Methods for in vivo editing of hepatic genes
Patent Information
- Application Number
- JP2023579195
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-02-28
- Filing Date
- 2022-06-22
- Publication Date
- 2025-07-22
AI Technical Summary
Current treatments for ATTR amyloidosis, such as TTR stabilization and mRNA degradation, require chronic administration and are associated with side effects, necessitating a need for gene editing therapies that can achieve long-term TTR knockdown without continuous dosing.
A CRISPR/Cas9-based therapeutic using lipid nanoparticles for in vivo liver-targeted delivery of guide RNA and mRNA encoding a Cas nuclease to edit the TTR gene, reducing TTR protein production systematically.
Achieves a substantial and potentially permanent reduction in serum TTR levels, improving clinical outcomes for ATTR amyloidosis with minimal side effects and reducing the need for ongoing treatment.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 202,744, filed June 22, 2021, U.S. Provisional Application No. 63 / 202,812, filed June 25, 2021, U.S. Provisional Application No. 63 / 263,466, filed November 3, 2021, U.S. Provisional Application No. 63 / 264,435, filed November 22, 2021, and U.S. Provisional Application No. 63 / 314,878, filed February 28, 2022, the contents of which are incorporated by reference in their entireties herein. [Background technology]
[0002] Amyloidosis, sometimes referred to as ATTR, is characterized by the accumulation of amyloid fibrils composed of misfolded transthyretin (TTR) protein in tissues and is a progressive, fatal disease (Marcoux et al., EMBO Mol Med 2015; Gertz et al., J Am Coll Cardiol 2015). ATTR can present with a wide range of symptoms, and subjects with different classes of ATTR may have different characteristics and prognosis. Some classes of ATTR include familial amyloid polyneuropathy (FAP), familial amyloid cardiomyopathy (FAC), and wild-type TTR amyloidosis (wt-TTR amyloidosis). FAP typically presents with sensory-motor neuropathy, while FAC and wt-TTR amyloidosis typically present with congestive heart failure. ATTR amyloidosis can be acquired (wild-type ATTR amyloidosis; ATTRwt) and is recognized as a cause of cardiomyopathy and heart failure (Gertz et al., J Am Coll Cardiol 2015). TTR amyloidosis can be inherited (mutant ATTR; ATTRv; hATTR) and can be caused by over 100 pathogenic mutations in the TTR gene (Ando et al., Orphanet J Rare Dis 2013). ATTRv amyloidosis is thought to be present in approximately 50,000 people worldwide (Hawkins et al., Ann Med, 2015; Schmidt et al., Muscle Nerve, 2018), with an autosomal dominant inheritance pattern and a clinical phenotype dominated by amyloid polyneuropathy or cardiomyopathy, with most subjects exhibiting a combination of the two (ATTR-PN-CM) (Dohrn et al., J Neurochem 2021). After symptom onset, ATTR amyloidosis is progressive, leading to death within a median of 2–6 years after diagnosis in subjects with amyloid cardiomyopathy (Maurer et al., Circ Heart Fail, 2019) and within a median of 4–17 years after symptom onset in subjects with amyloid polyneuropathy without cardiomyopathy (Merlini et al., Neurol Ther 2020).
[0003] TTR is a protein produced by the TTR gene that normally functions to transport retinol and thyroxine throughout the body. TTR is primarily synthesized in the liver, with a small portion produced in the choroid plexus and retina. TTR normally circulates in the blood as a soluble tetrameric protein. Pathogenic variants of TTR that may disrupt the stability of the tetramer may be encoded by mutant alleles of the TTR gene. Mutant TTR may result in misfolded TTR, which may generate amyloid (i.e., aggregates of misfolded TTR protein). In some cases, pathogenic variants of TTR may lead to amyloidosis, or diseases resulting from the accumulation of amyloid. For example, misfolded TTR monomers may polymerize into amyloid fibrils in tissues such as peripheral nerves, heart, and gastrointestinal tract. Amyloid fibrils may also contain wild-type TTR deposited on misfolded TTR.
[0004] Current treatments for ATTR amyloidosis rely on reducing ongoing amyloid formation through stabilization of the tetrameric form of TTR (diflunisal, tafamidis) (Maurer et al., NEJM 2018; Berk et al., Jama 2013) or inhibition of TTR protein synthesis by degradation of TTR mRNA (inotersen, patisiran) (Benson et al., NEJM 2018; Adams et al., NEJM 2018). Such treatments provide symptomatic relief, improved function, and prolonged survival (Adams et al., NEJM 2018; Adams et al., Lancet Neurol 2021; Solomon et al., Circulation 2019), but are limited by the need for lifelong dosing to maintain TTR knockdown. More generally, existing gene editing approaches for many disorders provide short-term effects in gene expression but require chronic administration to maintain the desired effects in gene expression. In the case of patisiran, chronic treatment is associated with premedication with glucocorticoids and antihistamines (Urits et al., Neurol Ther 2020). Furthermore, subjects receiving TTR stabilizers experience disease progression (Lozeron et al., Eur J Neurol 2013). Inotersen is associated with severe side effects including glomerulonephritis and reduced platelet counts (Gertz et al., Expert Rev Clin Pharmacol 2019). Higher degrees of TTR knockdown are associated with greater improvement in neuropathic endpoints in subjects with hATTR polyneuropathy (Adams et al., NEJM 2018). Enhanced TTR reduction, including sustained knockdown, may lead to improved outcomes in subjects with ATTR amyloidosis. Thus, there remains an unmet need for gene editing therapies that can produce long-term effects in gene expression, such as knockdown of TTR, without the need for chronic administration. Summary of the Invention
[0005] This disclosure describes the first systemic administration of CRISPR / Cas9-based therapeutics for in vivo editing in clinical trials. In some embodiments, the present invention provides methods for substantially reducing or knocking down the expression of the TTR gene using guide RNAs containing Cas nucleases, such as the CRISPR / Cas system, thereby substantially reducing or eliminating the production of TTR protein associated with ATTR. The substantial reduction or elimination of the production of TTR protein associated with ATTR by modifying the TTR gene can result in a long-term reduction or elimination of serum TTR levels, such as a permanent reduction in serum TTR. Additional embodiments include lipid nanoparticle systems for use in in vivo liver-targeted delivery of CRISPR / Cas RNA components, such as guide RNAs and mRNAs encoding Cas nucleases, to human subjects, as well as methods of using the same.
[0006] In one aspect, provided herein is a method of treating TTR-associated amyloidosis (ATTR) in a human subject, comprising systemically administering to the human subject an LNP composition, the LNP composition comprising an effective amount of (i) an mRNA encoding a Cas nuclease, and (ii) a guide RNA targeting the TTR gene, thereby treating ATTR, wherein administration of the composition reduces serum TTR compared to baseline serum.
[0007] In one aspect, provided herein is a method for in vivo editing of the transthyretin (TTR) associated amyloidosis (ATTR, also known as transthyretin amyloidosis) gene in a human subject having TTR gene, the method comprising systemically administering to the human subject a lipid nanoparticle (LNP) composition comprising (i) an mRNA encoding a Cas nuclease and (ii) a guide RNA targeting the TTR gene, and editing the gene in hepatocytes of the subject at a site targeted by the guide RNA, wherein administration of the composition results in an acceptable change in the level of a biosafety measure in the subject as compared to a baseline level of the biosafety measure.
[0008] In one aspect, provided herein is a method for in vivo editing of the TTR gene in a human subject having transthyretin (TTR)-associated amyloidosis (ATTR), comprising systemically administering to the human subject an LNP composition comprising an effective amount of (i) an mRNA encoding a Cas nuclease, and (ii) a guide RNA that targets the TTR gene, and editing the TTR gene at a site targeted by the guide RNA in liver cells of the subject, wherein administration of the composition results in a clinically significant improvement in the level of a clinical measure in the subject compared to a baseline level.
[0009] In one aspect, provided herein is a method of treating amyloidosis associated with TTR (ATTR) in a human subject, comprising systemically administering to the human subject an LNP composition, wherein the LNP comprises an effective amount of (i) an mRNA encoding a Cas nuclease, and (ii) a guide RNA targeting the TTR gene, thereby treating ATTR, wherein administration of the composition results in a clinically significant improvement in the level of a clinical measure in the subject as compared to a baseline level of the clinical measure.
[0010] In one aspect, provided herein is a method of treating amyloidosis associated with TTR (ATTR) in a human subject, comprising systemically administering to the human subject an LNP composition, wherein the LNP composition comprises an effective amount of (i) an mRNA encoding a Cas nuclease, and (ii) a guide RNA targeting the TTR gene, thereby treating ATTR, wherein the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered in a combined dose of about 25 to about 100 mg.
[0011] In one aspect, provided herein is a method for in vivo editing of a gene in the liver of a human subject with a single gene disorder, comprising systemically administering to the human subject an LNP composition, the LNP composition comprising (i) an mRNA encoding a Cas nuclease, and (ii) a guide RNA targeting the gene in the liver, and editing the gene at the site targeted by the guide RNA in the hepatocytes of the subject, wherein the administration of the composition results in an acceptable change in the level of biosafety measures in the subject compared to the baseline level of biosafety measures. In some embodiments, the single gene disorder is ATTR. In some embodiments, the gene is TTR.
[0012] In one aspect, provided herein is a method of treating a human subject with a single gene disorder, comprising systemically administering to the human subject an LNP composition, the LNP composition comprising an effective amount of (i) an mRNA encoding a Cas nuclease, and (ii) a guide RNA targeting a gene in the liver, and editing the gene in the liver, thereby treating the single gene disorder, wherein the treatment is safe and well tolerated. In some embodiments, the single gene disorder is ATTR. In some embodiments, the gene is TTR.
[0013] In one aspect, provided herein is a method of treating a human subject with a single gene disorder, comprising systemically administering to the human subject an LNP composition, the LNP composition comprising an effective amount of (i) an mRNA encoding a Cas nuclease, and (ii) a guide RNA targeting a gene in the liver. The method further comprises determining a first level of a biosafety measure in the subject prior to administration, determining a second level of the biosafety measure in the subject at a time period after administration, and assessing a change between the first level and the second level of the biosafety measure. In some embodiments, the change between the first level and the second level of the biosafety measure is an acceptable change. In some embodiments, the single gene disorder is ATTR. In some embodiments, the gene is TTR.
[0014] In any of the aforementioned aspects and embodiments, the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate.
[0015] In any of the foregoing aspects and embodiments, the LNP comprises a PEG lipid. In some embodiments, the PEG lipid comprises dimyristoylglycerol (DMG). In some embodiments, the PEG lipid comprises PEG-2k. In some embodiments, the PEG lipid is PEG-DMG2000.
[0016] In any of the above aspects and embodiments, the LNP composition has an N / P ratio of about 5 to 7. In any of the above aspects and embodiments, the LNP composition has an N / P ratio of about 4 to 6.
[0017] In any of the foregoing aspects and embodiments, the guide RNA and Cas nuclease are present in a ratio ranging from about 5:1 to about 1:5 by weight. In any of the foregoing aspects and embodiments, the guide RNA and Cas nuclease are present in a ratio ranging from about 3:1 to about 1:3 by weight. In any of the foregoing aspects and embodiments, the guide RNA and Cas nuclease are present in a ratio ranging from about 2:1 to about 1:2 by weight.
[0018] In any of the foregoing aspects and embodiments, the mRNA encodes a class 2 Cas nuclease. In some embodiments, the mRNA encodes a Cas9 nuclease. In some embodiments, the mRNA encodes S. pyogenes Cas9. In some embodiments, the mRNA encoding the Cas nuclease is codon optimized. In some embodiments, the mRNA comprises at least one modification.
[0019] In any of the foregoing aspects and embodiments, the guide RNA comprises at least one modification. In some embodiments, the at least one modification to the guide RNA comprises 2'-O-methyl modified nucleotides and / or phosphorothioate internucleotide linkages.
[0020] In any of the above aspects and embodiments, ATTR is hereditary transthyretin amyloidosis. In any of the above aspects and embodiments, ATTR is wild-type transthyretin amyloidosis. In any of the above aspects and embodiments, ATTR is hereditary transthyretin amyloidosis with polyneuropathy. In any of the above aspects and embodiments, ATTR is hereditary transthyretin amyloidosis with cardiomyopathy. In any of the above aspects and embodiments, ATTR is wild-type transthyretin amyloidosis with cardiomyopathy, for example, the subject is classified as class I, class II, or class III under the New York Health Association (NYHA) classification. In any of the above aspects and embodiments, the subject has ATTRv-PN and / or ATTR-CM.
[0021] In any of the foregoing aspects and embodiments, administration of the LNP composition results in a change in the level of a biosafety measure in the subject that is acceptable as compared to a baseline level of the biosafety measure.
[0022] In any of the foregoing aspects and embodiments, the biosafety measure is prothrombin. In any of the foregoing aspects and embodiments, the biosafety measure is activated partial thromboplastin time (aPTT). In any of the foregoing aspects and embodiments, the biosafety measure is fibrinogen. In any of the foregoing aspects and embodiments, the biosafety measure is alanine aminotransferase (ALT). In any of the foregoing aspects and embodiments, the biosafety measure is aspartate aminotransferase (AST).
[0023] In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 0.3 mg / kg to about 2 mg / kg. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 0.3 mg / kg to about 1 mg / kg. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 0.3 mg / kg. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 0.7 mg / kg. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 1.0 mg / kg.
[0024] In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 5 mg to about 9 mg of total RNA. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 15 mg to about 27 mg of total RNA. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 7 mg to about 9 mg of total RNA. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 25 mg to about 27 mg of total RNA.
[0025] In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 25 mg to about 150 mg of total RNA. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 25 mg to about 100 mg of total RNA. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 50 mg to about 90 mg of total RNA. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 50 mg of total RNA.
[0026] In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 35 mg to 65 mg of total RNA. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 40 mg of total RNA. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 60 mg of total RNA. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 70 mg of total RNA. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered at a total dose of about 80 mg of total RNA. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered in a combined dose of about 90 mg of total RNA. In any of the above aspects and embodiments, the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered in a combined dose of about 100 mg of total RNA.
[0027] In any of the foregoing aspects and embodiments, the clinical measure is serum TTR levels.
[0028] In any of the foregoing aspects and embodiments, the clinical measure is serum prealbumin level.
[0029] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces or knocks down expression of the TTR gene.
[0030] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces or knocks down expression of the TTR gene by 60-70%, 70-80%, 80-90%, 90-95%, 95-98%, 98-99%, or 99-100% compared to a baseline prior to administration of the composition.
[0031] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces or knocks down expression of the TTR gene by 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% compared to a baseline prior to administration of the composition.
[0032] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum TTR levels in the subject by at least 60% compared to serum TTR levels prior to administration of the composition (e.g., baseline).
[0033] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum TTR levels in the subject by at least 70% compared to serum TTR levels prior to administration of the composition (e.g., baseline).
[0034] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum TTR levels in the subject by at least 80% compared to serum TTR levels prior to administration of the composition (e.g., baseline).
[0035] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum TTR levels in the subject by at least 84% compared to serum TTR levels prior to administration of the composition (e.g., baseline).
[0036] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum TTR levels in the subject by at least 90% compared to serum TTR levels prior to administration of the composition (e.g., baseline).
[0037] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum TTR levels in the subject by at least 95% compared to serum TTR levels prior to administration of the composition (e.g., baseline).
[0038] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum TTR levels in the subject by at least 96% compared to serum TTR levels prior to administration of the composition (e.g., baseline).
[0039] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces TTR serum levels in the subject by 60-70%, 70-80%, 80-90%, 90-95%, 95-98%, 98-99%, or 99-100%, as compared to the serum TTR level prior to administration of the composition (e.g., baseline).
[0040] In any of the aforementioned aspects and embodiments, administration of the LNP composition reduces TTR serum levels in the subject by any of the aforementioned amounts 7 days after administration of the LNP composition.
[0041] In any of the aforementioned aspects and embodiments, administration of the LNP composition reduces TTR serum levels in the subject by any of the aforementioned amounts 14 days after administration of the LNP composition.
[0042] In any of the aforementioned aspects and embodiments, administration of the LNP composition reduces TTR serum levels in the subject by any of the aforementioned amounts 28 days after administration of the LNP composition.
[0043] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum prealbumin levels in the subject by at least 60% compared to the serum prealbumin levels before administration of the composition (eg, baseline).
[0044] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum prealbumin levels in the subject by at least 70% compared to the serum prealbumin levels prior to administration of the composition (eg, baseline).
[0045] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum prealbumin levels in the subject by at least 80% compared to the serum prealbumin levels before administration of the composition (eg, baseline).
[0046] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum prealbumin levels in the subject by at least 84% compared to the serum prealbumin level before administration of the composition (eg, baseline).
[0047] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum prealbumin levels in the subject by at least 90% compared to the serum prealbumin levels before administration of the composition (eg, baseline).
[0048] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum prealbumin levels in the subject by at least 95% compared to the serum prealbumin level before administration of the composition (eg, baseline).
[0049] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum prealbumin levels in the subject by at least 96% compared to the serum prealbumin level before administration of the composition (eg, baseline).
[0050] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum prealbumin levels in the subject by 60-70%, 70-80%, 80-90%, 90-95%, 95-98%, 98-99%, or 99-100%, as compared to the serum prealbumin level before administration of the composition (e.g., baseline).
[0051] In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum TTR levels to less than about 50 μg / mL. In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum TTR levels to less than about 40 μg / mL. In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum TTR levels to less than about 30 μg / mL. In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum TTR levels to less than about 20 μg / mL. In any of the foregoing aspects and embodiments, administration of the LNP composition reduces serum TTR levels to less than about 10 μg / mL.
[0052] In any of the foregoing aspects and embodiments, the LNP composition is also administered with a second therapeutic agent. In any of the foregoing aspects and embodiments, the second therapeutic agent is a stabilizer of the tetrameric form of TTR. In any of the foregoing aspects and embodiments, the second therapeutic agent is diflunisal or tafamidis.
[0053] In any of the aforementioned aspects and embodiments, administration of the LNP composition reduces serum prealbumin levels in the subject by any of the aforementioned amounts 14 days after administration of the LNP composition.
[0054] In any of the aforementioned aspects and embodiments, administration of the LNP composition reduces serum prealbumin levels in the subject by any of the aforementioned amounts 28 days after administration of the LNP composition.
[0055] In any of the foregoing aspects and embodiments, the method further comprises durably reducing expression of a gene, such as the TTR gene, following a single administration of the LNP composition.
[0056] In any of the foregoing aspects and embodiments, the serum TTR levels or serum prealbumin levels 28 days after administration of the LNP composition are persistent.
[0057] In any of the foregoing aspects and embodiments, the serum TTR level or serum prealbumin level at day 28 after administration of the LNP composition is persistent, e.g., at 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, and / or 12 months.
[0058] In one aspect, disclosed herein is a method of treating TTR-associated amyloidosis (ATTR) in a human subject, comprising administering to the subject an effective amount of a composition that reduces serum TTR levels in the subject by at least 95% as compared to baseline serum TTR levels.
[0059] This patent or application contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief description of the drawings]
[0060] [Figure 1-1] Overview of the methodology for NTLA-2001 LNP-based gene therapy. Panel A depicts the LNP particle composition and injection regimen, Panel B illustrates the proposed gene therapy delivery mechanism, and Panel C depicts CRISPR-Cas9-based gene editing of the TTR gene. [Figure 1-2] This is a continuation of Figure 1-1. [Diagram 2] Cell culture-based assessment of primary human hepatocytes for NTLA-2001 editing of the TTR gene as a function of sgRNA concentration. Primary measures shown are TTR gene editing as a percentage compared to control, TTR mRNA levels, and TTR protein levels. [Diagram 3] A, In vivo evaluation of TTR editing frequency and gene editing patterns using Cyn-LNP in non-human primates. B, In vivo evaluation of TTR editing frequency and gene editing patterns using Cyn-LNP in non-human primates. [Figure 4A] Change in serum TTR protein concentration as a function of time in humans treated with NTLA-2001 (compared to control) (data shown through day 28). Measures shown are from both cohorts A and B. [Figure 4B] Change in serum TTR protein concentration as a function of time in humans treated with NTLA-2001 (compared to control) (data shown through day 28). Measures shown are from both cohorts A and B. [Figure 4C] Change in serum TTR protein concentration as a function of time in humans treated with NTLA-2001 (compared to control) (data shown through day 28). Measures shown are from both cohorts A and B. [Diagram 5] Potential off-target sites of NTLA-2001 sgRNA identified by Cas-OFFinder, GUIDE-seq, and SITE-Seq. [Figure 6A] On-target and off-target gene editing frequencies assessed in cell cultures of primary human hepatocytes treated with NTLA-2001. [Figure 6B] On-target and off-target gene editing frequencies assessed in cell cultures of primary human hepatocytes treated with NTLA-2001. [Figure 7] Schematic illustrating the method used to characterize gene mutations induced by NTLA-2001. [Figure 8A] Schematic diagram illustrating the PCR method used for high-throughput sequencing. [Figure 8B] Schematic diagram illustrating the PCR method used for high-throughput sequencing. [Figure 9] Evaluation of structural variants detected around the TTR locus in primary human hepatocytes treated with NTLA-2001. [Figure 10A]Dose-dependent assessment of NTLA-2001 editing in a mouse model, measured as the percentage of TTR gene editing in the liver. [Figure 10B] Dose-dependent assessment of NTLA-2001 editing in a mouse model, measured as serum protein levels. [Figure 11] Assessment of the permanence of NTLA-2001-based editing of the TTR gene as measured by serum TTR levels after partial hepatectomy in mice. [Figure 12] Serum RNA concentrations as a function of time in Cyn-LNP-treated non-human primates. [Figure 13A] Assessment of TTR editing as measured by gene editing rate in Cyn-LNP-treated non-human primates. [Figure 13B] Assessment of TTR editing as measured by serum TTR levels in Cyn-LNP-treated non-human primates. [Figure 14] Correlation between TTR serum protein levels and gene editing rates in the liver of non-human primates treated with Cyn-LNP. [Figure 15A] Hepatic and coagulation parameters in NTLA-2001 treated subjects, measured as prothrombin time (PT). [Figure 15B] Hepatic and coagulation parameters in NTLA-2001 treated subjects, measured as activated partial thromboplastin time (aPTT). [Figure 15C] Liver and coagulation parameters in NTLA-2001 treated subjects, measured as fibrinogen. [Figure 15D] Hepatic and coagulation parameters in NTLA-2001 treated subjects, measured as alanine aminotransferase (ALT). [Figure 15E] Hepatic and coagulation parameters in NTLA-2001 treated subjects, measured as aspartate aminotransferase (AST). [Figure 16] Plasma concentrations of components of Cyn-LNP in non-human primates. [Figure 17] NTLA-2001 treatment adverse events. [Figure 18] Characteristics of enrolled clinical trial subjects. [Figure 19A] Clinical trial subject data for a dose escalation study of polyneuropathy. [Figure 19B] Clinical trial subject data for a dose escalation study of polyneuropathy. [Figure 19C] Clinical trial subject data for a dose escalation study of polyneuropathy. [Figure 19D] Clinical trial subject data for a dose escalation study of polyneuropathy. [Figure 20] Reduction in TTR by dose. SE, standard error. (*) N=2 at 2 months. (†) N=5 at 2 months. [Figure 21A] Prothrombin time (PT) data. SE = standard error. [Figure 21B] Activated partial thromboplastin time (aPTT) data. SE = standard error. [Figure 21C] Fibrinogen data. SE = standard error. [Figure 21D] Alanine aminotransferase (ALT) data. SE = standard error. [Figure 21E] Aspartate aminotransferase (AST) data. SE = standard error. [Figure 21F] d-Dimer data. SE = standard error. [Figure 22] NTLA-2001 Treatment Adverse Events, Including Cohorts 3 and 4. [Figure 23A] Demographics and baseline characteristics of enrolled clinical trial subjects. [Figure 23B] Demographics and baseline characteristics of enrolled clinical trial subjects. [Figure 24] Median mean plasma concentration-time profile of LPO1 following a single dose IV infusion of NTLA-2001. NTLA-2001 declines rapidly from the peak followed by a secondary peak and a log-linear phase. Available PK data for LPO1 is presented out to 48 hours post-dose. [Diagram 25] Observed (dots) and model predicted (line) mean (SE) of TTR at Day 28 versus NTLA (AUC mg*h / mL) shows that serum TTR decreases at Day 28 with increasing NTLA-2001 exposure. Pre-dose TTR concentration data are shown with AUC=0. Data are presented as the mean of the distribution of observed individual TTR and AUC values at each dose level indicated. [Figure 26] Intermediate model predicted distribution of NTLA-2001 AUC (mg*h / mL) following 1.0 mg / kg and 80 mg by weight quartiles as shown. Simulation identified NTLA-2001 80 mg as the fixed dose equivalent to 1.0 mg / kg. [Figure 27] Minor, transient changes in AST and ALT levels observed following NTLA-2001 infusion. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0061] Reference will now be made in detail to certain specific embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the invention will be described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the invention to these embodiments. Instead, the invention is intended to cover all alternatives, modifications, and equivalents that may be included within the invention as defined by the accompanying embodiments.
[0062] Before describing the teachings of the present application in detail, it should be understood that the present disclosure is not limited to specific compositions or process steps, as such compositions or process steps may vary. As used herein and in the accompanying embodiments, it should be noted that the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "conjugate" includes a plurality of conjugates, reference to a "cell" includes a plurality of cells or cell populations, and so forth. As used herein, the term "include" and grammatical variations thereof are intended to be non-limiting, and the recitation of items in a list does not exclude other similar items that may be substituted or added to the recited items.
[0063] Numerical ranges are inclusive of the numbers defining the range. Measurements and measurables are understood to be approximations taking into account significant digits and error associated with measurement. Additionally, the use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "include," "includes," and "including" are not intended to be limiting. It should be understood that the foregoing general description and detailed description are exemplary and explanatory only and are not intended to limit the present teachings.
[0064] Unless otherwise noted herein, embodiments described herein as "comprising" various components are also contemplated as "consisting" or "consisting essentially" of the described components, and embodiments described herein as "consisting" various components are also contemplated as "comprising" or "consisting essentially" of the described components. Also, embodiments described herein as "consisting essentially" of various components are also contemplated as "consisting" or "comprising" the described components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and / or," unless the context clearly dictates otherwise. The term "about," when used prior to a list, modifies each member of the list. The term "about" or "approximately" refers to an acceptable error for a particular value as determined by one of ordinary skill in the art, which error depends, in part, on how the value is measured or determined. In some embodiments of the present invention, "about" includes ±10%, or in some cases ±5% of the stated value.
[0065] The term "at least" preceding a number or a series of numbers is understood to include the number adjacent to the term "at least" and all subsequent numbers or integers that may be logically included, as is clear from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 20 nucleotide nucleic acid molecule" means that 18, 19, or 20 nucleotides have the indicated property. When present before at least a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range.
[0066] As used herein, "less than" or "less than" is understood to mean the expression and the logical lower zero or adjacent integer value that is logical from the context. For example, a duplex region of "2 nucleotide base pairs or less" has 2, 1, or 0 nucleotide base pairs. When "less than" or "less than" is present before a series of numbers or ranges, it is understood that each of the series of numbers or ranges is modified.
[0067] As used herein, ranges include both upper and lower limits.
[0068] As used herein, when a value is expressed as a maximum amount of 100% (e.g., 100% inhibition or 100% encapsulation), it is understood that the value is limited by the detection method.For example, 100% inhibition is understood to be inhibition to a level below the detection level of the assay, and 100% encapsulation is understood to be that the substance intended to be encapsulated cannot be detected outside the vesicle.
[0069] Unless otherwise stated, the following terms and expressions used herein are intended to have the following meanings:
[0070] "mRNA" is used herein to refer to a polynucleotide comprising an RNA or modified RNA that comprises an open reading frame that can be translated into a polypeptide (i.e., can be a substrate for translation by ribosomes and aminoacylated tRNA). An mRNA can comprise a phosphate-sugar backbone that comprises ribose residues or analogs thereof, e.g., 2'-methoxyribose residues. In some embodiments, the sugars of the nucleic acid phosphate-sugar backbone consist essentially of ribose residues, 2'-methoxyribose residues, or combinations thereof. Generally, an mRNA does not contain a significant amount of thymidine residues (e.g., 0 residues, or fewer than 30, 20, 10, 5, 4, 3, or 2 thymidine residues; or a thymidine content of less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1%). An mRNA can comprise modified uridines at some or all of its uridine positions.
[0071] "Polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds that contain nucleosides or nucleoside analogs with nitrogen-containing heterocyclic bases or base analogs linked together along a backbone, including polymers that are conventional RNA, DNA, mixed RNA-DNA, and analogs thereof. In some embodiments, the polynucleotide is chemically synthesized or in vitro transcribed. The polynucleotide can be an mRNA, such as an in vitro transcribed RNA that contains modified uridines. The nucleic acid "backbone" can be composed of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA; PCT No. WO95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions such as 2' methoxy or 2' halide substitutions. The RNA can contain DNA or one or more deoxynucleosides or deoxynucleoside analogs. "Guide RNA", "gRNA" and "guide" are used interchangeably herein to refer to an RNA, such as a crRNA (also known as CRISPR RNA), or a combination of a crRNA and a trRNA (also known as tracrRNA), that targets a Cas nuclease to a genomic location. Cognate guide RNA structures for Cas nucleases, such as Cas9 nuclease, are known in the art. The crRNA and trRNA sequences of a guide RNA may be associated as a single RNA molecule (single guide RNA, sgRNA) or, for example, as separate RNA molecules (dual guide RNA, dgRNA). The trRNA may be a naturally occurring sequence or a trRNA sequence that has modifications or differences compared to a naturally occurring sequence. The guide RNA may include modified RNAs as described herein.
[0072] As used herein, a "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and functions to guide the guide RNA to the target sequence for binding or modification (e.g., cleavage) by a Cas nuclease. A "guide sequence" may also be referred to as a "targeting sequence" or a "spacer sequence." A guide sequence may be, for example, 20 base pairs in length for Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologues. Shorter or longer sequences, for example, sequences 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length, may also be used as guides. A guide sequence may be 18-25 or 18-20 nucleotides in length. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch. For example, the guide sequence and target sequence may contain 1, 2, 3, or 4 mismatches, where the total length of the target sequence is at least 18, 19, 20, or more base pairs. In some embodiments, the guide sequence and target region may contain 0 or 1-4 mismatches, where the guide sequence contains at least 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and target region may contain 1, 2, 3, or 4 mismatches, where the guide sequence contains 20 nucleotides.
[0073] Since the nucleic acid substrate of the Cas protein is a double-stranded nucleic acid, the target sequence of the Cas protein includes both the plus and minus strands of genomic DNA (i.e., the given sequence and the reverse complement of the sequence). Thus, when a guide sequence is described as being "complementary to a target sequence," it is understood that the guide sequence can direct the guide RNA to bind to the reverse complement of the target sequence. Thus, in some embodiments, when the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to a particular nucleotide in the target sequence (e.g., the target sequence without the PAM), except that T is replaced by U in the guide sequence.
[0074] As used herein, "Cas nuclease" refers to a polypeptide or complex of polypeptides having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, where the DNA-binding activity is sequence-specific and dependent on the sequence of the guide RNA. Exemplary Cas nucleases (and "Cas proteins") include Cas cleavage / nickases. In some embodiments, the Cas nuclease cleaves one or two strands of DNA. In some embodiments, the Cas nuclease is a nickase. In some embodiments, the Cas nuclease is a dsDNA cleavase. Cas nucleases include the Csm or Cmr complex of type III CRISPR systems, its Cas10, Csm1, or Cmr2 subunits, the Cascade complex of type I CRISPR systems, its Cas3 subunit, and class 2 Cas nucleases. As used herein, a "class 2 Cas nuclease" is a single-chain polypeptide with RNA-guided DNA binding activity, such as Cas9 nuclease or Cpf1 nuclease. Class 2 Cas nucleases include class 2 Cas cleavases and class 2 Cas nickases (e.g., H840A, D10A, or N863A mutants), which further have RNA-guided DNA cleavage or nickase activity. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A mutants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A mutants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A mutants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A mutants) proteins and modifications thereof. The Cpf1 protein (Zetsche et al., Cell, 163: 1-13 (2015)) is homologous to Cas9 and contains a RuvC-like nuclease domain. The Cpf1 sequence of Zetsche is incorporated by reference in its entirety.See, e.g., Tables S1 and S3 of Zetsche. "Cas9" includes Spy Cas9, variants of Cas9 listed herein, and equivalents thereof. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015). As used herein, delivery of a Cas nuclease (e.g., Cas9 nuclease, or S. pyogenes Cas9 nuclease) includes delivery of a polypeptide or mRNA. For example, the LNP compositions described herein can include an mRNA encoding a Cas nuclease.
[0075] As used herein, "modified uridine" refers to a nucleoside other than thymidine that has the same hydrogen bond acceptor as uridine and one or more structural differences from uridine. In some embodiments, the modified uridine is a substituted uridine, i.e., a uridine in which one or more aprotic substituents (e.g., alkoxy, such as methoxy) replace a proton. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is a substituted pseudouridine, i.e., a pseudouridine in which one or more aprotic substituents (e.g., alkyl, such as methyl) replace a proton, e.g., N1-methylpseudouridine. In some embodiments, the modified uridine is either a substituted uridine, a pseudouridine, or a substituted pseudouridine.
[0076] As used herein, a "uridine position" refers to a position in a polynucleotide that is occupied by a uridine or modified uridine. Thus, for example, a polynucleotide with "100% of uridine positions being modified uridines" contains modified uridines at all positions that would be uridines in conventional RNA of the same sequence (where all bases are standard A, U, C, or G bases). Unless otherwise indicated, U in the polynucleotide sequences in this disclosure or in the sequence listing or sequence listing accompanying this disclosure can be a uridine or modified uridine.
[0077] As used herein, "treatment" refers to any administration or application of a therapeutic agent for a disease or disorder in a subject, including inhibiting the disease, slowing the progression of the disease, arresting its occurrence, reversing the progression of the disease (e.g., reversing the accumulation of amyloid fibrils), alleviating one or more symptoms of the disease, curing the disease, improving one or more clinical measures described herein, or preventing the recurrence of one or more symptoms of the disease. In some embodiments, the treatment of ATTR may include alleviating the symptoms of ATTR. In some embodiments, the treatment of ATTR may include substantially reducing or knocking down the expression of the TTR gene, e.g., permanently reducing by at least 95%, thereby substantially reducing or eliminating the production of TTR protein associated with ATTR.
[0078] As used herein, "amyloid" refers to abnormal aggregates of normally soluble proteins or peptides. Amyloids are insoluble, and amyloids can cause proteinaceous deposits in organs and tissues. Proteins or peptides in amyloids can misfold into a form in which many copies of the protein can attach to form fibrils. While some forms of amyloids may have normal functions in the human body, "amyloid" as used herein refers to abnormal or pathological aggregates of proteins. Amyloids may contain a single protein or peptide, such as TTR, or multiple proteins or peptides, such as TTR and additional proteins.
[0079] As used herein, "amyloid fibrils" refer to insoluble fibers of amyloid that are resistant to degradation. Amyloid fibrils can cause symptoms based on the particular protein or peptide and the tissue and cell type in which they aggregate.
[0080] As used herein, "amyloidosis" refers to a disease characterized by symptoms caused by the deposition of amyloid or amyloid fibrils. Amyloidosis can affect multiple organs, including the heart, kidneys, liver, spleen, nervous system, and digestive tract.
[0081] As used herein, "TTR" refers to transthyretin, the gene product of the TTR gene. TTR is also known in the art as CTS, CTS1, HEL111, HsT2651, PALB, prealbumin, TBPA, and ATTN. See, e.g., HGNC:HGNC:12405 (https: / / www.ncbi.nlm.nih.gov / gene / 7276).
[0082] As used herein, "ATTR", "TTR-associated amyloidosis", "TTR amyloidosis", "ATTR amyloidosis", "amyloidosis associated with TTR", or "transthyretin amyloidosis" refers to a condition resulting from misfolded TTR protein that accumulates as amyloid fibrils in multiple tissues (mainly nerves and muscles), leading to predominantly polyneuropathy (PN) and / or cardiomyopathy (CM) disease phenotypes. Symptoms of PN include numbness in the limbs due to peripheral neuropathy, dizziness, and gastrointestinal upset due to autonomic neuropathy. Symptoms of CM include shortness of breath and other symptoms of cardiac dysfunction, including congestive heart failure. Both phenotypes are associated with hereditary (familial) ATTR (ATTRv). ATTR-CM can result from a mutation(s) in the TTR gene (ATTRv-CM) and / or a wild-type TTR gene (ATTR-CM). Wild-type ATTR (ATTR-wt) is primarily associated with CM. Subjects with ATTRv can present with a mixed clinical phenotype consisting of both neurological and cardiac dysfunction.
[0083] As used herein, "hereditary ATTR" refers to ATTR associated with a mutation in the sequence of the TTR gene. Known mutations in the TTR gene associated with ATTR include those resulting in TTR containing substitutions of T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). Hereditary ATTR includes familial amyloid cardiomyopathy ("FAC"), which is characterized by restrictive cardiomyopathy, also known as hereditary transthyretin amyloidosis with cardiomyopathy ("ATTRv-CM"). Congestive heart failure is common in FAC. The average age of onset is approximately 60-70 years, and the estimated life expectancy is 4-5 years after diagnosis. Hereditary ATTR also includes familial amyloid polyneuropathy ("FAP"), also known as hereditary transthyretin amyloidosis with polyneuropathy ("ATTRv-PN"), characterized primarily by sensory-motor neuropathy. Autonomic neuropathy is common in FAP. Although neuropathy is the primary feature, symptoms of FAP may also include cachexia, renal failure, and cardiac disease. The average age of onset of FAP is approximately 30-50 years, with an estimated life expectancy of 5-15 years after diagnosis. As used herein, "hereditary ATTR" refers to ATTRv-PN and / or ATTRv-CM.
[0084] As used herein, "wild type ATTR" and "ATTRwt" refer to ATTR that is not associated with a pathological TTR mutation, such as T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). ATTRwt is also known as senile systemic amyloidosis. Onset typically occurs in men over 60 years of age, and the most common symptoms are congestive heart failure and abnormal heart rhythms, such as atrial fibrillation. Additional symptoms include the consequences of cardiac dysfunction, such as shortness of breath, fatigue, dizziness, swelling (especially of the legs), nausea, angina, sleep disturbances, and weight loss. As used herein, "wild type ATTR" refers to a disease phenotype of polyneuropathy and / or cardiomyopathy that is not associated with a TTR mutation.
[0085] In some embodiments, the human subject is already diagnosed with ATTR prior to treatment or is diagnosed with ATTR at the same time. In some embodiments, the human subject is diagnosed with ATTR based on genetic testing (e.g., documenting a TTR mutation). In some embodiments, the human subject is diagnosed with ATTR based on a clinical diagnosis of sensorimotor peripheral neuropathy. In some embodiments, the human subject is diagnosed with ATTR prior to treatment based on a neuropathy score (NIS) of 5 or more and 130 or less. In some embodiments, the human subject is diagnosed with ATTR based on a documenting of tissue deposits of TTR amyloid by biopsy or validated non-invasive imaging. In some embodiments, the human subject is diagnosed with ATTR based on a polyneuropathy disability (PND) score of 3b or less. In some embodiments, the human subject is diagnosed with ATTR amyloidosis with cardiomyopathy, classified as hereditary ATTR amyloidosis with cardiomyopathy (ATTRv) or wild-type cardiomyopathy (ATTRwt). In some embodiments, a human subject with ATTR-CM is classified as Class I or Class II under the New York Health Association (NYHA) classification. In some embodiments, a human subject with ATTR-CM is classified as Class III under the New York Health Association (NYHA) classification.
[0086] In some embodiments, the human subject has a progression of symptoms (e.g., polyneuropathy symptoms) prior to treatment. In some embodiments, the human subject has an increase of 1 or more points in the Polyneuropathy Disability (PND) score. In some embodiments, the human subject has an increase of 1 or more points in the Familial Amyloid Polyneuropathy (FAP) stage. In some embodiments, the human subject has an increase of 5 or more points in the Neuropathy Score (NIS). In some embodiments, the human subject has an increase of 5 or more points in the NIS-Left Limb (LL). In some embodiments, the human subject has a decrease of 25 kg / m2×g / L or more in the corrected body mass index (mBMI). In some embodiments, the human subject has a decrease of 30 meters or more in the 6-minute walk test. In some embodiments, the human subject has a decrease of 0.1 m / s or more in the 10-meter walk test. As used herein, "mutated TTR" refers to a gene product of TTR (i.e., TTR protein) that has an alteration in the amino acid sequence of TTR compared to the wild-type amino acid sequence of TTR. The human wild type TTR sequence is available at NCBI Gene ID: 7276; Ensembl: Ensembl: ENSG000001 18271. Mutant forms of TTR, e.g., related to ATTR in humans, are designated according to the amino acid position based on the mature protein sequence without the signal sequence (e.g., T60A corresponds to T80A, which is also designated p.T80A), including, but not limited to, T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-).
[0087] As used herein, "knockdown" refers to reducing the expression of a particular gene product (e.g., TTR) in, for example, a cell, cell population, tissue, or organ by gene editing. In some embodiments, gene editing can be assessed by sequencing, for example, next generation sequencing (NGS). Expression can be reduced by at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or below the detection level of the assay, compared to a suitable control, for example, the subject's baseline or pre-treatment. Methods for measuring mRNA knockdown are known and include sequencing of mRNA isolated from the tissue or cell population of interest. Protein knockdown can be measured by detecting the amount of protein from the tissue, cell population, or fluid of interest. Flow cytometry analysis is a known method for measuring knockdown of protein expression. For secreted proteins, knockdown can be assessed in tissue culture medium or blood, or fluids derived therefrom, such as serum or plasma. Serum protein levels can be measured by quantitative assays, for example, by ELISA, and can be used to detect knockdown. In some embodiments, "knockdown" may refer to some loss of expression of a particular gene product, such as a reduction in the amount of full-length wild-type mRNA that is transcribed or translated into a full-length protein, or a reduction in the amount of protein expressed by a population of cells. It is well understood what changes in mRNA sequence lead to reduced expression of wild-type or full-length proteins. In some embodiments, "knockdown" may refer to some loss of expression of a particular gene product, such as TTR.
[0088] As used herein, "durable" in the context of serum TTR or serum prealbumin knockdown (e.g., permanent knockdown), or "durably" reducing expression of a gene (e.g., TTR gene), refers to a sustained effect, such as a sustained knockdown or sustained reduction in gene expression. In some embodiments, a permanent knockdown of serum TTR or serum prealbumin refers to a reduction (relative to baseline levels) measured 14 days or 28 days after administration of the LNP composition, and maintained for, e.g., at least 6 months, 9 months, 1 year, 2 years, 3 years, 4 years, 5 years, or more. In some embodiments, the maintained level may vary. In some embodiments, the reduction correlates with the desired clinical efficacy for the disorder being treated. The level of reduction to achieve the desired clinical efficacy for a given disorder, such as ATTR, is known in the art. For example, a reduction of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more correlates with the desired clinical efficacy for a particular disorder. For example, a reduction of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more correlates with a desired clinical benefit against ATTR.
[0089] As used herein, "single gene disorder" refers to a disorder resulting from abnormal expression or activity of a hepatic gene product. A single gene disorder can be treated by editing a gene in the liver or a non-coding region that causes abnormal expression or activity of a hepatic gene product. In some embodiments, the gene product is a protein. In some embodiments, the gene product is an RNA molecule. In some embodiments, editing a gene in the liver or a non-coding region that causes abnormal expression or activity of a hepatic gene product reduces the level (e.g., serum level) of the gene product. In some embodiments, the gene comprises one or more modifications in the gene compared to the wild type. In some embodiments, the gene is wild type. A single gene disorder can be a genetic disorder suitable for treatment by single gene editing.
[0090] As used herein, an "effective amount" refers to an amount of the Cas nuclease-encoding mRNA and guide RNA that reduces serum TTR levels in a subject by at least 60% compared to baseline serum TTR levels and / or reduces serum TTR to less than about 50 μg / mL following administration of the Cas nuclease-encoding mRNA and guide RNA. For example, an LNP composition may include an effective amount of a Cas nuclease-encoding mRNA and a guide RNA, such as a guide RNA targeting TTR (total RNA or total RNA). In some embodiments, an LNP composition delivers a Cas nuclease-encoding mRNA and guide RNA that may include an "effective amount" of RNA measured as total RNA. In some embodiments, an effective amount of the Cas nuclease-encoding mRNA and guide RNA reduces serum TTR levels in a subject by at least 60-70%, 70-80%, 80-90%, 90-95%, 95-98%, 98-99%, or 99-100% compared to baseline serum TTR levels. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA reduces serum prealbumin levels in a subject by at least 60% compared to baseline serum prealbumin levels. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA reduces serum prealbumin levels in a subject by at least 60-70%, 70-80%, 80-90%, 90-95%, 95-98%, 98-99%, or 99-100% compared to baseline serum prealbumin levels. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA reduces serum TTR to less than about 50 μg / mL, less than about 40 μg / mL, less than about 30 μg / mL, less than about 20 μg / mL, or less than about 10 μg / mL after administration of the mRNA encoding the Cas nuclease and the guide RNA.
[0091] As used herein, "biosafety measures" refer to clinical measures used to monitor safety events associated with administration of the LNP compositions described herein to human subjects. Biosafety measures may allow for the determination of safety events, including adverse events (NCI-CTCAE grade 3 or higher), serious adverse events, adverse events of particular interest, and / or treatment-emergent adverse events (CTCAE grade 3 or higher), as described herein. Guidelines for defining the severity of safety events (e.g., adverse events) are known in the art (e.g., the National Cancer Institute (NCI) Common Terminology Criteria for Adverse Events (CTCAE), including version 5.0). In some embodiments, the level of the biosafety measure is measured before administration of the LNP composition. In some embodiments, the level of the biosafety measure is measured after administration of the LNP composition. In some embodiments, the level of the biosafety measure is measured before and after administration of the LNP composition, thereby allowing a comparison of the level of the biosafety measure before and after treatment with the LNP composition to be made and to determine changes, such as acceptable changes. As used herein, an "acceptable" change refers to a change in a biosafety measure level where the resulting change does not constitute a safety event (e.g., an adverse event (NCI-CTCAE grade 3 or higher), a serious adverse event, an adverse event of particular interest, a treatment-emergent adverse event (CTCAE grade 3 or higher), and / or an event that would otherwise require discontinuation of the investigational drug as determined by the clinician. In some embodiments, the level of a biosafety measure measured prior to administration of the LNP composition can serve as a baseline for comparison to one or more levels of the biosafety measure measured after administration of the LNP composition (e.g., measurements taken at specific intervals after administration can be compared against a baseline level). In some embodiments, the baseline is the last available measurement taken prior to administration of the LNP composition. In some embodiments, a biosafety measure is not compared against a baseline when the value alone can be used to determine a safety event.
[0092] As used herein, "safe and well tolerated" refers to the absence of any safety events as described herein, e.g., no adverse events (NCI-CTCAE grade 3 or higher), no serious adverse events, no adverse events of particular interest, no treatment-emergent adverse events (CTCAE grade 3 or higher), and / or no events that would otherwise require discontinuation of the investigational drug as determined by the clinician. In some embodiments, "safe and well tolerated" includes patients who experience an NCI-CTCAE grade 3 or higher that is unrelated to administration of a composition described herein, e.g., a LNP composition comprising an effective amount of an mRNA encoding a Cas nuclease and a guide RNA targeting TTR, and / or, e.g., the event resolves after an acceptable period of time with or without intervention.
[0093] In some embodiments, adverse events of particular interest include, for example, infusion-related reactions (IRRs) (e.g., those requiring treatment or discontinuation of the infusion and / or Grade 3 or greater); occurrence of cytokine release syndrome; evidence of abnormal coagulation or occurrence of thrombi or hemorrhage as defined by clinically significant abnormal bleeding or abnormal blood test results of CTCAE Grade 2 or greater; acute liver injury as evidenced by elevated ALT of CTCAE Grade 2 or greater, elevated AST of CTCAE Grade 2 or greater, elevated total bilirubin of CTCAE Grade 2 or greater, elevated GLDH of CTCAE Grade 2 or greater; events due to effects on the spleen (splenic hemorrhage, splenic infarction, sometimes thrombocytopenia, sometimes anemia, or lymphopenia with specific abnormalities on microscopic examination of blood cells); events due to effects on the adrenal glands; clinically significant symptoms of hypothyroidism; decreased thyroxine (T4 levels) below the normal range; and ocular events consistent with vitamin A deficiency.
[0094] In some embodiments, an adverse event is any untoward medical occurrence in a subject administered an investigational drug or receiving a study treatment that does not necessarily have a causal relationship to the treatment. In some embodiments, an adverse event is an unintended sign (including abnormal laboratory findings), symptom, or disease that is temporally related to the treatment, whether or not related to the medicinal (investigational) product. In some embodiments, an adverse event induces a clinical sign or symptom. In some embodiments, an adverse event requires active intervention. In some embodiments, an adverse event requires interruption or discontinuation of treatment. In some embodiments, an adverse event is a clinically significant abnormality in the opinion of the investigator. Adverse event grading criteria are known in the art, such as, for example, the CTCAE, including the National Cancer Institute's (NCI) Common Terminology Criteria for Adverse Events (CTCAE).
[0095] Biosafety measures include, for example, known laboratory endpoints commonly related to coagulation, hematology, clinical chemistry, urinalysis, and other bioanalytical evaluations (e.g., cytokines, complement). Specific biosafety measures include liver enzyme levels (e.g., elevation of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) >5×ULN for more than 4 weeks after administration of treatment, ALT or AST >3×ULN and total bilirubin >2×ULN (Hy's law) after administration of treatment), activated partial thromboplastin time (aPTT) levels (e.g., elevation of aPTT) >5×ULN for more than 4 weeks after administration of treatment), prothrombin time (PT) levels, thrombin generation time (TGT) levels (e.g., peak height, lag time, and / or endogenous thrombin potential), fibrinogen levels, prothrombin international normalized (INR) ratio levels, d-dimer levels, laboratory parameters consistent with disseminated intravascular coagulation, changes in hematology laboratory values (e.g., CTC after administration of treatment, Abnormal blood test results greater than AE Grade 2), changes in chemistry values, changes in coagulation, changes in urinalysis, glutamate dehydrogenase levels, C-reactive protein levels, complement (C3, C4, C3a, C5a, Bb) levels, cytokine (GM-CSF, INF-γ, IL-1β, IL-4, IL-5, IL-6, IL-8, IL-10, IL-13, IL-23, TNF-α, IL-17, MCP-1) levels, thyroxine (T4 levels) (e.g., levels below normal range or clinically significant symptoms / signs of hypothyroidism following administration of treatment), acute liver injury (e.g., elevation of ALT, AST, total bilirubin or GLDH greater than CTCAE Grade 2 or clinically significant symptoms / signs of liver injury following administration of treatment), and changes in 12-lead electrocardiograms. Additional biosafety measures, including those associated with administration of LNP compositions, are known in the art. Similarly, acceptable levels and / or changes in biosafety measures are known in the art and can be assessed by routine methods, for example, by a clinician or laboratory.
[0096] As used herein, "clinical efficacy measure" refers to a measure used to assess disease improvement in a human subject treated with an LNP composition described herein. In some embodiments, the level of the clinical efficacy measure is measured after administration of the LNP composition. In some embodiments, the level of the clinical efficacy measure is measured before and after administration of the LNP composition, thereby allowing for a comparison of the level of the clinical efficacy measure before and after treatment with the LNP composition. In some embodiments, the level of the clinical measure measured before administration of the LNP composition can serve as a baseline or control for comparison to one or more levels of the clinical measure measured after administration of the LNP composition. In some embodiments, the baseline is the last available measurement obtained before administration of the LNP composition.
[0097] For disorders characterized by transthyretin amyloid, clinical efficacy measures include, but are not limited to, a reduction in serum TTR (e.g., a 60% reduction in serum TTR as measured by ELISA after administration of treatment), a reduction in serum TTR (e.g., at least a 60% reduction in serum TTR as measured by mass spectrometry after administration of treatment), a reduction in serum prealbumin, a reduction in polyneuropathic disability (PND) score, a reduction in familial amyloid polyneuropathy (FAP) stage, a reduction in neuropathy score (NIS), a reduction in corrected neuropathy score (mNIS+7), a reduction in neuropathy score (NIS)-legs (LL), an increase in corrected body mass index (mBMI) of 25 kg / m2×g / L or more, an increase in the 6-minute walk test (6-MWT) of 30 meters or more, and an increase in the 10-meter walk test (10-MWT) of 0.1 meters / second or more. Additional clinical efficacy measures include improved serum neurofilament light chain (NfL) levels, improved quality of life as assessed by Norfolk Quality of Life-Diabetic Neuropathy, improved quality of life as assessed by EuroQOL (EQ)-5D-5L, improved cardiac MRI, improved N-terminal prohormone of brain natriuretic peptide (NT-proBNP) levels, improved troponin I levels, improved New York Health Association (NYHA) classification, and improved Kansas City Cardiomyopathy Questionnaire (KCCQ) scores. Additional clinical efficacy measures, including for TTR amyloidosis, are known in the art. Similarly, "clinically significant improvement" in clinical efficacy measures, i.e., levels and / or changes in clinical efficacy measure(s) that indicate improvement in disease, including TTR amyloidosis, are known in the art and can be routinely assessed, for example, by a clinician or laboratory. For example, serum TTR levels are a clinical efficacy measure for TTR amyloidosis.A "clinically significant improvement" in this clinical efficacy measure for treating TTR amyloidosis includes at least a 60%, 70%, 80%, 85%, 90%, or 95% decrease in serum TTR levels after treatment compared to baseline, e.g., before treatment with the LNP compositions described herein. For example, serum prealbumin levels are also a clinical efficacy measure for TTR amyloidosis. A "clinically significant improvement" in this clinical efficacy measure for treating TTR amyloidosis includes at least a 60%, 70%, 80%, 85%, 90%, or 95% decrease in serum prealbumin levels after treatment compared to baseline, e.g., before treatment with the LNP compositions described herein. Although "TTR" is synonymous with "prealbumin," "serum prealbumin levels" refers to a different assay for measuring this protein level when compared to an assay for measuring "serum TTR levels." Both assays measure the same protein.
[0098] As used herein, the term "lipid nanoparticle" (LNP) refers to a particle that includes a plurality (i.e., two or more) of lipid molecules physically associated with each other by intermolecular forces. LNPs can be, for example, microspheres (which include unilamellar and multilamellar vesicles, e.g., lamellar phase lipid bilayers referred to as "liposomes," which in some embodiments are substantially spherical, and in certain embodiments can include an aqueous core, e.g., including a substantial portion of RNA molecules), the dispersed phase of an emulsion, a micelle, or the internal phase of a suspension. See, for example, WO2017173054A1 and WO2019067992A1, the contents of which are incorporated herein by reference in their entirety.
[0099] As used herein, the phrase "pharmaceutical acceptable" means useful in preparing pharmaceutical compositions that are generally non-toxic, not biologically undesirable, and not otherwise unacceptable for pharmaceutical use.
[0100] As used herein, systemic administration can be by intravenous infusion. "Infusion" refers to active administration of one or more agents, for example, using an infusion time of approximately 2 hours. In some embodiments, for example, LNPs comprising an mRNA encoding a Cas nuclease (such as Cas9) as described herein and a gRNA as described herein are administered systemically to a human subject.
[0101] As used herein, "infusion prophylaxis" refers to a regimen administered to a subject prior to treatment (e.g., including administration of LNP), including, for example, administration of intravenous steroids (e.g., dexamethasone 10 mg), intravenous H1 blockers (e.g., diphenhydramine 50 mg) or oral H1 blockers (e.g., cetirizine 10 mg), and intravenous or oral H2 blockers (e.g., famotidine 20 mg).
[0102] I. Gene Targeting Compositions Disclosed herein are methods for editing a gene of interest (e.g., TTR) in the liver of a human subject, methods for modifying a gene in a subject's hepatocytes, or methods for treating a disease, and related compositions, including compositions for use in such methods.Generally, disclosed herein are LNP compositions, including mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA that targets a gene, such as a guide RNA that targets the TTR gene.Subjects treated with such methods and compositions can have wild-type or non-wild-type genes of a sequence of interest, such as subjects with ATTR, which can be ATTRwt or a hereditary (or familial) form of ATTR.
[0103] In some embodiments, the methods disclosed herein comprise systemic administration of a lipid nanoparticle system for in vivo liver-targeted delivery of guide RNA and mRNA encoding a Cas nuclease.
[0104] 1. Guide RNA (gRNA) The guide RNA used in the disclosed methods and compositions comprises a guide sequence targeting a gene of interest (e.g., TTR gene). Exemplary guide sequences targeting the TTR gene are shown in the sequence listing, along with exemplary general sgRNA structures and conserved portions of guide RNAs. The guide sequence may further comprise additional nucleotides to form a crRNA, for example, with the following exemplary nucleotide sequence following the 3' end of the guide sequence: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 33). In the case of a sgRNA, the above guide sequence may further comprise additional nucleotides to form a sgRNA, for example, with the following exemplary nucleotide sequence following the 3' end of the guide sequence (5'→3' direction): GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 32). In some embodiments, the gRNA may comprise a guide sequence within a generic sgRNA structure, or may comprise a guide sequence and an sgRNA conserved region, such as the exemplary sequences shown in the sequence listing. In some embodiments, the sgRNA is modified. In some embodiments, the sgRNA comprises the modification pattern shown in SEQ ID NO: 19 below, where N is any natural or non-natural nucleotide, and the entirety of N constitutes a guide sequence as described herein, and the modified sgRNA has the following sequence: mN * mN * mN * NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU * mU * mU *mU (SEQ ID NO: 19), where "N" can be any natural or non-natural nucleotide. For example, the present specification encompasses SEQ ID NO: 19, where N is replaced with any of the guide sequences disclosed herein. Modifications can remain as shown in SEQ ID NO: 19 when substituting N with a guide nucleotide, i.e., the guide nucleotide is replaced with "N", but the first three nucleotides are 2'OMe modified, and there are phosphorothioate linkages between the first and second nucleotides, the second and third nucleotides, and the third and fourth nucleotides.
[0105] In some embodiments, the gRNA comprises a guide sequence that guides a Cas nuclease, which may be a nuclease (e.g., a Cas9 nuclease, such as SpyCas9), to a target DNA sequence. The gRNA may comprise a crRNA that comprises 18, 19, or 20 consecutive nucleotides of the guide sequence. In some embodiments, the gRNA comprises a crRNA that comprises a sequence that has about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to at least 18, 19, or 20 consecutive nucleotides of the guide sequence. In some embodiments, the gRNA comprises a crRNA that comprises a sequence that has about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the guide sequence. The gRNA may further comprise a trRNA. In each of the composition and method embodiments described herein, the crRNA and trRNA may be associated as a single RNA (sgRNA) or on separate RNAs (dgRNA). In the context of the sgRNA, the crRNA and trRNA components can be covalently linked, for example, via a phosphodiester bond or other covalent bond.
[0106] In some embodiments, guide sequences are included that include sgRNA sequences and modified sequences in the sequence listing.
[0107] In some embodiments, a guide RNA targeting the TTR gene comprises any one or more of SEQ ID NOs: 15, 16, 34, 35, and 38-54, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, a sgRNA targeting the TTR gene comprises any one or more of SEQ ID NOs: 15, 16, 34, 35, and 38-54, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NOs: 15, 16, 34, 35, and 38-54, or an 18, 19, or 20 nucleotide portion thereof.
[0108] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 15, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 15, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 15, or an 18, 19, or 20 nucleotide portion thereof.
[0109] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 16, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 16, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 16, or an 18, 19, or 20 nucleotide portion thereof.
[0110] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 34, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 34, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 34, or an 18, 19, or 20 nucleotide portion thereof.
[0111] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 35, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 35, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 35, or an 18, 19, or 20 nucleotide portion thereof.
[0112] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 38, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 38, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 38, or an 18, 19, or 20 nucleotide portion thereof.
[0113] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 39, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 39, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 39, or an 18, 19, or 20 nucleotide portion thereof.
[0114] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 40, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 40, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 40, or an 18, 19, or 20 nucleotide portion thereof.
[0115] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 41, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 41, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 41, or an 18, 19, or 20 nucleotide portion thereof.
[0116] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 42, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 42, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 42, or an 18, 19, or 20 nucleotide portion thereof.
[0117] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 43, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 43, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 43, or an 18, 19, or 20 nucleotide portion thereof.
[0118] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 44, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 44, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 44, or an 18, 19, or 20 nucleotide portion thereof.
[0119] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 45, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 45, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 45, or an 18, 19, or 20 nucleotide portion thereof.
[0120] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 46, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 46, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 46, or an 18, 19, or 20 nucleotide portion thereof.
[0121] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 47, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 47, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 47, or an 18, 19, or 20 nucleotide portion thereof.
[0122] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 48, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 48, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 48, or an 18, 19, or 20 nucleotide portion thereof.
[0123] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 49, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 49, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 49, or an 18, 19, or 20 nucleotide portion thereof.
[0124] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 50, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 50, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 50, or an 18, 19, or 20 nucleotide portion thereof.
[0125] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 51, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 51, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 51, or an 18, 19, or 20 nucleotide portion thereof.
[0126] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 52, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 52, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 52, or an 18, 19, or 20 nucleotide portion thereof.
[0127] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 53, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 53, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 53, or an 18, 19, or 20 nucleotide portion thereof.
[0128] In some embodiments, the guide RNA targeting the TTR gene comprises SEQ ID NO: 54, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the sgRNA targeting the TTR gene comprises SEQ ID NO: 54, or an 18, 19, or 20 nucleotide portion thereof. In some embodiments, the LNP compositions disclosed herein comprise a guide RNA targeting the TTR gene comprising any one or more of SEQ ID NO: 54, or an 18, 19, or 20 nucleotide portion thereof.
[0129] Any of the above TTR guide RNAs may include the general sgRNA structure of the sequence listing, or, for example, the guide RNA conserved region structure shown in the sequence listing.
[0130] In each of the embodiments of the compositions, uses, and methods described herein, the guide RNA can comprise two RNA molecules as a "dual guide RNA" or "dgRNA." The dgRNA comprises a first RNA molecule, e.g., comprising a crRNA, which includes a guide sequence, and a second RNA molecule, e.g., comprising a trRNA. The first and second RNA molecules may not be covalently linked, but can form an RNA duplex via base pairing between a portion of the crRNA and a portion of the trRNA.
[0131] In each of the embodiments of the compositions, uses, and methods described herein, the guide RNA can comprise a single RNA molecule as a "single guide RNA" or "sgRNA." The sgRNA can comprise a crRNA (or a portion thereof) that comprises a guide sequence covalently linked to a trRNA. The sgRNA can comprise 18, 19, or 20 or more consecutive nucleotides of the guide sequence. In some embodiments, the sgRNA can comprise 20 consecutive nucleotides of the guide sequence. In some embodiments, the crRNA and the trRNA are covalently linked via a linker. In some embodiments, the sgRNA forms a stem-loop structure via base pairing between a portion of the crRNA and a portion of the trRNA. In some embodiments, the crRNA and the trRNA are covalently linked via one or more bonds that are not phosphodiester bonds.
[0132] In some embodiments, the trRNA can include all or part of the trRNA sequence from a naturally occurring CRISPR / Cas system. In some embodiments, the trRNA includes truncated or modified wild-type trRNA. The length of the trRNA depends on the CRISPR / Cas system used. In some embodiments, the trRNA includes or consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more nucleotides. In some embodiments, the trRNA can include a certain secondary structure, such as, for example, one or more hairpin or stem-loop structures, or one or more bulge structures.
[0133] The guide RNAs provided herein can be useful for recognizing (e.g., hybridizing to) target sequences in genes of interest. For example, the target sequences of genes of interest can be recognized and cleaved by the provided Cas cleavase comprising guide RNA. Thus, a Cas nuclease, such as a Cas cleavase, can be guided to a target sequence of a gene of interest by the guide RNA, where the guide sequence of the guide RNA hybridizes to the target sequence, and the Cas nuclease, such as a Cas cleavase, cleaves the target sequence.
[0134] In some embodiments, the selection of one or more guide RNAs is determined based on a target sequence within a gene of interest.
[0135] Without being bound to any particular theory, mutations in certain regions of a gene (e.g., frameshift mutations resulting from nuclease-mediated DSBs or indels resulting from editing the gene of interest) may not be as well tolerated as mutations in other regions of the gene, and thus the location of the DSB is an important factor in the amount or type of protein knockdown that may result. In some embodiments, a gRNA that is complementary to or has complementarity to a target sequence within the gene of interest is used to direct a Cas nuclease to a specific location in the gene of interest.
[0136] 2. gRNA Modification In some embodiments, the gRNA is chemically modified. A gRNA that includes one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or a "chemically modified" gRNA to denote the presence of one or more non-naturally occurring and / or naturally occurring components or structures that are used in place of, or in addition to, the canonical A, G, C, and U residues. In some embodiments, a modified gRNA is synthesized that includes non-canonical nucleosides or nucleotides and is referred to herein as "modified."
[0137] Modified guide RNAs may include nucleosides or nucleoside analogs with nitrogen-containing heterocyclic bases or base analogs linked together along the backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof. The guide RNA "backbone" may be composed of a variety of linkages, including one or more of sugar-phosphodiester linkages, phosphorothioate linkages, or combinations thereof. The sugar portion of the guide RNA may be ribose, deoxyribose, or similar compounds with substitutions such as 2' methoxy. The nitrogen-containing bases may be conventional bases (A, G, C, T, U), their analogs (e.g., modified uridines, such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine); inosine; derivatives of purines or pyrimidines (e.g., N 4 -methyldeoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituents at the 5- or 6-position (e.g., 5-methylcytosine), purine bases with substituents at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4 -alkyl-pyrimidines; U.S. Pat. No. 5,378,825 and PCT WO 93 / 13121). For a general description of chemical modifications of guide RNAs, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11 th ed., 1992). Guide RNAs may contain only conventional RNA or DNA sugars, bases, and linkages, or may contain both conventional components and substitutions (e.g., conventional bases with 2' methoxy linkages, or polymers containing both conventional bases and one or more base analogs). RNA and DNA have different sugar moieties and can differ by the presence of uracil or its analogs in RNA and thymine or its analogs in DNA.
[0138] Unmodified nucleic acid may be susceptible to degradation, for example, by intracellular nucleases or nucleases found in serum.For example, nucleases can hydrolyze the phosphodiester bond of nucleic acid.Therefore, in one aspect, gRNA described herein can contain one or more modified nucleosides or nucleotides to introduce stability against, for example, intracellular or serum nucleases.
[0139] Phosphorothioate (PS) linkage or bond refers to a phosphodiester bond, such as a bond between nucleotide bases, in which a sulfur replaces one non-bridging phosphate oxygen. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides are sometimes called S-oligos.
[0140] To indicate PS modification, use * " may be used. * , C * , U * , or G * The term may be used to refer to a nucleotide that is linked to the next (eg, 3') nucleotide by a PS bond.
[0141] In this application, "mA * ", "mC * ", "mU * " or "mG * " may be used to refer to a nucleotide that is substituted with 2'-O-Me and linked to the next (eg, 3') nucleotide with a PS bond.
[0142] The diagram below shows the substitution of S- for the non-bridging phosphate oxygen to create a PS bond instead of a phosphodiester bond: [ka]
[0143] In some embodiments, one or more of the first three, four, or five nucleotides at the 5' end and one or more of the last three, four, or five nucleotides at the 3' end are modified, in some embodiments, the modifications are 2'-O-Me, 2'-F, inverted abasic nucleotides, PS linkages, or other nucleotide modifications well known in the art to enhance stability and / or performance.
[0144] In some embodiments, the first four nucleotides at the 5' end and the last four nucleotides at the 3' end are linked by phosphorothioate (PS) bonds.
[0145] In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise, for example, 2'-O-methyl (2'-O-Me) modified nucleotides.
[0146] In some embodiments, the guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification pattern shown in SEQ ID NO: 19, where N is any natural or non-natural nucleotide, and the entirety of N constitutes a guide sequence that directs a nuclease to a target sequence.
[0147] In some embodiments, the guide RNA comprises an sgRNA comprising any one of the guide sequences in Table 2 of WO0201906787, the contents of which are incorporated herein in their entirety. In some embodiments, the guide RNA comprises an sgRNA comprising any one of the guide sequences in Table 1 of WO02019067872, the contents of which are incorporated herein in their entirety, and the nucleotides of SEQ ID NO: 32, where the nucleotides of SEQ ID NO: 32 are at the 3' end of the guide sequence, and the guide sequence may be modified as depicted in SEQ ID NO: 19.
[0148] 3. RNA containing an open reading frame encoding a Cas nuclease Any RNA comprising an ORF encoding a Cas nuclease, such as a Cas9 nuclease, such as S. pyogenes Cas9, as disclosed herein, can be combined with any of the gRNAs disclosed herein in a composition or method. In any of the embodiments described herein, the nucleic acid comprising an open reading frame encoding a Cas nuclease can be an mRNA.
[0149] Codons that increase translation and / or codons that correspond to highly expressed tRNAs; exemplary codon sets In some embodiments, the nucleic acid comprises an ORF with codons that increase translation in a mammal, such as a human. In further embodiments, the nucleic acid comprises an ORF with codons that increase translation in an organ, such as the human liver. In further embodiments, the nucleic acid comprises an ORF with codons that increase translation in a cell type, such as a human hepatocyte. The increase in translation in hepatocytes, liver, or humans, etc., can be determined relative to the degree of translation of a wild-type sequence of the ORF, or relative to an ORF with a codon distribution that matches the codon distribution of another prokaryotic organism in the case of a prokaryotic Cas nuclease, such as the organism from which the ORF was derived or the organism containing the most similar ORF at the amino acid level, e.g., Cas nucleases from S. pyogenes, S. aureus, or other prokaryotes described below. Alternatively, in some embodiments, the increase in translation of the Cas9 sequence in a mammal, cell type, mammalian organ, human, human organ, etc. is determined relative to the translation of an ORF with the sequence of SEQ ID NO: 36, all other conditions being equal, including any applicable point mutations, heterologous domains, etc. Codons useful for increasing expression in humans, including human liver and human hepatocytes, may be codons that correspond to tRNAs that are highly expressed in human liver / hepatocytes, as described in Dittmar KA, PLos Genetics 2(12): e221 (2006). In some embodiments, at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons that correspond to tRNAs that are highly expressed in a mammal, such as a human (e.g., the most highly expressed tRNA for each amino acid). In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons that correspond to tRNAs that are highly expressed in a mammalian organ, such as a human organ (e.g., the most highly expressed tRNA for each amino acid).In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons that correspond to tRNAs that are highly expressed in mammalian liver, such as human liver (e.g., the most highly expressed tRNA for each amino acid). In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons that correspond to tRNAs that are highly expressed in mammalian liver cells, such as human hepatocytes (e.g., the most highly expressed tRNA for each amino acid).
[0150] Alternatively, codons corresponding to tRNAs that are highly expressed throughout organisms (eg, humans) may be used.
[0151] In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are from a codon set shown in Table 3 (e.g., a low U, low A, or low A / U codon set). The codons in the low A and low A / U sets use codons that minimize the nucleotides shown, and also use codons that correspond to highly expressed tRNAs if more than one option is available. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are from a low U codon set shown in Table 3. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are from the low A codon set shown in Table 3. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are from the low A / U codon set shown in Table 3. [Table 1]
[0152] Exemplary Sequences In some embodiments, the ORF encoding the Cas nuclease comprises a sequence having at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to any of SEQ ID NOs: 1-12 and 36.
[0153] In some embodiments, the mRNA comprises an ORF encoding a Cas nuclease, the Cas nuclease comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to any of SEQ ID NOs: 13-14.
[0154] In some embodiments, the ORF encoding the Cas nuclease comprises a sequence that is codon-optimized according to any of SEQ ID NOs:1-12 and 36 to a sequence shown in Table 3, or a sequence that has at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to any of SEQ ID NOs:1-12 and 36.
[0155] As used herein, a first sequence is considered to "contain a sequence having at least X% identity to" a second sequence if alignment of the first sequence to the second sequence shows that X% or more of the positions of the second sequence match the first sequence overall. Exemplary alignment algorithms include the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will know which algorithm and parameter settings are appropriate for aligning a given pair of sequences. For sequences of roughly similar length and predicted identity of >50% for amino acids or >75% for nucleotides, the Needleman-Wunsch algorithm using default settings of the Needleman-Wunsch algorithm interface provided by EBI on its web server at www.ebi.ac.uk is generally appropriate.
[0156] Additional characteristics of RNA, mRNA, and ORF Any of the additional features described herein may be combined, as long as they are feasible in any of the above-mentioned embodiments.
[0157] Encoded Cas nuclease In some embodiments, the Cas nuclease is a class 2 Cas nuclease. In some embodiments, the Cas nuclease has cleavage activity, which may also be referred to as double-stranded endonuclease activity or nickase activity. In some embodiments, the Cas nuclease is a class 2 Cas nuclease (which may be, for example, a type II, type V, or type VI Cas nuclease). Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, and C2c3 proteins, and modifications thereof. Examples of Cas9 nucleases include those of the type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotes (see, for example, the list in the next paragraph), as well as modified (e.g., engineered or mutant) versions thereof. See, for example, US2016 / 0312198A1, US2016 / 0312199A1. Other examples of Cas nucleases include the Csm or Cmr complexes of type III CRISPR systems, or the Cas10, Csm1, or Cmr2 subunits thereof, and the Cascade complexes of type I CRISPR systems, or the Cas3 subunits thereof. In some embodiments, the Cas nucleases can be from type IIA, type IIB, or type IIC systems. For descriptions of various CRISPR systems and Cas nucleases, see, for example, Makarova et al., Nat. Rev. Microbiol. 9:467-477 (2011); Makarova et al., Nat. Rev. Microbiol, 13: 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015). In some embodiments, the Cas nuclease is a Cas cleavase, such as a Cas9 cleavase. In some embodiments, the Cas nuclease is a Cas nickase, such as a Cas9 nickase. In some embodiments, the Cas nuclease is a S. pyogenes Cas9 nuclease, such as a cleavase.
[0158] Cas9 is the case of the Cas The specific strains and strains are Streptococcus pyogenes meningitidis、Campylobacter jejuni、Pasteurella multocida、Fibrobacter succinogene、Rhodospirillum rubrum、Nocardiopsis dassonvillei、Streptomyces pristinaespiralis、Streptomyces viridochromogenes、Streptomyces viridochromogenes Streptosporangium roseum Streptosporangium roseum Alicyclobacillus acidocaldarius Bacillus pseudomycoides Bacillus selenitireducens Exiguobacterium sibiricum Lactobacillus delbrueckii Lactobacillus salivarius、Lactobacillus buchneri、Treponema denticola、Microscilla marina、Burkholderiales bacterium、Polaromonas naphthalenivorans、Polaromonas sp.、Crocosphaera watsonii、Cyanothece sp.、Microcystis aeruginosa、Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohlobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp.、Lachnospiraceae bacterium ND2006、、、Acaryochloris marina is included。.
[0159] In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nuclease is a Cas9 nuclease from Neisseria meningitidis. In some embodiments, the Cas nuclease is a Cas9 nuclease from Staphylococcus aureus. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In certain embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus or Lachnospiraceae.
[0160] Wild-type Cas9 has two nuclease domains, RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 nuclease comprises two or more RuvC domains and / or two or more HNH domains. In some embodiments, the Cas9 nuclease is wild-type Cas9. In some embodiments, the Cas9 nuclease can induce a double-stranded break in the target DNA.
[0161] In some embodiments, chimeric Cas nucleases are used in which one domain or region of a protein is replaced with a portion of a different protein. In some embodiments, the Cas nuclease domain may be replaced with a domain from a different nuclease, such as Fok1. In some embodiments, the Cas nuclease may be a modified nuclease.
[0162] In other embodiments, the Cas protein may be from a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of a cascade complex of a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas nuclease may be from a type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleavage activity.
[0163] Poly A tail In some embodiments, the RNA (e.g., mRNA) further comprises a polyadenylation (polyA) tail. In some cases, the polyA tail, when encoded by a plasmid, is "interrupted" with one or more non-adenine nucleotide "anchors" at one or more positions within the polyA tail. The polyA tail may comprise at least eight consecutive adenine nucleotides, and in some embodiments, the polyA tail also comprises one or more non-adenine nucleotides. As used herein, "non-adenine nucleotides" refers to any natural or non-natural nucleotide that does not contain adenine. Guanine, thymine, and cytosine nucleotides are exemplary non-adenine nucleotides. Thus, the polyA tail of the polynucleotides (e.g., mRNA) described herein may comprise consecutive adenine nucleotides located 3' to the nucleotides encoding the Cas nuclease or sequence of interest. In some cases, the polyA tail of the mRNA comprises non-contiguous adenine nucleotides located 3' to the nucleotides encoding the Cas nuclease or sequence of interest, where the non-adenine nucleotides interrupt the adenine nucleotides at regular or irregular intervals.
[0164] In some embodiments, the polyA tail is encoded by the plasmid used for in vitro transcription of the mRNA and becomes part of the transcription product. The polyA sequence encoded by the plasmid, i.e., the number of consecutive adenine nucleotides in the polyA sequence, may not be precise, e.g., 100 polyA sequences in the plasmid may result in up to 100 polyA sequences in the transcribed mRNA. In some embodiments, the polyA tail is not encoded by the plasmid and is added by PCR tailing or enzymatic tailing, e.g., using E. coli poly(A) polymerase.
[0165] UTR; Kozak sequence In some embodiments, the RNA (e.g., mRNA) encoding the Cas nuclease comprises a 5'UTR, a 3'UTR, or a 5'UTR and a 3'UTR. In some embodiments, the RNA (e.g., mRNA) comprises at least one UTR from hydroxysteroid 17-beta dehydrogenase 4 (HSD17B4 or HSD), e.g., a 5'UTR from an HSD. In some embodiments, the RNA (e.g., mRNA) comprises at least one UTR from a globin mRNA, e.g., human alpha globin (HBA) mRNA, human beta globin (HBB) mRNA, or Xenopus laevis beta globin (XBG) mRNA. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5'UTR, a 3'UTR, or a 5'UTR and a 3'UTR from a globin mRNA, such as HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5'UTR from bovine growth hormone, cytomegalovirus (CMV), mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 3'UTR from bovine growth hormone, cytomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5'UTR and a 3'UTR from bovine growth hormone, cytomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, XBG, heat shock protein 90 (Hsp90), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta-actin, alpha-tubulin, tumor protein (p53), or epidermal growth factor receptor (EGFR).
[0166] In some embodiments, the polynucleotide (e.g., mRNA) comprises the 5'UTR and 3'UTR from the same source, e.g., a constitutively expressed mRNA, such as actin, albumin, or a globin, such as HBA, HBB, or XBG.
[0167] In some embodiments, the polynucleotide (e.g., mRNA) comprises a Kozak sequence. Kozak sequences are known in the art. Kozak sequences can affect translation initiation and the overall yield of a polypeptide translated from a nucleic acid. Kozak sequences include a methionine codon that can function as a start codon. A minimal Kozak sequence is NNNRUGN, where at least one of the following is true: the first N is A or G, and the second N is G. In the context of a nucleotide sequence, R refers to a purine (A or G). In some embodiments, the Kozak sequence is gccgccRccAUGG (SEQ ID NO: 37), with zero mismatches or up to one, two, three, or four mismatches relative to the lowercase positions.
[0168] Modified Nucleotides In some embodiments, an mRNA comprising an ORF encoding a Cas nuclease comprises modified uridines at some or all uridine positions. In some embodiments, the modified uridine is a uridine modified at the 5-position, e.g., with a halogen or a C1-C3 alkoxy. In some embodiments, the modified uridine is a pseudouridine modified at the 1-position, e.g., with a C1-C3 alkyl. The modified uridine can be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine.
[0169] In some embodiments, at least 90%, 95%, 98%, 99%, or 100% of the uridine positions in the nucleic acid are modified uridines. In some embodiments, 85-95%, or 90-100% of the uridine positions in the nucleic acid are modified uridines, e.g., N1-methylpseudouridine, pseudouridine, or combinations thereof. In some embodiments, 85-95%, or 90-100% of the uridine positions in the nucleic acid are pseudouridine. In some embodiments, 85-95%, or 90-100% of the uridine positions in the nucleic acid are N1-methylpseudouridine.
[0170] 5' Cap In some embodiments, an mRNA comprising an ORF encoding a Cas nuclease (e.g., Cas9) comprises a 5' cap, e.g., Cap0, Cap1, or Cap2. A 5' cap is generally a 7-methylguanine ribonucleotide linked to the first nucleotide of the 5' to 3' strand of a nucleic acid, i.e., the 5' position of the first cap-proximal nucleotide, via a 5'-triphosphate (which may be further modified, e.g., for ARCA, as described below). In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2'-hydroxyl. In Cap1, the riboses of the first and second transcribed nucleotides of the mRNA both comprise a 2'-methoxy and a 2'-hydroxyl, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2'-methoxy. See, e.g., Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30; Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115.
[0171] A cap can be included in RNA by co-transcription. For example, ARCA (anti-reverse cap analog; Thermo Fisher Scientific model no. AM8045) is a cap analog containing 7-methylguanine 3'-methoxy-5'-triphosphate linked to the 5' position of a guanine ribonucleotide that can be incorporated in vitro into transcripts at initiation. ARCA results in a Cap0 cap in which the 2' position of the first cap-proximal nucleotide is a hydroxyl. See, e.g., Stepinski et al., (2001) "Synthesis and properties of mRNAs containing the novel 'anti-reverse' cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG," RNA 7: 1486-1495. The ARCA structure is shown below. [ka]
[0172] The Cap1 structure can be obtained by co-transcription using CleanCap™ AG (m7G(5')ppp(5')(2'OMeA)pG; TriLink Biotechnologies product number N-7113) or CleanCap™ GG (m7G(5')ppp(5')(2'OMeG)pG; TriLink Biotechnologies product number N-7133). 3'-O-methylated versions of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies as product numbers N-7413 and N-7433, respectively. The structure of CleanCap™ AG is shown below. CleanCap™ structures are sometimes referred to herein using the last three digits of the product numbers above (e.g., "CleanCap™ 113" for TriLink Biotechnologies product number N-7113). [ka]
[0173] Alternatively, a cap can be added to RNA post-transcriptionally. For example, vaccinia capping enzyme is commercially available (New England Biolabs model number M2080S), which has RNA triphosphatase and guanylyltransferase activities provided by its D1 subunit, and guanine methyltransferase provided by its D12 subunit. Thus, in the presence of S-adenosylmethionine and GTP, it can add 7-methylguanine to RNA to give Cap0. See, for example, Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci.USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479. For additional description of caps and capping techniques, see, e.g., WO2017 / 053297 and Ishikawa et al., Nucl. Acids. Symp. Ser. (2009) No. 53, 129-130.
[0174] 4. Delivery of Nucleic Acid Compositions In some embodiments, a method is provided for inducing a double strand break (DSB) or gene editing in a gene of interest (e.g., TTR) comprising administering a composition comprising a guide RNA as described herein. In some embodiments, one or more of the guide sequences are administered to induce a DSB in the gene of interest. The guide RNA is administered together with an RNA (e.g., mRNA) encoding a Cas nuclease (e.g., Cas9). The Cas nuclease can be S.pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA encoding the Cas nuclease are administered in a LNP as described herein, for example, an LNP comprising lipid A. In further embodiments, the LNP comprises a lipid component comprising lipid A, a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).
[0175] In some embodiments, a method is provided for inducing a double strand break (DSB) in a gene of interest (e.g., TTR) comprising administering an LNP composition comprising a guide RNA, such as a chemically modified guide RNA. In some embodiments, one or more sgRNAs are administered to induce a DSB in the gene of interest. The guide RNA is administered together with an RNA described herein that encodes a Cas nuclease (e.g., Cas9). The Cas nuclease can be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA encoding the Cas nuclease are administered in an LNP described herein, for example, an LNP comprising lipid A, a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).
[0176] In some embodiments, a method of modifying a gene of interest (e.g., TTR) is provided that includes administering a composition comprising a guide RNA, such as a chemically modified guide RNA. In some embodiments, one or more sgRNAs are administered to modify the gene of interest. The guide RNA is administered together with an RNA described herein that encodes a Cas nuclease (e.g., Cas9). The Cas nuclease can be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA encoding the Cas nuclease are administered in a LNP described herein, for example, an LNP comprising lipid A, a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).
[0177] In some embodiments, a method of treating a disease (e.g., ATTR) is provided that includes administering a composition comprising one or more of the guide RNAs. The guide RNA is administered together with an RNA described herein that encodes a Cas nuclease, such as Cas9. The Cas nuclease can be S.pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the nucleic acid encoding the Cas nuclease are administered in a LNP described herein, for example, an LNP comprising lipid A, a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).
[0178] In some embodiments, a method of reducing a gene product (e.g., TTR) is provided that includes administering one or more guide RNAs. In some embodiments, a gRNA is administered that includes one or more of the guide sequences to reduce or prevent accumulation of the gene product. The gRNA is administered together with a nucleic acid encoding a Cas nuclease, such as Cas9. The Cas nuclease can be S.pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA encoding the Cas nuclease are administered in a LNP as described herein, for example, an LNP that includes lipid A, a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).
[0179] In some embodiments, a method of reducing the concentration of a gene product is provided, comprising administering one or more guide RNAs as described herein. In some embodiments, a gRNA comprising one or more of the guide sequences is administered to reduce or prevent the accumulation of the gene product. The gRNA is administered together with a nucleic acid encoding a Cas nuclease, such as Cas9. The Cas nuclease can be S.pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA encoding the Cas nuclease are administered in a LNP as described herein, e.g., LNP comprising lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).
[0180] In some embodiments, a method of reducing or preventing the accumulation of a gene product in a subject is provided, comprising one or more guide RNAs as described herein. In some embodiments, a method of reducing or preventing the accumulation of a gene product in a subject is provided, comprising administering a composition comprising one or more of the sgRNAs. In some embodiments, a gRNA comprising one or more guide sequences is administered to reduce or prevent the accumulation of TTR in amyloid or amyloid fibrils. The gRNA is administered together with an RNA encoding a Cas nuclease, such as Cas9. The Cas nuclease can be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the nucleic acid encoding the Cas nuclease are administered in a LNP as described herein, e.g., LNP comprising lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).
[0181] In some embodiments, a gRNA containing a guide sequence together with a Cas nuclease translated from a nucleic acid induces a DSB, and non-homologous end joining (NHEJ) during repair results in a mutation in the TTR gene. In some embodiments, NHEJ results in the deletion or insertion of a nucleotide(s), thereby inducing a frameshift or nonsense mutation in the TTR gene.
[0182] 5. Lipid composition In some embodiments, the nucleic acid compositions described herein, including gRNA and nucleic acids encoding Cas nucleases, such as Cas9, described herein, are formulated as or administered by lipid nanoparticles. See, for example, WO2017173054A1, entitled "LIPID NANOPARTICLE FORMULATIONS FOR CRISPR / CAS COMPONENTS," and WO2019067992A1, entitled "FORMULATIONS." The contents of these documents, particularly the LNP compositions disclosed therein, are incorporated herein by reference in their entirety. Lipid nanoparticles (LNPs) known to those skilled in the art to be capable of delivering therapeutic RNA to a subject may be utilized with the nucleic acids encoding guide RNAs and Cas nucleases described herein.
[0183] A composition comprising an LNP can comprise two active agents, i.e., a guide RNA and an RNA encoding a Cas nuclease, together with a lipid component comprising an ionizable lipid. A lipid nanoparticle refers to a particle comprising a plurality (i.e., two or more) lipid molecules physically associated with each other by intermolecular forces.
[0184] Ionizable lipids A lipid composition for delivering CRISPR / Cas mRNA and guide RNA components to liver cells can include lipid A, which is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also referred to as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate. Lipid A is [ka] It can be expressed as:
[0185] Lipid A can be synthesized according to WO2015 / 095340 (e.g., pp. 84-86).
[0186] Additional lipids Suitable "neutral lipids" for use in the lipid compositions of the present disclosure include, for example, a variety of neutral lipids, uncharged lipids, or zwitterionic lipids. Examples of neutral phospholipids suitable for use in the present disclosure include 5-heptadecylbenzene-1,3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), phosphocholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoylphosphatidylcholine (MPPC), 1-palmitoyl-2-myristoylphosphatidylcholine (PMPC), 1-palmitoyl-2-stearoylphosphatidylcholine (PMP ... phosphatidylcholine (PSPC), 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2-palmitoylphosphatidylcholine (SPPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoylphosphatidylcholine (POPC), lysophosphatidylcholine, dioleoylphosphatidylethanolamine (DOPE), dilinoleoylphosphatidylcholine distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), palmitoyloleoylphosphatidylethanolamine (POPE), lysophosphatidylethanolamine, and combinations thereof. In one embodiment, the neutral phospholipid may be selected from the group consisting of distearoylphosphatidylcholine (DSPC) and dimyristoylphosphatidylethanolamine (DMPE). In another embodiment, the neutral phospholipid may be distearoylphosphatidylcholine (DSPC).
[0187] "Helper lipids" include steroids, sterols, and alkylresorcinols. Helper lipids suitable for use in the present disclosure include, but are not limited to, cholesterol, 5-heptadecylresorcinol, and cholesterol hemisuccinate. In one embodiment, the helper lipid may be cholesterol.
[0188] A "stealth lipid" is a lipid that alters the length of time that a nanoparticle can reside in vivo (e.g., in blood), and the stealth lipid can be a PEG lipid. The stealth lipid can aid in the formulation process, for example, by reducing particle aggregation and controlling particle size. The stealth lipid used herein can modulate the pharmacokinetic properties of the LNP. Stealth lipids suitable for use in the lipid compositions of the present disclosure include PEG lipids that include a lipid portion and a polymer portion based on PEG, although this is not typical. PEG lipids known in the art are contemplated, including lipids that include "PEG-2K," also known as "PEG 2000," having an average molecular weight of about 2,000 daltons. PEG-2K is represented herein by the following formula (I), where n is 45, meaning that it includes subunits with a number average degree of polymerization of about 45. However, other PEG embodiments known in the art may be used. [ka]
[0189] In any of the embodiments described herein, the PEG lipid may be PEG-dilaurylglycerol, PEG-dimyristoylglycerol (PEG-DMG) (model number GM-020, manufactured by NOF, Tokyo, Japan), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE) (model number DSPE-020CN, manufactured by NOF, Tokyo, Japan), PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, and PEG-distearoylglycamide, PEG-cholesterol (1-[8'-(cholest-5-ene-3[beta]-oxy)carboxamido-3',6'-dioxaoctanyl)-1-(1-methylethyl)-1-(2-methylethyl)-1-(1 ... 1,2-Dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DMPE), or 1,2-Dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG2k-DMG), 1,2-Distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSPE) (product number 880120C, Avanti Polar Lipids (Alabaster, Alabama, USA), 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG2k-DSG; GS-020, NOF Tokyo, Japan), poly(ethylene glycol)-2000-dimethacrylate (PEG2k-DMA), and 1,2-distearyloxypropyl-3-amine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSA). In one embodiment, the PEG lipid may be PEG2k-DMG.
[0190] In some embodiments, the PEG lipid comprises a glycerol group. In some embodiments, the PEG lipid comprises a dimyristoyl glycerol (DMG) group. In some embodiments, the PEG lipid comprises PEG2k. In some embodiments, the PEG lipid is PEG-DMG. In some embodiments, the PEG lipid is PEG2k-DMG. In some embodiments, the PEG lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000. In some embodiments, the PEG2k-DMG is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000.
[0191] LNP formulation The LNP composition may include a lipid component and an RNA component including a Cas nuclease mRNA (e.g., a class 2 Cas nuclease mRNA, such as Cas9 mRNA) and a gRNA. In some embodiments, the LNP composition includes as the RNA component an mRNA encoding a class 2 Cas nuclease and a gRNA. In certain embodiments, the LNP composition may include an RNA component, lipid A, a helper lipid, a neutral lipid, and a stealth lipid. In certain LNP compositions, the helper lipid is cholesterol. In certain compositions, the neutral lipid is DSPC. In additional embodiments, the stealth lipid is PEG2k-DMG.
[0192] In certain embodiments, the lipid composition is expressed according to the respective molar ratios of the component lipids in the formulation. The embodiments of the present disclosure provide lipid compositions expressed according to the respective molar ratios of the component lipids in the formulation. In one embodiment, the molar % of the ionizable lipid, such as lipid A, can be about 40 mol% to 60 mol%, and in some cases about 50 mol%. In one embodiment, the molar % of the ionizable lipid can be about 55 mol%. In some embodiments, the ionizable lipid molar % of the LNP batch will be ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target molar %. In some embodiments, the ionizable lipid molar % of the LNP batch will be ±4 mol%, ±3 mol%, ±2 mol%, ±1.5 mol%, ±1 mol%, ±0.5 mol%, or ±0.25 mol% of the target molar %. All molar % figures are given as a percentage of the lipid components in the LNP composition.
[0193] In one embodiment, the mol % of neutral lipids, such as neutral phospholipids, can be about 5 mol % to 15 mol %, and in some cases about 9 mol %. In some embodiments, the neutral lipid mol % of the LNP batch will be ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target neutral lipid mol %.
[0194] In one embodiment, the mole % of the helper lipid can be about 20 mole % to 60 mole %. In one embodiment, the mole % of the helper lipid can be about 25 mole % to 55 mole %, and in some cases, the mole % of the helper lipid can be about 30 mole % to 40 mole %. In one embodiment, the mole % of the helper lipid is adjusted based on the concentration of the ionizable lipid, neutral lipid, and PEG lipid to bring the lipid component to 100 mole %. In one embodiment, the mole % of the helper lipid is adjusted based on the concentration of the ionizable lipid and PEG lipid to bring the lipid component to at least 99 mole %. In some embodiments, the helper mole % of the LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target mole %.
[0195] In one embodiment, the PEG lipid mole % can be about 1 mol % to 10 mol %. In one embodiment, the PEG lipid mole % can be about 2 mol % to 4 mol %. In one embodiment, the PEG lipid mole % can be about 2.5 mol % to 4 mol %. In one embodiment, the PEG lipid mole % can be about 3 mol %. In some embodiments, the PEG lipid mole % of the LNP batch will be ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target PEG lipid mole %.
[0196] In certain embodiments, the cargo comprises a nucleic acid (e.g., mRNA) encoding a Cas nuclease (e.g., a Cas nuclease, a class 2 Cas nuclease, or Cas9) and a gRNA. In one embodiment, the ionizable lipid is lipid A. In various embodiments, the LNP composition comprises an ionizable lipid (e.g., lipid A), a neutral lipid, a helper lipid, and a PEG lipid. In certain embodiments, the helper lipid is cholesterol. In certain embodiments, the neutral lipid is DSPC. In certain embodiments, the PEG lipid is PEG2k-DMG. In some embodiments, the LNP composition may comprise lipid A, a helper lipid, a neutral lipid, and a PEG lipid. In additional embodiments, the LNP composition comprises lipid A, cholesterol, DSPC, and PEG2k-DMG.
[0197] The embodiments of the present disclosure also provide lipid compositions expressed according to the molar ratio between the positively charged ionizable groups (N) of the ionizable lipids and the negatively charged phosphate groups (P) of the encapsulated nucleic acid. This may be mathematically expressed by the ratio of N / P. In some embodiments, the LNP composition may include a lipid component including ionizable lipids, helper lipids, neutral lipids, and PEG lipids, and a nucleic acid component, with an N / P ratio of about 3-10. In one embodiment, the N / P ratio may be about 5-7, and in some cases, the N / P ratio may be about 6. In one embodiment, the N / P ratio may be 6±1. In one embodiment, the N / P ratio may be 6±0.5. In some embodiments, the N / P ratio is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target N / P ratio.
[0198] In some embodiments, the RNA component can include an RNA, such as a nucleic acid disclosed herein, encoding a Cas nuclease described herein (e.g., a Cas9 mRNA described herein), and a gRNA described herein. In some embodiments, the RNA component includes a Cas nuclease mRNA described herein and a gRNA described herein. In some embodiments, the RNA component includes a Class 2 Cas nuclease mRNA described herein and a gRNA described herein. In any of the foregoing embodiments, the gRNA can be an sgRNA described herein, such as a chemically modified sgRNA described herein.
[0199] In certain embodiments, the LNP composition comprises a Cas nuclease mRNA (e.g., class 2 Cas mRNA) as described herein and at least one gRNA as described herein. In certain embodiments, the LNP composition comprises a gRNA and a Cas nuclease mRNA, such as a class 2 Cas nuclease mRNA, in a ratio of about 10:1 to 1:10. In some embodiments, the ratio of gRNA and a Cas nuclease mRNA, such as a class 2 Cas nuclease, is about 1:1. In some embodiments, the ratio of gRNA and a Cas nuclease mRNA, such as a class 2 Cas nuclease, is about 1:2. In some embodiments, the ratio of gRNA and a Cas nuclease mRNA, such as a class 2 Cas nuclease, is about 1:3.
[0200] In some embodiments, LNP is formed by mixing an aqueous RNA solution with an organic solvent-based lipid solution, such as 100% ethanol. Suitable solutions or solvents can include or contain water, PBS, Tris buffer, NaCl, citrate buffer, ethanol, chloroform, diethyl ether, cyclohexane, tetrahydrofuran, methanol, isopropanol. For example, a pharma- ceutically acceptable buffer for in vivo administration of LNP can be used.
[0201] In some embodiments, microfluidic mixing, T-mixing, or cross-mixing is used. In certain aspects, the flow rate, junction size, junction geometry, junction shape, tube diameter, solution, and / or RNA and lipid concentration can be varied. The LNP or LNP composition can be concentrated or purified, for example, by dialysis, tangential flow filtration, or chromatography. The LNP can be composed of four lipids, including lipid A, DSPC, cholesterol, and DMG-PEG2k. In some embodiments, the LNP is formulated suspended in an aqueous buffer of 50 mM Tris, 45 mM NaCl, and 5% (w / v) sucrose, pH 7.4.
[0202] Dynamic light scattering ("DLS") can be used to characterize the polydispersity index (pdi) and size of the LNPs of the present disclosure. DLS measures the scattering of light resulting from exposing a sample to a light source. The PDI determined from a DLS measurement represents the particle size (approximate average particle size) distribution in a population; a completely homogenous population would have a PDI of zero.
[0203] In some embodiments, the LNPs disclosed herein have a size of 50-100 nm. In some embodiments, the LNPs have a size of 85-90 nm. Unless otherwise stated, all sizes referred to herein are the average size (diameter) of fully formed nanoparticles as measured by dynamic light scattering on a Malvern Zetasizer. Nanoparticle samples are diluted in phosphate buffered saline (PBS) to give a count rate of approximately 200-400 kcts. Data are presented as a weighted average of intensity measures.
[0204] In some embodiments, the gRNAs disclosed herein and LNPs associated with RNAs (e.g., mRNAs) encoding the Cas nucleases (e.g., Cas9, Spy Cas9) disclosed herein are for use in preparing a medicament for treating ATTR. In some embodiments, the gRNAs disclosed herein and LNPs associated with RNAs (e.g., mRNAs) encoding the Cas nucleases (e.g., Cas9, Spy Cas9) disclosed herein are for use in preparing a medicament for reducing or preventing TTR accumulation and aggregation in amyloid or amyloid fibrils in a subject with ATTR. In some embodiments, the gRNAs disclosed herein and LNPs associated with RNAs (e.g., mRNAs) encoding the Cas nucleases (e.g., Cas9, Spy Cas9) disclosed herein are for use in preparing a medicament for reducing serum TTR concentrations. In some embodiments, the gRNAs disclosed herein and LNPs associated with RNAs (e.g., mRNAs) encoding the Cas nucleases (e.g., Cas9, Spy Cas9) disclosed herein are for use in preparing a medicament for reducing serum prealbumin concentrations. In some embodiments, the gRNAs disclosed herein and LNPs associated with RNAs (e.g., mRNAs) encoding the Cas nucleases (e.g., Cas9, Spy Cas9) disclosed herein are for use in treating ATTR in a subject, such as a mammal, e.g., a primate, e.g., a human. In some embodiments, the gRNAs disclosed herein and LNPs associated with RNAs (e.g., mRNAs) encoding the Cas nucleases (e.g., Cas9, Spy Cas9) disclosed herein are for use in reducing or preventing accumulation and aggregation of TTR in amyloid or amyloid fibrils in a subject, e.g., a mammal, e.g., a primate, e.g., a human, having ATTR.In some embodiments, the gRNAs disclosed herein and LNPs associated with RNA (e.g., mRNA) encoding the Cas nucleases (e.g., Cas9, Spy Cas9) disclosed herein are for use in reducing serum TTR concentrations in a subject, such as a mammal, e.g., a primate, such as a human. In some embodiments, the gRNAs disclosed herein and LNPs associated with RNA (e.g., mRNA) encoding the Cas nucleases (e.g., Cas9, Spy Cas9) disclosed herein are for use in reducing serum prealbumin concentrations in a subject, such as a mammal, e.g., a primate, such as a human.
[0205] In some cases, the lipid components include 48-53 mol% lipid A; about 8-10 mol% DSPC; and 1.5-10 mol% PEG lipid (PEG2k-DMG), with the remaining lipid components being cholesterol, and the N / P ratio of the LNP composition is 3-8±0.2.
[0206] In some embodiments, the LNP comprises a lipid component, the lipid component comprises, consists essentially of, or consists of about 50 mol% of an ionizable lipid, e.g., lipid A; about 9 mol% of a neutral lipid, e.g., DSPC; about 3 mol% of a stealth lipid, e.g., a PEG lipid, e.g., PEG2k-DMG; and the remaining lipid component is a helper lipid, e.g., cholesterol, and the N / P ratio of the LNP composition is about 6. In some embodiments, the ionizable lipid is lipid A. In some embodiments, the neutral lipid is DSPC. In some embodiments, the stealth lipid is a PEG lipid. In some embodiments, the stealth lipid is PEG2k-DMG. In some embodiments, the helper lipid is cholesterol. In some embodiments, the LNP comprises a lipid component, the lipid component comprises about 50 mol% of lipid A; about 9 mol% of DSPC; about 3 mol% of PEG2k-DMG; and the remaining lipid component is cholesterol, and the N / P ratio of the LNP composition is about 6.
[0207] II. Methods of Systemic Delivery In some embodiments, the LNP compositions described herein (e.g., comprising an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, such as a guide RNA targeting a TTR gene) are administered systemically. As used herein, systemic administration refers to wide biodistribution in an organism, such as intravenous administration, intraperitoneal injection, etc.
[0208] In some embodiments, a single administration of the LNP composition described herein is sufficient to knock down expression of the target protein. In some embodiments, a single administration of the LNP composition is sufficient to knock down expression of the target protein in a cell population. In other embodiments, two or more administrations of the LNP composition may be beneficial to maximize editing by a cumulative effect. For example, the LNP composition can be administered two or three times ("booster doses"), e.g., a second or third dose. The dose of the second or third dose can be determined by the clinician, for example, to reduce serum TTR and / or serum prealbumin by about 60%, 70%, 80%, or 90%, or more, compared to baseline levels (e.g., levels before the first LNP administration). The two or more doses (the second dose or the third dose) may be administered on a weight basis (e.g., 0.7 mg / kg or 1.0 mg / kg) or as a fixed dose (e.g., about 60 mg, 70 mg, 80 mg, or 90 mg) regardless of how the first dose was administered (weight based or fixed dose).
[0209] In some embodiments, the LNP compositions described herein are administered by injection for an infusion time of about 2 hours to 4 hours. In some embodiments, the LNP compositions described herein are administered by injection for an infusion time of about 2 hours to 3 hours. In some embodiments, the LNP compositions described herein are administered by injection for an infusion time of about 3 hours to 4 hours. In some embodiments, the LNP compositions described herein are administered by injection for an infusion time of about 4 hours to 5 hours. In some embodiments, the LNP compositions described herein are administered by injection for an infusion time of about 4 hours. In some embodiments, the LNP compositions described herein are administered by injection for an infusion time of at least 2 hours. In some embodiments, the LNP compositions described herein are administered by injection for an infusion time of at least 3 hours. In some embodiments, the LNP compositions described herein are administered by injection for an infusion time of at least 4 hours.
[0210] III. Dose 1. Weight-Based Dosage In some embodiments, the LNP compositions described herein (e.g., including an effective amount of an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, e.g., a guide RNA targeting the TTR gene (total RNA or total RNA)) are administered using a weight-based dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 0.1 mg / kg to 2 mg / kg of combined dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 0.3 mg / kg to 1 mg / kg of combined dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 0.1 mg / kg of combined dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 0.3 mg / kg of combined dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 0.7 mg / kg combined dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 1 mg / kg combined dose. The LNP composition may be administered in an effective amount, in the sense that when the LNP composition is dosed on a total RNA basis, an effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is administered.
[0211] In other embodiments, subjects receiving a 0.1 mg / kg dose may receive two or more doses of the LNP composition to maximize editing by cumulative effect. For example, the LNP composition may be administered two, three, four, five, or more times, e.g., two times, and may be administered, e.g., a second, third, fourth, or fifth dose. In some embodiments, the LNP composition is administered to a human subject who has previously been administered the LNP composition. In some embodiments, the LNP composition is administered to a human subject who has previously been administered the LNP composition and has not achieved a greater than 60%, greater than 70%, or greater than 80% reduction in serum TTR (e.g., a less than 60%, less than 70%, or less than 80% reduction in serum TTR measured by ELISA after administration of the LNP composition), e.g., as determined 28 days after the first LNP administration. In some embodiments, the LNP composition is administered to a human subject who has previously been administered an LNP composition and has not achieved a greater than 60%, greater than 70%, or greater than 80% reduction in serum TTR (e.g., less than 60%, less than 70%, or less than 80% reduction in serum TTR as measured by mass spectrometry or ELISA after administration of the LNP composition), e.g., as determined 28 days after administration of the first LNP administration. In some embodiments, the LNP composition is administered to a human subject who has previously been administered an LNP composition and has not achieved a greater than 60%, greater than 70%, or greater than 80% reduction in serum prealbumin (e.g., less than 60%, less than 70%, or less than 80% reduction in serum prealbumin as measured by turbidity assay or the like after administration of the LNP composition), e.g., as determined 28 days after administration of the first LNP administration. In some embodiments, the LNP composition is administered to a human subject who has previously been administered an LNP composition and has not achieved a greater than 60%, greater than 70%, or greater than 80% decrease in serum prealbumin (e.g., less than a 60%, less than 70%, or less than 80% decrease in serum prealbumin after administration of the LNP composition), e.g., as determined 28 days after the first LNP administration.
[0212] 2. Fixed dose In some embodiments, the LNP compositions described herein (e.g., including an effective amount of an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, e.g., a guide RNA targeting the TTR gene (total or combined dose)) are administered using a fixed dose. The fixed dose can be about 25-150 mg in a human subject. In some embodiments, the effective amount of the mRNA encoding a Cas nuclease and the guide RNA targeting the TTR gene is about 5 mg-75 mg, optionally about 25 mg-75 mg, about 25 mg-60 mg, about 25 mg-80 mg, or about 25 mg-115 mg combined dose. In some embodiments, the effective amount of the mRNA encoding a Cas nuclease and the guide RNA targeting the TTR gene is about 50 mg-150 mg, optionally about 50 mg-100 mg or about 75 mg-150 mg combined dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 5 mg to 9 mg of total dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 15 mg to 27 mg of total dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 50 mg to 90 mg of total dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 35 mg to 65 mg of total dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 5 mg to 180 mg of total dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 50 mg to 70 mg of total dose. In some embodiments, the effective amount of mRNA encoding a Cas nuclease and a guide RNA targeting a TTR gene is a combined dose of about 60 mg to 80 mg.In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 70 mg to 90 mg combined dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 80 mg to 100 mg combined dose. The LNP composition may be administered in an effective amount, in the sense that when the LNP composition is dosed on a total RNA basis, an effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is administered.
[0213] In some embodiments, the LNP compositions described herein (e.g., including an effective amount of an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, e.g., a guide RNA targeting the TTR gene (total or combined dose)) are administered using a fixed dose. The fixed dose can be 25-150 mg in a human subject. In some embodiments, the effective amount of the mRNA encoding a Cas nuclease and the guide RNA targeting the TTR gene is a combined dose of 5 mg-75 mg, optionally 25 mg-75 mg, 25 mg-60 mg, 25 mg-80 mg, or 25 mg-115 mg. In some embodiments, the effective amount of the mRNA encoding a Cas nuclease and the guide RNA targeting the TTR gene is a combined dose of 50 mg-150 mg, optionally 50 mg-100 mg or 75 mg-150 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of 5 mg to 9 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of 15 mg to 27 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of 50 mg to 90 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of 35 mg to 65 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of 5 mg to 180 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of 50 mg to 70 mg. In some embodiments, the effective amount of mRNA encoding a Cas nuclease and a guide RNA targeting a TTR gene is a combined dose of 60 mg to 80 mg.In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a combined dose of 70 mg to 90 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a combined dose of 80 mg to 100 mg.
[0214] In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 7 mg to 9 mg combined dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 25 mg to 27 mg combined dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 44 mg to 68 mg combined dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 59 mg to 111 mg combined dose.
[0215] In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of 7 mg to 9 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of 25 mg to 27 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of 44 mg to 68 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of 59 mg to 111 mg.
[0216] In some embodiments, the effective amount of mRNA encoding a Cas nuclease and guide RNA targeting the TTR gene is a combined dose of about 25 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, or 150 mg. In some embodiments, the effective amount of mRNA encoding a Cas nuclease and a guide RNA targeting a TTR gene is 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, 50 mg, 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg, 57 mg, 58 mg, 59 mg, 60 mg, 61 mg, 62 mg, 63 mg, 64 mg, 65 mg, 66 mg, 67 mg, 68 mg, 69 mg, 70 mg, 71 mg, 72 mg, 73 mg, 74 mg, 75 mg, 76 mg, 77 mg, 78 mg, 79 mg, 80 mg, 81 mg, 82 mg, 83 mg, 84 mg, 85 mg, 86 mg, 87 mg, 88 mg, 89 mg, 90 mg, 91 mg, 92 mg, 93 mg, 94 mg, 95 mg, 96 mg, 97 mg, 98 mg, 99 mg, 100 mg, 101 mg, 102 mg, 103 mg, 104 mg, 105 mg, 106 mg, 107 mg, 108 mg, 109 mg, 110 mg, 111 mg, 112 mg, 113 mg, 114 mg, 115 mg, 116 mg, 117 mg, g, 50mg, 51mg, 52mg, 53mg, 54mg, 55mg, 56mg, 57mg, 58mg, 59mg, 60mg, 61mg, 62mg, 63mg, 64mg, 65mg, 66mg, 67mg, 6 8mg, 69mg, 70mg, 71mg, 72mg, 73mg, 74mg, 75mg, 76mg, 77mg, 78mg, 79mg, 80mg, 81mg, 82mg, 83mg, 84mg, 85mg, 86mg, 87mg, 88mg, 89mg, 90mg, 91mg, 92mg, 93mg, 94mg, 95mg, 96mg, 97mg, 98mg, 99mg, 100mg, 101mg, 102mg, 103mg, 104m g, 105mg, 106mg, 107mg, 108mg, 109mg, 110mg, 111mg, 112mg, 113mg, 114mg, 115mg, 116mg, 117mg, 118mg, 119mg, 12 The total dose is 0 mg, 121 mg, 122 mg, 123 mg, 124 mg, 125 mg, 126 mg, 127 mg, 128 mg, 129 mg, 130 mg, 131 mg, 132 mg, 133 mg, 134 mg, 135 mg, 136 mg, 137 mg, 138 mg, 139, 140 mg, 141 mg, 142 mg, 143 mg, 144 mg, 145 mg, 146 mg, 147 mg, 148 mg, or 150 mg.In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 80 mg combined dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 80 mg combined dose.
[0217] In other embodiments, subjects receiving a dose of about 5 mg to 9 mg may receive two or more doses of the LNP composition to maximize editing by a cumulative effect. For example, the LNP composition may be administered two, three, four, five, or more times, e.g., two doses, and may be administered, e.g., a second, third, fourth, or fifth dose. In some embodiments, the LNP composition is administered to a human subject who has previously been administered the LNP composition. In some embodiments, the LNP composition is administered to a human subject who has previously been administered the LNP composition and has not achieved a greater than 60%, greater than 70%, or greater than 80% reduction in serum TTR (e.g., a less than 60%, less than 70%, or less than 80% reduction in serum TTR measured by ELISA after administration of the LNP composition), e.g., as determined 28 days after the first LNP administration. In some embodiments, the LNP composition is administered to a human subject who has previously been administered an LNP composition and has not achieved a greater than 60%, greater than 70%, or greater than 80% reduction in serum TTR (e.g., less than 60%, less than 70%, or less than 80% reduction in serum TTR as measured by ELISA or mass spectrometry after administration of the LNP composition), e.g., as determined 28 days after administration of the first LNP administration. In some embodiments, the LNP composition is administered to a human subject who has previously been administered an LNP composition and has not achieved a greater than 60%, greater than 70%, or greater than 80% reduction in serum prealbumin (e.g., less than 60%, less than 70%, or less than 80% reduction in serum prealbumin as measured by turbidity assay or the like after administration of the LNP composition), e.g., as determined 28 days after administration of the first LNP administration. In some embodiments, the LNP composition is administered to a human subject who has previously been administered an LNP composition and who has not achieved a greater than 60%, greater than 70%, or greater than 80% decrease in serum prealbumin (e.g., less than a 60%, less than 70%, or less than 80% decrease in serum prealbumin after administration of the LNP composition), e.g., as determined 28 days after the first LNP administration.
[0218] In some embodiments of the invention, "about" means within ±5% of the stated value, e.g., in the range of 76 mg to 84 mg for a value that is about 80 mg. In some embodiments of the invention, "about" means within ±10% of the stated value.
[0219] IV. How to use 1. Methods for in vivo editing Provided herein is a method for in vivo editing of genes in the liver of a human subject with a single gene disorder.In some embodiments, the method for in vivo editing of genes comprises systemically administering to a human subject the LNP composition described herein (for example, comprises mRNA encoding a Cas nuclease such as Cas9 and a guide RNA that targets a gene, for example, a guide RNA that targets the TTR gene).In some embodiments, in vivo editing occurs at the site that is targeted by the guide RNA in the liver cells of the subject.
[0220] Also provided herein is a method for in vivo editing of TTR gene in the liver of a human subject.In some embodiments, the method for in vivo editing of TTR gene comprises systemically administering to a human subject the LNP composition described herein (e.g., comprising mRNA encoding Cas nuclease such as Cas9 and guide RNA targeting TTR gene).In some embodiments, the in vivo editing of TTR gene occurs at the site targeted by guide RNA in the liver cells of the subject.
[0221] In these embodiments, administration of the LNP composition to a subject may be associated with a change in biosafety measures. In some embodiments, the subject is evaluated to determine whether the change in biosafety measures is an acceptable change. In some embodiments, an acceptable change may be determined by a clinician and / or a testing laboratory. In some embodiments, an acceptable change may not qualify as a safety event, including an adverse event (NCI-CTCAE grade 3 or less), a serious adverse event, an adverse event of special interest, and / or a treatment-emergent adverse event (CTCAE grade 3 or less), as described herein. Biosafety measures, including those associated with administration of the LNP composition, are known in the art. Acceptable levels and / or changes in biosafety measures are known in the art and may be evaluated by routine methods.
[0222] In some embodiments, an acceptable biosafety measure level is one that is included in the subject inclusion criteria and / or is not included in the subject exclusion criteria described herein.
[0223] In some embodiments, an acceptable change in biosafety scale level is one that is acceptable after a period of time, e.g., a change that is initially outside an acceptable level but stabilizes to an acceptable level by, e.g., the 2nd, 3rd, 4th, 5th, 6th, 7th, 14th, or 28th day after administration. In some embodiments, an acceptable change in biosafety scale level is a change in level that falls within 150% of the upper normal limit of said biosafety scale and / or within 50% of the lower normal limit of said biosafety scale, e.g., within 150% of the prothrombin ULN and / or within 50% of the fibrinogen LLN.
[0224] In some embodiments, an acceptable biosafety scale level (or an acceptable change in a biosafety scale level) is one that does not constitute an adverse event of Grade 3 or higher according to CTCAE guidelines, including the National Cancer Institute (NCI)-CTCAE guidelines, version 5.0. In some embodiments, a change in a biosafety scale level (e.g., one or more levels relating to laboratory parameters, vital signs, ECG data, physical exam, etc., as described herein) constitutes an adverse event if the change induces, for example, a clinical sign or symptom; requires active intervention; requires interruption or cessation of the LNP composition; and / or is determined by a clinician to be clinically significant.
[0225] In some embodiments, an adverse event is any untoward medical occurrence in a subject administered an investigational drug or receiving a study treatment that does not necessarily have a causal relationship to the treatment. In some embodiments, an adverse event is an unintended sign (including abnormal laboratory findings), symptom, or disease that is temporally related to the treatment, whether or not related to the medicinal (investigational) product. In some embodiments, an adverse event induces a clinical sign or symptom. In some embodiments, an adverse event requires active intervention. In some embodiments, an adverse event requires interruption or discontinuation of treatment. In some embodiments, an adverse event is a clinically significant abnormality in the opinion of the investigator. Adverse event grading criteria are known in the art, such as, for example, the CTCAE, including the National Cancer Institute's (NCI) Common Terminology Criteria for Adverse Events (CTCAE).
[0226] In some embodiments, an acceptable biosafety scale level (or an acceptable change in a biosafety scale level) is one that does not constitute a serious adverse event. In some embodiments, a serious adverse event results in death. In some embodiments, a serious adverse event is life threatening (e.g., places the subject at imminent risk of death as determined by a clinician). In some embodiments, a serious adverse event results in a persistent or significant disability. In some embodiments, a serious adverse event results in an inability or substantial interference with the ability to perform normal life functions. In some embodiments, a serious adverse event results in a congenital anomaly or birth defect. In some embodiments, a serious adverse event requires hospitalization of the patient or leads to an extended hospital stay.
[0227] In some embodiments, acceptable biosafety scale levels (or acceptable changes in biosafety scale levels) are not adverse events of particular interest. In some embodiments, adverse events of particular interest include, for example, infusion-related reactions (IRRs) (e.g., those requiring treatment or infusion discontinuation and / or grade 3 or higher), occurrence of thrombus, occurrence of bleeding, abnormal blood test results of CTCAE grade 2 or higher, elevated ALT of CTCAE grade 2 or higher, elevated AST of CTCAE grade 2 or higher, elevated total bilirubin of CTCAE grade 2 or higher, elevated GLDH of CTCAE grade 2 or higher, occurrence of cytokine release syndrome, events due to splenic effects (splenic hemorrhage, splenic infarction, sometimes thrombocytopenia, sometimes anemia, or lymphopenia with specific abnormalities on microscopic examination of blood cells), events due to adrenal effects, clinically significant symptoms or hypothyroidism, and ocular events consistent with vitamin A deficiency.
[0228] In some embodiments, an acceptable biosafety scale level (or an acceptable change in biosafety scale level) is one in which the treatment-emergent adverse event does not meet Common Terminology Criteria for Adverse Events (CTCAE) Grade 3 or higher. In some embodiments, the treatment-emergent adverse event is a nervous system disorder (e.g., headache, peripheral sensory neuropathy). In some embodiments, the treatment-emergent adverse event is a gastrointestinal disorder (e.g., diarrhea, nausea). In some embodiments, the treatment-emergent adverse event is an injury, poisoning, and procedural complication (e.g., infusion-related reaction, skin abrasion). In some embodiments, the treatment-emergent adverse event is an ear and labyrinth system disorder (e.g., positional vertigo). In some embodiments, the treatment-emergent adverse event is an eye disorder (e.g., intraocular foreign body sensation). In some embodiments, the treatment-emergent adverse event is a systemic disorder or administration site condition (e.g., catheter site swelling). In some embodiments, the treatment-emergent adverse event is an infection or infestation (e.g., acute sinusitis). In some embodiments, the treatment-emergent adverse event is a decrease in thyroxine. In some embodiments, the treatment-emergent adverse event is a respiratory, thoracic, or mediastinal disorder (e.g., rhinorrhea). In some embodiments, the treatment-emergent adverse event is a skin and subcutaneous tissue disorder (e.g., pruritus, rash).
[0229] Methods of in vivo editing may include, for example, measuring known laboratory endpoints commonly related to coagulation, hematology, clinical chemistry, urinalysis, and other bioanalytical assessments (e.g., cytokines, complement). Specific biosafety measures include, but are not limited to, the following biosafety measures: liver enzymes, activated partial thromboplastin time (aPTT) levels, prothrombin time (PT) levels, thrombin generation time (TGT) levels (e.g., peak height, lag time, and / or endogenous thrombin potential), fibrinogen levels, prothrombin international normalized (INR) ratio, d-dimer levels, vitamin A, vitamin B12, retinol binding protein (RBP), thyroid stimulating hormone (TSH), free thyroxine, free triiodothyronine (T3), HBV, HBsAg, HCV. Abs, laboratory parameters consistent with disseminated intravascular coagulation, changes in hematology lab values, changes in chemistry lab values, changes in coagulation, changes in urinalysis, glutamate dehydrogenase levels, C-reactive protein levels, complement (C3, C4, C3a, C5a, Bb) levels, cytokine (GM-CSF, INF-γ, IL-1β, IL-4, IL-5, IL-6, IL-8, IL-10, IL-13, IL-23, TNF-α, IL-17, MCP-1) levels, thyroxine (T4 levels) (e.g., a fall below the normal range following administration of treatment or clinically significant symptoms / signs of hypothyroidism), acute liver injury (e.g., an elevation in ALT, AST, total bilirubin or GLDH greater than CTCAE grade 2 following administration of treatment or clinically significant symptoms / signs of liver injury), and changes in a 12-lead electrocardiogram.
[0230] Other biosafety measures related to, for example, hematology, coagulation, clinical chemistry, and urinalysis are known in the art. For example, biosafety measures related to hematology include, but are not limited to, platelet count, RBC count, hemoglobin, hematocrit, RBC indices (MCV, MCH, MCHC, RDW), reticulocyte percentage (%), WBC count and differential (neutrophils, lymphocytes, monocytes, eosinophils, basophils). For example, biosafety measures related to coagulation include, but are not limited to, aPTT, PT, INR, fibrinogen, d-dimer, and TGT. For example, biosafety measures related to clinical chemistry include, but are not limited to, albumin, blood urea nitrogen, creatinine, non-fasting glucose, potassium, sodium, chloride, carbon dioxide, calcium, AST, ALT, alkaline phosphatase, total and direct bilirubin, total protein, creatine kinase, lactose dehydrogenase, total cholesterol, and LDL cholesterol. For example, biosafety measures relevant to urinalysis include, but are not limited to, specific gravity, pH, glucose, protein, blood, ketones, bilirubin, urobilinogen, nitrites, and leukocyte esterase.
[0231] In some embodiments, the level of the biosafety measure is measured after administration of the LNP composition. In some embodiments, the level of the biosafety measure is measured before and after administration of the LNP composition, thereby allowing for a comparison of the level of the biosafety measure before and after treatment with the LNP composition. In some embodiments, the level of the biosafety measure measured before administration of the LNP composition can be a baseline for comparison to the level of one or more of the biosafety measures measured after administration of the LNP composition. In some embodiments, the baseline is the last available measurement obtained before administration of the LNP composition. In these embodiments, administration of the LNP composition results in an acceptable change in liver enzyme levels (e.g., an increase of no more than ALT or AST > 5 x ULN for more than 4 weeks after administration of the treatment, an increase of no more than ALT or AST > 3 x ULN and total bilirubin > 2 x ULN (Hy's law) after administration of the treatment). In these embodiments, administration of the composition results in an acceptable change in the level of activated partial thromboplastin time (aPTT) (e.g., an increase of no more than aPTT > 5 x ULN for more than 4 weeks after administration of the treatment). In these embodiments, administration of the composition results in an acceptable change in the level of prothrombin time (PT). In these embodiments, administration of the composition results in an acceptable change in the level of thrombin generation time (TGT) (e.g., peak height, lag time, and / or endogenous thrombin potential). In these embodiments, administration of the composition results in an acceptable change in the level of fibrinogen. In some embodiments, administration of the composition results in an acceptable change in the prothrombin international normalized (INR) ratio. In these embodiments, administration of the composition results in an acceptable change in the level of d-dimer. In these embodiments, administration of the composition results in an acceptable change in a laboratory parameter consistent with disseminated intravascular coagulation. In these embodiments, administration of the composition results in an acceptable change in a hematology laboratory value (e.g., an abnormal blood test result greater than CTCAE grade 2 following administration of a treatment).In these embodiments, administration of the composition results in an acceptable change in a chemistry test value. In these embodiments, administration of the composition results in an acceptable change in abnormal coagulation findings defined by clinically significant abnormal bleeding. In these embodiments, administration of the composition results in an acceptable change in a urinalysis. In these embodiments, administration of the composition results in an acceptable change in the level of glutamate dehydrogenase. In these embodiments, administration of the composition results in an acceptable change in the level of C-reactive protein. In these embodiments, administration of the composition results in an acceptable change in the level of complement. In these embodiments, administration of the composition results in an acceptable change in the level of cytokines.
[0232] In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a treatment-emergent adverse event of Grade 3 or higher according to the CTCAE guidelines. In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a thrombus occurrence. In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a hemorrhage occurrence. In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a disseminated intravascular coagulation occurrence. In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a cytokine release syndrome occurrence. In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a finding due to splenic effects (splenic hemorrhage, splenic infarction, sometimes thrombocytopenia, sometimes anemia, or lymphopenia with specific abnormal findings on microscopic examination of blood cells). In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a finding due to adrenal effects. In these embodiments, administration of the composition results in an acceptable change in biosafety scale levels that does not represent ophthalmological findings consistent with vitamin A deficiency. In these embodiments, administration of the composition results in an acceptable change in thyroxine levels (T4 levels) (e.g., does not reduce levels below the normal range or represent clinically significant symptoms / signs of hypothyroidism after treatment administration). In these embodiments, administration of the composition results in an acceptable change in biosafety scale levels that does not represent acute liver injury (e.g., elevation of ALT, AST, total bilirubin, or GLDH above CTCAE grade 2 or clinically significant symptoms / signs of liver injury after treatment administration). In these embodiments, administration of the composition results in an acceptable change in 12-lead electrocardiogram as determined by a clinician.
[0233] In some embodiments, the method of in vivo editing of a gene comprises systemically administering to a human subject an effective amount of a LNP composition comprising mRNA encoding Cas9, where the administration results in an acceptable change in the level of an anti-Cas antibody (e.g., an anti-Cas9 antibody).
[0234] In some embodiments, administration of the LNP composition results in an acceptable change in the pharmacokinetics of lipid A. In some embodiments, administration of the LNP composition results in an acceptable change in the pharmacokinetics of DMG-PEG2k. In some embodiments, administration of the LNP composition results in an acceptable change in the pharmacokinetics of Cas9 mRNA. In some embodiments, administration of the LNP composition results in an acceptable change in the pharmacokinetics of sgRNA.
[0235] 2. Treatment Method A method of treating a human subject by in vivo editing of a gene is provided herein. In some embodiments, the method treats a single gene disorder resulting from abnormal expression or activity of a hepatic gene product. A single gene disorder can be treated by editing (e.g., single editing) a gene in the liver or a non-coding region that causes abnormal expression or activity of a hepatic gene product. In some embodiments, the gene product is a protein. In some embodiments, the gene product is an RNA molecule. In some embodiments, editing a gene in the liver or a non-coding region that causes abnormal expression or activity of a hepatic gene product reduces the level (e.g., serum level) of a gene product. In some embodiments, the method targets and edits the TTR gene in the liver (e.g., in hepatocytes). In some embodiments, the single gene disorder is ATTR.
[0236] In some embodiments, the method of in vivo editing of a gene comprises systemically administering to a human subject an LNP composition described herein (e.g., comprising an effective amount of an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, such as a guide RNA targeting a TTR gene), and determining the level of biosafety measures. In some embodiments, the treatment method comprises in vivo editing of a gene that occurs in the liver cells of the subject at a site targeted by the guide RNA.
[0237] In some embodiments, a method of treating a human subject having a monogenic disorder includes systemically administering to the human subject an LNP composition described herein (e.g., comprising an effective amount of an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, e.g., a guide RNA targeting a TTR gene), determining a first level of a biosafety measure in the subject prior to administration, determining a second level of the biosafety measure in the subject a period of time after administration, and assessing a change between the first level and the second level of the biosafety measure.
[0238] In some embodiments, the treatment method comprises administering a guide RNA that targets a gene in liver cells of the subject.
[0239] In some embodiments, the method of treating a human subject with a single gene disorder comprises systemically administering to the human subject an LNP composition described herein (e.g., comprising an effective amount of an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, such as a guide RNA targeting the TTR gene) to edit the gene in the liver. In some embodiments, the method of treating a human subject with a single gene disorder comprises systemically administering to the human subject an LNP composition described herein (e.g., comprising an effective amount of an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, such as a guide RNA targeting the TTR gene) to knock down the production of an abnormal hepatic gene product. In some embodiments, the treatment method knocks down the production of a hepatic gene product in a cell population. In some embodiments, the treatment method results in long-term knockdown (e.g., permanent knockdown) of a hepatic gene product after a single edit in the liver. In some embodiments, the treatment method includes administering the LNP compositions described herein more than once, e.g., 1, 2, 3, 4, or 5 times, e.g., to maximize editing by a cumulative effect. In some embodiments, the treatment method includes administering the LNP compositions described herein more than once (e.g., 2 times) to achieve an effective reduction (e.g., achieve at least a 60% reduction in levels of hepatic gene products compared to baseline levels).
[0240] The treatment method includes administering the LNP composition described herein and further determining the level of the biosafety measure. In these embodiments, administration of the LNP composition to a subject may be associated with a change in the biosafety measure. In some embodiments, the subject is evaluated to determine whether the change in the biosafety measure is an acceptable change. In some embodiments, an acceptable change may be determined by a clinician and / or a testing laboratory. In some embodiments, an acceptable change may not qualify as a safety event, including an adverse event (NCI-CTCAE grade 3 or less), a serious adverse event, an adverse event of special interest, and / or a treatment-emergent adverse event (CTCAE grade 3 or less), as described herein. Biosafety measures, including those associated with administration of the LNP composition, are known in the art. Acceptable levels and / or changes in biosafety measures are known in the art and can be evaluated by routine methods.
[0241] In some embodiments, an acceptable biosafety measure level is one that is included in the subject inclusion criteria and / or is not included in the subject exclusion criteria described herein.
[0242] In some embodiments, an acceptable change in biosafety scale level is one that is acceptable after a period of time, e.g., a change that is initially outside an acceptable level but stabilizes to an acceptable level by, e.g., the 2nd, 3rd, 4th, 5th, 6th, 7th, 14th, or 28th day after administration. In some embodiments, an acceptable change in biosafety scale level is a change in level that falls within 150% of the upper normal limit of said biosafety scale and / or within 50% of the lower normal limit of said biosafety scale, e.g., within 150% of the prothrombin ULN and / or within 50% of the fibrinogen LLN.
[0243] In some embodiments, an acceptable biosafety scale level (or an acceptable change in a biosafety scale level) is one that does not constitute an adverse event of Grade 3 or higher according to CTCAE guidelines, including the National Cancer Institute (NCI)-CTCAE guidelines, version 5.0. In some embodiments, a change in a biosafety scale level (e.g., one or more levels relating to laboratory parameters, vital signs, ECG data, physical exam, etc., as described herein) constitutes an adverse event if the change induces, for example, a clinical sign or symptom; requires active intervention; requires interruption or cessation of the LNP composition; and / or is determined by a clinician to be clinically significant.
[0244] In some embodiments, an adverse event is any untoward medical occurrence in a subject administered an investigational drug or receiving a study treatment that does not necessarily have a causal relationship to the treatment. In some embodiments, an adverse event is an unintended sign (including abnormal laboratory findings), symptom, or disease that is temporally related to the treatment, whether or not related to the medicinal (investigational) product. In some embodiments, an adverse event induces a clinical sign or symptom. In some embodiments, an adverse event requires active intervention. In some embodiments, an adverse event requires interruption or discontinuation of treatment. In some embodiments, an adverse event is a clinically significant abnormality in the opinion of the investigator. Adverse event grading criteria are known in the art, such as, for example, the CTCAE, including the National Cancer Institute's (NCI) Common Terminology Criteria for Adverse Events (CTCAE).
[0245] In some embodiments, an acceptable biosafety scale level (or an acceptable change in a biosafety scale level) is one that does not constitute a serious adverse event. In some embodiments, a serious adverse event results in death. In some embodiments, a serious adverse event is life threatening (e.g., places the subject at imminent risk of death as determined by a clinician). In some embodiments, a serious adverse event results in a persistent or significant disability. In some embodiments, a serious adverse event results in an inability or substantial interference with the ability to perform normal life functions. In some embodiments, a serious adverse event results in a congenital anomaly or birth defect. In some embodiments, a serious adverse event requires hospitalization of the patient or leads to an extended hospital stay.
[0246] In some embodiments, acceptable biosafety scale levels (or acceptable changes in biosafety scale levels) are not adverse events of particular interest. In some embodiments, adverse events of particular interest include, for example, infusion-related reactions (IRRs) (e.g., those requiring treatment or infusion discontinuation and / or grade 3 or higher), occurrence of thrombus, occurrence of bleeding, abnormal blood test results of CTCAE grade 2 or higher, elevated ALT of CTCAE grade 2 or higher, elevated AST of CTCAE grade 2 or higher, elevated total bilirubin of CTCAE grade 2 or higher, elevated GLDH of CTCAE grade 2 or higher, occurrence of cytokine release syndrome, events due to splenic effects (splenic hemorrhage, splenic infarction, sometimes thrombocytopenia, sometimes anemia, or lymphopenia with specific abnormalities on microscopic examination of blood cells), events due to adrenal effects, clinically significant symptoms or hypothyroidism, and ocular events consistent with vitamin A deficiency.
[0247] In some embodiments, an acceptable biosafety scale level (or an acceptable change in biosafety scale level) is one in which the treatment-emergent adverse event does not meet Common Terminology Criteria for Adverse Events (CTCAE) Grade 3 or higher. In some embodiments, the treatment-emergent adverse event is a nervous system disorder (e.g., headache, peripheral sensory neuropathy). In some embodiments, the treatment-emergent adverse event is a gastrointestinal disorder (e.g., diarrhea, nausea). In some embodiments, the treatment-emergent adverse event is an injury, poisoning, and procedural complication (e.g., infusion-related reaction, skin abrasion). In some embodiments, the treatment-emergent adverse event is an ear and labyrinth system disorder (e.g., positional vertigo). In some embodiments, the treatment-emergent adverse event is an eye disorder (e.g., intraocular foreign body sensation). In some embodiments, the treatment-emergent adverse event is a systemic disorder or administration site condition (e.g., catheter site swelling). In some embodiments, the treatment-emergent adverse event is an infection or infestation (e.g., acute sinusitis). In some embodiments, the treatment-emergent adverse event is a decrease in thyroxine. In some embodiments, the treatment-emergent adverse event is a respiratory, thoracic, or mediastinal disorder (e.g., rhinorrhea). In some embodiments, the treatment-emergent adverse event is a skin and subcutaneous tissue disorder (e.g., pruritus, rash).
[0248] Methods of in vivo editing may include, for example, measuring known laboratory endpoints commonly related to coagulation, hematology, clinical chemistry, urinalysis, and other bioanalytical assessments (e.g., cytokines, complement). Specific biosafety measures include, but are not limited to, the following biosafety measures: liver enzymes, activated partial thromboplastin time (aPTT) levels, prothrombin time (PT) levels, thrombin generation time (TGT) levels (e.g., peak height, lag time, and / or endogenous thrombin potential), fibrinogen levels, prothrombin international normalized (INR) ratio, d-dimer levels, vitamin A, vitamin B12, retinol binding protein (RBP), thyroid stimulating hormone (TSH), free thyroxine, free triiodothyronine (T3), HBV, HBsAg, HCV. Abs, laboratory parameters consistent with disseminated intravascular coagulation, changes in hematology lab values, changes in chemistry lab values, changes in coagulation, changes in urinalysis, glutamate dehydrogenase levels, C-reactive protein levels, complement (C3, C4, C3a, C5a, Bb) levels, cytokine (GM-CSF, INF-γ, IL-1β, IL-4, IL-5, IL-6, IL-8, IL-10, IL-13, IL-23, TNF-α, IL-17, MCP-1) levels, thyroxine (T4 levels) (e.g., a fall below the normal range following administration of treatment or clinically significant symptoms / signs of hypothyroidism), acute liver injury (e.g., an elevation in ALT, AST, total bilirubin or GLDH greater than CTCAE grade 2 following administration of treatment or clinically significant symptoms / signs of liver injury), and changes in a 12-lead electrocardiogram.
[0249] Other biosafety measures related to, for example, hematology, coagulation, clinical chemistry, and urinalysis are known in the art. For example, biosafety measures related to hematology include, but are not limited to, platelet count, RBC count, hemoglobin, hematocrit, RBC indices (MCV, MCH, MCHC, RDW), reticulocyte percentage (%), WBC count and differential (neutrophils, lymphocytes, monocytes, eosinophils, basophils). For example, biosafety measures related to coagulation include, but are not limited to, aPTT, PT, INR, fibrinogen, d-dimer, and TGT. For example, biosafety measures related to clinical chemistry include, but are not limited to, albumin, blood urea nitrogen, creatinine, non-fasting glucose, potassium, sodium, chloride, carbon dioxide, calcium, AST, ALT, alkaline phosphatase, total and direct bilirubin, total protein, creatine kinase, lactose dehydrogenase, total cholesterol, and LDL cholesterol. For example, biosafety measures relevant to urinalysis include, but are not limited to, specific gravity, pH, glucose, protein, blood, ketones, bilirubin, urobilinogen, nitrites, and leukocyte esterase.
[0250] In some embodiments, the level of the biosafety measure is measured after administration of the LNP composition. In some embodiments, the level of the biosafety measure is measured before and after administration of the LNP composition, thereby allowing for a comparison of the level of the biosafety measure before and after treatment with the LNP composition. In some embodiments, the level of the biosafety measure measured before administration of the LNP composition can be a baseline for comparison to the level of one or more of the biosafety measures measured after administration of the LNP composition. In some embodiments, the baseline is the last available measurement obtained before administration of the LNP composition. In these embodiments, administration of the LNP composition results in an acceptable change in liver enzyme levels (e.g., an increase of no more than ALT or AST > 5 x ULN for more than 4 weeks after administration of the treatment, an increase of no more than ALT or AST > 3 x ULN and total bilirubin > 2 x ULN (Hy's law) after administration of the treatment). In these embodiments, administration of the composition results in an acceptable change in the level of activated partial thromboplastin time (aPTT) (e.g., an increase of no more than aPTT > 5 x ULN for more than 4 weeks after administration of the treatment). In these embodiments, administration of the composition results in an acceptable change in the level of prothrombin time (PT). In these embodiments, administration of the composition results in an acceptable change in the level of thrombin generation time (TGT) (e.g., peak height, lag time, and / or endogenous thrombin potential). In these embodiments, administration of the composition results in an acceptable change in the level of fibrinogen. In these embodiments, administration of the composition results in an acceptable change in the level of prothrombin international normalized (INR) ratio. In these embodiments, administration of the composition results in an acceptable change in the level of d-dimer. In these embodiments, administration of the composition results in an acceptable change in a laboratory parameter consistent with disseminated intravascular coagulation. In these embodiments, administration of the composition results in an acceptable change in a hematology laboratory value (e.g., an abnormal blood test result greater than CTCAE grade 2 following administration of a treatment).In these embodiments, administration of the composition results in an acceptable change in a chemistry test value. In these embodiments, administration of the composition results in an acceptable change in abnormal coagulation findings defined by clinically significant abnormal bleeding. In these embodiments, administration of the composition results in an acceptable change in a urinalysis. In these embodiments, administration of the composition results in an acceptable change in the level of glutamate dehydrogenase. In these embodiments, administration of the composition results in an acceptable change in the level of C-reactive protein. In these embodiments, administration of the composition results in an acceptable change in the level of complement. In these embodiments, administration of the composition results in an acceptable change in the level of cytokines.
[0251] In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a treatment-emergent adverse event of Grade 3 or higher according to the CTCAE guidelines. In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a thrombus occurrence. In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a hemorrhage occurrence. In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a disseminated intravascular coagulation occurrence. In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a cytokine release syndrome occurrence. In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a finding due to splenic effects (splenic hemorrhage, splenic infarction, sometimes thrombocytopenia, sometimes anemia, or lymphopenia with specific abnormal findings on microscopic examination of blood cells). In these embodiments, administration of the composition results in an acceptable change in biosafety scale level that does not represent a finding due to adrenal effects. In these embodiments, administration of the composition results in an acceptable change in biosafety scale levels that does not represent ophthalmological findings consistent with vitamin A deficiency. In these embodiments, administration of the composition results in an acceptable change in thyroxine levels (T4 levels) (e.g., does not reduce levels below the normal range or represent clinically significant symptoms / signs of hypothyroidism after treatment administration). In these embodiments, administration of the composition results in an acceptable change in biosafety scale levels that does not represent acute liver injury (e.g., elevation of ALT, AST, total bilirubin, or GLDH above CTCAE grade 2 or clinically significant symptoms / signs of liver injury after treatment administration). In these embodiments, administration of the composition results in an acceptable change in 12-lead electrocardiogram as determined by a clinician.
[0252] Provided herein is a method for treating human subjects by in vivo editing of TTR gene.In some embodiments, the method for in vivo editing of TTR gene comprises systemically administering to human subjects the LNP composition described herein (e.g., comprising an effective amount of mRNA encoding Cas nuclease such as Cas9 and guide RNA targeting TTR gene) and determining the level of biosafety measures as described above.In some embodiments, the in vivo editing of TTR gene occurs at the site targeted by guide RNA in the liver cells of the subject.
[0253] In some embodiments, provided herein is a method of treating a human subject suffering from TTR-associated amyloidosis (ATTR) as described herein. In some embodiments, the method is for treating a human subject suffering from hereditary ATTR (ATTRv). In some embodiments, the method is for treating a human subject suffering from non-hereditary (wild type) ATTR (ATTRwt). In some embodiments, the method is for treating a human subject suffering from ATTRv-PN. In some embodiments, the method is for treating a human subject suffering from familial amyloidotic cardiomyopathy (FAC, also known as ATTRv-CM). In some embodiments, the method is for treating a human subject suffering from wild type ATTR (ATTRwt-CM). In some embodiments, the method is for treating a human subject suffering from ATTR-CM, NYHA class I, class II, or class III.
[0254] In some embodiments, provided herein are methods of treating amyloidosis associated with TTR (ATTR) in a human subject, comprising systemically administering to the human subject an LNP composition described herein (e.g., comprising an effective amount of an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA that targets a gene, e.g., a guide RNA that targets the TTR gene), thereby treating ATTR, wherein administration of the composition results in a clinically significant improvement in the level of a clinical measure in the subject as compared to a baseline level of the clinical measure.
[0255] In some embodiments, provided herein are methods of treating amyloidosis associated with TTR (ATTR) in a human subject, comprising systemically administering to the human subject an LNP composition described herein (e.g., comprising an effective amount of an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, e.g., a guide RNA targeting the TTR gene), thereby treating ATTR, wherein the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene are administered in a combined dose of about 25 to about 100 mg.
[0256] In some embodiments, provided herein is a method of treating TTR-associated amyloidosis (ATTR) in a human subject, comprising systemically administering to the human subject an LNP composition described herein (e.g., comprising an effective amount of an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, e.g., a guide RNA targeting the TTR gene), thereby treating ATTR, wherein administration of the composition reduces serum TTR compared to baseline serum. In some embodiments, ATTR is hereditary transthyretin amyloidosis. In some embodiments, ATTR is wild-type transthyretin amyloidosis. In some embodiments, ATTR is hereditary transthyretin amyloidosis with polyneuropathy. In some embodiments, ATTR is hereditary transthyretin amyloidosis with cardiomyopathy. In embodiments where ATTR is wild-type transthyretin amyloidosis with cardiomyopathy, the subject is classified as class I, class II, or class III under the New York Health Association (NYHA) classification. In some embodiments, ATTR is ATTRv-PN and / or ATTR-CM. In some embodiments, the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate. In some embodiments, the LNP comprises a PEG lipid. In embodiments where the LNP comprises a PEG lipid, the PEG lipid comprises dimyristoyl glycerol (DMG). In embodiments where the PEG lipid comprises dimyristoyl glycerol (DMG), the PEG lipid comprises PEG-2k. In some embodiments, the LNP composition has an N / P ratio of about 5-7. In some embodiments, the guide RNA and Cas nuclease are present in a ratio ranging from about 5:1 to about 1:5 by weight. In some embodiments, the mRNA encodes a class 2 Cas nuclease.In some embodiments, the mRNA encodes a Cas9 nuclease. In some embodiments, the mRNA encodes S.pyogenes Cas9. In some embodiments, the Cas nuclease is codon-optimized. In some embodiments, the guide RNA comprises at least one modification. In embodiments in which the guide RNA comprises at least one modification, the guide RNA comprises 2'-O-methyl modified nucleotides or phosphorothioate internucleotide bonds. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a combined dose of about 0.3 mg / kg to about 2 mg / kg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a combined dose of about 0.3 mg / kg to about 1 mg / kg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a combined dose of about 0.3 mg / kg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 0.7 mg / kg total dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 1.0 mg / kg total dose. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 25 mg to about 150 mg total dose of total RNA. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 25 mg to about 100 mg total dose of total RNA. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 50 mg to about 90 mg total dose of total RNA. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is about 40 mg total dose of total RNA.In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of about 50 mg of total RNA. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of about 60 mg of total RNA. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of about 70 mg of total RNA. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of about 80 mg of total RNA. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of about 90 mg of total RNA. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the TTR gene is a total dose of about 100 mg of total RNA. In some embodiments, administration of the composition reduces serum TTR by 60-70%, 70-80%, 80-90%, 90-95%, 95-98%, 98-99%, or 99-100% compared to baseline serum TTR before administration of the composition. In some embodiments, the serum TTR level is less than about 50 μg / mL after administration of the composition. In some embodiments, the serum TTR level is less than about 40 μg / mL after administration of the composition. In some embodiments, the serum TTR level is less than about 30 μg / mL after administration of the composition. In some embodiments, the serum TTR level is less than about 20 μg / mL after administration of the composition. In some embodiments, the serum TTR level is less than about 10 μg / mL after administration of the composition. In some embodiments, the method further comprises administering a second dose of the LNP composition, wherein administration of the second dose reduces serum TTR level by at least 80% compared to baseline serum TTR level before administration of the first dose.In some embodiments, the method further comprises administering a second dose of the LNP composition, wherein the administration of the second dose reduces serum TTR levels by at least 80% compared to baseline serum TTR levels before administration of the second dose and after administration of the first dose. In some embodiments, the composition is administered with a second therapeutic agent. In some embodiments, the second therapeutic agent is diflunisal or tafamidis.
[0257] In some embodiments, the human subject is already diagnosed with ATTR before treatment or is diagnosed with ATTR simultaneously with treatment. In some embodiments, the human subject is diagnosed with ATTR based on genetic testing (e.g., documenting a TTR mutation). In some embodiments, the human subject is diagnosed with ATTR based on a clinical diagnosis of sensorimotor peripheral neuropathy. In some embodiments, the human subject is diagnosed with ATTR based on a neuropathy score (NIS) of 5 or more and 130 or less before treatment. In some embodiments, the human subject is diagnosed with ATTR based on a documenting of tissue deposits of TTR amyloid by biopsy or validated non-invasive imaging. In some embodiments, the human subject is diagnosed with ATTR based on a polyneuropathy disability (PND) score of 3b or less.
[0258] In some embodiments, the human subject has a progression of ATTRv-PN symptoms prior to treatment. In some embodiments, the human subject has an increase of 1 or more points in the Polyneuropathic Disability (PND) score. In some embodiments, the human subject has an increase of 1 or more points in the Familial Amyloid Polyneuropathy (FAP) stage. In some embodiments, the human subject has an increase of 5 or more points in the Neuropathy Score (NIS). In some embodiments, the human subject has an increase of 5 or more points in the NIS-Left Limb (LL). In some embodiments, the human subject has a decrease of 25 kg / m2×g / L or more in the Modified Body Mass Index (mBMI). In some embodiments, the human subject has a decrease of 30 meters or more in the 6-minute walk test. In some embodiments, the human subject has a decrease of 0.1 m / s or more in the 10-meter walk test.
[0259] In some embodiments, provided herein is a method of treating a subject with ATTR progression while undergoing TTR-lowering therapy. In some embodiments, the treatment method comprises systemically administering to a human subject an LNP composition as described herein (e.g., comprising an effective amount of an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, such as a guide RNA targeting a TTR gene), and the subject has been or is currently being treated with a different ATTR therapy. In some embodiments, the subject has ATTR progression while undergoing a different ATTR therapy, as measured, for example, by a clinical efficacy measure, such as mNIS+7 score. In some embodiments, the subject to whom the LNP composition as described herein is administered has been or is currently being treated with inotersen and exhibits ATTR progression. In some embodiments, the subject to whom the LNP composition as described herein is administered has been or is currently being treated with patisiran and has ATTR progression. In some embodiments, a subject to whom an LNP composition described herein is administered has been treated or is currently being treated with diflunisal and has progression of ATTR. In some embodiments, a subject to whom an LNP composition described herein is administered has been treated or is currently being treated with tafamidis and has progression of ATTR.
[0260] In some embodiments, a method of in vivo editing of the TTR gene comprises systemically administering to a human subject an LNP composition described herein (e.g., comprising an effective amount of an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting the TTR gene), resulting in a clinically significant improvement in the level of a clinical scale.
[0261] In some embodiments, a method of treating a TTR-associated amyloidosis comprises administering an LNP composition described herein and further determining one or more clinical efficacy measures, including, but not limited to, a reduction in serum TTR (e.g., a 60% reduction in serum TTR as measured by ELISA after administration of treatment), a reduction in serum TTR (e.g., a 60% reduction in serum TTR as measured by mass spectrometry after administration of treatment), a reduction in serum prealbumin, a reduction in polyneuropathy disability (PND) score, a reduction in familial amyloidotic polyneuropathy (FAP) stage, a reduction in neuropathy score (NIS), a reduction in corrected neuropathy score (mNIS+7), a reduction in neuropathy score (NIS)-legs (LL), an increase in corrected body mass index (mBMI) of 25 kg / m2×g / L or more, an increase in 6-minute walk test (6-MWT) of 30 meters or more, and an increase in 10-meter walk test (10-MWT) of 0.1 meters / second or more. Additional clinical efficacy measures include improved serum neurofilament light chain (NfL) levels, improved quality of life as assessed by Norfolk Quality of Life-Diabetic Neuropathy, improved quality of life as assessed by EuroQOL (EQ)-5D-5L, improved cardiac MRI (e.g., reduced extracellular volume), improved N-terminal prohormone of brain natriuretic peptide (NT-proBNP) levels, improved troponin I levels, improved New York Health Association (NYHA) classification, and improved Kansas City Cardiomyopathy Questionnaire (KCCQ) scores. Additional clinical efficacy measures, including measures for assessing efficacy against TTR amyloidosis, are known in the art. Similarly, levels and / or changes in clinical efficacy measures that indicate improvement in disease, including TTR amyloidosis, are known in the art and can be assessed by routine methods, for example, by clinicians or laboratories.
[0262] In some embodiments, a method of treating amyloidosis associated with TTR comprises administering an LNP composition described herein and measuring a clinical efficacy measure after administration of the LNP composition. In some embodiments, a method of treating amyloidosis associated with TTR comprises administering an LNP composition described herein and measuring a clinical efficacy measure before and after administration of the LNP composition, thereby allowing for a comparison of the levels of the clinical efficacy measure before and after treatment with the LNP composition.
[0263] For example, serum TTR levels are a clinical efficacy measure for TTR amyloidosis. In some embodiments, a method for treating amyloidosis associated with TTR comprises administering an LNP composition as described herein and reducing TTR levels, such as serum TTR levels, in a subject. In some embodiments, a method for treating amyloidosis associated with TTR comprises administering an LNP composition as described herein and reducing TTR levels, such as serum TTR levels, in a subject after treatment (e.g., 14 days or 28 days after administration of the LNP composition), by at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, for example, compared to baseline before treatment. In some embodiments, a method for treating amyloidosis associated with TTR as described herein results in at least a 60% reduction in TTR levels, such as serum TTR levels, after treatment (e.g., 14 days or 28 days after administration of the LNP composition), compared to baseline. In some embodiments, the methods of treating TTR-related amyloidosis described herein result in at least a 70% reduction in TTR levels, such as serum TTR levels, after treatment (e.g., 14 or 28 days after administration of the LNP composition) compared to baseline. In some embodiments, the methods of treating TTR-related amyloidosis described herein result in at least an 80% reduction in TTR levels, such as serum TTR levels, after treatment (e.g., 14 or 28 days after administration of the LNP composition) compared to baseline. In some embodiments, the methods of treating TTR-related amyloidosis described herein result in at least an 85% reduction in TTR levels, such as serum TTR levels, after treatment (e.g., 14 or 28 days after administration of the LNP composition) compared to baseline. In some embodiments, the methods of treating TTR-related amyloidosis described herein result in at least a 90% reduction in TTR levels, such as serum TTR levels, after treatment (e.g., 14 or 28 days after administration of the LNP composition) compared to baseline.In some embodiments, the methods of treating TTR-associated amyloidosis described herein result in at least a 95% reduction in TTR levels, such as serum TTR levels, after treatment (e.g., 14 or 28 days after administration of the LNP composition) compared to baseline. In some embodiments, the methods of treating TTR-associated amyloidosis include administering an LNP composition described herein and reducing TTR levels, such as serum TTR levels, in the subject after treatment (e.g., 14 or 28 days after administration of the LNP composition) by at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% compared to baseline.
[0264] Methods for measuring serum levels of TTR are known in the art, for example, by ELISA.
[0265] For example, serum prealbumin levels are a clinical efficacy measure for TTR amyloidosis. In some embodiments, a method of treating amyloidosis associated with TTR comprises administering an LNP composition described herein and reducing TTR levels, such as serum prealbumin levels, in a subject. In some embodiments, a method of treating amyloidosis associated with TTR comprises administering an LNP composition described herein and reducing TTR levels, such as serum prealbumin levels, in a subject after treatment (e.g., 14 days or 28 days after administration of the LNP composition), by at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, for example, compared to baseline before treatment. In some embodiments, a method of treating amyloidosis associated with TTR described herein results in at least a 60% reduction in TTR levels, such as serum prealbumin levels, after treatment (e.g., 14 days or 28 days after administration of the LNP composition), compared to baseline. In some embodiments, the methods of treating TTR-related amyloidosis described herein result in at least a 70% reduction in TTR levels, such as serum prealbumin levels, after treatment (e.g., 14 or 28 days after administration of the LNP composition) compared to baseline. In some embodiments, the methods of treating TTR-related amyloidosis described herein result in at least an 80% reduction in TTR levels, such as serum prealbumin levels, after treatment (e.g., 14 or 28 days after administration of the LNP composition) compared to baseline. In some embodiments, the methods of treating TTR-related amyloidosis described herein result in at least an 85% reduction in TTR levels, such as serum prealbumin levels, after treatment (e.g., 14 or 28 days after administration of the LNP composition) compared to baseline.In some embodiments, the methods of treating TTR-associated amyloidosis described herein result in at least a 90% reduction in TTR levels, such as serum prealbumin levels, after treatment (e.g., 14 or 28 days after administration of the LNP composition) compared to baseline. In some embodiments, the methods of treating TTR-associated amyloidosis described herein result in at least a 95% reduction in TTR levels, such as serum prealbumin levels, after treatment (e.g., 14 or 28 days after administration of the LNP composition) compared to baseline. Methods of measuring serum levels of prealbumin are known in the art, such as, for example, ELISA.
[0266] In other embodiments, administration of the LNP composition reduces serum TTR levels in a subject to less than about 50 μg / mL. In some embodiments, administration of the LNP composition reduces serum TTR levels to less than about 40 μg / mL. In some embodiments, administration of the LNP composition reduces serum TTR levels to less than about 30 μg / mL. In some embodiments, administration of the LNP composition reduces serum TTR levels to less than about 20 μg / mL. In some embodiments, administration of the LNP composition reduces serum TTR levels to less than about 10 μg / mL.
[0267] In some embodiments, the treatment results in a decrease in serum prealbumin compared to baseline levels. In some embodiments, the treatment results in a decrease in polyneuropathy disability (PND) score by at least 1 point from baseline. In some embodiments, the treatment results in a decrease in familial amyloid polyneuropathy (FAP) stage by at least 1 point from baseline. In some embodiments, the treatment results in a decrease in neuropathy score (NIS) by at least 1 point compared to baseline. In some embodiments, the treatment results in a decrease in corrected neuropathy score (mNIS+7) compared to baseline. In some embodiments, the treatment results in a decrease in neuropathy score (NIS)-Leg (LL) compared to baseline. In some embodiments, the treatment results in an increase in corrected body mass index (e.g., (mBMI)≧25 kg / m2×g / L) compared to baseline. In some embodiments, the treatment results in an increase of 30 meters or more in the 6-minute walk test (6-MWT) compared to baseline. In some embodiments, the treatment results in an increase of 0.1 meters / second or more in the 10-meter walk test (10-MWT) compared to baseline. In some embodiments, the treatment results in improved serum neurofilament light chain (NfL) levels compared to baseline. In some embodiments, the treatment results in improved quality of life as assessed by Norfolk Quality of Life-Diabetic Neuropathy compared to baseline. In some embodiments, the treatment results in improved quality of life as assessed by EuroQOL (EQ)-5D-5L compared to baseline. In some embodiments, the treatment results in improved cardiac MRI (e.g., cardiac imaging of amyloid fibrils) compared to baseline. In some embodiments, the treatment results in improved N-terminal prohormone of brain natriuretic peptide (NT-proBNP) levels compared to baseline, and in some embodiments, the treatment results in improved troponin I levels compared to baseline.In some embodiments, treatment results in an improvement in New York Health Association (NYHA) classification compared to baseline. In some embodiments, treatment results in an improvement in Kansas City Cardiomyopathy Questionnaire (KCCQ) score compared to baseline.
[0268] In some embodiments, treatment slows or stops the progression of FAP, hi some embodiments, treatment results in improvement, stabilization, or slowing of changes in sensorimotor or autonomic neuropathy symptoms.
[0269] In some embodiments, the treatment results in an improvement, stabilization, or slowing of changes in symptoms of FAC. In some embodiments, the treatment results in an improvement, stabilization, or slowing of changes in symptoms of restrictive cardiomyopathy or congestive heart failure.
[0270] In some embodiments, the effectiveness of treatment is measured by an improvement in or slower progression of symptoms of sensory motor or autonomic neuropathy. In some embodiments, the effectiveness of treatment is measured by an increase in, or slower decline in, motor ability in an area of the body or sensory ability in any area of the body. In some embodiments, the effectiveness of treatment is measured by an improvement in, or slower decline in, ability to swallow, breathe, use an arm, hand, leg, or foot, or ability to walk. In some embodiments, the effectiveness of treatment is measured by an improvement in, or slower decline in, neuralgia. In some embodiments, neuralgia is characterized by pain, burning, tingling, or abnormal sensations. In some embodiments, the effectiveness of treatment is measured by an improvement in, or slower decline in, postural hypotension, dizziness, gastrointestinal motility disorders, bladder dysfunction, or sexual dysfunction. In some embodiments, the effectiveness of treatment is measured by an improvement in, or slower decline in, weakness. In some embodiments, the efficacy of treatment is measured using electromyograms, nerve conduction studies, or subject-reported outcomes.
[0271] In some embodiments, the effectiveness of treatment is measured by improvement or slowing of progression of symptoms of congestive heart failure or CHF. In some embodiments, the effectiveness of treatment is measured by reduction or slowing of increase in shortness of breath, difficulty in breathing, fatigue, or swelling of ankle, foot, abdomen, or neck veins. In some embodiments, the effectiveness of treatment is measured by improvement or slowing of progression of fluid accumulation in the body, which can be evaluated by measures such as weight gain, frequent urination, or nighttime coughing. In some embodiments, the effectiveness of treatment is measured using cardiac biomarker tests (such as B-type natriuretic peptide [BNP] or N-terminal pro-b-type natriuretic peptide [NT-proBNP]), pulmonary function tests, chest x-rays, or electrocardiograms.
[0272] In some embodiments, treatment results in the prolongation of subject survival.In some embodiments, treatment slows or stops disease progression.In some embodiments, the effectiveness of treatment with compositions described herein is seen 2 weeks, 4 weeks, 2 months, 4 months, 6 months, 9 months, 1 year, 2 years, 3 years, 4 years, 5 years, or 10 years after delivery.
[0273] In other embodiments, the LNP compositions are also administered with a second therapeutic agent. In some embodiments, the second therapeutic agent is a stabilizer of the tetrameric form of TTR. In some embodiments, the second therapeutic agent is diflunisal or tafamidis.
[0274] a. Inclusion criteria In some embodiments, subjects with TTR amyloidosis (ATTRv-PN and ATTR-CM) who are administered an LNP composition described herein (e.g., comprising an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, e.g., a guide RNA targeting the TTR gene) are evaluated for one or more of the following subject inclusion criteria:
[0275] i. ATTRv-PN subject inclusion criteria In some embodiments, the human subject is already diagnosed with ATTR prior to treatment or is diagnosed with ATTR at the same time. In some embodiments, the human subject is diagnosed with ATTR based on genetic testing (e.g., documenting a TTR mutation). In some embodiments, the human subject is diagnosed with ATTR based on a clinical diagnosis of sensorimotor peripheral neuropathy. In some embodiments, the human subject is diagnosed with ATTR prior to treatment based on a neuropathy score (NIS) of 5 or more and 130 or less. In some embodiments, the human subject is diagnosed with ATTR based on a documenting of tissue deposits of TTR amyloid by biopsy or validated non-invasive imaging. In some embodiments, the human subject is diagnosed with ATTR based on a polyneuropathy disability (PND) score of 3b or less.
[0276] In some embodiments, the human subject has a progression of ATTRv-PN symptoms prior to treatment. In some embodiments, the human subject has a 1 or more point increase in Polyneuropathic Disability (PND) score. In some embodiments, the human subject has a 1 or more point increase in Familial Amyloid Polyneuropathy (FAP) stage. In some embodiments, the human subject has a 5 or more point increase in Neuropathy Score (NIS). In some embodiments, the human subject has a 5 or more point increase in NIS-Left Limb (LL). In some embodiments, the human subject has a 25 kg / m2×g / L or more decrease in modified Body Mass Index (mBMI). In some embodiments, the human subject has a 30 meter or more decrease in the 6 minute walk test. In some embodiments, the human subject has a 0.1 m / s or more decrease in the 10 meter walk test. Evaluation of these and other inclusion criteria is known in the art.
[0277] In some embodiments, the human subject is between 18 and 80 years of age at the time of administration. In some embodiments, the human subject has a diagnosis of peripheral neuropathy (PN) due to TTR amyloidosis (ATTR) based on a record of TTR mutations (e.g., full TTR gene sequencing information). In some embodiments, the human subject has a diagnosis of sensorimotor peripheral neuropathy. In some embodiments, the human subject has a neuropathy score (NIS) of 5 or greater and 130 or less. In some embodiments, the human subject has a record of tissue deposits of TTR amyloid by biopsy or validated non-invasive imaging. In some embodiments, the human subject has a polyneuropathy disability (PND) score of 3b or less. In some embodiments, the human subject has a body weight of about 50 kg to 90 kg. In some embodiments, the human subject has a body weight of about 50 kg to 120 kg. In some embodiments, the human subject has an aspartate aminotransferase (AST) level at or below the upper limit of normal (ULN) at screening. In some embodiments, the human subject has an alanine aminotransferase (ALT) level at or below the upper limit of normal (ULN) at screening. In some embodiments, the human subject has a total bilirubin level at or below the upper limit of normal (ULN) at screening. In some embodiments, the human subject has an international normalized ratio (INR) at or below the upper limit of normal (ULN) at screening. In some embodiments, the human subject has an estimated glomerular filtration rate (GFR) (e.g., as measured by the Modification of Diet in Renal Disease equation) of greater than 45 mL / min / 1.73 m2 at screening. In some embodiments, the human subject has a platelet count of greater than or equal to 100,000 cells / mm3 at screening. In some embodiments, the human subject has an N-terminal prohormone of brain natriuretic peptide (NT-proBNP) of less than 2,000 pg / mL at screening. In some embodiments, the human subject has a low-density lipoprotein (LDL) cholesterol of less than 200 mg / dL at screening.In some embodiments, the human subject has vitamin A at or above the lower limit of normal (LLN) at screening. In some embodiments, the human subject has thyroid stimulating hormone (TSH) within the normal range at screening. In some embodiments, the human subject has vitamin B12 levels at or above the LLN at screening. In some embodiments, the human subject has an echocardiogram. In some embodiments, the human subject is male and must agree not to donate sperm for 84 days after administration.
[0278] ii. ATTR-CM Inclusion Criteria In some embodiments, the human subject has a recorded diagnosis of transthyretin (ATTR) amyloidosis with cardiomyopathy, classified as hereditary ATTR amyloidosis with cardiomyopathy (ATTRv) or wild-type cardiomyopathy (ATTRwt).
[0279] In some embodiments, the human subject has at least one history of heart failure hospitalization and / or clinical evidence of heart failure, hi some embodiments, the human subject has New York Heart Association (NYHA) Class I-III heart failure.
[0280] In some embodiments, human subjects receive oral diuretic therapy at least three times weekly at a dose that has been consistently maintained (or changed by no more than 50%) for at least 21 days prior to screening.
[0281] In some embodiments, the human subject is clinically stable with no cardiovascular-related hospitalizations within four weeks prior to administration of the compositions described herein.
[0282] In some embodiments, the human subject's heart failure condition is optimally controlled and clinically stable as assessed by the investigator.
[0283] In some embodiments, the human subject is able to complete 150 meters or more in the 6-minute walk test (6-MWT) during the screening period.
[0284] In some embodiments, the human subject weighs at least 45 kg at the time of screening.
[0285] In some embodiments, the human subject meets certain test criteria during screening. In some embodiments, the human subject has aspartate aminotransferase (AST), alanine aminotransferase (ALT), and total bilirubin below the upper limit of normal (ULN) range (unless the subject has Gilbert's syndrome). In some embodiments, for human subjects with a history of Gilbert's syndrome, the subject has total bilirubin below 2×ULN at screening. In some embodiments, the human subject has an estimated glomerular filtration rate (eGFR) of greater than 30 mL / min / 1.73 m2 as measured by CKD-EPI. In some embodiments, the human subject has a platelet count of 100,000 cells / mm3 or greater. In some embodiments, the human subject has activated partial thromboplastin time (aPTT), prothrombin time (PT), fibrinogen, and d-dimer levels within the normal range or deemed clinically insignificant by the investigator. In some embodiments, the human subject has NT-proBNP greater than 600 pg / mL (or NT-proBNP greater than 1,000 pg / mL if the patient has a known atrial fibrillation diagnosis). In some embodiments, the human subject has low-density lipoprotein (LDL) cholesterol less than 200 mg / dL at screening, with or without medication. In some embodiments, the human subject has vitamin A at or above the lower limit of normal (LLN). In some embodiments, the human subject has a thyroid stimulating hormone (TSH) measurement within the normal range. In some embodiments, the human subject meets all of the above test criteria at screening.
[0286] In some embodiments, human subjects limit alcohol consumption to one alcoholic drink per day during screening and until 28 days after treatment with the compositions described herein.
[0287] In some embodiments, the human subject is a male and / or female subject, e.g., 18-90 years of age (inclusive) at the time of signing informed consent. In some embodiments, the female subject is postmenopausal (e.g., has had no menses for 12 months without another medical cause prior to screening. In some embodiments, high follicle stimulating hormone (FSH) levels in the postmenopausal range may be used to confirm postmenopausal status in women not using hormonal contraception or hormone replacement therapy. In some embodiments, a single FSH measurement is insufficient in the absence of amenorrhea for 12 months). In some embodiments, the female subject has been surgically sterilized (e.g., hysterectomy, bilateral salpingectomy, and bilateral oophorectomy) at least one month prior to screening. In some embodiments, male subjects with fertile or pregnant partner(s) agree to use condoms prior to screening and for 84 days after administration of the study drug. In some embodiments, the male subject agrees not to donate sperm for 84 days after administration of the study drug. This time frame may be extended beyond 84 days if sperm donation is contraindicated based on country-specific guidelines.
[0288] In some embodiments, the human subject is assessed for risk of SARS-CoV-2 transmission or disease that is deemed acceptable for proceeding with the elective procedure in a medical facility (e.g., documented completion of vaccination series, recent negative PCR test results, or no longer needing such testing).
[0289] In some embodiments, the human subject agrees not to participate in another interventional study for at least 28 days after dosing.
[0290] In some embodiments, during the screening period, the human subject has three blood pressure measurements recorded using an appropriately sized cuff, each of which is less than 140 / 90 mmHg. If the blood pressure is 140 / 90 mmHg or greater during screening, the subject may receive a new or modified antihypertensive therapy and continue screening until the subject's three blood pressure measurements are less than 140 / 90 mmHg before proceeding with administration of the compositions described herein.
[0291] b. Exclusion criteria In some embodiments, subjects with TTR amyloidosis (ATTRv-PN and ATTR-CM) who are administered an LNP composition described herein (e.g., comprising an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, e.g., a guide RNA targeting the TTR gene) are evaluated for one or more of the following exclusion criteria:
[0292] i. ATTRv-PN Exclusion Criteria In some embodiments, the human subject does not have amyloidosis due to a non-TTR protein, e.g., amyloid light chain (AL) amyloidosis. In some embodiments, the human subject does not have leptomeningeal transthyretin amyloidosis. In some embodiments, the human subject does not have hypersensitivity to any lipid nanoparticle (LNP) component, or has previously received LNP and experienced any treatment-related laboratory abnormality or adverse event (e.g., ALT or AST >3×ULN if baseline was normal, or >3×baseline if baseline was above normal, INR, aPTT or d-dimer >1.5×ULN if baseline was normal, or >1.5×baseline if baseline was above normal, LNP treatment-related adverse event classified as CTCAE grade 3 or higher, infusion-related reaction (IRR) to LNP-containing product requiring treatment or infusion discontinuation) after receiving LNP-containing product). In some embodiments, the human subject does not have other known causes of sensorimotor or autonomic neuropathy (e.g., diabetic neuropathy, autoimmune disease-related neuropathy). In some embodiments, the human subject does not have a diagnosis of type 1 diabetes mellitus or type 2 diabetes mellitus for more than 5 years. In some embodiments, the human subject does not have current or past NYHA class III or IV symptoms due to heart failure or worsening heart failure symptoms within 90 days prior to screening or during screening. In some embodiments, the human subject has not had a cardiovascular hospitalization or invasive procedure within 90 days. In some embodiments, the human subject has not had an invasive cardiovascular procedure (e.g., coronary stent, pacemaker placement, etc.). In some embodiments, the human subject does not receive vitamin A supplementation. In some embodiments, the human subject does not receive a pre-treatment medication regimen. In some embodiments, the human subject has not had a history of antiplatelet (e.g., aspirin, clopidogrel) or antithrombotic therapy (e.g., warfarin, dabigatran, apixaban) use within 14 days of administration.In some embodiments, the human subject does not have a history of thrombophilia or a positive genetic test result for Factor V Leiden and / or Prothrombin 20210. In some embodiments, the human subject does not have an expected life expectancy of less than 2 years. In some embodiments, the human subject does not have ophthalmologic findings consistent with Vitamin A deficiency. In some embodiments, the human subject does not have a history of cirrhosis. In some embodiments, the human subject does not have a history or suspected viral, parasitic, or fungal systemic infection, and has not received antibiotics for a bacterial infection. In some embodiments, the human subject does not have a history of Hepatitis B or Hepatitis C infection, or a positive test result for Hepatitis B surface antigen (HBsAg) or Hepatitis C virus antibody (HCV Ab). In some embodiments, the human subject does not have a history of positive human immunodeficiency virus (HIV) status. In some embodiments, the human subject does not have a history of liver, heart, or other solid organ transplant or a bone marrow transplant, or a transplant scheduled within one year of administration. In some embodiments, the human subject has no history of active malignancies within 5 years prior to screening or during the screening period, except for basal cell carcinoma of the skin, curatively resected squamous cell carcinoma of the skin, curatively resected intraepithelial neoplasia of the cervix, or low-grade prostate adenocarcinoma where adequate management is observation only. In some embodiments, the human subject has no history of alcohol or drug abuse within 3 years prior to screening. In some embodiments, the human subject is not a woman of childbearing potential or breastfeeding. In some embodiments, the human subject has no positive severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) polymerase chain reaction (PCR) test result within 7 days of administration.
[0293] Evaluation of these and other exclusion criteria is known in the art.
[0294] ii. ATTR-CM exclusion criteria In some embodiments, the human subject does not have amyloidosis due to a non-TTR protein, such as amyloid light chain (AL) amyloidosis, hi some embodiments, the human subject does not have known leptomeningeal transthyretin amyloidosis.
[0295] In some embodiments, the human subject has no history of hypersensitivity to any lipid nanoparticle (LNP) component. In some embodiments, the human subject has not previously received LNP and has not experienced any treatment-related laboratory abnormalities or adverse events (AEs) (e.g., ALT or AST > 3 x ULN if baseline was normal, or > 3 x baseline if baseline was above normal, after receiving LNP-containing product; INR, aPTT or d-dimer > 1.5 x ULN if baseline was normal, or > 1.5 x baseline if baseline was above normal, after receiving LNP-containing product; any LNP treatment-related adverse event classified as CTCAE grade 3 or higher; infusion-related reaction (IRR) to LNP-containing product requiring treatment or infusion discontinuation (in some embodiments, slowing of infusion rate to mitigate infusion-related reaction is not considered an exclusion); and / or any LNP treatment-related adverse event that should be an exclusion in the opinion of the investigator).
[0296] In some embodiments, the human subject does not use the following TTR-directed therapies for ATTR within a specified time frame: Patisiran (small interfering ribonucleic acid (siRNA) therapeutic formulation LNP), e.g., history of previous use and / or last dose within 90 days prior to study drug administration. History of previous use of inotersen (antisense oligonucleotide (ASO)), e.g., and / or last dose within 160 days prior to study drug administration. History of past use of butrisilane (an investigational GalNAc conjugate for siRNA therapy), e.g. Tafamidis (a TTR stabilizer), for example, the subject has been receiving continuous treatment for at least 14 days prior to administration of the study drug. Diflunisal (a TTR stabilizer), e.g., administration of last dose within 14 days prior to study drug administration. Administration of doxycycline and / or tauroursodeoxycholic acid (a TTR substrate solvent), e.g., last dose within 14 days prior to study drug administration. Administration of an experimental TTR stabilizer (e.g., AG-10), e.g., last dose within 6 months prior to study drug administration. Any other investigational agent for the treatment of ATTRv-CM, including the administration of the last dose within 30 days or within 5 half-lives prior to administration of the investigational agent, whichever is longer.
[0297] In some embodiments, the human subject does not have heart failure that, in the opinion of the investigator, is caused by ischemic heart disease (e.g., previous myocardial infarction with documented cardiac enzyme and ECG changes), hypertension, or unresolved valvular disease and is not primarily due to transthyretin amyloid cardiomyopathy.
[0298] In some embodiments, the human subject has no history of termination of sustained ventricular tachycardia or ventricular fibrillation, or atrioventricular (AV) nodal or sinoatrial (SA) nodal dysfunction for which a pacemaker is indicated but not placed. In some embodiments, the human subject has no pacemaker or defibrillator placement, antiarrhythmic drug initiation or change within 28 days prior to administration of the investigational drug.
[0299] In some embodiments, the human subject is not unable or unwilling to receive vitamin A supplementation.
[0300] In some embodiments, the human subject does not have a clinical evaluation indicating a meaningful risk associated with the required pre-medication ATTR-CM status management, hi some embodiments, the human subject is not unable or unwilling to undergo the required pre-treatment medication regimen.
[0301] In some embodiments, the human subject is not expected to require antithrombotic therapy with warfarin or heparin / heparin derivatives within 14 days prior to study drug administration, or warfarin antithrombotic therapy during the post-study drug period. In some embodiments, the use of apixaban, dabigatran, edoxaban, or rivaroxaban is permitted if the dose is stable for 28 days prior to screening, stable during screening, and expected to remain stable for 90 days after study drug administration.
[0302] In some embodiments, the human subject has no history of thrombophilia or a positive genetic test for either Factor V Leiden, Prothrombin 20210, or a positive test for Protein S deficiency and / or Protein C deficiency.
[0303] In some embodiments, the human subject does not have, in the opinion of the investigator, an expected survival time of less than one year.
[0304] In some embodiments, the human subject does not have ophthalmologic findings consistent with vitamin A deficiency upon screening ophthalmologic examination.
[0305] In some embodiments, the human subject has no history of cirrhosis.
[0306] In some embodiments, human subjects have no known or suspected viral, parasitic, or fungal systemic infections and have not received antibiotics for bacterial infections within 14 days of screening.
[0307] In some embodiments, human subjects do not have a history of hepatitis B or C infection, or a positive test result for hepatitis B surface antigen (HBsAg) or hepatitis C virus antibody (HCV Ab) at the time of screening. In some embodiments, subjects who have no evidence of cirrhosis, have completed a regimen intended to cure hepatitis C, and are determined by a gastroenterologist to have neither active hepatitis C nor elevated risk of hepatotoxicity are not excluded.
[0308] In some embodiments, the human subject has no history of positive human immunodeficiency virus (HIV) status.
[0309] In some embodiments, the human subject has no history of liver, heart or other solid organ transplant or bone marrow transplant, or is scheduled for a transplant within one year of screening. In some embodiments, a history or schedule of a corneal transplant is not an exclusion.
[0310] In some embodiments, the human subject has no history of active malignancies within 3 years prior to screening or during the screening period, except for basal cell carcinoma of the skin, curatively resected squamous cell carcinoma of the skin, curatively resected cervical intraepithelial neoplasia, or low-grade prostate adenocarcinoma where the appropriate management is observation.
[0311] In some embodiments, human subject does not have a history of alcohol or drug abuse within 3 years prior to screening.In some embodiments, female subject is not fertile or lactating.In some embodiments, human subject does not have any condition, test abnormality, or other reason that, in the opinion of the investigator, may adversely affect the subject's safety, interfere with the evaluation of study results, or prevent compliance with the study.
[0312] 3. Injection prevention method In some embodiments, the methods described herein further comprise administering to a subject an LNP composition described herein (e.g., comprising an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA targeting a gene, e.g., a guide RNA targeting a TTR gene). In some embodiments, the infusion prophylaxis is administered to the subject prior to administration of the gene editing composition. In some embodiments, the infusion prophylaxis regimen administered to the subject prior to administration of the LNP composition comprises administering an intravenous steroid, an intravenous H1 blocker or an oral H1 blocker, and an intravenous or oral H2 blocker. The intravenous steroid can be dexamethasone, e.g., 10 mg. The intravenous H1 blocker can be diphenhydramine, e.g., 50 mg. The oral H1 blocker can be cetirizine, e.g., 10 mg. The intravenous or oral H2 blocker can be famotidine, e.g., 20 mg. EXAMPLES
[0313] Example 1. LNP particle-based compositions for TTR gene editing In vitro transcription ("IVT") of nuclease mRNA Capped and polyadenylated mRNA containing N1-methylpseudo-U was generated by in vitro transcription using routine methods. Briefly, linearized plasmid DNA template and T7 RNA polymerase. Plasmid DNA containing the T7 promoter, sequence for transcription, and polyadenylation region was linearized with XbaI according to the manufacturer's protocol. XbaI was inactivated by heating. Linearized plasmid was purified from enzymes and buffer salts. IVT reactions to generate modified mRNA were performed by incubating 50 ng / μL linearized plasmid; 2-5 mM each of GTP, ATP, CTP, and N1-methylpseudo-UTP (Trilink); 10-25 mM ARCA (Trilink); 5 U / μL T7 RNA polymerase; 1 U / μL mouse RNase inhibitor (NEB); 0.004 U / μL inorganic E. coli pyrophosphatase (NEB); and 1x reaction buffer at 37°C. TURBO DNase (ThermoFisher) was added to a final concentration of 0.01 U / μL, and the reaction was incubated at 37°C to remove the DNA template.
[0314] The mRNA was purified using MegaClear Transcription Clean-up kit (ThermoFisher) or RNeasy Maxi kit (Qiagen) according to the manufacturer's protocol. Alternatively, the mRNA was purified by a precipitation protocol followed in some cases by HPLC-based purification. Briefly, after DNase digestion, the mRNA was purified using LiCl precipitation, ammonium acetate precipitation, and sodium acetate precipitation. In the case of HPLC-purified mRNA, after LiCl precipitation and reconstitution, the mRNA was purified by RP-IP HPLC (see, e.g., Kariko, et al. Nucleic Acids Research, 2011, Vol. 39, No. 21 el42). The fractions selected for pooling were combined and desalted by sodium acetate / ethanol precipitation as described above. In yet another method, the mRNA was purified by LiCl precipitation followed by further purification by tangential flow filtration. RNA concentrations were determined by measuring absorbance at 260 nm (Nanodrop), and transcripts were analyzed by capillary electrophoresis with a Bioanlayzer (Agilent).
[0315] Streptococcus pyogenes ("Spy") Cas9 mRNA was generated from plasmid DNA encoding the open reading frame set forth in the sequence listing. It is understood that when the sequences cited in this paragraph are referred to below in relation to RNA, T should be replaced with U (which may be a modified nucleoside as described above). The messenger RNA used in the examples includes a 5' cap and a 3' polyadenylation sequence (e.g., up to 100 nt), which are identified in Table 3. Guide RNAs are chemically synthesized by methods known in the art.
[0316] Preparation of LNP formulations containing sgRNA and Cas9 mRNA In general, lipid nanoparticle components were dissolved in 100% ethanol at various molar ratios. RNA cargo (e.g., Cas9 mRNA and sgRNA) was dissolved in 25 mM citric acid, 100 mM NaCl, pH 5.0 to a concentration of approximately 0.45 mg / mL of RNA cargo. The LNP used was an ionizable lipid ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate), also referred to herein as lipid A. The LNPs contained ((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50:38:9:3, respectively. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA weight ratio of 1:2. The LNPs used contained Cas9 mRNA and sgRNA.
[0317] LNPs were prepared using a cross-flow technique that utilizes impinging jet mixing of lipid-containing ethanol with two volumes of RNA solution and one volume of water. Lipid-containing ethanol was mixed with two volumes of RNA solution by a mixing cross. A fourth stream of water was mixed with the outlet stream from the cross via an in-line T-piece (see FIG. 2 of WO2016010840). The LNPs were held at room temperature for 1 hour and further diluted with water (approximately 1:1 v / v). The diluted LNPs were concentrated using tangential flow filtration on a flat sheet cartridge (Sartorius, 100 kD MWCO) and then buffer exchanged into 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) using a PD-10 desalting column (GE). The resulting mixture was then filtered by use of a 0.2 μm sterile filter. Characterization of the final LNPs was performed to determine encapsulation efficiency, polydispersity index, and average particle size. The final LNPs were stored at 4° C. or −80° C. until further use.
[0318] Next generation sequencing ("NGS") and editing efficiency analysis Genomic DNA was extracted from cells or tissues according to methods known in the art, for example, using QuickExtract DNA Extraction solution (Epicentre, model number QE09050) or Quick Extract (Lucigen, model number SS000035-D2). To quantitatively determine the editing efficiency at the target position in the genome, sequencing was used to identify the presence of insertions and deletions introduced by gene editing. PCR primers were designed around the target site in the gene of interest (e.g., TTR) to amplify the genomic region of interest. Primer sequence design was performed as standard in the art.
[0319] Further PCR was performed according to the manufacturer's protocol (Illumina) and chemicals for sequencing were added. Amplicons were sequenced on an Illumina MiSeq instrument. After removing low quality scores, reads were aligned against a reference genome (e.g., hg38). Result files containing reads were mapped to the reference genome (BAM files), reads overlapping the target region of interest were selected, and the number of reads containing insertions or deletions ("indels") relative to the number of wild-type reads was calculated.
[0320] The editing percentage (e.g., "editing efficiency" or "editing rate") is defined as the total number of sequence reads with insertions or deletions ("indels") relative to the total number of sequence reads including wild type.
[0321] Example 2. Selection of sgRNAs targeting the TTR gene sgRNAs targeting the TTR gene sequence AAAGGCUGCUGAUGACACCU (SEQ ID NO: 15; human genome build hg38 chromosome 18:31592987-31593007) were selected for efficient knockout and specificity after a comprehensive off-target characterization workflow that applied a combination of both in silico and empirical approaches. To select for a high therapeutic index (ratio of on-target to off-target editing), genome-wide analysis and targeted sequencing were performed to identify and validate candidate sgRNA off-target sites.
[0322] Complementary computational and laboratory-based methods (Cas-OFFinder, GUIDE-seq, and SITE-Seq) were used to discover genomic loci with potential off-target editing. We then examined mismatches between potential off-target sites and single guide RNA (sgRNA) targeting sequences in NTLA-2001. We used an interval tree algorithm to detect sites that overlapped with protein-coding exons. For those that overlapped with protein-coding exons by at least one nucleotide, we retained them if they had no more than four mismatches with the protospacer sequence. For potential off-target sites that did not overlap with exons from the coding DNA sequence (CDS), three mismatches were allowed. Both sets of sites were combined and included in the curation of predicted potential off-target editing loci for NTLA-2001.
[0323] The CRISPR / Cas9 off-target generation assay GUIDE-seq was performed as previously reported with minor modifications. Illumina next-generation sequencing (NGS) libraries were prepared according to published protocols and sequenced on both Illumina MiSeq and HiSeq 2,500 using paired-end reads of 150 base pairs (bp). GUIDE-seq of NTLA-2001 was performed in a HEK293 cell line engineered to constitutively express a Spy Cas9 green fluorescent protein (Spy Cas9-GFP) fusion protein (HEK293-Cas9).
[0324] The CRISPR / Cas9 off-target discovery assay SITE-Seq is performed on deproteinized and purified genomic DNA (gDNA) to eliminate any substrate limitations for CRISPR / Cas9 enzymatic activity, making this assay one of the most sensitive cell-free biochemical methods for discovering potential off-target editing. SITE-Seq was performed on human gDNA derived from peripheral blood mononuclear cells of two unique male blood donors. Each gDNA sample was digested with NTLA-2001, which contains in vitro assembled Cas9 ribonucleoprotein and transthyretin [TTR] targeting sgRNA, to induce DNA cleavage at on-target sites and potential off-target sites with homology to the sgRNA sequence. After gDNA digestion, the ends of the free gDNA fragments were ligated with adapters to facilitate enrichment of edited fragments and construction of NGS libraries. NGS libraries were sequenced as described in Example 1, and reads were analyzed by bioinformatics analysis to determine the genomic coordinates of the free DNA ends. Next, locations in the human genome where there was an accumulation of reads were annotated as potential off-target sites.
[0325] All potential off-target editing loci discovered by computational predictions with Cas-OFFinder and empirical discovery assays GUIDE-seq and SITE-Seq were curated and annotated for validated off-target editing in NTLA-2001 genome-edited cells. Discovery of potential off-target editing for NTLA-2001 from Cas-OFFinder, GUIDE-seq, and SITE-Seq yielded a total of 658 sites, including NTLA-2001 on-target sites. SITE-Seq discovered 476 (72.3%) sites, of which 431 (65.5%) were discovered exclusively by this method. Cas-OFFinder discovered 222 (33.7%) sites, of which 178 (27.1%) were discovered exclusively by this method. GUIDE-seq discovered 12 (1.8%) sites, of which 4 (0.6%) were discovered exclusively by this method (Figure 5).
[0326] False discovery rates were uniquely controlled for each discovery assay: (1) Cas-OFFinder was tuned to identify loci with up to three mismatches genome-wide and up to four mismatches within exonic DNA; (2) GUIDE-Seq, a cell-based assay, was optimized in a HEK293 cell line engineered to constitutively express Cas9 and used the maximally tolerated dose of double-stranded donor oligonucleotides; (3) SITE-Seq, a biochemistry-based assay, was qualified for off-target discovery at Cas9 RNP concentrations of 16 nM, 64 nM, and 256 nM, selecting Cas9 RNP digestion at 64 nM as optimal to ensure capture of all potential off-target loci that could be validated in edited cells without reducing validation sensitivity by the burden of more potential off-target loci.
[0327] The misclassification rates were as follows: Cas-OFFinder results, which allows up to three mismatches across the genome and up to four mismatches within exonic DNA, identified 221 potential off-target loci. Based on validation data in edited cells: ○ False positive rate=1-(3÷221)=98.6% ○ False negative rate=1-(3÷7)=57.1% GUIDE-Seq identified 11 potential off-target loci. Based on validation data of indel detection in edited cells: ○ False positive rate=1-(3÷11)=72.7% ○ False negative rate=1-(3÷7)=57.1% SITE-Seq identified 475 potential off-target loci. Based on validation data of indel detection in edited cells: ○ False positive rate=1-(7÷475)=98.5% ○ False negative rate=1-(7÷7)=0%
[0328] Example 3. Validation of potential off-target editing in primary human hepatocytes The highest concentration of lipid nanoparticles [LNPs] used to assess potential off-targeting was selected based on the highest concentration of NTLA-2001 that did not induce cytotoxicity in primary human hepatocytes (PHH). This concentration was determined based on the 90% effective concentration (EC 90 (the concentration that achieved >90% TTR protein knockdown in PHH).
[0329] To validate potential off-target editing in PHH, two complementary techniques were used. The first is a multiplex PCR technique called RNase H2-dependent PCR amplification and NGS (rhAMPSeq). This assay allows for simultaneous enrichment of on-target loci and potential off-target loci in a single PCR reaction for amplicon sequencing using NGS. The second technique is standard singleplex amplicon sequencing (Amp-Seq) as described in Example 1, which was used to characterize loci that did not meet the inclusion criteria applied to rhAMPSeq.
[0330] An Illumina Next Seq instrument was used to sequence rhAMPSeq libraries containing 150 base bp paired-end sequencing reads plus two 8 bp dual index reads. Sample-specific sequencing reads were then stitched and aligned to the human genome reference sequence (build GRCh38) using bowtie2 (v2.2.6) and local realignment using the Smith-Waterman algorithm. Nucleotides within 10 base pairs of potential Cas9 cleavage sites were evaluated for indels against the human genome reference sequence. Site editing percentage was defined as the total number of sequencing reads containing indels divided by the total number of sequencing reads.
[0331] Following exposure to supersaturating concentrations of NTLA-2001, seven validated off-target indels were detected in two PHH donor lots (Table 1). This approach was chosen because off-target editing is directly proportional to on-target editing, and thus detection of validated off-target edits was maximized by supersaturating genome editing with NTLA-2001. [Table 2]
[0332] Five of the loci were located in intergenic regions of the human genome, and two were located in introns of protein-coding genes. These validated off-target editing loci were further characterized as a function of dose of NTLA-2001 exposure (Figure 6). This approach allowed for a more detailed characterization of the detection and frequency of off-target indel formation in therapeutically meaningful TTR protein reduction.
[0333] Analysis of these specific off-target sequencing data by NGS revealed that zero validated off-target indels were detected when PHH were treated with NTLA-2001 up to 3-fold higher than the EC90 that achieved an average of 90% TTR protein reduction in PHH.
[0334] No truth set exists to determine the false classification rate of potential off-target loci. Currently available whole genome sequencing technologies are inadequate compared to the sensitivity of off-target indels detected by targeted amplicon sequencing. A total of 657 potential off-targets were subjected to amplicon sequencing validation, which was assessed as being qualified to detect >90% of indels down to a frequency of 0.2%. ● Total number of parts that failed validation = 98.93% Validated off-target loci = 1.07%
[0335] Example 4. In vitro evaluation of the efficacy of NTLA-2001 The in vitro dose response and gene editing efficacy of NTLA-2001 was evaluated in primary cell cultures of human hepatocytes.
[0336] In primary human hepatocytes, NTLA-2001 was highly potent (EC 50 0.05-0.15nM EC 90NTLA-2001 was shown to induce TTR gene knockout in vivo (Figure 2).
[0337] Figure 2 shows the relationship between increasing concentrations of guide RNA and the resulting percentage of TTR gene editing, as well as the reduction of TTR mRNA and protein in a single lot of primary human hepatocytes. The predominant indel pattern was a single base deletion or insertion at the cleavage site that induced a frameshift mutation (data not shown).
[0338] Example 5. Characterization of DNA structural variants following genome editing CRISPR / Cas9 genome editing can result in DNA structural changes (SVs) as a natural consequence of double-stranded DNA break repair. Potential DNA SVs include interchromosomal translocations, inversions, duplications, and deletions. To perform comprehensive characterization of potential DNA SVs that may arise after genome editing with NTLA-2001, Intellia developed and qualified two complementary methods: (1) short-read NGS using an SV characterization assay and (2) long-read NGS using long-range PCR (Figure 7). Results from these methods revealed concordantly low (<1%) levels of DNA SVs, consistent with published results of highly efficient CRISPR / Cas9 genome editing.
[0339] Analysis of paired-end NGS data from SV characterization assays can yield two possible outcomes. One is the concordant mapping of paired-end sequencing reads. Concordant mapping of reads could potentially indicate balanced rearrangements. However, balanced rearrangements would be indistinguishable from normal on-target editing that preserves the native chromosome structure. An alternative outcome is discordant mapping of paired-end sequencing reads. Discordant mapping could potentially indicate the presence of structural changes following DNA repair, such as interchromosomal translocations, inversions, or duplications.
[0340] SV characterization assays were performed on two donor lots of PHH treated with NTLA-2001. High molecular weight gDNA was isolated and libraries prepared as described above. NGS libraries were sequenced using Illumina MiSeq or NextSeq NGS technology with 150 bp paired-end sequencing reads and two 8 bp dual-index reads. NGS reads were analyzed for DNA SVs using an in-house developed code. Briefly, each read or read pair was aligned to the reference genome (GRCh38). Discordant reads, or split NGS alignments, were defined as reads or read pairs whose 5' and 3' ends aligned to two different locations in the genome that were larger than the maximum size of a DNA insert expected from the wild-type genome (300 bp for a single read and 1,000 bp for a read pair). When NGS aligned to more than one locus in the genome, the two fragments involved were used to classify the SV with the following criteria: (1) intrachromosomal translocation, (2) interchromosomal, (3) inversion, and (4) duplication. If the alignment matched two or more class signatures, it was classified as "complex." Repetitive DNA SVs were defined as those with two or more unique molecular identifiers that represent the detected DNA SV.
[0341] PHHs genome-edited with NTLA-2001 showed low (<1%) DNA SV repair outcomes at supersaturating levels of on-target editing. The frequency of DNA SVs detected after genome editing with NTLA-2001 is in keeping with previously reported results for highly efficient editing gRNAs. None of the translocations identified were associated with known risks, and the only recurrent translocations detected were acentric and dicentric fusions between on-target sites on sister chromatids.
[0342] The potential for DNA kilobase pair (Kb) deletions as potential repair outcomes following genome editing with CRISPR / Cas9 has been previously reported in mouse embryonic stem cells, mouse hematopoietic progenitor cells, and human differentiated cell lines. Targeted PCR-based amplicon sequencing using Illumina-based NGS is limited in its ability to characterize and quantify large structural variants such as deletions greater than 100 bp. Therefore, to characterize the potential for DNA repair outcomes following genome editing with NTLA-2001, we performed long-range PCR followed by long-read sequencing using Pacific Biosciences technology at the Icahn School of Medicine at Mt Sinai, New York (USA) and qualified the results by determining the detection limit for a 966 bp deletion (Figure 8).
[0343] Two donor lots of PHH were treated with NTLA-2001, and gDNA was isolated for long-range PCR and sequencing was performed using a Pacific Biosciences Sequel II instrument at the Icahn School of Medicine at Mt Sinai, New York (USA). Analysis of on-target indel frequency using standard short-read Amp-Seq after genome editing with NTLA-2001 in PHH revealed on-target indel editing frequencies of 92.57 ± 7.85% (lot 1) and 93.50 ± 0.10% (lot 2). Analysis of long-range PCR followed by long-read sequencing using Pacific Biosciences technology for NTLA-2001 in PHH genome-edited in vitro at supersaturating genome editing doses revealed a low frequency of two deletions of sizes 471 bp and 1,065 bp in one of the two PHH donors, 0.26% and 0.48% of reads, respectively (Figure 9). The nearest gene to the NTLA-2001 on-target site is approximately 28 Kb away; therefore, the DNA structural variants characterized in this report are likely the result of productive genome editing by NTLA-2001 that resulted in disruption of the TTR gene without additional unintended genomic modifications to the coding DNA sequence.
[0344] Example 6. Dose-dependent and durable effects in transgenic mice Studies in transgenic mice revealed dose-dependent and durable effects of NTLA-2001.
[0345] In the first experiment, huTTR transgenic mice were treated with 0.1, 0.3, or 1 mg / kg NTLA-2001, 1 mg / kg non-targeting control lipid nanoparticles (LNP), or tris-sucrose saline buffer control (n=5 mice per group). Liver TTR gene editing (Panel A) and serum human TTR protein (Panel B) were measured by next generation sequencing and human transthyretin enzyme-linked immunosorbent assay, respectively, 7 days after dosing. Mean and standard error values from 5 mice treated in each group are shown (Figure 10).
[0346] TTR gene editing reduced circulating serum TTR protein levels, which reached a nadir by 4 weeks post-dose and remained maximally suppressed at 12 months.
[0347] In the second experiment, after 2 / 3 liver resection and subsequent total liver regeneration, the gene editing percentage and corresponding protein levels were unchanged, supporting the permanent nature of the edits (Figure 11). CD1 mice were treated with 1 mg / kg lipid nanoparticles (LNPs) containing CRISPR / Cas9 mRNA and single guide RNA targeting the TTR gene, or tris sucrose saline (TSS) control (n=5 mice per group). On day 7, mice underwent partial hepatectomy (PHx) to remove approximately 70% of the liver. Serum TTR protein concentrations were measured by TTR enzyme-linked immunosorbent assay on days 0, 7 (pre-PHx), and 17 (4 days post-PHx) after dosing. Mean and standard error values from 5 mice treated in each group are shown.
[0348] Seven days after administration of the LNP formulation, animals showed a 98% knockdown of serum TTR, which was maintained following liver regeneration after PHx. These LNP-treated animals also showed identical TTR gene editing percentages (73%) both before and after PHx, indicating that gene editing is maintained throughout the liver regeneration process.
[0349] Example 7. LNP-mediated editing in non-human primates Three cynomolgus monkeys per dose group (1, 2, 3, and 6 mg / kg) were pretreated with dexamethasone at least 1 hour prior to Cyn-LNP infusion to mimic planned preclinical treatment. Transthyretin (TTR) gene editing was assessed in the liver using next-generation sequencing on day 29. Serum TTR protein concentrations were assayed by liquid chromatography-tandem mass spectrometry and reported as a percentage of basal (day 0) values. TTR gene editing showed a dose response from 1 to 6 mg / kg (Panel A), which corresponded to a reduction in serum TTR protein levels compared to baseline (Panel B). Mean and standard deviation values are shown for each treatment group. The shaded box in Panel B indicates the therapeutically meaningful range of TTR protein reduction (Figure 13).
[0350] Cynomolgus monkey studies demonstrated rapid initial distribution and clearance of the LNP components (FIG. 16 and FIG. 12).
[0351] FIG. 14 is a combined summary plot of the pharmacokinetics of a single dose of Cyn-LNP in cynomolgus monkeys.
[0352] Furthermore, a single dose of 3 mg / kg or 6 mg / kg Cyn-LNP was associated with a 73% gene editing percentage (maximum) in the whole liver and a near-complete reduction in serum TTR (>94%) that was sustained over 12 months (Figure 3A).TTR gene editing was confirmed by NGS analysis of liver tissue (Figure 3B).
[0353] FIG. 3A shows the mean reduction in serum transthyretin (TTR) protein concentration as a percentage of baseline in cynomolgus monkeys (n=3 per cohort) given intravenous Cyn-LNP at doses of 1.5, 3.0, and 6.0 mg / kg (total RNA / body weight) on day 0 and followed for 367 days. A control cohort that received no treatment is presented for comparison. The vertical lines for each point indicate the standard deviation for each group of 3 monkeys. Panel B shows the results of next generation sequencing data following Cyn-LNP administration to cynomolgus monkeys. The guide RNA target sequence is shown in blue next to the required PAM sequence in red. [G / A] represents the naturally occurring SNP among cynomolgus monkeys used in the study. The nucleotide position of the indel relative to the cynomolgus genome build mf5 chromosome 18 is as follows: +1:50681549-50681550.
[0354] The predominant indel pattern was a single base insertion at the break site that induced a frameshift mutation. The "N" at the insertion site refers to a multi-base insertion (AA, AGG, etc.) that collectively constituted 1.03% of all indels. The remaining fraction contained deletions of various lengths. sgRNA stands for single guide RNA. [Table 3]
[0355] Example 8. Clinical Trials The overall treatment design is summarized in Figure 1. Panel A shows the main components of NTLA-2001. The carrier system of NTLA-2001 is a lipid nanoparticle (LNP). LNP formulations are described herein. The active components of NTLA-2001 are a human optimized messenger RNA (mRNA) molecule (a sequence of approximately 4400 nucleotides with a molecular weight of approximately 1.5 MDa) encoding the Streptococcus pyogenes (Spy) Cas9 protein, and a single guide RNA (sgRNA) molecule (a molecular weight of approximately 35 kDa) specific for the human gene encoding transthyretin (TTR). These components form the cargo of the LNP for drug administration. After intravenous administration of NTLA-2001 and entry into the circulation, the LNP is transported through the systemic circulation directly into the liver and is preferentially distributed in the liver. Panel B shows transport of NTLA-2001 LNP to the capillaries of the hepatic sinusoids in the liver. Similar to other clinically approved LNPs, NTLA-2001 is expected to be opsonized by apolipoprotein E (ApoE) in the circulation and then undergo uptake by low-density lipoprotein (LDL) receptors expressed on the surface of hepatocytes, followed by endocytosis and endosome formation. Following degradation of the LNP and disruption of the endosomal membrane, the active components (TTR-specific sgRNA and mRNA encoding Cas9) are released into the cytoplasm. The Cas9 mRNA molecule is translated through natural ribosomal processes to produce the Cas9 endonuclease enzyme. The TTR-specific sgRNA interacts with the Cas9 endonuclease and clusters to form a complex of regularly interspaced short palindromic repeats (CRISPR) and Cas9 ribonucleoprotein (RNP). Panel C shows that the Cas9 RNP complex is targeted for nuclear import and enters the nucleus, where it recognizes the protospacer adjacent motif (PAM) on the non-complementary DNA strand of TTR. A target-specific 20-nucleotide sequence at the 5' end of the sgRNA binds to the DNA double helix at the target site, allowing the CRISPR-Cas9 complex to unwind the helix and access the target gene.Cas9 undergoes a series of conformational changes and nuclease domain activation (HNH and RuvC domains) resulting in DNA cleavage precisely targeted to the TTR sequence as defined by the sgRNA complementary sequence. Endogenous DNA repair mechanisms ligate the ends of the cleavage and potentially introduce base insertions or deletions (indels). The generation of indels can result in reduced levels of functional target gene mRNA as a result of missense or nonsense mutations that reduce the amount of full-length mRNA, ultimately resulting in reduced levels of the target protein. Indels that result in the abrogation of production of the target protein (in this case TTR) are called knockout mutations.
[0356] A. Dose Escalation Study of Polyneuropathy Polyneuropathy cohorts 1 and 2 Registration At one study site, three subjects were screened, of which two were eligible and recruited. One subject's weight was above the upper limit allowed by the study protocol at that time. At the other study site, four patients were screened, of which four were eligible and recruited. Patients were aged 46-64 years, and 4 / 6 were male. Weight ranged from 70-90 kg. Three patients had the p.T80A mutation, two had the p.S97Y mutation, and one had the p.H110D mutation. Three patients had not received previous treatment, and three had previously received diflunisal. All six patients had a polyneuropathy disability score of 1 and New York Heart Association functional class I. N-terminal pro-B-type natriuretic peptide (NT-proBNP) ranged from 50-596 ng / L.
[0357] Clinical Trial Design and Eligibility We report two initial cohorts (Cohorts 1 and 2) from part 1 of a two-part, international, Phase 1, open-label, multicenter study. Patients were treated with a single dose of NTLA-2001 intravenously at 0.1 mg / kg or 0.3 mg / kg total RNA / body weight between November 2020 and April 2021. Herein, we also report data from these patients who were subsequently treated. Key eligibility criteria for part 1 included age 18-80 years, diagnosis of polyneuropathy due to hATTR amyloidosis (with or without cardiomyopathy), weight 50-90 kg at the screening visit, and no access to approved treatment for ATTR amyloidosis. Patients with non-ATTR amyloidosis, known leptomeningeal ATTR amyloidosis, or a history of RNA silencing therapy were excluded. History of use of TTR stabilizers was permitted with a washout period (diflunisal: 3 days) (Figure 18).
[0358] Clinical Trial Safety A safety study in cynomolgus monkeys determined the no-observed-adverse-effect level (NOAEL) to be a single dose of 3 mg / kg intravenous infusion, equivalent to a dose of 1 mg / kg in humans. After allometric scaling based on total body surface area and application of a safety factor of 10, the maximum recommended starting dose of NTLA-2001 in this study was 0.1 mg / kg. To mitigate potential pro-inflammatory effects of intravenous LNP infusion, patients were given glucocorticoids and histamine receptor type 1 and type 2 blockers prior to infusion.
[0359] NTLA-2001 treatment was completed without interruption of infusion. No protocol-defined discontinuation events were observed. Treatment-emergent adverse events were reported in 3 of 6 patients, all of which were mild in severity (Grade 1). One patient experienced an adverse event of special note (Grade 1 infusion-related reaction; see Figure 17). No serious adverse events were observed.
[0360] D-dimer levels were assessed by methods known in the art. Elevated d-dimer levels were observed 4-24 hours after infusion in 5 of 6 patients. The elevations were lower than those observed at the NOAEL dose in non-human primates. Values returned to baseline by day 7 in all 6 patients. The coagulation parameters activated partial thromboplastin time and prothrombin time were assessed by methods known in the art and results remained within 1.2 times the upper limit of the reference range. Fibrinogen and platelet counts were performed by methods known in the art and remained above the lower limit of the reference range. Liver function tests (aspartate aminotransferase and alanine aminotransferase) were performed by methods known in the art and results remained within normal ranges (Figure 15).
[0361] FIG. 15A shows prothrombin time, FIG. 15B shows activated partial thromboplastin time, FIG. 15C shows fibrinogen, FIG. 15D shows alanine aminotransferase, and FIG. 15E shows aspartate aminotransferase. Blue lines show individual subject results over time. Single red lines show average results over time. Horizontal dashed lines indicate either the ULN or LLN, as appropriate, for each parameter. Baseline is defined as the last available measurement obtained before the start of study drug infusion. Only results obtained through day 28 from the central laboratory are plotted.
[0362] ALT means alanine aminotransferase, aPTT means activated partial thromboplastin time, AST means aspartate aminotransferase, BL means baseline, PT means prothrombin time, LLN means lower limit of normal, and ULN means upper limit of normal. Patients were monitored for evaluation of treatment-emergent adverse events and laboratory findings. Serum samples were obtained at baseline and at weeks 1, 2, and 4 for analysis of TTR protein levels by enzyme-linked immunosorbent assay (ELISA). Patients are evaluated for safety and therapeutic activity outcomes over 24 months following NTLA-2001 infusion.
[0363] Pharmacokinetics Interim pharmacokinetic data suggest that following intravenous (IV) infusion, NTLA-2001 ionizable lipids show a rapid decline from peak levels, followed by a secondary peak and then a log-linear phase.
[0364] Clinical Trial Efficacy To determine the pharmacodynamic effects of NTLA-2001, multiple serum TTR levels were assessed. A sandwich ELISA method was developed and validated as a quantitative assay using human plasma TTR from healthy subjects (Sigma, P1742) as the standard.
[0365] Briefly, assay microplates (Nunc, 446612) were incubated overnight with 1ug / ml polyclonal rabbit anti-human prealbumin antibody (Dako, A0002) in 0.05M carbonate coating buffer pH 9.6. Plates were washed 4 times with TTR Wash Solution (TTRWS: 0.05% Tween-20, 1x Dulbecco's PBS), blocked with 1x Powerblock (Biogenix, HK085-5k) for 1 hour, and washed 4 times with TTRWS. Standards, controls, and diluted test samples were incubated on the prepared plates for approximately 2 hours. Plates were washed 4 times with TTRWS and then incubated with sheep anti-human prealbumin antibody (Bio-Rad, AHP1837) diluted 1:2,500 in 1x Powerblock for 1 hour. The plate was washed 4 times with TTRWS and then incubated for 1 hour with anti-sheep alkaline phosphatase conjugated antibody (Sigma, A5187) diluted 1:10,000 in 1X Powerblock. The plate was washed 4 times with TTRWS. The plate was developed using SIGMAFAST™ p-nitrophenyl phosphate tablets (Sigma-Aldrich, N1891) according to the manufacturer's instructions. After 30 minutes of incubation with the developing reagent, the reaction was stopped using 2N sodium hydroxide solution. The absorbance was assessed spectrophotometrically. A standard curve of signal (OD) vs. concentration was generated using human plasma TTR (Sigma, P1742) to quantify QC and unknown samples.
[0366] Reductions in serum TTR protein concentrations from baseline were observed by day 14 and progressed through day 28 (Figure 4A). At day 28, NTLA-2001 was associated with a mean TTR reduction of 52% in cohort 1 (dose level 0.1 mg / kg) and 87% in cohort 2 (0.3 mg / kg; Figure 4B). The effect was dose-dependent, with greater reductions in TTR concentrations in patients receiving higher doses of NTLA-2001. Furthermore, the effect of NTLA-2001 was reproducible for all patients at each dose level, with reductions at day 28 ranging from 47-56% (47%, 52%, and 56%) in cohort 1 and 80-96% (80%, 84%, and 96%) in cohort 2 (Figure 4C).
[0367] Panel A shows the percentage change in total circulating serum transthyretin (TTR) protein from baseline for cohort 1 (0.1 mg / kg). TTR protein was quantified by a validated enzyme-linked immunosorbent assay following regulatory guidelines for biomarker method validation. Serum samples were measured once with each sample tested in duplicate. In accordance with good laboratory practice, no retesting was performed for successful assay runs. Data are shown for each patient in cohort 1 (0.1 mg / kg) at days 7, 14, and 28 post-dose for the percentage decrease in serum TTR protein compared to pre-dose baseline (mean concentrations from three sampling time points). Panel B shows the percentage change in total circulating serum TTR protein from baseline for cohort 2 (0.3 mg / kg). Methods and analysis are identical to those shown in panel A. Panel C shows the mean percentage change from baseline in total circulating serum TTR protein at day 28 for both Cohort 1 and Cohort 2 (N=3 per cohort).
[0368] As noted above, reductions in serum TTR protein concentrations from baseline were observed through day 28. Reductions in serum TTR protein concentrations from baseline were also observed through 9 months (Cohort 1 subject 1 and Cohort 1 subject 3, FIG. 19A) or 12 months (Cohort 1 subject 2, FIG. 19A) following treatment with NTLA-2001. The mean percent TTR reduction at day 28 was 52% in Cohort 1 (dose level 0.1 mg / kg) and 87% in Cohort 2 (dose level 0.3 mg / kg). The mean percent TTR reduction at month 2 was 54% in Cohort 1 and 81% in Cohort 2. At 9 months post-treatment, the mean serum TTR reduction in Cohort 2 was 86% (FIGS. 19A and 19B). The mean percent TTR reduction at month 12 was maintained at 89% in Cohort 2 (Table 4).
[0369] Polyneuropathy cohorts 3 and 4 Registration Six subjects were recruited for cohort 3 and three subjects were recruited for cohort 4. Subjects ranged in age from 19 to 70 years, five of the nine subjects were male, and weights ranged from 59 to 111 kg. Three subjects had the p.T80A mutation, two had the p.E62D mutation, one had the p.S70R mutation, one had the p.V50M mutation, and one had the p.E94G mutation. Seven subjects had a polyneuropathy disability score of 1 and two had a polyneuropathy disability score of 2. Seven subjects had New York Heart Association functional class I, one had class II, and one did not have a diagnosis of heart failure. N-terminal pro-B-type natriuretic peptide (NT-proBNP) ranged from 50 to 544 ng / L (Figures 23A and 23B).
[0370] Clinical Trial Design and Eligibility Included herein are interim results of cohorts 3 and 4 from part 1 of a two-part, international, Phase 1, open-label, multicenter study. Patients were treated with a single dose of NTLA-2001 intravenously at 1.0 mg / kg (6 patients in cohort 3) or 0.7 mg / kg (3 patients in cohort 4) total RNA / body weight. Enrollment and eligibility criteria were as described herein.
[0371] Clinical Trial Safety A safety study in cynomolgus monkeys determined the no-observed-adverse-effect level (NOAEL) to be a single dose of 3 mg / kg intravenous infusion, equivalent to a dose of 1 mg / kg in humans. To mitigate potential pro-inflammatory effects of intravenous LNP infusion, patients were given glucocorticoids and histamine receptor type 1 and type 2 blockers prior to infusion.
[0372] NTLA-2001 treatment was completed without interruption of the infusion. Treatment-emergent adverse events were reported in all nine subjects. The majority of adverse events were mild in severity (Figure 22). All infusion-related reactions resolved without clinical sequelae and were considered mild. One grade 3 event (SAE) of associated vomiting was reported at the 1.0 mg / kg dose in one patient with underlying gastroparesis. No clinically significant laboratory findings were observed, and transient grade 1 liver enzyme elevations were observed. No protocol-specified discontinuation events were observed.
[0373] Liver function (aspartate aminotransferase and alanine aminotransferase), coagulation parameters (activated partial thromboplastin time, prothrombin time, fibrinogen), and d-dimer levels were assessed by methods known in the art and results remained within normal ranges (Figure 21).
[0374] Figure 21A shows prothrombin time, Figure 21B shows activated partial prothrombin time, Figure 21C shows fibrinogen, Figure 21D shows alanine aminotransferase, Figure 21E shows aspartate aminotransferase, and Figure 21F shows d-dimer ratio. Data are presented as the average results over time for each cohort. Baseline is defined as the last available measurement obtained before the start of the study drug infusion. Only results obtained from the central laboratory through day 7 are plotted.
[0375] ALT means alanine aminotransferase, aPTT means activated partial thromboplastin time, AST means aspartate aminotransferase, BL means baseline, and PT means prothrombin time. Patients were monitored for evaluation of treatment-emergent adverse events and laboratory findings. Serum samples were obtained for analysis of TTR protein levels by enzyme-linked immunosorbent assay (ELISA) at baseline, and at weeks 1, 2, and 4, and at month 2. Patients are evaluated for safety and therapeutic activity outcomes over 24 months following NTLA-2001 infusion.
[0376] Clinical Trial Efficacy To determine the pharmacodynamic effects of NTLA-2001, multiple serum TTR levels were assessed. A sandwich ELISA method was developed and validated as a quantitative assay using human plasma TTR from healthy subjects (Sigma, P1742) as the standard.
[0377] Briefly, assay microplates (Nunc, 446612) were incubated overnight with 1ug / ml polyclonal rabbit anti-human prealbumin antibody (Dako, A0002) in 0.05M carbonate coating buffer pH 9.6. Plates were washed 4 times with TTR Wash Solution (TTRWS: 0.05% Tween-20, 1x Dulbecco's PBS), blocked with 1x Powerblock (Biogenix, HK085-5k) for 1 hour, and washed 4 times with TTRWS. Standards, controls, and diluted test samples were incubated on the prepared plates for approximately 2 hours. Plates were washed 4 times with TTRWS and then incubated with sheep anti-human prealbumin antibody (Bio-Rad, AHP1837) diluted 1:2,500 in 1x Powerblock for 1 hour. The plate was washed 4 times with TTRWS and then incubated for 1 hour with anti-sheep alkaline phosphatase conjugated antibody (Sigma, A5187) diluted 1:10,000 in 1X Powerblock. The plate was washed 4 times with TTRWS. The plate was developed using SIGMAFAST™ p-nitrophenyl phosphate tablets (Sigma-Aldrich, N1891) according to the manufacturer's instructions. After 30 minutes of incubation with the developing reagent, the reaction was stopped using 2N sodium hydroxide solution. The absorbance was assessed spectrophotometrically. A standard curve of signal (OD) vs. concentration was generated using human plasma TTR (Sigma, P1742) to quantify QC and unknown samples.
[0378] Interim results reported for 3 of 6 subjects in Cohort 3 and 1 of 3 subjects in Cohort 4 A decrease in serum TTR protein concentration from baseline was observed by day 14 and progressed through day 28. At day 7, a 78% decrease in serum TTR was reported for one cohort 4 subject (0.7 mg / kg; subject 3 in Figure 19C). This subject's serum TTR had decreased by 94% by day 14 and 97% by day 28. At day 7, three cohort 3 subjects showed decreases ranging from 43 to 88% (43% in subject 1, 80% in subject 2, and 88% in subject 3). At day 14, a further decrease in serum TTR was observed (80% in subject 1, 88% in subject 2, and 97% in subject 3). At day 28, the decrease ranged from 88 to 98% (88% in subject 1, 88% in subject 2, and 98% in subject 3; Figure 19).
[0379] Interim results reported for 6 of 6 subjects in Cohort 3 and 3 of 3 subjects in Cohort 4 Reductions from baseline in serum TTR protein concentrations were observed at days 7, 14, 28, 56 (2 months), 4 months (some subjects), 6 months (some subjects), and 6 months (some subjects). All individual subject values available at the time of this interim result are shown in Figures 19B-19D. The mean TTR reduction at day 28 was 93% in cohort 3 (dose level 1 mg / kg) and 86% in cohort 4 (dose level 0.7 mg / kg). The mean TTR reduction at month 2 was 93% in cohort 3 and 88% in cohort 4. The reductions were maintained at month 2, as shown in Figure 20. The reductions in percentages represent the change from baseline in total circulating serum transthyretin (TTR) protein for each subject in cohort 3 (1 mg / kg) and cohort 4 (0.7 mg / kg). Further updated serum TTR decline information for the results shown in Figures 19A-19D is shown in Table 4 below. The mean TTR decline at 6 months was 93% for all subjects in Cohort 3 (dose level 1 mg / kg) and 87% for all subjects in Cohort 4 (dose level 0.7 mg / kg). At this time of update, the mean TTR decline at 9 months remained at 93% for 3 of 6 subjects in Cohort 3. ATTR protein was quantified by a validated enzyme-linked immunosorbent assay following regulatory guidelines for biomarker method validation. Serum samples were measured once with each sample tested in duplicate. In accordance with good laboratory practice, no retesting was performed to ensure successful assay runs. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4]
[0380] B. 80mg Fixed Dose Study of Polyneuropathy As of this update, one subject had been recruited into the 80 mg fixed dose study. The subject was a 36 year old male. Clinical trial design and eligibility were as described herein for the polyneuropathy study, except that subjects were treated with a single dose of NTLA-2001 at a fixed dose of 80 mg of total RNA (guide RNA plus messenger RNA).
[0381] Serum TTR levels were evaluated to determine the pharmacodynamic effects of NTLA-2001. As described herein, a sandwich ELISA method was developed and validated as a quantitative assay using human plasma TTR (Sigma, P1742) from healthy subjects as a standard. A decrease from baseline in serum TTR protein concentration was observed by day 7. At day 7, subjects reported a 58% decrease in serum TTR (absolute TTR concentration 139ug / ml).
[0382] C. Cardiomyopathy Dose Escalation Study Enrollment cohorts 1a and 2a Recruitment for cohort 1a and cohort 2a is currently ongoing. Herein, we provide recruitment information for subjects in cohorts 1a and 2a for which TTR decline data are available. Three cohort 1a subjects were recruited, these subjects were 71-75 years old, all three subjects were male, and the weight range was 63-88 kg. For cohort 1a, two of the three subjects had wild-type TTR, two subjects had New York Heart Association (NYHA) functional class II, and one subject had NYHA functional class I. NT-proBNP baseline levels ranged from 2103 pmol / L to 3637 pmol / L. One cohort 2a subject was recruited, this patient was a 75-year-old male weighing 71 kg. The cohort 2a subject had wild-type TTR and NYHA functional class III.
[0383] Clinical Trial Design and Eligibility Included herein are interim results from an ongoing study in cohorts 1a and 2a from part 1 of a two-part, international, Phase 1, open-label, multicenter study. Subjects were treated with a single dose of NTLA-2001 administered intravenously at 0.7 mg / kg (3 subjects in cohort 1a) or 0.7 mg / kg (1 subject in cohort 2a) total RNA / body weight. Enrollment and eligibility criteria were as described herein.
[0384] To determine the pharmacodynamic effect of NTLA-2001, serum TTR levels were evaluated. As described herein, a sandwich ELISA method was developed and validated as a quantitative assay using human plasma TTR (Sigma, P1742) from healthy subjects as a standard. A decrease from baseline in serum TTR protein concentration was observed, as summarized in Table 5 below. [Table 5]
[0385] Example 9. Additional Clinical Assays Bioanalytical Methods and Clinical Pharmacology Plasma pharmacokinetic methods were developed and validated to quantify the four components of NTLA-2001: ionizable lipid A (also known as LP01), DMG-PEG2k lipid, guide RNA, and mRNA. Lipid A and DMG-PEG2k are quantified by liquid chromatography-tandem mass spectrometry (LC-MS / MS) methods. Standard curves of assay signal (ratio of area under the curve of standard to internal standard (IS, isotopically labeled standard)) versus concentration response are used. Plasma concentrations are determined by interpolation of QC and unknown sample signals from the standard curve. Both guide RNA and mRNA are quantified by qRT-PCR. Standard curves of signal cycle threshold (Ct) versus concentration are used. Plasma concentrations are quantified by interpolation of QC and unknown samples from the standard curve. Urinary PK methods were developed and validated to characterize excretion for lipid A and DMG-PEG2k.
[0386] Immunogenicity methods were developed and validated to evaluate anti-drug antibodies (ADA) and anti-Cas9 protein (Cas9 mRNA transgene product) antibodies against NTLA-2001. Both methods used a sandwich format Meso Scale Discovery Electrochemiluminescence (MSD-ECL) assay, with NTLA-2001 LNP or Cas9 protein coated as capture antigen. Immobilized antibodies against drug or Cas9 protein were detected by anti-human IgM / IgG-sulfotag detection antibody. Sample analysis is planned as a tiered analysis with cut points according to regulatory guidelines for screening, confirming, and titrating antibody responses. Confirmatory assays are based on competitive inhibition of drug or Cas9 protein based on cut points. Confirmed positive samples are tested for endpoint titers.
[0387] Additional pharmacodynamic methods included serum TTR by ELISA as primary PD and LC-MS / MS as secondary PD, as well as prealbumin in vitro diagnostics (IVD) for patient management and PD. A sandwich ELISA method was developed and validated as a quantitative assay using human plasma TTR from healthy subjects as a standard. Polyclonal antibodies are used as both capture and detection antibodies. A standard curve of signal (OD) vs. concentration is generated to quantify QC and unknown samples. An LC-MS / MS method was developed and validated using three surrogate peptides to quantify TTR, including the V30M mutant and corresponding wild type V30V, as well as a third peptide upstream similar to the NHP LC-MS / MS peptide position to bridge the NHP data. Serum concentrations were determined by interpolating QC and unknown samples using the signal (ratio of standard / isotopically labeled IS for each peptide) vs. concentration response as a standard curve. The prealbumin method is based on the turbidimetric principle as an IVD method, where the presence of TTR results in turbidity upon immune complex formation by addition of polyclonal antiserum against TTR. For exploratory purposes, we developed and validated additional PD biomarker assays, including retinoid-binding protein (RBP) by sandwich ELISA. We quantified circulating neurofilament light chain (NfL) as an exploratory PD biomarker using a qualified method based on the Quanterix Simoa platform. This biomarker is specific for ATTR-PN.
[0388] To assess cytokine responses following NTLA-2001 infusion, multiplex cytokines by Luminex (GM-CSF, IFNg, IL-1b, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12(p70), IL-13, IL-17A, IL-23, TNFa) and MCP-1 by ELISA were developed and validated. To assess complement activation, complement components C3a, C5a, and Bb by ELISA were developed and validated.
[0389] Preliminary plasma PK data are available for the four components of NTLA-2001 (ionizable lipid A, DMG-PEG2k lipid, guide RNA, and mRNA). Following a single IV infusion of NTLA-2001 at doses of 0.1-1.0 mg / kg, LPO1 exhibited a rapid decline from peak levels, followed by a secondary peak and a log-linear phase characterized by a mean (%CV) terminal phase t1 / 2 ranging from 19.74 (16.57) to 24.81 (23.55) (hours) over this dose range. Figure 24. Data for the other components are not shown.
[0390] Example 10. Exposure-Response (ER) Analysis For NTLA-2001, TTR (% baseline) at day 28 was used to develop an intermediate ER model by assuming a sigmoidal relationship according to Equation 1 and using nonlinear least squares with R 4.0.5 (The R Foundation for Statistical Computing, Vienna, Austria).
number
[0391] The model fit is shown in FIG. 25, which shows the saturation ER relationship for NTLA-2001.
[0392] Example 11. Population Pharmacokinetics (POPPK) For NTLA-2001 analyte LP01, an intermediate POPPK model was developed using NONMEM software (version 7.5.0, ICON Clinical Research LLC, Blue Vell, PA) based on a published model. There were 290 observations in 15 ATTRv-PN subjects in this analysis. Parameter values and goodness of fit plots for this model were obtained (not shown). The relationship between body weight and estimated elimination clearance was determined, along with a modeled linear relationship. This relationship does not satisfy proportionality, i.e., a doubling of body weight leads to less than a two-fold change in clearance.
[0393] Figure 26 provides the distribution of simulated AUC by weight quartile following dosing of 1 mg / kg (left panel) and 80 mg (right panel) NTLA-2001. POPPK simulations performed in 10,000 hypothetical subjects with a median [5%, 95%] body weight of 81 [48, 146] kg suggest that there is a large overlap of LP01 AUC following 1 mg / kg NTLA-2001 across weight quartiles, but a slight trend for median exposure to increase with body weight. Similarly, there is overlap of simulated LP01 AUC following 80 mg NTLA-2001 across weight quartiles. The geometric mean of NTLA-2001 AUC estimates following fixed weight-based dosing and the 5th and 95th percentile ranges of the individual ratios (GMRs) are 0.98 [0.74, 1.28]. The ratio of simulated mean exposure for the 4th weight quartile ([90.3-146] kg) to the 1st weight quartile ([48-71.7] kg) was 1.25 for NTLA-2001 1 mg / kg and 0.81 for NTLA-2001 80 mg. Simulations identified NTLA-2001 80 mg as the fixed dose equivalent to 1.0 mg / kg.
[0394] Sequence Listing The following sequence listing provides a list of sequences disclosed herein. It is understood that when a DNA sequence (containing T) is referred to in relation to RNA, T should be replaced with U (which may or may not be modified depending on the context), and vice versa. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10] [Table 6-11]
Table 6-12
Table 6-13
Table 6-14
Table 6-15
Table 6-16
Table 6-17
Table 6-18
Table 6-19
Table 6-20
Table 6-21
Table 6-22
Table 6-23
Table 6-24
Table 6-25
Table 6-26
Table 6-27
Table 6-28
Table 6-29
Table 6-30
Table 6-31
Table 6-32
Table 6-33
Table 6-34
Table 6-35
Claims
**Claim 1**: An effective amount of: i. mRNA encoding Cas nuclease, and ii. guide RNA targeting the TTR gene A LNP composition for use in a method of treating transthyretin-related amyloidosis (ATTR) in a human subject, comprising administering the LNP composition systemically to the human subject, wherein the method a. comprises administering the LNP composition systemically to the human subject, The LNP composition, wherein the effective amount of the mRNA and the guide RNA is a total dose of about 0.3 mg / kg, 0.7 mg / kg, 1 mg / kg, or a total dose of about 50 mg to 90 mg of total RNA. **Claim 2**: The LNP composition according to claim 1, wherein the method results in editing the gene at a site targeted by the guide RNA in hepatocytes of the subject. **Claim 3**: The administration of the composition (1) reduces serum TTR compared to baseline serum TTR, (2) results in a change that is acceptable compared to the baseline level at the level of the biosafety scale in the subject, or (3) results in a clinically significant improvement compared to the baseline level of the clinical scale at the level of the clinical scale in the subject, The LNP composition according to claim 1. **Claim 4**: The LNP composition according to claim 3, wherein the administration of the composition reduces serum TTR compared to baseline serum TTR. **Claim 5**: The LNP composition according to claim 3, wherein the administration of the composition results in a change that is acceptable compared to the baseline level at the level of the biosafety scale in the subject. **Claim 6**: The LNP composition according to claim 3, wherein the administration of the composition results in a clinically significant improvement compared to the baseline level of the clinical scale at the level of the clinical scale in the subject, and optionally, the clinical scale is the serum TTR level. **Claim 7**: An effective amount of: i. mRNA encoding Cas nuclease, and ii. guide RNA targeting a gene in the liver A LNP composition for use in a method of treating a human subject having a single-gene disorder (e.g., transthyretin-related amyloidosis (ATTR)), comprising a. Systemically administering the LNP composition, wherein the effective amounts of the mRNA and the guide RNA are a total dosage of about 0.3 mg / kg, 0.7 mg / kg, 1 mg / kg, or a total dosage of about 50 mg to 90 mg of total RNA; b. Editing the gene in the liver, thereby treating the single gene disorder, wherein the treatment is safe and well-tolerated, the LNP composition. **Claim 8** The method is b. Determining a first level of a biosafety metric in the subject prior to administration; c. Determining a second level of the biosafety metric in the subject at a period after administration; d. Further comprising evaluating a change between the first level and the second level of the biosafety metric, wherein the administration of the composition results in a change that is acceptable at the level of the biosafety metric in the subject as compared to the baseline level, thereby treating ATTR, the LNP composition according to claim 1. **Claim 9** The method includes selecting a human subject having transthyretin-related amyloidosis (ATTR) prior to the systemic administration, the LNP composition according to any one of claims 1-8. **Claim 10** The LNP comprises (9Z,12Z)-3-(((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, or a PEG lipid, such as dimyristoyl glycerol (DMG) of PEG-2k etc., the LNP composition according to any one of claims 1-8. **Claim 11** The LNP composition has an N / P ratio of about 5 to 7, the LNP composition according to any one of claims 1-8. **Claim 12** The guide RNA and the Cas nuclease are present in a ratio ranging from about 5:1 to about 1:5 by weight, the LNP composition according to any one of claims 1-8. **Claim 13** The mRNA encodes a class 2 Cas nuclease, such as a Cas9 nuclease such as S. pyogenes Cas9, and optionally, the Cas nuclease is codon-optimized, the LNP composition according to any one of claims 1-8. **Claim 14** The LNP composition according to any one of claims 1 to 8, wherein at least one of the guide RNA and the mRNA comprises at least one modification, such as a 2'-O-methyl modified nucleotide or a phosphorothioate bond between nucleotides.
15. The LNP composition according to any one of claims 1 to 8, wherein the ATTR is hereditary transthyretin amyloidosis, such as hereditary transthyretin amyloidosis with polyneuropathy, or hereditary transthyretin amyloidosis with cardiomyopathy, or the ATTR is wild-type transthyretin amyloidosis, such as wild-type transthyretin amyloidosis with cardiomyopathy.
16. The LNP composition according to claim 15, wherein the cardiomyopathy is classified as Class I, Class II, or Class III under the New York Health Association (NYHA) classification.
17. The LNP composition according to claim 3, 5, or 7, wherein the biosafety measure is at least one of prothrombin, activated partial thromboplastin time (aPTT), fibrinogen, alanine aminotransferase (ALT), and aspartate aminotransferase (AST).
18. The LNP composition according to any one of claims 1 to 8, wherein the total RNA is within about ±10% of the total mg dose, and optionally within about ±5% of the total mg dose.
19. The LNP composition according to any one of claims 1 to 8, wherein administration of the composition reduces or knockdowns the expression of the TTR gene, or reduces the TTR serum level in the subject by at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 98%, 99%, or 100% compared to the baseline before administration of the composition, or reduces the TTR serum level in the subject after administration of the composition to a level of less than about 50 μg / mL, 40 μg / mL, 30 μg / mL, 20 μg / mL, or 10 μg / mL.
20. The LNP composition according to any one of claims 1 to 8, wherein the composition is administered together with a second therapeutic agent, such as diflunisal or tafamidis.
21. The LNP composition according to any one of claims 1 to 8, wherein the LNP composition is administered two or more times, for example, 2, 3, 4, 5, or more times.
22. The LNP composition according to any one of claims 1 to 8, wherein the guide RNA targeting the TTR gene comprises any one or more of SEQ ID NOs: 15, 16, 34, 35, and 38 to 54, or an 18-, 19-, or 20-nucleotide portion thereof.
23. The LNP composition according to any one of claims 1 to 8, wherein the guide RNA comprises sgRNA, and optionally, the sgRNA comprises the modification pattern shown in SEQ ID NO:
19.
24. The LNP composition according to any one of claims 1 to 8, wherein the Cas nuclease comprises a sequence having at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to any of SEQ ID NOs: 1 to 12 and 36.