroviral vector to the subject as a plasmid or as infectious retroviral particles.

40. The pharmaceutical composition according to claim 34, wherein the subject is a mammal.

41. The pharmaceutical composition according to claim 40, wherein the subject is a human.

42. The pharmaceutical composition according to claim 34 for systemic administration, topical administration, or local administration.

43. The pharmaceutical composition according to claim 34 for administering the first and second retroviruses of the system to the subject simultaneously or sequentially.

Images